Upload 1006 files to data/part_1

data/part_1/001e38d913400a1d112c39b7f3267995.json

@@ -0,0 +1 @@
+{"metadata":{"id":"001e38d913400a1d112c39b7f3267995","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ca8a06f2-6e7e-443b-ac34-c99ead484949/retrieve"},"pageCount":30,"title":"","keywords":[],"chapters":[{"head":"OBJETIVOS","index":1,"paragraphs":[{"index":1,"size":39,"text":"Evaluar el comportamiento reproductivo de las novillas bajo condiciones de pastoreo en pastos mejorados • 2.2 Establecer comparaciones entre el comportamiento reproductivo de las novillas que tienen acceso a pastos mejorados versus las ~ue se encuentran solamente en sabana."},{"index":2,"size":24,"text":"2.3 Evaluar el comportamiento de los pastos mejorados a travez del tiempo. principalmente lo correspondiente a persistencia. composi ción botánica e invasión de malezas."}]},{"head":"REVISION DE LITERATÚRA","index":2,"paragraphs":[{"index":1,"size":12,"text":"3.1 Factores que influyen en el comportamiento reproductivo de las nov; 11as."},{"index":2,"size":5,"text":"3.1.1 Nutrición de novillas 2."},{"index":3,"size":151,"text":"Son muchos los factores que pueden modificar el comportamiento reproductivo de las novillas. discutirlos todos sería un tema muy amplio y complejo. El objetivo del presente trabajo es analizar los aspectos relacionados con la nutrición. su efecto en el crecimiento y. la vida rep•roductiva de las novillas. Aspecto que depende directamente de la calidad de las praderas y la suplementación mineral (CIAT 1983), afirma que una de las características de la ganadería extensiva en los trópicos es el muy lento crecimiento de las hembra~ jóvenes de reemplazo. existiendo una relación entre las bajas tasas de crecimiento y la manifestación del primer celo; debido probablemente a una interacción entre peso y edad para alcanzar la pubertad. La nutrición adecuada permite al animal expresar todo su potenCial genético en términos de eficiencia reproductiva; peso al destete. crecimiento y engorde; altos índices de conversión alimenticia y buen rendimiento al mercado (Plasse 1979)  . ,"}]},{"head":"4.","index":3,"paragraphs":[{"index":1,"size":117,"text":"Según Helman (1977), en la primera de las etapas dé crecimiento, que ,es muy activo y se extiende hasta los seis y ocho meses, la' alimentación ,queda cubierta por la leche de la madre. Esto significa que, para satisfacer plenamente las necesidades de las mamonas, el esfuerzo deberá dirigirse a asegurar un buen amamantamiento brindando buenas pasturas a la madre. y, es en este 'aspecto donde el clima tropical, con sus altas temperaturas, tiene un poderoso papel negativo. Como reacción a la incomodidad fisiológfca que ,producen los fuertes calores, las vacas padecen una intensa inapetencia. Dejan de comer para no aumentar la formación de calor, pero, al disminuir el aporte de nutrientes reducen la producción de leche."},{"index":2,"size":46,"text":"Una ración nutricional adecuada es básica para un buen crecimiento y normal funcionamiento del proceso reproductivo. Es bien conocido que la falta de fósforo dispon~ble en los suelos tropicales influye negativamente en la eficiencia reproductiva y el mismo resultado tiene la falta de proteína, , '"},{"index":3,"size":254,"text":"'energía y de algunas vitaminas (Plasse 1979). Cajas (1984), menciona que niveles bajos de energía resultan en inactividad ovárica y anestros postparto, sin influencia de los niveles óe proteína dados a vacas jóvenes lactando. Según (Helman '1977), se ha demostrado, en forma experimental, que la falta de energía en la alimentación de vacunos en crecimiento es responsable de una disminución en el volúmen del animal, mientras que carencias o disminuciones en el aporte de proteína retardan la formación muscular. la edad de 1 a vaca, el estado de 'lactanci a y 1 a interacción entre ambos constituyen influencias de orden no genético inherentes al animal. Existen suficientes observaciones para considerar un hecho el fenómeno de que la vaca, cebuína no concibe bien durante su primera lactancia. resultando esto en valores, altos para el primer intervalo entre partos y en un porcentaje de preñez bajo para vacas que entran a su segunda temporada de monta. Aun cuando este fenómeno ha sido corregido en parte por cruzamientos y un mejor desarrollo de las novillas de primer servicio, se observa en rebaños 'con una adecuada eficiencia reproductiva que las vacas de primer parto tienen una efi~iencia reproductiva muy por debajO del promedio del rebaño (Plasse 1979). Cajas (1984) menciona que la ,más baja reproduCCión'en el ganado de la Florida fue observado en novillas de dos años en su primér parto y en vacas lactantes de tres años, en su segundo parto. La razón principal para la baja reproducción de las novillas. fue el nivel nutricional inadecuado 5."},{"index":4,"size":114,"text":"después del destete. al punto de que el crecimiento y la pubertad no fueron alcanzados a la edad deseada. As1 mismo los bajos niveles de nutrición de las vacas de tres años tuvo como consecuencia el que éstas no entrasen en' calor después del parto. dentro del período de apareamiento regular. Si no existe un adecuado crecimiento después'del destete. la novilla tratará de obtenerlo cuando esté criando su prime'r ternero. Esto es agravado por la necesidad de mantener un nivel nutriciona1 suficiente para que continúe ovulando y conciba durante el segundo período de apareamiento; entonces son necesarios nutrientes adicionales para mantener la función fisiológica, normal de una madre adulta en el período de lactancia."},{"index":5,"size":37,"text":"Estudios real; zados por ETES en los L-l anos Or;-enta 1 es de Co lombi a encontraron que los pesos ,dramáticamente bajos de vacas y novillas en estas fincas muestran claramente que su n'ivel nutricional fue inadecuado."},{"index":6,"size":66,"text":"Entre novillas de 36 meses de edad, las que aún no habían'concebido pesaban, aproximadamente. 255 kg; las que estaban preñadas. cerca de 300 kg; y las que ya hab1an parido, solamente 252 kg. En otras palabras. descontando el efecto de ]a gestación sobre el peso. estos animales pesaban a los 3 años lo que en otros sistemas de pastoreo podrían haber pesado al aJi.o de edad."},{"index":7,"size":149,"text":"Dentro de este panorama de nutrición insuficiente. ,con una baja tasa de procreo de las vacas y un tardío comienzo de la actividad reproductiva de las novillas, se puede examinar la variación de los parámetros reproductivos entre las fincas en función de la variación en peso vivo de las hembras. La tala de preñez estuvo estrechamente asociada con el promedio del peso de las vacas, la tasa de preñez aumentó en 2.8 unidades porcentuales. con un coeficiente de correlación de 0.8 (ETES 1982)   Es bien sabido que las pasturas tropicales suelen caracterizarse por ser pronunciadamente pobres en proteínas y relativamente parcas en el sumistro de los niveles necesarios de principios energéticos. Cuando se trata de .los• meses correspondientes al período seco del año. las pasturas abundan en celulosas'y ligninas. poco digestibles y con extrema escasez de hidratos de carbono solubles y proteínas. por lo' tanto configuran una alimentación 7."},{"index":8,"size":15,"text":"extremadamente deficiente para las novillas que se hallan en pleno crecimiento y desarrollo (Helman 1977)."},{"index":9,"size":266,"text":"La presentación periódica de épocas de insuficiencia en el aporte de alimentos es casi habitual en las regiones tropicales, como consecuencia de la pronunciada estacionalidad de ras pasturas. De esa situación deriva que los animales en crecimiento manifiesten un retardo en la .evoluciÓn de su conformación y aptitudes. En. las vaquillas se registra una demora de más de siete meses en la presentación de la pubertad y de alrededor de más de 10 meses en la obtención de la primera cria (Helman 1977). La sequía se convierte en estas condiciones en un modifi~ador preponderante de los sistemas de producción (Paladines y Leal 1978). En la sabana nativa, la baja carga animal que se emplea, es lo que permite el mantenimiento del equilibrio biológico. Los intentos de intensificación de la producción, con el solo 'aumento de la carga animal, tienen como consecuencia final la perturbación del balance ecológico y la disminución de la productividad, ya -inicialmente baja (Vilela '1977, Paladines y Leal 1978). La vegetación predominante en la sabana nativa y que es consumida por el ganado como forraje, está constituida por: Trachypogon vestitus, Heptochoritium lanatus, Paspalum pectenatum, Andropogon semiberbis, Axenopus pulcher, Panicum versfcolor, etc.; los cuales ofrecen allá una disponibilidad de forrajes (Paladines 1978). No es posible afirmar que la~ diferencias en ganancia de peso se deban a la di•sponibil idad de forrajes. En este tipo de praderas la quema juega un papel importante. siendo costumbre quemar las praderas durante la época seca para conseguir un rebrote tierno, en esta forma se consigue aumentar el crecimiento de los animales hasta en 250% (Paladines y leal 1978)."},{"index":10,"size":46,"text":"Es clara la evidencia en el sentido de la baja calidad de la sabana nativa y en general de las pasturas nativas en los trópicos; lo cual incide fundamentalmente en el comportamiento de los animales, tanto en el crecimiento como en el aspecto reproductivo. ¡ 8."}]},{"head":"Pastos mejorados en el trópico","index":4,"paragraphs":[{"index":1,"size":74,"text":". La disponibilidad de energta radiante y de temperaturas favorables para el crecimiento de las.plantas forrajeras determinan que el potencial de p~oducción de materia seca de los pastos tropicales sea muy alta (Tergas 1983) • Lo antes mencionado llamó la atención de investigadores y empezaron las pruebas con pastos mejorados. primeramente en la Estación Experimental de Cárimagua y posteriormente en fincas colaborativas de los Llanos Orientales de Colombia en condiciones de sabana bien drenada."},{"index":2,"size":69,"text":"'En trabajos realizados por el ClAT. a 'nivel de granja experimental, . como a nivel de fincas comerciales se ha encontrado una alta correlación \" entre el peso del animal y la tasa de concepción. Se encontró relación entre ~l peso y la edad al primer celo, de modo que las novillas de menor edad y mayor' peso presentaron el primer celo más temprano que las demás (Cajas 1984)."},{"index":3,"size":33,"text":"Se vienen desarrollando experimentos. con la finalidad de evaluar diferentes modalidades de uso estratégiCO de pasturas mejoradas como suplemento de la sabana nativa', para mejorar parametros reproductivos en novillas y vacas de cda."},{"index":4,"size":85,"text":"Resultados preliminares sugieren que durante el pertodo' examinado, el uso estratégico de pequeñas áreas de pasto mejorado fueran capaces de mantener los indices productivos de la sabana nativa a pesar de una carga animal mayor en aquellos. Desde el punto de vista del peso de las vacas, se observó la tendencia a que los animales de los sistemas de manejo intensivo lograron pesos ligeramente más altos en los periodos críticos de concepción y parto, momentos en los cuales tenían acceso controlado a \"los pastos mejorados."},{"index":5,"size":71,"text":"En experimentos realizados por (Tergas, Paladines. K1einheisterkamp y Velásquez 1983). reportan el potencial de las pasturas mejoradas para aumentar la productividad animal en Brachiaria decumbens de un 8-26%, mediante el pastoreo complementario con Pueraria Orientales de Colombia, debido prinCipalmente al en la nutrición animal durante la estación seca. por (Holroyd, O'Rourke, Clarke, Loxton 1983) para phaseol.oides en los Llanos efecto de la leguminosa En un estudio realizado examinar el comportamiento 9."},{"index":6,"size":151,"text":"reproductivo de vacas y la tasa de crecimiento de sus terneros hasta el momento del destete durante un periodo de 4 años. las vacas pastorean en una pradera natural con una carga animal de 1 vacal 4 ha; o en una pradera natural sobre la cual se sembró Stylosanthes .humilis y fertilizada con superfosfato (carga animal de 1 vaca/ 2 ha). Se observó que las vacas que pastorean en una pradera de leguminosa fertilizada presentaran tasas de concepción significativamente mayores, as1 como fecha de parición mas tempranas; estas vaca~ presentaron generalmente una mejor condición f1sica, mayor peso. y sus terneros alcanzaron más rápidamente el momento del destete que las que pastorean en una pradera natural. La pradera de leguminosa fertilizada produjo un aumento de 2.4 veces (en comparación con la pradera natural) en el peso vivo de vacas y terneros/unidad de área (38.7 Kg/ha vs. 159.8 kg/ha) durante los 4 años."},{"index":7,"size":141,"text":"(Caja~, .1984) encontró un efecto altamente significativo de carga •anima1 en pastos mejorados sobre las ganacias diarias de peso vivo. La mayor gana~cia fue para la carga baja, siendo las novillas de dicho tratamiento las que en menos tiempo alcanzaroñ el peso. que se había establecido para entrar al servicio. Las novillas de carga media alcanzaron dicho peso tres meses después, mientras que las de carga alta llegaron al final del experimento con solo 219 kg en promedia. Esto fue debido principalmente al efecto de la carga sobre las disponibilidad de forraje; aún que la calidad fuera buena, la baja disponibilidad de forraje en la carga alta afecta tremendamente el crecimiento y consecuentemente en el comportamiento reproductivo de dichas novillas. la edad a la cual se presentó el primer celo estuvo relacionada en este trabajo con el peso vivo. .. ,"}]},{"head":"MATERIALES Y METODOS","index":5,"paragraphs":[]},{"head":"10.","index":6,"paragraphs":[{"index":1,"size":30,"text":"entre Puerto lópez y Carimagua. se considera este tramo como representativo de las sabanas de la Orinoquía Colombiana que ocupan aproximadamente, 17 millones de ha. el 15% del territorio nacional."}]},{"head":"Caracter1sticas fisiográfícas","index":7,"paragraphs":[{"index":1,"size":88,"text":"Dentro de las características del ecosistema de esta región. se'distinguen cuatro unidades fisiógráficas bien demarcadas y diferenciadas entre si: a) Sabana alta o bien drenada. son sectores altos y planos. de topografía ligeramente convexa y con pendientes muy suaves. la vegetación, es la típica sabana. casi sin árboles ni arbustos; estas áreas soportan un período de sequía de aproximadamente 4 meses tienen general~ente buen drenaje 10 cual hace posible la mecanización 'agrícola. ya que favorece la topografía; carecen de pedrejosidad. y presentan buenas condic';ones físicas para el laboreo."},{"index":2,"size":215,"text":"las limítantes de estas áreas son su baja fertilidad y la falta de humedad del suelo durante el verano para facilitar el desarrollo vegetativo de las especies forrajeras. La ganaderí'a del Ll ano se desarrolla principalmente en las áreas de sabana alta durante la mayor parte del año. es aquí donde se tiene toda la infraestructura existente para el manejo de los hatos y los potreros con pasturas . ' \" mejoradas. b) Sabana .baja, llamada también bajos. se caracteriza por presentar mal drenaje, son estrechos y elongados que sirven como sistema de drenaje de la sabana alta. Los bajos aparentan pequeños valles muy humedos la vegetación es de tamaño medio donde predomina la palma moriche que le dá también la denominación de morichales. La corriente de agua es estacional, solamente en la época lluviosa, condición que favorece al desarrollo de pasto tierno durante las épocas críticas del año (sequía) y es muy bien aprovechada por los ganaderos. el valor de Cabe mencionar de que los bajos son la tierra en la altillanura plana.   Q) Bosque de galería, se presenta en las márgenes de lechos con agua ~nente conocidos en la región con el nombre de caños. aquí el moriche es desplazado por una vegetación más diversificada y de mayor embergadura encontrandose hasta especies maderables."}]},{"head":"Suelos","index":8,"paragraphs":[{"index":1,"size":103,"text":"Según los estudios realizados por ETES Colombia, las características de los suelos son marcadamente similares a lo largo de todo el paisaje. la fertilidad de estos suelos es extremadamente baja y se clasifican como Haplustox Típico, caolinítico, arcilloso. isohipertérmico. Son suelos profundos, bien estructurados. porosos. muy permeables. que no se encharcan con las lluvias torrenciales. No tienen pedrejosidad ni en la superficie ni en la profundidad. En las áreas mal drenadas se presentan abundantes moteados y pocas concreciones blandas fracturables con las uñas. Los bajos presentan una mayor disponibilidad de fósforo razón por la cual son considerados como suelos buenos por los ganaderos."}]},{"head":"Clima","index":9,"paragraphs":[{"index":1,"size":34,"text":"Para caracterizar el clima de la región se toman en cuenta los registros meteorológicos del Centro Nacional de Investigaciones Agropecuarias (CNIA) en Carimagua por considerarse los más representativos para el área en estudi•o. ."},{"index":2,"size":21,"text":". Brasil Colombia Brasil Colombia --------------------kgl an ; r.la 1 --------------------- ' ,--, ¡, --' . ' \", '-: . ,"},{"index":3,"size":16,"text":"; 91t, 1975 197.6 197i 1978 1~79 1980' 1961, \\91\\2 1~53 l'ror::c- : Julio '.  -."},{"index":4,"size":142,"text":"--,. Realizando una observación del panorama general de la ganadería en los Llanos Orientales de Colombia, pueden diferenciarse tres niveles de\" explotación ganadera. 4.1.4.1 Uno de los tipos, qUizás el ancestral, se caracteriza por la oacupación de grandes superficies de tierras que no tienen infraestructura digna de mención, cuando más un corral rústico y cercas perimetrales. Lo's animales se encuentran libres en la sabana. no se realiza ningún tipo de manejo, excepto al final de la época lluvio~a cuando son recogidos para hacer la hierra y' el aparte de las reses para la venta. Los costos de producción en estos hatos son insignificantes así como los rendimientos obtenidos: y los ingresos que obtiene el ganadero o finquero más propiamente dicho. es por la cantidad de animales que dispone para la venta y ~ .. ,. . n~,as' por la calidad de estos."}]},{"head":"4.1.4.2","index":10,"paragraphs":[{"index":1,"size":132,"text":"En el segundo nivel, el ganadero ya ha cercado su propiedad y ha realizado algunas subdivisiones. El ganado es trabajado dos veces al año, a la entrada y finalización de la época lluviosa con el fin de herrar los becerros, vacunar los animales y hacer el aparte para la venta, cría y ceba. 12. 4.1.4.3 Finalmente, hay un reducido número de ganaderos que realizan grandes inve.rsiones económicas destinadas a la construcción de infraestructura de manejo (corrales, bretes, alambradas y bañaderos) e implantación de, pasturas: se toman medidas profilácticas en la prevención de enfermedades y parásitos. En estos hatos se realizan controles permanentes del estado ~eproductivo de los animales, se llevan registros 'bien organizados del hato y generalmente tienen la visita periódica del Médico Veterinario que es, también solventada por ellos-o .' \"-13."}]},{"head":"Descripción de las fincas en estudio:","index":11,"paragraphs":[{"index":1,"size":141,"text":"Los resultados de estudios realizados por ETES indican que el tamaño de las fincas varían entre 375 y 8.891 ha. En_promedio el 65% de la superficie de las fincas estaba ocupada por sabana alta y un 20% por bajos. El resto de la superficie comprendía la serranía (11%) y bosque (4%). la sabana bien drenada es el principal recurso forrajero durante la época lluviosa. mientras que-'os bajos constituyen la base del pastoreo durante los periodos de sequía y en algunas fincas. los caños constituyen los abrevaderos para el ganado. los suelos de todas las firicas tienen las características edáficas comunes a la región. es decir. son ácidos e infértiles. Dentro de éstas características generales el suelo de Jos bajo tiene, en promedio. una disponibilidad de. fósforo mayor y una saturación de aluminio algo menor que el suelo de la sabana alta."},{"index":2,"size":69,"text":"La subdivisión de la mayor parte de las fincas en potreros respondía a un esquema común. en que era típica la presencia de uno o dos potreros de más_de 1.000 ha que representaban 60% o más de la superficie de la finca, y de un número variable de potreros menores generalmente de menos de 100 ha que en muchos casos ocupaban un área cubierta con pastos cultivados (ETES 1985)."}]},{"head":"las pasturas","index":12,"paragraphs":[{"index":1,"size":61,"text":"Al iniciarse el estudio. en 1977, siete de las fincas tenían más del 5% de su superficie cubiertos con pastos cultivados. mientras que en otras tres fincas había exclusivamente sabana nativa. Los pastos cultivados estab~n representdos exclusivamente por las gramíneas Me1inis minutiflora, Hyparrhenia rufa y Brachiaria decumbens. Esta última está sustituyendo a las otras dos en la preferencia de los ganaderos."},{"index":2,"size":54,"text":"El material utilizado por el Proyecto ETES en la fase de validación de tecnología, está constituido por especies forrajeras que fueron liberadas por el Centro N~cional de Investigac\"iones Agropecuarias de Carimagua. Este material está constituido por gramíneas y leguminosas que serán evaluadas en fincas comerciales bajo condiciones de pastoreo en establecimientos de praderas asociadas. "}]},{"head":"Las novillas","index":13,"paragraphs":[{"index":1,"size":75,"text":"En cada finca se realiza la 'selección de las novillas bajo el criterio de obtener lotes o grupos más o 'menos uniformes en edad y peso. alcanzando una edad promedio de 15 meses y 165 kg de peso vivo aproximadamente. 10 importante es que todas las novillas no hayan llegado todavía a la prubertad El número de animales por grupo es variable así como también el número de grupos en las diferentes pasturas o tratamientos."}]},{"head":"Metodología","index":14,"paragraphs":[]},{"head":"Establecimiento de las pasturas","index":15,"paragraphs":[{"index":1,"size":38,"text":"La ejecución de los programas en las fincas empieza con el establecimiento de las pasturas. ya sean estas solamente de gramíneas o de asociaciones con leguminosas. Las siembras se realizan con una aplicación simultánea de , \" \""},{"index":2,"size":124,"text":". fertilizante para el establecimiento a base de Calfos en la proporción. de 300 kg/ha. En el caso de asociaciones con leguminosas, e'stas últimas, 15 . deben ser previamente inoculada con la rizobia correspondiente para garantizar una buena modulación y conSecuentemente asegurar un buen establecimiento. Las densidades de siembra son variables según la especie; en el caso de las asociaciones de ~. gayanus más ~. capitata, se emplean 7 kg de semilla de ~,gayanus más 1.5 kg de semilla de ~. capitata por hectárea. Cuando se trata de asociaciones con Centrosemas, se utilizan 2 kg de semilla de éstas por hectárea, Las siembras se realizan al boleo, con boleadoras calibradas para garantizar una distribución uniforme tanto de la semi 11a éomo del fertil izante."},{"index":3,"size":22,"text":"El terreno debe ser preparado con anticipación para asegurar un buen reciclaje de la materia orgánica hasta el momento de la siembra."}]},{"head":"Visitas a las fincas y datos a tomar","index":16,"paragraphs":[{"index":1,"size":34,"text":"El equipo técnico del CrAT, realiza como m~nimo tres visitas por año a las diferentes fincas del programa para realizar trabajos de corral y evaluaciones en las pasturas donde se toman los siguientes datos:"},{"index":2,"size":83,"text":"-De los animales, información correspondiente a peso y reproducción: peso de los terneros, pesó de los levantes, pesos de 'los terneros al año de edad, lo cual permite calcular las ganancias de pesos ~n los levantes; en el aspecto reproductivo, se toman pesos de las novillas a los 36 meses de edad. peso de las vacas, tasa de preñez por palpación rectal; tasa de aborto y de pérdidas de terneros. Con la tasa de preñez se calcula el intervalo entre partos por vaca."},{"index":3,"size":74,"text":"De las pasturas, datos de composición botánica como número de plantasl m 2 , porcentaje de cobertura, porciento de maleza y altura promedio de las plantas. También se toman muestras de cada potrero para determinar materia seca, relación hoja tallo y,material inerte. ,Estos datos permitirán evaluar el comportamiento de las praderas bajo el efecto del animal y en el transcurso del tiempo, 10 que en otros términos se denominaría persistencia de la pradera.   -."},{"index":4,"size":2,"text":"---O--t --oPeso "}]},{"head":"RESULTADOS","index":17,"paragraphs":[{"index":1,"size":69,"text":"En el presente trabajo se muestran algunos resultdos preliminares registrados hasta el año 1984 con las diferentes especies forrajeras en estudio: Brachiaria decumbens es una de las gram~neas mejores adaptadas a las condiciones de los LLanos Orientales de Colombia no solamente por su tolerancia a bajos niveles de fertilidad natural del suelo ( Spain. 1975) sino también por su productividad animal y facilidad de manejo (Tergas et aL 1982)."},{"index":2,"size":12,"text":"En la Evaluación de un hato por su comportamiento reproductivo en 16."},{"index":3,"size":72,"text":"~. decumbens. 4 terneros murieron durante la lactancia: estas presentaron sintomas de fotosensibilización. 10 cual podría obstaculizar la evaluación precisa del potenCial reproductivo en pasturas de esta gramínea. Sin embargo. el comporta~iento de los terneros sobrevivientes fue satisfactorio. La reconcepción de las vacas lactantes fue también alta. 78%. 10 cual contrasta con la sit4ación observada normalmente en las sabanas nativas: la diferencia es debida probablemente a los altos pesos de éstos animales."},{"index":4,"size":99,"text":"La alternativa más interesante que se presenta en pastúras constituyen indudablemente las asociaciones de gramíneas y leguminosas. Las asociaciones que se vienen evaluando en fincas son: ~. gayanus +~. capitata y ~. humidico1a + Q. ovalifolium. en este último caso por problemas de nemátodos desapareció la legumi'nosa y se evaluó a los animales como en !. humidicola sóla. Otras asociaciones como~. gayanus + Centrosema sp. 5277. ~. gayanus + Centrosema brasilianum y Brachiaria.dietyoneura + Arachis pintoi. están recién en fase de establecimiento a nivel de fincas comerciales en los Llanos Orientales de Colombia. por tanto no se tiene •."},{"index":5,"size":10,"text":"todavla absolutamente ningún dato sobre comportamiento de animales pastoreando \"."},{"index":6,"size":5,"text":"estas asociaciones en fines comerciales."},{"index":7,"size":111,"text":"Actualmente se está evaluando la asociación de~. gayanus y ~. capitata en las fincas cooperadoras de los Llanos Orientales de Colombia •. En 'dos de las mismas se compara el crecimiento y desempeño reproductivo de novillas en sabanas. sujeta al manejo habitual del productor (tratamiento los datos antes citados sobre peso y natalidad sugieren que las mezclas minerales utiljzadas no han limitado el desempeño de los animales hasta el presente, y comparando el comportamiento de 'novillas en sabana versus asociación ~. gayanus/~. capitata parecerla que en presencia de estos niveles de suplementación mineral, la disponibilidad suficiente de forraje de buena calidad es factor determinante del comportamiento reproductivo de \"ovil 1 as."}]},{"head":"CONCLUSIONES","index":18,"paragraphs":[{"index":1,"size":39,"text":"-Durante los primeros años del uso de pastos mejorados para el levante \"de novillas. confirman la superioridad de la asociación de~. gayanus y~. capitata en ganancia de peso. capacidad de carga y desempeño reproductivo en relación a la sabana."},{"index":2,"size":36,"text":"-Los pesos y edades a la primera concepción reflejan claramente el muy lilllitado potenci a 1 de 1 a sabana. en 1 a cual 1 a primera gestad ón comienza a los tres o más años."},{"index":3,"size":82,"text":"En la asociación de~. gayanus/~. capitata se dió la primera parición a los tres años de edad de las novillas • . Por el contrario. la pastura de ~. numidicola confirmó que en ausencia de una leguminosa asociada. su potencial para generar ganancia de peso no es superior al de la sabana • la influencia del peso en la tasa de concepción de las novillas se pone de manifiesto. concontrándose una alta correlación entre ambos parámetros. Cajas, G., S • celos de"}]}],"figures":[{"text":" . "},{"text":" . "},{"text":" queA continuación se presenta un esquema enumerativo de los problemas acarrea la deficiente alimentación en las novillas antes del primer servicio y después de la primera parición: "},{"text":"4. 1 localización y características de las fincas las fincas que fueron seleccionadas para la fase de. validación de tecnología por el proyecto ETES en 105 llanos Orientales de Colombia, se . encuentran ubicadas en el Departamento del Meta, al sur del Río Meta, , . "},{"text":" . son paisajes de colinas redondeadas con pendientes mayores al 30%. suelos muy pedregosos y no aptos para la mecanización agrícola. "},{"text":" 14. "},{"text":"- Figura 1. entre peso vivo y la tasa de concepción en novillas. Datos de la finca 15. "},{"text":"Figura 2 . Figura 2. Curva de crecimiento de novillas. "},{"text":" .... . testigo) con animales semejantes permanentemente en pastos mej~rados o con acceso estacional a los mismos • 17. • , , • , , . ' '. . ' '. . , . , ' . ' .  "}],"sieverID":"8b657b3f-4349-4ad6-a6c5-665be1de95b7","abstract":"eminentemente ganadera, con características de explotación Que corresponde a un sistemas de tipo extensivo. debido principalmente' a la gran disponibilidad de tierras y la baja densidad demográfica Que presenta esa región. La producción ganadera se ve limitada por muchos factores; entre los cuales, la disponibilidad de forrajes pr.incipalmente durante los periodos de sequía y la baja calidad de 'estos que inciden fundamentalmente en los indices 'de producción bovina. \" Los paráme~ros reproductivos se ven seriamente afectados debido probablemente a un bajo consumo de nutrientes tanto protéicos como minerales en la dieta diaria.Por lo antes mencionado. surgió la necesidad de buscar especies con la finalidad de garantizar una mayor disponibilidad y mejor calidad del forraje principalmente durante los periodos críticos (verano) del año. Es así como actualmente el Centro Internacional de Agricultura Tropical, CIAr después de varios años de' invest,ígación, viEme:eyaluando (bajO pastoreo en fincas) el comportamiento de algunas especies forrajeras consideradas como promísorias para la zona, y la incidencia de las mismas en el comportamiento de los animales tanto en \"el aspecto reproductivo, como de levante y ceba. Esta actividad se viene desarrollando en diferentes fincas de los llanos Orientales de Colombia que fueron seleccionadas bajo los criterios de Que estas sean representativas de los sistemas de producción ganadera que se desarrolla en la región, disposición a cooperar por parte de los responsables de la finca. acceso fácil a la finca todo el año e infraestruc-'tura mínima de corrajes para manejo de ganado."}

data/part_1/013a445b3a68e51a1626910da664c118.json

@@ -0,0 +1 @@
+{"metadata":{"id":"013a445b3a68e51a1626910da664c118","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6ae51a96-0b7c-43b0-ae60-6c039bcd73a7/retrieve"},"pageCount":24,"title":"ADAPTING GREEN INNOVATION CENTRES TO CLIMATE CHANGE: ANALYSIS OF VALUE CHAIN ADAPTATION POTENTIAL Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes Regions, Togo CLIMATE RISK PROFILE SERIES","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":20,"text":"Agricultural production in Togo is reliant on rain-fed irrigation, leaving the country highly vulnerable to the effects of climate change."},{"index":2,"size":87,"text":"Changes in rain patterns coupled with other climatic hazards like heat waves and droughts have caused the country to experience a decline in crop yields and revenue. Climatic projections depict increasing temperature and decreasing rainfall, which will continue to affect farming households. This situation calls for interventions that increase farmers' adaptive capacity, for example through extension delivery, policy implementation, and the provision of climate information. Togo has already developed policies to strengthen the agricultural sector and tackle climate change but implementation of these policies is still weak."}]},{"head":"Development cooperation and the private sector collaborate with the government to supplement efforts on climate change.","index":2,"paragraphs":[{"index":1,"size":212,"text":"A key collaboration is the one between the German Agency for International Cooperation (GIZ), the Ministry of Agriculture, Livestock, and Fisheries (MAEP), and other locally acting nongovernmental organizations (NGOs) to execute Green Innovation Centres (GIC) under GIZ's \"ONEWORLD No Hunger\" initiative. 2 Through the GICs, GIZ aims to enhance farmers' income, create employment and improve farmers' technical and management skills, and develop awareness of biodiversity and environmental protection. In Togo, the GICs focus on three value chains: soya beans, peanuts, and cashews (Figure 1).  Togolese agriculture is non-mechanized, relying heavily on individual labour (Ministry of Agriculture, 2014). While many farmers rely on family labour, when laborers are hired, it is often for intense activities like harvesting and ploughing. Payments made to workers vary depending on the activity, but on average women earn less due to the lower value of their tasks. Women are responsible for more than half of sowing, where they represent 65% of the labour force, followed by transport (61%) and harvesting (56%). The paid workforce is primarily male (87%) (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2014). In regions like Savanes and Kara, where the cropping cycle makes it possible to cultivate several crops on the same plot (for example, millet and peanuts), labour intensity is higher."}]},{"head":"This document presents","index":3,"paragraphs":[]},{"head":"Key messages","index":4,"paragraphs":[]},{"head":"Agricultural Context","index":5,"paragraphs":[]},{"head":"Economic relevance of farming","index":6,"paragraphs":[]},{"head":"People and livelihoods","index":7,"paragraphs":[{"index":1,"size":173,"text":"The total population in Togo in 2018 was 7,889,094 and 58.3% of the total population lives in rural areas. 49.5% were men and 50.5% women (World Bank, 2019). Though the population is growing, the growth rate has decreased since 2010. Additionally, the rural population has also decreased (-0.07% since 2010). Importantly, a large share of the rural population is comprised of young people. On average, 42.4% of the rural population is between the ages of 15 and 49. According to the National Census of Agriculture, the Plateau region has the largest segment of Togo's rural population at 31.4%, up from 29% in 1996. This is due to availability of agricultural land that has drawn people from other regions (Ministry of Agriculture, 2014). In the last several decades, most regions in the country have seen an increase in their rural populations. The exception is the Maritime region, whose share of the rural dropped from 26.9% in 1996 to 19.4% in 2012 due to growing economic development of the region and urbanization (Figure 2).  2020)."}]},{"head":"The population of","index":8,"paragraphs":[{"index":1,"size":6,"text":"The adult population also faces malnutrition."},{"index":2,"size":71,"text":"Importantly, 48.9% of women of reproductive age have anaemia (Global Nutrition Report, 2020). The prevalence of undernourishment among the total population in 2017 was 16.1% (Global Nutrition Report, 2020). Nationwide, the main causes of food insecurity are insufficient financial resources (46.1%), followed by rainfall irregularities (28%) and high costs of food products on the market (13.2%). In rural areas, the main cause of food insecurity is poor harvests (44.7%) (INSEED, 2016). "}]},{"head":"Agricultural activities","index":9,"paragraphs":[]},{"head":"The use of chemical fertilizers is minimal.","index":10,"paragraphs":[{"index":1,"size":102,"text":"Most plots use organic fertilizers. The Savanes region has the highest use of fertilizers; 86% of plots here use organic and 36% use chemical fertilizers (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2014). According to the latest data available, in 2016, the use of fertilizers in Togo averaged 11.03 kg/ha of arable land, well below the world average of 418.7 kg/ha for that same year (World Bank, 2019). The Togolese government has tried to increase the use of inputs through subsidies covering up to 52% of the market price. These subsidies aim to improve accessibility for small farmers (ECDPM, 2013)."},{"index":2,"size":31,"text":"As the current use of fertilizers is low, possible concurrent environmental impacts are also low; significant increases in chemical fertilizer use in coming years could affect soil quality and water ecosystems."},{"index":3,"size":92,"text":"The main source of credit is from NGOs and cooperatives. In 2012, these provided 47% of cash credits and 31% of in-kind credits. Banks have a very low representation, providing only 4% of the cash credits (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2014). Of the total credits given in 2012, 65% were cash credits and 35% were credit-in-kind. Men in general have higher access to credits; in 2012 they received 60% of cash credits and 68% of in-kind credits (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2014)."}]},{"head":"Agricultural value chain commodities","index":11,"paragraphs":[{"index":1,"size":14,"text":"The soya bean, cashew, and peanut value chains have been analyzed in this study."},{"index":2,"size":85,"text":"While these crops make up less volume and area under cultivation compared to maize, yams, and cassava, they present notable development potential within the framework of climate-smart agriculture (CSA). Wholesalers, on the other hand, are usually men based in the main cities of a region. Wholesalers work closely with collectors who go into small villages to buy the produce. They generally sell the produce for exports to regional clients from Benin, Burkina Faso, and Ghana, although India and China are gaining importance as export markets."}]},{"head":"Soya bean","index":12,"paragraphs":[{"index":1,"size":11,"text":"Compared with conventional production, the organic farming sector is highly structured."},{"index":2,"size":72,"text":"Organic producers are organized into groups of 10 to 15 farmers at the village level. These groups are usually also part of a cooperative that supports farmers with access to inputs such as seeds and sacs, credits, and help with monitoring for quality (GFA & GIZ, 2018). Microfinance actors are also important as they help cover up to 50% of production costs, particularly for buying seeds. Organic soy producers are mainly male."},{"index":3,"size":80,"text":"Cooperatives also play an important role in the production and commercialization of organic soya beans, providing training for producers, helping them access inputs, and linking producers to exporters (GFA & GIZ, 2018). Each year, exporters set purchase price and supply targets with the cooperatives, which then set a purchase price for the producers. The margins for organic soya bean farming organizations are, on average, 5 to 10 FCFA/kg (less than 0.02 USD/ kg), but the margin of exporters is unreported"},{"index":4,"size":55,"text":"Organic soya bean production in Togo is governed by international standards and certification bodies. The main certification bodies are: ECOCERT (France), CERTISYS (Belgium), CERES (Germany) and AGROBIOCERT (Italy). These agencies apply European and American standards. 4 It is exporters who generally contact the agencies and finance certification of the value chain (GFA & GIZ, 2018)."},{"index":5,"size":186,"text":"In this sense, they are the foundation of the organic soy value chain.  GIZ, 2015). The small fraction of Togolese cashew nuts that are consumed within the country often go through an artisanal value addition in the hands of women who grill them and turn them into appetizers to be sold in Lomé (Tebonou et al., 2012). Opportunities furthermore exist to add value to cashew fruits, for example, by processing them into juice. However, limitations on storage and packaging and cultural beliefs that drinking cashew apple juice is unhealthy limit the development of this area of the value chain. Production is dominated by men, who constitute of 62.2% of producers. Nationally, women represent only 37.8% of producers, but as many as 46.7% are engaged in peanut production in the Kara region (Banla et al., 2018). Clearing and plowing are done mostly by men, sometimes as a hired workforce. Sowing is done by both men and women (Banla et al., 2018). Most farmers (51.67%) save seeds from the previous season's harvest for the next season's plating, while 38.9% buy seeds from local markets (Banla et al., 2018)."}]},{"head":"Peanut","index":13,"paragraphs":[{"index":1,"size":44,"text":"Most producers grow groundnuts mixed with other crops such as sorghum, millet, and maize (Banla et al., 2018). Chemical fertilizers are only applied to peanuts when they are produced with maize, as groundnuts receive the fertilizers applied to the maize (Banla et al., 2018)."},{"index":2,"size":112,"text":"81% of the peanuts produced in the Centrale, Kara, and Savanes regions are sold in local markets (Banla et al., 2018). Farmers are often forced to sell a large proportion of their produce soon after harvest, at low price, to cover their debts or to meet financial needs such as school fees and health care (Banla et al., 2018). Access to credit is limited, necessitating selling at low prices. There is no evidence of peanut farmers' organizations in Togo, but since peanuts are often produced in a mixed system, farmers may benefit from other cooperatives in which they participate.  » The costs and scope of these plans will present challenges to implementation."}]},{"head":"Agricultural sector challenges","index":14,"paragraphs":[]},{"head":"Policies, Strategies and Programs on Climate Change Key messages","index":15,"paragraphs":[{"index":1,"size":173,"text":"The most important adaptation policy in Togo is the National Climate Change Adaptation Plan (PNACC). This policy identifies agriculture as the sector most in need of adaptation given its importance to the economy and its vulnerability (Gouvernement du Togo, 2017). There are also structural factors within the agriculture sector that make farmers particularly vulnerable to climate change effects. These include land tenure insecurity, gender inequality, insufficient infrastructure, and a lack of connectivity between rural areas and main cities. These must also be addressed to have a more resilient agricultural sector.  Tossou 2015). Farmers estimates of temperature increases were generally aligned with measured temperature changes. Farmer perceptions of rainfall patterns over the same time period were also aligned with rainfall data to some extent (Gadédjisso-Tossou 2015). About 75% of farmers across the three regions detected a decrease in total rainfall, while the data shows a slight decreasing trend for the maritime and plateau regions and a slight increasing trend for the savannah region. Interannual rainfall data was highly variable, making these trends statistically insignificant."}]},{"head":"Adapting Green Innovation","index":16,"paragraphs":[{"index":1,"size":71,"text":"Farmers' gender, land tenure status, farming experience, and home region significantly impact climate change perceptions (Gadédjisso-Tossou 2015). Men and individuals with land tenure were more likely to report temperature change than women and untenured farmers; there was no difference in rainfall perceptions across gender or land tenure status. Farmers with more farming experience were less likely to perceive changes in temperature or rainfall, especially those in the plateau and savannah regions."}]},{"head":"Climate change and variability: historic and future trends","index":17,"paragraphs":[{"index":1,"size":50,"text":"Agriculture in Mali is mainly rain-fed and Heat stress poses an imminent risk to agricultural production in Togo. Climate projections show an increase of the number of days with a maximum temperature above 35ºC across the country (Figure 3), with the greatest effect in the regions of Savanes, Plateaux, and"},{"index":2,"size":90,"text":"Maritimes. In Savanes, the number of days with heat stress is projected to increase from fewer than 80 days/year to approximately 125 days/ year. In Plateaux, the number of days with heat stress increases from 50 to approximately 125 days/year. Maritimes is mainly affected during the first half of the year, when the number of days with heat stress increases from fewer than 40 to approximately 140 days/year. Moreover, mean temperature in the departments of Savanes and Kara is projected to reach 32.1ºC -33.1ºC by 2100 (Government of Togo, 2015)."}]},{"head":"Changes in the length of the growing season","index":18,"paragraphs":[{"index":1,"size":100,"text":"(LGP) will also affect agricultural production across Togo. The LGP is projected to decrease in most of the country, with the Savanes and Kara regions being the most affected (Figure 4). In Savanes, the LGP may fall from a current average of 100 to 120 days per year low as 60-100 days. Kara may experience a drop from a current average of 140-160 days per year to fewer than 120 days per year. The Maritimes region is an outlier in that the LGP there may increase slightly (by about 5 days per year) during the second half of the year."}]},{"head":"The results of climate modelling indicate that drought is one of the main hazards affecting","index":19,"paragraphs":[{"index":1,"size":69,"text":"Togo. In the Plateaux region, the number of consecutive dry days (CDD) is projected to double from an average 20 days per year to 40 days per year (Figure 5). In Maritimes, the number of CDD will increase in the first half of the year and then decrease slightly in the second half. In Savanes, Kara, and Centrale regions, there will be a slight increase in CDD as well."},{"index":2,"size":74,"text":"Another indicator of drought is moisture stress, which modelling indicates is a risk for northern part of the country. In the Savanes region, the number of days with moisture stress (NDWS) is projected to increase from 50 days/year to 100-110 days/year. In the Kara region, a current average of 40-60 NDWS per year is projected to increase to 70-90 days/year. Other regions would experience slight increases in the number of days with moisture stress."},{"index":3,"size":58,"text":"Flooding due to extreme rainfall events also presents a major risk in the Savanes, Kara, and Plateaux regions. The maximum 5-day running average precipitation is projected to experience a significant increase. For instance, in the Savanes and Kara regions, it may increase from an average rainfall of 18 mm in 2015 to 30 mm by 2061 (Figure 6).  "}]},{"head":"Climate vulnerabilities across agriculture value chain commodities","index":20,"paragraphs":[]},{"head":"Soya bean","index":21,"paragraphs":[{"index":1,"size":108,"text":"The main hazard identified for the soya bean value chain is drought. Drought's impacts are variable across production stages, low at the input supply stage, moderate at the on-farm stage, and low to major on the post-harvest and marketing stages. Temperature variability is a related hazard that affects the growing season by hastening plant development (especially the grain filling stage), resulting in lower yields (Billore et al., 2018;Chen, 2019;Mall et al., 2004). Based on this information, the main impacts of higher temperatures fall on the input supply stage, insofar as they may affect water availability and soil conditions, and the on-farm stage, given their effects on plant development."}]},{"head":"Cashew","index":22,"paragraphs":[{"index":1,"size":119,"text":"The two main hazards identified by experts in the survey for the cashew value chain are drought and high temperatures. Cashew trees are drought tolerant, but sensitive to high temperatures and changes in rainfall patterns, such as excess moisture and flooding-they thrive in well drained soils. Survey participants were asked to rank the impact of these hazards on the different stages of the value chain, they ranked drought as having a major impact at the on-farm stage (land preparation, nursery, planting, weeding, harvesting). For the other stages (input supply, post-harvest, and marketing), the impact was rated low. High temperatures impacts were distributed similarly, considered major at the on-farm stage and low on the other stages of the value chain."}]},{"head":"Peanut","index":23,"paragraphs":[{"index":1,"size":141,"text":"For the peanut value chain, the two main hazards identified were drought and decreased length of the rainy season. The impacts of drought are considered to be low on the input supply stage (land preparation; acquisition of seeds/planting material, fertilizers, pesticides), moderate to major on the onfarm stage, low to moderate on the postharvest stage, and low on the marketing stage. Regarding the decreased length of the rainy season, impacts are moderate on the input supply stage, and major on all the other stages of the value chain. The identification of these hazards is consistent with the literature review, where high temperatures and reduced rainfall are said to be the main limiting climatic factors for peanuts. Although some studies suggest that there might be a positive feedback through the CO 2 fertilizing effect, this requires further study (Ezihe et al., 2017)."}]},{"head":"Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential","index":24,"paragraphs":[{"index":1,"size":56,"text":"Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo » With the exception of highly-organized organic soya bean farmers, producers in the soya bean, peanut, and cashew value chains all currently have a low adaptive capacity due to small land holdings, subsistence-level agriculture, low input use, and poor market integration."},{"index":2,"size":29,"text":"» A range of strategies were identified as promising to meet climate threats in Togo; improved seed varieties, improved seek quality, and agricultural insurance were common across value chains."},{"index":3,"size":19,"text":"» Adoption of these adaptive strategies is limited by poor access to resources such as land, inputs, and information."},{"index":4,"size":35,"text":"» The CBA analysis shows that the high implementation cost and a longer payback period may be, therefore, a barrier to the adoption and scaling up of 'changing planting and harvesting period' for peanut production."}]},{"head":"Adaptation to Climate Change and Variability","index":25,"paragraphs":[]},{"head":"Key messages","index":26,"paragraphs":[]},{"head":"On-farm adaptation strategies","index":27,"paragraphs":[{"index":1,"size":75,"text":"The current adaptive capacity of producers in the peanut, cashew, and soya bean value chains is generally low. With the exception of organic soya bean producers, who are organized into cooperatives, most producers in the selected value chains are smallholders, operating at a subsistence level, with low levels of input use, and with variable, mediated connection to markets. These factors together serve to render producers in Togo particularly vulnerable to climate change effects (Table 1)."}]},{"head":"Soya bean","index":28,"paragraphs":[{"index":1,"size":120,"text":"Organic soya bean producers are linked by highly structured cooperatives. These organizations provide inputs such as seeds, sacs, credits, and help monitor quality. Therefore, organic soy producers have access to better information, technical assistance, and production monitoring than conventional soy producers. Given these characteristics, the adaptive capacity of organic soya bean famers is higher than that of conventional producers. Ongoing adaptation strategies for the soya beans value chains under the green innovations project include the improvement of the availability and quality of seeds, climate-intelligent innovations, CSA practices (i.e. mulching), and introduction of modifications in agricultural calendars. Potential adaptation strategies may include the use of new varieties tolerant to heat stress, the promotion of sustainable soil management and agricultural insurance programs."},{"index":2,"size":69,"text":"Neither organic nor conventional soy producers have direct access to markets, resulting in low levels of governance involvement for farmers. Organic producers' cooperatives facilitate the export of crops, while conventional farmers are dependent on collectors and wholesalers for market access. In addition to these limiting factors, transportation costs are high due to deficits in road infrastructure as only 18% of the national road networks are asphalted (Togo First, 2020)."}]},{"head":"Cashews","index":29,"paragraphs":[{"index":1,"size":92,"text":"An increase in the number of cooperatives in the cashew value chain is providing structure for adaptation efforts. For example, the company Cajou Espoir has helped to empower women within the value chain and to provide structure to it. The fact that there is a private sector actor with interest in the prosperity of the value chain can strengthen the adaptive capacity of producers and other actors in the value chain. Current adaptation strategies include planting cashew in poor soils to help recover fertility and to prevent erosion (Catarino et al., 2015);"},{"index":2,"size":35,"text":"improving the availability and quality of seeds, introducing climate-intelligent innovations and climate smart practices (i.e. mulching), and crop association. Potential strategies include the adoption of varieties more resistant to heat stress and agricultural insurance programs."}]},{"head":"Peanuts","index":30,"paragraphs":[{"index":1,"size":13,"text":"Ongoing adaptation strategies for the peanut value chain focus on inputs and intercropping."},{"index":2,"size":82,"text":"They include improving the availability and quality of seeds, introducing climate-intelligent innovations and CSA practices (i.e. mulching), and crop association. Since peanuts help fix nitrogen in the soil, they are often mixed with other crops, particularly maize. Potential adaptation strategies include the adoption of high-yielding peanut varieties that have a large pod size and resistance to late leaf spot; changes in the agricultural calendar (for example, offseason production), and the development of farmers' cooperatives that could promote best practices and technology transfer."}]},{"head":"Overall ranking of the adaptation strategies","index":31,"paragraphs":[{"index":1,"size":106,"text":"Adaptations were identified and selected using an iterative process with experts from each value chain. A literature review identified farmers' current adaptation strategies, some of which are traditional CSA practices, while others are modern practices introduced by development organizations including those introduced by GICs. Similarly, a list of all hazards that affected production in the three value chains was compiled. Experts were then tasked with identifying the two hazards that impacted each value chain the most. Then, the experts chose the two most promising adaptation strategies for each of the two hazards at every stage of the value chain (input acquisition, onfarm production, post-harvest and marketing)."},{"index":2,"size":58,"text":"All the promising strategies were then ranked on a scale of 1-8, where the value 1 implied a highly-ranked strategy and 8 a low one. The final ranking resulted in two strategies for each hazard in each value chain This section will present the main adaptation strategies for the two most important hazards selected for each value chain."},{"index":3,"size":92,"text":"For the cashew value chain, the most promising adaptation strategies focus on inputs, with quality seed as a primary concern. The highest-ranked adaptations against drought are improving the availability and quality of seeds and providing technical assistance. For heat stress, the most promising adaptation strategies are better seeds and the rehabilitation of abandoned cashew plantations. The improvement of seed quality is ranked as most promising adaptation across the stages of the value chain, while rehabilitation of abandoned cashew plantations is ranked as most promising in the input and on-farm stages (Table 2)."},{"index":4,"size":85,"text":"In the peanut value chain, promising adaptations focus on crop calendars, insurance, and the introduction of improved varieties. The most promising adaptation strategies in the case of drought are modifying agricultural calendars and the introduction of new varieties. For the decrease of the rainy season, the most promising adaptation strategies are agricultural insurance and the introduction of improved varieties. New and improved varieties and calendar modification are most promising at the input and on-farm stages, while agricultural insurances are most promising in the post-harvest stage."},{"index":5,"size":19,"text":"Finally, the introduction of new, tolerant varieties and improving seed quality are the most promising adaptations for soya beans."},{"index":6,"size":44,"text":"These are thought to be effective against the main hazards of drought and high temperatures, and they are most promising on the inputs and on-farm stages. As with peanuts, agricultural insurance is ranked as most promising for the post-harvest stage in this value chain."}]},{"head":"Cost benefit analysis of the prioritized adaptation strategies","index":32,"paragraphs":[{"index":1,"size":134,"text":"Cost and benefit analysis (CBA) is critical when making investment decisions, including those associated with Climate-Smart agricultural practices or innovations. This is because CBA allows for the comparison of costs and returns associated with a given CSA innovation when compared to those already existing (or business as usual) (Ng'ang 'a et al., 2017). In CBA, three indicators, the Net Present Value (NPV), Internal Rate of Return (IRR), and payback period are normally used to assess the profitability associated with an improved practice or innovation. The NPV measures the incremental flow of net benefits from the innovation over its lifecycle, while the IRR is the discount rate that equates NPV to 0. A higher IRR indicates that innovation is profitable. The payback period is the number of years it takes to recoup the initial investment."},{"index":2,"size":57,"text":"In this report, CBA was computed for the highest-ranked innovation in the peanut value chain in Togo, specifically, \"changing planting and harvesting period\". \"Changing planting and harvesting period\" for peanut was considered a priority because it improves the yields when compared to the conventional practice. Changing the planting and harvesting period has a lifecycle of 4 years.    "},{"index":3,"size":15,"text":"The \"new innovation\" in this case refers to the \"changing the planting and harvesting period.\""},{"index":4,"size":210,"text":"To implement and maintain \"changing planting and harvesting period\" of peanut requires a similar amount of capital as is required in the case of BAU 3). The cost of operating \"changing planting and harvesting period\" was 50% more compared to that of BAU. The main benefit arising from \"changing planting and harvesting period\" for peanut, therefore, was associated with the increase in yield by about 50% (Table 3 and Figure 10). The lack of change in installation and maintenance cost when \"changing planting and harvesting period\" for peanut is because no new inputs were introduced as compared to the BAU or conventional practice 6 . The NPV \"changing planting and harvesting period\" for peanut was on average US$ 425 over its lifecycle per hectare (Table 4) and an IRR of more than 500% which is higher than the prevailing discount rate of 6%. Investing in \"changing planting and harvesting period\" for peanuts had a payback period of 1 year (Table 4), meaning that \"changing planting and harvesting period\" for peanut could be quite appealing to farmers because of the relatively short payback period and the low cost of implementing and maintaining this practice. Under normal circumstances, a longer payback act as a barrier for adoption and scaling up of innovations."},{"index":5,"size":45,"text":"The risk associated with \"changing planting and harvesting period\" for peanut was assessed using modelled using Monte Carlo simulation (n=10,000). The result showing the probability of losing money after investing \"changing planting and harvesting period\" for peanut is summarized in column 6 in Table 4."},{"index":6,"size":80,"text":"The likelihood or risk of losing money invested \"changing planting and harvesting period\" for peanut given the characteristics of the cumulative density function of expressing the probability of the NPV of being less than or equal to the costs of adopting this innovation (i.e., when taking into account the no-change in implementation and maintenance costs) is significantly high (approximately 95%). This means that \"changing 6 Conventional irrigation system and business as usual (BAU) are used synonymously in the CBA reporting."},{"index":7,"size":28,"text":"planting and harvesting period\" for peanut has promising returns, investing in it is not risky at all because the likelihood of losing invested money is 0% (Table 3)."},{"index":8,"size":67,"text":"The lack of change in implementation and maintenance costs (Table 3) could also explain why this innovation takes 1 year to achieve a break-even point. This implies that this innovation is one of the promising innovation in the study area, and even without sufficient financial support for a majority of the farmers, they will still be able to adopt \"changing planting and harvesting period\" for peanut innovation."},{"index":9,"size":27,"text":"High implementation cost and a longer payback period may be, therefore, a barrier to the adoption and scaling up of innovation among smallholder farmers in most cases."},{"index":10,"size":235,"text":"CBA is a very important evaluation too, especially when an investment decision needs to be made. Although CBA like any other methodology has its strengths and limitation (i.e., potential inaccuracies that may arise when identifying and/or quantifying costs and benefits for a given innovation), it is critical when it comes to planning, when making a future investment decision (i.e., whether to invest on a given innovation or not) and scaling up. \"Changing planting and harvesting period\" for peanut in Togo considered in this CBA analysis is a 'noregret option', implying that it has the potential to yield economic benefits now and in the future and could, therefore, play an important role in strengthening household resilience in the future.\" Changing planting and harvesting period\" for peanut is profitable and have a high IRR, and this could explain why this innovation emerged as a strong choice for stakeholders during the prioritization process. \"Changing planting and harvesting period\" for peanut as a practice requires similar investment capital as BAU, thereby increasing the likelihood of being profitable. Given that GIC interest is in helping to identify innovations that can produce desirable outcomes for a majority of smallholder farmers in Togo. The CBA results presented here are crucial because investments that require high investment costs may not be appealing to a majority of the smallholder farmers unless they are supported both technically and financially at the start of the practice. "}]},{"head":"Synthesis and Recommendations","index":33,"paragraphs":[{"index":1,"size":94,"text":"The main hazards expected to affect Togo are drought, heat stress, shortening of the growing season, and flooding. While drought will affect mainly the Plateaux and Maritimes regions, the northern departments of Savanes and Kara will be affected by increasing moisture stress and by flood risks. Heat stress will mainly affect the departments of Savanes, Plateaux, and Maritimes, while the decreasing LGP will mostly affect the Kara and Savanes regions. These hazards have affected production in the cashew nut, peanut and soya bean value chains, pointing to the need of enhancing farmers' adaptive capacity."},{"index":2,"size":16,"text":"With support from international cooperation and NGOs, farmers have been able to implement some adaptation strategies."},{"index":3,"size":60,"text":"The most adaptation strategies with the best potential for cushioning farmers from the impacts of the climatic hazards include the use of quality and improved seed varieties, providing technical assistance, rehabilitation of existing (abandoned) cashew plantations, modification of agricultural calendars, and the introduction of agricultural insurance programs. These strategies can help improve producers' income levels, food security, and overall wellbeing."},{"index":4,"size":74,"text":"However, institutional capacity building is key for agricultural development. For example, in the conventional soya bean value chain, the organization of producers (into cooperatives or associations) could be very helpful to strengthen producers' governance and adaptive capacity. In the cashew value chain, which is well organized, it would be helpful to have other private sector actors such as Cajou Espoir in other regions of the country, processing the produce locally and generating aggregate value."},{"index":5,"size":14,"text":"It is also necessary to address structural issues. This includes improving access to basic "}]}],"figures":[{"text":" CONTEXT ..................................................... "},{"text":"Figure 1 .Figure 2 .Figure 3 .Figure 4 .Figure 5 .Figure 6 .Figure 7 .Figure 8 .Figure 9 .Figure 10 . Figure 1. Map of the selected regions in Togo ...................................... 9 Figure 2. Agriculture and livelihoods ............................................. 14 Figure 3. Historical (right), future projected (center), and projected change (right) for the total number of days with maximum temperature greater or equal to 35°C in season 1 (average of last 30 years) in Togo ......................................25Figure 4. Historical (right), future projected (center), and projected change (right) for the length (days) of the first growing season (average of last 30 years) in Togo......26 Figure 5. Historical (left), future projected (center) and projected change (right) for the maximum number of consecutive dry days in season 1 (average of last 30 years) in Togo........................................................................26 Figure 6. Historical (left), future projected (center), and projected change (right) for the maximum 5-day running average precipitation in millimeters for season 1 (average of last 30 years) in Togo .................................................26 Figure 7. Left: Historical and future (scenario RCP 8.5, periods 2030 and 2050) suitability of cashew production in Togo. Right: Suitability change of cashew production ....................................................................28 Figure 8. Left: Historical and future (scenario RCP 8.5, periods 2030 and 2050) suitability of soya bean production in Togo. Right: Suitability change of soya bean production ...............................................................28 Figure 9. Left: Historical and future (scenario RCP 8.5, periods 2030 and 2050) suitability of groundnut production in Togo. Right: Suitability change of groundnut production ....................................................................29 Figure 10. Yield for Business as usual versus \"changing planting and harvesting period\" for peanuts in Togo .....................................................37 "},{"text":"»»»» Figure 1. Map of the selected regions in Togo Togo is a West African country bordered by Burkina Faso in the north, Ghana to the west, and Benin to the east. "},{"text":" ©www.freepik.com Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo » Togo has adopted policies and plans that address climate change and agriculture directly, including PNACC, the National Development Plan, and PNIASA. "},{"text":"» Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo » High temperatures, drought, and shortening growing seasons are the climatic hazards affecting value chain activities in the cashew, peanut, and soya bean value chains. Only negligible climate-instigated changes in crop suitability are projected for the highlighted crops in Togo. The majority of farmers believe temperatures are increasing; this is supported by meteorological data for the same time period, which shows a statistically significant upward trend in temperature (Gadédjisso- "},{"text":"Figure 3 . Figure 3. Historical (right), future projected (center), and projected change (right) for the total number of days with maximum temperature greater or equal to 35°C in season 1 (average of last 30 years) in Togo "},{"text":"Figure 4 .Figure 6 . Figure 4. Historical (right), future projected (center), and projected change (right) for the length (days) of the first growing season (average of last 30 years) in Togo "},{"text":"Figure 10 . Figure10. Yield for Business as usual versus \"changing planting and harvesting period\" for peanuts in Togo "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 . Specific practices within each practice group relevant to the focus value chains ........................................................................31  "},{"text":"Table 2 . Adapting to climate change: strategies across major value chain commodities ...............................................................33  "},{"text":"Table 3 . Summary Information on Installation cost for business as usual (BAU) and \"changing planting and harvesting period\" for peanut in Togo ...................37  "},{"text":"Table 4 . Summary  "},{"text":"Agriculture generates over 20% of export earnings (Government of Togo, 2018), and contributes to 23.4% of GDP (World Bank  , , 2019). According to the National Development 2019). According to the National Development Plan (NDP), Togolese economic growth has Plan (NDP), Togolese economic growth has increased steadily since 2008, with a 5.2% increased steadily since 2008, with a 5.2% growth rate in the period 2013-2016. This growth growth rate in the period 2013-2016. This growth is explained by increases both in agricultural is explained by increases both in agricultural activities and in other sectors of the economy, activities and in other sectors of the economy, such public investments or the extraction of such public investments or the extraction of phosphates and clinker (Government of Togo, phosphates and clinker (Government of Togo, 2018). 2018). While there are many agricultural activities While there are many agricultural activities in Togo, the subsistence farming of food in Togo, the subsistence farming of food crops dominates the system. Of the total crops dominates the system. Of the total available land for agriculture in Togo, 93% is available land for agriculture in Togo, 93% is dedicated to subsistence agriculture. The main dedicated to subsistence agriculture. The main crops are cereals (61%), tubers (22%), and grain crops are cereals (61%), tubers (22%), and grain legumes (13%) (Ministry of Agriculture, 2014). legumes (13%) (Ministry of Agriculture, 2014).  "},{"text":"Agriculture is the main activity of 79% of the rural population, followed closely by livestock husbandry. In  2018, agriculture employed 38.3% 2018, agriculture employed 38.3% of the population overall, contributing to 40.2% of the population overall, contributing to 40.2% of total male employment and 36.4% of total of total male employment and 36.4% of total female employment (World Bank, 2019). Other female employment (World Bank, 2019). Other important secondary activities are commerce and important secondary activities are commerce and arts and crafts (Ministry of Agriculture, 2014). arts and crafts (Ministry of Agriculture, 2014).  "},{"text":"Access to basic services is very low in the rural areas of Togo compared to the urban centres. Sanitation  Factors that contributing to poverty include Factors that contributing to poverty include low economic growth, low levels of access to low economic growth, low levels of access to productive resources, and the low levels of productive resources, and the low levels of access to basic social services such as drinking access to basic social services such as drinking water, health systems, electricity, and education water, health systems, electricity, and education (Government of Togo, 2015). (Government of Togo, 2015). services were only available services were only available to 7.4% of the rural areas in 2017, compared to to 7.4% of the rural areas in 2017, compared to 28.6% in urban areas. Access to electricity in that 28.6% in urban areas. Access to electricity in that same year was 19.5% in rural areas, compared same year was 19.5% in rural areas, compared to 88.8% in urban areas (World Bank, 2019). to 88.8% in urban areas (World Bank, 2019). The percentage of the population with access to The percentage of the population with access to basic drinking water in rural areas was 48.4% in basic drinking water in rural areas was 48.4% in 2017 (89.1% in urban areas), and the prevalence 2017 (89.1% in urban areas), and the prevalence of practicing open defecation was 72.1% in rural of practicing open defecation was 72.1% in rural areas and 12.8% in urban areas (World Bank, areas and 12.8% in urban areas (World Bank, 2019). 2019). Togo is also subject to Togo is also subject to poverty. According to the World Bank, as of poverty. According to the World Bank, as of 2015, 49.8% of Togo's population lived on less 2015, 49.8% of Togo's population lived on less than 1.90 USD/day (World Bank, 2019). The than 1.90 USD/day (World Bank, 2019). The Unified Questionnaire of Basic Indicators of Well- Unified Questionnaire of Basic Indicators of Well- being (QUIBB) survey reports that in the same being (QUIBB) survey reports that in the same year, 78.9% of poor people lived in rural areas, year, 78.9% of poor people lived in rural areas, and that they represented 68.7% of the rural and that they represented 68.7% of the rural population (Government of Togo, 2018; INSEED, population (Government of Togo, 2018; INSEED, 2016). QUIBB also found that the impoverished 2016). QUIBB also found that the impoverished population was mainly located in the Savanes population was mainly located in the Savanes and Central regions. Self-employed farmers had and Central regions. Self-employed farmers had the highest poverty rate at 72.6% (INSEED, 2016). the highest poverty rate at 72.6% (INSEED, 2016).  "},{"text":"The literacy rate for people over 15 years in Togo was 63.8% in 2015, with a higher literacy rate for men (76.7%) than women (51%) (World Bank, 2019); (INSEED, 2016). Urban  areas also have a higher rate of literacy, at 79.8% areas also have a higher rate of literacy, at 79.8% compared to a rate of 49.3% in rural areas in compared to a rate of 49.3% in rural areas in 2015 (INSEED, 2016). When analysed by type of 2015 (INSEED, 2016). When analysed by type of employment, the highest literacy rates appear employment, the highest literacy rates appear among public sector employees (97.4%), while among public sector employees (97.4%), while the rate among self-employed farmers is only the rate among self-employed farmers is only 49.6% (INSEED, 2016). The Kara and Savanes 49.6% (INSEED, 2016). The Kara and Savanes regions have the highest illiteracy rates, at 45.4% regions have the highest illiteracy rates, at 45.4% and 54.9% respectively. Illiteracy is higher among and 54.9% respectively. Illiteracy is higher among rural women, who comprise 60% of the illiterate rural women, who comprise 60% of the illiterate rural population. rural population.  "},{"text":"In 2015, 33.9% of Togolese households had difficulties meeting the food needs of their members. This  rate was higher in rural areas rate was higher in rural areas (35.7%) than in urban areas (31.8%) (INSEED, (35.7%) than in urban areas (31.8%) (INSEED, 2016). It is estimated that 46.6% of households 2016). It is estimated that 46.6% of households had experienced food shortages in the past had experienced food shortages in the past 12 months. There was, however, a notable 12 months. There was, however, a notable difference between rural areas (51.2%) and difference between rural areas (51.2%) and urban areas (41.5%) (INSEED, 2016). A monthly urban areas (41.5%) (INSEED, 2016). A monthly analysis showed that food shortages were most analysis showed that food shortages were most frequent in June and July (INSEED, 2016). frequent in June and July (INSEED, 2016).  "},{"text":"Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts , cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions,  "},{"text":"Togo Incidences of malnutrition and poor health outcomes among children are also prevalent in Togo. In  2017, 71% of children under five 2017, 71% of children under five years old suffered from anaemia and 51.7% of years old suffered from anaemia and 51.7% of childhood deaths in 2016 were attributed to childhood deaths in 2016 were attributed to communicable diseases or maternal, prenatal, communicable diseases or maternal, prenatal, and nutrition conditions (World Bank, 2019). The and nutrition conditions (World Bank, 2019). The national prevalence of under-five stunting was national prevalence of under-five stunting was 27.6% in 2014 and the prevalence of wasting in 27.6% in 2014 and the prevalence of wasting in the same age group was 6.6% (Global Nutrition the same age group was 6.6% (Global Nutrition Report, 2020). Wasting is only slightly more Report, 2020). Wasting is only slightly more common in rural areas (6.8%) than in urban common in rural areas (6.8%) than in urban areas (6.3%), but there is a marked difference areas (6.3%), but there is a marked difference between the prevalence of stunting in rural between the prevalence of stunting in rural areas (33.3%) compared to urban (16.2%), as areas (33.3%) compared to urban (16.2%), as of 2014 (Global Nutrition Report, 2020). In that of 2014 (Global Nutrition Report, 2020). In that same year, 57.2% of infants in the country same year, 57.2% of infants in the country were exclusively breastfed, well above the West were exclusively breastfed, well above the West African average of 32.5%, and rate of low birth African average of 32.5%, and rate of low birth weights was of 16.1% (Global Nutrition Report, weights was of 16.1% (Global Nutrition Report,  "},{"text":"Togo's agricultural land is dominated by smallholder farmers. Togo  (INSEED, 2016). Land ownership is higher (INSEED, 2016). Land ownership is higher among households headed by men (66.3%) among households headed by men (66.3%) than women (52.3%) (INSEED, 2016). 76.6% of than women (52.3%) (INSEED, 2016). 76.6% of farm households have less than 0.5 ha, while farm households have less than 0.5 ha, while 14.7% hold between 0.5 and 1 ha (Ministère de 14.7% hold between 0.5 and 1 ha (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2013). l'Agriculture, de l'Elevage et de la Pêche, 2013). has 38,200 km2 has 38,200 km2 of agricultural land, which represents 70.2% of agricultural land, which represents 70.2% of its total land area (World Bank, 2019). The of its total land area (World Bank, 2019). The arable land surface is 2,650,000 hectares, arable land surface is 2,650,000 hectares, corresponding to 48.7% of the total land corresponding to 48.7% of the total land area (World Bank, 2019). 3 About 62.7% of area (World Bank, 2019). 3 About 62.7% of households owned their land in 2015, with households owned their land in 2015, with 86% of landowners residing in the rural areas 86% of landowners residing in the rural areas 3 This information corresponds to the year 2016, last year available for this indicator. 3 This information corresponds to the year 2016, last year available for this indicator.  "},{"text":"Legacy is by far the main method for acquiring agricultural land. At  the national the national level, 54.7% of cultivated land is acquired level, 54.7% of cultivated land is acquired by inheritance, followed by 17.3% obtained by inheritance, followed by 17.3% obtained by loan or usufruct. Purchase and lease by loan or usufruct. Purchase and lease together represent only 5% of land ownership together represent only 5% of land ownership transactions. There are regional variations to transactions. There are regional variations to these patterns: inheritance accounts for as these patterns: inheritance accounts for as much as 73% of land ownership in the Savanes much as 73% of land ownership in the Savanes region and as little as 41% in the Centrale region. region and as little as 41% in the Centrale region. Likewise, more land is loaned or in usufruct in Likewise, more land is loaned or in usufruct in the Centrale (29%) and Kara (27%) regions than the Centrale (29%) and Kara (27%) regions than the national average. Of the land obtained by the national average. Of the land obtained by inheritance, women hold 51% of it (this is the inheritance, women hold 51% of it (this is the main way for women to acquire land) (Ministère main way for women to acquire land) (Ministère de l'Agriculture, de l'Elevage et de la Pêche, de l'Agriculture, de l'Elevage et de la Pêche, 2014) Women hold 51% of the land obtained by 2014) Women hold 51% of the land obtained by inheritance. The proportion of men and women inheritance. The proportion of men and women in other modes of land acquisitions are very in other modes of land acquisitions are very similar. similar.  "},{"text":"In Togo, 70.1% of farm households practice livestock breeding and farming simultaneously. About  14.3% practice 14.3% practice agriculture only, while 10.4% combine agriculture only, while 10.4% combine agriculture with livestock breeding and forestry agriculture with livestock breeding and forestry (Ministère de l'Agriculture, de l'Elevage et de la (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2013). Again, there are significant regional Pêche, 2013). Again, there are significant regional differences: 86% of farm households in Savanes differences: 86% of farm households in Savanes and 76% in Kara practice agriculture paired with and 76% in Kara practice agriculture paired with livestock husbandry while just 64% in the Plateau livestock husbandry while just 64% in the Plateau and 60% in the Maritime regions do so (Ministère and 60% in the Maritime regions do so (Ministère de l'Agriculture, de l'Elevage et de la Pêche, de l'Agriculture, de l'Elevage et de la Pêche, 2013). 2013).  "},{"text":"Togolese agriculture is characterized by low levels of mechanization and irrigation 4% in Savanes, 3.7% in Kara, and only 1% in the Centrale region use irrigation (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2014). Under-equipment in agriculture results in low productivity, and so it is important to note that the National Census of Agriculture identified only 341 hitches, 7 tillers, and 37 private tractors in the country as of 2012, and these numbers represent decreases from 1996, when, for example, 174 private tractors had been identified. Low maintenance justifies this decrease (Ministère de l'Agriculture, de l'Elevage et de la Pêche, 2013).  "},{"text":"Soya beans have great potential to contribute to food security as a source of income for producers and due to their high protein content for on-farm consumption  In contrast, only 36% of conventional soya In contrast, only 36% of conventional soya beans are exported. Within Togo, 35% of the beans are exported. Within Togo, 35% of the conventional soya bean crop is used for roasting, conventional soya bean crop is used for roasting, 15% is processed in other ways, and 2% is used 15% is processed in other ways, and 2% is used for on-farm consumption (GIZ, 2018). for on-farm consumption (GIZ, 2018).  "},{"text":"Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo Agriculture and livelihoods is reflected in the fact that inputs represent, on average, 11% of costs, while the main expense comes from the workforce (44-70%) (GFA & GIZ, 2018). In addition to farmers' cooperatives, an important institution for commercialization is the Service Enterprises and Producers Organization (ESOP). ESOP was created in 1998 to support the production, commercialization, and transformation of soya beans. In 2016 they commercialized 10% of the national production Figure 2.      Figure 2. DEMOGRAPHICS     DEMOGRAPHICS    of the population 58.3% Savanes Kara of the population 58.3%Savanes Kara togo's population  live in rural areas Centrale togo's populationlive in rural areasCentrale 7,889,094 inhabitants % of female vs. male population 50.5% 49.5% Plateaux Maritime 7,889,094 inhabitants% of female vs. male population50.5%49.5%Plateaux Maritime ACCESS TO BASIC NEEDS    ACCESS TO BASIC NEEDS % of the population suffering from  % of households with access Urban population Rural population % of the population suffering from% of households with accessUrban populationRural population 49.8% absolute poverty   to electricity for lighting 87% 20% 49.8% absolute povertyto electricity for lighting87%20% Youth literacy rate (15-30 years) 84.3%  % households with access to electricity for cooking 47% Youth literacy rate (15-30 years)84.3%% households with access to electricity for cooking47% % households with access to potable water 65.1% % of total households with access to clean fuels and technologies for cooking 6.7% % households with access to potable water65.1%% of total households with access to clean fuels and technologies for cooking6.7% FOOD SECURITY     FOOD SECURITY % children stunting  29.4%  % children wasted in Togo 2.0% % children stunting29.4%% children wasted in Togo2.0% FARMING & LAND USE     FARMING & LAND USE Arable land % of total in country land area BEEF caTTLE DAIRY caTTLE 30,620 314,810 Arable land% of total in country land areaBEEF caTTLE DAIRY caTTLE30,620314,810     SHEEP  337,598 SHEEP337,598 2,011KM 2 62%   CHICKEN GOAT 88,429 427,517 2,011KM 2 62%CHICKEN GOAT88,429427,517     0 50,000 150,000 250,000 350,000 450,000 050,000150,000250,000350,000450,000  "},{"text":"Because farmers' access to markets in the soya bean value chain is rarely direct, soybean farmers see low levels of governance and high transportation costs   "},{"text":"Collection and bulking are important activities in the conventional soya bean value chain. Since  most producers have small plots most producers have small plots (< 0.5 ha on average), their production volume (< 0.5 ha on average), their production volume is low, averaging 530 kg per producer. In cases is low, averaging 530 kg per producer. In cases where producers are involved in cooperatives, where producers are involved in cooperatives, soy is generally sold through these cooperatives soy is generally sold through these cooperatives to local collectors and wholesalers (GFA & GIZ, to local collectors and wholesalers (GFA & GIZ, 2018). Collectors, generally women, work either 2018). Collectors, generally women, work either alone or in groups to buy from producers and alone or in groups to buy from producers and then sell bulked produce in village and city then sell bulked produce in village and city markets. While collectors usually work with markets. While collectors usually work with clients based in Lomé, they also sometimes clients based in Lomé, they also sometimes interface with clients from other countries such interface with clients from other countries such as Benin and Burkina Faso (GFA & GIZ, 2018). as Benin and Burkina Faso (GFA & GIZ, 2018).  "},{"text":"Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions,  "},{"text":"Togo 2.4.2. Cashew In 2018, Togo produced 7,197 tons of raw cashew nuts on an area of 4,864 ha (FAO   Historically, the cashew sector is not Historically, the cashew sector is not  very well organized, but the number of very well organized, but the number of , cooperatives is increasing. Currently, there ,cooperatives is increasing. Currently, there 2019). Between 2014-2018, there was a slight are about 30 cooperatives nation-wide. The 2019). Between 2014-2018, there was a slightare about 30 cooperatives nation-wide. The decrease (-3%) in the volume of production. National Association of Cashew Cooperatives decrease (-3%) in the volume of production.National Association of Cashew Cooperatives Cashew nuts are primarily produced in the and Producers (ANCPA) was created in 2015 Cashew nuts are primarily produced in theand Producers (ANCPA) was created in 2015 Centrale (44% of total production) and Plateaux (Ministry of Agriculture & GIZ, 2015). 5 Another Centrale (44% of total production) and Plateaux(Ministry of Agriculture & GIZ, 2015). 5 Another (45.5%) regions. There is no production in the key actor is Cajou Espoir, which is the only (45.5%) regions. There is no production in thekey actor is Cajou Espoir, which is the only Maritimes region (GFA, 2017). Cashews are local company engaged in value addition by Maritimes region (GFA, 2017). Cashews arelocal company engaged in value addition by produced either in monocrop plantations or in processing raw cashew fruits into cashew nuts. produced either in monocrop plantations or inprocessing raw cashew fruits into cashew nuts. mixed crop systems. In the latter, cashews are Their factory, which has generated 700 jobs, mixed crop systems. In the latter, cashews areTheir factory, which has generated 700 jobs, commonly combined with the production of is in Tchamba (Centrale region). Most of the commonly combined with the production ofis in Tchamba (Centrale region). Most of the maize, rice, manioc, cowpea (blacked-eye pea), employees are women. In 2014 this company maize, rice, manioc, cowpea (blacked-eye pea),employees are women. In 2014 this company peanuts, soya beans, sorghum, and sesame. As processed 2400 tonnes and exported 25 peanuts, soya beans, sorghum, and sesame. Asprocessed 2400 tonnes and exported 25 cashew production is almost entirely for exports, containers of cashew nuts, worth $3 million USD cashew production is almost entirely for exports,containers of cashew nuts, worth $3 million USD it could present a threat to food security when (Ministry of Agriculture & GIZ, 2015). However, it could present a threat to food security when(Ministry of Agriculture & GIZ, 2015). However, cultivated as a monoculture. local companies are subject to competition with cultivated as a monoculture.local companies are subject to competition with  foreign exporters in the country, to the extent foreign exporters in the country, to the extent  that they sometimes must import cashews that they sometimes must import cashews  from Benin to meet their production quotas from Benin to meet their production quotas  (ResponsAbility, 2016; Tebonou et al., 2012). (ResponsAbility, 2016; Tebonou et al., 2012).  The Farmer Business School, (FBS) funded The Farmer Business School, (FBS) funded  by GIZ and the Gates Foundation, has also by GIZ and the Gates Foundation, has also  provided support for this value chain. While provided support for this value chain. While  it has supported the development of farmers' it has supported the development of farmers'  entrepreneurial skills and the improvement entrepreneurial skills and the improvement  of techniques and investments in agricultural of techniques and investments in agricultural  production, improvements can still be made production, improvements can still be made  to increase productivity and rents. The African to increase productivity and rents. The African  Cashew Alliance offers a certification to cashew Cashew Alliance offers a certification to cashew  processors, ACA SEAL, to guarantee the quality processors, ACA SEAL, to guarantee the quality  of their products for international exporters of their products for international exporters  (African Cashew Alliance, 2020; Ministry of (African Cashew Alliance, 2020; Ministry of  Agriculture & GIZ, 2015). Agriculture & GIZ, 2015). Access to inputs and finance are low in the Collectors and small processors play Access to inputs and finance are low in theCollectors and small processors play cashew value chain in Togo. Most producers important roles in the cashew value chain. As cashew value chain in Togo. Most producersimportant roles in the cashew value chain. As use natural fertilizers (e.g., rotten manioc leaves) most cashews in Togo are exported to the United use natural fertilizers (e.g., rotten manioc leaves)most cashews in Togo are exported to the United due to the expense of chemical fertilizers. States and the European Union, exporters are due to the expense of chemical fertilizers.States and the European Union, exporters are Access to financial services is a constraint in key aggregators. Most of the exporters in Togo Access to financial services is a constraint inkey aggregators. Most of the exporters in Togo the cashew value chain, as it is for agricultural are Indian or Pakistani (Ministry of Agriculture & the cashew value chain, as it is for agriculturalare Indian or Pakistani (Ministry of Agriculture & producers generally in Togo, but organization  producers generally in Togo, but organization into cooperatives and micro-finance initiatives  into cooperatives and micro-finance initiatives can help.  can help.  "},{"text":"In Togo, peanuts are an important legume crop, grown for both home consumption and marketing (Banla et al., 2018).  In 2018, Togo In 2018, Togo produced 43,842 tons of peanuts on 59,290 ha of produced 43,842 tons of peanuts on 59,290 ha of land (FAO, 2019). Kara and Savanes are the main land (FAO, 2019). Kara and Savanes are the main producing regions. Between 2014 and 2018, producing regions. Between 2014 and 2018, peanut production increased by 8%. peanut production increased by 8%.  "},{"text":"The absence of a clear development strategy for agriculture in the medium and long term has affected the development of competitive growth poles around which agriculture could develop. This may be resolved with the new Despite the country's economic growth, Despite the country's economic growth, extreme poverty persists throughout extreme poverty persists throughout Togo. According to the NDP 2018-2022, the Togo. According to the NDP 2018-2022, the low productivity of the agro-pastoral sector low productivity of the agro-pastoral sector is a contributing factor (Government of Togo, is a contributing factor (Government of Togo, 2018). The NDP further identifies the main 2018). The NDP further identifies the main weaknesses of the agricultural sector as low weaknesses of the agricultural sector as low levels of organization among farmers (mainly levels of organization among farmers (mainly smallholders), weak structuring of the value smallholders), weak structuring of the value chains, lack of control over water resources, chains, lack of control over water resources, insufficient technologies, difficulties in land insufficient technologies, difficulties in land access, insufficient infrastructures and access, insufficient infrastructures and equipment combined with weak supervision, equipment combined with weak supervision, and the isolation of production areas due to a and the isolation of production areas due to a lack of roads and tracks (Government of Togo, lack of roads and tracks (Government of Togo, 2018). The low professionalization of actors in 2018). The low professionalization of actors in the sector, low quality of investment in terms the sector, low quality of investment in terms of opportunities and jobs, and lack of financing of opportunities and jobs, and lack of financing mechanisms are also challenging. In addition, mechanisms are also challenging. In addition, agriculture in Togo is heavily dependent on agriculture in Togo is heavily dependent on weather conditions, which makes it more weather conditions, which makes it more vulnerable to climate change (Government of vulnerable to climate change (Government of Togo, 2018). Togo, 2018). Programme National d'Investissements Agricoles Programme National d'Investissements Agricoles et de Sécurité alimentaire (PNIASA) 2016-2030, et de Sécurité alimentaire (PNIASA) 2016-2030, although that program is still in its early stages. although that program is still in its early stages. Agricultural transformation poles (agropoles) Agricultural transformation poles (agropoles) could focus on improving productivity and could focus on improving productivity and achieving food security. Diversification of the achieving food security. Diversification of the  "},{"text":"Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo Regulation and Regulation and awareness regarding awareness regarding the use of pesticides the use of pesticides is also an important is also an important issue. Pesticide use is issue. Pesticide use is not well regulated in not well regulated in Togo, even though some Togo, even though some pesticides are harmful pesticides are harmful for human health and the for human health and the environment. Pesticides environment. Pesticides are heavily used in are heavily used in cotton, coffee, and cocoa cotton, coffee, and cocoa production and their production and their use for vegetable crops use for vegetable crops is increasing. Some is increasing. Some NGOs are working on NGOs are working on education and raising education and raising public awareness, public awareness, particularly in reducing particularly in reducing the use of insecticides, the use of insecticides, supporting traditional supporting traditional methods of conservation methods of conservation and pest control, and and pest control, and combating pollution by combating pollution by chemical fertilizers. The chemical fertilizers. The country has had a Pest country has had a Pest Management Plan since Management Plan since 2011, which provides 2011, which provides guidance to farmers, guidance to farmers, but stricter regulation is but stricter regulation is needed (Government of needed (Government of Togo, 2016). Togo, 2016). Finally, disparities Finally, disparities in access to factors in access to factors of production (land, of production (land, finance, technology) finance, technology) for rural women must for rural women must still be addressed. For still be addressed. For example, the revision of example, the revision of the PNIASA included in the PNIASA included in its vision a \"development its vision a \"development that is inclusive for all that is inclusive for all rural actors without rural actors without discrimination,\" but discrimination,\" but the implementation of the implementation of this vision may still be a this vision may still be a challenge (FAO, 2018). challenge (FAO, 2018).  "},{"text":"Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions,  (Government of Togo, 2018). For this it relies of (Government of Togo, 2018). For this it relies of  four pillars: access to inputs, social inclusion, four pillars: access to inputs, social inclusion,  mitigation of climate change, and governance mitigation of climate change, and governance  improvement (Government of Togo, 2018). While improvement (Government of Togo, 2018). While  all four pillars support climate change resiliency, all four pillars support climate change resiliency,  access to inputs, including improved seed, access to inputs, including improved seed, Among its guidelines for agriculture, PNACC is particularly key for effective adaptation to Among its guidelines for agriculture, PNACCis particularly key for effective adaptation to proposes the construction or recovery of water rapidly evolving climatic conditions. proposes the construction or recovery of waterrapidly evolving climatic conditions. storage for micro-irrigation (estimated cost: 50  storage for micro-irrigation (estimated cost: 50 million USD) because droughts and changes in The government is also on track to modernize million USD) because droughts and changes inThe government is also on track to modernize rainfall patterns are one of the main climate and improve its institutional management rainfall patterns are one of the main climateand improve its institutional management hazards for agriculture in Togo. It also proposes of agriculture. It has set up a tool called the hazards for agriculture in Togo. It also proposesof agriculture. It has set up a tool called the the promotion of resilient and productive crops Agri-SWAP Agenda, which integrates Internet- the promotion of resilient and productive cropsAgri-SWAP Agenda, which integrates Internet- within a climate change context (estimated controlled technologies (ICTs) through the within a climate change context (estimatedcontrolled technologies (ICTs) through the cost: 10 million USD) and fighting against soil Agri PME Project to connect farmers and cost: 10 million USD) and fighting against soilAgri PME Project to connect farmers and degradation by promoting comprehensive improve practices for soil fertility and land use degradation by promoting comprehensiveimprove practices for soil fertility and land use management for soil fertility (estimated cost: 25 while generating agricultural potential maps management for soil fertility (estimated cost: 25while generating agricultural potential maps Million USD) (Gouvernement du Togo, 2017). (Government of Togo, 2018). This type of tool Million USD) (Gouvernement du Togo, 2017).(Government of Togo, 2018). This type of tool The National Development Plan (NDP 2018-2022) can help farmers improve and modernize their The National Development Plan (NDP 2018-2022)can help farmers improve and modernize their also prioritizes the agricultural sector. Among practices, better connect them to markets, and also prioritizes the agricultural sector. Amongpractices, better connect them to markets, and the measures it proposes are a policy for water ultimately allow them to gain in advocacy in the measures it proposes are a policy for waterultimately allow them to gain in advocacy in resources, a policy for disaster prevention, governance. resources, a policy for disaster prevention,governance. and an action program to fight desertification.  and an action program to fight desertification. Although these measures do not specifically aim  Although these measures do not specifically aim for climate change adaptation, their goals are  for climate change adaptation, their goals are aligned with climate change risks and could be  aligned with climate change risks and could be helpful for this purpose.  helpful for this purpose.  "},{"text":"Togo » Climate-smart agriculture has support from the Togolese national government and international organizations. » Institutional capacity is, however, limited by finance, gaps in research capacity, and barriers to implementing climate related policies. » Climate-smart agriculture has support from the Togolese national government and international organizations. » Institutional capacity is, however, limited by finance, gaps in research capacity, and barriers to implementing climate related policies. Key messages 4. Governance, institutional resources and capacity The MAEP and the Ministry of Rural Equipment constitute the decision-making centres of agricultural development.  The  The MAEP comprises five regional directorates. In  MAEP comprises five regional directorates. In addition, it has nine attached organizations,  addition, it has nine attached organizations, including the Institute of Consulting and  including the Institute of Consulting and Technical Support (ICAT), which supports the Nevertheless, institutional capacities in Technical Support (ICAT), which supports theNevertheless, institutional capacities in professionalization of agricultural producers; agricultural sector in the country remain professionalization of agricultural producers;agricultural sector in the country remain the Togolese Institute of Agricultural Research low. Total government expenditure in this the Togolese Institute of Agricultural Researchlow. Total government expenditure in this (ITRA), which carries out research and provides sector has not reached the 10% set under the (ITRA), which carries out research and providessector has not reached the 10% set under the guidelines for the management of natural Comprehensive Africa Agriculture Development guidelines for the management of naturalComprehensive Africa Agriculture Development resources, agricultural systems, and technology Programme (CAADP) agreement. Moreover, resources, agricultural systems, and technologyProgramme (CAADP) agreement. Moreover, use; and the Togo National Food Security Agency the country only spends 0.4% of its agricultural use; and the Togo National Food Security Agencythe country only spends 0.4% of its agricultural (ANSAT). The National Institute of Statistics GDP on research and development. Agricultural (ANSAT). The National Institute of StatisticsGDP on research and development. Agricultural and Economic and Demographic Studies research capacity in Togo is low and needs to be and Economic and Demographic Studiesresearch capacity in Togo is low and needs to be (INSEED) also plays a key role in conducting expanded to foster innovation. The number of (INSEED) also plays a key role in conductingexpanded to foster innovation. The number of the agricultural census, which is essential for young agricultural researchers needs to increase the agricultural census, which is essential foryoung agricultural researchers needs to increase appropriate policy and planning. as a large number of researchers may retire appropriate policy and planning.as a large number of researchers may retire  in the coming years (ZEF et al., 2017). ITRA is in the coming years (ZEF et al., 2017). ITRA is International organizations and research heavily dependent on the support received from International organizations and researchheavily dependent on the support received from institutions are also present in the country. external organizations such as the World Bank. institutions are also present in the country.external organizations such as the World Bank.  There seems to be a gap between the policy There seems to be a gap between the policy  and planning stage and the implementation and planning stage and the implementation  "},{"text":"Table 1 . Specific practices within each practice group relevant to the focus value chains Practice SOYA BEAN CASHEW PEANUT PracticeSOYA BEANCASHEWPEANUT Groups Value Value Value GroupsValueValueValue  Chain Chain Chain ChainChainChain Variety improvement • Introduction of heat-  • Introduction of new, Variety improvement• Introduction of heat-• Introduction of new,  resistant varieties  improved varietes resistant varietiesimproved varietes  • Improving availability  • Improving availability • Improving availability• Improving availability  and quailty of seed  and quality of seed and quailty of seedand quality of seed Conservation agriculture • Mulching • Intercropping • Crop Association • Mulching Conservation agriculture• Mulching • Intercropping• Crop Association• Mulching Land management  • Rehabilitation of  Land management• Rehabilitation of   abandoned cashew  abandoned cashew   plantations  plantations Production best practices • Modifying cropping calendars • Providing technical assistance • Modifying cropping calendars * Production best practices• Modifying cropping calendars• Providing technical assistance• Modifying cropping calendars * insurance   • Agricultural risk insurance• Agricultural risk    insurance insurance *Denotes most promising adaptation strategy in the value chain  *Denotes most promising adaptation strategy in the value chain  "},{"text":"Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo  "},{"text":"Table 2 . Adapting to climate change: strategies across major value chain commodities  "},{"text":"Adapting Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo Adapting          Adapting Cashews input ON-FARM POST-Harvest marketing Peanuts input ON-FARM POST-Harvest marketing Cashews inputON-FARMPOST-HarvestmarketingPeanuts inputON-FARMPOST-Harvestmarketing Drought • A low quantity of certified seed • May affect the flowering stage • Lower yields • No information Drought  • A low quantity of certified seed growing period • Shorter length of • Lower yields • No information Drought• A low quantity of certified seed• May affect the flowering stage• Lower yields• No informationDrought• A low quantity of certified seedgrowing period • Shorter length of• Lower yields• No information  available, a low • May reduce crop     available, a low • Disease and pest risks  available, a low• May reduce cropavailable, a low• Disease and pest risks  germination rate after sowing;, a quality     germination rate after sowing;, a may reduce yields particularly in Kara and  germination rate after sowing;, aqualitygermination rate after sowing;, amay reduce yields particularly in Kara and  decrease in the      decrease in the Savanes regions  decrease in thedecrease in theSavanes regions  income of seed      income of seed • May cause reduction  income of seedincome of seed• May cause reduction  producers      producers of photosynthesis, affecting plant growth.  producersproducersof photosynthesis, affecting plant growth. Magnitude of impact Promising strategies adaptation low • Providing technical assistance • Improving the availability and quality of seeds MAJOR low low impact of low low-moderate MAJOR low Magnitude of impact Promising strategies adaptationlow • Providing technical assistance • Improving the availability and quality of seeds MAJORlowlowimpactoflowlow-moderateMAJORlow High temperatures • A low quantity available, a low of certified seed be burned • Leaf plasmolysis • Flowers and crops can harvesting more difficult • Makes manual • No information      High temperatures• A low quantity available, a low of certified seedbe burned • Leaf plasmolysis • Flowers and crops canharvesting more difficult • Makes manual• No information  germination rate decrease in the after sowing;, a development. • Damage to flowers can unfavorable to crop • Lower yields       germination rate decrease in the after sowing;, adevelopment. • Damage to flowers can unfavorable to crop• Lower yields  income of seed lead to early maturity        income of seedlead to early maturity  producers and reduced yields        producersand reduced yields Magnitude of impact low MAJOR low low      Magnitude of impactlowMAJORlowlow Promising strategies adaptation • Improving the availability and quality of seeds • Rehabilitation of existing (abandoned) cashew plantations       Promising strategies adaptation• Improving the availability and quality of seeds • Rehabilitation of existing (abandoned) cashew plantations Strategies to mitigate both hazards         Strategies to mitigate both hazards Farmers' coping strategies • Use of cashew tree leaves for mulching • Application of manure        Farmers' coping strategies• Use of cashew tree leaves for mulching • Application of manure On-going adaptation strategies • Improving the availability and quality of seeds • Climate smart practices (i.e. mulching) • Crop association        On-going adaptation strategies• Improving the availability and quality of seeds • Climate smart practices (i.e. mulching) • Crop association  "},{"text":"Green Innovation Centres to climate change: analysis of value chain adaptation potential Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo  "},{"text":"Table 3 . Summary Information on Installation cost for business as usual (BAU) and \"changing planting and harvesting period\" for peanut in Togo      and harvesting period\" for peanut in Togo VALUE CHAIN INNOVATION Installation Costs (US $ /ha) Business Changing of as usual planting and Maintenance costs (US$/ha) Operation Cost (US$/ha) Business as Changing of Business as Changing of usual planting and usual planting and VALUE CHAININNOVATIONInstallation Costs (US $ /ha) Business Changing of as usual planting andMaintenance costs (US$/ha) Operation Cost (US$/ha) Business as Changing of Business as Changing of usual planting and usual planting and   harvesting dates  harvesting dates  harvesting dates harvesting datesharvesting datesharvesting dates  Cost per hectare 489 489 1,312 1,312 600 900 Cost per hectare4894891,3121,312600900 PeanuT % change in cost when the innovation 7 is compared with the BAU n/a 0% n/a 0% n/a +50% PeanuT% change in cost when the innovation 7 is compared with the BAUn/a0%n/a0%n/a+50%  "},{"text":"Table 4 . Summary information on profitability associated with investing in \"changing planting and harvesting period\" for peanut in Togo   harvesting period\" for peanut in Togo Value chain Innovation Net present Profitability indicators Internal rate Payback The riskiness of the Value chainInnovationNet presentProfitability indicators Internal rate Payback The riskiness of the   Value (NPV) of returns (IRR) period investment Value (NPV)of returns (IRR)periodinvestment   in US$ in (%) (year) in US$in (%)(year) Peanut Changing 425 More than 1 A farmer has a 0% Peanut Changing425More than1A farmer has a 0%  planting and harvesting period  500% (>r)  probability of making unprofitable returns planting and harvesting period500% (>r)probability of making unprofitable returns  "},{"text":" necessities (water, electricity), communication and information technologies (internet, phones, radio), and road networks. It is also very important to develop better development and commercial policies for value chains like cashew and soya bean that are mainly exported, since activities generating aggregate value are currently done abroad (processing, transformation, certification). Developing local capacities to carry out these activities could help create jobs, professionalize actors in the value chains, and improve the livelihoods of rural populations, while generating more solid grounds for the sustainable development of agriculture in Togo.  "}],"sieverID":"f5ccf6bb-b615-461f-99ba-dfecbfdf0f85","abstract":"Peanuts, cashews, and soya beans in the Centre, Kara, Maritime, Plateaux, and Savanes regions, Togo"}

data/part_1/01535705b04ca3964a6007e8216e544b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01535705b04ca3964a6007e8216e544b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b94b2ffc-b152-4f19-9713-c2ca6b6025a1/retrieve"},"pageCount":1,"title":"Evaluating the impact of contour bunding technology on runoff, soil erosion and crop yield in southern Mali","keywords":[],"chapters":[{"head":"Objectives and approach","index":1,"paragraphs":[{"index":1,"size":22,"text":" The objective of the study was to evaluate the impact of contour bunding technology on runoff, soil erosion and crop yield."},{"index":2,"size":67,"text":" Field experimentation (Fig 2) in identified farmers' fields and technology parks where field were divided into two parts: one in Contour Bund (CB) and the other in No contour bund (NCB). The experiment was replicated twice and measurement was performed on runoff, erosion, soil moisture and crop yield. Two equations (Eq 1, Eq 2 were used to determine runoff volume and runoff rate from field measurement."}]},{"head":"Key results","index":2,"paragraphs":[{"index":1,"size":106,"text":" Soil moisture was always higher in the CB fields compared to the NCB fields during the cropping season. Whereas runoff and erosion rates were higher in fields without CB (Fig 3).  Runoff rate ranged from 39 to 43% in NCB fields and 24 to 26% in the CB fields.  Soil erosion of rain events ranged from 0.329 to 6 t ha -1 in CB and 0.73 to 14 t ha -1 in NCB fields.  A yield increase of 381 kg ha -1 (+24%) and 432 kg ha -1 (+49%) were observed for cotton and millet fields treated with CB respectively (Table 1)."},{"index":2,"size":16,"text":"Eq 1: Runoff water = \uD835\uDC49\uD835\uDC5C\uD835\uDC59\uD835\uDC62\uD835\uDC5A\uD835\uDC52 \uD835\uDC5C\uD835\uDC53 \uD835\uDC64\uD835\uDC4E\uD835\uDC61\uD835\uDC52\uD835\uDC5F \uD835\uDC54\uD835\uDC52\uD835\uDC5B\uD835\uDC52\uD835\uDC5F\uD835\uDC4E\uD835\uDC61\uD835\uDC52\uD835\uDC51 \uD835\uDC4F\uD835\uDC66 \uD835\uDC45\uD835\uDC62\uD835\uDC5B\uD835\uDC5C\uD835\uDC53\uD835\uDC53 \uD835\uDC64\uD835\uDC4E\uD835\uDC61\uD835\uDC52\uD835\uDC5F (\uD835\uDC3F) \uD835\uDC40\uD835\uDC52\uD835\uDC4E\uD835\uDC60\uD835\uDC62\uD835\uDC5F\uD835\uDC52\uD835\uDC5A\uD835\uDC52\uD835\uDC5B\uD835\uDC61 \uD835\uDC4E\uD835\uDC5F\uD835\uDC52\uD835\uDC4E (\uD835\uDC5A2)"},{"index":3,"size":95,"text":"Significance and scaling potential  The data obtained from experimental plots updated the national hydrological data that stopped measurement at least 15 years ago.  Where it was applied the contour bunding technology reduced runoff and erosion rates and increased soil water infiltration, an important phenomenon in the rain fed agriculture system. In addition the increase in crop yield was a key element for farmer's food security, income generation and livelihoods improvement.  Capacity building and farmers exchange visits on the benefits of contour bunding technology would help reaching at least 1000 households every year.  "}]}],"figures":[{"text":"Figure 1 .Figure 2 .Figure 3 . Figure 1. Millet field in southern Mali without application of contour bunding (NCB) and with CB "},{"text":"Table 1 . Yield of Cotton and Millet in farm fields treated with and without CB  "}],"sieverID":"8139b714-9bc6-4076-bf98-c67d6062afde","abstract":"We thank farmers and local partners in Africa RISING sites for their contributions to this research. We also acknowledge the support of all donors which globally support the work of the CGIAR centers and their partners through their contributions to the CGIAR system"}

data/part_1/01732d1c787ee25d6b8fd080b036d575.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01732d1c787ee25d6b8fd080b036d575","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1752ef6f-3296-4f4d-acc2-ba4029f69a2d/retrieve"},"pageCount":16,"title":"Tro dev Eth","keywords":["Commodity development","fruit production","IPMS","private fruit nurseries","value chain"],"chapters":[{"head":"Acknowledgement","index":1,"paragraphs":[{"index":1,"size":139,"text":"This paper documents interventions, results and lessons learned for tropical fruit commodity development in Alamata Woreda, based on a participatory market oriented value chain approach. The approach was introduced by the IPMS project/staff, who not only facilitated the introduction of the approach (technically and financially), but also played an important role as partner in the development process. The credit for the development results obtained go however to all the partners involved in this endeavor, especially farmers and staff of the Alamata OoARD, IWMI and private sector input suppliers and traders. Besides the authors, several people have contributed to the realization of the report including Rebeka Amha/Abraham Getachew and Dr Moti Jaleta who provided summarized baseline data and household level cost/benefit impact data, respectively, Yasin Getahun who provided maps and Genevieve Renard who edited the final version of this document."}]},{"head":"Abstract","index":2,"paragraphs":[{"index":1,"size":53,"text":"The Raya valley in Tigray, where Alamata Woreda is located, has suitable climate and rich water resources, among others, to grow various tropical fruits. Development of fruits only started a few years ago (1996) with the Raya Valley Development Project and the OoARD (Office of Agriculture and Rural Development), mostly focusing on papaya."},{"index":2,"size":116,"text":"A participatory rural appraisal (PRA) study conducted by the Woreda stakeholders identified tropical fruits as a potential marketable commodity in 2005. Using the commodity value chain approach, production, input supply and marketing problems, and opportunities were identified. Major problems were lack of knowledge and skills on tropical fruit production and management. Also, farmers were discouraged to grow fruits in their seasonally irrigated plots because of the free grazing which takes place during the dry season. Different extension approaches were used, including study tours to change the mind set of experts and farmers and to acquire knowledge. It also helped communities to devise organizational/institutional arrangements to protect seedlings, which encouraged the uptake of grafted mangoes and avocadoes."},{"index":3,"size":102,"text":"Most of the fruits can be sold locally, since most fruits so far were \"imported\" from other parts of the country. Some market linkages were also established in 2009 for the sale of the first grafted improved mango varieties. Farmer to farmer communications, trainings, workshops and media coverage facilitated the further dissemination of knowledge and skills between PAs (Peasant Associations) in Alamata and neighboring Woredas. Both women and men farmers benefited from the intervention. The household survey conducted in 2009 indicated that households involved in fruit production, on average, earned around Birr 1300 from the sale of fruits -70 % from papaya."},{"index":4,"size":53,"text":"While in other Districts the development of improved marketable varieties was supported with the development of private nurseries, attempts to introduce them in Alamata did not succeed because of the presence of large scale regional nurseries, which grow a large number of seedlings and sale seedlings at a much reduced price to farmers."}]},{"head":"Introduction","index":3,"paragraphs":[{"index":1,"size":41,"text":"The IPMS project, funded by the Canadian International Development Agency, was established to assist the Ministry of Agriculture and Rural Development in the transformation of smallholder farmers from a predominantly subsistence oriented agriculture to a more market oriented (commercial) oriented agriculture."},{"index":2,"size":65,"text":"The project adopted a \"participatory market oriented commodity value chain development\" approach which is based on the concepts of innovation systems and value chains. Crucial elements in the approach are the focus on all the value chain components instead of only a production technology focus; the linking and capacitating of value chain partners and the assessment, and synthesis and sharing of knowledge among the partners."},{"index":3,"size":94,"text":"The project introduced this approach in 10 Pilot Learning Woredas (PLW) in Ethiopia with the objective of testing/adopting the approach so that it can be promoted nationwide. An integral part of the approach is the identification of marketable commodities and the value chain constraints and interventions. This was accomplished through a participatory process in all PLWs This case study focuses on the development of fruits in Alamata Woreda with the objectives of documenting diagnostic results and value chain interventions, and providing proof of concept, challenges and lessons learned to be considered for scaling out."},{"index":4,"size":86,"text":"Following the introductory section, the remaining sections are structured as follows. Section two deals with methods and approaches used in the study, while section three presents background information, including description of the PLW and the history and diagnosis of fruit development. In section four, value chain interventions -extension, production, input supply, marketing, and credit issues -are presented. Section five dwells on results and discussion on production/income, input supply/marketing, gender/environment/labour use, organizational and institutional aspects, while sections six and seven deal with challenges and lessons learned, respectively."}]},{"head":"Methods and approaches","index":4,"paragraphs":[{"index":1,"size":112,"text":"To start the development of a commodity, IPMS used a district level participatory market oriented value chain planning approach, aimed at identifying i) main farming systems, ii) potential marketable crop and livestock commodities at farming system level, iii) constraints, potentials and interventions for each value chain component iv) value chain stakeholder assessment with potential (new) roles and linkages. Different value chain stakeholders were involved and consulted in this planning exercise. Secondary biophysical and socio economic data were collected, followed by open ended interviews with focus groups and key stakeholders. The results were presented in a stakeholder workshop in which priority marketable commodities were decided upon together with key intervention areas and partners."},{"index":2,"size":33,"text":"This initial rapid assessment was followed by some more detailed studies on selected commodities. Such studies were conducted by partner institutions and/or students and or IPMS staff using formal surveys, interviews and observations."},{"index":3,"size":59,"text":"To implement the program at Woreda, Peasant Association (PA) and community levels, the project facilitated different knowledge management and capacity development approaches and methods to stimulate the introduction of the value chain interventions by the actors concerned. The various value chain interventions are documented by the project staff in the six monthly progress reports and the annual M&E reports."},{"index":4,"size":31,"text":"To quantify the results from individual and/or combination of interventions, the project established a baseline and measured/documented changes. Several data sources were used to establish the baseline and to measure change."}]},{"head":"Baseline information","index":5,"paragraphs":[{"index":1,"size":32,"text":"To establish a baseline, data from a formal baseline study and data from some special diagnostic studies were used. The initial PRA study also contributed to the quantitative and qualitative baseline information."},{"index":2,"size":45,"text":"Amongst others, the formal baseline study used PA level interviews and records to collect information on fruit tree coverage and the number of households involved in fruit trees. This information was used to compile district level information on fruit trees acreage by crop and households."}]},{"head":"Documenting change processes and results","index":6,"paragraphs":[{"index":1,"size":71,"text":"Several sources were used for regular documentation of change processes and results, including six monthly progress reports, annual M&E reports, ICRAF fruit marketing study report, records kept by the OoARD, personal observations and diaries. Monitoring changes in production/productivity of tropical fruits for a few selected farmers was conducted on a regular basis. The stakeholder meeting was organized to establish the evolution of the roles and linkages of the value chain actors."},{"index":2,"size":87,"text":"In 2009, the project also developed a set of guidelines for the PLW staff to systematically collect relevant information for the case studies including history, changes in extension services, value chain interventions (production, input supply, marketing and credit), results, challenges and lessons learned. Part of the information was obtained from the previously mentioned baseline and other sources and specially arranged key informant interviews and a commodity stakeholder workshop. The stakeholder meeting was organized to establish the evolution of the roles and linkages of the value chain actors."},{"index":3,"size":116,"text":"In Alamata, all the eight PAs (Kulugize Lemlem, Selam Bekalsi, Limat, Tumuga, Selem Weha, Tao, Laelay Dayu, Gerjele) targeted by IPMS for market development were included in the formal household survey conducted in 2009. The survey data consists of relevant production and marketing information on vegetables including area allocation, production costs and inputs use, level of production, and marketed surplus. In selecting the sample households, with the aim of getting some idea about the effect of the different interventions, a distinction was made between households who had adopted/benefited from the various interventions and households who did not. In both sample groups, both wealth and gender criteria were considered to get a representative distribution of sample households."},{"index":4,"size":34,"text":"Following the collection of all relevant information, a write-shop was organized to present information in a systematic manner. Drafts of the PLW specific commodity case studies were then reviewed at the IPMS Head Quarters."}]},{"head":"Background to tropical fruits development","index":7,"paragraphs":[]},{"head":"PLW description","index":8,"paragraphs":[{"index":1,"size":235,"text":"Alamata is located 600 km North of Addis Ababa. It is the most Southern Woreda of the Tigray Region and borders with Amhara region from the South and West and Afar region from the East (Figure 1). There are 10 PAs and 2 town dwellers associations in the Woreda. The total population of the Woreda was 128,872 while the number of agricultural households was 17,597 in 2003/04. Altitude in the area ranges from 1178 to 3148 m and 75% of the Woreda is low land (1500 masl or below) and only 25% is found in intermediate highlands and highlands falling between 1500 and 3148 masl. The small undulating mountains surrounding the Woreda are very steep with low vegetation cover. These mountains cover a large area and drain to the Alamata valley. The mountains surrounding Alamata cover a large area and have a series of dissected gullies which serve as a source of runoff water to the Alamata valley. The gullies join together and form seasonal rivers down the foot of the mountains. The dissected channels slowly spread over the valley depositing silts and water down to the valley. The fine silt is relatively fertile and the water becomes a source of supplementary irrigation. The Alamata valley is one of the most agriculturally potential areas in the region. Farmers in the Woreda extensively cultivate cereals and vegetable; and raise mainly sheep and cattle in the valley."},{"index":2,"size":112,"text":"Eutric Vertisols, Lithic Leptosols (Cambic) and Lithic Leptosols (Orthic) are the soil types covering nearly 100% of the land in the Woreda. Soil pH for profiles tested by Relief Society of Tigray (REST) from the valley bottoms indicate that it ranges from 7.4 to 8.5 and is reported to increase with depth. Traditionally, fertility of the soils on the plains is believed to be fertile because of the silt coming from the adjacent mountains. However, previous studies by the Raya Valley Project indicate that soil fertility is low. Field observations demonstrated that the soils in some areas indicated salinisation problems and needs careful reassessment of the area (IPMS 2005;Makombe and Prasad 2006)."},{"index":3,"size":75,"text":"Rainfall is usually intense, short in duration and unreliable. Average annual rainfall for 8 years (1995 to 2002) was 831 mm/yr. As a result of all these, Alamata is one the 16 drought prone Woredas in the region. Alamata experiences bimodal rainfall, but since recently the rainfall pattern has drastically changed so that at times the main rains (July to August) start around mid August and stop soon after while the small rains are unreliable."},{"index":4,"size":65,"text":"Tef and sorghum are the dominant crops covering around 75% of the Woreda cultivated area, even though yield of these crops is very low at about 5 and 7 qt/ha, respectively. Farmers in the area plant the long seasoned sorghum but usually have poor harvests. Parthenium hysterophorus L. (congress weed) is becoming a major weed in the area, especially in the lowlands of the Woreda."},{"index":5,"size":69,"text":"Livestock are integral component of the farming systems. Oxen provide almost the entire traction and threshing power. Despite the large population of livestock, especially cattle and sheep, productivity is low as in many other parts of Ethiopia. Alamata is suitable for small ruminants, both sheep and goat production. Livestock feed is a major limiting factor in the area. However, sorghum contributes a significant proportion of the supplementary feed resource. "}]},{"head":"History and diagnosis of tropical fruits development","index":9,"paragraphs":[{"index":1,"size":64,"text":"Many types of tropical fruits can be grown in Alamata because of the conduciveness of the climate and easy access to water resources. The District is among the potentially best tropical fruits producing areas in Tigray region. It is considered by the Regional government as a \"Development Corridor\" where commercial agriculture can develop. Both surface water and ground water sources are available in Alamata."},{"index":2,"size":190,"text":"Intervention on tropical fruit production in Alamata started in 1996 by the OoARD and the Integrated Raya Valley Development project. At that time, emphasis was given on the introduction of non improved and less productive fruit seedlings such as papaya, guava, lemon and coffee. In 2002, for the first time, 49 grafted mango and 1110 grafted orange seedlings were introduced to the Woreda and distributed to farmers (Table 1). Similarly, 198 of 4276 mango seedlings introduced in 2005 were also grafted (Table 1). Otherwise, many of the fruit seedlings distributed until 2005 were none grafted. Other seedlings, including papaya were raised in the Regional Government Nursery in Alamata. Private fruit nursery is not available in the Woreda although few farmers exercise raising papaya and non grafted orange seedlings. Source: OoARD report IPMS introduced the participatory market oriented commodity value chain approach in Alamata in March 2005. The stakeholders identified tropical fruits production as one of the marketable commodities, despite the lack of knowledge on the fruits, poor husbandry practices, including free movement of animals during the dry season, an inadequate input supply system for seeds/seedlings and lack of market linkages."}]},{"head":"Value chain interventions","index":10,"paragraphs":[]},{"head":"Extension services","index":11,"paragraphs":[{"index":1,"size":47,"text":"As there was a lack of awareness on tropical fruits production by farmers, emphasis was put on creating a better understanding through training and experience sharing study tours. From February to June 2006, one training and two study tours were conducted on market oriented tropical fruit development."},{"index":2,"size":48,"text":"As a result of these tours, several farmers took up tropical fruits seedlings, especially mango, papaya, orange and lemon during the 2006/07 rain season. Success stories of papaya and mango production from 2006-2009 were documented and presented for learning purposes during different conferences, farmers meetings and field days."},{"index":3,"size":35,"text":"Scaling out/up knowledge sharing events were arranged by Raya Azebo Woreda (neighboring Woreda) and Maichew (zonal capital). Success stories of IPMS Alamata were presented during the farmers' conferences and policy makers' meetings in these districts."},{"index":4,"size":51,"text":"There was also good media coverage, including Ethiopian Television (ETV) and a local radio station on fruit market promotion in Alamata. Also the successful reclamation of the swampy land and transformation into productive farmland was documented by the Ethiopian Television, local radio station and a national daily newspaper-Addis Zemen (IPMS 2008)."}]},{"head":"Production intervention","index":12,"paragraphs":[{"index":1,"size":137,"text":"Fruits have been planted on some of the newly reclaimed swampy and irrigated areas. A major problem was the poor establishment of seedlings (mango, avocado) on fields away from the homestead, due to the free grazing system, shortage of improved varieties and poor management practices. IPMS, in collaboration with OoARD and BoARD (Regional Bureau of Agriculture and Rural Development) in line with capacity development activities has facilitated and promoted the distribution of grafted mango varieties (Keit, Kent and Tommy Atkins) and hermaphrodite papaya (solo). As a result of the expansion of fruit production in the district, communities in Timuga, Selam Bekalsi, Kulugize Lemlem, Gerjelle and Laelay Dayu PAs developed bylaws that prohibit free grazing of livestock. This has encouraged farmers to plant fruits on farmlands, outside of the backyards which were the only places for planting fruits."}]},{"head":"Input supply/service provision","index":13,"paragraphs":[{"index":1,"size":230,"text":"Fruit seedlings supply is organised by the OoARD except for few farmers who raised papaya seedlings for their own plantation. Grafted fruit varieties were obtained from the Upper Awash area while non grafted/improved fruits (e.g avocado, guava, papaya) were raised in the Regional nursery in Alamata. To enhance the supply of grafted mango, avocado and orange varieties by encouraging private seedling supply in the Woreda, training on fruit seedling nursery management was given to 7 farmers. These farmers however, didn't enter into the business because the OoARD nursery has been selling grafted seedlings at a much subsidized price of Birr 2/seedling since March 2005 and continued until 2009. Additional effort was made with the regional BoARD to encourage private fruit nursery establishment of private fruit nurseries by providing plastic bags and forest soil although the farmers still were not courage enough to start the business. To address the shortage of grafted seedlings, FAO assisted the regional government with strengthening the government nursery in Alamata. In 2008, FAO brought improved scions of avocado (Hass, Ettinger and Bacon) and new varieties of papaya. Accordingly, 100 grafted avocados were tried at one farmer at Gerjele PA, but the performances of these materials were not satisfactory due to poor management. But the newly introduced papaya varieties, Yellow and red maradon, in 4 PAs (Gerjele, Laelay Dayu, Selam bikalsi and Kulgize lemlem) are doing well."}]},{"head":"Output marketing","index":14,"paragraphs":[{"index":1,"size":115,"text":"Tropical fruit marketing in Alamata is not well organized. Papaya, orange and guava are sold to passengers who travel largely by buses along the road side. Papaya, mango, avocado and orange are also sold in juice houses and the number of these has increased from 2 in 2005 to 7 on 2009. However, most mango, avocado and orange fruit are transported from either the central part of Ethiopia (Addis Ababa) and/or from Amhara region (Mersa). Production of papaya fruit in Alamata increased since 2006 and market linkage with Mekelle juice houses and a fruit whole seller (fruit distributer) was arranged. Papaya is transported to Mekelle and sold on time with no spoilage on production site."},{"index":2,"size":162,"text":"The grafted mango varieties named Kent, Keit and Tommy Atkins planted in 2005 (Table 1) and 2006 rainy season (Table 2) reached to fruit production in May -August 2009. These improved mango varieties were well managed by few farmers and their fruits are already in Alamata and Mekelle markets. Fruit market promotion and field day for knowledge sharing was arranged by the Woreda OoARD, and IPMS. Participants were about 50 farmers from 5 PAs (Timuga, Selam Bekalsi, Kulugize Lemlem, Gerjelle and Laelay Dayu), DAs, OoARD experts, Woreda, Alamata town and zonal administrators. Field visit to one private sector fruit plantation was made in June 2009. Mango and papaya fruit plantation at Gerjelle PA (swampy area) was visited. Innovative knowledge sharing event was conducted by allowing all participants to test the fruits by eating. All participants ate one mango each and ½ slice of papaya at the spot and took on full papaya fruit to their homes to give it to their families."},{"index":3,"size":31,"text":"The intention here was to influence the whole family so that those households plant these fruits. The event was recorded and broadcasted by Ethiopian Television for a wider knowledge sharing purpose."}]},{"head":"Results and discussion","index":15,"paragraphs":[]},{"head":"Area/household coverage, production/productivity and income","index":16,"paragraphs":[{"index":1,"size":93,"text":"The baseline data conducted in 2005 indicated the number of households and PAs engaged in fruit production in 2005 (see Table 2). As a result of the various interventions, in particular the study tour, training and subsequent arrangement for protection of planted seedlings in the fields, demand of farmers for grafted fruit seedlings started to increase. From 2006 onwards all mango seedlings were grafted, however the seedlings had been raised in the Upper Awash Agro industry fruit nurseries, transported to the Regional nursery in Alamata and distributed from this nursery to different Districts/farmers."},{"index":2,"size":124,"text":"Although the demand by Alamata farmers for mango seedlings continued to be high, distribution did not show any increase for the major fruits in 2007 (Table 3). This was due to shortage of grafted seedlings. Part of this was caused by the quota allotted by BoARD, which was lower in 2007 because the Woreda received more than its normal quota in the previous year. At the time of the baseline survey, impact at household and District level of most of these varieties was still limited especially since survival rates had been poor and most trees had not yet started producing fruits. The household survey conducted in 2009 started showing some impact at household level from the sale of fruits, in particularly papaya (Table 4). "}]},{"head":"Input supply/marketing","index":17,"paragraphs":[{"index":1,"size":95,"text":"Fruit seedling (Grafted mango and orange, lemon, papaya and coffee) is sold to the farmers at a subsidized price (Birr 2/seedling) by the OoARD. FAO provide fruit seeds to be planted in the OoARD nursery and also supported financially to the running cost of the nursery site. As mentioned earlier the project's efforts to introduce private nurseries did not bear fruit because of the availability of this big regional nursery and the fact that seedlings were sold at a much reduced price. As a result, there is no private sector involved in fruit seedling marketing."},{"index":2,"size":92,"text":"Because of the increased interest in fruit development, various stakeholders began to intervene in the capacity building and establishment of storage facilities. Accordingly, Oxfam-America, USAID/REST and OoARD built four cool storage facilities to increase shelf life of onion and fruits, in three PAs (Kulu Gize Lemlem, Gerjele and Laelay Dayu). Though the two cool storage facilities at Laelay Dayu were designed exclusively for fruit, so far they are only used for onion. These facilities could possibly be used for both fruits and vegetables because of differences in harvesting time and production volume."},{"index":3,"size":28,"text":"For example, mango comes to fruiting between May and August, when relatively fewer amounts of vegetables are ready for harvest. This means there will less competition for space."},{"index":4,"size":91,"text":"Market linkage of the improved mango fruits was made with supermarket in Mekelle and it was sold for between Birr 12 to15/kg to the supermarket owners. Demand for Mango fruits was very high in Alamata town and juice houses alone requested for daily supply of about 200 kg/day. However, mango production was only widely grown in two private farms and the number of improved mango trees on individual holdings is few but most are also young that these trees have not yet started bearing fruit and hence supply is still low."}]},{"head":"Indirect effects on gender and the environment","index":18,"paragraphs":[{"index":1,"size":147,"text":"Although, it might require a study to assess the attitude and awareness of the farmers regarding the benefits of fruit development, it is believed to have improved and changed the mentality of many farmers that fruits are considered as food and vital element to human health and improving economic gains. Since women nurture and manage fruit plantation as compared to men, at the backyards, they have benefited from managing the income generated from fruits for the household. Moreover, the increasing plantation and expansion of tropical fruits in the Woreda has improved the micro climate of the specified pocket areas and the Woreda at large, creating a greener environment suitable for fauna and flora of the area. In addition, if the population of these mango trees increases over time, the increase in water table and hence salinity problems might be minimized because these fruit trees are deep rooted."}]},{"head":"Organizational/institutional arrangements","index":19,"paragraphs":[{"index":1,"size":20,"text":"Actors involved in the development of tropical fruits production and their roles in Alamata PLW are presented in Table 5 "}]},{"head":"Challenges in the intervention process/approach and recommendations","index":20,"paragraphs":[{"index":1,"size":16,"text":"Challenges which prompt further development of the value chain components to sustain interest and growth, include:"},{"index":2,"size":234,"text":"-The fact that there is regional nursery and projects in Alamata which handout fruit seedlings at a much subsidized price or for free has discouraged potential private nursery operators in the area to come into this business. -The fact that most of the fruit farmers are located in 5 different PAs is expected to create some problems for group marketing. -Free movement of animals was a serious bottle neck for tropical fruit development in the Woreda. Only fruit leaves are available in some of the areas that all cattle, goats and camels can browse. The freely wondering animals did not find any green feed to be grazed and their choice is to destroy the fruit leaves. However, bylaws and rules were developed at community level to protect the orchard fruit area. -Skills development for production interventions aimed at improving the productivity (planting, pest and disease management, water management) have to be more vigorously pursued by the extension system. Proper staffing of the OoARD with fruit, irrigation and horticulture expertise is required to support the ever increasing fruit production. -Exhibitions, field days and study tours should be organized to increase the awareness of farmers on tropical fruits production and confinement of livestock in support of fruit production. -While marketing of fruits in as well as outside the district is very promising, more marketing arrangements should be developed when fruits will become available in increasing quantities."}]},{"head":"Lessons learned","index":21,"paragraphs":[{"index":1,"size":20,"text":"The Raya Valley where Alamata district is found has suitable climate and natural resource (soil, water) for tropical fruit production."},{"index":2,"size":19,"text":"Demand for fruits was increased through a combination of knowledge interventions, communal protection of planted seedlings and introduction of"}]}],"figures":[{"text":"Figure 1 . Figure 1. Location of Alamata PLW "},{"text":"Table 1 . Fruit seedling distribution in thePLW, 1998PLW,  -2005        Type of          Type of Fruit 1998 1999 2000 2001 2002 2003 2004 2005 Total Fruit1998 1999 2000 2001 2002 200320042005Total Papaya 795 5435 0 200 5856 24265 10803 11283 58637 Papaya795 54350200 5856 24265 10803 1128358637 Guava 163 440 0 100 660 3521 0 5123 10007 Guava163440010066035210512310007 Avocado 0 0 0 5 19 1342 1604 613 3583 Avocado000519134216046133583 Mango 0 0 0 0 137* 198 1711 4276** 6185 Mango0000137*1981711 4276**6185 Banana 30 0 0 5 320 20 4325 750 5450 Banana300053202043257505450 Orange 0 380 0 0 1110 0 0 0 1490 Orange03800011100001490 Coffee 905 1776 0 1050 1554 5044 0 3590 13919 Coffee905 177601050 1554 50440359013919 Total 1893 8031 0 1360 9519 34390 18443 25635 99271 Total1893 803101360 9519 34390 18443 2563599271  "},{"text":"Table 2 . Number of households and PAs involved in fruit production Land use No of HH No of PAS Land useNo of HHNo of PAS  producing  producing Avocado 191 8 Avocado1918 Papaya 665 8 Papaya6658 Irrigated papaya 919 8 Irrigated papaya9198 Mango 99 8 Mango998 Source: IPMS baseline survey, 2005  Source: IPMS baseline survey, 2005  "},{"text":"Table 3 . Fruit seedling distribution in thePLW, 2006PLW,  -2009        Type of Fruit 2006 2007 2008 2009 Total Type of Fruit2006200720082009Total Papaya 11154 11554 17120 3916 43744 Papaya11154 1155417120391643744 Guava 147 66 0 0 213 Guava1476600213 Avocado 2767 927 310 0 4004 Avocado276792731004004 Mango 3540 356 1869 4228 9993 Mango3540356186942289993 Banana 920 104 1570 641 3235 Banana92010415706413235 Orange 964 1074 808 12 2858 Orange9641074808122858 Coffee 0 5017 549 200 5766 Coffee050175492005766 Total 19492 19098 22226 8997 69813 Total19492 1909822226899769813 Source: OoARD, 2009     Source: OoARD, 2009  "},{"text":"Table 4 . Household data on volume of sale and income from fruit production, 2009 No Fruit  For all growers  For sellers  % of No FruitFor all growersFor sellers% of  type Obs Average volume Average value Obs Average volume Mean value Average selling selling HH typeObsAverage volumeAverage valueObs Average volumeMean valueAverage sellingselling HH    sold sold  sold  price  soldsoldsoldprice    (kg/HH) (Birr/HH)  (Kg/HH) (Birr/HH) (Birr/kg)  (kg/HH)(Birr/HH)(Kg/HH)(Birr/HH)(Birr/kg) 1 Papaya 15 254.9 864.40 15 254.9 864.40 3.50 100.0 1Papaya15254.9864.4015254.9864.403.50100.0 2 All 19  1272.75 19  1272.75  100.0 2All191272.75191272.75100.0  fruits         fruits Source: IPMS Household survey, 2009      Source: IPMS Household survey, 2009  "},{"text":"Table 5 . Main actors and roles in development of tropical fruit production Alamata Provide tissue cultured banana seedlings -Provide infrastructural and organizational support for deep well irrigation schemes FAO -Provide capacity building to farmers, DAs and experts -Supply fruit seeds to be planted in the OoARD nursery -Support financially the running cost of the nursery site IPMS -Facilitate training, study tours and field days to farmers and OoARD experts -Facilitate linkages between actors, provide knowledge, assist in market development and document processes and results Actor Role (changes) ActorRole (changes)  -Build capacity of farmers, DAs and technical -Build capacity of farmers, DAs and technical OoARD/Kebelle backstopping to producers at PA level OoARD/Kebellebackstopping to producers at PA level administrators -Employs qualified staff to strengthen the development administrators-Employs qualified staff to strengthen the development  of tropical fruit of tropical fruit  -Organize community arrangements to protect fruit -Organize community arrangements to protect fruit  seedlings in the open fields seedlings in the open fields  -Actively participated in the reclamation of Gerjelle and -Actively participated in the reclamation of Gerjelle and TARI Timuga wetland TARITimuga wetland  -Changed land use from low value cereal crop -Changed land use from low value cereal crop Farmers production to high value tropical fruits plantation Farmersproduction to high value tropical fruits plantation  -Women farmers engaged in homestead papaya and -Women farmers engaged in homestead papaya and  mango production mango production  -Allow their fruit plantation area for knowledge sharing -Allow their fruit plantation area for knowledge sharing Private sector purpose through field days. Private sectorpurpose through field days.  -Support other farmers in technical advice and provision -Support other farmers in technical advice and provision  of seedling of seedling  -Organized group marketing of papaya fruits by -Organized group marketing of papaya fruits by  facilitating market linkage with traders in bigger cities. facilitating market linkage with traders in bigger cities. REST/USAID/Oxfam -Assisted in establishment of storage facilities REST/USAID/Oxfam -Assisted in establishment of storage facilities  -Provide capacity building to farmers, DAs and experts -Provide capacity building to farmers, DAs and experts  through study tour through study tour  "}],"sieverID":"dc0806f8-cb1f-47ea-9447-1a4d099039c0","abstract":""}

