diff --git "a/deduped/dedup_0030.jsonl" "b/deduped/dedup_0030.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0030.jsonl"
@@ -0,0 +1,78 @@
+{"text": "Undifferentiated Nasopharyngeal Carcinoma (NPC) patients show a characteristic pattern of antibody responses to the Epstein-Barr virus (EBV) which is regularly associated with this tumor. However, no EBV-specific cytotoxic activity is detectable by the standard chromium-release assay at both peripheral and intratumoral levels. The mechanisms underlying this discrepancy between the humoral and cellular immune responses in NPC are still unknown, but might be related to an imbalance in immunoregulatory interleukin production. In this report, we investigated the ability of peripheral (PBL) and tumor- infiltrating (TIL) lymphocytes of undifferentiated NPC patients to produce in vitro three interleukins  and three immunoglobulin isotypes .Lymphocytes from 17 patients and 17 controls were cultured in the presence of Pokeweed mitogen (PWM) for 12 days and their culture supernatants were tested for interleukins and immunoglobulins by specific enzyme-linked immunosorbent assays (ELISA). Data were analysed using Student's t-test and probability values below 5% were considered significant.The data obtained indicated that TIL of NPC patients produced significantly more IL-2 , IL-10 , IgM  and IgG  than their PBL. On the other hand, patients PBL produced significantly higher levels of IL-2 , IL-10  and IgM  than those of controls. No significant differences for IL-6 and IgA were observed.Taken together, our data reinforce the possibility of an imbalance in immunoregulatory interleukin production in NPC patients. An increased ability to produce cytokines such as IL-10 may underlie the discrepancy between humoral and cellular immune responses characteristic of NPC. Undifferentiated nasopharyngeal carcinoma (NPC) is a malignant epithelial tumor characterized by a heavy infiltration of non malignant lymphocytes and most of these tumor infiltrating lymphocytes (TIL) have been shown to be T cells .The Epstein-Barr virus (EBV) is causally associated with this malignancy since viral DNA is regularly present in the malignant epithelial cells but not in the neighbouring normal tissues. In addition, NPC patients show a specific pattern of humoral responses against EBV antigens .Viral proteins known to be expressed in NPC tumor cells are the EBV-encoded nuclear antigen 1 (EBNA-1) and the latent membrane proteins LMP-1 in 35 to 65% of cases, and LMP-2 . The latRecently, CD8 positive EBV-specific cytotoxic T cell clones were isolated from the peripheral blood and tumors of NPC patients . The majThe expression of IL-10 in NPC has been controversial. While it has been reported that IL-10 is not expressed by NPC cells as detected by RNA in situ hybridisation , some reIn this report, we investigated the ability of both peripheral blood lymphocytes (PBL) and TIL of undifferentiated NPC patients to express three interleukins  and three immunoglobulin isotypes  following pokeweed mitogen (PWM) stimulation in vitro.The data obtained indicated some significant differences between NPC patients and controls in interleukin and immunoglobulin production. However, further investigations are needed to establish the relevance of these differences to the discrepancy between humoral and cellular immune responses characteristic of NPC.17 untreated Tunisian NPC patients were included in this study. Informed consent was obtained from all patients before collection of blood and biopsy samples. These patients presented for treatment at the National Cancer Institute Salah Azaiez, Tunis or at the Farhat Hached hospital, Sousse, Tunisia. Their mean age was 47,5 years (range 25\u201370). All patients were diagnosed histopathologically as undifferentiated NPC.17 healthy EBV carriers who presented to donate blood at the National Blood Transfusion Centre, Tunis, Tunisia, were included as controls in this study.Sera of all patients and controls were titrated for antibodies directed against EBV antigens by indirect immunofluorescence .6 cells/ml.Peripheral blood and biopsy samples were taken on the same day from each of the 17 NPC patients. Peripheral blood was collected from patients and healthy donors in heparin. Mononuclear cells were isolated by centrifugation over Ficoll-Hypaque (Pharmacia) according to Boyum . Followi6 cells/ml.For the preparation of tumor-infiltrating lymphocytes, biopsies were collected from NPC tumors under sterile conditions and immediately transferred to RPMI-1640 medium supplemented with 50 \u03bcg/ml Gentamicin. The biopsies were washed several times in this medium and then minced into small pieces in order to extract lymphocytes. The extracted cells were then washed by centrifugation in the same medium and then resuspended in complete medium at a final concentration of 2 \u00d7 102 fragment. The labelled cells were counted under a fluorescence microscope.Samples from each lymphocyte preparation were taken for immunophenotyping by indirect membrane immunofluorescence using mouse monoclonal antibodies directed against CD3, CD4, CD8 or CD19 and FITC-conjugated goat anti-mouse F(ab')6 cells/ml in complete medium were distributed at 1 ml / well in 24-well Costar plates. One hundred microliters of a predetermined optimal dilution of PWM (Gibco), for treated wells, or complete medium alone, for untreated controls, were added in corresponding wells. The cells were then cultured for 12 days at 37\u00b0C, 5% CO2 and 98% relative humidity in a CO2 incubator. At the end of this incubation period, culture supernatants were harvested and used for cytokine and immunoglobulin determination as described below.PBL from healthy donors or NPC patients and TIL from the same patients suspended at 2 \u00d7 10Culture supernatants of PBL and TIL stimulated by PWM under optimal conditions were used for both cytokine and immunoglobulin determination by enzyme-linked immunosorbent assays (ELISA).IL-2, IL-6 and IL-10 concentrations were measured using commercial sandwich-type ELISA kits  according to the procedures described by the manufacturer.IgM, IgG and IgA concentrations were measured using sandwich-type ELISA assays prepared in our laboratory. Briefly, 96 well-microplates  were coated for 2 hours at 37\u00b0C and overnight at 4\u00b0C with 150 \u03bcl/well of isotype-specific mouse monoclonal antibody  appropriately diluted in 0,1 M carbonate buffer, pH 9.6. The microplates were washed four times with phosphate-buffered saline pH 7.4 containing 0,1 % Tween 20 (PBS-Tween), then blocked with 300 \u03bcl/well of PBS containing 1% FCS for 30 minutes at 37\u00b0C. For the assay, 100 \u03bcl /well of appropriately diluted culture supernatants in PBS-Tween containing 10% FCS were incubated in coated microplates for 2 hours at 37\u00b0C. The microplates were then washed four times with PBS-Tween and 100 \u03bcl/well of the appropriate alkaline phosphatase-labeled conjugate  were added at a 1:20000 dilution in PBS containing 1% FCS. After a two-hour incubation at 37\u00b0C, the microplates were washed and a p-nitrophenylphosphate substrate solution was added. The microplates were incubated for 1 hour at 37\u00b0C and the reaction was stopped with 50 \u03bcl/well of 1 N NaOH. Immunoglobulin standards were generated using purified human immunoglobulins of each isotype . The microplates were read at 405 nm on a microplate reader . Data were represented as the mean immunoglobulin concentration of triplicate cultures. Immunoglobulin values were obtained by interpolation from standard curves.Data were analysed using \"Student's t-test\". Probability values below 5% were considered significant.All patients showed a typical serological profile characteristic of NPC as determined by indirect immunofluorescence. Levels of IgG antibodies to VCA were considerably higher than those in healthy donors. Their titers varied from 640 to 2560 (mean titer = 1065), whereas in healthy donors such titers fluctuated between 40 and 160 (mean titer = 70). IgG antibodies to EA were present in NPC patients only, with titers ranging from 20 to 320 (mean titer = 50).Anti-VCA IgA antibodies were detected in all patients  and anti-EA IgA antibodies were detected in only 4 patients . None of the controls showed IgA antibodies against these antigens.Immunophenotypic analysis of the lymphocyte preparations obtained from patients and controls indicated that CD3+ lymphocytes constituted the major subpopulation with a mean frequency of (60 \u00b1 8)% in PBL of both patients and controls and (55 \u00b1 9)% in TIL. CD4+ lymphocytes represented (35 \u00b1 5)% in PBL of both patients and controls and (20 \u00b1 3)% in TIL. CD8+ cells showed mean values of (40 \u00b1 6)% in PBL of patients, (36 \u00b1 4)% in TIL, and (28 \u00b1 5)% in PBL of controls.On the other hand, CD19+ B lymphocytes represented in average (25 \u00b1 5)% in PBL of patients, (23 \u00b1 6)% in TIL, and (22 \u00b1 3)% in PBL of controls.As illustrated in Figures Unstimulated lymphocytes cultured in the absence of PWM did not show any detectable cytokine production (data not shown).The results of immunoglobulin determination showed that the PBL of NPC patients produced significantly higher levels of IgM (8262 \u00b1 5315 ng/ml) than the PBL of controls .Previous reports indicate the absence of EBV-specific cytotoxic T lymphocytes detectable by the standard chromium release assay in both the peripheral and intratumoral compartments -10,21 inThe expression of IL-10 in NPC has been controversial. While some authors have reported that NPC tumor cells do not express IL-10 , others The expression of cytokines such as IL-2 , IL-6 1 and IL-1In this report, we investigated the ability of both peripheral blood and tumor infiltrating lymphocytes of 17 undifferentiated NPC patients to produce cytokines following mitogenic stimulation in culture. Since immunoglobulin isotypes are determined by cytokine patterns, we also looked for possible correlations between measured cytokine levels and immunoglobulin isotypes produced. PWM was chosen to stimulate the lymphocyte cultures because it is known to activate both T and B lymphocytes in humans ,30. In aThe data obtained indicate that the highest levels of IL-2 were produced by TIL cultures followed by patients'PBL. This is in line with a report by Lakhdar et al  showing IL-10, a representative of the Th2 pattern of cytokines, is generally considered immunosuppressive. It inhibits IL-6 secretion by activated macrophages but not by Th2 lymphocytes . In the Cultures of tumor infiltrating lymphocytes secreted significantly higher amounts of IgM and IgG than the PBL of either patients or controls in good agreement with the increased levels of IL-2 and IL-10, since these cytokines are involved in B cell activation and enhance immunoglobulin synthesis ,25. No sIn an attempt to see whether the observed differences in cytokine and immunoglobulin production between patients and controls or between PBL and TIL of patients could be due to differences in the composition of individual lymphocyte preparations, we performed an immunophenotypic analysis of each lymphocyte preparation. As shown in the results, the only significant changes in the proportions of lymphocyte subsets between patients and controls were observed in the CD8 subpopulation which showed an increase in patients PBL and TIL. On the other hand, the CD4 subset showed a significant decrease in TIL. Such differences in lymphocyte subpopulations are not expected to produce the changes in cytokine and immunoglobulin production observed here, since CD4 lymphocytes are well known for being the main source of IL-2 and IL-10, and for their ability to stimulate immunoglobulin synthesis .Recently, CD4+ lymphocyte populations have been shown to be more heterogeneous and complex than previously thought  and new In conclusion, our data point to the possibility of an imbalance in immunoregulatory interleukin production in NPC patients. Their lymphocytes, especially those infiltrating the tumors, showed in particular a high propensity to produce IL-10 following mitogenic stimulation in vitro. Overproduction of this pleiotropic cytokine may lead to a discrepancy between humoral and cellular immune responses similar to that seen in NPC. The relevance of the present observations to the in vivo situation is not yet established and warrants further investigations.The authors declare that they have no competing interests.LFJ designed and carried out the experimental work, performed the statistical analysis and drafted the manuscript. NK maintained the cell cultures and provided technical help. RHK and KB participated in the design and coordination of the study. RK directed the research and finalized the manuscript.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The Easy CD4 assay showed 100% sensitivity for estimating the CD4+ T cell counts < 200 cells/mm3 and < 350 cells/mm3 and 97% sensitivity to estimate CD4+ T cell count < 500 cells/mm3. The specificity ranged from 82 to 100%. The Kappa factor ranged from 0.735 for the CD4+ T cell counts < 350 cells/mm3 to 0.771 for < 500 cells/mm3 CD4+ T cell counts. The system works with a simple protocol, is easy to maintain and has low running cost. The system is compact and generates minimum amount of waste. Hence the EasyCD4 System could be applied for estimation of CD4+ T cell counts in resource poor settings.The CD4+ T cell count estimation is an important monitoring tool for HIV disease progression and efficacy of anti-retroviral treatment (ART). Due to availability of ART at low cost in developing countries, quest for reliable cost effective alternative methods for CD4+ T cell count estimation has gained importance. A simple capillary-based microflurometric assay  was compared with the conventional flow cytometric assay for estimation of CD4+ T cell counts in 79 HIV infected individuals. CD4+ T cell count estimation by both the assays showed strong correlation . The Bland Altman plot analysis showed that the limits of variation were within agreeable limits of \u00b1 2SD (-161 to 129 cells/mm Three by five initiative by World Health Organization (WHO) has accelerated efforts to provide anti-retroviral treatment (ART) to all those who need it even in the developing world . The ARTFlow cytometry has been used as a method of choice for CD4+ T cell measurements since the beginning of HIV epidemic ,4. AlthoHence, alternative methods for CD4+ T cell count estimation with lower costs and simplicity in techniques are being explored worldwide ,6. The EWe compared the CD4+ T cell estimations in HIV infected individuals using EasyCD4 System with the conventional flow cytometry.Thirty-one of the 79 study subjects were females and 48 were males with mean age of 29 and 36 years respectively.The CD4+ T cell counts estimated using EasyCD4 System and flow cytometry showed strong correlation   .A limited number of samples (N = 10) were additionally processed by FACSCount , a single platform system. The mean CD4 counts obtained by FACSCount and Guava EasyCD4 system were 218 and 221 cells/mmThe performance of EasyCD4 assay on five stabilized blood samples showed satisfactory performance within acceptable range of \u00b1 2SD figure .The intra-sample variation in the EasyCD4 assay was assessed in four samples for the CD4 counts obtained on the same day and after 24 hours. The mean % coefficient of variation (CV) was found to be 6.75% in the range of 1 to 18% while the mean % CV of duplicate testing was found to be 5.17 % (range: 1 to 13%).Flow cytometry has been accepted as a gold standard for estimating CD4+ T cell count. However, it has high initial as well as running cost and requires frequent maintenance. The frequent power failures, unavailability of temperature controlled laboratories make the maintenance of flow cytometer difficult. Hence the use of flow cytometry is constrained in resource-poor settings. A number of alternative assays have been developed and some are commercially available, i.e., Dynal CD4 assay using magnetic beads and Coulter Cytoshpere assay. These two microscope-based assays were found to be highly comparable with the Flow cytometry -9. HowevThe EasyCD4 System from Guava Technologies evaluated in the present study is a modified flow cytometer that uses simple volumetric micro capillary-based technology instead of conventional flow cell using sheath fluid for carrying the cells. In conventional flow cytometry, the sheath fluid carries the cells through the LASER path to maintain a single cell suspension so that only one-cell passes through laser beam at one time. In Guava PCA the cells pass through a micro capillary eliminating need of sheath fluid for maintaining single cell suspension. Due to this modification, the volume of accumulated waste is 20 times less than the conventional flow cytometry. Additionally, the conventional flow cytometry in the present study uses the dual side scatter gating depending upon cell morphology (size (FSC) and granularity (SSC)), where as the guava Easy CD4 System uses T cell gating strategy to gate CD3+ cells and estimates CD3+CD4+ cells. The gating on CD3+ T cells removes the monocytes (expressing CD4 but not CD3 on their cell surface) from the gate. The Easy CD4 System is a single platform volumetric system that calculates absolute CD4+ T cell counts on the basis of volume of sample acquired. This eliminates the variability introduced by using Absolute Lymphocyte Count (ALC) from the other analyzer as in dual platform system used in conventional flow cytometry.3, < 350 cells/mm3 and < 200 cells/mm3. The degree of agreement is high as showed by kappa factor. The Bland-Altman analysis, which is a more reliable method to assess variation, also showed that the variation was within agreeable limits. Hence the method is reliable for making decisions on starting ART or prophylaxis for opportunistic infections. The assay has shown very good agreement with single platform technology like FACSCount or multiTest assay using flowcytometer (13\u201316) and in the present study although on limited sample size.The CD4+ T cell counts estimated by EasyCD4 System showed high correlation with the CD4+ T cell counts obtained by conventional flow Cytometry and showed high sensitivity and specificity to identify patients with CD4 + T cell count < 500 cells/mmThe intra-sample %CV in Easy CD4 assay as 6.75% (1 to 18 %), which was comparable with the values (5 to 13%) reported in previous studies  and less than the %CV reported for \"double-platform\" systems ranging form 14.5 to 43.4%  (17). Hence, the Easy CD4 assay could be better than the double platform system.The assay showed satisfactory performance when five stabilized blood samples were assessed for CD4+ T cell counts.As compared to the conventional flow cytometry the EasyCD4 System was found to be simple to operate, easy to maintain and the equipment requires less space. Since it requires only 10 \u03bcl of sample it is possible to explore its application using finger prick blood samples. Hence, it can be adopted for CD4+ T cell count estimation in HIV infected individuals. The running cost of the CD4+ T cell estimation by EasyCD4 System is 5 times lower than the conventional flowcytometry at the current costing. However, the pricing of the reagents and instruments might be subjected to change due to higher demand and wider choice of technologies available to the customer.EasyCD4 assay, although operationally simple, the users need training in gating of the CD3+ T lymphocytes. The use of minimum quantity of antibodies (1 \u03bcl of antibody cocktail) requires precision in technique of reverse pipetting used in case of minute quantities of reagents using the air displacement pipettes as described (18). Also, the EasyCD4 System does not prescribe validity criteria for assessing the formation of the gate. This was found to be extremely critical for reliable gating for accurate estimation of CD4+ T cell counts, to minimize the variations in CD3+ T cell counts and to overcome the acquisition of debris causing high event rate. The laboratory using the equipment needs to set up such criteria locally such as use of commercially available controls or use of healthy individuals sample for gating the CD3+ T cells. This essentially highlights the need of development of laboratory based quality control check on the equipment.In conclusion, the availability of EasyCD4 System enhances the options for reliable and valid CD4+ T cell count estimation technology for HIV infected individuals. The validation of the system on finger prick samples could be taken up to assess the simplicity of sample collection and cost reduction.79 HIV infected individuals attending the referral clinic of National AIDS Research Institute (NARI), Pune were enrolled in the study after obtaining written informed consent from 5 February to 21 April 2004. The blood sample was collected in a vacutainer containing K3 EDTA to avoid clotting of blood.The CD4 + T cell counts were estimated by dual platform Flow cytometry  as a part of routine investigations using IMK Plus kit . The kit included a panel of monoclonal antibodies of CD45-Fluorescein Isothiocynate (FITC)/CD14-Phycoerythrin (PE), CD3-FITC/CD19-PE, CD4-FITC/CD8-PE, CD3-FITC/CD3 HLA-DR-PE and CD3-FITC/CD16+56-PE and SimulSET software. Hundred \u03bcl of noncoagulated blood was stained with 20 \u03bcl of each of the antibody pair. After 30 minutes incubation the red blood cells were lysed using freshly diluted (1:10) FACS lysing solution . The samples were then acquired in the instrument and the lymphocytes were gated on the basis of size (Forward scatter: FSC) and relative granularity (Side scatter: SSC) for further analysis. Two-colour analysis for each antibody subset was performed to obtain percentages of each lymphocyte subset. The run was considered valid only if more than 95% lymphocytes were in the gate.3. These ALCs were obtained on the hematology analyzer .The absolute CD4+ T cell counts were computed by feeding the ALC in the SimulSET software and were expressed as cells/mmAn aliquot of the same blood samples were coded to blind the technician and processed by Guava Easy CD4 assay  on the same day of sample collection. The coding was carried out only when at least three samples were available on a given day to ensure blinding of the laboratory technician.Ten \u03bcl of noncoagulated blood was stained with 1:10 diluted antibody cocktail of CD3-PE-Cy5 and CD4-PE or CD3-PE-Cy5 and CD8-PE separately for 15 minutes at room temperature in dark and the RBCs were lysed using the freshly prepared lysing solution for 15 minutes. The instrument was calibrated daily using Guava check beads (cat# 42000070) in triplicate and the instrument was considered to be ready for use if the average CV% for FSC intensity and PM1 and PM2 mean fluorescence Index (MFI) of all three replicates is within 1\u20135. The sample was acquired within five hours of staining using Cytosoft software. The gate was automatically set around the CD3+ T lymphocytes using the scatter plot showing cells stained with antibodies against CD3 conjugated to PECy5 and the size of the cells as shown in figure 3 = (tCD4 \u00d7 df)/v cells.Absolute CD4+ T cell count/mmDuring the preliminary experiments, it was observed that in few cases there was variation in the CD3+ T cell counts obtained in both, sample tubes estimating CD4+ and CD8+ T cell counts and also there was variations in the event rate (no of cells acquired per second). The high event rate was found to occur in case of the samples having a high proportion of non-lymphocyte population in the sample. So the run was considered valid if the variation between the CD3+ T cell counts in both sample tubes (used to estimate CD4 and CD8 T cell counts) was less than 10%, the event rate of acquisition of the sample was less than 700/\u03bcl and the CD3+ cells acquired in the gate ranged from 1000 to 2000 cells/\u03bcl.At the end of the study, the CD4+ T cell counts obtained by the EasyCD4 System were decoded and compared with the CD4+ T cell counts obtained by the flowcytometry. The correlation between the two methods was assessed using Pearson's correlation test and the degree of agreement was estimated by calculating the kappa factor. The Bland-Altman plots were generated for assessment of the variation between the two methods. The sensitivity and specificity of the Easy CD4 assay was estimated for different ranges of CD4+ T cell counts. Data analysis was carried out using SPSS statistical package (version 12.0) to calculate degree of agreement, and to calculate correlation coefficient. The percent coefficient of variation (%CV) was calculated to assess intra-sample variation by using Microsoft Excel software.The author(s) declare that they have no competing interests.MT conceived of the study, and participated in its design, coordination and drafted the manuscript. BM carried out the CD4+ T cell count estimation assays. BK participated in the design of the study and performed the statistical analysis. SM and RP participated in design of the study, monitored the progress and reviewed the draft of the manuscript. All authors read and approved the final manuscript."}