data/part_1/018cebba6e9714ef80cc757faec58e29.json

@@ -0,0 +1 @@
+{"metadata":{"id":"018cebba6e9714ef80cc757faec58e29","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0b53cf44-54f2-43ad-b736-4c2acf103113/retrieve"},"pageCount":8,"title":"Reprinted with permission from ASCOLFI. Originally published in Fitopatología Colombiana","keywords":[],"chapters":[],"figures":[],"sieverID":"1aeaf43d-f08d-433e-acf7-a9bc3deb9a9f","abstract":""}

data/part_1/0198ec208892fdf6b3375addf8f01a4f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0198ec208892fdf6b3375addf8f01a4f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/152ed201-f06e-4faf-b3ad-63cfb7952f01/retrieve"},"pageCount":3,"title":"Helping women farmers to succeed through improved access to basic infrastructure CATALYSING ACTIONABLE KNOWLEDGE TO MAKE NEXT-GENERATION ACP AGRICULTURE WORK FOR WOMEN BLOG","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":106,"text":"advances secured by these and other ICT tools, some basic aspects of rural farming remain arduous and create risks for the millions of women smallholder producers who comprise the majority of Africa's farming community. Specifically, most women smallholder farmers do not have access to irrigation technology. With climate change phenomena having a growing impact on weather patternsmore drought, more floodsthis is having a particularly negative effect on women farmers. Drip irrigation is a solution that is relatively inexpensive and, when coupled with a solar powered pumping system, also allows for the securing of sub-soil water, even if the farm is not located close to water sources."}]},{"head":"The power of solar energy","index":2,"paragraphs":[{"index":1,"size":44,"text":"Given the rapid decline in the overall cost of solar photo-voltaic (PV) technology, there are numerous ways in which access to solar energy systems, such as embedded power generation and/or mini-grid systems, can significantly improve the revenue that women smallholders generate from their labour."},{"index":2,"size":42,"text":"As well as pumping water, powering irrigation systems and providing the electricity that is needed to charge mobile phones, solar electricity can help women farmers and agripreneurs to increase their revenues in a number of other ways. It can be used to:"},{"index":3,"size":12,"text":"• dry their produce, to preserve and give it a longer shelf-life;"},{"index":4,"size":32,"text":"• run various types of equipment that can be used to process and grade their produce, adding value as a result; • power cold storage facilities, to preserve their harvests for longer."},{"index":5,"size":58,"text":"In the case of traders, electricity enables them to do business for longer, from earlier in the morning till later in the evening. Lighting also helps to improve safety, a particularly important issue for women farmers. Electricity allows rural farmers to automate their farm management, especially effective when coupled with coaching in electronic record-keeping using tablets and computers."},{"index":6,"size":53,"text":"Beyond solar PV, other ways that energy infrastructure can be developed to help reduce postharvest losses and add value close to the farmgate include using bio-digesters to produce biogasparticularly useful in farming communities where animal faeces can be used as feedstockand mini-hydro turbines, in the case of smallholder farming communities located near waterways."},{"index":7,"size":28,"text":"The development of shared processing facilitiespack houses, packaging facilities, mechanisation service centres and storage facilitiesare all examples of infrastructure that is extremely useful to rural smallholder women farmers."}]},{"head":"Public-private partnerships","index":3,"paragraphs":[{"index":1,"size":82,"text":"Fortunately, a number of African countries are starting to encourage public-private partnerships to develop more of these types of facilities. Nigeria (staple crop processing zones); Ethiopia (agricultural industrial parks); Cote d'Ivoire (agricultural hubs); South Africa (agricultural hubs); and the Democratic Republic of Congo (agriparcs) are just some of the countries recognising the value of encouraging the development of infrastructure oases that can provide women smallholder farmers with technology, machines and equipment to reduce their post-harvest losses and increase their income from farming."},{"index":2,"size":134,"text":"Meanwhile, development partners such as the Food and Agriculture Organization of the Nations, the International Trade Center, and the US African Development Foundation are funding initiatives aimed at designing and developing these shared infrastructure resource centres, to help women smallholders become more profitable and sustainable farmers. In urban areas, there is also an increasing focus on the value of using hydroponic, aquaponic and vertical soil-less farming systems to reduce soil related and pest risks, increase water efficiency, and produce fast growing crops that can be harvested every two weeks (yearround), thereby increasing cash flow for the farmer. While these technologies are being promoted as 'urban farming' techniques, and are seen as a potential way of attracting youth to agriculture, they can also be incorporated in rural areas, and many are especially suited to women."},{"index":3,"size":89,"text":"Only through interventions that harness improved rural infrastructure can the concept of promoting farming 'as a business' become truly meaningfulespecially for the millions of African women for whom farming is currently a strenuous endeavour, aimed principally at securing subsistence, rather than a livelihood with real prospects for growth. This article was created through a CTA-led process to document and share actionable knowledge on 'what works' for ACP agriculture. It capitalises on the insights, lessons and experiences of practitioners to inform and guide the implementation of agriculture for development projects."}]}],"figures":[{"text":"  "}],"sieverID":"67f41d31-aa7c-4f4a-9939-0cb8325e5851","abstract":"Much greater focus is needed on infrastructure development in rural farming communities, to help modernise the equipment that women use to farm, relieve some of the drudgery of the tasks that they undertake, lower the risks to which they are exposed, and reduce the post-harvest losses that significantly affect their overall earnings as primary agricultural producers.Significant strides have been made in terms of developing innovative ways to use smartphones in supporting farmersboth women and menin rural communities, with applications in savings, payments, weather information, market intelligence, insurance, soil analysis, accounting, messaging, communication and extension information. But despite the"}

data/part_1/01ff6c98748bf4364c7472b8e53a78cf.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01ff6c98748bf4364c7472b8e53a78cf","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1dc0c9b8-975c-4d72-8008-34acbfa6cc1f/retrieve"},"pageCount":4,"title":"Community gender profiles across livestock production systems in Ethiopia: Implications for intervention design","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":307,"text":"In 2015 and 2016, a participatory rural appraisal (PRA) exercise was undertaken into the gender characteristics of the small ruminant value chain sites in five regions of Ethiopia, one of the value chains of the CGIAR Livestock and Fish (L&F) research program. The assessment helped guide development of gender profiles of 14 target peasant associations in seven woredas (districts) within the regions. Horro, Astbi, Menz and Doyogena districts, located in the highlands, are characterized by crop-livestock mixed farming system. Yabello, Abergelle, and Shinelle districts are located in the semi-arid and arid agro-ecology with agro-pastoralist and pastoralist farming systems. Focus group discussions-constituting 8 to 12 participantswere conducted with men, women, and male and female youth within the L&F target sites. The information collected included but was not limited to: roles and responsibilities of community members-men, women, boys and girls; labour and time allocation; and access to and control over resources. Gender analysis and PRA tools were employed, such as daily activity clocks, access to and control over resources' profile and seasonal calendars. The daily activity clock was used to capture the relative workloads of the different community groups, the types of activities undertaken, amount of time worked by group, amount of leisure time available by group etc. The groups recorded the data on activity clocks for peak and slack seasons represented by the wet and dry seasons. Household-and community-level power dynamics were assessed by analysing access to and control over key household and community resources. Seasonal changes in activities, income, expenditure, and other livelihood-related activities were assessed using calendars. Overall, 137 men, 114 women, 115 young people (73 male and 42 female) participated in the group discussions. Since the number of male and female youth was small in most cases, they formed one group. But, the activities that applied to a specific group were specified during the discussions."},{"index":2,"size":147,"text":"The 24 hour daily activity clock All household members actively participate in productive roles related to crop and livestock production. Reproductive roles are exclusively carried out by women and girls in the mixed crop-livestock farming system, while certain reproductive roles such as barn cleaning and milking i are shared by men in the agro-pastoralist and pastoralist farming systems. Women, supported by young girls, are mostly responsible for all domestic activities-e.g. cooking, fetching water and firewood, childcare and milking. As most women's and young girls are engaged in multiple tasks simultaneously, their activities across the study sites are difficult to fit into hour-long time slots as compared to men and boys. Women get less sleep and take less leisure time than men in both seasons, except during the dry season in the pastoralist farming system where men spend more time searching for water and feed for their animals."},{"index":3,"size":89,"text":"On average, women work 8.5-19 and 14.5-18 hours, and men 8-15.5 and 6.8-14 hours in the wet and dry seasons respectively (Figure 1). During dry season, women spend much of their time on reproductive activities and lose the help of their children when school begins. Youth also work longer hours (12.5-17.1 and 10-17 hours in the wet and dry seasons), including time spent studying at home. Young girls share women's activities, whereas young boys share those of men but also participate in other activities considered feminine e.g. fetching firewood."}]},{"head":"Figure 1. Estimated working hours for men, women and youth across the study sites","index":2,"paragraphs":[]},{"head":"Gender roles and valuation of labour","index":3,"paragraphs":[{"index":1,"size":85,"text":"Across the study sites, livestock-related activities carried out around the homestead-such as milking, burn/shade cleaning, supplementary feeding, looking after weak/sick animals-are mainly regarded as women's and girls' tasks and culturally less valued. Conversely, activities such as herding, taking sick animals to the veterinary clinic and market are usually done by adult men and young boys, and culturally highly valued. Table 2 illustrates the gender roles in small ruminant production at the different sites. Table 2. Main gender roles in small ruminant production and sheep fattening"},{"index":2,"size":110,"text":"Men are main decision-makers and generally in charge of general herd management. Women retain primary responsibilities for managing small ruminants and dairyrelated activities in pastoral farming systems. In croplivestock mixed-farming systems, men also actively take part in small ruminant activities. In the drier areas of L&F target sites, feed collection and animal feeding constitute the main tasks of both genders in the dry season; though this role is gendered based on animal species-i.e. men are responsible for large animals, while women are responsible for small ruminants and large but weak/diseased/or lactating animals. Across the study sites, all groups spend a significant portion of the day on animal-related activities (Figure 2)."}]},{"head":"Figure 2. Estimated time allocated to livestock-related activities by gender","index":4,"paragraphs":[]},{"head":"Seasonal calendar exercises","index":5,"paragraphs":[{"index":1,"size":101,"text":"As seasons change, the number and type of activities for men and women change. During the wet season both men and women are busy with cropping activities in the croplivestock farming system. In agro-pastoral farming systems, wet seasons give men time for social affairs and leisure, but not women. In the dry season, households engage in more livestock-related activities. It is a busy season for both men and women living in drier areas. In some study sites, during the dry season, women engage in non-farm activities, such as brewing local beverages and petty trading which are important sources of family income."}]},{"head":"Access-to and control-over resources profile","index":6,"paragraphs":[{"index":1,"size":248,"text":"Resources such as land, crops, livestock, farm equipment and extension services are considered important productive resources by participants across the study sites. Additionally, cow dung in Menz and camel carts in Shinelle district are important household resources. Regardless of the region or farming system, men and women generally have access to these productive resources. But when it comes to control over these resources, including decision-making power over their disposal, women tend to have less voice. Men and women participants mentioned that income is usually controlled by men or jointly by both spouses. Resources like milk and milk products are  under the control of women. Women also have equal control over food crops in Abergelle districts (Amhara and Tigray regions), and livestock and food crops in Menz and Shinelle districts (unlike at the other study sites). In Borena, men control important food crops, such as beans and Teff. Participation in community training and politics is considered the role of men across all study areas. Women across all sites conceptualized access to and control over resources differently. For Horro women accessing extension services meant being able to obtain information at farm gate, while for Menz women it included participation in community training, extension visits and demonstrations. This may imply that it is not culturally acceptable for Horro women to participate in extension activities outside the home. However, more research is needed to understand how these gender concepts are defined by men, women and youth across socio-cultural contexts and farming systems."}]},{"head":"Key messages","index":7,"paragraphs":[{"index":1,"size":119,"text":"• Innovations reducing women's workload free up their time to engage in economic activities and community affairs, helping improve their control over benefits and income. • Differences in gender roles in livestock production are not only observed across regions but also across farming systems. Men undertake a few tasks, while women do multiple activities, illustrating the complexity of their roles. • Women are primarily responsible for dairy-related and small ruminant management activities across sites, particularly in the drier areas. Interventions aimed at improving livestock production in general and small ruminant production in particular are more likely to help increase women's incomes in the short run and enhance their economic decision-making position visà-vis household productive resources in the long run."},{"index":2,"size":35,"text":"• Designing technical solutions to the problems of men and women farmers should take into account the amount of time allocated to household and productive activities, access to and control of resources, and cultural norms."},{"index":3,"size":32,"text":"Innovations working well in one area may not in others due to contextual differences. • The small ruminant value chain development initiative will maximize its impact if youth are considered key actors."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"Table 1 . Sample daily activity clock for women and men in wet season Doyogena, Serara Bokata peasant association Women Women  "}],"sieverID":"c21442bf-5154-4c8c-97d4-172f7ac94bb5","abstract":"The design of research and development interventions promoting gender-responsive value chains is hampered by the lack of gender disaggregated data. Data shortages in the livestock sector span multiple issues including gender roles, time allocation, access to and control over resources, economic decision-making and gender-based constraints, and value chain development opportunities (Rota et al. 2010). In Ethiopia, there is a general lack of intra-household sex disaggregated agricultural data. While Ethiopia's annual Agricultural Sample Survey does allow women to identify as female farm operators/holders, few women with a male spouse (less than 5%) choose this category (Warner et al. 2015). Available data is generally based on headship analysis typically indicating the gender of the household head, making intrahousehold analysis, using inclusive analytical categories i.e. women in male-headed households practically impossible. These constraints prompted recent studies to recommend the collection of gender disaggregated data to take into account intra-household division of labour, access to and control over resources and decision-making (Njuki et al. 2013;Doss et al. 2013). For instance, identifying who is responsible for specific livestock husbandry practices may reveal who within the household is best placed to observe clinical signs of animal health problems (Curry et al. 1996 in World Bank et al. 2009). Community gender profiles provide an understanding of the intra-community and intra-household gender relations helping the design and implementation of more effective and sustainable interventions."}

data/part_1/02245ea135214f01d99ada214e0f03d5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02245ea135214f01d99ada214e0f03d5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/452e14cb-fbf5-4bbf-af0a-2052e20fd9be/retrieve"},"pageCount":3,"title":"Study #2749 Contributing Projects: • P1573 -IRRI contribution to RICE Flagship Project 5","keywords":[],"chapters":[{"head":"Part II: CGIAR system level reporting","index":1,"paragraphs":[]},{"head":"Elaboration of Outcome/Impact Statement:","index":2,"paragraphs":[{"index":1,"size":84,"text":"In the flood-prone areas of Northern Bangladesh, adoption of flood-tolerant varieties decreased rice production damage by flood, thereby increasing profitability, ensuring food security and reducing poverty. In the 2017-2018 Boro/dry season, 2.1 tons of improved seeds and stress-tolerant rice varieties were distributed to 500 farmers. In the 2018 Aman/wet season, 6.7 ton seeds of improved and stress-tolerant rice varieties were distributed to more than 1,500 farmers. These varieties are making significant impact on farm income, food security, and livelihood of rice farmers in Bangladesh."},{"index":2,"size":165,"text":"This study examines the adoption of submergence-tolerant (Sub1) rice varieties (BRRI dhan51, BRRI dhan52, BINA Dhan 11, and BINA Dhan 12), grown in the Aman season (JulyNovember) in northwest Bangladesh, using data obtained from more than 1,100 farm households. The impacts of these varietal adoptions on profit from rice production and household consumption expenditure are also examined. Employing the endogenous switching regression model, this paper finds that the predicted probability of adopting Sub1 varieties is about 0.40, implying that 40% of the sampled farm households in northwest Bangladesh adopted Sub1 rice varieties. The main drivers of Sub1 adoption decisions are education, access to information, cropped area, migration, and access to electricity. This paper also finds that Sub1 rice varieties had a significant positive impact on adopters' farm profit and consumption expenditure compared with those of non-adopters. Therefore, we suggest implementing policies and developing institutional capacity that help increase the dissemination of Sub1 seeds and incentivize farmers to adopt Sub1 varieties in flood-prone areas in Bangladesh."}]}],"figures":[{"text":"Link to Common Results Reporting Indicator of Policies : No Stage of maturity of change reported: Stage 2 Links to the Strategic Results Framework:  Country(ies): Country(ies): • Bangladesh • Bangladesh Comments: <Not Defined> Comments: <Not Defined> Key Contributors: Key Contributors: Contributing CRPs/Platforms: Contributing CRPs/Platforms: • Rice -Rice • Rice -Rice Contributing Flagships: Contributing Flagships: • F1: Accelerating impact and equity • F1: Accelerating impact and equity • F5: New rice varieties • F5: New rice varieties Contributing Regional programs: <Not Defined> Contributing Regional programs: <Not Defined> Contributing external partners: Contributing external partners: • BRRI -Bangladesh Rice Research Insitute • BRRI -Bangladesh Rice Research Insitute Sub-IDOs: Sub-IDOs: • Adoption of CGIAR materials with enhanced genetic gains • Adoption of CGIAR materials with enhanced genetic gains • Increased household capacity to cope with shocks • Increased household capacity to cope with shocks Is this OICR linked to some SRF 2022/2030 target?: Yes Is this OICR linked to some SRF 2022/2030 target?: Yes SRF 2022/2030 targets: SRF 2022/2030 targets: • # of more farm households have adopted improved varieties, breeds or trees • # of more farm households have adopted improved varieties, breeds or trees • # of people, of which 50% are women, assisted to exit poverty • # of people, of which 50% are women, assisted to exit poverty Description of activity / study: <Not Defined> Description of activity / study: <Not Defined> Geographic scope: Geographic scope: • National • National  "}],"sieverID":"b7b42e4b-df54-4061-9fc4-96b17a8b4871","abstract":"In the flood-prone areas of Northern Bangladesh, adoption of flood-tolerant varieties decreased rice production damage by flood, thereby increasing profitability, ensuring food security and reducing poverty."}

data/part_1/024b6588dc46173e2023e2498df2b33f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"024b6588dc46173e2023e2498df2b33f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/bf33dab3-76ad-4ee7-aec7-470302122bd8/retrieve"},"pageCount":1,"title":"Study #2815 Contributing Projects: • P567 -WLE Program Management Unit","keywords":[],"chapters":[],"figures":[],"sieverID":"7772a80b-2c0d-47b9-87c3-498719666b51","abstract":""}

data/part_1/02579b87a9ff18e8a68bed1bb373c739.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02579b87a9ff18e8a68bed1bb373c739","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d071c6bf-5e31-408f-b656-3d4e6fee3bad/retrieve"},"pageCount":9,"title":"ISPC Assessment of the Water, Land and Ecosystems (WLE) CRP II revised proposal (2017-2022) ISPC CRP RATING 1 : A","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":107,"text":"• WLE aims to provide the evidence base and solutions to help decision-makers scale up sustainable water, land and ecosystem management innovations and investment. The CRP aims to assist 21 million farm households to adopt improved water and land management practices, 5.74 million people to exit poverty, a 5% increase in water-and nutrient-use efficiency over 24 million ha across its target countries, a 0.01 Gt CO2eq reduction in agriculture-related GHG emissions, and the restoration of 7.7 million ha of degraded land 2 . • The proposed staff and newly appointed leader have good leadership experience; recent reports/evaluations make reference to the CRP's effective management and governance arrangements."},{"index":2,"size":270,"text":"• The ambition of WLE is central to the SRF. It addresses a grand challenge that underpins the entire CGIAR, and it covers areas that CGIAR has directed insufficient funds to in the past. As an iCRP, it takes seriously its intended role of providing a pathway to enhance delivery of the System as a whole into key policy areas in the WLE field. • The partnership strategy indicates a well-developed appreciation and understanding of the many and varied partner relationships, including linkages to regional and global policy initiatives that WLE requires to achieve its objectives. Nevertheless, given the CRP's huge research agenda, its outward focused partnership strategy remains relatively vague. • The research activities of the CRP will consist of modelling and policy analysis that seek to analyze the sustainability of different technologies, combining insights from social sciences and natural sciences. Interactions of this research and its applications across the CGIAR show considerable promise of productive collaboration. It is not always sufficiently clear, however, whether there is a close relationship between this CRP and the AFS CRPs on technology development, or if most of the interaction will be linked to policy advocacy and data provision. • WLE appears to define its main role as identifying winning packages of technologies, policies, and institutions, and facilitating the needed changes to bring these packages into social and economic use. Whilst there is no doubt that this is an important area of work, it is not always clear what the sources of innovation and the expertise in policy process and political analysis are, that will allow WLE to occupy this rather high-level position."},{"index":3,"size":21,"text":"1 A+: Outstanding -of the highest quality, at the forefront of research in the field (fully evolved, exceeds expectations; recommended unconditionally)."},{"index":4,"size":33,"text":"A: Excellent -high quality research and a strongly compelling proposal that is at an advanced stage of evolution as a CRP, with strong leadership which can be relied on to continue making improvements."},{"index":5,"size":98,"text":"A-: Very good -a sound and compelling proposal displaying high quality research and drawing on established areas of strength, which could benefit from a more forward-looking vision. B+: Good -a sound research proposal but one which is largely framed by 'business as usual' and is deficient in some key aspects of a CRP that can contribute to System-wide SLOs. B: Fair -Elements of a sound proposal but has one or more serious flaws rendering it uncompetitive; not recommended without significant change. C: Unsatisfactory -Does not make an effective case for the significance or quality of the proposed research."},{"index":6,"size":1,"text":"3"}]},{"head":"Characterization of Flagships","index":2,"paragraphs":[]},{"head":"FP","index":3,"paragraphs":[]},{"head":"Main strengths","index":4,"paragraphs":[{"index":1,"size":2,"text":"Weaknesses/Risks Rating"}]},{"head":"FP1: Restoring degraded landscapes","index":5,"paragraphs":[{"index":1,"size":22,"text":"The FP focusses on support to the implementation of equitable landscape and soil restoration strategies and concomitant monitoring, evaluation, and learning systems."},{"index":2,"size":10,"text":"• Good evidence of collaboration and integration with other CRPs. "}]},{"head":"Strong","index":6,"paragraphs":[]},{"head":"FP2: Land and water solutions for sustainable intensification","index":7,"paragraphs":[{"index":1,"size":23,"text":"The objective of this FP is to deliver science into practice that will help unlock the potential value of more resilient farming systems."},{"index":2,"size":38,"text":"• Few alternative suppliers of research with a global mandate. • Team with sound scientific expertise and track record. • Recognition and integration into proposal of the need for transformative change to achieve adaptation and intensification at scale."},{"index":3,"size":13,"text":"• Limited track record and experience in influencing policy to support sustainable intensification."},{"index":4,"size":19,"text":"• Potential over-reliance on the availability of existing knowledge and technologies that can increase system resilience with limited trade-offs."}]},{"head":"Strong","index":8,"paragraphs":[]},{"head":"FP3: Sustaining rural -urban linkages","index":9,"paragraphs":[{"index":1,"size":34,"text":"The focus of this FP is to contribute to urban food security and to reduce the environmental impact of urbanization through the implementation of urban waste and water resource recovery and reuse business models."},{"index":2,"size":33,"text":"• Strength of expertise and track record on issues of water and nutrient flows. • Good potential for impact in area of work of rapidly growing importance, given prior experience in this area."},{"index":3,"size":15,"text":"• Current lack of focus enhances the risk of moving beyond areas of comparative advantage."},{"index":4,"size":26,"text":"• Need for more direct engagement with sustainable cities and other major initiatives on 'tropical urban design' to provide leverage for impact along nontraditional development trajectories."}]},{"head":"Strong","index":10,"paragraphs":[]},{"head":"FP","index":11,"paragraphs":[]},{"head":"Main strengths Weaknesses/Risks Rating","index":12,"paragraphs":[]},{"head":"FP4: Managing resource variability, risk, and competing uses for increased resilience","index":13,"paragraphs":[{"index":1,"size":22,"text":"The focus of this FP is on reducing risks and losses to agriculture from floods and droughts and natural resource use trade-offs."},{"index":2,"size":29,"text":"• FP directly addresses one the world's grand challenges. • Good network of proposed internal and external partnerships potentially facilitating delivery. • Strength of scientific expertise and track record."},{"index":3,"size":23,"text":"• Broad scope of research may affect feasibility of delivery. • Limited track record and experience in influencing policy on natural resource use."}]},{"head":"Strong","index":14,"paragraphs":[]},{"head":"FP5: Enhancing sustainability across agricultural systems","index":15,"paragraphs":[{"index":1,"size":21,"text":"This FP focusses on the identification and testing of ways to promote sustainable intensification at scale with partners, including AFS CRPs."},{"index":2,"size":30,"text":"• Ambition of the FP to become an important interface across the CGIAR for links with global partners and initiatives, thus potentially enhancing its role as a globally integrating CRP."},{"index":3,"size":71,"text":"• A lack of focus and specificity raises questions about the feasibility of delivering results. The WLE team believes that their unique, comparative advantage lies in the integration of both science and facilitation, with research applied along the entire impact pathway. They hypothesis that the ISPC's perception might be the result of the team's response to earlier comments. This might have overshadowed the explanation of the science that WLE will deliver."},{"index":4,"size":17,"text":"The team acknowledges that WLE must conduct cutting edge disciplinary biophysical and socioeconomic research plus translational research. "}]},{"head":"Partially addressed.","index":16,"paragraphs":[{"index":1,"size":65,"text":"It seems plausible that WLE might have underplayed the research agenda. The addendum provides a compelling example of WLE's contribution to the development of NRM-focused water policies by providing science-based policy support for the waterenergy-food production nexus (e.g. rather than simply replacing old water pumps with new, solar powered pumps to extract scarce groundwater, the technology can be used to sell power into the grid)."},{"index":2,"size":52,"text":"a) modelling seems to be the only way this issue can be addressed; this deserves support. b) less convincing, given the global resources that have already gone into this issue that seems to defy resolution. c) appropriate given the potential of this technology at a time of rapidly declining costs for UAV."}]},{"head":"Initial ISPC comment (16 June 2016)","index":17,"paragraphs":[{"index":1,"size":90,"text":"CRP response/changes proposed (31 July) ISPC assessment (14 September) FP2: In collaboration with AFS CRPs, LWS will codevelop research on agricultural land and water management (ALWM) technologies for small scale irrigation and poverty alleviation (e.g. ICT for smallholder farmers to help manage water and soil capital) and improving performance of medium-and large-scale publicly managed irrigation systems. FP4: (a) Designing approaches that simultaneously reduce flood damage and recharge the aquifer (managed recharge); (b) remote sensing of water resources for early warning; and (c) co-design of flood/drought weather index insurance for smallholders."},{"index":2,"size":29,"text":"Advice for smallholders via mobile apps for example, has potential and is being tried elsewhere. This is an area that comes up in several iCRPs and requires careful coordination."},{"index":3,"size":98,"text":"Transforming the NRM performance of large farms and commercial farms by '… applying business-like approaches to transform delivery of irrigation services' is ambitious and desirable, but will require a sustained effort in influencing perceptions and ambitions while developing skills of the operators. Projects teams are likely to encounter aspirational, educational and institutional barriers. a) innovative and disruptive but not without risks; the type of research CGIAR should be involved in. b) early warning rarely leads to early action; this needs to be embedded in a clear signalaction framework. c) again, some concern about possible, excessive overlap with CCAFS."},{"index":4,"size":39,"text":"(WLE has addressed both issues together) 3. The ISPC requests WLE to provide details on the scientific expertise within the CRP on the issues of process and intermediation, as well as its comparative advantage in dealing with these issues."},{"index":5,"size":57,"text":"WLE argued strongly that they have considerable core expertise in sociology, political economics of agroecosystems and NRM; they also acknowledge that that this pool of expertise could be strengthened via collaboration and partnerships with other CRPs. They outlined these strengthened partnerships in a revised Annex 3.6 that now demonstrates additional links particularly via FP 1 and FP5."}]},{"head":"Partially addressed.","index":18,"paragraphs":[{"index":1,"size":55,"text":"Added links to e.g. UNESCO-IHE and Wageningen University are welcome, but it could be questioned whether these changes go far enough in order to really draw in the wealth of global knowledge that resides outside the CGIAR. This is a perpetual question not just for WLE but also for the CGIAR as a whole. It"}]},{"head":"Initial ISPC comment (16 June 2016)","index":19,"paragraphs":[{"index":1,"size":56,"text":"CRP response/changes proposed (31 July) ISPC assessment (14 September) Further information on the types of scientific knowledge and impact pathways that will inform the \"influence agenda\" and shape institutions, including an increased awareness of trade-offs and uncertainty across scales and priorities as part of the recognition of the complexity of systemic change should also be provided."}]},{"head":"Provision of further information on the","index":20,"paragraphs":[{"index":1,"size":23,"text":"scientific expertise within the CRP on the issues of process and intermediation, as well as its comparative advantage in dealing with these issues."},{"index":2,"size":41,"text":"Across CRPS, WLE gives an example where they are jointly promoting change. This is a collaborative effort by PIM, A4NH, CCAFS and WLE that defines a shared policy agenda and coordinate policy-oriented research during Phase 2 starting with Bangladesh and Ethiopia."},{"index":3,"size":36,"text":"In terms of impact pathways and ToC concerns, WLE points to their long tradition and experience in this field going back to the Challenge Program on Water and Food where some of these concepts were pioneered."},{"index":4,"size":72,"text":"is understandable that in an environment with shrinking resources organisations need to protect their internal expertise. This needs to be balanced against the long-term benefits of true collaboration in order to tap into expertise and knowledge that sit outside. We need to question whether it is sufficient to identify individuals for a range of outside institutions or if there might be more robust models of engagement that would overcome single person dependencies."},{"index":5,"size":9,"text":"The example given for cross CRP collaboration seems appropriate."},{"index":6,"size":101,"text":"This is correct and it needs to be recognised that they have come a very long way from the early days of the Challenge Programme. WLE is probably better placed than most CRPs due to that experience, but this is not an argument for keeping most of the work in house. So, whilst the ISPC has no doubt about the usefulness and necessity of the proposed activities, what is not always clear from the proposal, is what the sources of innovation and the expertise in policy process and political analysis are, that will allow WLE to occupy its proposed 'high-level' position."},{"index":7,"size":26,"text":"5. Elaborate upon the justification for prioritizing RUL (FP3) in the CRP as well as a discussion of the comparative advantage of CGIAR in this area."},{"index":8,"size":44,"text":"WLE argues that the inclusion of a flagship on Rural-Urban Linkages is a result of the growing importance of urban and peri-urban areas for the overall sustainability of agriculture and food systems, which has been stressed by a number of partners and by the"}]},{"head":"Satisfactorily addressed.","index":21,"paragraphs":[{"index":1,"size":31,"text":"ISPC agrees with the urgent need to consider and develop linkages to urban and peri-urban regions. For a food systems perspective, this is where the action is. The ISPC asked some"}]}],"figures":[{"text":" The team then proceeds to give concrete examples for: FP1: a) modelling benefits & costs of interventions at landscape/catchment level & quantification of on-and off-site ecosystems services. b) building soil carbon reserves and c) UAV-based land and crop monitoring (soil mapping, chlorophyll florescence, near-infrared spectroscopy in the soil-plant continuum. "},{"text":"  "},{"text":"Assessment of CRP response to the ISPC major comments Initial ISPC comment (16 June 2016) CRP response/changes proposed (31 July) ISPC assessment (14 September)  Initial ISPC comment (16 June 2016) 3. 1. Further elucidation of the process of prioritization at the basis of the research agenda for the CRP, and how this affects the functional integration amongst FPs, and with the other AFS and GIP CRPs. CRP response/changes proposed (31 July) Provided more clarity on how WLE sets its research priorities within and among its Flagship Programs (FPs) and with regard to its joint work with other AFS and GIP CRPs (see Annex 3.6). Did not consider it feasible or cost-effective to set ISPC assessment (14 September) for moral hazard to occur is large ('double dipping'). This requires close attention to Satisfactorily addressed. monitoring and evaluation of resources used in Overall, the team provided coherent and the delivery of agreed outcomes. The concept convincing arguments and examples of the of 'additionality' as an essential and type of cutting edge research they will engage documented requirement before WLE funds in. Some specific examples are given, some can be accessed might mitigate against this Initial ISPC comment (16 June 2016) 3. 1. Further elucidation of the process of prioritization at the basis of the research agenda for the CRP, and how this affects the functional integration amongst FPs, and with the other AFS and GIP CRPs.CRP response/changes proposed (31 July) Provided more clarity on how WLE sets its research priorities within and among its Flagship Programs (FPs) and with regard to its joint work with other AFS and GIP CRPs (see Annex 3.6). Did not consider it feasible or cost-effective to setISPC assessment (14 September) for moral hazard to occur is large ('double dipping'). This requires close attention to Satisfactorily addressed. monitoring and evaluation of resources used in Overall, the team provided coherent and the delivery of agreed outcomes. The concept convincing arguments and examples of the of 'additionality' as an essential and type of cutting edge research they will engage documented requirement before WLE funds in. Some specific examples are given, some can be accessed might mitigate against this  criteria a priori and then follow a scoring and more convincingly than other. risk. criteria a priori and then follow a scoring andmore convincingly than other. risk. 2. Clarification of the focus of the CRP on facilitation versus science, accompanied by a description and clarification of the science, technology, and innovation agenda (particularly for FP1, FP2 and FP4). • Over-reliance on partners who have a mixed track record on implementation '3.6 Results Based Management', rather than and delivery. Weak screening process; instead used the Results Based integrated body of work. Management (RBM) system (Annex 3.5) to distinguish among the best investments across the program. Functional integration via four thematic FPs, each an important issue on their own, together a coherent, Priority setting via triangulation of the most important issues appears appropriate, particularly for a CRP that is dealing with complex, adaptive systems with often contended values (Confusingly the RBM on page 41 of Annex 3 is incorrectly labelled as 2. Clarification of the focus of the CRP on facilitation versus science, accompanied by a description and clarification of the science, technology, and innovation agenda (particularly for FP1, FP2 and FP4).• Over-reliance on partners who have a mixed track record on implementation '3.6 Results Based Management', rather than and delivery. Weak screening process; instead used the Results Based integrated body of work. Management (RBM) system (Annex 3.5) to distinguish among the best investments across the program. Functional integration via four thematic FPs, each an important issue on their own, together a coherent, Priority setting via triangulation of the most important issues appears appropriate, particularly for a CRP that is dealing with complex, adaptive systems with often contended values (Confusingly the RBM on page 41 of Annex 3 is incorrectly labelled as  • Limited track record and experience in '3.5'). In-depth discussions with the leaders of other CRPs to influencing policy in support of the identify joint priorities (reflected in Annex 3.6 on The thematic scope for priority collaboration promotion of sustainable intensification linkages and site integration). with other CRPs will happen via alignment at scale. with FPs, while the geographic scope is WLE will engage when there is evidence of strong determined through CG target countries, which comparative advantage, else via partners. seems appropriate. WLE FPs will concentrate their work in integration Strong linkages on joint priorities identified sites where AFS and GIP CRPs also work, frequently with A4HN, CCAFS and PIM as well as through the same local and national partners. collaborations with the Agri-Food System • Limited track record and experience in '3.5'). In-depth discussions with the leaders of other CRPs to influencing policy in support of the identify joint priorities (reflected in Annex 3.6 on The thematic scope for priority collaboration promotion of sustainable intensification linkages and site integration). with other CRPs will happen via alignment at scale. with FPs, while the geographic scope is WLE will engage when there is evidence of strong determined through CG target countries, which comparative advantage, else via partners. seems appropriate. WLE FPs will concentrate their work in integration Strong linkages on joint priorities identified sites where AFS and GIP CRPs also work, frequently with A4HN, CCAFS and PIM as well as through the same local and national partners. collaborations with the Agri-Food System   CRPs are outlined in Annex 3.6. CRPs are outlined in Annex 3.6.   This makes sense as long as suitable partners This makes sense as long as suitable partners   are identified. Problems can arise when the are identified. Problems can arise when the   capabilities simply don't exist. It would be capabilities simply don't exist. It would be   useful for the team to reflect on this core risk useful for the team to reflect on this core risk   and possible mitigation options. and possible mitigation options.   While the principle is logical, the approach While the principle is logical, the approach   poses a risk to good governance. The potential poses a risk to good governance. The potential  "}],"sieverID":"113564c4-914e-4f55-b755-3a8d5b96ceac","abstract":""}

data/part_1/0280acbc9a1fb300698549664ea0e053.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0280acbc9a1fb300698549664ea0e053","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7c99ed0d-d080-43c4-a860-144ded762ae4/retrieve"},"pageCount":20,"title":"","keywords":[],"chapters":[{"head":"Potential MEL actions for each sphere","index":1,"paragraphs":[]},{"head":"Sphere of Influence","index":2,"paragraphs":[]},{"head":"Sphere of Control","index":3,"paragraphs":[]},{"head":"Sphere of Interest","index":4,"paragraphs":[]},{"head":"One question we will keep asking in 2017 and 2018","index":5,"paragraphs":[{"index":1,"size":7,"text":"Planning and reporting online systems in place"},{"index":2,"size":11,"text":"Platforms interoperability or single system? Grain Legumes and Dryland Cereals (GLDC) "}]},{"head":"RTB management cycle","index":6,"paragraphs":[]}],"figures":[{"text":"• Impact pathways (full proposal and cluster business cases) • Milestones and indicators -> Performance Indicators Matrix PLANNING Retrieved at the cluster (and project level) to facilitate harmonization and data aggregation "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"(SRF/SDGs)  Monitoring of: •Quality of Research •Tracking output delivery •CapDev interventions •Monitoring stakeholder behavior (project/ research initiative) •Outcome stories (research teams) •Outcome assessments (evaluations -impact studies) •Monitor sub-set of SDGs and SRF indicators •Pursue impact studies, embedding this as part of the research process, where appropriate Monitoring of: •Quality of Research •Tracking output delivery •CapDev interventions•Monitoring stakeholder behavior (project/ research initiative) •Outcome stories (research teams) •Outcome assessments (evaluations -impact studies)•Monitor sub-set of SDGs and SRF indicators •Pursue impact studies, embedding this as part of the research process, where appropriate  "}],"sieverID":"1876ad2b-8ba5-415c-9af0-649c48264e36","abstract":""}

data/part_1/0328324ba6810b2fcd595ae1a24a6b6f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0328324ba6810b2fcd595ae1a24a6b6f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/06ec38c9-da6e-4c8e-a0fb-66e9b318ee3e/retrieve"},"pageCount":25,"title":"Options for smallholder milk processing in sub-Saharan Africa*","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":130,"text":"Milk is an important product in most pastoral and agropastoral systems of sub-Saharan Africa and in the smallholder farming systems in areas with high human population density. In these production systems, milk is one of the staple foods, providing such vital nutrients as calcium, protein, phosphorus and lipids, and, in many instances, is a major source of cash for the family. Dairy income is usually used to purchase food grains, clothing and other household items, but it may also provide the means of financing some aspects of rural development. The amount of cash generated by dairying will depend on the form in which milk is marketed, the accessibility of markets, and on whether the prevailing pricing arrangements allow for a realistic margin between the purchase and sale prices of milk."},{"index":2,"size":81,"text":"Most milk produced in the rural areas of sub-Saharan Africa is consumed at home or bartered, either fresh or sour, and only in the vicinity of urban markets are milk surpluses processed into dairy products (especially butter) with longer shelf life. Traditional methods of milk processing generally give low yields of final product per unit of milk and require high labour inputs, while the manufactured products have low stability and are hygienically inferior to similar products produced in large-scale dairy plants."},{"index":3,"size":186,"text":"Although the success of any dairy development scheme depends to a large extent on the available marketing facilities and the pricing policies pursued, an equally important factor at the smallholder level is the availability of small-scale processing techniques for the manufacture of high-quality dairy products with good storage characteristics. The work of the Dairy Technology Unit at ILCA is aimed at developing appropriate physical and technological means for milk processing at the smallholder level. In addition, technologies for small-scale processing of milk by village cooperatives are being investigated. ILCA's efforts in the field of smallholder milk processing are expected to have an impact on employment and earning opportunities in rural areas, as well as on the viability of smallholder mixed enterprises. This paper describes the major constituents of cow's milk and their exploitation in milk processing. The technologies needed for small-scale manufacture of such dairy products as fermented milks, milk-fat products and soft or pickled cheeses are discussed, as well as the product options most suitable for on-farm or village-level manufacture. Some suggestions on how best to utilise byproducts of butter and cheese making are made."}]},{"head":"Milk composition","index":2,"paragraphs":[{"index":1,"size":64,"text":"In Africa, milk from cows, sheep, goats and camels is used. Of these, cow's milk is the most widely produced and processed and the subsequent discussion in this paper refers to cow's milk only. Since the nutritive quality of milk and its value as a raw material for making food products is determined by its composition, a general overview of its components is presented."},{"index":2,"size":88,"text":"Essentially, milk is an emulsion of fat in a watery solution of sugar and mineral salts, with protein in a colloidal suspension. The major solid constituents of milk are fat, protein and carbohydrate. Milk salts, enzymes, vitamins and trace elements are minor constituents but are very important for balanced human nutrition. The concentration of each constituent varies and is determined by genetic, physiological and environmental factors (Webb et al, 1983). The average composition of milk from Bos taurus and Bos indicus cows is shown in Table 1.  (1980)."},{"index":3,"size":50,"text":"Milk processing exploits one or more of the major solid constituents of milk. Commercially, milk fat is the most important solid fraction in milk, while milk proteins are important for human nutrition (O'Sullivan,1973). Water and minor constituents such as milk salts are incorporated in all milk products to varying degrees."}]},{"head":"Milk fat","index":3,"paragraphs":[{"index":1,"size":57,"text":"Milk fat is one of the most complex natural fats known, comprising a mixture of triglycerides-fatty acids esterified with glycerol--and several minor lipid components, such as phospholipids, sterols, carotenoids and the fat-soluble vitamins A, D, E and K. The triglyceride esters are peculiar to milk and markedly influence the texture of dairy products. Their chemical formula is:"},{"index":2,"size":1,"text":"where:"},{"index":3,"size":13,"text":"R n = fatty acids with C 4 to C 20 hydrocarbon chains."},{"index":4,"size":84,"text":"The molecules of fatty acids may be saturated or unsaturated. Saturated fatty acids have no carbon-carbon double bonds, whereas unsaturated fatty acids have one or more of these bonds. The melting point of milk fat increases with the length of the carbon chain and decreases with a higher degree of unsaturation. Because the fatty acids in milk fat vary in chain length and degree of unsaturation, milk fat melts gradually (Webb et al, 1983) and this affects its processing properties (Brunner and Jack, 1950)."},{"index":5,"size":86,"text":"Fat is present in milk in the form of tiny droplets (fat globules) suspended in milk plasma and forming an oil-in-water emulsion. Milk fat can be concentrated into cream by gravitational or centrifugal separation and de-emulsified from either milk or cream by agitation. After working, the concentrated mass of fat is recovered as butter containing lipids, some water and non-fat milk solids. Water can be removed from the butter by evaporation and the clear fat separated from non-fat milk solids to produce butter oil (McDowell, 1953)."}]},{"head":"Milk proteins","index":4,"paragraphs":[{"index":1,"size":44,"text":"The two main groups of milk proteins are caseins, which account for up to 80% of the total protein in milk, and whey proteins, which account for about 20% of the total milk proteins but are of higher nutritional value than caseins (O'Sullivan, 1973)."},{"index":2,"size":105,"text":"Caseins can be precipitated from raw skim milk by acidification to pH 4.6 at 20°C. They form relatively large (30 to 300 mm diameter), nearly spherical particles known as micelles. Caseins are heterogeneous proteins which are stabilised by the k-casein fraction, and which can be recovered from milk by either acid or enzymatic precipitation (Webb et al,1983). Enzymatic precipitation of caseins is used to coagulate milk for cheese making. The traditional coagulant is rennin, a proteolytic enzyme extracted from the abomasa of 10-to 30-day old, milk-fed calves. A variety of coagulants of animal, plant and microbial origin are now used in cheese making (Green, 1977)."},{"index":3,"size":65,"text":"Whey proteins are also heterogeneous but they are more soluble than caseins and denature at temperatures above 60°C (Harland et al, 1953). Denatured whey proteins are less soluble than undenatured whey proteins, enabling them to coprecipitate with caseins at pH 4.6. Heating milk to 80°C for 30 minutes denatures most whey proteins and they can be recovered with caseins by acid precipitation (Larson and Rolleri,1955)."},{"index":4,"size":62,"text":"Whey proteins form chemical complexes with caseins at temperatures above 80°C (Hartman and Swanson, 1965), and this inhibits enzymatic coagulation of milk. Heating milk to high temperatures prior to renneting cannot therefore be used to increase the yield of rennet cheeses. Care must also be taken not to overheat milk during pasteurisation, as the denatured whey proteins will again inhibit rennet coagulation."}]},{"head":"Lactose","index":5,"paragraphs":[{"index":1,"size":88,"text":"Lactose is a disaccharide found only in the milk of mammals (Webb et a1,1983). Usually it is the predominant solid in milk, but cows of some breeds produce milk containing more fat than lactose. Lactose is present in solution and is therefore more difficult to recover from milk as an isolated fraction. Bacterial fermentations of lactose to lactic, acetic and propionic acids are critical to many milk processing techniques, since the resultant acidity helps to preserve the other milk constituents and to accelerate casein precipitation in cheese making."}]},{"head":"Minor milk components","index":6,"paragraphs":[{"index":1,"size":77,"text":"Milk salts, enzymes, vitamins and trace elements are classified as minor milk components. Milk is rich in calcium (Ca), phosphorus (P), potassium (K), sodium (Na) and chlorine (Cl), in addition to containing small amounts of iron (Fe), copper (Cu) and zinc (Zn). As a source of Ca and P, milk is particularly important in diets based on cereals. However, very high concentrations of Ca and P in milk fed to infants can adversely affect its nutritional properties."},{"index":2,"size":89,"text":"On average, milk contains 132.1 mg Ca and 95.8 mg P per 100 ml, with 39.2% of Ca and 37.9% of P being in the soluble phase while 61% of Ca and 61 to 63% of P are associated with casein in the colloidal phase (Webb et al, 1983). These colloidal salts are recovered with caseins in rennet cheeses. The physical stability of caseinates is highly dependent on the type of salts present, which means that the physical state of the salt system affects rennet coagulation time (Fox, 1969b)."}]},{"head":"Dairy products for smallholder manufacture","index":7,"paragraphs":[{"index":1,"size":99,"text":"Although the manufacture of many dairy products necessitates high technical and capital inputs, there is a range of products suitable for small-scale processing at the farm using simple equipment. The processing steps required to make some of these products, as well as their composition and keeping quality, are given in Tables 2, 3, 4, 5 and 6. Figure 1 shows the major solid constituents of milk incorporated in the dairy products described in Tables 2 to 6.  c The yield of cream varies with the composition of milk and separation method used. n.a.= not available.  Source: Unpublished ILCA data."},{"index":2,"size":47,"text":"Sour milk and yoghurt contain all milk constituents, while cream, butter and butter oil are high in fat. Caseins are incorporated with fat and moisture in hard cheeses and can also be precipitated from defatted milk as cottage cheese. Lactose and whey proteins are incorporated in whey."},{"index":3,"size":80,"text":"Fermenting milk reduces its pH, which in turn limits the growth of putrefactive and lipolytic bacteria, thereby preserving milk solids (Kosikowski, 1982). The low moisture content of butter and cheese retards bacterial growth, and as a result these products have greater storage stability than whole milk. Salting butter and cheese also retards bacterial growth (Hunziker, 1927;Kosikowski, 1982). Thus dairy products of good storage stability can be made by applying the three basic methods of pH reduction, moisture reduction and salting."}]},{"head":"Fermented milks","index":8,"paragraphs":[]},{"head":"Background","index":9,"paragraphs":[{"index":1,"size":119,"text":"Fermented milks originated in the Near East, perhaps before the Phoenician era. They are nutritious, tasty and stable products obtained from good-quality milk subjected to one of a number of controlled fermentations (Fox, 1967). In some countries, fermented milks (e.g. yoghurt, kefir, acidophilus skim milk) are preferred to fresh milk because of their hygienic safety, better flavour and texture and possible therapeutic effects (Kosikowski, 1982). The Russian biologist Metchnikoff, who was a research associate of Louis Pasteur, attributed the longevity of the people in the Balkan states to their very high consumption of fermented milk products (Fox, 1967); more recently, other scientists have also begun speculating that the unique qualities of fermented milks may be of value in geriatrics."}]},{"head":"Natural fermentation","index":10,"paragraphs":[{"index":1,"size":103,"text":"Production of fermented milk is wide-spread in sub-Saharan Africa. In Ethiopia, milk is allowed to ferment naturally without addition of a starter. Milk is accumulated over a number of days in a clay pot vessel (of about 24 litres volumetric capacity) or in a bottle gourd (O'Mahony and Ephraim Bekele, 1985a) and allowed to develop up to 1% acidity. In cold weather the vessel is placed near the fire to keep the milk warm. The soured milk (irgo) is viscous, has a strong acid flavour, and is consumed as a side dish. If not consumed, sour whole milk is used for butter making."},{"index":2,"size":77,"text":"Natural fermentation of milk exploits lactic-acid-producing streptococci and lactobacilli which are present in any milk and which generally suppress spoilage and pathogenic organisms. A similar fermentation process is used by the Fulani (Waters-Bayer, 1986) and Maasai pastoralists (Grandin, personal communication). Borana pastoralists in Sidamo, Ethiopia, make a concentrated fermented milk by removing clear whey (about one sixth of the total milk volume) from coagulated cow's milk. The product can be stored for up to 20 days (O'Mahony,1986)."},{"index":3,"size":104,"text":"The processing steps of heating milk to sterilisation temperature, followed by cooling and inoculation with bacteria (starter cultures) to achieve a controlled fermentation, are not used by either pastoralists or smallholders in sub-Saharan Africa. Heating kills undesirable organisms and also concentrates the milk, giving the fermented product a heavier body (Fox, 1967). The use of pure bacterial cultures as starters enables different acid flavours to be developed, leading to a range of fermented ('cultured') products. Since 'cultured' milks have better storage stability than fresh milk, and a better product consistency than naturally soured milks, their introduction into the small-holder processing system should be considered."}]},{"head":"Technology of fermented milks","index":11,"paragraphs":[{"index":1,"size":73,"text":"Milk for fermentation is first boiled for a considerable time to reduce the microbial population. It is then cooled, inoculated with starter culture or fermented milk from a previous batch and incubated at 30 to 38°C for 3 to 4 hours. Higher temperatures cause wheying off, while lower temperatures result in slow fermentations and may lead to the establishment of undesirable micro-organisms. Fermented milks can be made in simple containers of any size."},{"index":2,"size":17,"text":"Figure 1. Incorporation of major milk solids in the dairy products described in Tables 2 to 6."}]},{"head":"Defects","index":12,"paragraphs":[{"index":1,"size":57,"text":"Off-flavours described as 'unclean', 'putrid' and 'bitter' are caused by coliform and putrefactive organisms. Good sanitary procedures and adequate heat treatment prior to fermentation help to prevent spoilage. Other problems are sharp acid flavour, which occurs if the fermentation is too vigorous, and wheying off, which is the result of the temperature being too high during fermentation."}]},{"head":"Milk fat products Butter","index":13,"paragraphs":[{"index":1,"size":284,"text":"Commercially, milk fat is the most significant solid fraction in milk. The two main products made from milk fat are butter and butter oil. Butter can be produced under smallholder conditions by churning either sour whole milk or ripened cream (Figure 2). Sour milk is usually churned in a bottle gourd or an earthenware jar (O'Mahony and Ephraim Bekele, 1985a), but any watertight vessel of the required volume is suitable. Churning efficiency can be improved by the use of an agitator (Figure 3). Provided that the churning temperature is held below 16°C the process enables efficient recovery of milk fat as butter from up to 12 litres of milk in each batch (O'Mahony and Ephraim Bekele, 1985a). Churning temperature can be reduced by evaporative cooling.  For larger milk volumes (up to 300 litres), centrifugal separation of cream (Figure 4) followed by churning cream in a wooden churn (Figure 5) is more appropriate. Centrifugal separation concentrates milk fat in the cream phase; with proper temperature control (35-40°C) and correct operation of the separator, as little as 0.1% of the milk fat remains in the separated milk (Hunziker, 1927). Cream separation offers more processing options than are available with soured milk. After separation, cream is allowed to ferment for 2 to 3 days until serum acidity exceeds 0.5 % and milk fat becomes viscous and solidifies. Both factors influence the speed and effectiveness of churning, while the diacetyl, propionic and acetic acids developed during fermentation contribute to the more aromatic flavors of ripened butter. The churn should be filled to not more than half its volumetric capacity. The type shown in Figure 5 is normally used to churn up to 20 litres of cream per batch."}]},{"head":"Figure 5. Wooden churn for cream churning","index":14,"paragraphs":[{"index":1,"size":139,"text":"The efficiency of churning is influenced by the churning temperature; as this decreases from 24 to 14°C churning time increases, resulting in increased fat recovery as butter (Hunziker, 1927). The break point in churning sour whole milk or cream is reached when visible butter grains begin to form, which is also indicated by the changing sound of the churn. Churning should be stopped when the butter granules are the size of sorghum grains or small peas; if they are smaller, fat losses will be high, while overchurning makes it difficult to control the moisture content of the finished product. After churning the contents of the churn are strained through a muslin cloth to recover the butter. Washing butter in cold water removes residual non-fat milk solids and reduces the off-flavours associated with them, but it also depresses butter yield."},{"index":2,"size":103,"text":"Butter yield. The two main factors determining butter yield are the quantity of butter fat extracted from milk and the amount of moisture incorporated in the butter. The standard level of fat in butter is set at not less than 80% milk fat, and most developed countries also specify that moisture level should not exceed 16% (Webb et al,1983). While processing losses are unavoidable, these should not exceed 5% of the total fat available in sour whole milk and 3% of the total fat in cream. Care should also be taken to ensure complete moisture incorporation to 16%, of the weight of butter."},{"index":3,"size":33,"text":"Assuming that butter is composed of 82% fat, 2% non-fat milk solids and 16% moisture, the expected yield of butter from 100 kg of milk containing 3.7% fat can be calculated as follows:"},{"index":4,"size":86,"text":"1. Weight of fat = 3.70 kg Off-flavours caused by hydrolytic rancidity dominate the flavour of traditionally produced butter. Rancid butter is favoured in certain markets, but as the level of free fatty acids increases above 10%, the market value of butter decreases. Hydrolytic rancidity can be retarded by salting butter to 2% salt by weight, which delays its development, presumably by inhibiting bacterial activity. This type of rancidity in butter can also be minimised by using polythene-lined, opaque packaging and storing in a cool place."},{"index":5,"size":74,"text":"Oxidative rancidity is caused by lipid oxidation and occurs in unsaturated fatty acids. In butter, it is manifested by off-flavours which are due to a number of breakdown products formed in a series of chemical reactions. Lipid oxidation is accelerated by the presence of metals (Cu, Fe and Ni), low pH, oxygen, high temperature and light (Downey, 1970). It can be retarded by packing butter in opaque packages and storing in a cool place."}]},{"head":"Butter oil","index":15,"paragraphs":[{"index":1,"size":160,"text":"Butter oil, also known as dry butterfat or ghee, consists of fat which is almost completely free of water, protein, milk sugar and mineral substances (McDowell, 1953). In some areas of India the product is made by direct evaporation of milk or cream (Madan Pal and Rajorhia,1975). This process requires a lot of heat and results in much of the fat becoming entrapped in curd particles. A more efficient method is to evaporate moisture from butter made by churning sour whole milk or cream (Madan Pal and Rajorhia, 1975). Melting butter in an equal volume of water at 60°C, followed by centrifugal separation, gives a good yield of butter oil. The product is free from non-fat milk solids and contains not more than 1.5% moisture (O'Mahony, un-published data). The residual moisture can be removed by further heating. According to Madan Pal and Rajorhia (1975), the product yield in butter oil manufacture should be about 97% of the total fat processed."},{"index":2,"size":47,"text":"Preservation of butter oil. Heat treatment and the low moisture content in butter oil prevent the development of hydrolytic rancidity in the product. Oxidative rancidity will occur but can be minimised by packing butter oil in opaque, air-tight containers and storage in a cool place (McDowell, 1953)."}]},{"head":"Byproducts of butter making","index":16,"paragraphs":[{"index":1,"size":119,"text":"Butter making recovers almost all the milk fat but not the proteins and lactose. Further processing of milk after removal of fat yields protein in a stable form. Churning sour whole milk gives buttermilk, cottage cheese (known as ayib in Ethiopia) and whey as byproducts. The main byproducts of butter making based on milk separation and cream churning are skim milk, cottage cheese, whey and buttermilk. Fresh, separated milk can be consumed by humans, fed to animals or added to cheese milk. The latter is an attractive option since it increases the yield of cheese. Separated milk can be ripened and heated to precipitate soft cheese. The supernatant whey can either be consumed by people or fed to animals."},{"index":2,"size":66,"text":"Buttermilk, which is a byproduct of traditional butter making, is usually consumed without further processing (Beyene Kebede, 1983). In some areas of Ethiopia, it is heated to produce ayib. The process enables good recovery of caseins and residual fat and yields a marketable product (Whalen,1985). Initial studies by ILCA showed that the remaining whey contains as little as 0.75% protein, indicating a near-complete recovery of casein."},{"index":3,"size":71,"text":"About 8 litres of buttermilk are needed to produce 1 kg of ayib. The product contains 79.5% water, 14.7% protein, 1.8% fat and 0.9% ash. The high moisture content in the product contributes to its poor keeping quality. It has been reported that ayib with longer shelf life is produced in some parts of Ethiopia, by heating buttermilk to very high temperatures and then pressing out as much water as possible."},{"index":4,"size":57,"text":"In summary, the on-farm method of processing small quantities of accumulated sour milk is flexible, requires little capital input and enables good product recovery. Processing larger volumes of milk into butter and skim milk gives the processor more efficient recovery of butterfat and provides more options for the disposal of separated milk, but also requires more equipment."}]},{"head":"Cheese varieties","index":17,"paragraphs":[]},{"head":"Background","index":18,"paragraphs":[{"index":1,"size":104,"text":"Cheese is known to have been the standard fare of the ancient Greeks and Egyptians. The art of cheese making was popularised by the Romans, and at present there are over 2000 known varieties of cheese (Kosikowski, 1982). Cheese is a good source of fat and protein (Scott, 1981), and as such it has a high nutritional value. Many cheese varieties require considerable technical skill and equipment in their manufacture. An important aspect of cheese making is the treatment of milk with starter cultures to produce controlled amounts of lactic acid in the curd, while many cheese varieties require special storage facilities for ripening."}]},{"head":"Small-scale cheese making","index":19,"paragraphs":[{"index":1,"size":176,"text":"The five cheese varieties (Halloumi, Queso Blanco, Feta, Domiati and 'White cheese') discussed in this section are relatively simple to manufacture under smallholder conditions in Africa. The processing steps required are shown in Figures 6 to 10. Some of the varieties are already made in parts of Africa and resemble either boiled-curd or pickled cheeses which can be ripened and preserved under tropical conditions. The compositions and expected yields of the five varieties tested at ILCA are given in Table 7. Cheese yield is affected by the concentration of fat, caseins and insoluble salts in milk, as well as by processing efficiency and moisture incorporation in the final product.     Halloumi cheese originated in Cyprus and was first made from sheep and goat milk (Brumby, personal communication). Its manufacture does not need starter cultures and the milk, now usually from cows, is not standardised. At ILCA, the cheese has been made using rennet and bovine pepsin as coagulants, and the trials have indicated that the latter does not adversely affect the quality and yield of the cheese."},{"index":2,"size":75,"text":"An important processing step in the manufacture of Halloumi cheese is heating the curd to between 70 and 80°C. This pasteurises the curd, gives it the correct texture and denatures proteolytic enzymes. After heating the curd is removed, sprinkled with dried leaves of Mentha viridis and folded. Halloumi can be consumed fresh or ripened in whey brine. A whey cheese (anari) can be recovered from the residual whey as a byproduct (O'Mahony and Ephraim Bekele,1985b)."},{"index":3,"size":120,"text":"Queso Blanco originated in Latin America (Kosikowski, 1982) and its name derives from the fact that it is white. This fresh, unripened cheese is made from cow's milk by direct acid precipitation of milk solids at 83°C. Milk is normally standardised to 3% fat, giving a fat-to-casein ratio of 1.3:1. Various acidulants (e.g. acetic, lactic and citric acids) can be used to form the curd, which is then quickly removed, salted and pressed. The end product is white, creamy, with a salty and acid taste, has good slicing properties and a body texture similar to young, high-moisture cheddar, but does not melt well. Queso Blanco is usually consumed fresh, but it can also be cured and stored for extended periods."},{"index":4,"size":91,"text":"Queso Blanco has been made at ILCA using lemon juice diluted with an equal amount of water (O'Mahony and Ephraim Bekele, 1985b). The acidulant imparts a pleasant flavour to the cheese and product yield is good. The low protein content of the residual whey (Table 3) indicates good recovery of whey proteins by coprecipitation with caseins. Cream removed during milk standardisation can be used for butter or ghee making, which is another option worth considering in the context of smallholder dairying. Whey can be fed to animals or consumed by humans."},{"index":5,"size":91,"text":"Feta cheese is a white, pickled cheese ripened in salt brine. It originated in Greece, where it is normally made from sheep milk (O' Keeffe and Phelan, 1979). It can also be made from cow's milk, but the fat content must be adjusted to give a fat-to-casein ratio of 1.3:1. Feta cheese was made at ILCA from unpasteurised milk using the procedures outlined in Figure 8. The cheese ripened well in brine and developed good flavour. The high salt content of the brine ensures good storage stability over a 1-year period."},{"index":6,"size":97,"text":"Domiati cheese is a pickled cheese containing up to 10% salt. It is one of the most popular cheeses in Egypt (Fox, 1969a) and it is also made in Sudan, where it is known as Gybna Beyda. 'White cheese' contains more fat and protein and less moisture than Domiati cheese, and it is made by rennet coagulation and salting whereas the salt in the Domiati cheese is added to the milk before coagulation. The high concentration of salt in these cheeses enhances their keeping qualities. The cheese varieties described above can be made using small-scale processing techniques."},{"index":7,"size":22,"text":"Other factors favouring their manufacture by smallholders are good yield and stability under tropical conditions. Furthermore, the products proved acceptable to consumers."}]},{"head":"Processing options for development","index":20,"paragraphs":[{"index":1,"size":132,"text":"Milk, as it comes from the cow, has a temperature of about 38°C. Bacteria multiply rapidly in warm milk (Robinson, 1983). In sub-Saharan Africa, where the temperature, and often humidity, are high for most of the year, raw milk spoils quickly unless it is cooled or treated with a preservative (Korhonen, 1980). Preservatives are not readily available in rural areas and cooling systems are not feasible due to water shortages in many parts of the subcontinent. This makes collection of milk from rural areas counter-productive, as the milk quality will have deteriorated below acceptable standards by the time it reaches the centralised processing plant. In addition, milk collection systems in sub-Saharan Africa are difficult to operate, mainly because of the seasonality of milk supply, small quantities of milk produced and infrastructural problems."},{"index":2,"size":47,"text":"Stimulating efficient on-farm or village-level processing therefore appears to be a better strategy for dairy development in rural areas. The selection of products for small-scale manufacture will depend on the quantity of milk available for processing, the technical skills and equipment needed, marketing infrastructure and consumer preferences."},{"index":3,"size":154,"text":"Given the small amounts of surplus milk produced by smallholders, and the scarcity of smallscale processing techniques, ILCA has tested a number of technologies which could be adopted by small-scale milk producers. Natural fermentation of milk is suitable for on-farm processing, since it is best achieved with small quantities of milk (1 to 2 litres/day) while the acidity developed preserves milk solids (Kosikowski, 1982) and improves churnability (Ephraim Bekele and O'Mahony, unpublished data). ILCA studies have shown that as little as 0.1-0.2% fat (determined by Gerber analysis) remains in the buttermilk when sour whole milk is churned at about 14 to 16°C (O' Mahony and Ephraim Bekele, 1985a). The equipment used to make butter from sour whole milk is available locally, and ILCA has designed a simple detachable agitator to improve churning efficiency. The butter produced can be sold fresh or salted and preserved for subsequent sale, or it can be converted into ghee."},{"index":4,"size":59,"text":"Residual liquid after butter making is highly nutritious (since it contains all the non-fat milk solids) and can be consumed without further treatment. Caseins are often recovered from the liquid in the form of ayib which is consumed fresh or preserved by salting or reducing its moisture content. Whey proteins are utilised as animal feed or in human diets."},{"index":5,"size":78,"text":"Village-level processing can be undertaken with milk volumes of up to 500 litres/ day. The recommended equipment includes hand-driven milk separators and wooden churns. ILCA's experience to date has shown that this equipment is quickly adopted in areas where sufficient milk is available for processing. Large yields of high-quality butter are being produced at 15 producer cooperatives throughout Ethiopia, using milk separation and cream churning. Up to 200 litres of milk are being processed daily at each unit."},{"index":6,"size":69,"text":"Centralised village processing of milk supplied by individual smallholders is presently being investigated. It is too early to comment on the effectiveness of this system in sub-Saharan Africa, but experience in India (Mogens Jul, 1977) shows that the system could be successful. Small-scale centralised milk processing reduces labour requirements on the farm, provides a nucleus for sale of farm inputs and strengthens the marketing capability of individual milk producers."},{"index":7,"size":76,"text":"The manufacture of cheese is difficult with small quantities of milk. However, a village cooperative could make cheese and thus widen its product range. The feasibility of making cheese by village cooperatives is now being investigated in Ethiopia. Preliminary observations indicate that cheese making may be a suitable option for rural cooperatives that are far from allweather roads, and therefore have to accept a lower price for their butter, and which have difficulties marketing ayib locally."},{"index":8,"size":74,"text":"The cheese varieties discussed in this paper are more stable than butter. Their manufacture would give farmers greater independence from local traders who exploit the fact that butter has to be sold before it develops rancidity above the acceptable level. Research on the economics of milk processing by village cooperatives and the potential market for cheese in rural areas of Ethiopia is under way in order to assess the viability of small-scale cheese production."},{"index":9,"size":75,"text":"A rapid introduction of appropriate dairy processing technologies in the field requires adequate training of extension agents. ILCA has held four courses in rural dairy technology during the past 2 years. The trainees were given basic training in milk chemistry and microbiology and were acquainted with the technologies described in this paper. Follow-up visits revealed that the trainees were passing on their newly acquired skills to farmers and that the equipment was being used properly. "}]},{"head":"Conclusions","index":21,"paragraphs":[{"index":1,"size":62,"text":"At present, only a small fraction of the milk produced by smallholders in sub-Saharan Africa enters the commercial market, owing to lack of milk collection systems in rural areas, low producer prices for milk and scarcity of small-scale processing techniques. Yet making this milk available to consumers would improve both the economic status of smallholders and the nutritional status of the population."},{"index":2,"size":40,"text":"Dairy products suitable for small-scale manufacture include fermented milks, butter, butter oil, and some cheeses. The technology for their manufacture has been adapted to suit local conditions, and some of the modified processing techniques have been tried successfully in Ethiopia."}]}],"figures":[{"text":"Figure 2 . Figure 2. Products and byproducts of butter making. "},{"text":"Figure 3 . Figure 3. Traditional churn fitted with a wooden, detachable agitator. "},{"text":"Figure 4 . Figure 4. Centrifugal cream separator. "},{"text":" 2. A 5% fat loss during production = 0.19 kg 3. Fat available for butter making = 3.51 kg 4. Expected yield of butter containing 82% fat = 3.51 x 100/82 = 4.30 kg Salting butter to 2% increases its keeping quality and yield. The expected yield of salted butter containing 80% milk fat, 2% milk solids non-fat, 2% salt and 16% moisture is 3.51 x 100/80 = 4.4 kg.Butter quality. Butter deteriorates rapidly at high temperatures. Besides the off-flavours attributed to the non-fat milk solids there are two other off-flavours--caused by hydrolytic and oxidative rancidity--which develop in the fat itself(Downey,1970). Hydrolytic rancidity is caused by lipolysis, i.e. hydrolysis of the triglyceride to glycerol and component free fatty acids:which is: triglycende + water + enzyme = glycerol + free fatty acids where: R n = fatty acids of C 4 to C 20 chain length. "},{"text":"Figure 6 . Figure 6. Processing steps for Halloumi cheese. "},{"text":"Figure 7 . Figure 7. Processing steps for Queso Blanco cheese. "},{"text":"Figure 8 . Figure 8. Processing steps for Feta cheese. "},{"text":"Figure 9 . Figure 9. Processing steps for Domiati cheese. "},{"text":"Figure 10 . Figure 10. Processing steps for 'White cheese'. "},{"text":"  "},{"text":"Table 1 . Average composition of milk from Bos taurus and Bos indicus cows. Constituent Average percentage by weight Bos taurus a Bos indicus b ConstituentAverage percentage by weight Bos taurus a Bos indicus b Water 87.2 86.1 Water87.286.1 Fat 3.7 5.3 Fat3.75.3 Protein 3.5 3.4 Protein3.53.4 Lactose (carbohydrate) 4.9 4.6 Lactose (carbohydrate)4.94.6 Ash (minerals) 0.7 0.6 Ash (minerals)0.70.6 Solids-not-fat 9.1 8.6 Solids-not-fat9.18.6 Total solids 12.8 13.9 Total solids12.813.9 Sources:   Sources:  "},{"text":"Table 2 . Process, composition, yield  and keeping quality of fresh milk, separated milk and cream. Dairy product Process Moisture (%) Protein (%) Composition Fat % Lactose (%) Ash (%) Whey protein (%) Yield (litres of milk/kg product) Keeping quality Dairy product ProcessMoisture (%)Protein (%)Composition Fat % Lactose (%)Ash (%)Whey protein (%)Yield (litres of milk/kg product)Keeping quality Fresh milk a None 87.2 3.5 3.7 4.9 0.71 0.75 1 5 Fresh milk aNone87.23.53.74.90.710.7515          hours hours Fresh milk b None 86.1 3.4 5.3 4.6 0.6 n.a. 1 5 Fresh milk bNone86.13.45.34.60.6n.a.15          hours hours Separated a milk Milk 90.5 3.6 0.1 5.1 0.7 0.75 1.2 5 Separated a milk Milk90.53.60.15.10.70.751.25  separation        hours separationhours Cream a  57.3 2.2 36.8 3.2 0.6 n.a. 10 c 1 day Cream a57.32.236.83.20.6n.a.10 c1 day Sources and notes:         Sources and notes:  "},{"text":"Table 3 . Process, composition, yield and keeping qualities of fermented milks.     Composition   Yield  CompositionYield Dairy product Process Moisture (%) Protein (%) Fat % Lactose (%) Ash (%) Lactic acid (%) (litres of milk/kg product) Keeping quality Dairy productProcessMoisture (%)Protein (%)Fat %Lactose (%)Ash (%)Lactic acid (%)(litres of milk/kg product)Keeping quality Sour milk (irgo) a Natural fermentation 88.5 4.7 2.2 3.9 0.7 0.91 1 10 days Sour milk (irgo) aNatural fermentation88.54.72.23.90.70.91110 days  Sterilisation         Sterilisation Kefir b followed by 89.4 3.5 2.0 4.0 0.7 0.60 1 10 days Kefir bfollowed by89.43.52.04.00.70.60110 days  inoculation         inoculation  Sterilisation         Sterilisation Yoghurt b followed by 87.2 3.4 3.4 4.1 0.6 0.90 1 10 days Yoghurt bfollowed by87.23.43.44.10.60.90110 days  inoculation         inoculation Acidophilus skim milk b Acid fermentation 90.1 3.5 0.5 4.4 0.7 0.70 1 1 day Acidophilus skim milk bAcid fermentation90.13.50.54.40.70.7011 day Sources: a Ethiopian Nutrition Institute (1980).      Sources: a Ethiopian Nutrition Institute (1980).  "},{"text":"Table 4 . Process, composition, yield and keeping quality of milk fat products.        Composition   Yield CompositionYield Dairy product Process Moisture (%) Protein (%) Fat % Lactose (%) Ash (%) Lactic acid (%) (litres of milk/kg product) Keeping quality Dairy productProcessMoisture (%)Protein (%)Fat %Lactose (%)Ash (%)Lactic acid (%)(litres of milk/kg product)Keeping quality Sour milk (irgo) a Natural fermentation  88.5 4.7 2.2  3.9 0.7 0.91 1 10 days Sour milk (irgo) aNatural fermentation88.54.72.23.90.70.91110 days   Sterilisation          Sterilisation Kefir b  followed by   89.4 3.5 2.0  4.0 0.7 0.60 1 10 days Kefir bfollowed by89.43.52.04.00.70.60110 days   inoculation          inoculation   Sterilisation          Sterilisation Yoghurt b followed by   87.2 3.4 3.4  4.1 0.6 0.90 1 10 days Yoghurt bfollowed by87.23.43.44.10.60.90110 days   inoculation          inoculation Acidophilus skim milk b Acid fermentation  90.1 3.5 0.5  4.4 0.7 0.70 1 1 day Acidophilus skim milk bAcid fermentation90.13.50.54.40.70.7011 day  Sources and notes:         Sources and notes:        Composition   Yield CompositionYield Dairy product Process Moisture (%) Protein % Fat % Lactose % Ash % Salt % Whey protein % Lactic acid (%) (litres of milk/kg product) Keeping quality Dairy productProcessMoisture (%)Protein %Fat %Lactose %Ash %Salt %Whey protein %Lactic acid (%)(litres of milk/kg product)Keeping quality Separated milk a Milk separation 90.5  3.6 0.1 5.1  0.7 0 0.75 0 1.1 5 hours Separated milk aMilk separation90.53.60.15.10.700.7501.15 hours Buttermilk (A) b Churning of sour milk 91.5  3.1 1.4 3.2  0.6 0 0.75 0.8 1.1 5 days Buttermilk (A) bChurning of sour milk91.53.11.43.20.600.750.81.15 days Buttermilk (B) a Cream Churning 90.5  3.6 0.4 4.3  0.7 0 n.a 0 16 5 days Buttermilk (B) aCream Churning90.53.60.44.30.70n.a0165 days Ayib b Heating ripened buttermilk (A) 79.5  14.7 1.8 -c  0.9 0 -c -c 8 5 days Ayib bHeating ripened buttermilk (A)79.514.71.8-c0.90-c-c85 days Whey Heating ripened buttermilk (A) 93.5  0.7 0.4 -d  0.8 -d 0.7 0 0 - WheyHeating ripened buttermilk (A)93.50.70.4-d0.8-d0.700-  Sources and notes:         Sources and notes:  "},{"text":"Table 6 . Process, composition, yield and keeping qualities of Halloumi, Queso Blanco, Feta,  'White cheese' and Domiati cheeses.     Cheese Variety Process Composition Moisture % Protein % Fat % Ash % Yield (litres of milk/kg product Keeping Quality Cheese VarietyProcessComposition Moisture % Protein % Fat % Ash %Yield (litres of milk/kg productKeeping Quality Halloumi Rennet coagulation, and boiling the curd 35 26 33 3 9.5 >60 days HalloumiRennet coagulation, and boiling the curd35263339.5>60 days Queso Blanco Heating milk to 83 0 C and acidification 46 24 23 3 8.00 >60 days Queso Blanco Heating milk to 83 0 C and acidification46242338.00>60 days Feta Rennet coagulation and pickling 49 17 27 3 9 1 year FetaRennet coagulation and pickling491727391 year 'White cheese' Rennet coagulation and salting 52.3 22 23 4.3 9.00 1 year 'White cheese' Rennet coagulation and salting52.322234.39.001 year Domiati/ Gybna Beyda Salting milk, rennet coagulation 61.5 12.5 120 4.0 6.00 1 year Domiati/ Gybna BeydaSalting milk, rennet coagulation61.512.51204.06.001 year  "},{"text":"Table 7 . Composition and yield of Halloumi, Queso Blanco, Feta, Domiati and 'White cheese',  and residual whey protein.     Variety Fat (%) Protein (%) Moisture (%) Salt (%) Ash (%) Yield (litres of milk/kg product) Whey protein VarietyFat (%)Protein (%)Moisture (%)Salt (%)Ash (%)Yield (litres of milk/kg product)Whey protein Halloumi 33 26 35.0 3 3 9.5 0.77 Halloumi332635.0339.50.77 Feta 27 17 49.0 3.5 1 9.0 0.80 Feta271749.03.519.00.80 Queso Blanco 23 24 46.0 3 3 8.0 0.29 Queso Blanco232446.0338.00.29 Domiati/Gybna Beyda 12 12.5 61.5 7.5 4 5.5 0.76 Domiati/Gybna Beyda1212.561.57.545.50.76 'White cheese' 23 22 52.32 6.7 4.23 9.5 0.80 'White cheese'232252.326.7 4.239.50.80  "},{"text":" In October 1986, ILCA's Dairy technologist explained the Centre's dairy technology concept to the participants of a dairy training course organised by FAO in Kenya. In February 1987, ILCA's Dairy Technology Unit gave a dairy technology course to personnel from national training institutes, who are expected to conduct similar training courses in their countries.  "}],"sieverID":"2e182664-7e75-4f79-9564-1407356f60fd","abstract":"MILK IS PRODUCED in almost every production system of sub-Saharan Africa, but only a minor portion of this milk enters the commercial sector owing to marketing constraints and lack of processing techniques suitable for smallholder dairying. ILCA's Dairy Technology Unit has identified simple standard methods which, when adapted to suit local conditions, can be used to process milk into high-quality dairy products. The manufacture of stable marketable products including butter, ghee, low-moisture cottage cheese, some hard cheeses and fermented milks will provide smallholder producers with an additional source of cash, facilitate reinvestment in the enterprise, yield byproducts for home consumption and enable the conservation of milk solids for future sale or consumption. The technologies described in this paper can be rapidly transferred by appropriate training programmes."}

data/part_1/0336d23a82f9f8cc6e1a8a6b77499c78.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0336d23a82f9f8cc6e1a8a6b77499c78","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1df27515-c26c-475c-bae0-683aa6b054f9/retrieve"},"pageCount":20,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":1,"text":"6"}]},{"head":"Open questions","index":2,"paragraphs":[{"index":1,"size":4,"text":"Regulatory Frameworks Open questions"}]},{"head":"Access to Resources","index":3,"paragraphs":[{"index":1,"size":86,"text":"• How does the land tenure system work in the territory? • Does access to adoption programs depend on collateral tenure? • How is access to incentives (PES Schemes, Advisory Services) guaranteed for minority or excluded populations? Are these measures effective for technology adoption? • Are there challenges associated with elite capture in the territory? • How is the institutional architecture for access to credit in the territory?     Governance problems tend to be more severe in agriculturebased countries 12 What type of research are we conducting?"},{"index":2,"size":12,"text":"Analyzing the evolution of public policies for the livestock sector in Colombia"},{"index":3,"size":24,"text":"The policy emphasizes silvo-pastoral systems for improved productivity and reduced GHG emissions, but neglects to propose guidelines for problematic cattle ranching in various ecosystems."},{"index":4,"size":17,"text":"Livestock policies have undergone a gradual transformation, involving institutional reforms and technical regulations across all value chains."},{"index":5,"size":15,"text":"Livestock policies aim to enhance productivity and competitiveness, aligning with global trends and consumer demands."},{"index":6,"size":24,"text":"Traditional agrarian society grapples with institutional and economic challenges in integrating traceability, food safety, health, and sustainability criteria, despite significant physical and social limitations."},{"index":7,"size":36,"text":"Unraveling the complexities of building Payments for Ecosystem Services (PES) schemes for silvopastoral systems PES schemes for SPS are useful to change the behavior or practices of producers but should not be understood as stand-alone solution."},{"index":8,"size":21,"text":"Producers prefer technical assistance over monetary payments for SPS, emphasizing the importance of both monetary and in-kind payments for farm adjustments."},{"index":9,"size":22,"text":"It is important to connect PES schemes to markets, so that ecosystem services are not reversed once the PES schemes are terminated."},{"index":10,"size":24,"text":"Colombia's land distribution, violent appropriation, and armed conflict hinder project development. SPS projects address these issues by incorporating multiple owners and good faith figures."},{"index":11,"size":41,"text":"The institutional framework of agricultural credit and extension systems for the adoption of forage technologies 16 Credit for livestock does not seem to cause significant changes in deforestation levels, but rather external factors like peace processes, Covid-19 restrictions, and land changes."},{"index":12,"size":25,"text":"The credit system in developing countries often leads to low rural credit supply due to market failures, causing state intervention and reinforcing rural credit failures."},{"index":13,"size":23,"text":"Livestock farming is increasingly requiring credit for optimizing practices like silvopastoral systems. However, this process is complex and slows the transition towards sustainability."},{"index":14,"size":24,"text":"Livestock farming requires resources for animal purchases, working capital, and investments not necessarily related to sustainable practices, indicating a need for more sustainable practices."},{"index":15,"size":31,"text":"Studying institutions in the context of adopting forages and pasture technologies is essential for addressing the complex interplay of social, economic, and environmental factors that limit or enhance the adoption processes."},{"index":16,"size":19,"text":"Institutions provide the formal and informal rules that make up the regulatory framework for organizations or individual economic actors."},{"index":17,"size":19,"text":"Sound technology adoption strategies require stronger capacity for policy analysis and evaluation, and a commitment to evidence-based policy making.  "}]}],"figures":[{"text":"Figure 1 .•Figure 1 . Figure 1. Governance dimensions for technology adoption. "},{"text":"Figure 1 . Figure 1. Governance dimensions for technology adoption. "},{"text":"•Figure 1 . Figure 1. Governance dimensions for technology adoption. "},{"text":"•Figure 1 . Figure 1. Governance dimensions for technology adoption. "},{"text":"•Figure 1 . Figure 1. Governance dimensions for technology adoption. "},{"text":"•Figure 1 . Figure 1. Governance dimensions for technology adoption. "},{"text":"Figure 2 . Figure 2. Agriculture-based and transforming countries get low scores for governance. Source: Kaufmann et al. (2006) "},{"text":" 17 "},{"text":"  "}],"sieverID":"768161f0-9d96-4433-9c96-e45137ab4181","abstract":""}

data/part_1/03c77a932e1697dd375c410e1bed5e8c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03c77a932e1697dd375c410e1bed5e8c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7d358d0f-7624-4a61-b646-6d64e4d86dfa/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"L'approche adoptée","index":1,"paragraphs":[{"index":1,"size":206,"text":"Alors que les agriculteurs utilisaient couramment trois espèces fourragères, notamment Calliandra et Sesbania, ainsi que le napier, leurs connaissances sur l'utilisation et la gestion des fourrages herbacés étaient beaucoup plus limitées. Les agriculteurs et les chercheurs ont défini d'un commun accord les espèces et les variétés fourragères à tester (Tableau 1), puis les caractéristiques communes à chaque parcelle expérimentale. Pour mesurer le rendement, les agriculteurs ont retenu les critères suivants : croissance et vigueur, hauteur de la plante, production de fourrage et résistance à la sécheresse. Ils ont également mentionné la germination, la période de floraison, la production de graines, la résistance aux ravageurs et aux maladies, et l'appétibilité. Selon les modalités de recherche convenues, les membres des groupements paysans étaient responsables de la collecte d'une grande partie des données (à l'exception des données concernant la biomasse fourragère), les facilitateurs de recherche intervenant, aux côtés des agriculteurs, pour analyser les données à l'issue de chaque saison culturale et pour examiner la performance des méthodes de collecte. Les chercheurs ont pris en main la collecte des informations relatives à la production de biomasse par les fourrages, sachant que des données très rigoureuses étaient nécessaires pour pouvoir comparer le taux de production entre les différentes espèces et accessions."}]},{"head":"Analyse et ajustements","index":2,"paragraphs":[{"index":1,"size":79,"text":"Au cours du premier cycle expérimental, les agriculteurs se sont familiarisés avec l'apparence des nouvelles plantes fourragères, les caractéristiques de germination et la croissance précoce. La collecte des données quantitatives, sur la base des critères définis par les agriculteurs eux-mêmes, s'est avérée être un exercice des plus complexes, d'autant que l'un des groupements s'est vu affecté par les irrégularités de sa direction. Pour faciliter le processus de recherche, les membres ont alors diminué le nombre de paramètres à mesurer. "}]},{"head":"Expansion des cultures fourragères, extension du projet","index":3,"paragraphs":[{"index":1,"size":163,"text":"La dissémination des fourrages au delà des parcelles expérimentales sur les terres des membres des groupements paysans a été lente et de portée limitée. La plupart des agriculteurs bouturaient les racines pour répandre la culture fourragère. Le programme de distribution de vaches laitières s'est avéré être la cause des grandes variations observées au niveau de l'engagement des agriculteurs à participer au processus expérimental, ceux ayant reçu du bétail démontrant un intérêt beaucoup plus affirmé. Il apparaît clairement que la sélection de zones géographiques pour l'expérimentation d'espèces fourragères doit prendre en considération le niveau de développement du secteur laitier dans ces zones. En l'absence de services de bonne qualité, la productivité peut néanmoins être améliorée au moyen de vaches, chèvres et moutons de race locale ou croisée. Le champ d'application du projet a été étendu à 11 autres groupes de chèvres et de vaches laitières à Tororo, où la variété Brachiaria et des hybrides sont cultivés dans les fermes en rangées et en parcelles."}]},{"head":"Les enseignements tirés •","index":4,"paragraphs":[{"index":1,"size":36,"text":"Préalablement à la réalisation des expérimentations agricoles concurrentes, les groupements paysans avaient mis au point des plans participatifs de suivi et d'évaluation. L'intégration des cultures fourragères expérimentales à ces plans a facilité le processus de recherche."}]},{"head":"•","index":5,"paragraphs":[{"index":1,"size":38,"text":"La dynamique interne au groupement a favorisé la continuité et l'intérêt des membres vis-à-vis des expérimentations sur les fourrages. En l'absence de cohésion de groupe, il est préférable de gérer les parcelles en partenariat avec des agriculteurs individuels."}]},{"head":"•","index":6,"paragraphs":[{"index":1,"size":143,"text":"Brachiaria hybride Mulato, Brachiaria var. Toledo, et Stylosanthes ont démontré une performance supérieure aux autres fourrages et ont eu un rendement comparable à celui du napier, réputé pour son rendement élevé. Dans des conditions similaires, à savoir sans apport d'engrais, le napier peut produire jusqu'à 40 tonnes de fourrage frais (10 tonnes de fourrage sec). En outre, les brachiarias sont résistantes aux maladies, telles que le charbon et la maladie de la croissance, qui menacent sévèrement la production de napier en Afrique de l'Est. L'espèce Brachiaria est originaire d'Afrique orientale, mais la variété supérieure et l'hybride utilisés dans le cadre de ces recherches ont été sélectionnés et élevés par le CIAT et ses partenaires en Amérique latine. Stylosanthes, une légumineuse exotique, est une source de protéines bon marché qui permet d'apporter un supplément à la ration alimentaire insuffisante des animaux en saison sèche."}]},{"head":"Orientations d'avenir","index":7,"paragraphs":[{"index":1,"size":115,"text":"Bien que les travaux décrits n'en soient qu'à leur début, ils ont permis d'identifier des fourrages adaptés, susceptibles d'être cultivés dans d'autres zones présentant des conditions similaires. Une fois la culture fourragère intégrée aux systèmes agricoles, elle procure des bénéfices tangibles au niveau de la génération de revenus, de la gestion des ressources naturelles, ainsi que d'autres avantages socio-économiques. Par exemple, grâce aux technologies fourragères mises en place dans les systèmes agricoles à petite échelle en Asie du sud-est, les ménages ont vu les revenus issus de l'élevage augmenter de jusqu'à 30%, générant une production accrue de fumier, ainsi que des économies de temps et d'efforts, autrefois consacrés à chercher, couper et transporter le fourrage."},{"index":2,"size":110,"text":"La culture du fourrage présente néanmoins des aspects beaucoup plus complexes que les autres cultures. La pratique privilégiée des agriculteurs consiste à associer les fourrages aux autres cultures, plutôt que de leur allouer des parcelles séparées. Une grande diversité d'espèces et de variétés de fourrages est disponible, chacune présentant des conditions spécifiques de gestion et d'adaptation au milieu. Ces caractéristiques inhérentes aux technologies fourragères offrent de nombreuses opportunités, à condition toutefois que les petits agriculteurs expérimentent les espèces et les variétés qui leur semblent les plus prometteuses, et qu'ils inventent des stratégies locales à même de rendre la culture de ces fourrages rentable, durable et compatible avec les autres cultures. "}]}],"figures":[{"text":" à identifier les espèces et les variétés fourragères qui répondaient le mieux aux besoins alimentaires du bétail au cours de la saison sèche, du point de vue de la quantité, comme de la qualité.L'enthousiasme retrouvé, ils ont conduit les essais sur les qualités gustatives des fourrages. Brachiaria hybride Mulato, Brachiaria var. Toledo, Panicum maximum and P. coloratum ont été classées comme les plus performantes, suivant l'ordre de préférence du bétail de race locale, les espèces laitières améliorées appréciant indifféremment tous les types de fourrage. Lors de la saison sèche suivante, les deux variétés de Stylosanthes guianensis; Brachiaria hybrid Mulato, Brachiaria var. Toledo et Chamaecrista rotundifolia, ont démontré une excellente tolérance à la sécheresse. "},{"text":" Nous remercions vivement Africa2000 Network, la PABRA et le Programme du CGIAR à l'échelle du système sur la recherche participative et l'analyse du genre pour leur appui financier. "}],"sieverID":"c5f4e9f4-d1eb-431c-876e-aa6125709f81","abstract":"A vec plus de 60% des ménages vivant en dessous du seuil absolu de pauvreté, le District de Tororo figure parmi les régions les plus pauvres d'Ouganda. Un diagnostic participatif réalisé par l'association Africa 2000 Network (A2N) et le CIAT en 2003 a mis en exergue l'importance de la disponibilité en alimentation pour les vaches et les chèvres laitières de race améliorée ou croisée, particulièrement au cours de la saison sèche, qui s'étend du mois de décembre au mois de mars. En 1997, diverses organisations de recherche et de développement basées dans cette province formèrent un consortium, appelé « Initiative de gestion intégrée des sols par la recherche et l'éducation » (Integrated Soil Productivity Initiative through Research and Education -INSPIRE), dans le but de lutter contre l'insécurité alimentaire et la pauvreté en améliorant la fertilité des sols. Evaluant tout d'abord la performance de différentes cultures de légumineuses, telles que Mucuna et Canavalia, principalement au moyen de critères d'ordre agronomique, les agriculteurs ont ensuite ajouté aux critères retenus l'utilisation du fourrage comme alimentation animale. En 2003, le CIAT et A2N ont sélectionné deux groupements paysans intéressés, Katamata and Umoja, en vue de mesurer la performance des plantes fourragères améliorées sur leurs espèces laitières. Des vaches laitières avaient déjà été attribuées aux membres de ces groupes, dans le cadre de prêts accordés par le biais du programme de distribution d'A2N. Le premier objectif de cette étude était d'évaluer, sur la base de critères définis par les agriculteurs et par les chercheurs, les espèces et les variétés fourragères qui répondaient le mieux aux besoins alimentaires du bétail au cours de la saison sèche, du point de vue de la quantité, comme de la qualité. Le second objectif visait à concevoir une approche applicable à l'évaluation participative des espèces fourragères en Afrique."}

data/part_1/03d553676fec00ddf9fe90e44ca160e9.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03d553676fec00ddf9fe90e44ca160e9","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8cefaf19-c58f-42dc-811a-a3d407da4e18/retrieve"},"pageCount":15,"title":"Women in Agriculture: Accelerating Impact of CGIAR Climate Research for Africa","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":65,"text":"The Rallying Cry and the International Institute of Tropical Agriculture (IITA) contin ued to collaborate on the workshops that engaged Zambian youth and women in agri-busin ess. In the second series of the workshops (or webinars), the participants were encour aged to further engage with each other, their identified challenges and opportunities, and their wish list items previously identified in the first workshop in September."},{"index":2,"size":68,"text":"The objective of the second workshop was to deep dive into a collaborative approach to identifying potential solutions, consider the role of key ecosystem stakeholders inclu ding the banks, policy makers and IITA/AICCRA and prioritise wish list items for poten tial action. The conclusions reached provide a framing and context for next steps of s takeholder engagement in the third and final workshop for this phase of work."},{"index":3,"size":20,"text":"This report summarises the key findings and outcomes from Workshop Two and concludes w ith key actions identified and recommendations."}]},{"head":"The Workshop Approach","index":2,"paragraphs":[{"index":1,"size":64,"text":"The workshop opened at 9:00 a.m. and closed at 3:00 p.m. on the 2 nd of December 2022 at the Urban Hotel in Lusaka. The workshop participants were a blend of twenty-three (23) women and youth who came from different towns located in four key provinces. The seati ng arrangement was designed to encourage open dialogue, maximise participation and nud ge people to engage."},{"index":2,"size":75,"text":"The Rallying Cry team opened the workshop with a check-in that enabled the participant s to self-assess how empowered they felt in various settings, in comparison to other s takeholders and how important it is to them to be seen, heard and counted. This activi ty encouraged active participation, provided an opportunity for informal benchmarking, set the tone for the day and also served as a meter to assess key check points through the day."},{"index":3,"size":41,"text":"The participants were then divided into smaller working groups of 5-6 participants for the remainder of the day to encourage deeper levels of discussion and to facilitate pr oblem-solving. Group work was presented back to the plenary by self-nominated represen tatives."}]},{"head":"Outputs","index":3,"paragraphs":[{"index":1,"size":73,"text":"The goal of the second workshop was to build on the insights from the first workshop w hile doing a deep dive into plausible solutions to address previously identified const raints and desired \"wish list\" items. Building on the \"wish list\" items identified in Workshop One, the participants were requested to rank and prioritise these items, i ncluding mapping potential solutions by stakeholder group. The following sections capt ure their inputs as below."}]},{"head":"Challenges and Solutions","index":4,"paragraphs":[{"index":1,"size":38,"text":"The initial over-arching themes identified in Workshop One were reviewed to remind participants of their outputs: (1) Knowledge, (2) Climate change response (3) Tech nical expertise, (4) Environmental constraints (5) Cultural and social norms and ( 6) Networks."},{"index":2,"size":11,"text":"With further discussion, the participants prioritized the original list as follows:"},{"index":3,"size":25,"text":"1. Environmental constraints 2. Network 3. Climate change response 4. Capacity Building (two items Knowledge and Technical expertise were combined) 5. Social and cultural norms"}]},{"head":"Environmental Constraints","index":5,"paragraphs":[{"index":1,"size":32,"text":"Challenge: This pillar encompassed external constraints that inhibit business grow th including (but not limited to) supply chain issues, route-to-market system flaw s, lack of access to markets and access to finance."},{"index":2,"size":43,"text":"Potential Solution: Deliberate government and stakeholder assistance in creation l inkages between agribusiness producers and trading points from markets to supermar kets and everything in between. This should include altering and/or developing pol icies that constrain businesses e.g. high tax rate for businesses."},{"index":3,"size":122,"text":"Stakeholder Roles and Actions Required: The Policy makers were identified as a ce ntral change maker for this work stream. They need to develop and implement delibe rate policies that mainstream gender in the agriculture sector. This would include simplifying processes of group (co-operative organisations registration) which is currently online and offline. This can be done by working closely with organisatio ns such as AICCRA that understand the plight of this marginalised demographic and are keen to increase their likelihood of success. The banks also have a role to pl ay and can create more gender inclusive solutions and be more welcoming to women b usiness leaders. Finally, the women understand their role and are keen to continue lobbying and raising awareness."}]},{"head":"Networks","index":6,"paragraphs":[{"index":1,"size":83,"text":"Challenge: Building on their previous work, Networks was identified as the second most important pillar. Being part of a network bridges gaps for a range of challen ges such as information, knowledge, access to finance and/or markets. Etc. The imp ortance of synergy in this pillar resonated even more strongly in the second works hop as the participants had developed relationships with one another and extended kindness towards each other such as COMACO representatives bringing Gliricidia tre e seeds for their fellow participants."},{"index":2,"size":44,"text":"Potential Solution(s): The participants generated several solutions that anchored them as the action owners. Among these were the formation of a WhatsApp group, sit e visits among themselves and being part of a larger network that would foster ski lls development and business growth."},{"index":3,"size":91,"text":"Stakeholder Roles and Actions Required: The women and youth also desired support f rom AICCRA to aid in the development of mechanisms that would drive these networks such as workshops, events and platforms that would make these networks invaluable. They seek the support of banks in the provision of necessary services and offering s that input value into these networks. These include access to finance, skills de velopment or even business preparedness. They seek support from the policy makers to create the enabling environment for them and the banks to succeed."}]},{"head":"Climate change response","index":7,"paragraphs":[{"index":1,"size":79,"text":"Challenge: The impact of climate change by the agricultural sector is significant as it threatens food security. The participants shared their current realities and the efforts they are taking to mitigate and adapt to these adverse conditions. Potential Solution(s): Some solutions such as the planting of Gliricidia trees for soil and atmospheric rejuvenation and crop diversification were echoed from the pr ior workshop. Additional solutions included integration or smart agriculture pract ices and roll-out of green houses for sustainability."},{"index":2,"size":60,"text":"Stakeholder Roles and Actions Required: The women and youth with knowledge of the se practices can train others especially in smart agriculture techniques. They req uire support from relevant policy makers to provide a platform and environment for this to be possible. Policy makers also need to integrate sustainability into the core of policies and government and private sector implementation."},{"index":3,"size":36,"text":"Other players such as the banks and AICCRA can provide access to funding that enab les enterprises to scale up these solutions and where possible climate smart agric ulture models that are replicable at community level."}]},{"head":"Capacity building","index":8,"paragraphs":[{"index":1,"size":43,"text":"Challenge: This unique pillar was a blend of theory (knowledge) and practical (han ds-on technical assistance). The need for more knowledge combined with the lack of technical expertise on the ground are a reality for agro-businesses, as discussed at length by the participants."},{"index":2,"size":85,"text":"Potential Solution(s): Policy makers need to encourage formulation of policies th at deliberately support all stakeholders i.e. The banks, women & youth and support organisations such as AICCRA. They (i.e. the policy makers) could also partner wit h experts to provide free trainings (such as those offered by Livestock services) and hands-on technical expertise such as fast tracking the integration of extensio n officers in the community. The extension officers require assistance from the go vernment ministries to execute their role as they lack mobility."},{"index":3,"size":127,"text":"Stakeholder Roles and Actions Required: Organisations such as AICCRA can bridge t his gap by providing subject matter experts or partnering with institutions such a s GIZ and Access who have provided special training to women and youth groups in Z ambia. The banks can support the policy makers by driving financial literacy exten sively among the women and youth and explore avenues of financial inclusion that d o not side-line women and youth. This does not necessarily need to be done indepen dently of AICCRA/IITA who can provide a program of trainings and technical experti se for the enterprises. This structured approach provides a network for the women to engage and glean from one another and participate in public speaking opportunit ies e.g. radio talk shows."}]},{"head":"Social and Cultural Norms","index":9,"paragraphs":[{"index":1,"size":41,"text":"Challenge: The challenge is multi-faceted and unlike the other pillars requires a significant mind-set shift and external stakeholder intervention. Social and cultu ral barriers are still existing and deeply engrained even though they may appear a s objects of the past."}]},{"head":"Potential Solution(s):","index":10,"paragraphs":[{"index":1,"size":43,"text":"The solutions under this pillar identified a need for a col laborative effort among key players. This includes identification of key challenge s faced by women and youth (such as Land tenure) and development of platforms that would serve as vehicles for sensitization."},{"index":2,"size":76,"text":"Stakeholder Roles and Actions Required: The awareness and barrier breakdown can b e aided by AICCRA and other organisations who have the capacity to usher team memb ers into a single forum (or Insaka) to dialogue on solutions to address this chall enge. This includes policy makers such as chiefs and headmen buying into the pligh t of these marginalized individuals and implementing changes in customs that would facilitate the increase of business and individual success."},{"index":3,"size":83,"text":"The traditional leaders supported by policy makers can formulate gender inclusive policies that address the challenges and work closely with banks to implement simp ler payment processes, collateral free loans and change the perception of the wome n's inability to pay loans for this structured approach. A start point for these activities is land tenure, ownership and titling. The women and youth, can drive a dvocacy through a range of platforms, including a performing arts group, that enab le them to be heard."}]},{"head":"Wish-list and solutions","index":11,"paragraphs":[{"index":1,"size":50,"text":"This portion of the workshop recapitulated previous wish-list items, prioritized t hem in their pillars and drilled down into solutions by key players (stakeholders) . The initial short medium and long term pillars were maintained to provide partic ipants with an opportunity for continuity on work done in previous workshops."}]},{"head":"Short Term","index":12,"paragraphs":[{"index":1,"size":30,"text":"These goals were items that were easier to do and thus considered \"low hanging fr uit\". This pillar contained two goals which were categorized as follows (in order of importance):"},{"index":2,"size":30,"text":"(a) Capacity building This sub-theme was composed a series of business development areas identified p reviously by the participants. These too, were ranked in order of importance as shown below"},{"index":3,"size":12,"text":"1. Climate smart agriculture practises 2. Financial literacy 3. Access to market"},{"index":4,"size":5,"text":"The participants highlighted the following:"},{"index":5,"size":20,"text":"• Acknowledgement that they have to take an active interest in self-develo pment by participating in online and offline lessons;"},{"index":6,"size":34,"text":"• They would need to be part of a network and seek opportunities to improv e their businesses; the realization of the need for financial literacy, capacity building and access funding for business growth."},{"index":7,"size":49,"text":"Such capacity building opportunities could be provided by the banks and AICCRA in various formats including trainings, workshops, and informal cascades. The p olicy makers can additionally support these collaborations and the women & yout h by working closely with these partners and co-creating solutions that address identified gaps."},{"index":8,"size":147,"text":"(b) Access to governmental solutions: The participants expressed an appreciation to wards the solutions the current government had rolled out such as Zambia Farmer s Input Support Program (FISP), Constituency Development Fund (CDF) and loans b eing provided by Citizens Economic Empowerment Commission (CEEC). The CDF was c onsidered as the most important proceeded by CEEC and finally FISP. However, th ey highlighted the complexity of the application process and at times the level of ambiguity and the lack of knowledge with regards to these facilities. As wom en and youth they are committed to applying for these financials solutions; how ever policy makers should build capacity and educate them on the process. In ad dition, they should partner with banks to ease account opening procedures to en sure simplified issuance of funds. AICCRA/IITA and other such organisations should aid women and youth in their jo urney"}]},{"head":"Medium Term","index":13,"paragraphs":[{"index":1,"size":19,"text":"The medium-term wish-list items activities equally underwent ranking and top three fundamental actions were selected and analyzed. These include:"},{"index":2,"size":5,"text":"(a) Equitable access to finance"},{"index":3,"size":81,"text":"The solution for this action is deeply rooted in literacy and actual financing of the enterprise. This will enable vision implementation and ascertainment of profitability. Entities like AICCRA and banks can provide access to an assortme nt of financing instruments and the necessary technical assistance to aid these business owners to grow and scale their businesses. It is imperative that they build relevant skills for optimized management. They need the support of govern ment policy makers to create this inclusive environment."},{"index":4,"size":3,"text":"(b) Capacity development:"},{"index":5,"size":78,"text":"This theme has been consistent through the workshops and navigated through cons traints, wishes and next steps. The first step is buy-in and commitment by the women and youth to address this need. The policy makers need to follow through on extension services, associated logistics and climate change policies being i mplemented. The supporting enterprises can provide more training opportunities and networking events while the banks need to delve into financial solutions th at aid purchase of equipment."},{"index":6,"size":3,"text":"(c) Platform creation:"},{"index":7,"size":31,"text":"This wish-list item addresses the knowledge gap, access to finance and network requirement identified by the women. This platform will save them time spent on research and enable structured peer interactions."}]},{"head":"Long Term","index":14,"paragraphs":[{"index":1,"size":31,"text":"The participants agreed that in order of priorities, the market linkages were the m ost critical. This was followed closely behind by policy development and finally c ooperative growth and development."},{"index":2,"size":3,"text":"(a) Market linkages:"},{"index":3,"size":84,"text":"The themes encompassed the development of sustainable and supportive market sys tems and linkages for produce. The various stakeholders including the women and youth each have a role to play. The first step is for the women and youth to pr oduce the various items and seek channels to sell this produce such as aggregat ion, out-grower models and even trading amongst themselves. They still require support in financing from banks and policy makers and where necessary capacity building and market information from AICCRA/IITA."}]},{"head":"(b) Policy development and revision:","index":15,"paragraphs":[{"index":1,"size":37,"text":"The policy makers form a core piece of creating environment that enables busine ss tenacity and success. By creating interventions around land titling, taxes, unfair market trading terms and factors affecting SMEs as a matter of urgency."},{"index":2,"size":56,"text":"They also have a responsibility to monitor and evaluate the implementation of t hese endeavors. In addition, they have to create an enabling environment for ba nks to sustainably provide access to finance and be willing work with organisat ions such as AICCRA or and lobby groups who equally are working on improving th ese policies."},{"index":3,"size":23,"text":"The women and youth are most impacted and this awareness requires them to creat e a structured approach as they lobby for transformation."},{"index":4,"size":5,"text":"(c) Cooperative creation and growth:"},{"index":5,"size":136,"text":"The role of cooperatives was discussed and the realization for mind-set shift i s necessary to show that cooperatives should not be formed to receive Farmer In put Support Program (FISP) and Constituency Development Fund (CDF) grants. Ther e is a general perception of under-performance and politicized registration. In addition, members lack training, interest and general business acumen. These co operatives can solve value chain challenges such as hatcheries, solar cold room s, etc. This can be solved through intervention by government institutions in s implifying and optimizing the registration. They also have an obligation to edu cate the groups during their formation and aid them through the leadership sele ction process. The members (i.e. the women and youth) have the responsibility o f understanding that these organized groups are businesses and should commit to them."},{"index":6,"size":24,"text":"All stakeholders have a responsibility to provide access to finance, capacity b uilding and aiding these enterprises to deliver on set goals during formation."}]},{"head":"Recommendations and Action plan","index":16,"paragraphs":[{"index":1,"size":25,"text":"This section collates the insights, verbal and written feedback forms. They have b een refined into insights translated into actionable information (lessons learned and recommendations)."}]},{"head":"Workshop Feedback","index":17,"paragraphs":[{"index":1,"size":23,"text":"As per the first workshop, the participants provided feedback on three key elements : 1. Content / Discussion 2. Delivery/ Facilitation 3. Participation"},{"index":2,"size":13,"text":"These three items were selected on the basis of creating a replicable model."},{"index":3,"size":83,"text":"The ratings of each component were calculated out of five ( 5) with 1 being poor and five (5) being excellent. The delivery/facilitation element was the highest with a rating of 4.91. It was followed closely behind by Content/discussion with 4.87 and participation at 4.57 out 5. The participation aspect was measured in the second wo rkshop to determine the level of interaction which was raised as a concern in the p revious workshop. These factors show that overall the workshop was successful."},{"index":4,"size":21,"text":"The responses provided by the participants have been integrated below and form a si gnificant part of next steps and recommendations."}]},{"head":"Lessons learned and Key Findings","index":18,"paragraphs":[{"index":1,"size":11,"text":"The second workshop revealed some new things and confirmed previous findings:"},{"index":2,"size":39,"text":"• Re-affirmed that business owners understood their enterprises, their shortcomin gs and were able to articulate their needs. • Showcased the value of networking as the women and youth shared industry knowle dge, closed deals and shared Gliricidia seeds."},{"index":3,"size":42,"text":"• The role of the various stakeholders in the solutions identified was clear and a roadmap can be developed • Re-affirmed the need for technical and financial support so that the women and youth led businesses can engage in sustainable impact management;"},{"index":4,"size":81,"text":"• The feedback both verbally and in writing showed resonating themes around the n eed capacity building and access to finance; • The access to finance consistently was a secondary desire or requirement with t he primary need being knowledge and understanding. This validated previous find ings that showed the desire for capacity building and training outweighed reque sts for financing; and • Demonstrated nature-based solutions that the participating SMEs were already im plementing and could be replicated by other farmers."},{"index":5,"size":50,"text":"The deep dive provided profound insights such as the hunger and desire that women and youth possess for knowledge and growth. It also introduced a new aspect i.e. climate s mart agriculture, which is not a new practice to the participants but needs to be furt her discussed and recognised."},{"index":6,"size":63,"text":"The interactive approach provides an opportunity for attendees to participate in a sma ller setting or group set up. It is an inclusive way to ensure all inputs are captured and every individual feels part of the co-creation process. The presentation by team l eaders also provides a sense of ownership. This is anchored to an environment that is safe and fosters comradery."},{"index":7,"size":72,"text":"The AICCRA/IITA project is engaging the target audience on multiple fronts. It became apparent that these women and youth are unaware of the different offerings availableby AICCRA/IITA or otherwise -including grant programs and technical assistance. There is most certainly an opportunity in this space for IITA to educate members from the as sorted bundles on their key strengths and leverage the partnership networks and the dr aft programs of work going forward."}]},{"head":"Recommendations and next steps","index":19,"paragraphs":[{"index":1,"size":16,"text":"We provide our recommendations and next steps below for the short, medium and longer t erm."}]},{"head":"Short Term","index":20,"paragraphs":[{"index":1,"size":41,"text":"These recommendations are quick wins that ideally would be implemented promptly to ens ure that attendees feel heard and believe change is on the horizon. A further step has been taken to bucket these wish list items into themes Capacity Building"},{"index":2,"size":1,"text":"• "}]},{"head":"Nature based solutions","index":21,"paragraphs":[{"index":1,"size":72,"text":"• Roll-out nature conservation projects such tree planting of Gliricidia, or Mori nga that are good for the soil and can be used as animal fodder; • Implement smart agriculture models Capacity building (practical) • Provide Technical assistance to SMEs in-situ through easy and practical approac hes via government field resource officers and experts; and • Avail extension officers with an understanding of the community and agricultura l practises that can work"}]},{"head":"Long Term","index":22,"paragraphs":[{"index":1,"size":13,"text":"These long term activities should form part of the strategy to ensure implementation."},{"index":2,"size":19,"text":"• Roll-out affordable and sustainable irrigation solutions for farmers to ensure full year production and address impact of drought;"},{"index":3,"size":21,"text":"• Engage stakeholders for policy interventions and reforms around land titling, t axes, unfair market trading terms and factors affecting SMEs."},{"index":4,"size":125,"text":"Overall these recommendations and the solutions identified for the challenges and wish list items were co-created by the participants. This confirms the fact that they are i ndeed capable of generating their own answers to the challenges they face and these ac tionable as they are tailored in lights in their realities. These solutions will be consolidated and utilized as a framework for the third and fin al workshop of Phase 1 where the participants will engage a range of invited stakehold ers. These explications should be at the centre of the dialogue and addressed respectf ully. Post interaction, it cannot be over emphasized that a structured program of work or action plan be implemented and monitored (coupled with course correction) for optim ized results."}]},{"head":"Action Plan","index":23,"paragraphs":[{"index":1,"size":39,"text":"This portion of the report highlights a top level action plan that was curated for imm ediate implementation. These are low hanging and were expressly stated as areas that t he participants wanted to be addressed. Among these are:"},{"index":2,"size":49,"text":"• Mapping of different types of Enterprise Support Organisations and programs • Mapping of financial service providers, their benefits and their offerings • Access to pre-finance, finance and post support • Development of a program of work which focuses on strategy development, busines s enrichment and an action plan."},{"index":3,"size":27,"text":"• IITA/AICCRA to provide participants with more information about the organisatio ns, their benefits, offerings and programs of work that may be relevant for bus iness growth"},{"index":4,"size":27,"text":"These five actions points do entail that other recommendations are irrelevant. They re -inforce the urgency of delivery of short-term actions on key business fundamentals or aids."}]},{"head":"How The Rallying Cry could potentially contribute","index":24,"paragraphs":[{"index":1,"size":20,"text":"The Rallying Cry team could potentially support the development of some of the recomme ndations from both workshops, for example:"},{"index":2,"size":2,"text":"Ecosystem mapping"},{"index":3,"size":19,"text":"• The Rallying Cry could help develop a map of financial service providers and lo cal Enterprise Support Organisations. "}]},{"head":"Capacity","index":25,"paragraphs":[]},{"head":"Network","index":26,"paragraphs":[{"index":1,"size":24,"text":"• Aid in the development and management of a single platform that will serve as a single source of information, training and opportunity dissemination."},{"index":2,"size":102,"text":"The take-outs from the workshop show that more needs to be done with regards to traini ng, access to finance and capacity building. The Rallying Cry able to aid AICCRA and t he women and youth as they embark on this journey. A partnership between AICCRA and Th e Rallying Cry would help create the right service solution delivery with solutions th at are in tune with the concerns of the women and youth in Zambia and enable the devel opment of a solution template that can be replicated in other countries and customised to suit the local agribusinesses for each market."}]}],"figures":[{"text":" Develop enterprise capacity through workshop and/or trainings calendar • Workshops and/or trainings should be a minimum of one day, and should follow a similar engaging and inclusive format with deliberate effort by facilitator to engage all participants; • Where possible workshops and trainings should be facilitated by a localized res ource for increased relatability; Business strengthening • Development of business plans and comprehensive business goal • Development of SMART goals and action plan for Wishlist items with mechanisms t o monitor these activities; Network development • Development of a platform where women and youth led business can engage and hav e access to peers, knowledge and finance. • A network map should be executed to identify a pool of skilled entrepreneurs or individuals from various industries to provide training for the women and youth e.g. value addition, human resource recruitment, and technical expertise. • Development of an ecosystem map showing financiers and enterprise support organ isations and their offerings. AICCRA input • Education of members and participants on IITA/AICCRA offerings • IITA/AICCRA to engage subject matter experts to address needs identifies • Commence stakeholder engagement to embark on policy reform journey 4.3.2 Medium-Term These activities require buy-in from external stakeholders and creation of partnership s. Access to finance • Partner or collaborate with a team for the development and implementation of op timized equitable access to capital models for women owned and led agribusiness es; • IITA to share grant opportunities post capacity building activities • Engage stakeholders on the development of solutions for distribution of Constit uency development fund. "},{"text":" Building • The Rallying Cry could help prepare a training proposal (and calendar) for the w omen and youth covering both soft and hard skills requested by the women; • Develop content and facilitate trainings and workshops; • Aid in the development of, and propose a mechanism for, follow-up based on the o utcomes of workshop trainings; • Support further research and development of gender-smart, climate responsive too ls for agribusiness. • Development of a program of work that focuses on developing enterprise resilienc e and crafting the relevant tools to address identified gaps • Provide technical assistance specifically on the gender-climate nexus Access to Finance • Develop and implement optimized equitable access to capital models for gender-sm art and climate responsive agribusinesses. "},{"text":"  "}],"sieverID":"4d8d6018-2e3f-458e-880c-9e88c06e660b","abstract":""}

data/part_1/03da96ae446b2ef42a8c5f86f13bbd8e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03da96ae446b2ef42a8c5f86f13bbd8e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1a463912-5f18-43dd-9c26-c159d088ba40/retrieve"},"pageCount":1,"title":"Soil Status and its Relationship with Gender and Health Inequalities in Guatemala Aim of Study: Understand soil status inequalities in Guatemala and how this affects gender and health inequalities","keywords":[],"chapters":[{"head":"Recommendations:","index":1,"paragraphs":[{"index":1,"size":11,"text":"• Enhance female participation and engagement with extension workers and workshops."},{"index":2,"size":10,"text":"• Encourage gender-focused research on household management in Central America."},{"index":3,"size":30,"text":"• Promote soil management practices to enhance soil quality • Promote and incentivize the utilization of homefield land to improve soil quality and empower females to maximize their available plots "}]},{"head":"Agricultural inputs","index":2,"paragraphs":[{"index":1,"size":37,"text":"• Gender-based inequality in accessing agricultural inputs is a concern. • Home fields had more inputs when the household head was female, often due to outfield space limitations in femaleheaded households. • Inorganic fertilizer distribution was uneven."},{"index":2,"size":18,"text":"• Most small and large livestock were owned by males, with their manure primarily used on the outfield."}]},{"head":"Land Ownership","index":3,"paragraphs":[{"index":1,"size":25,"text":"• Most interviewees identified a male as the head of the household (HH). • Data confirmed our research hypothesis that females predominantly manage the homefield. "}]}],"figures":[{"text":"Small animals Fertilizer distribution not equal Organic fertilizer Outfield fertilizer Homefield fertilizer Soil inputs by head of HH Gender       Field Managers Gender     Field Managers Gender   Head of HH           Head of HH  Outfi eld manager           Outfi eld manager  Homefield manager           Homefield manager  Outfi eld ownership           Outfi eld ownership Female Male 100% 80% 60% 40% 20% 0% 20% 40% 60% 80% 100% FemaleMale100%80%60%40%20%0%20%40%60%80%100% 80% Ox/cows      Female Male      80% Ox/cowsFemaleMale 70%             70% 60%             60% 50%             50% 40%             40% 30%             30% 20%             20% 10%             10% 0%             0% Intercropping             Intercropping • Homefield Farming:             • Homefield Farming: ⚬ Only 4% practiced intercropping with beans, pumpkins, and maize.            ⚬ Only 4% practiced intercropping with beans, pumpkins, and maize. ⚬ Field observations revealed additional crops not mentioned by            ⚬ Field observations revealed additional crops not mentioned by interviewees.             interviewees. • Outfield Farming:             • Outfield Farming: ⚬ 77% practiced intercropping with various crops.            ⚬ 77% practiced intercropping with various crops. • Objectives:             • Objectives: ⚬ Homefield intercropping aimed to optimize land use and increase            ⚬ Homefield intercropping aimed to optimize land use and increase production.             production. ⚬ Outfield intercropping aimed to enhance production and improve soil            ⚬ Outfield intercropping aimed to enhance production and improve soil quality; some farmers were visited by extension workers.            quality; some farmers were visited by extension workers.  "}],"sieverID":"2adfad03-12b9-43e2-b20c-094b2d264c53","abstract":""}

data/part_1/0418be76975615fa08bb9858b6f20f3a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0418be76975615fa08bb9858b6f20f3a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3a8373f2-3a97-49fd-a3c0-03e4a174bf0c/retrieve"},"pageCount":11,"title":"Innovative Partnerships to Scale Up Climate-Smart Agriculture for Smallholder Farmers in Southern Africa","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":219,"text":"Southern Africa is particularly vulnerable to climate change because smallholder subsistence farmers, a majority in the region, rely almost entirely on rain-fed farming (Nhemachena et al. 2010). Weather patterns such as droughts, floods and erratic rainfall impact rural households' food security, nutrition and income, which is significant in a region where the majority of the population are poor and have the lowest adaptive capacity (Beegle et al. 2016;Nhemachena and Hassan 2007). Amongst the most vulnerable are smallholders, especially female farmers who have the least capacity to adapt, and are thus disproportionally impacted by climate change compared to their male counterparts (UN 2009). This high vulnerability to climate change causes food insecurity (recurrent swings between food scarcity and surplus) for up to six million people annually. For example, in the 2015-2016 agricultural season, countries including Lesotho, Malawi, Swaziland, Botswana, Namibia and Zimbabwe declared national emergencies because of drought (WFP 2016). There is an increasing call from farmers, development practitioners and policymakers to recognise drought as the \"new normal\" in the region, and to respond appropriately (Ajayi et al. 2007a, b). Part of the response is to shift from \"relief efforts\" (giving food aid to farmers after crop failure) to \"production relief\"--helping farmers to adopt practices that make them resilient, so they can continue to produce food despite climate change uncertainties."},{"index":2,"size":42,"text":"Innovative partnerships are increasingly recognised as essential for addressing the negative consequences of climate change, however there is limited literature about the practicalities of putting into use innovative partnerships to scale up climateresilient agricultural solutions in southern Africa (Surminski and Leck 2016;"},{"index":3,"size":68,"text":"The Technical Centre for Agricultural and Rural Co-operation (CTA (ACP-EU)), Wageningen, The Netherlands e-mail: [email protected] Andersson et al. 2016;Fünfgeld 2015;UNEP 2015;Forsyth 2010). The objective of this chapter is therefore to describe the processes and experiences of forming country project teams, partnership models and approaches to reach farmers in Zimbabwe, Zambia and Malawi. This will improve understanding of methods of setting up sustainable partnerships that exist beyond donor-funded projects."}]},{"head":"Solutions for Scaling CSA","index":2,"paragraphs":[{"index":1,"size":146,"text":"The specific climate-smart solutions for scaling up were selected over multiple phases, in consultation with farmers and a range of stakeholders including development workers and researchers. The process began with a call for proposals for climate-smart solutions, followed by an evaluation process that involved many experts from Europe, African, Caribbean and Pacific (ACP) countries (CTA 2015). The experts were six individuals from Europe, Africa and the Caribbean; an agroecologist, a climate change scientist, an international agricultural development specialist, and representatives from the farmers' organisation and the Forum for Agricultural Research in Africa (FARA). The top 15 solutions were documented and published to assess their respective development, adoption, impact and potential for being scaled up in other regions, after which four climate-smart solutions were selected (CTA 2015). The project adopts a \"bundled solution\" approach rather than a single technology. The four climate-smart solutions being scaled up are:"},{"index":2,"size":32,"text":"(i) Drought tolerant maize seeds (ii) Information and communication technology (ICT) enabled weather information services for smallholder farmers (iii) Weather based index insurance for smallholder farmers (iv) Diversified options for livestock farmers"}]},{"head":"Partnerships for Scaling Up Climate Resilient Solutions: Country Case Studies","index":3,"paragraphs":[{"index":1,"size":16,"text":"The scaling up project is currently implemented in three countries: Zimbabwe, Zambia and Malawi (Table 25.1)."}]},{"head":"Bilateral Partnership Model: Zimbabwe","index":4,"paragraphs":[{"index":1,"size":218,"text":"The partnership in Zimbabwe is bilateral, with the two implementing partners, the Zimbabwe Farmers Union (ZFU) and Econet Wireless, sharing common economic interests and equal responsibility. Whilst ZFU acts as the aggregator to reach farmers, Econet Wireless provides a platform to digitally register farmers and disseminate information to them. Their shared interest (i.e., reaching farmers with information) and mutually agreed delineation of responsibility (including management of project resources) allows autonomy and ease of operations when carrying out specialised project activities. Additionally, ZFU and Econet Wireless have an equal share of decisive power in project planning, programming and implementation, facilitated by regular project meetings, a joint project implementation plan, and a signed Memorandum of Understanding (MoU). This also supports the management and dissemination of profit from farmer subscriptions to the information services provided. The partners also share an online portal containing project statistics, including farmers' subscriptions to the insurance product, billings and payments. This second-generation partnership--the two partners have previously worked together in partnership--in Zimbabwe was established in 2015 with the aim of providing farmers with highly valuable services at a minimum cost through ICT. The services, collectively referred to as the original ZFU EcoFarmer Combo, included: crop advice, weather index insurance, payment for ZFU membership and funeral cover. This original combo reached approximately 39,000 farmers by mid 2017."},{"index":2,"size":144,"text":"The current ZFU EcoFarmer Combo costs 1 USD per month and includes all the services in the original version, as well as weather information in real time, toll-free phone information on drought tolerant seeds, and advice for crop and livestock farmers (via the Dial-a-Mudhumeni phone in extension service). With CTA support (especially regarding real-time weather data and increasing reach to farmers) this current combo has reached approximately 10,000 farmers in the first 2 months of mobilization. The lead farmer is the main contact for the project and partner organisations. He/she is selected from his/her peers in the community based on educational background as well as standing in the community and is trained (as an entry point to the community). Lead farmers are given training materials, a push bike and a schedule to train or disseminate the information to other farmers in their respective locality"},{"index":3,"size":145,"text":"The partnership is mutually beneficial. Organisational theorists have demonstrated that member organisations are most likely to survive if they are able to mobilise resources and demonstrate legitimacy, both of which ZFU achieved through this partnership (Walker and McCarthy 2010). As a member-based organisation which farmers subscribe to, ZFU relies on membership fees for continuity. Before the EcoFarmer Combo was introduced, these were collected manually (i.e., at the district level by ZFU employees and then remitted to ZFU central via a bank deposit), a process that was laborious, inefficient and ineffective. The EcoFarmer Combo package includes the ZFU membership fee and is bought by mobile payment, thereby resolving the issue for ZFU. The partnership also enables ZFU to demonstrate relevance to members through the delivery of tangible, valuable services at a relatively low cost, and reduces cost thanks to their discounted telecom rates from Econet Wireless."},{"index":4,"size":71,"text":"The key benefit for Econet Wireless is that working with ZFU opens up a new clientele of smallholder farmers to which they can market their services, including their insurance products and ICT subscription services. Both organisations profit financially from farmer subscriptions to the EcoFarmer Combo, which ensures that ZFU can exist and that Econet Wireless achieve their commercial goals, both of which are key outcomes for the continuity for the partnership."},{"index":5,"size":76,"text":"The public sector (specifically the Ministry of Agriculture) has also helped facilitate the scale-up of CSA innovations in Zimbabwe. Specifically, farmer recruitment to the ZFU EcoFarmer Combo within Municipal Wards (the smallest political demarcation of a district in Zimbabwe) is supported by local government extension staff. By providing skeptical members of the general public and local (political) leaders with project information, they have played a vital role in validating and legitimising the work of the partnership."}]},{"head":"Multilateral Partnership Model: Zambia","index":5,"paragraphs":[{"index":1,"size":94,"text":"In Zambia a multilateral partnership comprised of Zambia Open University, Musika Development Initiatives (Musika) and the Professional Insurance Company of Zambia (PICZ) works in collaboration with officers and field workers from the Ministry of Agriculture and Livestock to reduce the vulnerability of smallholder farmers. Specifically, the partnership is working to increase farmers' resilience through diversified, adaptive, climate resilient production systems. Each partner has equal influence in the implementation of the project, achieved through joint regular meetings, field implementation and monitoring. Zambia Open University, by leading the consortium, has ensured government engagement in the project."},{"index":2,"size":53,"text":"Musika previously implemented the DFID-funded project Vuna to promote different aspects of CSA through the creation of a supportive policy environment. They trained farmers and agro-dealers to understand changes in the agricultural landscape, the benefits of using climate smart practices, and the use of pesticides, herbicides and post-harvest technology in an altered environment."},{"index":3,"size":22,"text":"Musika has capitalised on this previous work in the current partnership by using agro-dealer networks already established and previously trained in CSA."},{"index":4,"size":146,"text":"To ensure sustainability beyond the life of the project, each partner in the Zambian consortium is responsible for the areas in which they specialise. For example, PICZ developed the insurance product for farmers, and provide the digital platform for farmer registration. Musika is responsible for farmer mobilization (sensitising farmers so that they can register for the program) using existing staff and local structures, while Zambia Open University, apart from coordinating and leading project implementation, manages the research components of the project. As in the Zimbabwe partnership described above, there are multiple benefits to this approach for each partner; PICZ acquires new clientele in the form of smallholder farmers, Musika Initiatives (which uses a market facilitation approach to link farmers with agribusinesses) mobilises new farmers for their market linkages work. Zambia Open University benefits from capacity building for their students, field project management experience and research outcomes."},{"index":5,"size":246,"text":"The consortium aims to reach 60,000 farmers in 2 years. Between 2013 and 2015, up to 75,000 smallholders in Zambia were introduced to weather index insurance. In early 2017, the Zambian Government announced a policy that made the purchase of weather index insurance compulsory for all farmers benefiting from the Farmer Input Support Programme (FISP). 1 Approximately 1.2 million farmers will subscribe to weather index insurance as a result of this policy. The Zambian Government has approached the project consortium to support the implementation of the new policy, and has adopted their training materials on CSA and weather index insurance for use by all front line government extension staff and farmers. Additionally, nationwide efforts to scale up weather index insurance will draw lessons from the consortium target areas. Government buy in, although not a panacea to low adoption and limited access to CSA innovations by smallholders, is of paramount importance in the scale up of climate resilient solutions. Furthermore, the public sector in Zambia plays a key role in the project via the National Agricultural Information Services (NAIS) -the source of all technical agronomic information that the consortium in Zambia intends to disseminate to farmers via mobile phone services during the cropping season. This creates synergies between on-going public services and upcoming private/academic initiatives, such as CTA's work to scale up CRS under discussion. Most importantly, the use of government-approved technical information ensures that farmers do not get conflicting extension service messages from different service providers."}]},{"head":"Unipolar Partnership Model: Malawi","index":6,"paragraphs":[{"index":1,"size":57,"text":"Project implementation in Malawi began in the last quarter of 2017. The processes that have thus far taken place have drawn lessons from the Zambian and Zimbabwean consortiums, as summarised in Table 25.2. As the partnership unfolds, there are some insights for consideration in Malawi listed below, particularly for the National Smallholder Farmers Association of Malawi (NASFAM):"},{"index":2,"size":180,"text":"(i) Beyond moral persuasion, the opportunity for continuous scaling up of CSA on a sustained basis increases when there are stakeholders who have well defined economic interests and a sound business case to engage in scaling up efforts (i.e., the private sector). (ii) Strong, vibrant partnerships require transparency, trust, shared influence and decision-making, mutual benefits (economic interests), commitment, recognition of partners' specialised roles and profit sharing. (iii) Champions are needed to rally the private sector to develop market-driven climate resilient solutions; the government to create an enabling environment; and the farming community to raise awareness of CSA benefits. Strategically placed individuals or institutions in the climate change/agriculture/food security nexus are best suited to act as champions. (iv) Using field based agricultural extension staff helps the case for scaling up climate resilient solutions. For this to be effective there is need to build capacity of the field staff in key technical areas related to CSA. In the case of NASFAM, this entails building the capacity of Association Field Officers in weather index insurance, drought tolerant seeds and ICT-enabled weather information services."}]},{"head":"Implications for Development","index":7,"paragraphs":[{"index":1,"size":51,"text":"The identification of the \"best partnership type\" for scaling up CSA in southern Africa is not yet conclusive, however some preliminary lessons for successful partnerships can be drawn: they must be inclusive and participatory, have clear mutual benefits, and ensure transparency in project operations. Other enabling factors needed for success include:"},{"index":2,"size":162,"text":"1. Private sector involvement: Bringing non-state actors on board effectively improves the chances of successfully scaling up proven innovations (such as CSA) in a sustainable manner. In Zimbabwe, farmers outside the ZFU project have access to similar innovations as the ZFU-EcoFarmer combo because Econet Wireless--as a private commercial entity--is working nationally. In Zambia, PICZ facilitates access to weather index insurance for farmers in the CTA project areas and nationally. Both the Zimbabwe and Zambia case studies show that bundled climate resilient solutions will be scaled up by the private sector provided they have commercial viability. 2. Strong and charismatic institutional leadership: this is key to galvanise others into action, and leverage financial incentives. 3. Financial incentives: key for private sector buy in and investment. 4. Make use of existing value chain innovations: partnerships must build on existing and successful mechanisms and processes (e.g., second-generation partnerships in Zimbabwe, engagement of Musika Development Initiatives after their successful implementation of the Vuna project in Zambia)."},{"index":3,"size":113,"text":"Beyond the lessons described here, further research is needed to critically assess the challenges associated with scaling up single solutions in relation to bundled solutions, and their impacts on the livelihoods of the poor in a changing climate. Additional research is also needed to better understand how partnerships can be flexible and adaptable in light of the dynamic nature of climate change, and to determine how to better provide clear evidence of a business case for the private sector to invest in scaling up climate resilient solutions. Additionally, action research is needed to monitor and evaluate the extent to which partnerships, such as those explored in this chapter, deliver results and achieve impact."}]}],"figures":[{"text":"Table 25  .1 Summary of country projects   .1 Summary of country projects Country Zimbabwe Zambia Malawi CountryZimbabweZambiaMalawi Project goal To contribute to climate resilient agrifood systems that improve food security, Project goalTo contribute to climate resilient agrifood systems that improve food security,  nutrition and income for smallholder farm households under climatic nutrition and income for smallholder farm households under climatic  uncertainties   uncertainties Beneficiaries 140,000 farmers (approximately 40% female) over 2 years in Zimbabwe Beneficiaries 140,000 farmers (approximately 40% female) over 2 years in Zimbabwe  (30,000) Zambia (60,000) and Malawi (50,000)  (30,000) Zambia (60,000) and Malawi (50,000) Regions Mashonaland West, Eastern, Central and Southern, Central RegionsMashonaland West,Eastern, Central andSouthern, Central  Masvingo, Midlands Southern Provinces and Northern Masvingo, MidlandsSouthern Provincesand Northern    Regions Regions Districts Chegulu, Makonde, Zvimba, Lundazi, Chipata, Nyimba, Zomba, Mchinji, DistrictsChegulu, Makonde, Zvimba,Lundazi, Chipata, Nyimba,Zomba, Mchinji,  Hurungwe, Chivi, Masvingo, Petauke, Chibombo, Nkhotakota, Hurungwe, Chivi, Masvingo,Petauke, Chibombo,Nkhotakota,  Zaka, Gokwe South, Mumbwa, Kapiri Mposhi, Ntchisi, Mzimba Zaka, Gokwe South,Mumbwa, Kapiri Mposhi,Ntchisi, Mzimba  Shurungwe, Kwekwe Serenje, Kalomo, Choma,  Shurungwe, KwekweSerenje, Kalomo, Choma,   Monze, Mazabuka  Monze, Mazabuka Key Zimbabwe Farmers Union Market facilitation: Weather based KeyZimbabwe Farmers UnionMarket facilitation:Weather based innovations (ZFU) EcoFarmer Combo: Better price negotiations index insurance innovations(ZFU) EcoFarmer Combo:Better price negotiationsindex insurance promoted A service bundle offering for farmers and links to  promotedA service bundle offeringfor farmers and links to  weather information seed producers, meat  weather informationseed producers, meat  (including advice for traders and processors to  (including advice fortraders and processors to  livestock farmers), smallholders, training  livestock farmers),smallholders, training  weather index insurance, agro-dealers in CSA to  weather index insurance,agro-dealers in CSA to  payment for ZFU enable them to provide  payment for ZFUenable them to provide  membership and funeral advice at point of sale  membership and funeraladvice at point of sale  cover   cover  Agronomic advisory Awareness campaigns ICT-enabled Agronomic advisoryAwareness campaignsICT-enabled  services via SMS for farmers to create weather services via SMSfor farmers to createweather   demand for drought information demand for droughtinformation   tolerant maize seed and services for tolerant maize seed andservices for   weather based index smallholder weather based indexsmallholder   insurance farmers insurancefarmers  Dial-a-Mudhumeni: A Agronomic and animal Drought tolerant Dial-a-Mudhumeni: AAgronomic and animalDrought tolerant  phone-in facility for crop husbandry training for maize seeds phone-in facility for crophusbandry training formaize seeds  and livestock farmers to Lead Farmers a  and livestock farmers toLead Farmers a  get extension advice Advisory services for  get extension adviceAdvisory services for   integrated crop-livestock  integrated crop-livestock   farming  farming Implementing Zimbabwe Farmers Union Zambia Open University, National ImplementingZimbabwe Farmers UnionZambia Open University,National partners (ZFU), Econet Wireless Musika Development Smallholder partners(ZFU), Econet WirelessMusika DevelopmentSmallholder   Initiatives, Professional Farmers Initiatives, ProfessionalFarmers   Insurance Company of Association of Insurance Company ofAssociation of   Zambia (PICZ) Malawi (NASFAM) Zambia (PICZ)Malawi (NASFAM)    (continued) (continued)  "},{"text":"Table 25 .  1 (continued)   1 (continued) Country Zimbabwe Zambia Malawi CountryZimbabweZambiaMalawi Other Public sector: Public sector: Ministry of Public sector: OtherPublic sector:Public sector: Ministry ofPublic sector: collaborating Meteorological Services Agriculture (MOA), Department of collaboratingMeteorological ServicesAgriculture (MOA),Department of partners Department (MSD), National Agricultural Climate Change partnersDepartment (MSD),National AgriculturalClimate Change  Government Extension Information Services and Meteorological Government ExtensionInformation Servicesand Meteorological  Service Department, (NAIS), MOA Block and Services (DCCMS) Service Department,(NAIS), MOA Block andServices (DCCMS)  Zimpost Camp Agricultural  ZimpostCamp Agricultural   Extension Officers  Extension Officers  Private sector: Seed Co, Private sector: Seed Private Sector: Private sector: Seed Co,Private sector: SeedPrivate Sector:  Pannar Seeds, Klein Karoo Companies NICO General Pannar Seeds, Klein KarooCompaniesNICO General  (K2) Seeds, Agriseeds,  Insurance Limited, (K2) Seeds, Agriseeds,Insurance Limited,  aWhere  Risk Shield aWhereRisk Shield    Consultants Consultants a    a  "}],"sieverID":"93c92a82-3443-41d9-850e-6962148fb7b7","abstract":""}

data/part_1/04218767a02c513aa0d0d056c3406507.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04218767a02c513aa0d0d056c3406507","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3764309c-430a-4344-a714-e9d13ec676b9/retrieve"},"pageCount":46,"title":"Tropical Forages: an interactive selection tool","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":11,"text":"• Make knowledge available to users in appropriate format (interpreted data)"},{"index":2,"size":7,"text":"• Link knowledge on plant adaptation to:"},{"index":3,"size":12,"text":"• Bibliography • Forage management information • Seed/planting material sources and availability"}]},{"head":"Methodology","index":2,"paragraphs":[{"index":1,"size":5,"text":"• Database design and maintenance"},{"index":2,"size":4,"text":"• Database linkages (FAO)"},{"index":3,"size":3,"text":"• Information sources"},{"index":4,"size":48,"text":"Putting it together -Development The ability to select and prioritize forages for specific niches and environments and for specific animal requirements is important to mitigate feed shortages and improve natural resource management as part of sustainable smallholder farming systems, which can help make agriculture more productive and competitive"},{"index":5,"size":92,"text":"New research has generated information on forage performance and use in a wide range of environments over the last ten years and its utility, usability and desirability could be greatly enhanced by updating and extending the information content Also the last ten years have seen quick advances in knowledge management and information technology, including the use of mobile devices and fast searching that could be employed in SoFT version 2.0. The linkage with complementary websites such as Feedipedia, Agroforestree, GRIN and Genesys will further improve end-user experience and knowledge dissemination about forages"}]},{"head":"Learnt Lessons","index":3,"paragraphs":[{"index":1,"size":50,"text":"Cuando nos alineamos a la teoría, que el verdadero motor de desarrollo de una economía no es el comercio, es la educación Cuando pensamos, no en publicar, sino en divulgar la información necesaria basada en las necesidades de los productores, lograremos casos exitosos de adopción y por tanto de impacto "}]}],"figures":[{"text":"Forage• Rapidly increasing demand for livestock products • Increased demand for forage • To supplement crop by-products • New forages in sown grasslands • Forages in cropping systems -large and small scale farmers • Forages for resource conservation The Status, Background • 50 years of detailed research on species and accession adaptation • Range of farming systems • Range of environments • Systems: Extensive, crop-livestock, cut and carry, agroforestry, erosion control, beef, dairy, fish • Accumulated knowledge difficult to harness • Adaptation studies being repeated • Investment priorities should be elsewhere Where are 50 years of knowledge? • Traditional and grey literature • Summarised info. (FAO and Prosea) • Personal knowledge • Specialist forage agronomists • National and international centres • Many retired Our aim, The Solutions • Need to value what we already know • Assemble knowledge • Develop selection tool • Updated fact sheets • Include elite accessions • Map climate adaptation "},{"text":"•• Workshops around the tropics • A team of experienced writers • Selection tool validation • Mapping adaptationOutputs• Selections of best options at the germplasm level -not just cultivars -but not nursery results• Appropriate bibliography• Information sheets• Best sources of planting material Research providers -information for a particular farming system in a particular environment• Development agencies• Seed companies and FarmersSoFT has been extensively used by researchers, extension workers, NGOs, farmers, and educational institutions around the world with an average of 220,000 visits per yearThe SoFT tool (Selection of Tropical Forages) has a user-friendly platform for producers, technicians and scientists "},{"text":" the theory that the real incentive for the development of an economy is not trade but education When we think not only about publishing, but about the dissemination of the necessary information based on the needs of producers, we get to achieve successful cases of adoption and therefore impact SoFT-A tool for targeting forages 15,629 pages visited average per month since launch in 2005 Revised version in 4 languages "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"a331bd73-0a15-4bf5-9f41-70ec4d68b44c","abstract":""}

data/part_1/04220d43c815eacae7b94604f559dbbe.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04220d43c815eacae7b94604f559dbbe","source":"gardian_index","url":"https://www.cifor.org/publications/pdf_files/FTA/FTA-Highlights-2.pdf"},"pageCount":42,"title":"Tree Seed and Seedling Systems for Resilience and Productivity FTA HIGHLIGHTS OF A DECADE","keywords":[],"chapters":[{"head":"Executive summary","index":1,"paragraphs":[{"index":1,"size":385,"text":"The work of the CGIAR Research Program on Forests, Trees and Agroforestry (FTA) on tree seed systems -the authors' shorthand for the means through which growers obtain access to tree-planting materials, either seeds or seedlings -has sought to address significant constraints in the diversity and genetic quality of the tree seeds and seedlings that are being supplied. These concerns are exacerbated by an increase in demand for germplasm to meet huge global forest landscape restoration commitments and other tree-planting targets. Over the last decade, FTA has worked on twin concerns in this regard: first, how to make available quality tree-planting material; and second, how to ensure that tree seeds and seedlings are planted in the right places for the right purposes. It has addressed availability through building stakeholder partnerships and model tree seed systems; delivering improved \"orphan\" (under-researched) tree crops through supporting breeding and its impact; mainstreaming food trees through nurseries; conserving and making available diverse tree germplasm to support delivery and use; and developing policies to support the effective supply of tree seeds and seedlings. It has supported better decision making through building information platforms to support tree-planting choices and tree seed system operations; designing maps to guide tree seed and seedling distribution that is suited to current and predicted future climatic conditions; and releasing statistical packages to guide appropriate tree planting and assess the impacts of this planting in terms of benefits such as additional carbon sequestered and extra soil protected. This work is the foundation of local and global economic and environmental benefits of huge significance. It supports climate change mitigation and adaptation, restores landscapes and conserves biodiversity, and provides healthy foods and other products for local and global communities. This publication focuses on FTA's work in these areas. Future directions for work identified include a closer analysis of the relative importance of supplyside versus demand-side measures for mainstreaming improved tree genetic materials by growers; working with investors to improve tree seed quality at the project design stage of tree-planting programmes; and scaling up existing tree seed systems experience to burgeoning forest landscape restoration and broader tree planting initiatives. This scaling up will involve further engagement with major global initiatives such as the Bonn Challenge, the UN Decade on Ecosystem Restoration 2021-2030, and the Global Plan of Action on Forest Genetic Resources."}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":254,"text":"Tree seed systems -as defined in Box 1 and the authors' shorthand for the sourcing of both tree seeds and seedlings for planting purposes -are the starting point from which farmers, foresters and others are able to grow trees. These systems have been a major topic of work by the CGIAR Research Program on Forests, Trees and Agroforestry (FTA) in the last decade because of the current constraints faced by growers in obtaining tree-planting material of good quality (Nyoka et al. 2015b). Even when quality tree seeds are available for planting, growers do not always know or fully consider what trees to plant, and where, so that they are effectively matched to planting environments and purposes (Cernansky 2018). It is common for inappropriate tree species or seeds or seedlings with unsuitable provenance (particular origin) to be planted, often with a few exotic species being used rather than a broader mix of more appropriate indigenous and exotic trees (Thomas et al. 2014;Jalonen et al. 2018;Roshetko et al. 2018). This lack of attention to what is planted, and the ecological havoc this may cause, is a topic discussed globally by societies who are rightly and increasingly questioning the effectiveness of current 'restoration' practices (e.g. see the criticisms in popular media such as Williams 2020 and Jones 2021, and the more scientific but still broadly accessible critical viewpoint of Fleischman et al. 2020). For more information about work on forest and landscape restoration conducted within FTA, see Highlight No. 4 in this series (Guariguata et al. 2021)."},{"index":2,"size":119,"text":"In the last decade, FTA scientists have brought these deficiencies in tree seed sourcing to the attention of forest landscape restoration practitioners and the wider tree planting community. A recent comment piece in the journal Science, for example, took up this topic after interviews with FTA researchers (Cernansky 2021). The article explains how the struggle to make headway in the African Union's Great Green Wall restoration initiative (GGW 2021) is in part due to problems in tree seed sourcing. FTA scientists quoted in the piece elaborated on the problems faced, and how, unfortunately, the costs of poor tree seed sourcing are borne mostly by the planters who establish and grow the trees, not the planners who design the interventions."}]},{"head":"Potting of a seed","index":3,"paragraphs":[]},{"head":"Photo by Patrick Shepherd/CIFOR","index":4,"paragraphs":[{"index":1,"size":130,"text":"The problem of tree seed sourcing is becoming ever more acute due to the increased demand for seeds to meet now-massive global commitments to forest landscape restoration and other tree planting initiatives. Coincident with the beginning of the FTA program in 2011, for example, the Bonn Challenge (Bonn Challenge 2021) seeks to bring 350 million ha of degraded and deforested landscapes globally into restoration by 2030, through a combination of facilitated natural regeneration and planting (often tree planting). The United Nations considers such restoration as a key challenge for the next 10 years, and has thus designated the decade of 2021 to 2030 as the UN Decade on Ecosystem Restoration (UN 2021); although this is obviously a welcome development, it also further illustrates how overstretched current tree seed systems are."},{"index":2,"size":166,"text":"Responding to these restoration initiatives and the recent greater focus on accountability in how tree planting is done (Holl and Brancalion 2020;Di Sacco et al. 2021) provides new opportunities for bringing about the necessary improvements in tree seed sourcing practices. Over the last decade, FTA has positioned itself to take advantage of these opportunities for the benefit of growers' livelihoods and to provide more effective nature-based solutions to environmental problems, including climate change. FTA's work, as described in the current Highlight, seeks to address twin concerns in this regard: first, how to make available quality tree planting material through appropriate partnerships, supply models, linked conservation strategies, policies, and the like; and second, how to ensure that tree seeds and seedlings are planted in the right places for the right purposes through building and disseminating decisionsupport tools. Information on conservation strategies that support seed supply can be found in Highlight 3 in this series on conservation of tree biodiversity and sustainable forest management (Vinceti et al. 2021)."},{"index":3,"size":181,"text":"The importance of addressing the above two concerns can hardly be overemphasized. It has been estimated that natural climate solutions, for example, could provide over one-third of the cost-effective climate mitigation needed between now and 2030 to stabilize planetary warming to below 2 o C (Griscom et al. 2017), and at the same time provide benefits to economies, biodiversity and human health (Rosenstock et al. 2019). These solutions would involve reforestation of up to 0.7 billion ha of land, with better tree plantations and more trees in agricultural lands on an additional similar area of land (Griscom et al. 2017), together representing 10% or more of the global terrestrial surface. Provided these twin concerns are met, along with the implementation of other principles of good restoration practice (Di Sacco et al. 2021), the ecological havoc that may be caused by inappropriate 'restoration' can be avoided and genuine restoration can be achieved (Girardin et al. 2021). This would better support the goals of the Bonn Challenge and the UN Decade on Ecosystem Restoration, and provide support for other global and regional initiatives."},{"index":4,"size":8,"text":"Tree nursery in the village of Romee, DRC."},{"index":5,"size":70,"text":"Photo by Axel Fassio/CIFOR Box 1. Defining tree seed systems and understanding their importance A tree seed system is the way that actors organize the collection and distribution of tree seeds and seedlings, from seed collection to the growers' planting of seedlings. The system can involve uncoordinated ad hoc collection of seeds from whatever sources are available or the coordinated collection of quality seeds. A well-organized system encompasses several elements:"},{"index":6,"size":83,"text":"• the basic practices of tree seeds' and seedlings' production, including the establishment and maintenance of seed sources; • the processing and storage of seeds and the nursery propagation of seedlings; • the distribution of seeds and seedlings to growers, with guidance on use and on the approaches needed to monitor and report on their performance; • the roles, relationships and responsibilities of the various stakeholders who are involved in seed and seedling supply; • the regulatory aspects of seed and seedling quality."},{"index":7,"size":53,"text":"Seed sources -which are an integral part of the system -include forests, farmland, plantations, seed orchards and \"clonal\" mother blocks (these blocks are propagated as cuttings and scions rather than as seed, and are often used for the propagation of fruit trees; see Lillesø et al. 2011 for more on all these sources)."},{"index":8,"size":172,"text":"Tree seed systems can be \"formal,\" composed of public and private organizations with specialized or designated roles in production, distribution or regulation; or \"informal,\" made up of private households, farmers and NGOs sharing material with each other. Most formal systems have focused on enhancing productivity, but they often suffer from the shortcomings of focusing on a few (often exotic) plantation tree species. Formal systems often are also not very accessible to smallholder tree growers. Informal systems provide a broad range of products and services, and more easily reach growers, but they often rely on tree seeds of low quality. Neither formal nor informal approaches are currently meeting the need for a broad mix of tree species for planting that is well matched to planting sites and planting purposes, or for addressing both livelihood goals and environmental requirements, which are intensified by climate change. Growers often end up planting whatever tree seeds and seedlings they can find, regardless of how suboptimal -and they are often highly suboptimal -they are (Graudal and Lillesø 2007)."}]},{"head":"Box 1. Defining tree seed systems and understanding their importance","index":5,"paragraphs":[{"index":1,"size":63,"text":"Addressing the supply bottleneck is a key challenge to current global forest landscape restoration programmes becoming successful (Kettle et al. 2020). To improve the current situation, it is necessary to realize the potential of many more rural organizations, small-scale private nurseries and local communities to effectively participate in tree seed systems, integrating formal and informal approaches to ensure supply (Lillesø et al. 2018)."},{"index":2,"size":80,"text":"To help drive improvements in tree seed systems, FTA scientists have undertaken ex ante assessments of the benefits of good tree seed sourcing practice from both an economic and environmental perspective. For example, recent preliminary work, using a very simple bottom-up cost model, showed that the savings from better seedling establishment rates far surpassed the extra expense of quality tree seed sourcing in restoration programmes (Nef et al. 2021). This was because higher survival after out-planting reduced seedling replacement costs."},{"index":3,"size":152,"text":"More advanced calculations indicate that modest investments to improve tree seed and seedling genetic quality will have significant quantifiable livelihood and environmental benefits. Estimates based on African Forest Landscape Restoration Initiative (AFR100) activities, for example, suggested that an extra cost per tree seedling of less than 5% invested in improving genetic quality, under modest assumptions of uptake in the use of improved planting materials, would generate more than USD 5 billion of additional income for tree growers (Lillesø et al. 2021). The same authors indicated that it could also sequester 19 million more tonnes of carbon every year, and annually save 4 million tonnes more of soil from erosion. As indicated in this Highlight publication, FTA scientists have spent considerable effort developing ways to evaluate tree seed systems in order to understand how they can be improved to better address carbon sequestration, soil erosion and other concerns, and bring greater economic benefits."}]},{"head":"Improving the availability of quality tree seed","index":6,"paragraphs":[{"index":1,"size":86,"text":"To upgrade tree seed systems, FTA facilitates partnerships between publicand private-sector (and formal and informal) stakeholders, and supports their innovation. It does this while engaging directly in a range of practical programmes that seek to deliver quality tree planting material at scale. The broad FTA approach to tree seed system development is being applied in Africa, Asia and Latin America, for a range of tree species that provide timber, fruit, fodder and green fertilizer. The examples presented below are designed to be replicated for wider scaling."}]},{"head":"Building stakeholder partnerships and model tree seed systems","index":7,"paragraphs":[{"index":1,"size":123,"text":"A good example of the application of the FTA approach is the ongoing Provision of Adequate Tree Seed Portfolios (PATSPO) project, implemented by ICRAF with the University of Copenhagen and Ethiopian partners (ICRAF 2021b). This project started in 2017 and has focused on improving tree seed sourcing to support Ethiopia's forest landscape restoration targets, which are the most ambitious of any country in the African Forest Landscape Restoration Initiative (AFR100 2021). The need to improve tree seed sourcing in Ethiopia was identified during earlier restoration activities, which were hampered by the lack of an efficient network for supplying tree planting material, and by the low quality and limited diversity of the tree seeds that were available (Dedefo et al. 2017;Tadesse et al. 2020)."},{"index":2,"size":118,"text":"PATSPO has identified stakeholders in the Ethiopian tree seed sector, promoted collaboration among them, and built their capacity. It has also established breeding seedling orchards (BSOs) to supply quality tree seed; identified and registered other quality natural and planted sources of tree seed; and used low-input \"diversity breeding\" methods (i.e. methods designed to provide tree types that support both livelihood and environmental goals; see Graudal et al. 2021) to supply appropriate planting material. PATSPO has so far trained more than 1,000 stakeholders in tree seed collection and procurement methods; established 26 BSOs of 13 trees prioritized by communities and government in 10 different locations; and described and registered more than 100 existing seed sources of mostly indigenous trees."},{"index":3,"size":63,"text":"Although it is too early to fully evaluate how effective PATSPO will be in improving the quality of the trees planted in Ethiopia, it has worked closely with the Ethiopian government to develop policies to support the involvement of the private and informal sectors in tree seed supply. FTA scientists' work has shown that this is important for delivering impact (see section 2.5)."},{"index":4,"size":52,"text":"Separately, but related to PATSPO, and under the umbrella of FTA, the International Bamboo and Rattan Organisation has developed collection and processing protocols for sourcing Ethiopian highland and lowland bamboo seeds that are also important for supporting landscape restoration activities in the country, but are not easily accessible to planters (Mulatu 2021)."}]},{"head":"Cordia africana BSO at Sekelemariam, Amhara Region","index":8,"paragraphs":[{"index":1,"size":5,"text":"Photo by Eyob Getahun/ PATSPO"}]},{"head":"Delivering improved orphan tree crops through supporting breeding pathways","index":9,"paragraphs":[{"index":1,"size":257,"text":"Orphan crops -so called because they were under-researched in the past in terms of their genetic improvement and the marketing of their useoften lack seed supply capacity (McMullin et al. 2021). The African Orphan Crops Consortium (Jamnadass et al. 2020), which has involved ICRAF as a major partner since being established in 2011, is concerned with addressing production gaps for 101 lesser-used food crops that have high potential for addressing nutritional deficiencies in Africa (AOCC 2021). Specifically, the consortium develops genetic tools for the orphan crops, and sequences representative panels of varieties, genotypes, etc., to explore available genetic diversity (Hendre et al. 2019). Almost half of the plants on the AOCC action list are naturalized or indigenous food trees. This work is connected to improved seed delivery through the African Plant Breeding Academy 1 (AfPBA 2021), which trains, mentors and empowers Africa's plant breeders to employ state-of-the-art approaches in their breeding work. By the end of 2020, the academy had 114 graduated alumni from 27 African nations. Collectively, these graduates were undertaking breeding work on more than 100 different crops, comprised of a mix of annual and perennial species (Jamnadass et al. 2020). AfPBA alumni conceived and helped establish the African Plant Breeders Association (APBA) for the continued professional development of plant breeders on the continent. At its inaugural meeting in Ghana in 2019, there were more than 400 participants. Measuring the impact of AOCC and AfPBA on the ground, in terms of delivering improved tree types to growers, will be a future activity of the consortium. "}]},{"head":"Mainstreaming food trees through nurseries","index":10,"paragraphs":[{"index":1,"size":84,"text":"In principle, delivering planting material for a diversity of food trees to (potential) growers should improve rural communities' diets if they consume the foods, and should benefit local livelihoods (Lagneaux et al. 2021). For more information about work on food security and nutrition conducted within FTA, see Highlight No. 5 in this series (Ickowitz et al. 2021). The current Highlight illustrates by the examples below that there are good opportunities for scaling up food tree seedling supply with appropriate nursery support and related strategies."},{"index":2,"size":127,"text":"One approach applied by FTA researchers to facilitate the availability and use of tree foods is to design \"fruit tree portfolios\" of suitable tree species that, combined with other plant foods, supply required nutrients yearround; the supply of seedlings of the trees is then supported through nursery development and other measures (McMullin et al. 2019). The design of portfolios is covered in FTA Highlight No. 5; but, in brief, it involves working with local communities to determine a recommended list of tree foods whose increased production, complementing other foods, would help fill nutrient gaps in food consumption calendars. The recommended tree foods generally come from a mix of exotic and indigenous species, the seedlings of which are made available through local tree nurseries established by farmer groups,"}]},{"head":"Rural resource centre (RRC)","index":11,"paragraphs":[{"index":1,"size":40,"text":"Photo by Regreening Africa Project/ICRAF nursery businesses and schools (McMullin et al. 2020;IFAD 2021). In the last decade, such portfolios have been developed for 17 locations in East Africa, and the methods involved are now being expanded to other regions."},{"index":2,"size":57,"text":"Pilot projects in Kenya, Uganda and Ethiopia that scale up the portfolio approach have reached 6,000 farmers with training and supplied 1,800 smallholder households with a diversity of portfolio trees' seedlings. In Kenya, work with the Kenya Agricultural and Livestock Research Organization has embraced the trials, propagation and distribution of 15 of the prioritized food tree species."},{"index":3,"size":160,"text":"The rural resource centre (RRC) is another approach that FTA researchers have developed to supply food tree seedlings. RRCs are designed to instruct people in tree propagation, farm management and other skills; and to provide processing facilities, business training and a venue where group associations can meet to market tree products and obtain farm services (Takoutsing et al. 2014;Degrande et al. 2015). Hundreds of thousands of vegetatively propagated seedlings of a diverse range of fruit trees have been distributed in Central and West Africa through RRCs and their decentralized satellite nurseries, and at the same time producers have been linked to markets (Asaah et al. 2011). The approach has been used to diversify cocoa and other production systems in order to supply quality foods, sequester carbon, build resilience and take pressure off natural forest resources. Important positive impacts have been achieved for local communities in terms of income, education, youth and women's empowerment, and health, among other benefits (Leakey 2020)."},{"index":4,"size":140,"text":"FTA's tree nursery work in Viet Nam, carried out in conjunction with government-led land restoration initiatives, has also supported the scaling up of food tree seedling delivery. In this case, there has been an emphasis on the promotion of the indigenous son tra fruit tree (H'mong apple, Docynia indica). The work started with genetic improvement and propagation method development for the species, then extended to farm-based demonstration trials. More than 1,000 participants were taught about contextappropriate agroforestry systems, son tra propagation techniques, the management of on-farm tree nurseries, and value chain development (Tiep et al. 2018). Between 2016 and 2020, more than 3,000 ha of existing son tra stands were rehabilitated in Viet Nam through the use of better germplasm, while more than 6,000 ha of degraded land were planted with the fruit tree in the country's Yen Bai Province."},{"index":5,"size":109,"text":"The \"nurseries of excellence\" (NOEL) approach that FTA scientists have applied in Indonesia has also provided farmers with the skills and infrastructure they need to implement quality seedling delivery systems for the food trees they have prioritized. The NOEL approach trains farmer leaders and farmer groups in tree nursery establishment and management, agroforestry management and market integration (Roshetko et al. 2013). In a single project that ran between 2011 and 2016, more than 300 group and individual nurseries on Sulawesi were established by farmer partners with the help of the approach. These nurseries produced more than two million quality seedlings of over 50 tree species (Roshetko et al. 2017)."}]},{"head":"Conserving diverse tree germplasm to support delivery and use","index":12,"paragraphs":[{"index":1,"size":154,"text":"Fundamental to supporting the availability of quality tree seeds to growers is that approaches are in place to conserve tree genetic resources. At ICRAF, this is an important function of the Genetic Resources Unit (GRU). The unit conserves tree genetic resources, both as seeds in its seed genebanks and as seedlings in the field genebanks it maintains with its partners. GRU's tree seed genebank in Nairobi is one of the world's most comprehensive tree seed collections that is being actively used to improve tropical tree planting; by the end of 2020 it contained 190 tree species. GRU's field genebanks, located in Africa, Asia and Latin America (see Figure 1), now feature more than 80 tree species maintained along with partners (ICRAF 2021a). These latter genebanks are particularly important for the conservation of those tree species whose seeds do not store well in seed genebanks (because the seeds die when they are dried and/or cooled)."}]},{"head":"MAP","index":13,"paragraphs":[]},{"head":"Figure 1.","index":14,"paragraphs":[{"index":1,"size":206,"text":"Map showing where ICRAF -partner field genebanks are located and where collections of tree species in the ICRAF seed genebank originated. Note: As indicated in the key, the red circles show countries where field genebanks are situated and maintained with partners, and the number of species that they contain. The key also shows the number of species in the seed genebank in Nairobi known to be sampled from a particular country. Field genebanks not only have a conservation function, but are direct sources of propagules for planting. They are also observed by researchers and planters to understand more about the reproductive biology and genetic diversity of the trees, and so that they can choose the best planting material for specific locations and planting purposes (e.g. Nyoka et al. 2015a;Tiep et al. 2018). The breeding seedling orchards of the PATSPO initiative described earlier are examples of tree stands that fulfil the multiple purposes of conservation, evaluation and seed supply. For most of GRU's seed and field collections, multiple accessions are held (over 20,000 in all), so that extensive genetic variation within each tree species is retained. In the last six years, GRU has supplied more than 5,000 seed samples to users, including researchers, breeders and development practitioners."}]},{"head":"Number of species in live genebanks","index":15,"paragraphs":[{"index":1,"size":68,"text":"The CATIE Forest Seed Bank (Banco de semillas forestales, or BSF) in Costa Rica is a self-sustaining commercial facility that multiplies and distributes quality seeds of (forest) tree species. It keeps 50 species in stock. Each year it reaches more than 170 clients in 20 countries, with seeds that come from its own collections, from other seed banks in the region, or from other selected sources (BSF 2021)."}]},{"head":"Developing policies to support effective tree seed systems","index":16,"paragraphs":[{"index":1,"size":115,"text":"An important part of FTA's work has been to engage with national partners to help develop policies that support more effective integrated tree seed systems. This work begins by assessing, in detail, a country's existing tree seed systems, to identify bottlenecks in seed supply. In work led by Bioversity International, FTA has developed a set of indicators for this purpose, and has applied them in seven countries in Latin America. These allow the countries to identify priorities for practical steps and policy areas to strengthen their national tree seed systems (Atkinson et al. 2021). This analysis indicated opportunities for horizontal learning between countries from successful approaches, which point to the importance of active stakeholder engagement"}]},{"head":"Juniperus procera BSO at Yerba, Amhara Region","index":17,"paragraphs":[{"index":1,"size":32,"text":"Photo by Eyob Getahun / PATSPO and incentive schemes. The same set of indicators is now being applied in western Africa and southeast Asia to help people understand tree seed systems there."},{"index":2,"size":100,"text":"In further recent work FTA researchers developed a dynamic system approach to understand the interrelated problems that constrain the supply of good quality and site-adapted tree seeds, and applied it in Burkina Faso and the Philippines (Valette et al. 2020). Their analysis indicated that emerging options to strengthen tree seed systems for successful forest landscape restoration in those countries included better tailoring interventions to address the local context; aligning government and NGO interventions; and complementing the enforcement of regulations with strengthening the capacities of tree nurseries to produce high-quality planting material and the capacities of local institutions in resource management."},{"index":3,"size":174,"text":"In other work, with the University of Copenhagen, FTA researchers have shown that, although each country has its specific features, there are three basic prevailing models of tree seed supply: the government model, the NGO model and the decentralized model (Lillesø et al. 2011). FTA research has shown that the decentralized model, involving community-based tree seed and seedling multiplication and delivery, is most likely to be successful in sustainably improving seed quality. However, analysis has indicated that community entrepreneurs are significantly disadvantaged by the many NGOs (practising the NGO model of supply) who distribute tree seeds and seedlings to growers without requiring payment, and who thus depress the ability to create a functioning market. The involvement of entrepreneurs in tree seed systems is also discouraged by parastatal suppliers such as national tree seed centres, practising the government model of supply. Those suppliers enjoy an inbuilt competitive advantage in selling tree seeds and seedlings in cases where they also have a government-assigned role in regulating the quality of supply across the sector as a whole."},{"index":4,"size":234,"text":"Based on the analysis of Lillesø et al. (2011) and other similar research, FTA's policy work therefore has been directed to changing the roles of NGOs and parastatals to become more supportive of entrepreneurial suppliers of tree seed. This includes developing policy measures that encourage NGOs to provide business training and networking support to entrepreneurial suppliers of tree seeds and seedlings, and that discourage NGOs' direct involvement in supply; and measures that facilitate national tree seed centres to provide technical support and quality initial seed to entrepreneurs in seed provision, and that exclude these centres from having both productive and normative (regulatory) functions (Lillesø et al. 2018). This reorientation of roles is an important aspect of the integrated seed system development approach that the authors of the current Highlight piece have designed (Lillesø et al. 2021). This approach builds on previous work on implementing integrated seed systems for annual crops by considering the unique features of trees. These features include usually being field planted as seedlings rather than as seeds, high multiplication rates, and (generally) lengthy juvenile periods. As might be expected, however, the appropriate roles for different stakeholders in tree seed systems are not always as described above, so a dogmatic approach is not advisable. In Latin America, for example, modelling has indicated that additional approaches based on direct subsidies are needed to meet the requirements of restoration programmes (Cornelius and Miccolis 2018)."}]},{"head":"Hagenia abyssinica BSO at Suba, Oromia","index":18,"paragraphs":[{"index":1,"size":4,"text":"Photo by Abayheh Derero/EEFRI"}]},{"head":"Supporting better decision making in what to plant where and for what purpose","index":19,"paragraphs":[{"index":1,"size":53,"text":"In the last decade, to address knowledge gaps in understanding what trees to plant where, and for what purpose, FTA researchers have developed a wide range of decision-support tools. These inform more optimal planting choices that better support livelihoods and ecosystem service provision, and link tree growers with appropriate sources of planting material."}]},{"head":"Building information platforms to support planting choice and seed system operation","index":20,"paragraphs":[{"index":1,"size":123,"text":"In recent years, FTA scientists have focused on bringing existing knowledge resources together onto online platforms that provide easy access to a broad range of decision-support information. These platforms provide information on selecting trees for planting, and on how to better carry out the practices of seed collection, seed production, seed supply, tree establishment, and other procedures. One example is the Agroforestry Species Switchboard (Kindt et al. 2019), which provides access to more than 50 different webbased information sources on trees and other plants. Its particular objective is to provide information that supports both research on trees and tree-based development activities; the current version (2.0) of the switchboard provides information on more than 172,000 plant species, from across the tropics and more widely."},{"index":2,"size":283,"text":"Another resource is the Global Tree Knowledge Platform (GTKP) (Kindt et al. 2021a) that was released in 2021 and was one of the 50 innovation highlights showcased by CGIAR@50. 2 This platform contains a range of tree knowledge products that are relevant to the tropics and globally. The individual are grouped by resource type and subject area, and are designed to ensure that the right tree is planted in the right place. The platform provides access to many still-relevant older resources to guide tree seed sourcing that were developed by ICRAF and its partners, as well as new materials. Older resources include the Tree Seeds for Farmers toolkit (Kindt et al. 2006), remains a crucial practical manual for sourcing tree seeds and seedlings by and with local communities in tropical nations. Another resource available from the GTKP is Agroforestry Tree Domestication Primer (Dawson et al. 2012). It explains the various steps involved in bringing into cultivation, including how to set priorities for which tree species to plant, how to carry out participatory tree domestication, and how to source quality planting material. The primer has been downloaded more than 50,000 times. third platform, also released in 2021, is the Resources for Tree Planting Platform (RTPP) (Schmidt et al. 2021) that was built by the University of Copenhagen with ICRAF as part of the PATSPO The RTPP, which contains more than 200 individual resources from around the world, focuses specifically on tree seed system development, including practical \"how to\" guidelines and advice on tree seed programme design. includes many resources from the University of Copenhagen's back catalogue of publications on the topic that are newly relevant based on the recent expansion in treeglobal restoration efforts."},{"index":3,"size":2,"text":"2 https://www.cgiar.org/cgiar-at-50/"}]},{"head":"TREE DATABASES","index":21,"paragraphs":[]},{"head":"MAPS & APPS","index":22,"paragraphs":[]},{"head":"GUIDELINES ANALYSIS PACKAGES","index":23,"paragraphs":[{"index":1,"size":36,"text":"The online Global Tree Knowledge Platform contains a wide range of tree knowledge products that are organized by resource type, as shown at the entrance to the Platform (resources are also separately organized by subject area)."}]},{"head":"Designing maps to guide appropriate planting under current and future climates","index":24,"paragraphs":[{"index":1,"size":96,"text":"An important resource, developed by FTA in conjunction with the University of Copenhagen and national African partners, is the vegetationmap4Africa (V4A) (van Breugel et al. 2015). The map, which took several years to develop, provides a high-resolution view of the different vegetation types of eight countries in eastern Africa and is complemented by a species selection tool for deciding what trees to plant where (Kindt et al. 2015). The documentation for V4A includes various characteristics of the different vegetation types, and information on thousands of useful tree species; it has been downloaded more than 40,000 times."},{"index":2,"size":117,"text":"Another map-based resource developed by FTA scientists, led by Bioversity International, is the Diversity for Restoration tool (D4R), which currently covers the countries of Colombia, Peru, Ecuador, Burkina Faso and Cameroon (Thomas et al. 2017;Fremout et al. 2021b). This tool guides practitioners on tree species and seed selection for restoration use and wider tree planting efforts under current climate conditions and potential future climates. The tool uses information on geographic distributions and functional traits, and covers hundreds of tree species.  Fremout et al. 2020Fremout et al. , 2021a)). For more information about work on adaptation to climate change with forests, trees and agroforestry conducted within FTA, see Highlight No. 12 in this series (Meybeck et al. 2021)."},{"index":3,"size":18,"text":"Section of V4A map and a suitability map showing different colors based the vegetation close to Lake Victoria."},{"index":4,"size":4,"text":"Snapshot taken http://maps.vegetationmap4africa.org/ ea_pnv.html"}]},{"head":"Statistical packages to support appropriate tree planting","index":25,"paragraphs":[{"index":1,"size":108,"text":"FTA scientists' open-access analysis packages also support adaptive tree seed sourcing. BiodiversityR, for example, a package that ICRAF originally released in 2005 to provide a range of methods for statistically analyzing tree species' diversity (Kindt and Coe 2005), now includes methods for ensemble species suitability modelling in current and potential future climates. These methods were first added to the package in 2012 and have been updated since then (Kindt 2018). A more recent analysis package that ICRAF developed, called AlleleShift, explores changes in the distribution of genetic markers associated with climate change and helps to select tree seed sources that are matched to new environmental conditions (Kindt 2021)."},{"index":2,"size":58,"text":"These statistical tools allow growers and researchers to think into the future to the environmental conditions that will prevail when trees come into their full maturity in terms of the products and ecosystem services they provide. Trees with their long lifetimes are unique plants from this perspective, with planning needed to account for future conditions -often decades away."},{"index":3,"size":61,"text":"The approach of developing climate-appropriate portfolios of tree diversity for productive and resilient landscapes and livelihoods uses eco-geographic data as a surrogate for genetic variation in tree species, as for a broad range of tree species it is not possible to look directly at diversity in each one (Graudal et al. 2014). The authors of the current Highlight piece have therefore"},{"index":4,"size":6,"text":"Planting avocado trees in Yanonge -DRC."},{"index":5,"size":38,"text":"Photo by Axel Fassio/CIFOR explored whether the use of such surrogates is justified; they found it to be so, at least when tested through a meta-analysis of tree genetic variation studies in East Africa (Dawson et al. 2017)."},{"index":6,"size":99,"text":"FTA researchers have also developed statistical tools that can be used to assess the impacts of using better quality tree planting material in forest landscape restoration. These tools measure the additional carbon sequestered, the extra soil protected, and other benefits, compared to the incurred costs (Pedercini et al. 2021). The same tools allow users to determine the geographic areas that are priorities for landscape restoration, and where tree seed system infrastructure therefore needs to be built. The same authors (ibid.) demonstrated for Ethiopia a multi-indicator approach that has an advantage compared to previous prioritization methods in its broad applicability."},{"index":7,"size":14,"text":"Holding a Gnetum (okok) plant in the village of Minwoho, Lekié, Center Region, Cameroon."},{"index":8,"size":4,"text":"Photo by Ollivier Girard/CIFOR"}]},{"head":"Future directions","index":26,"paragraphs":[{"index":1,"size":159,"text":"Recently, FTA scientists have begun to explore the relative success of supplyside versus demand-side measures for mainstreaming improved genetic materials of trees and other plants. For example, a paper published earlier this year reviewed the literature, surveyed production data, and questioned stakeholders to understand the success factors for adoption of annual orphan crops in Africa (McMullin et al. 2021). This work has not yet been extended to orphan tree foods, because there are insufficient intervention case studies recorded in the literature to date to assess the situation properly (using the same methodology). The analysis of annuals showed that both productionoriented (including seed supply) and consumption-oriented (including nutritional education) interventions were frequently mentioned success factors, and it seems likely that the same would apply to orphan tree crops. A gap in testing for both annuals and perennials, however, is the absence of evaluation of the simultaneous effects of both production-and consumptionbased interventions, so information on their relative importance is limited."},{"index":2,"size":41,"text":"It is therefore recommended that future work to improve tree seed quality should evaluate both supply-and demand-side interventions together, where production and the market are seen as two parts of a single, extended and integrated value chain (Lillesø et al. 2021)."},{"index":3,"size":155,"text":"The above text provides options both for addressing the availability of tree seeds and for their better use. Recently, the authors have been exploring interventions that may help better combine these aspects, including implementing tree seed sourcing standards at the design stage of tree planting projects. This concept is based on discussions of possible solutions to address poor tree seed sourcing practices that took place during the September 2020 online event Can tree planting save our planet? The event, which involved almost 5,000 participants, was organized by CIFOR and ICRAF in collaboration with the Global Landscapes Forum. 3 The concept would require applicants asking for funding from investors to support their tree planting to explain their tree seed sourcing strategy as part of a project proposal design template. An evaluation by potential investors of the effectiveness of this strategy for realizing high seed quality would then help determine whether the project proposal should receive funding."},{"index":4,"size":53,"text":"The authors are currently in discussion with planters, researchers and investors within the global forest landscape restoration community to understand whether this could be an effective approach to improve restoration outcomes. Initial dialogue suggests that there is indeed potential to work with investors to improve tree seed quality at the project design stage."},{"index":5,"size":92,"text":"From a practical rather than research perspective, the primary challenge for the coming years will be to scale up the experience already gained in tree seed systems to the world's increasing forest landscape restoration commitments and to its broader tree planting initiatives, particularly through on-the-ground examples of appropriate tree seed system development and policymaker engagement. Such upscaling will provide enormous benefits in terms of climate change mitigation and adaptation, in the restoration of landscapes and conservation of biodiversity, and in the provision of healthy foods and other tree products that support livelihoods.  "}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Scaling up will involve further engagement with major global initiatives such as the Bonn Challenge (2021), the UN Decade on Ecosystem Restoration 2021-2030 (UN 2021), and the Global Plan of Action (GPA) for the Conservation, Sustainable Use and Development of Forest Genetic Resources (FAO 2014a), among others. The GPA was based on the landmark State of the World's Forest Genetic Resources, published in 2014(FAO 2014b), in which FTA scientists were very active in their contributions. FTA's work on tree seed systems addresses all four of the priority areas for action identified in the GPA: 1) access to knowledge; 2) in situ and ex situ conservation; 3) sustainable use and management; and 4) policies, institutions and capacity building. Thus, it also needs to be incorporated into the national plans of action of individual countries that are based on the GPA.Over the last decade, the CGIAR Program on Forests, Trees and Agroforestry (FTA) has undertaken innovative basic and applied research across different scientific disciplines on tree seed systems. FTA's work supports climate change mitigation and adaptation, restores landscapes and conserves biodiversity, and provides healthy foods and other products for local and global communities. This publication presents key FTA outputs on seeds and seed systems from 2011 to 2021.  "}],"sieverID":"624bcc58-c122-4862-91c4-33f879bccaa4","abstract":"This publication is part of a series that highlights the main findings, results and achievements of the CGIAR Research Program on Forests, Trees and Agroforestry (FTA), from 2011 to 2021 (see full list of chapters on the last page).FTA, the world's largest research for development partnership on forests, trees and agroforestry, started in 2011. FTA gathers partners that work across a range of projects and initiatives, organized around a set of operational priorities. Such research was funded by multiple sources: CGIAR funders through program-level funding, and funders of bilateral projects attached to the programme, undertaken by one or several of its partners. Overall this represented an effort of about 850 million USD over a decade.The ambition of this series is, on each topic, to show the actual contributions of FTA to research and development challenges and solutions over a decade. It features the work undertaken as part of the FTA program, by the strategic partners of FTA (CIFOR-ICRAF, The Alliance of Bioversity and CIAT, CATIE, CIRAD, Tropenbos and INBAR) and/or with other international and national partners. Such work is presented indifferently in the text as work \"from FTA\" and/ or from the particular partner/organization that led it. Most of the references cited are from the FTA program.This series was elaborated under the leadership of the FTA Director, overall guidance of an Editorial Committee constituted by the Management Team of FTA, support from the FTA Senior Technical Advisor, and oversight of the FTA Independent Steering Committee whose independent members acted as peer-reviewers of all the volumes in the series."}

data/part_1/04335f5dbbfd412dd974c61cc898d935.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04335f5dbbfd412dd974c61cc898d935","source":"gardian_index","url":"https://www.cifor.org/publications/pdf_files/Infobrief/8920-Infobrief.pdf"},"pageCount":6,"title":"Gobiernos regionales y enfoques jurisdiccionales para REDD+ en Perú Un análisis del actual marco legal y de políticas públicas","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":368,"text":"1. Existe un gran interés en los enfoques jurisdiccionales para REDD+ por parte de nuevas fuentes de financiamiento climático y mecanismos voluntarios de mercado (por ejemplo, la Coalición LEAF). Dado este interés, es importante reflexionar sobre la manera en que las políticas públicas y los marcos regulatorios de cada país pueden contribuir a facilitar estos enfoques jurisdiccionales. 2. Perú constituye un caso de estudio útil, dado que algunos de los gobiernos regionales del país han suscrito acuerdos para la venta de reducciones de emisiones de futuros programas de REDD+ en sus jurisdicciones. 3. En Perú no existen actualmente políticas públicas o reglamentos explícitos para iniciativas jurisdiccionales de gobiernos regionales. Sin embargo, el gobierno nacional está desarrollando normas como parte del Registro Nacional de Medidas de Mitigación (RENAMI) y está considerando lineamientos para anidar iniciativas utilizando el Nivel de Referencia de Emisiones Forestales (NREF) y el Nivel de Referencia Forestal (NRF) para el bioma amazónico peruano, las cuales podrían proporcionar reglas relevantes para este tipo de iniciativas jurisdiccionales. 4. Subsisten incertidumbres legales sobre los enfoques jurisdiccionales liderados por gobiernos regionales. Estas incluyen cómo definir las áreas de sus jurisdicciones que pueden formar parte de una iniciativa; si el marco jurídico permite a los gobiernos regionales realizar transacciones en el mercado de carbono; y cómo los gobiernos regionales recibirían y gestionarían los ingresos derivados de dichas transacciones. 5. Este Infobrief examina el marco legal y de políticas públicas actual y futuro del Perú con el fin de entender de qué manera los gobiernos regionales pueden participar en los enfoques jurisdiccionales, y para evaluar hacia dónde se dirigen las normas del gobierno nacional. Wunder et al. 2020). Los gobiernos subnacionales son claves para la implementación de estos enfoques, considerando sus competencias sobre gobernanza forestal y el uso de la tierra, y su proximidad geográfica a las comunidades y a otros actores que manejan y toman decisiones en el campo sobre el uso de la tierra (Stickler et al. 2018). Los gobiernos subnacionales pueden liderar o tener una activa participación en el desarrollo y la implementación de iniciativas de REDD+ en sus jurisdicciones, con el fin de facilitar y mejorar su alineación con las políticas y prioridades públicas (Boyd et al. 2018)."},{"index":2,"size":67,"text":"La atención que se ha puesto en el rol que cumplen los gobiernos subnacionales en la acción climática, incluidos los enfoques jurisdiccionales para REDD+, ha venido acompañada de compromisos de financiamiento y de la introducción de normas específicas. Por ejemplo, LEAFuna coalición integrada por gobiernos y grandes empresas privadas, lanzada en abril de 2021-se ha comprometido con más de USD 1500 millones para la compra de créditos"}]},{"head":"Introducción","index":2,"paragraphs":[{"index":1,"size":52,"text":"Los enfoques jurisdiccionales para la implementación del mecanismo de reducción de emisiones derivadas de la deforestación y la degradación de los bosques (REDD+) También será de utilidad para mecanismos de financiamiento o estándares del mercado voluntario que tengan interés en relacionarse con iniciativas jurisdiccionales de gobiernos subnacionales, facilitarlas o invertir en ellas."}]},{"head":"Los mercados de carbono y los enfoques jurisdiccionales en el Perú","index":3,"paragraphs":[{"index":1,"size":174,"text":"Desde hace casi dos décadas, el Perú ha apoyado mecanismos de mercado para financiar esfuerzos de mitigación. El país participó en el Mecanismo de Desarrollo Limpio (MDL) en el marco del Protocolo de Kioto, y su contribución nacionalmente determinada (NDC por sus siglas en inglés) apoyó de manera explícita los mecanismos basados en el mercado para aumentar el financiamiento climático (Peña y Sarmiento Barletti 2022). Desde el año 2006, varias iniciativas de REDD+ en el Perú han participado en mercados voluntarios de carbono 5 . Más recientemente, algunos gobiernos regionales, el mayor nivel subnacional de gobierno del país, han mostrado su interés en desarrollar programas jurisdiccionales de REDD+. A finales de 2022, dos gobiernos regionales de la Amazonia -Ucayali 6 y Madre de Dios 7 -habían firmado acuerdos para diseñar e implementar programas jurisdiccionales de REDD+ con Mercuria, una empresa suiza. Sin embargo, al momento de escribir este documento, el Ministerio del Ambiente (la autoridad nacional peruana en materia de REDD+) se opuso al acuerdo firmado por el gobierno regional de Ucayali 8 ."},{"index":2,"size":105,"text":"Considerando el interés de los gobiernos regionales en programas jurisdiccionales de REDD+, surgen varias preguntas legales, entre ellas si estas autoridades subnacionales tienen un mandato que les permita establecer tales programas y, en caso afirmativo, qué áreas dentro sus territorios pueden ser incluidas en ellos. También existen preguntas sobre si las propias jurisdicciones pueden suscribir acuerdos para la compra y/o transferencia de créditos de carbono, y si podrán luego utilizar los ingresos provenientes de esas transacciones, y cómo. Otro asunto importante por considerar es si las jurisdicciones subnacionales solo tendrían que cumplir con la legislación nacional o si tendrían que pasar también por una evaluación"},{"index":3,"size":2,"text":"No. 387"},{"index":4,"size":2,"text":"Junio 2023"},{"index":5,"size":57,"text":"del Ministerio del Ambiente. Y, por último, surge una pregunta importante relativa a los mecanismos de transparencia y acceso a la información relacionados con la negociación de los contratos y con el diseño e implementación de los enfoques jurisdiccionales, en especial teniendo en cuenta el derecho reconocido a la consulta previa de los pueblos indígenas del Perú."}]},{"head":"Consideraciones legales y de política pública","index":4,"paragraphs":[{"index":1,"size":460,"text":"En el Perú, una gran variedad de actores privados y públicos pueden ser titulares de derechos de carbono. Una interpretación restrictiva del derecho de los titulares de los bosques a los \"beneficios económicos\" de REDD+ podría incluir el acceso a los mecanismos de distribución de beneficios, pero excluirlos de un derecho previo a ser propietarios de créditos de carbono. Sin embargo, esta misma disposición legal podría interpretarse de una manera más amplia en el sentido de que la propiedad de los créditos de carbono forma parte de dichos \"beneficios económicos\", de manera similar a como los titulares de concesiones forestales tienen derechos de propiedad sobre los frutos o productos derivados de sus otros usos del bosque 11 . Muchas iniciativas de REDD+ han asumido que los titulares de tierras y bosques tienen derechos de propiedad sobre los créditos de carbono y, siguiendo esta interpretación, han desarrollado contratos y transacciones en el mercado voluntario. Esta idea no ha sido disputada legalmente. Al menos en teoría, las entidades públicas que tienen derechos sobre las tierras forestales como propietarios o administradores pueden formar parte de una iniciativa o programa de REDD+ 12 . Los gobiernos regionales, \"en el marco de sus competencias\", podrían formar parte de una iniciativa de REDD+ que incluya \"las áreas de conservación regional, los bosques bajo su administración y los ecosistemas ubicados dentro de los predios de su propiedad\" 13 . El uso del término \"bosques bajo su administración\" probablemente signifique que los gobiernos regionales no pueden reclamar los derechos de carbono de una hipotética iniciativa jurisdiccional de REDD+ en la totalidad del bosque ubicado dentro su jurisdicción, sino solo sobre el bosque considerado \"libre\" (por ejemplo, áreas de bosque que no tengan ningún otro titular). Pero definir esto no es siempre sencillo; por ejemplo, no estaría claro quién sería el titular de los derechos de carbono de bosques con superposición de derechos, como es el caso de los pueblos indígenas que viven en áreas de conservación regional (áreas naturales protegidas administradas por gobiernos regionales). Además, una disposición de la Ley Orgánica de Gobiernos Regionales del Perú de 2002 (Ley N.º 27867) autoriza a estos gobiernos regionales a \"formular planes, desarrollar e implementar programas para la venta de servicios ambientales en regiones con bosques naturales o áreas protegidas\" 14 . La frase \"venta de servicios ambientales\" puede sonar extraña, pero es probable que simplemente refleje una concepción temprana sobre los mecanismos de retribución por servicios ecosistémicos (MRSE), en la época en la que se aprobó la ley. Podría interpretarse de manera que apoye la idea de que los gobiernos regionales pueden desarrollar o formar parte de programas jurisdiccionales de REDD+ y \"vender\" créditos de carbono, lo que implicaría que cuentan con algún tipo de derecho de propiedad sobre ellos."},{"index":2,"size":127,"text":"Potencialmente, los gobiernos regionales podrían asumir el papel de facilitadores o agregadores en programas jurisdiccionales de REDD+, como parte de sus competencias más generales. Así, un gobierno regional podría desarrollar un programa jurisdiccional de REDD+ que incluya no solo los bosques \"libres\" que administra directamente, sino también los bosques con titulares privados o de comunidades nativas que acepten participar. En este caso hipotético, los titulares recibirían beneficios provenientes de proyectos de inversión pública o programas de apoyo a la agricultura sostenible, u otros incentivos o pagos en especie o monetarios, como parte del plan de distribución de beneficios de la iniciativa 15 . Los gobiernos regionales también están legalmente autorizados a participar en MRSE, incluidos los que forman parte de las iniciativas de REDD+, en calidad de"},{"index":3,"size":2,"text":"No. 387"},{"index":4,"size":46,"text":"Junio 2023 retribuyentes (es decir, \"pagadores\" o \"compradores\") 16 . Bajo esta autorización, parecería que un gobierno regional podría incluso, por lo menos en teoría, comprar créditos de carbono de iniciativas de REDD+ dentro de su jurisdicción como parte de un programa de incentivos, por ejemplo."},{"index":5,"size":146,"text":"A pesar de estos mandatos y autorizaciones legales que, al parecer, permitirían que un gobierno regional establezca un programa jurisdiccional de REDD+, existe un importante obstáculo legal: el impedimento constitucional de que las entidades públicas participen en actividades empresariales y comerciales. El artículo 60 de la Constitución Política del Perú prohíbe a todos los niveles de gobierno dedicarse, de manera directa o indirecta, a la \"actividad empresarial\", salvo una autorización expresa por ley por una razón de \"alto interés público o de manifiesta conveniencia nacional\". En principio, si se entiende la venta de créditos de carbono como una \"actividad empresarial\" -y dado que el Congreso peruano no ha aprobado una ley que exima a los gobiernos regionales de la prohibición de dedicarse a estas actividades-, los gobiernos regionales estarían impedidos de establecer programas jurisdiccionales de REDD+ que les requieran dedicarse al comercio de reducciones de emisiones."},{"index":6,"size":65,"text":"Suponiendo que pudieran superar esta restricción constitucional (por ejemplo, argumentando con éxito que no se trata de actividades empresariales, o logrando que el Congreso apruebe una ley que los exima de la prohibición), los gobiernos regionales interesados en establecer un programa jurisdiccional deben considerar dos cuestiones legales adicionales: cumplir con las regulaciones nacionales de REDD+ y cumplir con la legislación de financiamiento y presupuesto público."}]},{"head":"Cumplimiento de la regulación nacional de REDD+","index":5,"paragraphs":[{"index":1,"size":136,"text":"Los gobiernos regionales tendrían que cumplir con la regulación de REDD+ que se encuentra en proceso de elaboración por el Ministerio del Ambiente, la autoridad nacional de REDD+ en el Perú. Este paquete regulatorio determina qué actividades son consideradas acciones REDD+ y definirá el anidamiento y el uso obligatorio de NREF/NRF de deforestación para el bioma amazónico desarrollados por el gobierno nacional, así como otros asuntos importantes, entre ellos la acreditación oficial de estándares voluntarios para los mercados de carbono (Peña y Sarmiento Barletti 2022). Además, esta regulación incluye directrices para el registro de iniciativas de REDD+ en el futuro Registro Nacional de Medidas de Mitigación (RENAMI). El Ministerio del Ambiente evaluará las iniciativas en función de una serie de requisitos y criterios, 16 Véase la Ley de Mecanismos de Retribución por Servicios Ecosistémicos, art. 13.1."},{"index":2,"size":36,"text":"entre ellos el cumplimiento de salvaguardas, antes de que sean registradas en el RENAMI y autorizadas a reclamar y vender unidades oficiales de reducción de emisiones en los mercados de carbono (Peña y Sarmiento Barletti, 2022)."},{"index":3,"size":58,"text":"El RENAMI también cumplirá un papel clave en el caso de cualquier programa jurisdiccional que desee vender unidades de reducción de emisiones mediante enfoques cooperativos en el marco del artículo 6.2 del Acuerdo de París que requieran ajustes correspondientes (relacionados con los créditos de carbono que se comercializan entre países), los cuales el gobierno nacional deberá previamente autorizar."},{"index":4,"size":97,"text":"En términos más generales, los estándares voluntarios ya exigen que las iniciativas de REDD+ cumplan con la normativa nacional. En el caso de las iniciativas jurisdiccionales lideradas por gobiernos subnacionales, el programa Arquitectura para Transacciones REDD+ (ART) ha creado un procedimiento. Este requiere \"una carta de la entidad nacional pertinente autorizando la solicitud del Participante y su participación en ART. La carta certificará que el gobierno nacional apoyará al Participante alineando la contabilidad y el reporte según lo requerido por el Acuerdo de París y hacia las NDC, lo que incluye atender la doble contabilidad\" 17 ."}]},{"head":"Cumplir con legislación de presupuesto público y financiamiento público","index":6,"paragraphs":[{"index":1,"size":94,"text":"Los gobiernos regionales también deben tener en cuenta las leyes financieras y de presupuesto para el sector público, así como las normas relacionadas con la venta de bienes del Estado 18 . Es posible que las unidades de reducción de emisiones de los enfoques jurisdiccionales sean consideradas bienes financieros públicos (de propiedad del Estado). Esto implicaría que las transacciones de carbono tendrían que cumplir con la normativa que rige las transacciones de bienes del Estado similares, incluidas normas de tasación para establecer un precio, o un proceso de licitación para elegir a los compradores."},{"index":2,"size":79,"text":"Otras preguntas legales específicas relacionadas incluyen, por ejemplo, qué direcciones del gobierno regional se encargarían de aprobar las ventas de carbono, bajo qué procedimientos se tasarían los créditos de carbono y cómo se fijarían sus precios, y si los gobiernos regionales incorporarían las unidades de reducción de emisiones como activos en su sistema contable (y de qué manera). Se trata de temas importantes para las entidades públicas que están sujetas a supervisión del uso de bienes del Estado y"},{"index":3,"size":2,"text":"No. 387"},{"index":4,"size":21,"text":"Junio 2023 fondos públicos, y cuyos procesos de toma de decisiones se rigen por principios de transparencia y rendición de cuentas."},{"index":5,"size":114,"text":"Incluso en el caso hipotético de que se concluyera un acuerdo de compra, habría otras cuestiones legales por aclarar. Un asunto clave es de qué manera los gobiernos regionales incorporarían a sus presupuestos los ingresos procedentes de la venta de unidades de reducción de emisiones; en cuanto se incluyan esos ingresos en sus presupuestos, pasarían a ser fondos públicos y estarían sujetos a las normas correspondientes. Otra pregunta importante es en qué actividades podrían gastarse o invertirse dichos fondos (por ejemplo, considerando las normas que establecen límites a las transferencias de fondos públicos a particulares, o restricciones para canalizarlos a través de fondos fiduciarios independientes no autorizados por el Ministerio de Economía y Finanzas)."},{"index":6,"size":74,"text":"Una vía posible para evitar esta regulación sobre fondos públicos es considerar una alianza entre los gobiernos regionales y PROFONANPE, el fondo nacional ambiental del Perú, para que administre los ingresos de los programas jurisdiccionales en el ámbito regional. PROFONANPE fue creado por el gobierno nacional, pero es gestionado de manera independiente y con arreglo al derecho privado, por lo que no tiene que seguir las normas estatales para el uso de fondos públicos. "}]},{"head":"Conclusiones y recomendaciones","index":7,"paragraphs":[{"index":1,"size":111,"text":"El interés por los programas jurisdiccionales de REDD+ se ha incrementado en los últimos años, impulsado en parte por la premisa de que el financiamiento, junto con las herramientas y el conocimiento técnico, sería todo lo que se necesita para poner en marcha estos programas. Sin embargo, este Infobrief demuestra que, antes de que estos programas puedan ser diseñados e implementados, sus proponentes deben entender las políticas públicas y el marco legal, tanto los ya existentes como los que se encuentran en desarrollo en cada país, que pueden facilitar o limitar su implementación. Esto atañe no solo al marco legal para REDD+, sino también a otras funciones y procedimientos de gobierno."},{"index":2,"size":34,"text":"A partir de nuestro análisis, proponemos tres recomendaciones para los responsables de la formulación de políticas públicas y los actores privados en relación con el diseño y la implementación de programas jurisdiccionales de REDD+."},{"index":3,"size":86,"text":"Es necesaria una coordinación multinivel y multisectorial entre actores estatales, liderada por el Ministerio del Ambiente, a fin de establecer marcos adecuados para los enfoques jurisdiccionales. Esto incluye decidir el modelo jurisdiccional más adecuado para el Perú, y definir si los gobiernos regionales pueden estar involucrados y de qué manera. También se requiere de la aprobación de nuevas normas, o la modificación de las ya existentes, para promover y apoyar este modelo jurisdiccional y proporcionar seguridad jurídica a los inversionistas y a los mercados de carbono."},{"index":4,"size":119,"text":"El interés de los inversionistas por acuerdos de financiamiento a plazo o forwards (contratos entre un comprador y un vendedor para comerciar un bien a un precio determinado en una fecha futura) y los compromisos de compra de créditos de carbono para programas jurisdiccionales, son una señal positiva. Sin embargo, tanto los inversionistas como los proponentes deben tener en claro las dinámicas legales en curso y determinar los vacíos existentes, para así evitar crear dificultades a los enfoques jurisdiccionales liderados por gobiernos subnacionales. En el Perú, los proponentes de estos acuerdos podrían poner innecesariamente en riesgo legal a sus contrapartes de los gobiernos subnacionales (dadas las leyes del gobierno nacional en materia de financiamiento público o presupuesto público, por"},{"index":5,"size":2,"text":"No. 387"},{"index":6,"size":83,"text":"Junio 2023 ejemplo). Además, el promover o apoyar programas jurisdiccionales a nivel subnacional que no estén alineados con las normas nacionales de REDD+ y el NREF/ NRF también puede entrar en conflicto con los procesos de anidamiento de las acciones de REDD+, lo que podría comprometer el rigor de la contabilidad nacional de carbono. A la larga, esto podría afectar la percepción del mercado sobre la integridad ambiental de las reducciones de emisiones peruanas, en detrimento de los propios intereses de los inversionistas."},{"index":7,"size":107,"text":"Los donantes y agencias de desarrollo interesados que estén apoyando estándares y mecanismos de mercado orientados al ámbito subnacional deberían colaborar con las autoridades nacionales de REDD+ proporcionando financiamiento y apoyo técnico para la elaboración de reglamentos y directrices para enfoques jurisdiccionales que tomen en cuenta todas las cuestiones jurídicas tratadas en este Infobrief, y que sean eficaces y transparentes. Estas normas y directrices también deberán incluir de manera equitativa las inquietudes y la participación de los hombres y las mujeres de viven en los bosques y que han venido realizando gran parte del trabajo de mantener los bosques en pie en algunas zonas del sur global. "}]},{"head":"Agradecimientos","index":8,"paragraphs":[]}],"figures":[{"text":" Esta investigación forma parte del Estudio Global Comparativo de CIFOR sobre REDD+ (www.cifor.org/ gcs). Entre los socios financiadores que apoyaron esta investigación se encuentran la Agencia Noruega de Cooperación para el Desarrollo (Norad), la Iniciativa Internacional sobre el Clima (IKI) del Ministerio Federal Alemán de Medio Ambiente, Conservación de la Naturaleza y Seguridad Nuclear (BMU), la Agencia de los Estados Unidos para el Desarrollo Internacional (USAID) y el Programa de Investigación del CGIAR sobre Bosques, Árboles y Agroforestería (CRP-FTA), con el apoyo financiero de los donantes que contribuyen al Fondo del CGIAR. Los autores agradecen a Rocío García García Naranjo y José Luis Capella por sus comentarios a versiones preliminares de este Infobrief.  "}],"sieverID":"da7a016d-d214-4491-a2c8-69bc1bc9d395","abstract":""}

data/part_1/043a64decf6b6e10a071a1b00d946260.json

@@ -0,0 +1 @@
+{"metadata":{"id":"043a64decf6b6e10a071a1b00d946260","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/dd3f039a-d441-46f6-9b91-2997fe6e867d/retrieve"},"pageCount":32,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":69,"text":"Efecto de los factores de manejo del pastoreo sobre la utilización de pasturas tropicales L.E. Tergas* \"Resumen En el presente trabajo se discuten algunos conceptos básicos relacionados con los factores del manejo del pastoreo que influyen en la utilización de pasturas tropicales. El objetivo principal es el de discutir los efectos de carga animal y sistema de pastoreo y su interacción, en relación a evaluación del germoplasma en pastoreo."},{"index":2,"size":30,"text":"Se infiere-que estas interacciones son importantes en determinar no solamente la productividad animal sino también el manejo apropiado para asegurar la persistencia de las especies, principalmente leguminosas asociadas con gramíneas."},{"index":3,"size":78,"text":"Se sugiere que en las evaluaciones del germoplasma nuevo en pequeñas parcelas se caracterice la producción de materia seca y la persistencia de las leguminosas en condiciones que tomen en consideración los factores del manejo y sus interacciones. Esta forma de caracterización sería muy útil para diseñar pruebas de pastoreo más simples y evaluar el potencial de producción animal del nuevo germoplasma en las condiciones de manejo apropiado de acuerdo con la especie y las condiciones del ecosistema."}]},{"head":"Introducción","index":2,"paragraphs":[{"index":1,"size":87,"text":"Las especies de pastos tropicales, especialmente las gramineas tienen una gran capacidad de aprovechar la energia radiante. el anhídrido carbónico del aire. el agua y los nutrimentos del suelo para producir grandes cantidades de materia seca la cual puede utilizarse para producción bovina como parte de alimento de alto valor biológico al hombre. No obstante, Whyte (l962) señaló que en términos de producción animal este potencial era mayormente un mito y que por largo tiempo la mayor contribución en términos de productos pecuarios precederla de zonas templadas."},{"index":2,"size":138,"text":"A pesar de que se han logrado progresos en la. investigación en pastos tropicales. especialmente en el uso de leguminosas (Hutton. 1970) y que resultados experimentales demuestran un gran potencial para aumentar la productividad animal en el trópico (Cuadro 1). la producción de carne de estas regiones sigue siendo baja. considerando que cuenta con la mayor propo:ción de la poblaci6n ganadera en el mundo (Jasiorowsld, 1973). La principal razón es que aún cuando los factores ambientales como falta de humedad y temperatura no sean limitan tes y la fertilidad de suelo sea adecuada y se produzcan grandes cantidades de materia seca de valor nutritivo adecuado. la utilizaci6n del forraje por el animal no llega siquiera al 50% Y varia tanto en gramineas (Cuadro 2) como en asociaciones de grarnfneas y leguminosas (Okorie et al, 1%5;Olubajo y Oyenuga, 1971)."},{"index":3,"size":52,"text":"El objetivo de este trabajo es discutir algunos conceptos básicos que están relacionados con la utilizaci6n de praderas tropicales desde el punto de vista del manejo del pastoreo. El énfasis está en asociaciones de gramineas y leguminosas considerando la importancia que tienen estas últimas para mejorar la productividad animal en América tropical."},{"index":4,"size":60,"text":"U tili:!: ación La utilización de pasto es la eficiencia con que la producción de materia seca de la pradera es usada para producción animal (Noy-Meir, 1(78). Dentro de este contexto se reconoce la necesidad de evaluar el verdadero valor de una pastura en relación a su transferencia 'a produCción animal como una medida indirecta de la utilización del forraje."},{"index":5,"size":143,"text":"El consumo de forraje o utilización y la producción animal están relacionados con la cantidad de pasto presente. Si los demás factores que están relaéionados con consumo de forrajes en pastoreo (Figura 1 permanecieran más o menos constantes, la producción animal por unidad de área deber!a estar directamente relacionada con disponibilidad del pasto. Esta relación se podrla describir de acuerdo a una 'curva asintótica (Figura 2), en la cual el consumo de materia seca aumentarla en relación a la disponibilidad del pasto hasta un punto de cambio sobre . el cual una mayor disponibilida<! no produce aumento en la productivididad. Sin embargo, existe una fuerte interacción entre la pradera y el animal en pastoreo, de modo que esta relación no es del todo simple (Stobbs, 1975). Además los factores de manejo de la pradera tienen una gran influencia en determinar su utilización (Mannetje,.1(72)."}]},{"head":"¡ . i 4 Factores de Manejo de Praderas","index":3,"paragraphs":[{"index":1,"size":74,"text":"El principal objetivo del manejo de la pradera es asegurar una productividad animal a largo plazo, manteniendo la estabilidad de la pradera, principalmente de leguminosas que se considera el componente más valioso e inestable del sistema. Entre los factores de manejo de praderas que tienen mayor influencia en utilización se consideran: carga animal, sistema de pastoreo, la duraci6n del periodo de descanso y de ocupación en la rotaci6n y prácticas de conservaci6n de forraje."}]},{"head":"Carga Animal","index":4,"paragraphs":[{"index":1,"size":70,"text":"La carga animal es• el factor más importante que influye en la utilizaci6n de pastos, estableciendo una fuerte interacci6n entre la disponibilidad de forraje resultado del crecimiento de las plantas y la defoliaci6n y consumo de forraje de los animales. La persistencia de las especies en la pradera especialmente leguminosas es afectada fuertemente por la carga animal y vada de acuerdo con las caractensticas morfol6gicas y fisiol6gicas de l¡ls plantas."},{"index":2,"size":34,"text":"Varios investigadores han establecido relaciones entre carga animal y producci6n de las praderas representadas por diferentes tipos de curvas que parecen diferir de acuerdo al tipo de pradera y ecosistema donde han sido evaluadas."},{"index":3,"size":135,"text":"Mott (l960) propuso una relaci6n en la cual la ganancia por animal es máxima con carga baja y se mantiene as!. a medida que la carga aumenta gradualmente, hasta un punto en que comienza a disminuir rápidamente con aumentos sucesivos de carga (Figura 3). El autor ha sugerido que la relación debe ser descrita más bien en términos de presi6n de pastoreo o sea la cantidad 'de materia seca del forraje presente por animal en pastoreo, en vez de la carga animal •• Esta • ¡ i 5 relación es interpretada por Paladines (1972) en función de la cantidad de forraje disponible y el consumo por animal, lo cual deberla ser equivalente a ganancias en peso, siempre y cuando los factores de calidad del forraje no estén mayormente influenciados por la carga animal (Figura 2)."},{"index":4,"size":365,"text":"Otros investigadores como Riewe (1961) y Cowlishaw (1969) establecieron una relación más bien de tipo linear entre ganancias por animal y carga animal sobre un rango amplio de cargas y tipos de praderas. Jones y Sandland (1974) propusieron un modelo (Figura 4) en el cual esta relación permanece linear sobre un rango de cargas establecidas en experimentos de pastoreo. Este tipo de relación se cumple especialmente cuando se aplica a praderas compuestas por asociaciones de gram!neas y leguminosas donde éste último componente es 1 el que más influye en la productividad animal y es afectado severamente con un incremento en carga animal. El autor del presente trabajo encontró en una revisión de datos publicados de diferento¡¡s regiones tropicales que la relación linear propuesta por Jones y Sandland (1974) se cumple en la mayoría de estu.ru.0s sobre praderas asociadas de gramíneas y leguminosas (Cuadro 3) Aunque hay discrepancias en cuanto a la forma de la curva que describe la relación entre carga animal y productividad animal, existe un consenso entre los investigadores de que a medida que la carga animal se reduce, la ganancia por animal aumentará en forma asintótica hasta un nivel que está relacionado c~n el metabolismo del animal. Sin embargo, Stobbs (969) señaló que en praderas de Hyparrhenia rufa en Uganda, la producción por animal disminuyó en las cargas bajas debido al bajo valor nutritivo ocasionado por el excesivo crecimiento y madurez del forraje. Edye et al (1978) encontraron que la carga animal no tuvo un efecto .. ¡ 6 significativo sobre la producción animal anual, debido a un efecto antagónico de las estaciones lluviosa y seca. (Figura 5). Durante la estación lluviosa la producción animal aumentó con el incremento en carga animal, relacionado además con aumento en la disponibilidad de materia verde seca total, pero durante la estación seca se observó una disminución linear en las ganancias por animal en relación al total de materia verde seca y carga animal. Los autores concluyen que es posible que en el trópico húmedo el excesivo crecimiento del pasto ocasione una reducción en calidad del forraje y su utilización por parte del animal lo cual resulta en productividad animal baja cuando se usan cargas bajas."},{"index":5,"size":276,"text":"En Carimagua, con las gramíneas Brachiaria decumbens, !!..:. humidicola y Andropogon gayanus se ha observado una acumulación excesiva del pasto cuando las cargas son bajas sobre todo al comienzo de la estación lluviosa que resulta en menor utilización del pasto en términos de producción animal. Al mismo tiempo l~ proporción de material muerto del pasto. va en aumento a medida que la estación lluviosa avanza y puede representar más del 50% del pasto ofrecido, especialmente con cargas bajas, lo cual tiene una gran influencia en la productividad animal durante está época crítica del año (Figuras 6, 7 Y 8). En Nueva Zelandia, Campbell (l966b) mostró un incremento en forraje muerto cuando se disminuian las cargas. Stuth et al (1981) señalan que se dispone de muy poca información de la influencia de la defoliación sobre las tasas de senectud de los pastos de zonas templadas y la necesidad de investigar la relación que existe entre disponibilidad de pastos y tasas de senectud estacionales. En vista de que las especies de pastos tropicales maduran más rápido y la duración de la estación seca es generalmente más prolongada y caliente en las regiones 'tropicales, las tasas de senectud podrían tener una gran influencia en reducir las tasas de utilizaci6n del pasto y estarían relacionadas con el manejo del pastoreo especialmente la carga animal • .. La carga animal tiene un efecto muy marcado sobre la persistencia de las leguminosas en asociaciones con gramineas tropicales (Figura 9 y lO). Este efecto varia de acuerdo con las características de las especies (Roberts, 1979) de modo que las leguminosas rastreras son más tolerantes a cargas altas que las leguminosas volubles y arbustivas."},{"index":6,"size":125,"text":"Bisset y Marlowe (l974) encontraron una relaci6n entre la carga animal, las ganancias por animal y el número de coronas de plantas de Siratro por hectárea, (Figura 11). Cuando en uno de los sitios experimentales el número de coronas de plantas de siratro se mantuvo alrededor de 100,OOO/ha la productividad animal no varió significativamente con el aumento en la carga animal. Sin embargo,en otro sitio, al disminuir el número de coronas de 39,000 a IZ,OOO/ha, por efecto de un aumento en la carga animal, la producción animal disminuyó significativamente. La diferencia fue atribuida a una mejor adaptación y establecimiento de la leguminosa en uno de los sitios. La mejor adaptaci6n resultó en un desarrollo más vigorosos de estolones y coronas secundarias que en el otro."}]},{"head":"Sistemas de Pastoreo","index":5,"paragraphs":[{"index":1,"size":120,"text":"La mayoria de los trabajos de investigaci6n en utilización de praderas tropicales asociadas de gramíneas y leguminosas se han realizado en condiciones de pastoreo continuo y se considera que las  Stobbs (1969) en una región con un período seco muy definido no encontró diferencias significativas entre pastoreo continuo y pastoreo rotacional con 3 y 6 potreros, respectivamente, con cargas altas en una sociación de .E:.. maximum y Siratro. Riewe (1976) sefialó que en los estudios en que se comparan sistemas de pastoreo continuo y rotacional en asociaciones de gra!lÚneas y leguminosas templadas, usando diferentes cargas, invariablemente se presenta una interacción, de tal modo que las cargas bajas favorecen el pastoreo continuo mientras que cargas altas favorecen pastoreo rotacional (Figura 12)."},{"index":2,"size":494,"text":"Si bien es cierto que no ha habido trabajos que muestren ventajas del sistema de 'pastoreo rotacional sobre el pastoreo continuo en praderas asociadas de gramíneas y leguminosas con relación a la producción animal\" se considera que es posible que a largo plazo sea necesario algún sistema de pastoreo intermitente para favorecer la persistencia de las leguminosas (Stobbs, 1969). Jones (1979) encontró que la disminución, en el rendimiento de Siratro como consecu~ncia del aumento en la carga animal, fue menos ~arcada en una frecuencia de pastoreo de nueve comparado can 3 semanas, al mismo tiempo que la invasión de malezas fue menor. Este efecto, fue asociado principalmente con cargas altas. Es evidente la necesidad de realizar trabajos de investigación a largo plazo sobre todo en ecosistemas de trópico húmedo empleando leguminosas agresivas cuya pq.latabilidad relativa a la de las gramíneas acompañantes, pudiera estar afectada por la distribución de las lluvias Evans (1982) considera que el beneficio de] pastoreo rotacional podría estar más relacionado con el control de la composición botánica en antes que con el aumento de] valor nutritivo del forraje y la producción animal. Sin embargo, en condiciones ambientales donde se p'resente una \" • -. , gran variación estacional en el consumo de leguminosas (CIAT, 1981) o con especies de baja palatabilidad relativa a la de las gramfneas acompañantes, la producción animal podría estar limitada por el predominio de las leguminosas en la asociación. En Carimagua fue este aparentemente el caso de la asociación de D. ovalifolium con gramíneas de buena palatabilidad relativa como Brachiaria decumbens y Andropogon gayanus en las cuales la producción animal disminuyó significativamente cuando la leguminosa se 'volvió dominante en (CrA T ,1980) • Períodos de' Descanso La duración del período de descanso está directamente relacionado con el sistema -de pastoreo rotacional. Existe una interacción entre la defoliación del pasto por los animales. el área foliar después del pastoreo I y el período de descanso de la pradera entre pastoreo que determina la producción del pasto (CampbelI, 1966). De acuerdo con esto, la velocidad de rebrote de la pradera depende in dice del área foliar (IAF) del residuo después del pastoreo y se define como la superficie de las hojas activas presentes por unidad de superficie del suelo. Paladines (1972) explica que de acuerdo con este concepto la mejor utilización de la pradera se produciría cuando la defoliación se realice en condiciones en que el IAF haya pasado apenas el punto óptimo y no exceda el punto minimo de manera que afecte la síntesis de carbohidratos del pasto residual. pero que ese punto óptimo no es fácil de determinar desde el punto de vista práctico. El IAF óptimo estaría relacionado con las características de las especies en cuanto a acumulación de reservas de carbohidratos en las raíces. formas y puntos de crecimiento activos, balance entre la capacidad fotosíntética y transpiración etc •• las cuales son muy relevantes al tipo de manejo apropiado para una mejor persistencia. La ,"},{"index":3,"size":63,"text":"• i 10 aplicación de este concepto al manejo de praderas significarla periodos cortos de pastoreo y largos de descanso. En condiciones tropicales tendrla que ser modificado de acuerdo con las caracterlsticas de las especies, y el regimen y distribución de lluvias, ya que normalmente perlados largos de descanso producen una disminución en la calidad del forraje que podría afectar la productividad animal."}]},{"head":"Conservación del forraje","index":6,"paragraphs":[{"index":1,"size":61,"text":"Las prácticas de conservación del forraje forman parte integral del manejo de praderas en regiones templadas para aumentar la utilización del pasto. En el trópico debido a la baja calidad del forraje conservado (Miller et al 1963) y por lo poco práctico y económico de estas prácticas (Catchpoole y Henzell. 1971), su uso es muy limitado en el trópico (Tergas. 1979)."}]},{"head":"Selección del Germoplasma","index":7,"paragraphs":[{"index":1,"size":247,"text":"Se considera en general que el germoplasma seleccionado para ser utilizado como componente de praderas, además de ser caracterizado por su adaptación al ecosistema y los factores limitantes de la producCión, deberla evaluarse en relación a su capacidad de tolerar defoliaciones frecuentes con diferentes intensidades de pastoreo. Sin embargo, Blazer para asegurar su persistencia y productividad animal. Riewe (1976) dice que las diferencias en respuesta a la intensidad y método de pastoreo podrían ser explicadas en términos de diferencias fisiológicas a la defoliación. En especies de hábito erecto, palatables y de fácil defoliación el rebrote crece a expensas de los carbohidratos de reserva de las raíces, mientras que en especies postradas, estoloníferas, que no son defoliadas completamente por el pastoreo, el rebrote no depende tanto de las reservas de carbohidratos en los estolones y ralees. Ambos casos se refieren a especies de regiones templadas y quizás estos conceptos no tendrían la misma interpretación en regiones tropicales con tasas de crecimiento más altas y continuas a través del año; sin embargo deberían ser consideradas y estudiadas en las evaluaciones de germoplasma como características que pudieran estar relacionadas con la persistencia de las especies. El potencial de mejorar la persistencia de las leguminosas a través del manejo del pastoreo dependerá en gran parte del conocimiento que se tenga de como ese manejo afecta aspectos tan importantes de la persistencia como son: sobrevivencia de plantas, producción de semillas en pastoreo, regeneración y sobrevivencia de plántulas nuevas (Jones y Mott, 1980)."},{"index":2,"size":78,"text":"En vista de que las condiciones socio-económicas en que se desenvuelven los sistemas de producción ganadera en el trópico americano casi que requieren especies de pasto tolerantes a condiciones de •stress en pastoreo continuo y de manejo simple o poco manejo, la selección del germoplasma debería estar basado en estas características. No obstante, otras especies de gran valor forrajero podrían considerarse para un uso alterno en condiciones específicas donde manejos más intensivos podrían tener aplicación.   '\" e '\""},{"index":3,"size":1,"text":"(!;"},{"index":4,"size":32,"text":"F\"igura 5. Relación entre la carga animal y cambios de :Jeso por animal para 3 estaciones lluviosas (LL). 3 secas (5) y 2 períodos anuales (A) (Edye. et El .. 1978) 12."},{"index":5,"size":1,"text":"\""},{"index":6,"size":32,"text":".' .  Carga ,(novillos/ha) Efectos de la carga animal sobre la ganancia de peso anual por novillo en pasto Dallis-Trebol Blanco en . pastoreo continuo y rotacional (5 y 25 días). (Riewei;1976\" "}]}],"figures":[{"text":" rotacional se presentan únicamente con cargas altas.Grof y Harding (1970)  encontraron en el tr6pico húmedo de Australia, una mayor productividad animal en un sistema de pastoreo alterno con dos potreros con cargas altas en P maximum asociado con C. "},{"text":" et al(1914)  sefíalan más bien que el método y la intensidad del pastoreo deberían estar basados en las características morfológicas y fisiológicas de las especies. Así por ejemplo estos autores indican que el método y la intensidad del pastoreo es menos importante con especies anuales que con perennes y que las especies perennes de crecimiento erecto, que son requerirían algún tipo de pastoreo intermitente "},{"text":" Figura 4. "},{"text":"Figura 8 Figura 6. "},{"text":" Figura 10. Efecto de la capacidad de carga en el rendimiento de las leguminosas enJulio 1972Julio  , 1973Julio   Y 1974   en praderas de Siratro/Setaria Kuzungula en Kouma1a, Queensland Central.( Walker, 1975)     "},{"text":" Pr!,d!lcción de carne ,potencial estimadas en praderas tropicales naturales y cult:!.vadas(Stobbs. 1974). Cuadro 3. Regresiones lineales calculadas para la relación entre carga animal (X; animales/ha) y ganancia de peso (Y; kg/animal) en asociaciones de gramíneas y leguminosas tropicales en diferentes regimes de lluvias. Tomado de Tergas (1982).     5 . 5 .  Cuadro 2. Utilización de tres gramíneas tropicales con fertilización y Cuadro 2. Utilización de tres gramíneas tropicales con fertilización y  manejo intensivo. Promedios de regiones húmedas y con uso de manejo intensivo. Promedios de regiones húmedas y con uso de  riego en Puerto Rico. Adaptado de Vicente-Chandler, et al riego en Puerto Rico. Adaptado de Vicente-Chandler, et al  1967.  -- 1967.-- •    Ambiente •Ambiente     Húmedo/Seco Húmedo Húmedo/SecoHúmedo • ¡¡ Praderas N atu rales: Buen manejo Con leguminosas C ult:!.v adas: G ramineas/legu minosas Fe~adas con N Materia seca Eficiencia ofrecida utilización 5-6 meses seco kg/ha/año 10 -80 120 -170 200 -300 300 -500 Ganancia de Peso Animal ha Especie kg/ha/año % kg kg Coeficiente Lluvias (mm) Regresilín Regresión Referenciss sin sequía kg/ha/año 60 -100 250 -450 300 -600 800 -1500 Eficiencia (!onversión Factores del Animal kg MS/kg P.V. a Napier 42,224 35.4 203 1233 720 y=198.5-52.9x -0.98 Mannetje y Nicholls, 1974 1. Tamaño 34.2 Guinea 35,124 45.7 200 905 y-141.7-35.6x -0.79 Shaw, 1978 2. Ca.:¡acidad del tracto 1308 26.8 Pangola 31.761 43.5 198 1139 1.070 y-241.1-56.7x -0.99 digestivo Jones, 1974 3. Estado fisiológico 27.9 1.090 y-208.8-18.2x -0.95 VUela et al, 1978 4. Nutrición previa • ¡¡Praderas N atu rales: Buen manejo Con leguminosas C ult:!.v adas: G ramineas/legu minosas Fe~adas con N Materia seca Eficiencia ofrecida utilización 5-6 meses seco kg/ha/año 10 -80 120 -170 200 -300 300 -500 Ganancia de Peso Animal ha Especie kg/ha/año % kg kg Coeficiente Lluvias (mm) Regresilín Regresión Referenciss sin sequía kg/ha/año 60 -100 250 -450 300 -600 800 -1500 Eficiencia (!onversión Factores del Animal kg MS/kg P.V. a Napier 42,224 35.4 203 1233 720 y=198.5-52.9x -0.98 Mannetje y Nicholls, 1974 1. Tamaño 34.2 Guinea 35,124 45.7 200 905 y-141.7-35.6x -0.79 Shaw, 1978 2. Ca.:¡acidad del tracto 1308 26.8 Pangola 31.761 43.5 198 1139 1.070 y-241.1-56.7x -0.99 digestivo Jones, 1974 3. Estado fisiológico 27.9 1.090 y-208.8-18.2x -0.95 VUela et al, 1978 4. Nutrición previa  Promedio 1. 700 5. Nivel de producci6n 36,369 y=201.6-24.7x 41.5 -0.96 200 Toledo y Morales, 1979 1226 29.6 Promedio 1. 700 5. Nivel de producci6n 36,369 y=201.6-24.7x41.5-0.96200 Toledo y Morales, 1979 1226 29.6  2.650 y=220.0-31.8x  -0.99 Partridge, 1979 2.650y=220.0-31.8x-0.99Partridge, 1979  a. Eficiencia de conversión expresada como kg de MS utilizados para realizar a. Eficiencia de conversión expresada como kg de MS utilizados para realizar  una ganancia de peso de 1 kg • CLIMA CONSUMO VOLUNTARIO I una ganancia de peso de 1 kg • CLIMACONSUMO VOLUNTARIO I  tWlEJO   tWlEJO  Factores de la vegetaci6n Factores de la vegetaci6n  1. Especies  1. Especies  2. Disponibilidad  2. Disponibilidad  3. Composición qulmica  3. Composición qulmica  4. Digestiblidad  4. Digestiblidad  5. Aceptabilidad  5. Aceptabilidad  6. Estado de madurez  6. Estado de madurez  7. Estructure de la pastura 7. Estructure de la pastura  S. Nivel de suplementación S. Nivel de suplementación • •    • • . . . • Factores relacionados con consumo de forrajes en pastoreo. <Johnson (1970 ). . . . •Factores relacionados con consumo de forrajes en pastoreo. <Johnson (1970 ).  "},{"text":" Relaciones generales entre carga animal y ganancia de pesa ppr individuo y por unidad' de área. Adaptada deMott (1960) • •  8 . ... . •8 .... . • •   • • i   i --e ro ....... O> -\"\" ~   --e ro ....... O> -\"\" ~ Consumo de M.S. o Ganancia de peso por animal individua Ganancia de pesa por kg/día Individua o VI ... o-... \"O ro .,... u c <: . . '\" <!l .. I 1 I Punt~ de cambio sobre el cual produce aumento en la produc-una mayor disponibilidad no f:anancia de peso por qnidad de área ka/ha/día Consumo de M.S. o Ganancia de peso por animal individua Ganancia de pesa por kg/día Individua o VI ... o-... \"O ro .,... u c <: . . '\" <!l.. I 1 I Punt~ de cambio sobre el cual produce aumento en la produc-una mayor disponibilidad no f:anancia de peso por qnidad de área ka/ha/día   tividad. tividad.   .. ..   Disponibilidad de Forraje Disponibilidad de Forraje  !. •Kg•. M.S./ha !.•Kg•. M.S./ha Figura 2. Relaci6n general entre disponibilidad de forraje y producción animal (Paladines. 1972) ) Figura 2.Relaci6n general entre disponibilidad de forraje y producción animal (Paladines. 1972) )  Carga Animal• Carga Animal• Figura 3. •   Figura 3. •   • •  "}],"sieverID":"2791de74-28c5-45be-a59f-539cdbce0c17","abstract":""}

data/part_1/043d1f60b2e6c4e7389d75ddf8b5fa0e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"043d1f60b2e6c4e7389d75ddf8b5fa0e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c1288cad-a421-46da-a3f7-e5d92acdd70d/retrieve"},"pageCount":1,"title":"Transmission and Occurrence of Leptospira infection among livestock and humans in Uganda","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":13,"text":"• Leptospira: bacteria that cause leptospirosis, a zoonotic disease endemic in the tropics"},{"index":2,"size":8,"text":"• Annual global morbidity of about 1,000,000 cases"}]},{"head":"Gaps","index":2,"paragraphs":[{"index":1,"size":9,"text":"• Livestock are implicated for human leptospirosis in Uganda"},{"index":2,"size":16,"text":"• Prevention and control requires understanding which livestock species are reservoirs, and how humans get infected"},{"index":3,"size":5,"text":"Scan to find out more"}]}],"figures":[],"sieverID":"66c30b96-6c93-41a8-9326-d84ab9893bf6","abstract":""}

data/part_1/046777cbf7e039148d1fd0f1b9092bb2.json

@@ -0,0 +1 @@
+{"metadata":{"id":"046777cbf7e039148d1fd0f1b9092bb2","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6fa179df-7c24-4a2e-802b-f6b539b95523/retrieve"},"pageCount":1,"title":"Sweetpotato Varieties and Seed Systems Combatting Drought and Food Insecurity","keywords":["Contributing Centers/PPA partners: Evidence link: Deliverables associated: <Not Defined> Contributing CRPs/Platforms:","RTB -Roots, Tubers and Bananas","CCAFS -Climate Change, Agriculture and Food Security"],"chapters":[],"figures":[],"sieverID":"fa204ac3-2353-4c26-94c8-acae7108b8aa","abstract":"Description of the innovation: Orange-fleshed sweetpotato varieties rich in beta-carotene to address vitamin A deficiency. Varieties also have robust traits making them drought tolerant and early maturing. Combined with Triple S (Storage in Sand and Sprouting) system to improve farmers ability to produce their own planting material."}

data/part_1/0477afd934f73fe8ed6f17815c60d071.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0477afd934f73fe8ed6f17815c60d071","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/05f0ce95-3371-4652-8a0f-15a5ffb677c8/retrieve"},"pageCount":10,"title":"News and updates from AfricanBioServices, a European Union-funded research project investigating ecosystem services in the greater Serengeti-Mara ecosystem in eastern Africa","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":67,"text":"It is my expectation that everybody is currently working hard with their field data to ensure that theAfricanBioServices project will be visible in the scientific word as well as in the media. Already, some of us have produced many scientific articles and our project has been visible in various media outlets; however, our challenge is to see more of the young scientists' work exposed in the media."},{"index":2,"size":44,"text":"As an example, we have an active website but until now, very few of the scientists in the project have shared their research and experiences on this platform. I therefore encourage all of you to be more active in contributing content for our website."},{"index":3,"size":231,"text":"I know that dissemination through the media is not a favourite activity for many young scientists as it is regarded as one that gives no credits in the academic world. However, as part of a project funded by the European Union (EU), it is our responsibility to be active and contribute towards disseminating and exploiting our findings. Please contribute in this activity! Currently, we are planning the third AfricanBioServices consortium meeting to be held in Serengeti, Tanzania on 28-29 August this year. The venue of the meeting is the Tanzania National Park conference room at Seronera. All social activities, including all meals, will be organized at the conference centre. It is important for everybody to start planning to attend as these consortium meetings are the arena for us to meet and discuss results. The two days following the consortium meeting will be set aside for internal work package and inter-work package workshops. Therefore, most of us will be around for 4-5 days giving us a lot of opportunities to interact. To prepare and plan for this meeting is your most important activity over the next few months. In addition to this meeting, we need to work on our contribution to the second periodic report to the EU as well as several deliverables with a deadline of 31 August 2018. Please also consider scientific publications on top of all these mandatory activities."},{"index":4,"size":5,"text":"See you all in August."}]},{"head":"Eivin Røskaft","index":2,"paragraphs":[{"index":1,"size":3,"text":"Coordinator, AfricanBioServices project"}]},{"head":"Land cover and land use mapping in the greater Serengeti ecosystem, Tanzania","index":3,"paragraphs":[]},{"head":"By Hamza Kija","index":4,"paragraphs":[{"index":1,"size":153,"text":"The Serengeti-Mara ecosystem that straddles northern Tanzania and southern Kenya has over the past decades undergone major changes in land use and land cover, affecting wildlife habitats and biodiversity. This study attempts to characterize and quantify spatial patterns and temporal changes in land use and land cover  in the greater Serengeti ecosystem, Tanzania. Multitemporal Landsat Multi Spectral Scanner, Thematic Mapper, Enhanced Thematic Mapper Plus and Operational Land Imagery were utilized by random forest classification algorithm. Time series of Landsat images for the years 1975, 1995 and 2017 from paths 168, 169 and 170 and rows 61, 62 and 63 were downloaded from the United States Geological Survey portal. Before analysis, images were corrected for geometric and radiometric effects to ensure that the corrected images were of sufficiently high quality. Image and/or sensor differences within and between scenes were normalized by converting the brightness values of each pixel to obtain the actual ground reflectance."},{"index":2,"size":73,"text":"The study area was stratified into nine strata: Makao and Ikona Wildlife Management Areas; Ngorongoro Conservation Area; Loliondo Game Controlled Area; Ikorongo-Grumeti, Kijereshi and Maswa Game Reserves and Serengeti National Park. Based on the principle of binomial distribution, 75-100 random samples per class were collected and assigned to one of the following classes: (i) bare land, (ii) agriculture, (iii) water, (iv) wetland and swamps, (v) grassland, (vi) shrubland, (vii) riverine or (viii) woodland."},{"index":3,"size":111,"text":"However, due to logistical and financial constraints, terrain features and legal prohibition of off-road access within protected areas, only about 30% of the required sample size was validated (n = 1190 points). The selected samples were traced on ground using hand-held Garmin CSX GPS. Sample points falling in inaccessible areas (due to terrain features, absence of roads or restricted off-road access) were replaced with samples from nearby pixels with similar reflectance or overlaid with high-resolution Google Earth images and identified. Polygons (areas representing a land cover feature) of regular, irregular, circular or elliptical shape of not less than nine pixels were digitized on each sample point across the image and saved."},{"index":4,"size":65,"text":"Images were classified using Random Forest package in R software. Random Forest is a powerful machine learning classifier that has received wide acceptance in land-based remote sensing. Digital Elevation Model data (ancillary data) were combined with spectral data to improve the classification scheme and accuracy of the classified land use and land cover maps. To increase precision and accuracy, strata were classified independently then merged."},{"index":5,"size":87,"text":"Land use and land cover were characterized as bare land, agriculture, water, wetland and swamps, grassland, shrubland, riverine or woodland (see map). The overall classification accuracy for the 2015 land use and land cover map was 88.84% with the Kappa statistic of 0.86. As part of analysis of animal disease dynamics in the greater Mara ecosystem, a longitudinal study of foot-and-mouth disease (FMD) incidence has been set up to monitor outbreaks of the disease in cattle; monitoring started in January 2018 and will continue for 12 months."}]},{"head":"Map of land use and land cover in the","index":5,"paragraphs":[{"index":1,"size":56,"text":"We are also monitoring outbreaks along trade routes and in markets used by the Maasai pastoralists to establish if livestock movement and marketing contributes to the spread of FMD virus in the area. The study will characterize the virus strains circulating in the area and determine their phylogenetic relatedness to provide evidence on their possible origins."},{"index":2,"size":36,"text":"The surveillance system uses a participatory framework involving various stakeholders including community disease reporters, local veterinarians, the county government veterinary department, the International Livestock Research Institute (ILRI) and the FMD national diagnostic laboratory in Embakasi, Kenya."},{"index":3,"size":87,"text":"The community disease reporters and county veterinary officers act as communication links between farmers, actively scout for FMD outbreaks in the villages and report to ILRI and the county veterinary department. The county veterinary department records the reported outbreaks and initiates interventions to control the spread of the virus. ILRI and the FMD diagnostic laboratory carry out the sampling, with ILRI providing transport and other field work logistics. The FMD laboratory screens the samples by first determining the circulating serotypes and then isolating the virus by culturing."},{"index":4,"size":36,"text":"Further analysis of collected samples will be done at Pirbright, United Kingdom and will involve polymerase chain reaction and sequencing of virus protein 1 to establish the phylogenetic relationships of virus strains circulating in the area."},{"index":5,"size":54,"text":"Through this collaborative network, we have so far sampled several herds suspected of being infected with FMD and we continue to scout for more as the study continues. The results will give us a reliable picture of the transmission pathways of FMD in the area and identify high-risk zones for targeted disease control interventions."},{"index":6,"size":42,"text":"Through participatory meetings with farmers, we are also investigating the frequency of outbreaks and factors that may be associated with incidence. We are grateful to the various stakeholders for their participation and look forward to completing the study and sharing the findings."}]},{"head":"Mapping of the possible source of an outbreak of FMD in a farm in one village. Map by Nicholas","index":6,"paragraphs":[{"index":1,"size":3,"text":"Ngwili of ILRI."}]},{"head":"Human activity in villages near Serengeti National Park poses a threat to wildlife","index":7,"paragraphs":[{"index":1,"size":117,"text":"By David Sulle, Janemary Ntalwila and Robert Fyumagwa Agricultural activity in areas bordering game reserves and national parks can lead to human-wildlife conflict, with negative impacts on wildlife. One such incident recently occurred in Mwauchumu village, Bariadi District near the Serengeti National Park when an elephant got stuck in a water hole under construction within 500 metres from the border of the park where farming activities are taking place. The incident happened on the night of 7 January 2018 and was reported the following morning to officials from the Department of Land and Natural Resources. Unfortunately, the information reached the department too late and the rescue team was unable to save the life of the trapped elephant."},{"index":2,"size":79,"text":"After the removal of government trophy (elephant tusks) and burial of the carcass, we managed to speak to the 200 or so people who had gathered to witness the incident. We raised awareness on the negative effects of poaching and agricultural activities carried out within 500 metres from the protected areas. We also advised them to ensure proper construction of water holes in the area and to cover water holes to avoid unnecessary injury to and death of wildlife. "}]},{"head":"Map of the study area in western Serengeti","index":8,"paragraphs":[{"index":1,"size":57,"text":"The study used a randomized block design with one factor and five replications. The blocks were (1) communal grazing lands within villages and (2) protected areas that included Serengeti National Park and game reserves. Replications included 3000-metre transects that extended from village lands to protected areas. The main factor considered in each block was herbaceous plant species."},{"index":2,"size":35,"text":"A 0.25 square-metre quadrat was used to sample herbaceous plants. Plant samples within quadrats were identified by the plant nomenclature of Agnew and Agnew (1994) then cut at ground level to determine above-ground biomass production."},{"index":3,"size":54,"text":"Continuous livestock grazing in communal grazing lands was found to contribute to unavailability of edible plant species as compared to protected areas. Generally, grazing pressure distribution is high in communal grazing land, moderate in protected areas near borders between communal land and protected areas, and low in protected areas situated far from village land."},{"index":4,"size":46,"text":"Livestock incursion in protected areas resulted in reduced above-ground biomass production of herbaceous plants. The number of edible plant species was low in communal grazing lands but increased as one moved towards the protected areas. Overgrazing in communal lands was depicted by existence of bare spaces."},{"index":5,"size":48,"text":"Ikorongo Game Reserve and Ngitiri in Matale village had the highest levels of above-ground biomass due to strict regulations on trespassing of livestock. Deferred grazing in Ngitiri (private grazing lands) is a promising strategy for conservation of livestock forage in villages adjacent to protected areas in western Serengeti."},{"index":6,"size":18,"text":"Bare spaces are a sign of overgrazing in communal grazing land in Nyamatoke village (photo credit: Pius Kavana)."}]},{"head":"Give us your feedback!","index":9,"paragraphs":[{"index":1,"size":32,"text":"We welcome your feedback on this newsletter. Please feel free to share your views by sending us an email. Remember to send your contributions for the next newsletter to Tezira Lore ([email protected])."},{"index":2,"size":38,"text":"You are receiving this newsletter because you are associated the AfricanBioServices project or are interested in ecosystems and biodiversity. If you prefer not continue receiving these updates, please use the unsubscribe link at the bottom of this newsletter."}]}],"figures":[{"text":" scheme. "},{"text":" Such human-wildlife conflict is the direct result of poor land use planning and human population increase that has forced people towards the arable land near the protected areas. Bariadi District is made up of 84 villages, 14 of which border Serengeti National Park and Maswa Game Reserve and are part of a village land use plan supported by Serengeti National Park, the German Government and Bariadi District Council. Elephant trapped in a water hole under construction in Mwauchumu Village, Bariadi District, Tanzania, 500 metres from the border of Serengeti National Park. Investigating the impacts of continuous livestock grazing on the western Serengeti ecosystem By Pius Yoram Kavana, Anthony Z. Sangeda, Ephraim J. Mtengeti, Christopher Mahonge, Bukombe John,Janemary Ntalwila and Robert Fyumagwa Western Serengeti, which includes Serengeti, Bunda, Meatu and Bariadi districts, is a zone of low agricultural potential and marginally suitable for arable agriculture. The main types of land use are communal livestock grazing, game reserves and national parks. Extensive livestock production is commonly practised in villages and is characterized by continuous livestock grazing in communal lands. However, this practice causes deterioration of rangelands which provide habitats to both wildlife and livestock. A rapid vegetation survey of western Serengeti was conducted in May 2017 in village grazing lands and adjacent protected areas, namely Ikorongo and Maswa Game Reserves, and Handajega and Ndabaka in Serengeti National Park. The study was conducted in four districts (names of respective villages in brackets): Serengeti (Park Nyigoti), Bunda (Nyamatoke), Bariadi (Mwantimba and Matale) and Meatu (Makao). "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"375b4ade-682a-44d7-9e5f-35bf83272c0a","abstract":""}

data/part_1/053b8b7f50b1bd5e9cad26a5f21a1412.json

@@ -0,0 +1 @@
+{"metadata":{"id":"053b8b7f50b1bd5e9cad26a5f21a1412","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/890c5786-38d6-417e-90b5-cd7864ce0237/retrieve"},"pageCount":1,"title":"~~!W Phenotypic and Genetic Ch~~~es as a Result of","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":79,"text":"• A phenotypic evaluation of cassava, flabeflifofia and the F 2 poputation was conducted under controlled conditions in a greenhouse al SlU. • Significant differences in root and slem traits between cassava and flabeJlifolia were found. Tuberous roo!s devetoped early during growth of cassava, white in flabellifoJia the luberous roots started lo fonn when the shoot growth had ceased. The F 2 population showed large phenotypic variation and sorne F 2 genotypes showed higher luberous roo! weighl than cassava."},{"index":2,"size":25,"text":"• This project wiU provide significanl knowledge far the development of molecular marker lools for the introgression of favorable wild genes into cassava farmers' varieties."}]},{"head":"Phenotyplc chBnges","index":2,"paragraphs":[{"index":1,"size":89,"text":"Cassava originales fmm Soulh America and has been domeslicaled for more Ihan SOOO years 'rcm its wild ancesto!\" Manihol esculenla ssp. flabellifolia (1), whlch has resulted in phenotypic changes. We study phenotypie differencas between cassava and \".be//ifoJi. and lhe genetie basls 01 Ihese differences. Replicales 01 cassava, flabellifoia and F 2 planls have been grown in 3 blocks in a greenhouse and harvested after 6 and 10 monlhs, respec1ively, and are siso growing in an ongoing sludy. Be/ow we presanl soma 01 Ihe sludied Irails Irom Ihe greenhousa IrleI."}]},{"head":"Stem .nd root tra/ts dlffer between cauava and \"abellffoUa","index":3,"paragraphs":[{"index":1,"size":40,"text":"Phenotypie mean and standard error al 6 monlhs after pianllng 01 one parenl genotype each of casSBV8 and flabeNifoli. and Ihe derived F 2 offspring. , ... Weighl and number of luberous roots al 6 and 10 months after piantlng. "}]},{"head":"Goals","index":4,"paragraphs":[{"index":1,"size":48,"text":"• Our specific goal is lo understand the phenolypic and genetie changes that have occurred as a result of domestication, especially lo identify the genes Ihat conlrol trail differences between cassava and ils wild ancestor using QTl mapping, a melhod Iha! combines molecular markers, trail and slatisticaJ analyses.   "}]}],"figures":[{"text":"' e mon!hs 10 mon lhl ........ 10 monlhS lNeighl 01 fIbrous ,lid luberous rooIS (101) 35.a \"e.! .S.5.&.0 5.&\" 0.1 10.3. \\.5' INelgtll ollubenws rooIs (101So~ cMol\\IIM llamO 10'0 ........... (AHOVA PSI.05j , . , _ of CUH't1 ,un15 81 e monIIII _ Q. 81,0.........\". _ e. ,.......,.. pIIl\\lI MO~. g.ndal ,Omontt. • • . "},{"text":" 8tl)'ejuSl l(1do E. C~Ka\"un L. Egw.ng T. Ff1I9IlM M , lid WlSllrbergl\"l A. 2007 . Genetlc _. 01 ClSSIVI 00 srnd-SCllIe 11I1I1S In Ugtndl: A.n Intefdllc:iplinlry Sludy Genelicl 1311: 3111•31 &. RIIICINed lile 200II Qulsllndlrog "},{"text":",  "},{"text":" • Our Iong•tenn goal is lo develop molecular markers for introgression of favorable witd genes inlo cassava. These markers wilt be usad in marker•assisted selection where !he breeders can take advanlage of the linkage between a molecular marker allele and a QTllhat controls Ihe Irait of interest. EupIIorbiaClII) .1Id h w\\Id 1lI11\\ives: I'urIIMIr e'o'ldeootlor. sout\"'m A ...... ZMÍln origin oldomeSlielliorI. Am J Bol ea: 131•142. 8tl)'ejusa KW:o E. Bu. A. Fregfil' M. E'ir\"'ang T . GuIbe<V U and w.sIertJergh A. 200~. TI>e erred 01 CUSlVl mosalc dis .... on lile II'IIMIic: di\\Ie~l~ 01 ClutVa In UgtndI. EuphyOc:t I\"e: 4~S<4 . cassava began relatively recanlty compared lo olher cassava began relatively recanlty compared lo olher I have been Ihe englne behlnd the breedlng fO!\" Ihave been Ihe englne behlnd the breedlng fO!\"  needs vary a 101 wilhin different areas and they needs vary a 101 wilhin different areas and they . This Is seen in a hlgh heterozygosily leve! wilhln . This Is seen in a hlgh heterozygosily leve! wilhln  i varialion within and betweeo farmers' varíeUes (3). i varialion within and betweeo farmers' varíeUes (3). In cassava compared lo many other crops may haya In cassava compared lo many other crops may haya  changes. Sud! difference has been fouod changes. Sud! difference has been fouod  aTL aTL Mothods  Mothods F, hybrid se!fed  F, hybrid se!fed F 2 poputallon showlng large phellOlyplc varlalion In slem aod rool lIails al6 F 2 poputallon showlng large phellOlyplc varlalion In slem aod rool lIails al6 monlhs after plantino and F 2 genolypes with considerable higher luberous rool monlhs after plantino and F 2 genolypes with considerable higher luberous rool welghl than cessava were observed. The mean values and 95 % conrtdenee welghl than cessava were observed. The mean values and 95 % conrtdenee ¡nlarvals for dones of Ihe lIabellifolia (f) and cessava (e) parenls are hldicaled . ¡nlarvals for dones of Ihe lIabellifolia (f) and cessava (e) parenls are hldicaled .  Fibrous and luberous Fibrous and luberous  rools of eassava (el and rools of eassava (el and  Ihe F 2 -3<4 genotype (F 2 ) Ihe F 2 -3<4 genotype (F 2 )  "}],"sieverID":"a6a3d99f-bf55-461c-b762-48da33fec842","abstract":"An F 2 popu!ation derivad from a cross between cassava and its wild ancestor, Menihot escu/enta spp. flabellifo/ia, is analyzed by quantitative Irait \\oci (QTL) mapping lo identify the genes tha! control Irait differences between cassava and its ancestor.• A linkag8 map basad on SSR and EST-SSR mar1<ers is under conslruction in our lab at SLU."}