+{"text": "IRIS usually occurs in individuals with a rapidly rising CD4 T-cell count or percentage upon initiation of ART, who develop a deregulated immune response to infection with or without reactivation of opportunistic organisms. Here, we evaluated rises in absolute CD4 T-cells, and specific CD4 T-cell responses in 4 HIV-1in vitro proliferative responses. Results were compared with those observed in 11 matched, successfully treated asymptomatic clinical progressors (CP) with no evidence of opportunistic infections, and uninfected controls.We assessed CD4 T-cell counts, HIV-1 RNA loads, phenotype for na\u00efve and activation markers, and Median CD4 T-cell counts in IRIS patients rose from 22 cells/\u03bcl before initiation of ART, to 70 cells/\u03bcl after 8 months of therapy (median 6.5 fold increase). This coincided with IRIS diagnosis, lower levels of na\u00efve CD4 T-cells, increased expression of immune activation markers, and weak CD4 T-cell responses. In contrast, CP had a median CD4 T-cell counts of 76 cells/\u03bcl at baseline, which rose to 249 cells/\u03bcl 6 months post ART, when strong T-cell responses were seen in > 80% of patients. Higher levels of expression of immune activation markers were seen in IRIS patients compared to CP and UC (IRIS > CP > UC). Immunotherapy with IL-2 and GM-CSF paralleled clinical recovery.These data suggest that mycobacterial IRIS is associated with inadequate immune reconstitution rather than vigorous specific T-cell responses, and concomitant administration of IL-2 and GM-CSF immunotherapy with effective ART may correct/augment T-cell immunity in such setting resulting in clinical benefit. Results are expressed as stimulation indices (SI) with a positive response defined as an SI of 3 or more and \u0394 counts per minute (CPM) > 600 as described previously thymidine, and cells were harvested as described above. Results are expressed as the mean cpm for triplicate cultures, with an error of the mean of \u00b1 15%. A positive result is defined as significant proliferation above the background activity and detection threshold. In all experiments, a standard titration of indicator cell proliferation to a range of recombinant IL-4 from 0.01 to 100 U/ml was included. Control wells for calculation of background activity contained indicator cells only.Fifty \u03bcl of supernatant from proliferative cultures was transferred to 96-well round-bottomed plates in triplicate for quantification of IL-4 on the indicator cell line CT.h4S  as previously described -22. BriePMBC were incubated with a panel of murine anti-human mAbs , for 30 minutes at 4\u00b0C. Directly conjugated antibodies used were: Fluorescein isothiocyanate (FITC)-CD8, CD45RA; Phycoerytherin (PE)-CD38, HLA-DR, CD27, and CD45RA; PE-cyanine (PC-5)-CD4, all used according to the manufacturer's instructions. Cells were washed and fixed in PBS containing 2% paraformaldehyde (Sigma). On acquisition, a gate was set around the lymphocyte population on a forward scatter versus side scatter dot plot, and 10,000 gated events collected for each sample. Data analysis was performed using CELLQuest\u2122 Software . Appropriate isotype matched controls were run in parallel for each sample.P values below 0.05 were considered significant.Computer software  was used for all statistical calculations. Data are presented as median (inter-quartile range IQR). Analysis of data between the different groups was performed using a Mann Whitney-U-test and intra-group variations were compared using the Wilcoxon signed rank test. We studied both IRIS and CP patients who had been receiving effective ART for similar periods. IRIS was diagnosed at a median 10 months (IQR 8\u201313) after initiation of ART (Table + T-cell counts of 70 cells/\u03bcl (IQR 63\u2013123) after a median 10 months on ART, with persistent MAC infection, received IL-2 and GM-CSF (see Table + T-cell counts to 171 cells/\u03bcl (IQR 128\u2013302)  who were unable to achieve remission after receiving ART and anti-mycobacterial therapy. Four patients with median CD4l IQR 63\u201323 after l IQR 63\u201323 after 2) Table , and wertion Fig . The partion Fig . We alsol IQR 63\u201323 after tion Fig .In 3/4 IRIS patients we carried out IL-4 bioassays in culture supernatants, rather than ELISA, in order to assess the levels of bioactive cytokine being produced. We were able to detect production of IL-4 in cultures with antigens to which the patients had been previously exposed including anti-PPD responses in 2/3 patients  (Table We assessed T-cell proliferation in CP and uninfected controls (UC) and compared these with the responses seen in IRIS patients. CP presented a median 3.9 fold increase in CD4 T-cell counts 6 months post initiation of ART from 76 cells/\u03bcl (IQR 22.5\u201390) to 249 cells/\u03bcl (IQR 187.5\u2013303.5) (+HLA-DR+ T lymphocytes (p < 0.005), and significantly higher percentages of CD8+CD38+ T cells (p < 0.05) , as demonstrated by analysing the mean fluorescent intensity levels of CD38 expression (Table +CD45RA+CD27+ T cells in IRIS patients was significantly lower than in CP and UC (p < 0.005). These observations are not surprising as IRIS patients were more immuno-compromised when therapy was initiated suggesting that IRIS may be associated with persistent hyperactivation of both CD4 and CD8 T lymphocytes, and associated with a lack of na\u00efve CD4 T cells possibly due to absence of thymic function.Compared to CP, IRIS patients showed significantly higher percentages of CD45) Table . When acin vitro immune function of T lymphocytes in peripheral blood and direct comparison with asymptomatic HIV-1+ subjects as well as uninfected controls. Some reports have shown the lack of correlation between these two assays [in vitro functional data and clinical evidence.Immune reconstitution after initiation of ART may be concurrent with both an increase in immuno-pathological responses against opportunistic pathogens and with the induction of IRIS -19,24. To assays , as funco assays . TherefoThere were two important findings in this study. Firstly, patients admitted with IRIS lacked antigen-specific T-cell responses. Secondly, administration of IL-2 and GM-CSF appeared to rapidly introduce these responses and was associated with clinical recovery in patients with advanced HIV-1 infection.Data from uninfected controls and treated asymptomatic clinical progressors, revealed the presence of lymphoproliferative responses to recall/viral antigens, compared to IRIS patients, confirming that functional specific T lymphocytes are associated with the control of opportunistic infections. Thus, the clinical picture presented by our cohort of IRIS patients is likely to be associated with the lack of lymphoproliferation and IL-2 production rather than with robust antigen-specific T cell responses. This suggests an alternative/additional mechanism for IRIS, distinct from previous hypotheses which suggest that IRIS is caused by pathogen-specific responses induced by successful ART.Of note, are the generally weak proliferative responses observed in response to other pathogens such as CMV, which recover after initiation of ART ,28. AlthThe mechanisms behind IRIS still remain elusive. Through cell-to-cell contact, various complex molecular interactions and the production of cytokines, CD4 T helper lymphocytes modulate the activity of all cells involved in both innate and acquired immunity, including virus-specific cytotoxic CD8 T lymphocytes -33. AlthThe use of immunotherapy in severely immuno-compromised patients has been shown to have beneficial effects in partially reversing the CD4 T-cell defects exerted by HIV-1, when administered concomitantly with ART ,21. Suchet al describing the occasional lack of correlation between the percentage of T cells expressing activation markers and thymidine incorporation [During HIV-1 infection immune hyperactivation is accompanied by up-regulation of surface expression of CD38 and HLA-DR on CD4 and CD8 T cells . Higher poration . It is sporation . Furtherporation ,45. Thisporation . The lowOur data suggests that the degree of immune reconstitution achieved with potent ART alone is dependent on the clinical stage of the patient when therapy was initiated. Furthermore, we hypothesise that in some late-stage patients ART may elicit the expansion of abnormal/anergic T cell clones responsible for an erratic immune response. Concomitant administration of IL-2 and GM-CSF may be associated with provision of proliferative signals to immature thymocytes and/or rescue of anergic CD4 T cells to generate fully functional T-cell responses. GM-CSF acts directly on antigen presenting cells, including macrophages, which may induce and contribute to a more rapid remission from intracellular infection -48.Mycobacterium avium. Such responses may be associated with a better outcome and, possibly quicker recovery, in immuno-compromised patients who fail to achieve immune reconstitution with ART alone, indicating that this therapeutic approach as salvage immuno-therapy may have an impact on short-term mortality. The small number of patients is noteworthy- this is nonetheless an interesting and provocative finding that deserves further prospective exploration in larger numbers of similar patients.In conclusion, ART induced immune reconstitution restores specific responses, which likely help in the clearance of opportunistic pathogens. However, inadequate immune responses observed in treated late-stage disease, in addition to other possible confounders, may be causative of IRIS. Administration of IL-2 and GM-CSF concomitantly with ART in late-stage patients may result in proliferation of pathogen-specific CD4 T-lymphocytes, which likely enable a more rapid clearance of intracellular pathogens such as The author(s) declare that they have no competing interests.AP carried out the proliferation assays, phenotypic analysis, data analysis, participated in the study design and wrote the manuscript. MN, ALP, MF and BG recruited patients and participated in the study design. FG participated in the study design and participated in the drafting of the manuscript. NI conceived the study, carried out proliferation assays and bioassays, data analysis and the design, coordination, the draft and finalisation of the manuscript. All authors read and approved the final manuscript."}
+{"text": "As part of the Houston Vanguard study, a subset of 10 patients randomized to receive IL-2 therapy were compared to 4 patients randomized to not receive IL-2, for markers of T cell activation and death during the first three cycles of IL-2. All patients were treated with combination antiretroviral therapy (ART) and were virally suppressed. The purpose of the study was to examine the role of CD8+ T cell death in responses to ART and IL-2 therapy.Lymphocytes were examined at Day 0, 5 and 30 days during three cycles of IL-2 therapy. CD25, CD38, HLA-DR expression and annexin (cell death) were examined on CD4 and CD8 subpopulations. Follow up studies examined CD4 levels and CD4:CD8 reconstitution after 6 years using both univariant and multivariate analyses.+ T cells, leading to an increase in CD4 cell counts. CD8+ T cells did not increase CD25 expression, but upregulated activation antigens (CD38 and DR) and had increased death. At baseline, 7 of the 14 patients had high CD8+ T cell apoptosis (mean 17.0% \u00b1 6.0). We did an exploratory analysis of immune status after six years, and found that baseline CD8+ T cell apoptosis was correlated with CD4 cell count gain beginning two years post enrollment. Patients with low levels of CD8+ T cell apoptosis at baseline (mean 2.2% \u00b1 2.1) had significantly higher CD4 cell counts and more normalized CD4:CD8 ratios than patients with high CD8+ T cell apoptosis .Human lymphocytes responded to IL-2 therapy by upregulation of CD25 on CD4+ T cell apoptosis may reflect inherent activation status, which continues in some patients even though viral replication is suppressed which influences the ability of CD4+ T cells to rebound. Levels of CD8+ T cell apoptosis may therefore be an independent predictor of immune status, which should be shown in a prospective study.We postulate that CD8 Recent data suggests that the expansion of CD25 expressing cells after IL-2 administration is associated with less proliferation of T cells in the long-term (12 months) as measured by both Ki67 expression [+ CD25+ T cells, which might limit subsequent CD4 T cell activation [IL-2 therapy leads to dose-dependent, sustained CD4 cell count increases in most HIV-infected patients treated with antiretroviral therapy (ART) ,2. Earlyong-term ,4. The mpression ,4 and af+ T cells return after IL-2 therapy. Likewise, the older the IL-2 treated patient, the less likely they are to respond well to IL-2, especially after three cycles [Other predictors of the amount of CD4 restoration after IL-2 include the CD4 nadir and the age of the patient ,7. The le cycles ,7.+ T cell return after IL-2 therapy was being non-white; this group of individuals had almost a 200 cells/mm3 larger increase in CD4 cell counts than the white group studied from a cohort of more than 250 patients [In another study, a predictor of the amount of CD4patients .+ and CD8+ T cells that is commonly seen in HIV-infected patients. Increased CD4+ T cell death could be due to HIV infection directly or bystander CD4+ T cells may die via multiple mechanisms (8\u201310). CD8+ T cell death is likely due to increased activation [Another feature of HIV pathogenesis that might influence T cell normalization after immune reconstitution is the increased cell death of both CD4tivation -13. In ttivation -16.+ T cell apoptosis, was associated with recovery of CD4+ T cell numbers after ART, so that higher levels of CD8+ T cell apoptosis was associated with fewer CD4+ T cells after therapy [+ T cells also had more CD8+ T cell apoptosis, whether or not they were on ART therapy [+ T cell apoptosis was reduced after four weeks with or without IL-2 therapy, but reduction of CD8+ T cell apoptosis levels took 24 weeks to develop [+ T cell apoptosis remained after ART, which were reflective of continuing low levels of viral replication [One study showed that the levels of T cell apoptosis, especially CD8 therapy . This is therapy . Another develop . However develop ,20. Whenlication .+ T cell apoptosis at baseline before commencing scIL-2 therapy was associated with both CD4 cell counts as well as CD4:CD8 ratio normalization after six years. These differences in T cell numbers based on initial CD8+ T cell apoptosis levels appeared after two years of scIL-2 therapy and were maintained until the current analysis.The present Houston Vanguard sub-study examines a small group of subcutaneously IL-2 (scIL-2) treated patients. Patients were randomized from October 1998 to May 1999. An exploratory analysis of immunologic status was assessed an average of six years after randomization. We found that, in this small group of patients, the level of spontaneous CD83 at screening. The Karnofsky performance status had to be \u2265 80 and the patients had to be receiving antiretroviral therapy for at least 7 days prior to starting scIL-2 therapy. Women of childbearing potential were required to have a negative pregnancy test before initiation of scIL-2 therapy. At baseline, all but one of the individuals had plasma HIV RNA levels below 500 copies/mL. That single individual had a viral load of 2,007 copies/mL. The main exclusion criteria for this study included any concurrent or prior history of AIDS-defining illnesses, malignancy requiring systemic therapy within the prior 5 years, concomitant use of systemic corticosteroids, chemotherapy or experimental cytotoxic drugs, or current or prior history of autoimmune and/or inflammatory diseases and breastfeeding. This study was approved by the institutional review board (IRB) at The University of Texas Health Science Center at Houston and the National Institute of Allergy and Infectious Disease (NIAID) IRB. All subjects provided written informed consent.To participate in the Houston Vanguard study, subjects had to be at least 18 years old, have documented HIV-1 infection and a CD4 cell count \u2265 350 cells/mmThe Houston Vanguard study was an open-label, randomized trial designed with a target sample size of 72 subjects with CD4 cell count change from baseline as the primary endpoint. Subjects were sequentially randomized to three groups of 24 . The first group of 24 subjects received 1.5 Million International units (MIU) per dose of scIL-2 plus antiretroviral therapy or antiretroviral therapy alone (control); the second group of 24 subjects was randomized to 4.5 MIU scIL-2 or control; and the third group was randomized to 7.5 MIU of scIL-2 or control. For the purpose of this immunology sub-study of the Houston Vanguard, consecutive patients who volunteered to participate in the sub-study were enrolled: five patients from the 1.5 MIU per dose cohort (low dose), five patients from the 7.5 MIU per dose cohort (high dose) and four from the no IL-2 cohort (control group).Subcutaneous IL-2  was administered for 5 days every 8 weeks for a minimum of three cycles in addition to continued antiretroviral therapy. Dosing with scIL-2 was begun at 1.5 MIU. This dose was escalated to 4.5 MIU and then to 7.5 MIU when at least 9 of the 12 subjects had completed all doses of the first cycle with scIL-2 at a lower dose level in the absence of dose-limiting toxicities. Dose reductions of scIL-2 were allowed for dose-limiting toxicities defined as grade IV toxicities , investigator's assessment or subject tolerance.\u00ae in a Randomized International Trial). Additional cycles of scIL-2 were encouraged to maintain CD4 cell counts more than twice baseline or greater than 1,000 cells/mm3. For subjects randomized to 1.5 and 4.5 MIU, dose escalation was allowed by increments of 1.5 MIU per dose up to a maximum of 7.5 MIU. Subjects receiving less than 4.5 MIU were permitted to dose escalate by increments of 1.5 to 3.0 MIU upon the investigator's discretion. Dosage could be reduced by 1.5 MIU decrements (to a minimum dose of 1.5 MIU) if the assigned dose was not tolerated. During the extension phase and roll-over ESPRIT no control subjects were treated with scIL-2 at any dose. The cumulative amount of IL-2 given to the 10 IL-2 treated patients in this study ranged between 165\u2013570 MIU, with a mean of 302 \u00b1 132.After completion of three cycles, subjects were enrolled in an extension phase (months 6 to 12) and, thereafter, rolled-over into the ESPRIT study . CD4 and CD8 counts were done by commercial flow cytometry laboratories using CAP defined criteria.Peripheral blood was separated using Ficoll gradients. The cells were washed in PBS, counted and then stained for cell surface markers and Annexin V to determine levels of apoptotic cells. CD4, CD8, CD25, CD38, and DR antibodies were purchased from BD Pharmingen  and Annexin V was obtained from Biosource International . The cells were analyzed using a Beckman Coulter XL2 flow cytometer. Twenty-thousand events were collected, gated on \"viable\" light scatter, and fluorescence distributions collected and analyzed and expressed as percentages or mean fluorescence intensity .Group means and standard deviations of study variables: CD4, CD8, and CD4:CD8 ratios were obtained for both low and high annexin groups. Tests for normality were performed. Normally distributed data were analyzed using the t-test and one way repeated measures analysis of variance. A difference of p < 0.05 was considered significant. For missing data, the last value carried forward (LVCF) principle was applied to the analyses. A multivariate analysis of the data was also performed using generalizing estimating equations (GEE) a technique appropriate for longitudinal data with a small number of subjects . VariablInitial studies conducted after randomization examined five scIL-2 treated patients at high dose (7.5 MIU per dose) and five on low dose (1.5 MIU per dose) for three cycles of scIL-2 over a six month period. These groups were compared to four patients treated with ART who did not receive scIL-2 therapy (controls). Results show that the absolute CD4 cell counts increased in all three groups and that the ending CD4:CD8 ratios were significantly different between groups  and 7 patients had low levels CD8+ T cell apoptosis (2.2% \u00b1 2.1). Four and 6 patients from each group, respectively, received scIL-2. After five days of scIL-2 therapy there was an increase in CD8 apoptosis which mirrored the amount of the CD38+ DR+ increase, as shown in a representative patient in Figure + T cell death was seen. We also observed increases in CD38 and DR expression on the CD4+ T cells at 5 days (data not shown). The levels of CD38 and DR returned to normal on both CD4+ and CD8+ T cells after each cycle. There was variability in the amounts of cell death and CD38 and DR increases over the cycles, depending on the person and cycle number with no discernible pattern. In sum, our initial data is characteristic of the data in a number of published papers with larger groups of patients, except that we saw little CD4+ T cell death [Next, we examined whether cells were dying at increased levels both before and after IL-2 therapy by Annexin V staining. At baseline, 7 patients had high levels of CD8ll death .Six years after our initial study, we examined the patients for their immune status using an exploratory analysis. We compared their CD4 and CD8 cell counts and the CD4:CD8 ratios to their baseline parameters. At baseline, only 3 of the 14 patients had CD4:CD8 ratios over 1; five patients had ratios below 0.5. Examination after six years showed that 9 of 12 patients had CD4:CD8 ratios over 1 and only 2 patients had ratios below 0.5.+ CD8+ T cells at baseline and the final CD4 cell count and CD4:CD8 ratio, which indicates the extent of T cell normalization. Patients with high levels of CD8+ T cell apoptosis at baseline (mean 17.0% \u00b1 6.0) did not normalize their CD4 cell counts or CD4:CD8 ratios after six years of follow-up; whereas, patients with low levels of CD8+ T cell apoptosis (mean 2.2% \u00b1 2.1) normalized their CD4 cell counts and CD4:CD8 ratio. The mean CD4 cell counts were 1,209 \u00b1 164 vs 754 \u00b1 320 cells/mm3 and the CD4:CD8 ratios 1.55 vs. 0.70, for the low and high baseline CD8+ T cell apoptosis level groups, respectively  .We next used GEE modeling to exam the outcomes over time. Baseline annexin had a significant inverse relationship with CD4 T cell count and ratio over time (p \u2265 0.02). When age at randomization was entered into the model, baseline annexin remained a significant predictor of both CD4 T cell count over time (p \u2265 0.04) and CD4:CD8 ratio (p \u2265 .0.05). A similar finding occurred for age at HIV diagnosis, so that baseline annexin remained a significant predictor of CD4+ cell count over time (p \u2265 0.03) and CD4:CD8 ratio (p \u2265 .0.04). When race was entered into the model, annexin was no longer independently related to CD4 T cell and CD4:CD8 ratio over time. When annexin, age and race were entered into the model, age at diagnosis was significant predictor of CD4 T cell number over time (p \u2265 0.03). Thus, this data is similar to previously reported trends with age as a predictor.+ T cell apoptosis was a characteristic of about 70% of previously studied patients where we found a negative correlation between high CD8+ T cell apoptosis and low CD4+ T cell percentages [+ T cells in HIV-infected patients is an independent predictor of immune status, separable from viral load and CD4 cell count [+ T cell apoptosis also may independently predict response to therapies, including scIL-2, by not only increasing the absolute number CD4 cells, but perhaps by regulating the levels of CD8+ T cell expansion.These results, in a small group of scIL-2 treated, virally suppressed HIV-infected patients suggest that the amount of CD8 cellular death at baseline may correlate with the ability to restore CD4 cell counts and CD4:CD8 ratios after immune reconstitution involving ART with or without additional scIL-2 therapy. These differences were detectable after two years of study enrollment. Increased CD8centages . Others ll count ,25. Our + and CD8+ T cells tend to be reduced after ART (14\u201316). However, in multiple studies, the levels of apoptosis still remains higher than in controls, which likely indicates the presence of continued immune activation which was previously demonstrated in the lymph nodes [+ T cells was also seen by another group at 5 days post scIL-2 therapy similar to our observations [+ T cell apoptosis levels with time, suggesting that IL-2 did not change the inherent level of CD8+ T cell apoptosis.The role of lymphocytic apoptosis in the response to ART with or without IL-2 has been studied by several groups. Most suggest apoptosis levels of both CD4ph nodes . IL-2 thrvations . However+ CD8+ T Cells and CD4+ T cells over two years of ART therapy. Another difference in our work is that the patients were already virally suppressed when baseline apoptosis was measured. Our data, with a small group of patients indicates that the starting level of apoptosis reflects long term outcome to therapy and that the level of CD8 T cell death is independent of viral load.The work that most closely approximates the work reported here followed 17 patients during the first 2\u20133 years of ART and showed that lymphocyte apoptosis was reduced most in those who had the best response to therapy . Althoug+ DR+ population, which dies after acute administration of IL-2, is indicative of this type of response to IL-2 in vivo. Since CD8+ T cells do not upregulate CD25, it is likely they respond to IL-2 via binding to CD122, (B chain IL-2R), which at the time of these studies was not commercially available. Of importance is that we saw no increase in CD4+T cell death, even though there was CD38+ DR+ activation marker upregulation in the treated people at Day 5 of the scIL-2 cycle. This is in contrast to the conclusions of another report; however, the data in that manuscript also clearly show more apoptosis in the activated CD8+ T cells than the CD4+ T cells after scIL-2 administration at Day 5 [+ vs. CD8+ T cell subpopulations. Recent data, which examined DNA turnover in CD4+ and CD8+ T cell subsets of HIV-infected people after long-term scIL-2 therapy, are supportive of this idea because IL-2 therapy enhanced CD4+ T cell survival, but not CD8+ T cell survival [IL-2 is known as the consummate T cell growth factor; however, IL-2 not only enhances proliferation and survival of T cells, it can also signal death in susceptible cell populations. We suggest that the activated CD38at Day 5 . We thin+ T cell death is unclear. It may be associated with a better overall CD4 cell count at the beginning point in the low CD8+ T cell apoptosis group. The CD4 cell count nadir in this group was about 100 cells/mm3 higher and the median was higher than in the high CD8+ T cell apoptosis group, which is consistent with our previous observations that a high level of CD8+ T cell apoptosis was correlated with fewer CD4+ T cells [The mechanism responsible for enhanced normalization of CD4 cell counts in those with less CD8 T cells .