data/part_1/0583512e846ab23018e0eb5b36efa51b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0583512e846ab23018e0eb5b36efa51b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d4f147c8-0d0a-4c0a-aa5e-711cb4f3302a/retrieve"},"pageCount":8,"title":"Best bets technologies for improving agricultural water management and system","keywords":[],"chapters":[{"head":"Introduction 1.1 General","index":1,"paragraphs":[{"index":1,"size":235,"text":"With its human population estimated at 77 million in 2007 which increases annually cent, adding nearly 2 million each year, Ethiopia is the second most populous country Africa next to Nigeria. The main mainstay of the country's economy is agriculture w about 45% and 85% to the GDP and the national export earnings, respectively. Large the highly variable rainfall, coupled with the rampant land degradation agricult continues to decline or stagnate to perpetuate poverty, food and 'human needs i increased vulnerability to the recurrent drought. Recurrent drought is one of the majo security and sustainable use and conservation of natural resources in Ethiopia. Th Eth degradation and recurrent with accelerated land degradation also played an important role in aggravating insecurity in the country. In the face of current soaring food prices in th importing agricultural products through purchase or aid is becoming more challe before, calling for substantial increase in agricultural productivity. Thus, a widesp of improved land and water management systems that ensures sustainable develop relative advantage of the different agro-ecological and geographic settings of the c of urgency in order to ensure food security both at national and household lev economic development of the country. sesame and sugar cane which have high potential for export earning constitute small proportion of the ut under illion hectares. mainly industrial or export crops, the semi-subsistent and traditional rain-fed farming together with the limited small scale uction."},{"index":2,"size":120,"text":"on in Ethiopia and ase in land land occupied by rainhich shows an ry year. The higher ibuted to the itions of the year the prevailing , partly due to tangled in abject poverty and persistently faced with chronic food deficit since early 1970's. Therefore, while the antly enhance the productivity of the rain-fed system through the use of improved tilizers, suitable deration to e a major increase in Ethiopia. The major egetables. These schemes. While ns to provide grow cash all scale or ain-fed and ignificant. According to Hagos et al (Forthcoming), irrigation contributed about 5.7 and 2.5 percent, respectively, despite its higher average income of about ystem Hagos et ensure increased eased contribution velopment efforts of the country."}]},{"head":"Objective of the paper","index":2,"paragraphs":[{"index":1,"size":224,"text":"1) review the various technologies used in Ethiopia in relation to hey are o the impact of h a long term ology and its identification of ing technologies for scaling up. The method of collecting data and information included literature review from both local and international sources, key informants were identified at federal, iscussions were held at all els dition, a aire was d and d d to relevant experts in various institutions (GO, NGO, UN agencies, private, etc) to capture diversified information on agricultural water management practices, ranking of technologies including the constraints that exist. Where conditions favor site observations were made and discussion with individual farmers were also held. In total 38 different types of AWM technologies for rainfall and water conservation/control are identified that are practiced in Ethiopia as micro catchment (eg. stone terraces, trash lines) and macro catchment (eg ponds, small dams, diversion) technologies. Based on the inventory, interviews and ranking the following table provide the most promising type of technologies in the four major regions of Ethiopia About 20 % of the total arable land, exceeding 10Million ha of the country has been p cultivation. Irrigation coverage is estimated at about 6% of the countries 3.7 M Although there are some large scale commercial irrigation farms producing traditional irrigation farms contribute the largest share in the total agricultural prod"}]},{"head":"Rainfed System","index":3,"paragraphs":[{"index":1,"size":168,"text":"Rain-fed agriculture contributes the largest share in the total agricultural producti this is expected to continue in the foreseeable future as indicated in the sustained incre area under rain-fed farming. According to CSA (2006), the size of agricultural fed agriculture during 2003/04 to 2005/06 increased from 9.5 M ha to 10.4 M ha, w increase of 9.5 % while production was reported to have increased 12 to 15% eve rate of yield increase as compared to the increase in area coverage could be attr increased use of improved inputs such as fertilizers and favorable weather cond 2005/06. The rain-fed system could not keep pace with the population growth under management; there is a substantial room for improvement of its productivity though climate related constraints and other limitations?. As a result, the country is en endeavor to signific technologies such as superior crop varieties and appropriate type and quantity of fer water management technologies including irrigation and drainage deserve due consi accelerate the progress in the poverty reduction front."}]},{"head":"Irrigated Systems","index":4,"paragraphs":[{"index":1,"size":191,"text":"Irrigation is among the technological interventions believed necessary to achiev agricultural productivity to meet the growing demand for agricultural products in crops commonly grown under irrigation are sugar cane, cotton, sesame, fruits and v crops are grown under small and traditional as well as medium to large scale irrigation the major food crops are under the rain-fed system, irrigation has been seen as a mea employment opportunities and increase the livelihood of rural people by enabling them crops. However, the toiling mass of Ethiopian farmers is at best having access to sm traditional irrigation which is less costly, and often can be easily integrated into the r livestock farming. Consequently, the contribution of irrigation to the economy is ins of the agricultural and overall GDP during the 2005/06 cropping season. This is relative efficiency, that smallholder managed irrigation systems generated an USD 323/ha compared to an average income of USD 147/ha obtained under rain-fed s al (Forthcoming). Therefore, expanding the use of irrigation systems is believed to income of the smallholders and thereby stimulates rural development. Also, its incr to the agricultural and overall GDP will fuel the overall economic de"},{"index":2,"size":70,"text":"The objectives of this paper is agricultural water management and describe the suits of these technologies i.e. how t combined with respect to rain or water control, conveyance and application 2) look in t these technologies with respect to poverty reduction and household income 3) Throug study on specific rain water management technology, evaluate the impact of the techn integration with other interventions with respect to water and crop productivity"}]},{"head":"Review of AWM technologies and their suites","index":5,"paragraphs":[]},{"head":"Technologies widely practiced","index":6,"paragraphs":[{"index":1,"size":30,"text":"The overall objective of this component is aimed at assessing suitability of AWMT and promis regional and in some instances at zonal and woreda levels; interviews and d lev .  "}]},{"head":"Poverty Analysis Results","index":7,"paragraphs":[{"index":1,"size":487,"text":"In brief the analysis of poverty followed six steps. First, we have chosen househ expenditure as welfare measure and this was adjusted for the size and composition o Second, the consumption poverty line is set at 1821.05 Birr (1USD=9.2 Birr), an in poverty line of the baseline poverty line of ETB 1075 set in 1995/96 as measure corresponding to some minimum acceptable standard of living in Ethiopia (MOFED, used an inflation-adjusted poverty line of 1096.03 as absolute food poverty lin corresponding 1995/96 food poverty line. These lines were chosen to enable meanin of poverty levels in Ethiopia between various groups and over time (in reference to The poverty line acts as a threshold, with households falling below the poverty line and those above the poverty line considered non-poor. Third, after the poor has poverty indices such as head count, poverty gap and poverty gap squared were estima constructed poverty profiles showing how poverty varies over population subgroups (e non-users) or by other characteristics of the household (for example, level of educa holding, location, etc.). The poverty profiling is particularly important as what m policymakers is not so much the precise location of the poverty line, but the comparison across subgroups or across time. Furthermore, we undertook ordinal pove using stochastic dominance tests to test the robustness of the poverty orderings. T because the estimation of the poverty line could be influenced by old consumption f the household. flation-adjusted of welfare 2006). We also e based on the gful comparison earlier studies). considered poor been identified, ted. Fourth, we xample users Vs tion, age, asset atters most to implied poverty rty comparisons his is important measurement error. Lastly, we explored the determinants of poverty using multivariate regression analysis. We analyzed the household head ge level factors, access to AWM n fact, our -users of AWMT. river diversions ompared to the ore micro dams, ater withdrawal overty reducing than 50 percent rly, households using gravity irrigation were found to have significantly lower poverty levels compared to those using manual (using cans) applications because of ion technologies f technology, i.e. ction. We found are statistically robust. Furthermore, from the ctively povertythe poor and for parable groups, hing, however, indicated that the average treatment effect of using AWMT is significant and has led to an increase in income which amounts to average income of USD 82/ household. While access to AWMT seems to unambiguously reduce poverty, our study also indicated that there this impact. The most important determinants include asset services and e, a need to: i) bor markets and access to markets (input or output markets). These areas could provide entry points for policy correlates of poverty against household and demographic factors, specific individual/ characteristics, asset holdings including adoption of and use AWM technologies, villa and policy related variables (access to services). By doing so, the marginal impact of technologies on poverty was assessed while controlling for other possible covariates."},{"index":2,"size":194,"text":"Our results show that there was significant reduction in poverty from use of AWMT. I calculations show that there is about 22% less poverty among users compared to non The magnitude of poverty reduction is technology specific. Accordingly, deep wells, and micro dams have led to 50, 32 and 25 percent reduction in poverty levels c reference, i.e. rain fed system. This may imply that there is a need to promote m deep wells and river diversions for higher impact on poverty. Use of modern w technologies (treadle pumps and motorized pumps) were also found to have strong p potential. Households using of motorized pumps were found to have led to more reduction in the incidence of poverty. Simila scale benefits. This implies that promotion of modern water withdrawal and applicat could enhance poverty reduction. But this will also have important impact on choice o to focus on macro than micro-water harvesting technologies for effective poverty redu the poverty orderings between users and non-users poverty analysis (severity indices), we have found that AWMT are not only effe reducing but also equity-enhancing technologies. Equitable development is good for better performance of the economy (Ravallion, 2005)."},{"index":3,"size":80,"text":"While poverty analysis techniques do not have in-built mechanisms of creating com and hence, could lead to attribution bias1, our results from the propensity score matc are a host of factors that could enhance holdings, educational attainment, underutilization of family labor and poor access to markets. To enhance the contribution of AWMT to poverty reduction, there is, henc build assets; ii) human resource development; and iii) improve the functioning of la interventions to complement improved access to AWMT in Ethiopia."}]},{"head":"Interventions for increasing crop production","index":8,"paragraphs":[]},{"head":"In situ water management interventions","index":9,"paragraphs":[{"index":1,"size":307,"text":"One of the most appreciated techniques by farmers in Southern Ethiopia was the plant-pit system or \"Zai\", originated in Mali and was adopted and improved in northern Burkina Faso (Roose etal., 1999). There was a significant yield advantage difference from zai plots over traditional land management practices in Southern Ethiopia (Amede etal. 2008). For instance, Potato yield was significantly higher in Zai pits than those planted in flat fields. The yield advantage of the Zai was ranging from 5 xs t xs depending on the landscape positions. The effect of different levels of fertilizers on pronounced mainly when accompanied by Zai pits. In addition to crop yield, soil mo the Zai pits was significantly higher than in the flat planting; the difference was by ab Water productivity has also tripled with Zai interventions, without any considerable ch status of the soils (Amede etal. 2008). It also suggests that higher soil water conten due more to physical conservation of water by the pits than contributions made by higher water budget was also reported from fields with organic fertilizer and con o 20 tuber yield was isture content of out 10% higher. ange in nutrient t in the Zai was the manure. A servation tillage compared to chemical fertilizers or conventional tillage (Yaduvanshi and Sharma 2008). Similarly, zai he water productivity of millets in the Sahel by a factor of 2 (Fatondji ility in Ethiopian than 10 kg/ha es et al., 1997). The concept of integrated nutrient management through combination of organic and inorganic nutrient resources has been rarely practices as the system is in shortage of res both efficient and economic use of scarce nutrient resources. Various ity of farms and s associated with low soil organic matter content, which commonly dictates nutrient availability & storage, underground biodiversity, soil water holding building organic proved organic l processes and"},{"index":2,"size":90,"text":"). Legume cover kby, 2004), and in the Ethiopian navalia, and vetch (Amede & Kirkby, 2004). However, despite a significant after effect of LCCs on the preceding maize yield (up to 500% yield ume technology hed data, 2002). n to the farming conomic criteria capes, farm size, competition for ral highlands of hat more than 80% of the manure is used as a source of fuel. Further more, the sometimes with (Murwira et al., ontent   1). The effect is highly pronounced when forage legumes were integrated into the cropping system."}]},{"head":"Fertilizer sub-plot","index":10,"paragraphs":[{"index":1,"size":6,"text":"Wheat after vetch (kg ha -1)"},{"index":2,"size":16,"text":"Wheat after wheat (kg ha -1) pits were also found to improve t et al., 2007)."}]},{"head":"Integrated Nutrient Management","index":11,"paragraphs":[{"index":1,"size":47,"text":"Over-mining of nutrients is an important factor contributing to decline in soil fert highlands. The system received external inputs very rarely with a fertilizer rate of less (Quinon organic biomass. This ensu sources of nutrients and approaches have been tested in Ethiopia to improve soil fertil landscapes."},{"index":2,"size":55,"text":"i) Improving soil organic matter The major problem of Ethiopia soils i capacity and many other biological and chemical processes. On the other hand, matter of soils in the short term requires a combination of interventions including im residue management, deliberate crop rotations, improved soil biota and their biologica minimizing carbon loss through soil conservation."},{"index":3,"size":124,"text":"One key intervention tested in Ethiopia was integration of legume cover crops (LCCs crops could produce up to 10 ton/ha dry biomass within four months (Amede and Kir are also fixing up to 120 kg N per season (Giller, 2002). High quality legumes tested highlands include tephrosia, mucuna, crotalaria, ca advantage over the local management) farmers were reluctant to adopt the leg because of trade-off effects for food, feed and soil fertility purposes (Amede, unpublis In an attempt to understand factors affecting integration of soil improving legumes i systems of southern Ethiopia, Amede & Kirkby (2004) identified the following socio-e of farmers as determinants of adoption namely, soil fertility status of farms and lands land ownership, access to market and demand for livestock feed."},{"index":4,"size":197,"text":"Another source of organic fertilizer is farm yard manure. There is an apparently strong manure use between soil fertility and cooking fuel. Recent survey in the upper cent Ethiopia showed t available manure is of low quality; N fertilizer equivalency values of less than 30%, high initial quality that did not explain the quality of the manure at times of use 2002). The manure quality is also variable; wet season manure has a higher nutrient c season manure, and pit manure has a better quality than pilled manure. Besides, manure produced per farm is small. Sandford (1989)   1. Effects of different rates of nitrogen and phosphorus fertilizers with or without green to the cropping systems improved fertilizer efficiency by 3 xs. Wheat yield after vetch was almost triple compared to wheat after wheat, though there is an additional opportunity costs incurred by farmers while growing over the es N & P in 1993 to 137 000 tones in 1996 (Quinones et al., 1997). It was mainly as a result of a strong institutional ration with the national institutions. However, resource poor farmers are challenged to invest on chemical fertilizers due to the increasing cost of fertilizers, produces."},{"index":5,"size":80,"text":"ap between the more than pure advantage was tilized by pollen failure and even s the silk of the pollen from the nhanced by habit may have t ver sole crops was their potential to produce relatively higher yield when they were grown under low soil fertility conditions, which was much higher than the early maturing low soil fertility by small scale competition in and may differ. ture of varieties often yield more than pure stands (Panse et al., 1989)."},{"index":6,"size":129,"text":"Moreover, growing maize mixtures of different height and maturity period may create a spatial and when the early turing plants for rcrops once the e to better light due to differential plant heights of the mixtures. tions and enable ers to experiment and share knowledge. There is a need to have a continual interaction between farmers and researchers during technology testing to provide insights about potential adoption of new amendments such as in situ water management. The challenge therefore is to impact the idea of them adapt and ns, experiences, n highlands, resourcepoor farmers resisted the adoption of soil conservation bunds as it would take up land from their small holdings while the rich farmers resisted adopting it due to its very high labour demand. (Amede et al 2006)."},{"index":7,"size":90,"text":"Given the complexity of the problem of land resources degradation, and its link to social, economical and policy dimensions, it requires a comprehensive approach that combines local and scientific knowledge through community participation, capacity building of the local actors through farmers' participatory research and enhanced farmer innovation. This approach requires the full involvement of stakeholder at different levels to facilitate and integrate social, biophysical and policy components towards an improved natural resource management and sustainable livelihoods (Stroud, 2001). manuring on wheat grain yield at Holleta, Ethiopian highlands (After Asnakew, 1989)."},{"index":8,"size":19,"text":"As indicated in Table 2, crop rotation, particularly integrating forage legumes in vetch during the growing season replacing wheat."},{"index":9,"size":48,"text":"In general, there is an increasing trend in use of mineral fertilizer in the Ethiopian highlands past decades, and fertilizer imports into the country have increased from 47000 tonn campaign of Sasakawa-Global 2000 in collabo lack of credit opportunities to resource poor farmers and low returns from agricultural"}]},{"head":"Varietal mixtures for efficient use of resources","index":12,"paragraphs":[{"index":1,"size":267,"text":"Maize mixtures of early and mid-late maturing cultivars in which there is only a short g tasseling date of the late cultivar and the silking date of the early cultivar yielded 60% stands in drought years, but only 30% more when there was more rain. The yield partly because the silk of the early variety remained receptive long enough to be fer from the late maturing variety. Varietal mixtures was found to minimize risk of crop increased grain yield under drought prone conditions due to improved pollination, a early maturing maize variety may remain receptive long enough to be fertilized by mid-late maturing varieties (Amede, 1995). The compensation effect could be also e efficient use of resources as varieties of various maturity period and growth differential demands for water, nutrients and sun light at a given time and space. The most apparen yield advantage of mixtures o variety at all conditions, and yielded much higher than late maturing varieties under and stress conditions (Amede, 2004, unpublished), a strategy that could be used farmers to minimize risk of complete crop failure. There was a possibility of minimizing water and nutrient use as the timing of the two components in resource dem Experiences from other crops also showed that intra-specific mix temporal niche for planting forage legumes as intercrops. The niches could be created maturing component are dead or removed that leaves free space among the late ma planting of a new intercrop, and/or allowing better growth of early interplanted inte critical demand of the early variety declines. The benefit could also be enhanced du interception of the intercrop"}]},{"head":"Approaches for scaling-up","index":13,"paragraphs":[{"index":1,"size":25,"text":"Participatory approaches are required to demonstrate effects of agronomic interven farm integrating interventions to farmers' fields through participatory approaches and have adopt alternative organic resources."},{"index":2,"size":24,"text":"Various social groups could adopt or reject technologies based on their own perceptio risk carrying capacity and perceived benefits. For instance in Southern Ethiopia"}]}],"figures":[{"text":"Table 1 : Major AWM Technologies Practiced in the Four Major Regions of Ethiopia  Rank Tigray Amhara Oromia SNNPR RankTigrayAmharaOromiaSNNPR  "},{"text":". Poverty Impact of AWM technologies Very often, technologies of AWM are advocated in isolation of particular functio applicable for most of the in situ technologies of soil and water conservation type of f ex-situ type of systems actually require more than one combination of technolog includes all or some of the technologies used for water control/storage, water lifting, conveyance and field application. The suits of technologies relates to how these technologi n. While this is unctions, for the ies. This usually es are combined and used. The factors that influence these combinations are many. Affordability, experience, availability, lack of hiopia are shown in Annex. 12. However, one cannot deny the existence of other technology suits in use. Annex 12 also shows are widely adopted and practiced in Ethiopia 1. River Dive rsio n Riv er dive rsion lls We Riv er diversion 1.River DiversionRiver dive rsionlls WeRiver diversion 2. Micro dam  Micro dam s  River d iversion Pump irrigation 2.Micro damMicro damsRiver diversionPumpirrigation          (from perennial river) (from perennial river) 3. Wells    Wells   Pond Dams 3.WellsWellsPondDams 4. Ponds   Pond   Spate Ponds 4.PondsPondSpatePonds 5. Tankers       Terraces Soil bund 5.TankersTerracesSoil bund 6.         Dams 6.Dams 3.2 Suits of Technologies     3.2 Suits of Technologies          ollowing as the main ones: ollowing as the main ones:         ding ding          th/without) drip/sprinkler th/without)drip/sprinkler        her pump channel flooding her pumpchannelflooding Hemi-spherical tank (mortar) channel flooding Hemi-spherical tank (mortar) channelflooding     ete) channel flooding ete)channelflooding          eading) eading)       nderground tank watering can nderground tankwatering can     orized pump Flooding orized pumpFlooding          age drum drip age drum drip Shallow well treadle/motorized pump (canal + furrow)/sprinkler Shallow welltreadle/motorized pump(canal + furrow)/sprinkler       p/sprinkler  p/sprinkler 3ch as deep and 3ch as deep and          verty, and verty, and          act we followed act we followed          ty analysis. The ty analysis. The    dataset from a representative sample of 1517 households from 29 Peasant dataset from a representative sample of 1517 households from 29 Peasant Associations (Kebeles) in four regions of Ethiopia. Associations (Kebeles) in four regions of Ethiopia. so        tal sample of 1517 households from 29 study sites sotal sample of 1517 households from 29 study sites (peasa   s R  s As w ted b n sence of identified (peasasRsAs wted bnsence of identified is echnologi he e househol from e ed based on the criterion of isechnologihee householfrom eed based on the criterion of a to AWM hnol s vs. no a ss using non-proporti al random sampling. Details of ato AWMhnols vs. no ass using non-proporti al random sampling. Details of m househol  f technolo s from t four region e giv below in table 2. This mhouseholf technolos from tfour regione givbelow in table 2. This In ad as based interviews mentioned above. For details see Loulseged, et al. 2008. The data was collected for the questionn designe ctio e identifi n of ising tec gies rough key informant istribute In ad as based interviews mentioned above. For details see Loulseged, et al. 2008. The data was collected for the questionn designe ctio e identifi n of ising tec gies rough key informant istribute 2006/2007 cropping season.     2006/2007 cropping season.  "},{"text":"Table 2 : Summary of sample households Agricultural water management technologies  awareness are some to mention. Technology suits mostly practiced in Et awareness are some to mention. Technology suits mostly practiced in Et the location of these technologies where they the location of these technologies where they In our analysis of suits of technologies, we have identified the f In our analysis of suits of technologies, we have identified the f 3.2.1 Rainwater Harvesting Suits 3.2.1 Rainwater Harvesting Suits Pond bucket/watering can/pulley/siphon floo Pondbucket/watering can/pulley/siphonfloo Pond bucket/ pressure treadle pump storage drum (wi Pondbucket/ pressure treadle pumpstorage drum (wi Pond suction treadle pump/rope and was Pondsuction treadle pump/rope and was Dome shaped tank (concr Dome shaped tank (concr Spring / motorized pump + storage) channel flooding Spring/ motorized pump + storage) channel flooding Spate irrigation (gully plugging, stone bund and water spr Spate irrigation (gully plugging, stone bund and water spr Roof rain water harvesting surface/u Roof rain water harvestingsurface/u Subsurface dam  hand/mot Subsurface damhand/mot 3.2.2 Micro Irrigation Suits 3.2.2 Micro Irrigation Suits Shallow well bucket/hand/(motorized pump + drip) stor Shallow well bucket/hand/(motorized pump + drip) stor Deep well motorized pump dri Deep wellmotorized pumpdri 3.2.3 Small Scale Irrigation Suits 3.2.3 Small Scale Irrigation Suits Earth dam Canal furrow/flooding Earth damCanalfurrow/flooding Diversion weir Canal furrow/flooding Diversion weirCanalfurrow/flooding River motorized pump outlet chamber canal furrow/flooding Rivermotorized pump outlet chambercanalfurrow/flooding 3.1    3.1  "},{"text":"Method and Data The  Total  860    657  Total860657        pover pover study used a unique      study used a unique The cio-economic survey data gathered from a to    Thecio-economic survey data gathered from a to  nt association ) in 4 egional state . The P ere selec ased o the pre nt association ) in 4 egional state . The Pere selecased o the pre prom ing t es. T n th ds ach PA were select  prom ing tes. T n thdsach PA were select their ccess tec ogie cce  on  their ccesstecogiecceon the sa ple ds by type o gie he s ar en the sa pleds by type ogiehes aren sele n w first on th catio prom hnolo th selen wfirst on thcatiopromhnoloth Region       Region   Purely rainfed Pond Shallow wells Deep River Micro others Purely rainfedPondShallow wellsDeepRiverMicroothers      wells diversion dams wellsdiversiondams Amhara 281 8 45 10 28 13 5 Amhara2818451028135 Oromia 219 12 23 68 68 1 2 Oromia2191223686812 SNNPR 217 68 55 0 14 25 0 SNNPR2176855014250 Tigray  143 47 91 1 40 35 18 Tigray14347911403518  "},{"text":" indicated that to produce sufficie sustainable production of about 3 tonnes/ha of maize in Ethiopia it required 10-40 h grazing land and 3 to 10 of wet season range land, which is beyond the capacity of Eth Mean 3350 1380 Mean33501380 LSD (0.05) 800 1590 LSD (0.05)8001590 Table   Table The applicatio al fertilizers in Et y low, which in a The applicatioal fertilizers in Ety low, which in a  tilizers is a alue crops tilizers is aalue crops plot ty in E ctors plotty in Ectors che ver, c icantly chever, cicantly appli nied w and applinied wand exa cond ch cen exacondch cen that whea doubl ombin that wheadoublombin N0P0 2840 940 N0P02840940 N0P26 3050 990 N0P263050990 N20P0 2910 1040 N20P029101040 N30P26 3630 1830 N30P2636301830 N60P0 3120 1530 N60P031201530 N60P26 4550 1960 N60P2645501960  "}],"sieverID":"55e22560-5ad8-4535-b7ca-2c7179d7fac6","abstract":"spells, recurrent ighly vulnerable. ricultural water gricultural water ous technologies practicing these h the integrated gies and system d ex-situ water soil and water mon. However, ell established river diversion, , the incidence, n-users and the poor compared are found to be respectively. AWM was best s. Yield gains of nted by ased yield of succeeding crop significantly while improving soil fertility and water holding capacity. The effect of lication was highly pronounced when legumes were integrated into the cropping system. varietal mixtures of different height and maturity period increased crop yield by up to 60% ime and space. is essential that anagement and at about 2.8 per in sub-Saharan hich contributes ly dependent on ural productivity nsecurity' and r threats to food e rural poor in iopia are often trapped in this vicious cycle between poor access to resources (poverty), land drought. Inefficient water management in the rain-fed agriculture coupled the recurrent food e international markets, nging than ever read implementation ment based on the ountry is a matter els and to fuel the ……"}

data/part_1/05c5e46691a6a46da8ca44d3de1effe8.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05c5e46691a6a46da8ca44d3de1effe8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d014b873-020b-4c3e-9304-98d32b16ea1d/retrieve"},"pageCount":8,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":32,"text":"successfully accomplished the building of a modern gene bank in Sheik Zuwahid, Sinai. This facility has been conceived to address specifically the conservation of plant genetic resources from dry and desert areas."},{"index":2,"size":124,"text":"The \"Egyptian Desert Gene Bank\" (EDGB), this is its name, is equipped with the latest technologies for best addressing the safe maintenance of germplasm. It consists of three cold storage rooms (a temporary collection room, an active and a long term conservation room), chambers for seed germination and seed cleaning, computer rooms and fields for carrying out multiplication of germplasm material, characterization and any other relevant work. Each storage room is controlled and monitored directly through the computer. The EDBG is also equipped with an advanced Management Information System that will allow the automatic recording of each stored sample. This is made possible thanks to the tagging of each accession with code bars that will allow optical identification, automatic data retrieval and data entry."},{"index":3,"size":361,"text":"The EDGB has already organized a successful training course for Egyptian researchers, which was carried out with the assistance of IPGRI experts in September 1999. The new gene bank will also play an important role in strengthening the collaboration among all national players s.a. Universities, Research Centers and relevant Ministries that are involved in the conservation and use of PGR at various levels. This gene bank will cover all the spectrum of PGR activities, from survey and collecting to characterization, evaluation, conservation, documentation etc. Particular emphasis will be given to the evaluation of local material as well as to the strengthening of in situ conservation activities. Emphasis will be given to landraces and wild species of all those major crops, which have a great diversity in North Africa, s.a. durum wheat (Triticum durum), medics (Medicago spp.), barley (Hordeum vulgare), etc. In addition it is envisaged to also launch an electronic network that will provide scientists with up-to-date information on ex situ and in situ germplasm material and its associated data. The gene bank is expected to play a leading role in the exchange of material and in the strengthening of regional collaboration on PGR. This facility is expected to be a strategic tool to address the conservation of Tunisian ecosystems and the use of PGR for the development of dry lands and desert areas.   IPGRI CWANA is currently launching an electronic networking for PGR in the region. This effort, which has been preceded by a region-wide feasibility study will enable the members of the regional Network WANANET to better communicate, collaborate and interact among each other. Such a new platform of cooperation is an innovative way to bring together partners in \"real time\" and allow them to exchange data and any other sort of information in a fast and reliable manner. This electronic link will also provide a gateway to partners for all other PGR fora and enhance thus the interaction between WANANET and the international PGR Community. It is expected that this new way of collaboration will greatly strengthen the participation of countries in WANANET and contribute to make a more effective use of funds for PGR in the region."}]},{"head":"TUNISIA Tunisia strengthens its conservation ex situ efforts","index":2,"paragraphs":[]},{"head":"Yemen establishes a National Steering Committee for pgr","index":3,"paragraphs":[{"index":1,"size":104,"text":"Through this novel approach, scientists will be able to work closely also in the development of specific applications to better access and analyze data. A feature of this system is in fact the possibility for two or more partners to work at the same time on the same document without the need to send large documents across, saving time and money! These efforts are well tuned with recent recommendations made in several venues, including the Global Forum on Agricultural Research, which has stressed in its last year meeting, \"the need to facilitate accessibility to information and greater capacities for converting information into useful knowledge\"."},{"index":2,"size":14,"text":"Training can be also carried out at a distance through these electronic networking facilities."},{"index":3,"size":37,"text":"Presentations and lectures could be delivered to participants through the phone or via Internet using this technology. Lecturers will be able to interact with the students by sharing completely any application that is relevant to the course."},{"index":4,"size":97,"text":"This interaction, among WANANET members, may also develop jointly databases and applications in the area of GEOSTATISTICS and GIS. What the Ben Omar family has done, confused quite a bit the local population who thought that by doing so they were in fact throwing their savings in the sand: \"How can they grow date palms in such a poor land where it will take even more years to get some fruits out of the trees? Will this activity be a viable one? These were some of the key questions that were raised by people from nearby areas."},{"index":5,"size":5,"text":"This was happening in 1996."},{"index":6,"size":76,"text":"Since then, things have actually developed and for better. Date palm trees are today well established and to the surprise of many, they have been even starting bearing fruits, though they are just 4 years old! Yet, according to some estimates made by the Ben Omar family, no less that 2000 trees will bear good quality dates by the end of this year and such initial harvest may start paying back the efforts spent so far."},{"index":7,"size":127,"text":"This short true story, deserves some further comments. This farmer in fact has contributed to enhance the use of date palm in two ways, by expanding the cultivation in marginal lands and by planting several local varieties which have been neglected and thus under threat of genetic erosion. To better understand the situation faced by the date palm growers, we need to mention the Bayoud disease, which has devastating effects on this crop. The majority of date palm local varieties, well appreciated for their quality, are in fact very sensitive to this disease (e.g. the case for instance of the famous Moroccan variety \"Majhoul\"). This fact has led to a dramatic decrease in the number of varieties grown in Morocco and elsewhere along the date palm belt."},{"index":8,"size":52,"text":"The Bayoud is actually one of the most terrible diseases affecting this crop, a strategic fruit tree of the region and in the oases in particular. The disease is caused by a fungus, which halts the flow of nutrients in the plant causing its death in a matter of weeks or months."},{"index":9,"size":23,"text":"It is estimated that so far Bayoud has destroyed up to 2/3 of the palm groves in Morocco during the last century alone."},{"index":10,"size":27,"text":"Early this year, a major project has been approved by UNDP-GEF to promote the maintenance and better use of the date palm diversity present in North Africa."},{"index":11,"size":60,"text":"The partners of this regional project, Algeria, Tunisia and Morocco will work closely together for the safeguard of the genetic diversity of date palm, through activities for promoting the use of the local types with high quality value. This project will be coordinated by the International Plant Genetic Resources Institute, which has been appointed by UNDP-GEF as the Executing Agency."},{"index":12,"size":87,"text":"IPGRI through its regional Office for CWANA will appoint a regional coordinator and each country their own national coordinator. The project will be carried out in close partnership with farmers like the Ben Omar Family who will be main actors in the efforts to maintain in situ/on farm the threatened local varieties. In October an annual meeting was also held to analyze the results mentioned above and to discuss the work plan for the following years. The primary centre of diversity of pomegranate is the Middle East."},{"index":13,"size":18,"text":"According to literature sources the main germplasm ex situ collection of pomegranate is located in Turkmenistan (1117 accessions)."},{"index":14,"size":30,"text":"Italy and Greece also have small field gene bank collections. Characterization and evaluation of some varieties have been carried out, but most of the accessions have yet to be evaluated."},{"index":15,"size":43,"text":"Pomegranate has been known since ancient times. It is estimated that in Iran and in Armenia this fruit tree has been cultivated for about five thousand years. Images and sculptures of its fruits can be found even in the monuments of ancient Egypt."},{"index":16,"size":101,"text":"From Central Asia the plant started to be cultivated in the Mediterranean region and farther East till China. In addition, it was brought to North America from Spain after the colonization of Mexico by the Spanish.  'Mollar' and 'Tendral' in Spain; 'Schahvar' and 'Robab' in Iran; 'Hicaz' in Turkey; 'Zehri' and 'Gabsi' in Tunisia; 'Alandi' and 'Ganesh' in India, etc. The pomegranate is both selfpollinated and cross-pollinated by insects. The fruit is consumed fresh or can be processed into juice, syrup (grenadine), jams or a type of wine. The juice of pomegranate can reach up to 65% of the fruit weight."},{"index":17,"size":63,"text":"Pomegranates are also valued for their medicinal properties. Pistachio fruit is a nut, with thin pericarp and solid kernel. The seed consists of two cotyledons of green colour. Fruits ripen in August. The edible kernels are rich in fats (40-70%), proteins (15-20%), and carbohydrates (13%). Oil can also be produced from the kernel. Nuts are used fresh or processed by the confectionery industry."},{"index":18,"size":23,"text":"The trees do not bear fruits every year. Today the only places of pistachio nut production in Central Asia are the natural populations."},{"index":19,"size":69,"text":"Yields of these natural stands are rather low. The average yield is 1 kg/tree, although up to 15 kg/tree could be collected sometimes from some individuals. Greater yields are obtained from 60-80 years old trees. Pistachio is able to produce fruits for more than 300 years. The nuts of Central Asian pistachios are characterized by higher oil concentration more than those of Pistcahio nuts (Central Asia); Photo N. Nikolj"}]},{"head":"Pistachio in Central Asia","index":4,"paragraphs":[{"index":1,"size":11,"text":"Iran, Tunisia or Italy. Pistachio nuts are also used in medicine."},{"index":2,"size":64,"text":"There is a considerable amount of tannins in leaves, branches, bark and in the pericarp of pistachio tree, all parts are used for dyeing. Pistachio resin is also used for production of expensive paints. There is up to 50% of tannin content in its galls (local name \"boozgoonch\"), produced when leaves are attacked by aphids. Many plant parts are also used for pharmaceutical purposes."},{"index":3,"size":43,"text":"Pistacia vera is an extremely drought-resistant plant. This trait allows the plant to grow under poor moisture conditions, dry air and high temperatures (up to +50 o C). At the same time pistachio trees are also resistant to low temperatures (-41 o C)."},{"index":4,"size":74,"text":"The trees prefer to grow in light loamy or sandy loam soils, but can also grow in shallow and very stony soils. Due to their deep and strong ground root system, pistachio trees prevent the erosion process in mountains. The large diversity found in pistachio from Central Asia especially in terms of tree height, leaf size and structure and nuts ripening, is of great interest for the breeding works on this valuable horticultural crop."}]}],"figures":[{"text":" By A. Ghorbel, INRST In Tunisia, a new genebank, is expected to be opened in the capital by the year 2002. This facility will greatly enhance the ex situ for central & west asia and north africa conservation capacities of plant genetic resources of the country. "},{"text":" Electronic Networking: A new technological tool for enhancing communication in PGR By A.Bari and K. Durah A typical session meeting with Netmeeting. sharing an appplication/document. Netmeeting shwoing two INRA (Morocco) entering into conversation. "},{"text":" By A. Bari, H Mellas and S. Padulosi At the heart of the Moroccan desert in the Tissint village (near Zagora, some 60 km from the border with Algeria) the Ben Omar family started to plant date palms in areas and in ways that have never been used before! These trees (about 12,000) have been planted in some marginal lands far away from the oases, where they are usually grown. "},{"text":"  "},{"text":"The Kingdom of Saudi Arabia approves a new plan for PGR with a key role for IPGRI   4. The holding of a workshop to be 4. The holding of a workshop to be  hosted by the Ministry of hosted by the Ministry of  Agriculture and Water, in Agriculture and Water, in  coordination with IPGRI and the coordination with IPGRI and the  national PGR Committee, to national PGR Committee, to  review strategies and review strategies and By A. Al Jouwayed technologies of conservation By A. Al Jouwayedtechnologies of conservation The Minister of Agriculture of the Kingdom of Saudi Arabia, H.E. Dr. Abdullah Bin Abdulaziz Al and use of PGR together with relevant scientific institutions across the country. The Minister of Agriculture of the Kingdom of Saudi Arabia, H.E. Dr. Abdullah Bin Abdulaziz Aland use of PGR together with relevant scientific institutions across the country. Mouammar, has approved the  Mouammar, has approved the recommendations resulting from  recommendations resulting from meetings held last year with  meetings held last year with scientists and Ministry officials  scientists and Ministry officials during the visit by IPGRI (Drs. Geoff  during the visit by IPGRI (Drs. Geoff Hawtin, Director General and George  Hawtin, Director General and George Ayad, Regional Director for CWANA).  Ayad, Regional Director for CWANA). The Minister endorsed the initiation  The Minister endorsed the initiation of systematic and coordinated  of systematic and coordinated activities for the conservation and  activities for the conservation and use of PGR in Saudi Arabia. Initial  use of PGR in Saudi Arabia. Initial steps to implement these  steps to implement these recommendations include the  recommendations include the establishment of a national network  establishment of a national network of institutions concerned with PGR  of institutions concerned with PGR and the organization of a national  and the organization of a national workshop in Saudi Arabia to address  workshop in Saudi Arabia to address a strategic Action Plan for the  a strategic Action Plan for the country. A key role for IPGRI in the  country. A key role for IPGRI in the area of technical and scientific  area of technical and scientific advice, training and PGR information  advice, training and PGR information management has been also called  management has been also called upon to help this process. Relevant  upon to help this process. Relevant excerpts from the recommendations  excerpts from the recommendations are:  are: 1. The establishment of a National  1. The establishment of a National Committee for plant genetic  Committee for plant genetic resources, under the auspices of  resources, under the auspices of the Ministry of Agriculture,  the Ministry of Agriculture, whose role is to coordinate the  whose role is to coordinate the various PGR activities between  various PGR activities between the members and developing  the members and developing appropriate research  appropriate research programmes for conservation  programmes for conservation and use of PGR.  and use of PGR. 2. National Agriculture and Water  2. National Agriculture and Water Research Center (AWRC) is to  Research Center (AWRC) is to start up exploration and  start up exploration and conservation activities  conservation activities immediately using current  immediately using current resources while the gene bank  resources while the gene bank will be completed.  will be completed. 3. IPGRI will provide training  3. IPGRI will provide training support in the areas of seed  support in the areas of seed storage, collecting techniques,  storage, collecting techniques, information, data management  information, data management and data analysis.  and data analysis.  "},{"text":"Egypt launches an inter- Ministerial effort for PGR  By S. Padulosi By S. Padulosi On 11 August 1999 his Excellency On 11 August 1999 his Excellency the Deputy Prime Minister and the Deputy Prime Minister and Minister of Agriculture and Land Minister of Agriculture and Land Reclamation (MALR), Prof. Y. Wally, Reclamation (MALR), Prof. Y. Wally, has issued a Ministerial Decree (No. has issued a Ministerial Decree (No. 1065) to establish The Egyptian 1065) to establish The Egyptian National Plant Genetic Resources National Plant Genetic Resources Program (NPGRP). Program (NPGRP). The Decree designates the members The Decree designates the members of the Board of Trustees for the of the Board of Trustees for the Program and establishes hitherto an Program and establishes hitherto an ad hoc Preparatory Committee that ad hoc Preparatory Committee that will endeavor for the implementation will endeavor for the implementation of a specific work plan for PGR in of a specific work plan for PGR in Egypt. This important step follows a Egypt. This important step follows a technical study on PGR technical study on PGR conservation and use carried out in conservation and use carried out in Egypt in February 1999 through a Egypt in February 1999 through a German-supported Appraisal German-supported Appraisal Mission executed with the Mission executed with the participation of IPGRI. participation of IPGRI. The Decree has been conceived to The Decree has been conceived to meet specifically the meet specifically the recommendations produced in the recommendations produced in the Appraisal Mission and sets out the Appraisal Mission and sets out the framework necessary for the building framework necessary for the building of the Central PGR Coordinating of the Central PGR Coordinating Agency and the so called \"Satellite\" Agency and the so called \"Satellite\" Units which will form together the Units which will form together the backbone of this Program. backbone of this Program. The Programme will bring together The Programme will bring together for the first time stakeholders from for the first time stakeholders from various Ministries in partnership with various Ministries in partnership with NGOs, farmer communities and NGOs, farmer communities and representatives of the private sector. representatives of the private sector.  "},{"text":"farmers to rescue date palms in North Africa    In situ conservation In situ conservation   Preliminary results from Preliminary results from   Morocco Morocco  took place in Fergana Valley and targeted vegetable crops such as By S. Achtar A. Birouk took place in Fergana Valley and targeted vegetable crops such asBy S. Achtar A. Birouk  onion, garlic, coriander, black The year 1999 is the second year of onion, garlic, coriander, blackThe year 1999 is the second year of  cumin, fenugreek and basil. The the project \"Strengthening the cumin, fenugreek and basil. Thethe project \"Strengthening the  expedition team included Dr. scientific basis of in situ expedition team included Dr.scientific basis of in situ  Ravza Mavlyanova (organizer of conservation of agricultural Ravza Mavlyanova (organizer ofconservation of agricultural  the expedition mission), Dr. Alexei Biodiversity\". During this year the expedition mission), Dr. AlexeiBiodiversity\". During this year  Pimakhov (leader of the Team), consistent progress has been Pimakhov (leader of the Team),consistent progress has been  Mr. Abdumalik Rustamov achieved in Morocco in order to Mr. Abdumalik Rustamovachieved in Morocco in order to  (vegetable specialist), and Mr. meet the project's objectives (i) to (vegetable specialist), and Mr.meet the project's objectives (i) to  Karim Baimetovn (Head of fruit trees reinforce national capabilities (ii) to Karim Baimetovn (Head of fruit treesreinforce national capabilities (ii) to  and grapes department). As a determine factors effecting genetic and grapes department). As adetermine factors effecting genetic  whole 292 samples of onion, garlic, diversity and (iii) to initiate the whole 292 samples of onion, garlic,diversity and (iii) to initiate the  wild Allium species, coriander, basil, valorization of local varieties wild Allium species, coriander, basil,valorization of local varieties  black cumin, dill , hyssop, fennel, including local knowledge for a better black cumin, dill , hyssop, fennel,including local knowledge for a better  caraway, carrot, hot pepper, melon conservation and use of PGR in the caraway, carrot, hot pepper, melonconservation and use of PGR in the  and garden radish have been country. and garden radish have beencountry.  collected. Outputs so far include: collected.Outputs so far include:   • A videocassette on the project • A videocassette on the project   activities. activities.   • An article on the importance of • An article on the importance of   in situ conservation published in in situ conservation published in   the monthly magazine (Al the monthly magazine (Al   Mouzarii Al Maghribi (October Mouzarii Al Maghribi (October   1999). 1999).   • A broadcast on environmental • A broadcast on environmental   issues recorded at a symposium issues recorded at a symposium   organized at Ifrane and later organized at Ifrane and later   sent on air by the Moroccan sent on air by the Moroccan   Radio RTM. Radio RTM.   • Characterization and evaluation • Characterization and evaluation   of cereals, faba bean and alfalfa of cereals, faba bean and alfalfa   undertaken through PhD undertaken through PhD   research work. research work.   • Completion of two studies on in • Completion of two studies on in   situ conservation. situ conservation.   • Capacity building carried out • Capacity building carried out In view of the threats of genetic erosion recorded for many of these local varieties and considering breeders' needs for this material, surveying, collecting and conservation of vegetables are therefore of paramount importance to the country. In Namangan and Andijan prov-inces original local onion varieties with rounded bulbs have been also gathered. A rich diversity of hot peppers is observed in all prov-inces across the valley. This crop is very popular in that area and it is used for seasoning. Very sweet melon varieties have been also encountered and sampled in the valley. Local garlic verities were encountered and gathered in through training on agro-ecology at the University of California, USA and on molecular marker techniques at the University of Goetingen, Germany, respectively. • A training course on participatory approach on in situ held on 19-23 April. • Additional laboratory and office equipment, computers and supplies acquired. In view of the threats of genetic erosion recorded for many of these local varieties and considering breeders' needs for this material, surveying, collecting and conservation of vegetables are therefore of paramount importance to the country.In Namangan and Andijan prov-inces original local onion varieties with rounded bulbs have been also gathered. A rich diversity of hot peppers is observed in all prov-inces across the valley. This crop is very popular in that area and it is used for seasoning. Very sweet melon varieties have been also encountered and sampled in the valley. Local garlic verities were encountered and gathered inthrough training on agro-ecology at the University of California, USA and on molecular marker techniques at the University of Goetingen, Germany, respectively. • A training course on participatory approach on in situ held on 19-23 April. • Additional laboratory and office equipment, computers and supplies acquired.  Namangan and Andijan  Namangan and Andijan  provinces.  provinces.  "},{"text":"unique vegetable diversity in Uzbekistan  By Prof. Adnan Hadj-Hassan By Prof. Adnan Hadj-Hassan Aleppo University, Syria Aleppo University, Syria Pomegranates (Punicaceae) are Pomegranates (Punicaceae) are native to Southeastern Europe and native to Southeastern Europe and Asia (from Iran to the Himalayas in Asia (from Iran to the Himalayas in northern India). The ancestor of northern India). The ancestor of today pomegranate is recorded only today pomegranate is recorded only in the Socotra Island, Yemen. in the Socotra Island, Yemen. P. granatum is the only species that P. granatum is the only species that has been domesticated and farmer has been domesticated and farmer selections have resulted over selections have resulted over generations to an incredible array of generations to an incredible array of varietal diversity. Breeders varietal diversity. Breeders distinguish fruit producing varieties distinguish fruit producing varieties from those used for exclusively from those used for exclusively ornamental purposes s.a. P. ornamental purposes s.a. P.  "},{"text":"Punica granatum): an ancient and popular fruit in CWANA  By Dr. G. M. Chernova, Uzbek By Dr. G. M. Chernova, Uzbek Research Institute of Forestry and Research Institute of Forestry and Dr. M. K. Turdieva, IPGRI, Tashkent, Dr. M. K. Turdieva, IPGRI, Tashkent, Uzbekistan Uzbekistan There is abundant proof that There is abundant proof that five species of pistachio have five species of pistachio have been growing in the past in been growing in the past in Central Asia. However, as Central Asia. However, as climate became drier, those climate became drier, those species with small fruits died out species with small fruits died out and the only surviving one is and the only surviving one is Pistacia vera. Pistacia vera. The largest populations of The largest populations of natural pistachio are in Tajikistan natural pistachio are in Tajikistan (on the slopes of Karatau, (on the slopes of Karatau, Teriklitau, Alatau, Chaltau, Teriklitau, Alatau, Chaltau, Sarsarek and Jilantau mountain Sarsarek and Jilantau mountain chains), in Uzbekistan (in the chains), in Uzbekistan (in the south, along the slopes of south, along the slopes of Babatag mountains), in Babatag mountains), in Turkmenistan (the Badkhyz and Turkmenistan (the Badkhyz and Kushka) and in Kyrgyzstan (on Kushka) and in Kyrgyzstan (on the slopes of Fergana, Chatkal the slopes of Fergana, Chatkal mountain chains and the Talass mountain chains and the Talass Alatau). These populations are Alatau). These populations are recorded at an altitude ranging recorded at an altitude ranging from 600 to 1700 m.a.s.l. It is from 600 to 1700 m.a.s.l. It is estimated that during the Bronze estimated that during the Bronze Age the territory covered by Age the territory covered by pistachio trees in Central Asia pistachio trees in Central Asia was about 2 million ha, but at the was about 2 million ha, but at the present they do not amount to present they do not amount to 300,000 ha. In the past these 300,000 ha. In the past these trees were cut for firewood, and trees were cut for firewood, and burned for the preparation of burned for the preparation of coal. Today natural pistachio in coal. Today natural pistachio in Central Asia form fragmented thin Central Asia form fragmented thin stands with a density of 30-70 stands with a density of 30-70 trees per ha. trees per ha. Pistacia vera is a tree which is 6- Pistacia vera is a tree which is 6- 7m high, with wide globe-shaped 7m high, with wide globe-shaped crown. Young branches and crown. Young branches and scions are smooth and red- scions are smooth and red- brown. Old branches are covered brown. Old branches are covered with rough bark of ash-gray with rough bark of ash-gray colour. Leaves are dense, wide- colour. Leaves are dense, wide- oval or egg-shaped of light-green oval or egg-shaped of light-green colour, glittering on the top and colour, glittering on the top and mat below. mat below.  "}],"sieverID":"c79fb172-ed94-477a-8b0c-728c286fcc19","abstract":"In this issue of our Newsletter, we would like to inform our readers about some new developments taking place in the CWANA region. Among these new initiatives are the establishment of new conservation facilities, the adoption of innovative information and communication technology for plant genetic resources and the latest developments on in situ/on farm conservation. These efforts are contributing to a new \"renaissance\" in the region with regards to the better conservation and use of plant genetic resources."}

data/part_1/060a7eba8820f638a615930f010a0f5e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"060a7eba8820f638a615930f010a0f5e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d51b5a96-b74e-43e8-8266-475febdcc889/retrieve"},"pageCount":4,"title":"Get One, Bring One Creating sustainability for orange-fleshed sweetpotato in school feeding programs in Malawi","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":78,"text":"Accordingly, CIP provided OFSP vines to eight school-managed gardens in 2018/19 season and 53 schools in 2020/21 season with the goal of integrating the harvest in existing school meals through prepared porridges blended with OFSP-puree or flour To determine the potential for this intervention, it was first necessary to test different recipes and mixes to ensure that school meals would be well-received in the test schools and so that the intervention could be scaled up properly once successful."},{"index":2,"size":97,"text":"If successful, learners will be encouraged to take vines from the school gardens to plant at home, and then to bring a vine from home to plant in the school garden during the next planting season. Thus, the \"take one, bring one\" program for OFSP vines to ensure a sustainable supply of sufficient growing material for home and school. This also reinforces the development of young farmers To complement the lessons learned in this initiative, we also developed an easy-to-read flyer with recipes and instruction for using OFSP flour and puree in school meals and home dishes."}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":20,"text":"The Government of Malawi recognizes the low enrollment, high dropout rates, that result in poor performance of primary school learners."},{"index":2,"size":56,"text":"School meals are one simple tool for removing major barriers of access to education, retention and achievement. The basic meal is corn or corn-soy based flour in form of porridge While the school meal program enjoyed initial success, the need to improve its nutritional content and sustainability have remained nagging challenges in need of evidencebased solutions."}]},{"head":"The research problem","index":3,"paragraphs":[{"index":1,"size":44,"text":"In response to high dropout rates and low enrollment in primary schools, free daily school meals are provided by a number of stakeholders, primarily the Government of Malawi and the World Food Programme through Mary's Meals and the Home-Grown School Feeding Program, for example."},{"index":2,"size":64,"text":"Currently, many children in Malawi enjoy porridge made with maize flour or a corn-soy flour blend as part of school meal program (SMP). Each SMP provides approximately 280 calories from 100g of porridge. Including OFSP in these porridges will help boost its nutritional content, especially for vitamin A with beta carotene, which can help improve vision, bone development and immune systems in young people."},{"index":3,"size":23,"text":"Beyond this intervention, we encounter questions about sufficient supply and making the food more appetizing to ensure its uptake and sustainability in SMPs."},{"index":4,"size":35,"text":"To obtain answers, we devised two studies with local partners and in cooperation with the District Nutrition Coordinating Committees to taste test OFSP porridges in various blends to see which were most preferred by students."}]},{"head":"Approach Study 1 | Use of OFSP Puree in school meals","index":4,"paragraphs":[{"index":1,"size":18,"text":"We began by distributing OFSP vines (100 per bundle) to school gardens of eight primary schools (Table 1).   "}]},{"head":"Study 2 | Use of OFSP flour in school","index":5,"paragraphs":[{"index":1,"size":140,"text":"In the second evaluation, we selected 32 students from each of six schools of ages between 8-10. The students were selected on the basis of their performance records to ensure they would properly understand how to score the evaluation, including the sensory terms being used for evaluation. We followed ethical guidelines from the University of Malawi Research Ethics Committee in selecting and working with the learners. Porridge was prepared by members of the school Feeding Programme Committee at respective schools. The committees were given the flours of various blends to prepare the porridges using traditional preparation methods. In general, the porridge was boiled for an average of 20 minutes or until cooked. Sugar and salt were added to taste. OFSP flour from 4 sweetpotato varieties were used in the study and tested with eight types of flour blends (Table 2)."},{"index":2,"size":71,"text":"CIP thanks all donors and organizations that globally support its work through their contributions to the CGIAR Trust Fund. https://www.cgiar.org/funders/ The students tested the samples in a consecutive manner (singularly) until they had tried all eight samples. After evaluating each sample, the participants were asked to rinse their mouths with clean bottled water before tasting the next sample. New spoons, disposable cups and plates were used for each sample as well."}]},{"head":"Findings","index":6,"paragraphs":[{"index":1,"size":23,"text":"In the first study, the students overwhelmingly preferred two OFPS porridges to regular porridge: 88% OFSP groundnut; 82% OFSP-maize; and 42% regular porridge."},{"index":2,"size":25,"text":"In the second test, appearance was the most important quality where learners tended to prefer the OFSP blended porridges because of the appetizing orange color."}]}],"figures":[{"text":"Figure 1 . Figure 1. (right) Members of the school feeding committee preparing OFSP puree to be used in porridge; (left) Stanley Mbewe with CIP provides training in preparing OFSP-based porridge (photo: O. Malugagwa for CIP) "},{"text":"a. Ordinary porridge (using available flour, pure maize or maize-soy blend meal); b. Mashed OFSP combined with groundnuts and milk; and c. OFSP with either maize meal or maize-soy blend meal (depending on availability) in simple proportions of 1 cup of OFSP puree, 2 cups water, and 1 cup of available flourThen we conducted formal taste tests by color, taste and texture with the 128 selected students. "},{"text":"Figure 2 . 70 Figure 3 : Figure 2. (right) Learners receiving porridge at school; (left) students line up to receive porridge for a taste test (photos: S. Mbewe/CIP). "},{"text":"  "},{"text":"Table 1 . 2019/20 pilot schools on the integration of OFSP in school feeding program District Zone School Enrolment Boys Girls Total DistrictZoneSchoolEnrolment Boys Girls Total Mwanza Chidoole Mphingwi 443 550 993 MwanzaChidoole Mphingwi443550993   Chizumbi 485 555 1,040 Chizumbi485555 1,040 Neno Chikonde Kalion JP 116 71 187 NenoChikonde Kalion JP11671187   Matandani 132 146 278 Matandani132146278 Zomba Mayaka Namiyala 543 570 1,113 ZombaMayakaNamiyala543570 1,113 Phalombe Boma Namikango 753 762 1,515 Phalombe BomaNamikango753762 1,515 Chiradzulu PIM PIM 707 719 1,426 Chiradzulu PIMPIM707719 1,426   Phinda 552 562 1,114 Phinda552562 1,114 Total   3,731 3,935 7,666 Total3,731 3,935 7,666 CIP and local agriculture extension agents provided CIP and local agriculture extension agents provided training in agronomic and storage practices for cultivating training in agronomic and storage practices for cultivating and harvesting the OFSP. At harvest, a total of 128 pupils and harvesting the OFSP. At harvest, a total of 128 pupils were selected to participate in consumer preference study were selected to participate in consumer preference study of three types of porridge prepared for evaluation: of three types of porridge prepared for evaluation:  "}],"sieverID":"9c062bf8-d4dc-4739-884c-3a53e6abb6b9","abstract":"Orange-fleshed sweetpotato (OFSP) is suitable for integration in nutrition-sensitive agriculture education in schools to build capacity of young farmers. Only OFSP vines are required.• OFSP is an easy crop to integrate in homegrown initiatives for sustainable school feeding programs to contribute to a diversified nutritious diet for a better health and eyesight.• With assistance from district and local stakeholders, CIP piloted OFSP integration into school feed programs that could easily be scaled up with more stakeholder support."}

data/part_1/0627e0de36aa0f4c7d1f2f27acbaff5d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0627e0de36aa0f4c7d1f2f27acbaff5d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5300a5c3-7017-4b94-b67d-0ad9bdcb50d1/retrieve"},"pageCount":39,"title":"","keywords":[],"chapters":[{"head":"Utangulizi","index":1,"paragraphs":[{"index":1,"size":142,"text":"Utangulizi: Uwezeshaji wa Wanawake katika Biashara inahusiana na Mifugo (WELBI) ni kipimo kilichosawazishwa cha kunakili uwezeshaji wa wanawake wanaojihusisha na sekta ya biashara inayohusiana na mifugo. Mikakati mbalimbali ya kusaidia uwezeshaji wa wanawake ipo, ila ni vigumu kuipa mikakati hii kipaumbele bila njia za kuaminika za kupima uwezeshaji. Kwa kutumia WEAI kama hatua ya kwanza, timu ya watafiti wa nyanja mbalimbali kutoka Taasisi ya Kimataifa ya Utafiti wa Mifugo (ILRI) na Chuo Kikuu cha Emory waliunda Kielelezo cha Uwezeshaji wa Wanawake katika Mifugo (WELI) ambayo ni kielelezo kipya cha kutathmini uwezeshaji wa wanawake katika uzalishaji kwa sekta ya mifugo. ILRI ilirekebisha zaidi WELI kutalii mabadiliko katika uwezeshaji wa wanawake wanaojihusisha na biashara zilizo kwenye minyororo ya thamani ya mifugo. WELBI hupima uwezeshaji wa wanawake wanaojihusisha na biashara zinazoshughulikia mifugo, hasa, katika utoaji wa huduma ya afya kwa mifugo na ujasiriamali wa ufugaji."},{"index":2,"size":112,"text":"Kumbusho kwa wabunifu wa utafiti: Taarifa katika moduli G1 inaweza kunaswa kwa njia tofauti. Hata hivyo, ni lazima kuwe na njia ya: (a) kutambua mtu anayefaa kufanyiwa dodoso katika kaya, (b) kuainisha matokeo ya dodoso, hasa kama aliyetarajiwa kudodoswa hayupo, ili kutofautisha hili na data iliyokosekana, na (c) kurekodi nani mwingine alikuwepo wakati wa dodoso. Kifaa hiki lazima kirekebishwe kwa muktadha wa nchi ikijumuisha kuongeza mifano na tafsiri katika lugha za kiasili inapofaa. Bidhaa katika MODULI G3A si kamilifu kwa hivyo itahitaji kukaguliwa na kusasishwa ili kushughulikia vipengee vinavyohusika katika kitovu cha mnyororo wa thamani ulio muhimu katika utafiti unaoangaziwa. Matokeo kutoka kwa uchunguzi wa ubora yanapaswa kutoa msingi wa kusasisha orodha."},{"index":3,"size":96,"text":"Tanbihi kwa wadodosaji: Hojaji hii inapaswa kutumika kwa kudodosa mtu binafsi katika kaya ambaye anatambuliwa kama mfanyibiashara inayohusiana na ufugaji na/au mume/mke wake au anayeishi naye kama mke/mume (ikiwa inawezekana). Pale ambapo kuna haja ya kumdodosa mume/mke wake (mdodoswaji wa pili) wakati pia huyo mfanyibiashara (mdodoswaji mkuu) anadodoswa ila hakuna mume/mke wake, inapaswa kudodosa mwamuzi mkuu wa jinsia tofauti na mdodoswaji mkuu kutoka kwa kaya ya mdodoswaji mkuu. Unapaswa kukamilisha jalada hili kwa kila mtu aliyetambuliwa katika \"sehemu ya uteuzi\" hata kama mtu huyo hayupo kwa madhumuni ya kuripoti. Tafadhali hakikisha, na urudie tena, ya kwamba:"},{"index":4,"size":17,"text":"• Umejaza sehemu ya orodha ya dodoso ya kaya ili kubainisha mdodoswaji sahihi mkuu na/au wa pili;"},{"index":5,"size":16,"text":"• Umeandika kitambulisho cha kaya na kitambulisho cha mtu binafsi kwa usahihi kwa mtu unatakaye mdodosa;"},{"index":6,"size":12,"text":"• Umepata ridhaa ya utafiti kutoka kwa mdodoswaji katika dodoso la kaya;"},{"index":7,"size":17,"text":"• Umetafuta mahali pa faragha pa kufanyia dodoso au ambapo wanakaya wengine hawawezi kusikia wala kuchangia majibu."},{"index":8,"size":19,"text":"Usijaribu kusawasisha majibu kati ya wadodoswaji, mdodoswaji mkuu na mdodoswaji wa pilini sawa kuwa na tofauti katika majibu yao."}]},{"head":"Kutayarisha vifaa vya kukusanyia data na kufanya utafiti kwenye vifaa vya kidijitali","index":2,"paragraphs":[{"index":1,"size":64,"text":"a. Pakua na uweke ODK Collect kutoka kwa hifadhi ya programu hadi kwenye kifaa chako cha simu ya mkononi ya Android. b. Zindua programu na kwenye upande wa juu kulia uone vitone hivi vitatu. c. Bonyeza kwenye vitone hivi vitatu; chaguo la kushuka chini litafunguka. MWONGOZO WA MAAGIZO h. Mara inapomaliza kupakuliwa, bonyeza kwenye 'Jaza fomu iliyo tupu' ili kuzindua programu ya kukusanya data."}]},{"head":"Maagizo ya jumla kwa sehemu zote","index":3,"paragraphs":[{"index":1,"size":58,"text":"• Usiwasomee wadodoswaji orodha ya majibu yenye msimbo isipokuwa pale ambapo umeelekezwa kwa uwazi 'SOMA.' Badala yake, mruhusu mdodoswaji akupe jibu lake la swali kisha uchague jibu lifaalo zaidi kutoka kwenye orodha ya majibu yenye msimbo. Iwapo jibu la mdodoswaji halieleweki, inaweza kumaanisha kuwa mdodoswaji hakuelewa swali, kwa hivyo chunguza zaidi na kulipanga swali upya ili mdodoswaji aelewe."},{"index":2,"size":10,"text":"• Mwezi unapaswa kuandikwa kila wakati kwa nambari kutoka 1-12."},{"index":3,"size":9,"text":"• Mwaka unapaswa kuandikwa kwa tarakimu 4 kila wakati."},{"index":4,"size":31,"text":"• Tarehe kamili kama vile tarehe za kuzaliwa au tarehe za dodoso zinapaswa kuwa na muundo ufuatao: SIKU-MWEZI-MWAKA (yaani siku yenye tarakimu 2, mwezi wenye tarakimu 2, mwaka wenye tarakimu 4)."},{"index":5,"size":8,"text":"• Asilimia inapaswa kuandikwa kila wakati kutoka 0-100."},{"index":6,"size":40,"text":"• Anza na dodoso la kaya, na kisha dodoso za mtu binafsi. Ikiwezekana, na kama inavyowezeshwa na uundaji wa timu ya jufanya dodoso, wadodosaji wa kiume wanapaswa kumdodosa mdodoswaji wa kiume na wadodosaji wa kike wanapaswa kuwadodosa wadodoswaji wa kike."},{"index":7,"size":30,"text":"• Ni sawa kwa wanakaya wengine au washiriki wenza kwenye biashara ya mdodoswaji kusaidia kukumbuka majibu ya maswali yaliyoulizwa kwa mdodoswaji kama sehemu ya dodoso la kayaau la biashara TU."},{"index":8,"size":39,"text":"• Kwa sehemu zenye maswali yanayoelekezwa kwa mtu huyo binafsi, ikiwezekana, wadodoswaji wanapaswa kuhojiwa wakiwa kando kando, bila wanakaya wengine au watu wengine kuwepo. HAIPASWI wanakaya wengine au washiriki wa biashara kusaidia kukumbushana maswali kwenye dodoso la mtu binafsi."},{"index":9,"size":134,"text":"• Ingawa utafiti utakadiria viashiria tofauti, kikubwa kikiwa ni Kielezo cha Uwezeshaji Wanawake katika biashara inayohusiana na mifugo (WELBI), kutajwa kwa utafiti unaofanywa kunapaswa kuzingatia mradi ambao makisio ya WELBI yanahitajika ama kwa ajili ya kufuatilia maendeleo ya mradi au kutoa taarifa za shughuli za mradi, na sio lazima kuelezea zana za uchambuzi (k.v WELBI nk). Kama ilivyoonyeshwa katika fomu ya ridhaa ya utafiti, maswali katika utafiti yanalenga zaidi katika kufanya maamuzi ndani ya biashara na kaya na maswali mengine yahayohusiana na mdodoswaji katika biashara yake. Ili kutoleta hisia kwamba tunataka kubadilisha au kushawishi majukumu ya kijinsia au kuwawezesha wanawake kwa kutumia dodoso hili, jambo ambalo linaweza kupotosha au kupendelea matokeo, ni vyema kutanguliza mradi unaohusika na kile ambacho chombo kinashughulikia katika suala la kufanya maamuzi, na sio uchanganuzi wa data (uwezeshaji wa wanawake)."}]},{"head":"Vipengele vya ubadilishaji","index":4,"paragraphs":[{"index":1,"size":6,"text":"• Kilomita 1 = maili 0.6"},{"index":2,"size":6,"text":"• Kilomita 1.67 = maili 1"},{"index":3,"size":6,"text":"• Maili 1 = mita 1667"},{"index":4,"size":6,"text":"• GUU 1 = mita 0.30"}]},{"head":"KANUNI ZA ULIMWENGU","index":5,"paragraphs":[{"index":1,"size":42,"text":"Kanuni zifuatazo zinaweza kufaa katika swali lolote katika uchunguzi wa kaya. Kwa hali yoyote (isipokuwa mifumo ya kuruka) swali halipaswi kuachwa bila jibu. Ikiwa huna uhakika, andika tanbihi na umuulize msimamizi wako baada ya kukamilisha dodoso jinsi ya kujaza swali hilo mahususi."}]},{"head":"Sijui………………………………………………88","index":6,"paragraphs":[{"index":1,"size":6,"text":"Haitumiki (N/A)/Hakuna uamuzi uliofanywa…………………….98 lingine bainisha………………………………………………….99"}]},{"head":"MAAGIZO KWA SEHEMU","index":7,"paragraphs":[]},{"head":"I. Biashara, muundo wa kaya na uchaguzi wa washiriki","index":8,"paragraphs":[{"index":1,"size":152,"text":"Biashara ni shughuli ya kununua na kuuza bidhaa na huduma. Ingawa ufugaji unaweza kuchukuliwa kama biashara ya kulea na kuzalisha mifugo kwa madhumuni ya mapato, haswa wakati wigo unaenea zaidi ya kilimo cha kujikimu, biashara inayo husiana na mifugo, katika muktadha wa utafiti huu ni pamoja na kununua na kuuza mifugo, mazao ya mifugo, pembejeo na huduma zinazohusiana na mifugo kwenye viwango vingine vya mnyororo ya thamani isipokuwa kiwango cha mzalishaji . Biashara ya mifugo ni pamoja na biashara ya wanyama hai (mfano nguruwe, ng'ombe, mbuzi kondoo, ndege n.k), biashara ya mazao ya mifugo (km maziwa, mayai, nyama n.k), usambazaji wa pembejeo (km malisho, dawa za kuua wadudu, dawa za kinga na tiba za mifugo, vifaa, na chanjo), na utoaji wa huduma zinazohusiana na mifugo (km huduma za kliniki za afya ya wanyama, huduma za ushauri/ugani, huduma za uhimilishaji, huduma za kuthibiti gesi asilia/mbolea, na utoaji wa huduma za mikopo inayohusu mifugo)."},{"index":2,"size":42,"text":"Kaya: Ufafanuzi ulio wazi na uliosawazishwa wa kaya ni muhimu kwa kuwa fasili mbalimbali za kaya husababisha mikusanyiko tofauti ya kaya na zinaweza kuwa na athari kubwa katika utofauti wa viashirio vya matokeo hasa yanayozunguka kazi na matumizi (Beaman na Dillon 2012)."},{"index":3,"size":29,"text":"Ili kuwezesha ulinganisho wa nchi tofauti, tunapendekeza fasili zilizosawazishwa zitumike kutambua ni nani anayepaswa kujumuishwa kama 'mwanakaya,' na ni nani anayepaswa kuhusiswa kwenye dodoso kamamdodoswaji 'mkuu' na 'wa pili'."},{"index":4,"size":27,"text":"Tafiti nyingi za kaya zenye madhumuni mbalimbali hufafanua kaya kama kundi la watu wanaoishi pamoja na kushiriki chakula kutoka kwenye 'chungu kimoja' (Ayad et. al., 1994;Glewwe, 2000)."},{"index":5,"size":109,"text":"Sehemu muhimu ya ufafanuzi huu ni kwamba kundi la watu binafsi linashiriki angalau baadhi ya rasilimali za kawaida na kufanya baadhi ya maamuzi ya pamoja ya bajeti na matumizi. Mwanakaya ni mtu ambaye ameishi katika kaya angalau miezi sita (6), na angalau nusu ya wiki katika kila wiki katika miezi hiyo. Hata wale watu ambao hawana uhusiano wa damu (kama vile watumishi, wapangaji, au wafanyikazi wa kilimo) ni wanakaya kama wanakidhi sifa hizi. Watu ambao wanaishi pamoja na wanakaya (wanalala pengine kwenye vyumba vinavyoishi wanakaya), lakini hawagharamii au kushiriki chakula kutoka 'chungu kimoja' na wanakaya, hawachukuliwi kuwa wanackaya. Ufafanuzi huu, ikijumuisha mifano na miongozo mahususi zaidi, imepachikwa kwenye dodoso."},{"index":6,"size":13,"text":"Kumbuka kuwa mbali na maagizo yaliyo hapo juu, afuataye anapaswa kujumuishwa kama mwanakaya:"},{"index":7,"size":7,"text":"• Mtoto mchanga chini ya miezi 3."},{"index":8,"size":15,"text":"• Mtu ambaye amejiunga na kaya kwa njia ya ndoa chini ya miezi 3 iliyopita."},{"index":9,"size":26,"text":"• Watumishi, wapangaji na wafanyikazi wa kilimo walio katika kaya sasa hivi na watakaa katika kaya kwa muda mrefu lakini walifika chini ya miezi 3 iliyopita."},{"index":10,"size":3,"text":"Usijumuishe kama mwanakaya:"},{"index":11,"size":15,"text":"• Mtu aliyekufa hivi karibuni ingawa alikaa zaidi ya miezi 3 katika miezi 6 iliyopita."},{"index":12,"size":12,"text":"• Mtu ambaye ameacha kaya kupitia ndoa chini ya miezi 3 iliyopita."},{"index":13,"size":20,"text":"• Watumishi, wapangaji na wafanyikazi wa kilimo ambao walikaa zaidi ya miezi 3 katika miezi 6 iliyopita lakini waliondoka kabisa."}]},{"head":"Vidokezo vyema vya mazoezi","index":9,"paragraphs":[{"index":1,"size":47,"text":"• Iwapo fasili ya kawaida ya kaya haileti maana katika muktadha ambapo tafiti zitatekelezwa, ni muhimu zaidi kuhakikisha kwamba wadodosaji wana uelewa sawa wa fasili ili utekelezaji uwe thabiti katika kaya zote. Ukiwa na shaka juu ya nani wa kujumuisha au kumtenga, tafadhali jadiliana na msimamizi wako."},{"index":2,"size":131,"text":"Wadodoswaji wa wakuu na wa upili ni wanakaya ambao wamejitambulisha kuwa washiriki wa kimsingi wenye jukumu la kufanya maamuzi, kijamii na kiuchumi, ndani ya kaya. Kwa kawaida huwa ni mwenye biashara/mwekezaji na mume au mke wake. Hata hivyo mdodoswaji wa pili anaweza pia kuwa mwanakaya mwingine, mradi tu awe mwanaume (ikiwa mdodowaji mkuu ni mume) au/ mwanamke (ikiwa mdodowaji mkuu ni mke) mwenye umri wa miaka 18 na zaidi na anashiriki maamuzi katika kaya ya mdodoswaji. Pana uwezekano kupata mdodoswaji mkuu pekee ikiwa mtu huyo ni mwanabiashara na hakuna mtu mzima wa kiume katika kaya yake. Mwanamke/mwanaume kielelezo ni mwanamke/mwanaume anayetambuliwa kama mmiliki, mmiliki mwenza, mwekezaji au mfanyakazi katika biashara inayohusiana na mifugo ambaye anasimamia shughuli za biashara au ana fahamu vizuri gharama, michakato na uendeshaji wa kina wa biashara hiyo."}]},{"head":"II. Idhini iliyofahamika","index":10,"paragraphs":[{"index":1,"size":26,"text":"Kabla ya kuanza dodoso, ni muhimu kutanguliza utafiti kwa mdodoswaji na kupata ridhaa yake ya kushiriki. Waeleze wazi kwamba ushiriki wao katika utafiti ni wa hiari."},{"index":2,"size":41,"text":"Baada ya kusoma maelezo yote kwenye fomu ya ridhaa na kuomba ridhaa kutoka kwa mdodoswaji, hakikisha kwamba unatia sahihi katika nakala sawia za ya fomu ya ridhaa iliyoarifiwa kwa kila kaya na kuacha nakala moja kwa kaya hiyo baada ya dodoso."}]},{"head":"III. MODULI A: UTAMBULISHO WA BIASHARA","index":11,"paragraphs":[{"index":1,"size":51,"text":"Hii ni sehemu inayohitajika na ni muhimu sana kwa kutoa utambulisho wa kipekee kwa kila biashara iliyofanyiwa utafiti. Mfumo wa kipekee wa utambulisho wa biashara unapaswa kutengenezwa kabla ya utafiti na utumike kwa kuweka lebo kwenye kila hojaji. Hakuna biashara inayopaswa kupewa nambari ya utambulisho wa biashara iliyo sawa na nyingine."},{"index":2,"size":40,"text":"Hii pia ni sehemu ambapo unanakili jina la biashara (kama lipo). Ikiwa mjasiriamali hana jina la biashara yake, tumia jina la mjasiriamali unayemdodosa Pia nakili kitambulisho cha eneo kwa mfano majina ya wilaya, kata na kijiji mahali biashara ilipo/dodoso lilifanyika."}]},{"head":"IV. MODULI C: UCHAMBUZI WA BIASHARA","index":12,"paragraphs":[{"index":1,"size":16,"text":"Hii ni sehemu inayohitajika na muhimu sana kwa kuchambua biashara kulingana na asili, aina na ukubwa."},{"index":2,"size":1,"text":"Maswali:"},{"index":3,"size":10,"text":"1. Mahali pa dodoso -hapa, unatakiwa kurekodi eneo unalofanyia dodoso."}]},{"head":"2.","index":13,"paragraphs":[{"index":1,"size":74,"text":"Asili ya huluki ya biashara ya [jina la biashara]? (Kumbuka: jina la biashara kutoka kwa Moduli A): Hapa, unapaswa kujua jinsi biashara ilivyoundwa, yaani, ikiwa imesajiliwa na ni aina gani ya usajili ambao biashara iko nao. Katika baadhi ya matukio, wafanyabiashara huendesha biashara ambazo hazijasajiliwa kwa hivyo chagua msimbo unaofaa. Iwapo hakuna msimbo ulioorodheshwa unaofafanua vya kutosha asili ya biashara, basi chagua \"nyingine bainisha\" na uendelee kuandika aina ya biashara kama ulivyofafanuliwa na mdodoswaji."},{"index":2,"size":28,"text":"3. Wakati [jina la biashara] lilipoanzishwa (Mwezi na Mwaka) -ikiwa biashara imesajiliwa, muulize mdodoswaji mwezi na mwaka iliposajiliwa. Ikiwa biashara haijasajiliwa, muulize mdodoswaji mwezi na mwaka biashara ilipoanzishwa."}]},{"head":"4.","index":14,"paragraphs":[{"index":1,"size":22,"text":"Aina ya biashara [jina la biashara] inahusu nini -hili ni swali la chaguzi nyingi ambapo unapaswa kunakili shughuli zote ambazo biashara inashiriki."}]},{"head":"5.","index":15,"paragraphs":[{"index":1,"size":40,"text":"Ikiwa biashara ni ya mifugo na mazao ya mifugo, ni ipi? --ikiwa biashara inahusu mifugo na mazao ya mifugo, basi hili ni swali la chaguzi nyingi ambapo unapaswa kunakili mifugo na mazao yote ya mifugo ambayo biashara hiyo inajishughulisha nayo."},{"index":2,"size":44,"text":"6. Ukubwa wa biashara (kwa idadi ya wafanyakazi): -tafadhali nakili idadi ya wafanyakazi (aina zinazotolewa). Hii inajumuisha mmiliki ikiwa anajishughulisha na biashara hiyo. Hii inapaswa kuwatenga wanakaya wengine wowote ambao wanaweza kuwa wanasaidia katika biashara lakini hawapati mishahara au marupurupu kutoka kwa biashara hiyo."}]},{"head":"7.","index":16,"paragraphs":[{"index":1,"size":48,"text":"Idadi ya matawi ya kudumu/viduka vya nje vya biashara hiyo -tafadhali nakili matawi ya kudumu au viduka vyovyote vya nje vya kudumu ambavyo biashara inayo. Hii haijumuishi maeneo makuu ya biashara hiyo (ikiwa biashara ina eneo) -kwa taarifa yako, maelezo kuhusu majengo yatanakiliwa baadaye katika moduli ya raslimali."}]},{"head":"8.","index":17,"paragraphs":[{"index":1,"size":37,"text":"Idadi ya wafanyakazi wa kudumu katika biashara -kutoka kwa swali la 6, hapa unapaswa kutaja jumla ya idadi ya wafanyakazi wa kudumu walioajiriwa katika biashara, yaani wale wanaopata mshahara na wanatarajiwa kukaa katika biashara kwa muda mrefu."}]},{"head":"V. MODULI G1: KITAMBULISHO CHA MTU BINAFSI","index":18,"paragraphs":[{"index":1,"size":44,"text":"Jalada: Tafadhali hakikisha kuwa taarifa iliyokusanywa katika kila sehemu inayofuata ya dodoso inalingana na taarifa iliyonakiliwa katika moduli za awali. Kwa mfano, kuwa na kitambulisho sahihi cha kaya na kitambulisho cha mtu binafsi (kitambulisho sawa katika orodha ya kaya Moduli B) ni muhimu sana."},{"index":2,"size":50,"text":"G1.01. Utambulisho wa kaya -hiki ni kitambulisho cha kipekee kilichopewa kila kaya. Kinaweza kuwa nambari au nambari pamoja na herufi. Kabla ya kuelekea kwenye kaya yoyote, hakikisha kwamba msimamizi wako amekupa kitambulisho cha kaya ambayo unaenda kuidodosa. Andika kitambulisho cha kaya ulichopewa kwa urahisi wa kurejelea mara tu unapoanza dodoso."},{"index":3,"size":86,"text":"• Kidokezo kwa wasimamizi wa uchunguzi: Kitambulisho bora cha kutumia cha Kaya ni 'Kitambulisho chenye maarifa cha Kaya ' ambacho hutoa habari zaidi kuliko nambari tu. Hizi zinatolewa vyema katika umbo la nambari na herufi ambapo kwa mfano, herufi ya kwanza inawakilisha nchi, herufi ya pili inawakilisha wilaya/kata/woreda n.k., na kufuatiwa na tarakimu kwa kila kaya. Kwa mfano, kaya zilizododoswa katika Kaunti ya Nairobi (Kenya) zinaweza kupewa vitambulisho vya kaya kama KENAI001 … KENAI300 (KE=Kenya, NAI=Nairobi, 001=kaya ya kwanza kudodoswa na 300= kaya ya 300 kudodoswa)."},{"index":4,"size":19,"text":"• Kidokezo kwa mdodosaji na wasimamizi: Tafadhali hakikisha kwamba kitambulisho cha kaya ni sahihi (kutoka kwenye orodha ya sampuli)."}]},{"head":"G1.02.","index":19,"paragraphs":[{"index":1,"size":41,"text":"Jina la mdodoswaji anayedodoswa -Hili ni mahususi kwa kumtambulisha mtu anayedodoswa kwa jina (msimbo kutoka kwa orodha katika Sehemu B): Toa jina kwa mpangilio ufuatao: Jina la ukoo, Jina la kwanza. Jina la ukoo ni sawa na liitwalo 'Jina la Mwisho'."}]},{"head":"G1.03.","index":20,"paragraphs":[{"index":1,"size":11,"text":"Jinsia ya mdodoswaji -Jinsia ya mdodoswaji ipeanwe kama Mwanaume au Mwanamke."},{"index":2,"size":33,"text":"Nidhamu ya kazi: Usiulize swali hili kama jinsia ni dhahiri, aidha kwa jina au kwa uchunguzi wa kimwili. Hata hivyo, uliza wakati una shaka na mwanakaya hayupo kwa hiyvo huwezi kudhariri jinsia yake."},{"index":3,"size":40,"text":"G1.03a. Unamdodosa nani? -Hii ni mahususi kwa kumtambua mtu anayedodoswa, ikiwa ni mfanyabiashara mwanamke mwanamke kielelezo) au mfanyabiashara wa kiume (Mwanaume kielelezo) au wadodoswaji wa upili (mwanaume/mwanamke au mwanakaya wa mwanaume/mwanamke kielelezo) ambapo watu wawili wanapaswa kudodoswa kutoka kila kaya/biashara."}]},{"head":"G1.04","index":21,"paragraphs":[{"index":1,"size":46,"text":"Aina ya kaya ya mdodoswaji -swali hili linanakili ikiwa kaya limeundwa na wanaume na wanawake wazima (kaya ya watu wazima wawili) au kaya ya watu wazima wa jinsia moja kwa mfano, kaya ya watu wazima wa kike pekee au kaya ya watu wazima wa kiume pekee."},{"index":2,"size":64,"text":"G1.05. Matokeo ya dodoso: -Swali hili linaweza pia kuwekwa mwishoni mwa utafiti. Pale ambapo orodha ya wajasiriamali mahususi imetolewa kwa ajili ya utafiti, tafadhali hakikisha kuwa dodoso limejazwa hadi sehemu hii hata kama hukumpata uliyeelekezwa kumdodosa katika kaya kwa sababu moja au nyingine. Tumia misimbo inayofaa kuonyesha kuwa umekamilika ikiwa umeitambua kaya na umeweza kufanya dodoso. Au kwa nini kaya husika haikushirikishwa kwenye dodoso."},{"index":3,"size":36,"text":"G1.06. Uwezo wa kuhojiwa peke yako: Ni muhimu kuonyesha kama uliweza kumdodosa mdodoswaji peke yako au walikuwepo watu wengine wakati wa dodoso. Tafadhali chagua msimbo unaofaa ili kutoa taarifa juu ya wale waliokuwepo wakati wa dodoso."},{"index":4,"size":30,"text":"G1.07. Nafasi ya umiliki ya mdodoswaji katika biashara: nakili nafasi ya mdodoswaji katika biashara yaani iwapo mdodoswaji ni mmiliki wa biashara (mmiliki pekee au wa pamoja), muwekezaji, mfanyakazi, mwanakaya n.k."},{"index":5,"size":43,"text":"Kumbuka: Kwa utafiti wa WELBI, inashauriwa kumdodosa mmiliki wa biashara (na pale ambapo watu wawili wanahojiwa kwa kila biashara, mdodoswaji wa pili anapaswa kuwa mpenzi au mtu mzima wa jinsia tofauti na mdodoswaji mkuu, ambaye anahusika katika kufanya maamuzi. katika ngazi ya kaya/biashara."}]},{"head":"G1.08.","index":22,"paragraphs":[{"index":1,"size":16,"text":"Cheo cha kazi ya mdodoswaji katika biashara -hii inanakili tu kazi ambayo mdodoswaji anafanya katika biashara."}]},{"head":"G1.09. Muda wa kufanya kazi katika biashara[miaka] -hii inanakili tu muda ambao mdodoswaji","index":23,"paragraphs":[{"index":1,"size":5,"text":"amekuwa akifanya kazi katika biashara."}]},{"head":"Ikiwa ni mfanyakazi, ni shughuli gani za biashara anazosimamia: (chaguo nyingi) -hii inanakili","index":24,"paragraphs":[{"index":1,"size":18,"text":"shughuli za kazi ambazo mdodoswaji hufanya katika biashara. Kumbuka: wote wajibu swali hili isipokuwa wakati mdodoswaji ni mwekezaji."}]},{"head":"VI. MODULI B: ORODHA YA KAYA NA DEMOGRAFIA ()","index":25,"paragraphs":[]},{"head":"Mdodosaji: Uliza maswali haya kuhusu wanakaya wote","index":26,"paragraphs":[{"index":1,"size":42,"text":"Tafadhali tanguliza sehemu kwa kumwambia mdodoswaji: \"kuanza mjadala, ningependa kuzungumza kwa kifupi kuhusu kila mwanakaya wako, yaani, majina yao, uhusiano wake na mdodoswaji mkuu na tarehe zao za kuzaliwa. Tafadhali orodhesha majina ya kila mtu anayechukuliwa kuwa mwanakaya hii, kuanzia mdodoswaji mkuu.\""},{"index":2,"size":27,"text":"B01: Jina la mwanakaya -uliza majina ya kila mmoja wa wanakaya, kuanzia mdodoswaji mkuu akifuatiwa na mdodoswaji wa upili na wanakaya wengine kutoka mkubwa kiumri hadi mdogo."},{"index":3,"size":22,"text":"Toa jina kwa mpangilio ufuatao: Jina la Ukoo, Jina la Kwanza. Jina la ukoo ni sawa na kile kinachoitwa 'Jina la mwisho.'"}]},{"head":"B02:","index":27,"paragraphs":[{"index":1,"size":12,"text":"Jinsia ya [JINA] -Jinsia ya kila mwanakaya itatolewa kuwa Mwanaume au Mwanamke."},{"index":2,"size":29,"text":"Nidhamu ya kazi: Usiulize swali hili kama jinsia ni dhahiri, aidha kwa jina au kwa uchunguzi wa kimwili, hata hivyo, uliza wakati una shaka na mwanakaya hayupo ili kubainiwa."},{"index":3,"size":24,"text":"B03: Je, [JINA] ana uhusiano gani na mdodoswaji mkuu? -Hapa unauliza, kwa kila mwanakaya, jinsi wanavyohusiana na mdodoswaji mkuu, na si mkuu wa kaya."}]},{"head":"B04:","index":28,"paragraphs":[{"index":1,"size":19,"text":"[JINA] alizaliwa lini? (miaka YYYY) -Mbinu bora ya kupata umri wa mwanakaya ni kuuliza ni lini (mwaka), mwanakaya alizaliwa."},{"index":2,"size":23,"text":"B05: Je, hali ya ndoa ya [JINA] ni ipi? -Hapa unanakili ikiwa mwanakaya yumo katika ndoa, na ikiwa hayupo, yupo kwenye hali gani."},{"index":3,"size":18,"text":"B06: Je, [JINA] tayari amehudhuria shule? -Hapa unauliza, kwa kila mwanakaya kama amepata elimu yaani iwapo alihudhuria shule."},{"index":4,"size":44,"text":"B07: Je, ni kiwango gani cha juu cha elimu kilichofikiwa na [JINA]? -hili linaulizwa tu kwa wanakaya ambao wamehudhuria shule. Inakuja katika sehemu mbili, kwanza unauliza ni kiwango gani cha shule (mfano shule ya msingi, sekondari, chuo kikuu n.k) mwanakaya amemaliza au alifikia wapi."},{"index":5,"size":13,"text":"Kwa viwango visivyokamilika: Ni kiwango cha miaka mingapi aliyotimiza shuleni kabla kusitisha masomo?"},{"index":6,"size":18,"text":"B08: Je, [JINA] amefuata mafunzo yoyote ya ufundi stadi? -hapa, uliza ikiwa mwanakaya amehudhuria mafunzo yoyote ya ufundi."},{"index":7,"size":14,"text":"B09: Je, [JINA] yuko shuleni kwa sasa? -uliza kama mwanakaya anahudhuria shule kwa sasa."},{"index":8,"size":15,"text":"Kumbuka: Maswali B6-B9 yanapaswa kuulizwa kwa wanakaya walio na umri wa zaidi ya miaka 4."},{"index":9,"size":57,"text":"B10: Je, [JINA] anafanya kazi katika biashara? -hakikisha ikiwa kila mmoja wa wanakaya (ambao wana umri wa zaidi ya miaka 4) anafanya kazi katika biashara, iwe ya muda kamili baadhi ya masaa. Hili linapaswa kuulizwa hata kama mwanakaya hajaajiriwa katika biashara, kwa mfano mtoto anayesoma lakini humsaidia mama katika biashara ya kilimo wakati wa likizo ya shule."},{"index":10,"size":33,"text":"B11: Je, jukumu la [JINA] katika biashara ni gani? -kwa wale ambao mdodoswaji ambao wameashiria kuajishughulisha na biashara, iwe kwa muda wote au la, katika B10, uliza ni jukumu gani wanalofanya katika biashara."}]},{"head":"VII. MODULI D: DEMOGRAPHIKI ZA UJASIRIAMALI WA BIASHARA","index":29,"paragraphs":[{"index":1,"size":19,"text":"Mdodosaji: Uliza maswali haya kuhusu angalau washiriki 5 wa biashara ambao si wanakaya wanaojishughulisha zaidi katika maamuzi ya biashara."},{"index":2,"size":36,"text":"Tanguliza sehemu hii kwa kumwambia mdodoswaji kuwa: \"Ningependa kukuuliza maswali kuhusu angalau wanachama 5 ambao si wanakaya wanaofanya maamuzi katika biashara yaani watu ambao umewaajiri au wafanyakazi wenzako katika biashara wanaofanya maamuzi kuhusu uendeshaji wa biashara\"."},{"index":3,"size":52,"text":"D13: Jina-uliza majina ya kila mmoja wa washiriki wa hiyo biashara, kuanzia mdodoswaji mkuu, akifuatiwa na mmiliki wa biashara (kama mdodoswaji mkuu si mmiliki) na wanachama wengine kwa mpangilio wa kuelekea chini wa cheo. D21: Je, [JINA] amefanya mafunzo yoyote ya ufundi stadi? -hapa, uliza ikiwa mwanakaya amehudhuria mafunzo yoyote ya ufundi."}]},{"head":"VIII. MODULI G2: NAFASI KATIKA KUFANYA MAAMUZI KUHUSU SHUGHULI ZA BIASHARA","index":30,"paragraphs":[{"index":1,"size":71,"text":"Madhumuni ya moduli hii ni kupata wazo kuhusu majukumu ya wanakaya na washiriki wengine katika biashara unayoiangazia (wanaume na wanawake) katika kufanya maamuzi kuhusu shughuli za biashara. Usijaribu kuhakikisha kuwa majibu ni sawa kati ya mdodoswaji wa kiume na wa kike katika kaya. Ni sawa kwao kuwa na jibu tofauti. Pia usimdodosemdodoswaji mkuu akiwa pamoja na mdodoswaji wa upili pa, dodosa mmoja baada ya mwingine au mwambie mwenzako amdodose huyo mwingine."},{"index":2,"size":48,"text":"Majibu ya swali kuhusu ni nani anayefanya uamuzi yanapaswa kunakiliwa kwa kuchagua misimbo ya vitambulisho (kutoka sehemu ya ratiba ya kaya na biashara -Moduli B na D) iliwezesha kulinganisha maamuzi na sifa za wadodoswaji binafsi. Wabunifu wa utafiti wanapaswa kuingiza mifano ya ziada, ya ndani ya shughuli inapofaa."},{"index":3,"size":50,"text":"Tafadhali tanguliza sehemu kwa kumwambia mdodoswaji kuwa ungependa kuuliza baadhi ya maswali kuhusu ushiriki wake na washiriki wengine katika kufanya maamuzi ya ainatofauti kwa shughuli za kazi katika vipengele mbalimbali vya shughuli zao za biashara. Maswali yanahusu shughuli mbalimbali, huku msisitizo maalum ukiwa katika shughuli zinazohusiana na biashara ya mifugo."},{"index":4,"size":5,"text":"Moduli hii inajumuisha maswali yafuatayo:"},{"index":5,"size":34,"text":"• G2.01: Je, (JINA) alishiriki katika [SHUGHULI] katika muda wa miezi 12 iliyopita yaani, kutoka [MWEZI ULIOPO] mwaka jana hadi [MWEZI ULIOPO] mwaka huu? Swali hili linajibiwa na NDIYO au HAPANA. Tafadhali kumbuka yafuatayo:"},{"index":6,"size":84,"text":"o Muda wa marejeleo wa swali hili daima ni miezi 12. Katika baadhi ya matukio, kwa shughuli zinazohusiana na uzalishaji wa mazao, itasaidia kumwomba mdodoswaji afikirie kuhusu misimu miwili ya mwisho ya upanzi kama eneo lina msimu wa mazao mara mbili kwa mwaka. Katika hali nyingine, muda wa marejeleo unapaswa kuwa idadi ya misimu ya upanzi kulingana na idadi ya misimu ya upanzi kwa mwaka, uingiliaji kati na muda kati ya tafiti. Hili linapaswa kuamuliwa na kusawazishwa wakati wa kipindi cha mafunzo ya utafiti."},{"index":7,"size":58,"text":"o Katika baadhi ya lugha kuna umoja wewe na wingi wewe. Swali hili linarejelea umoja wewe (mtu anayedodoswa, wala si mdodoswaji pamoja na kaya yake). Ikiwa lugha ya kiasili haitofautishi kati ya umoja au wingi, hakikisha mdodoswaji anaelewa kuwa hili linamhusu yeye pekee (Hili pia litatumika kwa maeneo mengine yote ambapo tunakuuliza 'wewe' katika dodoso ya mtu binafsi)."},{"index":8,"size":30,"text":"o Ikiwa mdodoswaji atajibu 'hapana' hakushiriki katika shughuli, basi endelea na maswali kwenye shughuli inayofuata. o Ikiwa kuna watoa maamuzi zaidi ya 3, mwambie mdodoswaji ataje 3 walio muhimu zaidi."},{"index":9,"size":94,"text":"o Kumbuka: ikiwa mdodoswaji anajibu 'binafsi' pekee (yaani hakuna watoa maamuzi wengine waliotajwa isipokuwa mdodoswaji mwenyewe), basi elekea kwa swali G2.05. Maswali G2.03 na G2.04 huuliza kuhusu kiwango cha mchango na udhibiti ambao mdodoswaji anahisi anao katika shughuli, lakini ikiwa anaonyesha kuwa yeye peke yake ndiye anayefanya uamuzi, basi tunaweza kuchukulia kwa uhakika kuwa mdodoswaji ana kiwango cha juu cha mchango na udhibiti wa maamuzi hayo. o Katika baadhi ya matukio, katika lugha ya kiasili G2.03 inapaswa kuulizwa kama maswali mawili tofauti (kwanza uliza ikiwa mchango wowote umetolewa, kisha uulize kiwango cha mchango huo)."},{"index":10,"size":19,"text":"• G2.04: Je, unahisi unaweza kushiriki kwa kiasi gani katika maamuzi kuhusu [SHUGHULI] hii ikiwa unataka au ulitaka kushiriki?"},{"index":11,"size":70,"text":"o Weka alama ya mviringo jibu moja kutoka kwa kategoria zifuatazo: Sivyo kabisa…………………………….01 Kiwango kidogo ……………………………02 Kiwango cha wastani………………………….03 Kwa kiwango cha juu ………………………….04 o Hata kama mdodoswaji hakushiriki katika maamuzi, anaweza kuwa anafanya hivyo kwa hiari, kama vile uamuzi unapokabidhiwa kwa wengine, au ikiwa mdodoswaji hana haja ya kujishughulisha katika shughuli au uamuzi fulani. Swali hili linakusudiwa kunakili ikiwa mdodoswaji anaweza kushiriki katika mchakato wa kufanya maamuzi ikiwa angetataka."},{"index":12,"size":69,"text":"• G2.05: Je, ulikuwa na mchango kiasi gani katika maamuzi kuhusu jinsi ya kutumia mapato o Msimbo wa 98 ('hautumiki') unapaswa kuandikwa katika hali ambapo uamuzi haujafanywa, kwa mfano, hakuna mapato yaliyotolewa au bidhaa/huduma hazikuuzwa kwa hivyo mapato hayakuzalishwa. Kwa hali yoyote, swali hili lisiachwe bila kujazwa. Ikiwa jibu lililotolewa kwa swali lolote la G2.03 au G2.05 ni 'haitumiki au hakuna uamuzi uliofanywa' basi endelea na maswali kwenyeshughuli inayofuata."},{"index":13,"size":9,"text":"Kwa safumlalo B hadi L, maswali G2.05 hayafai kuulizwa."}]},{"head":"Vipengee ndani ya Jedwali G2.01 -G2.05B","index":31,"paragraphs":[{"index":1,"size":39,"text":"Katika baadhi ya matukio wadodoswaji watahitaji maelezo zaidi kuhusu vipengee vilivyomo katika jedwali. Mdodosaji anaweza kutumia mifano rahisi kueleza. Mifano inaweza kuelezwa kulingana na shughuli maalum zinazofanywa na kaya katika eneo la uchunguzi. Hapa kuna mifano ambayo inaweza kutumika:"},{"index":2,"size":50,"text":"• A. Kuuza bidhaa na/au huduma kwa wateja au kutangamana nawateja moja kwa moja: Kwa mfano, ulikuwa na mchango katika maamuzi kuhusu aina gani ya bidhaa, muda wa kuuza, kiasi cha kuuza na kwa nani na/au kuwasiliana na wateja kuhusu mauzo ya huduma au bidhaa ambazo biashara hii hushughulika nazo?"},{"index":3,"size":33,"text":"• B. Kushughulikia na/au kuhifadhi bidhaa: Kwa mfano, je, ulikuwa na mchango katika maamuzi kuhusu aina gani ya uhifadhi, uchakataji au shughuli zingine zinazohusisha kushughulikia na/au kuhifadhi bidhaa ambazo biashara hii hushughulika nazo?"},{"index":4,"size":61,"text":"• H. Ununuzi wa kawaida wa biashara (pamoja na vifaa vya ofisi na vifaa vingine vya matumizi kwa mahitaji ya biashara): Kwa mfano, je, ulikuwa na mchango katika ununuzi wa kawaida wa biashara, kama vile ununuzi wa vifaa vya ofisi, au bidhaa/huduma zingine ambazo biashara hutumia (hizi bidhaa/huduma sio zile ambazo biashara hii hushughulika nazo bali ni za matumizi kwa biashara)?"}]},{"head":"IX. MODULI G3(A) : UFIKIAJI WA MTAJI WENYE TIJA","index":32,"paragraphs":[{"index":1,"size":93,"text":"Tafadhali tanguliza sehemu kwa kumwambia mdodoswaji kwamba ungependa kuzungumzia mahali ambapo yeye au mwanakaya wake wanaendesha biashara inayohusiana na ufugaji. Maswali G3.01 hadi G3.06 G3.01.: Muulize mdodoswaji kama biashara kwa sasa inamiliki sehemu (maeneo) inapofanyia kazi (kama vile eneo la kutunzia vifaranga, duka, zizi la mifugo wa kuuzwa n.k.)? G3.10. Muulize mdodoswaji kama yeye (binafsi au kwa pamoja na wengine), anamiliki sehemu hizo (maeneowanapofanyia biashara). Kumbuka kuwa haya ni maswali mawili-ndani ya moja (21) kwa hivyo hakikisha kuwa jibu unalopata linajumuisha maswali yote mawili yaani, kumiliki na jinsi inavyomilikiwa (binafsi, kwa pamoja n.k)."}]},{"head":"G3.09.:","index":33,"paragraphs":[{"index":1,"size":97,"text":"Muulize mdodoswaji kama kuna mtu yeyote katika kaya yake akiwemo yeye mwenyewe, anayemiliki ardhi yoyote kwa sasa isipokuwa eneo lake la biashara au makazi? Kama jibu ni ndiyo, kwa kumiliki ardhi ambapo biashara ipo sasa au ndiyo kwa kumiki ardhi ya makazi, nakili NDIYO. Ikiwa HAPANA, nakili HAPANA kisha nenda kwa swali G3.11, BIDHAA A. G3.10. Muulize mdodoswaji kama yeye (binafsi), anamiliki ardhi yoyote inayomilikiwa au inayolimwa na kaya yake. Kumbuka kuwa haya ni maswali mawilindaniya moja (2-1) kwa hivyo hakikisha kuwa jibu unalopata linajumuisha maswali yote mawili yaani, kumiliki na jinsi inavyomilikiwa (binafsi, kwa pamoja n.k)."}]},{"head":"Jedwali G3.11 -G3.12","index":34,"paragraphs":[{"index":1,"size":33,"text":"Tanguliza sehemu hii kwa kumwambia mdodoswaji kuwa ungependa kuzungumzia idadi ya vitu ambavyo vinaweza kutumika katika biashara zinazohusiana na ufugaji. Chagua kipengee kimoja kwa wakati mmoja na umuulize mdodoswaji maswali G3.11 hadi G3.12."}]},{"head":"G3.06: Muulize mdodoswaji kama kuna mtu yeyote ana [KITU] chochote anachotumia katika biashara unayoianzazia? [KITU].","index":35,"paragraphs":[{"index":1,"size":12,"text":"G3.07: Muulize mdodoswaji kama yeye (binafsi), anamiliki hicho [KITU]/baadhi ha hivyo vitu."}]},{"head":"X. MODULI G3 (B): UFIKIAJI WA MKOPO","index":36,"paragraphs":[{"index":1,"size":13,"text":"Moduli hii ina maswali juu ya ufikiaji wa mkopo. Mambo machache ya kuzingatia:"},{"index":2,"size":132,"text":"• Vyanzo vya ukopeshaji vinaweza kurekebishwa kulingana na muktadha wa nchi/utafiti. Hata hivyo ni muhimu kuhakikisha kwamba vimefautishwa kutoka kwa kila kimoja na kutohesabu aina yeyote mara mbili. Ikiwa lugha ya asili haitofautishi kati ya aina ya vyanzo kadhaa vwa mikopo, vyanzo vinaweza kuunganishwa kuwa moja. Kwa mfano, ikiwa shirika lisilo la kiserikali na mikopo midogo ya vikundi au ukopeshaji ni sawa katika muktadha wa kiasili (ikiwa vikundi vidogo vya mikopo zinaendeshwa kupitia Mashirika yasiyo ya Kiserikali), basi ni sawa kuviweka vyanzo hivi viwili kuwa kimoja. Katika hali hii kutakuwa na vyanzo vitano badala ya sita. Kamwe chanzo kile kile cha mikopo kisihesabiwe chini ya chanzo kingine. Iwapo unahisi kuwa anachoeleza mdodoswaji kinaweza kuwa chini ya vyanzo viwili au zaidi, tumia uamuzi na ukiweke chini ya aina moja unayohisi kuwa bora zaidi."},{"index":3,"size":33,"text":"• Muda wa kurejesha ni ndani ya mwaka uliopita; hata hivyo, ikiwa chanzo cha mkopo kimekuwa kikiendelea kwa zaidi ya mwaka 1 (yaani, mkopo wa miaka mingi ulioanza miaka 2 iliyopita) unapaswa kuhesabiwa."},{"index":4,"size":19,"text":"• 'Mkopo wa bidhaa' unarejelea mkopo unaotolewa kwa njia ya bidhaa au huduma tofauti na mkopo wa pesa taslimu."},{"index":5,"size":18,"text":"• 'Wakopeshaji wasio rasmi' inarejelea wakopeshaji pesa/bidhaa/huduma na wengine ambao HAWAJAJUMUISHWA katika mojawapo ya vyanzo vingine vya mikopo."},{"index":6,"size":59,"text":"• Kumbuka kuwa swali G3.16 halijajumuishwa katika hesabu ya pro-WEAI. Hata hivyo, tunapendekeza uliulize, kwa kuwa inakuruhusu kubainisha ikiwa watu binafsi wanaweza kukopa kutoka vyanzo mahususi, hata kama hawakujaribu mwaka uliopita kabla ya dodoso. Hii ni muhimu kwa upangaji wa mikakati na miradi, kwa sababu inaonyesha iwapo kuna kikwazo cha mkopo katika suala la mahitaji ambayo hayajafikiwa ya mkopo."},{"index":7,"size":32,"text":"• Kwa upande wa G317, katika baadhi ya matukio huenda mtu binafsi asijue kama wanakaya wengine wamefikia au kutumia aina mahususi ya mkopo, na katika hali hii jibu 97 'Sijui' linaweza kuchaguliwa."},{"index":8,"size":42,"text":"• Kwa G3.18 Dodosa na urekodi hadi watu 3 (wanakaya ama washiriki biashara husika); hakikisha unamchunguza mdodoswaji na kuuliza, 'kuna mtu mwingine yeyote anayeshiriki maamuzi haya?' G3.18 (katika toleo la FULLBARE na XS) : Katika swali hili, uliza kama mdodoswaji alihusika mwenyewe."},{"index":9,"size":36,"text":"• Swali la G3.21 linajumuisha akaunti binafsi za benki na akaunti za pamoja za benki. Haijumuishi akaunti za benki zinazomilikiwa na vikundi (VSLA, SACCOS, n.k.), hata kama mtu binafsi ni mtiaji saini kwenye akaunti za kikundi"},{"index":10,"size":41,"text":"• Swali la G3.22 linajumuisha huduma za kidijitali za kifedha (pesa zilizo kwenye simu). Hata hivyo, hili halijumuishi akaunti za pesa zilizo kwenye simu zinazomilikiwa na vikundi (VSLA, SACCOS, n.k.), hata kama mtu binafsi ni mtiaji saini kwenye akaunti za kikundi."}]},{"head":"XI. MODULI G6: UHAMASHIKA WA KIMWILI","index":37,"paragraphs":[{"index":1,"size":18,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu maeneo ambayo wanaume na wanawake huenda nje ya nyumbani kwao."},{"index":2,"size":14,"text":"• Q6.01: Katika miezi 12 iliyopita, ni mara ngapi kwa ujumla huwa unaenda [MAHALI]?"},{"index":3,"size":8,"text":"Misimbo ya mara ngapi anaweza kuwa anaenda, imeorodheshwa."},{"index":4,"size":33,"text":"• Tanbihi: Mahali F: mji unarejelea eneo la mjini au manispaa ya jiji. Tafadhali tumia sensa rasmi au ufafanuzi wa serikali wa eneo la mjini au manispaa ambayo inatumika katika muktadha wako mahususi."}]},{"head":"XII. MODULI G8(D): SAIKOLOJIA YA UJASIRIAMALI","index":38,"paragraphs":[{"index":1,"size":44,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu mtazamo wa ujasiriamali wa mdodoswaji yaani, mchanganyiko wa kipekee wa sifa, ujuzi, na mitazamo ambayo huwawezesha watu binafsi kutambua fursa, kukumbana na changamoto na kuzalisha thamani. Wajasiriamali waliofanikiwa wanasifa kadhaa muhimu zinazochangia mafanikio yao (Gartner, 2023)."},{"index":2,"size":25,"text":"Katika moduli hii, kuna taarifa 11 ambazo unapaswa kumsomea mdodoswaji na kumuuliza kama anakubali kabisa, anakubali, hakubaliani wala kukataa, au hakubaliani kabisa kuhusu yeye mwenyewe."},{"index":3,"size":101,"text":"Tanguliza sehemu hii kwa kumwambia mdodoswaji kuwa: \"Sasa nitakuuliza baadhi ya maswali kuhusu kile unachofikiria kujihusu. Tafadhali sikiliza kila moja ya kauli zifuatazo. Fikiria jinsi kila kauli inavyohusiana na maisha yako, kisha uniambie kama unakubali au hukubaliani na kauli hiyo\". Kidokezo: Kwa moduli hili na maswali sawia kama hayoyanajulikana kwa kimombo kama ya 'likert-scale', anza kwa kutafuta mwelekeo wa makubaliano, yaani kama anakubali, hakubaliani au ni mtu wastani (hakubali wala hakatai). Baada ya kupata mwelekeo, na ikiwa jibu ni kukubaliana au kutokubali basi uliza kiwango cha kukubaliana au kutokubali ili kuthibitisha ikiwa ni kukubaliana au kutokubali kwake kuna uzito kiasi gani."}]},{"head":"XIII. MODULI G12(A): UFIKIAJI WA USAFI WA KUAMINIKA","index":39,"paragraphs":[{"index":1,"size":20,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu ufikiaji wa usafi kwenye mazingira ambamo mdodoswaji hufanya biashara inayohusiana na ufugaji."},{"index":2,"size":86,"text":"Kwa a maswali matatu yalio katika moduli hii, unapaswa kudodosa na kunakili ikiwa mahali pa kazi au karibu na mahali pa kazi pa mdodoswaji, kuna mahali ambapo mdodoswaji anadhani ni salama na safi kuenda haja ndogo, haja kubwa, na kunawa mikono. Usalama katika swali hili unamaanisha kutokuwa na hofu ya kushambuliwa au kudhihakiwa. Kwa wadodoswaji ambao biashara yao ni ya kuhama/kusafiri hama (kuhama/kusafiri kutoka sehemu moja hadi nyingine kwa kuuza bidhaa na/au huduma), swali hili bado ni muhimu kwa kuwa popote walipo, wanaweza kufikia vifaa vinavyohitajika?"},{"index":3,"size":56,"text":"Kidokezo: Maswali yanaweza kuonekana kuwa yenye ugumu wa kujieleza na yana aibi kuzumgumzia kwa hivyo yashughulikie kwa unyenyekevu na ikihitajika, mhakikishie mdodoswaji usiri na faragha ya taarifa hiyo. Mjulishe mdodoswaji kwamba tunajaribu kubaini mapungufu ya kimuundo ambayo kwa kawaida ni chanzo cha ukosefu wa usawa, na ni changamotokwa uwezo wanaume na wanawake kufanya vizuri kama wajasiriamali."},{"index":4,"size":31,"text":"Mara tu unapojiamini kuwa mdodoswaji ameridhika kuendelea na sehemu hiyo, basi tanguliza sehemu hiyo kwa kumwambia mdodoswaji kuwa: \"Sasa, nitakuuliza baadhi ya maswali kuhusu ufikiaji wa vifaa vya usafi wa mazingira\"."}]},{"head":"XIV. MODULI G12(B): USIMAMIZI WA USAFI WA HEDHI","index":40,"paragraphs":[{"index":1,"size":30,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu ufikiaji wa usafi wa mazingira mahali pa mdodoswaji pa kufanyia biashara tunayoiangazia inyohusana na ufugaji. Hii ni sehemu ya wadodoswaji wanawake pekee."},{"index":2,"size":33,"text":"G12.05: CAPI: Je, mdodoswaji ni mwanamke? -swali hili ni lako la kujibu badala ya kumuuliza mdodoswaji. Hapa unapaswa kutumia mtazamo wa kawaida wa jamii kuhusu nani ni mwanamke na nani ni mwanaume (kibaolojia)."},{"index":3,"size":79,"text":"Kuna maswali nane katika moduli hii. Unapaswa kudodosa na kunakili tayari unafahamu kama katika au karibu na mahali pa kazi pa mdodoswaji, mwanamke anaweza kusimamia kwa usalama mahitaji yake ya usafi wa hedhi. Usalama katika swali hili unamaanisha kutokuwa na hofu ya kushambuliwa au kudhihakiwa. Kwa wadodoswaji ambao biashara yao ni ya kuhama au kusafiri (kuhama/kusafiri kutoka sehemu moja hadi nyingine ili kuuza bidhaa na/au huduma), swali hili bado ni faafu kwa kuwa popote walipo, wanaweza kufikia vifaa vinavyohitajika?"},{"index":4,"size":58,"text":"Kidokezo: Maswali yanaweza kuonekana kuwa yenye ugumu wa kujieleza na ya aibu kuzumgumzia kwa hivyo yashughulikie kwa unyenyekevu, na ikihitajika, mhakikishie mdodoswaji usiri na faragha ya taarifa hiyo. Mjulishe mdodoswaji kwamba tunajaribu kubaini mapungufu ya kimuundo ambayo kwa kawaida ni chanzo cha ukosefu wa usawa, na ni changamoto kwa uwezo wa wanaume na wanawake kufanya vizuri kama wajasiriamali."},{"index":5,"size":28,"text":"Mara tu unapojiamini kuwa mdodoswaji ameridhika kuendelea na sehemu hiyo, basi tanguliza sehemu hiyo kwa kumwambia mdodoswaji kuwa:\"Sasa, nitakuuliza baadhi ya maswali kuhusu uthibiti wa usafi wa hedhi\"."}]},{"head":"XV. MODULI G14: UNYANYASAJI WA KIMAPENZI","index":41,"paragraphs":[{"index":1,"size":25,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu unyanyasaji wa kimapenzi mahali pa kazi pa mdodoswaji. Hii ni sehemu ya wadodoswaji wote (wanaume na wanawake)."},{"index":2,"size":47,"text":"\"Hapo awali ulisema kuwa unatumia muda wako mwingi wa kazi unapatikana\" [MAHALI]. -swali hili ni lako kutumia pamoja na mdodoswaji (limeandaliwa kwa namna ya kutomfanya mdodoswaji ajisikie kuwa hukuwa makini alipokutajia aina ya kazi yake na mahali anapotumia muda mwingiambayo katika baadhi ya matukio inaweza kuwa nyepesi)."},{"index":3,"size":59,"text":"Moduli hii ina maswali matano. Katika moduli hii, unapaswa kujua ni mara ngapi mdodoswaji anafikiri kwamba [wanaume/wanawake -kutegemea jinsia ya mdodoswaji] wa umri wa mdodoswaji wanaoishi katika jamii ya mdodoswaji, wanapokuwa mahali pao pa kazi, wanapitia hali ambapo wengine huwaweka kwenye aina tofauti za ukatili wa kijinsia. Ukatili wa kijinsia katika hali hii ni pamoja na matukio ambapo wengine:"},{"index":4,"size":17,"text":"A Hufanya majaribio yasiyotakikana ya kuanzisha uhusiano wa kimapenzi au kingono nao licha ya jitihada za kuzikataa/kuzikemea."},{"index":5,"size":33,"text":"B Papasa kwa njia ya kimapenzi bila idhini C Kumfanya mtu ahisi kama anahongwa ili ajihusishe na vitendo ya ngono D Kumpendekezea kimapenzi mtu, kwa mfano kumwalika mtu kushiriki tendo la ndoa nao?"},{"index":6,"size":19,"text":"E Kumfanya mtu aogope kwamba atatendewa vibaya, kwa mfano kutishia mtu, kutompa kazi, au kumpuuzwa ikiwa hatakubali kushiriki ngono."},{"index":7,"size":31,"text":"Kumbuka: Kusisitizia mdodoswaji kwamba hapa hatuangazii hali iliyompata yeye binafsi bali tungependa kujua maoni yao ikiwa matukio haya hutokea kwa wengine (ambao ni kama wao, jinsia na makundi ya rika n.k.)."},{"index":8,"size":58,"text":"Kidokezo: Maswali yanaweza kuonekana kuwa yenye ugumu wa kujieleza na ya kusumbuaaibu kuzumgumzia kwa hivyo yashughulikie kwa unyenyekevu, na ikihitajika, mhakikishie mdodoswaji usiri na faragha ya taarifa hiyo. Mjulishe mdodoswaji kwamba tunajaribu kubaini mapungufu ya kimuundo ambayo kwa kawaida ni chanzo cha ukosefu wa usawa, na ni changamoto kwa uwezo wa wanaume na wanawake kufanya vizuri kama wajasiriamali."},{"index":9,"size":32,"text":"Mara tu unapoamini kuwa mdodoswaji ameridhika kuendelea na sehemu hiyo, tanguliza sehemu hiyo kwa kumwambia mdodoswaji kwamba \"Linalofuata, nitakuuliza baadhi ya maswali kuhusu unyanyasaji wowote ambao mtu anaweza kupata wakati akijipatia riziki\"."}]},{"head":"XVI. MODULI G9: MITAZAMO KUHUSU MIGOGORO YA NYUMBANIDHIDI YA","index":42,"paragraphs":[]},{"head":"WANAWAKE","index":43,"paragraphs":[{"index":1,"size":48,"text":"Madhumuni ya moduli hili ni kupata taarifa juu ya mitazamo na imani kuhusu kuvumiliana kwa kutokea kwa migogoro dhidi ya wanawake katika mahusiano ya kimapenzi. Maswali katika moduli hii hayaulizi kuhusu kuathirika kwa mdodoswaji kibinafsi bali ni kupata mitazamo ya mdodoswaji kuhusu migogoro ya nyumbani dhidi ya wanawake."},{"index":2,"size":9,"text":"• MUHIMU: Maswali haya yanahitajika kwa wanaume na wanawake."},{"index":3,"size":19,"text":"• Hata kama mdodoswaji hana mpenzi (hajawahi oa, kutengana walakutalakiwa au ni mjane) uliza swali kwa njia hiyo hiyo."},{"index":4,"size":58,"text":"Kidokezo: Maswali yanaweza kuonekana kuwa yenye ugumu wa kujieleza na ya aibu kuzumgumzia kwa hivyo yashughulikie kwa unyenyekevu, na ikihitajika, mhakikishie mdodoswaji usiri na faragha ya taarifa hiyo. Mjulishe mdodoswaji kwamba tunajaribu kubaini mapungufu ya kimuundo ambayo kwa kawaida ni chanzo cha ukosefu wa usawa, na ni changamoto kwa uwezo wa wanaume na wanawake kufanya vizuri kama wajasiriamali."}]},{"head":"XVII. MODULI G17: LESENI","index":44,"paragraphs":[{"index":1,"size":25,"text":"Madhumuni ya moduli hii ni kupata maelezo kuhusu uwezo wa mdodoswaji kulipia leseni/vibali vinavyohitajika, na kama anaweza kulipa kwa wakati mara kwa mara leseni/vibali vinavyohitajika."},{"index":2,"size":77,"text":"Unapaswa kwanza kujua ikiwa biashara hiyo inayohusiana na mifugo, ambayo mdodoswaji ni muhusika, inahitaji kulipia leseni. Kisha uliza ni mara ngapi biashara hiyo ianaweza kulipia, kulingana na ni mara ngapi wanatakiwa kulipa, iwapo ni kila mwaka, robo mwaka au ni malipo ya mara moja. Kumbuka kuangazia vipengele vya kiasili vya leseni/vibali vya ndani na wajulishwe kuhusu mahitaji yao kabla ya kuanza utafiti ili unapouliza swali, uweze kupima kama mdodoswaji alielewa swali, ikiwa hapana, unaweza kuuliza swali upya."}]},{"head":"XVIII. MODULI G5: UANACHAMA WA VIKUNDI","index":45,"paragraphs":[{"index":1,"size":22,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu ufikiaji wa mtaji wa kijamii kwa wanaume na wanawake kupitia vikundi (uwezo wa kikundi)."},{"index":2,"size":4,"text":"Mambo machache ya kuzingatia:"},{"index":3,"size":15,"text":"• Kumbuka kuwa vikundi katika jamii vinaweza kuwa rasmi u visivyo rasmi na vya kimila."},{"index":4,"size":74,"text":"• Kumbuka ya kwamba kuwa mwanakaya 'hai' wa kikundi kunapaswa kufafanuliwa na mdodoswaji (yaani wazo lake la kibinafsi la nini kuwa mwanakaya kunahusisha). Ukiulizwa na mdodoswaji, unaweza kuashiria kuwa uanachama 'hai' unaweza kujumuisha kuhudhuria mikutano, kulipa ada ya mtumiaji, kuwa na cheo cha uongozi ndani ya kikundi, n.k. Aidha, eleza kuwa kuna tofauti nyingi sana katika aina ya kikundi hadi kuwa na ufafanuzi uliosawazishwakuhusu mwanakaya hai kwa hivyo mhimize mdodoswaji kutumia uamuzi wake mwenyewe."},{"index":5,"size":27,"text":"• Kumbuka kuwa 'jamii' imeachiwa mdodoswaji kufafanua na inaweza kuwa vikundi ndani ya kijiji chake au kujumuisha anuwai kubwa ya kijiografia ikijumuisha kijiji au jiji la karibu."},{"index":6,"size":76,"text":"• Kumbuka kuwa vikundi vingi vina shughuli nyingi. Kwa mfano, kikundi cha kilimo kinaweza pia kujishughulisha na akiba na mikopo. Wakati hali ikiwa hivi, chagua aina ya kikundi kinachowakilisha shughuli ya msingi ya hicho kikundi. Ikiwa kikundi cha wakulima kinatoa huduma za ugani kwa wingi, ikiwa ni pamoja na akiba na mikopokwa kiasi kidogo, basi kikundi hicho ni cha kilimo wala si kikundi cha akiba na mikopo. Muulize mdodoswaji aelezee kikundi kwa undani zaidi, ikiwa haieleweki."},{"index":7,"size":26,"text":"• Ikiwa kundi fulani si faafu kimuktadha,' linaweza kubadilishwa na kundi linalofaa katika kategoria sawa; kama hakuna ubadala uliopo wa kubadilishwa unaweza kuondolewa kutoka kwa dodoso."},{"index":8,"size":18,"text":"Ikiwa kuondoa kikundi au kutoshiriki inapaswa kuamuliwa wakati wa mafunzo; kikundi hakipaswi kamwe kuondolewa wakati wa kufanya dodoso."}]},{"head":"XIX. MODULI G4: MGAO WA MUDA","index":46,"paragraphs":[{"index":1,"size":92,"text":"Madhumuni ya moduli hii ni kupata wazo kuhusu jinsi muda wa wanaume na wanawake unavyotumika. Aina za shughuli na muda unaotumika kufanya shughuli hizo zinaweza kutumika katika uchambuzi wa kiuchumi na kijamii, kwa mfano mchango wa wanawake katika shughuli za kiuchumi; thamani ya uzalishaji wa nyumbani na sekta isiyo rasmi; tija; ukosefu wa wakati na mengine. Tunavutiwa sana na shughuli za biashara na shughuli zingine kama vile kilimo, kilimo cha bustanina ufugaji shambani au nyumbani. Pia tunavutiwa kujua ni muda gani unaotumika kuwatunza watoto, haswa iwapo itafanyika wakati mdodoswaji anafanya shughuli zingine."},{"index":2,"size":27,"text":"G4.01: Tafadhali rekodi kumbukumbu ya shughuli za mtu binafsi katika saa 24 kamili zilizopita (kuanzia jana asubuhi saa 10 asubuhi, kumaliza 9:59 asubuhi ya siku ya iliyopo)."},{"index":3,"size":53,"text":"G4.02: Weka alama ya kuteuwa kwenye kisanduku hiki ikiwa mdodoswaji pia alimtuza mtoto au watoto wakati akifanya shughuli nyingine. Kwa swali hili, kuwatunza watoto ni pamoja na kuwajali 'kikweli' (mfano: kulisha, kuosha mtoto) na kujali 'kwingine' (mfano: kuteka maji maji huku akibeba mtoto mtoto). Kumbuka: Hili linapaswa kuulizwa wakati shughuli za msingi zinajazwa."},{"index":4,"size":63,"text":"• Muda wa kuanza kuchunguza huanza saa 10 asubuhi ili kujumuishashughuli za mapema ikiwa mwanakaya aliamka mapema sana. Inasaidia sana kujaza jedwali hili wakati wa mazungumzo na mdodoswaji, badala ya kuwauliza walichokuwa wakifanya katika 10:15, 10:30, 10:45 na kadhalika. Kwanza, ni muhimu kujua ni saa ngapi mdodoswaji aliamka na ni saa ngapi alienda kulala, kwa hivyo masaa ya kua macho ndio yaliyosalia kunakili."},{"index":5,"size":25,"text":"o Unapaswa kwanza kumuuliza mdodoswaji ni saa ngapi aliamka siku iliyotangulia, na kisha ujaze wakati wowote kabla ya hapo kama wakati wa 'kulala na kupumzika.'"},{"index":6,"size":43,"text":"o Kisha, muulize ni saa ngapi alienda kulala siku iliyotangulia, na kisha ujaze wakati wowote baada ya hapo kama wakati wa 'kulala na kupumzika.' Kufanya hatua hizi mbili za kwanza mwanzoni huweka mipaka ya muda kwa siku inayohitaji kuelezwa namna muda wake ulitumiwa."},{"index":7,"size":136,"text":"• Baada ya kutambua saa za kuamka na kulala, mdodosaji anaweza kumuuliza mdodoswaji alichokifanya baadaye, na kwa muda gani, na kuendelea hadi shughuli za siku nzima zijazwe. Kwa mfano, uliza: je, baada ya kuamka ulifanya nini? Kisha mdodoswaji anasimulia alichofanya na kwa muda gani. Kazi ya mdodosaji basi ni kutambua msimbo sahihi unaohusishwa na kila shughuli na kuweka jibu katika kipindi sahihi cha muda. Kisha, mdodosaji anauliza, je, uliwajali pia watoto wakati wa kufanya shughuli hii? Mdodosaji anapaswa kujibu kwa kisanduku ikiwa mdodoswaji pia alikuwa akimtunza mtoto wakati akifanya shughuli nyingine. Hata kama mdodoswaji hamtunzi au kumshughulikia mtoto moja kwa moja au kutangamana na mtoto (kwa mfano, mtoto amelala au anafanya shughuli nyingine), kwa muda wote anapowajibika kwa mtoto wakati huo, inapaswa kuteua msimbo 'Ndiyo' kwenye kisanduku cha G4.02kwa kipindi kifaacho cha muda aliokuwa na mtoto."},{"index":8,"size":43,"text":"• Kulingana na muktadha, inaweza pia kuwa muhimu kutumia viashiria vya kawaida vya wakati ili kuwasaidia wadodoswaji kukumbuka shughuli zinazohusiana na matukio mengine ambayo hutokea kwa kutabirika siku nzima (yaani, kila wakati kula chakula cha mchana saa saba, saa za maombi, mawio/machweo, n.k)."},{"index":9,"size":74,"text":"• Vipindi vya muda vinawekwa alama katika vipindi vya dakika 15 na shughuli moja inaweza kutiwa alama kwa kila kipindi kwa kuandika msimbo wa shughuli kwenye kisanduku. Usiache visanduku vya vipindi vyovyote vikiwa wazi. Ikiwa shughuli itafanywa kwa muda mrefu zaidi (zaidi ya dakika 15), msimbo sawa wa shughuli unapaswa kurudiwa kwa muda wote wa shughuli. Kwa mfano, ikiwa shughuli 'E' ilifanywa kwa saa moja, basi alama 'E' inapaswa kutiwa katika visanduku vinne mfululizo."},{"index":10,"size":75,"text":"• Hakikisha kuwa alama zako zinaeleweka kwa uwazi. Hupaswi kamwe kuwa na zaidi ya shughuli moja iliyotiwa alama katika kipindi cha muda. Ikiwa mdodoswaji alikuwa akifanya mambo mengi (kwa mfano kula kifungua kinywa na kusikiliza redio) muulize mdodoswaji ni shughuli gani kati ya hizo mbili ambayo ilikuwa ya msingi kwa wakati huo na uweke msimbo wa shughuli hiyo msingi kwa muda ufaao. Ikiwa shughuli ya pili ni kumtunza mtoto, hakikisha pia umeteua kisanduku cha G4.02."},{"index":11,"size":111,"text":"• Ikiwa shughuli imekamilika kwa muda wa chini ya dakika tatu lakini umetumia sehemu kubwa ya dakika 15 (hadi dakika 8), basi weka alama kwenye kisanduku kizima cha shughuli hiyo. Aidha, ikiwa shughuli imekamilika kwa sehemu ndogo au chache ndani ya dakika 15 (chini ya dakika 8) basi usihesabu shughuli kwenye jedwali. Kwa mfano, ikiwa mdodoswaji alikula/kunywa kwa dakika 20, sanduku moja tu linafaa kujazwa (dakika 15 zinahesabiwa na dakika 5 zilizobaki zinapotea kwa sababu hazifiki dakika 8). Ikiwa hata hivyo, mdodoswaji alikula/kunywa kwa dakika 25, basi masanduku mawili ya dakika 15 yanapaswa kujazwa (dakika 15 kwenye kisanduku cha kwanza na dakika 10 kwenye kisanduku cha pili). Sanduku haliwezi kugawanywa kamwe."},{"index":12,"size":36,"text":"• Wakati mdodoswaji anapoelezea shughuli nyingi katika kipindi kifupi, kama vile utaratibu wao wa asubuhi, tumia uamuzi wako bora kubainisha ni kategoria gani za shughuli nyingi zinapatikana na ujaze gridi hiyo ya saa kwa kipindi hicho."},{"index":13,"size":15,"text":"• Usiache kamwe nyongeza ya dakika 15 ikiwa wazi. Masaa yote 24 yanapaswa kuelezwa yalivyotumika."},{"index":14,"size":66,"text":"Mfano: Katika mchoro ulio hapa chini, tunaweza kuona kwamba mdodoswaji alikuwa amelala au kupumzika hadi saa 11:30 asubuhi. Saa 11:30 asubuhi alisikiliza redio kwa dakika 30, ikifuatiwa na kula kifungua kinywa kwa dakika 15 na kuoga na kuvaa kwa dakika 15. Saa 12:30 asubuhi safari kwenda dukani kwa muda wa nusu saa kisha alianza kufanya kazi katika duka, ambayo aliendelea kwa masaa mawili na nusu iliyofuata."}]},{"head":"Usiku Asubuhi Jioni","index":47,"paragraphs":[{"index":1,"size":6,"text":"4:00 5:00 6:00 7:00 8:00 9:00"}]},{"head":"Kutambua shughuli✔","index":48,"paragraphs":[{"index":1,"size":33,"text":"Orodha ya shughuli ni ya jumla kwa hivyo inaweza kuwa jambo ambalo mdodoswaji amefanya halijaelezewa miongoni mwa shughuli zilizoorodheshwa. Kwanza tafakari kama shughuli anayoisema mdodoswaji inalingana na shughuli nyingine zozote ambazo hazikuchapishwa awali."},{"index":2,"size":40,"text":"Ikiwa hakuna shughuli sawia kwenye orodha iniyouchapishwa, basi tumia msimbo wa \"Nyingine, taja\" kisha kuielezea kwa undani iwezekanavyo shughuli hiyo. Iwapo kuna zaidi ya shughuli moja inayolingana na msimbo wa 'Nyingine, taja', hakikisha kuwa kuna maelezo tofauti kwa kila shughuli."},{"index":3,"size":70,"text":"Kazi rasmi na shule hupewa kipau mbele kuliko shughuli zingine. Utunzaji wa kibinafsi, kula, kusoma, kusafiri, n.k. wakati wa kazi na saa za shule kila mara inafaa kutumia msimbo wa kazi/shule, bila kuzitofautisha kuonyesha (km. usitofautishe wakati wa kula na wakati wa kufanya kazi rasmi ikiwa mtu atakula kwa muda katikati ya masaa ya kazi). Hata hivyo, mapumziko rasmi yanarekodiwa kama kula, utunzaji wa kibinafsi, ununuzi au chochote ambacho kimefanywa."},{"index":4,"size":43,"text":"Shughuli nyingi, kama vile ununuzi, zinahusishwa na usafari. Ikiwa safari kama hiyo ndio sehemu ndefu zaidi ya kipindi cha dakika 15, inapaswa kunakiliwa kama kusafiri (Msimbo \"U\". Usafiri mahususi wa kwenda na kutoka kazini au shuleni unapaswa kurekodiwa kama kusafiri tofauti (msimbo \"T\")."},{"index":5,"size":37,"text":"Kumbuka: Jalada la GL la shughuli linajumuisha vipengele VYOTE vya kategoria. Kwa mfano, kuhusiana na ufugaji mifugo kubwa (kama vile ng'ombe) hii inamaanisha muda unaotumika kulisha ng'ombe, kukamua ng'ombe na kusindika na kuuza maziwa kutoka kwa ng'ombe."},{"index":6,"size":157,"text":"A Kuuza bidhaa na/au huduma dukani, kwa ajili ya mtu binafsi au mwanakaya Inajumuisha shughuli zote za mauzo zinazofanywa katika eneo (duka) aidha kwa biashara za kibinafsi au za familia. Kumbuka: hii haijumuishi mauzo ya bidhaa za ziada kutoka kwa kilimo cha kaya, uvuvi na kazi za nguo ambazo si sehemu ya shughuli za biashara. B Kuuza bidhaa na/au huduma nyumba kwa nyumba, kwa ajili ya mtu binafsi au mwanakaya Inajumuisha shughuli zote za mauzo ya kuhama hama (kuhama kutoka sehemu moja hadi nyingine) zinazofanywa kwa biashara yako mwenyewe au ya familia. Kumbuka: hii ni kawaida ya huduma kama vile utoaji wa afya ya wanyama lakini inaweza pia kujumuisha uuzaji wa bidhaa. Kwa bidhaa, hii haijumuishi mauzo ya bidhaa za ziada kutoka kwa kilimo cha kaya, uvuvi na kazi za nguo ambazo si sehemu ya shughuli za biashara. C Kutafuta na kusafirisha bidhaa kwa ajili ya biashara mfano vifaranga vya kutwa, majani ya shahawa, malisho, madawa n.k"},{"index":7,"size":79,"text":"Hii inajumuisha muda unaotumika kununua na kuleta bidhaa ambazo biashara inafanyia mauzo au malighafi. Hii inajumuisha kuhudhuria madarasa na kufanya kazi za shuleni. Kumbuka kuwa utunzaji wa kibinafsi na mapumziko mafupi wakati wa saa za shule huchukuliwa kama shule. Fanya kazi (kwa hivyo jumuisha muda wote uliotumika shuleni). P Kupika Inajumuisha muda unaotumika kupata chakula sokoni (lakini si muda wa usafiri, ambao huhesabiwa chini ya usafiri), kuandaa chakula cha kupika, muda wa kupika na muda wa kufanya usafi baadaye."},{"index":8,"size":17,"text":"Haijumuishi muda uliotumika kuvuna mazao (weka katika 'kilimo/mifugo/uvuvi'). Q Kazi za ndani (pamoja na kuteka maji, mafuta)"},{"index":9,"size":52,"text":"Inajumuisha kazi zote za nyumbani zisizolipwa kama vile kuteka maji na kutafuta kuni, kusafisha, kufua nguo na kazi nyingine za nyumbani (bila kupika). Kazi za nyumbani zinazolipwa huhesabiwa kama 'kazi kama kuajiriwa.' R Kutunza watoto Kulea watoto kunahusisha kuwalinda 'moja kwa moja' na 'kufanya majukumu mengine'. S Kutunza watu wazima (wagonjwa, wazee)"},{"index":10,"size":24,"text":"Inajumuisha utunzaji usiolipwa kwa watu wote nyumbani na nje ya nyumbani. Utunzaji unaolipwa unahesabiwa kama 'kazi kama uliyoajiriwa.' T Kusafiri (kwenda/kutoka kazini au shuleni)"},{"index":11,"size":7,"text":"Usafiri kwenda na kurudi kazini au shuleni."},{"index":12,"size":7,"text":"U Kusafiri (kusiko kwa kazi au shule)"},{"index":13,"size":311,"text":"Usafiri unajumuisha safari zote, isipokuwa kutembea na kusafiri wakati wa kazi. Inajumuisha kutembea ikiwa lengo sio kufanya mazoezi. Safari ndefu zitatenganishwa na shughuli kama vile kula, utunzaji wa kibinafsi, n.k. V Kufanya mazoezi Aina zote za shughuli za michezo ya viungo ikiwa ni pamoja na kutembea, ikiwa lengo sio kuhama kutoka sehemu moja hadi nyingine (ambayo inahesabiwa kama 'kusafiri na kutembea'). W Shughuli za kijamii na burudani Kitengo hiki kinanakili shughuli zozote za kijamii, kama vile kuketi na familia, kutembelea marafiki, kuzungumza kwa simu na marafiki, kutembelea sehemu ya kunywa au mkahawa na marafiki, kwenda kutazama shughuli za michezo n.k. Aina hii pia inajumuisha shughuli za ngono ikiwa si kazi ya kulipwa (vinginevyo inaweza kunakiliwa kama 'kazi uliyoajiriwa' au 'biashara yako mwenyewe'). Pia inajumuisha shughuli za bustani, uvuvi na shughuli zingine za uzalishaji ikiwa ni za kufurahisha tu. Aina zote za shughuli za michezo ya viungo ikiwa ni pamoja na kutembea, ikiwa lengo sio kuhama kutoka sehemu moja hadi nyingine (ambayo inahesabiwa kama 'kusafiri na kutembea'). X Shughuli za kidini Jumuisha kuhudhuria ibada, maombi au shughuli/sherehe zingine za kidini. Kumbuka kwamba ikiwa mtu huyo ni Mchungaji, Imamu au mtu mwingine anayefanya hii kama kazi/kazi yao, inapaswa kuhesabiwa katika kategoria ya 'kazi iliyoajiriwa' na si kama shughuli ya kidini. Y Kufuma / kushona / utunzaji wa nguo Inajumuisha kazi ya nguo za kuuza na matumizi yako mwenyewe lakini haijumuishi ukarabati wa nguo (nakili kama 'kazi ya ndani'). Z Ukulima, kilimo cha mimea Shughuli zote zinazofanywa kwa mazao ya biashara na/au mazao yanayopandwa kimsingi kwa matumizi ya chakula (mboga, kahawa, matunda, mpunga, mahindi, mihogo, mtama, ngano). Hii ni pamoja na usindikaji baada ya kuvuna shambani na nyumbani bila kujali kama inazalisha mapato au kwa matumizi ya nyumbani. A A Ufugaji wa mifugo (ng'ombe, kuku, kondoo n.k.) Kulisha, kufuga, kuchunga, kupeleka ng'ombe, ndege,kondoo, mbuzi na kadhalika sokoni; usindikaji wa bidhaa na kupeleka bidhaa sokoni."},{"index":14,"size":56,"text":"AB Ununuzi / kupata huduma (pamoja na huduma za afya) kilimo cha bustani Inajumuisha utunzaji wa kibinafsi unaolipwa, kama vile kunyoa nywele, kutembelea daktari au kituo cha afya (kupata huduma za afya), huduma ya gari na benki, n.k. Usafiri wowote unaohusishwa na ununuzi utajulikana kama kusafari. Kutazama runinga/kusikiliza redio/kusoma Inajumuisha kutazama runinga, kusikiliza redio na/au kusoma."},{"index":15,"size":38,"text":"• G4.05: Je, katika saa 24 zilizopita ulifanya kazi kidogo kuliko kawaida, takriban sawa na kawaida au zaidi ya kawaida? Lengo la swali hili, ni kutaka kujua jinsi siku iliyotangulia ya mdodoswaji inalingana na utaratibu wake wa kawaida."},{"index":16,"size":54,"text":"o Kwa swali hili, kazi inafafanuliwa kama shughuli zote za riziki zinazofanywa nyumbani au nje ya nyumba, zinazolipwa au zisizolipwa, pamoja na kazi za nyumbani. Tunavutiwa tu na jumla ya muda unaotumika kufanya kazi (mtazamo wa mdodoswaji kuhusu'uzito wa kazi'), kwa hivyo ni sawa ikiwa mdodoswaji atajibu 'kama vile kawaida, lakini kwa kazi tofauti.'"}]},{"head":"XX. MODULI YA 16: VYANZO VINGINE VYA MAPATO YA KAYA","index":49,"paragraphs":[{"index":1,"size":15,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu vyanzo vya mapato kwa kaya ya mdodoswaji."},{"index":2,"size":16,"text":"Tanguliza sehemu kwa kumwambia mdodoswaji kuwa:\"Tungependa kujua kuhusu vyanzo mbalimbali vya mapato ya kaya yako (HH)\"."},{"index":3,"size":98,"text":"G13.01: Je, kaya yako inapata mapato kutoka kwa chanzo hiki? -nia hapa ni kujua ni vyanzo vipi vya mapato kwa wanakaya, sio tu mdodoswaji bali hata wengine. Maswali yanayofuata yanahusisha kurekodi ni nani katika kaya anapata mapato kutoka kwa kila chanzo, nani hufanya uamuzi juu ya nini cha kufanya na pesa kutoka kwa chanzo mara nyingi na, kupanga vyanzo kwa mpangilio kwanzia kile kilicho muhimu zaidi kwa kaya zao. Umuhimu unaweza kupimwa kwa mtazamo wa thamani ya mapato au kipimo kingine. Hata hivyo, unapaswa kumruhusu mdodoswaji aamue ni vipimo vipi vya kutumia katika ukadiriaji wa chanzo muhimu zaidi."}]},{"head":"XXI. MODULI G7: MAHUSIANO YA NDANI YA NYUMBANI","index":50,"paragraphs":[{"index":1,"size":52,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu uaminifu na uhusiano wa heshima kati ya mume na mke, kati ya watoa maamuzi wawili wa kaya (ambapo mwamuzi si mpenzi), au uhusiano mwingine wa karibu na kaya katika suala la kufanya maamuzi pale ambapo hakuna mume/mke na hakuna mtu mzima mwingine anayefanya maamuzi."},{"index":2,"size":45,"text":"• Kumbuka: Aidha safu mlalo A au B ZINAHITAJIKA; lakini ikiwa zote mbili hazitumiki, basi safu mlalo B ni SI LAZIMA. Ongeza safu kuuliza kuhusu watu walio nje ya kaya kama mama mkwe anayeishi nje ya kaya na wake wenza katika kaya zenye wake wengi."},{"index":3,"size":16,"text":"• G7.01: MUHIMU: weka kitambulisho cha mwanakaya # ambacho kinalingana na mtu aliyeorodheshwa kwenye safu mlalo."}]},{"head":"XXII. MODULI G8(B): KIWANGO KIPYA CHA UFANISI WA JUMLA","index":51,"paragraphs":[{"index":1,"size":20,"text":"Madhumuni ya moduli hii ni kupata taarifa kuhusu imani ya mdodoswaji kujihusu (kujiamini) na uwezo wao wa kufikia malengo waliyojiwekea."},{"index":2,"size":62,"text":"Tanguliza sehemu kwa kumwambia mdodoswaji kuwa: \"Sasa nitakuuliza baadhi ya maswali kuhusu hisia tofauti ambazo unaweza kuwa nazo. Tafadhali sikiliza kila moja ya kauli zifuatazo. Fikiria jinsi kila kauli inavyohusiana na maisha yako, kisha niambie ni kwa kiasi gani unakubali au hukubaliani na kauli hiyo kwa kipimo cha 1 hadi 5, ambapo 1 ina maana \"hukubaliani kabisa\" na 5 inamaanisha \"unakubali sana\"."}]}],"figures":[{"text":" d. Bonyeza kwenye mpangilio wa jumla kisha ingiza zifuatazo kama chaguo la seva yako. URL: ________ (taja URL sahihi iliyotolewa kwa mradi wako) jina la mtumiaji: _____ (taja jina sahihi la mtumiaji lililotolewa kwa mradi wako) Nenosiri: ________ (tumia nenosiri sahihi lililotolewa kwa mradi wako) rudi kwenye onyesho kuu la ODK na ubonyeze kwenye 'Pata fomu iliyo tupu'. f. Chagua kifaa kilichosasishwa zaidi na 'Weza Chagua.' g. Bonyeza SAWA ili kupakua fomu. WA WANAWAKE KATIKA BIASHARA INAYOHUSIANA NA MIFUGO (WELBI) : "},{"text":"o Ni hiari kuongeza swali hapa kuuliza ni nani mdodoswaji angependa afanye maamuzi hayo. o G2.02 (katika matoleo ya FULLBARE na XS): Katika swali hili, linauliza kama mdodoswaji mwenyewe alihusika katika kufanya maamuzi kuhusu kila moja ya shughuli zilizo orodheshwa. • G2.03:(mmoja) Ulikuwa na mchango kiasi gani katika kufanya maamuzi kuhusu [SHUGHULI]? o Chagua msimbo unalingana na majibu uliyopewa na mdodoswaji kutoka kwa misimbo iliyoorodheshwa chini ya moduli (chagua mmoja): Mchango mdogo au hakuna mchango wowote katika maamuzi …………………….….01 Mchango katika baadhi ya maamuzi …………………………….02 Mchango katika maamuzi mengi au yote …………………….03 Haitumiki/Hakuna uamuzi uliofanywa…….98 → Ikiwa msimbo huu umechaguliwa basi endelea na maswali kwenye shughuli inayofuata. "},{"text":"o Chagua msimbo unaofaa wa majibu ya mdodoswaji kutoka kwa misimbo iliyoorodheshwa chini ya moduli (andika Mmoja): Hakuna mchango wowote katika maamuzi ………………………………01 Mchango katika baadhi ya maamuzi ………………………….02 Mchango katika maamuzi mengi au yote ………………….03 Haitumiki/Hakuna uamuzi uliofanywa…………………98 → Shughuli inayofuata • G2.05A: Je, ulipokea au kupata maelezo ya biashara au ushauri kuhusu [SHUGHULI] katika miezi 12 iliyopita? • G2.05B: Je, wewe au mtu mwingine katika biashara yako aliufuata au kutekeleza ushauri huo kuhusu [SHUGHULI]? Kuhusu G2.03 na G2.05 tafadhali kumbuka yafuatayo: "},{"text":"  "},{"text":" Je,[JINA]  ana nafasi gani katika UMILIKI wa biashara? -nakili umiliki/wajibu wa mshiriki biashara katika biashara unayoiangazia, yaani iwapo ni mmiliki wa biashara hiyo (mmiliki binafsi au wa pamoja), mwajiriwa, mwanakaya wakaya ya mmiliki n.k. D17: Je, jukumu la [JINA] katika biashara ni gani? -nakili umiliki/wajibu wa mshiriki katika biashara D17: Je, jukumu la [JINA] katika biashara ni gani? -nakili umiliki/wajibu wa mshiriki katika biashara yaani iwapo ni mmiliki wa biashara (mmiliki), mwekezaji, meneja, mfanyakazi n.k. yaani iwapo ni mmiliki wa biashara (mmiliki), mwekezaji, meneja, mfanyakazi n.k. D18: [JINA] alizaliwa mwaka gani? (miaka YYYY) -Mbinu bora ya kupata umri wa mwanakaya ni D18: [JINA] alizaliwa mwaka gani? (miaka YYYY) -Mbinu bora ya kupata umri wa mwanakaya ni kuuliza ni lini (mwaka) mwanakaya alizaliwa. Kumbuka: Iwapo mdodoswaji hajui na mhusika kuuliza ni lini (mwaka) mwanakaya alizaliwa. Kumbuka: Iwapo mdodoswaji hajui na mhusika hayupo kutoa taarifa hii, kuna uwezekano wa kuashiria \"sijui\". hayupo kutoa taarifa hii, kuna uwezekano wa kuashiria \"sijui\". D15: Je, [JINA] ana uhusiano gani na mdodoswaji mkuu? -Hapa unauliza, kwa kila mshiriki biashara D15: Je, [JINA] ana uhusiano gani na mdodoswaji mkuu? -Hapa unauliza, kwa kila mshiriki biashara unayoiangazia, uliye mnakili kwa kuwa ni mfanya maamuzi katika biashara, jinsi anavyohusiana unayoiangazia, uliye mnakili kwa kuwa ni mfanya maamuzi katika biashara, jinsi anavyohusiana na mdodoswaji mkuu, na si mkuu wa kaya. na mdodoswaji mkuu, na si mkuu wa kaya.  "},{"text":"• G2.02: Wakati maamuzi yanaanywa katika kaya yako kuhusu [SHUGHULI], ni nani ambaye kwa kawaida huhusika kwa kufanya maamuzi hayo? Ikiwa hakuna maamuzi yaliyofanywa kuhusu [SHUGHULI], chagua HAKUNA UAMUZI ULIOFANYWA na uendelee na maswali kwenye shughuli inayofuata. o MUHIMU: Unapouliza ni nani anayehusika kufanya maamuzi, orodhesha kila o MUHIMU: Unapouliza ni nani anayehusika kufanya maamuzi, orodhesha kila mwanakaya au mshiriki biashara ili kuunganisha maamuzi na mtoa maamuzi binafsi mwanakaya au mshiriki biashara ili kuunganisha maamuzi na mtoa maamuzi binafsi aliyetajwa (na haya yanaweza kujumuisha baadhi ya wanakaya na washiriki biashara aliyetajwa (na haya yanaweza kujumuisha baadhi ya wanakaya na washiriki biashara unayoiangazi). Unatakiwa kuchukuwa data ya hadi washiriki maamuzi watatu (3). unayoiangazi). Unatakiwa kuchukuwa data ya hadi washiriki maamuzi watatu (3). o Iwapo mdodoswaji atataja watoa maamuzi ambao si miongoni mwa wanakaya au o Iwapo mdodoswaji atataja watoa maamuzi ambao si miongoni mwa wanakaya au washiriki biashara, chagua chaguo zifuatazo, zozote zile zinazofaa kama ilivyoelezwa washiriki biashara, chagua chaguo zifuatazo, zozote zile zinazofaa kama ilivyoelezwa na mdodoswaji: na mdodoswaji: MSHIRIKI ASIYEKUWA MWANAKAYA WA HII KAYA MSHIRIKI ASIYEKUWA MWANAKAYA WA HII KAYA (MWANAUME) (MWANAUME) MSHIRIKI ASIYEKUWA MWANAKAYA WA HII KAYA MSHIRIKI ASIYEKUWA MWANAKAYA WA HII KAYA (MWANAMKE) (MWANAMKE) MSHIRIKI ASIYEKUWA MSHIRIKI WA HII BIASHARA MSHIRIKI ASIYEKUWA MSHIRIKI WA HII BIASHARA UNAYOIANGAZIA (MWANAUME) UNAYOIANGAZIA (MWANAUME) MSHIRIKI ASIYEKUWA MSHIRIKI WA HII BIASHARA MSHIRIKI ASIYEKUWA MSHIRIKI WA HII BIASHARA UNAYOIANGAZIA (MWANAMKE) UNAYOIANGAZIA (MWANAMKE) o o  "},{"text":" KIELEZO CHA UWEZESHAJI WA WANAWAKE KATIKA BIASHARA INAYOHUSIANA NA MIFUGO (WELBI) : MWONGOZO WA MAAGIZO  "}],"sieverID":"9c72c7c8-b0aa-4635-b366-069b82ee4269","abstract":""}

data/part_1/065dc02b2bfd1df99f828bdd4779fb91.json

@@ -0,0 +1 @@
+{"metadata":{"id":"065dc02b2bfd1df99f828bdd4779fb91","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2581bb23-204b-4c86-b6e3-90764a65c625/retrieve"},"pageCount":8,"title":"CARACTERIZACIÓN MORFOLÓGICA, PATOGÉNICA Y GENÉTICA DEL AGENTE CAUSAL DE LA ANTRACNOSIS (Colletotrichum gloeosporioides) EN GUANÁBANA (Annona muricata) EN EL VALLE DEL CAUCA","keywords":["fruits","diseases","fungi"],"chapters":[{"head":"RESUMEN","index":1,"paragraphs":[{"index":1,"size":292,"text":"La Antracnosis, causada por el hongo Colletotrichum gloeosporioides, ocasiona pérdidas hasta del 90% en huertos no tecnificados de guanábana. Para el control de la enfermedad se requiere conocer bien la sintomatología y las características del agente causal. Teniendo en cuenta que existe poca información al respecto, en este estudio se pretendió identificar y caracterizar morfológica, genética y patogénicamente los aislamientos de Colletotrichum spp. obtenidos de cultivos de guanábana en el Valle del Cauca (Colombia). De 109 aislamientos se caracterizaron 54, seleccionados al azar. La caracterización se basó en morfología de colonia, patogenicidad y reacción en cadena de la polimerasa (RCP) usando cebadores específicos ITS, CaInt2 (C. acutatum) y CgInt (C. gloeosporioides). Además se realizó corte con enzimas de restricción de la región ITS y se evaluó la diversidad genética de la población mediante Amplificación al Azar de Microsatélites (RAMs). Los resultados mostraron correlación de -0,84 entre características de crecimiento de los aislamientos con su patogenicidad, destacándose como muy patogénicos los de crecimiento lento que presentaron micelio gris, esporulación escasa y relieve ondulado. La amplificación con los cebadores específicos para C. gloeosporioides y C. acutatum, generó fragmentos de 450 pb y 490 pb respectivamente, corroborando la presencia de dos especies. Por otra parte la combinación de cebadores universales ITS1 e ITS4 generó un fragmento de 580 pb, que al digerirlo con las enzimas de restricción Hae III y RsaI, mostró diferencias en los patrones de restricción, dando lugar a dos grupos, correspondientes a las dos especies de Colletotrichum spp. El análisis de RAMs, mostró una gran variabilidad genética de los aislamientos y permitió concluir que hay correlación entre variabilidad patogénica -diámetro de colonia, con variabilidad genética. Estos resultados evidencian la diversidad fenotípica y genética de Colletotrichum spp. asociado a la antracnosis en guanábana."},{"index":2,"size":5,"text":"Palabras clave: Frutales, enfermedades, hongos"}]},{"head":"SUMMARY","index":2,"paragraphs":[{"index":1,"size":294,"text":"Anthracnose, caused by the fungus Colletotrichum gloeosporioides, generates losses of up to 90% in traditionally grown soursop orchards. The pathogen attacks the leaves, branches, flowers, and fruits, producing black fruit rot, especially during the rainy season. Typical disease symptoms initially observed includes small dark specks in the tissue, followed by the formation of slightly sunken spots surrounded by a dark halo. Of 109 isolates of Colletotrichum spp. obtained from diseased crops in several production areas of Valle del Cauca, 54 were selected at random and characterized based on colony morphology, pathogenicity and polymerase chain reaction (PCR), using the specific primers ITS Ca Int2 (C. acutatum) and CgInt (C. gloeosporioides). In addition restriction enzyme digestion was performed on DNA from the internally transcribed spacer region of the ribosomal RNA gene for each strain and the genetic diversity of this population was evaluated by random amplified microsatellites (RAMs). The results showed a correlation of -0.84 between growth characteristics of isolates and pathogenicity. Slow growing isolates presenting gray mycelium, limited sporulation, and undulating relief were found to be highly pathogenic. The amplification with specific primers for C. gloeosporioides and C. acutatum generated 450-bp and 490-bp fragments, respectively, confirming the species identity. Fifty isolates were identified as C. gloeosporioides and 4 as C. acutatum. The combination of universal primers ITS1 and ITS4 generated a 580-bp fragment, which was digested by the Hae III and Rsa I restriction enzymes. The differences in restriction patterns gave rise to two groups that corresponded to each of the pathogen species. The analysis of RAMs indicated high genetic variability among isolates and made it possible to detect a relationship among pathogenic variability -colony diameter with genetic variability. These results illustrate the phenotypic and genetic diversity of Colletotrichum spp. associated with anthracnose of soursop."}]},{"head":"INTRODUCCIÓN","index":3,"paragraphs":[{"index":1,"size":303,"text":"Los frutales tropicales se perfilan como una de las mejores opciones en la agricultura Colombiana por el crecimiento de la demanda nacional e internacional que se ha reportado en 3,75% anual en los últimos cuatro años y por la activación de la industria poscosecha (jugos, mermeladas etc.), cuya demanda es suplida en la actualidad por importaciones (Cabra et al, 2002). La guanábana es una de las frutas que se presenta como promisoria para el consumo fresco y para la industria, con grandes posibilidades en los mercados nacionales y extranjeros por sus características organolépticas (García, 2001). El cultivo de la guanábana presenta una alta generación de empleo (250 jornales/hectárea /año), superando a cultivos como la palma de aceite, caña de azúcar, arroz entre otros (Urpa, Valle del Cauca, 2000). Además es altamente rentable con rendimientos cercanos a los 2500 US$/hectárea-año en cultivos tecnificados (Cabra et al, 2002). Sin embargo, por ser Colombia el centro de origen de la guanábana, se presenta una serie de problemas causados por fitopatógenos que han coevolucionado con la planta, destacándose Colletotrichum gloeosporioides el cual ocasiona la antracnosis, cuya problemática se agrava por la expansión de cultivos en zonas agroecológicas favorables a la enfermedad, constituyéndose en uno de los principales limitantes en la producción de guanábana en Colombia (Guz-mán, 1980;Zaráte, 1881;Zaráte,1987;Zaráte, 1988). La incidencia de la enfermedad se incrementa debido a factores como la selección inadecuada de zonas agroecológicas, distancias de siembra, drenaje, podas, fertilización, deficiente recolección de frutos afectados e inadecuado uso de fungicidas. Para el control de la enfermedad se requiere conocer bien la sintomatología y las características del agente causal. Teniendo en cuenta que existen pocos estudios al respecto, en esta investigación se pretendió identificar y caracterizar morfológica, genética y patogénicamente los aislamientos de Colletotrichum spp. obtenidos de cultivos de guanábana en el Valle del Cauca (Colombia)."}]},{"head":"MATERIALES Y MÉTODOS","index":4,"paragraphs":[]},{"head":"Colección de muestras","index":5,"paragraphs":[{"index":1,"size":43,"text":"Se obtuvieron muestras de hojas, ramas y flores de árboles de guanábana con síntomas característicos de Antracnosis (Figura 1). El muestreo se realizó en fincas con diferentes niveles de incidencia de la enfermedad ubicadas en zonas productoras del Valle del Cauca (Tabla 1)."}]},{"head":"Aislamiento del patógeno","index":6,"paragraphs":[{"index":1,"size":57,"text":"Las muestras se cortaron en fragmentos de tejido sano y enfermo, se lavaron con agua durante 1h, etanol al 70% por 45 seg. y finalmente agua durante 1 min. Los aislamientos se obtuvieron por siembra directa en medio de cultivo Papa Dextrosa Agar (PDA) siguiendo el procedimiento descrito por Agostini y Timmer, (1992) y por Ospina, (2002)."},{"index":2,"size":140,"text":"Para obtener cultivos monospóricos se sembró una asada de esporas del aislamiento puro, por agotamiento en cajas de petri con agar-dextrosa (Agar 15 gr y dextrosa 20 gr /L), incubando por 24 horas a 27 o C en oscuridad. Los aislamientos se observaron al estereoscopio ubicando esporas individuales germinadas, se marcó el sitio con un micro gancho sobre el agar y luego se verificó en el microscopio la presencia de una sola espora. Se transfirió un fragmento de agar con la espora seleccionada a una nueva caja de petri con PDA + estreptomicina-300 mg/L (PDA+S.), colocándolo sobre papel filtro estéril Whatman® # 1, utilizando el micro gancho y teniendo la precaución de que la espora quedara en contacto con el nuevo medio. Los aislamientos se incubaron de 7 a 10 días a 27 o C (Ospina, 2002;Agostini y Timmer, 1992)."},{"index":3,"size":47,"text":"Los aislamientos se mantuvieron en cajas de Petri con medio PDA y se transfirieron a medio fresco aproximadamente cada tres semanas. (González et al, 1998). Para su conservación a largo plazo, los aislamientos monospóricos se transfirieron a papel filtro siguiendo la metodología de Aricapa y Correa, 1994."}]},{"head":"Caracterización morfológica","index":7,"paragraphs":[{"index":1,"size":59,"text":"Se seleccionaron 54 aislamientos obtenidos en diferentes regiones productoras del Valle del Cauca y 2 controles (yuca y cítricos) (Tabla 1), se sembraron en medio PDA + S (Agostini y Timmer, 1992a) y se incubaron a 29 o C por 78 horas. Se evaluaron cuatro repeticiones por aislamiento y las variables consideradas fueron: diámetro y color de la colonia."}]},{"head":"Pruebas de patogenicidad","index":8,"paragraphs":[{"index":1,"size":141,"text":"Antes de proceder a realizar las pruebas de patogenicidad cada aislamiento se sembró en tres cajas de petri con medio de cultivo PDA + S y 2 cajas con Agar Avena (AV) + 300 mg de estreptomicina/L, esparciendo una asada de esporas de un cultivo monospórico puro sobre la superficie del medio y se incubaron durante 15 días a 25 o C, con periodo alterno de luz y oscuridad. Posteriormente se preparó una suspensión de esporas agregando agua estéril directamente sobre la colonia en la caja petri para resuspender las masas de esporas. La suspensión inicial se recolectó en un tubo Falcon® de 50mL filtrándola con gasa para eliminar micelio y fragmentos de medio, luego se llevó a una concentración de 1 x 10 7 esporas/mL y se le agregó Inex®, como dispersante de esporas a una concentración final de 0,5%."},{"index":2,"size":56,"text":"Para la inoculación bajo condiciones de invernadero se seleccionaron árboles injertos de tres meses de edad, de una copa de guanábana cultivar Elita sobre un patrón de semilla sexual de guanábana autóctona de la región (producidos por Profrutales S. A.). Previo a la inoculación, los árboles se asperjaron con Carborundum® (polvo abrasivo), utilizando un aspersor Devilbiss."},{"index":3,"size":65,"text":"La inoculación de los árboles se realizó por el método de herida, realizando pequeños cortes en bisel al tallo, y por aspersión al tallo, el ápice y hojas más jóvenes con una suspensión de esporas, a una concentración de 1x10 7 esporas/mL. Los controles se asperjaron con agua destilada estéril y se colocaron fragmentos de medio PDA en los cortes en bisel realizados al tallo."},{"index":4,"size":52,"text":"Se inocularon 54 aislamientos de guanábana, 1 aislamiento de yuca, 1 de cítricos y 3 controles con agua, en un diseño experi-mental completamente al azar con 3 repeticiones. Las plantas permanecieron 13 días en invernadero, antes de la inoculación, permitiendo su adaptación a las nuevas condiciones y el fortalecimiento de los injertos."},{"index":5,"size":58,"text":"Las plantas inoculadas se ubicaron al azar en cámara húmeda durante 72 horas, humedad relativa del 100% y una temperatura de 27 o C. Posteriormente las plantas se mantuvieron a 29 o C y recibieron humidificaciones periódicas de 5 minutos cada hora durante 13 días y luego un minuto, cada 3 horas hasta finalizar el ensayo (1 mes)."},{"index":6,"size":47,"text":"Para la evaluación de la reacción de las plantas a la inoculación se utilizó una escala de severidad con base en la aparición de lesiones sobre el tallo, considerado por los agricultores como el síntoma más importante y que mayor daño causa a los árboles (Tabla 2)."},{"index":7,"size":62,"text":"Las evaluaciones se realizaron a los 3, 13 y 30 días después de la inoculación. La información obtenida en este ensayo se analizó estadísticamente con el programa SAS. Se calculó para cada aislamiento, el área bajo la curva de progreso de la enfermedad (ABCPE) durante el experimento, se hizo un análisis de varianza y se determinó la correlación de las variables calculadas."}]},{"head":"Identificación de las especies y caracterización genética","index":9,"paragraphs":[{"index":1,"size":160,"text":"Para identificar las especies de Colletotrichum asociadas a la antracnosis en guanábana y determinar su variabilidad genética se utilizaron técnicas moleculares que incluyeron la amplificación de la región del espaciador interno transcrito, ITS ( \"Internal Transcribed Spacer\" por sus siglas en inglés) del ADN ribosomal (ADNr), una de las regiones más ampliamente utilizada en hongos incluyendo cebadores específicos para su sistemática molecular a nivel de especie y aún entre especies para identificación de razas (Álvarez et al, 2001;Freeman et al, 2000;Freeman et al 1996;Freeman et al, 1998;Sreenivasaprasad et al, 1996). También se utilizó el análisis de polimorfismo de fragmentos de restricción combinado con la reacción en cadena de la polimerasa (PCR-RFLP) para detectar diferencias ínter específicas (Freeman et  Amplificación de la región ITS. Para la amplificación de la región ITS, se utilizó la técnica de la reacción en cadena de la polimerasa (PCR) con los cebadores universales de la región conservada del gen ADNr descrita por White et al, 1990:"},{"index":2,"size":10,"text":"ITS 1: (5'TCCGTAGGTGAACCTGCGG3') e ITS 4: (5'TCCTCCGCTTATTGATATGC3'), ITS 2: (5'GCTGCGTTCTTCATCGATGC3')"},{"index":3,"size":9,"text":"Para identificar el patógeno se usaron los cebadores específicos:"},{"index":4,"size":27,"text":"CgInt: (5'GGCCTCCCGCCTCCGGGCGG3') y CaInt2: (5'GGGGAAGCCTCTCGCGG3'), combinados con el cebador -ITS 4 de la región conservada del gen 25/28S del ADNr (Brown et al, 1996;Afanador et al, 2003)."},{"index":5,"size":121,"text":"Para cada etapa de PCR se utilizó: Buffer Taq 10 X a una concentración final de 1X (100mM de Tris HCl, pH 8, 2,5 mM MgCl 2 y 500 mM KCl) 0,2 mM de cada uno de los dNTPs, 0,5 mM de cada primer, 1,5mM de MgCl 2 , 2ng/µL de ADN, agua HPLC filtrada (0,22 µm) -autoclavada y 0,0375 U/µL de Taq polimerasa. Las condiciones de amplificación consistieron en 40 ciclos de amplificación con una desnaturalización a 94 o C por 30 seg (120 seg para la inicial), 55 o C por 30 seg de apareamiento y una extensión de 120 seg a 72 o C (240 seg para la final), utilizando un termociclador (PTC-100, MJ Research, Inc., Watertown, MA)."},{"index":6,"size":101,"text":"Análisis PCR-RFLP. Para el análisis con enzimas de restricción se evaluaron ocho enzimas, Alu I, Msp I, Dra I, Hae III, Hind III, Rsa I, Taq I y EcoRV. Para la reacción de digestión se tomaron 10 µL del producto amplificado por PCR con los cebadores ITS 1 -ITS 4, 2 µL de buffer 10X para la enzima y 0,6 µL de enzima a una concentración de 10000 u/µL. El volumen final de la reacción fue 20µL que se completó con agua HPLC filtrada (0,22 µm) y autoclavada. La reacción de digestión se incubó a la temperatura sugerida para cada enzima."},{"index":7,"size":36,"text":"Inicialmente se analizaron 10 aislamientos con características morfológicas diferentes. Las enzimas de restricción que mostraron polimorfismo en los patrones de corte entre estos aislamientos, se usaron para cortar el producto amplificado de los 46 aislamientos restantes."},{"index":8,"size":93,"text":"Amplificación al azar de microsatélites (RAMs). Para determinar la variabilidad genética de los aislamientos se utilizó la amplificación aleatoria con cebadores microsatélites RAMs: GT, CA, CGA, CT, CCA, TG, AG. En la reacción de PCR se utilizó: Buffer Taq 10X a una concentración final de 1X (100 mM Tris HCl, pH 8; 2,5 mM MgCl 2 y 500 mM de KCl) 0,2 mM de cada uno de los dNTPs, 1mM del cebador, 1,5mM de MgCl 2 , 1 ng/µL de ADN, agua HPLC filtrada (0,22 µm) -autoclavada y 0.0375 U/µL de Taq polimerasa."},{"index":9,"size":199,"text":"Visualización y análisis de productos. Para la visualización y análisis del producto amplificado de la región ITS se prepararon geles de agarosa al 1,5% con bromuro de etidio 0,5µg/mL y buffer TBE 0,5X (trisma base, ácido bórico y EDTA). Las condiciones de la electroforesis fueron: 100 voltios, 35 miliamperios. El producto digerido con enzimas de restricción se corrió en geles de agarosa al 0,7 % y Sinergel al 0,5%, a 120 voltios y 65 miliamperios. Los fragmentos amplificados con RAMs se observaron mediante electroforesis en gel de agarosa al 2%, teñido con bromuro de etidio al 1% de una solución de 10mg/mL, a 150 voltios y 80 miliamperios. Análisis de datos. Cada fragmento generado con RAMs fue analizado como un carácter independiente. Los fragmentos de ADN del mismo tamaño se asumieron como un representante del mismo locus genético y evaluado como ausente o presente. Para cada banda individual se asignó el valor de 1 para presencia y 0 para ausencia. La similitud entre los individuos fue estimada usando el coeficiente de similitud de Dice. El dendrograma se generó usando UPGMA (unweighted pair group method with arithmetic mean, por sus siglas en inglés), con el paquete estadístico NTSYS-PC versión 2.02."}]},{"head":"RESULTADOS Y DISCUSIÓN","index":10,"paragraphs":[]},{"head":"Aislamiento del patógeno y caracterización morfológica","index":11,"paragraphs":[{"index":1,"size":37,"text":"Se obtuvieron 109 aislamientos (Tabla 1), de las seis zonas del Valle del Cauca y el Eje Cafetero, los cuales se almacenaron en papel filtro a -20 o C, siguiendo la metodología descrita en materiales y métodos."},{"index":2,"size":210,"text":"En la colección de aislamientos obtenida, se determinaron tres tipos de colonia (Figura 2, Tabla 3). El tipo de colonia 1, se caracterizó por su crecimiento muy lento, micelio gris, esporulación lenta, escasa y con un relieve ondulado. Este tipo de colonia se obtuvo frecuentemente de lesiones en hojas muy jóvenes. El tipo 2 se caracterizó por su esporulación rápida y abundante, de color naranja, con poco micelio de color blanco y crecimiento rápido. La colonia tipo 3, se caracterizó por su crecimiento rápido, micelio blancogrisáceo, abundante, esponjoso, que al aglomerarse genera una masa micelial oscura y compacta; la esporulación es medianamente abundante y se observan masas de esporas de color anaranjado, muy bien definidas, a manera de gotas. El tipo de colonia 1 se detectó con mayor frecuencia (53,7%) seguido por el tipo 3 (7,4%) y el tipo 2 (38,9%). Las diferencias morfológicas entre los tipos de colonia observados sugieren que por lo menos una de ellas, la tipo 2, puede ser de una especie diferente a las del tipo 1 y 3, situación que sugiere la presencia de dos especies de Colletotrichum asociadas a la enfermedad como ocurre en el olivo (Martin y Garcia-Figueres, 1999), al juzgar por las características de las colonias de los aislamientos (Figura 2)."}]},{"head":"Pruebas de Patogenicidad","index":12,"paragraphs":[{"index":1,"size":66,"text":"El análisis estadístico de los datos mostró una correlación inversamente proporcional entre patogenicidad y el tipo de colonia (coeficiente de correlación -0,84), de forma que los aislamientos que presentaron tipo de colonia 1 se correlacionaron con alta patogenicidad , exceptuando los aislamientos m17pdfl-37, 20452 y los controles positivos de yuca y cítricos; los tipos de colonia 2 y 3 mostraron patogenicidad intermedia a baja (Tabla 3)."},{"index":2,"size":192,"text":"El avance de la enfermedad, medido en función del área bajo la curva o ABCPE (Tabla 3), realizando el análisis de varianza, mostró diferencias significativas entre aislamientos en cuanto a patogenicidad (Tabla 3 y Tabla 4), y facilitó la conformación, para cada aislamiento, de cinco grupos, por medio del análisis de conglomerados Ward con un nivel de confianza de 97% (Tabla 3). Por su parte con el diámetro de colonia, se formaron cinco grupos mediante el mismo análisis de conglomerados. El 80 % de los aislamientos con promedios entre 1,0 y 2,9 cm de diámetro, presentaron alta patogenicidad mientras que el 20 % restante con promedios entre 3,0 y 4,2 cm mostraron patogenicidad intermedia y baja. De los 54 aislamientos obtenidos de guanábana, el 5,5% no reprodujo síntomas en las plantas inoculadas, el 9,3% reprodujo síntomas con valores de ABCPE entre 2 y 6, correspondiente a baja patogenicidad, el 61,1% correspondió a patogenicidad intermedia, con valores de ABCPE entre 9,75 y 77, mientras que el 20,4% mostró alta patogenicidad, con valores de ABCPE mayores de 80 (Tabla 3). Los aislamientos más agresivos fueron lentos en su crecimiento en medio de cultivo PDA+S."},{"index":3,"size":190,"text":"Los aislamientos patogénicos, como resultado de las inoculaciones bajo las condiciones experimentales, indujeron la sintomatología característica de la enfermedad, según lo descrito por otros investigadores (Zárate, 1981;Zárate, 1987;Zárate, 1998). En hojas inoculadas se observaron lesiones típicas, con presencia de defoliación, la cual no fue consistente entre repeticiones. Los aislamientos que causaron enfermedad con escala entre 3 y 5, indujeron defoliaciones fuertes o totales. En general se observaron lesiones necróticas de borde oscuro en hojas, sin halo clorótico, ni forma definida, ubicadas principalmente en el ápice de la hoja. Estas lesiones avanzaron hacia el pedúnculo y cubrieron el ancho de la lámina foliar. En el haz y el envés de la hoja se observaron lesiones sobre la nervadura, que ocasionaron su entorchamiento. En flores, se presentaron lesiones deprimidas principalmente sobre los sépalos, oscuras, con forma redondeada y bien definida. La inoculación de tallo reprodujo síntomas similares a los observados en el campo, observándose en tallos y ramas afectadas manchas negras, deprimidas, inicialmente ovaladas o redondeadas, con bordes irregulares. En cortes longitudinales, se apreció un avance necrótico muy oscuro; en lesión avanzada se observó un exudado de aspecto seco sobre la corteza."}]},{"head":"Identificación de las especies y caracterización genética","index":13,"paragraphs":[{"index":1,"size":83,"text":"La amplificación de la región ITS del ADN ribosomal (ADNr), con los cebadores ITS 1 e ITS 4 mostró un fragmento de 580 pb, mientras el producto amplificado con los cebadores ITS 1 e ITS 2 tuvo un tamaño de 240 pb. (Figura 3), indicativo de ausencia de polimorfismo entre los aislamientos de Colletotrichum spp. evaluados. Al digerir el producto amplificado con las enzimas de restricción Hae III y Rsa I, se observaron diferencias entre los aislamientos, confirmándose la presencia de dos especies."},{"index":2,"size":190,"text":"La amplificación del ADN ribosomal con cebadores específicos a partir del ADN obtenido de 56 aislamientos de Colletotrichum spp., produjo un fragmento de 450 pb en 50 aislamientos con la combinación de cebadores CgInt (específico para C. gloeosporioides) e ITS 4, igual al fragmento amplificado en el aislamiento control (C. gloeosporioides de cítricos) (Figura 4A). En contraste, la reacción de PCR con el cebador específico para C. acutatum CaInt2 y el cebador ITS 4 amplificó un fragmento de 490pb en 5 aislamientos incluyendo el control C. acutatum de yuca (Figura 4B). Un aislamiento no amplificó con los cebadores específicos evaluados en este estudio (CgInt y CaInt2). El 89,3% de los aislamientos evaluados correspondieron a la especie C. gloeosporioides, el 8,9% a la especie C. acutatum y el 1,7 % pertenece, posiblemente, a una especie aún no identificada (Tabla 3). Sin embargo, el análisis genético y los criterios morfológicos colocaron este aislamiento dentro del género Colletotrichum sp. En futuros estudios es recomendable realizar análisis de secuencia de la región ITS (ITS1-5.8S-ITS2), para obtener mayor información sobre las especies de este género asociadas con la antracnosis en guanábana (Afanador et al, 2003)."},{"index":3,"size":124,"text":"El análisis PCR-RFLP, con la enzima MspI, generó un patrón de bandas monomórfico con fragmentos de 290 y 110 pb. Con la enzima Alu I se obtuvieron fragmentos de 280 y 95 pb. Las enzimas Dra I y Hind III no tuvieron sitio de corte y las enzimas Hae III y Rsa I mostraron diferencias entre aislamientos, generando dos grupos correspondientes a las dos especies de Colletotrichum spp identificadas. Hae III generó fragmentos de 290, 180 y 105 pb para los aislamientos de C. gloeosporioides y fragmentos de 290, 180 y 95 pb para C. acutatum, Rsa I generó un patrón monomórfico con fragmentos de 190 y 380 pb para C. gloeosporioides y no presentó corte para los aislamientos de C. acutatum (Figura 5)."},{"index":4,"size":39,"text":"La amplificación aleatoria de microsatélites (RAMs) con los aislamientos utilizando el cebador CA: 5'DBDACACACACACACACA3', generó patrones de bandas que indican el polimorfismo en los aislamientos de Colletotrichum spp, (Figura 6) y por lo tanto la presencia de variabilidad genética."},{"index":5,"size":182,"text":"El dendrograma de similitud (Figura 7), basado en el coeficiente de Dice, para 56 aislamientos de Colletotrichum spp, generado a partir de la técnica PCR-RFLP, RAMS, amplificando el ADN con el cebador CA y la amplificación con los cebadores específicos CgInt y CaInt2 en combinación con el cebador ITS 4, mostró alta variabilidad genética y  permitió la conformación de cuatro grupos que se relacionan con especie y patogenicidad: el primer grupo constituido por 25 aislamientos donde el 92% son altamente patogénicos con diámetros de colonia entre 1,8 y 2,6, el restante 8% conformado por 2 aislamientos (m25pdrb y Cd14r-42) con patogenicidad intermedia. Un segundo grupo donde el 88% de los aislamientos presentan patogenicidad baja y diámetros de colonia altos, dos aislamientos (19945-36 y m9pdra) mostraron diámetros de colonia bajos. El tercer grupo conformado por 9 aislamientos heterogéneos en patogenicidad, 28% mostrando baja patogenicidad, 43% con patogenicidad intermedia y otro 28% con una alta patogenicidad. El cuarto grupo genético conformado por cuatro aislamientos de guanábana y uno de yuca de C. acutatum, conformando un grupo genético aparte de los aislamientos de C. gloeosporioides."},{"index":6,"size":107,"text":"La variabilidad genética observada con esta técnica fue alta, a un coeficiente de similitud de 0,31 hay un agrupamiento total de los aislamientos. Si se tiene en cuenta que el muestreo estuvo restringido en cuanto área de estudio, se puede deducir que existe alta variación en la población del patógeno entre regiones agro-climáticas diferentes, aisladas geográficamente y alta variación dentro de grupos de aislamientos seleccionados previamente por características morfológicas como diámetro de colonia. Esto sugiere la planificación de un muestreo sistemático más amplio dirigido a responder las dudas que surgen de este estudio inicial sobre la población de C. gloeosporioides, agente causante de la antracnosis en guanábana."},{"index":7,"size":54,"text":"Estos resultados evidencian la variabilidad existente tanto fenotípica como genética del agente causante de la antracnosis en guaná bana. Se confirmó la asociación de dos o más especies de Colletotrichum spp. con la enfermedad. Posteriores estudios se requieren para determinar el efecto de cada una de estas especies en el síndrome de la antracnosis"}]},{"head":"AGRADECIMIENTOS","index":14,"paragraphs":[{"index":1,"size":45,"text":"Los autores agradecen a la Corporación Biotec, y al Fondo de Cooperación Española por el soporte financiero, a Cristina Londoño, estudiante de Biología de la Universidad de Antioquia, por su asistencia técnica y a Benjamín Pineda L. por su colaboración en la edición del texto. "}]},{"head":"REFERENCIAS BIBLIOGRÁFICAS","index":15,"paragraphs":[]}],"figures":[{"text":"Figura 2 .Figura 1 . Figura 2. Tipos de colonias de aislamientos de Colletotrichum spp. obtenidos en medio de cultivo PDA modificado con streptomicina. 1 = 19942-40, 2 = m3612sr-46, 3 = m25pdrb. "},{"text":"Figura 3 .Figura 5 .Figura 6 . Fuente de variación No de tratamientos GL Patogenicidad (cuadrado medio 1 ) F Aislamientos 59 58 4758,9619** 18,.06 Coeficiente de variación % 40,90Nota: El ANOVA se obtuvo de un solo experimento en un diseño de bloques completos al azar con cuatro plantas por tratamientos y cuatro repeticiones; cinco controles (un aislamiento de cítricos, uno de yuca y tres inoculados con agua). 1 Cuadrado medio obtenido para el Área Bajo la Curva del Progreso de la Enfermedad (ABCPE). ** representa significancia en Pr>F 0,0001. "},{"text":" Tabla 1. Fincas del departamento del Valle del Cauca en donde se determinó la presencia de árboles de guanábana afectados por antracnosis. 2000) y la amplificación aleatoria de micro-    2000) y la amplificación aleatoria de micro- satélites (RAMs, Random Amplification of    satélites (RAMs, Random Amplification of microsatellites, por sus siglas en Inglés)    microsatellites, por sus siglas en Inglés) (Hantula et al, 1996) para identificar variabi-    (Hantula et al, 1996) para identificar variabi- lidad entre aislamientos de la misma especie.    lidad entre aislamientos de la misma especie. Multiplicación de los aislamientos y obten-    Multiplicación de los aislamientos y obten- ción de ADN. Los 56 aislamientos del estu-    ción de ADN. Los 56 aislamientos del estu- dio se sembraron en medio de Papa-Dextrosa    dio se sembraron en medio de Papa-Dextrosa líquido (infusión de 200gr de papa, 20gr de    líquido (infusión de 200gr de papa, 20gr de dextrosa/L) y se incubaron durante 15 días a    dextrosa/L) y se incubaron durante 15 días a 25 o C con períodos alternos de 12 horas luz y    25 o C con períodos alternos de 12 horas luz y 12 horas de oscuridad. Después de la incuba-    12 horas de oscuridad. Después de la incuba- ción se colectó el micelio y se filtró en papel    ción se colectó el micelio y se filtró en papel Finca filtro estéril, se depositó en cajas de Petri Municipio Observaciones estériles y se secó a 35 o C durante tres días; Aislam No.   Finca filtro estéril, se depositó en cajas de Petri Municipio Observaciones estériles y se secó a 35 o C durante tres días;Aislam No. Lote exp. BIOTEC, CIAT Palmira posteriormente se maceró con nitrógeno lí-Algunos árboles con afección en el follaje 11   Lote exp. BIOTEC, CIAT Palmira posteriormente se maceró con nitrógeno lí-Algunos árboles con afección en el follaje11 Lote Corpoica Reg. 5 Agrícola Varaonda quido y se depositó en tubos Eppendorf de Palmira Alta incidencia, afección en follaje y ramas Pradera Algunos árboles con follaje, ramas y flores afectadas Bitaco Bitaco Algunos árboles con lesiones en pedúnculo 1,5 mL, utilizando 0,3 g de micelio seco ma-La Elena Montenegro Algunos árboles con lesiones en hojas cerado por tubo para iniciar la extracción del La Marcela Sevilla Algunos árboles con lesiones en el follaje ADN. En este caso, se siguió el protocolo Venecia 3 Caicedonia Alta incidencia, lesiones en hojas, rama y pedúnculo descrito por George Mahuku (Mahuku, 12 34 1 1 4 30 Tabla 2. Escala de severidad para evaluar la Lote Corpoica Reg. 5 Agrícola Varaonda quido y se depositó en tubos Eppendorf de Palmira Alta incidencia, afección en follaje y ramas Pradera Algunos árboles con follaje, ramas y flores afectadas Bitaco Bitaco Algunos árboles con lesiones en pedúnculo 1,5 mL, utilizando 0,3 g de micelio seco ma-La Elena Montenegro Algunos árboles con lesiones en hojas cerado por tubo para iniciar la extracción del La Marcela Sevilla Algunos árboles con lesiones en el follaje ADN. En este caso, se siguió el protocolo Venecia 3 Caicedonia Alta incidencia, lesiones en hojas, rama y pedúnculo descrito por George Mahuku (Mahuku,12 34 1 1 4 30Tabla 2. Escala de severidad para evaluar la San Rafael 2004), con algunas modificaciones. Se adi-La Unión Algunos árboles con lesiones en follaje y ramas 13 antracnosis en guanábana San Rafael 2004), con algunas modificaciones. Se adi-La Unión Algunos árboles con lesiones en follaje y ramas13antracnosis en guanábana Brasil 1 cionaron 900µL de buffer de extracción Anserma Nuevo Algunos árboles con lesiones en el follaje. 1 El lote se había asperjado con fungicida cúprico (NaCl 1,4 M, 20 mM EDTA, 100 mM Tris -HCl pH 8,0) y 1,5 µL de proteinasa K 10mg/mL, a 0,3g de micelio seco macerado mezclándolos en un agitador tipo vórtex. Los tubos se llevaron a incubación a 65°C por una hora, se adicionaron 200 µL de acetato de 3 Grado 0 1 2 3 4 Descripción de síntomas Ausencia total de lesiones en tallo Por lo menos una lesión en el tallo Varias lesiones pequeñas a lo largo del tallo Varias lesiones pequeñas y media-nas a lo largo del tallo Lesiones pequeñas, medianas y Brasil 1 cionaron 900µL de buffer de extracción Anserma Nuevo Algunos árboles con lesiones en el follaje. 1 El lote se había asperjado con fungicida cúprico (NaCl 1,4 M, 20 mM EDTA, 100 mM Tris -HCl pH 8,0) y 1,5 µL de proteinasa K 10mg/mL, a 0,3g de micelio seco macerado mezclándolos en un agitador tipo vórtex. Los tubos se llevaron a incubación a 65°C por una hora, se adicionaron 200 µL de acetato de3Grado 0 1 2 3 4Descripción de síntomas Ausencia total de lesiones en tallo Por lo menos una lesión en el tallo Varias lesiones pequeñas a lo largo del tallo Varias lesiones pequeñas y media-nas a lo largo del tallo Lesiones pequeñas, medianas y amonio 7,5M, manteniéndolos a temperatura   grandes a lo largo del tallo amonio 7,5M, manteniéndolos a temperaturagrandes a lo largo del tallo ambiente por 10 minutos. Posteriormente, se centrifugó a 12500 r.p.m. por 20 min, transfi-riendo el sobrenadante a otro tubo Eppendorf de 1,5 mL, al cual se le adicionó igual volu-  5 Total deterioro de la planta, las lesiones coalescen de forma que no se diferencia fácilmente el tamaño de las mismas ambiente por 10 minutos. Posteriormente, se centrifugó a 12500 r.p.m. por 20 min, transfi-riendo el sobrenadante a otro tubo Eppendorf de 1,5 mL, al cual se le adicionó igual volu-5Total deterioro de la planta, las lesiones coalescen de forma que no se diferencia fácilmente el tamaño de las mismas men de Cloroformo -Isoamil (24:1), se mez-    men de Cloroformo -Isoamil (24:1), se mez- cló por inversión y se centrifugó a 12500    cló por inversión y se centrifugó a 12500 r.p.m., durante 10 minutos, recuperando el    r.p.m., durante 10 minutos, recuperando el sobrenadante. Este se transfirió a un tubo    sobrenadante. Este se transfirió a un tubo Eppendorf de 1,5 mL, y se le adicionó 1/3    Eppendorf de 1,5 mL, y se le adicionó 1/3 del volumen de isopropanol frío, y se conser-    del volumen de isopropanol frío, y se conser- vó a -20 C° durante la noche. Posteriormente    vó a -20 C° durante la noche. Posteriormente se centrifugó a 12500 r.p.m, 10 min y se des-    se centrifugó a 12500 r.p.m, 10 min y se des- cartó el sobrenadante. El centrifugado se lavó, adicionando 350 µL de etanol 70 %    cartó el sobrenadante. El centrifugado se lavó, adicionando 350 µL de etanol 70 % frío; luego se centrífugó por cinco minutos a    frío; luego se centrífugó por cinco minutos a 12000 r.p.m.; este lavado se hizo dos veces,    12000 r.p.m.; este lavado se hizo dos veces, se descartó el sobrenadante, se dejó secar el    se descartó el sobrenadante, se dejó secar el precipitado para eliminar el exceso de alco-hol, y se resuspendió en 50 µL de Buffer TE.    precipitado para eliminar el exceso de alco-hol, y se resuspendió en 50 µL de Buffer TE.  "},{"text":" Tabla 3. Origen, grupos morfológicos, genéticos y patogenicidad de 56 aislamientos de Colletotrichum spp. del Valle del Cauca, inoculados en el cultivar de guanábana (Annona muricata) Elita, en condiciones de invernadero Identificación Sitio Tejido Diámetro (cm) Prome- dio a Progreso de la enfer- medad ABCPE b Patogenicidad grupo c Diámetro grupo d Tipo de colonia RAMs grupo PCR-RFLP grupo CgInt / ITS 4 e CaInt2 / ITS 4 f IdentificaciónSitioTejidoDiámetro (cm) Prome-dio aProgreso de la enfer-medadABCPE bPatogenicidadgrupo cDiámetro grupo dTipo de coloniaRAMs grupoPCR-RFLP grupoCgInt / ITS 4 eCaInt2 / ITS 4 f 19942-40 Corpoica Hoja 1,8 98,25  5 1 1 1 2 + - 19942-40CorpoicaHoja1,898,2551112+- 19945-36 Corpoica Hoja 2,3 60,63  4 4 1 2 2 + - 19945-36CorpoicaHoja2,360,6344122+- 19945-35 Corpoica Hoja 2,1 63,75  4 1 1 1 2 + - 19945-35CorpoicaHoja2,163,7541112+- 19945ped-36 Corpoica Pedúnculo 2,2 80,00  5 1 1 1 2 + - 19945ped-36CorpoicaPedúnculo2,280,0051112+- cd12rb-29 Caicedonia Rama 3,6  nd g  nd 3 3 4 1 - + cd12rb-29CaicedoniaRama3,6nd gnd3341-+ cd14r-42 Caicedonia Rama 3,9 27,33  3 5 3 1 2 + - cd14r-42CaicedoniaRama3,927,3335312+- cd23r-44 Caicedonia Rama 3,0 14,50  2 2 3 4 1 - + cd23r-44CaicedoniaRama3,014,5022341-+ 19945-38 Corpoica Hoja 2,0 65,88  4 1 1 1 2 + - 19945-38CorpoicaHoja2,065,8841112+- 20451-15 Corpoica Hoja 2,0 69,75  4 1 1 1 2 + - 20451-15CorpoicaHoja2,069,7541112+- Amonmt6h-3 CIAT Hoja 3,6 11,75  2 3 3 2 2 + - Amonmt6h-3CIATHoja3,611,7523322+- Amonvs1ab2m6-4 CIAT Hoja 3,3 10,75  2 2 3 2 2 + - Amonvs1ab2m6-4CIATHoja3,310,7522322+- c1-19 CIAT Hoja 4,0  2,00  1 5 3 2 2 + - c1-19CIATHoja4,02,0015322+- c5-26 CIAT Hoja 3,8  2,00  1 5 3 2 2 + - c5-26CIATHoja3,82,0015322+- cd14h Caicedonia Hoja 2,0 88,25  5 1 1 1 2 + - cd14hCaicedoniaHoja2,088,2551112+- cd1h Caicedonia Hoja 2,1 87,13  5 1 1 1 2 + - cd1hCaicedoniaHoja2,187,1351112+- 20172ped Corpoica Pedúnculo 2,1 66,50  4 1 1 1 2 + - 20172pedCorpoicaPedúnculo2,166,5041112+- cd23ra-44 Caicedonia Rama 4,0 10,00  2 5 3 2 2 + - cd23ra-44CaicedoniaRama4,010,0025322+- cd40-41 Caicedonia Rama 3,3  2,00  1 2 3 2 2 + - cd40-41CaicedoniaRama3,32,0012322+- cd43r Caicedonia Rama 1,8 94,00  5 1 1 1 2 + - cd43rCaicedoniaRama1,894,0051112+- cd6r-28 Caicedonia Rama 3,4 25,25  3 2 3 2 2 + - cd6r-28CaicedoniaRama3,425,2532322+- cd7r Caicedonia Rama 2,0 71,50  4 1 1 1 2 + - cd7rCaicedoniaRama2,071,5041112+- m10pdr-49 Pradera Rama 2,3 31,75  3 4 1 3 2 + - m10pdr-49PraderaRama2,331,7534132+- f20-12 CIAT Hoja 3,2  20,5  3 2 3 3 2 + - f20-12CIATHoja3,220,532332+- f21-5 CIAT Hoja 3,8  nd  nd 5 3 3 2 + - f21-5CIATHoja3,8ndnd5332+- f28-17 CIAT Hoja 3,6  2   1 3 3 2 2 + - f28-17CIATHoja3,6213322+- m17pdfl-37 Pradera Flor 2,1 11,67  2 1 1 1 2 + - m17pdfl-37PraderaFlor2,111,6721112+- m12sra-9 La Unión Hoja 3,8 29,88  3 5 3 2 2 + - m12sra-9La UniónHoja3,829,8835322+- m13pd Pradera Hoja 2,1 72,00  4 1 1 1 2 + - m13pdPraderaHoja2,172,0041112+- m13sra-22 La Unión Hoja 3,7  nd  nd 3 3 2 2 + - m13sra-22La UniónHoja3,7ndnd3322+- m13srb-31 La Unión Hoja 2,4 83,88  5 4 1 3 2 + - m13srb-31La UniónHoja2,483,8854132+- m14pdh Pradera Hoja 2,6 55,75  4 4 1 1 2 + - m14pdhPraderaHoja2,655,7544112+- m15pd-47 Pradera Hoja 2,1 76,13  4 1 1 1 2 + - m15pd-47PraderaHoja2,176,1341112+- cd12-43 Caicedonia Hoja 3,9 12,00  2 5 3 2 2 + - cd12-43CaicedoniaHoja3,912,0025322+- m16a-34 La Unión Hoja 4,0 20,25  3 5 3 2 2 + - m16a-34La UniónHoja4,020,2535322+- m20pd Corpoica Hoja 2,3 61,50  4 4 1 1 2 + - m20pdCorpoicaHoja2,361,5044112+- m25pdrb Pradera Rama 3,2 35,00  3 2 3 1 2 + - m25pdrbPraderaRama3,235,0032312+- m25pdfl-50 Pradera Flor 1,9 87,75  5 1 1 1 2 + - m25pdfl-50PraderaFlor1,987,7551112+- M26pdh Pradera Hoja 1,9 73,13  4 1 1 1 2 + - M26pdhPraderaHoja1,973,1341112+- m3612b La Unión Hoja 2,4  nd  nd 4 2 3 2 + - m3612bLa UniónHoja2,4ndnd4232+- m3612sr-46 La Unión Hoja 3,5 13,00  2 3 2 3 2 + - m3612sr-46La UniónHoja3,513,0023232+- m3612srcg-18 La Unión Hoja 2,4 11,75  2 4 2 3 2 + - m3612srcg-18La UniónHoja2,411,7524232+- m3913sr-30 La Unión Hoja 2,4  37,5  3 4 2 3 2 - - m3913sr-30La UniónHoja2,437,534232-- m3brasil b-39 Anserma Hoja 1,7 81,25  5 1 1 3 2 + - m3brasil b-39AnsermaHoja1,781,2551132+- m9pdr-45 Pradera Rama 1,9 48,25  3 1 1 1 2 + - m9pdr-45PraderaRama1,948,2531112+- m9pdra Pradera Rama 2,0  nd  nd 5 1 2 2 + - m9pdraPraderaRama2,0ndnd5122+- m3brasil-33 Anserma Hoja 1,9 84,67  5 1 1 1 2 + - m3brasil-33AnsermaHoja1,984,6751112+- m8brasila-35 Anserma Hoja 2,0 74,75  4 1 1 1 2 + - m8brasila-35AnsermaHoja2,074,7541112+- mamt4caliz-25 CIAT Hoja 4,2  6,00  1 5 3 2 1 - + mamt4caliz-25CIATHoja4,26,0015321-+ qh1m1-24 Quindío Hoja 3,0  9,75  2 2 3 2 2 + - qh1m1-24QuindíoHoja3,09,7522322+- 20171 Corpoica Hoja 2,0 107,25  5 1 1 1 2 + - 20171CorpoicaHoja2,0107,2551112+- cr26 CIAT Hoja 3,9  13,5  2 5 3 2 2 + - cr26CIATHoja3,913,525322+- bitaco- Bitaco Hoja 2,0 95,75  5 1 1 1 2 + - bitaco-BitacoHoja2,095,7551112+- 20452 Corpoica Hoja 1,9  0,00  1 5 1 1 2 + - 20452CorpoicaHoja1,90,0015112+- 20451Ped- Corpoica Pedúnculo 2,1 76,88  4 1 1 4 1 - + 20451Ped-CorpoicaPedúnculo2,176,8841141-+ Cd8-(control cítricos) Quindío Hoja nd  0   1 5 1 1 2 + - Cd8-(control cítricos)QuindíoHojand015112+- colleyuca-27 (control yuca)  Tallo 1.8  0   1 5 1 4 1 - + colleyuca-27 (control yuca)Tallo1.8015141-+  "}],"sieverID":"8c8ea489-c232-4ad4-8fa2-6dcc05e16416","abstract":""}

data/part_1/067b18dc917a73c34579a4554a01ce4e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"067b18dc917a73c34579a4554a01ce4e","source":"gardian_index","url":"https://dataverse.harvard.edu/api/access/datafile/:persistentId/?persistentId=doi:10.7910/DVN/N8F1FC/UKLKYK"},"pageCount":38,"title":"","keywords":[],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[]},{"head":"SEC","index":2,"paragraphs":[{"index":1,"size":4,"text":"Respondent Type Sample Type"}]},{"head":"PLS CHECK IN S6 CODE OF OCCUPATION FOR SUBSTITUTION","index":3,"paragraphs":[{"index":1,"size":125,"text":"Sinasabi ko sa magulang ko /ibang myembro ng pamilya ang gusto kong klase ng bigas at binibili nila ito para sa akin gamit ang pera nila 3 I tell my parents/other household members the type of rice that I like and they buy it for me using their own money Sinusubukan kong ipabili sa magulang ko/ibang myembro ng pamilya ang klase ng bigas na gusto ko pero tinatanggap ko kung ano man ang kanilang bilhin 4 TERMINATE I try to influence my parents on what type of rice to buy BUT accept whatever they buy Ang mga magulang ko/ibang myembro ng pamilya ang pumipili ng klase ng bigas na kakainin ko 5 My parents/other household members choose the type of rice that I will eat"}]},{"head":"Kadalasan, ako mismo ang nagdedesisyon at bumibili ng klase ng bigas na PERSONAL kong kakainin sa BAHAY 1","index":4,"paragraphs":[]},{"head":"CONTINUE","index":5,"paragraphs":[{"index":1,"size":68,"text":"Usually, I personally decide and buy the type of rice that I PERSONALLY eat AT HOME Kadalasan, ako mismo ang nagdedesisyon sa klase ng bigas na PERSONAL kong kinakain SA BAHAY at pinabibili ko lang ito sa iba gamit ang pera ko 2 Usually, I personally decide the type of rice that I PERSONALLY eat AT HOME and just ask somebody to buy it using my money 1/16/2020"}]},{"head":"Confirm the following demographic questions from the Probability Respondent S5 Maaari po bang malaman ang inyong edad noong inyong huling kaarawan? [SA]","index":6,"paragraphs":[{"index":1,"size":1,"text":"May "}]},{"head":"ASK ALL EVER USED Q4 Alin naman sa mga klase ng bigas na ito ang PERSONAL mong nasubukang kainin kahit minsan sa bahay nyo? Alin pa po? Mayroon pa po ba? [MA]","index":7,"paragraphs":[{"index":1,"size":20,"text":"Which of these types of rice have you ever tried PERSONALLY eating even once at home? Which else? Anything else?"}]},{"head":"SEE ANSWER GRID FOR Q4 ON THE NEXT PAGE PAST YEAR Q5 Alin naman sa mga ito ang PERSONAL mong nasubukang kainin kahit minsan nitong nakaraang isang taon sa bahay nyo? Alin pa po? Mayroon pa po ba? [MA]","index":8,"paragraphs":[{"index":1,"size":19,"text":"Which of these types of rice have you PERSONALLY tried eating even once in the past year at home? "}]},{"head":"Simulan po natin sa… (MENTION ATTRIBUTE).","index":9,"paragraphs":[{"index":1,"size":52,"text":"There are several factors that people think of when buying rice. For each factor that I am going to read out, please tell me how important it is. Please assign a score of 10 to VERY IMPORTANT and a score of 1 to NOT IMPORTANT AT ALL. Let's start with… (MENTION ATTRIBUTE). "}]},{"head":"SECTION D. IMPORTANCE AND IMAGERY","index":10,"paragraphs":[]},{"head":"Good quality packaging (Mataas ang kalidad ng packaging/ lalagyan ng bigas)","index":11,"paragraphs":[{"index":1,"size":6,"text":"Rice easily expands while cooking (\"Maalsa\")"},{"index":2,"size":8,"text":"Cooked rice is loose / not sticky (\"Buhaghag\")"},{"index":3,"size":6,"text":"Value for money (Sulit sa halaga)"}]},{"head":"Promotes indigenous farming and cultural practices (Nagsusulong ng katutubong pamamaraan ng pagsasaka at kultura)","index":12,"paragraphs":[]},{"head":"Conserves traditional rice varieties and biodiversity (Pinangangalagaan ang mga tradisyunal na klase ng bigas at ang biodiversity)","index":13,"paragraphs":[{"index":1,"size":8,"text":"Preserves rice terraces landscape (Pinangangalagaan ang rice terraces)   "}]}],"figures":[{"text":"From a reliable source or brand (Ang pinanggalingan o brand ng bigas ay mapagkakatiwalaan)Good quality packaging (Mataas ang kalidad ng packaging/ lalagyan ng bigas)Cooked rice is soft (Malambot ang nalutong kanin)Has a high degree of whiteness (Mas maputi ang bigas)Conserves traditional rice varieties and biodiversity (Pinangangalagaan ang mga tradisyunal na klase ng bigas at ang biodiversity)Preserves rice terraces landscape (Pinangangalagaan ang rice terraces)Value for money (Sulit sa halaga)Promotes indigenous farming and cultural practices (Nagsusulong ng katutubong pamamaraan ng pagsasaka at kultura)Rice easily expands while cooking (\"Maalsa\")Cooked rice is loose / not sticky (\"Buhaghag\")Suits my taste (Naaayon sa aking panlasa)Cooked rice does not easily get spoiled (Hindi madaling mapanis ang kanin)Best quality rice (Pinakamagandang kalidad ng bigas)Has low percentage of broken grains (Konti lang ang nadudurog na bigas)Good only for special occasions (Pang mga espesyal na okasyon lang) Can be eaten by children and adults (Pwede sa bata at matanda) "},{"text":"usapan naman po natin ang tungkol sa klase ng bigas na PERSONAL mong kinakain sa loob ng bahay. Huwag niyong isali ang mga kinakain niyong klase ng kanin sa labas ng bahay. I know your age as of your last birthday?[SA]    Now, let's talk about the type of rice that you PERSONALLY eat at home. Please exclude those you consume out-of-home.     1/16/2020 1/16/2020 BELOW 20 YRS. OLD 20-25 yo 26-30 yo 31-35 yo Pag-SPONTANEOUS AWARENESS 36-40 yo 41-45 yo Q1 Maaari n' 0 1 2 3 5 4 TERMINATE CONTINUE ACTUAL AGE BIRTHDAY BELOW 20 YRS. OLD 20-25 yo 26-30 yo 31-35 yo Pag-SPONTANEOUS AWARENESS 36-40 yo 41-45 yo Q1 Maaari n'0 1 2 3 5 4TERMINATE CONTINUEACTUAL AGE BIRTHDAY 46-50 yo  6  46-50 yo6 51-55 yo  7  51-55 yo7 56-60 yo  8  56-60 yo8 ABOVE 60 YRS. OLD 9 TERMINATE ABOVE 60 YRS. OLD9TERMINATE S6 Ano po ang kasalukuyan nyong trabaho? S6 Ano po ang kasalukuyan nyong trabaho? What is your current occupation?  ACTUAL OCCUPATION: What is your current occupation?ACTUAL OCCUPATION: Professional (board passer e.g. teacher, lawyer, doctor, nurse, CPA, engineer, architect, etc) Professional (board passer e.g. teacher, lawyer, doctor, nurse, CPA, engineer, architect, etc) Self-employed (no employer; not registered) Self-employed (no employer; not registered) Business owner (registered micro business, with less than 10 employees) Business owner (registered micro business, with less than 10 employees) Business owner (registered small business, with 10-99 employees) Business owner (registered small business, with 10-99 employees) Business owner (registered medium business, with 100-199 employees) Business owner (registered medium business, with 100-199 employees) Skilled-White Collar    Skilled-White Collar Skilled-Blue Collar    Skilled-Blue Collar Unskilled worker (construction worker, bagger, etc.) Unskilled worker (construction worker, bagger, etc.) Sales-related occupation   Sales-related occupation Military/Police/AFP/Navy   10 Military/Police/AFP/Navy10 Small vendor    11 Small vendor11 Driver (public/private transport)   12 Driver (public/private transport)12 S7 Ano ang inyong marital status?   S7 Ano ang inyong marital status? What is your marital status?   What is your marital status? Single  1  Single1 Married/Living with partner 2  Married/Living with partner2 Separated/Widowed 3  Separated/Widowed3 S8 RECOND GENDER   S8 RECOND GENDER Male 1   Male1 Female 2   Female2     PROJECT: HEIRLOOM JN 15-0007 PROJECT: HEIRLOOM JN 15-0007     of 38 of 38  "},{"text":"yo bang sabihin sa akin kung anu-anong klase ng bigas ang alam mo? Ano pa po? Mayroon pa po ba? Can you please tell me the types of rice that you are aware of? What else? Anything else? SEE ANSWER GRID FOR Q1 ON THE NEXT PAGE SEE ANSWER GRID FOR Q1 ON THE NEXT PAGE USE SHOWCARDS FOR Q2 -Q7 USE SHOWCARDS FOR Q2 -Q7 PROMPTED AWARENESS PROMPTED AWARENESS Q2 Ngayon, Q2 Ngayon,  "},{"text":"kung titingin sa kard na ito, alin sa mga klase ng bigas na ito ang alam mo kahit hindi pa nyo ito nasusubukan? Ano pa po? Mayroon pa po ba? [MA] Now, looking at this card, which of these types of rice are you aware of? What else? Anything else?[MA]      "},{"text":"SEE ANSWER GRID FOR Q2 ON THE NEXT PAGE ASK AMONG THOSE WHO ARE AWARE OF SUPER PREMIUM (codes 5&6,22), BROWN RICE (codes 7&8,23) OR PIGMENTED RICE (codes 9&10,24) , REFER TO Q1 & Q2 SOURCE OF AWARENESS Q3 Paano mo nalaman ang [MENTION RICE TYPES AWARE OF, REFER TO Q1/Q2]? Paano pa? Mayroon pa po ba? [MA] SEE ANSWER GRID FOR Q3 BELOW   "},{"text":"SEE ANSWER GRID FOR Q5 ON THE NEXT PAGE codes 7/8/23 ANSWER GRID FOR Q3  MAIN QUESTIONNAIRE      MAIN QUESTIONNAIRE SECTION A.      SECTION A. Super Premium Brown Rice Pigmented Rice SuperPremiumBrownRicePigmentedRice Word of mouth from Family/Relatives / Narinig sa pamilya/kamag-anak 1 1 1 Word of mouth from Family/Relatives / Narinig sa pamilya/kamag-anak111 Word of mouth from Friends / Narining sa (mga) kaibigan 2 2 2 Word of mouth from Friends / Narining sa (mga) kaibigan222 Recommended by Doctors/Nutritionist/Dietician 3 3 3 Recommended by Doctors/Nutritionist/Dietician333 Recommended by Fitness Instructor 4 4 4 Recommended by Fitness Instructor444 Free samples/Gift from friends/relatives 5 5 5 Free samples/Gift from friends/relatives555 TV 6 6 6 TV666 Radio 7 7 7 Radio777 Newspapers 8 8 8 Newspapers888 Magazines 9 9 9 Magazines999 Billboards 10 10 10 Billboards101010 Public transport wraps/stickers (buses, jeeps, tricycle) 11 11 11 Public transport wraps/stickers (buses, jeeps, tricycle)111111  "},{"text":"AWARENESS AND CONSUMPTION OF RICE TYPES REFER TO Q1 / Q2 codes 5/6/22 codes 9/10/24  1/16/2020 1/16/2020 12 12 13 13 14 14 15 15 16 16 17 17 99 99 PAST 3 MONTHS PAST 3 MONTHS Q6 Alin Q6 Alin  "},{"text":"naman sa mga ito ang PERSONAL mong nasubukang kainin kahit minsan nitong nakaraang 3 buwan sa bahay nyo? Alin pa po? Mayroon pa po ba? [MA]  Which of these types of rice have you PERSONALLY tried eating even once in the past 3 months at home? Which of these types of rice have you PERSONALLY tried eating even once in the past 3 months at home? Which else? Anything else? [MA] Which else? Anything else? [MA] PAST MONTH PAST MONTH Q7 Alin Q7 Alin  "},{"text":"naman sa mga ito ang PERSONAL mong nasubukang kainin kahit minsan nitong nakaraang isang buwan sa bahay nyo? Alin pa po? Mayroon pa po ba? [MA]  Instore materials /          Instore materials / Blogs       15  15 Blogs1515        16  16 1616 Cooking shows on TV / Cooking demo     17  17 Cooking shows on TV / Cooking demo1717 Others, please specify:          Others, please specify: _______________          _______________ CAN'T RECALL       99  99 CAN'T RECALL9999  Q1 Q1 Q2 Q4 Q5 Q6 Q7 Q8 Q9 Q1Q1Q2Q4Q5Q6Q7Q8Q9  TOM Others Aided Ever Used Past Year Past 3M Past Month Most Often Regularly Eaten by Other HH members TOM Others AidedEver UsedPast YearPast 3MPast MonthMost OftenRegularly Eaten by Other HH members  [SA] [MA] [MA] [MA] [MA] [MA] [MA] [SA] [MA] [SA][MA][MA][MA][MA][MA][MA][SA][MA] NFA 1 1 1 1 1 1 1 1 1 NFA111111111  2 2 2 2 2 2 2 2 2 222222222  _____ _____ _____ _____ _____ _____ _____ _____  _____ _____ _____ _____ _____ _____ _____ _____  _____ _____ _____ _____ _____ _____ _____ _____  _____ _____ _____ _____ _____ _____ _____ _____ Organic 3 3 3 3 3 3 3 3 3 Organic333333333 Non-organic 4 4 4 4 4 4 4 4 4 Non-organic444444444 Unspecified 21 21 21 21 21 21 21 21 21 Unspecified212121212121212121  "},{"text":"Mga advertisement sa loob ng pamilihan(i.e. posters, price tags, streamers, stickers, brochures, pamphlets, etc.)           1/16/2020 1/16/2020 1/16/2020 1/16/2020 Saw rice type in the supermarket/market stalls/other stores Super Premium Rice (Ex:  12   12 Saw rice type in the supermarket/market stalls/other stores Super Premium Rice (Ex:1212 Basmati, Japanese/ ASK ALL JapaneseSasanishki SHOWCARD      13   13 Basmati, Japanese/ ASK ALL JapaneseSasanishki SHOWCARD1313 Internet Japonica, Jasmine, Miponica, SOURCE OF PURCHASE Doña Maria Rice, etc.) Q10 Saan 14 _____ _____ _____ _____ _____ _____ _____ _____ 14 ________________ Internet Japonica, Jasmine, Miponica, SOURCE OF PURCHASE Doña Maria Rice, etc.) Q10 Saan14 _____ _____ _____ _____ _____ _____ _____ _____14 ________________ Social Networking site (Facebook, instagram, etc.) Organic 5 5 5 5 5 5 5 5 5 Social Networking site (Facebook, instagram, etc.) Organic 5 5 5555555 Non-organic 6 6 6 6 6 6 6 6 6 Non-organic666666666 Unspecified 22 22 22 22 22 22 22 22 22 Unspecified222222222222222222 Brown Rice          Brown Rice Organic 7 7 7 7 7 7 7 7 7 Organic777777777 Non-organic 8 8 8 8 8 8 8 8 8 Non-organic888888888 Unspecified 23 23 23 23 23 23 23 23 23 Unspecified232323232323232323 Pigmented Rice (Red,          Pigmented Rice (Red, Black/Purple)          Black/Purple) Organic 9 9 9 9 9 9 9 9 9 Organic999999999 Non-organic 10 10 10 10 10 10 10 10 10 Non-organic101010101010101010 Unspecified 24 24 24 24 24 24 24 24 24 Unspecified242424242424242424 Ifugao/Sagada/Cordillera Rice         Ifugao/Sagada/Cordillera Rice Organic 11 11 11 11 11 11 11 11 11 Organic111111111111111111 Non-organic 12 12 12 12 12 12 12 12 12 Non-organic121212121212121212 Unspecified 25 25 25 25 25 25 25 25 25 Unspecified252525252525252525 Malagkit/ Sticky Rice 15 15 15 15 15 15 15 15 15 Malagkit/ Sticky Rice151515151515151515 NONE x 99 x x x x x x x NONEx99xxxxxxx Ordinary Rice (Ex: Angelica,          Ordinary Rice (Ex: Angelica, Azucena, C4, Intan, IR64,          Azucena, C4, Intan, IR64, Laon, Long Grain, Maharlika,          Laon, Long Grain, Maharlika, Wagwag, etc.)         ________________ Wagwag, etc.)________________ Premium Rice (Ex:          Premium Rice (Ex: California, Dinorado, Kukuyo,          California, Dinorado, Kukuyo, Milagrosa, Sinandomeng, etc)         ________________ Milagrosa, Sinandomeng, etc)________________  "},{"text":"karaniwang binibili ang [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8]? Saan pa po? Mayroon pa po ba? [MA]  Where do you normally buy [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8]? Where else? Where do you normally buy [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8]? Where else? Where else? [MA] Where else? [MA] ASK IF ATE SUPER PREMIUM (codes 5-6,22), BROWN RICE (codes 7-8,23), PIGMENTED (codes 9-10,24) ASK IF ATE SUPER PREMIUM (codes 5-6,22), BROWN RICE (codes 7-8,23), PIGMENTED (codes 9-10,24) AND ORGANIC RICE (codes 3,5,7,9,11) IN THE PAST YEAR, REFER TO Q5 AND ORGANIC RICE (codes 3,5,7,9,11) IN THE PAST YEAR, REFER TO Q5 SHOWCARD SHOWCARD Q11 Saan naman karaniwang binibili ang [SUPER PREMIUM / BROWN RICE / PIGMENTED RICE / Q11 Saan naman karaniwang binibili ang [SUPER PREMIUM / BROWN RICE / PIGMENTED RICE / ORGANIC RICE, REFER TO ANSWER IN Q5]? [MA] ORGANIC RICE, REFER TO ANSWER IN Q5]? [MA] And where do you normally purchase [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC And where do you normally purchase [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC RICE REFER TO ANSWER IN Q5]? [MA] RICE REFER TO ANSWER IN Q5]? [MA] Supermarket/Hypermart Supermarket/Hypermart Groceries Groceries Others, specify Others, specify  "},{"text":"ASK ALL USUAL PURCHASER Q12 Sino ang karaniwang bumibili ng [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8]? [MA]  Who normally buys [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8?] [MA] Who normally buys [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8?] [MA]  "},{"text":"ASK IF ATE SUPER PREMIUM (codes 5-6,22), BROWN RICE (codes 7-8,23), PIGMENTED (codes 9-10,24) AND ORGANIC RICE (codes 3,5,7,9,11) IN THE PAST YEAR, REFER TO Q5 Q13 Sino naman karaniwang bumibili ng [SUPER PREMIUM/BROWN RICE/PIGMENTED RICE/ ORGANIC RICE, REFER TO ANSWER IN Q5]? [MA]  Market Stalls selling rice and      Market Stalls selling rice and other products (      other products ( Special Kiosks/Specialty Rice      Special Kiosks/Specialty Rice stores (store selling special 5 5 5 5 5 stores (store selling special55555 types of rice only)      types of rice only)  6 6 6 6 6 66666  7 7 7 7 7 77777 And who normally purchase [SUPER PREMIUM/BROWN RICE/PIGMENTED RICE/ORGANIC RICE,  And who normally purchase [SUPER PREMIUM/BROWN RICE/PIGMENTED RICE/ORGANIC RICE, REFER TO ANSWER IN Q5]? [MA]      REFER TO ANSWER IN Q5]? [MA]  "},{"text":"Stall sa palengke na nagtitinda ng bigas at iba pang paninda)  Market Stalls only selling rice     Market Stalls only selling rice (     ( 4 4 4 4 4 44444  "},{"text":"Stall sa palengke na bigas lang itinitinda)  Sari Sari Store      Sari Sari Store Neighborhood Rice Stalls (bigas lang ang itinitinda) 2 2 2 2 2 Neighborhood Rice Stalls (bigas lang ang itinitinda)22222  3 3 3 3 3 33333  "},{"text":"(nagtitinda ng bigas at iba pang paninda)  RICE     RICE 1 1 1 1 1 11111  "},{"text":"EAT MOST OFTEN SUPER PREMIUM (codes 5-6,22 in Q5) BROWN RICE (codes 7-8,23 in Q5) PIGMENTED (codes 9-10,24 in Q5) ORGANIC (codes 3,5,7,9,11 in Q5)       1/16/2020 1/16/2020 SECTION B. PURCHASE BEHAVIOR Q12 Q13  SECTION B. PURCHASE BEHAVIOR Q12Q13  [MA] [MA] [MA] [MA] [MA] [MA][MA][MA][MA][MA] Respondent 1 1 1 1 1 Respondent11111 Spouse / Asawa 2 2 2 2 2 Spouse / Asawa22222 Mother / Mother-in-law 3 3 3 3 3 Mother / Mother-in-law33333 Father / Father-in-law 4 4 4 4 4 Father / Father-in-law44444 Sibling / Kapatid 5 5 5 5 5 Sibling / Kapatid55555 Children / Anak 6 6 6 6 6 Children / Anak66666 Household help/ Kasambahay 7 7 7 7 7 Household help/ Kasambahay77777 Others, specify      Others, specify  Q10   Q11  Q10Q11  [MA] [MA] [MA] [MA] [MA] [MA][MA][MA][MA][MA]  "},{"text":"RICE EAT MOST OFTEN SUPER PREMIUM (codes 5-6,22 in Q5) BROWN RICE (codes 7-8,23 in Q5) PIGMENTED (codes 9-10,24 in Q5) ORGANIC (codes 3,5,7,9,11 in Q5) 1/16/2020 ASK ALL FREQUENCY OF PURCHASE Q14 Gaano kayo kadalas bumili / magpabili ng [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8] sa karaniwan? [SA]  How often do you buy/ask someone to buy [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8]? How often do you buy/ask someone to buy [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8]? on the average? [SA] on the average? [SA]  "},{"text":"ASK IF ATE SUPER PREMIUM (codes 5-6,22), BROWN RICE (codes 7-8,23), PIGMENTED (codes 9-10,24) AND ORGANIC RICE (codes 3,5,7,9,11) IN THE PAST YEAR, REFER TO Q5 Q15 Gaano naman kayo kadalas bumili / magpabili ng [SUPER PREMIUM / BROWN RICE / PIGMENTED/ ORGANIC RICE, REFER TO ANSWER IN Q5]?  How often do you buy/ask someone to buy [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC How often do you buy/ask someone to buy [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC RICE REFER TO ANSWER IN Q5]? RICE REFER TO ANSWER IN Q5]?  "},{"text":"ASK ALL PURCHASE VOLUME PER PURCHASE OCCASION Q16 Mga ilang kilong bigas ang karaniwan mong binibili/pinapabili kada bili mo ng [MENTION RICE TYPE EAT MOST OFTEN, REFER TO Q8] sa karaniwan?  How many kilos do you normally buy / ask someone to buy everytime you buy [MENTION RICE EAT How many kilos do you normally buy / ask someone to buy everytime you buy [MENTION RICE EAT MOST OFTEN, REFER TO Q8]? MOST OFTEN, REFER TO Q8]?  "},{"text":"ASK IF ATE SUPER PREMIUM (codes 5-6,22), BROWN RICE (codes 7-8,23), PIGMENTED (codes 9-10,24) AND ORGANIC RICE (codes 3,5,7,9,11) IN THE PAST YEAR, REFER TO Q5 Bought only once / Isang beses pa lang bumili/ nagpabili  Less often than once a month /     Less often than once a month / 99 99 99 99 99 9999999999  "},{"text":"Mas madalang pa kaysa isang beses kada buwan (specify)  Once a week or more often/      Once a week or more often/ 2-3 times a month / 2-3 beses kada buwan 2 2 2 2 2 2-3 times a month / 2-3 beses kada buwan22222 Once a month / Isang beses kada buwan 3 3 3 3 3 Once a month / Isang beses kada buwan33333  ______ ______ ______ ______ ______ ______________________________  "},{"text":"Isang beses kada linggo o mas madalas (specify)  RICE     RICE ______ ______ ______ ______ ______ ______________________________  "},{"text":"EAT MOST OFTEN SUPER PREMIUM (codes 5-6,22 in Q5) BROWN RICE (codes 7-8,23 in Q5) PIGMENTED (codes 9-10,24 in Q5) ORGANIC (codes 3,5,7,9,11 in Q5) [SA] [SA] [SA] [SA] [SA] Q14 Q15 1/16/2020 Q17 At mga ilang kilo namang [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC RICE, REFER TO ANSWER IN Q5] ang binibili/pinapabili mo kada bili ng bigas?  And how many kilos of [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC RICE, REFER And how many kilos of [SUPER PREMIUM / BROWN RICE / PIGMENTED / ORGANIC RICE, REFER TO ANSWER IN Q5] do you buy/ask someone to buy everytime you buy rice?  TO ANSWER IN Q5] do you buy/ask someone to buy everytime you buy rice? Q16 Q17 Q16Q17 Purchase volume in kilos  Purchase volume in kilos  "},{"text":"RICE EAT MOST OFTEN SUPER PREMIUM (codes 5-6,22 in Q5) BROWN RICE (codes 7-8,23 in Q5) PIGMENTED (codes 9-10,24 in Q5) ORGANIC (codes 3,5,7,9,11 in Q5) 1/16/2020 ASK IF ATE SUPER PREMIUM (codes 5-6,22), BROWN RICE (codes 7-8,23), PIGMENTED (codes 9-10,24) IN THE PAST YEAR, REFER TO Q5 Q18 Magkano naman kada kilo ang [SUPER PREMIUM / BROWN RICE/PIGMENTED / ORGANIC RICE, REFER TO ANSWER IN Q5] na binibili/pinapabili mo? How much per kilo do you normally pay for [SUPER PREMIUM/BROWN RICE/PIGMENTED/ORGANIC RICE, REFER TO ANSWER IN Q5] that you buy/ask someone to buy? Super Premium Rice (ex. Basmati, Jasmine, Japanese Rice)   Super Premium Rice (ex. Basmati, Jasmine, Japanese Rice) Organic Php /kilo OrganicPhp/kilo Non-organic Php /kilo Non-organicPhp/kilo Unspecified Php /kilo UnspecifiedPhp/kilo Brown Rice   Brown Rice Organic Php /kilo OrganicPhp/kilo Non-organic Php /kilo Non-organicPhp/kilo Unspecified Php /kilo UnspecifiedPhp/kilo Pigmented Rice (Red, Black/Purple)   Pigmented Rice (Red, Black/Purple) Organic Php /kilo OrganicPhp/kilo Non-organic Php /kilo Non-organicPhp/kilo Unspecified Php /kilo UnspecifiedPhp/kilo  "},{"text":"codes 5-6,22 in Q5) BROWN RICE (codes 7-8,23 in Q5)   1/16/2020 1/16/2020 Q21 Anu-  Q21 Anu-  Price / kilo Price / kilo SECTION C. CONSUMPTION BEHAVIOR SECTION C. CONSUMPTION BEHAVIOR PIGMENTED (codes 9-10,24 in Q5) ORGANIC (codes 3,5,7,9,11 in Q5) PIGMENTED (codes 9-10,24 in Q5)ORGANIC (codes 3,5,7,9,11 in Q5)  "},{"text":"ano ang mga hindi mo nagustuhan sa [SUPER PREMIUM/BROWN RICE/ PIGMENTED/ ORGANIC RICE] na nasubukan mo nitong nakaraang taon? Ano pa po? Mayroon pa po ba? What did you not like about the [SUPER PREMIUM/BROWN RICE/PIGMENTED/ORGANIC RICE] that you tried in the past year? What else? Any other reason? SUPER PREMIUM (codes 5-6,22 in Q5) BROWN RICE (codes 7-8,23 in Q5) SUPER PREMIUM (codes 5-6,22 in Q5)BROWN RICE (codes 7-8,23 in Q5) PIGMENTED (codes 9-10,24 in Q5) ORGANIC (codes 3,5,7,9,11 in Q5) PIGMENTED (codes 9-10,24 in Q5)ORGANIC (codes 3,5,7,9,11 in Q5)  "},{"text":"Lampas nang isang taon) 1 a year ago (Isang taon na ang nakalipas) 2   "},{"text":"6 na buwan na ang nakalipas pero hindi pa lalampas sa isang taon) 3 months to less than 6 months ago (  "},{"text":"3 na buwan na ang nakakalipas pero hindi pa lalampas sa 6 na buwan) a month to less than 3 months ago (  "},{"text":"1 na buwan na ang nakakalipas pero hindi 5 pa lalampas sa 3 buwan) less   "},{"text":"hindi pa aabot sa isang buwan ang nakakalipas) 6 INFLUENCERS Q23 Sino ang nagrekomenda o ano ang nag-impluwensya sa iyo para subukan ang BROWN RICE? Sino o ano pa po? Mayroon pa po ba   "},{"text":"mo kanina na nasubukan mong kumain ng BROWN RICE. Nung niluto/pinaluto mo ba ito ay sinunod mo ang cooking instructions? You mentioned earlier that you have tried eating BROWN RICE. When you cooked it / asked someone to cook it, did you follow the cooking instructions? Yes, followed the cooking instructions in the label Oo  "},{"text":", sinunod ang cooking instruction o paraan ng pagluluto na nakalagay sa label No, did not follow the cooking instructions in the label Hindi  "},{"text":"sinunod ang cooking instruction o paraan ng pagluluto na nakalagay sa label   "},{"text":"nakalagay na cooking instruction o paraan na pagluluto Q25 Kapag sinasaing mo ba ang BROWN RICE, ito ba ay walang halo o hinahaluan mo ng ibang klase ng bigas? When you cook BROWN RICE, do you cook it as is or you mix it with other rice types? Cook on its own (Sinasaing ng walang halo) 1 Cook on its own (Sinasaing ng walang halo)1 Mix it with other rice type (  Mix it with other rice type (  "},{"text":"Sinasaing ito na may halong ibang klaseng bigas) 2 Q26 May iba bang myembro ng pamilya na kumakain din ng BROWN RICE? Saang age range sila kasali  12 years old and below 1 41-45 yo 7 12 years old and below141-45 yo7 13 -19 2 46-50 yo 8 13 -19246-50 yo8 20-25 yo 3 51-55 yo 9 20-25 yo351-55 yo9 26-30 yo 4 56-60 yo 10 26-30 yo456-60 yo10 31-35 yo 5 ABOVE 60 YRS. OLD 11 31-35 yo5ABOVE 60 YRS. OLD11 36-40 yo 6 None/No other household member 99 36-40 yo6None/No other household member99 NOTE TO INTERVIEWERS    NOTE TO INTERVIEWERS  "},{"text":"/EDITORS/DP: CHECK CONSISTENCY VS. Q9 (IF CODE 7/8/23) Q27 Kumakain ka rin ba ng BROWN rice pag nasa labas ka nang bahay (office, school, restaurants, etc)? Do  Yes / Oo 1 Yes / Oo1 No / Hindi 2 No / Hindi2 ASK ALL  ASK ALL FREQUENCY OF EATING RICE TYPE FREQUENCY OF EATING RICE TYPE Q28 Gaano  Q28 Gaano  "},{"text":"ka kadalas kumain ng kanin sa bahay kapag [MENTION RICE EAT MOST OFTEN, REFER TO Q8] ang kinakain? [SA]   1/16/2020 1/16/2020 ASK IF ATE BROWN RICE IN THE PAST YEAR [Q5=codes 7/8/23]  ASK IF ATE BROWN RICE IN THE PAST YEAR [Q5=codes 7/8/23] Q29 Paano naman kung [BROWN RICE, REFER TO ANSWER IN Q5]? [SA]  Q29 Paano naman kung [BROWN RICE, REFER TO ANSWER IN Q5]? [SA] How about [BROWN RICE, REFER TO ANSWER IN Q5]? [SA]  How about [BROWN RICE, REFER TO ANSWER IN Q5]? [SA] Q29  Q29  1 1  2 2 More than 3 times a day 2-3 times a day 3 More than 3 times a day 2-3 times a day3 Once a day  Once a day 2-3 times a week  2-3 times a week Once a week  Once a week 2-3 times a month  2-3 times a month Once a month  Once a month SHOWCARD  SHOWCARD OCCASIONS EAT RICE  OCCASIONS EAT RICE Q30 Nitong  Q30 Nitong How often do you eat rice at home when eating [MENTION RICE EAT MOST OFTEN, REFER TO Q8]? [SA] How often do you eat rice at home when eating [MENTION RICE EAT MOST OFTEN, REFER TO Q8]? [SA]  "},{"text":"nakalipas na isang taon, sa alin sa mga sitwasyon o okasyon na ito ka kumakain ng kanin sa bahay, kasama dito ang mga lutuin at desserts na ginagamitan ng bigas? Kung may iba pang sitwasyon o okasyon na wala sa listahan ay pakisabi lang sa akin   1/16/2020 1/16/2020 ASK IF ATE  ASK IF ATE Q28  Q28 RICE EAT MOST OFTEN (in Q8) BROWN RICE (in Q5) RICE EAT MOST OFTEN (in Q8)BROWN RICE (in Q5) [SA] [SA] [SA][SA] 1 1 11 2 2 22 3 3 33 4 4 44 5 5 55 6 6 66 7 7 77 Less often than once a  Less often than once a month, specify  month, specify  "},{"text":"BROWN RICE IN THE PAST YEAR [Q5=codes 7/8/23] Q31 Sa anong sitwasyon o okasyon mo naman kinakain ang [BROWN RICE REFER TO Q5] nitong nakalipas na isang taon? Saan pa po? Mayroon pa po ba? Kung may iba pang sitwasyon o okasyon na wala sa listahan ay pakisabi lang sa akin. [MA] On what situations or occasions do you eat [BROWN RICE REFER TO Q5] this past year? What else? Anything else? If there are other situations or occasions not in the list, please tell me.[MA] Meal Parts Meal Parts Breakfast Breakfast Morning Snacks Morning Snacks Lunch Lunch Afternoon Snacks Afternoon Snacks Dinner Dinner Midnight Snacks Midnight Snacks Special Occasions Special Occasions Fiesta Fiesta Promotions/Milestones Promotions/Milestones Others, specify Others, specify SHOWCARD SHOWCARD RICE/RICE RICE/RICE  "},{"text":"-BASED FOOD CONSUMED IN THE PAST YEAR Q32 Anu-anong klase ng pagkakaluto ng kanin ang kinain mo nitong nakaraang isang taon, ito man ay niluto mo/ng iba o binili. Pakisama pati ang mga lutuin at desserts na ginagamitan ng bigas. Kung may iba pang klase ng pagkakaluto ng kanin na wala sa listahan ay pakisabi lang sa akin. Umpisahan natin sa [MENTION OCCASION EAT RICE IN GENERAL IN Q30   "},{"text":"Note to Interviewer: Ask on all Occasions Eat rice/Rice-based dishes/desserts in Q30              1/16/2020 1/16/2020  (1) (2) (3)  (4) (5)  (6)   (1)(2)(3)(4)(5)(6)  Breakfast AM Snacks Lunch Q30 PM Snacks Dinner Q31 Midnight Snacks   BreakfastAM SnacksLunchQ30PM SnacksDinnerQ31 MidnightSnacks Steamed Rice [MA] 1 [MA] 1 [MA] RICE IN [MA] GENERAL 1 1 [MA] BROWN RICE [MA] 1 1 [MA] 1 [MA] 1 [MA] 1 Steamed Rice[MA] 1[MA] 1[MA] RICE IN [MA] GENERAL 1 1[MA] BROWN RICE [MA] 1 1[MA] 1[MA] 1[MA] 1 Fried Rice/Sinangag    [MA]   [MA]     Fried Rice/Sinangag[MA][MA] Adobo Rice 2 2 2  2 2  2 2 2 2 Adobo Rice222222222 Bagoong Rice 3 3 3 1 3 3 1 3 3 3 3 Bagoong Rice33313313333 Garlic Rice 4 4 4 2 4 4 2 4 4 4 4 Garlic Rice44424424444 Seafood Rice 5 5 5 3 5 5 3 5 5 5 5 Seafood Rice55535535555 Yangchow Rice 6 6 6 4 6 6 4 6 6 6 6 Yangchow Rice66646646666 Plain (Cooking Oil+Salt only) Others, specify 7 7 7 5 6 7 7 5 6 7 7 7 7 Plain (Cooking Oil+Salt only) Others, specify7775 6775 67777 Big Parties with other relatives and guests Paella 20 Arroz caldo/Lugaw/Goto 21 Maki 22 Celebrations with Immediate Family (Birthday, 20 21 22 Sushi 23 23 Anniversary,etc) Biko 24 24 Champorado 25 25 20 21 22 23 24 25 10 8 7 9 20 21 22 23 24 25 20 21 22 23 24 25 7 8 9 10 20 21 22 23 24 25 20 21 22 23 24 25 20 21 22 23 24 25 20 21 22 23 24 25 Big Parties with other relatives and guests Paella 20 Arroz caldo/Lugaw/Goto 21 Maki 22 Celebrations with Immediate Family (Birthday, 20 21 22 Sushi 23 23 Anniversary,etc) Biko 24 24 Champorado 25 2520 21 22 23 24 2510 8 7 920 21 22 23 24 2520 21 22 23 24 257 8 9 1020 21 22 23 24 2520 21 22 23 24 2520 21 22 23 24 2520 21 22 23 24 25 Kalamay 26 26 26  26 26  26 26 26 26 Kalamay262626262626262626 Palitaw 27 27 27  27 27  27 27 27 27 Palitaw272727272727272727 Others, specify            Others, specify  "},{"text":"ASK IF ATE BROWN RICE IN THE PAST YEAR [Q5=codes 7/8/23] SHOWCARD Q33 Anu-anong klase ng pagkakaluto ng BROWN RICE ang kinain mo nitong nakaraang isang taon, ito man ay niluto mo/ng iba o binili. Pakisama pati ang mga lutuin at desserts na ginagamitan ng BROWN RICE? Kung may iba pang klase ng pagkakaluto ng BROWN RICE na wala sa listahan ay pakisabi lang sa akin. Umpisahan natin sa [MENTION OCCASION EAT BROWN RICE IN Q31]. In general, what types of BROWN RICE preparation did you eat in the past year regardless if you personally cooked it/cooked by others or bought? Please include all rice and rice/based dishes and desserts made from BROWN RICE. If there are other types of BROWN preparation not in the list, please tell me. Let's start with [MENTION OCCASION EAT BROWN RICE IN Q31].  "},{"text":"Note to Interviewer: Ask on all Occasions Eat rice/Rice-based dishes/desserts in Q31 Q32. RICE IN GENERAL              1/16/2020 1/16/2020  (1) Breakfast (2) AM Snacks (3) Lunch (4) PM Snacks (5) Dinner (6) Midnight Snacks Special Occ 1: ____________ Special Occ 2: ____________ Special Occ 3: ____________ (1) Breakfast(2) AM Snacks(3) Lunch(4) PM Snacks(5) Dinner(6) Midnight SnacksSpecial Occ 1:____________Special Occ 2:____________Special Occ 3:____________  [MA] [MA] [MA] [MA] [MA] [MA] [MA] [MA] [MA] [MA][MA][MA][MA][MA][MA][MA][MA][MA] Steamed Rice 1 1 1 1 1 1 1 1 1 Steamed Rice111111111 Fried Rice/Sinangag            Fried Rice/Sinangag Adobo Rice 2 2 2 2 2 2 2 2 2 Adobo Rice222222222 Bagoong Rice 3 3 3 3 3 3 3 3 3 Bagoong Rice333333333 Garlic Rice 4 4 4 4 4 4 4 4 4 Garlic Rice444444444 Seafood Rice 5 5 5 5 5 5 5 5 5 Seafood Rice555555555 Yangchow Rice 6 6 6 6 6 6 6 6 6 Yangchow Rice666666666 Plain (Cooking Oil+Salt only) 7 7 7 7 7 7 7 7 7 Plain (Cooking Oil+Salt only)777777777 Others, specify            Others, specify Paella 20 20 20 20 20 20 20 20 20 Paella202020202020202020 Arroz caldo/Lugaw/Goto 21 21 21 21 21 21 21 21 21 Arroz caldo/Lugaw/Goto212121212121212121 Maki 22 22 22 22 22 22 22 22 22 Maki222222222222222222 Sushi 23 23 23 23 23 23 23 23 23 Sushi232323232323232323 Biko 24 24 24 24 24 24 24 24 24 Biko242424242424242424 Champorado 25 25 25 25 25 25 25 25 25 Champorado252525252525252525 Kalamay 26 26 26 26 26 26 26 26 26 Kalamay262626262626262626 Palitaw 27 27 27 27 27 27 27 27 27 Palitaw272727272727272727 Others, specify            Others, specify  "},{"text":"DISHES PAIRED WITH STEAMED RICE ASK Q34 AMONG THOSE WHO ATE STEAMED RICE --CODE 1 IN Q32 Q34 Anu-anong ulam ang kadalasan mong kinakain kasama ang STEAMED RICE? Umpisahan natin sa [MENTION OCCASION EAT RICE IN GENERAL IN Q32]. What   "},{"text":"Note to Interviewer: Ask on all Occasions Eat RICE IN GENERAL in Q32 ASK Q35 AMONG THOSE WHO ATE STEAMED BROWN RICE --CODE 1 IN Q33 Q35 Anu-anong ulam ang kinain mo kasama ang STEAMED BROWN RICE? Umpisahan natin sa [MENTION OCCASION EAT BROWN RICE IN Q33]. What viands/ dishes did you eat with STEAMED BROWN RICE? Let's start with [MENTION OCCASION EAT BROWN RICE IN Q33]. Note  "},{"text":"to Interviewer: Ask on all Occasions Eat BROWN RICE IN Q33 SEE ANSWER GRID FOR Q34 & Q35 ON THE NEXT PAGE Q33. BROWN RICE CONSUMED IN PAST YEAR Special Occ 1: ________________ Special Occ 2: ________________ Special Occ 3: ________________ 1 OF 2 Breakfast Morning Snacks Lunch Afternoon Snacks Dinner DISHES PAIRED WITH STEAMED RICE Q35. BROWN RICE Q34. RICE IN GENERAL  Midnight Snacks 2 OF 2 1/16/2020 PROJECT: HEIRLOOM JN 15-0007 1/16/2020 Midnight Snacks 2 OF 21/16/2020 PROJECT: HEIRLOOM JN 15-0007 1/16/2020  "},{"text":"Fiesta Promotions/Milestones Others DISHES PAIRED WITH STEAMED RICE Q34. RICE IN GENERAL Q35. BROWN RICE Big Parties with other relatives and guests   1/16/2020 1/16/2020 Q36 Kapag Q36Kapag  Celebrations with Immediate Celebrations with Immediate  Family (Birthday, Family (Birthday,  Anniversary,etc) Anniversary,etc)  "},{"text":"hindi kayo kumakain ng kanin, ano ang kinakain nyo na pamalit sa kanin? Ano pa po? Mayroon pa po ba? When you do not eat rice, what do you eat as a substitute for rice? What else? Anything else?  Bread 1 Bread1  Crackers/Biscuits 2 Crackers/Biscuits2  Instant Noodles 3 Instant Noodles3  Pancit 4 Pancit4  Pasta (Spaghetti, Macaroni, etc) 5 Pasta (Spaghetti, Macaroni, etc)5  Fruits 6 Fruits6  Vegetables 7 Vegetables7  Others, specify Others, specify  Always eat rice 99 Always eat rice99 Q37 Alin sa mga Q37Alin sa mga  "},{"text":"kadahilanang babanggitin ko ang dahilan kung bakit nyo kinakain bilang pamalit sa kanin ang (MENTION ALL PRODUCTS ANSWERED IN Q36)? Alin pa po? Alin pa po? Kung wala sa mga binanggit ko ang dahilan ay maaring pakisabi lang sa akin. [MA] Which of the reasons that I will mention is the reason why you substitute rice with (MENTION ALL PRODUCTS ANSWERED IN Q36 )? Which else? Which else? If your reason is not among those I've mentioned, or if you have other reasons, please let me know. READ OUT  READ OUT To stay healthy (Para maging/manatiling malusog) 1 To stay healthy (Para maging/manatiling malusog)1 To slim down / on a diet (Para pumayat/nagda-diet) 2 To slim down / on a diet (Para pumayat/nagda-diet)2 Medical reasons/Manage ailments 3 Medical reasons/Manage ailments3 For variety (Para maiba naman ang kinakain) 4 For variety (Para maiba naman ang kinakain)4 Easy preparation (Madaling i-prepare) 5 Easy preparation (Madaling i-prepare)5 When we run out of rice supply (Kapag naubusan kami ng bigas) 6 When we run out of rice supply (Kapag naubusan kami ng bigas)6 Others, specify  Others, specify SHOWCARD (10  SHOWCARD (10  "},{"text":"-PT SCALE RATING); STRIPS (ATTRIBUTES/STATEMENTS) ASK ALL IMPORTANCE RATINGS Q38 Meron akong ilang mga katangiang naiisip ng mga tao kapag bumibili ng bigas. Sa bawat katangian na aking babasahin, pakisabi sa akin kung gaano kaimportante ang katangiang ito. Bigyan po natin ng score na 10 kung \"talagang napakaimportante\" at 1 kung \"talagang hindi importanteng\" katangian. Paano ninyo gagraduhan ang importansya ng bawat katangiang ito.   "},{"text":"kasama na ang positibo at negatibong aspeto, paano mo gagraduhan ang mga klase ng bigas na ito gamit ang scale na ito?                 1/16/2020 1/16/2020 1/16/2020 1/16/2020 1/16/2020 1/16/2020 1 OF 3 sa lahat ng klase ng ulam) aking panlasa) ng mga maliliit na Suits my taste (Naaayon sa (Pinapabuti ang kabuhayan Suits all types of viands (Bagay NOTE TO INTERVIEWER: SINGLE ANSWER PER ATTRIBUTE ONLY. 2 3 4 5 6 7 1 2 3 4 5 6 7 1 2 3 4 5 6 7 1 2 3 4 5 6 7 NOT AT ALL 1 2 3 4 5 6 7 marginalized farmers nadudurog na bigas) Improves livelihoods of grains (Konti lang ang 1 Has low percentage of broken abono) IMPORTANT 1 2 3 4 5 6 7 Best quality rice SHOWCARD (TYPE OF RICE) ; STRIPS (ATTRIBUTES/STATEMENTS) 1 16 30 15 14 Free from chemical pesticides (Pinakamagandang kalidad ng bigas) 29 1 2 3 4 5 6 7 and fertilizers (Hindi ginamitan BRAND IMAGE ASSOCIATION ng kemikal na pesticides at Q40 May  8 8 8 8 8 8 8 9 9 9 9 9 VERY IMPT 10 10 10 10 1 OF 3 sa lahat ng klase ng ulam) aking panlasa) ng mga maliliit na Suits my taste (Naaayon sa (Pinapabuti ang kabuhayan Suits all types of viands (Bagay NOTE TO INTERVIEWER: SINGLE ANSWER PER ATTRIBUTE ONLY. 2 3 4 5 6 7 1 2 3 4 5 6 7 1 2 3 4 5 6 7 1 2 3 4 5 6 7 NOT AT ALL 1 2 3 4 5 6 7 marginalized farmers nadudurog na bigas) Improves livelihoods of grains (Konti lang ang 1 Has low percentage of broken abono) IMPORTANT 1 2 3 4 5 6 7 Best quality rice SHOWCARD (TYPE OF RICE) ; STRIPS (ATTRIBUTES/STATEMENTS) 1 16 30 15 14 Free from chemical pesticides (Pinakamagandang kalidad ng bigas) 29 1 2 3 4 5 6 7 and fertilizers (Hindi ginamitan BRAND IMAGE ASSOCIATION ng kemikal na pesticides at Q40 May8 8 8 8 8 8 89 9 9 9 9VERY IMPT 10 10 10 10  Can be used as an ingredient Cooked rice does not easily get magsasaka)             Can be used as an ingredient Cooked rice does not easily get magsasaka) 17 for rice-based dishes spoiled (Hindi madaling   1 2 3  4 5  6 7  8 9 17for rice-based dishes spoiled (Hindi madaling123456789 2 ASK ALL (Pwedeng gamiting sangkap mapanis ang kanin) 3 4 5 6 (Bagay sa mga nagpapapayat/ayaw tumaba) at ang biodiversity) Very good (Talagang mahusay) tradisyunal na klase ng bigas sa ulam o anumang putaheng gawa sa bigas,i.e., paella, lugaw, at iba pa) Can be used for preparing 18 19 Cooked rice is loose / not sticky (\"Buhaghag\") SHOW CARD Rice easily expands while OVERALL ASSESSMENT cooking (\"Maalsa\") Q39 Sa kabuuan, (On the overall, including positive and negative characteristics, how would you rate the different types of rice using this 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 5 5 5 5 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 delicacies, snacks/ desserts (Pwedeng gamitin sa mga kakanin, pang-meryenda o dessert) Filling (Mabigat sa tyan / Nakakabusog) High fiber content (Mataas ang fiber content) Suitable for those trying to lose weight/avoiding weight gain 20 1 2 3 4 5 6 7 8 9 21 1 2 3 4 5 6 7 8 9 22 1 2 3 4 5 6 7 8 9 Value for money (Sulit sa halaga) Promotes indigenous farming and cultural practices (Nagsusulong ng katutubong pamamaraan ng pagsasaka at kultura) Conserves traditional rice varieties and biodiversity (Pinangangalagaan ang mga scale?) NFA Brown Rice Premium Rice (Ex: California, Dinorado, Kukuyo, Milagrosa, Sinandomeng, etc) Super Premium Rice (Ex: Basmati, Japanese/ JapaneseSasanishki Japonica, Jasmine, Miponica, Doña Maria Rice, etc.) Ordinary Rice (Ex: Angelica, Azucena, C4, Intan, IR64, Laon, Long Grain, Maharlika, Wagwag, etc.) 10 10 10 10 5 10 Pigmented Rice (Ex. Red, Black/Purple Rice) 2 ASK ALL (Pwedeng gamiting sangkap mapanis ang kanin) 3 4 5 6 (Bagay sa mga nagpapapayat/ayaw tumaba) at ang biodiversity) Very good (Talagang mahusay) tradisyunal na klase ng bigas sa ulam o anumang putaheng gawa sa bigas,i.e., paella, lugaw, at iba pa) Can be used for preparing 18 19 Cooked rice is loose / not sticky (\"Buhaghag\") SHOW CARD Rice easily expands while OVERALL ASSESSMENT cooking (\"Maalsa\") Q39 Sa kabuuan, (On the overall, including positive and negative characteristics, how would you rate the different types of rice using this 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 5 5 5 5 1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8 9 delicacies, snacks/ desserts (Pwedeng gamitin sa mga kakanin, pang-meryenda o dessert) Filling (Mabigat sa tyan / Nakakabusog) High fiber content (Mataas ang fiber content) Suitable for those trying to lose weight/avoiding weight gain 20 1 2 3 4 5 6 7 8 9 21 1 2 3 4 5 6 7 8 9 22 1 2 3 4 5 6 7 8 9 Value for money (Sulit sa halaga) Promotes indigenous farming and cultural practices (Nagsusulong ng katutubong pamamaraan ng pagsasaka at kultura) Conserves traditional rice varieties and biodiversity (Pinangangalagaan ang mga scale?) NFA Brown Rice Premium Rice (Ex: California, Dinorado, Kukuyo, Milagrosa, Sinandomeng, etc) Super Premium Rice (Ex: Basmati, Japanese/ JapaneseSasanishki Japonica, Jasmine, Miponica, Doña Maria Rice, etc.) Ordinary Rice (Ex: Angelica, Azucena, C4, Intan, IR64, Laon, Long Grain, Maharlika, Wagwag, etc.)10 10 10 10 5 10 Pigmented Rice (Ex. Red, Black/Purple Rice)  Good (Mahusay)    4  4   4   4  4 4 Good (Mahusay)444444  Good for people with diabetes Preserves rice terraces Can't say (Hindi masabi)   3  3   3   3  3 3 Good for people with diabetes Preserves rice terraces Can't say (Hindi masabi)333333 7 23 (Maganda sa mga may diabetes) landscape (Pinangangalagaan ang rice terraces) Poor (Hindi mahusay)  1 1 2 2 2 3 3 2 4 4 5 5 2 6 6 7 7 2 8 8 9 2 10 2 7 23(Maganda sa mga may diabetes) landscape (Pinangangalagaan ang rice terraces) Poor (Hindi mahusay)1 12 2 23 324 45 526 67 728 89 210 2  Very poor (Talagang hindi mahusay) 1  1   1   1  1 1 Very poor (Talagang hindi mahusay)111111 24 2 OF 3 Cooked rice is soft (Malambot NOT AT ALL IMPORTANT 1 1 ang nalutong kanin) 2 2 3 3  4 4 5 5  6 6 7 7  8 8 9 VERY IMPT 10 242 OF 3 Cooked rice is soft (Malambot NOT AT ALL IMPORTANT 1 1 ang nalutong kanin)2 23 34 45 56 67 78 89VERY IMPT 10 8 25 High nutrient content (Mataas ang nutrient content) Has a high degree of whiteness (Mas maputi ang bigas)  1 1 2 2 3 3  4 4 5 5  6 6 7 7  8 8 9 10 8 25High nutrient content (Mataas ang nutrient content) Has a high degree of whiteness (Mas maputi ang bigas)1 12 23 34 45 56 67 78 8910 9 26 From a reliable source or brand Has appetizing aroma --cooked or uncooked (May (Ang pinanggalingan o brand ng bigas ay nakakatakam na amoy --luto man o bigas pa lang) mapagkakatiwalaan)  1 1 2 2 3 3  4 4 5 5  6 6 7 7  8 8 9 10 9 26From a reliable source or brand Has appetizing aroma --cooked or uncooked (May (Ang pinanggalingan o brand ng bigas ay nakakatakam na amoy --luto man o bigas pa lang) mapagkakatiwalaan)1 12 23 34 45 56 67 78 8910 10 Easy to cook or prepare (Madaling lutuin) 3 OF 3 1 NOT AT ALL IMPORTANT 2 2 3 3  4 4 5 5  6 6 7 7  8 8 9 10 VERY IMPT 10Easy to cook or prepare (Madaling lutuin) 3 OF 31 NOT AT ALL IMPORTANT2 23 34 45 56 67 78 8910 VERY IMPT 11 12 13 28 27 lalagyan ng bigas) matanda) (Maganda ang packaging/ adults (Pwede sa bata at Has attractive packaging Can be eaten by children and (Pang mga espesyal na bigas) okasyon lang) packaging/ lalagyan ng (Mataas ang kalidad ng Good only for special occasions Good quality packaging (Mabibili kahit saan) Can be bought anywhere 1 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3  4 4 4 4 4 5 5 5 5 5  6 6 6 6 6 7 7 7 7 7  8 8 8 8 8 9 9 10 10 10 11 12 13 28 27lalagyan ng bigas) matanda) (Maganda ang packaging/ adults (Pwede sa bata at Has attractive packaging Can be eaten by children and (Pang mga espesyal na bigas) okasyon lang) packaging/ lalagyan ng (Mataas ang kalidad ng Good only for special occasions Good quality packaging (Mabibili kahit saan) Can be bought anywhere11 1 1 1 12 2 2 2 23 3 3 3 34 4 4 4 45 5 5 5 56 6 6 6 67 7 7 7 78 8 8 8 89 910 10 10  "},{"text":"babasahin ako sa inyong mga pangungusap. Pakisabi lamang sa akin kung aling klase ng bigas ang pinakamalapit na inilalarawan ng bawat pangungusap. Maaari kayong magsabi ng isang klase ng bigas lamang, 2 o mahigit pang mga klase, lahat ng klase o maaari rin namang wala sa alinmang klase. Wala ditong tama o maling sagot. Nais lang namin malaman ang inyong opinyon . I am going to read out some statements. Please tell me which types of rice you most closely associate with each statement. You can give one type only, two or more types, all types or none of them. There are no right or wrong answers. It is only your opinion we are after.   NFA Ordinary Rice (Ex: Angelica, Azucena, C4, Intan, IR64, Laon, Long Grain, Maharlika, Wagwag, etc.) Premium Rice (Ex: California, Dinorado, Kukuyo, Milagrosa, Sinandomeng, etc) Super Premium (Ex: Basmati, Japanese/ JapaneseSasanishki Japonica, Jasmine, Miponica, Doña Maria Rice, etc.) Brown Rice Pigmented Rice (Ex: Red, Black/Purple Rice) NONE NFAOrdinary Rice (Ex: Angelica, Azucena,C4, Intan, IR64, Laon, Long Grain, Maharlika, Wagwag, etc.)Premium Rice (Ex: California, Dinorado,Kukuyo, Milagrosa, Sinandomeng, etc) Super Premium (Ex: Basmati,Japanese/ JapaneseSasanishki Japonica, Jasmine, Miponica, Doña Maria Rice, etc.)Brown RicePigmented Rice (Ex: Red, Black/PurpleRice)NONE 1  1  2 3  4 5 6 9 11234569 2  1  2 3  4 5 6 9 21234569 3  1  2 3  4 5 6 9 31234569 4  1  2 3  4 5 6 9 41234569 5  1  2 3  4 5 6 9 51234569  Suitable for those trying to lose weight/avoiding         Suitable for those trying to lose weight/avoiding 6 weight gain (Bagay sa mga 1  2 3  4 5 6 9 6weight gain (Bagay sa mga1234569  nagpapapayat/ayaw tumaba)         nagpapapayat/ayaw tumaba) 7 Good for people with diabetes (Maganda sa mga may diabetes) 1  2 3  4 5 6 9 7Good for people with diabetes (Maganda sa mga may diabetes)1234569 8 High nutrient content (Mataas ang nutrient content) 1  2 3  4 5 6 9 8High nutrient content (Mataas ang nutrient content)1234569  Has appetizing aroma --cooked or uncooked         Has appetizing aroma --cooked or uncooked 9 (May nakakatakam na amoy --luto man o 1  2 3  4 5 6 9 9(May nakakatakam na amoy --luto man o1234569  bigas pa lang)         bigas pa lang) 10  1  2 3  4 5 6 9 101234569 11  1  2 3  4 5 6 9 111234569  "},{"text":"Pwedeng gamiting sangkap sa ulam o anumang putaheng gawa sa bigas,i.e., paella, lugaw, at iba pa)  Can be used for preparing delicacies, snacks/ Can be used for preparing delicacies, snacks/ desserts ( desserts (  "},{"text":"Pwedeng gamitin sa mga kakanin, pang-meryenda o dessert) Filling (Mabigat sa tyan / Nakakabusog) High fiber content (Mataas ang fiber content)            1/16/2020 1/16/2020 12  1  2 3  4 5 6 12123456 13  1  2 3  4 5 6 13123456 14  1  2 3  4 5 6 14123456 15  1  2 3  4 5 6 15123456   NFA Ordinary Rice (Ex: Angelica, Azucena, C4, Intan, IR64, Laon, Long Grain, Maharlika, Wagwag, etc.) Premium Rice (Ex: California, Dinorado, Kukuyo, Milagrosa, Sinandomeng, etc) Super Premium (Ex: Basmati, Japanese/ JapaneseSasanishki Japonica, Jasmine, Miponica, Doña Maria Rice, etc.) Brown Rice Pigmented Rice (Ex: Red, Black/Purple Rice) NONE NFAOrdinary Rice (Ex: Angelica, Azucena,C4, Intan, IR64, Laon, Long Grain, Maharlika, Wagwag, etc.)Premium Rice (Ex: California, Dinorado,Kukuyo, Milagrosa, Sinandomeng, etc) Super Premium (Ex: Basmati,Japanese/ JapaneseSasanishki Japonica, Jasmine, Miponica, Doña Maria Rice, etc.)Brown RicePigmented Rice (Ex: Red, Black/PurpleRice)NONE 16  1  2 3  4 5 6 16123456 17  1  2 3  4 5 6 17123456 18  1  2 3  4 5 6 18123456 19  1  2 3  4 5 6 19123456 20  1  2 3  4 5 6 20123456 21  1  2 3  4 5 6 21123456 22  1  2 3  4 5 6 22123456 23  1  2 3  4 5 6 23123456 24 Cooked rice is soft (Malambot ang nalutong kanin) 1  2 3  4 5 6 24Cooked rice is soft (Malambot ang nalutong kanin)123456 25 Has a high degree of whiteness (Mas maputi ang bigas) 1  2 3  4 5 6 25Has a high degree of whiteness (Mas maputi ang bigas)123456  From a reliable source or brand (Ang         From a reliable source or brand (Ang 26 pinanggalingan o brand ng bigas ay 1  2 3  4 5 6 26pinanggalingan o brand ng bigas ay123456  mapagkakatiwalaan)         mapagkakatiwalaan) 27  1  2 3  4 5 6 27123456  "},{"text":"Pang mga espesyal na okasyon lang) only for special occasions (  1/16/2020 1/16/2020 Q41 Narinig nyo na ba ang Heirloom Rice? Q41 Narinig nyo na ba ang Heirloom Rice? Can be eaten by children and adults (Pwede sa Have you heard of Heirloom Rice? Can be eaten by children and adults (Pwede sa Have you heard of Heirloom Rice? bata at matanda)  bata at matanda) Yes / Oo Best quality rice (Pinakamagandang kalidad 1 CONTINUE ng bigas) No / Hindi 2 GO TO C1 Yes / Oo Best quality rice (Pinakamagandang kalidad 1 CONTINUE ng bigas) No / Hindi 2 GO TO C1 Has low percentage of broken grains (Konti Q42 Nasubukan nyo na ho ba itong kainin? Has low percentage of broken grains (Konti Q42 Nasubukan nyo na ho ba itong kainin? lang ang nadudurog na bigas) Have you tried eating it? lang ang nadudurog na bigas) Have you tried eating it? Yes / Oo 1 Yes / Oo1 No / Hindi 2 No / Hindi2 SHOW CONCEPT BOARD TO THE RESPONDENT AND LEAVE IT THROUGHOUT THE SHOW CONCEPT BOARD TO THE RESPONDENT AND LEAVE IT THROUGHOUT THE CONCEPT EVALUATION CONCEPT EVALUATION I have here a description of RICE which I will ask you to read. Will you be needing eye glasses to read it? I have here a description of RICE which I will ask you to read. Will you be needing eye glasses to read it? Mayroon  Mayroon Suits my taste (Naaayon sa aking panlasa) Suits my taste (Naaayon sa aking panlasa) Cooked rice does not easily get spoiled (Hindi Cooked rice does not easily get spoiled (Hindi madaling mapanis ang kanin) madaling mapanis ang kanin)  "},{"text":"po ako ritong description o paglalarawan ng BIGAS na ipapabasa ko sa inyo. Kailangan ba ninyo ng salamin/eye glasses para mabasa ito? [REQUEST RESPONDENT TO WEAR READING GLASSES, IF NECESSARY] [HAND CONCEPT BOARD TO RESPONDENT] I will have a few questions about the concept after you have read it. Please take your time. Mayroon  "},{"text":"po akong mga ilang katanungan tungkol sa konseptong ito pagkabasa ninyo. Huwag po kayong magmadali sa pagbasa. [GIVE RESPONDENT ENOUGH TIME TO READ THE CONCEPT AGAIN SILENTLY.] INITIAL REACTION TO THE PRODUCT C1 Sa kabuuan, ano po ang inyong masasabi tungkol nabasa ninyong konsepto? On the overall, what can you say about the concept that you have just read?  "},{"text":"WHETHER INITIAL REACTION IS POSITIVE OR NEGATIVE C1a Para sa inyo, ito po ba ay positibo o negatibo?  For you, is it positive or negative?   For you, is it positive or negative? Positive reaction 1 ASK C2 FIRST, THEN C3 Positive reaction1ASK C2 FIRST, THEN C3 Negative reaction 2 ASK C3 FIRST, THEN C2 Negative reaction2ASK C3 FIRST, THEN C2 LIKES ABOUT THE PRODUCT   LIKES ABOUT THE PRODUCT C2 Ano   C2 Ano  "},{"text":"po, kung mayroon man ang inyong NAGUSTUHAN sa konsepto na kababasa n'yo lamang? Ano pa po? Mayroon pa ho ba? (PROBE FULLY) [I-probe kung hindi klaro ang sagot: \"Bakit nyo nasabi na…. Bakit pa po?]  1/16/2020 1/16/2020 DISLIKES ABOUT THE PRODUCT SECTION E. HEIRLOOM RICE AWARENESS AND CONCEPT C3 Ano DISLIKES ABOUT THE PRODUCT SECTION E. HEIRLOOM RICE AWARENESS AND CONCEPT C3 Ano What, if any, did you like about the concept that you have just read? What else? Anything else? What, if any, did you like about the concept that you have just read? What else? Anything else? [Probe unclear or ambiguous answers: \"Why do you say that? What else?] [Probe unclear or ambiguous answers: \"Why do you say that? What else?]  "},{"text":"po, kung mayroon man ang HINDI NINYO NAGUSTUHAN sa konsepto na kababasa n'yo lamang? Ano pa po? Mayroon pa ho ba? (PROBE FULLY) [I-probe kung hindi klaro ang sagot: \"Bakit nyo nasabi na…. Bakit pa po?] What, if any, did you dislike about the concept that you have just read? What else? Anything else? [Probe unclear or ambiguous answers: \"Why do you say that? What else?] SHOWCARD SHOWCARD OVERALL LIKING OF THE PRODUCT OVERALL LIKING OF THE PRODUCT C4 Ngayon, C4 Ngayon,  "},{"text":"kung iisipin ang lahat-lahat ng bagay, kasama na ang mga positibo at negatibong aspeto, pakisabi sa akin kung alin sa mga pangungusap sa kard na ito ang pinaka-naglalarawan kung gaano ninyo KAGUSTO o HINDI KAGUSTO ang konseptong kababasa n'yo lamang. [SA] Taking everything into consideration, including all its positive and negative characteristics, please tell me which statement on this card best describes how much you like or dislike the concept that you have just read?[SA]     I like it very much (Talagang gusto ko ito) 5 I like it very much (Talagang gusto ko ito)5 I like it (Gusto ko ito) 4 I like it (Gusto ko ito)4 I neither liked it nor disliked it (  I neither liked it nor disliked it (  "},{"text":"Hindi ko masasabi kung gusto ko ito o hindi)   3 3 I dislike it (Hindi ko ito gusto) 2 I dislike it (Hindi ko ito gusto)2 I dislike it very much (  I dislike it very much (  "},{"text":"Talagang hindi ko ito gusto) 1 SHOWCARD UNIQUENESS C5 Aling pangungusap sa card na ito ang naglalarawan kung gaano kabago at naiiba ang BIGAS na ito kumpara sa mga ibang klase ng bigas na mabibili sa tindahan base sa konseptong nabasa ninyo   "},{"text":"Talagang bagung-bago at ibang-iba) 5 Very new and different (Talagang bago at naiiba) 4 Somewhat new and different (Medyo bago at naiiba) 3 Slightly new and different (Medyo bago at naiiba ng kaunti) 2 Not at all new and different (Talagang hindi bago at naiiba) 1 SHOWCARD RELEVANCE OF PRODUCT DESCRIBED IN THE CONCEPT C6 Base po sa konseptong nabasa ninyo tungkol sa produktong ito, maaari po ba ninyong sabihin sa akin kung gaano nasasagot ng produktong ito ang pangangailangan ninyo? [SA] Keeping in mind what you read in the concept board for this product, could you tell me to what extent do you think this product is relevant to you/ answers your needs? [SA]  1/16/2020 1/16/2020 ASK IF [C8 = CODE 1/2/3]  ASK IF [C8 = CODE 1/2/3] PARTS WHICH ARE DIFFICULT TO UNDERSTAND  PARTS WHICH ARE DIFFICULT TO UNDERSTAND C9 Anong  C9 Anong Extremely relevant (Talagang nasasagot nito ang aking pangangailangan) 5 Extremely relevant (Talagang nasasagot nito ang aking pangangailangan)5 Quite relevant (Medyo nasasagot nito ang aking pangangailangan) 4 Quite relevant (Medyo nasasagot nito ang aking pangangailangan)4 Somewhat relevant (Maaaring nasasagot nito ang aking pangangailangan) 3 Somewhat relevant (Maaaring nasasagot nito ang aking pangangailangan)3 Not so relevant (Hindi nito gaanong nasasagot ang aking pangangailangan) 2 Not so relevant (Hindi nito gaanong nasasagot ang aking pangangailangan)2 Not at all relevant (Talagang hindi nito nasasagot ang aking pangangailangan) 1 Not at all relevant (Talagang hindi nito nasasagot ang aking pangangailangan)1  "},{"text":"parte sa konsepto ang nahirapan kang intindihin? Ano pa po? Mayroon pa po ba? Which part in the concept did you not understand? Which else? Anything else? SHOWCARD (5-point rating scale) ; STRIPS (ATTRIBUTES/STATEMENTS) SHOWCARD (5-point rating scale) ; STRIPS (ATTRIBUTES/STATEMENTS) RATING ON SPECIFIC ATTRIBUTES RATING ON SPECIFIC ATTRIBUTES C10 Ang C10 Ang  "},{"text":"mga sumusunod ay ilang mga pangungusap na maaaring gamitin upang ilarawan ang Heirloom Rice. Sa bawat pangungusap, pakisabi lamang po sa akin kung gaano kayo sumasang-ayon o hindi sumasang-ayon na ito ay naglalarawan sa Heirloom Rice. Gamitin ho ninyo ang scale na ito kung saan ang 1 ay nangangahulugang \"talagang 'di sumasang-ayon\" at ang 5 naman ay \"talagang sumasang-ayon\" [SA per statement] Following are some statements that might be used to describe Heirloom Rice. For each statement, please tell me how much you agree or disagree that it describes Heirloom Rice. Please use this scale where 1 means \"Strongly Disagree\" while 5 means \"Strongly Agree\".[SA per statement]      1 OF 2 Strongly agree / Talagang sumasang-ayon Somewhat agree / Medyo sumasang-ayon Can't say / Hindi masabi Somewhat disagree / Medyo hindi sumasang- ayon Strongly disagree / Talagang hindi sumasang- ayon 1 OF 2Strongly agree / Talagang sumasang-ayonSomewhat agree / Medyo sumasang-ayonCan't say /Hindi masabiSomewhat disagree / Medyo hindi sumasang-ayon Strongly disagree / Talagang hindi sumasang-ayon 1 Suits all types of viands (Bagay sa lahat ng klase ng ulam) 5 4 3 2 1 1Suits all types of viands (Bagay sa lahat ng klase ng ulam)54321  Can be used as an ingredient for rice-based dishes (       Can be used as an ingredient for rice-based dishes ( 2  5 4 3 2 1 254321 3  5 4 3 2 1 354321 4  5 4 3 2 1 454321 5  5 4 3 2 1 554321 6  5 4 3 2 1 654321 7  5 4 3 2 1 754321 8  5 4 3 2 1 854321 9  5 4 3 2 1 954321 10  5 4 3 2 1 1054321 11  5 4 3 2 1 1154321  "},{"text":"Pwedeng gamiting sangkap sa ulam o anumang putaheng gawa sa bigas,i.e., paella, lugaw, at iba pa)  Can be used for preparing delicacies, snacks/ desserts ( Can be used for preparing delicacies, snacks/ desserts (  "},{"text":"Pwedeng gamitin sa mga kakanin, pang-meryenda o dessert) Filling (Mabigat sa tyan / Nakakabusog) High fiber content (Mataas ang fiber content)  Suitable for those trying to lose weight/avoiding weight gain (Bagay sa Suitable for those trying to lose weight/avoiding weight gain (Bagay sa mga nagpapapayat/ayaw tumaba) mga nagpapapayat/ayaw tumaba) Good for people with diabetes (Maganda sa mga may diabetes) Good for people with diabetes (Maganda sa mga may diabetes) High nutrient content (Mataas ang nutrient content) High nutrient content (Mataas ang nutrient content) Has appetizing aroma --cooked or uncooked (May nakakatakam na Has appetizing aroma --cooked or uncooked (May nakakatakam na amoy --luto man o bigas pa lang) amoy --luto man o bigas pa lang) Easy to cook or prepare (Madaling lutuin) Easy to cook or prepare (Madaling lutuin) Can be bought anywhere ( Can be bought anywhere (  "},{"text":"Mabibili kahit saan) Ask respondent to encircle the parts not understood in the concept.         1/16/2020 1/16/2020 12  5 4 3 2  125432 13  5 4 3 2  135432 14  5 4 3 2  145432 15  5 4 3 2  155432  2 OF 2 Strongly agree / Talagang sumasang-ayon Somewhat agree / Medyo sumasang-ayon Can't say / Hindi masabi Somewhat disagree / Medyo hindi sumasang- ayon Strongly disagree / Talagang hindi sumasang- ayon 2 OF 2Strongly agree / Talagang sumasang-ayonSomewhat agree / Medyo sumasang-ayonCan't say /Hindi masabiSomewhat disagree / Medyo hindi sumasang-ayon Strongly disagree / Talagang hindi sumasang-ayon 16  5 4 3 2  165432 17  5 4 3 2  175432 18  5 4 3 2  185432 19  5 4 3 2  195432 20  5 4 3 2  205432 21  5 4 3 2  215432 22  5 4 3 2  225432 23  5 4 3 2  235432 24  5 4 3 2  245432 25  5 4 3 2  255432 26  5 4 3 2  265432 27  5 4 3 2  275432 28  5 4 3 2  285432 29  5 4 3 2  295432 30 Improves livelihoods of marginalized farmers ( 5 4 3 2  30Improves livelihoods of marginalized farmers (5432  "},{"text":"Pinapabuti ang kabuhayan ng mga maliliit na magsasaka) Has attractive packaging (Maganda ang packaging/ lalagyan ng bigas) Free from chemical pesticides and fertilizers (  "},{"text":"Hindi ginamitan ng kemikal na pesticides at abono)   "},{"text":"SHOWCARD UNPRICED PURCHASE INTENT C11 Gaano ka-malamang o di-malamang na bilhin ninyo ang BIGAS na inilarawan sa konsepto kung ito ay mabibili o available sa mga tindahan sa presyong katanggap-tanggap sa inyo? [SA] How likely or unlikely are you to buy the RICE described in the concept if it were available in the shops at a price acceptable to you? [SA]  price acceptable to you? [SA] I would definitely buy it (Talagang bibilhin ko ito) 5 I would definitely buy it (Talagang bibilhin ko ito)5 I would probably buy it (Malamang na bibilhin ko ito) 4 I would probably buy it (Malamang na bibilhin ko ito)4 I am not certain whether I would buy it or not (Hindi ako sigurado kung bibilhin ko ito o hindi) 3 I am not certain whether I would buy it or not (Hindi ako sigurado kung bibilhin ko ito o hindi)3 I would probably not buy it (Malamang na hindi ko ito bibilhin) 2 I would probably not buy it (Malamang na hindi ko ito bibilhin)2 I would definitely not buy it (Talagang hindi ko ito bibilhin) 1 I would definitely not buy it (Talagang hindi ko ito bibilhin)1 SHOWCARD  SHOWCARD PRICED PURCHASE INTENT  PRICED PURCHASE INTENT C12 Gaano ka-  C12 Gaano ka-  "},{"text":"malamang o di-malamang na bilhin ninyo ang BIGAS na inilarawan sa konsepto kung ito ay mabibili o available sa mga tindahan sa presyong (MENTION PRICE) kada kilo? Kung (MENTION PRICE) naman po? How likely or unlikely are you to buy the RICE described in the concept if it were available in the shops priced at [MENTION PRICE] per kilo? How about if priced [MENTION PRICE]? Ask until all prices have been asked. ROTATE PRICES       Ask until all prices have been asked. ROTATE PRICES  ( ) ( ) ( ) ( ) ( ) ( ) ( )( )( )( )( )( ) I would definitely buy it (Talagang bibilhin ko ito) 5 5 5 5 5 5 I would definitely buy it (Talagang bibilhin ko ito)555555 I would probably buy it (Malamang na bibilhin ko ito) 4 4 4 4 4 4 I would probably buy it (Malamang na bibilhin ko ito)444444 I am not certain whether I would buy it or not (Hindi       I am not certain whether I would buy it or not (Hindi  2 2 2 2 2 2 222222  1 1 1 1 1 1 111111 ASK       ASK  "},{"text":"C13 IF RESPONDENT ANSWERED WILL DEFINITELY BUY (code 5) OR PROBABLY BUY (code 4) AT PHP130 C13 Ano ang pinakamataas na presyo kada kilo kung saan hindi na talaga kayo bibili ng bigas na inilarawan sa konsepto dahil hindi na ito abot kaya o hindi na ito sulit sa halaga. What is the maximum price at which you will definitely not buy the product described, because you can't afford it or you don't think it is worth the money? Php____________________ Php____________________ ASK C14 & C15 ON PRICES THAT RESPONDENT WILL DEFINITELY BUY (code 5) OR PROBABLY BUY ASK C14 & C15 ON PRICES THAT RESPONDENT WILL DEFINITELY BUY (code 5) OR PROBABLY BUY (code 4) IN C12, OTHERWISE, SKIP TO A1 (code 4) IN C12, OTHERWISE, SKIP TO A1 ANTICIPATED FREQUENCY OF PURCHASE ANTICIPATED FREQUENCY OF PURCHASE C14 Gaano kadalas, C14 Gaano kadalas,  "},{"text":"kung sakali man, sa palagay niyo kayo BIBILI ng produktong ito sa hinaharap sa presyong [MENTION PRICE]? [SA per price point coded 4/5 in C12]        1/16/2020 1/16/2020 SHOWCARD       SHOWCARD  ___ ___ ___ ___ ___ ___ __________________ 2-3 times a month /2-3 beses kada buwan 2 2 2 2 2 2 2-3 times a month /2-3 beses kada buwan222222 Once a month/ Isang beses kada buwan 3 3 3 3 3 3 Once a month/ Isang beses kada buwan333333  ___ ___ ___ ___ ___ ___ __________________ Never / Hindi kailanman (DO NOT PROMPT) 99 99 99 99 99 99 Never / Hindi kailanman (DO NOT PROMPT)999999999999 C15 Mga       C15 Mga  Php80 Php90 Php100 Php110 Php120 Php130 Php80Php90Php100Php110Php120Php130 ako sigurado kung bibilhin ko ito o hindi) 3 3 3 3 3 3 ako sigurado kung bibilhin ko ito o hindi)333333 I would probably not buy it (Malamang na hindi ko ito       I would probably not buy it (Malamang na hindi ko ito bibilhin)       bibilhin) I would definitely not buy it (Talagang hindi ko ito       I would definitely not buy it (Talagang hindi ko ito bibilhin)       bibilhin) How often, if ever, do you think you would buy this product in the future if priced at [MENTION PRICE]? How often, if ever, do you think you would buy this product in the future if priced at [MENTION PRICE]? [SA per price point coded 4/5 in C12]       [SA per price point coded 4/5 in C12]  "},{"text":"ilang kilong bigas ang malamang na bilhin mo kada bibili/magpapabili ka ng BIGAS na ito sa presyong [MENTION PRICE]? Around how many kilos will you likely buy / ask someone to buy everytime you will buy this RICE priced at [MENTION PRICE]?       1/16/2020 1/16/2020 A1 Mayroon Php80 Php90 Php100 Php110 Php120 Php130 A1 MayroonPhp80Php90Php100Php110Php120Php130 Once a week or more often/ Isang beses kada linggo o       Once a week or more often/ Isang beses kada linggo o mas madalas (specify)       mas madalas (specify) Less often than once a month / Mas madalang pa       Less often than once a month / Mas madalang pa kaysa isang beses kada buwan (specify)       kaysa isang beses kada buwan (specify)  Php80 Php90 Php100 Php110 Php120 Php130 Php80Php90Php100Php110Php120Php130 # of kilos       # of kilos  "},{"text":"ako ritong mga pangungusap na naglalarawan ng mga paniniwala at nakaugalian na ng mga tao tungkol sa aspeto ng kalusugan, wellness, kalikasan at iba pang sitwasyon sa kanilang kapaligiran. Pakisabi sa akin kung gaano ka sumasang-ayon o hindi sumasang-ayon na ang bawat pangungusap ay naglalarawan sa iyong nararamdaman? I have here some statements describing people's beliefs and attitudes about certain aspects of their health, wellness, environment and other situations around them. Could you tell me, with the aid of this card, how much you Agree or Disagree that each statement describes how you feel?[5-point agreement scale]     SELF ACCOMPLISHED Strongly agree/ Talagang sumasang-ayon Somewhat agree/ Medyo sumasang-ayon Can't say (Hindi masabi) Somewhat disagree/ Medyo hindi sumasang-ayon Strongly disagree / Talagang hindi sumasang- ayon SELF ACCOMPLISHEDStrongly agree/ Talagangsumasang-ayonSomewhat agree/ Medyosumasang-ayonCan't say (Hindi masabi)Somewhat disagree/ Medyohindi sumasang-ayonStrongly disagree / Talagang hindi sumasang-ayon I will buy local food products even if these are more expensive if I know          I will buy local food products even if these are more expensive if I know that this will help our farmers          that this will help our farmers \"          \"  "},{"text":"Bibili ako ng mga pagkaing local kahit na mas mahal ito, kung alam kong makatutulong sa ating mga magsasaka\" It is important to preserve our heritage and pass on beliefs and practices to younger generations \"  "},{"text":"Mahalagang ma-preserve o mapangalagaan ang ating heritage o pamana ng ating mga ninuno at maipasa/maibahagi ang mga paniniwala at kagawian sa mga nakababatang henerasyon\" I am willing to pay extra for organic food products as these are healthier and better for the body \"  "},{"text":"Pumapayag akong magbayad ng karagdagan para sa organic na pagkain dahil ang mga ito ay mas mabuti sa kalusugan at sa pangangatawan\" Farming is a dying livelihood, we should help revive this industry \"  "},{"text":"Ang pagsasaka ay unti-unti nang nawawala bilang paraan ng pamumuhay, at kailangang matulungang buhayin muli ang industriyang ito\" I select the food I eat because I am health-conscious \"  "},{"text":"Pinipili ko ang mga pagkaing kinakain ko dahil ako ay health-conscious\" I exercise regularly to stay fit \"Regular akong nag-e-exercise para nasa mabuting kundisyon ang katawan ko\" Usually, food items that are \"healthy\" do not taste good \"  "},{"text":"Sa kadalasan, hindi masarap ang lasa ng mga pagkaing healthy\" Rice is more fattening than bread and pasta \"  "},{"text":"Mas nakakataba ang kanin kaysa sa tinapay at pasta/noodle \" I will change my eating habits only if I still get the same satisfaction from alternative foods \"  "},{"text":"Babaguhin ko ang aking eating habits kung nakukuha ko ang kaparehas na satisfaction mula sa alternatibong pagkain\" The incidence of diet-related diseases such as diabetes and obesity is increasing among Filipinos because of unhealthy eating practices \"  "},{"text":"Tumataas ang bilang ng mga Filipino na nagkakaroon ng mga sakit na ugnay sa kinakain, tulad ng diabetes at labis na pananaba, dahil sa unhealthy eating practices\" Importation of farm produce has affected our agricultural sector and should be managed by the government \"  "},{"text":"Ang pag-aangkat ng mga produktong agrikultura ay nakakaapekto sa ating local na pagsasaka at dapat itong i-manage ng gobyerno   "},{"text":"kaya dapat ang presyo ng mga pagkaing napo-produce locally o natatanim dito sa Pilipinas\" 1 /16/2020 I know I should change my eating habits but I cannot give up the food I enjoy eating \"  "},{"text":"Alam kong dapat kong baguhin ang aking eating habits kaya lang hindi ko kayang i-give-up ang mga pagkaing nag-e-enjoy akong kainin\" Children should be taught about good eating habits at an early age \"  "},{"text":"Habang maaga pa, dapat nang tinuturuan ang mga bata tungkol sa mabuting pagkain o good eating habits \" I patronize organic food/products because I know it can help preserve our natural environment \"  "},{"text":"Sinusuportahan ko ang mga organic na pagkain / produkto dahil alam kong makakatulong itong mapangalagaan ang ating kalikasan\"       1/16/2020 1/16/2020 SHOWCARD      SHOWCARD 13 AIDED SOURCE OF INFORMATION A2 Saan 5 4 3 2 1 13 AIDED SOURCE OF INFORMATION A2 Saan54321 14 5 4 3 2 1 1454321 15 5 4 3 2 1 1554321  "},{"text":"ka nakakakuha ng impormasyon tungkol sa pagkain/kalusugan/wellness? Saan pa po? Saan pa po? Where do you get information on food/health/wellness? Where else? Where else?  "},{"text":"A3 Kayo ba ay myembro o supporter ng isang cultural o environmental na grupo? [SA] Are you a member or supporter of any cultural or environmental group?[SA]    I am a member of a cultural /environmental group Ako  "},{"text":"ay miyembro ng cultural/environmental group I am not a member BUT I support a cultural/environmental group Hindi  "},{"text":"ako miyembro PERO sumusuporta ako sa isang cultural/environmental group I am not a member nor a supporter of a cultural / environmental group Hindi  "},{"text":"ako miyembro at hindi rin sumusuporta sa anumang cultural/environmental group END INTERVIEW AND THANK RESPONDENT  Instore materials /  Instore materials / Blogs 15 Blogs15 Social Networking site (Facebook) 16 Social Networking site (Facebook)16 Cooking shows on TV / Cooking demo 17 Cooking shows on TV / Cooking demo17 Others, please specify:  Others, please specify: _______________  _______________ CAN'T RECALL 99 CAN'T RECALL99  "},{"text":"Mga advertisement sa loob ng pamilihan(i.e. posters, price tags, streamers, stickers, brochures, pamphlets, etc.)  Word of mouth from Family/Relatives / Narinig sa pamilya/kamag-anak 1 Word of mouth from Family/Relatives / Narinig sa pamilya/kamag-anak1 Word of mouth from Friends / Narining sa (mga) kaibigan 2 Word of mouth from Friends / Narining sa (mga) kaibigan2 Recommended by Doctors/Nutritionist/Dietician 3 Recommended by Doctors/Nutritionist/Dietician3 Recommended by Fitness Instructor 4 Recommended by Fitness Instructor4 Free samples/Gift from friends/relatives 5 Free samples/Gift from friends/relatives5 TV 6 TV6 Radio 7 Radio7 Newspapers 8 Newspapers8 Magazines 9 Magazines9 Billboards 10 Billboards10 Public transport wraps/stickers (buses, jeeps, tricycle) 11 Public transport wraps/stickers (buses, jeeps, tricycle)11 Saw rice type in the supermarket/market stalls/other stores 12 Saw rice type in the supermarket/market stalls/other stores12  13 13 Internet 14 Internet14  "}],"sieverID":"0e0c6ab0-d0ac-4079-966a-b6c5694557bd","abstract":"Could you spare a few minutes to answer our questions? Rest assured that we are not trying to sell you anything and that the information we are seeking will be used for research purposes only. The opinions you share will be treated with confidentiality and will not be shared with anyone. S8. Gender S5. Age 1/16/2020 SHOWCARD AFFINITY S1 Kayo po ba o sinumang miyembro ng inyong pamilya ay nagtatrabaho sa alinman sa mga sumusunod na industriya? Do you or any member of your household work in any of the following industries? Market research agencies like us 1 TERMINATE Rice distributors /dealers 2 Rice millers 3 Supermarkets/Groceries/Sari-sari Stores/Market Stalls selling rice 4 Rice farmers 5 NONE OF THE ABOVE 6 GO TO S3a SHOWCARD ASK AMONG THOSE WHO ANSWERED CODES 2-5 in S1 S2 Nabanggit mo na [kayo o miyembro ng inyong pamilya] ay nagtatrabaho sa [MENTION ANSWER in S1], alin sa mga sumusunod ang naglalarawan ng impluwensya nito sa inyong personal o ng inyong pamilya pagdating sa pagpili ng bigas na inyong kakainin? You mentioned that you or a household member works in/as a [MENTION ANSWER in S1], which of the following describes its influence in your personal or your family's choice of rice to eat? Walang impluwensya, binibili ko ang bigas na gusto ko/namin 1 (No influence, we buy the rice we prefer) Binibigyan nila kami ng libreng bigas (They provide us free rice) 2 Sa kanila LANG kami bumibili ng bigas (We ONLY buy rice from them) 3 Binibili namin ang klase ng bigas na nirerekomenda nila (We buy the 4 rice that they recommend) SELECTION OF PROBABILITY RESPONDENT FOR THE MAIN SAMPLE S3a Sino po ba sa mga permanenteng nakatira dito (natutulog dito ng hindi bababa sa 5 beses sa isang linggo) ang nagkakaedad mula 20 hanggang 60? Pakibanggit lang po sa akin ang kanilang mga pangalan, edad at kaarawan mula sa pinakamatanda hanggang sa pinakabata. Huwag po ninyong isali ang mga kasambahay, driver o OFW/seaman na myembro ng pamilya na wala pang 6 na buwan na nakakabalik sa bahay. May I know the members of the household permanently living here (sleeps here at least 5 days in a week) with ages 20 to 60? Please tell me their names, age and birthdays starting from the oldest up to the youngest. Please exclude household helps, drivers or OFW/seaman who are members of household but have returned to your household for less than 6 months, if any. Write down the household members aged 20-60 in the following table from the oldest to the youngest."}