+ T cell apoptosis at baseline indicates existing immune activation to HIV antigens, which can continue in some patients, even without detectable viremia [+ T cells, therefore, get activated and die at an increased level in some individuals. Even though CD4 cell count increases in IL-2 treated patients, the amount of proliferation in the long term actually becomes reduced as shown in two studies [2M phase of the cell cycle, is similar to measurements of activation using CD38 and DR expression [+ and CD8+ T cells remained high, even after 22 cycles of scIL-2, indicating that chronic activation in some people is not relieved by IL-2 therapy. Of interest is that this patient also had about a log10 more HIV RNA  than other patients. However, we saw no correlation in our small study with viral load, which remained undetectable or barely detectable throughout the study [+ T cell death. The underlying reason for this is not clear, but could be related to inherent host differences or a \"set point\" of CD4 cell count, below which an enhanced CD8+ T cell apoptosis is triggered.Our interpretation of this data is that the amount of CD8 viremia -16. CD8+ studies ,4. It hapression . Hence, pression ,29. In the study . We did + T cell apoptosis relates to what drives the proliferation of T cells. That is, homeostatic mechanisms, like that driven by IL-7, are one way that T cell proliferation is driven. By contrast, activation-induced proliferation is another mechanism whereby T cells divide. We think it likely that the predominant form of CD8 proliferation occurring in those with high CD8+ T cell apoptosis is activation-induced, rather than homeostatic-driven proliferation, because death occurs mainly with activation induced proliferation, not homeostatic driven proliferation [Another possible mechanism to account for the role of CD8feration . This ma+ T cell apoptosis might serve as an indirect measure of the ability to respond to immunoreconstitution. Our longitudinal univariate analyses showed that both age and annexin were significant predictors of CD4 T cell numbers over time. However, entry of race into the model, showed that annexin lost it's independent relationship to CD4+ T cell number over time. Examination of possible ethnic differences in response to immune reconstitution is therefore also warranted.These data suggest that examination of CD8Interleukin-2 IL-2Antiretroviral therapy ARTMillion International Units MIUGeneralizing estimating equations GEEThe author(s) declare that they have no competing interests.DEL wrote the paper, RAC conducted the clinical aspects dealing with patients, CAK performed the multivariate analysis, KLG did the initial data analysis of the flow cytometry data, other's  helped with patient accrual and data management."}
+{"text": "All CD4+ TCCs of patients and all control TCCs secreted IFN\u03b3 and no IL-4. In contrast, CD8+ TCCs of patients secreted very little IFN\u03b3, while production of IL-10 did not significantly differ from other T cell subsets. Interestingly, all CD8+ clones producing IL-10 in large excess over IFN\u03b3 lacked expression of CD28. Functional assays showed a stimulatory effect of the supernatants derived from these CD8+CD28- hnRNP-A2 specific TCCs that was similar to that of CD4+CD28+ clones. Taken together, the pronounced peripheral T cell reactivity to hnRNP-A2 observed in the majority of SLE patients and the distinct phenotype of patient-derived CD8+ TCCs suggest a role for these T cells in the pathogenesis of SLE.A hallmark of systemic lupus erythematosus (SLE) is the appearance of autoantibodies to nuclear antigens, including autoantibodies directed to the heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2), which occur in 20% to 30% of SLE patients as well as in animal models of this disease. To investigate the underlying cellular reactivity and to gain further insight into the nature and potential pathogenic role of this autoimmune response we characterized the T cell reactivity against hnRNP-A2 in patients with SLE in comparison to healthy controls. Cellular proliferation of peripheral blood T cells to hnRNP-A2 was determined by [3H]thymidine incorporation and T cell clones (TCCs) specific for hnRNP-A2 were grown by limiting dilution cloning; IFN\u03b3, IL-4 and IL-10 in culture supernatants were measured by ELISA. Bioactivity of culture supernatants was determined by incubation of anti-CD3/anti-CD28 stimulated peripheral blood CD4+ T cells with supernatants of TCCs. Stimulation assays performed with peripheral blood mononuclear cells of 35 SLE patients and 21 healthy controls revealed pronounced proliferative responses in 66% of SLE patients and in 24% of the controls, which were significantly higher in SLE patients (p < 0.00002). Furthermore, hnRNP-A2 specific TCCs generated from SLE patients ( Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by a wide spectrum of multi-organ manifestations, and genetic, hormonal, environmental and immunoregulatory factors are known to contribute to expression of the disease . HoweverAbout 15 years ago, the heterogeneous nuclear ribonucleoprotein (hnRNP-)A2, another component of the spliceosome, was characterized as a novel target of autoAbs in systemic autoimmune diseases . AlthougMost of the autoAbs in SLE patients have undergone immunoglobulin class switching and affinity maturation. This and the association of HLA-DR subtypes with the presence of certain autoAbs indicates an antigen-driven immune response, emphasizing the role of T cells in SLE ,19. The Recently, we were able to characterize the cellular response against hnRNP-A2 in patients with RA . We obseTo gain more insight into the role of autoantigen specific T cells in SLE, we investigated spontaneous T cell responses to hnRNP-A2 in patients with SLE and in healthy control subjects and characterized TCCs specific for this antigen. The data obtained suggest that hnRNP-A2 may constitute an important T cell autoantigen in patients with SLE, indicating a potential role for it in the pathogenesis of this disorder.n = 21) and/or low-dose glucocorticoids (n = 15). Nine patients did not receive any medication. Disease activity was determined by European Consensus Lupus Activity Measurement (ECLAM) score TdR  was added and the incorporated radioactivity was measured by scinitillation counting. Results were expressed as stimulation index (SI) defined as the ratio of mean counts per minute (cpm) obtained in cultures with antigen to mean cpm obtained in cultures incubated in the absence of antigen. An SI \u22653.0 and a \u0394cpm >1,000 (mean cpm obtained in cultures with antigen minus mean cpm obtained in cultures incubated in the absence of antigen) was regarded as a positive response.Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized blood of SLE patients and controls by centrifugation on Ficoll Hypaque (Pharmacia). After washing and counting cells were either immediately used or frozen in RPMI medium containing 10% dimethylsulfoxide and 20% fetal calf serum. Cells were cultured in the presence of the antigens for 5 days at 37\u00b0C in triplicate in 96-well plates  in a total volume of 200 \u03bcl  in 96-wells plates. T cells were cultured in the presence of 1 \u00d7 105 irradiated  allogeneic PBMCs as 'feeder cells', 0.5 \u03bcg/ml phytohemagglutinin and 20 U/ml IL-2 in medium containing 1% heat-inactivated human AB serum. Growing microcultures were then expanded at weekly intervals with fresh feeder cells in the presence of IL-2. The specificity of TCCs was assessed by proliferation assays incubating 2 \u00d7 104 T cells with 0.35 \u03bcg/ml hnRNP-A2 in the presence of 105 autologous irradiated PBMCs. After 48 hours incubation and pulsing with [3H]TdR for an additional 16 hours, cells were harvested and the incorporated radioactivity was measured by scintillation counting. Production of IL-4, IFN\u03b3 and IL-10 was measured by ELISA in supernatants collected after 24 hours of incubation as described TdR and proliferation was measured after anadditional 16 hours. Incubation with IL-10 alone  was used as control.To investigate a possible functional difference between the CD4+CD28+ and CD8+CD28- TCCs, purified CD4+ T cells from two SLE patients and two healthy controls  were observed in 66% of the SLE patients and 24% of the controls , the difference was not significant. Of note, while in controls the stimulation elicited by tetanus toxoid was considerably higher than the one induced by hnRNP-A2, the response of SLE patients to tetanus toxoid was slightly but significantly lower than the response to hnRNP-A2  could be raised. Twenty-two TCCs were derived from SLE patients: 13 (59%) of them were CD4+/CD8- and thus belonged to the helper T cell subset, while 9 were CD4-/CD8+. The TCCs showed high variability in their degree of proliferation, with SIs ranging from 3.0 to 26.0 and a mean SI of 6.2 \u00b1 1.2. Figure . Analysin = 8; 67%) were CD4+/CD8-, while 3 clones (25%) were CD4-/CD8+ and one TCC was CD4-/CD8-. In contrast to SLE TCCs, all clones secreted IFN\u03b3, though in highly varying amounts , the difference between patient and control TCCs (39.5 \u00b1 29.4 pg/ml versus 376 \u00b1 312 pg/ml) did not reach statistical significance.Proliferation of the 12 TCCs derived from control individuals was comparable to patient-derived clones, with SIs ranging from 3.6 to 37 and a mean SI of 9.0 \u00b1 2.8 Figure . Phenotys Figure . Whereass Figure . Additios Figure ; howeverExpression of the costimulatory molecule CD28 was measured in six CD4+ and seven CD8+ TCCs from SLE patients and in five TCCs from healthy subjects Figure .As pronounced differences in the cytokine secretion pattern of SLE patient derived CD4+CD28+ and CD8+CD28- TCCs had been observed, we were interested in the functional properties of these two populations. To address this question, CD4+ T cells  were stimulated with anti-CD3 and anti-CD28 mAbs and subsequently incubated with supernatants from two CD8+CD28- and two CD4+CD28+ TCCs derived from SLE patients Figure . All supIn previous investigations we characterized the humoral response to hnRNP-A2 in SLE patients and some clinical implications thereof ,10,31,32The occurrence of autoreactive T cells in healthy individuals is a common finding that has previously been reported for antigens associated with SLE  as well Interestingly, no correlation of cellular reactivity to hnRNP-A2 with the appearance of the respective autoAbs in SLE patients could be observed. Thus, hnRNP-A2 appears to be a predominant T cell antigen, while the generation of autoAbs might represent a bystander phenomenon occurring in a subgroup of patients. However, recent data indicate that in SLE patients the humoral response to hnRNP-A2 fluctuates considerably and increases during flares. Therefore, the prevalence of these autoAbs may be considerably higher than previously assumed (unpublished observation).in vitro from CD8+CD28- T cells [Although the cellular reactivity to hnRNP-A2 appeared to be primarily a Th1 response, we observed a relatively high percentage of CD8+ TCCs in SLE patients. Of particular interest, most of these clones lacked CD28 expression and produced neither IFN\u03b3 nor IL-4, but did produce IL-10. This may indicate a special pathological role of this T cell subset because this phenotype appeared to be restricted to SLE patient derived TCCs. In previous reports, CD4+ T cells in SLE were shown to be of predominantly Th1 or Th0 subtypes ,24. Furt T cells . This su T cells -40. An iSurprisingly, though, the supernatants of the hnRNP-A2 specific CD8+CD28- TCCs derived from SLE patients did not inhibit proliferation of CD4+ T cells, but instead enhanced anti-CD3/anti-CD28 induced stimulation, similar to supernatants derived from CD4+CD28+ TCCs. As IL-10 alone had an antiproliferative effect, the increased content of IL-10 in the supernatants of CD8+CD28- TCCs was obviously counteracted by other yet unknown stimulatory components of the supernatant, which remain to be identified. Of note, the lack of CD28 expression is also a hallmark of senescent T cells, which are known to be increased in various autoimmune diseases and chronic inflammatory conditions and may show a rather aggressive phenotype . TherefoElevated IL-10 serum levels have been reported in SLE patients and correlated with clinical and serological disease activity, especially anti-DNA antibody titres . SeveralFinally, the question remains why hnRNP-A2 is such a preferred target of the T cell response in SLE, while autoAbs occur less frequently and may represent an epiphenomenon of ongoing T cell autoreactivity. On the other hand, autoAb titers increase during disease flares (unpublished observation) and, importantly, autoAbs to hnRNP-A2 are, together with anti-Sm antibodies, among the earliest detectable autoAbs in MRL/lpr mice, where they were found to precede anti-dsDNA autoAbs . HnRNP-AOur data reveal a pronounced T cell response against the autoantigen hnRNP-A2 in the majority of SLE patients in contrast to a scarcer and lower response in healthy subjects. Although this autoreactivity seemed to be mainly conferred by CD4+ T cells showing a Th1 phenotype, a newly defined hnRNP-A2 specific CD8+CD28- T cell-subset was observed in SLE patients. This subpopulation showed a predominant IL-10 secretion and a lack of IFN\u03b3 or IL-4 production. Our data suggest involvement of both populations in the complex and still incompletely understood pathogenesis of SLE, and warrant further investigations into the cellular aspects of this autoimmune response.autoAb = autoantibody; cpm = counts per minute; ds = double stranded; ECLAM = European Consensus Lupus Activity Measurement; ELISA = enzyme-linked immunosorbent assay; FITC = fluorescein isothiocyanate; hnRNP = heterogeneous nuclear ribonucleoprotein; IFN = interferon; IL = interleukin; mAb = monoclonal antibody; PBMC = peripheral blood mononuclear cell; RA = rheumatoid arthritis; SI = stimulation index; SEM = standard error of the mean; SLE = systemic lupus erythematosus; TCC = T cell clone.They authors declare that they have no competing interests.RF participated in the design of the study, worked with the T cell cultures and drafted the manuscript. DM performed the T cell cloning and T cell assays. KS prepared the recombinant antigen. BJS participated in the design of the study. JS and GS conceived of the study, participated in its design and coordination and helped to write the manuscript. All authors read and approved the final manuscript."}
+{"text": "HIV-associated immune reconstitution disease (IRD) is the clinical presentation or deterioration of opportunistic infections that results from enhancement of pathogen-specific immune responses among patients responding to antiretroviral treatment (ART). The vast majority of reported cases of IRD have been associated with mycobacterial, chronic viral and invasive fungal infections; such cases result from dysregulated augmentation of cell-mediated type 1 cytokine-secreting host immune responses. However, the spectrum of infections now recognized as associated with IRD is expanding and includes a number of parasitic infections, which may be mediated by different immunopathological mechanisms. These include leishmaniasis , schistosomiasis and strongyloidiasis. Since the major burden of HIV lies in resource-limited countries where access to ART is now rapidly expanding, increased awareness and knowledge of these phenomena is important. Here we review the clinical spectrum and pathogenesis of IRD associated with parasitic infections. HIV-associated morbidity and mortality has dramatically decreased in many high-income countries since the advent of antiretroviral treatment (ART) in the mid 1990s . Robust IRD is not a new phenomenon, but has long been recognized as a complication occurring among patients with severe immunosuppression in whom immune function is rapidly restored. Thus, for example, IRD may occur following withdrawal or rapid dosage reduction of corticosteroid treatment and among patients in whom the blood neutrophil count recovers following cytotoxic chemotherapy or bone marrow transplantation . The patMycobacterium tuberculosis, Mycobacterium avium complex and other non-tuberculous mycobacteria); (b) viruses ; and (c) fungi  (vide infra).The vast majority of cases of IRD associated with ART have been reported from high-income countries and have been associated with a wide range of non-parasitic opportunistic infections, including: (a) bacteria (ma spp.) . HoweverThe majority of people with HIV/AIDS live in resource-limited countries and in June 2005 WHO estimated that 6\u00b75 million people living in such countries were in urgent need of ART . DespiteIRD can be defined as the clinical presentation or deterioration of opportunistic infections that results from enhancement of pathogen-specific immune responses among patients responding to ART. However, diagnosis in practice is not straightforward, being one of clinical judgement based on various lines of indirect evidence. These may include: (a) the clinical manifestation or pattern of progression of an opportunistic infection that is unusual; (b) a temporal relationship with ART initiation; (c) exclusion of alternative explanations; (d) demonstrated efficacy of ART  evidence of improved CD4 cell function (e.g. development of a positive tuberculin skin test); and (f) histopathology consistent with the diagnosis. Competing explanations for these clinical manifestations that should be excluded are the occurrence of opportunistic infections as a result of residual immunodeficiency and inadequate treatment of an opportunistic infection, including that resulting from drug resistance.+CD45RO+ memory cells previously sequestered in lymphoid tissue and a reduction in apoptotic cell death (+CD62L+ cells (Successful ART is associated with a rapid (> 90%) reduction in plasma viral load within the first weeks of ART. The most characteristic immunological feature of HIV infection is depletion of CD4 T cell numbers, and restoration of the CD4 cell subset during ART appears to occur in two principal phases. The initial rapid phase of CD4 cell recovery can usually be detected within the first 1\u20132 weeks of starting treatment and extends over 2\u20133 months . Data sull death ,17. Thosll death \u201321. A slL+ cells .The increase in circulating CD4 cell numbers is also associated with an improvement in effector function, the extent of which is directly related to the degree of viral load suppression and the CD4 cell counts in the longer term . IL-2-meAlthough HIV is principally characterized by CD4 cell depletion, functional deficits in other cells of the innate and acquired immune systems also occur. However, the literature concerning effects of ART on other cell types is much less comprehensive than that concerning CD4 cell reconstitution. Moreover, many of these effects are CD4 cell-dependent, so that attributing ART-induced improvements in immune function to either CD4 cells or to other cell types is difficult.+ T cell counts are also associated with decreased circulating CD3\u2212/CD16+/CD56+ NK cells  decreases during ART ,16,22, p+ CD25+ IL-10-secreting T regulatory cells  cytokine-secreting immune responses  is the clinical form of leishmaniasis that has the most substantial geographical overlap with HIV and typically occurs as an opportunistic infection among HIV-infected individuals with CD4 cell counts < 200 cells/\u00b5L . This oveficient .L. infantum VL in southern France describe asymptomatic patients who developed fever and hepatosplenomegaly due to VL within the first 2 weeks of initiating ART  are associated with an intense granulomatous response, causing tissue pathology via a CD4 cell-dependent process ,73. FromLeishmania braziliensis were established in both patients and both responded well to treatment with either amphotericin B or pentavalent antimony . On. On74). Two cases of PKDL presenting as IRD have been reported from Israel  and ItalLeishmania donovani during ART has been reported from the Netherlands .,84.83,84et al. , schistosomiasis and strongyloidiasis. No studies have yet examined the mechanisms of IRD associated with helminth infections, but these may be due to augmentation of appropriate type 2 immune responses. More research is needed to increase our understanding of these emerging phenomena."}