data/part_1/06b1c43118cbc01e40073fb7fe4023fc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06b1c43118cbc01e40073fb7fe4023fc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/aaaad0c9-9d77-46c3-afc7-febffcff5a5e/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":118,"text":"Actualmente, el sistema agroalimentario, parte fundamental del estilo de vida de millones de personas, se ve amenazado por el cambio climático, lo cual provoca un aumento en la frecuencia de fenómenos climatológicos extremos como sequías, heladas y olas de calor; que se deriva en bajos rendimientos, la pérdida de biodiversidad, así como déficits o excesos de agua; entre otros. Estos efectos tienen consecuencias directas sobre la seguridad alimentaria y nutricional de las familias rurales y empobrece una de sus principales fuentes de ingresos, acelerando los procesos migratorios del campo a la ciudad, sobre todo en los miembros más jóvenes de las poblaciones rurales, interrumpiendo la transmisión entre generaciones de expresiones culturales, económicas y sociales propias de dichas localidades."},{"index":2,"size":71,"text":"Otra de las realidades es que a menudo la agricultura familiar en Latinoamérica carece de prácticas responsables con el entorno que sean sostenibles en el tiempo, lo cual deteriora progresivamente la calidad de las fuentes de agua que usa la población con fines domésticos y agrícolas, así como la fertilidad del suelo y representa una importante fuente de emisión de gases de efecto invernadero que agrava los efectos del cambio climático."},{"index":3,"size":70,"text":"Las capacidades locales al adaptarse al cambio climático son en extremo limitadas debido al carente acceso a servicios de financieros y no financieros y de capacitación en el uso de tecnologías. Por ello, es imperativo empezar a destinar esfuerzos y recursos para promover la adaptación y mitigación de efectos del cambio climático, mejorar la productividad, afianzar la seguridad alimentaria desde la agricultura familiar y favorecer la conservación de la agrobiodiversidad. "}]},{"head":"Objetivos","index":2,"paragraphs":[{"index":1,"size":55,"text":"Este escenario se vive en las regiones de Huancavelica y Junín en Perú, de Patacamaya y Sica Sica en Bolivia, y de Chimborazo y Tungurahua de Ecuador; dos territorios donde la diversidad, producción y comercialización de papa son base de sus sistemas agroalimentarios y de la cultura local, y se encuentran en situación de vulnerabilidad."},{"index":2,"size":48,"text":"El Centro Internacional de la Papa, junto al Instituto Interamericano de Cooperación para la Agricultura (IICA) y su red de socios, se han propuesto mejorar la capacidad de los agricultores y las instituciones públicas y privadas localizados en estas regiones, para adaptarse a los efectos del cambio climático."},{"index":3,"size":67,"text":"Esto a través del fortalecimiento de capacidades para el desarrollo, aplicación y difusión de buenas prácticas de agricultura climáticamente inteligente; es decir, con capacidad de adaptarse a los cambios extremos de clima y asegurar la productividad de los cultivos al mismo tiempo de reducir la emisión de gases de efecto invernadero, así como la integración de su producción a mercados donde sean más competitivos para elevar ingresos."}]},{"head":"¿Qué resultados podemos esperar? ¿Cómo lo haremos?","index":3,"paragraphs":[{"index":1,"size":68,"text":"Para la ejecución del proyecto se seleccionarán 1500 familias cuyos medios de subsistencia se basan en sistemas agroalimentarios basados en papa, y que viven en una de las localidades mencionadas. Ellas participarán en el diseño, implementación y evaluación de procesos de fortalecimiento de capacidades donde se validarán buenas prácticas agrícolas climáticamente inteligentes que consideren, a su vez, el conocimiento local y los métodos transmitidos de generación en generación."},{"index":2,"size":44,"text":"También se trabajará de la mano con instituciones público-privadas y vinculadas con las familias agricultoras para potenciar el proceso de aplicación de las buenas prácticas, las cuales incidan en políticas y estrategias para su escalamiento e implementación en grupos similares en zonas alto andinas."},{"index":3,"size":58,"text":"Los actores del sector privados vinculados al comercio, como industrias, procesadoras y restaurantes, tendrán además un rol particular, ya que se les asignará la responsabilidad de generar oportunidades para integrar al mercado los productos ofrecidos por los agricultores y considerando una oferta diferenciada donde se valoricen los atributos derivados y diferenciados de las prácticas de agricultura climáticamente inteligente."},{"index":4,"size":35,"text":"1. Actores con mayor capacidad de respuesta frente al cambio climático al estar en la capacidad de utilizar, difundir y gestionar nuevas y mejores prácticas de 'agricultura climáticamente inteligente' , en sistemas basados en papa."},{"index":5,"size":26,"text":"2. Hombres y mujeres productores que aplican prácticas de 'agricultura climáticamente inteligente' que les permiten aumentar la resiliencia de su producción integrándolo con sus saberes locales."},{"index":6,"size":14,"text":"3. Acceso a nuevos actores de la cadena de valor y a mercados diferenciados."},{"index":7,"size":35,"text":"4. Proyectos y programas de gobiernos locales y otros actores que utilizan los productos y lecciones del proyecto como tecnologías y metodologías, para diseñar e implementar iniciativas que aumenten la resiliencia de los sistemas agroalimentarios."}]}],"figures":[],"sieverID":"b9b3c1a5-03b1-4d2f-81b6-698173539134","abstract":"Se conoce como agricultura familiar campesina a la actividad productiva en tierras de cultivo con una extensión no mayor a cinco hectáreas que son atendidas por grupos pequeños de personas con parentesco sanguíneo, quienes comercializan y consumen lo que cosechan de estos campos. Dicha práctica, aplicada a la siembra, cosecha y comercialización de papa, representa el 70% de la producción interna de este tubérculo en toda América Latina."}

data/part_1/06e0064241b0e7a7f90fed8ac9726079.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06e0064241b0e7a7f90fed8ac9726079","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/32a91602-f542-4be9-86b7-69f58e85b48f/retrieve"},"pageCount":4,"title":"Rainwater management for resilient livelihoods in Ethiopia The Nile Basin Development Challenge: Methods, outputs and outcomes","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":151,"text":"The Nile Basin Development Challenge (NBDC) is one of six global focal basins of the Challenge Program on Water and Food (CPWF). The overall objective of the CPWF program is to increase water productivity and resilience of social and ecological systems, through broad partnerships and research that leads to local impact and wider change. Within this framework, the NBDC has set out to improve and build on rainwater management strategies as a way to improve livelihoods and reduce poverty. The focus of the work has been on the Blue Nile where rainfed agriculture dominates and over 80% of the population relies on subsistence, rainfed agriculture. In contrast, the downstream countries, principally Egypt and Sudan, are dominated by large-scale irrigated agriculture. However they will also potentially benefit from improvements in rainwater management upstream through reductions in land degradation and associated soil erosion which when transported downstream reduces the efficacy of irrigation schemes."},{"index":2,"size":65,"text":"To meet the Nile Basin Development Challenge, it was found necessary to adopt an outcome logic model in which a range of approaches have been used to generate outputs and outcomes to support policy development and enhance best practices in relation to selected land management. These are briefly presented in summary here with subsequent papers in the proceedings developing the issues in greater a depth."}]},{"head":"Methods","index":2,"paragraphs":[{"index":1,"size":85,"text":"The approach to the NBDC has been to develop work in three dimensions, social, economic and technical, which when put together will give an overall set of integrated outputs and outcomes. To realize the broad CPWF aims, work was conducted at multiple scales: Households, communities and catchments and the Blue Nile Basin as a whole. Importantly, the project was undertaken in partnership with a range of organizations, universities, regional researchers and NGOs. Some examples of the methods used in the different disciplines across scales are:"},{"index":2,"size":327,"text":"In our sentinel sites (see Figure 1), the project established biophysical monitoring which has involved 'state of the art' technical equipment to measure meteorology, soil-water, groundwater and stream heights. At the same time, the project used farmer and community participation to measure rainfall, river flows and water samples for water quality analysis. Together these data provide primary data to understand water fluxes and stores in detail at a high spatial and temporal resolution. To further understand and engage with communities, we have established, within the same communities, 'innovation platforms'. These IPs and the processes they involve are designed to ensure full participation and ownership in terms of recognizing issues and potential solutions relating to natural resource management. The process is designed to maximize both indigenous knowledge and the necessary supplementary technical input to bring about change in knowledge, attitude and skills amongst the communities and their advisors. To assess this, the project also collected extensive information on economics, institutional set ups and livelihood strategies. Some of the process methods used in the IPs involved: training members of the community to use audiovisual equipment and then recording of events they see and face in the landscape and also recording of digital stories through use of still photography to test and develop some scenarios for the future; we have used role playing simulation type games called Happy Strategies Wat a Game. At a wider regional and basin scale, greater emphasis was given to use of GIS and mathematical models. These tools allow some of the work undertaken at the smaller scale to be scaled out to wider areas to examine the consequences of changes in practice for rainwater management strategies. Finally, at the national scale, the NBDC established a high level think tank or national innovation platform composed of stakeholders from a range of backgrounds and skills. This national IP has been set up to disseminate and consider how best to develop the findings coming out of the work."}]},{"head":"Outputs","index":3,"paragraphs":[{"index":1,"size":73,"text":"From this growing body of work, we have developed a range of outputs including formal type publications submitted to the research literature, briefing notes on the various activities undertaken and technical reports and numerous Masters theses. Other outputs are the less formal ones such as field visits, technical meetings and workshops (some of which have minutes and proceedings. Other descriptions can be viewed and contributed through the project web pages and wiki (http://nilebdc.wikispaces.com/)."}]},{"head":"Outcomes","index":4,"paragraphs":[{"index":1,"size":93,"text":"Central to the work of the CPWF and NBDC is to take all of these outputs and transfer them into evidence-based outcomes aimed at transforming the livelihoods of vulnerable communities practising rainfed farming in the Blue Nile Basin. At the same time, such improvements should lead to a more sustainable use of natural resources which in turn should have positive impact on downstream users. At the current stage, the messages we are developing are built around a core concept of an emerging New Integrated Watershed Rainwater Management Paradigm, the elements of which, are:"},{"index":2,"size":1,"text":"1."},{"index":3,"size":11,"text":"Local community empowerment and leadership based on demand, equity and inclusiveness;"},{"index":4,"size":9,"text":"2. Partnerships integrating and sharing local and scientific knowledge;"}]},{"head":"3.","index":5,"paragraphs":[{"index":1,"size":11,"text":"Emphasis on learning process by all parties in a linked manner;"}]},{"head":"4.","index":6,"paragraphs":[{"index":1,"size":10,"text":"Creating incentives and risk management mechanisms for innovation and success;"}]},{"head":"5.","index":7,"paragraphs":[{"index":1,"size":18,"text":"Transforming institutional and human capacities of all stakeholders; and 6. Adapting and using new learning and planning tools."},{"index":2,"size":50,"text":"These elements are highly integrated and success is more likely if all the elements in policies and implementation strategies are included. A landscape or watershed perspective is central to the new RWM paradigm. We believe that the critical innovations justifying our use of the term 'new' emerging from NBDC are:"},{"index":3,"size":1,"text":"7."},{"index":4,"size":30,"text":"Integration of the core elements of a new integrated RWM paradigm at watershed level and 8. Development of tools and methodologies for effective planning, learning and implementation emerging from NBDC."},{"index":5,"size":35,"text":"Therefore, the proposed new paradigm shall not replace existing programs and strategies. Rather, it offers a clear pathway to achieving ambitious conservation as well as livelihood and production outcomes that Ethiopia may otherwise not achieve."},{"index":6,"size":77,"text":"The target audience for these integrated core messages includes senior Ethiopian policymakers and leaders of implementation at federal and regional levels, senior officials at zone, woreda and kebele levels and Ethiopia's development partners (i.e. donors and international finance institutions). In addition, researchers, NGOs and other stakeholders will also find the messages useful. For effective implementation of the new RWM paradigm, we will develop additional specific technical messages for local level stakeholders, researchers, trainers and technical support staff."},{"index":7,"size":35,"text":"Over the coming six months to the close of the program, we will work on further developing and refining these messages together with developing an indication of the strength of the evidence that underpins them."}]}],"figures":[{"text":"Figure 1 . Figure 1. The Blue Nile and the three sentinel site setting. "}],"sieverID":"3ee97305-9dbf-4c82-b43a-f6e1e36640e8","abstract":""}

data/part_1/06f316cb43cb56c01fab155b55c96383.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06f316cb43cb56c01fab155b55c96383","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d0b7f50e-6fc3-4cd8-9b2d-9caff3469d68/retrieve"},"pageCount":34,"title":"Recommendation domains for conservation agriculture (CA) in Eastern and Southern Africa","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":301,"text":"Conservation agriculture (CA) is a sustainable agronomic practice that is increase resilience of farming systems to the effect of soil degradation, climate change, and reduced soil water. It is known to improve crop productivity against dwindling biophysical and soil resources. Hence, it is being promoted in east and southern Africa as a climate-smart technology that can buffer against the effects of extreme weather events. The countries of the ESA present diverse socio-economic and biophysical scenarios for agricultural development, such as overutilization of natural resources, poor land use management and soil degradation due to high demographic pressure. CA is recommended to mitigate these challenges. Due to the heterogeneity of the farming landscapes in the ESA countries, CA technology needs to be appropriately deployed to have maximum benefits. Conservation agriculture (CA) technologies are applicable in diverse biophysical conditions ranging from low to high rainfall areas with varied edaphic conditions (Thierfelder et al., 2014). The main factors influencing the effectiveness of CA approaches are the environment's socio-economic and biophysical conditions. Geospatial techniques have been used extensively to facilitate the integration of socio-economic and environmental variables in the development of recommendation domains (Muthoni et al., 2017). Open-source gridded data from remote sensing platform is increasingly available to support the development of spatially explicit recommendations. Recommendation domains (RDs) are spatially contiguous zones where specific development policies, investments and livelihood options, and technologies are likely to be most beneficial, enhancing faster adoption rates. In this study, we have used multi-source high-resolution geospatial data to characterize the biophysical and socio-economic environment in nine east and southern African countries. Geospatial analysis generated spatial maps of the recommendation domains for CA. The analytics results will guide extension and development agencies in targeting the most suitable zones to promote the efficient allocation of resources and reduce the risk of technology failure."}]},{"head":"Material and methods","index":2,"paragraphs":[{"index":1,"size":137,"text":"Recently released gridded data representing the climatic, topographic, edaphic, and socio-economic variables (Table 1) was applied in the recommendation domain analysis. Rainfall amount and distribution is the most critical factor that drives agricultural productivity. CA practices help conserve soil moisture in rain-limited environments and minimises soil loss due to erosion in high rainfall ecology. Monthly satellite rainfall estimates were downloaded from the Climate Hazards Group InfraRed Precipitation with Station data version two (CHIRPS-v2) from 1981-2022 (Funk et al., 2015). CHIRPS-v2 data was produced by combining gauge station and satellite precipitation estimates to create gridded rainfall time series for trend analysis and seasonal drought monitoring. From this set of time series rainfall data, we generated the annual mean total rainfall and growing season rainfall distribution characteristics, such as the frequency of droughts and floods in the study area."},{"index":2,"size":179,"text":"Gridded soil physical and chemical properties from iSDA database (Hengl et al., 2021) was downloaded and aggregated to the original 30m to 1 Km 2 spatial resolution using the geodata R package. The soil layers include the soil texture, pH, Organic Carbon, and Total Nitrogen (Table 1). The iSDA soil physical and chemical properties dataset was created using machine-learning techniques from recent field soil surveys and legacy data (Hengl et al., 2021). Soil texture plays a significant role in soil water, and nutrient availability to crops, and yields are higher in well-drained soils than in poorly drained texture soils (Rusinamhodzi et al., 2011). Soil pH is an important secondary determinant of heavy metal transport, such as Aluminium ions, affecting their water solubility in the soil. Soil slope is another critical factor influencing CA adoption. It determines drainage and soil loss through erosion which is proportional to slope steepness. CA has been established to minimize soil degradation through minimum tillage and mulching effects. Gridded soil slope was generated from the SRTM elevation data and was downloaded from the NASA USGS."},{"index":3,"size":128,"text":"The relevant socio-economic data for CA adoption used in this analysis includes human population density, livestock density, and measures of accessibility to markets. Human population density affects CA adoption as it determines food demand levels and the degree of farming intensification. Cattle density influences the volume of crop residues left for CA practices; the higher the cattle density, the lower the crop residue quantity to be employed for CA. The human population density dataset was obtained from the Gridded Population of the World (GPW), version 4, produced by the Center for International Earth Science Information Network (CIESIN) of Columbia University, USA. The livestock density data in the study came from the Gridded Livestock Density Global -2010 (GLW 3), with a spatial resolution of 10km (Gilbert et al., 2018)."},{"index":4,"size":137,"text":"Another essential socio-economic factor explored for CA adoption was the market access measured as travel time to cities of 20,000 inhabitants. Market accessibility is crucial for CA adoption as it determines the availability of agro-inputs, extension services and ease of selling agricultural produce. Farmers in geographies with good market access have a solid incentive to uptake new technologies for increased productivity. Market access data used in the study was obtained from the travel time to a city of 20000 raster data at a 30 arc-seconds (about one km²) resolution (Nelson, 2019). Since there exist diverse land use categories in the target countries, we employed the cropland extent data from Digital Earth Africa to limit the area of possible CA adoption. A summary of critical variables that restrict or enhance CA practices' suitability is listed in Table 1. "}]},{"head":"Recommendation domain development","index":3,"paragraphs":[{"index":1,"size":83,"text":"The rainfall, slope, and soil texture layers were reclassified into different categories. Following Tesfaye et al. (2015) a factorial combination of the classes (Table 3) was applied to identify the biophysical potential of CA in the current cultivated areas. The combinations of biophysical factors representing the rainfall, slope and soil texture were used as indicators of plant water supply, drainage, and erosion. These were used to delineate three biophysical potentials of CA namely, high potential (HP), moderate potential (MP) and low potential (LP)."},{"index":2,"size":84,"text":"Similarly, the three socio-economic variables were reclassified into two classes each. Human population density >100 persons/km² was categorized as high potential while <=100persons/km² was low. Cattle density <50 was classified as having high potential for CA due to lesser competition of crop residues, while cattle density >=50 was considered low potential. Market access was classified into travel time less than three hours was considered high potential due to lower transaction costs, while more than three hours were considered the low potential for CA adoption. "}]},{"head":"Results","index":4,"paragraphs":[{"index":1,"size":80,"text":"Figures 1 -15 show the biophysical conditions that determine the suitability of CA practices in ESA region. Figures 16 -21 show the spatial variation of the socialeconomic factors that influence the adoption of CA practices. Figure 22 and Figure 23 present the biophysical and socio-economic potential of the CA practices in the ESA region. Finally, the recommendation domain of CA is shown in Figure 25. The largest contiguous zone showing the highest potential for CA occurs in Malawi (Figure 25).                     "}]}],"figures":[{"text":"Figure 1 . Figure 1. The percentage frequency of growing season drought (1981-2022) in the east and southern Africa (ESA) region. "},{"text":"Figure 2 . Figure 2. The number of growing seasons experiencing droughts from 1981to 2022 the east and southern Africa (ESA) region. "},{"text":"Figure 3 . Figure 3. The percentage of growing seasons experiencing droughts from 1981 to 2022 in the east and southern Africa (ESA) region. Severe droughts were defined as rainfall anomalies less than 1 standard deviation. "},{"text":"Figure 4 . Figure 4. The number of growing seasons experiencing droughts from 1981 to 2022 in the east and southern Africa (ESA) region. "},{"text":"Figure 5 . Figure 5. The number of growing seasons experiencing severe droughts from 1981 to 2022 in the east and southern Africa (ESA) region. "},{"text":"Figure 6 . Figure 6. The number of years experiencing flood in the growing season (1981-2022) in the east and southern Africa (ESA) region. "},{"text":"Figure 7 . Figure 7. The number of years experiencing more than moderate floods in the growing season (1981-2022) in the east and southern Africa (ESA) region. "},{"text":"Figure 8 . Figure 8. Map of the number of years experiencing severe floods in the growing season (1981-2022) in the east and southern Africa (ESA) region. "},{"text":"Figure 9 . Figure 9. The slope gradient presented in percentage in the east and southern Africa (ESA) region. "},{"text":"Figure 10 . Figure 10. Spatial variation of the soil texture classes in the east and southern Africa (ESA) region. "},{"text":"Figure 11 . Figure 11. Soil organic carbon content in the east and southern Africa (ESA) region. "},{"text":"Figure 12 . Figure 12. Soil total nitrogen content in the east and southern Africa (ESA) region. "},{"text":"Figure 13 . Figure 13. Soil available phosphorus in the east and southern Africa (ESA) region. "},{"text":"Figure 14 . Figure 14. Map of soil extractable potassium in the east and southern Africa (ESA) region "},{"text":"Figure 17 . Figure 17. Map of the human population density in the east and southern Africa (ESA) region. "},{"text":"Figure 18 . Figure 18. Human population density classified into two categories for identifying recommendation domains of the conservation agriculture in the east and southern Africa (ESA) region. "},{"text":"Figure 19 . Figure 19. Map of cattle density in the east and southern Africa (ESA) region. "},{"text":"Figure 20 . Figure 20. Map of cattle density classified into two categories for identifying recommendation domains of the conservation agriculture in the east and southern Africa (ESA) region. "},{"text":"Figure 21 . Figure 21. Map transaction cost measured as the travel time to a city with over 20,000 inhabitants identifying recommendation domains of the conservation agriculture in the east and southern Africa (ESA) region. "},{"text":"Figure 22 . Figure 22. The biophysical potential of conservation agriculture in the east and southern Africa (ESA) region. "},{"text":"Figure 23 . Figure 23. The socio-economic potential of conservation agriculture in the east and southern Africa (ESA) region. "},{"text":"Table 1 . Biophysical and socio-economic variables selected for mapping recommendation domains for conservation agriculture practices No Variable name Abbreviation Original resolution Units Source No Variable nameAbbreviationOriginal resolutionUnitsSource Precipitation variables     Precipitation variables 1 Total growing season rainfall Rainfall ~5 km mm CHIRPS (Funk et al. 2015) 1981-2022 1Total growing season rainfallRainfall~5 kmmmCHIRPS (Funk et al. 2015) 1981-2022 9 Standardised rainfall anomaly Rainfall Anomaly   Derived from Rainfall 9Standardised rainfall anomalyRainfall AnomalyDerived from Rainfall  Frequency of droughts Drought ~5 km  \" Frequency of droughtsDrought~5 km\"  Frequency of flooding Flood ~5 km  \" Frequency of floodingFlood~5 km\" Soil variables     Soil variables 27 Soil texture Texture  Class https://enviromet rix.nl/isdasoil-open-soil-data- 27Soil textureTextureClasshttps://enviromet rix.nl/isdasoil-open-soil-data-      for-africa/ for-africa/ Socio-economic variables    Socio-economic variables 28 Cattle density-weighted Cattle density ~10 km Heads (Gilbert et al., 2018) 28Cattle density-weightedCattle density ~10 kmHeads(Gilbert et al., 2018) 29 Market access Market access ~1 km minutes (Weiss et al., 2018) 29Market accessMarket access~1 kmminutes(Weiss et al., 2018)  Human population Pop density ~1 km  Gridded Population of the Human populationPop density~1 kmGridded Population of the  density 2020    World (GPW), v4 density 2020World (GPW), v4 Vegetation productivity/ phenology    Vegetation productivity/ phenology      https://www.digit alearthafrica.org/ https://www.digit alearthafrica.org/ 30 Cropland extent CropExt ~30/10 m  platform-resources/service s/cropland- 30Cropland extent CropExt~30/10 mplatform-resources/service s/cropland-      extent-map extent-map Terrain variables     Terrain variables 31 Digital elevation model DEM ~30 m m (METI and NASA, 2011) 31Digital elevation modelDEM~30 mm(METI and NASA, 2011) 32 Slope slope ~30 m % Generated from DEM 32Slopeslope~30 m%Generated from DEM  "},{"text":"Table 2 . Criteria for categorizing biophysical variables into potential zones for conservation agriculture practices. Slope (%)  Rainfall (mm)  Slope (%)Rainfall (mm)  400 -1,000 1,000 -1,500 >1,500 400 -1,0001,000 -1,500>1,500 TG1 a    TG1 a 0-3 HP MP LP 0-3HPMPLP 3-7 HP HP LP 3-7HPHPLP 7-50 HP HP MP 7-50HPHPMP TG2    TG2 0-3 LP MP MP 0-3LPMPMP 3-7 LP MP LP 3-7LPMPLP 7-50 LP HP LP 7-50LPHPLP TG3    TG3 0-3 MS LP LP 0-3MSLPLP 3-7 HP MP LP 3-7HPMPLP 7-50 HP HP MS 7-50HPHPMS High potential (HP), moderate potential (MS), marginal potential (LP). a Texture High potential (HP), moderate potential (MS), marginal potential (LP). a Texture Group1 (TG1) surface soil texture other than sand, loamy sand, and clay; TG2 sand and Group1 (TG1) surface soil texture other than sand, loamy sand, and clay; TG2 sand and loamy sand; TG3 heavy and light clay.   loamy sand; TG3 heavy and light clay.  "}],"sieverID":"b684c378-e277-436e-8da4-e3e5e9f191fe","abstract":"The Sustainable Intensification of Mixed Farming Systems Initiative aims to provide equitable, transformative pathways for improved livelihoods of actors in mixed farming systems through sustainable intensification within target agroecologies and socio-economic settings.Through action research and development partnerships, the Initiative will improve smallholder farmers' resilience to weather-induced shocks, provide a more stable income and significant benefits in welfare, and enhance social justice and inclusion for 13 million people by 2030.Activities will be implemented in six focus countries globally representing diverse mixed farming systems as follows: Ghana (cereal-root crop mixed), Ethiopia (highland mixed), Malawi: (maize mixed), Bangladesh (rice mixed), Nepal (highland mixed), and Lao People's Democratic Republic (upland intensive mixed/ highland extensive mixed)."}

data/part_1/0734d41466e55fad168fa897499bdd46.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0734d41466e55fad168fa897499bdd46","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5a653ae5-9659-4e7f-b606-d2a40daf2cb2/retrieve"},"pageCount":1,"title":"Greater banana diversity contributes to capacity development and improved rural livelihoods in Africa","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":69,"text":"Maximum banana diversity has been introduced, maintained and characterized in the East and Central African regional Musa collection in Mbarara, Uganda (NARO). Bioversity International's work there focuses on two areas: 1) Varieties with potential for disease resistance are introduced from the ITC genebank. Traits sources are identified, followed by the development of improved male parents, development of improved hybrids, and finally farmer participatory evaluation and variety promotion (left photo). "}]},{"head":"Bioversity International","index":2,"paragraphs":[{"index":1,"size":62,"text":"Bioversity International delivers scientific evidence, management practices and policy options to use and safeguard agricultural and tree biodiversity to attain sustainable global food and nutrition security. Together with our international, regional and local partners, we work throughout the tropical belt in which bananas thrive: South and Southeast Asia, Pacific, East and South Africa, West and Central Africa, Latin America and the Caribbean."}]},{"head":"Bioversity's banana genebank","index":3,"paragraphs":[{"index":1,"size":68,"text":"The International Musa Germplasm Transit Centre (ITC) is the world's largest collection of banana germplasm, which contains more than 1,500 accessions (varieties in a collection) of edible and wild species of banana, hosted at the Katholieke Universiteit Leuven (KU Leuven), Belgium (right photo). The ITC is considered the richest source of banana diversity globally and also serves as a transit centre and safety backup for national banana collections."}]},{"head":"Banana production in Africa","index":4,"paragraphs":[{"index":1,"size":69,"text":"The two major areas of production in Africa are East/Southern and West/Central Africa. Uganda is the world's thirdlargest producer with around 9.5 million tonnes (cooking and beer bananas (photo top left)). Although bananas originate from the Asia-Pacific region, the diversity of plantain cultivars is highest in West/Central Africa, where they are a major diet staple. African banana farming is primarily for subsistence, often in small garden plots (photo right). "}]},{"head":"Threats to banana production","index":5,"paragraphs":[]}],"figures":[{"text":"• One of the most important food commodities in the tropics • Global production: 145 million tonnes (FAO 2014) • 85% is produced by smallholders for local consumption • Increasing monoculture = greater vulnerability What we need to do: • Conserve the diversity • Broaden the genetic base for breeding • Promote the use of diversity Working with NARS and farmers "},{"text":"2) Where diversity is low, varieties from the ITC are sent to National Agricultural Research Stations (NARS), where they are evaluated on farm and then released to farmers by the Ministry of Agriculture. Examples are the cultivars 'Yangambi KM5' (right photo) and 'FHIA 25', which have shown resistance to disease. "},{"text":"A lack of cultivated diversity leaves banana highly vulnerable to pests, diseases and other risks. Banana Xanthomonas wilt, a bacterial disease that has spread across the East African region, is devastating and hard to control (bottom far left photo). Fusarium wilt (Tropical Race 4), a lethal fungal disease already present in many banana producing regions, has recently spread to Africa (bottom centre photo). Abiotic stresses, such as drought, are common in Africa and often wipe out the most susceptible banana varieties. Training workshops Two recent MusaNet workshops took place in Africa (at Centre Africain de Recherche sur les Bananiers et Plantains (CARBAP) in Cameroon and at the National Agricultural Research Organization (NARO) in Uganda) which provided training in field characterization and documentation for over 30 African national and regional Musa collection curators (centre photos). "}],"sieverID":"fd93c0bd-b5c0-4d25-9dcc-a16d6d004856","abstract":""}

data/part_1/074ec38e842dca58672887c7cf770b31.json

@@ -0,0 +1 @@
+{"metadata":{"id":"074ec38e842dca58672887c7cf770b31","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/4433/003b96afc9c3343a0766674bfdd38bda.pdf"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"SHRIMP FARMING AND RESEARCH IN BANGLADESH ADAPTS TO COVID-19 PANDEMIC by M. Mahfujul Haque and Ben Belton","index":1,"paragraphs":[{"index":1,"size":72,"text":"The COVID-19 pandemic has impacted tremendously every aspect of the economy in Bangladesh, including aquaculture. The entire aquaculture supply chain and marketing system is facing multiple challenges. Many fish farmers have reduced their activities due to low demand and uncertainty. At a time when many people are afraid to invest in aquaculture, Golam Kibria Ripon, a farmer from Paikgacha, Khulna, in southern Bangladesh, is successfully continuing his shrimp production and trading activities."},{"index":2,"size":34,"text":"\"The only thing I do and the only thing I know is shrimp culture. Whatever the situation is, I have to continue as many people depend on my business for their livelihoods,\" said Ripon."},{"index":3,"size":91,"text":"Ripon is a successful shrimp farmer and shrimp trader who has engaged in the aquaculture business since 1996. His business employs about 20 full-time staff, including five women. He noted that due to the COVID-19 pandemic, for the first time in his career he is experiencing such major disruptions in the shrimp business. In response, he hired 10 temporary staff to deliver the postlarvae (juvenile shrimp) to farmers during the pandemic, after nursing the shrimp fry himself, and began to deliver harvested shrimp to the processing plant with his own vehicle."},{"index":4,"size":62,"text":"\"Now I know how to cope and survive in an extreme situation. The demand of shrimp will not decrease, [and] all I have to do is to make sure to transport the harvested shrimp to the processing plant,\" said Ripon. Ripon ensures the health and safety of his staff by providing proper sanitizing facilities in his farms and maintaining basic preventive procedures."},{"index":5,"size":71,"text":"Ripon is a farmer participant in the Feed the Future Innovation Lab for Fish (Fish Innovation Lab) project Machine Learning for Better Aquaculture. This project's objective is to identify emerging technologies and innovative practices in aquaculture value chains and pilot digital extension approaches that accelerate their adoption to enhance productivity, efficiency, resilience, and human nutrition while reducing the transaction costs and time associated with traditional forms of technical research and extension."},{"index":6,"size":77,"text":"To address this objective, the project team is undertaking a comprehensive survey of fish and shrimp farmers in southern Bangladesh. Pretesting and refining draft questionnaires is a key element in the research design. Though the team planned to conduct questionnaire development through face-to-face meetings in Bangladesh, this proved impossible due to COVID-19-related travel restrictions. With quick planning and innovative thinking, the partners successfully adapted their plans and conducted the questionnaire drafting through a series of virtual meetings."}]},{"head":"Ripon on his farm. Submitted by authors","index":2,"paragraphs":[{"index":1,"size":55,"text":"This story was made possible by the generous support of the American people through the U.S. Agency for International Development (USAID) under the Feed the Future initiative. The contents are the responsibility of the Feed the Future Innovation Lab for Fish and do not necessarily reflect the views of USAID or the United States Government."},{"index":2,"size":28,"text":"However, a big remaining challenge was how to pretest the questionnaire with the farmers in the field, particularly with shrimp farmers in the remote Khulna region like Ripon."},{"index":3,"size":57,"text":"To cope with this crisis, the team invited Ripon to attend a virtual meeting for pretesting the questionnaire. Although he was unfamiliar with the videoconferencing application, the Machine Learning for Better Aquaculture team was able to quickly teach Ripon how to use it so that he could participate in a questionnaire pretesting interview lasting about three hours."},{"index":4,"size":142,"text":"Conducting the interview remotely allowed for researchers based in the US and Bangladesh to meet with this local producer and continue progress on the research that will benefit shrimp farmers across southern Bangladesh. The questionnaire was translated from English to Bangla for better communication prior to the interview. \"I think this research will identify our problems, such as shrimp disease and disappearance of stocked postlarvae that affect our farming, and according to the nature of problems we will find a proper solution from the researchers,\" said Ripon. \"I am the General Secretary of Paikgacha Shrimp Farmers Association. I can organize the shrimp farmers of my locality to receive advanced training on shrimp farming, disease management, and other topics though the Zoom platform. Moreover, we have a big Facebook group, which we can use to share any useful information among the shrimp farmers.\""},{"index":5,"size":73,"text":"The participation of a very knowledgeable shrimp farmer early in the research process provided a significant boost to questionnaire design and helped the project to meet its milestones on time, despite disruptions linked to COVID-19. This successful experiment in pretesting a questionnaire with a farmer in a remote area indicates possibilities for conducting other project activities, including workshops and information dissemination activities, virtually if COVID-19 continues to make travel or face-to-face meetings difficult. "}]},{"head":"______________________________________________________________________________________","index":3,"paragraphs":[]},{"head":"ABOUT THE FISH INNOVATION LAB","index":4,"paragraphs":[]}],"figures":[{"text":"  "},{"text":" The Fish Innovation Lab supports the United States Agency for International Development's agricultural research and capacity building work under Feed the Future, the U.S. Government's global hunger and food security initiative. Mississippi State University is the program's management entity. The University of Rhode Island, Texas State University, Washington University in St. Louis, and RTI International serve as management partners. MACHINE LEARNING FOR MACHINE LEARNING FOR BETTER AQUACULTURE TEAM BETTER AQUACULTURE TEAM Lead PI and U.S. PI Lead PI and U.S. PI Ben Belton, PhD Ben Belton, PhD Michigan State University Michigan State University Bangladesh PI Bangladesh PI Mohammad Mahfujul Haque, PhD Mohammad Mahfujul Haque, PhD Bangladesh Agricultural University Bangladesh Agricultural University Bangladesh Co-PI Bangladesh Co-PI Khondker Murshed-e-Jahan, PhD Khondker Murshed-e-Jahan, PhD WorldFish WorldFish U.S. Co-PI U.S. Co-PI Amipouyan Nejadhashemi, PhD Amipouyan Nejadhashemi, PhD Michigan State University Michigan State University Collaborators Collaborators Hazrat Ali Hazrat Ali WorldFish WorldFish Ricardo Hernandez, PhD Ricardo Hernandez, PhD International Center for Tropical Agriculture International Center for Tropical Agriculture www.feedthefuture.gov www.feedthefuture.gov www.fishinnovationlab.msstate.edu www.fishinnovationlab.msstate.edu  "}],"sieverID":"97fb8897-49f7-44c0-b6d7-1a80789ac7bd","abstract":""}

data/part_1/07bbef282746d80e0c612e727a2ca8dc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07bbef282746d80e0c612e727a2ca8dc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/dcabf411-c368-480b-ad77-ca4c65d1dd3e/retrieve"},"pageCount":14,"title":"Open access -Research article THIS ARTICLE IS PART OF A SPECIAL ISSUE ENTITLED 'MOLECULAR TECHNOLOGIES TO IMPROVE VEGETATIVELY PROPAGATED BANANA AND CASSAVA' A platform for efficient genotyping in Musa using microsatellite markers","keywords":[],"chapters":[{"head":"Principal results","index":1,"paragraphs":[{"index":1,"size":53,"text":"The marker set used in this study provided enough polymorphism to discriminate between individual species, subspecies and subgroups of all accessions of Musa. Likewise, the capability of identifying duplicate samples was confirmed. Based on the results of a blind test, the genotyping system was confirmed to be suitable for characterization of unknown accessions."}]},{"head":"Conclusions","index":2,"paragraphs":[{"index":1,"size":60,"text":"Here we report on the first complex and standardized platform for molecular characterization of Musa germplasm that is ready to use for the wider Musa research and breeding community. We believe that this genotyping system offers a versatile tool that can accommodate all possible requirements for characterizing Musa diversity, and is economical for samples ranging from one to many accessions."}]},{"head":"Introduction","index":3,"paragraphs":[{"index":1,"size":260,"text":"The important role of bananas and plantains (Musa spp.) as one of the top world trade commodities and as food security for millions of people, especially in humid tropics, is unquestionable. However, this crop faces serious endangerment by numerous pests and diseases. Breeding efforts are hampered by a high degree of banana sterility and a lack of characterized germplasm as potential parents for breeding. Currently grown banana cultivars are mainly triploid clones, which originated as intraspecific hybrids of Musa acuminata and interspecific hybrids between M. acuminata and Musa balbisiana, with a possible involvement of a few other species within the genus. To set up an efficient strategy for breeding improved banana varieties and support the choice of crossing parents, a solid understanding of the genetic diversity of available resources is needed. Likewise, conservation of existing gene resources is essential, especially when we observe the continuous loss of banana diversity due to indelicate environmental treatment of the rain forests, as well as changed farming practices of smallholders. The main objectives and means for Musa diversity conservation were formulated in the Global Conservation Strategy for Musa (INIBAP 2006) under the scope of GMGC (Global Musa Genomics Consortium). Nevertheless, irrespective of the selected strategy, efficient collection and preservation of banana diversity highly depend on unambiguous sample identification. To avoid problems of duplicates within national, regional and global germplasm collections, an accurate and standardized characterization of newly introduced accessions as well as those already deposited in gene banks would be of great benefit. This rationalization effort will allow Musa accessions to be efficiently conserved."},{"index":2,"size":119,"text":"Traditional classification of Musa species is based on morphological characters and chromosome counts (basic chromosome number; x) (Cheesman 1947;Simmonds and Shepherd 1955). Although a morphotaxonomic system allows for differentiation of specific banana clones (Stover and Simmonds 1987), insufficiencies of this approach start to emerge as the genetic basis of the plants under study gets narrow. Additionally, a small change at the DNA level can cause a large phenotypic manifestation, while sometimes no or minor morphological changes can be observed after extensive genetic changes. Obviously, a classification system that relies exclusively on the phenotypic manifestations of the genome suffers from limited accuracy (Crouch et al. 2000;De Langhe et al. 2005), but can be made robust if supported by molecular-based characterization."},{"index":3,"size":297,"text":"The enormous increase in the availability of various molecular techniques over the past decades has facilitated the classification of new banana cultivars, as well as reassessment of the traditional taxonomy. Among the broad portfolio of molecular tools, some of the markers have gained special attention in terms of their use in diversity studies and molecular characterization of banana genotypes. Most recently, diversity arrays technology was used for the assessment of genetic diversity within Musa spp. (Risterucci et al. 2009). While having the advantage of a high-throughput approach suitable for large numbers of genotypes, its use for a limited number of samples in a short turn-around time would rank it within the more demanding methods in terms of funding support. The same applies to the genotyping by sequencing approach, which has gained special attention recently (Elshire et al. 2011). Other molecular markers applied in Musa diversity studies were RAPDs (random amplified polymorphic DNA; Pillay et al. 2000Pillay et al. , 2001;;Ruangsuttapha et al. 2007;Venkatachalam et al. 2008) and AFLPs (amplified fragment length polymorphisms; Loh et al. 2000;Wong et al. 2001a;Ude et al. 2002;Wang et al. 2007). Both these markers have a relatively high level of polymorphism, but they are dominant and, in the case of RAPDs, their reproducibility is a serious limitation (Jones et al. 1997). The more advantageous co-dominant markers were also used for Musa, such as RFLPs (restriction fragment length polymorphisms; Gawel et al. 1992;Nwakanma et al. 2003;Ning et al. 2007) and SSRs (simple sequence repeats; e.g. Kaemmer et al. 1997;Grapin et al. 1998;Lagoda et al. 1998;Buhariwalla et al. 2005). While RFLPs perform well in terms of reproducibility, they have a relatively low level of polymorphism and are difficult to use. On the contrary, SSR markers outperform the RFLPs and RAPDs in all the above-mentioned aspects."},{"index":4,"size":94,"text":"Microsatellites (SSRs) are stretches of simple 1-to 6base-pair-long repeat motifs arranged tandemly within the genomes of prokaryotic and eukaryotic organisms. Their flanking regions, which are usually highly conserved, are suitable for designing locus-specific primers. Simple sequence repeats have been successfully applied in the molecular genotyping of many important crops such as rice (Pessoa-Filho et al. 2007), cereals (Hayden et al. 2007), grapevine (This et al. 2004) or cacao (Zhang et al. 2006). Moreover, the use of SSR markers opens up the possibility of automation and multiplexing, which significantly increases the throughput of the technique."},{"index":5,"size":94,"text":"With the aim of developing a standardized protocol to classify Musa germplasm, we have tested and optimized the use of 22 published SSR markers on a set of banana genotypes. The goal of the present study was to investigate the potential of this marker set to distinguish individual accessions and to develop a standardized procedure for Musa genotyping that could serve as a basis for molecular characterization of new samples introduced into the global Musa gene bank (International Transit Centre (ITC), Leuven, Belgium) as well as to the wider Musa research and breeding community."}]},{"head":"Materials and methods","index":4,"paragraphs":[]},{"head":"Plant material and the reference DNA collection","index":5,"paragraphs":[{"index":1,"size":176,"text":"The reference DNA collection, comprising a total of 65 accessions [Additional Information 1], was established to represent genetic diversity within the genus Musa. In vitro plantlets of these accessions are available for distribution from the Bioversity ITC. The genomic DNA of 61 of the 65 accessions is stored in the Genome Resources Centre (http://www.musagenomics.org/cetest_firstpage1/genomic_dna.html) and is available for distribution. Out of the 65 accessions, 54 were successfully included in the analysis [Additional Information 1]. To extend the diploid representation of the genotype set, 39 additional diploid accessions were included [Additional Information 2], with three of them being duplicate samples to the Reference DNA collection. These duplicates were included intentionally to test the capability of the genotyping platform to identify sample duplicates. All 39 additional diploid accessions originated from the ITC collection (Leuven, Belgium) as in vitro rooted plants and were maintained in a heated greenhouse after transfer to soil. The DNA of these 39 entries was isolated from young leaf tissue using the Invisorb w Spin Plant Mini kit (Invitek, Berlin, Germany), following the manufacturer's instructions."}]},{"head":"Polymerase chain reaction amplification and fragment analysis","index":6,"paragraphs":[{"index":1,"size":225,"text":"The 22 SSR loci (Table 1) were amplified using specific primers (Crouch et al. 1998;Lagoda et al. 1998;Hippolyte et al. 2010) that were adjusted by 5 ′ -M13 tails to enable the use of universal fluorescently labelled primer according to Schuelke (2000). Four different flurophores were used for the primer labelling [6-carboxyfluorescein (6-FAM), VIC, NED and PET; Applied Biosystems, Foster City, CA, USA], allowing for subsequent multiplexing of the reactions (Table 1). The reaction was performed in a final volume of 20 mL containing 10 ng of template genomic DNA, reaction buffer (consisting of 10 mM Tris -HCl (pH 8), 50 mM KCl, 0.1% Triton-X100 and 1.5 mM MgCl 2 ), 200 mM dNTPs (each), 1 U of Taq polymerase, 8 pmol of the M13-tailed locus-specific forward primer, 6 pmol of the fluorescently labelled universal M13 forward primer and 10 pmol of the locusspecific reverse primer. The cycling conditions were set as follows: initial denaturation step at 94 8C for 5 min, followed by 35 cycles of denaturation (94 8C/45 s), annealing at the temperature corresponding to the locus-specific primer (1 min) and extension (72 8C/ 1 min). Final extension was allowed for 5 min at 72 8C. The polymerase chain reaction (PCR) products were purified by ethanol/sodium acetate precipitation. Three independent PCR reactions were performed in order to improve the accuracy of allele binning."},{"index":2,"size":133,"text":"For automatic capillary electrophoresis, optimized amounts of amplification products were combined with highly deionized formamide and internal standard (GeneScan TM -500 LIZ size standard; Applied Biosystems). After 5 min denaturation at 95 8C, samples were loaded onto the automatic 96-capillary ABI 3730xl DNA Analyzer, and electrophoretic separation and signal detection were carried out with default module settings. In order to reduce the cost and increase the capacity of the genotyping platform, samples were multiplexed for the second and third round of electrophoretic separation. Up to 4-fold multiplexing was applied by combining four PCR products, labelled with different fluorescent dyes (6-FAM, VIC, NED and PET; Table 1) into a single sample for loading. The level of multiplexing could be further increased by combining products of different expected lengths, labelled with the identical fluorescent dyes."}]},{"head":"Fragment sizing and data analysis","index":7,"paragraphs":[{"index":1,"size":93,"text":"The resulting data were analysed using GeneMarker w v1.75 (Softgenetics, LLC, State College, PA, USA). Automated scoring of the data was followed by a careful manual check, and low-quality DNA samples were discarded from the analysis. The marker panels were built based on allele calls of the Reference DNA collection sample set and later extended by additional diploid accession allele calls, in order to increase the reference SSR-profiles database. Bins for each allele were set with respect to the allele frequencies and signal strength extracted from the three repeated runs of each sample."},{"index":2,"size":180,"text":"The diploid and triploid accessions were analysed separately, because in the case of polyploid species, the polysomic inheritance brings the simultaneous occurrence of several alleles of a single SSR. In such a situation, the exact number of copies of individual alleles cannot be determined; therefore, the genotypic data are converted into binary data (coded by 1-presence/0-absence) and analysed as a dominant marker's record (Weising et al. 2005). Both genotypic and binary data were used to generate genetic similarity matrices based on Nei's genetic distance coefficient (Nei 1973) in the software PowerMarker v3.25 (Liu and Muse 2005). The unweighted pair-group method with arithmetic mean (UPGMA; Michener and Sokal 1957) was used to assess the relationship between individual genotypes. The results of UPGMA cluster analysis were visualized in the form of a tree using TreeView v1.6.6 (Page 1996). Polymorphism information content (PIC) and heterozygosity of individual markers were estimated in PowerMarker v3.25. The overall probability of identity (P ID ) of unrelated multilocus genotypes was assessed according to Paetkau et al. (1995), as implemented in the IDENTITY program (Wagner and Sefc 1999)."}]},{"head":"Blind test","index":8,"paragraphs":[{"index":1,"size":137,"text":"In order to verify the reliability of the optimized genotyping platform and its potential as a standardized methodology for molecular characterization of new accessions, a set of anonymous samples was analysed [Additional Information 3]. The genomic DNA was extracted from lyophilized leaf tissue provided by the ITC, and samples were analysed following an identical experimental procedure as for the reference DNA collection. Negative and positive controls (five previously analysed reference genotypes) were included in the blind test to ensure correct allele sizing and control the consistency of the electrophoretic condition. The unknown samples were coded numerically and their true identity was disclosed by our partners only after the data analysis. As revealed subsequently, the blind test sample set contained an additional four samples that were duplicates of the reference DNA collection [see Additional Information 1 and 3].  "}]},{"head":"Genotyping error handling","index":9,"paragraphs":[{"index":1,"size":114,"text":"To eliminate genotyping errors, several precautions were employed in the genotyping process, following the recommendations by Bonin et al. (2004). First, to minimize the allelic dropout effect, the multitube approach (Taberlet et al. 1996) was used with three independent reactions for each marker/genotype combination. The error-prone samples with low-quality DNA were discarded from the analysis. Second, the multilocus genotype was examined and accessions differing at a single locus were carefully inspected and reanalysed (if needed) to confirm the difference. Third, to decrease human factor errors, sample preparation was performed by two different people for the replicated reactions. Data evaluation was ruled by strictly pre-set parameters to avoid errors such as misinterpretation of stutter peaks."}]},{"head":"Results","index":10,"paragraphs":[{"index":1,"size":135,"text":"Twenty-two SSR markers were selected by CIRAD as a set enabling one to distinguish between individuals in the Musa reference DNA collection (Crouch et al. 1998;Lagoda et al. 1998;Hippolyte et al. 2010; Website 1; Table 1). After the initial double-repeated primer test screening using our protocol, 19 markers were selected out of the initial 22 markers set, for their clear reproducible amplification pattern. The three markers that were excluded from the analysis produced extensive stuttering of peaks, disabling the reproducible interpretation of the SSR profiles. All further analyses were performed with the selected 19 SSRs. Altogether, the SSR profiles were collected for 70 diploid and 38 triploid banana accessions. All necessary information on the genotyping methodology as well as the complete allele score files for the analysed genotypes are also available online through http:// olomouc.ueb.cas.cz/musa-genotyping-centre."}]},{"head":"Analysis of diploid accessions","index":11,"paragraphs":[{"index":1,"size":84,"text":"Diploid accessions were underrepresented in the reference DNA collection; therefore, we decided to include additional diploids in the analysis to increase the number of reference SSR profiles [Additional Information 2]. In the resulting set of 70 diploid accessions (including the blind test entries), a total of 292 alleles were scored from the 19 loci, with an average of 15.4 alleles per locus. The observed heterozygosity (the fraction of all individuals who are heterozygous for the observed locus) ranged between 0.179 and 0.714 (mean 0.450)."},{"index":2,"size":55,"text":"The PIC of the markers used was relatively high (mean 0.827), ranging between 0.625 and 0.936 (see Table 2 for details). The P ID (combined over all loci), which represents the probability of observing identical genotypes purely by chance, was 9.44 × 10 229 , denoting the extremely high resolution power of this marker set."},{"index":3,"size":240,"text":"The UPGMA cluster analysis based on the Nei (1973) genetic distance revealed a relatively clear grouping of genotype groups and subgroups (Fig. 1). The B-genome representatives M. balbisiana including the diploid hybrid cultivars (AB and BB×T) formed a separate cluster (cluster I). The A-genome representatives M. acuminata species were grouped in several clusters depending on their subspecies classification. Musa acuminata ssp. banksii entries grouped within cluster II, M. acuminata ssp. microcarpa grouped together with Musa schizocarpa and AS hybrids within cluster III. The sole representative of errans subspecies, cultivar Agutay, was present at the separate clade related to the above-described M. acuminata clusters. Subcluster VI contained the M. acuminata ssp. zebrina representatives. Subspecies burmannica, burmannicoides and siamea were grouped within cluster VII, sharing their position with several entries from the section Rhodochlamys. Musa acuminata ssp. malaccensis subspecies formed a separate cluster labelled VIII (Fig. 1). Most of the AA cultivars were grouped within cluster IV. The Australimusa section representatives included in the study formed cluster V, together with Musa beccarii (classified under the Callimusa section). Musa coccinea, another representative of the Callimusa section, was separated from all the other groups, resembling the behaviour of an outgroup species. As mentioned before, Rhodochlamys species were partly present in cluster VII (specifically the Musa ornata and Musa mannii entries). Musa velutina accessions, another representative of the Rhodochlamys section, formed a separate cluster labelled IX together with a single M. ornata accession (ITC 1330)."}]},{"head":"Blind test with diploid accessions","index":12,"paragraphs":[{"index":1,"size":110,"text":"When the anonymous samples were included in the dataset, the clustering was slightly changed (Fig. 2). The position of accession Agutay (M. acuminata ssp. errans) moved into cluster II containing mostly the M. acuminata ssp. banksii entries. Another alteration could be seen in the position of M. acuminata ssp. zebrina species, which no longer formed a separate subclade (previously labelled with VI), but instead clustered within cluster IV containing the AA cultivars. Finally, cluster VII, although not changed in the content, now showed a different subclustering pattern, with the M. acuminata ssp. burmannica, burmannicoides and siamea species grouped together within one subcluster (VIIa), separated from the Rhodochlamys entries (subcluster VIIb)."},{"index":2,"size":102,"text":"Out of the nine anonymous accessions, eight were assessed correctly as the closest related species to the corresponding reference accession (Fig. 2). The only exception was blind sample no. 4 (M. acuminata ssp. malaccensis ITC 0250), which did not group together with its reference genotype (the same ITC 0250 accession), but instead clustered together within the M. acuminata ssp. banksii subgroup (clade II). The multilocus genotypes of the blind sample no. 4 (ITC 0250) and the closest related genotype Higa (ITC 0428) differed at a single locus only, suggesting that the blind sample no. 4 belonged very likely to the banksii subspecies."},{"index":3,"size":148,"text":"In order to further investigate this incongruence in the blind test results, we conducted internal transcribed spacer (ITS) locus sequence analysis according to Hr ˇibova ´et al. (2011) in the problematic malaccensis accessions. This analysis confirmed that the blind sample no. 4 was not identical to the genotype M. acuminata ssp. malaccensis ITC 0250, which was originally received from the ITC and stored in the local greenhouse [see Additional Information 4]. The results are, however, not conclusive about the identity of blind sample no. 4, as only a single representative of the banksii subspecies was used for the ITS analysis in our previous study. Thus, it cannot be explicitly stated whether blind sample no. 4 is a different genotype of M. acuminata ssp. malaccensis or ssp. banksii, or rather a hybrid between malaccensis and banksii subspecies. Only a more detailed sequence analysis would probably provide a definite answer."}]},{"head":"Analysis of triploid accessions","index":13,"paragraphs":[{"index":1,"size":53,"text":"Altogether, 38 triploid accessions were analysed (including the blind test entries). The 19 microsatellite loci scored a total of 267 alleles, ranging between 8 and 24 per locus, with a mean value of 14 alleles per locus. The average PIC of the SSR markers applied on the triploid accessions was 0.850 (Table 3)."},{"index":2,"size":39,"text":"The UPGMA analysis majority rule consensus tree showed two main clusters, cluster A and cluster B (Fig. 3). Cluster A contained solely the AAA hybrid accessions, with a separated clade bearing the Lujugira/Mutika subgroup representatives, as well as a     "}]},{"head":"Blind test with triploid accessions","index":14,"paragraphs":[{"index":1,"size":131,"text":"Six encoded triploid samples were included in the blind test and all of them were assessed correctly as the closest related species to the corresponding reference genotype from identical subgroups, with significant statistical support (Fig. 4). The position of some clades was slightly altered after the inclusion of anonymous samples in the analysis (Fig. 4). Specifically, the UPGMA cluster analysis has now shown an altered position of the clade previously labelled III (ABB accessions Pelipita and Kluai Tiparot) and the subclade of the cluster previously labelled II, bearing the AAB genotypes P. Palembang, P. Rajah and P. Raja Bulu. However, the bootstrap statistical support for nodes leading to these clades was not significantly strong in either dataset, and the position of all the other clades in the consensus tree remained unchanged."}]},{"head":"Identification of duplicate accessions","index":15,"paragraphs":[{"index":1,"size":212,"text":"One hundred per cent similarity in multilocus genotypes was seen in nine pairs of duplicate accessions [Additional Information 5]. Some of the duplicates were introduced into the accession set intentionally from the local greenhouse (originally coming from the ITC collection) to assess the capability of our genotyping system at spotting the duplicate accessions. Others were introduced through the blind test samples (see Materials and methods). All the duplicates were identified [Additional Information 5], with two exceptions. The Musa textilis reference collection DNA sample (ref. 50), which was reported to correspond to the ITC accession ITC 1072, was shown to be identical to another M. textilis accession (ITC 0539). This suggests that the reference sample (ref. 50) was mislabelled or its origin was not reported correctly. Another anticipated duplicate, introduced into the triploid entries through the blind test, was accession blind 12 (Pisang Bakar ITC 1064). Its corresponding reference DNA sample was ref. 19. However, their identity based on the multilocus molecular profile was not approved. Although the two samples differed at 7 out of the 19 scored SSR loci, their closest relationship was revealed after the UPGMA cluster analysis (Fig. 4), suggesting that their mutual subgroup classification (subgr. Ambon) may be correct, but the identity of one of the samples was confused."},{"index":2,"size":43,"text":"Moreover, more than one duplicate accession was reported for both accession ref.  either the marker set used did not have enough resolution power to distinguish these accessions or, more likely, based on the low P ID value mentioned above, these accessions were mislabelled."}]},{"head":"Discussion","index":16,"paragraphs":[{"index":1,"size":91,"text":"While the use of microsatellite markers to analyse genetic diversity among Musa species is well documented (e.g. Kaemmer et al. 1997;Grapin et al. 1998;Buhariwalla et al. 2005;Ning et al. 2007;Venkatachalam et al. 2008;Wang et al. 2010), its application in the form of a standardized platform to serve for genotyping purposes for the wider Musa community is still missing. In this study, we attempted to develop an optimized SSR-based system for molecular characterization of Musa accessions that could be used as the basis for the foundation of the Musa Genotyping Centre (MGC)."},{"index":2,"size":211,"text":"Mislabelling of accessions and sample duplications are common problems in germplasm collections (e.g. Virk et al. 1995;Zhang et al. 2006). The resolution of the marker set tested in this study was high enough (P ID ¼ 9.44 × 10 -29 ) to distinguish between different accessions and proved to be powerful enough to identify mislabelled accessions, as documented in the case of the M. acuminata ssp. malaccensis accession. Similarly, its potential for identifying duplicates was clearly proved on the present dataset. Nevertheless, we wanted to ensure reproducibility of results and minimization of genotyping errors prior to its implementation into practice. When compared with the original data reported by Lagoda et al. (1998) for a subset of markers, the allele size ranges were overlapping, but not identical. Similar problems have been described previously, and most often they were attributed to the method used and the conditions of electrophoretic separation (e.g. Testolin et al. 2000;Creste et al. 2003). Also, the automatic capillary electrophoresis system used in this experiment allows for much higher resolution and run-to-run precision than the previously used gel-based systems. Therefore, the wider range of allele sizes and higher numbers of identified alleles are adding to the resolution power of the marker set rather than restricting the capability of the platform."},{"index":3,"size":253,"text":"Among the common genotyping errors that are responsible for misidentification of a particular genotype, allele dropout and false allele amplification play an important role. Allele dropout is an accidental failure of PCR to amplify one of the alleles present at the heterozygous locus, which produces false homozygous patterns (Pompanon et al. 2005). To deal with this problem, three options have been proposed. The first relies on systematic replication of the genotyping, i.e. a multitube approach, which in most cases would expose the underlying allelic dropouts or allele shifts due to poor amplification (Taberlet et al. 1996). Another possibility is to allow for a certain level of mismatch tolerance, provided that enough loci are scored. Then based on the multilocus genotype, the differences generated by genotyping errors can be distinguished from those that are actual differences between two genotypes by the low number of mismatches (McKelvey and Schwartz 2004). The third option combines the two former ones, with replicated genotyping only for samples where three or fewer mismatches at different loci were observed. These multilocus genotypes are re-evaluated after the repeated typing to prove that they are different genotypes in reality, but the cost increase by PCR replications is minimized (Zhang et al. 2006). In this pilot study, we adopted the multitube approach with three replicates to ensure maximum precision. However, with many more samples coming to be analysed in the MGC, and thereby increasing the reference database of molecular profiles, the third (combined) option appears to be adequate and is currently being tested."},{"index":4,"size":306,"text":"The grouping revealed by the UPGMA cluster analysis was consistent with the characterization based on the morphotaxonomic classification of accessions (Figs. 2   and 4). The Callimusa section, however, did not form a separate cluster, which reflects its controversial position and agrees with its previously reported close relationship to the Australimusa species (Jarret and Gawel 1995;Wong et al. 2001bWong et al. , 2002)). Also, the close relationship between Rhodochlamys and M. acuminata species (Wong et al. 2002;Bartos ˇet al. 2005;Li et al. 2010;Liu et al. 2010) was confirmed. The marker set enabled distinction to the level of individual subgroup/subspecies. The degree of polymorphism varied between subgroups and subspecies, and polymorphic sites were still to be found within the subgroups and subspecies. For example, in contrast to the study of Creste et al. (2003) who were not able to find polymorphic loci among the Cavendish subgroup of bananas in their study based on six SSR loci, the marker set used in our study did provide polymorphic loci among the three representatives of the Cavendish subgroup, allowing for their distinction. Obviously, the larger number of loci scored increases the possibility of finding enough polymorphic loci. On the other hand, limitations in the resolution of microsatellite markers become evident when somatic mutants are analysed; as they share the common origin, the genetic variation that is narrowed through the cycles of vegetative propagation may not be reflected in their SSR molecular profile (Cipriani et al. 1994;Creste et al. 2003;Esselink et al. 2003). As most of the commercial banana cultivars are vegetatively propagated clones, assessment of their genetic variability through the marker set tested in this study may not be successful and is yet to be confirmed. However, it still presents a very useful platform for molecular characterization of unknown samples and assessment of the genetic integrity of the Musa germplasm collections."},{"index":5,"size":192,"text":"Although microsatellites have been used as reliable markers for projects with labour division among laboratories (Bredemeijer et al. 2002;Ro ¨der et al. 2002), several pieces of work have shown that there was a significant level of incongruence between the results obtained at different workplaces, thus complicating the transferability and comparability of the data (Jones et al. 1997;Weeks et al. 2002;This et al. 2004;Van Treuren et al. 2010). In the light of this, centralization of genotyping activities in Musa and its standardization as a service to the research community appear to be preferable options. In addition to facile quality control, the core facility would enable the use of other methods to support the genotyping, such as flow cytometric estimation of ploidy level and/or genome size, keeping in mind that the genotyping data treatment differs for the diploid and polyploid accessions (see Materials and methods). Obviously, sample transfer requirements can be minimized if both types of analysis are performed at a single site. Moreover, with every new sample passing through the analysis, the database of reference SSR profiles is enlarged and the probability of identifying the closest relative or exactly matching accession is enhanced."},{"index":6,"size":241,"text":"Based on our results obtained with the SSR markers presented in this work and those of Hr ˇibova ´et al. (2011) obtained with ITS, as well as the long-term experience in DNA flow cytometry (Dolez ˇel 1991;Lysa ´k et al. 1999;Roux et al. 2003;Bartos ˇet al. 2005;Dolez ˇelova ´et al. 2005), the MGC has been established at the Institute of Experimental Botany in Olomouc (Czech Republic) under the umbrella of Bioversity International (http://olomouc. ueb.cas.cz/musa-genotyping-centre). The Centre serves the whole Musa research and breeding community. Moreover, the genotyping platform has already been included in the pipeline for characterization of newly introduced accessions to the international banana germplasm collection (ITC). In this pipeline, fresh leaf tissue samples for molecular characterization are received at the MGC, where they are subjected to ploidy level measurement via flow cytometry; the DNA is extracted and used for collecting the SSR profiles of the 19 markers as described above. In certain cases, where the results of the SSR genotyping are not conclusive enough to reliably classify the unknown samples, the ITS sequence analysis according to Hr ˇibova ´et al. (2011) can be applied. Although it is obvious that new high-content, high-throughput, genotyping approaches will gradually replace marker-based systems, we feel confident that the platform described here offers a well-founded and ready-to-use approach, which can be applied immediately and which offers higher flexibility in scaling the analysis with respect to sample size, cost efficiency and turn-around time for results."}]},{"head":"Conclusions and forward look","index":17,"paragraphs":[{"index":1,"size":110,"text":"The platform for genotyping of Musa germplasm described here provides a robust and reproducible approach to characterize the genetic variability of this important crop, support the management of germplasm collections and direct genotype selection for breeding improved cultivars. The database of molecular profiles keeps growing with every new sample passing through the analytical pipeline, resulting in stepwise improvement in the grouping, and consequently increasing the chance of finding an exact match for unknown samples. As part of the future plans, a batch of tetraploid accessions will be included in the analysis to make it more versatile and satisfying all possible requirements for molecular characterization of the diverse Musa gene pool."}]},{"head":"Additional information","index":18,"paragraphs":[{"index":1,"size":23,"text":"The following additional information is available in the online version of this article -File 1: Taxonomic details of the reference DNA collection accessions."},{"index":2,"size":20,"text":"File 2: List of additional diploid accessions from the ITC collection (maintained in a local greenhouse) included in the analysis."},{"index":3,"size":11,"text":"File 3: List of encoded accessions included in the blind test."},{"index":4,"size":25,"text":"File 4: Detailed results of the ITS sequence analysis of blind sample no. 4 and its putative corresponding reference accession-M. acuminata ssp. malaccensis (ITC 0250)."},{"index":5,"size":10,"text":"File 5: List of duplicates identified among the analysed genotypes. "}]},{"head":"Sources of funding","index":19,"paragraphs":[]}],"figures":[{"text":" . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . "},{"text":" . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . "},{"text":"Fig. 1 Fig. 1 Dendrogram showing the results of the UPGMA analysis of diploid accessions dataset. Bootstrap support values higher than 50% are marked below the corresponding branches. The classification of the genotypes into individual sections, species and subspecies of the genus Musa is indicated by the coloured side bars and legends. A complete list of accessions with their taxonomic details can be found in [Additional Information 1 and 2]. "},{"text":"Fig. 2 Fig. 2 Dendrogram showing the results of the UPGMA analysis of diploid accessions dataset including the blind test samples. Bootstrap support values higher than 50% are marked below the corresponding branches. The anonymous samples included in the blind test are highlighted in red. The classification of the genotypes into individual sections, species and subspecies of the genus Musa is indicated by the coloured side bars and legends. A complete list of accessions with their taxonomic details can be found in [Additional Information 1, 2 and 3]. "},{"text":" 8 (M. acuminata ssp. burmannicoides 'Calcutta4') and ref. 21 (M. balbisiana 'Tani'). The second duplicate for each of the two reference samples was classified under the same species/subspecies [Additional Information 5]. This indicates that . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . "},{"text":"Fig. 3 Fig. 3 Dendrogram showing the results of the UPGMA analysis of triploid accessions dataset. Bootstrap support values higher than 50% are marked below the corresponding branches. A complete list of accessions with their taxonomic details can be found in [Additional Information 1 and 2]. "},{"text":"Fig. 4 Fig. 4 Dendrogram showing the results of the UPGMA analysis of the triploid accessions dataset including the blind test samples. Bootstrap support values higher than 50% are marked below the corresponding branches. The anonymous samples included in the blind test are highlighted in red. A complete list of accessions with their taxonomic details can be found in [Additional Information 1, 2 and 3]. "},{"text":"Table 1 Detailed list of the SSR markers used in the study. Marker Fluorophore Motif Reference Accession Annealing Minimum Maximum MarkerFluorophore MotifReferenceAccessionAnnealingMinimumMaximum     GenBank temperature allele (this allele (this GenBanktemperatureallele (thisallele (this      (this study; 8 8 8 8 8C) study; bp) study; bp) (this study; 8 8 8 8 8C)study; bp)study; bp) mMaCIR01 6-FAM (GA)20 Lagoda et al. (1998) X87262 55 241 440 mMaCIR016-FAM(GA)20Lagoda et al. (1998)X8726255241440 mMaCIR03 6-FAM (GA)10 Lagoda et al. (1998) X87263 55 111 147 mMaCIR036-FAM(GA)10Lagoda et al. (1998)X8726355111147 mMaCIR07 NED (GA)13 Lagoda et al. (1998) X87258 53 136 195 mMaCIR07NED(GA)13Lagoda et al. (1998)X8725853136195 mMaCIR08 VIC (TC)6N24(TC)7 Lagoda et al. (1998) X87264 55 229 283 mMaCIR08VIC(TC)6N24(TC)7Lagoda et al. (1998)X8726455229283 mMaCIR13 PET (GA)16N76(GA)8 Lagoda et al. (1998) X90745 53 268 427 mMaCIR13PET(GA)16N76(GA)8Lagoda et al. (1998)X9074553268427 mMaCIR24 PET (TC)7 Lagoda et al. (1998) Z85972 48 240 291 mMaCIR24PET(TC)7Lagoda et al. (1998)Z8597248240291 mMaCIR27 a PET (GA)9 Lagoda et al. (1998) Z85962 58 232 277 mMaCIR27 a PET(GA)9Lagoda et al. (1998)Z8596258232277 mMaCIR39 VIC (CA)5GATA(GA)5 Lagoda et al. (1998) Z85970 52 329 390 mMaCIR39VIC(CA)5GATA(GA)5Lagoda et al. (1998)Z8597052329390 mMaCIR40 6-FAM (GA)13 Lagoda et al. (1998) Z85977 54 169 247 mMaCIR406-FAM(GA)13Lagoda et al. (1998)Z8597754169247 mMaCIR45 6-FAM (TA)4CA(CTCGA)4 Lagoda et al. (1998) Z85968 57 274 318 mMaCIR456-FAM(TA)4CA(CTCGA)4Lagoda et al. (1998)Z8596857274318 mMaCIR150 VIC (CA)10 Hippolyte et al. (2010) AM950440 54 253 376 mMaCIR150 VIC(CA)10Hippolyte et al. (2010)AM950440 54253376 mMaCIR152 6-FAM (CTT)18,(CT)17,(CA)6 Hippolyte et al. (2010) AM950442 54 147 195 mMaCIR152 6-FAM(CTT)18,(CT)17,(CA)6Hippolyte et al. (2010)AM950442 54147195 mMaCIR164 VIC (AC)14 Hippolyte et al. (2010) AM950454 55 256 458 mMaCIR164 VIC(AC)14Hippolyte et al. (2010)AM950454 55256458 mMaCIR195 a VIC (GA)11,(GA)6 Hippolyte et al. (2010) AM950461 54 262 306 mMaCIR195 a VIC(GA)11,(GA)6Hippolyte et al. (2010)AM950461 54262306 mMaCIR196 NED (TA)4, (TC)17, (TC)3 Hippolyte et al. (2010) AM950462 55 163 201 mMaCIR196 NED(TA)4, (TC)17, (TC)3Hippolyte et al. (2010)AM950462 55163201 mMaCIR214 NED (AC)7 Hippolyte et al. (2010) AM950480 53 115 238 mMaCIR214 NED(AC)7Hippolyte et al. (2010)AM950480 53115238 mMaCIR231 NED (TC)10 Hippolyte et al. (2010) AM950497 55 236 286 mMaCIR231 NED(TC)10Hippolyte et al. (2010)AM950497 55236286 mMaCIR260 PET (TG)8 Hippolyte et al. (2010) AM950515 55 204 264 mMaCIR260 PET(TG)8Hippolyte et al. (2010)AM950515 55204264 mMaCIR264 6-FAM (CT)17 Hippolyte et al. (2010) AM950519 53 234 383 mMaCIR264 6-FAM(CT)17Hippolyte et al. (2010)AM950519 53234383 mMaCIR307 NED (CA)6 Hippolyte et al. (2010) AM950533 54 143 173 mMaCIR307 NED(CA)6Hippolyte et al. (2010)AM950533 54143173 Ma-1-32 a NED (GA)17AA(GA)8AA(GA)2 Crouch et al. (1998) n/a 58 208 251 Ma-1-32 aNED(GA)17AA(GA)8AA(GA)2 Crouch et al. (1998)n/a58208251 Ma-3-90 PET (CT)11 Crouch et al. (1998) n/a 53 147 191 Ma-3-90PET(CT)11Crouch et al. (1998)n/a53147191  "},{"text":"Table 2 Allele number, frequency of the major allele, unique genotypes observed, heterozygosity and informativeness (PIC) of the 19 microsatellite loci applied on the dataset of 70 diploid Musa accessions. Marker Major allele frequency Number of unique Allele number Observed heterozygosity PIC a MarkerMajor allele frequencyNumber of uniqueAllele numberObserved heterozygosityPIC a   genotypes observed    genotypes observed mMaCIR01 0.125 39 26 0.531 0.936 mMaCIR010.12539260.5310.936 mMaCIR03 0.357 13 7 0.400 0.694 mMaCIR030.3571370.4000.694 mMaCIR07 0.181 33 21 0.551 0.883 mMaCIR070.18133210.5510.883 mMaCIR08 0.231 22 12 0.646 0.830 mMaCIR080.23122120.6460.830 mMaCIR13 0.229 28 19 0.543 0.870 mMaCIR130.22928190.5430.870 mMaCIR24 0.328 19 15 0.344 0.767 mMaCIR240.32819150.3440.767 mMaCIR39 0.200 39 20 0.714 0.893 mMaCIR390.20039200.7140.893 mMaCIR40 0.233 29 23 0.534 0.887 mMaCIR400.23329230.5340.887 mMaCIR45 0.207 16 8 0.357 0.801 mMaCIR450.2071680.3570.801 mMaCIR150 0.328 20 15 0.522 0.797 mMaCIR1500.32820150.5220.797 mMaCIR152 0.232 19 11 0.250 0.849 mMaCIR1520.23219110.2500.849 mMaCIR164 0.161 28 22 0.322 0.916 mMaCIR1640.16128220.3220.916 mMaCIR196 0.250 23 13 0.453 0.855 mMaCIR1960.25023130.4530.855 mMaCIR214 0.383 12 7 0.313 0.670 mMaCIR2140.3831270.3130.670 mMaCIR231 0.214 27 14 0.540 0.880 mMaCIR2310.21427140.5400.880 mMaCIR260 0.329 20 14 0.357 0.765 mMaCIR2600.32920140.3570.765 mMaCIR264 0.239 35 24 0.522 0.900 mMaCIR2640.23935240.5220.900 mMaCIR307 0.500 10 6 0.179 0.625 mMaCIR3070.5001060.1790.625 Ma-3-90 0.167 31 15 0.474 0.893 Ma-3-900.16731150.4740.893 Mean 0.258 24.4 15.4 0.450 0.827 Mean0.25824.415.40.4500.827  "},{"text":"Table 3 Major allele frequency, allele number and informativeness (PIC) of the 19 microsatellite loci applied on the dataset of 38 triploid Musa accessions. Marker Major allele Allele number PIC MarkerMajor alleleAllele numberPIC  frequency   frequency mMaCIR01 0.105 24 0.942 mMaCIR010.105240.942 mMaCIR03 0.237 12 0.839 mMaCIR030.237120.839 mMaCIR07 0.132 17 0.912 mMaCIR070.132170.912 mMaCIR08 0.237 14 0.867 mMaCIR080.237140.867 mMaCIR13 0.342 12 0.804 mMaCIR130.342120.804 mMaCIR24 0.289 12 0.817 mMaCIR240.289120.817 mMaCIR39 0.316 18 0.859 mMaCIR390.316180.859 mMaCIR40 0.289 9 0.817 mMaCIR400.28990.817 mMaCIR45 0.289 12 0.814 mMaCIR450.289120.814 mMaCIR150 0.263 8 0.808 mMaCIR1500.26380.808 mMaCIR152 0.263 12 0.850 mMaCIR1520.263120.850 mMaCIR164 0.131 18 0.913 mMaCIR1640.131180.913 mMaCIR196 0.237 15 0.881 mMaCIR1960.237150.881 mMaCIR214 0.263 8 0.788 mMaCIR2140.26380.788 mMaCIR231 0.132 16 0.905 mMaCIR2310.132160.905 mMaCIR260 0.474 13 0.733 mMaCIR2600.474130.733 mMaCIR264 0.158 18 0.913 mMaCIR2640.158180.913 mMaCIR307 0.342 8 0.760 mMaCIR3070.34280.760 Ma-3-90 0.105 21 0.934 Ma-3-900.105210.934 Mean 0.242 14.1 0.850 Mean0.24214.10.850  "},{"text":" This work has been supported by Bioversity International (LOA CfL 2009/48 and LoA CfL 2010/58), Internal Grant Agency of Palacky ´University, Olomouc, Czech Republic (grant award no. Prf-2010-001) and by the Ministry of  "}],"sieverID":"18305658-58d2-4e6f-ac54-39639580ae33","abstract":"Bananas and plantains (Musa spp.) are one of the major fruit crops worldwide with acknowledged importance as a staple food for millions of people. The rich genetic diversity of this crop is, however, endangered by diseases, adverse environmental conditions and changed farming practices, and the need for its characterization and preservation is urgent. With the aim of providing a simple and robust approach for molecular characterization of Musa species, we developed an optimized genotyping platform using 19 published simple sequence repeat markers."}