+{"text": "CD4+ T lymphocyte (CD4) cell count testing is the standard method for determining eligibility for antiretroviral therapy (ART), but is not widely available in sub-Saharan Africa. Total lymphocyte counts (TLCs) have not proven sufficiently accurate in identifying subjects with low CD4 counts. We developed clinical algorithms using TLCs, hemoglobin (Hb), and body mass index (BMI) to identify patients who require ART.We conducted a cross-sectional study of HIV-infected adults in Uganda, who presented for assessment for ART-eligibility with WHO clinical stages I, II or III. Two by two tables were constructed to examine TLC thresholds, which maximized sensitivity for CD4 cell counts \u2264 200 cells \u03bcL, while minimizing the number offered ART with counts > 350 cells \u03bcL. Hb and BMI values were then examined to try to improve model performance.1787 subjects were available for analysis. Median CD4 cell counts and TLCs, were 239 cells/\u03bcL and 1830 cells/\u03bcL, respectively. Offering ART to all subjects with a TLCs \u2264 2250 cells/\u03bcL produced a sensitivity of 0.88 and a false positive ratio of 0.21. Algorithms that treated all patients with a TLC <2000 cells/\u03bcL, excluded all patients with a TLC >3000 cells/\u03bcL, and used Hb and/or BMI values to determine eligibility for those with TLC values between 2000 and 3000 cells/\u03bcL, marginally improved accuracy.TLCs appear useful in predicting who would be eligible for ART based on CD4 cell count criteria. Hb and BMI values may be useful in prioritizing patients for ART, but did not improve model accuracy. Guidelines developed by the World Health Organization (WHO) for the use of antiretroviral therapy (ART) in low-income countries state that HIV-infected individuals should commence ART if they have WHO stage IV disease, stage III disease and a CD4+ T lymphocyte (CD4) cell count of \u2264350 cells/\u03bcL, or stage I or II disease with CD4 cell counts \u2264200 cells/\u03bcL . RecentlIf CD4 cell counting is not available, as is the case in most of sub-Saharan Africa, the WHO guidelines recommend using clinical staging alone, or in combination with total lymphocyte counts (TLCs) of < 1200/\u03bcL in order to determine ART eligibility-5. StudiWe designed an analysis among HIV-infected adults in rural Uganda being screened for ART eligibility. We examined the clinical utility of TLCs, Hb, and body mass index (BMI) to maximize the sensitivity to detect individuals with CD4 cell counts below 200 cells/\u03bcL, and limit the proportion of individuals who would be offered ART with CD4 cell counts above 350 cells/\u03bcL.The Home-Based AIDS Care Program (HBAC) is a clinical trial of three different monitoring strategies for patients receiving ART in rural Eastern Uganda. Registered clients of The AIDS Support Organization (TASO), a local HIV/AIDS care and support organization in Tororo and Busia districts, were invited to be screened for ART eligibility. The study includes participants from a prior diarrhea prevention and cotrimoxazole study described elsewhere , as wellAll subjects in this analysis were HIV-infected adults aged \u2265 18 years. Clinical and laboratory assessments at baseline included a complete blood counts (CBC), viral load, and CD4 cell counts. Those who had a CD4 count \u2264250 or had WHO stage III (excluding pulmonary TB) or IV were offered ART. Blood samples for TLC and CD4 testing were collected in the same vacutainer tube containing EDTA at the study clinic and transported to the CDC laboratory in Entebbe. CD4 cell counts were measured by a dual-platform protocol using a FACScan instrument and Tritest reagents . TLCs were measured both using a hematology analyzer  and the FACScan instrument. We have previously found that delays in transport of up to 5 days do not affect the accuracy of the FACScan results for CD4 cell counts  and therefore used the TLC results obtained on the FACScan in order to determine if transport time to the lab significantly affected the difference between the two methods. TLCs results from the hematology analyzer were used for the analysis. Clinical information during screening was collected using standardized instruments completed by study physicians. Subjects with WHO stage IV disease were excluded for this analysis.Bivariate correlations between TLC results obtained on the FACscan and hematology analyzer were conducted. Differences between the two results were calculated and compared with results stratified by time between blood draw to testing of \u2264 1 day and > 1 day, using the Wilcoxan Rank Sum test. Distributions of TLCs, Hb and BMI across CD4 cell count strata were compared in a pair-wise fashion using the Wilcoxan Rank Sum test. Two by two tables were constructed to examine the association between different strata of TLCs, Hb and BMI with CD4 cell counts \u2264 200/\u03bcL or \u2264350/\u03bcL. Sensitivity, specificity, positive and negative predictive values and accuracy  of the models were then calculated. We examined different TLC thresholds in terms of their ability to maximize sensitivity in detecting subjects with CD4 cell counts \u2264 200 cells/\u03bcL and minimize the proportion of subjects offered ART with cell counts > 350 cells/\u03bcL . Hb and BMI thresholds, alone and in combination, were then used to classify subjects with intermediate TLCs as qualifying for therapy. 95% confidence intervals for sensitivity and false positive ratios were calculated for the final models according to the Wald method . Final mThe effects of tuberculosis, malaria parasitemia, or diarrhea at the time of screening were examined by conducting sub-group analyses which excluded subjects with these illnesses. All statistical analyses were conducted in SAS version 9.0 2 = 0.85, p < 0.001) with the analyzer consistently giving greater values . Differences were slightly greater for subjects whose blood samples were tested 2 days after blood draw in comparison with those whose blood was tested \u2264 1 day after draw .Between May 2003 and June 2005, 1944 HIV-infected adults presented for assessment of ART eligibility. Of these, 104 (5.2%) were excluded from this analysis as they were found to have WHO clinical stage IV disease. Another 53 individuals were excluded because of missing TLC or CD4 cell count values leaving 1787 subjects available for analysis. 75.2% were women and 27.8% were men. Median baseline CD4 cell counts and total lymphocyte counts, were 239 (inter-quartile range [IQR] = 119\u2013411) and 1830 (IQR = 1420\u20132360) cells/\u03bcL, respectively. The mean time between blood sample collection and TLC and CD4 testing was 1.4 days; 56% of subjects had blood tested on the same day or one day after blood draw and 43% were tested 2 days after blood draw. One patient had blood tested 8 days after blood draw and was excluded from the analysis. TLC results between the hematology analyzer and the FACScan instrument were highly correlated (Pearson's r2 (IQR = 18.-21.9). TLCs, Hb and BMI were distributed differently between the CD4 cell count strata , with higher values for all parameters measured in the higher CD4 cell count strata.In total, 763 (42.7%) subjects had baseline CD4 cell counts \u2264 200 cells/\u03bcL, 459(25.7%) had cell counts of 201\u2013350 cells/\u03bcL and 565 (31.6%) had CD4 counts > 350 cells/\u03bcL (Table A TLC threshold of 2250 cells/\u03bcL was the most accurate (0.73) predictor of CD4 cell counts \u2264 350 cells/\u03bcL, yielding a sensitivity of 0.81 and a specificity of 0.54 (Table Results for women were unchanged from that of the whole group (data not shown). Both algorithms from the whole group analysis performed well for men separately, with accuracies of 0.72 and 0.73 for the models including TLC and Hb; and TLC, Hb and BMI, respectively Table . HoweverOffering ART to all subjects with WHO stage III disease and using the algorithms to determine ART-eligibility for those with stage I or II disease would have resulted in treatment being offered to 1282 or 1328 subjects with similar levels of sensitivity and false positives. A total of 19 subjects had malaria parasitemia, 60 subjects were on TB treatment or diagnosed with TB at screening and 96 subjects had diarrhea at screening. However, excluding any of these subjects did not improve the predictive value of the final models.We have demonstrated that using a TLC of 2250 cells/\u03bcL to determine ART eligibility in subjects with WHO clinical stages I, II or III, could identify 88% of subjects with CD4 cell counts \u2264 200 cells/\u03bcL, while 21% of subjects offered ART would have CD4 cell counts > 350 cells/\u03bcL. Using a TLC threshold of 2000 cells/\u03bcL to offer ART and an upper threshold of 3000 cells/\u03bcL to exclude subjects from treatment with Hb and BMI thresholds to determine ART eligibility for those with intermediate TLCs only marginally improved the accuracy of TLCs alone.Despite the failure to improve accuracy of TLCs in predicting CD4 cell counts, using Hb and BMI may still be of value in determining who should initiate ART in resource-limited settings. Recent studies have shown that low Hb values and low BMI are independent risk factors for early mortality on ART in African settings ,16. TherThe number of patients offered therapy under our TLC/Hb/BMI criteria were similar to the number offered treatment had ART been offered to all patients with CD4 cell counts \u2264 350 cells/\u03bcL, however, the same patients would not be treated under both scenarios. Between 17 and 19% of subjects with CD4 cell counts \u2264350 cells/\u03bcL would not be offered ART using the TLC/Hb/BMI algorithms, however, as they would not have low BMIs or low Hb values, unless they also had TLCs >3000 cells/\u03bcL, it is unlikely that they would be at risk for early mortality without treatment.More than 75% of the participants in this study were women. While the proportion of women aged 15 \u2013 59 with HIV in Uganda is about 28% greater than men (7.3 versus 5.2%), it is lIf TLCs are to prove to be a viable alternative to using CD4 cell counting in managing HIV-infected individuals in resource-limited settings, they will need to be shown to be useful not only in determining when individuals should initiate ART, but also in monitoring patients on ART. There have been few studies on the use of TLCs in monitoring individuals on ART, but all have concluded that TLCs correlate well with changes in CD4 cell counts on ART,20. HoweThe proportion of subjects in our study with CD4 cell counts \u2264 200 cells/\u03bcL and \u2264 350 cells/\u03bcL was very high , resulting in a large number of subjects being ART-eligible. It is likely that our algorithm may not function as well in settings where the proportion of ART eligible subjects is not so high. However, uptake of voluntary counseling and testing is quite low in Uganda in that only 13% of women and 11% of men have ever been tested for HIV and is aThis study has two potential limitations. Firstly, TLCs and CD4 cell counts were not conducted at the site of blood drawing, but were transported to the CDC laboratory in Entebbe, which may have resulted in some deterioration of the blood samples. However, we had previously shown that CD4 cell count results from the FACScan instrument are stable up to 5 days after blood draw and the variability between the TLC values obtained on the FACScan were only a median of 40 cells/\u03bcL less for subjects whose blood was tested 2 days after draw compared to those whose samples were tested after \u2264 1 day delay between blood collection and testing. These observations suggest that transport time may not have caused significant inaccuracy in our laboratory test results. Secondly, the gold standard for determining inclusion or exclusion criteria for ART used in this study, that of CD4+ T lymphocyte counts, are also not perfect predictors of morbidity and mortality among people with HIV. While CD4 cell counting has proven useful in allowing stratification of risk for disease progression on ART individual variation of disease progression within CD4 cell count strata is large . TLCs haThus, while TLCs may not correlate perfectly with CD4 cell counts, they may be as useful in predicting disease progression and therefore can be equally useful in determining when ART should be initiated. While evaluating how well ART-eligibility criteria based on TLCs perform in comparison to CD4 cell count \u2013 based criteria can only be answered by conducting clinical trials, this study has again demonstrated that TLCs are useful proxy measures for CD4 cell counts in determining ART eligibility."}
+{"text": "Patients accessing antiretroviral treatment (ART) programmes in sub-Saharan Africa frequently have very advanced immunodeficiency. Previous data suggest that such patients may have diminished capacity for CD4 cell count recovery.Rates of CD4 cell increase were determined over 48 weeks among ART-na\u00efve individuals (n = 596) commencing ART in a South African community-based ART programme.The CD4 cell count increased from a median of 97 cells/\u03bcl at baseline to 261 cells/\u03bcl at 48 weeks and the proportion of patients with a CD4 cell count <100 cells/\u03bcl decreased from 51% at baseline to just 4% at 48 weeks. A rapid first phase of recovery  was followed by a slower second phase . Compared to patients with higher baseline counts, multivariate analysis showed that those with baseline CD4 counts <50 cells/\u03bcl had similar rates of phase 1 CD4 cell recovery (P = 0.42), greater rates of phase 2 recovery (P = 0.007) and a lower risk of immunological non-response (P = 0.016). Among those that achieved a CD4 cell count >500 cells/\u03bcl at 48 weeks, 19% had baseline CD4 cell counts <50 cells/\u03bcl. However, the proportion of these patients that attained a CD4 count 200 cells/\u03bcl at 48 weeks was lower than those with higher baseline CD4 cell counts.Patients in this cohort with baseline CD4 cell counts <50 cells/\u03bcl have equivalent or greater capacity for immunological recovery during 48 weeks of ART compared to those with higher baseline CD4 cell counts. However, their CD4 counts remain <200 cells/\u03bcl for a longer period, potentially increasing their risk of morbidity and mortality in the first year of ART. The World Health Organisation (WHO) estimated that in June 2005 4.7 million people living in sub-Saharan Africa were in urgent need of antiretroviral treatment (ART) . DespitePatients enrolling into ART programmes with very low CD4 cell counts have heightened risk of morbidity and mortality both before and during the initial months of ART -8. MoreoIn this study we have examined determinants of CD4 cell count recovery among patients accessing a community-based antiretroviral programme in South Africa. We focus on the hypothesis that advanced pre-treatment immunodeficiency diminishes the capacity for CD4 cell count recovery during ART as determined by rates of CD4 cell count increase and risk of immunological non-response.We studied patients accessing ART at the Gugulethu Community Health Centre, Cape Town, South Africa . The vasThe first-line ART regimen was comprised of stavudine, lamivudine plus a non-nucleoside reverse transcriptase inhibitor (efavirenz or nevirapine). The second-line regimen for those failing first-line treatment was comprised of lopinavir/ritonavir, zidovudine and didanosine. Treatment adherence exceeds 90% at one year . All trePlasma HIV-1 load was measured at baseline and 4 monthly during treatment using Versant\u2122 HIV-1 RNA 3.0 branched chain DNA assay  with a lower limit of detection of 50 RNA copies/ml. Blood CD4 cell counts were measured at the same time-points by flow cytometry using FACSCount\u2122 . These assays were all performed in a single nationally accredited laboratory which has rigorous quality assurance procedures.Structured clinical and laboratory records were maintained on all patients screened on entry to the ART programme and this information was transferred on a weekly basis to a computer database. Data were analysed from the start of the programme in September 2002 until data censorship in August 2005. All treatment-naive patients aged over 15 years and with at least a 16-week follow-up time point were included in the analysis. Study of these patients was in compliance with the Declaration of Helsinki and was approved by the Research Ethics Committee of the University of Cape Town; all patients enrolled gave written informed consent.Data were analysed using Stata version 9.0 . We calculated absolute responses in CD4 cell counts during three intervals , as well as rates of CD4 cell increase (cells/\u03bcl/month) during each interval. The first interval was used as an estimate of the initial (phase 1) response to ART. The CD4 cell count responses observed during the latter two intervals (16 to 32 and 32 to 48 weeks after treatment initiation) were very similar, and were combined into a single measure of the second phase of CD4 cell responses (phase 2).We further evaluated CD4 cell responses in the following ways: i) whether patients failed to attain an absolute CD4 cell count increase from baseline of at least 50 cells/\u03bcl at 48 weeks ; ii) whether patients achieved an absolute CD4 count of 200 cells/\u03bcl at the 48 week visit; iii) and whether patients had achieved an absolute CD4 cell count of 500 cells/\u03bcl at 48 weeks (super-responders).In bivariate analyses, medians were compared using Wilcoxon rank-sum and sign-rank tests; proportions were compared using chi-square tests. All statistical tests were two-sided at alpha = 0.05. Separate multiple linear regression models were used to examine factors associated with rates of CD4 cell count increase per month during the first and second phases. Baseline CD4 cell counts were categorised as follows: <50, 50\u201399, 100\u2013149 and >150 cells/\u03bcl. Multiple logistic regression was used to assess factors associated with the binary outcomes of a CD4 cell increase of \u2265 50 cells/\u03bcl and \u2265 100 cells/\u03bcl during the 48 weeks of ART, as well as achieving an absolute CD4 cell count of \u2265 200 cells/\u03bcl during follow-up. Variables were included in multivariate models if they demonstrated a persistent association with the outcome of interest, or if their removal affected appreciably associations involving other variables .Of 698 individuals who commenced ART between September 2002 and April 2005, 596 (85%) had completed a 16-week follow-up visit at the time of data censorship, 34 (5%) were awaiting this appointment, 48 (7%) had died and 20 (3%) were either transferred out or were lost to follow-up. Of the 596 individuals who met the inclusion criteria for the study, 580 (97%) remained within the programme at study censorship, 11 (2%) died and 7 (1%) were lost from the programme.10 RNA copies/ml  and 58% of patients had a viral load >100,000 copies/ml. The median blood CD4 cell count was 97 cells/\u03bcl  and the proportions of patients with CD4 cell counts within the ranges <50, 50\u201399, 100\u2013149 and \u2265 150 cells/\u03bcl were 25%, 26%, 23% and 26%, respectively. Eighty per cent of patients had symptomatic disease, with 53% and 27% of patients having WHO stages 3 and 4 disease, respectively. During follow-up, only 7 (1%) patients switched to the second-line drug regimen.At baseline the median age was 32 years  and 75% were female. The median plasma viral load was 4.88 logVirological responses to treatment were excellent with viral load suppressed <400 copies/ml in \u2265 94% of patients at each of the follow-up time-points Table . As a reThe rate of CD4 cell count increase in the first 16 week period greatly exceeded the rates in both the 16\u201332 week and 32\u201348 week intervals, but the rates did not differ comparing the latter two intervals. Thus, the pattern of CD4 cell count increase was divided into 2 phases: a ra\u2013pid phase 1  and a slower phase 2 .Baseline characteristics and rates of CD4 cell count change in phase 1 and phase 2 did not differ when comparing the results of analyses of all eligible patients with those restricted to subjects who had data for every time-point (n = 292); this was also the case for all subsequent stratified analyses. Use of data from the larger cohort (n = 596) was therefore validated.10 copies/ml the phase 1 CD4 cell slope was 21.3 cells/\u03bcl/month compared to 31.0 cells/\u03bcl/month among those with baseline viral load of >5 log10 copies/ml (P < 0.001).Rates of phase 1 CD4 cell increase were similar across all CD4 cell count strata Figure . SubsequContrary to our initial hypothesis, the rate of phase 2 CD4 cell increase was greater among those with a baseline CD4 cell count <50 cells/\u03bcl compared to those with higher baseline counts Figure . MultivaIn the multivariate model predicting rates of phase 2 CD4 cell increase, factors associated with the response to ART during the first 16 weeks were also included. A lower rate of phase 1 CD4 cell increase and full suppression of viral load at 16 weeks were both strongly associated with greater rate of phase 2 CD4 cell increase. Viral load suppression <400 copies/ml at 16 weeks was associated with a subsequent rate of CD4 cell increase of 6.8 cells/\u03bcl/month compared to 0.7 cells/\u03bcl/month among those whose viral load remained >400 copies/ml (P < 0.001).We next examined whether baseline CD4 cell count was a risk factor associated with immunological non-response (defined as a CD4 cell increase of <50 cells/\u03bcl at 48 weeks). Among those followed to 48 weeks n = 311), the blood CD4 cell count increased by <50 cells/\u03bcl among 30 (9.7%) patients; of these, the viral load was suppressed <50 copies/ml among 22 patients, representing a treatment discordance rate of 7%. Contrary to our initial hypothesis, low baseline CD4 cell counts were not associated with increased risk of immunological non-response. Among patients with baseline CD4 cell counts of <50, 50\u201399, 100\u2013149 and 150 cells/\u03bcl, the proportions of patients who were immunological non-responders were 5%, 4%, 11% and 19%, respectively. Furthermore, in multivariate analyses, an increment of <50 cells/\u03bcl was independently associated with higher baseline CD4 cell count as well as older age, lower baseline viral load, and a viral load >400 copies/ml at any follow-up time-point  achieved an absolute CD4 cell count of >500 cells/\u03bcl. These super-responders were principally characterised by age <40 years and by all having follow-up viral loads persistently suppressed <50 copies/ml and a CD4 cell count of 150 cells/\u03bcl after 16 weeks of ART. This group of patients had a wide distribution of baseline CD4 cell counts, and included among them were 4 (19%) who had baseline CD4 cell counts of <50 cells/\u03bcl. Thus, a low baseline CD4 cell count did not preclude patients from having an excellent immunological response.To our knowledge this is the first analysis to examine the determinants of CD4 cell count recovery among patients receiving ART in resource limited settings. These data indicate that those with baseline CD4 cell counts <50 cells/\u03bcl had similar rates of phase 1 CD4 recovery (0\u201316 weeks) and greater rates of phase 2 recovery 16\u201348 weeks) compared to rates among those with higher baseline CD4 cell counts. Moreover, those with the lowest baseline counts were least likely to be immunological non-responders to ART. Despite these observations, those with baseline CD4 cell counts <50 cells/\u03bcl were nevertheless least likely to attain a CD4 cell count 200 cells/\u03bcl at 48 weeks. Taken together, these results suggest that although patients with very low baseline CD4 cell counts retain capacity for similar or slightly greater rates of CD4 cell count recovery compared to those with higher counts, they are nevertheless likely to require a longer period of time to attain a CD4 cell count threshold of 200 cells/\u03bcl. Thus, a prolonged period below a 'safe' CD4 cell count threshold rather than a diminished rate of immunological recovery is likely to underlie the high rates of morbidity and mortality observed among those with advanced disease during the early months of ART [ weeks coThe findings of this analysis are strengthened by the relatively homogeneous study population receiving treatment at a single facility using standardised clinical protocols. Patients were all ART-na\u00efve and received a standard triple-drug regimen with uniform follow-up time points. Quality-assured laboratory assays were all performed in a single nationally accredited laboratory. In contrast, previous studies of the determinants of CD4 cell count recovery have examined heterogeneous study populations in multiple centres and used diverse treatment regimens. Moreover, these studies included many patients with prior ART exposure -22 and set al.[et al. showed a similar but non-significant trend when comparing patients with baseline CD4 cell counts <200 cells/\u03bcl with those with higher counts [et al. found that CD4 cell increases in the first year of ART were similar comparing those with baseline counts <100 cells/\u03bcl with those with counts 100\u2013199 cells/\u03bcl [The immunological response to ART among those with low CD4 cell counts was excellent with the proportion of patients with a CD4 cell count <100 cells/\u03bcl decreasing from 51% at baseline to just 4% at 48 weeks. However, our most important finding was that in multivariate analysis baseline CD4 cell counts <50 cells/\u03bcl were independently associated with similar rates of phase 1 CD4 cell recovery and greater rates of phase 2 CD4 cell recovery compared to individuals with higher baseline CD4 cell counts. This has not been clearly highlighted in previous publications from Europe and North America although comparison of our data with previous studies is difficult in view of differing cohort compositions. However, this overall observation is consistent with the findings of Bennett et al., and Le cells/\u03bcl .Survival bias could potentially have affected our findings. We have previously shown in this cohort that patients with the lowest baseline CD4 cell counts had a higher risk of death  and immuWe have previously shown that low baseline CD4 count at entry to an ART programme was associated with increased risks of tuberculosis and of mortality during the first year of ART ,8. Resul5 log10 copies/ml had 11-fold greater CD4 count increases than those with lower viral loads. Immune dysregulation and immune cell activation promote sequestration of CD4+CD45Ro+ memory T cells in lymphoid tissue; suppression of viral replication then triggers rapid redistribution of this cell pool and a reduction in apoptotic cell death during the initial weeks of ART [Mycobacterium tuberculosis[Cryptococcus neoformans[Rates of phase 1 and phase 2 CD4 cell increase were similar in magnitude to those previously reported from high-income countries ,20. The s of ART ,27. A poerculosis, Cryptoceoformans that is Greater phase 2 CD4 cell recovery was strongly associated with age as reported elsewhere ,24. SustPatients with the lowest CD4 counts in this setting do not have diminished capacity for immune recovery. Although patients with low baseline CD4 counts have increased risk of acute morbidity and mortality, if such patients survive the initial months of ART and fully suppress the viral load, their chances of immunological recovery are good during the first year. Future studies are required to determine the long-term prospects for immune recovery among patients treated in ART programmes in sub-Saharan Africa.The author(s) declare that they have no competing interests.SDL and RW initiated and designed the study. LM did the statistical analyses. LGB and RW established the study cohort and data collection systems. SDL wrote the manuscript, which RW, LM and LGB all helped to revise.The pre-publication history for this paper can be accessed here:"}