data/part_1/07d0730ab9c7f638ed8dcf9519376a8b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07d0730ab9c7f638ed8dcf9519376a8b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5ee39bd2-5f07-4f6d-97f9-b69254324ba1/retrieve"},"pageCount":13,"title":"3. Commenting Toolfor highlighting a section to be changed to bold or italic or for general comments","keywords":[],"chapters":[{"head":"Insert Toolfor inserting missing text","index":1,"paragraphs":[{"index":1,"size":6,"text":"at specific points in the text."},{"index":2,"size":14,"text":"Use these 2 tools to highlight the text where a comment is then made."}]},{"head":"How to use it:","index":2,"paragraphs":[{"index":1,"size":4,"text":" Click on ."},{"index":2,"size":14,"text":" Click at the point in the proof where the comment should be inserted."},{"index":3,"size":9,"text":" Type the comment into the box that appears."},{"index":4,"size":18,"text":"Marks an insertion point in the text and opens up a text box where comments can be entered."},{"index":5,"size":16,"text":"Click and drag over the text you need to highlight for the comment you will add."},{"index":6,"size":9,"text":" The text will be struck out in red."}]},{"head":"","index":3,"paragraphs":[{"index":1,"size":3,"text":"Click on ."},{"index":2,"size":9,"text":" Click close to the text you just highlighted."}]},{"head":"USING e-ANNOTATION TOOLS FOR ELECTRONIC PROOF CORRECTION","index":4,"paragraphs":[{"index":1,"size":20,"text":"For further information on how to annotate proofs, click on the Help menu to reveal a list of further options:"}]},{"head":"Attach File Toolfor inserting large amounts of text or replacement figures.","index":5,"paragraphs":[{"index":1,"size":15,"text":"Inserts an icon linking to the attached file in the appropriate place in the text."}]},{"head":"How to use it:","index":6,"paragraphs":[{"index":1,"size":4,"text":" Click on ."},{"index":2,"size":15,"text":" Click on the proof to where you'd like the attached file to be linked."},{"index":3,"size":12,"text":" Select the file to be attached from your computer or network."},{"index":4,"size":16,"text":" Select the colour and type of icon that will appear in the proof. Click OK."},{"index":5,"size":7,"text":"The attachment appears in the right-hand panel."},{"index":6,"size":12,"text":"6. Add stamp Toolfor approving a proof if no corrections are required."},{"index":7,"size":11,"text":"Inserts a selected stamp onto an appropriate place in the proof."}]},{"head":"How to use it:","index":7,"paragraphs":[{"index":1,"size":4,"text":" Click on ."},{"index":2,"size":29,"text":" Select the stamp you want to use. (The Approved stamp is usually available directly in the menu that appears. Others are shown under Dynamic, Sign Here, Standard Business)."},{"index":3,"size":36,"text":" Fill in any details and then click on the proof where you'd like the stamp to appear. (Where a proof is to be approved as it is, this would normally be on the first page)."},{"index":4,"size":17,"text":"7. Drawing Markups Toolsfor drawing shapes, lines, and freeform annotations on proofs and commenting on these marks."},{"index":5,"size":20,"text":"Allows shapes, lines, and freeform annotations to be drawn on proofs and for comments to be made on these marks."}]},{"head":"How to use it:","index":8,"paragraphs":[{"index":1,"size":12,"text":" Click on one of the shapes in the Drawing Markups section."},{"index":2,"size":17,"text":" Click on the proof at the relevant point and draw the selected shape with the cursor."},{"index":3,"size":17,"text":" To add a comment to the drawn shape, right-click on shape and select Open Pop-up Note."},{"index":4,"size":10,"text":" Type any text in the red box that appears."}]},{"head":"Drawing tools available on comment ribbon","index":9,"paragraphs":[{"index":1,"size":4,"text":"Funding Info Query Form"},{"index":2,"size":153,"text":"Please confirm that the funding sponsor list below was correctly extracted from your article: that it includes all funders and that the text has been matched to the correct FundRef Registry organization names. If a name was not found in the FundRef registry, it may not be the canonical name form, it may be a program name rather than an organization name, or it may be an organization not yet included in FundRef Registry. If you know of another name form or a parent organization name for a \"not found\" item on this list below, please share that information.   (F€ orch, Kristjanson, Thornton, & Kiplimo, 2011). The soils in both districts are also degraded and fertility has continued to decline (F€ orch et al., 2011) and as such farmers in the districts have adjusted their farming systems to adapt their crop production to suit the conditions (Kyazze & Kristjanson, 2011;Mubiru & Kristjanson, 2012)."},{"index":3,"size":72,"text":"Based on these backgrounds, a study was initiated to assess resident farmers' preferences on a given set of varieties with traits that are able to address production constraints such as drought, diseases, low soil fertility and nutrition. Our specific objectives were to identify farmers preferred varieties and to find out whether the selections of varieties can be affected by seasons and fertilizer management. where the experiments were in three villages (Table 1)."}]},{"head":"| MATERIALS AND METHODS","index":10,"paragraphs":[{"index":1,"size":170,"text":"The trials were set up in a split plot design with two fertilizer application treatments (DAP and no DAP) as the main plots and 15 bean varieties as the subplots with two replications. The varieties included four Katumani bean varieties selected for drought tolerance, seven disease-resistant varieties, three farmer-preferred varieties and one variety with a high iron content (Table 2). DAP fertilizer of 150 kg was broadcasted in two of the four main plots measuring 40.5 9 7 m each. The replications for the management levels were laid side-by-side for ease of fertilizer application and Farmers participated in selecting their preferred varieties at pod filling stage from the two outer blocks with DAP and no-DAP  The significance of the main effects of variety and management, subcounty and seasons, and the interaction mean squares were tested at an alpha level of 0.05, with testing denominators chosen based on the contributions of the interaction effect to the variability (Table 2). The means were separated using Fishers' protected least significant difference (LSD) method."}]},{"head":"| RESULTS","index":11,"paragraphs":[{"index":1,"size":50,"text":"The selection of varieties by farmers was significantly (p < .001) different in the different seasons (Table 3). Similarly, highly significant (p < .001) interaction of subcounty-by-season-by-variety and subcounty-by-gender-by-variety were also found (Table 3). However, no-significant interaction in preference index between subcountyby-management-by-variety interactions was registered (p > .05, Table 3)."}]},{"head":"| Variety-by-season","index":12,"paragraphs":[{"index":1,"size":39,"text":"In the choices made by farmers, varieties Masindi Yellow Long, Farmers' seed and NABE 15 were the most preferred whereas varieties NABE 2, KAT B9, RWR 719 and ROAB1 were the least preferred varieties over the seasons (  5)."}]},{"head":"| Farmers' selection of bean varieties by subcounties and gender groups","index":13,"paragraphs":[{"index":1,"size":70,"text":"Masindi Yellow Long and Farmers' seed registered the highest preference index values in the selection by male and female farmers in all subcounties except in Kasaali-Rakai subcounty where Farmers' seed recorded the least preference index (Table 6). High preference index was registered for KAT B1 and NABE 15 in Lwanda-Rakai subcounty, varieties KAT B1 in Kiziranfumbi-Hoima, and KATX 69 and CAL 143 in Kyabigambire-Hoima by both gender group (Table 6)."}]},{"head":"| The criteria used by farmers for acceptance and rejection of the varieties","index":14,"paragraphs":[{"index":1,"size":63,"text":"The choice of the varieties by the farmers was influenced by a range of factors. These included farmers' perceived varietal responses to drought, excessive rainfall and poor soils, maturity, yield, reaction to diseases and insect pests, taste, cooking time and cooking quality, and seed quality aspects (Tables S1a,b and S2a,b). The responses of farmers showed that varieties that were chosen as most preferred"},{"index":2,"size":54,"text":"were not superior for all farmers' desired traits and also the varieties that were rejected carried some traits that farmers desired (Table S1a,b and S2a,b). The male farmers in Kalagala subcounty reported that some of their desired varieties were highly susceptible to weevil attack and are thus difficult to store for long (Table S2a,b)."},{"index":3,"size":35,"text":"The selection criteria were also influenced by the availability or market demand for the varieties especially among men, whereas for the females, the selection criteria were associated with the cooking traits (Tables S1a,b and S2a,b)."}]},{"head":"| DISCUSSION","index":15,"paragraphs":[{"index":1,"size":348,"text":"The farmers' preference index showed clear differences among the fifteen common bean varieties that aided in the selection of the most desired varieties. According to Ntare and Ndjeunga ( 2009), voting for the best and worst varieties by farmers can be associated with a high likelihood of varietal adoption and/or non-adoption. The direct farmers' participation in the actual selection of the varieties reveals more accurately the desired varietal preferences than either recording farmers rating or ranking for traits (Asfaw et al., 2011). This allowed for comparison of the performance for complex traits among the locally grown and modern varieties by breeders and farmers (Joshi & Witcombe, 1996). In our study, farmers were able to compare varieties for the supply for their desired traits attributes such as tolerance to    Varieties NABE 2, RWR 719 and ROBA 1 were least preferred by farmers in the different seasons and by both gender groups in the different subcounties because of their small seed sizes, late maturity and semi-climbing tendency. Farmers in the focus group discussion reported that these particular varieties could not combine well in their intercropping system and that the climbing tendency could affect management and harvesting of the companion crop. In addition, the seed size and colour had low market demand. One variety, NABE 2 having black seed coat colour was rejected by two third of the farmers. The low preference was associated with the anticipated poor culinary attributes such as \"colour not attractive to the eye,\" \"the taste not good and the soup looks bad,\" \"sticky in the mouth,\" \"colour not interesting,\" and thus, these contributes to it being lowly demanded in the market. In an earlier study by Asfaw et al. (2011), farmers also showed less preference for black seeded bean genotypes. However, these varieties are mostly high yielding and resistant to key diseases prevalent in bean growing areas (Asfaw et al., 2011;Awio et al., 2017). The rejection of these varieties could therefore be associated with lack of \"the must-have farmer traits,\" and the farmers are often unwilling to sacrifice these traits for other traits in a variety."},{"index":2,"size":100,"text":"Finally, the selection of RWR 719 among the most preferred by the male farmers in Kyabigambire-Hoima, and the preference of ROBA 1 in 2013B in Kasaali could be associated with the high yield attributes, less damage by storage pest, less seed required for planting and short cooking time. The varieties also showed resistance to the common diseases in the area, high pod load and highest grain yield in the villages. Generally, the low preference for varieties (NABE 2, RWR 719 and ROBA 1) by farmers was associated with lack of desired seed quality traits such as seed size and colour."}]},{"head":"ACKNOWLEDG EMENTS","index":16,"paragraphs":[{"index":1,"size":51,"text":"The study was funded by Climate Change, Agriculture and Food Security (CCAFS) and was implemented by CIAT, NARO-bean breeding programme and Makerere University. We thank the farmer groups of Hoima and Rakai district who participated in the management of the experiments and provided their opinions during the evaluation of the varieties.   "}]}],"figures":[{"text":" verted to a preference index, and analysis of variance was conducted to examine differences in farmers' preference indices among subcounties and combined across subcounties, seasons, management and gender. Management had no-significant influence on the way farmers selected varieties in the subcounties. Choice of varieties varied significantly (p ≤ .001) between seasons and gender in the different subcounties. Variety Masindi Yellow Long and Farmers' seed (Kaduli), and the introduced KATB1 were accepted by farmers due to their medium seed size, desired seed colour and potential of varietal adaptability to their farm conditions. Varieties NABE2, ROBA1 and RWR719 were deselected due to possession of traits less desired in the market. These results demonstrate the need for breeding programmes to involve diverse stakeholders in capturing the diverse traits preferences in varietal development process.K E Y W O R D S farmer evaluation, food security, grain legumes, participatory research 1 | INTRODUCTION Common bean (Phaseolus vulgaris) is the most important legume grown by subsistence farmers in a range of farming systems in Africa either as a sole crop and or as an intercrop in banana, cassava and maize gardens. The grain yields under the varying systems are declining due to the farmers' continued use of landrace and old released varieties, declining soil fertility, drought, pest and diseases. Based on a survey conducted from 2003 to 2005, the share of improved varieties being grown by farmers was on the rise although this was still regarded as low with the estimated adoption rates of 31% in Uganda, 19% in Rwanda, 9.5% in Zambia and 45.8% in Tanzania, respectively (Muthoni & Andrade, 2015). The old varieties released earlier than 1996 were found to occupy over half of the share of improved varieties grown (Muthoni & Andrade, 2015) probably as a result of a combination of limited varietal promotion by research and extension services, and the lack of specific adaptation of the varieties to farmers' fields due to poor choice of environmentsfor varietal evaluations before variety release. To increase the number of new varieties adopted and the scale of their production, there will be a need for farmers to participate in the selection of varieties that are adapted to their farm conditions and with consumption and market preferences.Participatory variety selection (PVS) has been identified as a vital tool for enhancing variety adoption rates in farming communities(Assefa et al., 2014)    6 . The 7 approach helps reduce the amount of time required to move varieties to the farmers' field and determine varieties that farmers want to grow, learn traits that farmers value and differences in varietal selection criteria(Gridley, Jones, & Wopereis-pura, 2002). Studies show that varieties identified this way are quickly adopted and widely disseminated by farmers through the informal networks (Aw-Hassan, Mazid, & Salahieh, 2008) such as friends, neighbours and social groups within communities(Katungi, Edmeades, & Smale, 2008 "},{"text":"Farmer managed experimental field trials were set up in nine villages: five in Hoima and four in Rakai districts in Uganda where beans are commonly grown and form a major source of people's livelihoods (UBOS 2010). The trials were conducted in the two seasons of 2013 (March-June and August-December). Rakai district that is located in the Kagera Basin (south-western Uganda) receives annual rainfall in the range of 850-2,125 mm, which falls bimodally, peaking from March to May and October to November (Kimbugwe, 2013). However, declines in the amounts of rainfall and the number of rainy days in these months were reported byMubiru et al. (2015). The mean annual temperature was 25°C, with a range of 15-27°C (Kimbugwe, 2013), and an increasing trend of about 0.5°C per year(Mubiru et al., 2015). On the other hand, Hoima district that is located in the Albertine Rift valley, central western Uganda, receives a mean annual rainfall of 1,270 mm with a range of 800-1,400 mm, during March to May and August to November. The district experiences increasing amounts of rains in January, March and August with declining trends in certain months(Mubiru et al., 2015). In these two districts, the studies were conducted in two villages per subcounty except in Kyabigambire subcounty in Hoima district "},{"text":" farmer participation in the choice of variety. The fifteen varieties were sown in the subplots measuring 3 9 2 m within each main plot. Varieties were sown between 4 and 9 April 2013 in season 2013A and, from 12 to 15 August 2013 and 9 to 12 September 2013 in the season 2013B in Hoima and Rakai districts, at a spacing of 50 cm between rows and 10 cm between plants in a four-row plot. The experiments were hand weeded twice in the growing cycle, and the first and second weeding was carried out 3 weeks after planting and then before flowering, respectively, in 2013A and 2013B. The harvesting of the trials was performed from 25 to 28 June in 2013A and from 9 to 21 December in 2013B. "},{"text":" ease of supervision by researchers during the voting process. A total of 164 and 174 farmers participated in 2013A and 2013B, respectively. Of these, 45 farmers were from Kasaali, 14 farmers were from Lwanda in Rakai district, and 46 farmers were from Kyabigambire and 59 farmers were from Kiziranfumbi subcounty in Hoima district in 2013A. The same farmers participated in selecting the varieties in 2013B, though with an increase in the number of participants more so in Lwanda subcounty. For farmers' selection of their preferred and/or best-performing bean varieties, each of the farmers was given two sets of three cards, each set with distinctive colours to make a total of six cards. The two distinct colours represent either acceptance or rejection of a particular variety, respectively. The cards of white and yellow colour were for voting for the best varieties, whereas blue and pink coloured cards were for choosing the least desired varieties by men and women, respectively. The farmers were guided through the voting process under the non-fertilized block, first to choose their three best varieties and thereafter the three least preferred varieties. On completion of voting under the non-fertilizer block, farmers were also led through the fertilizer management block to choose also their best and worst varieties. The farmers were unaware of the status of the treatments in each block. Focus group discussions were conducted, separately for men and women, at the end of the voting sessions to discuss the selection criteria the farmers used in the variety selection (voting) process and recorded.2.1 | Data analysisThe sum of the votes for each of varieties selected by the farmers was evaluated separately for positive and negative votes under the two management levels in the nine villages. The preference index (PI) for each variety was calculated using the formula proposed byNtare and Ndjeunga (2009). The analysis of variance was performed on the preference index using R-software (R Core Team, 2013) to determine the relative magnitude of the sources of variation towards the selection of the varieties by farmers. Each village in a subcounty was considered as a replicate for each of the management levels resulting in two replications in Kasaali, Kiziranfumbi and Lwanda and three replications in Kyabigambire subcounties. In the analysis, replication nested in a subcounty and season, management, subcounty, variety, gender and the associated interactions were considered as random factors and variety and management level as fixed factors. "},{"text":" were in search of varieties that could adapt to their soil, climatic and socio-economic environments.The choice of the varieties by farmers was observed to be different between men and women in the different subcounties and between seasons in the different subcounties. Similar findings have been reported byAsfaw et al. (2011)  when selecting among thirtyeight advanced drought-tolerant common bean genotypes. In their study, farmers in the different sites selected different sets of genotypes for their own farms. In our study, the difference in selection by gender might be due to differences in the combination of traits considered as most important by male and female farmers in different subcounties. The female farmers more so in Kasaali-Hoima subcounty were less driven by market demand as compared to the male farmers. The farmers showed a preference for the newly released bean varieties and the introduced Katumani varieties. Their preference could be associated with the desire for salient attributes the varieties possess. Katumani bean varieties were bred for drought tolerance, an attribute that was consistently mentioned by farmers during the focus group discussion in all farmer groups. Considering the different fertilizer management levels, the rankings of varieties were found to be similar in the different subcounties indicating that farmers' preference traits were not affected by management.The farmers were able to equally appraise the varieties for responses to improved management. The seed quality traits and the growth habits were probably the most important traits combinations used by farmers, and these were not influenced by improvement in man-agement. The study by De Ron et al. (2004) 10 showed that qualitative traits are often highly heritable and therefore expressed in all environments. Varieties Masindi Yellow Long, KAT B1 and Farmers' seed (Kaduli) were consistently selected by farmers in the different management and in the two seasons, and by both gender groups in the different subcounties indicating farmers' desire to continue growing those varieties. The combination of traits' that farmers T A B L E 4 Mean preference index and the associated rankings (R) of the 15 bean varieties evaluated by farmers in the 2013A and 2013B seasons across four subcounties of Hoima and Rakai districts "},{"text":" these varieties was not affected by the differences in management and seasons. Farmers perceived these varieties as adapted to their farm conditions and have high market demand.The farmers acknowledged that the landrace (farmer seed, Kaduli) and Masindi Yellow Long offer less risk of crop failure even though they were average in grain yield(Awio et al., 2017). In the study, an aspect of seed colour, seed size and growth habit also contributed to the general acceptance of the varieties by the farmers. A case of interest was variety KAT B1, a drought-tolerant bean variety released in Kenya, having yellow seed coat colour which could have gained general acceptance from farmers due to its similarity to Masindi Yellow Long in terms of seed colour, size and also the possibility of it gaining high market demand. The preference for large seed beans is in line with a previous study conducted in eastern and south-western Uganda where farmers preferred largely seeded bean genotypes relative to the smallseeded ones(Mukankusi, 2008). "},{"text":" T A B L E 6 Mean preference index and the associated rankings of the 15 bean varieties evaluated by farmers in the four subcounties of Hoima and Rakai district aggregated by gender as averages across 2013A and 2013B "},{"text":"1 Villages and subcounties in Rakai and Hoima districts, Uganda where experimental field trials were conducted     Average Average     distance distance     between between District Subcounty Villages Altitude (masl) sites (km) District SubcountyVillagesAltitude (masl)sites (km) Rakai Lwanda Kyengeza a , 1,177-1,243 8.5 RakaiLwandaKyengeza a ,1,177-1,2438.5   Gosola a   Gosola a  Kasali Kalagala a , 1,064-1,084 9.4 KasaliKalagala a ,1,064-1,0849.4   Ninzi a   Ninzi a Hoima Kiziranfumi Mpalangasi, 1,202-1,241 7.0 HoimaKiziranfumiMpalangasi,1,202-1,2417.0   Kyakamese,   Kyakamese,   Ngobi   Ngobi  Kyabigambire Butimba, 1,202-1,241 7.0 Kyabigambire Butimba,1,202-1,2417.0   Butyamba   Butyamba  "},{"text":"Table 4 Common bean genotypes evaluated in Hoima and Rakai district in 2013A and 2013B of 2013  BRUNO ET AL.    BRUNO ET AL. 1     1 2     2 3  Origin of Year of  3Origin ofYear of 4 Genotype seed release Attributes 4GenotypeseedreleaseAttributes 5 CAL 96 Uganda 1995 Popular variety, disease 5CAL 96Uganda1995Popular variety, disease 6    susceptible check 6susceptible check 7 NABE 2 Uganda 1995 Drought tolerance, 7NABE 2Uganda1995Drought tolerance, 8    resistant to BCMVD 8resistant to BCMVD 9 NABE 14 Uganda 2006 Resistance to root rot 9NABE 14Uganda2006Resistance to root rot 10 NABE 15 Uganda 2010 Resistance to Bean 10NABE 15Uganda2010Resistance to Bean 11    anthracnose 11anthracnose 12 13 NABE 17 Uganda 2010 Resistance to anthracnose, BCMVD, ALS 12 13NABE 17Uganda2010Resistance to anthracnose, BCMVD, ALS 14 NABE 21 Uganda 2012 Resistance to 14NABE 21Uganda2012Resistance to 15    anthracnose, BCMVD, 15anthracnose, BCMVD, 16    ALS 16ALS 17 Masindi Uganda Released Farmer and consumer 17MasindiUgandaReleasedFarmer and consumer 18 Yellow Long   preferred 18Yellow Longpreferred 19 Farmers' seed Uganda Landrace Farmer and consumer 19Farmers' seed UgandaLandrace Farmer and consumer 20    preferred 20preferred 21 KAT B1 Kenya 1987 Drought tolerance 21KAT B1Kenya1987Drought tolerance 22    (Escape mechanism) 22(Escape mechanism) 23 24 KAT B9 Kenya 1998 Heat and drought tolerance 23 24KAT B9Kenya1998Heat and drought tolerance 25 KATX 56 Kenya 1995 Drought tolerance 25KATX 56Kenya1995Drought tolerance 26 KATX 69 Kenya  Drought tolerance 26KATX 69KenyaDrought tolerance 27 28 CAL143 Malawi 1996 Resistance to angular leaf spot (ALS) 27 28CAL143Malawi1996Resistance to angular leaf spot (ALS) 29 ROBA 1 TZ, DRC and Ethiopia  High iron, high yield & resistant to multiple 29ROBA 1TZ, DRC and EthiopiaHigh iron, high yield & resistant to multiple 30    stresses 30stresses 31 RWR 719 Rwanda 2003 and High yield, resistant to 31RWR 719Rwanda2003 andHigh yield, resistant to 32  and Ethiopia 90s root rot and other 32and Ethiopia90sroot rot and other 33    diseases 33diseases 34 Source: PABRA database (2014), BCMVD, bean common mosaic virus 34Source: PABRA database (2014), BCMVD, bean common mosaic virus 35 disease.    35disease. 36     36 37     37 38     38 39     39 40     40 41     41 42     42 43     43 44     44 45     45 46     46 47     47 48     48 49     49 50     50 51     51 52     52 53     53  "},{"text":" Combined analysis of variance for preference index of selected bean varieties by farmers of Hoima and Rakai districts for two seasons of 2013. The minimum value of the preference index was À0.148, and the maximum was 0.159 8     8    Mean Testing MeanTesting N/O Sources of variation df squares term N/O Sources of variationdfsquaresterm 1 Subcounty 3 3 5 1Subcounty335 2 Season 1 8 5 2Season185 3 Management 1 46 6 3Management1466 4 Gender 1 2 8 4Gender128 5 Subcounty 9 season 3 65 11 5Subcounty 9 season36511 6 Subcounty 9 Management 3 20 13 6Subcounty 9 Management32013 7 Season 9 Management 1 64 11 7Season 9 Management16411 8 Subcounty 9 gender 3 11 12 8Subcounty 9 gender31112 9 Season 9 gender 1 52 12 9Season 9 gender15212 10 Management 9 gender 1 1 13 10Management 9 gender1113 11 Subcounty 9 season 9 3 2 5 1 5 11Subcounty 9 season 932 51 5  Management    Management 12 Subcounty 9 season 9 3 4 1 1 5 12Subcounty 9 season 934 11 5  gender    gender 13 Subcounty 9 Management 9 3 3 5 1 5 13Subcounty 9 Management 933 51 5  gender    gender 14 Season 9 Management 9 1 2 1 5 14Season 9 Management 9121 5  gender    gender 15 Subcounty 9 season 9 3 2 1 1 6 15Subcounty 9 season 932 11 6  Management 9 gender    Management 9 gender 16 Rep/(subcounty, season) 9 30 17 16Rep/(subcounty, season)93017 17 Rep/(subcounty, season) 9 9 3 2 2 9 17Rep/(subcounty, season) 993 22 9  Management    Management 18 Variety 14 11114 20 18Variety14 1111420 19 Subcounty 9 Variety 42 1462 20 19Subcounty 9 Variety42146220 20 Season 9 Variety 14 5927*** 23 20Season 9 Variety145927*** 23 21 Management 9 Variety 14 445 24 21Management 9 Variety1444524 22 Gender 9 Variety 14 724 26 22Gender 9 Variety1472426 23 Subcounty 9 season 9 Variety 42 1598*** 29 23Subcounty 9 season 9 Variety421598*** 29 24 Subcounty 9 Management 9 Variety 42 699 29 24Subcounty 9 Management 9 Variety4269929 25 Season 9 Management 9 Variety 14 581 29 25Season 9 Management 9 Variety1458129 26 Subcounty 9 gender 9 Variety 42 1466*** 29 26Subcounty 9 gender 9 Variety421466*** 29 27 Season 9 gender 9 Variety 14 374 29 27Season 9 gender 9 Variety1437429 28 Management 9 gender 9 Variety 14 382 29 28Management 9 gender 9 Variety1438229 29 Residual 674 658  29Residual674658  "},{"text":" Mean preference index and the associated rankings of the 15 bean varieties evaluated by farmers in the four subcounties of Hoima and Rakai districts for 2013A and 2013B   Season             Season  Variety 2013A R  2013B R         Variety2013AR2013BR  Farmers seed 0.008 5  0.021 1         Farmers seed0.00850.0211  CAL96 À0.005 9  0.021 2         CAL96À0.00590.0212  Masindi Yellow long 0.059 1  0.015 3         Masindi Yellow long0.05910.0153  NABE 17 À0.001 8  0.014 4         NABE 17À0.00180.0144  CAL 143 À0.009 10  0.012 5         CAL 143À0.009100.0125  NABE 15 0.008 6  0.006 6         NABE 150.00860.0066  ROBA 1 À0.037 14  0.006 7         ROBA 1À0.037140.0067  KAT X69 0.019 4  0.000 8         KAT X690.01940.0008  KAT B1 0.026 3  0.000 9         KAT B10.02630.0009  NABE 14 À0.017 11  À0.006 10         NABE 14À0.01711À0.00610  KATX 56 0.038 2  À0.010 11         KATX 560.0382À0.01011  RWR 719 À0.028 13  À0.016 12         RWR 719À0.02813À0.01612  NABE 21 0.003 7  À0.017 13         NABE 210.0037À0.01713  KAT B9 À0.019 12  À0.017 14         KAT B9À0.01912À0.01714  NABE 2 À0.042 15  À0.025 15         NABE 2À0.04215À0.02515  LSD 0.015   0.017          LSD0.0150.017  T A B L E 5 Variety Kasaali 2013A R 2013B R Lwanda 2013A R 2013B R Kiziranfumbi 2013A R 2013B R Kyabigambire 2013A R 2013B R T A B L E 5 VarietyKasaali 2013AR2013BRLwanda 2013AR2013BRKiziranfumbi 2013A R2013BRKyabigambire 2013A R2013BR  KAT B1 0.051 1 À0.011 12 0.0182 3 0.0206 4 0.022 5 0.023 5 0.014 4 À0.021 13 KAT B10.0511 À0.011 120.018230.020640.02250.02350.0144 À0.02113  Masindi Yellow Long 0.047 2 À0.004 9 0.0707 1 0.0012 8 0.052 1 0.044 1 0.066 1 0.0149 5 Masindi Yellow Long0.0472 À0.00490.070710.001280.05210.04410.06610.01495  NABE 17 0.022 3 0.009 4 À0.024 12 0.0256 3 À0.015 11 0.033 3 0.005 7 À0.003 10 NABE 170.02230.0094 À0.024120.02563 À0.015 110.03330.0057 À0.00310  KATX 56 0.018 4 0.008 5 0.0646 2 À0.008 10 0.027 4 À0.019 11 0.048 2 À0.018 11 KATX 560.01840.00850.06462 À0.008100.0274 À0.019 110.0482 À0.01811  KAT X69 0.013 5 0.000 8 0.000 9 0.0039 7 0.030 3 À0.006 8 0.027 3 0.0035 8 KAT X690.01350.00080.00090.003970.0303 À0.00680.02730.00358  Farmers seed 0.008 6 À0.009 11 0.0029 8 0.0363 1 0.031 2 0.039 2 À0.005 9 0.0205 4 Farmers seed0.0086 À0.009 110.002980.036310.03120.0392 À0.00590.02054  NABE 15 0.007 7 0.006 7 0.0062 5 0.0201 5 0.012 6 0.008 7 0.007 6 À0.002 9 NABE 150.00770.00670.006250.020150.01260.00870.0076 À0.0029  KAT B9 0.006 8 À0.007 10 0.0092 4 0.0093 6 À0.039 15 À0.012 9 À0.039 13 À0.043 15 KAT B90.0068 À0.007 100.009240.00936 À0.039 15 À0.0129 À0.039 13 À0.04315  CAL96 0.001 9 0.022 1 À0.006 10 0.0261 2 À0.018 12 0.028 4 0.000 8 0.0115 6 CAL960.00190.0221 À0.006100.02612 À0.018 120.02840.00080.01156  NABE 21 À0.008 10 0.016 2 0.006 6 À0.016 13 À0.002 7 À0.024 12 0.013 5 À0.037 14 NABE 21À0.008 100.01620.0066 À0.01613 À0.0027 À0.024 120.0135 À0.03714  NABE 14 À0.008 11 À0.023 15 0.0033 7 À0.015 12 À0.039 14 À0.027 13 À0.018 12 0.0257 3 NABE 14À0.008 11 À0.023 150.00337 À0.01512 À0.039 14 À0.027 13 À0.018 120.02573  CAL 143 À0.009 12 À0.02 14 À0.009 11 0.0008 9 À0.008 8 0.018 6 À0.010 10 0.0358 1 CAL 143À0.009 12 À0.0214 À0.009110.00089 À0.00880.0186 À0.010 100.03581  RWR 719 À0.038 13 À0.016 13 À0.058 15 À0.041 15 À0.011 9 À0.031 14 À0.017 11 0.0084 7 RWR 719À0.038 13 À0.016 13 À0.05815 À0.04115 À0.0119 À0.031 14 À0.017 110.00847  NABE 2 À0.05 14 0.006 6 À0.043 13 À0.036 14 À0.022 13 À0.055 15 À0.051 15 À0.02 12 NABE 2À0.05140.0066 À0.04313 À0.03614 À0.022 13 À0.055 15 À0.051 15 À0.0212  ROBA 1 À0.054 15 0.013 3 À0.043 14 À0.015 11 À0.011 10 À0.018 10 À0.040 14 0.0306 2 ROBA 1À0.054 150.0133 À0.04314 À0.01511 À0.011 10 À0.018 10 À0.040 140.03062  LSD 0.033  Ns    0.034  0.023  0.032  0.032  0.031 LSD0.033Ns0.0340.0230.0320.0320.031 9 R, Rankings               9R, Rankings  "},{"text":" À0.010 10 À0.035 15 À0.043 15 À0.034 14 À0.030 15 À0.047 15 À0.057 15 À0.010 14                 R R KAT B1 0.037 1 0.002 8 0.013 5 0.027 3 0.020 3 0.026 3 0.000 9 À0.009 13 KAT B10.03710.00280.01350.02730.02030.02630.0009 À0.009 13 KATX 56 0.031 2 À0.006 10 0.025 1 0.007 7 0.000 8 0.009 6 0.023 2 À0.001 9 KATX 560.0312 À0.006 100.02510.00770.00080.00960.0232 À0.0019 Masindi Yellow Long 0.030 3 0.012 5 0.016 3 0.033 1 0.031 2 0.067 1 0.049 1 0.028 1 Masindi Yellow Long0.03030.01250.01630.03310.03120.06710.04910.0281 NABE 17 0.026 4 0.005 7 0.013 6 0.005 8 À0.005 9 0.023 4 À0.005 11 0.007 6 NABE 170.02640.00570.01360.0058 À0.00590.0234 À0.005 110.0076 NABE 21 0.018 5 À0.011 12 À0.006 11 À0.011 12 0.002 7 À0.029 12 À0.021 13 À0.007 12 NABE 210.0185 À0.011 12 À0.006 11 À0.011 120.0027 À0.029 12 À0.021 13 À0.007 12 KAT X69 0.018 6 À0.005 9 0.004 9 0.001 9 0.016 4 0.008 7 0.019 5 0.008 4 KAT X690.0186 À0.00590.00490.00190.01640.00870.01950.0084 KAT B9 0.006 7 À0.007 11 0.010 8 0.009 6 À0.012 11 À0.040 13 À0.049 14 À0.033 15 KAT B90.0067 À0.007 110.01080.0096 À0.012 11 À0.040 13 À0.049 14 À0.033 15 CAL96 0.004 8 0.020 2 0.012 7 0.019 4 À0.006 10 0.016 5 0.012 6 0.000 8 CAL960.00480.02020.01270.0194 À0.006 100.01650.01260.0008 NABE 15 0.001 9 0.012 6 0.015 4 0.016 5 0.015 5 0.005 9 À0.003 10 0.007 5 NABE 150.00190.01260.01540.01650.01550.0059 À0.003 100.0075 NABE 2                 NABE 2 ROBA 1 À0.015 11 À0.027 14 À0.031 13 À0.017 13 À0.015 12 À0.015 11 0.000 8 À0.004 11 ROBA 1À0.015 11 À0.027 14 À0.031 13 À0.017 13 À0.015 12 À0.015 110.0008 À0.004 11 Farmers seed À0.016 12 0.016 4 0.022 2 0.028 2 0.037 1 0.033 2 0.020 3 À0.003 10 Farmers seedÀ0.016 120.01640.02220.02820.03710.03320.0203 À0.003 10 RWR 719 À0.027 13 À0.027 13 À0.041 14 À0.054 15 À0.028 14 À0.014 10 À0.019 12 0.014 2 RWR 719À0.027 13 À0.027 13 À0.041 14 À0.054 15 À0.028 14 À0.014 10 À0.019 120.0142 CAL 143 À0.044 14 0.017 3 0.001 10 À0.006 10 0.004 6 0.006 8 0.020 4 0.011 3 CAL 143À0.044 140.01730.001 10 À0.006 100.00460.00680.02040.0113 NABE 14 À0.061 15 0.033 1 À0.008 12 À0.011 11 À0.025 13 À0.042 14 0.012 7 0.000 7 NABE 14À0.061 150.0331 À0.008 12 À0.011 11 À0.025 13 À0.042 140.01270.0007 LSD 0.046  0.033  0.036  0.044  0.019  0.034  0.037  0.02  LSD0.0460.0330.0360.0440.0190.0340.0370.02  "}],"sieverID":"5c3f4d4f-e51b-4a49-9862-16350ec2f0c0","abstract":"Please confirm that given names (red) and surnames/family names (green) have been identified correctly."}

data/part_1/07d9f97c8e2a377ee4b0580476ec7724.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07d9f97c8e2a377ee4b0580476ec7724","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H038719.pdf"},"pageCount":7,"title":"Low Risk for Helminth Infection in Wastewater-Fed Rice Cultivation in Vietnam","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":77,"text":"Vietnam is one of the developing countries where household wastewater and excreta have been used for decades and even centuries by farmers in urban and peri-urban areas in agriculture as well as aquaculture systems. Products from wastewater-fed systems contribute significantly to food production and food security in Vietnam (Raschid-Sally et at. 2004). However despite its widespread use, such practices are often informal and only to a limited degree recognized by the authorities and the public at large."},{"index":2,"size":203,"text":"In Vietnam wastewater is used mostly untreated and this scenario is not likely to change in t,he near future without resources to provide adequate wastewater treatment facilities for the growing urban population. Irrigation with untreated wastewater can therefore pose risks for the health of irrigators, for communities in prolonged contact with the wastewater, to the consumers of produce irrigated with wastewater and through spread of pathogens in the environment. Epidemiological studies in different countries have established that the highest risk to human health of using wastewater in agriculture is posed by soil-transmitted intestinal helminth infections (Mara & Cairncross 1989; Blumenthal et at. 2000). However, little information is available about specific occupational risks for intestinal helminth infections associated with wastewater-irrigated rice culture. Infections with roundworm (Ascaris), whipworm (Trichuris), and hookworm are widespread in Vietnam (van der Hoek et ai. 2003). But in addition to the use of wastewater, there are other environmental and human behavioral risk factors for infection with soil-transmitted helminths. of which poor sanitation is probably the most important one. The relative importance of the different risk factors in different wastewater use systems is unknown. This makes it difficult for policy makers and urban planners to make informed decisions about wastewater irrigation."},{"index":3,"size":26,"text":"This study was done to assess the risk of helminth infection in association with wastewater-fed rice cultivation in an agricultural setting of Nam Dinh city, Vietnam."}]},{"head":"Methods","index":2,"paragraphs":[{"index":1,"size":66,"text":"In a cross sectional survey data were collected of 202 households in a commune where wastewater was used for irrigation and 201 households in a commune that used river water. Parasitological examination was conducted on single stool samples obtained from 1,088 individuals aged 215 years from the households. The irrigation water used in both communes was enumerated for helminth eggs and thermotolerant coliforms (bacterial fecal indicators."}]},{"head":"Results","index":3,"paragraphs":[{"index":1,"size":122,"text":"Data from the irrigation water sampling showed that the microbiological quality of the river water was rather consistent during the sampling period, while that of wastewater varied between the four samplings. Nevertheless, as expected, wastewater contained higher concentrations of helminth eggs and thermotolerant coliforms. The quality of wastewater (40-200 eggs/L and 10 4 thermotolerant coliforms/l00 ml) exceeded the WHO guidelines for wastewater application in agriculture and aquaculture, which stipulates less than 1. viable nematode egg per liter and less than 1,000 fecal coliforms per 100 ml (Mara & Cairncross 1989). The river water samples had a much lower level of thermotolerant coli forms, within the WHO permissible limit, and helminth eggs could not be found in 3 out of the 4 samples."},{"index":2,"size":155,"text":"A total of 1,139 persons from the 403 households of My Tan (570 persons) and My Trung (569 persons) communes were included in the surveys. Their age ranged from 15 to 94 years old, with a mean age of 40.4 years in the wastewater exposed commune and 42.3 in the unexposed commune. There was no significant difference in the female/male ratio between the two communes. Compliance with stool examination was very high (95.5%) and out of the 1,088 samples that were available for analysis, 53.4% were positive for one or more of the three helminth parasites. Prevalence was 42.2% for Ascaris spp., 19.9% for Trichuris spp.. and 10.5% for hookworm. There was no clear association between prevalence of helminth infection and age. However, it could be noted that for the age group of 60 years and above, the prevalence of infection with Ascaris spp. and Trichuris spp. decreased but the hookworm infection prevalence slightly increased."},{"index":3,"size":75,"text":"The univariate analyses were performed with the data from the subjects that had provided a stool specimen. Surprisingly, people who were exposed to wastewater (all living in My Tan commune) had significant lower prevalence of Ascaris spp. and Trichuris spp. than people in My Trung commune and the people in My Tan commune who were not exposed to wastewater. For hookworm infection there was no significant difference between those exposed and not exposed to wastewater."},{"index":4,"size":125,"text":"Not having a latrine was a strong risk factor for helminth infection (odds ratio [OR] for the three helminth parasites combined was 2.57, 95% CI 1.10-6.70). However, only 31 out of the 1,088 people had no latrine available. Therefore, in the further analyses we used the hygienic status of the latrine, with people not having a latrine regarded as a separate category, although its OR would not be used to interpret the results. People from households that did not apply any treatment on latrine waste after defecation (direct discharge) had an increased risk of infection with Ascaris spp. and Trichuris spp., such as those who used overhung fishpond latrines or disposed feces directly to open surface drains (OR for combined infection was 1.99,95% CI 1.37-2.81)."},{"index":5,"size":201,"text":"Having only a limited storage capacity for drinking water (less than 2 m 3 ) was a risk factor for helminth infection. Presumably this reflects the amount of water that people had available for personal and household hygiene. Those individuals who practised hand washing after defecation experienced a lower risk of infections with Ascaris spp. and Trichuris spp.. In particular, hand washing with soap seemed to further reduce the risk of helminth infection. However, only the association between Ascaris spp. infection and no handwashing was found statistically significant. People using nightsoil, including fresh excreta on their agricultural fields. had a higher risk for helminth infection than those not using nightsoil, but the difference did not reach statistical significance (data not shown). Of the people involved in agricultural work (1,018 people), only 4.4% reported using personal protective measures while doing fieldwork, such as shoes, plastic boots or gloves. These people had a much lower risk of Ascaris and Trichuris infection than those not using any means of personal protection. Significant differences in the use of overhung fishpond latrines, non-treatment of latrine waste and the lack of protective measures were also observed, with conditions being worse in My Trung than in My Tan."},{"index":6,"size":166,"text":"Socio-economic status (SES) was significantly associated with Ascaris spp. and Trichuris spp. infections but not with the combined infection of helminths. Households in My Trung were generally of lower SES than in My Tan (p<0.05). The risk for helminth infection was higher in people with lower levels of education (ranging from illiteracy to secondary school) compared to people of higher education (high school or university levels). No significant gender difference in risk of infection was found. Specific agricultural practices, such as rice and vegetable farming or aquaculture, could not be associated with risk for helminth infection, except for flower planting that gave an increased risk (OR 1.37, p=0.078, controlling for factor \"commune\"). However, this could not explain the difference in prevalence of helminth infections between the two communes because flower cultivation was more common among the households in My Tan commune than in My Trung commune. No significant differences between the two communes were found in the status of latrines, use of nightsoil or educational level."},{"index":7,"size":114,"text":"Most risk factors pointed in the same direction for the three helminth parasites. Factors that were significantly associated with any of the helminth species were also significant for single infection with Ascaris spp. or Trichuris spp.. Unlike for Ascaris spp., Trichuris spp., and for the three parasites combined, few risk factors for hookworm could be identified. This could be due to the different way of transmission where hookworm depends on the penetration of human skin (usually the feet) by larvae, which develop from eggs passed in human stools into the environment. However, the much lower prevalence of hookworm compared with Ascaris could in itself explain why most risk factors did not reach statistical significance."},{"index":8,"size":232,"text":"Because of a similar oral transmission pattern, the infections with Ascaris spp. and Trichuris spp. were combined as the outcome variable in the multivariate analysis (Table 1). Exposure to wastewater remained a significant protective factor, even when controlling for confounding by other variables. This indicates that other differences between the two communes than the ones considered in the study had impact on the prevalence of helminth infections. Poor standard of hygiene and sanitation, not using protective measures, and lack of access to large quantities of water, were independent risk factors in the multivariate analysis (Table 1). Because not every subject did participate in agricultural production, a separate logistic regression model was run, including only people doing farm work (N= 1,018), to assess the effect of not using protective measures. However similar results were obtained with only slight changes in the odds ratios (data not shown). Variables that were significant in this model also stayed significantly in the other. Adding interaction terms of covariates did not improve the fit of the multivariate model (data not shown).   **, from the reduced model; n/a: the variable was dropped out during the stepwise multivariate analysis so there was no OR obtained in the reduced model; a, people who did not do agricultural work were included in the group that used protective measures since it was assumed that they would probably do so when performing some fieldwork."},{"index":9,"size":37,"text":"The helminth egg counts were low for all helminths . Except for a few infections with Ascaris spp. that would be classified as \"moderate\", all other infections would be classified as \"light\" according to WHO criteria (2002)."},{"index":10,"size":82,"text":"There were clear differences in nutritional status between the two communes. The mean Z-score of weight-for-age for children in My Tan was significantly (p<O.O 1) higher than that of children in My Trung. The percentage of children underweight «-2SD from the median of the NCHS reference) was 20.7% in My Tan and 27.8% in My Trung (Chi squared test = 5.45, P = 0.02). Children living in the non-wastewater site had an increased risk of being underweight (OR=1.47, 95% CI 1.05 2.06)."}]},{"head":"Discussion","index":4,"paragraphs":[{"index":1,"size":360,"text":"Contrary to what was expected, people who were exposed to wastewater had a lower prevalence of helminth infection than those who were not exposed. The study could therefore not find evidence that rice cultivation with urban wastewater posed a risk for intestinal helminth infection in agricultural workers. Despite taking account of differences in socio-economic status and sanitary practices, the variables included in the study could not fully explain the difference in infection prevalence between the exposed and non-exposed. The most probable explanation for the lower prevalence of helminth infection in My Tan commune would still be the overall higher welfare level as compared with My Trung. This was reflected in the better child nutritional status in the exposed commune. Nutritional status is a well-known compound indicator representing effects of access to food, standards of living, womens' educational level, access to water supply and sanitation, and burden of infectious diseases. These aspects might have been insufficiently captured in the variables that we used. This also bears on possible flaws in the design of the study. The study was designed as a cross-sectional study with analysis at the individual level. However, one could criticize the approach as being a comparison between an exposed and an unexposed community. Such a \"one to one comparison\" is a major methodological problem in many studies on environmental sanitation, as pointed out by Blum & Feachem (1983). Our interest was not the difference between the two communities but the relative importance of different risk factors throughout the entire study population. We felt that the chosen design was justifiable because the communities were located very close to each other and were similar in many aspects. Another limitation of the study is that some of the variables pertained to individuals while other variables pertained to all members in a household. It is well known that helminth infections tend to aggregate in certain individuals within households, in certain households, and in certain communities. We did not account for this aggregation. Especially aggregation of heavy infections is extremely relevant for targeting control measures but we feel that this phenomenon of aggregation did not affect the validity of the individual-level risk •assessments."},{"index":2,"size":319,"text":"Our analyses showed that most of the people infected with Ascaris spp. and Trichuris spp. came from lower socioeconomic groups and households with inadequate sanitary conditions and poor hygiene practices. This is in line with findings from previous studies such as by AI-Shammari et al. Another possible explanation of the counterintuitive findings of the present study is that the concentration of helminth eggs in the irrigation water might have been too low to cause an increase in human helminth infection prevalence. Although worm counts in wastewater samples exceeded the WHO guideline level, the samples were collected just before the wastewater entered the pumping station, from where the wastewater was distributed to local irrigation canals and then to the paddy fields. After the pumping station, the helminth eggs in wastewater would have been diluted because of natural sedimentation processes along the wastewater flow, together with the die off of eggs because they do not have optimal conditions for their survival and development, which is a moist, warm and shady environment (Paniker 2002). This could have resulted in a low concentration of helminth eggs in the water in the fields, to which the farmers were actually exposed. The quality of the wastewater in My Tan commune was to some extent similar to or better than that studied elsewhere, such as in the Mezquital Valley (Mexico) with concentrations of 10 8 thermotolerant coliforms/l00 ml and 90-150 helminth eggs/L (Cifuentes 1998) or in Calcutta with 200-2130 helminth eggs/L (Ayres et al. 1992). Furthermore, it could be questioned whether farmers using wastewater in wet rice cultivation would be exposed to any particular risk for Ascaris spp. and Trichuris spp. infections, since such farmers must have an oral intake of the eggs present in the wastewater to acquire the infection. This is different from wastewater irrigated crops, including crops consumed raw, where an oral intake of eggs will mainly occur through consumption of contaminated produce."},{"index":3,"size":78,"text":"Our findings of lower prevalence of helminth infections in a wastewater dependent area are inconsistent with other studies of the effect of wastewater on enteric infections. In a study in Mexico, Blumenthal et al. (200 I) reported that the risk of infection with A. lumbricoides in those aged >5 years when directly exposed to untreated wastewater (6 x 10 7 thermotolerant coliforms/l00 ml and 90-135 helminth eggs/L) was 13.5 times higher than for those who were not exposed."},{"index":4,"size":75,"text":"However, the prevalence of Ascaris spp. infection in adults above 15 years of age in the exposed group (4.3%) was much lower than what was found in the present study in Vietnam. Living in a wastewater using area was also found to be associated with ascariasis, but not with trichuriasis, in children in Morocco (Habbari et al. 2000). That study also found low intensities of the helminth infections in wastewater as well as non-wastewater areas."}]},{"head":"Conclusion and Perspectives","index":5,"paragraphs":[{"index":1,"size":60,"text":"In conclusion, this study showed no evidence that rice cultivation with wastewater poses a risk for helminth infection. More detailed studies are needed on the reduction offecal indicators and helminth eggs in peri-urban wastewater-irrigated rice culture systems and on the relative importance of wastewater irrigation compared to other risk factors for human helminth infection such as poor sanitation and poverty."}]}],"figures":[{"text":",  "},{"text":"Table 1 : Assessment of risk factors for helminth infections (Ascaris spp. and Trichuris spp. combined) using multivariate logistic regression (N=I,088) Ascaris spp. and Trichuris s p. "},{"text":" (2001),Cifuentes (1998), andKightlinger et al. (1995). "}],"sieverID":"889ff189-b0af-4af8-a068-44726cf91a81","abstract":""}

data/part_1/07e5451f847cabb1a625793bac617aa3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07e5451f847cabb1a625793bac617aa3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ca4ff275-b26c-49a2-8ff7-b7b2e8f730c5/retrieve"},"pageCount":1,"title":"Study #2855 Contributing Projects: • P1671 -CIAT contribution to flagship project 5 • P1571 -CIAT Contribution to RICE Flagship project 1","keywords":[],"chapters":[],"figures":[],"sieverID":"df6fa61c-2008-4253-b7cd-5ae9cfaf402c","abstract":""}

data/part_1/080c6e6f1997f76ba993d4d3a4850fa4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"080c6e6f1997f76ba993d4d3a4850fa4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f7ecf08b-4fb4-4c35-a694-acc1624715c1/retrieve"},"pageCount":36,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":30,"text":"The Alliance of Bioversity International and the International Center for Tropical Agriculture (CIAT) delivers research-based solutions that address the global crises of malnutrition, climate change, biodiversity loss, and environmental degradation."},{"index":2,"size":69,"text":"The Alliance focuses on the nexus of agriculture, nutrition and environment. We work with local, national, and multinational partners across Africa, Asia, and Latin America and the Caribbean, and with the public and private sectors and civil society. With novel partnerships, the Alliance generates evidence and mainstreams innovations to transform food systems and landscapes so that they sustain the planet, drive prosperity, and nourish people in a climate crisis."},{"index":3,"size":31,"text":"The Alliance is part of CGIAR, the world's largest agricultural research and innovation partnership for a food-secure future dedicated to reducing poverty, enhancing food and nutrition security, and improving natural resources."}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":182,"text":"Food and nutritional security of resource poor farmers globally is increasingly under a serious threat of climate change. In Kenya, Tanzania and Uganda, agricultural production rates are low, exacerbated by frequent erratic rainfall and droughts due to climate change. The homogenization of agriculture to single crops or varieties in hope of higher yields, coupled with the associated loss of biodiversity, has further decreased the resilience of resource-poor farmers. The loss of genetic diversity in farmers' custody has greatly narrowed the gene pool from which to depend on. In order to help them adapt to climate change, a project called \"Promoting Open Source Seed Systems for Beans, Millet and Sorghum for Climate Change Adaptation\" funded by the Benefit-sharing Fund (BSF) established under the International Treaty on Plant Genetic Resources for Food and Agriculture (ITPGRFA) was implemented in Kenya, Uganda and Tanzania. This project increased the availability and diversity of climate-smart varieties of four important crops, namely beans, forage legumes, finger millet and sorghum through testing, breeding and production of high quality seeds and increasing access to a wider range of locally adapted varieties."},{"index":2,"size":149,"text":"In Kenya, a total of 193 sorghum and 68 finger millet accessions were locally sourced and others shared with the Kenyan genetic resource center from Uganda and Tanzania national gene banks through Standard Material Transfer Agreement (SMTA) to be used in the project. However, only 52 Sorghum and 48 finger millet were able to sail through multiplication stages, and were later distributed amongst 400 farmers in Lower and Upper Nyando for testing through crowdsourcing and participatory varietal evaluation during the cropping season of 2018 and 2019. The farmers were able to identify and select 10 best performing varieties of each crop based on their preferred attributes like pest and disease resistance, early maturity, high yields, droughts and flood tolerance and taste. This catalogue presents the best and top selected varieties of sorghum and Fingermillet in Nyando that can be disseminated in larger areas and also improved further through breeding."},{"index":3,"size":75,"text":"The catalogue provides a summary of soils and climatic conditions in Nyando, and agronomic attributes and nutritional content of the selected varieties of sorghum and finger millet. The agronomic attributes were collected during trials. For sorghum, the attributes included grain colour, plant height, lodging, tillering ability, days to maturity, yield potential and pest, disease and drought resistance. For Fingermillet, they included number of spikelets/fingers, color of spikelet/fingers, days to maturity, yield potential and grain color."},{"index":4,"size":42,"text":"The nutritional content of the selected varieties was done at the Food and Nutritional Evaluation Laboratory (FANEL-BeCa ILRI Hub) in Nairobi Kenya. The nutritional evaluation included determination of moisture content, proteins, ash, fat, crude fibre, carbohydrate, iron, zinc, calcium and total phenolics. "}]},{"head":"Soils and climate information of Nyando Kenya","index":3,"paragraphs":[]},{"head":"Sorghum Catalogue (Nyando)","index":4,"paragraphs":[]},{"head":"Documented importance and nutritional profile of sorghum","index":5,"paragraphs":[{"index":1,"size":88,"text":"Sorghum (Sorghum bicolor, L) is a cereal crop indigenous to Africa and is globally used for food, feed, and biofuel. It is also a leading crop in arid and semi-arid regions, and is ranked fifth in importance among the world's grain crops after wheat, maize, rice, and barley (Gedifew and Tsige, 2019). it is very important for climate change adaptation and can withstand drought and poor weather conditions as well as poor soils. The grains have also become an important feed for livestock, especially for pigs and poultry."},{"index":2,"size":49,"text":"Sorghum is a nutrient-packed grain that you can use in many ways. It's rich in vitamins and minerals like B vitamins, magnesium, potassium, phosphorus, iron, and zinc. It's likewise an excellent source of fiber, antioxidants, and protein and is important as a gluten-free alternative to other types of flour."},{"index":3,"size":4,"text":"Sorghum grains pictures collage."},{"index":4,"size":8,"text":"Credit: Alliance of Bioversity International and CIAT/ T.Recha"},{"index":5,"size":29,"text":"Catalogues presented here are the best performing varieties selected in conjuction with farmers and breeders after a series of PVS trials and nutritional testing in lower and upper Nyando."}]},{"head":"Variety Name: GBK 44669","index":6,"paragraphs":[{"index":1,"size":14,"text":"Country of origin: Kenya It has white grain color, medium sized plump and lustrous"}]},{"head":"Agronomic Characteristics","index":7,"paragraphs":[{"index":1,"size":17,"text":"• The plant has a growing height of up to 200 cm, therefore it is very tall."},{"index":2,"size":9,"text":"• It is characterized by medium cases of bending."},{"index":3,"size":6,"text":"• It does not produce tillers."},{"index":4,"size":13,"text":"• It takes 153 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":27,"text":"• It can yield up to 2300 kg/ha (26 -90-kg bags), therefore it is a high-yielding variety. Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Further information","index":8,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":6,"text":"• High in iron and calcium"},{"index":3,"size":11,"text":"• Calcium content is seven times more than the reported average."},{"index":4,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers"}]},{"head":"Variety Name: GBK 44672","index":9,"paragraphs":[{"index":1,"size":13,"text":"Country of origin: Kenya It has red grain colour, large sized, medium lustre"}]},{"head":"Agronomic Characteristics","index":10,"paragraphs":[{"index":1,"size":18,"text":"• The plant has a growing height of up to 152 cm, therefore it is of medium height."},{"index":2,"size":7,"text":"• It is usually erect/does not bend."},{"index":3,"size":6,"text":"• It does not produce tillers."},{"index":4,"size":13,"text":"• It takes 138 days to mature, therefore it is a medium-maturing variety."},{"index":5,"size":17,"text":"• It can yield up to 3167 kg/ha (35 90-kg bags) therefore a very high yielding variety"},{"index":6,"size":15,"text":"• It is pest resistant Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Further information","index":11,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":7,"text":"• High in iron, zinc, and calcium"},{"index":3,"size":11,"text":"• The calcium content is about seven times higher than reported."},{"index":4,"size":8,"text":"• Total phenolics is slightly higher than reported."},{"index":5,"size":13,"text":"• Processing methods like fermentation and germination increase mineral availability to the body."}]},{"head":"Variety Name: GBK 44626","index":12,"paragraphs":[{"index":1,"size":13,"text":"Country of origin: Kenya It has pale white/cream grain colour with no lustre"},{"index":2,"size":18,"text":"• The plant has a growing height of up to 232 cm, so it is a very tall"},{"index":3,"size":8,"text":"• It usually bends during the growing period"},{"index":4,"size":6,"text":"• It does not produce tillers"},{"index":5,"size":13,"text":"• It takes 143 days to mature, therefore it is a medium-maturing variety."},{"index":6,"size":18,"text":"• It can yield up to 3000 kg/ha (33 90-kg bags), therefore it is a very high-yielding variety."},{"index":7,"size":20,"text":"• It is pest and disease resistant and drought tolerant. Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Nutritional Value","index":13,"paragraphs":[]},{"head":"Further information","index":14,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":6,"text":"• High in iron and zinc"},{"index":3,"size":8,"text":"• High in phenolics, which have health benefits"},{"index":4,"size":13,"text":"• Processing is important to improve mineral and protein availability to the body."}]},{"head":"Variety Name: GBK004251","index":15,"paragraphs":[{"index":1,"size":12,"text":"Country of origin: Kenya It has white grain colour which is lustrous"}]},{"head":"Agronomic Characteristics","index":16,"paragraphs":[{"index":1,"size":16,"text":"• The plant has a growing height of up to 170 cm, therefore it is tall."},{"index":2,"size":9,"text":"• It is characterised by medium cases of bending."},{"index":3,"size":6,"text":"• It does not produce tillers."},{"index":4,"size":13,"text":"• It takes 135 days to mature, therefore it is a medium-maturing variety."},{"index":5,"size":27,"text":"• It can yield up to 3100kg (34 90-kg bags), therefore it is a very high-yielding variety. Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Further information","index":17,"paragraphs":[{"index":1,"size":4,"text":"• High in iron"},{"index":2,"size":4,"text":"• High in calcium"},{"index":3,"size":9,"text":"• High in total phenolics, which promote good health."},{"index":4,"size":11,"text":"• Processing is important for increased availability of minerals and protein."}]},{"head":"Variety Name: GBK 51843","index":18,"paragraphs":[{"index":1,"size":13,"text":"Country of origin: Tanzania It has reddish grain colour and medium sized grain"}]},{"head":"Agronomic Characteristics","index":19,"paragraphs":[{"index":1,"size":17,"text":"• The plant has a growing height of up to 198 cm, therefore it is very tall."},{"index":2,"size":8,"text":"• It usually bends during the growing period."},{"index":3,"size":9,"text":"• It can produce up to three fertile tillers."},{"index":4,"size":13,"text":"• It takes 155 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":17,"text":"• It can yield up to 2500 kg/ha (28 90-kg bags), so it is a high-yielding variety. "}]},{"head":"Further information","index":20,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":4,"text":"• High in iron"},{"index":3,"size":4,"text":"• High in calcium"},{"index":4,"size":13,"text":"• The calcium content is about six times higher than the reported average."},{"index":5,"size":10,"text":"• High in total phenolics, which are good for health."},{"index":6,"size":11,"text":"• Processing is crucial for increased availability of minerals and proteins."},{"index":7,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers."}]},{"head":"Variety Name: GBK 51759","index":21,"paragraphs":[{"index":1,"size":9,"text":"Country of origin: Tanzania It has white grain colour"}]},{"head":"Agronomic Characteristics","index":22,"paragraphs":[{"index":1,"size":18,"text":"• The plant has a growing height of up to 167 cm, therefore it is of medium height."},{"index":2,"size":9,"text":"• It is characterised by medium cases of bending."},{"index":3,"size":6,"text":"• It does not produce tillers."},{"index":4,"size":9,"text":"• It can produce up to three fertile tillers."},{"index":5,"size":13,"text":"• It takes 135 days to mature, therefore it is a medium-maturing variety."},{"index":6,"size":16,"text":"• It can yield up to 3433 kg/ha (27 90-kg bags), so it's a high-yielding variety."},{"index":7,"size":18,"text":"• It is pest resistant and drought tolerant. Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Nutritional Value","index":23,"paragraphs":[]},{"head":"Further information","index":24,"paragraphs":[{"index":1,"size":5,"text":"• High in protein content"},{"index":2,"size":6,"text":"• High in iron and calcium"},{"index":3,"size":12,"text":"• The calcium content is about nine times higher than the average."},{"index":4,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers."}]},{"head":"Variety Name: GBK 051855","index":25,"paragraphs":[{"index":1,"size":10,"text":"Country of origin: Tanzania It has a white grain colour"}]},{"head":"Agronomic Characteristics","index":26,"paragraphs":[{"index":1,"size":15,"text":"• The plant has a growing height of up to 130 cm, therefore it's short."},{"index":2,"size":8,"text":"• It usually bends during the growing period."},{"index":3,"size":9,"text":"• It can produce up to four fertile tillers."},{"index":4,"size":12,"text":"• It takes 152 days to mature, therefore it's a medium-maturing variety."},{"index":5,"size":16,"text":"• It can yield up to 1667 kg (19 90-kg bags), therefore it's a medium-yielding variety."},{"index":6,"size":20,"text":"• It is pest and disease resistant, and drought tolerant. Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Nutritional Value","index":27,"paragraphs":[]},{"head":"Further information","index":28,"paragraphs":[{"index":1,"size":4,"text":"• High in Protein"},{"index":2,"size":10,"text":"• High in ash, which could imply high mineral content"},{"index":3,"size":7,"text":"• High in iron, zinc, and calcium"},{"index":4,"size":13,"text":"• The calcium content is about nine times higher than the reported average."},{"index":5,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers"}]},{"head":"Variety Name: GBK 51737","index":29,"paragraphs":[{"index":1,"size":10,"text":"Country of origin: Uganda It has dark red grain colour"}]},{"head":"Agronomic Characteristics","index":30,"paragraphs":[{"index":1,"size":18,"text":"• The plant has a growing height of up to 157 cm, therefore it has a medium height."},{"index":2,"size":9,"text":"• It is characterized by medium cases of bending."},{"index":3,"size":9,"text":"• It can produce up to four fertile tillers."},{"index":4,"size":13,"text":"• It takes 147 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":18,"text":"• It can yield up to 3333 kg/ha (37 90-kg bags), therefore it is a very high-yielding variety."},{"index":6,"size":13,"text":"• Disease resistant Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Further information","index":31,"paragraphs":[{"index":1,"size":13,"text":"• High in protein • High in ash, which implies high mineral content"},{"index":2,"size":7,"text":"• High in iron, zinc, and calcium"},{"index":3,"size":9,"text":"• High in total phenolics, which promote good health"},{"index":4,"size":12,"text":"• Processing is important for increased protein and minerals to the body."},{"index":5,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers"}]},{"head":"Variety Name: GBK051746","index":32,"paragraphs":[{"index":1,"size":10,"text":"Country of origin: Uganda It has dark red grain colour"}]},{"head":"Agronomic Characteristics","index":33,"paragraphs":[{"index":1,"size":16,"text":"• The plant has a growing height of up to 180 cm, therefore it is tall."},{"index":2,"size":8,"text":"• It usually bends during the growing period."},{"index":3,"size":6,"text":"• It does not produce tillers."},{"index":4,"size":13,"text":"• It takes 153 days to mature, therefore it is a medium-maturing variety."},{"index":5,"size":18,"text":"• It can yield up to 5000 kg/ha (55 90-kg bags), therefore it is a very high-yielding variety."},{"index":6,"size":20,"text":"• It is pest and disease resistant, and drought tolerant. Source of reported average: Oluwafemi (2020); FAO (1995); Leder (2004)."}]},{"head":"Nutritional Value","index":34,"paragraphs":[]},{"head":"Further information","index":35,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":7,"text":"• High in iron, zinc, and calcium"},{"index":3,"size":13,"text":"• Low total phenolics, implying higher protein and mineral availability to the body"},{"index":4,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers"}]},{"head":"Variety Name: GBK051744","index":36,"paragraphs":[{"index":1,"size":4,"text":"Country of origin: Uganda"}]},{"head":"It has red grain colour","index":37,"paragraphs":[]},{"head":"Agronomic Characteristics","index":38,"paragraphs":[{"index":1,"size":18,"text":"• The plant has a growing height of up to 160 cm, therefore it is of medium height."},{"index":2,"size":9,"text":"• It is characterised by medium cases of bending."},{"index":3,"size":9,"text":"• It can produce up to six fertile tillers."},{"index":4,"size":13,"text":"• It takes 140 days to mature, therefore it is a medium-maturing variety."},{"index":5,"size":28,"text":"• It can yield up to 5000 kg (55 90-kg bags), therefore it is a very high-yielding variety. Source of reported average: Oluwafemi (2020); FAO (1995) Leder (2004)."}]},{"head":"Further information","index":39,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":7,"text":"• High in iron, zinc, and calcium"},{"index":3,"size":12,"text":"• The calcium content is five times higher than the reported average."},{"index":4,"size":10,"text":"• High in total phenolics, which are beneficial to health"},{"index":5,"size":13,"text":"• Processing is essential for increased protein and mineral availability to the body."},{"index":6,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers"}]},{"head":"Millet Catalogue (Nyando)","index":40,"paragraphs":[]},{"head":"Documented importance and nutritional profile of millet","index":41,"paragraphs":[{"index":1,"size":126,"text":"Millets are traditional crops that perform better than other grains like wheat and rice in areas with marginal growing conditions and have high nutritional value (Kumar et al., 2018). Cultivation of mil-lets has been reported to keep dry lands productive and ensure food and nutritional security. Moreo-ver, millet grains contain vital nutrients and their protein content is considered to be higher than or equal to that of wheat rice, maize and sorghum (Kumar et al., 2018;Kajuna, 2017). In addition, it is resistant to pests and diseases. Millet grain also contains health-promoting components. They are said to be antidiabetic (type 2 diabetes mellitus), anti-diarrheal, antiulcer, anti-inflammatory, anti-tumerogenic (K562 chronic myeloid leukemia), to alleviate atherosclerogenic effects, to be anti-microbial and to have antioxidant properties (Chandra et al., 2016)."},{"index":2,"size":4,"text":"Finger millet pictures collage."},{"index":3,"size":8,"text":"Credit: Alliance of Bioversity International and CIAT/ T.Recha"}]},{"head":"Name: GBK043052","index":42,"paragraphs":[{"index":1,"size":10,"text":"Country of origin: Kenya It has dark red grain colour"}]},{"head":"Agronomic Characteristics","index":43,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 74 cm."},{"index":2,"size":11,"text":"• It is characterised by high cases of bending during growth."},{"index":3,"size":9,"text":"• It can produce up to two fertile tillers."},{"index":4,"size":13,"text":"• It takes 145 days to mature, therefore it is a medium-maturing variety."},{"index":5,"size":17,"text":"• It can yield up to 1366 kg (15 90-kg bags), therefore it is a medium-yielding variety."},{"index":6,"size":21,"text":"• It is pest and disease resistant and drought tolerant. Total Phenolics (Health benefiting compounds) 14.20 mg/100g 0.1 to 368 mg/100g"}]},{"head":"Nutritional Value","index":44,"paragraphs":[{"index":1,"size":16,"text":"Source of reported averages: Ramashia et al. (2019); Leder (2004); Chandra et al. (2016) Further information"},{"index":2,"size":4,"text":"• High in protein"},{"index":3,"size":8,"text":"• High in ash implying high mineral content"},{"index":4,"size":6,"text":"• High in zinc and calcium"},{"index":5,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers."}]},{"head":"Variety Name: GBK043180","index":45,"paragraphs":[{"index":1,"size":10,"text":"Country of origin: Kenya It has dark red grain colour"}]},{"head":"Agronomic Characteristics","index":46,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 93 cm."},{"index":2,"size":11,"text":"• It is characterised by high cases of bending during growth."},{"index":3,"size":7,"text":"• It can produce one fertile tiller."},{"index":4,"size":13,"text":"• It takes 160 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":17,"text":"• It can yield up to 1333 kg (14 90-kg bags), therefore it is a medium-yielding variety."},{"index":6,"size":26,"text":"• It is pest and disease resistant and drought tolerant. Source of reported averages: Ramashia et al. (2017); Leder (2004): Chandra et al. (2016) Further information"}]},{"head":"Nutritional Value","index":47,"paragraphs":[{"index":1,"size":8,"text":"• High in ash, implying high mineral content"}]},{"head":"• High in zinc","index":48,"paragraphs":[{"index":1,"size":3,"text":"Variety Name: GBK043275"},{"index":2,"size":10,"text":"Country of origin: Kenya It has dark red grain colour"}]},{"head":"Agronomic Characteristics","index":49,"paragraphs":[{"index":1,"size":8,"text":"• The plant grows up to 88 cm."},{"index":2,"size":12,"text":"• It is characterised by very high cases of bending during growth."},{"index":3,"size":7,"text":"• It can produce one fertile tiller."},{"index":4,"size":13,"text":"• It takes 160 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":18,"text":"• It can yield up to 3000 kg (33 90-kg bags), therefore it is a very high-yielding variety."},{"index":6,"size":26,"text":"• It is pest and disease resistant and drought tolerant. Source of reported averages Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"}]},{"head":"Nutritional Value","index":50,"paragraphs":[{"index":1,"size":10,"text":"• High in ash, which implies a high mineral content"},{"index":2,"size":20,"text":"• High in zinc Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"},{"index":3,"size":4,"text":"• High in protein"},{"index":4,"size":8,"text":"• High in ash, implying high mineral content"},{"index":5,"size":6,"text":"• High in zinc and calcium"}]},{"head":"Variety Name: GBK051721","index":51,"paragraphs":[{"index":1,"size":9,"text":"Country of origin: Uganda It has red grain colour"}]},{"head":"Agronomic Characteristics","index":52,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 109 cm."},{"index":2,"size":12,"text":"• It is characterised by extremely high cases of bending during growth."},{"index":3,"size":9,"text":"• It can produce up to three fertile tillers."},{"index":4,"size":13,"text":"• It takes 160 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":17,"text":"• It can yield up to 2333 kg (26 90-kg bags), therefore it is a high-yielding variety."},{"index":6,"size":26,"text":"• It is pest and disease resistant and drought tolerant. Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"}]},{"head":"Nutritional","index":53,"paragraphs":[{"index":1,"size":4,"text":"• High in protein"},{"index":2,"size":8,"text":"• High in ash, implying high mineral content"},{"index":3,"size":6,"text":"• High in zinc and calcium"}]},{"head":"Variety Name: GBK051718","index":54,"paragraphs":[{"index":1,"size":9,"text":"Country of origin: Uganda It has red grain colour"}]},{"head":"Agronomic Characteristics","index":55,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 71 cm."},{"index":2,"size":11,"text":"• It is characterised by high cases of bending during growth."},{"index":3,"size":9,"text":"• It can produce up to two fertile tillers."},{"index":4,"size":13,"text":"• It takes 150 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":34,"text":"• It can yield up to 5000 kg (56 90-kg bags), therefore it is a very high-yielding variety. Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"},{"index":6,"size":8,"text":"• High in ash implying high mineral content"},{"index":7,"size":6,"text":"• High in zinc and calcium"}]},{"head":"Variety Name: GBK 051725","index":56,"paragraphs":[{"index":1,"size":9,"text":"Country of origin: Uganda It has red grain colour"}]},{"head":"Agronomic Characteristics","index":57,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 90 cm."},{"index":2,"size":12,"text":"• It is characterised by very high cases of bending during growth."},{"index":3,"size":7,"text":"• It can produce one fertile tiller."},{"index":4,"size":13,"text":"• It takes 150 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":33,"text":"• It can yield up to 2000 kg (22 90-kg bags), therefore it is a high-yielding variety. Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"},{"index":6,"size":8,"text":"• High in ash, implying high mineral content"},{"index":7,"size":6,"text":"• High in iron and zinc"},{"index":8,"size":5,"text":"• High in calcium content"},{"index":9,"size":9,"text":"• Good for complementary feeding, pregnant, and lactating mothers"}]},{"head":"Variety Name: GBK51705","index":58,"paragraphs":[{"index":1,"size":9,"text":"Country of origin: Uganda It has red grain colour"}]},{"head":"Agronomic Characteristics","index":59,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 90 cm."},{"index":2,"size":12,"text":"• It is characterised by very high cases of bending during growth."},{"index":3,"size":7,"text":"• It can produce one fertile tiller."},{"index":4,"size":13,"text":"• It takes 150 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":34,"text":"• It can yield up to 3667 kg (41 90-kg bags), therefore it is a very high-yielding variety. Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"},{"index":6,"size":4,"text":"• High in protein"},{"index":7,"size":15,"text":"• High in ash, implying high total mineral content • High in zinc and calcium"}]},{"head":"Variety Name: CHEPNYALTET","index":60,"paragraphs":[{"index":1,"size":9,"text":"Country of origin: Kenya It has red grain colour"}]},{"head":"Agronomic Characteristics","index":61,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 85 cm."},{"index":2,"size":11,"text":"• It is characterised by high cases of bending during growth"},{"index":3,"size":7,"text":"• It can produce one fertile tiller."},{"index":4,"size":13,"text":"• It takes 155 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":13,"text":"• It can yield up to 9286 kg/ha, therefore it is high yielding."},{"index":6,"size":26,"text":"• It is pest and disease resistant and drought tolerant. Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"}]},{"head":"Nutritional","index":62,"paragraphs":[{"index":1,"size":8,"text":"• High in ash, implying high mineral content"},{"index":2,"size":6,"text":"• High in zinc and calcium"}]},{"head":"Variety Name: GBK057855","index":63,"paragraphs":[{"index":1,"size":10,"text":"Country of origin: Uganda It has dark red grain colour"}]},{"head":"Agronomic Characteristics","index":64,"paragraphs":[{"index":1,"size":11,"text":"• It has a growing height of up to 71 cm."},{"index":2,"size":11,"text":"• It is characterised by high cases of bending during growth."},{"index":3,"size":9,"text":"• It can produce up to two fertile tillers."},{"index":4,"size":13,"text":"• It takes 150 days to mature, therefore it is a late-maturing variety."},{"index":5,"size":18,"text":"• It can yield up to 3000 kg (33 90-kg bags), therefore it is a very high-yielding variety."},{"index":6,"size":26,"text":"• It is pest and disease resistant and drought tolerant. Source of reported averages: Ramashia et al. (2017); Leder (2004); Chandra et al. (2016) Further information"}]},{"head":"Nutritional","index":65,"paragraphs":[{"index":1,"size":5,"text":"• High in protein content"},{"index":2,"size":8,"text":"• High in ash, implying high mineral content"},{"index":3,"size":4,"text":"• High in zinc"}]}],"figures":[{"text":"Figure 1 : Figure 1: Map of Nyando project site in Kenya "},{"text":" • It is pest and disease and drought tolerant. Nutritional Value Dry weight basis Reported Averages Nutritional ValueDry weight basisReported Averages Moisture content 14.06% 12% Moisture content14.06%12% Protein 9.34% 6.2-14.9% Protein9.34%6.2-14.9% Ash 1.78% 0.9-4.2% Ash1.78%0.9-4.2% Fat 2.87% 1.3-10.5% Fat2.87%1.3-10.5% Crude fibre 4.64% 2.3% Crude fibre4.64%2.3% Carbohydrate 67.31% 54.6-85.2% Carbohydrate67.31%54.6-85.2% Iron 4.26 mg/100g 4.2 mg/100g Iron4.26 mg/100g4.2 mg/100g Zinc 1.68 mg/100g 2.5 mg/100g Zinc1.68 mg/100g2.5 mg/100g Calcium 25.71 mg/100g 15 mg/100g Calcium25.71 mg/100g15 mg/100g Total Phenolics (Health benefiting compounds) 92.47mg/100g 3-43 mg/100g Total Phenolics (Health benefiting compounds)92.47mg/100g3-43 mg/100g  "},{"text":" • It is pest and disease resistant, and drought tolerant. Nutritional Value Dry weight basis Reported Averages Nutritional ValueDry weight basisReported Averages Moisture content 13.90% 12% Moisture content13.90%12% Protein 11.12% 6.2-14.9% Protein11.12%6.2-14.9% Ash 2.61% 0.9-4.2% Ash2.61%0.9-4.2% Fat 3.55% 1.3-10.55% Fat3.55%1.3-10.55% Crude Fibre 7.48% 2.3% Crude Fibre7.48%2.3% Carbohydrate 61.78% 54.6-85.2% Carbohydrate61.78%54.6-85.2% Iron 5.36 mg/100g 4.2 mg/100g Iron5.36 mg/100g4.2 mg/100g Zinc 2.20 mg/100g 2.5 mg/100g Zinc2.20 mg/100g2.5 mg/100g Calcium 103.04 mg/100g 15 mg/100g Calcium103.04 mg/100g15 mg/100g Total Phenolics (Health promoting compounds) 119.66 mg/100g 3-43 mg/100g Total Phenolics (Health promoting compounds)119.66 mg/100g3-43 mg/100g  "},{"text":" • It is pest and disease resistant, and drought tolerant. Nutritional Value Dry weight basis Reported Averages Nutritional ValueDry weight basisReported Averages Moisture content 11.44% 12% Moisture content11.44%12% Protein 8.59% 6.2-12.3% Protein8.59%6.2-12.3% Ash 2.61% 0.83-2.72% Ash2.61%0.83-2.72% Fat 1.61% 1.3-5% Fat1.61%1.3-5% Crude Fibre 7.64% 2.2-12% Crude Fibre7.64%2.2-12% Carbohydrate 68.12% 49-75% Carbohydrate68.12%49-75% Iron 7.50 mg/100g 0.5-18.6 mg/100g Iron7.50 mg/100g0.5-18.6 mg/100g Zinc 3.09 mg/100g 0.7-3.1 mg/100g Zinc3.09 mg/100g0.7-3.1 mg/100g Calcium 433.44 mg/100g 20-398 mg/100g Calcium433.44 mg/100g20-398 mg/100g Total Phenolics (Health promoting compounds) 18.84 mg/100g 0.1-368 mg/100g Total Phenolics (Health promoting compounds)18.84 mg/100g0.1-368 mg/100g  "},{"text":" • It is pest and disease resistant and drought tolerant. Nutritional Value Dry weight basis Reported Averages Nutritional ValueDry weight basisReported Averages Moisture content 11.58% 12% Moisture content11.58%12% Protein 9.62% 6.2-12.3% Protein9.62%6.2-12.3% Ash 4.00% 0.83-2.72% Ash4.00%0.83-2.72% Fat 1.18% 1.3-5% Fat1.18%1.3-5% Crude Fibre 9.20% 2.2-12% Crude Fibre9.20%2.2-12% Carbohydrate 64.42% 49-75% Carbohydrate64.42%49-75% Iron 16.80 mg/100g 0.5-18.6 mg/100g Iron16.80 mg/100g0.5-18.6 mg/100g Zinc 3.92 mg/100g 0.7-3.1 mg/100g Zinc3.92 mg/100g0.7-3.1 mg/100g Calcium 425.95 mg/100g 20-398 mg/100g Calcium425.95 mg/100g20-398 mg/100g Total Phenolics (Health promoting compounds) 18.30 mg/100g 0.1-368 mg/100g Total Phenolics (Health promoting compounds)18.30 mg/100g0.1-368 mg/100g  "},{"text":" • It is pest and disease resistant and drought tolerant. Nutritional Value Dry weight basis Reported Averages Nutritional ValueDry weight basisReported Averages Moisture content 11.56% 12% Moisture content11.56%12% Protein 11.01% 6.2-12.3% Protein11.01%6.2-12.3% Ash 2.45% 0.83-2.72% Ash2.45%0.83-2.72% Fat 1.56% 1.3-5% Fat1.56%1.3-5% Crude Fibre 10.97% 2.2-12% Crude Fibre10.97%2.2-12% Carbohydrate 62.45% 49-75% Carbohydrate62.45%49-75% Iron 8.13 mg/100g 0.5-18.6 mg/100g Iron8.13 mg/100g0.5-18.6 mg/100g Zinc 3.65 mg/100g 0.7-3.1 mg/100g Zinc3.65 mg/100g0.7-3.1 mg/100g Calcium 343.58 mg/100g 30-398mg/100g Calcium343.58 mg/100g30-398mg/100g Total Phenolics (Health promoting compounds) 7.56 mg/100g 0.1-368 mg/100g Total Phenolics (Health promoting compounds)7.56 mg/100g0.1-368 mg/100g  "},{"text":"Value Dry weight basis Reported Averages  Moisture content 10.32% 12% Moisture content10.32%12% Protein 8.22% 6.2-12.3% Protein8.22%6.2-12.3% Ash 3.28% 0.83-2.72% Ash3.28%0.83-2.72% Fat 1.74% 1.3-5% Fat1.74%1.3-5% Crude Fibre 8.48% 2.2-12% Crude Fibre8.48%2.2-12% Carbohydrate 67.97% 49-75% Carbohydrate67.97%49-75% Iron 5.33mg/100g 0.5-18.6 mg/100g Iron5.33mg/100g0.5-18.6 mg/100g Zinc 3.21 mg/100g 0.7-3.1 g/100g Zinc3.21 mg/100g0.7-3.1 g/100g Calcium 403.11 mg/100g 20-398 mg/100g Calcium403.11 mg/100g20-398 mg/100g Total Phenolics (Health promoting compounds) 9.01 mg/100g 0.1-368 mg/100g Total Phenolics (Health promoting compounds)9.01 mg/100g0.1-368 mg/100g  "},{"text":"Value Dry weight basis Reported Averages  Moisture content 11.83% 12% Moisture content11.83%12% Protein 14.05% 6.2-12.3% Protein14.05%6.2-12.3% Ash 3.41% 0.83-2.72% Ash3.41%0.83-2.72% Fat 3.79% 1.3-5% Fat3.79%1.3-5% Crude Fibre 10.60% 2.2-12% Crude Fibre10.60%2.2-12% Carbohydrate 56.32% 49-75% Carbohydrate56.32%49-75% Iron 6.44 mg/100g 0.5-18.6 mg/100g Iron6.44 mg/100g0.5-18.6 mg/100g Zinc 2.92 mg/100g 0.7-3.1 mg/100g Zinc2.92 mg/100g0.7-3.1 mg/100g Calcium 165.49 mg/100g 20-398 mg/100g Calcium165.49 mg/100g20-398 mg/100g Total Phenolics (Health promoting compounds) 12.64 mg/100g 0.1-368 mg/100g Total Phenolics (Health promoting compounds)12.64 mg/100g0.1-368 mg/100g  "}],"sieverID":"7556432c-bb0e-445e-8a8b-cf66b09ce977","abstract":"and Musuya David (2020), Enhancing access to genetic resources for climate change adaptation in Kenya, Uganda and Tanzania: Seed Catalogues of Best Perfoming Varieties of Finger millet and Sorghum in Nyando Kenya."}

data/part_1/089bf435d680053d2ef4190044d0fe72.json

@@ -0,0 +1 @@
+{"metadata":{"id":"089bf435d680053d2ef4190044d0fe72","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/190c5b3f-44ba-4ded-9ef1-f56d69424294/retrieve"},"pageCount":10,"title":"Documentación fotográf ica","keywords":[],"chapters":[{"head":"Ficha #03","index":1,"paragraphs":[{"index":1,"size":2,"text":"Ficha #08"}]},{"head":"Ficha #02","index":2,"paragraphs":[{"index":1,"size":2,"text":"Ficha #06"},{"index":2,"size":8,"text":"Herramientas de Rikuy Agrobio que se pueden combinar"}]},{"head":"Catálogos","index":3,"paragraphs":[]},{"head":"SIG participativo Ensayos en campo de agricultores y descriptores morfológicos","index":4,"paragraphs":[]},{"head":"Descripción","index":5,"paragraphs":[{"index":1,"size":57,"text":"La documentación fotográfica es una herramienta que, como su nombre lo indica, permite obtener un registro sistemático de la agrobiodiversidad a través de imágenes de variedades, representando una forma didáctica de entender su dimensión y dinámica. Al mismo tiempo, permite transmitir conocimientos complejos de una manera eficaz, porque se puede involucrar a los agricultores en el monitoreo."},{"index":2,"size":72,"text":"Actualmente, el acceso a celulares con cámaras más sofisticadas y a costos accesibles abre la oportunidad a cualquier persona interesada, de poder realizar una documentación fotográfica de plantas con un entrenamiento básico previo. Esta actividad ayuda a documentar las características morfológicas de las variedades (Sánchez, J.M. 1994). Las imágenes se pueden incluir en catálogos, registros y bases de datos. Los registros varietales con fotografías sirven para conocer la distribución geográfica de variedades."},{"index":3,"size":27,"text":"Esta herramienta te ayudará a responder las siguientes preguntas de investigación: A continuación, se describe los pasos básicos a tomar en cuenta en la fotografía de plantas."}]},{"head":"? ¿","index":6,"paragraphs":[]},{"head":"Ejemplos de uso","index":7,"paragraphs":[{"index":1,"size":36,"text":"Esta herramienta es muy común y ha sido utilizada para registrar la agrobiodiversidad en diferentes cultivos. La documentación fotográfica se usa para elaborar catálogos.  (Manrique et al., 2014;Manrique et al., 2017;León et al.,2018;Becerra et al., 2020)."},{"index":2,"size":111,"text":"La documentación fotográfica también es usada en proyectos de ciencia ciudadana. Estos proyectos se construyen con el apoyo voluntario de los y las ciudadanas para colectar datos relacionados con la agrobiodiversidad. Por ejemplo, en el 2021 en España, el Consejo Superior de Investigaciones Científicas participó en el proyecto europeo INCREASE (Intelligent Collections of food-Legume Genetic Resources for European Agrofood Systems; Consejo Superior de Investigaciones Científicas, 2022). Este proyecto investigó la diversidad genética de seis variedades de frejoles (Phaseolus vulgaris) en 14 países. Los voluntarios y voluntarias cultivaron estas variedades, las documentaron fotográficamente, y registraron sus características y finalmente compartieron la información a través de la aplicación para celulares: INCREASE Citizen Science."},{"index":3,"size":15,"text":"Fotografía 1. Investigadores realizando la documentación fotográfica de hojas y flores de papa. ©Luz Bernardo."}]},{"head":"Metodología","index":8,"paragraphs":[{"index":1,"size":29,"text":"1. Un paso sugerido en caso de no tener experiencia, es practicar las técnicas de fotografía con el objetivo de sacar las mejores imágenes posibles. Estas técnicas consisten en:"},{"index":2,"size":180,"text":"(1) calibrar la cámara fotográfica o configurar la cámara del celular, (2) practicar el enfoque y el centrado de la parte de la planta que se quiere fotografiar y (3) practicar el uso del brillo, la luz y el contraste. Es importante mencionar que un pequeño error en el enfoque puede hacer que las imágenes se vean poco claras cuando se muestran en una pantalla grande o se imprimen en un catálogo. El uso de un trípode puede ayudar a que las fotografías salgan nítidas y bien centradas, ya que la cámara estaría fija. Luego, basados en los resultados de las prácticas, se toman decisiones para optimizar las condiciones. Para esto se debe identificar las mejores condiciones de luz y ángulos para las fotografías. Es importante manejar estándares fijos en cuanto a la composición y el ángulo ya que no se puede controlar todas las condiciones cada vez que se toman las fotografías. Sin embargo, hay algunos momentos del díatemprano y/o por la tarde, cuando las condiciones de luz suelen ser mejor para la toma de fotografías (ver caja 1)."}]},{"head":"Materiales","index":9,"paragraphs":[{"index":1,"size":6,"text":"Esta herramienta emplea los siguientes materiales:"}]},{"head":"Duración de la implementación","index":10,"paragraphs":[{"index":1,"size":89,"text":"La duración de la documentación fotográfica dependerá del objetivo del proyecto, del número de variedades o especies que el proyecto quiera documentar y la zona donde se encuentre el cultivo. Dependiendo de esos factores, la documentación puede tomar entre 6 meses (una campaña) hasta 5 años (múltiples 6 meses 5 años a campañas), teniendo en cuenta que gran parte del trabajo será realizado in situ. Hay que tomar en cuenta de que las condiciones ambientales influyen mucho en la expresión de todas las características que se pretende documentar visualmente."},{"index":2,"size":24,"text":"• Cámaras fotográficas digitales o celulares que tengan cámara con buena resolución y con función \"macro\" que se encuentra generalmente representada por este ícono"},{"index":3,"size":8,"text":"• Tarjeta de memoria (2 a 15 GB)"},{"index":4,"size":12,"text":"• Baterías de cámara (mínimo dos), cargadores de celular (eléctricos o solares)"},{"index":5,"size":7,"text":"• Mesa portátil de trabajo o tablero"},{"index":6,"size":4,"text":"• Sombrilla (mínimo dos)"},{"index":7,"size":2,"text":"• Trípode"},{"index":8,"size":19,"text":"• Tela o marco para hacer un fondo claro (de preferencia gris) o contrastante con el material a fotografiar"},{"index":9,"size":8,"text":"• Lista / registro de variedades a fotografiar"},{"index":10,"size":7,"text":"• Etiquetas para códigos (por cada muestra)"},{"index":11,"size":9,"text":"• Regla o cinta métrica para referenciar el tamaño"},{"index":12,"size":16,"text":"• Cartilla de colores para referenciar el color de la piel y pulpa de la muestra"},{"index":13,"size":12,"text":"• Material vegetativo (esto puede ser plantas en ensayos, flores, hojas, etc.)"},{"index":14,"size":6,"text":"• Cuaderno de apunte y lápiz"},{"index":15,"size":24,"text":"• Laptop, tablet, o computadora Caja 1. Recomendaciones para mejorar la calidad de las fotografías de plantas enteras, hojas, raíces, tubérculos, frutos y brotes."}]},{"head":"Recomendaciones generales","index":11,"paragraphs":[{"index":1,"size":31,"text":"• Es importante usar un fondo contrastante al momento de tomar las fotografías. Este fondo puede ser de color gris mate para evitar los brillos y perturbaciones causadas por la luz."},{"index":2,"size":85,"text":"• Es necesario tener en cuenta que, en la mayoría de los cultivos, la documentación fotográfica se realiza cuando las plantas están en plena floración o en la cosecha. Sin embargo, esto puede variar dependiendo de los objetivos del proyecto o del cultivo. Por ejemplo, en el caso de yuca (Manihot esculenta) las fotos se toman paralelamente a la descripción morfológica que es a los 3, 6 y 9 meses después de la siembra y al momento de la cosecha (Delaquis y De Haan, 2018)."},{"index":3,"size":16,"text":"• Es importante evitar el uso del flash para la fotografía de plantas (automático o programado)."},{"index":4,"size":42,"text":"• En campo se sugiere tomar las fotografías por la mañana o la tarde, evitando las horas de mayor brillo solar, es decir entre 12:00 p.m. y 2:00 p.m. Sin embargo, en días (medianamente) nublados se puede trabajar a medio día también."},{"index":5,"size":14,"text":"• Se sugiere tomar al menos tres fotografías por cada característica de la variedad."},{"index":6,"size":17,"text":"• Se debe evitar el uso del zoom ya que suele bajar la calidad de la imagen."},{"index":7,"size":50,"text":"• Se recomienda mantener el lente de la cámara limpio y libre de grasa. Se puede usar alcohol para desinfectar las manos antes de limpiar el lente. Se debe limpiar previamente el polvo adherido al lente (soplando o con pincel suave) antes de pasar un paño húmedo, para evitar rayaduras."},{"index":8,"size":29,"text":"• Una vez cosechada o cortada una porción de planta como muestra, lo mejor es tomar las fotografías inmediatamente para evitar su ablandamiento o la variación de sus características."},{"index":9,"size":89,"text":"2. Se debe definir y estandarizar las partes de la planta a fotografiar en campo. En muchos casos la documentación fotográfica está relacionada con la descripción morfológica de las plantas. Por esta razón se recomienda revisar con anterioridad los descriptores morfológicos. Dependiendo de los descriptores morfológicos seleccionados, se toman fotos de la planta entera (hábito de crecimiento), la flor o la inflorescencia, la hoja, las raíces, tubérculos, granos y/o frutos. Y, en el caso de tubérculos, también se suele tomar fotos de brotes (brotes de 2.0 a 2.5 cm)."}]},{"head":"Fotografías de tubérculos, raíces o frutos","index":12,"paragraphs":[{"index":1,"size":147,"text":"Antes de tomar estas fotografías se necesita limpiar y lavar las raíces, tubérculos o frutos. Se sugiere que los materiales a documentar se encuentren sobre un fondo contrastante. Las fotografías de estas partes de la planta se deberían tomar inmediatamente o hasta cinco días después de la cosecha. Se sugiere agrupar entre 4 a 5 tubérculos o frutos por cada variedad, los cuales deben ser de tamaño diferente y sin daños externos preferentemente. Los tubérculos o frutos se deben ordenar de grande (izquierda) a pequeño (derecha) debajo de una línea imaginaria (Figura 1). Luego se debe cortar transversalmente un tubérculo o fruto y se debe colocar debajo o al costado de los tubérculos ordenados para identificar el color de la pulpa (Figura 1). Además, se sugiere que cada una de las fotografías contenga el código de cada variedad, la carta de colores y una regla (Figura 1)."}]},{"head":"Fotografías de brotes","index":13,"paragraphs":[{"index":1,"size":36,"text":"Antes de tomar estas fotografías, lo primero que se debe hacer es inducir el brotamiento de los tubérculos. Para esto, se colocan dos tubérculos en una bolsa de papel (previamente rotulado con su código de identidad)."},{"index":2,"size":73,"text":"Estas bolsas de papel no se deben cerrar y se deben cubrir con una tela u otro material que permita a los tubérculos recibir luz difusa, es decir los tubérculos no deben recibir luz directamente o estar en un lugar completamente oscuro. Una vez que los brotes midan aproximadamente 2 cm se procede a tomar las fotografías. Se sugiere usar la función \"macro\" para este tipo de fotografías (ver ejemplo en Anexo 1)."}]},{"head":"Fotografías de plantas enteras","index":14,"paragraphs":[{"index":1,"size":44,"text":"Para tomar fotos de una planta entera se sugiere escoger de preferencia un día (ligeramente) nublado, con poco brillo solar, pero con suficiente luz natural. Esto se hace para evitar sombras o fotos demasiado iluminadas que podrían alterar la coloración real de la planta."},{"index":2,"size":35,"text":"También es importante tomar una foto desde una distancia que permita capturar la imagen de la planta entera y centrada de manera frontal a la misma altura de la planta (ver ejemplo en Anexo 1)."}]},{"head":"Fotografías de flores","index":15,"paragraphs":[{"index":1,"size":38,"text":"Para tomar fotografías de flores se escoge una flor o inflorescencia recién abierta que no tenga ningún tipo de daño. Se toma la fotografía frontalmente a una distancia que permita apreciar el tamaño de las flores o inflorescencia."},{"index":2,"size":61,"text":"Por ejemplo, en el caso de las flores de papa la distancia es entre 8 y 10 cm. Hay que tener cuidado con las especies o variedades que producen pocas flores porque puede ser la única oportunidad para capturar la imagen. Dependiendo de la cámara, se sugiere usar la función \"macro\" para este tipo de fotografías (ver ejemplo en Anexo 1)."}]},{"head":"Fotografías de hojas","index":16,"paragraphs":[{"index":1,"size":82,"text":"Para tomar fotografías de hojas se sugiere capturar la imagen de la misma hoja que se utilizó para la descripción morfológica. Esto se hace para asegurarse que los datos descritos coincidan con la imagen. Para este tipo de fotografías, las hojas se cortan desde la base del peciolo (unión del tallo), se aplanan y se acomodan en un fondo contrastante. Se sugiere fotografiar la hoja inmediatamente después del corte para evitar que se marchite o pierda turgencia (ver ejemplo en Anexo 1)."},{"index":2,"size":22,"text":"Figura 1. Ejemplo de documentación fotográfica de tubérculos de papa junto con la carta de colores, regla y código de la variedad."},{"index":3,"size":147,"text":"Tabla 1. Sistema potencial de codificación de fotografías digitales 3. El siguiente paso es transferir las fotografías de las cámaras a la computadora. Aquí, se debe codificar y organizar las fotos usando el código de la muestra, la parte de la planta fotografiada, y el número de la toma (Tabla 1). En general, se unen todas estas partes para tener un código definitivo de las fotos como se muestra en la Tabla 1. Éste se anota en un cuaderno / registro / tablet en campo y es el mismo que se usa para codificar al bajar las fotografías en la computadora. El código definitivo idealmente se completa el mismo día de la toma de fotos a fin de evitar errores. Si al momento de bajar las fotos a la computadora se desordenan, éstas se pueden reordenar con la opción \"Organizar según fecha y hora\". • Iluminación adecuada."}]},{"head":"Código de la muestra","index":17,"paragraphs":[{"index":1,"size":5,"text":"• Correcto encuadre, nítido, iluminado."},{"index":2,"size":5,"text":"• Uso adecuado de macro."},{"index":3,"size":5,"text":"• Espacio de encuadre adecuado."},{"index":4,"size":3,"text":"• Iluminación adecuada."},{"index":5,"size":7,"text":"• Buena posición, sin flash, uso macro."},{"index":6,"size":12,"text":"• Tallo excelente que permite ver las características óptimamente de los peciolos."},{"index":7,"size":6,"text":"• Correcta iluminación, centrado y nítido."},{"index":8,"size":5,"text":"• Tubérculos con distanciamiento adecuado."},{"index":9,"size":7,"text":"• Buena posición, sin flash, uso macro."},{"index":10,"size":9,"text":"• Brote excelente que permite ver sus características óptimamente."},{"index":11,"size":7,"text":"• Foto tomada desde el ángulo incorrecto."},{"index":12,"size":7,"text":"• Exceso de plantas para la foto."},{"index":13,"size":7,"text":"• Distancia de toma fotográfica muy lejana."},{"index":14,"size":13,"text":"• No se hizo uso correcto del enfoque, encuadre, iluminación, ni del macro."},{"index":15,"size":7,"text":"• Ángulo incorrecto para la toma fotográfica."},{"index":16,"size":17,"text":"• No presencia de flor abierta, solo son botones florales y no se muestra características de flor."},{"index":17,"size":5,"text":"• Fotografía opaca, con sombra."},{"index":18,"size":9,"text":"• Muestra de hoja deshidratada, mala calidad de imagen."},{"index":19,"size":5,"text":"• Fotografía opaca, con sombra."},{"index":20,"size":9,"text":"• Muestra de hoja deshidratada, mala calidad de imagen."},{"index":21,"size":13,"text":"• Presencia de sombra, desorden de las raíces para la foto. Encuadre inadecuado."},{"index":22,"size":14,"text":"• Fondo no contrastante y falta de complementos (regla, tabla colores, código no visible)."},{"index":23,"size":13,"text":"• Excesivo número de brotes pequeños y no se logra identificar el principal."},{"index":24,"size":9,"text":"• Deficiente iluminación no permite ver características del brote. "}]}],"figures":[{"text":" Finalmente, se realiza la evaluación de las fotos para preseleccionar las que se incluirán como parte de la documentación fotográfica (ver anexo 1). Se toman en cuenta los siguientes criterios: Buena resolución y nitidez de la foto.Centrado y encuadre de la muestra, con espacio a los extremos superior, inferior, derecho, izquierdo. "},{"text":" Comparación de buenas y malas fotografías de acuerdo a la parte de la planta documentada "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Qué características visibles diferencian unas variedades de otras ? ¿ Cómo hacer visible la diversidad varietal de una forma atractiva y didáctica ? ¿ Cómo contrastar visualmente variedades de diferentes características que tienen el mismo nombre o variedades con diferentes nombres que posiblemente son las mismas  Por ejemplo, la documentación fotográfica puede ayudar Por ejemplo, la documentación fotográfica puede ayudar a diferenciar variedades que tienen el mismo nombre a diferenciar variedades que tienen el mismo nombre con el apoyo de un agricultor custodio o de un experto. con el apoyo de un agricultor custodio o de un experto. Igualmente, puede ayudar -en combinación con otras Igualmente, puede ayudar -en combinación con otras herramientas como los descriptores morfológicos o herramientas como los descriptores morfológicos o marcadores genéticos -a reconocer variedades que son marcadores genéticos -a reconocer variedades que son homólogas. homólogas.  "},{"text":" Para ello se requiere de fotografías estandarizadas de buena calidad. Un ejemplo constituye el Catálogo Línea de Base de la Diversidad de Papas Nativas de Yauli-Paucará (Centro Internacional de la Papa et al., 2021). En este catálogo se documentaron 185 variedades de papa nativa (ver fotografía 1) para dar a conocer sus características agronómicas, nutricionales, usos culinarios, información genética y otros saberes adicionales, como relatos, creencias o festividades relacionados con su cultivo. Existen muchos otros ejemplos para papa nativa (Centro Internacional de la Papa et al., 2015; Ministerio de Agricultura y Riego et al., 2017; Centro Internacional de la Papa et al., 2021) y otros cultivos  "}],"sieverID":"09d51a34-a8e7-44cd-9c13-a7026a5c6264","abstract":"Este trabajo fue realizado y financiado por el programa de Investigación en Raíces, Tubérculos y Bananas (RTB) y apoyado en su continuidad por la iniciativa NATURE+ del CGIAR (https:// www.cgiar.org/initiative/12-nature-positive-solutionsenhancing-productivity-and-resilience-safeguarding-theenvironment-and-promoting-inclusive-community-growth/),"}

data/part_1/08ca7a83d8d7075305a229ec5fee4dc3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08ca7a83d8d7075305a229ec5fee4dc3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/eb9c6bf7-0136-403a-b64a-cfc4687b934e/retrieve"},"pageCount":25,"title":"Kenya County Climate Risk Profile Series Highlights Climate Risk Profile Kisumu County","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":183,"text":"Climate change is becoming one of the most serious challenges to Kenya's achievement of its development goals as described under Vision 2030. Kenya is already highly susceptible to climate-related hazards, and in many areas, extreme events and variability of weather are now the norm; rainfall is irregular and unpredictable; while droughts have become more frequent during the long rainy season and severe floods during the short rains. The arid and semi-arid areas are particularly hard hit by these climate hazards, thereby putting the lives and livelihoods of millions of households at risk. In 2010, Kenya developed a National Climate Change Response Strategy (NCCRS), which recognized the importance of climate change impacts on the country's development. This was followed by the National Climate Change Action Plan (NCCAP) in 2012, which provided a means for implementation of the NCCRS, highlighting a number of agricultural adaptation priorities. The focus of these initiatives has been at the national level, there is need to mainstream climate change into county level policies, programmes, and development plans; therefore ensuring locally relevant, integrated adaptation responses with active involvement of local stakeholders."},{"index":2,"size":113,"text":"The Government of Kenya (GoK) through the Ministry of Agriculture, Livestock and Fisheries (MALF), with funding by the International Development Agency (IDA-World Bank Group) is therefore implementing the Kenya Climate-Smart Agriculture Project (KCSAP). This projects objective is to increase agricultural productivity and build resilience to climate change risks in targeted smallholder farming and pastoral communities in Kenya, and in the event of an eligible crisis or emergency, to provide immediate and effective response. This Climate Risk Profile has been conducted within the framework of KCSAP and aims to inform county governments and stakeholders on the climate change risks and opportunities for agriculture so they are able to integrate these perspectives into county development."},{"index":3,"size":134,"text":"This document presents the Climate Risk Profile for Kisumu County which has a climate vulnerability index of 0.448 1 , a region where more than 5,000 people are affected annually by floods (particularly in the months of April to June and October to November), due to damages caused to properties and agricultural crop losses of 80-100%. In the Kano plains, yearly flood-related losses are estimated at US$ 850,000 (Masese et al, 2016), while relief needs amount to US$ 600,000. Such events represent major barriers to food security and poverty alleviation efforts in the County. As precipitation is likely to increase in intensity and unpredictability and flood risks are expected to become imminent in the future, concerted measures to increase the resilience of the rural population to the adverse effects of climate change are required."},{"index":4,"size":162,"text":"The profile is organised into six sections, each reflecting an essential analytical step in understanding current and potential adaptation options in key local agricultural value chain commodities. The document first offers an overview of the county's main agricultural commodities key for food security and livelihoods as well as major challenges to agricultural sector development in the county. This is followed by identification of the main climatic hazards based on the analysis of historical climate data and climate projections including scientific assessment of climate indicators for dry spells, flooding and heat stress among other key climate hazards for agriculture. The document continues with an analysis of vulnerabilities and risks posed by the hazards on the respective value chains. Based on these vulnerabilities, current and potential on-farm adaptation options and off-farm services are discussed. The text also provides snapshots of the enabling policy, institutional and governance context for adoption of resilience-building strategies. Finally, pathways for strengthening institutional capacity to address climate risks are presented."}]},{"head":"Foreword","index":2,"paragraphs":[{"index":1,"size":9,"text":"1 The national climate vulnerability index average is 0.4317.http://hdr.undp.org/sites/default/files/knhd_report_2013.pdf"}]},{"head":"Economic relevance of farming","index":3,"paragraphs":[]},{"head":"Agricultural context","index":4,"paragraphs":[{"index":1,"size":62,"text":"The County is home to the third largest city 2 in Kenya, Kisumu, and covers a total land area of 2085.9 square kilometres (km 2 ) 3 (GoK, 2012). It is bordered by Homa Bay County to the South, Nandi County to the North East, Kericho County to the East, Vihiga County to the North West and Siaya County to the West."},{"index":2,"size":125,"text":"Agriculture plays a major role in the economic growth and development of the County, contributing 47% to household income. Slightly less than two thirds (62%) of all households in Kisumu County 4 depend on crop farming for their livelihoods (GoK, 2012). On average, agricultural income amounts to 82,482 Kenyan shillings (KES) per household per year and is generated from crop faming (40% of on-farm income), fish (23%), and livestock (11%). Female-headed households normally earn more income compared with the male-headed ones, as women tend to diversify their activities, are more actively involved in farmer groups and cooperatives, and engage in high-value crops production (GoK, 2014). The agricultural sector also provides raw materials to the manufacturing sector and therefore stimulates non-farm incomes and employment (GoK, 2012)."},{"index":3,"size":100,"text":"The main subsistence crops include maize, sorghum, rice, bean, finger millet, cassava, potato, groundnut, and kale (GoK, 2014). In 2012, major food crops produced in the County were valued at approximately KES10 billion; maize was the highest contributor, accounting for 56% of the total food crops' value (KES5.7 billion), followed by sorghum (KES1.9 billion, equivalent of 20% of the total food crops value), and beans (KES 1.4 billion, 14.6%) (GoK, 2014). Key cash crops cultivated in Kisumu are sugarcane 5 , rice 6 , and cotton 7 , all of which generated approximately KES10.5 billion in 2012 8 (GoK, 2014)."},{"index":4,"size":83,"text":"Fishing is one of the key economic activities in Kisumu County, especially around Lake Victoria. With the introduction of aquaculture, households have been increasingly investing in pond construction and maintenance. There are over 1,330 fish farms, 3,275 fishermen, and 189 fish farm families in the County. The most common fish include omena, tilapia, and Nile perch, which generate incomes of KES12 million, 28 million, and 11 million per year, respectively. The fish is sold locally 9 and also processed for export (GoK, 2013)."},{"index":5,"size":63,"text":"In 2013, livestock production generated KES1.5 billion (GoK, 2014). On average, 93% of the households in Kisumu County rear chicken, 47% keep cattle, and 39% keep goats and, 24% hold sheep. Some of the main non-agricultural (informal) activities in the County include boda boda 10 (especially in Kisumu City), small-scale trading (shop vendors), tourism , and, to lesser extents, recreational sailing and fishing."},{"index":6,"size":81,"text":"In 2009, Kisumu County had a population of 968,909 people 12 , 35% of whom were categorized as youth (15-29yrs). The County's total population is expected to increase by 13.4% by the end of 2017, totalling 1.1 million people 13 . Roughly 70% of the people live in rural areas, most of whom are women; rural-to-urban migration is particularly high among men, who move to urban centres such as Kisumu, Ahero, Maseno, Chemelil, Muhoroni, and Awasi, in search for off-farm jobs."},{"index":7,"size":47,"text":"Literacy levels are fairly high in Kisumu County, where 82% of the population can read and write. However, poverty remains pervasive in both urban and rural areas 14 . The poverty index has been estimated at 40% 15 (GoK, 2012) and is closely tied to HIV and"}]},{"head":"People and livelihoods","index":5,"paragraphs":[{"index":1,"size":5,"text":"2 Following Nairobi and Mombasa."},{"index":2,"size":38,"text":"3 Area under water in Kisumu County is equivalent to 567 km 2 . 4 A typical household in Kisumu County has 6 members (GoK, 2014). There are approximately 226,000 households in the County (GoK, 2012(GoK, , 2009))."},{"index":3,"size":24,"text":"5 Predominantly grown in the lower midlands (Maseno, Muhoroni and Miwani 6 Grown especially along the Rivers Nyando and Awach, Chemelil, Miwani and Kibos."},{"index":4,"size":51,"text":"7 Cultivated mainly in Kadibo and Nyando. 8 KES9, 956 million from sugarcane, KES400 million from coffee, and KES123 million from cotton production. 9 Within and outside the county 10 Refers to transportation services using motorbikes and bicycles. The activity is especially common among male youth in urban and rural areas."},{"index":5,"size":48,"text":"11 Tourism is mainly developed around Lake Victoria, Ndere Island National Park, the Kisumu Impala Sanctuary in Kisumu City, the National Museum in Kisumu and Songhor Paleontological Site in Muhoroni. Others are the viewpoints in Nyabondo, the Luanda Magere site in Miwani and Kit Mikayi in Kisumu West."},{"index":6,"size":20,"text":"12 The youth represent 35% of the total population and they contribute significantly to the labor force in the County."},{"index":7,"size":12,"text":"13 Average national population growth rate is estimated at 3.1% per year."},{"index":8,"size":16,"text":"14 Incidence of poverty is slightly higher in the cities (70%), compared with rural areas (63%)."},{"index":9,"size":18,"text":"15 For the same year, the national poverty index was estimated at 45%, representing almost 17 million people. "}]},{"head":"Agricultural activities","index":6,"paragraphs":[]},{"head":"Agricultural value chain commodities","index":7,"paragraphs":[{"index":1,"size":15,"text":"22 This zone overlaps with the upland e.g. Nyakach and midland e.g. Muhoroni topographical zones."},{"index":2,"size":34,"text":"23 Value chain commodities are considered more resilient if they are able to withstand climate conditions, given the current production systems and holding other aspects constant (including variations in technology adoption rates among farmers/pastoralists)."},{"index":3,"size":20,"text":"24 The category of \"poor\" people was based on workshop participants' perceptions and not on a specific poverty measuring standard."},{"index":4,"size":13,"text":"25 Includes cattle and local chicken and crops such as maize and sorghum."}]},{"head":"Leafy cowpea","index":8,"paragraphs":[{"index":1,"size":116,"text":"Cowpea, known as boo by the locals, is a key staple food and livelihood source in Kisumu County. Its leaves are boiled and served as a side-dish to maize meal (ugali) and other starchy foods, such as cassava. Dried cowpea leaves are sometimes stored for use in the dry season, when fresh leaves are unavailable. Between 2012 and 2013, the area under cowpea production in Kisumu County reduced by two thirds (66%), from 3,880 ha to 1,304 ha; so did total production, which experienced decreases by 32%, from 19,400 tonnes to 13,184 tonnes during the same time period. In 2014, the cowpea area increased slightly to 1,462 ha, while yields remained low (9-10 bags/ha) (GoK, 2015)."},{"index":2,"size":120,"text":"Little information is available on the leafy vegetable varieties, since most research has focused on the grain cowpeas. However, some common varieties include K80, M66, and KVU 27-1.Cowpea is commonly cultivated by small-scale, resource-constrained farmers in various AEZs, including LM2 (in Nyakach areas), where the crop is grown under small, mixed farming systems 25 ) and LM3, where cowpea is cultivated on large scale, commercial, and mixed farms (includes Crops are usually stored in the houses, traditional onfarm granaries and cribs, but also at off-farm facilities, such as the National Cereals and Produce Board (NCPB) in Kisumu. Some farmers have established or joined farmer groups and cooperatives for bargaining power, yet the majority of the farmers sell the surplus individually."}]},{"head":"Sorghum","index":9,"paragraphs":[{"index":1,"size":80,"text":"Sorghum is widely cultivated throughout the entire County, given the crop's resilience to climate shocks. Despite decreases in cultivated area between 2012 and 2014 (from 11,645 ha to 11,082 ha), total production increased by 65%, from 131,370 tonnes to 225,150 tonnes over the same period (GoK, 2015). This could be attributed to the changing of crop types (from staples such as maize) as an adaptation to a changing climate and the food and nutritional security provided by the sorghum crop."},{"index":2,"size":65,"text":"Sorghum production occurs mostly under smallscale, subsistence, mixed farming systems. While seed supply is generally ensured by local agro dealers, many farmers still recycle the seeds. Institutions such as KALRO and the African Biodiversity Conservation and Innovation Centre (ABCIC) have played an important role in developing and disseminating new crop varieties that are better adapted to climate variability and shocks, including KARI Mtama-4 and Seredo."},{"index":3,"size":12,"text":"Very few farmers afford the use of fertilizers to grow the crop."},{"index":4,"size":122,"text":"Processing and bulking is mostly within the households, using Purdue Improved Crop Storage (PICS) bags. Sorghum is dried in an open environment to minimize aflatoxin contamination and to avoid heaping and dumping of wet sorghum heads, which can enable the growth of mycotoxin-producing fungi and ultimately lead to post-harvest losses. Some farmers also use silos of the cereal board (NCPB) Kisumu City. There are no active cooperatives to support collective marketing of sorghum; however Jubilee National Produce Board Cassava constitutes a key source of dietary energy for low-income consumers and provides a stable food base in drought-prone areas. Small amounts of the crop are used as agro-industrial livestock feeds and for starch production. For human consumption, roots are boiled or eaten raw."},{"index":5,"size":116,"text":"Cassava is mainly grown in Ahero, Miwani and Rabuor regions (LM3), but also in the areas of Maseno (UM1, UM2) where mixed, commercial, and mediumscale production systems prevail. Approximately 41-60% of the population is involved in the cassava value chain. The area under cassava production and the total quantity of the crop produced decreased slightly between 2012 and 2014 26 , while yields have shown an increasing trend, from 10 tonnes/ha to 11 tonnes/ha over the same period (GoK, 2015). Cassava commercialization is limited and only a few processors are available; however industries such as textiles, pharmaceuticals, brewery, paper and paper board manufacturers, adhesives, and dry cell manufacturers could be potential outlets for cassava by products."},{"index":6,"size":77,"text":"Farm Africa has introduced new early-maturing, disease-and drought-tolerant varieties of cassava. They have also invested in training farmers in Nyando on the management of the new variety so that they could further disseminate the knowledge. The Community Rehabilitation and Environmental Protection (CREP) Programme promotes the use of improved cassava seeds (MM96/0183, MYGERA, SS4, TM14, UKNOWN 1&2) as a component of its food security package. On its part, KALRO has been active in promoting clean and certified varieties."},{"index":7,"size":65,"text":"Planting occurs mainly during the long rains (February/ March) and maturity is reached after 8-12 months. Farmers rely heavily on the extension advice offered by public and private actors such as the Department of Agriculture (DA) and Farm Africa. While some farmers receive trainings on input management through the Kenya Organic Agriculture Network (KOAN), others many still use inorganic fertilizers for growing their cassava crops."},{"index":8,"size":25,"text":"Many cassava growers chip and dry the crop 27 as a measure to reduce post-harvest losses, others areas such as Ahero, Rabuor, Onjiko, Miwani, Awasi)."},{"index":9,"size":27,"text":"The crop thrives with minimal or no fertilizer and it is not labour-intensive. Even though it grows best with consistent and well-distributed irrigation, cowpea is heat-and drought-tolerant."},{"index":10,"size":87,"text":"Cowpea seeds are readily available on local markets, and most farmers use family labour, ox plough and simple farm tools (hoes) for growing and harvesting the crop. The crop is collected, bulked, and later transported to various market centres across the county, such as Katito, Sondu, Ahero, Chemilil, Holo, Maseno, Awasi, and Pap Onditi. In the absence of cooperatives that can support the commercialization of cowpea in the County, farmers have established groups to facilitate links with buyers, negotiated pricing, and selling of products (leaves and peas)."},{"index":11,"size":20,"text":"in Awasi is a major retailer of sorghum produce. Other towns with vibrant market centres include Katito, Ahero and Sondu."}]},{"head":"Cassava","index":10,"paragraphs":[{"index":1,"size":73,"text":"process it into flour or turn the peeled roots into dried fermented or unfermented chips, adding value to the product. Crisps, chapatis, and mandazis contribute to the consumer's nutrition and contributes to greater consumption of the crop. This value chain has received considerable support (new disease tolerant varieties with high yields, teaching value addition) from farmer groups (such as Kamicha Kabondo) and other public actors (DA, KALRO) when it comes to product commercialization."},{"index":2,"size":1,"text":"The "}]},{"head":"Chicken (local)","index":11,"paragraphs":[{"index":1,"size":41,"text":"Access to safe water for human consumption and agriculture constitutes a major challenge for the population in Kisumu County. As per the latest census, less than one percent of the households had access to piped water in their dwellings and another"},{"index":2,"size":21,"text":"Agricultural sector challenges 31 Sporadic pasture conflicts along Chemase-Chemelil border have resulted in deaths, displacements of people, and destruction of properties."},{"index":3,"size":26,"text":"32 The disease is transmitted through ticks during the rainy seasons, when increased vegetation boosts the prevalence of ticks. This is a County-wide menace to livestock."},{"index":4,"size":19,"text":"33 Especially around areas of Nyakach, areas in adjacent to the lake in Nyando Sub-county, Seme and Kisumu East."},{"index":5,"size":138,"text":"seven percent had to acquire piped water elsewhere (GoK 2013). A large proportion 41.7% rely on springs wells and boreholes while 37.6% fetch their water from the streams, 7.9% from ponds. In spite of many water sources most are unsuitable for drinking, due to the high concentration of pollutants from effluent discharges from factories (especially along Nyando River), sediment loading from upstream farms, and siltation 29 . This situation is exacerbated during the rainy season, when flooding affects the quality of water sources (especially in Nyando, Nyakach, and Muhoroni areas), causing damages to crops and properties and increasing the risk of waterborne diseases 30 . During the dry spell, some water sources dry up, compelling inhabitants (especially women and children) to travel even longer distances to fetch the water. This also drives conflicts among water users 31 . "}]},{"head":"Climate change-related risks and vulnerabilities","index":12,"paragraphs":[{"index":1,"size":134,"text":"Climate change and variability: historic and future trends stress is also expected to increase significantly under both scenarios, the number of days with a mean temperature above 35°C in the second season being particularly affected and expected to rise from an historical average of just under 10 days to over 15 days under the conservative emissions scenario and 20 days under the high emissions scenario. These changes represent an increase in the number of heat stressed days by approximately 50% and 100% respectively. Under the low emissions scenario rainfall quantity and intensity are expected to increase along with an increase in flood risk 35 in both the first and second season; however under the high emissions scenario the projection is for an overall decrease in the amount and intensity of rainfall in both seasons."},{"index":2,"size":39,"text":"Although the projections of future climate change under the two GHG emissions scenarios show some differences, both indicate the likelihood of significant changes in the weather and climate of the county with probable impacts on crop and livestock production.  "}]},{"head":"Leafy Cowpea","index":13,"paragraphs":[{"index":1,"size":96,"text":"Sorghum long. This leads to poor germination of the seeds/ planting material, rotting of the planting materials, and also increases higher demand and costs for labour and even mechanization. Given the high moisture content, the incidence of aflatoxin in the post-harvest stage increases, as the likelihood of post-harvest pests and diseases is higher. Lower quality and quantity of sorghum drives prices down, affecting sales and incomes 40 . Children are particularly affected by crop failure and post-harvest losses, as sorghum is a key staple food for the population and a main nutrition source for most households."},{"index":2,"size":44,"text":"Erratic seasonal rainfall and failure of grain crops have spurred the interest of many farmers in looking into cassava production, as a viable alternative to sustaining their livelihoods. Cassava has high risk aversion potential, being able to grow under harsh soil and weather conditions."},{"index":3,"size":64,"text":"However, the uncertainty of season (onset and duration) affects land use planning, preparation, and seed supply, with spill-over consequences on the other value chain stages. Moreover, extreme rainfall may have detrimental effects on land preparation due to soil erosion, but also on labour needs for weeding activities, as rains increase the frequency and quantity of weeds that compete with the crop for soil nutrients."},{"index":4,"size":78,"text":"The farmers in the low-lying areas of the Kano Plains, Nyando, and lower Nyakach are more vulnerable due to the risk of flooding than the farmers in the highlands of Nyakach Koguta, Kajulu and the midlands in Maseno. Heavy rainfall also affects the accessibility of the already poor road network, limiting the availability of seeds and thus driving prices higher. Delivery of extension services is also affected, as officers are unable to physically reach the farmers on time."},{"index":5,"size":83,"text":"In the post-harvest stage, incidences of moulding are quite frequent, requiring additional time for cleaning and drying of harvest. On the market, the competition between cassava crop and other crops with higher tolerance to excess rains (such as arrow roots) is high, reducing sales of cassava and hence affecting farm incomes. Some farmers are organized into groups (e.g. Kamicha Kabondo) and their vulnerability to fluctuating demand and prices is relatively lower, as they engage in collective bargaining and promotional activities during field days."}]},{"head":"Cassava Chicken (local)","index":14,"paragraphs":[{"index":1,"size":77,"text":"Increased temperatures trigger the incidence of Newcastle disease and infectious bursal disease (Gumboro disease), leading to declines in production and/or stock loss. Heavy rainfall causes significant damages to poultry housing structures and storage facilities, bringing about fowl typhoid, and coccidiosis, which increase the demand for and expenditures on vaccination and treatment. Such conditions are particularly common in the low-lying areas of Nyando and the Kano plains due to the frequency of flooding, hence increased incidences of diseases."},{"index":2,"size":75,"text":"Farmers linked to a cooperative (such as KICOPE) are more likely to acquire vaccination and feeds since they access the services as a group, while procure additional water, engage in water-harvesting techniques, and purchase and/or store supplementary feed for the poultry. In general, access to advisory services is challenged by poor road conditions in times of extreme rainfall, but also by reduced office hours of extension agents/ advisors, due to low human and financial capacity."},{"index":3,"size":49,"text":"As with other agricultural products, low quality meat and eggs result to low prices and incomes. The absence of any form of association also limits the farmers' ability to sell their goods. Reliance on social media, television, and radio for obtaining market information becomes the sole option for many."}]},{"head":"Adaptation to climate change and variability","index":15,"paragraphs":[]},{"head":"On-farm adaptation practices","index":16,"paragraphs":[{"index":1,"size":166,"text":"In response to some of the previously mentioned challenges, farmers in Kisumu County have come up with a wide range of on-farm adaptation measures to increase the resilience of their production systems and livelihoods to a changing, unpredictable climate. These strategies include soil management and conservation practices (staggered cropping, green manure, composting, ploughing back of the organic material), promotion of drought-tolerant varieties 41 of traditional crops (sorghum, cassava, green grams sweet potatoes), intercropping with legumes (maize and sorghum in Stopamba, Nyakach), and also water conversation practices (rainwater harvesting and storage to enable use during the dry spell, water pans, and irrigation infrastructure); smallholder irrigation schemes are currently extended over a total of 6,000 ha of land. According to ASDSP household report, the main adaptation strategies used were; tree planting (31%), changing the crop type (27%), practising staggered cropping (19%), and water harvesting (12%). However, male and youth headed 42 households tend to practice tree planting more while women do staggered cropping and changing of crop types."},{"index":2,"size":154,"text":"In addition, to prevent post-harvest grain loss that occurs due to inadequate harvest times, insufficient drying of crop, or inadequate handling, farmers now benefit from post-harvest storage technologies (PICS improved storage bag, use of Actellic Super Dust) that allow storage of grain for longer periods (often for several months), until selling becomes profitable (One Acre Fund 2014). The use of PICS bags has helped lower pesticides usage, ensure higher quality and quantity of stored grain, and facilitate access to higher market prices (One Acre fund 2014). Many farmers also apply traditional knowledge to cope with crop stresses; for instance, they use ash as a natural insecticide to fight against pests and diseases in grains and store their produce on timber platforms above the ground, to prevent absorption of moisture. 50 This paid for service (warehouse receipt system) allows the farmers to deposit the receipts with banks (e.g. Equity Bank) for cash loans or credit."},{"index":3,"size":94,"text":"nurseries (currently at 22) 46 , offering great potential to improve the forest cover 47 , but also to enhance women's livelihoods, as they own more than half of the nurseries in Lower Nyando. Bee keeping has been used as a key diversification activity, especially by farmers whose crops or livestock are very exposed to climatic risks. Through Phase II of the Lake Victoria Environmental Management Project (LVEMP II), bee keeping has been introduced as an income-generating activity among six farmer groups in Kajulu areas. This project offers financial support to these farmer groups."},{"index":4,"size":44,"text":"Through the asset financed solar irrigation pumps for small holder farmers' project various agro dealers are engaged in the distribution of solar powered irrigation 48 pumps for horticultural farmers. This helps them to reduce reliance on fossil fuels and maximise on their profit margins."},{"index":5,"size":106,"text":"In Agricultural extension officers also provide trainings and on-farm demonstrations on sustainable land management practices such as intercropping, conservation agriculture, terracing, water harvesting, composting, and agro-ecological crop selection. Many male-and female-headed households rely on traditional indigenous knowledge to plan their agricultural activities (GoK, 2014). Most farmers have organized themselves into farmer groups especially based on their crop and/or livestock farming systems (affiliated to Friends of Katuk Odeyo [FOKO] 49 ), to establish cereal banks e.g. the off-farm sorghum storage facility set up in the NCPB warehouse in Kisumu city. This service 50 allows farmers to cushion themselves from possible postharvest losses caused by poor grain handling."},{"index":6,"size":109,"text":"Information regarding markets and marketing channels is weak and insufficiently available throughout the County and across value chains. The most welldeveloped and better organized cooperatives are KICOPE and KIPOTRA, who offer market information Policies, programmes, strategies and action plans are key considerations for agriculture decision making, since they affect actions and outcomes related to resource use. Kisumu County implements a wide range of policies ranging from the international conventions, to national statutes to the local policies 52 . These policies are implemented by key institution in the line ministry of the specific policies, the decentralization of the decision making is a pro in the effective implementation of these policies."},{"index":7,"size":106,"text":"Kenya is a signatory to United Nations Framework Convention on Climate Change (UNFCCC) since 2005 and the DGECC is commissioned to ensure that Countylevel operations are aligned with the commitments framed under the UNFCCC. DGECC ensures alignment through the institution of the low carbon, it engages in advocacy and awareness in the adaptation towards the green energy and the reduction of the pollution to reduce on the greenhouse gas emission 53 . However, some of the challenges faced in the implementation of this policy is the inaccessibility of the funds from the treasury as the recurrent budget is minimal thus curtailing the implementation of the policy."},{"index":8,"size":112,"text":"The country's development programme, Kenya Vision 2030, identifies agriculture as one of the main sectors to deliver the 10% annual economic growth rate envisaged under the economic pillar. Key to this growth, is the transformation of smallholder agriculture from subsistence to an innovative, commercially oriented and modern agricultural sector. This has been achieved in Kisumu through, production of enough raw materials for the industries and conserving the agricultural base. Kisumu County is also a beneficiary to the Kenya Climate Smart Agriculture Project (KCSAP) that will provide opportunities for upscaling climate smart agricultural activities, strengthening climate smart agricultural research and seed system, supporting agroweather, market, climate, and advisory services, project coordination and management. "}]},{"head":"Policies and Programmes","index":17,"paragraphs":[{"index":1,"size":25,"text":"to their members and facilitate them access to buyers. Farmers outside such groups remain deprived of such marketing opportunities and their incomes are visibly affected."},{"index":2,"size":132,"text":"Insurances for crops, livestock, and fisheries are underutilized services in the County. They are facilitated by the Kenya Commercial Bank (KCB) and Equity Bank, which offer financial insurances against floods, fire, drought, excessive rainfall, pests and diseases, frost, and hailstorms. However, very few farmers are aware of the availability of such instruments and even fewer are able to afford 51 them since they do not have enough capital to cover the agricultural insurance. Financial institutions such as banks and the Agricultural Finance Corporation (AFC) offer agricultural credits and loans, especially for horticulture, beekeeping, dairy goat and cattle value chains, at interest rates that vary between 10% for farmers and 15% for agribusinesses. Yet most products are unsuitable for those farmers who cannot demonstrate ownership of the land or credits and loans history."},{"index":3,"size":42,"text":"51 Most insurers would want farmers to provide collateral (land, premium subsidies) as part of a safety net 52 The local policies are however in draft form. The international and the national laws are domesticated to meet the needs of the county."},{"index":4,"size":21,"text":"53 Through the community climate change committee in each of the sub counties. Each village has a climate change resource person."},{"index":5,"size":70,"text":"56 By mid-2016 this project had more than 5 million beneficiaries with access to improved cooking facilities and 180,000 people with had access to electric power due to the small solar power systems. It is estimated that 640,000 tons of CO2 was prevented saving more than 0.5 million tons of firewood. 64 KFS has a central nursery and sells tree seedlings at a subsidized price, starting with KES12 per tree."},{"index":6,"size":77,"text":"umbrella organization, which represents the interests of Kenyan farmers (approximately two million families) through focused lobbying, advocacy, and targeted capacity building. In Kisumu, KENAFF is engaged in developing trainings for farmers and community members on soil management, tree planting, and avoiding deforestation, in publishing quarterly magazines on agriculture and forestry-related issues, and in monitoring impact of their trainings through farm visits. However, insufficient funding and human capacity limits the role and impact of KENAFF in the County."},{"index":7,"size":66,"text":"Community The GECCD was initiated by the Governor of Kisumu County as a local governmental structure to promote a clean environment and encourage the reduction of GHG levels in the County. The initiatives run by GECCD include school feeding programme using biogas and the green energy hospital in Lower Kolwa. However, there are challenges that curtail its operations such as accessibility of funds from the treasury."},{"index":8,"size":70,"text":"As discussed in previous sections, a couple of financial institutions provide credit facilities and crop and livestock insurance to farmers, including the Equity Bank, Cooperative Bank, KCB, national banks, and AFC. However, awareness about the availability of such services among farmers is relatively low and capacity to access them is constrained by limited ownership of resources (especially land), low incomes, and no or limited credit history for most smallholder farmers."}]},{"head":"Synthesis and Outlook","index":18,"paragraphs":[{"index":1,"size":167,"text":"Climate change impacts have differentiated effects on natural and human systems. Some regions in Kisumu County, such as Miwani and Ombey, the Nyando basin, and the Kano plains, are highly exposed to the adverse effects of floods, while agricultural production in other areas is threatened by prolonged dry spells, higher temperatures and heat stress, including Nyakach, Seme, and Nyando regions. Small-scale farmers depending on rain fed farming for their livelihoods and with limited opportunities to acquire inputs and financial assets are unequipped to fight the negative consequences of climate change and are thus by far the most vulnerable groups. Especially for the Children Headed Households as a result of the loss of their guardian and parents to HIV/AIDS. Hence, silver bullet solutions to the climate-related challenges are counter-productive and unpropitious; measures to manage climate risks need to be tailored to very specific contexts and to take into account existing needs and capacities, in order to be viable and to maximize benefits for the people and the environment."},{"index":2,"size":136,"text":"A value chain approach sets the stage for more integrated responses to climate risks; it allows for a better understanding of the vulnerabilities (weaknesses) and capacities (opportunities) of individuals and groups engaged in different economic stages of the production system to tackle climate challenges. Moreover, such an approach offers the opportunity to look beyond the products, to the processes that are essential for comprehensive climate risk management, including value chain governance, information and service provision, value addition, and market access, among others. In Kisumu County, the emphasis on postproduction adaptation measures remains narrow. Most resilience-building strategies are found at farm level and are closely tied to the socio-economic and cultural context of each household. Where they already exist, off-farm services are oftentimes limited in coverage or insufficiently coordinated to provide meaningful and timely support to farmers. "}]}],"figures":[{"text":"34 The two RCPs, RCP2.6 and RCP8.5, are named after a possible range of radiative forcing values in the year 2100 relative to pre-industrial values (+2.6 and +8.5 W/m2, respectively). The pathways are used for climate modelling and research. They describe two possible climate futures, considered possible depending on how much greenhouse gases are emitted in the years to come. RCP 2.6 assumes that global annual GHG emissions (measured in CO2-equivalents) peak between 2010 and 2020, with emissions declining substantially thereafter. In RCP 8.5, emissions continue to rise throughout the 21st century.35 Indicated by the maximum 5-day running average precipitation in mm/day 36 More exactly, it refers to the long rains (March-April-May) and their late onset at the end of March and early onset in mid-February. 37 A testimonial from a sorghum farmer in Stopamba Nyakach Sub county.38 Sporadic cattle rustling along the Nyakach-Nandi border and also the disputed boundary have resulted to conflicts between the Kalenjin and Luo community especially due to the discovery of potential oil deposits in Nyakach and Kericho. "},{"text":" The county has two rainfall seasons, the first from March to May and the second from November to December. Mean annual rainfall in the county is mostly in the range of 1200 to 1500mm. However some areas do receive mean annual rainfall of above 1500mm. The climate and weather of Kisumu is largely modified by its location on the shore of the Winam Gulf of Lake Victoria, which results in high humidity all year round. Kisumu County has a relatively warm and humid  Kisumu County has a relatively warm and humid climate all year round with mean annual temperatures  climate all year round with mean annual temperatures being predominantly in the range of 21°C to 23°C in  being predominantly in the range of 21°C to 23°C in most parts of the county, except for a few pockets in  most parts of the county, except for a few pockets in the south and east where mean annual temperatures  the south and east where mean annual temperatures are below 21°C and a few pockets in the central parts  are below 21°C and a few pockets in the central parts where mean annual temperatures are between 23°C  where mean annual temperatures are between 23°C and 24°C. Analysis of temperature trends in the county over  and 24°C. Analysis of temperature trends in the county over 25 years (1980 to 2005), showed that although  25 years (1980 to 2005), showed that although mean second season temperatures have remained  mean second season temperatures have remained relatively constant, there has been a significant  relatively constant, there has been a significant increase of approximately 0.5°C in mean first season  increase of approximately 0.5°C in mean first season temperatures. Average annual rainfall, measured over  temperatures. Average annual rainfall, measured over a 35-year period (1980-2015), has also increased in  a 35-year period (1980-2015), has also increased in both seasons. However the increase has been more Land tenure and management is another challenge to both seasons. However the increase has been moreLand tenure and management is another challenge to pronounced in the second season. The increase in agricultural production in the County. In the absence of pronounced in the second season. The increase inagricultural production in the County. In the absence of second season rainfall has been accompanied by an clear title deeds and land delimitations, open grazing second season rainfall has been accompanied by anclear title deeds and land delimitations, open grazing increase in the length of the growing season, and a is a common practice, causing damages and even increase in the length of the growing season, and ais a common practice, causing damages and even slight decrease in the number of heat stress days. The losses to crops due to animal interference. Moreover, slight decrease in the number of heat stress days. Thelosses to crops due to animal interference. Moreover, first season on the other hand has not had a significant population growth and cultural inheritance norms have first season on the other hand has not had a significantpopulation growth and cultural inheritance norms have change in season length, drought stress or the number led to further pressure on natural resources, leading to change in season length, drought stress or the numberled to further pressure on natural resources, leading to of heat stress days but has experienced a reduction in high land fragmentation that threatens the economic of heat stress days but has experienced a reduction inhigh land fragmentation that threatens the economic flood risk. efficiency of agricultural production systems of most flood risk.efficiency of agricultural production systems of most  farmers. farmers. Looking ahead to the period 2021-2065, climate  Looking ahead to the period 2021-2065, climate projections based on two representative concentration Access to markets becomes especially difficult during projections based on two representative concentrationAccess to markets becomes especially difficult during pathways (RCPs 34 ) indicate that under both scenarios the rainy season, due the poor road infrastructure pathways (RCPs 34 ) indicate that under both scenariosthe rainy season, due the poor road infrastructure there is expected to be a moderate decrease in the that gets affected by rains and floods. Moreover, for there is expected to be a moderate decrease in thethat gets affected by rains and floods. Moreover, for length of both growing seasons as well as a large not being part of cooperatives and group structures, length of both growing seasons as well as a largenot being part of cooperatives and group structures, backward shift in the start of the second growing farmers lose their bargaining power to intermediaries backward shift in the start of the second growingfarmers lose their bargaining power to intermediaries season by as much as 50 days from a historical start and brokers, since they are unable to fetch good season by as much as 50 days from a historical startand brokers, since they are unable to fetch good day at 240 to as late as day 295 under RCP8.5. Heat prices for their products, to access credit, and pool day at 240 to as late as day 295 under RCP8.5. Heatprices for their products, to access credit, and pool  resources for value addition. Despite the existence of resources for value addition. Despite the existence of  "},{"text":"Past and future impacts of climate hazards in Kisumu Farmers The effects of climate change and variability are already faced by most farmers in Kisumu County. They report overall poor distribution and higher variability and unpredictability of rains (including late onset 36 of rains in 2016 and early onset in 2017), affecting the plants' growing season, as well as increased cases of floods in Miwani and Ombei, the Nyando basin, the Kano plains, the lower Nyakach areas, and Kisumu East. \"Having been a farmer all my life, I have seen first-hand how climate variability has affected the maize production, we used to have two robust seasons every year now we have one and have resulted to planting drought tolerant crops such as sorghum 37 .\" Higher temperatures and heat stress, prolonged dry spell in areas of Nyakach, Seme, Nyando, stronger winds, have also become more regular, in their opinion. Soil degradation, drying of wells and rivers, and reduction in water volumes are some of the many environmental challenges that constantly hit already vulnerable farmers (GoK 2014). All these combined have brought about new weeds, pests and diseases, have reduced sizes of pastures and spawned conflicts over land resources 38 , caused crop failures, and increased food insecurity and even costs of living in the area. in Kisumu County are heavily reliant on rain fed agriculture and thus extremely vulnerable to climate change and variability. The frequency and severity of climate shocks such as drought, floods, and heat stress; the uncertainty related to the start of the growing season and the duration of the growing periods affect key value chains and farmer groups in differentiated ways, as discussed in the sub-sections below. conditions of the crop. Cowpea is heat-tolerant, yet germination rates can be low if soil moisture is insufficient at early stages of the planting cycle, causing low crop productivity. Extreme rainfall conditions are also detrimental, as the crop cannot survive in waterlogged soils. In Kisumu County, soils are susceptible to erosion and soil nutrients leaching, which can greatly affect the overall crop's growth. The low-lying areas of Kano plains, Lower Nyakach and some parts in Muhoroni are more flood prone than the highland areas of Nyakach Koguta and the midland areas of Maseno. Climate vulnerabilities across agriculture  Climate vulnerabilities across agriculture value chain commodities  value chain commodities Uncertainty of season (onset and duration) affects  Uncertainty of season (onset and duration) affects land preparation and management and subsequently  land preparation and management and subsequently changes the growing Crop rotting during storage or transportation is Climate Perceptions by the farmers changes the growing Crop rotting during storage or transportation isClimate Perceptions by the farmers also common, if moisture levels are too high. This  also common, if moisture levels are too high. This renders low-quality marketing output and lower  renders low-quality marketing output and lower prices for the farmers, especially under conditions  prices for the farmers, especially under conditions where smallholders' bargaining power is undermined  where smallholders' bargaining power is undermined by intermediaries, in the absence of established  by intermediaries, in the absence of established associations and cooperatives.  associations and cooperatives. Apart from decreases in the length of the growing  Apart from decreases in the length of the growing season 39 that trigger pre-harvest sprouting, extreme/  season 39 that trigger pre-harvest sprouting, extreme/ increased rainfall is particularly disturbing for  increased rainfall is particularly disturbing for sorghum. This leads to soil erosion and water logging,  sorghum. This leads to soil erosion and water logging, affecting both crop growth and the infrastructure for  affecting both crop growth and the infrastructure for transportation of inputs (seeds) and outputs to the  transportation of inputs (seeds) and outputs to the market. Re-used seeds are likely to have increased  market. Re-used seeds are likely to have increased moisture content, which renders them unproductive.  moisture content, which renders them unproductive. The black cotton soils in the low-lying areas of Kano  The black cotton soils in the low-lying areas of Kano (Nyando Sub-county) are very prone to waterlogging  (Nyando Sub-county) are very prone to waterlogging (compared to loam soils), as they hold moisture for  (compared to loam soils), as they hold moisture for  "},{"text":"57 Partners include: Community Rehabilitation and Environmental Protection (CREP) Programme, Family Health Options Kenya (FHOK), Vi Agroforestry, and Osienala 58 It supports coordination and collaboration in these three areas as these three areas are interrelates and interdependent issues in the various departments in the county. However, County and have offered farmer trainings on improved of technical, commercial, and organizational capacities of constrained by insufficient funding and infrastructural issues in the various departments in the county. However, County and have offered farmer trainings on improvedof technical, commercial, and organizational capacities of constrained by insufficient funding and infrastructural there is need for adequate collaboration and coordination animal husbandry practices such as selective mating. the actors involved in producing, marketing and installing support (well-equipped laboratories, high-tech seed there is need for adequate collaboration and coordination animal husbandry practices such as selective mating.the actors involved in producing, marketing and installing support (well-equipped laboratories, high-tech seed The organization of the households into CSVs provides a improved cooking stoves, with a focus on promotion of storage banks) to carry out the planned interventions. The organization of the households into CSVs provides aimproved cooking stoves, with a focus on promotion of storage banks) to carry out the planned interventions. The Forest Act of 2005 embodies several innovative great opportunity for capacity development which should entrepreneurship. Apart from the stoves, EnDEV Kenya KMD generates seasonal forecasts based on analysis The Forest Act of 2005 embodies several innovative great opportunity for capacity development which shouldentrepreneurship. Apart from the stoves, EnDEV Kenya KMD generates seasonal forecasts based on analysis solutions to rehabilitate degraded sites and support have a strong component of engaging the youth, and the also promotes access to clean sources of lighting and basic of climate data and stakeholders' workshops, solutions to rehabilitate degraded sites and support have a strong component of engaging the youth, and thealso promotes access to clean sources of lighting and basic of climate data and stakeholders' workshops, national tree planting efforts, including a strong emphasis development of a selection and breed improvement. electricity services (such as mobile phone charging). The where indigenous weather forecasters and relevant national tree planting efforts, including a strong emphasis development of a selection and breed improvement.electricity services (such as mobile phone charging). The where indigenous weather forecasters and relevant on partnerships and the engagement of local communities. programme also explores the technological and economic departments are present. Through PSP, experts develop on partnerships and the engagement of local communities.programme also explores the technological and economic departments are present. Through PSP, experts develop However this has not fallen through due to lack of Other projects related to agriculture and climate change viability of power generation using biogas from agricultural an information dissemination plan that is usually However this has not fallen through due to lack of Other projects related to agriculture and climate changeviability of power generation using biogas from agricultural an information dissemination plan that is usually community participation , inadequate collaboration with implemented by the Kisumu county government through waste. implemented through the ASDSP Environmental community participation , inadequate collaboration with implemented by the Kisumu county government throughwaste. implemented through the ASDSP Environmental the county government, limited funding that hinders their the line ministries 60 include, among others: the \"Clean Resilience Office. KMD downscales national forecasts the county government, limited funding that hinders their the line ministries 60 include, among others: the \"CleanResilience Office. KMD downscales national forecasts interventions. seed\" programme to encourage the use of certified The Pambazuko New Dawn Lake Victoria project is a to the County level, disaggregating the data into three interventions. seed\" programme to encourage the use of certifiedThe Pambazuko New Dawn Lake Victoria project is a to the County level, disaggregating the data into three planting material, The \"Rehabilitation of the irrigation multi-partner 57 project that aims to improve the resilience County climatological zones and also builds capacity planting material, The \"Rehabilitation of the irrigationmulti-partner 57 project that aims to improve the resilience County climatological zones and also builds capacity CAP 364 Disease control is an act of parliament that schemes\" project, the \"Micro irrigation\" Project, The of vulnerable communities through the integration of of farmers to interpret and use weather forecasts, by CAP 364 Disease control is an act of parliament that schemes\" project, the \"Micro irrigation\" Project, Theof vulnerable communities through the integration of of farmers to interpret and use weather forecasts, by provides for the prohibition and the regulation of importation \"Excavation of water pans to conserve water and promote reproductive health and rights into sustainable development means of simple mobile phone applications. However, provides for the prohibition and the regulation of importation \"Excavation of water pans to conserve water and promotereproductive health and rights into sustainable development means of simple mobile phone applications. However, under section 8 of the subsidiary legislation. This subsidiary fertilizer use\" Project, the Project for restocking of the fish programming. The project targets vulnerable communities the number of Automated Weather Stations (AWS) under section 8 of the subsidiary legislation. This subsidiary fertilizer use\" Project, the Project for restocking of the fishprogramming. The project targets vulnerable communities the number of Automated Weather Stations (AWS) legislation informs the public of the notifiable disease ponds, The \"Improvement of the local Chicken\" Project, in Awasi and Nyangoma locations in Nyando Sub-is limited (only two AWS operate in the County), the legislation informs the public of the notifiable disease ponds, The \"Improvement of the local Chicken\" Project,in Awasi and Nyangoma locations in Nyando Sub-is limited (only two AWS operate in the County), the (Section 2). It provides for Animal Diseases (Compulsory The \"Apiculture\" project, etc. County and is implemented through Population Health costs of adequate equipment to measure precipitation (Section 2). It provides for Animal Diseases (Compulsory The \"Apiculture\" project, etc.County and is implemented through Population Health costs of adequate equipment to measure precipitation Rinderpest Vaccination) Rules of 1964. Where, all cattle and Environment (PHE) an integrated that recognizes (especially rain gauges 63 ) are high and funding to Rinderpest Vaccination) Rules of 1964. Where, all cattleand Environment (PHE) an integrated that recognizes (especially rain gauges 63 ) are high and funding to shall be immunized by a rinderpest vaccine approved by the Director of Veterinary Services and immunity shall be maintained by repeated vaccinations as considered necessary by the Director of Veterinary Services. The animal Governance, institutional resources, and capacity relationship in population 58 , health and population , approach by the Danish Family Planning Association (DFPA) and the Danish International Development Agency (DANIDA). The activities developed integrate health and cover such acquisitions and staff remuneration is limited, diminishing KMD's capacity to deliver on its objectives. Moreover, there is a tendency of implementing organisations collecting environmental/ shall be immunized by a rinderpest vaccine approved by the Director of Veterinary Services and immunity shall be maintained by repeated vaccinations as considered necessary by the Director of Veterinary Services. The animal Governance, institutional resources, and capacityrelationship in population 58 , health and population , approach by the Danish Family Planning Association (DFPA) and the Danish International Development Agency (DANIDA). The activities developed integrate health and cover such acquisitions and staff remuneration is limited, diminishing KMD's capacity to deliver on its objectives. Moreover, there is a tendency of implementing organisations collecting environmental/ vaccination program is spread across the county through environmental conservation initiatives to seek synergies climate data work independently and in isolation from vaccination program is spread across the county throughenvironmental conservation initiatives to seek synergies climate data work independently and in isolation from subsidized vaccination. The county government achieves In agriculture, the role of institutions can be related for greater conservation and human welfare outcomes. each other, often failing to produce and share data in a subsidized vaccination. The county government achieves In agriculture, the role of institutions can be relatedfor greater conservation and human welfare outcomes. each other, often failing to produce and share data in a through the revolving fund. Meat Control Cap 356 is also to the design of policies and investment frameworks, The project achieves this through clustering groups and coordinated, timely, and meaningful way. through the revolving fund. Meat Control Cap 356 is also to the design of policies and investment frameworks,The project achieves this through clustering groups and coordinated, timely, and meaningful way. an act of parliament that provides for licensing, control knowledge development and sharing, technological individual members to groups to work through model an act of parliament that provides for licensing, control knowledge development and sharing, technologicalindividual members to groups to work through model and regulation of slaughterhouses and for premises where development or the delivery of financial and non- farms and common interest groups for ease knowledge The KFS is a semi-autonomous government and regulation of slaughterhouses and for premises where development or the delivery of financial and non-farms and common interest groups for ease knowledge The KFS is a semi-autonomous government meat is processed in any manner for human consumption; financial incentives for agricultural investments sharing, capacity building and joint initiatives, mobilizing parastatal, implementing activities related to climate meat is processed in any manner for human consumption; financial incentives for agricultural investmentssharing, capacity building and joint initiatives, mobilizing parastatal, implementing activities related to climate health, sanitary and hygiene standard in slaughter houses (FAO, 2010). In Kisumu County, there are several and lobbying the stakeholders from the three sectors change, forestry, forest conservation, and ecosystem health, sanitary and hygiene standard in slaughter houses (FAO, 2010). In Kisumu County, there are severaland lobbying the stakeholders from the three sectors change, forestry, forest conservation, and ecosystem and meat processing premises: packing and labelling of institutions 61 actively involved in climate-related issues, to work in synergy for better coordination. Some of the conservation. In collaboration with the Kenya Forestry and meat processing premises: packing and labelling of institutions 61 actively involved in climate-related issues,to work in synergy for better coordination. Some of the conservation. In collaboration with the Kenya Forestry meat; storage and transport of meat. Other very key legal ranging from government actors and NGOs, to private impacts/ outcomes of the project include, realization of the Research Institute (KEFRI) in Maseno and other key meat; storage and transport of meat. Other very key legal ranging from government actors and NGOs, to privateimpacts/ outcomes of the project include, realization of the Research Institute (KEFRI) in Maseno and other key considerations include National Livestock Policy 2008, sector, community based organizations (CBOs) and interdependence on PHE by the beneficiary communities, stakeholders, KFS finances and monitors projects considerations include National Livestock Policy 2008, sector, community based organizations (CBOs) andinterdependence on PHE by the beneficiary communities, stakeholders, KFS finances and monitors projects National Irrigation Policy 2012 and Kenya Forest Policy cooperatives. greater appreciation for the need for environmental related to ecosystem conservation. KFS engages in National Irrigation Policy 2012 and Kenya Forest Policy cooperatives.greater appreciation for the need for environmental related to ecosystem conservation. KFS engages in 2015, conservation in view for its importance to health and tree planting 64 (such as the afforestation project in 2015,conservation in view for its importance to health and tree planting 64 (such as the afforestation project in KALRO, a governmental organization operating at sustainable development. Nyakach), provides extension services to farmers like KALRO, a governmental organization operating atsustainable development. Nyakach), provides extension services to farmers like In addition to these policies, several programs and on-the County level, is responsible for the promotion providing quality germplasm at subsidised rates and In addition to these policies, several programs and on-the County level, is responsible for the promotionproviding quality germplasm at subsidised rates and field operations aimed at addressing climate vulnerability and dissemination of knowledge and technological Scaling up Climate smart village models in East Africa project technical advisory. Even though the staff has technical field operations aimed at addressing climate vulnerability and dissemination of knowledge and technologicalScaling up Climate smart village models in East Africa project technical advisory. Even though the staff has technical have been put in place through the collaboration of local, development among relevant stakeholders. Together builds up on the previous CCAFS CSVs. It is a partnership and operational capacity, communities have shown have been put in place through the collaboration of local, development among relevant stakeholders. Togetherbuilds up on the previous CCAFS CSVs. It is a partnership and operational capacity, communities have shown international, public and private actors. Some of them are with its partners 62 , the institution supports the between research and development organizations and the strong resistance to KFS' tree planting initiatives, international, public and private actors. Some of them are with its partners 62 , the institution supports thebetween research and development organizations and the strong resistance to KFS' tree planting initiatives, discussed below. development of trials and on-farm demonstration Nyando rural community. They that have developed Climate-as community engagement in the planning and discussed below. development of trials and on-farm demonstrationNyando rural community. They that have developed Climate-as community engagement in the planning and plots for sustainable land and water management Smart Villages (CSVs) model to test local actions that ensure implementation of intervention has been minimal, plots for sustainable land and water managementSmart Villages (CSVs) model to test local actions that ensure implementation of intervention has been minimal, The Energising Development Programme (EnDEV) 56 is a and crop and livestock production practices, all food security, promote adaptation and build resilience to leading to destruction of household property by the The Energising Development Programme (EnDEV) 56 is a and crop and livestock production practices, allfood security, promote adaptation and build resilience to leading to destruction of household property by the global initiative to expand access of rural households to these targeted at farmers and staff in relevant local climatic stresses in Nyakach Sub County. This includes free ranging animals (in the absence of fences), or global initiative to expand access of rural households to these targeted at farmers and staff in relevant localclimatic stresses in Nyakach Sub County. This includes free ranging animals (in the absence of fences), or clean energy, with co-financing from the governments of departments. In Kisumu, KALRO Kibos focuses its testing of drought tolerant crop varieties and sustainable the replacement of indigenous trees with exotic, early- clean energy, with co-financing from the governments of departments. In Kisumu, KALRO Kibos focuses itstesting of drought tolerant crop varieties and sustainable the replacement of indigenous trees with exotic, early- Netherlands, Germany, Australia, the United Kingdom, research on medium-altitude crop varieties of maize, small ruminant breeding program using participatory maturing varieties e.g. the fast growing Eucalyptus Netherlands, Germany, Australia, the United Kingdom, research on medium-altitude crop varieties of maize,small ruminant breeding program using participatory maturing varieties e.g. the fast growing Eucalyptus Norway, and Switzerland. In Kenya, the initiative was sorghum, cassava, and horticulture. Improved crop community approaches 59 , the project promotes increased grandis. Norway, and Switzerland. In Kenya, the initiative was sorghum, cassava, and horticulture. Improved cropcommunity approaches 59 , the project promotes increased grandis. launched in 2006 under the leadership of the German varieties, such as striga-tolerant maize (Maize GAF meat and milk production of small ruminants, with the aim launched in 2006 under the leadership of the German varieties, such as striga-tolerant maize (Maize GAFmeat and milk production of small ruminants, with the aim Development Agency (GIZ), with the aim to encourage 4) and Sorghum KARI Mtama 4, were developed by to increase incomes of smallholder farmers and pastoral The Kenya National Association of Federation of Farmers Development Agency (GIZ), with the aim to encourage 4) and Sorghum KARI Mtama 4, were developed byto increase incomes of smallholder farmers and pastoral The Kenya National Association of Federation of Farmers wider uptake of improved cooking stoves, as part of a KALRO Kibos. However, its operational capacity is herders. Up to now, project researchers have enabled the (KENAFF) is a non-political, non-profit, member-based wider uptake of improved cooking stoves, as part of a KALRO Kibos. However, its operational capacity isherders. Up to now, project researchers have enabled the (KENAFF) is a non-political, non-profit, member-based larger endeavour to promote private sector engagement introduction of Galla goats and red Maasai sheep crossed larger endeavour to promote private sector engagementintroduction of Galla goats and red Maasai sheep crossed in agriculture. The programme supports the development with Dorper sheep in the seven villages in Nyakach Sub in agriculture. The programme supports the developmentwith Dorper sheep in the seven villages in Nyakach Sub 59 Establishment of breeding programs  59 Establishment of breeding programs  "},{"text":" Rehabilitation and EnvironmentalProtection(CREP 65 ) Programme is an organisation that supports needy small scale farmers, vulnerable individuals and community groups. It supports these groups through promotion of appropriate farming technologies for self-reliance and environmental sustainability. Through cooperatives, farmer groups, self-help groups, and CBOs, farmers are able to reduce production and commercialization risks via access to better financing, acquisition and sharing of farm machinery and other assets, output markets and better negotiated prices. Cooperatives in Kisumu County vary in size and influence and include KICOPE (focused on poultry production), KIPOTRA (focused mainly on chicken processing and selling), Muhoroni Farmers' Cooperative Poultry Society, SIATOK widows and orphans group 66 , Kamicha Kabondo self-help group 67 , and Friends of Katuk Odeyo (FOKO, among others. There is still need to promote farmers' cooperatives especially in other value chains e.g. sorghum so as to improve the welfare of farmers.Agro-veterinary companies engage in the distribution and sale of agro-chemicals and other farm inputs and often train farmers on the safe usage of pesticides, fertilizers and other input supplies. For instance, the Magos Agrovet Enterprise distributes drought-tolerant and early-maturing varieties of maize (Drought TEGO and SC Simba 61) and sorghum (Seredo) at subsidised rates. They also engage in the distribution of PICS bags to reduce on post-harvest losses.By means of demonstration plots, the Agricultural Training Centre (ATC) in Maseno conducts annual field days where farmers and students gain practical knowledge on sustainable land management practices and animal husbandry, feed formulation 68 , value addition (yoghurt making, juices, jams, etc.), which can help boost incomes and improve local livelihoods. ATC's educational efforts are complemented by Maseno University, who's recently created Climate Change Department has been seminal in preparing new generations of specialists in climate change and variability-related topics.  "},{"text":" To close the climate risk gap in the agricultural sector, additional private and public investments are required for technological development and access, innovations in value-added activities, and enabling financial mechanisms and markets for small-holder farmers. FAO. 2010. Climate-Smart Agriculture: Policies, Practices and Financing Food Security, Adaptation and Mitigation. Food and Agriculture organization of the United Nations (FAO), Rome, Italy. farmafrica.org  "}],"sieverID":"013ff817-2dce-4961-9b20-fea0e46feca0","abstract":"In Kisumu County, agriculture contributes almost half of household incomes and represents a key agent for the population's food security. In 2012, major food crops produced in the County (maize, sorghum, and beans), generated approximately 10 billion of Kenyan Shillings (KES), cash crops (sugarcane, rice, and cotton) another KES10.5 billion, and livestock products KES1.5 billion. Female-headed households generally earn higher on-and off-farm incomes compared with the male-headed ones, as women tend to diversify their activities, be more actively engaged in farmer groups and cooperatives, and engage in high-value crops production.Small-scale production represents 90% of total agricultural production, 75% of total agricultural output, and 70% of marketed agricultural produce in Kisumu County.Food insecurity, unaffordable health care, poor water and sanitation systems, lack of title deeds, and the impacts of erratic and unreliable rainfall and climate hazards magnify the already high poverty incidence in the County. Roughly 40% of the people are poor and another 61% are considered food-poor.The predominant reliance on rain fed systems increases farmers' exposure and vulnerability to climate variability and change. In recent years, floods, droughts, and heat stress have become more frequent, intense and unpredictable, leading to significant losses to agriculture and livelihoods.On-farm measures taken up by smallholder farmers to cope with an unpredictable climate include change of crop type, staggered planting, infield soil and water conservation practices, and use of food preservation and processing techniques.In general, male-headed households undertake post-harvest handling activities, such as construction of food storage facilities, establishment of communal seed banks, and valueadded processing. Female-headed households are more likely to invest in longer term strategies to improve yields and ensure sustainable production, such as increased use of irrigation infrastructure, water harvesting, staggered cropping, change of crop type. These may relate to differences in access to information and productive resources.Despite heavy involvement of women and youth across the value chain stages, efforts should be made towards increasing their economic gains and improving decision making powers.Highly targeted interventions (especially in the postharvest and marketing stages) that support these benefits should be considered.Off-farm services to improve farmers' resilience to climate change, including early warning systems, extension and training, storage facilities, credit, insurance and market information are offered to farmers by public, private, non-profit and local institutions. However, the capacity to deliver relevant and timely support to farmers within the County is limited by a lack of institutional coordination in producing and delivering information, poor road infrastructure to reach farmers, and resource availability for staff and operations.Most of the institutional support for farmers goes to the input supply and production stages, and less on post-harvest, value-addition, and marketing phases of the value chain.Despite the existence of a wide range of financial institutions (banks, insurance companies, and corporations), most of the credit facilities and insurance services available to farmers require clear title deeds as collateral and incur high interest rates, discouraging the use of such financial products and even farmers' engagement in agri-business."}

data/part_1/097f50117dc920dc6c760c03a0f3f69d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"097f50117dc920dc6c760c03a0f3f69d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/edaa3cde-7e3f-4bbe-b33f-f69a7fccc272/retrieve"},"pageCount":12,"title":"Plant Physiology and Biochemistry","keywords":["Banana Guijiao 9 Panama disease Fusarium oxysporum f","sp","cubense (Foc) race 4 Disease resistance Transcriptome"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":143,"text":"Banana, cooking banana and plantain (Musa spp.), with an annual global production over 120 million tons, are among the most important fruit crops in the world and serve as the major staple food crop for millions of people in the sub-tropics of Africa and South East Asia (Ghag et al., 2015). The edible varieties are derived from Musa acuminata and Musa balbisiana hybridisations, carrying genomes A and B, respectively (Ploetz, 2015a). The most significant varieties are the triploids, including the Cavendish (genome AAA) and plantains (genome AAB) (Ploetz, 2015a). These two, out of 50 subgroups, are responsible for 64% of the world banana production. In China, the banana cultivation areas are mainly distributed in Guangdong, Guangxi, Hainan, Fujian, Yunnan and Taiwan province. Guangxi is one of the major banana producing areas and its annual yield accounts for 31% of the total national production."},{"index":2,"size":292,"text":"However, Fusarium wilt of banana caused by Fusarium oxysporum f. sp. cubense (Foc) is the most destructive plant disease in banana production (Siamak and Zheng, 2018), It has devastated thousands of hectares of banana crops in the world. Foc infects the roots of banana plants, colonizes and occludes the xylem vessels, causing wilt syndrome with necrosis and rotting (Zhang et al., 2018). The spores of pathogen can spread through soil and water, and the chlamydospore can survive in soil for decades (Ploetz, 2015b). Fusarium wilt was firstly reported in 1870s and caused a major epidemic in commercial banana plantations of the cultivar Gros Michel in South and Central America. The Fusarium wilt epidemic was caused by Foc race 1 and decimated the large-scale monocultures of Gros Michel. No effective control methods were found other than replacing Gros Michel with resistant Cavendish bananas during the 1960s. However, in the early 1990s, a damaging new variant of Foc, tropical race 4 (TR4) was detected in South East Asia that is capable of infecting Cavendish bananas and has since spread in the tropics of Asia (Ploetz, 2015b). Foc-TR4 devastated Cavendish plantations in Indonesia, China, Malaysia, the Philippines, Australia, and Mozambique. It is capable of spreading out relatively fast from a source. For example, TR4 was detected around the same time in banana growing regions of Jordan, Pakistan and Labanon (Syed et al., 2015;Ordonez et al., 2016). TR4 has caused significant economic losses to the banana exports in countries including Malaysia and Indonesia with each having reported losses of up to 121 and 243 million dollars, respectively (Aquino et al., 2013). In China, Foc-TR4 has spread to Guangdong, Fujian, Hainan, Guangxi and Yunnan provinces, where 80% of the banana plantations were affected (Zheng et al., 2018)."},{"index":3,"size":171,"text":"Through better understanding of the epidemiology of Foc, measures can be put in place to control the disease from spreading, through good practices and early diagnosis methods. However, there is no true ways to remove the pathogen from the infested soil once the plants are infested (Ploetz, 2015b). The use of resistant varieties is the most effective means to manage Fusarium wilt disease (Dita et al., 2018). Through breeding and genetic manipulation, plant host resistance has the potential to offer a solution that is more sustainable, through the deployment of resistant lines in the TR4 affected areas. It is very difficult to develop resistant cultivar by conventional hybridization breeding because of the parthenocarpy phenotype associated with the triploid Cavendish bananas which make them highly sterile. Most of banana varieties used in industry are developed by somaclonal variation. However planting a single variety over a long period of time can often lead to susceptibility due to the fungus being able to overcome host resistance by acquiring new virulence in the monoculture fields."},{"index":4,"size":87,"text":"The cultivar 'Guijiao 9' (Guishenguo, 2,015,008), released by Guangxi Committee of Crops Variety Examination in 2015, was identified as good resistant to Foc-TR4 from a resistance screen of natural variant lines grown in the field where banana plants were severely infected by TR4. 'Guijiao 9′ showed good yields in the assessment of agronomic traits and that is correlated with its resistance to Foc-TR4 over five years of field trials. Understanding of the host resistance would be very useful towards the development of disease resistance in cultivar improvement."},{"index":5,"size":161,"text":"The rapid and low-costing high-through deep sequencing technology has been successfully used for comparative genomics, expression profiling and molecular mechanism investigation of plants after pathogen infection. The draft sequence of a doubled-haploid Musa acuminata is publicly available (D'Hont et al., 2012). The genome of cultivated banana is expected to be more complex due to its polyploidy and heterozygosity. Therefore, the genome of a doubled-haploid Musa acuminata was used as a reference for mapping. Transcriptome analysis of bananas infected by Foc-TR4 will enable us to understand the molecular mechanism through discovering genes and pathways related to Foc resistance. A study is designed to evaluate the resistance of 'Guijiao 9′ and conduct comparative transcriptome analysis by using mRNA-Seq method. Analysis leads to identification of genes that control differences in pathogenesis process of Foc-TR4. The long-term objective is to understand the resistance mechanism of bananas to Fusarium wilt disease, and eventually to identify, isolate and utilize the Foc resistancerelated genes for banana cultivar improvement."}]},{"head":"Materials and methods","index":2,"paragraphs":[]},{"head":"The breeding of 'Guijiao 9′","index":3,"paragraphs":[{"index":1,"size":271,"text":"In order to obtain Cavendish banana cultivar tolerant to Foc-TR4, selection of somaclonal variation on Cavendish banana was performed. Nine healthy banana plants that survived in fields severely infested with Foc-TR4 were found in Huangliu town, Hainan, China (18°50′N, 108°79′E) in 2010. The cultivar Williams was grown in the infested field. The nine banana plants were collected as original parental plants to conduct tissue culture of mutant. The mutant plantlets were selected as suitable parents from which clones were multiplied and propagated through tissue culture of suckers of the parents. The somatic mutant plantlets derived from parent were screened for resistance against Foc-TR4 in pots and fields. After selection and purification, resistant lines were further assessed in the field for agronomic traits through variety comparative tests and regional trials during 2012-2017. The resistant lines were planted in the commercial banana plantations in different season in Guangxi, Hainan and Guangdong regions. The growth cycle was recorded and the plant height and yield were measured during the mature period. Thirty banana fruits were prepared and the peel were separated from pulp. The banana peel thickness and banana pulp were measured. The data of peel thickness and banana edible percentage were calculated in average. Soluble solids concentration and was evaluated by a refractometer (Model N1, Atago Co., Japan) and the Vitamin C was determined according to Ding et al. (2015) method. The total sugar and soluble titratable acid were detected and quantified using the method of Bernard et al. (2008). The cultivar 'Guijiao 9′ which showed superior Foc-TR4 resistance and yield related traits was released by Guangxi Committee of Crops Variety Examination in 2015."}]},{"head":"Fungal culture, plant materials and pathogen infection","index":4,"paragraphs":[{"index":1,"size":270,"text":"The Foc-TR4 strain (CNSD1) was originally collected from Wuming banana plantations at Nanning, China in 2012. In 2016, vegetative compatibility group (VCG) testing performed on this strain by Department of Plant Pathology, Stellenbosch University (Stellenbosch, South Africa) confirmed that it is VCG 01213/16. The Foc-TR4 isolate was routinely cultured on potato dextrose agar (PDA) plates for 7 days at 28 °C. Spores were harvested from the plates by rubbing the surface mycelium gently with a rubber swab and collecting the spores in distilled water. The concentration of the suspension was adjusted to 1 × 10 6 spores per ml with a hemocytometer and used for infection. Experiments were conducted using Williams (Musa acuminate L. AAA Cavendish cv. Williams) and 'Guijiao 9' (Musa acuminate L. AAA Cavendish cv. 'Guijiao 9′), which were obtained from Institute of Biotechnology of Guangxi Academy of Agricultural Sciences. Tissue cultured banana plants (cv. Williams and cv. 'Guijiao 9') were transplanted into pots and incubated at 28 °C with a 16-h light/8-h dark photoperiod and 60% relative humidity (RH). Banana plants grown with five or six leaves and healthy root system were selected for Foc-TR4 inoculation. The roots were immersed in Foc-TR4 spore suspension for 4 h and replanted into pots. The xylems of the roots of three inoculated plants were collected for each treatment at 0, 2, 4 and 6 days post inoculation (dpi), and each genotype had two biological replicates. The xylems of the roots harvested from the water-inoculated plants at 0 day were served as a control. The harvested tissues were snap frozen in liquid nitrogen and stored at −80 °C for RNA extraction."}]},{"head":"RNA extraction, cDNA library construction and illumina sequencing","index":5,"paragraphs":[{"index":1,"size":180,"text":"High-throughput Illumina sequencing was completed by using the HiSeq™ 2000 platform. Total RNA was extracted from the xylems of banana roots by a modified CTAB method (Li et al., 2012). RNA integrity was confirmed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA; http://www.agilent.com) with a minimum RNA integrated number (RIN) value of seven. Two biological replicates for each treatment were subjected to RNA-Seq library construction. The library for sequencing was constructed using the Illumina's kits following the manufacturer's recommendations. Briefly, poly (A)-enriched mRNA was purified from total RNA using Oligo (dT) magnetic beads and cleaved into small pieces with divalent cations under elevated temperature. First-strand cDNA was synthesized using random hexamer (N6) primers and reverse transcriptase (Invitrogen, Carlsbad, CA, USA), and followed by second-strand cDNA synthesis using DNA polymerase I (NEB, Ipswich, MA, USA) and RNaseH (Invitrogen, Carlsbad, CA, USA). After end repairing, cDNA were ligated to adapters, purified and enriched by PCR to create the final cDNA library. The cDNA library prepared was sequenced on Illumina HiSeq™ 2000 platform and 100-bp raw PE reads were generated."}]},{"head":"Transcriptome assembly and analysis from RNA-seq","index":6,"paragraphs":[{"index":1,"size":188,"text":"Raw reads were filtered to obtain clean reads, by removing the adaptor sequences, the low-quality sequences, and the reads with unknown base pairs 'N'. All high-quality reads of each sample were aligned to the Musa genome sequence (http://banana-genome.cirad.fr version 1) using TopHat 2.0 and Bowtie 2 with default parameters (Trapnell et al., 2009). Cufflinks 1.0.3 (Trapnell et al., 2010) was then used to assemble the transcripts from the TopHat alignment results to determine gene expression values. Two biological replicates of each sample were used for differential gene expression analysis, and Pearson's correlation coefficients between biological replicates for each sample were calculated in R (logiciel). The genes with absolute values of log 2 (fold change) ≥ 1 and adjusted false discovery rate in qvalue ≥ 0.99 were identified as differentially expressed genes (DEGs). The gene ontology (GO) functional classification of DEGs (Fisher, Pvalue < 0.05) was carried out by BLAST2GO 2.5 program (Conesa et al., 2005). Kyoto Encylopedia of Genes and Genomics (KEGG) enrichment analysis (P-value < 0.05) of DEGs was performed using KOBAS2. The gene expression patterns was analyzed with MeV software (www.tm4.org/mev.html) to construct the heat maps."}]},{"head":"Real-time RT-PCR for validation of transcript levels","index":7,"paragraphs":[{"index":1,"size":199,"text":"Gene-specific primers were designed by using the software primer premier 5.0 (Premier Biosoft Interpairs, Palo Alto, CA) and the primer sequences are listed in Table S1. Total RNA was isolated from the xylems of banana roots as mentioned for the transcriptome sequencing. The first-strand cDNA was synthesized from 1.0 μg of total RNA using the PrimeScriptTM RT Master Mix Kit (TaKaRa,Bio Inc., Japan). The rps2 gene of banana was used as the reference gene for normalization (Chen et al., 2011). The qRT-PCR was carried out using the SYBR Premix ExTaq Kit (TaKaRa, Bio Inc., Japan), with a reaction (20 μl) included 20 ng cDNA, 0.3 μM of each primer, and 1 × SYBR Premix ExTaq. All qRT-PCR reactions were performed on the Light Cycler 480 (Roche Diagnostics, Germany) under the following conditions: 95 °C for 30 s, 40 cycles of 95 °C for 10 s, 60 °C for 20 s and 72 °C for 10 s to calculate cycle threshold (Ct) values. Each treatment was examined in three technical replicates and the melt curves were analyzed to ensure the primer specificity. The relative expression of each gene was estimated by using the 2 -△△Ct method (Livak and Schmittgen, 2001)."}]},{"head":"Evaluation of 'Guijiao 9′ resistant to Foc-TR4","index":8,"paragraphs":[{"index":1,"size":103,"text":"In order to ascertain the resistance of the cultivars, Williams and 'Guijiao 9′ was evaluated in glasshouse and field trials by investigating the disease incidence and severity. Disease severity was graded according to the method described by Mak et al. (2004). Banana plants were inoculated with Foc-TR4 as described above for the sample preparation of sequencing. The pot trial experiment was repeated three times and each treatment had 30 plants. Validation of resistance in field experiments were carried out over a period spanning 6 years from 2012 to 2017. 'Guijiao 9′ was planted in Foc-TR4 infested fields in Hainan, Guangdong and Guangxi province."}]},{"head":"Statistical analysis","index":9,"paragraphs":[{"index":1,"size":71,"text":"The false discovery rate (FDR) was used to determine the threshold of P value in multiple test and analysis. The significance of gene expression difference was defined by FDR≤0.001 and the absolute value of fold change |log2Ratio|≥1 as the threshold (Smyth, 2004). Statistical analysis of the data was conducted using SPSS 25.0 software. Significance in all the comparisons among means was calculated by analysis of variance with Duncan's multiple comparison adjustment."}]},{"head":"Results","index":10,"paragraphs":[]},{"head":"Agronomic traits of 'Guijiao 9′","index":11,"paragraphs":[{"index":1,"size":155,"text":"The new breeding variety 'Guijiao 9′ was the somatic mutant of Musa AAA Cavendish, which is the first Foc-tolerant banana variety bred by Guangxi Academy of Agricultural Sciences. It is suitable for planting in the autumn and the early spring growing seasons in Guangxi, Hainan and Guangdong regions. The whole growth cycle takes 310-350 days to complete when planting is performed in early spring in Guangxi province. The fruit pulp had 22.3% of soluble solid content and 0.43% of soluble titratable acid, with 19.6 mg/100 g of total sugar and 16.38 mg/100 g of Vitamin C (Table 1). The fruit showed an improved storability of 3-5 days at ambient temperature after ripening and before the fruit quality starts to degrade. Pseudostem is green accompanied with brown blotch, can reach 230.0-320.0 cm in height with a stem circumference of 70.0-90.0 cm. The yield of a single plant can total up to 40.0 kg of harvest weight."}]},{"head":"Evaluation of 'Guijiao 9′ resistant to Foc-TR4 in glasshouse and field trials","index":12,"paragraphs":[{"index":1,"size":171,"text":"'Guijiao 9′ was shown to have significantly lower disease incidence and severity after inoculation with Foc-TR4, compared to susceptible cultivar Williams in glasshouse (Table 2). The disease incidence of 'Guijiao 9′ was approximately 10% while the incidence of Williams under the same treatment reached up to 95%, and this reflected in the death rate of 'Guijiao 9' (11.7%) which is significantly lower than that of Williams. The resistant response in 'Guijiao 9′ is correlated with phenotypes that show few yellow leaf symptoms and healthy corms (Fig. 1A and B), while the leaves of Williams showed yellowing and necrotic symptoms as well as browning of the corms in cross dissections (Fig. 1C and D) at 30 days after inoculation with Foc-TR4. The pseudostems from all of the inoculated plants were scored for vascular discoloration and the infested samples were selected for fungal isolation and PCR-based assays to test existence of Foc-TR4 (Dita et al., 2010). All of the 20 samples were tested positive for Foc-TR4, which confirmed the accuracy of the diagnostic."},{"index":2,"size":45,"text":"MR and HS abbreviate moderately resistant and highly susceptible phenotypes, respectively. Data are the means of three replicates. The data in the same column followed by different letters are significantly different at 0.05 levels. Statistical analysis of the data was performed using SPSS 25.0 software."},{"index":3,"size":297,"text":"In order to determine whether 'Guijiao 9′ could confer TR4 resistance in infested regions, we assessed 'Guijiao 9′ for resistance in field trials over a 6 year period. The trial sites were commercial banana plantations in south China where Foc-TR4 has destroyed Cavendish banana plants. 'Guijiao 9′ was planted in Foc-TR4 infested plantations in Hainan, Guangdong and Guangxi provinces. The controls in the field trials were the Foc-TR4-susceptible cultivars Baxi and Williams. The trials were regularly inspected for plants showing leaf yellowing, wilting and/or pseudostem splitting (Fig. 2A, B, C and D). The susceptible Williams showed the typical Foc-TR4 symptoms such as leaf yellowing and pseudostem splitting while the resistant 'Guijiao 9′ has no obvious symptoms. The pseudostems were further examined for the presence of the reddish-brown vascular discoloration characteristic of Foc-TR4 infection (Fig. 2E, F, G and H). In general, disease developed faster in the control plants Baxi and Williams (Table 3). By the end of the trials, all of the control plants were either infected or dead in Huangliu and Dongying, Hainan. The incidence of Foc-TR4 infection of 'Guijiao 9′ plangting in Huangliu increased from 8.1% to 21.4%, while the incidence of Baxi increased from 72.5% to 100% in 2012 and 2013. The results in Dongying showed the similar situation in Huangliu. The incidence of 'Guijiao 9′ plangting in Dongying increased from 4.6% to 11.3%, while the incidence of Baxi increased from 52.7% to 100%. The results of Foc-TR4 screen performed in Xiaqiao, Guangdong field trial also indicated that 'Guijiao 9′ was more resistant to Foc-TR4 than Williams. In the trial of Ningwu of Guangxi, the disease incidence of 'Guijiao 9′ developed slowly, only increased to 7.23% from 2014 to 2017, while the incidence of Williams increased up to 33.6% in 4 years (Table 3).   "}]},{"head":"Illumina sequencing and mapping of reads to the Musa genome","index":13,"paragraphs":[{"index":1,"size":171,"text":"In order to identify differentially expressed genes (DEGs) putatively involved in the resistance response, RNA-Seq analysis was carried out on total RNA samples from both resistant (cv. 'Guijiao 9′) and susceptible (cv. Williams) banana cultivars infected with Foc-TR4 and mock controls. Low-complexity and low quality reads were filtered out to obtain reliable reads. More than 48 million high quality reads were acquired and an average of 80% of the filtered reads mapped to the Musa genome (D'Hont et al., 2012) (mapped reads) for each of the two biological replicates (Table 4). Among the mapped reads, 75% matched to unique locations (unique mapped reads) and 5.8% displayed multiple matches (multiple mapped reads) (Table 4). Two biological replicates for each sample were sequenced and high Pearson's correlation coefficients (R 2 ) of FPKM (Fragments Per Kilobase of transcript per Million mapped reads) distribution between the two biological replicates were detected (R2 = 0.92-0.96, p < 0.001) (Figure S1). This indicated that the sequencing data of different replicates has a good level of repeatability."}]},{"head":"Musa genes differentially expressed at Foc-TR4 different infection stages","index":14,"paragraphs":[{"index":1,"size":76,"text":"To get a better understanding of the mechanism underlying Foc-TR4 resistance, comparative transcriptome analysis was performed. According to the method described by Audic (Audic and Claverie, 1997), we identified the differentially expressed genes (DEGs) of 'Guijiao 9′ and Williams at different Foc-TR4 infection stages. A total of 9612 DEGs were identified, highlighting the complex transcriptional reprogramming of banana roots in response to Foc-TR4 inoculation. The comparison of DEGs between different genotypes were summarized in Table 5."},{"index":2,"size":105,"text":"Overall, a large number of genes were found up-or down-regulated in Williams at all times, whereas the pattern in 'Guijiao 9′ is different. A much smaller number of genes showed altered expression levels in 'Guijiao 9′ at 2 dpi (Table 5). After 2 d of Foc-TR4 infection, a total of 841 and 1876 TR4-responsive genes were identified in Williams and 'Guijiao 9′, respectively. Out of the 841 DEGs, 580 TR4-responsive genes were exclusively identified in Williams, whereas 1615 TR4- The data in the same column followed by different letters are significantly different at 0.05 levels.Statistical analysis of the data was performed using SPSS 25.0 software."}]},{"head":"Table 4","index":15,"paragraphs":[{"index":1,"size":27,"text":"Mapping results of high quality reads against the Musa genomic sequence. The numbers in parentheses are the percentage of reads over total number of high quality reads."},{"index":2,"size":221,"text":"responsive genes were uniquely observed in 'Guijiao 9'. The remaining 261 genes were commonly regulated by Foc-TR4 in both Williams and 'Guijiao 9'. Similarly, a total of 904 and 590 TR4-responsive genes were identified in Williams and 'Guijiao 9′ after 4 d of Foc-TR4 infection, respectively. Out of the 904 DEGs, 771 TR4-responsive genes were exclusively identified in Williams, whereas 457 TR4-responsive genes were uniquely observed in 'Guijiao 9′ and 133 genes were commonly regulated by Foc-TR4 in both Williams and 'Guijiao 9'. After 6 d of Foc-TR4 infection, a total of 1034 and 4310 TR4-responsive genes were identified in Williams and 'Guijiao 9′, respectively. Out of the 1034 DEGs, 379 TR4-responsive genes were exclusively identified in Williams, whereas 3655 TR4-responsive genes were uniquely observed in 'Guijiao 9'. The remaining 655 genes were commonly regulated by Foc-TR4 in both Williams and 'Guijiao 9' (Table 5). It is noteworthy that among DEGs unique to Williams more are down-than up-regulated at all times, whereas the pattern in Guijiao 9 is different. We pay more attention to the DEGs that are either specifically regulated in 'Guijiao 9′ or those with transcript levels that are significantly different between 'Guijiao 9′ and Williams at a given time point. These two categories of genes are probably involved in the transcriptome signaling of Foc-TR4 resistance in 'Guijiao 9'."}]},{"head":"Functional annotation of DEGs","index":16,"paragraphs":[{"index":1,"size":202,"text":"To functionally categorize the DEGs, the analysis of Gene Ontology (GO) was performed using the Blast2go software on the DEGs identified in resistant cv. 'Guijiao 9'. These DEGs in 'Guijiao 9′ were assigned to three principal GO categories separately and the percentage of DEGs belonging to each category: biological process (72.5%), cellular component (42.2%) and molecular function (82.2%). In the biological function category, the DEGs were assessed by Blast2go resulting in 63 enriched GO terms. Amongst these the most relevant GO terms that are consistent with the response to fungal infection were response to stress (GO:0006950), signal transduction (GO:0007165), generation of precursor metabolites and energy (GO:0006091), and secondary metabolic process (GO:0019748) (Fig. 3). Thirty GO terms were grouped into the category of cellular component which are enriched for DEGs involved in the localization and targeting of resistance response and they include intracellular membrane-bounded organelle (GO:0043231), cell wall (GO:0005618) and cytoplasm (GO:0005737) (Fig. 3). Finally the GO category for molecular function identified DEGs that are involved in Ion binding (GO:0043167), transcription factor binding (GO:0008134) and oxidoreductase activity (GO:0016491) (Fig. 3). The 6581 DEGs specific to Guijiao 9 or significantly different in expression level between Williams and Guijiao 9 (threshold ≥2) were further analyzed."}]},{"head":"Differentially expressed genes in response to Foc-TR4 infection","index":17,"paragraphs":[{"index":1,"size":116,"text":"In order to facilitate the inspection of the plant and fungus networks and understand their interactions, the biological pathways mapping of the DEGs activated in resistant cv. 'Guijiao 9′ or significantly expression between Williams and Guijiao 9 were performed using KEGG database (http://www.genome.jp/kegg/). Top 25 KEGG pathways were significantly enriched in 'Guijiao 9' (P-value < 0.05) (Table 6), of which 4 pathways, namely Plant-pathogen interaction, Plant hormone signal transduction, Phenylpropanoid biosynthesis and Flavonoid biosynthesis are normally regarded as disease-resistance related events. In addition, our data also suggested that ubiquitination may also participate in the incompatible interactions between 'Guijiao 9′ and Foc-TR4. These genes from the 4 categories which related to disease-resistance were mainly analyzed as follows."}]},{"head":"Plant-pathogen interaction","index":18,"paragraphs":[{"index":1,"size":246,"text":"The resistant plant 'Guijiao 9′ exhibited higher up-regulation of genes involved in plant-pathogen interaction compared to the susceptible plant Williams. A well known NBS-LRR gene RPS2 (GSMUA_Achr7G08530_001) accumulated more abundantly in 'Guijiao 9′ than in Williams throughout the whole experiment (Fig. 4A). At the late stages of infection, two disease resistance protein genes (RPM1, GSMUA_Achr9G28020_001, GSMUA_Achr6G29800_001) and one pathogenesis-related transcriptional activator gene (PTI6, GSMUA_Achr7G21980_001) were significantly up-regulation in 'Guijiao 9′ compared to Williams (Fig. 4A). A gene encoding chitin elicitorbinding protein (CEBiP, GSMUA_Achr1G02750_001) was only induced in 'Guijiao 9′ at 6 dpi. Three genes encoding Ca 2+ -dependent protein kinase (CDPK, GSMUA_Achr1G05040_001, GSMUA_Achr2G17730_001, GSMUA_Achr3G18430_001) involved in hypersensitive response and signal transduction was up-regulated in 'Guijiao 9′ during the time course experiment. PR proteins have been regarded as pivotal components of defense proteins against pathogens attack in plants (Li et al., 2015). Three PR1 genes (GSMUA_Achr2G13210_001, GSMUA_Achr2G13240_001, GSMUA_Achr4G23100_001) were strongly  Another PR1 gene (GSMUA_Achr4G28250_001) was expressed rarely in Williams but expressed much higher at 6 dpi in 'Guijiao 9'. A gene encoding MEKK1 (GSMUA_Achr2G07690_001) was expressed higher in 'Guijiao 9′ at 6 dpi (Fig. 4A). A gene encoding heat shock protein 90 kDa beta (HSP90, GSMUA_Achr1G07620_001), downstream components of hypersensitive response, also showed positive expression in the time course experiment. A pathogenesis-related genes transcriptional activator gene PTI5 (GSMUA_Achr3G15550_001) was abundantly expressed at 2 dpi in 'Guijiao 9' (Fig. 4A). However, two WRKY transcription factor 22 genes (GSMUA_Achr10G01150_001, GSMUA_Achr10G14710_001) were down-regulated in 'Guijiao 9′ in the infection process."}]},{"head":"Signal transduction","index":19,"paragraphs":[{"index":1,"size":333,"text":"Plant hormones such as auxins, abscisic acid (ABA), ethylene (ET), salicylic acid (SA) and Jasmonates (JA) are known to play roles in mediating plant defense response against biotic stress. In this study, five SAsignaling genes were identified to be associated with 'Guijiao 9′ against Foc-TR4. Among them, a gene encoding regulatory protein NPR1 (GSMUA_Achr6G00950_001) and a gene encoding transcription factor TGA (GSMUA_Achr8G05800_001) were up-regulated to high levels only at 6 dpi (Fig. 4B). In ET-signaling pathway, two genes encoding ethylene receptor (ETR, GSMUA_Achr11G02140_001, GSMUA_Achr8G14350_001) and two genes encoding EIN3-binding F-box protein (EBF1_2, GSMUA_Achr4G30680_001, GSMUA_Achr9G28510_001) had high expression levels at 2 dpi in 'Guijiao 9' (Fig. 4B). A gene encoding ethylene-responsive transcription factor 1 (ERF1, GSMUA_Achr5G19610_001) was induced higher at the early stage of infection, while another ERF1 gene (GSMUA_Achr4G05520_001) was more abundant at the later stage (Fig. 4B). For JA signaling, a jasmonate-ZIM-domain (JAZ) gene (GSMUA_AchrUn_randomG27570_001) was induced higher in 'Guijiao 9′ infected by Foc-TR4, but not expressed in Williams. A gene encoding jasmonic acid-amino synthetase (JAR1, GSMUA_Achr4G08460_001) and a gene encoding transcription factor MYC2 (GSMUA_Achr4G16980_001) involved in JA signaling were significantly up-regulated in 'Guijiao 9′ compared to Williams at the early stage of infection (Fig. 4B). Of all ABAsignaling related genes, two genes encoding protein phosphatase 2C (PP2C, GSMUA_Achr10G14430_001, GSMUA_Achr11G21980_001) were up-regulated rapidly to a high level in 'Guijiao 9′ at 4 dpi and 6 dpi in response to the Foc-TR4 infection. Two ABA responsive element binding factor genes (ABF, GSMUA_Achr6G15970_001, GSMUA_Achr6G30550_001) and one serine/threonine-protein kinase gene (SnRK2, GSMUA_Achr11G11970_001) were found up-regulated dramatically in 'Guijiao 9′ at the late stage of infection. A gene belong to abscisic acid receptor PYR/PYL family (GSMUA_Achr10G27940_001) was found up-regulated in 'Guijiao 9′, and down-regulated in Williams at the time course experiment (Fig. 4B). Other genes associated with auxin also responded to pathogen challenge. Of the auxin related genes, two encoding auxin influx carrier (LAX, GSMUA_Achr11G24200_001, GSMUA_Achr6G25630_001) and three encoding auxin-responsive protein (IAAs, GSMUA_Achr3G16300_001, GSMUA_Achr4G21030_001, GSMUA_Achr9G02960_001) were up-regulated in 'Guijiao 9′ during the infection process (Fig. 4B)."},{"index":2,"size":53,"text":"In addition, MAPK and Calcium signals were also identified. A MAPK-signaling gene, mitogen-activated protein kinase kinase 3 (MEKK3, GSMUA_Achr9G19130_001) was up-regulated in 'Guijiao 9′ and down-regulated inWilliams. Two calcium signaling genes (CaM, GSMUA_Achr7G01390_001, GSMUA_AchrUn_randomG12510_001) presented more repression in 'Guijiao 9′, indicating their negative regulation in the Fusarium wilt disease resistance of 'Guijiao 9'."}]},{"head":"Secondary metabolism","index":20,"paragraphs":[{"index":1,"size":242,"text":"Phenylpropanoid biosynthesis and flavonoid biosynthesis, belonging to secondary metabolism, have been proved to be involved in plant defense response through reinforcement of plant cell walls and phytoalexins synthesis. At 2 dpi, two beta-glucosidase genes (bglB, GSMUA_Achr1G26250_001, GSMUA_Achr3G29530_001), a 4-coumarate-CoA ligase gene (4CL, GSMUA_Achr2G18040_001) and a cinnamyl-alcohol dehydrogenase gene (CAD, GSMUA_Achr4G26450_001) accumulated more abundantly in 'Guijiao 9′ than in Williams (Fig. 4C), indicating cell wall responses that reinforce plant's defense at the cellular level. Peroxidases (POD) are PR-9 gene expressions are induced in plant tissues upon pathogen infection and this may lead to the production of reactive oxygen and nitrogen species which prevent cellular diffusion of pathogens into the host plants. In this study, more than a dozen of POD related genes are identified in the phenylpropanoid biosynthesis pathway. The transcriptional changes may suggest an activated defense mechanism in response to Foc-TR4 infection. Among them, Four genes encoding Peroxidases (POD, GSMUA_Achr10G01840_001, GSMUA_Achr5G29600_001, GSMUA_Achr2G15480_001, GSMUA_Achr2G21710_001) were dramatically expressed in 'Guijiao 9′ throughout the entire period of the experiment (Fig. 4C). In the flavonoid biosynthesis pathway, a gene encoding leucoanthocyanidin dioxygenase (LDOX, GSMUA_Achr5G04080_001) was expressed much higher in 'Guijiao 9′ than in Williams at 2 dpi (Fig. 4C). A gene encoding chalcone synthase (CHS, GSMUA_Achr10G12260_001) was induced exclusively in 'Guijiao 9′ and another CHS gene (GSMUA_Achr6G10910_001) accumulated abundantly in the resistant cultivar at the whole infection process. Two genes encoding caffeoyl-CoA O-methyltransferase (CCoAMs, GSMUA_Achr8G15650_001, GSMUA_Achr9G25230_001) were up-regulated in 'Guijiao 9′ at 6 dpi (Fig. 4C)."}]},{"head":"Ubiquitin mediated proteolysis","index":21,"paragraphs":[{"index":1,"size":127,"text":"Ubiquitination is known to play an important role in plant defense. In response to Foc-TR4 infection, 'Guijiao 9′ induces the expression of a gene encoding RING finger and CHY zinc finger domain-containing protein 1 (RCHY1, GSMUA_Achr8G12910_001) and two genes encoding ubiquitinconjugating enzyme E2 H (UBE2H, GSMUA_Achr1G01320_001 and GSMUA_Achr5G13210_001) at 2 dpi (Fig. 4D). At the later stage of  infection, one S-phase kinase-associated protein 2 gene (SKP2, GSMUA_Achr6G18620_001), one ubiquitin-conjugating enzyme E2 C gene (UBE2C, GSMUA_Achr3G08740_001), one ubiquitin-conjugating enzyme E2 O gene (UBE2O, GSMUA_Achr7G25120_001) and three E3 ubiquitin-protein ligase SIAH1 genes (SIAH1, GSMUA_Achr3G08700_001, GSMUA_Achr3G16360_001 and GSMUA_Achr9G05880_001) were more expressed in 'Guijiao 9' (Fig. 4D). In contrast, in the incompatible interaction, a gene encoding ubiquitin-conjugating enzyme E2 D (UBE2D, GSMUA_Achr7G17820_001) was less expressed at 2 dpi and 4 dpi."}]},{"head":"Validation of DEGs by qRT-PCR","index":22,"paragraphs":[{"index":1,"size":222,"text":"In order to confirm the results of the Illumina sequencing, eighteen DEGs were selected based on their expression patterns in 'Guijiao 9′ and Williams at different time points for quantitative RT-PCR (qRT-PCR) by using the same RNA extracts as for RNA-seq experiments. Of the 16 genes analyzed, six genes (PR1, GSMUA_Achr4G28250_001; NPR1, GSMUA_Achr6G00950_001; RPM1,GSMUA_Achr6G29800_001; PTI6, GSMUA_Achr7G21980_001; RPK2, GSMUA_Achr3G19620_001; WRKY22, GSMUA_Achr10G01150_001) were significantly up-regulated and one gene (Putative Protein lap1, GSMUA_AchrUn_randomG04530_001) was down-regulated in 'Guijiao 9′ compared to Williams at 6 dpi (Fig. 5). These results are consistent with the findings from the RNA-Seq results. CDPK (GSMUA_Achr1G05040_001), CHI10 (chitinase 10, GSMUA_Achr9G16770_001) and RPPL1 (Putative disease resistance RPP13-like protein 1, GSMUA_Achr3G22290_001) were expressed abundantly in 'Guijiao 9′ throughout the whole experiment and a similar trend in their expression profiles were characterized by the RNA-Seq technique (Fig. 5). ERF1 (GSMUA_Achr5G19610_001) was expressed at a higher level in 'Guijiao 9′ than Williams at the early stage of infection but its expression level appears to be down-regulated at 4 dpi. Two genes (CaM, GSMUA_AchrUn_randomG12510_001; PI206, GSMUA_Achr6G17790_001) were also down regulated in 'Guijiao 9′, while other three genes (POD59, GSMUA_Achr2G21710_001; WRKY 28, GSMUA_Achr4G14990_001; SAP1 Zinc finger A20 and AN1 domaincontaining stress-associated protein 1, GSMUA_Achr3G11070_001) presented the similar expression profile in the two varieties (Fig. 5). As expected, these data confirmed the reliability of the transcriptome analysis by RNA-Seq."}]},{"head":"Discussion","index":23,"paragraphs":[{"index":1,"size":65,"text":"RNA-Seq, based on deep sequencing, is a reliable and cost-effective approach for huge sequence data collection and analysis. Transcriptome analyses can help uncover mechanisms that control resistance to Fusarium wilt disease in banana. Previous studies have reported the gene expression profiling for the host-pathogen interaction (Li et al., 2013), and comparison of transcriptomes between resistant and susceptible genotypes (Li et al., 2012;Bai et al., 2013)."},{"index":2,"size":148,"text":"'Guijiao 9′ is a somatic Cavendish type mutant that has shown to produce improved yields under Foc-TR4 infested fields. The resistance and agronomic traits of 'Guijiao 9′ have been investigated and well characterized for multiple years (Wei et al., 2016). The resistance and agronomic traits of 'Guijiao 9′ had already been investigated and well characterized for five years before the RNA-seq experiment. The genome of banana (Musa acuminata) was firstly sequenced in 2012 (D'Hont et al., 2012), and the sequencing reads we obtained are aligned primarily by mapping onto the sequenced reference genome. Plants have evolved complex signaling and defense pathways in response to pathogen attacks. Identifying key components of transcriptome response to Foc-TR4 may facilitate the discovery and annotation of important genes in the plant's defense response. Here, we performed a comprehensive transcriptome profiling against Foc-TR4 on the resistant and susceptible cultivars 'Guijiao 9′ and Williams respectively."}]},{"head":"Gene expression changes in response to Foc-TR4 infection","index":24,"paragraphs":[{"index":1,"size":145,"text":"We identified differentially expressed genes (DEGs) of 2, 4 and 6 dpi for each cultivar compared with the 0 dpi. A total of 6776 and 2779 DEGs in resistant 'Guijiao 9′ and susceptible Williams banana, respectively, were identified. qRT-PCR results validated the 16 candidate DEGs identified from the RNA-Seq study. The expression levels of candidate genes correlated positively with the number of reads mapped to these genes. During the onset of Foc-TR4 infection, the resistant 'Guijiao 9′ samples showed a much higher number of DEGs than the susceptible Williams, which may indicate that the different banana cultivars may activate different genes or gene networks which control the underlying response to Foc-TR4 infection. These findings are similar to what has been previously described for the interaction between banana and Foc-TR4, where the resistant cultivar showed much more DEGs than the susceptible one (Bai et al., 2013)."}]},{"head":"Plant-pathogen interaction","index":25,"paragraphs":[{"index":1,"size":405,"text":"Plants have established a series of defense mechanisms against pathogens during their co-evolution. The innate immunity in plant is triggered via the response of pattern recognition receptors (PRRs) to pathogen-associated molecular patterns (PAMPs), thereby providing the first layer of defense mechanism for pathogens (PTI) (Bernoux et al., 2011). Chitin, a major component of fungal cell walls, is one of the most common PAMPs in fungi (Chen and Ronald, 2011). The chitin elicitorbinding protein (CEBiP) and the chitin elicitor receptor kinase (CERK1) have been identified as critical components of the plant signaling pathway that recognizes chitin oligosaccharides (Chen and Ronald, 2011). In this study, CEBiP was only induced in 'Guijiao 9′ at 6 dpi, which is consistent with the reports that the expression of CEBiP were up-regulated in resistant banana cultivar (Li et al., 2012;Bai et al., 2013). The results suggested that TR4 infection trigger an immune response in resistant 'Guijiao 9'. The time course of CEBiP up-regulation in 'Yueyoukang 1′ and 'Nongke No 1' (Li et al., 2012;Bai et al., 2013) was a little earlier than in 'Guijiao 9′, which may be caused by the difference of cultivar. The genes related to CERK1 showed no significant changes in their expression levels in the resistant cultivar, which may indicate that they did not play a role in incompatible interaction between 'Guijiao 9′ and Foc-TR4. The second layer of immunity relies on the recognition of pathogen virulence molecular effectors by plant-specific resistance proteins (R proteins) in direct or indirect ways, which leads to ETI (Jones and Dangl, 2006). ETI is often initiated by a subset of R genes. The largest class of R genes encodes a NB-LRR class of proteins (Dangl and Jones, 2001). RPM1 and RPS2 genes, belonging to NB-LRR genes, were accumulated abundantly in 'Guijiao 9′ after Foc-TR4 inoculation compared to Williams. RPM1 conferred resistance to Pseudomonas syringae expressing either avrRpm1 or avrB effector (Boyes et al., 1998). The accumulation of RPM1 in 'Guijiao 9′ indicated that it may be required to mediate incompatible interactions in banana, which is in agreement with the previous work (Li et al., 2012;Bai et al., 2013). The up-regulation of RPS2 in 'Guijiao 9′ at the all stages of infection may suggest that it plays an important role in mediating or maintaining host resistance against the pathogen, while the previous reports did not find the accumulation of RPS2 in other resistant banana cultivars (Li et al., 2012;Bai et al., 2013)."},{"index":2,"size":236,"text":"Calcium, which is regarded as an important secondary messenger, plays an essential role in the production of hypersensitive reactions in the plant response to biotic stress. The genes related to CNGC and Rboh (Respiratory burst oxidase homolog) in 'Guijiao 9′ were not expressed differentially after TR4 infection, suggesting there was no HR-like reaction in inoculated Guijiao 9. The calcium (Ca 2+ ) related proteins include CaM, CaM-binding protein, CDPK, and Ca 2+ -CaM-regulated protein phosphatase all of which are involved in calcium mediated signaling in plants (Lecourieux et al., 2006). Recent evidence suggests that Ca 2+ signaling via CDPKs, CBL/CBL-interacting protein kinases and Ca 2+ signaling may play a part in the melon-Monosporascus cannonballus interaction and melon-Fusarium oxysporum f. sp. melonis Snyd. & Hans race 1.2 interaction (Sebastiani et al., 2017). In this research, we observed the expression of CDPK gene was up-regulated in 'Guijiao 9′ in response to Foc-TR4 infection, while CaM and CML genes had lower transcript abundance, indicating Ca 2+ signaling may be engaged in a complicated manner in banana-TR4 interaction. The PR1 gene is often used as a molecular marker of disease resistance. Researches have shown that the expression level of PR1 increased with pathogen infection (Hamamouch et al., 2011). Here, we found PR1 genes accumulated dramatically in 'Guijiao 9′ at 2 dpi (Fig. 4), suggesting that PR1 genes may be involved in the incompatible interaction at the early stage of infection."}]},{"head":"Transduction of defense signals","index":26,"paragraphs":[{"index":1,"size":382,"text":"Multiple phytohormones, including Jasmonic acid (JA), salicylic acid (SA), and ethylene (ET), are involved in plant defense processes. JA plays regulatory roles in plant development and responses to fungal infection. Plant resistance to necrotrophic pathogens, such as Fusarium oxysporum and Fusarium fujikuroi, is activated by JA signaling (Matic et al., 2016). We observed that JAR1, COI1, and MYC2, were upregulated in 'Guijiao 9′ and down-regulated in Williams, indicating that JA pathway was activated in the disease resistance response to Foc-TR4. This is in line with previous reports showing that the JA pathway mediates plant resistance to pathogens (Li et al., 2012;Bai et al., 2013). SA is a critical factor in local and systemic acquired resistance responses. The SA response pathway is usually thought to be effective against biotrophic pathogens. NPR1 is an essential regulator of plant systemic acquired resistance (SAR), which confers immunity to abroadspectrum of pathogens. SAR induction results in accumulation of the signal molecule SA, which induces defense gene expression via activation of NPR1 (Mou et al., 2003). NPR1 has been shown interacting with the TGA subclass of basic leucine-zipper (bZIP) transcription factors. These TGA factors can bind to the as-1 element present in the PR1 gene promoter, which is required for SA-responsiveness of the gene (Mou et al., 2003). In this present study, SA-signaling associated genes encoding NPR1 and TGA did not show significant difference between the two cultivars, suggesting that SA may or may not be directly involved in the defense response towards Foc-TR4. Future work may involve the determination of SA levels in the roots of these cultivars. In Arabidopsis, PR1 and SA levels can be quantified to measure the pattern of SAR (Kiefer and Slusarenko, 2003). In our study, PR1 gene expression was strongly induced in 'Guiijao 9′ but not in Williams suggesting that PR1 may play a role in the plant-pathogen interactions, but future experiments will need to address whether the response mediated through PR1 is part of the SA-signaling pathway. Pathogen attack triggers complex signaling cascades regulated by these signaling molecules, resulting in the expression of defense-related genes such as those encoding PR proteins. In ET-signaling pathway, genes including ETR, EBF1 and ERF1 played as positive regulators in 'Guijiao 9′ response to Foc-TR4 infection, which could have activated ET signaling in the disease resistance."}]},{"head":"Expression of defense related products","index":27,"paragraphs":[{"index":1,"size":234,"text":"Secondary metabolism has been proved to play an important role in plant disease resistance. The pathway of phenylpropanoid, flavonoids and stilbenoid biosynthesis participate in the formation of secondary resistance metabolites, such as phytoalexin, lignin and phenolic compounds (Zhang et al., 2017). Here, eight DEGs were identified to participate in phenylalanine metabolic pathways. Among them, two bglBs (GSMUA_Achr1G26250_001, GSMUA_Achr3G29530_001), 4CL (GSMUA_Achr2G18040_001) and CAD (GSMUA_Achr4G26450_001) showed increased transcript levels in Foc-TR4 treated roots of the resistant 'Guijiao 9'. These genes are involved in the synthesis of lignin polymers which could lead to the reinforcement of the cell wall during the activation of the resistance response. In comparison, up-regulation of transcripts were not detected in all four genes in Williams. A series of peroxidase (POD) genes (GSMUA_Achr10G01840_001, GSMUA_Achr5G29600_001, GSMUA_Achr2G15480_001, GSMUA_Achr2G21710_001) were also found to be induced after Foc-TR4 infection. Studies have shown that POD participates in the polymerization of monolignols into lignin and confers resistance to a wide range of plant pathogens (Marjamaa et al., 2009). Two CHSs genes (GSMUA_Achr10G12260_001, GSMUA_Achr6G10910_001), and a LDOX gene (GSMUA_Achr5G04080_001) involved in flavonoids biosynthesis accumulated in the roots of 'Guijiao 9′ during banana-TR4 incompatible interaction at all the time points. CcoAM (GSMUA_Achr8G15650_001) displayed an increased level of transcripts in the resistant cultivar 'Guijiao 9′ at 6 dpi. Taken together, our results suggest that the biosynthesis of secondary metabolites may be important components of the plant defense in response to Foc-TR4 infection."}]},{"head":"Regulatory role of ubiquitination in disease resistance","index":28,"paragraphs":[{"index":1,"size":208,"text":"Ubiquitination is proposed to play a critical role in plant defense response against pathogen challenge (Li et al., 2015;Sebastiani et al., 2017). There are three major stages during the tagging of a protein to ubiquitination and consequently there are three major enzyme classes, including E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme and E3 ubiquitin ligase (Craig et al., 2009). Here, two genes encoding E2 enzyme were significantly up-regulated at the early stage of infection in the resistant cultivar, suggesting a positive regulation of this enzyme in Foc-TR4 resistance. Studies have indicated a prominent role for E3 ubiquitin ligases during plant defence (Li et al., 2015). We found that four genes encoding E3 ubiquitin ligases were positively correlated with Foc-TR4 resistance. This is the first ever study in which E3 ubiquitin is shown to participate in Foc resistance. A gene (GSMUA_Achr6G18620_001) encoding SKP2 subunit of E3 ligase SCF complex that is a crucial component of R-mediated resistance (Craig et al., 2009), exhibited up-regulation at 6 dpi in the incompatibility, indicating SCF complex may also exert positive effect in Foc resistance. This is not consistent with the previous reports. Overall, ubiquitination driven by E2 conjugating enzymes and E3 ligases could have played important roles in R-mediated Foc resistance in 'Guijiao 9'."}]},{"head":"Conclusion","index":29,"paragraphs":[{"index":1,"size":174,"text":"In this study, we performed root xylem transcriptome analysis of resistant 'Guijiao 9′ and the susceptible Williams banana using RNA-Seq and compared expression profile differences between the two cultivars infected by Foc-TR4 for 2, 4 and 6 dpi. The differences in terms of DEGs between the resistant cultivar 'Guijiao 9′ and the susceptible cultivar Williams provide a comprehensive overview of the transcriptome of two banana cultivars with contrasting disease responses. The resistant 'Guijiao 9′ activated multiple resistance pathways, and DEGs were involved in the plant-pathogen interaction, signal transduction, second metabolism and other processes, suggesting that pathogen response is regulated by multi-gene networks. Among the DEGs, some defense-related genes showed different expression patterns between 'Guijiao 9′ and other resistant cultivars ('Yueyoukang 1′ and 'Nongke No 1′) challenged with Foc-TR4, suggesting that 'Guijiao 9′ had a different resistance mechanism. The resistance to Foc-TR4 was mainly signaled by JA/ET, which act in tandem to induce local and systemic expression of defense genes. It will provide insights into the host-pathogen interactions and uncovering the resistant mechanism of banana."}]}],"figures":[{"text":"Fig. 1 . Fig. 1. Characteristic symptoms of Foc-TR4 in susceptible and resistant banana in glasshouse. Plants were inoculated with Foc-TR4 and photographs were taken 1 month after inoculation. A, a clonal plant of 'Guijiao 9'. B, the rhizome of 'Guijiao 9′ cut in half. C, a clonal plant of Williams. D, the rhizome of Williams cut in half. "},{"text":"Fig. 2 . Fig. 2. Characteristic symptoms of Foc-TR4 in susceptible and resistant banana in field trials. External symptoms of Foc-TR4 in infected Williams A and B compared with resistant 'Guijiao 9′ C and D. Reddish-brown internal vascular discoloration of Foc-TR4 in infected Williams E and F compared with resistant 'Guijiao 9′ G and H. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) "},{"text":"Fig. 3 . Fig. 3. GO annotation of DEGs response to Foc-TR4 found in resistant cv. 'Guijiao 9′. "},{"text":"Fig. 4 . Fig. 4. Expression patterns of Foc-TR4 resistance-related genes. The color bars represent the values of log2-fold change at the same time point, ranging from green (−2) to red (2). A: plant-pathogen interaction; B: signal transduction; C: secondary metabolism; D: ubiquitin mediated proteolysis. The asterisk means the gene has been validated by qRT-PCR in the following chapter. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) "},{"text":"Fig. 5 . Fig. 5. Expression profiles of the 16 DGEs in 'Guijiao 9′ and Williams from 0, 2, 4 and 6 day inoculations with Foc-TR4. The qRT-PCR of each sample was performed three times and each treatment was amplified in triplicate. The red column indicates the resistant 'Guijiao 9′, and the blue column indicates the susceptible var. Williams. Dpi indicates days after inoculation. These DEGs were marked with an asterisk in Fig. 4. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.) "},{"text":"Table 1 Quality characteristics performance of Guijiao 9. Banana variety Banana peel thickness Banana edible percentage Total soluble solid Total sugar content Vitamins content (mg/ Titratable acid content Banana variety Banana peel thicknessBanana edible percentageTotal soluble solidTotal sugar contentVitamins content (mg/Titratable acid content  (mm) (%) content (%) (mg/100 g) 100 g) (%) (mm)(%)content (%)(mg/100 g)100 g)(%) Guijiao 9 3.64a 69a 22.3a 19.6b 6.38a 0.43a Guijiao 93.64a69a22.3a19.6b6.38a0.43a Williams 3.67a 72a 22.9a 20.3a 6.62a 0.33a Williams3.67a72a22.9a20.3a6.62a0.33a  "},{"text":"Table 2 Evaluation of banana germplasm for resistance to Foc-TR4. Variety Number of treated plants Glasshouse Evaluation VarietyNumber of treated plantsGlasshouse Evaluation  "},{"text":"Table 3 Disease incidence and yield of 'Guijiao 9′ in different plantations from 2012 to 2017. Location Year Line Tested area (ha) Number of treated plants Yield per plant (kg) Total yield (kg/ha) Incidence of Foc-TR4 infection (%) LocationYearLineTested area (ha)Number of treated plantsYield per plant (kg)Total yield (kg/ha)Incidence of Foc-TR4 infection (%) Huangliu, Hainan 2012 Guijiao 9 1.33 900 25.3b 62776.5a 8.10b Huangliu, Hainan2012Guijiao 91.3390025.3b62776.5a8.10b   Baxi  900 26.7a 19825.5b 72.50a Baxi90026.7a19825.5b72.50a  2013 Guijiao 9 1.33 900 26.6a 51747.0a 21.40b 2013Guijiao 91.3390026.6a51747.0a21.40b   Baxi  900 0b 0b 100.00a Baxi9000b0b100.00a Dongying, Hainan 2012 Guijiao 9 6.67 5000 27.6b 67663.6a 4.60b Dongying, Hainan2012Guijiao 96.67500027.6b67663.6a4.60b   Baxi  5000 31.2a 39846.0b 52.70a Baxi500031.2a39846.0b52.70a  2013 Guijiao 9 6.67 5000 28.7a 64915.5a 11.30b 2013Guijiao 96.67500028.7a64915.5a11.30b   Baxi  5000 0b 0b 100.00a Baxi50000b0b100.00a Xiaqiao, Guangdong 2013 Guijiao 9 1.33 900 27.7b 65740.5a 12.10b Xiaqiao, Guangdong2013Guijiao 91.3390027.7b65740.5a12.10b   Baxi  900 30.7a 38461.5b 53.60a Baxi90030.7a38461.5b53.60a Ningwu, Guangxi 2014 Guijiao 9 0.87 655 24.8b 46500.0a 0b Ningwu, Guangxi2014Guijiao 90.8765524.8b46500.0a0b   Williams  655 26.8a 46682.3a 7.10 Williams65526.8a46682.3a7.10  2015 Guijiao 9 0.87 655 25.3b 45084.6b 0.95b 2015Guijiao 90.8765525.3b45084.6b0.95b   Williams  655 27.9a 46036.7a 8.33a Williams65527.9a46036.7a8.33a  2016 Guijiao 9 0.87 655 22.8b 44460.0a 5.05b 2016Guijiao 90.8765522.8b44460.0a5.05b   Williams  655 26.5a 36296.5b 29.76a Williams65526.5a36296.5b29.76a  2017 Guijiao 9 0.87 655 26.2a 52149.0a 7.23b 2017Guijiao 90.8765526.2a52149.0a7.23b   Williams  655 26.9a 35746.5b 33.60a Williams65526.9a35746.5b33.60a  "},{"text":"Table 5 Differentially a expressed genes (DEGs) in Guijiao 9 and Williams during Foc-TR4 treatment.   Williams Unique in Williams Guijiao 9 Unique in Guijiao 9 Common in both WilliamsUnique in WilliamsGuijiao 9Unique in Guijiao 9Common in both DEGs at 2 dpi Total 841 580 1876 1615 261 DEGs at 2 dpiTotal84158018761615261  Up-regulated 411 238 909 736 173 Up-regulated411238909736173  Down-regulated 430 382 967 919 48 Down-regulated43038296791948 DEGs at 4 dpi Total 904 771 590 457 133 DEGs at 4 dpiTotal904771590457133  Up-regulated 443 332 386 275 111 Up-regulated443332386275111  Down-regulated 428 419 204 195 9 Down-regulated4284192041959 DEGs at 6 dpi Total 1034 379 4310 3655 655 DEGs at 6 dpiTotal103437943103655655  Up-regulated 320 40 3306 3026 280 Up-regulated3204033063026280  Down-regulated 714 342 1004 632 372 Down-regulated7143421004632372  "},{"text":"Table 6 Significantly enriched KEGG pathways of the defense-related DEGs. pathays ko term DEGs pathay ID pathaysko termDEGspathay ID   tested  tested Plant hormone signal transduction 30 115 ko04075 Plant hormone signal transduction30115ko04075 Starch and sucrose metabolism 27 79 ko00500 Starch and sucrose metabolism2779ko00500 Biosynthesis of amino acids 50 70 ko01230 Biosynthesis of amino acids5070ko01230 Carbon metabolism 44 65 ko01200 Carbon metabolism4465ko01200 Phenylpropanoid biosynthesis 14 55 ko00940 Phenylpropanoid biosynthesis1455ko00940 Protein processing in endoplasmic 22 53 ko04141 Protein processing in endoplasmic2253ko04141 reticulum    reticulum Plant-pathogen interaction 18 51 ko04626 Plant-pathogen interaction1851ko04626 Amino sugar and nucleotide sugar 22 44 ko00520 Amino sugar and nucleotide sugar2244ko00520 metabolism    metabolism Cysteine and methionine metabolism 25 42 ko00270 Cysteine and methionine metabolism2542ko00270 Ribosome 34 40 ko03010 Ribosome3440ko03010 Viral carcinogenesis 18 36 ko05203 Viral carcinogenesis1836ko05203 Glycolysis/Gluconeogenesis 18 32 ko00010 Glycolysis/Gluconeogenesis1832ko00010 Glutathione metabolism 12 29 ko00480 Glutathione metabolism1229ko00480 Cell cycle 19 26 ko04110 Cell cycle1926ko04110 Glycine, serine and threonine metabolism 20 25 ko00260 Glycine, serine and threonine metabolism2025ko00260 Oxidative phosphorylation 14 24 ko00190 Oxidative phosphorylation1424ko00190 RNA transport 19 23 ko03013 RNA transport1923ko03013 Glycerophospholipid metabolism 18 23 ko00564 Glycerophospholipid metabolism1823ko00564 Phenylalanine metabolism 11 20 ko00360 Phenylalanine metabolism1120ko00360 Flavonoid biosynthesis 10 16 ko00941 Flavonoid biosynthesis1016ko00941 Peroxisome 17 18 ko04146 Peroxisome1718ko04146 Carbon fixation in photosynthetic 14 18 ko00710 Carbon fixation in photosynthetic1418ko00710 organisms    organisms Ubiquitin mediated proteolysis 11 22 ko04120 Ubiquitin mediated proteolysis1122ko04120 MAPK signaling pathway 5 10 ko04010 MAPK signaling pathway510ko04010 Calcium signaling pathway 5 10 ko04020 Calcium signaling pathway510ko04020  "}],"sieverID":"98a0d487-6c03-412c-9ba6-f8edc503f012","abstract":"Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc), is one of the most devastating diseases in bananas resulting in significant loss of Cavendish bananas production worldwide. Here we show the agronomic traits and the resistance of 'Guijiao 9′ in the field trials from 2012 to 2017. And then we dissect and compare the transcriptome response from these two cultivars (cv. 'Guijiao 9′ and cv. Williams) in an attempt to understand the molecular basis that contribute to the enhanced Foc tropical race 4 (Foc-TR4) resistance.'Guijiao 9′ is a Cavendish cultivar with strong resistance to Foc-TR4, which was reflected in a lower disease severity and incidence in glasshouse and field trails, when compared to the susceptible cultivar Williams. Gene expression profiles of 'Guijiao 9′ and Williams were captured by performing RNA-Seq analysis on 16 biological samples collected over a six day period post inoculation with Foc-TR4. Transcriptional reprogramming in response to Foc-TR4 was detected in both genotypes but the response was more drastic in 'Guijiao 9′ than in Williams. Specific genes involved in plant-pathogen interaction and defense signaling including MAPK, calcium, salicylic acid, jasmonic acid and ethylene pathways were analyzed and compared between 'Guijiao 9′ and Williams. Genes associated with defense-related metabolites synthesis such as NB-LRR proteins, calmodulinbinding protein and phenylpropanoids biosynthesis genes were significantly up-regulated in 'Guijiao 9′ resistant to Foc-TR4 infection. Taken together, this study highlights the important roles of plant hormone regulation and defense gene activation in mediating resistance in 'Guijiao 9'."}

data/part_1/0a8044b057bee8bfd1bf7c414bed88f9.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a8044b057bee8bfd1bf7c414bed88f9","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9ef6bfb1-e12c-418a-a81d-455bab171d7c/retrieve"},"pageCount":28,"title":"International Centre for Tropical Agriculture (CIAT)-Uganda Office Presentation during Bioversity visit to CIAT-KAMPALA","keywords":["GAC","SDC","USAID","BMGF","IAid","AGRA","IDRC","WB","ASARECA","CORAF","CCARDESA GOV","NGOs"],"chapters":[{"head":"Platform For Building Partnerships Between And Within Networks","index":1,"paragraphs":[{"index":1,"size":2,"text":"And Countries "}]},{"head":"PABRA Framework","index":2,"paragraphs":[{"index":1,"size":28,"text":"• 5-Yr regional agenda and priorities • Comprehensive and covers all/most aspect of bean value chain • Aligned to national, sub-regional and CAADP priorities   Strengthening Private sector-led partnerships"},{"index":2,"size":7,"text":"• Partnerships expanded in the following areas:"},{"index":3,"size":4,"text":"• Input access-Syngenta, Yara,"},{"index":4,"size":7,"text":"• Integrated pest and disease management-Real IPM"},{"index":5,"size":5,"text":"• Private Sector: Corridor Approach  "}]}],"figures":[{"text":"• PABRA: Nutritionist (Nairobi), Market specialist (Rwanda), Agronomist (Nairobi), Seed system specialist (Tanzania); Gender specialist (Nairobi), Gender specialist, Climate change specialist, Project Officer, KM and Communication, breeders (Malawi and Ghana)• CIAT Global: Molecular Genetist/Breeder (Andean breeding program), Senior Breeder (Meso American breeding program), Physiologist, Plant Pathologist "},{"text":"• Basis for planning and execution of collective programmes and activities • Commonly used in all countries although doing different and relevant activities • Provide space and entry point for actors or donors to integrate and contribute components at any point/stage • Integrates projects:  "},{"text":"Partnership and Implementation Framework (SDC Support 2015 -2019)  Increased access to cost effective and environmentally Increased access to cost effective and environmentally friendly integrated stress management options (e.g. for friendly integrated stress management options (e.g. for soil fertility and water, pest and diseases) by particularly soil fertility and water, pest and diseases) by particularly women farmers women farmers Increased access to high value bean products targeted to Increased access to high value bean products targeted to niche markets with a niche markets with a  "},{"text":"focus on women Increased capacity of men and women to participate in technology development, delivery and decision making bodies equitably Increased access to new and existing markets and opportunities for both men and women Increased response to demands in the bean sector , and utilizing information and knowledge to influence bean policy in a gender equitable manner Increased   "},{"text":"communities Intermediate Outcomes Immediate Outcome Ultimate Outcome Increased access to market and advisory support services for men and women small holder farmers and SMEs  "},{"text":"Increased access to climate smart agricultural technologies, practices and information for bean production (volume and quality) Increased smallholder farmers' resilience to climate change  Contribute to Contribute to poverty poverty reduction among reduction among small holder small holder farmers by farmers by reducing food reducing food insecurity, insecurity, increasing increasing incomes, and incomes, and strengthening strengthening climate smart climate smart agriculture agriculture Increased access to skills, information and Increased access to skills, information and knowledge providing enabling environment for knowledge providing enabling environment for bean research and development in PABRA bean research and development in PABRA countries countries  "},{"text":"Increased income of smallholder farmers many of whom are women and the rural poor involved in the bean trade. Improved food and nutrition security in a gender equitable and sustainable manner Enhanced partnerships and linkages for increased access to markets in a gender equitable manner Increased access to bean and dry bean products for consumption among poor households in a gender equitable manner. Ultimate Intermediate Immediate Outcome UltimateIntermediateImmediate Outcome Outcome Outcomes  OutcomeOutcomes  "},{"text":"Improving Bean Productivity And Markets In Africa (Implementation Framework -2016-2022) Roles Of Partners A Long The Value Chain (From Lab To Market /Mouth)  Link    Link CIAT Biophysical Social NARES: Management Scientists Development Partners, Private and Policy makers Users CIAT Biophysical SocialNARES: Management ScientistsDevelopment Partners, Private and Policy makersUsers • Joint priority setting • Joint search for solutions • Strategic research • Catalyzing impact • Germplasm conservation • Technology adaptation and policy support pathways • Catalyzing impact • Catalyzing links and partnerships to reach users • Joint priority setting • Joint search for solutions • Strategic research • Catalyzing impact • Germplasm conservation• Technology adaptation and policy support pathways • Catalyzing impact• Catalyzing links and partnerships to reach users pathways    pathways • Capacity building    • Capacity building  "},{"text":"Research for Development and Impact  PABRA Partnership Principles PABRA Partnership Principles • To enhance synergy and efficiency • To enhance synergy and efficiency • Building social capital • Building social capital RESEARCH • Partnership and leveraging comparative advantages of partners RESEARCH • Partnership and leveraging comparative advantages of partners Technologies, Innovations, Management Practices (TIMPs) • Strengthen national ownership of programs • Breeding & variety development • Agronomy • Pest and disease monitoring • Take advantage of other potential / common actors (seed • Widescale uptake • Extension • Influence adoption NGOs) • Climate smart agriculture • Markets • Build on NARS bean programs and existing partner networks. Technologies, Innovations, Management Practices (TIMPs) • Strengthen national ownership of programs • Breeding & variety development • Agronomy • Pest and disease monitoring • Take advantage of other potential / common actors (seed • Widescale uptake • Extension • Influence adoption NGOs) • Climate smart agriculture • Markets • Build on NARS bean programs and existing partner networks. • Value Addition • Linkages with other big initiatives (several seed companies • Nutrition • Gender • Impact assessments and donor supported • Value Addition • Linkages with other big initiatives (several seed companies • Nutrition • Gender • Impact assessments and donor supported • Shared responsibility among PABRA members • Shared responsibility among PABRA members  "},{"text":"Partnership in bean variety development: Division of responsibility based on comparative advantage and national interest    Uganda,  Tanzania Uganda,Tanzania   Malawi Large Red Dark Red Zimbabwe MalawiLarge RedDark RedZimbabwe    Mottled Kidney MottledKidney Rwanda   Ethiopia RwandaEthiopia   Climbing  S. Tanzania ClimbingS. Tanzania   Beans  Small Red BeansSmall Red Uganda Kenya Snap Beans (French)  Kenya S. Africa Uganda KenyaSnap Beans (French)Kenya S. Africa     Pinto Pinto Madagascar Large White  Sugar, MadagascarLarge WhiteSugar,     Tan & Tan &     Yellow Yellow     DR Congo DR Congo    Small White Carioca (small striped) S. Africa Malawi Zambia Small WhiteCarioca (small striped)S. Africa Malawi Zambia   Ethiopia  Ethiopia EthiopiaEthiopia   S.  S.  "},{"text":"Africa Regional Networks/CIAT Strategic Research Backstopping, Technical Support and Capacity Building CIAT-HQ Elite breeding lines, breeding methodologies, tools, capacity building and backstopping PABRA countries without active Breeding Programs:  Commodity Corridor Approach MAC 44, MAC 70 Commodity Corridor ApproachMAC 44, MAC 70 MAC 44 • The Commodity Corridor Approach   MAC 44 • The Commodity Corridor Approach continuous to concretized ECABREN: Burundi and Sudan, SABRN: Angola, SDRC, Lesotho, continuous to concretizedECABREN: Burundi and Sudan, SABRN: Angola, SDRC, Lesotho, • Major bean corridors in Africa have MAC 64 been mapped Mauritius, Mozambique and Swaziland; WECABREN: Cameroon, Mali, Central Afr Rep, Ghana, Senegal, Togo, Burkina Faso, Guinea, S/Leone, Congo SMR 53 • Major bean corridors in Africa have MAC 64 been mappedMauritius, Mozambique and Swaziland; WECABREN: Cameroon, Mali, Central Afr Rep, Ghana, Senegal, Togo, Burkina Faso, Guinea, S/Leone, CongoSMR 53 • Corridor Approach forming the core of   • Corridor Approach forming the core of PABRA work   PABRA work • The Approach continues to receive a lot   • The Approach continues to receive a lot of interest from various partners, e.g. NUA45  of interest from various partners, e.g.NUA45 AfDB, WB, FAO   AfDB, WB, FAO • The Approach can be applied beyond beans Universities/ARI Testing methodologies, understanding genetics • The Approach can be applied beyond beansUniversities/ARI Testing methodologies, understanding genetics   etc.. etc.. SER125   SER125  "},{"text":"National Gov'ts Direct And Indirect PABRA Funding Private sector CIAT/PABRA NARS CIAT/PABRA Govts Direct grants Private sector Donors GAC, SDC, BMZ, IDRC, BMGF, SYNGENTA, IRISH AID, USAID etc CIAT Uganda Bean Program Staffing • Three IRS (Plant breeder, Agricultural economist/impact assessment, M&E specialist) • Research Support Staff : Research Associates: Plant pathologists 1, Plant breeder; 1, Agricultural economist; 1, Database officer; 1); Research Assistants (Molecular biologist; 1); Technical Assistants (Plant pathology/plant breeding; 6); Casual laborers >20 (wages) • Support staff; Human Resources, Executive secretary, Finance officer, Accountant, Drivers (3), Lab cleaner, Security guard • Seed production • Seed production • Processors • Processors • Traders -ICT and Ag-MasterCard Innovation Lab • Traders -ICT and Ag-MasterCard Innovation Lab • Post harvest handing-GrainPro • Post harvest handing-GrainPro • Product development-Lasting Solutions, Nutreal, Azuri, Farm Fresh • Product development-Lasting Solutions, Nutreal, Azuri, Farm Fresh • AFEX Commodities Exchange Limited, Nigeria -initial discussion • AFEX Commodities Exchange Limited, Nigeria -initial discussion  "}],"sieverID":"c29ba37b-6396-4845-85df-f2192a533b26","abstract":""}

data/part_1/0ace28d5bd63d991af93a45fb278d1f3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0ace28d5bd63d991af93a45fb278d1f3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/dc7f570c-42aa-486d-a868-4c735d88b647/retrieve"},"pageCount":48,"title":"","keywords":[],"chapters":[{"head":"DỰ ÁN FOODSTART+","index":1,"paragraphs":[{"index":1,"size":159,"text":"Dự án tăng cường khả năng phục hồi lương thực nhờ cây lấy củ vùng Miền núi và Duyên hải thuộc Châu Á Thái Bình Dương (FoodSTART+) là 1 dự án kéo dài 3 năm (2015)(2016)(2017)(2018), dựa trên nền tảng và nhân rộng của dự án FoodSTART được tài trợ bởi IFAD, với mục tiêu đảm bảo anh ninh lương thực thông qua cây lấy củ. FoodSTATR+ được điều phối và quản lí bởi Trung tâm Khoai tây Quốc tế (CIP) cùng với sự hợp tác thực hiện với Trung tâm nghiên cứu nông nghiệp nhiệt đới (CIAT). Dự án còn có sự hợp tác chặt chẽ với 2 chương trình nghiên cứu của CGIAR , thứ nhất là dự án nghiên cứu các cây cỏ củ và chuối (RTB), và thứ hai là chương trình nghiên cứu về biến đối khí hậu, nông nghiệp và an ninh lương thực (CCAFS). FoodSTATR+ được tài trợ bởi IFAD and EU."},{"index":2,"size":126,"text":"Mục tiêu của dự án là cải thiện khả năng phục hồi về lương thực cho người nghèo ở những vùng núi và vùng duyên hải Châu Á Thái Bình Dương thông qua các sáng kiến về các sản phẩm cây lấy củ. Để đạt được những mục tiêu đó, FoodSTART+ sẽ phát triển, hợp thức hóa, và triển khai các hoạt động thông qua hợp tác với các dự án đầu tư của IFAD để xúc tiến tính an ninh lương thực. Meghalaya, Ấn Độ; Đảo Maluku, Indonesia,Miền Đồng và miền Trung của vùng, Philippines, và Quảng Bình, Việt Nam là bốn nước được hưởng lợi chính từ dự án FoodSTART+. Trung Quốc và Myanmar là những nước hưởng lợi phụ từ dự án này"}]},{"head":"GIỚI THIỆU","index":2,"paragraphs":[{"index":1,"size":352,"text":"Cây khoai lang là cây đứng vị trí quan trọng thứ 2 trong họ cây lấy củ sau cây khoai tây và được đánh giá có tầm quan trọng đảm bảo an ninh lương thực ở nhiều nước châu Á. Trong lịch sử ghi nhận cây khoai lang được xem là cây cứu đói khi thiên tai xảy ra. Nhiều người Nhật đã phụ thuộc vào cây khoai lang khi thiên tai xảy ra ảnh hưởng nghiêm trọng đến cây lúa nước. Cũng tương tự như vậy, năm 2013 bão Hayan ở Philippine, người dân ở cùng nông thôn cũng đã sống sót được trong tuần đầu tiên sau bão nhờ cây khoai khi mà nguồn lương thực cứu trợ chưa thể tiếp cận được. Vào những năm đầu 1960, nạn đói xảy ra ở Trung Quốc và dịch bệnh gây nên bởi virus ravaged trên sắn, thì cây khoai được xem là cây có thể giúp những người địa phương vượt qua nạn đói. Bên cạnh đó, cây khoai lang được xem là cây có khả năng chống chịu ảnh hưởng với biến đối khí hậu, đặc biệt là ở vùng Trung Bộ Việt Nam, nơi chịu ảnh hưởng nặng nề và dễ bị tổn thương với các hình thái thời tiết cực đoan. Cây khoai là cây thân củ, phát triển sát mặt đất, ít bị ảnh hưởng bởi bão; thời gian sinh trưởng ngắn khoảng tầm 3-4 tháng, vì vậy, cây khoai lang có thể được trồng và thu hoạch trong thời gian ngắn và sản xuất để làm lương thực cho những cộng đồng bị ảnh hưởng bởi thiên tai. Thêm vào đó cây khoai lang còn được đánh giá có khả năng chống chịu với các đất nhiễm mặn trong bối cảnh biến đổi khí hậu làm mực nước biển dâng và một số đặc trưng khác. Tại Việt Nam, cây khoai lang đóng vai trò quan trọng cho các hộ nông dân sản xuất nhỏ lẻ, hoặc được dùng như một nguồn thực phẩm khác cho gia đình, hoặc có thể dùng trong lúc thiếu gạo."},{"index":2,"size":422,"text":"Tuy nhiên, theo nghiên cứu \" Đánh giá phương thức canh tác khoai và sắn hiện tại với phương thức canh tác thông minh với Biến đổi khí hậu (BDKH)\" được thực hiện bởi FoodSTART+ với sự hợp tác của Dự án Phát triển Nông thôn Bền vững vì người nghèo tỉnh Quảng Bình (SRDP) được đầu tư với của Quỹ Phát triển Nông nghiệp Quốc tế (IFAD) cho thấy rằng, nông dân hiện đang đối mặt với hiện tượng xói mòn và thoái hóa đất, đặc biệt là những vùng đồi núi nơi mà độ màu mỡ của đất giảm rất nhanh do giảm phủ xanh đồi trọc (Wilkins 2017). Thế nhưng nông dân thì không phải lúc nào cũng áp dụng các kĩ thuật canh tác để bảo tồn quản lí hiệu quả để duy trì chất dinh dưỡng cho đất. Sau một vài năm canh tác với việc áp dụng các phương thức canh tác không phù hợp, năng suất cây trồng giảm kéo theo đó là hiệu quả kinh tế giảm. Nông dân sản xuất ra các loại cây lấy củ với chất lượng và năng suất thấp nên điều tấc nhiên là không thể mở rộng diện tích sản xuất. Mặc dù vẫn chưa xác đinh được nguyên nhân chính xác, nhưng theo kết quả của nghiên cứu này cũng chỉ ra rằng việc sử dụng một cách rộng rãi các giống cây chất lượng kém, cộng với việc thiếu các kĩ thuật trong quản lí dịch hại. Nông dân cũng không tìm ra bất cứ một phương pháp áp dụng nào khác, hoặc thực hành kỹ thuật để áp dụng một cách tốt hơn, hoặc tin tưởng rằng không có một phương thức nào tốt hơn có thể được áp dụng để cải tiến phương thức canh tác hiện tại. Với những vấn đề nêu trên nông dân đang gặp phải, báo cáo nghiên cứu có đề cập đến việc áp dụng kĩ thuật canh tác thông minh với Biến đổi khí hậu (CSA) với mục đích giúp nông dân cải thiện phương thức canh tác hiện tại. Với các kĩ thuật canh tác theo CSA nó bao gồm các phương thức canh tác thông minh và hiệu quả các vật tư đầu vào (phân bón, thuốc trừ sâu, giống và nhân công) và sử dụng hiệu quả và tiết kiệm tài nguyên thiên nhiên (đất và nước) và kết quả mong muốn là tăng năng suất và giảm tác động lên đất, nước và rừng."},{"index":3,"size":202,"text":"Tài liệu tập huấn này được thiết kế để mô tả các phương thức canh tác CSA, theo lối tiếp cận là truyền đạt các kĩ thuật để đảm bảo phát triển bền vững và tăng cường an ninh lương thực trong bối cảnh BDKH. Nhóm biên tập cũng hy vọng rằng tài liệu sẽ có ý nghĩa thiệt thực đến những học viên tham gia vào khóa tập huấn như cán bộ khuyến nông cấp Huyện, xã, các trưởng nhóm nông dân, cán bộ điều phối SRDP tỉnh Quảng Bình ở các cấp khác nhau. Sau đó, nhóm học viên này sẽ tập huấn lại cho các nông dân trên địa bàn để có thể cải thiện phương thức canh tác hiện tại, giải quyết các vấn đề gặp phải và đưa ra các quyết định cho phương thức sản xuất của chính gia đình. Từ đó, nông dân có thể tiếp tục học tập, không ngừng tìm tòi học hỏi, thử các phương thức sản xuất mới với mục đích để giải quyết những thách thức, cơ hội liên quan đến sinh kế của chính gia đình. Mỗi dây giống có độ dài khoảng 25-35 cm và có 6-8 mắt."}]},{"head":"Thuận lợi:","index":3,"paragraphs":[{"index":1,"size":13,"text":"• Dễ dàng phục hồi sau khi bị sốc do cắt và trồng."},{"index":2,"size":9,"text":"• Lên nhanh hơn các phần dưới gần gốc."}]},{"head":"Độ dài khoảng cách giữa các đốt phụ thuộc vào từng giống khoai, 3 đốt khoảng 30cm Dây giống khỏe và sạch dịch bệnh","index":4,"paragraphs":[{"index":1,"size":6,"text":"Lựa chọn và chuẩn bị đất."},{"index":2,"size":99,"text":"Việc lựa chọn ruộng để trồng khoai không phải là chọn những ruộng đã từng trồng khoai trước đó. Ruộng khoai cần được cách xa khoảng 100m ruộng khoai vụ trước với mục đích để tránh sự lây lan của dịch hại và sâu bệnh. Tốt nhất nên chọn các ruộng khoai mà vụ trước trồng lúa hoặc các loại cây lương thực trồng ngập nước khác, đây là cách tối ưu nhất để hạn chế khả năng năng lây nhiễm dịch hại và sâu bệnh. Ruộng khoai cần gần nguồn nước để phục vụ cho việc tưới tiêu."},{"index":3,"size":88,"text":"Đất thịt pha cát, đất cát pha thịt nhẹ, và loại đất có khả năng thoát nước tốt là những loại đất tối ưu để trồng cây khoai lang (đất phù sa, bồi đắp từ hai bên bờ sông, đất đồng bằng canh tác lúa nước, đất có đồi dốc thấp sau khi vụ xuân-hè trồng bắp hoặc vụ hè-thu trồng đậu nành, đất đồi sau vụ hè-thu trồng đậu nành). Các loại đất dễ thoát nước đóng vai trò quan trọng trong việc canh tác khoai lang."}]},{"head":"Các kỹ thuật khuyến cáo:","index":5,"paragraphs":[{"index":1,"size":81,"text":"Cày: 2 lần và khoảng cách 1 tuần giữa 2 lần. Lần cày thứ 2 nên nên băng qua đường cày lần thứ nhất đồng thời kết hợp bón phân chuồng với tỉ lệ 600-900 kg/1,000 m2 hoặc tầm 9,000 kg/ha sau đó trộn lẫn vào đất. Độ sâu lưỡi cày khoảng tầm 20cm. Xử lí các bã cây của vụ trước còn lại có thể làm tăng khoáng chất cho đất và tốt cho sự phát triển của cây khoai."}]},{"head":"Dùng trâu để cày đất","index":6,"paragraphs":[{"index":1,"size":47,"text":"Bừa: mục đích làm tơi đất và loại bỏ những mảng đất to, nên bừa sau khi cày lần thứ 2 và ruộng khoai nên cần được bừa 2 lần trước khi lên vồn (luống), lần bữa thứ 2 cần đi băng qua đường bừa lần 1."}]},{"head":"Lên vồn (luống):","index":7,"paragraphs":[{"index":1,"size":16,"text":"Tạo vồn cho cây khoai và đảm bảo chôn vùi tấc cả xác cây vụ trước."}]},{"head":"Thuận lợi:","index":8,"paragraphs":[{"index":1,"size":11,"text":"• Làm nhỏ đất và loại bỏ những mảnh đất to."},{"index":2,"size":21,"text":"• Làm tơi đất và diệt cỏ dại • Tạo khe hỡ trong đất cho rễ, củ khoai lang phát triển."},{"index":3,"size":14,"text":"• Trồng trên các vồn khoai để tránh bị ngập nước khi mưa lớn."},{"index":4,"size":18,"text":"• Giải phóng các chất dinh dưỡng bằng cách phân hủy các xác cây vụ trước để lại."}]},{"head":"Bón phân hữu cơ và trộn lẫn vào đất","index":9,"paragraphs":[{"index":1,"size":1,"text":"Trồng:"},{"index":2,"size":5,"text":"Các kỹ thuật khuyến cáo: "}]},{"head":"Khoai lang được trồng theo vồn","index":10,"paragraphs":[{"index":1,"size":2,"text":"Thuận lợi:"},{"index":2,"size":61,"text":"• Trồng theo vồn (luống) có thể tạo độ thông thoáng đảm bảo cho rễ bắt đầu hình thành và phát triển tốt. • Trồng kiểu đặt ngang cho hình dạng củ đẹp, vì rễ có diện tích để phát triển. • Để có thể đạt được năng suất tối ưu khoai lang cần một lượng chất dinh dưỡng nhất định."}]},{"head":"Các dây giống được trồng trên các ụ đất","index":11,"paragraphs":[]},{"head":"Cách thức đặt dây giống khuyến cáo","index":12,"paragraphs":[{"index":1,"size":2,"text":"Bón phân.  "}]},{"head":"Làm cỏ.","index":13,"paragraphs":[{"index":1,"size":49,"text":"Làm cỏ đóng vai trò quan trọng trong việc đảm bảo cây khoai lang sinh trưởng thuận lợi và trong 2 tháng đầu tiên, có thể hạn chế sự cạnh tranh chất dinh dưỡng, nước với khoai lang và còn giảm sự lây lan dịch hại và sâu bệnh."}]},{"head":"Thuận lợi:","index":14,"paragraphs":[{"index":1,"size":29,"text":"• Khoai lang có thể sinh trưởng trong điều kiện tối ưu nhất để hấp thụ chất dinh dưỡng mà không có bất kì yếu tố cạnh tranh nào."}]},{"head":"Xả luống: Các kỹ thuật khuyến cáo:","index":15,"paragraphs":[{"index":1,"size":33,"text":"Đất ở hai bên vồn được xả luống ra ở rãnh vồn, và cỏ dại cũng sẽ bị chôn vùi ở rãnh vồn. Xả luống được tiến hành sau khi trồng 3-4 tuần."}]},{"head":"Thuận lợi:","index":16,"paragraphs":[{"index":1,"size":45,"text":"• Tơi và xả đất, đây có thể xem 1 biện pháp để giúp cây khoai lang sinh trưởng thuận lợi. • Nhổ cỏ để lại trên đất có thể tăng độ phì nhiêu cho đất bằng cách gia tăng các hợp chất hữu cơ."}]},{"head":"Cỏ được phủ giữa các rãnh vồn","index":17,"paragraphs":[{"index":1,"size":2,"text":"Lên luống."}]},{"head":"Các kỹ thuật khuyến cáo:","index":18,"paragraphs":[{"index":1,"size":52,"text":"Đất sau khi xả luống cần được lên luống lại. Tại cùng thời điểm này, cỏ dại bị trộn lẫn hoặc bị chôn vùi trôn đất. Lên luống được tiến hành sau 2-3 tuần khi xả luống. Việc lên luống đóng vai trò quan trọng với mục đích để bảo vệ củ."}]},{"head":"Thuận lợi:","index":19,"paragraphs":[{"index":1,"size":24,"text":"• Kiểm soát cỏ dại • Các thành phần của cây sẽ được che phủ, tránh sự tấn công của bọ hà khoai lang."}]},{"head":"Lên luống đưa đất để che phủ đất bị nức nẻ","index":20,"paragraphs":[]},{"head":"Đất bị nức nẻ và củ nhô ra khỏi mặt đất rất dễ bị bọ hà tấn công","index":21,"paragraphs":[]},{"head":"Lật ngọn Các kỹ thuật khuyến cáo:","index":22,"paragraphs":[{"index":1,"size":84,"text":"Lật ngọn khoai lang được tiến hành sau 4 tuần sau khi trồng, cần được tiếp tục làm 2 tuần 1 lần, cũng có thể tiến hành trong khi làm cỏ. Nếu đất ẩm và các cuống của cây khoai lang sẽ bám vào đất, rễ sẽ phát triển ở các mắc. Vì thế việc lật ngọn để tránh việc các rễ này phát triển, vì thường các rễ này phát triển thì củ sẽ nhỏ và khó có thể mang đi bán được."}]},{"head":"Thuận lợi:","index":23,"paragraphs":[{"index":1,"size":15,"text":"• Khoai có năng suất và chất lượng cao đáp ứng yêu cầu thị trường."},{"index":2,"size":26,"text":"• Kỹ thuật này còn được áp dụng để có thể làm đất ở những vùng thường được che phủ bởi cuống và lá khoai lang."}]},{"head":"Kỹ thuật tưới nước Các kỹ thuật khuyến cáo:","index":24,"paragraphs":[{"index":1,"size":209,"text":"Có rất ít tài liệu nói về lượng nước tưới cần cung cấp cho cây khoai lang trong suốt thời gian sinh trưởng, tuy nhiên cần phải lưu í rằng độ ẩm thích hợp đóng vai trò hết sức quan trọng trong giai đoạn tháng đầu tiên, và cũng có thể nói chung rằng mực nước yêu cầu khi canh tác ruộng khoai cần khoảng 450 đến 650mm nước ( lượng nước này có thể từ nguồn nước mưa) có thể được phân bố đều đặn trong suốt chu kì sinh trưởng phát triển cây khoai lang. Với mục đích giữ độ ẩm cho ruộng khoai, môi trường đất với độ ẩm lí tưởng nhất cho sự phát triển của cây khoai là 70-80%, độ ẩm này cần được giữ trong suốt quá trình phát triển của cây khoai lang, và ruộng khoai không nên để bị ngập nước quá nửa ngày, đặc biệt là trong giai đoạn quan trọng từ tuần thứ tư cho đến tuần thứ tám sau trồng. Cây khoai lang cần được tưới 2 lần 1 tuần kể từ lúc trồng cho đến ngày thứ 20 sau khi trồng, và 2 tuần 1 lần từ lúc 40 ngày sau trồng cho đến khi thu hoạch."},{"index":2,"size":44,"text":"Trước khi thu hoạch 1 tháng cần dừng tưới nước để củ phát triển về mặt sinh lý học như hình dạng bên ngoài chắc chắn và đẹp. Trong quá trình tưới cần lưu í, đất phải đủ ướt thấm xuống sâu đến củ."}]},{"head":"Thuận lợi:","index":25,"paragraphs":[{"index":1,"size":26,"text":"• Năng suất cao và chất lượng củ tốt là hoàn toàn có thể có nếu mực nước đầy đủ và độ ẩm trong đất được "}]},{"head":"Trồng khoai theo vồn là phù hợp cho việc dẫn nước tưới tiêu ở các rãnh","index":26,"paragraphs":[]},{"head":"Quản lí dịch hại tổng hợp","index":27,"paragraphs":[]},{"head":"Các kỹ thuật khuyến cáo:","index":28,"paragraphs":[{"index":1,"size":46,"text":"Phương pháp quản lí dịch hại tổng hợp (IPM) tiếp cận theo phương thức lồng ghép sự am hiểu về hệ sinh thái của các loài sinh vật gây hại cho cây trồng với các biện pháp đưa ra để tránh hoặc giảm thiệt hại mùa"}]},{"head":"Sâu đục thân gây hại cho cây khiến héo, tăng trưởng kém, và thậm chí là chết","index":29,"paragraphs":[{"index":1,"size":118,"text":"Các củ bị bọ hà ăn sinh sản ra các độc tố (terpenes) để chống lại sự gây hại và thường có mùi khó chịu. Làm các loại thuốc phòng trừ sâu bệnh tự chế tại nhà có nguồn gốc từ thiên nhiên: Ớt , thuốc lá, Xà phòng, Tỏi, Tỏi ( Kiến, rệp, sâu bướm, Rệp sáp bột hồng); Thuốc lá (sâu bướm, rệp, và một số loại khác); Xà phòng ( các loại côn trùng và rệp sắp bột hồng); Tỏi (sâu bướm, bọ trĩ, khả năng 1 số bệnh từ nấm); Đỗ mai (rệp, sâu bướm, ruồi trắng) ; Cây cóc kèn (sâu bướm, châu chấu, rệp, nhện giăng tơ, rầy nâu); Tro (châu chấu)."}]},{"head":"Thuận lợi:","index":30,"paragraphs":[{"index":1,"size":1,"text":"• "}]},{"head":"Dải cây hương bài và lớp phủ với mục đích ngăn chặn sự xói mòn trên các ruộng ngô.","index":31,"paragraphs":[{"index":1,"size":9,"text":"Các lớp rơm được phủ giữa các hàng cây."}]},{"head":"Trồng cây che phủ đất","index":32,"paragraphs":[{"index":1,"size":2,"text":"Thuận lợi:"},{"index":2,"size":36,"text":"• Hình thành lớp phủ trên đất với xác cây và trồng cây che phủ đất có thể làm các loại giun trong đất tăng tính hoạt động. • Cải thiện tính chất cấu trúc đất."},{"index":3,"size":47,"text":"• Cải thiện hoạt động và sự đa dạng hệ động thực vật trong đất, vì thế việc trồng cây che phủ đất là rất cần thiết áp dụng để phục hồi đất. • Cải thiện chất lượng đất và giảm các nguy cơ thoái hóa đất."}]},{"head":"Đất được che phủ bởi cây trồng, ví dụ cây họ đậu có thể trồng trên ruộng có xác cây từ vụ trước để lại.","index":33,"paragraphs":[]}],"figures":[{"text":" Sử dụng các dây giống sạch bệnh và có chất lượng tốt từ những cây mẹ cho giống t��t • Tuổi trung bình của dây giống (50-60 ngày sau khi nhân giống trong nhà màng). • Dấu hấu bên ngoài: Mỏng, mập, đốt ngắn, lá mỏng, cuốn ngắn.• Không có dấu hiệu dịch hại và sâu bệnh, chưa ra rể, chưa ra hoa • Chỉ dùng dây giống ở đỉnh đọt (phần thứ nhất) và phần thứ 2. "},{"text":" vồn để trồng cây khoai lang là hết sức cần thiết cho rễ bắt đầu hình thành và phát triển, vì thế chiều cao của vồn đóng vai trò hết sức quan trọng. Dây giống cần được cắt khoảng với độ dài ít nhất là 3 đốt (20-30 cm), khoảng cách trồng giữa cả dây giống khoảng 25-30cm và 60-100 cm giữa các vồn. Đặt dây giống theo kiểu nằm ngang hình dạng củ sẽ đẹp hơn, thẳng hơn so với những kiểu khác. Để đặt dây giống theo kiểu nằm ngang, cần chuẩn bị 1 cọc đào lỗ và phải chắc chắn ít nhất cần đảm bảo phải trồng 2 đốt dưới mặt đất để cây khoai lang có thể sinh trưởng thuận lợi và các rể đều được chắc chắn mọc trong đất, chỉ để phần ngọn nhô lên mặt đất. Khi trồng lưu í đất phải ướt. Khi đang trồng nên bón toàn bộ lượng phân Ure và Đạm và một nửa phân Kali (150 kg Urea, 133 kg TSP, and 75 kg K 2 O). Phần Kali còn lại sẽ được bón 4 tuần sau khi trồng. "},{"text":" Tỷ lệ các loại phân bón khuyến cáo cần được đảm bảo sự cân bằng giữa các loại phân khác nhau, ví dụ theo tỷ lệ khuyến cáo như sau trên 1 ha 60kg Đạm, 60kg Ure, 90kg Kali lúc trồng. Sau khi trồng khoảng 4 tuần lượng Kali bón khoảng 45kg/1ha. Bảng 1 đưa ra tỷ lệ phân bón khuyến cáo sử dụng trên cây khoai ở Miền Trung Việt Nam. Nếu sử dụng phân hỗn hợp NPK, cần phải chuyển đổi tỷ lệ phù hợp với các loại phân bón đã được khuyến cáo sử dụng.Bảng 1. Tỷ lệ phân bón khuyến cáo sử dụng trên cây khoai lang ở MiềnTrung, Việt Nam (FCRI, 2011).• Tỷ lệ đạm và kali trong đất 1:3 là môi trường tối ưu nhất để phát triển củ có trọng lượng và đạt chất lượng tốt. • Việc bón thúc Kali có thể giúp phát triển của thân củ Phân NPK 20-10-10 "},{"text":" Một số nông dân ở Cao Quảng và Quảng Thạch cho biết rằng hiện tại trên cây khoai lang đã có một vài loại sâu bệnh như các loại ăn lá và ăn củ, đây là nguyên nhân gây nên năng suất giảm nghiêm trọng. Sâu đục thân phá hại cũng được ghi nhận tại 1 số hộ nông dân, cũng như một số loại côn trùng gây hại khác gây nên việc không thể thu hoạch. Tuy nhiên rất ít hộ nông dân tại 2 xã dự án dùng các thuốc hóa học để diệt sâu bệnh bởi vì nông dân ở đây không biết về chức năng của các loại thuốc hoặc lo ngại về an toàn thực phẩm. Về vấn đề dịch bệnh, một số nông dân cũng cho biết rằng trên ruộng khoai xuất hiện lá bị vàng úa và nhăn, tuy nhiên nông dân không biết nguyên nhân do đâu. Một số nông dân khác cũng nói rằng ruộng khoai gia đình cùng từng mắc một số bệnh, tuy nhiên không thể mô tả các dấu hiệu và triệu chứng, và cũng không biết làm thế nào để có thể phòng trừ hoặc xử lí. "},{"text":" Cung cấp cho nông dân các kiến thức và các lựa chọn khác nhau để hạn chế việc sử dụng và phụ thuộc vào thuốc hóa học trong việc quản lí dịch hại trong canh tác khoai lang. • An toàn, không gây độc cho người • Giảm ô nhiễm khí, nước và đất Bọ cánh cứng rùa vàng (Aspidomorpha spp.) Triệu chứng gây hại: Ấu trùng và con trưởng thành tấn công lá bằng cách tạo ra các lỗ hình tròn trên phiến lá Thiên địch: Pupal parasitoid, bọ ngựa Biện pháp kiểm soát: Kiểm soát loại vật chủ như các loại cỏ. Một số thiên địch như trứng và ấu trùng của các loại ký sinh trùng (Ong kí sinh, ong bắp cày, ong kư sinh) và các loại thiên địch ăn thịt (bọ ngựa trên cây khoai lang) Bọ hà (Cylas formicarius) Triệu chứng gây hại: Sâu non của bọ hà đục trong dây và củ tạo thành các đường đục, chất bài tiết được thải ra trong các đường đục. Bọ hà trưởng thành ăn các chồi mềm, lá, cuống lá và củ Thiên địch: Bọ chân chạy, nhện, kiến đầu to Biện pháp kiểm soát: Vệ sinh đồng ruộng, dùng dây giống sạch không bị sâu bệnh, vun xung quanh các gốc cây, luân canh cây trồng, cho ruộng ngập nước, tạo lớp phủ bề mặt ruộng. Sâu đục thân (Omphisa anastomosalis) Triệu chứng gây hại: Sâu non đục vào thân các đường đục lớn, gây nên các lỗ sâu rỗng ở thân cây, nghiêm trọng hơn có thể làm cây héo và chết. Thiên địch: Bộ sâu tai, bọ rùa, bọ chân chạy, kiến, nhện Biện pháp kiểm soát: Dùng dây giống sạch không bị sâu bệnh, hủy các dây giống bị nhiễm bệnh sau khi thu hoạch, luân canh cây trồng, bẫy ánh sáng, vun xung quanh các gốc cây. Bọ xít (Physomerus grossipes) Triệu chứng gây hại: Bọ xít non và trưởng thành chích dây, cuống lá khoai lang và nhựa cây làm cây héo và còi cọc. Biện pháp kiểm soát: Kiểm soát cỏ. Các loại cỏ vật chủ của bọ xít. Trồng các loại hoa nhỏ có thu hút các loại thiên địch như bướm và ong bắp cày. Cày lật tấc cả để đảm bảo rằng tiêu diệt các nơi sinh sản của bọ xít. Ruồi trắng (Homoptera: Aleyrodidae) Triệu chứng gây hại. Làm lá vàng và hoại tử Thiên địch: Bộ cánh màng (Ong) (prospatella clypealis Silvestra và crospatella sp.) Biện pháp kiểm soát: Vệ sinh đồng ruộng, dùng các giống không bị nhiễm côn trùng gây hại. Trồng các loại cây trồng không phải là vật chủ của ruồi trắng sau khi trồng khoai lang. Phun tỏi, xà phòng. Rệp vừng (Aphis gossypii) Triệu chứng gây hại: Các triệu chứng gây hại trực tiếp thường biến dạng của lá non và chồ.Triệu chứng bị nặng là lá quăn Thiên địch: (Oxyopes javanus Thorell), Nhện (Thomisus sp.), bọ rùa (Menochilus sexmaculatus) Biện pháp kiểm soát: Các loại thiên địch ăn thịt như: bọ rùa, chuồn chuồn cỏ and Ruồi giả ong, các loài này đều bắt cả con non và trưởng thành côn trùng có hại Các loại thiên địch thường hay gặp trên cây khoai lang: Thiên địch là các loại côn trùng có lợi trong việc kiểm soát sâu hại. tạo điều kiện cho thiên địch sống sót có thể giảm sâu hại. Tạo các nơi ẩn nấp hoặc tạo môi trường sống như các lớp mùn phủ hoặc loại phủ bề mặt khác cũng như trồng các loại cây có bông hoa nhỏ hai bên bờ ruộng, hàng rào, hoặc các cây trồng lâu năm khác có thể được xem như là nguồn thức ăn và nơi trú ẩn cho các loại thiên địch. thường gặp trên cây khoai lang:Hai bệnh gây nên thoái hóa trên giống khoai lang thường hay gặp, có khả năng lây lan và phá hủy nghiêm trọng nhất trên cây khoai lang là bệnh virus đốm gợn sóng khoai lang (SPFMV) và bệnh virus lùn xoắn lá khoai lang (SPCSV). Các loại virus này nhỏ hơn rất nhiều so với các loại khác, chỉ có thể sống và nhân bản dựa vào vật chủ hoặc nạn nhân. Và sau đó làm mất chức năng của mô tế bào, gây thiệt hại nghiêm trọng và khó có thể phục hồi cho vật chủ. Bệnh gẻ bệnh gây nên do nấm cũng rất phổ biến trên cây khoai lang ở Việt Nam.bệnh virus đốm gợn sóng khoai lang (SPFMV)Triệu chứng gây hại: Gợn sóng, đốm mờ trên lá, đôi khi viềm màu tím nhạt. Các đốm hoại tử bên ngoài hay bần hóa bên trong có thể làm giảm đến chất lượng củ.Vật truyền nhiễm: RệpBiện pháp kiểm soát: Nên sử dụng các loại giống sạch, loại bỏ và đốt những cây mắc bệnh kể từ khi còn nhỏ, tránh trồng khoai trên ruộng đã từng trồng khoai vụ trước đó.bệnh virus lùn xoắn lá khoai lang (SPCSV)Triệu chứng gây hại: Giảm sự phát triển / còi cọc làm cho cây và lá vẫn còn nhỏ, gây úa vàng các mô lá, có thể nhận biết các cây bị bệnh nổi bật so với câ không nhiễm bệnhVật truyền nhiễm: Ruồi trắngBiện pháp kiểm soát: Luôn luôn sử dụng các dây giống khỏe không bị nhiễm bệnh, nên trồng các giống có khả ăng chống chịu với bệnh tốt.Bệnh ghẻ (Elsinoe batatas)Triệu chứng gây hại: Các vết bần nổi màu nâu đến màu nâu nhạt, với tâm màu tím đến màu nâu, xuất hiện dọc theo dây. Thời tiết ẩm có lợi cho bệnh phát triển Biện pháp kiểm soát: Dùng các giống có khả năng chống chịu, dùng giây giống khỏe, không có dấu hiệu nhiễm bệnh.Các kỹ thuật khuyến cáo:Một số phương pháp có thể được áp dụng để chống lại thoái hóa đất và làm cho đất màu mỡ hơn: Cày và xác định các hướng vồn khoai thep dọc các đường đồng mức, trồng khoai giữa các giải cỏ, kết hợp với việc bón phân hữu cơ cho đất.Cây khoai lang được trồng theo luống nên việc luân canh có thể xem khá dễ dàng. Vì các loại cây luân canh có thể hạn chế đư���c sự cạnh tranh về ánh sáng cũng như chất dinh dưỡng.Thuận lợi: • Lưu giữ các chất dinh dưỡng của đất và cây trồng trong thời gian dài. • Canh tác theo băng có hàng rào xanh có thể làm làm giảm hiện tượng mất chất dinh dưỡng do xói mòn gây nên, số tiền có thể tiết kiệm được 4,1-85,5 USD/ha/năm (93,000-1,900,000 VND/ ha.năm) (Irawan, 2003): • Việc xen canh có thể đóng góp vào tăng tính đa dạng mùa màng và thực phẩm, tăng độ phì nhiêu trong đất nếu xen canh với các loại cây có hàm lượng Nito, và cũng có thể làm giảm sự phát triển của cỏ dại.Canh tác theo dải băng có hàng rào xanh với 2 dải cỏ.Canh tác theo các đường đồng mức (đường viền, đường vòng quanh)Thuận lợi:• Phương pháp bảo tồn rẻ và hiệu quả.• Kiểm soát xói mòn và rửa trôi bề mặt.• Duy trì khả năng sản xuất tự nhiên của đất.Canh tác theo đường vòng.34Tạo lớp mùn che phủ cho đất và hạn chế cày bừa đấtThuận lợi:• Làm giảm sự rửa trôi của phân Đạm và phân Lân vào nguồn nước.• Việc che phủ ruộng khoai lang bằng cây họ đậu có thể giúp tăng hàm lượng Đạm cho đất, ví dụ cây hoa mông gà. • Việc che phủ bề mặt ruộng khoai còn được xem là 1 phương pháp chống xói mòn đất, làm hạn chế quá trình rửa trôi chất dinh dưỡng Đạm và Ure. • Việc che phủ bề mặt ruộng khoai còn làm tăng hoạt tính của đất bằng cách gia tăng các chất hữu cơ trong đất. "},{"text":" Loại phân hóa học phổ biến được sử dụng tại xã Cao Quảng là phân Kali (P) hoặc phân Đạm (N). Ở xã Quảng Thạch, nông dân chủ yếu dùng phân Đạm (N) và Ure (P). Hầu hết các nông dân bón thúc 1 tháng sau khi trồng hoặc trong lần làm cỏ thứ nhất. Thỉnh thoảng, một số hộ nông dân bón phân cho khoai lang phụ thuộc vào lượng phân còn thừa lại của các loại cây trồng khác.Cây khoai lang cũng như các cây lấy củ khác, cần nhiều phân Kali, và ít phân Đạm (N) và Ure (P) hơn là cây ngô. Vì Kali là thành phần quan trọng nhất trong việc hình thành và phát triển củ. Tuy nhiên không phải chỉ bón Kali là đủ cho sự phát triển của cây khoai lang, tỉ lệ phân Đạm và Ure cũng cần được phải bón phù hợp. Khối lượng củ có thể đạt được tối ưu nhất khi hàm lượng Đạm và Kali trong đất khoảng 1:3. Vì vậy, việc bón phân Kali trong nửa giai đoạn đầu để phát triển thân cây sẽ giúp phát triển vỏ củ chắc chắn hơn. Hàm lượng Đạm cao sẽ dẫn đến phát triển của dây, đồng nghĩa với việc củ chậm phát triển. Các kỹ thuật khuyến cáo: Các kỹ thuật khuyến cáo:  "},{"text":" màng bởi các loài sinh vật gây hại gây ra. Các tiếp cận của IPM theo phương thức áp dụng kết hợp cách tiếp cận khác nhau để có hạn chế sự phá hoại mùa màng của dịch hại và sâu bệnh, đưa về ngưỡng cây trồng có thể chống chịu được, chứ không tiếp cận theo phương thức là loại bỏ hoàn toàn.Các kỹ thuật bao gồm vệ sinh mùa màng, phương thức và dùng thuốc bảo vệ thực vật hóa học hay sinh học để kiểm soát sâu bệnh. Sự lựa chọn các phương pháp còn phụ thuộc loại dịch bệnh chính nào cần được kiểm soát, phần nào của cây trồng bị tấn công, loại thiệt hại nào và dụng cụ có thể tìm thấy dễ dàng Mục tiêu của vệ sinh mùa màng để ngăn ngừa và loại bỏ mầm mống và vật chủ trung gian của vi sinh vật có hại và mầm bệnh. Việc luân canh cây trồng có thể được xem là 1 biện pháp để ngăn ngừa việc phát triển của một loại dịch hại và sâu bệnh cụ thể ở cùng một đồng ruộng. Phòng trừ bằng phương thức lúc trồng bao gồm sử dụng các giống không bị nhiễm sâu hại và dịch bệnh, các cây giống khỏe có khả năng chống chịu tốt hơn với sự tấn công sâu hại và dịch bệnh. Trồng khoai với mật độ dày là không được khuyến cáo vì đó cũng là một trong những nguyên nhân làm cho cây trồng dễ mắc sâu bệnh hơn. Cách thức kiểm soát bằng cơ học có thể sử dụng một số thiết bị và dụng cụ hỗ trợ. Giống trong nhà màng có thể tránh được sự xâm nhập các loại côn trùng biết bay. Phương thức kiểm soát bằng sinh học sử dụng các loại thiên địch có lợi để kiểm soát sâu hại và dịch bệnh. Dùng các loại cây tự nhiên có thể làm thuốc b��o vệ thực vật cho các hộ nông dân sản xuất quy mô nhỏ, có mong muốn sản xuất bằng cách áp dụng các phương pháp quản lí dịch hại bằng phương pháp sinh học an toàn và rẻ tiền.  "}],"sieverID":"04cfe79a-c7c3-48a7-9c12-91b9df9a6dab","abstract":"Kỹ thuật khuyến cáo áp dụng trong canh tác khoai lang tỉnh Quảng Bình, Việt Nam; Một cách thức hỗ trợ phát triển bền vững vùng nông thôn Và đảm bảo an ninh lương thực trong bối cảnh Biến đổi khí hậu Tài liệu tập huấn Dự án tăng cường khả năng phục hồi lương thực nhờ cây lấy củ vùng Miền núi và Duyên hải thuộc Châu Á Thái Bình Dương (FoodSTART+) 11/2017 Tài liệu trích dẫn Tổ chức Khoai tây Quốc tế. 2017-Kỹ thuật khuyến cáo áp dụng trong canh tác khoai lang ở Quảng Bình, Việt Nam; Một cách thức hỗ trợ phát triển bền vững vùng nông thôn và đảm bảo an ninh lương thực trong bối cảnh Biến đổi khí hậu. Tài liệu tập huấn. Dự án đảm bảo an ninh lương thực nhờ cây lấy củ vùng Miền núi và Duyên hải thuộc Châu Á Thái Bình Dương (FoodSTART+). Tổ chức Khoai tây Quốc tế (CIP). Laguna, Philippines. 39pp. Xuất bản bởi Dự án đảm bảo an ninh lương thực nhờ cây lấy củ Vùng Miền núi và Duyên hải thuộc Châu Á Thái Bình Dương (FoodSTART+) Tổ chức Khoai Tây Quốc Tế (CIP)"}