+{"text": "Veazey and Lackner discuss a new study which found that most patients who start antiretroviral drugs as early as possible after HIV infection still do not experience complete restoration of intestinal CD4+ T cells to baseline levels. These studies confirmed earlier reports in macaques infected with simian immunodeficiency virus (SIV) [+ T cells in the body. However, profound losses can only be detected when examining mucosal tissues . Recognition of the mucosal immune system as a principal target of early HIV infection constitutes a fundamental change in our understanding of HIV pathophysiology, with potential implications for therapeutic monitoring and vaccine development [Recent studies have confirmed that acute HIV infection results in a rapid and profound loss of memory CD4nfection ,2. Sinceus (SIV)  and demo+ T cells imparts profound disturbances in mucosal immunity. However, since mucosal tissues are at best inconvenient to sample, little is known regarding the impact of the loss of this important T cell subset on host immunity or disease progression. In addition, the potential for antiretroviral therapy (ART) to restore mucosal CD4+ T cells has been difficult to assess, particularly in acute infection. In a new paper by Mehandru et al. [n = 54) of HIV-infected patients soon after infection. These samples were examined and compared with the same samples obtained from HIV-uninfected volunteers to determine whether early therapeutic intervention could restore intestinal CD4+ T cells to baseline levels. Prior to this study, few had examined the effects of ART on HIV-infected humans or SIV-infected macaques, particularly inearly infection. A study by Guadalupe et al. had suggested near complete restoration of mucosal CD4+ T cells in HIV-infected patients when therapy was initiated early, but only three acutely infected patients were examined [+ T cells, but again, few animals were examined [+ T cell repopulation in patients on ART, but this was a cross-sectional study and only eight patients were examined [+ T cells in the peripheral blood have been reported to fully reconstitute in patients on ART, there is considerable controversy regarding the capacity for restoration of intestinal CD4+ T cells, particularly for patients treated in the early stages of infection. This is more than an academic issue, since acutely infected patients are seldom started on ART. Treatment guidelines generally recommend waiting to initiate therapy until blood CD4 cell counts have fallen, in order to reduce the risk of medication side effects as well as the potential for selecting drug-resistant HIV.Clearly, the massive loss of intestinal memory CD4u et al. , lymphocexamined . Studiesexamined . In contexamined . In summThe mucosal immune system is a principal target of early HIV infection.+ T cells was observed on ART, the results clearly demonstrate that restoration is only partial in the majority of patients compared to uninfected controls, even after several years of \u201cfully suppressive\u201d ART. In addition, these studies demonstrate increased levels of activation in the intestinal immune system of patients on ART, even though immune activation in the peripheral blood often returns to baseline levels. The combined results of this new study suggest that ongoing viral replication and CD4+ T cell destruction occur in the intestine of patients on ART, despite what appears to be complete suppression of viral replication in the blood.In the current paper, 54 patients in the acute stage of HIV infection were examined and compared with 18 uninfected volunteers. Of the acutely infected patients, 14 were examined only prior to ART, 18 were examined prior to ART and then sequentially through one to three years of uninterrupted therapy, and 22 were examined cross-sectionally at time points ranging from less than one year to seven years after starting ART. Although partial restoration of mucosal CD4+ T cells, whereas macaque studies are usually performed using samples from the jejunum. The rectum/colon is a mix of immune inductive (organized lymphoid tissues) and effector sites (diffuse lamina propria) whereas the jejunum contains almost no immune inductive sites. This is reflected in the lymphoid composition of each tissue: the jejunum contains mostly memory CD4+ T cells, while the colon contains a larger proportion of na\u00efve CD4+ T cells. This makes it difficult to extrapolate comparisons of T cell subsets from these disparate sites. Third, the percentages of \u201cactivated\u201d T cell subsets remaining after treatment need to be interpreted with caution, as these are \u201csnapshot\u201d data observed during what is now believed to be a very dynamic process. For example, detection of increased percentages of \u201cactivated\u201d CD4+ T cells in a tissue that has undergone massive CD4+ T cell depletion could be interpreted either as an immune response to the infection or as a selective loss of \u201cresting\u201d CD4+ T cells. However, given that the study also found that higher activation levels were associated with poorer mucosal reconstitution, the more logical interpretation is that HIV infection results in continual activation, turnover, and destruction of intestinal CD4+ T cells. Finally, the low level of infected cells detected in the intestine of patients on ART should be interpreted with caution, as the conclusion was based on small biopsy samples taken from the largest immune organ in the body. Detecting even a small number of infected cells in these pinch biopsies could reflect a very large number of infected cells throughout the intestine.Given the enormous practical challenges involved in obtaining mucosal biopsies from acutely infected patients, the work presented here is certainly valuable. However, a few limitations are inherent in interpreting the results and especially in comparing these data to those from SIV-infected macaques. First, neither pre-infection CD4 levels nor the exact timing of the initial infection were known, as patients were deemed to be in acute stage of infection based on viremia in the face of negative serology. In contrast, studies of SIV-infected macaques were based on restoration to pre-inoculation CD4 levels. Furthermore, therapy in the macaques was initiated at six weeks of infection , which i+ T cells to baseline levels, regardless of the duration of therapy. Instead, HIV infection results in a continuous state of activation in the intestinal immune system that is not reflected in peripheral lymphoid tissues. Combined, the data provide evidence that intestinal inflammation and continual infection, destruction, and turnover of CD4+ T cells occur in patients on ART, suggesting that the major battle against HIV occurs in sequestered mucosal tissue sites. This important observation suggests a number of potential therapeutic strategies for further research; for example, the investigation of drugs with better intestinal tissue distribution and perhaps the exploration of mechanisms to reduce immune activation in mucosal tissues to more effectively combat HIV infection.In conclusion, the findings reported by Mehandru et al. indicate that most patients who initiate therapy as early as possible after HIV infection still do not experience complete restoration of intestinal CD4"}
+{"text": "CD4+ T cell help is critical in maintaining antiviral immune responses and such help has been shown to be sustained in acute resolving hepatitis C. In contrast, in evolving chronic hepatitis C CD4+ T cell helper responses appear to be absent or short-lived, using functional assays.Here we used a novel HLA-DR1 tetramer containing a highly targeted CD4+ T cell epitope from the hepatitis C virus non-structural protein 4 to track number and phenotype of hepatitis C virus specific CD4+ T cells in a cohort of seven HLA-DR1 positive patients with acute hepatitis C in comparison to patients with chronic or resolved hepatitis C. We observed peptide-specific T cells in all seven patients with acute hepatitis C regardless of outcome at frequencies up to 0.65% of CD4+ T cells. Among patients who transiently controlled virus replication we observed loss of function, and/or physical deletion of tetramer+ CD4+ T cells before viral recrudescence. In some patients with chronic hepatitis C very low numbers of tetramer+ cells were detectable in peripheral blood, compared to robust responses detected in spontaneous resolvers. Importantly we did not observe escape mutations in this key CD4+ T cell epitope in patients with evolving chronic hepatitis C.During acute hepatitis C a CD4+ T cell response against this epitope is readily induced in most, if not all, HLA-DR1+ patients. This antiviral T cell population becomes functionally impaired or is deleted early in the course of disease in those where viremia persists. We took advantage of an unusually immunodominant, HLA-DR1 restricted CD4+ T cell epitope which we had characterized in detail by specific CD4+ T cell clones from three different patients and which was complexed into an HLA-DR1 tetramer. This novel tetramer was used to explore the frequency, phenotype and function of hepatitis C virus (HCV)-specific CD4+ T cells in seven patients with acute hepatitis C during the most critical phase of viral elimination or persistence. We identified a novel pattern of dynamics of helper cell populations associated with viral persistence, which is likely to be critical in the evolution of HCV towards persistent infection.Seven HLA-DR1 positive patients with acute hepatitis C were included in this study. All patients were available for study within the first 3 months after onset of symptoms. Acute hepatitis C was diagnosed by documented seroconversion to anti-HCV antibodies or all of the following: acute onset of hepatitis in previously healthy individual, aminotransferases at least 10\u00d7 the upper limit of normal, exclusion of other infectious, metabolic, or toxic causes of hepatitis, recent exposure or source of infection identified. The clinical characteristics of the patients are summarized in Five HLA-DR1 positive patients with established chronic hepatitis C  and two long-term recovered patients  were studied for CD4+ T cell responses in peripheral blood . In six Four healthy and four HIV-infected HLA-DR1-positive individuals, as well as two healthy and five acutely HCV-infected HLA-DR1-negative individuals (n\u200a=\u200a15) served as controls.www.shcs.ch) that have all given informed consent for\u00a0use of clinical data, viral sequencing and genetic analyses. The HIV positive controls were recruited from an ethically approved study of St Mary's Hospital, London, UK (protocol 99/IA/161E).All patients gave informed consent to participate in the study and the protocol and the procedures of the study were conducted in conformity with the ethical guidelines of the Declaration of Helsinki. The patients with acute and chronic hepatitis C were recruited at the University Hospital Munich or at the University of Freiburg  comprising the non-structural protein 4 (NS4) or/and the non-structural protein 3 (NS3) region of the HCV polyprotein . Proteins were expressed as COOH-terminal fusion proteins with human superoxide dismutase in yeast (Saccharomyces cerevisiae). Protein was >90% pure.Eighty-three overlapping peptides (20mers) covering the region amino acid (aa) 1207\u20132014 were synthesized by Chiron Mimotopes  and 301 overlapping peptides (15mers) covering the entire HCV polyprotein were synthesized by EMC .4 cells/well) were incubated in 96-well U-bottom plates  for 5 days in the presence of HCV proteins  in 150 \u00b5l of tissue culture medium  containing 2 mM L-glutamine, 1 mM sodium pyruvate , 100 U of penicillin  per ml, 100 \u00b5g of streptomycin  per ml and 5% human AB serum . Cultures were labelled by incubation for 16 h with 2 \u00b5Ci of 3H-thymidine . Triplicate cultures were assayed routinely, and the results expressed as mean counts per minute. The stimulation index (SI) was calculated as the ratio of counts per minute obtained in the presence of antigen to that obtained without antigen. A SI of >3 was considered significant.Peripheral blood mononuclear cells (PBMC) were isolated on Ficoll-Hypaque gradients  and washed four times in phosphate buffered saline (PBS). PBMCs . After 48 h incubation, cells were washed off and the biotin-conjugated anti-IFN gamma antibody  was added. After an incubation period  unbound antibody was washed off and 100 \u00b5l of the streptavidin-alkaline phosphatase  was added for 1 h. Unbound conjugate was washed off and, finally, 100\u00b5l of 5-bromo-4-chloro-indolylphosphate/nitroblue tetrazolium substrate solution  was added for 2 h. The colour reaction was stopped by extensive washing. After drying the number of spots was scored by use of a dissection microscope.Nitrocellulose-bottom 96-well millititer HA plates  were coated with 100 \u00b5l of IFN-gamma monoclonal antibody , at a concentration of 15 \u00b5g/ml in PBS. Plates were incubated at 4\u00b0C overnight; before use unbound antibody was removed by excessive washing with PBS. The coated wells were filled with 100 \u00b5l tissue culture medium containing 2\u00d710a Protein-conjugated anti-CD14, Peridinin Chlorophyll-a Protein-conjugated anti-CD19, Viaprobe (Becton Dickinson), and FITC-conjugated anti-CD38 monoclonal antibody (Becton Dickinson) were added after at least 20 minutes of incubation. Cells were washed twice and then incubated with anti-PE microbeads for 20 minutes at 4\u00b0C. Cells were then washed once and 90% of cells were applied to MS columns  according to the manufacturer\u0300s instructions. The other 10% were reserved for FACS analysis. The PE positive cells were eluted from the column (post-enrichment sample) and analyzed by FACS. Cells were gated on the CD4+, CD14-, CD19- and Viaprobe-population.The DRB1*0101 tetramer complexed with HCV 1806-1818 (TLLFNILGGWVAA) was custom synthesized by Beckman Coulter Immunomics . PBMC were stained in 100 \u00b5l medium  with 3 \u00b5l of Phycoerythrin (PE)-conjugated MHC class II tetramer for 2 hours at room temperature. Allophycocyanin-conjugated anti-CD4, Peridinin Chlorophyll-Frequencies of tetramer-positive CD4+ T cells were determined as described previously 6 irradiated autologous PBMCs as feeder cells.Biopsies were obtained in patients with chronic hepatitis as clinically indicated. From material not needed for histological analysis, lymphocytes were isolated and expanded as explained previously Viral RNA was extracted from plasma samples using either the QIAamp Viral RNA Mini Kit (QIAGEN) or the COBAS AMPLICOR HCV Specimen Preparation Kit v2.0 (Roche) according to manufacturer's instructions. An initial RT-PCR using the primers 2412F2 (CACCTCCACCARAACATYGT) and 9192R (GGAGTGAGTTTGAGCTTGGT) in combination with the SuperScript III One-Step RT-PCR System with Platinum Taq DNA polymerase PCR Kit (Invitrogen) was performed. The first-round product was then used in nested 2nd round PCRs to amplify the relevant NS4 region with the following primer pairs, HCV-5040F/HCV-HCV-6121R (CACATAGATGCCCACTTCCT/GCCCCGGGAGGCRAASGC) and HCV-6076F/HCV-7636R (CTGTGCARTGGATGAACMG/TGATGAGGGCSCCKGTCCA) or alternatively the\u00a0genotype 1-specific primers 5517M13F/6531M13R (GAGCARTTCAAGCAGAAGGCSCTC/AGGGGCCCGTGGTGTABGCGTT) together with the Platinum Taq DNA Polymerase High Fidelity Kit (Invitrogen). PCR products were purified using the Exosap method (Amersham) and BigDyeTerminator (v3.1) sequencing reactions were set up with PCR or M13 primers. The samples were run on an ABI 3730 Genetic Analyser and electropherograms analysed using Seqscape v2.0 (ABI).DNA was obtained from whole blood using the QIAamp DNA Blood Mini Kit following the manufacturer's guidelines. HLA Class II typing was performed by PCR and/or direct DNA sequencing using previously described methods 6 CD4+ T cells For tetramer synthesis we selected the epitope HCV-1806-1818 which has previously been shown to be a highly targeted epitope in HLA-DR1 positive patients with acute or resolved hepatitis C 6 CD4+ T cells that were analysed, corresponding to a mean frequency of 0.00016\u00b10.00017% of CD4+ T cells (In the controls a mean of 0.73\u00b10.75 tetramer+ CD4+ T cells (range 0\u20132) were found among a mean of 0.5\u00d710 T cells .Representative dotblots of the HLA class II tetramer staining in patients AR1 and AC1 before and after enrichment are shown in A cohort of seven HLA-DR1 positive persons with acute hepatitis C was available for study . Five ofThe two other HLA-DR1 positive individuals with acute hepatitis C were available for study at a single time point one and four weeks after onset of disease, respectively. One was still viremic after 4 months and was treated successfully with antiviral therapy (AC4), and the other was lost to follow-up (AX).In four of the five longitudinally studied patients  proliferation assays with overlapping peptide libraries were performed to define the hierarchy of immunodominant epitopes . One pepTetramer+ CD4+ T cells were detected in all seven patients with acute hepatitis C, irrespective of clinical outcome, with frequencies ranging from 0.007% to 0.65% (mean 0.16%+/\u22120.2). Representative stainings from patients AR1 and AC1 showing both pre-enrichment and post-enrichment samples are displayed in In patient AR1, the highest frequency of tetramer+ CD4+ T cells  was measured at the earliest time point which was 2 weeks after spontaneous clearance of HCV-RNA from the serum. Tetramer+ CD4+ T cells subsequently declined to a level of about 0.1% and remained stable for more than 3.5 years of follow-up. Very strong peptide specific T cell proliferation and NS4-specific IFN-gamma secretion were present during the first 6 months after disease onset, and -despite some fluctuations-robust responses were maintained during long-term follow-up.In patient AR2, relatively high levels of tetramer+ CD4+ T cells (0.12%) and significant T cell proliferation were present during the phase of viral clearance. At week 12 the frequency of tetramer+ CD4+ T cells declined by one log and proliferation was lost. Despite the continuing absence of HCV-RNA from the serum at that time, the constantly elevated ALT levels suggested a high risk of viral relapse and interferon-alpha treatment was initiated. The frequency of tetramer+ CD4+ T cells recovered to the initial levels and finally remained around 0.05% during the follow-up after antiviral therapy. T cell proliferation was detected only intermittently during and after interferon-alpha treatment.All three patients with chronic evolution went through a phase of undetectable serum HCV-RNA in the first six months of disease. In all three, tetramer+ CD4+ T cells and significant antigen-specific proliferation were present during viral clearance and the first phase of viral control; antigen-specific proliferation, however, was completely lost in all three patients when viral relapse occurred. In patients AC2 and AC3 simultaneous IFN-\u03b3 Elispot assays revealed that IFN-\u03b3 secretion was absent even earlier. In patient AC3 this occurred three weeks before the loss of proliferation; in patient AC2 IFN-\u03b3 secretion could never be detected. Importantly, in AC2 and AC3 the loss of function occurred while the frequency of circulating tetramer+ CD4+ T cells was relatively stable at levels between 0.04% and 0.14%. While in patient AC2 the frequency of tetramer+ CD4+ T cells subsequently declined and eventually specific cells disappeared, successful interferon therapy in AC3 was associated with stable levels of tetramer+ CD4+ T cells although only a modest recovery of function was measurable. A different pattern was seen in patient AC1: here, the tetramer+ CD4+ T cells had already disappeared from the peripheral blood before viral recrudescence and only very low frequencies (0.003%) could be detected, intermittently, during the subsequent months. Importantly, in no case was the loss of HCV-specific CD4+ T cell function accompanied by a relevant decrease of recall antigen (tetanus toxoid) or mitogen (PHA) responses.Longitudinal phenotyping for CD38 was routinely performed with all tetramer stainings; in the first samples that could be studied, between 5.8 and 32% of tetramer positive cells expressed CD38. In contrast, at all time points beyond 6 months, CD38 expression was negative in both recovered and chronically infected patients. Representative experiments are shown in In HLA-DR1 positive patients with chronic hepatitis C a mean of 0.0032%+/\u2212 0.0025 of CD4+ T cells stained tetramer+ , which is more than 1.5 logs below the mean frequency of tetramer+ CD4+ T cells in patients in the early phase of acute hepatitis C, although still in some cases higher than the control stainings (DR1+HCV- and DR1-HCV+) which were all <0.001%  whereas in parallel, using similar antigen-independent stimulation techniques, in the same cohort of patients substantial class I tetramer+ CD8+ T cell populations were visualised http://www.bioafrica.net/GDElinux/GDEmicrobial.html).Another explanation for the clear loss of tetramer+ populations, and loss of responsiveness associated with chronic infection would potentially be immune escape within the target epitope. To address this question, we sequenced early and late viral samples from patients AC1 and AC2. In patient AC3 no HCV sequence could be obtained probably due to the low viral load before antiviral therapy was initiated. In both early and late samples the sequence within epitope 1805-1824 corresponded to the prototype sequence . To furtIn this study we used a novel MHC Class II peptide tetramer for the detection of HCV-specific CD4+ T cells in HLA DR1+ patients with different stages and courses of HCV infection. This is the first HCV specific HLA class II tetramer to be tested and validated using epitope specific CD4+ T cell clones and we could demonstrate that this tetramer possesses similar sensitivity and specificity to HIV or influenza specific HLA class II tetramers characterized in a similar manner The major novel aspect of this study was the analysis of tetramer+ populations at early time-points after HCV infection, and most importantly, longitudinal analysis of the fate of these virus-specific populations in patients with a different clinical outcome of acute hepatitis C. The data clearly show that regardless of the long term clinical outcome, CD4+ T cells specific for this immunodominant epitope are present in all patients with acute disease. Interestingly, the frequency of tetramer+ populations in our cohort with acute hepatitis C was among the highest ever reported with HLA class II tetramers in viral infection studied ex vivo The subsequent decline of tetramer+ CD4+ T cells mirrors the kinetics of HCV specific CD8+ T cells in acute hepatitis C that have been studied with HLA class I tetramers Possibly the most informative facet of acute hepatitis C is the phase of transient viral control and subsequent viral recrudescence in the majority of patients who eventually develop chronic hepatitis C. It has previously been described that viral relapse is associated with a loss of T cell proliferative responses to HCV antigens In conclusion, using a novel HLA-DR1 tetramer complexed with an immunodominant CD4+ T cell epitope, we could show that HCV specific CD4+ T cells are induced in each patient with acute hepatitis C irrespective of outcome. Whereas spontaneous viral clearance is associated with long term maintenance of tetramer+ CD4+ T cells, early loss of function followed by depletion of tetramer+ CD4+ T cells is observed in patients with evolving chronic hepatitis C. The impact of such T cell loss may be very significant, undermining both CD8+ T cell-mediated and B cell mediated immune responses in the long term which can be associated with accentuated escape from CD8+ T cells as has been observed in model and natural infection"}
+{"text": "Patients with HIV infection are at risk of co-infection with HBV, as the routes of transmission are shared and thus immunization with HBV vaccine could be protective in them. The aim of the present study was to assess the efficacy of recombinant vaccine in treatment-naive HIV positive patients and healthy controls, and to dissect out differences if any, in different limbs of immune response.Forty HIV positive patients and 20 HIV negative controls, negative for HBsAg, HBsAbs and HBcAbs were vaccinated with three doses of 40\u03bcg and 20\u03bcg of vaccine respectively. Patients were divided into high CD4 and low CD4 group based on CD4+ lymphocytes of 200 and < 200/mm3 respectively. Group II consisted of healthy controls. Detection of phenotypic markers was done by flowcytometry. Cytokine estimation was done by sandwich ELISA. HBsAbs were estimated in serum by ELISA.4+, CD8+ and CD3+ cells increased significantly in all the groups. There was no increase in NK cell activity in patients with high CD4+ lymphocytes and only a marginal increase in patients with low CD4+ lymphocytes (170 to 293/mm3) whereas a marked increase was observed in controls (252 to 490/mm3). After vaccination, although an increase in memory cells was observed in HIV positive patients, yet HBsAb levels were significantly lower than controls (P < 0.05) indicating a functional defect of memory cells in HIV/AIDS patients. Basal IFN-\u03b3 levels were also significantly lower in HIV/AIDS patients (P < 0.01). Although the levels increased after vaccination, the peak level remained lower than in controls. HBsAb titers were much lower in HIV positive patients compared to controls. . IL-4 and IL-10 were low in patients.After vaccination, CD4+ counts and lack of T help, accounted for low HBsAb levels. Vaccination in patients with CD4+ lymphocytes < 50/mm3 was ineffective. Thus early immunization is advocated in all HIV positive patients at a stage when they are still capable of mounting an adequate immune responseDespite a double dose in patients, IL-4 and IL-10, which regulate antibody response, were also lower in patients, and this together with low CD By the end of year 2004 nearly 5.1 million people were living with HIV/AIDS in India .Acute hepatitis caused by HBV is milder in HIV infected patients but chronic disease is more frequent with a poorer prognosis and increased infectivity . PatientAlthough substantial literature is available regarding antibody response to different HBV vaccines in Caucasians, yet precise events pertaining to cellular immune responses, which are crucial for an optimal immune response are either sparse or their correlation with antibody response is imperfect. Further, since immune responses are linked to environmental, genetic and nutritional factors, these are likely to vary in different geographical areas in different clades and different population groups. Thus, data obtained from the western countries cannot be reliably extrapolated to Indian population. The present study was aimed to assess the efficacy of an indigenous HBV vaccine in HIV positive patients harboring mainly clade C  and to sDiagnosis of HIV was established as per National AIDS Control Organization (NACO) guidelines (WHO criteria adopted by NACO) . HIV inf4+ lymphocytes, group IA, high CD4 group with an absolute CD4+ lymphocyte count of \u2265 200/mm3 and group 1B, low CD4 group with an absolute CD4+ lymphocyte count of < 200/mm3. Group II consisted of 20 normal healthy control subjects.HIV infected patients and controls were screened for HBsAg and HBsAb by ELISA using Monalisa HBsAg and Monalisa antiHBs 3.0 kits . Subjects positive for HBsAg, HBsAb and HBcAb were excluded from the study. A total of 40 asymptomatic HIV positive patients and 20 control subjects were included in the vaccination and immune assessment study under 2 groups. HIV positive patients were subdivided into two groups on the basis of their CDAll the patients and controls received three doses of recombinant Senvac\u2122 HBV vaccine  in the deltoid region at 0, 1 and 6 months. All HIV positive patients were given 40 \u03bcg (double dose) of vaccine in each dose, while controls subjects received 20 \u03bcg  of vaccine.Phenotypic characterization of immune cells was done by flowcytometry on EDTA blood using FACSCAN flowcytometer with cell quest software . CD4+ and CD8+ lymphocytes (helper/cytotoxic) were studied using Simultest CD4/CD8 monoclonal antibodies conjugated with fluorescein isothiocyanate (FITC)/phycoerythrin (PE) respectively. CD3+ T cells (pan-T cell) and CD16+56 NK  cells were studied using Simultest CD3 -FITC, CD16+56 -PE monoclonal antibodies. Na\u00efve T lymphocytes were studied using CD45RA-FITC monoclonal antibodies and memory cells were enumerated using CD45RO -PE monoclonal antibodies. The samples for flowcytometry were processed according to the method of Jackson and Warner [Functional characterization of TH1 and TH2 type of T cells was performed on heparinised venous blood according to the method of Luty et al [5/200 \u03bcl. Cultures were stimulated with 10% phytohemagglutinin [PHA-P (DIFCO)] in RPMI-1640 medium (Sigma) and without PHA-P (unstimulated). Cultures were incubated for 20 hrs at 37\u00b0C in an atmosphere of 5% CO2. The samples were centrifuged at 2000 rpm for 5 minutes and the supernatant stored at -70\u00b0C until required for cytokine assay. Cytokines  were estimated in the culture supernatants by sandwich ELISA using reagents from Pharmingen, (USA) as per manufacturer's instructions. Briefly, culture supernatants were distributed in ELISA plates coated with corresponding anti-cytokine antibodies. Corresponding detector antibodies were used to detect cytokine anti-cytokine complexes. The reaction was developed with TMB in 0.1 M sodium acetate solutions and H2O2, OD was recorded at 450 nm. The concentration of the cytokines in culture supernatants were calculated from the standard curve for each cytokine plotted on a log-log paper. Functional characterization of B cells was done by estimation of sequential levels of HBsAb by ELISA.ty et al  with min1 and TH2 subsets of T helper cells and levels of HBsAbs were estimated at baseline (B), before and 11 days after second (C & D) and before and 11 days after the third (E & F) dose of vaccine. The timing was selected to pick up the peak titers  and 11 days after second (D) and the third (F) dose of vaccine. Functional characterization of TH4 count, 17 were males and 10 were females and the age ranged between 22 to 45 years with mean age of 30 \u00b1 6 years. Out of 13 patients with low CD4 counts, 6 were males and 7 were females and the age ranged between 18 \u2013 50 years with mean age of 32 \u00b1 8 years. Of the 20 normal controls, 12 were males and 8 were females and the age ranged between 18 \u2013 45 years with mean age of 29 \u00b1 7 years.Out of 27 patients with high CD4+lymphocyte counts were highest in controls followed by patients with high CD4 counts and those with low CD4 counts in that order  . In controls, the NK cells increased significantly after each dose of vaccination . After vaccination, patients with high CD4 counts showed a significant increase in CD45RA+ na\u00efve cells after each dose of vaccination whereas patients with low CD4 counts and normal control subjects showed increase in CD45RA+ na\u00efve cells after the third dose of vaccination  but 77% of patients had statistically significant levels of HBsAb at stage D i.e. 11 days after second dose . Subsequently 46% of patients had transient lowering of HBsAb levels at stage E (524 \u00b1 1478 mIU/ml p > 0.05). After third dose of vaccination at stage F, 100% of patients with high CD4 counts showed statistically significant levels of HBsAb [8034 \u00b1 14136 mIU/ml, p < 0.01, .In comparison, only 47% of patients who had a CD4 counts where 100% of patients responded, yet the mean peak titers (60000 mIU/ml) were much higher in controls than in patients with high CD4 counts   Table . HBV vac5) Table .Basal IL-10 levels were also significantly higher in normal control subjects as compared to HIV positive patients and even after vaccination, IL-10 levels remained significantly higher in control subjects as compared to HIV positive patients Table . HBV vacBasal IL-12 levels were almost similar in control subjects and HIV positive patients. After vaccination, all patients showed delayed but significant increase in IL-12 levels whereas in controls there was massive though transient increase in IL-12 levels Table .4 counts was insignificant. However after vaccination, levels increased significantly in patients after 6 months. In controls, no further increase of IFN-\u03b3 levels could be registered. Yet levels were significantly higher than in patients (Table Baseline IFN-\u03b3 levels were much higher in control subjects as compared to HIV positive patients (p < 0.01) but the difference in basal IFN-\u03b3 levels in patients with high and low CDts Table .It is known that HIV infection may modify the natural history of HBV infection and HIV positive patients have higher rate of HBV chronicity, higher HBV replication and low rates of sero-conversion to anti-HBe and anti-HBs ,11. Immu4+ lymphocyte number, percentage and decreased CD4: CD8 ratio occurs early during the course of HIV infection and are predictors of disease progression [4+ lymphocytes and changes if any, in the number of CD4+ lymphocytes after HBV vaccination. The basal CD4+ cell count in Indians were found to be lower than Caucasians (743\u00b1 214). Response to any vaccine is dependant on adequate function of CD4+ helper cells. In the present study also, response to HBV vaccination was directly correlated with CD4+ lymphocyte number. After the second dose of HBV vaccination, 92% of patients with high CD4 counts, showed a significant increase in the number of CD4+ lymphocytes (peak of 1135/mm3) compared to only 61% of patients with low CD4 counts (peak of 472/mm3). In control subjects, the increase was more impressive after the third dose and peak levels were much higher (1531/mm3). It is important to note that mean CD4+ lymphocytes increased significantly after vaccination at each stage irrespective of the disease status.Decreased absolute CDgression . We anal8+ lymphocytes are responsible for eliminating virus infected cells and act as a second line of defense by becoming activated and eliminating any infected cell, despite the presence of neutralizing antibodies [8+ lymphocytes after HBV immunization. In the present study, average number of total circulating CD8+ lymphocytes in control subjects was 756/mm3, which is higher than the figures (500/mm3) reported in Caucasians [8+ cells was much higher in HIV positive patients. After immunization CD8+ T lymphocytes increased further in all the groups. It has earlier been documented that HIV is associated with a functional defect of CD8+ cells. Wilson et al [8+ CD38+ HLA DR+ T cells. In murine studies it has been observed that repeated exposure to unrelated pathogens, as happens in HIV infected patients, may adversely affect viral specific CD8+ lymphocytes [CDtibodies . They catibodies . Howeverucasians . Mean vaon et al  had repophocytes .4:CD8 ratio in normal control subjects was approximately 1, which is also distinctly different from the values reported in the west where the ratio is close to two [et al [4+ cell number, a higher CD8+ cell count and CD4:CD8 ratio of 1 in healthy North Indians.At baseline, CDe to two . Our dato [et al  who also4+ and CD8+ cells, NK cells are key cells that deal with virally infected cells. Majority of peripheral blood lymphocytes that mediate NK cytotoxic activity in healthy adults express both CD16 and CD56 . Using these two NK cell markers, a decrease in NK cell number has been reported in HIV infected individuals [4 counts and normal control subjects. After HBV vaccination, NK cells in controls increased after each dose unlike in patients with high CD4 counts where no significant difference was observed. Patients with low CD4 counts showed a significant increase only after the last dose of vaccination (170 vs. 293/mm3 p < 0.05). The present study thus illustrates that NK cell response is also compromised in HIV/AIDS.Besides CDividuals ,19. In t4+ lymphocytes with the memory phenotype harbor more HIV provirus and hence are candidates for depletion by HIV cytopathic effects following activation and subsequent stimulation of viral replication [In HIV infection, CDlication . Althouglication , subsequlication ,23.In the present study na\u00efve cells were significantly lower in patients with severe disease while the number of memory cells was increased in HIV/AIDS patients. In spite of this, HBsAb levels were lower than controls thus confirming a functional defect.In our study, HIV infected vaccinated patients failed to elicit adequate IL-4 response. IL4 and IL-10 are the two key cytokines facilitating antibody response. Klein et al  also demIn the present study IFN-\u03b3 levels were much higher in controls compared to both the groups of HIV infected patients. Further, the response was delayed in patients and the IFN-\u03b3 levels could not match the levels observed in controls indicating a lack of T cell help. IL-12 levels are documented to be low in plasma of HIV infected subjects  but we c4+ lymphocytes and low TH2 type of cytokines i.e., IL-4, IL-10 which promote antibody function and functionally abnormal memory cells possibly accounted for low antibody titers in HIV infected patients.Our study illustrates that HBsAb titers were highest in controls followed by seropositives and minimum in patients with AIDS. Low CD4 counts of > 500/mm3 was 87% while the response rate dropped to 33% in patients with a CD4 count between 200\u2013500/mm3. In our study only 6/40 patients had CD4 counts of > 500/mm3, thus the response rate of 100% in our patients with a CD4 count between 200\u2013500/mm3 is encouraging. These patients also gained weight and depicted a rise of CD4+ lymphocytes. The response rate in controls receiving the conventional dose was 90%. Tedalli et al [4 count of < 200/mm3 should be treated with HAART first and HBV vaccine given preferentially after the cut off of 200/mm3 is achieved. This, however, is not possible in resource poor countries. In an excellent comprehensive study on care of patients with chronic HBV [Diaz et al  stressedonic HBV , the intonic HBV .4 count, in spite of the double dose of vaccine, only 47% were responders and with poor titers against HBV and patients with CD4 counts of < 50/mm3 did not respond at all. Thus early immunization is advocated in all HIV positive patients at a stage when they are still capable of mounting an adequate immune response.In our patients with low CDThe author(s) declare that they have no competing interests.3 and AS recruited the HIV positive patients for the study. SA was the co-guide in the project. RM and BS helped in the documentation and statistical evaluation of the data. SS1 formulated the project and designed the study.NP carried out the phenotype and cytokine assays and the main bench work. UD guided (main guide) and provided the funds. YC did the liver workup of patients and HBV ELISAs. SSThe pre-publication history for this paper can be accessed here:"}
+{"text": "However, some individuals remain at risk for opportunistic diseases despite prolonged normalization of CD4+ T cell counts. Deficient Epstein-Barr virus (EBV)-specific CD4+ T cell function may explain the occurrence of EBV-associated opportunistic malignancy\u2014such as primary central nervous system (PCNS) lymphoma\u2014despite recovery of absolute CD4+ T cell counts.In chronic HIV infection, antiretroviral therapy\u2013induced normalization of CD4+ T cell counts and EBV-specific CD4+ T cell-dependent interferon-\u03b3 production were assessed in six HIV-positive individuals prior to development of PCNS lymphoma (\u201ccases\u201d), and these values were compared with those in 16 HIV-infected matched participants with no sign of EBV-associated pathology (\u201cmatched controls\u201d) and 11 nonmatched HIV-negative blood donors. Half of the PCNS lymphoma patients fulfilled IR criteria (defined here as CD4+ T cell counts \u2265500/\u03bcl blood). EBV-specific CD4+ T cells were assessed 0.5\u20134.7 y prior to diagnosis of lymphoma. In 0/6 cases versus 13/16 matched controls an EBV-specific CD4+ T cell response was detected . PCNS lymphoma patients also differed with regards to this response significantly from HIV-negative blood donors , but there was no evidence for a difference between HIV-negative participants and the HIV-positive matched controls (p = 0.47).Absolute CD4+ T cell counts, HIV-positive patients who subsequently developed PCNS lymphoma lacked EBV-specific CD4+ T cell function. Larger, ideally prospective studies are needed to confirm these preliminary data, and clarify the impact of pathogen-specific versus surrogate marker-based assessment of IR on clinical outcome.Irrespective of absolute CD4 In a case-control study from the Swiss HIV cohort, Hess and colleagues report that T-helper responses against Epstein-Barr virus are specifically absent in patients developing CNS lymphoma. + T cells that recognize infection and enable other cells of the immune system to respond. Advanced HIV infection, marked by very low numbers of CD4+ cells, is associated with a variety of infections and tumors that are rarely seen in people with intact immune systems. People with advanced HIV who receive highly active antiretroviral treatment (HAART) tend to have increases in their CD4+ cell counts and lose their susceptibility to these so-called opportunistic infections and cancers. For several common opportunistic infections, it is considered safe to discontinue preventive antibiotics after a patient's total CD4+ cell count has returned to normal levels on HAART. Some treated individuals, however, will develop these conditions even after their CD4+ cell counts have returned to normal levels. The reason this happens is unclear.AIDS causes disease by inactivating the body's immune responses. Most severely affected are the white blood cells known as T lymphocytes, particularly the CD4+ cells, but to loss of the specific CD4+ cells that recognize the infection in question. If this theory is correct, then those individuals who develop an opportunistic condition after their total CD4+ cell counts return to normal might be missing the specific cells that respond to the microbe causing the condition. The researchers wanted to test this theory in HIV patients with a brain tumor called primary central nervous system lymphoma (PCNS lymphoma). The Epstein-Barr virus (EBV), which causes mononucleosis in the general population, has been shown to be a cause of PCNS lymphoma in people with AIDS.For several years, scientists have speculated that susceptibility to a given opportunistic infection might be due not simply to low total CD4+ cell counts prior to lymphoma diagnosis and three had normal CD4+ cell counts, but CD4 responses specifically against EBV were absent or very low in all six patients before they were diagnosed with PCNS lymphoma. The researchers also studied a comparison group of cohort participants with comparable CD4+ cell counts but no PCNS lymphoma, and found that 13/16 of those participants did have CD4 responses to EBV.The researchers studied patients who developed PCNS lymphoma while enrolled in the Swiss HIV Cohort, an ongoing study that has enrolled more than 14,000 people. A large cohort was needed to address this question because PCNS lymphoma is uncommon, and indeed only six patients with a confirmed diagnosis were identified. Because they had been followed as part of the cohort study, these patients had given blood samples that could be tested in retrospect. Three of these patients had low CD4+ cells, rather than a given level of total CD4+ cells, is needed to prevent PCNS lymphoma. Because only a small number of cases were identified, this must be considered a preliminary result. Given the rarity of PCNS lymphoma, however, especially in people receiving HAART, it seems unlikely that a larger cohort will be available in the near future to provide a more definitive conclusion. Based on this result, it may be useful to perform similar studies of other opportunistic infections. If a \u201cgap\u201d in the CD4+ cell response can be shown to increase the risk of a specific condition, it may become appropriate to test specific CD4 responses before deciding to discontinue preventive treatment as CD4+ cell counts increase on HAART.These results support the idea that the action of EBV-specific CD4http://dx.doi.org/10.1371/journal.pmed.0040096.Please access these Web sites via the online version of this summary at Perspective by Mark Jacobson, MDRead the accompanying Swiss Cohort Study Web site contains information on related research projectsThe HIV InSite includes resources on HIV immunology and opportunistic infectionsThe UCSF Center for HIV Information's  The use of antiretroviral therapy (ART) has dramatically changed the course of HIV infection. ART-induced immune reconstitution (IR) is reflected by the fact that the incidence of opportunistic infections as well as several AIDS-defining malignancies decreases with treatment [The cardinal feature of HIV infection is depletion of CD4patients ,2. Immunreatment \u20137. Specireatment ,9.+ T cell counts to levels \u2265500/\u03bcl blood is used by some to define complete IR [+ T cell immunity in patients developing PCNS lymphoma. Here, the existence of a large cohort of HIV-infected individuals allowed us to study, in a controlled setting, predisease virus-specific CD4+ T cell function in rare individuals who developed PCNS lymphoma.An increase of CD4plete IR . Among i+ T cell counts and HIV viral loads  was matched as available with two or three HIV-positive patients who had not developed PCNS lymphoma (\u201cmatched controls\u201d) for: (i) age \u00b1 5 y, (ii) sex, (iii) history of intravenous drug abuse, (iv) use of ART, (v) time of documented HIV positivity, (vi) duration of follow-up, and (vii) the closest available match of median and range of CD4al loads . In bothhttp://www.sigmaaldrich.com). When using B cell lysate as the source of antigen, CD8+ T cells were depleted using anti-CD8 magnetic beads  following the manufacturer's protocol. Depletion was controlled for by FACScan-based enumeration, and was \u226598% complete (unpublished data).Peripheral blood mononuclear cells (PBMCs) were prepared by centrifugation through a density gradient on Histopaque-1077  were precoated overnight with 2 \u03bcg/ml of anti-IFN-\u03b3 mAb 1-D1K , and washed six times with sterile PBS containing 1% FCS before use. After washing, 30 \u03bcl of R10 culture medium was added to each well to avoid drying of the membrane, and 100,000 viable cells per well added in 100 \u03bcl of R10. The EBV-specific CD4+ T cell response was assessed using as the source of antigen a set of peptides consisting of 33 HLA II-restricted optimal epitopes [+ T cell-depleted samples, EBV-infected B cell lysates  [+ T cell depletion) [Virus-specific interferon-\u03b3 (IFN-\u03b3) production was determined by ELISPOT analyses as described ,12. Brieepitopes ,12 and, sys.com) . For eacpletion) ,12, and 2 before being developed. After washing with PBS, 100 \u03bcl of biotinylated anti-IFN-\u03b3 mAb 7-B6\u20131  was added and plates incubated for 1 h at room temperature. Plates were washed again and incubated with a 1:2,000 dilution of streptavidin-coupled alkaline phosphatase  for 1 h at room temperature in the dark. After further washing, IFN-\u03b3 production was detected as spots after 10\u201320 min incubation with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate . The color reaction was stopped by washing plates, and plates were air-dried before counting with an AID ELISPOT Reader Unit . Results are expressed as spot-forming cells (SFC) per million input cells. Thresholds for positive responses were determined as the mean plus three standard deviations of negative control wells.Plates were incubated for 16 h at 37 \u00b0C with 5% COhttp://www.genbio.com).EBV-VCA, and EBNA1-specific IgG antibody levels were determined using commercially available ELISA kits designed to detect IgG antibody bound to antigen-coated microtiter plates, following the manufacturer's protocol .Viral DNA quantification was performed in serum or plasma samples using routine TaqMan real-time PCR technique  was examined with an exact Mantel-Haenszel test of conditional independence. As sensitivity analysis, the cut-off of 0 SFCs was replaced by 100. Also, the patient's outcome was modelled using exact conditional logistic regression with the logarithm of the patient's median (or mean) measurement of the EBV-specific CD4+ T cell response  as a covariate. Samples from HIV-negative volunteers were nonmatched, and comparisons were performed with Fisher's exact test. The Wilcoxon test was used to quantitatively compare median EBV-specific CD4+ T cell responses in HIV-negative controls with median CD4+ T cell responses in HIV-positive matched controls. All statistical tests were two-sided and performed at the 5% significance level. Statistical analyses were performed with SAS v9.1 software .If an individual patient's SFC measurements were 0 at more than 50% of available time points or, equivalently, if the patient's median over all available time points was 0, an EBV-specific CD4In a search of the Swiss HIV Cohort Study database, six HIV-positive individuals who developed PCNS lymphoma were identified (cases 1\u20136). Diagnosis was established via biopsy in cases 1, 2, 3, and 5, and via imaging, detection of EBV in cerebrospinal fluid, and exclusion of alternate diagnoses in cases 4 and 6. EBV-specific antibodies were detected in all PCNS lymphoma patients more than 2.5 years prior to diagnosis of lymphoma, and in all matched controls. The search criteria applied for selection of control patients are described in the Methods, and patient characteristics are summarized in + T cell-mediated IFN-\u03b3 production was assessed covering a range of 0.5\u20134.7 y prior to diagnosis of lymphoma. The n-number of time points at which functional assays were performed in each patient is listed in + T cell-response was detected  . Absolute CD4+ T cell counts in samples tested from each of the controls were \u2264 absolute CD4+ T cell counts of samples tested from cases, thus excluding the possibility that the observed disparities were driven by differences in CD4+ T cell counts rather than by pathogen-specific CD4+ T cell function. The maximum SFC measurement at each available time point for each case and matched control patient is listed in Three of the six PCNS lymphoma patients fulfilled IR criteria (cases 1\u20133) . EBV-spe+ T cell-mediated IFN-\u03b3 production in 11 randomly selected HIV-negative blood donors . The median EBV-specific CD4+ T cell-response in HIV-positive and HIV-negative controls was 403 (range 0\u2013905) and 130 (range 40\u2013840), respectively, and there was no evidence of a difference in these responses (p = 0.47).We also assessed the EBV-specific CD4d donors B, right.+ T cell activity from specifically decreased anti-EBV responses in the participants who developed PCNS lymphoma, we tested the CMV-specific CD4+ T cell-response in CMV-positive cases (n = 4), and compared it to CMV-positive controls (n = 4). Responses were similar, with medians of 540 SFC/106 PBMCs  and 280 SFC/106 PBMCs , respectively. In CMV-negative cases and controls no CMV-specific CD4+ T cell response was detected.Aiming at distinguishing generally depressed CD4To further test for the specificity of a possible immune deficit, CMV viral loads were assessed longitudinally in these same CMV-positive cases and controls. In each patient four to 11 samples were tested . CMV DNA was detected in only two of 29 versus one of 29 samples in CMV-positive patients versus control participants, respectively. Thus, based on circulating DNA-levels, CMV was well controlled in both cases and controls.+ T cell counts <50/\u03bcl). Intriguingly, since the introduction of ART, PCNS lymphoma has also been reported in individuals with CD4+ T cell counts over 200/\u03bcl or even over 500/\u03bcl [Although PCNS lymphoma can develop in HIV-negative individuals, it much more often occurs in severely immunosuppressed HIV-infected persons  undetectable CMV replication suggest that CMV-specific immunity was adequate in both cases and controls.Here we observed\u2014irrespectively of absolute CD4+ T cell function irrespective of absolute CD4+ T cell counts likely represents a more general phenomenon. Case reports and a small case-control study have reported clinically significant CMV and Pneumocystis jiroveci infection in individuals with elevated absolute CD4+ T cell counts, and pathogen-specific CD4+ T cell deficiency has been suggested to persist in these patients [+ T cells is consistent with a recent report showing that during acute simian immunodeficiency virus infection, up to 60% of all CD4+ T memory cells throughout the body are irreversibly lost [+ T cells with specificity for a particular pathogen. Such thorough depletion may then be largely unresponsive to long-term control of HIV replication by ART and subsequent replenishment of absolute CD4+ T cell numbers.The lack of EBV-specific CD4patients \u201320. The + T cell effector function and/or help for cytotoxic CD8+ T cells may provide an immunological basis for development of PCNS lymphoma in HIV-infected individuals [Absence of EBV-specific CD4ividuals \u201323. LargFigure S1Shown are progressors (cases) before diagnosis (left) and matched control participants (right). Each dot represents the maximum SFC result for a given participant at a given time point. Overlapping dots are distributed on the x-axis to remain separated.(32 KB PDF)Click here for additional data file.Table S1(33 KB DOC)Click here for additional data file.Table S2(64 KB DOC)Click here for additional data file."}
+{"text": "Why this decline is slow is not understood. One potential explanation is that the low average rate of homeostatic proliferation or immune activation dictates the pace of a \u201crunaway\u201d decline of memory CD4+ T cells, in which activation drives infection, higher viral loads, more recruitment of cells into an activated state, and further infection events. We explore this hypothesis using mathematical models.The asymptomatic phase of HIV infection is characterised by a slow decline of peripheral blood CD4+ memory T cell loss. Instead it predicts the rapid attainment of a stable set point, so other mechanisms must be invoked to explain the slow decline in CD4+ cells.Using simple mathematical models of the dynamics of T cell homeostasis and proliferation, we find that this mechanism fails to explain the time scale of CD4+ T cell activation and proliferation drive HIV production and vice versa cannot explain the pace of depletion during chronic HIV infection. We summarize some alternative mechanisms by which the CD4+ memory T cell homeostatic set point might slowly diminish. While none are mutually exclusive, the phenomenon of viral rebound, in which interruption of antiretroviral therapy causes a rapid return to pretreatment viral load and T cell counts, supports the model of virus adaptation as a major force driving depletion.A runaway cycle in which elevated CD4 Using a simple mathematical model, Andrew Yates and colleagues show that a runaway cycle of T cell activation and infection cannot explain the slow rate of CD4 decline during chronic HIV infection. + T cells that recognize infection and enable other cells of the immune system to respond against it. Following rapid loss in the first few weeks of HIV infection, the number of CD4+ cells in the blood falls slowly, often over a period of ten years or longer. The exact mechanisms by which CD4+ cell depletion occurs are not fully understood.The AIDS virus causes disease by inactivating the body's immune responses. Most severely affected are the white blood cells known as T lymphocytes, particularly the CD4+ cell loss. In this description, CD4+ cells (like water in a sink) are constantly being eliminated by HIV (the drain), while the body is constantly replacing them with new ones (the tap). Over time, the tap cannot keep up with the drain, and CD4 counts begin to drop, leaving the body susceptible to the infections that define AIDS.For over a decade, researchers have used a \u201ctap and drain\u201d analogy to describe CD4+ cells that are activated in response to invading microbes (such as HIV) are highly susceptible to infection with HIV, and following infection these cells may produce many new copies of HIV before dying. Therefore, one popular explanation for CD4+ cell loss is the \u201crunaway\u201d hypothesis, in which CD4+ cells infected by HIV produce more virus particles, which activate more CD4+ cells that in turn become infected, leading to an ongoing cycle of CD4+ cell activation, infection, HIV production, and cell destruction. The authors wanted to investigate whether this hypothesis can explain why CD4+ cell levels fall slowly.CD4+ cells are produced and eliminated), the authors show that, if the \u201crunaway\u201d hypothesis were correct, then CD4+ cells would fall to low levels over a few months, not over several years. They therefore conclude that the \u201crunaway\u201d hypothesis cannot explain the slow pace of CD4+ cell depletion in HIV infection.Using a mathematical model (a series of equations to describe the processes by which CD4+ cells. Because of its simplicity, the model used in this study is convincing in its rejection of the runaway hypothesis, but a more detailed analysis will be needed to tell us precisely what the slow process is. One possibility raised by the authors is that this process is the slow adaptation of the virus itself over the course of infection. Specifically identifying this process will provide a key insight into the nature of HIV disease and indicate potential new approaches to therapy.These results show that a slow process must be active in the HIV-induced depletion of CD4http://dx.doi.org/10.1371/journal.pmed.0040177.Please access these Web sites via the online version of this summary at Perspective on this article by Rob J. de BoerRead the related HIV InSite Knowledge Base includes information on HIV immunologyUniversity of California, San Francisco's National Institute of Allergy and Infectious Diseases provides AIDS fact sheets and brochures that cover a variety of topicsThe  In the acute phase, virus appears to preferentially and efficiently target HIV-specific [+ T cells that reside in mucosal tissue [+ cells in the gut [+ cells. Studies in HIV-infected humans mirror these observations [+ T cell compartments is slowly eroded over a time scale of several years. What causes this slow loss is not known.Untreated HIV infection in humans is characterised by extensive depletion of CD4specific ,2 and efl tissue . Studiesrvations \u20137. Follo+ T cell activation and proliferation markers are observed in blood [There is considerable loss of uninfected cells in the chronic phase \u201312, suggin blood \u201322, and in blood .+ T cell compartments.This increase in IA and immunopathology may be a direct result of the immune cell interactions with HIV. An alternative hypothesis is that it is a secondary effect\u2014the acute mucosal lymphopaenia causes the relocation of immunogenic gut antigens and systemic responses . In eith+ turnover and the slow decline in the blood remains unclear. The average rates of division and death (turnover) of all CD4+ subpopulations are increased, and these rates are fast compared to the overall rate of T cell depletion. These two key observations are often restated in terms of a \u201ctap and drain\u201d analogy [+ T cell numbers. Yet we still need to explain the mechanism underlying this imbalance, or the failure of T cell homeostasis.Nevertheless, the causal link between the increased CD4 analogy  in which+ T cells. Specifically, can this mechanism provide the slow time scale for decline of peripheral blood CD4+ memory T cells? In this paper we use a simple mathematical model of T cell dynamics to address this question. We begin by constructing a model of memory CD4+ T cell maintenance in health, and discuss how it changes in the presence of HIV.The increased susceptibility of activated or proliferating T cells to infection  suggests+ T cell pool comprises naive (antigen-inexperienced) cells and heterogeneous memory (antigen-experienced) populations. The mechanisms by which memory cells are maintained are not completely defined [+ T cells results in compensatory homeostatic proliferation [The CD4 defined , but sur defined . In uninferation . This obferation , or at tferation .+ T cell homeostasis that distinguishes between resting cells and cells that have received homeostatic division signals and so are transiently activated  compete for homeostatic division signals and receive them at an average rate a. The mean interdivision time of memory CD4+ T cells in healthy humans (1/a) has been estimated using deuterated glucose labelling and is approximately 15 d for effector memory CD4+ T cells, 48 d for central memory cells [a increases) under lymphopaenic conditions, as observed experimentally in mice (unpublished data). We assume that the death rate of resting memory CD4+ T cells (\u03b4) is low [a(x) and \u03b4(x). For the simulations we show below, we used the linear forms a(x) = a(1 \u2212 x/\u03ba) and \u03b4(x) = \u03b40 (x/\u03ba), where \u03ba is a constant that scales the size of the memory T cell population. With our choice of parameters, in a \u201cfull\u201d memory CD4+ compartment the mean time between divisions is 60 d, decreasing to 30 d under lymphopaenic conditions, and the average lifetime of resting cells is 400 d.We assume that resting memory CD4ry cells , or 26 dry cells . Earlierry cells . We repr) is low ,37 and dy) and then return to the resting state at rate r, dividing once as they do so. The inverse of r is the average time for transit through the cell cycle from a resting state, which we choose to be 24 h, or r = 1 d\u22121 [+ memory cells are in an activated or dividing state y at any time in spleen and blood [\u03bc) given a and r.In our model, cells that have received a homeostatic division signal enter an actively dividing state  determines the time scale for homeostatic turnover or recovery from lymphopaenia. Even if we conservatively use the slowest estimates of memory turnover rates and we neglect the increase in homeostatic proliferation observed under lymphopaenia, our basic conclusion is unchanged. We describe it in the following section.Our key observation here is that the rate + homeostasis  are more susceptible to HIV infection than resting cells (x). We also assume that infection of the homeostatically dividing cells occurs at a rate proportional to both the average viral infectivity p, a parameter that represents the efficiency of infection, and the viral load, which we take to be proportional to the number of infected cells at any time (z). Infected cells have a short lifetime . For no+ T cell numbers (x + y + z) decline to a set-point which is inversely related to p  cells make the dominant contribution to increased T cell turnover during HIV infection, which decreases rapidly and substantially when viral replication and new infection is blocked by ART [This model does not include immune-activated cells, which may be recruited from naive or memory CD4d by ART . This re+ compartments, rapid proliferation, and death, either through activation-induced cell death or by cytopathic infection. Immune-activated cells may also return to a resting memory state. In other words, we argue that the chronic IA picture is essentially of a form similar to Chronic T cell activation comprises several processes\u2014recruitment from naive or resting memory CD4a*) per memory CD4+ T cell in untreated HIV infection is not known. The death rate \u03b31 has been estimated for acute LCMV infections [\u22121 for antigen-specific CD4+ T cells. This estimate may be reduced under conditions of chronic stimulation as in HIV infection. We choose the rate of return to resting memory \u03b32 to be 10% of the effector cell death rate. However, our results are insensitive to the choice of \u03b31 and \u03b32.The average rate of antigen or bystander activation  as might be expected intuitively (simulation results not shown). In a*, is smaller than the homeostatic activation rate a. In this case we see that the approach to a steady state is still too rapid to explain the progression of chronic HIV infection. The key point here is that in the presence of low average rates of IA, homeostatic activation provides a lower bound on the average time between T cell activation events and so determines the time scale of equilibration of the memory CD4+ T cell compartment. Thus other mechanisms must be invoked to explain the slow failure of homeostasis in HIV infection.When Resting cells may be infected\u2014potentially with lower susceptibility\u2014and generate virus upon activation. Including latent infection and assuming that these cells behave as normal resting memory cells, our conclusions are unchanged. Latently infected cells may be required to account for viral \u201crebound\u201d after cessation of ART see .+ compartments from the naive population. Naive CD4+ T cells show very little homeostatic turnover under normal conditions and are likely to be replenished largely by thymic output, which may be significantly impaired in HIV infection [The results we describe above are robust to adding small influx terms into either resting or activated memory CD4nfection . Furthernfection . The rolnfection . Howeverp allows comparisons to be drawn with other measurements of virus infectivity in the literature. In our model the key quantity is the rate of infection per activated CD4+ T cell, or pz, where z is the number or density of productively infected cells. In models used extensively elsewhere in the HIV literature  to be in the range 0\u20130.2 d\u22121 for 100 < p < 1,000 and for all levels of IA. Steady state numbers of cells at around 50% of healthy numbers correspond to values of pz of approximately 0.1 d\u22121, in reasonable agreement with these studies.The predicted dependence of steady state pool size with example, ), the cor et al.  estimatePerelson  estimatep), average death rates will remain higher than healthy levels during the return to a higher homeostatic set point. This prediction of elevated cell death even during the recovery of cell numbers arises because in our model proliferating cells are more susceptible to death than are resting cells, as has been noted previously in other HIV modelling studies [Qualitatively, we note that our model predicts that even after inhibition of viral replication with ART  the probability of productive infection upon encounter between a virion and a susceptible T cell, and (ii) the dependence of plasma virion density on infected cell numbers. The first may change over the course of an infection through a switch in coreceptor usage [+ T cells ex vivo over time. We note that this measure of fitness is not necessarily related to virus diversity. Clinical evidence is conflicting in this regard, and the association between diversity and progression is unclear [+ T cells.Increasing the efficiency of infection, ur model  and 6, sor usage ,53 or pe unclear \u201356. A fuv in the model above) over time [Impaired T cell help and/or CTL exhaustion may decrease the rate of recognition and killing of infected cells by CTLs , which is likely to be an increasing function of the viral load and/or p. If reservoirs of latently infected cells persist during treatment, retaining a representative memory of the pretreatment virus population, the virus adaptation model predicts that allowing viral replication to restart will drive the memory CD4+ numbers quickly\u2014on a time scale of weeks\u2014to the pretreatment set point determined by p0, a*, and the remaining (constant) homeostatic parameters. Other models predict the rapid return to the previous set point only if the homeostatic parameters remain constant during treatment\u2014that is, if there is not significant recovery of CTL function or repair of lymphoid architecture or T cell regenerative capacity while virus replication is suppressed.All of these models seek to explain the imbalance between the average rates of division and death across the CD4t levels . Assume Clearly the virus adaptation model is not the whole story. Assuming treatment effectively abrogates the production of virus, this model predicts the full reconstitution of the T cell memory compartment during sustained treatment, which is not usually observed. This discrepancy between the virus adaptation model and the observations implies an additional role for lasting impairment to homeostatic mechanisms in HIV infection, perhaps from attrition of homeostatic resources or through differentiation (senescence or exhaustion).+ T cell pool to reject the idea of slow runaway decline in HIV infection, in which homeostatic compensation and/or IA drives infection, higher viral loads, more recruitment of cells into an activated state, and further infection events\u2014and intuitively should lead to erosion of the memory CD4+ compartment. We argue that this mechanism fails to explain the slow decline of this cell population in the chronic phase of HIV infection. The model indicates that the memory CD4+ T cell pool will reach a dynamic equilibrium or set point within weeks or months of the end of the acute infection, a time scale that is dictated by the average time between homeostatic proliferation events. However, the \u201crunaway\u201d model may well be an appropriate description of depletion in the early stages of infection, and particularly among responding HIV-specific cells. Our study highlights how understanding memory CD4+ T cell dynamics in chronic HIV infection requires a quantitative description of T cell homeostasis in health, as well as knowledge of how HIV affects the turnover and differentiation of T cell subsets.In this paper we have used a model of self-renewing memory CD4The ordinary differential equation models used in this study were simulated and analysed using Mathematica .Text S1+ T cell population, in the form of slow differentiation into an exhausted or less responsive phenotype induced by chronic exposure to HIV antigens or inflammatory signals, can induce a slow decline in total cell numbers.We illustrate with an extension to the model how adding heterogeneity to the memory CD4(303 KB PDF)Click here for additional data file."}
+{"text": "Reconstitution in the peripheral blood during therapy with highly active antiretroviral therapy (HAART) is well established. However, the extent of immune reconstitution in the GI tract is unknown.During acute and early HIV-1 infection (AEI), up to 60% of CD4+ HLA-DR+, returned to levels seen in the uninfected control participants in the peripheral blood, but were elevated in the GI tract of patients with persistent CD4+ T cell depletion despite therapy. Rare HIV-1 RNA\u2013expressing cells were detected by in situ hybridization.Fifty-four AEI patients and 18 uninfected control participants underwent colonic biopsy. Forty of the 54 AEI patients were followed after initiation of antiretroviral therapy . Lymphocyte subsets, markers of immune activation and memory in the peripheral blood and GI tract were determined by flow cytometry and immunohistochemistry. In situ hybridization was performed in order to identify persistent HIV-1 RNA expression. Of the patients studied, 70% maintained, on average, a 50%\u201360% depletion of lamina propria lymphocytes despite 1\u20137 y of HAART. Lymphocytes expressing CCR5 and both CCR5 and CXCR4 were persistently and preferentially depleted. Levels of immune activation in the memory cell population, CD45ROApparently suppressive treatment with HAART during acute and early infection does not lead to complete immune reconstitution in the GI mucosa in the majority of patients studied, despite immune reconstitution in the peripheral blood. Though the mechanism remains obscure, the data suggest that there is either viral or immune-mediated accelerated T cell destruction or, possibly, alterations in T cell homing to the GI tract. Although clinically silent over the short term, the long-term consequences of the persistence of this lesion may emerge as the HIV-1\u2013infected population survives longer owing to the benefits of HAART. Despite early initiation of anti-HIV therapy, loss of T cells in the gastrointestinal mucosa persisted for years in most members of a clinical cohort identified early after HIV-1 infection. AIDS causes disease by inactivating the body's immune response against infection. The AIDS virus (HIV) is most active against the white blood cells called T lymphocytes, particularly the CD4 T lymphocytes, which recognize infection and activate other cells of the immune system to fight it. In what was formerly believed to be a gradual process, HIV infection is now known to deplete a subset of the body's CD4 lymphocytes, called memory cells, quite rapidly\u2014over only a few days\u2014within a few weeks after a person becomes infected with the AIDS virus. This was not known until recently because researchers were counting CD4 cells only in blood, while a majority of the memory lymphocytes are located in and around the digestive system. It is these intestinal memory lymphocytes that are rapidly wiped out, while those in the blood fall much more gradually, usually over several years. Few studies of mucosal lymphocytes have been done in humans because such studies require biopsies of the intestinal lining (mucosa).Although CD4 cells in the blood can return and remain at normal levels when HIV infection is treated with antiviral drugs, it has been unclear as to whether the mucosal CD4 cells return as well. People who begin treatment as soon as possible after becoming infected with HIV might seem to have the best chance of regaining their mucosal immunity, compared to those who wait until the CD4 cells in their blood have fallen, which is a generally accepted reason to start medication for HIV. Therefore, the researchers wanted to see whether people who start treatment early after becoming infected with HIV might experience restoration of their mucosal immunity over time and, if so, what kinds of lymphocytes would return.The researchers studied people who started treatment for HIV within a few weeks to months of becoming infected and who then remained on treatment. Some volunteers underwent biopsies of the intestinal mucosa before starting treatment and then at various points from 1 y until as long as 3 y after infection. Others volunteered for biopsy only one time, anywhere from less than 1 y to 7 y following treatment. The biopsy specimens were examined under the microscope and with a technique called flow cytometry using specific staining methods to assess their structure and functional characteristics. Results were compared to biopsies from a group of HIV-uninfected volunteers.The researchers found that the percentage of CD4 lymphocytes dropped much lower in the intestinal mucosa than in blood during early infection and then, unlike in blood, remained low even after several years of treatment for HIV. In the microscope images, they found that mucosal CD4 cells were lost mostly from regions of active battle against invading germs, rather than from \u201ctraining sites\u201d for new CD4 cells. Over time, only 30% of the volunteers showed return of CD4 cells to normal levels in these active sites.Unlike T lymphocytes in the blood, which tend to return to a resting state after HIV is treated, the T lymphocytes in the intestinal mucosa tended to persist in an activated state despite HIV treatment, even though only a tiny fraction of these cells were found to be infected with HIV. A high level of activation of mucosal lymphocytes soon after infection was found to predict poor restoration of mucosal CD4 cells over time.These experiments confirm that studying easily obtained blood lymphocytes provides only a limited view of how HIV affects the immune system as a whole. The finding that immune cells of the intestinal mucosa remain depleted and over-activated for years despite antiretroviral treatment raises the concern that over time this will result in clinical problems. Fortunately, this does not appear to be the case in most people currently being treated for HIV, some for as long as 10 y, but the results of this study suggest that we should remain vigilant for gastrointestinal problems resulting from impaired immunity over time. The finding that mucosal lymphocytes do appear to return to normal levels in a minority of volunteers is of interest, and suggests that early interventions to reduce activation of intestinal T cells  might be worth investigating in those recently infected with HIV. Finally, these results suggest that a vaccine to prevent HIV may need to stimulate immune responses that can act very quickly following infection, before the bulk of lymphocytes capable of countering the infection are lost, perhaps irreversibly.http://dx.doi.org/10.1371/journal.pmed.0030484.Please access these Web sites via the online version of this summary at UCSF HIV InSite includes resources on HIV immunology and vaccine developmentAIDS fact sheets and brochures from the US National Institute of Allergy and Infectious DiseasesMedline Plus article on acute HIV infection from the US National Library of Medicine Over the past 25 y, more than 25 million individuals have succumbed to the complications of HIV-1 infection . Recent + T cells in the gastrointestinal (GI) lamina propria (LP) compared with levels measured in the peripheral blood ), the sections were incubated with anti-CD4 or CD8 antibodies overnight as described above. Immunodetection was performed either with the StreptABComplex/HRP  using 3-amino-9-ethylcarbazole (Sigma-Aldrich) as the substrate or with APAAP (DakoCytomaton) and Fast Blue as chromogen. The sections were then heat-treated again for 5 min with 0.01 M buffered sodium citrate solution (pH 6.0). This was followed by an overnight incubation with MIB-1 . For the second antibody, either the APAAP (DakoCytomaton) or the StreptABComplex/HRP (DakoCytomaton) visualization system was applied.35S-labeled, single-stranded anti-sense RNA probe of HIV-1 , composed of fragments of 1.4\u20132.7 kb, which collectively represent approximately 90% of the HIV-1 genome [The in situ hybridization was performed on paraffin sections as described previously . A 35S-l1 genome , was use2 of tissue was calculated. To evaluate the number and distribution of T cell subsets, transmission light was used. Using a 40\u00d7 objective, a standard area was set by the image analyzer. The number of positive cells within this unit area was determined by manual counting. For the LP, a total of 10\u201315 consecutive nonoverlapping fields were analyzed for each staining. For the OLT, between two and five representative areas were chosen. The individual values obtained with each T cell marker were then pooled, and the mean numbers of positive cells per unit area of LP or OLT were determined separately.The autoradiographs were examined with a microscope equipped with epiluminescent illumination , a 3CD camera, and a PC-based image-analysis system  as described previously . Brieflyt-test. Statistical comparisons were made between HIV-1\u2013infected patients and control participants using a two-sample, unequal variance t-test. All reported p-values were two-sided at the 0.05 significance level using SPSS 11.0 for Windows software .Values are expressed as mean \u00b1 standard deviation. Statistical comparisons were made between PBMCs and MMCs from individuals using a paired n = 5), 2 y (n = 9), and 3 y (n = 4). An additional 22 patients were studied cross sectionally after initiation of HAART for up to 1 y (n = 7), 2 y (n = 7), and 3\u20137 y (n = 8)  . On presThe 18 HIV-1\u2013uninfected control participants were recruited from a population undergoing screening colonoscopy at the time of study recruitment. This group comprised ten men and eight women. None of the HIV-1\u2013infected patients or HIV-1\u2013uninfected control participants were found to have macroscopic evidence of GI mucosal disease, nor were any concomitant pathological processes found on histological examination. All enrolled patients and control participants signed an informed-consent form that was approved by the institutional review boards of the Rockefeller University, Bellevue Hospital Center, and Manhattan Veteran's Administration Hospital Center.+ T cells, we utilized flow cytometry to determine the percentage of CD4+ T cells in the GI tract and peripheral blood (n = 32) and uninfected control participants (n = 18). In the uninfected control participants, the mean PBMC CD4+ T cell percentage was 59.6% \u00b1 14.3% and the mean MMC CD4+ T cell percentage was 56.4% \u00b1 8.8%. In AEI patients, the mean PBMC CD4+ T cell percentage was 41.5% \u00b1 12.9% and the mean MMC CD4+ T cell percentage was 19.3% \u00b1 8.8%. In patients treated for up to 1 y (n = 7), the mean PBMC CD4+ T cell percentage was 46.9% \u00b1 10.1% and the mean MMC CD4+ T cell percentage was 27.8% \u00b1 14.5%. In patients treated for 1\u20133 y (n = 7), the mean PBMC CD4+ T cell percentage was 58.1% \u00b1 12.3% and the mean MMC CD4+ T cell percentage was 42.3% \u00b1 3.1%. In patients treated for 3\u20137 y (n = 8), the mean PBMC CD4+ T cell percentage was 59.9% \u00b1 12.0% and the mean MMC CD4+ T cell percentage was 42.5% \u00b1 13.6% , and remained low after treatment for up to 1 y (p < 0.001), 1\u20133 y (p = 0.003), and 3\u20137 y (p = 0.02).In order to study the effect of antiretroviral therapy on the reconstitution of CD4al blood A. Twenty \u00b1 13.6% B. Thus, + T cells remained significantly lower in the GI tract compared with the peripheral blood , 2 y , and 3 y  of suppressive antiviral therapy , 6.5 \u00b1 1.6 (p < 0.001), and 7.8 \u00b1 2.6 cells/unit area (p = 0.004)\u2014in the three treatment groups, respectively. On examination of individual patients, nine showed \u201cnormalization\u201d (defined as mean CD4+ T cells per unit area in the LP of 18 HIV-uninfected control participants\u201411.0 \u00b1 3.3 cells/unit area). The mean LP CD4+ T cell count in these nine patients was 9.5 \u00b1 1.4 cells (p = 0.13 compared with HIV-uninfected), the mean LP CD8+ T cell count was 8.4 \u00b1 2.7 cells (p = 0.3), and the mean CD4:CD8 ratio in the LP was 1.2 \u00b1 0.6 (p = 0.07).To corroborate flow cytometry\u2013derived data and to assess for the absolute numbers of mucosal CD4n the LP , we exam+ T cells was noted in the LP, with a mean CD4+ T cell count of 5.5 \u00b1 1.1 cells (p < 0.001). The mean CD8 T cell count in these 21 \u201cnon-reconstitutors\u201d was 8.0 \u00b1 1.7 cells (p = 0.3) and the mean CD4:CD8 ratio was 0.7 \u00b1 0.1 (p < 0.001). Thus, significant depletion of the GI CD4+ T cell count persisted in 21 out of 30 (70%) of patients despite uninterrupted, apparently suppressive, combination antiretroviral therapy. As a corollary, in nine out of 30 (30%) of patients, the absolute CD4+ T cell count per unit area reached HIV-uninfected levels with treatment.In the other 21 patients, persistent depletion of CD4+ T cells expressing chemokine receptors. Using four-color flow cytometry, we quantified the percentage of CD3+/CD4+ MMCs that expressed CCR5 or CXCR4, or co-expressed CCR5 and CXCR4 (n = 40). Comparisons were made between HIV-uninfected control participants, AEI, AEI treated for up to 1 y, AEI treated for 1\u20133 y, and AEI treated for 3\u20137 y. In the HIV-uninfected patients, 78.8% \u00b1 10.3% CD4+ T cells expressed CXCR4, 68.4% \u00b1 18.9% expressed CCR5, and 52.4% \u00b1 12.4% co-expressed CXCR4/CCR5. As reported previously [+ MMCs expressing CXCR4 , more so in CD4+CCR5+ T cells , and the most significantly in CD4+ MMCs dually expressing both CCR5 and CXCR4 chemokine receptors .Since a majority of the viruses during AEI are CCR5-tropic , and a snd CXCR4  in all peviously , depleti+CCR5+ and CD4+ dual-positive MMCs, when compared with HIV-uninfected patients. Specifically, CD4+CCR5+ MMCs in patients treated for up to 1 y , 1\u20133 y , and 3\u20137 y  remained depleted. Similarly, though more prominently, levels of CD4+CCR5+/CXCR4+ MMCs were lower in patients treated for up to 1 y , 1\u20133 y , and 3\u20137 y , respectively.Despite antiretroviral therapy, significant depletion persisted in the CD4+ T cell decline without therapy [+ and CD8+ T cells in the GI tract and peripheral blood. Using four-color flow cytometry, we assessed CD3+CD4+ and CD3+CD8+ lymphocytes for the expression of CD45RO, a marker of immunological memory, and HLA-DR, a marker of immunological activation.HIV-1 infection results in a significant increase in cellular activation, which has been shown to be of prognostic value in predicting the rate of CD4 therapy \u201324. We w+) phenotype [+ T cells were CD45RO+ in HIV-uninfected control participants. In patients with untreated AEI, the percentage of GI CD4+CD45RO+ T cells showed only a modest reduction to 86.3% \u00b1 12%, p = 0.17 despite a well-documented, profound depletion of the total number of GI CD4+ T cells. Thus, the relative percentage of memory cells in the GI tract remained stable despite an overall reduction in the total number of CD4+ T cells. To examine the levels of cellular activation, we examined memory (CD45RO+) lymphocytes for the expression of HLA-DR.It is well established that a majority of mucosal cells (>90%) have a memory  and CD8+CD45RO+HLA-DR+ MMCs  was noted. After 1 y of treatment, the percentage of CD8+CD45RO+HLA-DR+ PBMCs remained elevated  but approximated HIV-uninfected levels in the 1\u20133 y treated  and 3\u20137 y treated groups . In contrast, in the GI tract, the percentage of CD8+CD45RO+HLA-DR+ MMCs remained elevated despite HAART in all groups\u20141 y treated , 1\u20133 y treated , and 3\u20137 y treated   A.+ T cell subsets. CD3+CD4+ PBMCs co-expressing CD45RO/HLA-DR were 5.4% \u00b1 5.0% of the CD4 population in the HIV-uninfected control participants. During AEI, there was a significant increase in this population . Post-HAART, activated memory CD4+ PBMCs approximated HIV-uninfected levels in all groups . In the GI tract, however, activated memory CD4+ T cells persisted despite therapy. When compared with HIV-uninfected CD4+CD45RO+HLA-DR+ MMCs (11.3% \u00b1 5.0%), an increase in activated memory CD4+ T cells that developed during AEI  persisted despite potent antiretroviral therapy in the 1 y treated group  and 1\u20133 y treated group , but not in the 3\u20137 y treated group   B.+ T cells and CD8+ T cells by immunohistochemistry (+CD4+ T cells and 1.5% \u00b1 1.3% Ki67+CD8+ T cells), during untreated AEI, a significant increase was noted in the percentage of Ki67+CD4+ T cells  and CD8+ T cells . This increase persisted in the group treated for 1 y  and 1\u20133 y . In the 3\u20137 y treated group, the increase in the percentage of Ki67+ cells persisted , although it was not statistically significant.To study a more specific marker of cellular dynamics, we examined the expression of Ki67 on GI mucosal CD4hemistry C. Compar+ and CD8+ lymphocyte activation reverses with treatment in the peripheral blood, it remains elevated in the GI tract. In addition, there is a persistent increase in proliferating CD4+ and CD8+ T cells in the GI tract during antiretroviral therapy.Thus, while CD4+ T cells (and the CD4:CD8 ratio) in the GI LP persists in the majority of individuals despite therapy, we sought to identify virological and immunological factors at baseline and posttreatment that could account for inter-individual differences. Patients whose CD4+ T cell numbers reconstituted to HIV-uninfected levels  were compared with patients with persistent CD4+ T cell depletion in the LP .Having established that depletion of CD4+ T cell count, duration of infection prior to biopsy, timing of initiation of antiretroviral therapy, and duration of therapy (+ T cells were significantly higher at baseline (54.4% \u00b1 17.8%) and posttreatment (29.7% \u00b1 16.2%) in group B patients than in group A patient at baseline  and posttreatment , respectively (\u2212CD62L\u2212 phenotype [\u2212CD62L\u2212 CD4+ T cells (90.4% \u00b1 5.4%) and CCR7\u2212CD62L\u2212 CD8+ T cells (95.9% \u00b1 2.2%) in group A patients was significantly higher than in group B patients (80.1% \u00b1 12.3% and 91.4% \u00b1 2.5%), respectively  cells wectively . Thus, cGI biopsy sections were hybridized using a radiolabeled probe  to detec+ T cells do not reconstitute in the LP of the GI tract despite uninterrupted, apparently suppressive, antiretroviral therapy for up to 5\u20137 y. Based on immunohistochemistry, we estimate that approximately 50%\u201360% of LP CD4+ T cells remain depleted when compared with HIV-uninfected control participants. CD4+ T cells expressing the CCR5 receptor or dually expressing the CCR5/CXCR4 receptors are the cell populations most severely affected. Accompanying this persistent lesion are increased levels of activated CD4+ and CD8+ T cells within the GI tract. In contrast to the degree of CD4+ T cell depletion, only rare HIV-1 RNA\u2013expressing cells were detected by in-situ hybridization.The present study established that in a majority of patients, 70% of our cohort, CD4+ T cells residing in the LP are selectively depleted early in the course of acute HIV-1 infection [Recent studies of the role of the GI tract have demonstrated that the CD4nfection \u201312. Crosnfection . To defi+ T cell reconstitution within the GI tract. Our patients were closely followed, demonstrated excellent adherence to medication regimen, and maintained undetectable plasma viral loads for the study duration. Despite this, a majority of our patients show significant mucosal CD4+ T cell depletion. In this regard, our results are in contrast to two prior short-term follow-up studies in HIV-1\u2013infected humans [+ T cell reconstitution in the GI tract is equivalent to that in peripheral blood.This is, to our knowledge, the largest study describing the effects of antiretroviral therapy initiated during AEI on CD4d humans  and SIV-d humans  which in+ T cell percentage in the GI tract, 30% of the studied patients did show \u201cnormalization\u201d of absolute numbers of CD4+ T cells within the GI LP. This distinction needs to be taken into consideration so as not to over-interpret suggestions of \u201ca universal lack of mucosal reconstitution.\u201dIt is important to recognize that although flow cytometry permits the characterization of cellular phenotype for a large number of cells, the data obtained thus are based on relative cellular percentages, such that an increase in one cell population can affect the percentage of the other. To overcome this potential confounder and to examine absolute numbers of cells, immunohistochemistry was employed. It is noteworthy that, while none of the patients examined by flow cytometry showed \u201cnormalization\u201d of CD4+ T cell reconstitution, we sought to understand clinical, immunological, and virological differences between patients. While we did not observe significant clinical differences between the \u201creconstitutors\u201d and \u201cnon-reconstitutors\u201d in terms of baseline plasma viral loads, peripheral blood CD4+ T cell count, CD4:CD8 ratio, duration of antiretroviral therapy, or the timing of onset of antiretroviral therapy, we did observe immunological differences within the GI tract: the level of activated memory CD8+ T cells at baseline and posttreatment inversely correlated with CD4+ T cell reconstitution. In other words, the higher the level of CD8+ T cell activation, the less likely that reconstitution would be observed in the GI tract. These data echo the previously observed inverse correlation between levels of activated CD8+ T cells, as measured by CD38 expression, and total CD4+ T cell counts in the peripheral blood [+ T cell reconstitution. Perhaps an even larger study could confirm whether or not correlates of mucosal immune reconstitution exist among clinical parameters such as plasma viral load, duration of therapy, and timing of onset of therapy, among others.Based on the variation in CD4al blood \u201324. We h+ T cell depletion within the effector compartment may be due to reductions in the education of gut-homing lymphocytes, to altered cellular recruitment or homing, or to increased cell death due to either ongoing viral replication and/or immune activation in the effector compartment.Within the GI tract, there appears to be sub-compartmental variation: immune-inductive sites reconstitute better than immune-effector sites and instead resemble peripheral blood lymphocyte subsets in their reconstitution. It is currently believed that na\u00efve lymphocytes enter inductive sites through high endothelial venules expressing mucosal addressin cell adhesion molecule-1 (MAdCAM-1) interacting with cell surface receptors, particularly \u03b14\u03b27 integrin . Exposurl-selectin (CD62L) expression into cells with lymphoid tissue\u2013homing potential (CD62L+) and non-lymphoid tissue\u2013homing potential (CD62L\u2212) [+ T cells expressing \u03b14\u03b27 integrin during primary HIV-1 infection and partial recovery following 48 wk of antiretroviral therapy [+ T cell depletion. Indirect support for our hypothesis was provided by the observation that patients who reconstituted CD4+ T cells in the GI tract had a significantly greater percentage of GI effector memory cells (CD62L\u2212CCR7\u2212) compared with the \u201cnon-reconstitutors\u201d (Memory cells can be classified on the basis of (CD62L\u2212) . GI lymp(CD62L\u2212) . Krzysie therapy . Our datitutors\u201d . These d+ T cells expressing CCR5 and CCR5/CXCR4 (+ and CD8+ T cells, despite normalization in the peripheral blood (+ T cell depletion observed. Low sensitivity of in-situ hybridization, owing to the relatively small number of cells that can be examined, may possibly be one of the factors involved. Further studies using PCR-based techniques are underway to address this issue.It has been suggested that there may be ongoing viral replication during antiretroviral therapy ,36. PersR5/CXCR4 , the celal blood A and 4B,al blood . However+ T cell depletion in the GI tract are unknown at this point. It is clear that the largest reservoir of immune cells [+ T cell reconstitution during HAART. In the pre-HAART era, opportunistic mucosal infections were a common feature of disease progression. It is evident that, with treatment, patients do not demonstrate any short-term effects of having a 50% loss of CD4+ T cells in the GI LP. It is possible that sufficient redundancy in the immune system prevents adverse outcome in chronically HIV-1\u2013infected patients. However, it is important to recognize that, given the projected long-term survival of HIV-1\u2013infected patients, significant loss of mucosal CD4+ T cells could accelerate immune senescence with attendant consequences. In recent clinical studies, an increased incidence of polyps and colorectal malignancies has been observed in HIV-1\u2013infected individuals independent of antiretroviral therapy [+ T cell depletion become evident, modalities such as IL-15 may be considered as adjuncts to HAART in mucosal immune restoration.The consequences of persistent CD4ne cells  shows a  therapy ,39. Thes therapy . If longWhile previous studies have focused on the role of the GI tract during AEI, the present study establishes that there is a delay in the majority of patients in mucosal immune reconstitution despite years of apparently successful antiretroviral therapy. Taken together, these data highlight the susceptibility of mucosal sites to HIV-1 and underscore the critical need to develop better mucosal-protection strategies. Recent work in the SIV-macaque model has demonstrated that mucosal delivery of a vaccine may confer better protection against SIV challenge when compared with subcutaneous administration of the same vaccine . Other s+ T cell depletion in the GI tract, there were inherent limitations in a study of this nature. The patient population was selected and not random\u2014particularly those who are willing to undergo repeated biopsy. Furthermore, the group of control participants was limited in size and was not matched to the HIV-1\u2013infected study patients. Our study did not conclusively establish mechanisms of persistent CD4+ T cell depletion in the GI tract, and we were therefore unable to definitively identify factors associated with reconstitution\u2014an issue that we believe to be important. It is likely that a larger sample size is needed to address this issue. Finally, the consequences of the persistence of the identified lesion remain obscure. Ongoing research to better understand both the mechanisms of persistent depletion and its implications is in progress.Even though we believe this to be the largest study to date assessing the effect of antiretroviral therapy on the reconstitution of CD4In summary, we have shown that despite the early initiation of HAART, the marked depletion suffered by the GI mucosal immune system during acute infection does not completely reconstitute in the majority of patients. Though not clinically apparent in the short term, careful observation is warranted as the long-term consequences of this lesion may become evident as the HIV-1\u2013infected population ages."}
+{"text": "Fully functional HIV-1-specific CD8 and CD4 effector T-cell responses are vital to the containment of viral activity and disease progression. These responses are lacking in HIV-1-infected patients with progressive disease. We attempted to augment fully functional HIV-1-specific CD8 and CD4 effector T-cell responses in patients with advanced chronic HIV-1 infection.Chronically infected patients with low CD4 counts T-cell counts who commenced antiretroviral therapy (ART) were subsequently treated with combined interleukin-2 and therapeutic vaccination.Thirty six anti-retroviral naive patients were recruited and initiated on combination ART for 17 weeks before randomization to: A) ongoing ART alone; B) ART with IL-2 twice daily for 5 days every four weeks starting at week 17 for 3 cycles; C) ART with IL-2 as in group B and Remune HIV-1 vaccine administered once every 3 months, starting at week 17; and D) ART with Remune vaccine as in group C. Patients were studied for 65 weeks following commencement of ART, with an additional prior 6 week lead-in observation period. CD4 and CD8 T-cell counts, evaluations of HIV-1 RNA levels and proliferative responses to recall and HIV-1 antigens were complemented with assessment of IL-4-secretion alongside quantification of anti-HIV-1 CD8 T-cell responses and neutralizing antibody titres.Neither IL-2 nor Remune\u2122 vaccination induced sustained HIV-1-specific T-cell responses. However, we report an inverse relationship between HIV-1-specific proliferative responses and IL-4 production which continuously increased in patients receiving immunotherapy, but not patients receiving ART alone.Induction of HIV-1-specific cell-mediated responses is a major challenge in chronically HIV-1-infected patients even when combining immunisation with IL-2 therapy. An antigen-specific IL-4-associated suppressive response may play a role in attenuating HIV-specific responses. Immune recovery subsequent to antiretroviral therapy (ART) often appears to be partial and does not comprise the HIV-1-specific CD4 or CD8 T-cell proliferative and IL-2-producing responses that are associated with protection from disease progression . These pSub-cutaneous (S/C) interleukin (IL)-2, administered with ART, increases CD4 T-cell numbers -21 and rWe investigated the ability of Remune\u2122 and IL-2, combined and separately, to induce HIV-1-specific CD4 and CD8 T-cell responses in chronically HIV-1-infected patients on ART in an observational, open-label, randomized, pilot study. We also assessed antigen-specific IL-4 release as this cytokine plays a role in balance and/or suppression of cell-mediated responses ,27, We r6U) was administered S/C, twice daily, for 5 days at weeks 17, 21 and 25. 100 \u03bcg Remune\u2122 was administered I/M at weeks 17, 29, 41 and 53. Laboratory analysis was conducted at weeks- -6, -3 and 0 before ART, and weeks 1, 2, 4, 8, 16, 17, 21, 25, 29, 41, 53 and at study completion at week 65. The primary outcome was induction of positive changes in lymphocyte proliferative responses to HIV-1 antigens. In addition to the main study time points, a further sub-study of viral loads and lymphocyte subset numbers was conducted in a sub-set of patients (n = 15) receiving IL-2 in groups B and C on the 5th day of each IL-2 cycle, i.e. at weeks 18, 22 and 26. This sub-study was initiated after the main study had begun and included all patients receiving IL-2 in groups B and C from the date of its inception. Appropriate regulatory approval was granted by Riverside Ethics Committee and patients gave written informed consent.In this observational, phase I, pilot study conducted at Chelsea and Westminster Hospital, London, 36 antiretroviral-naive patients were initiated on ART at week 0, which was continued for the duration of the study. ART comprised 2 nucleoside analogues and one protease inhibitor or non-nucleoside reverse transcriptase inhibitor. At week 17 patients were randomized to receive immunotherapy with IL-2 and/or therapeutic immunisation with a gp120-depleted whole inactivated HIV-1 immunogen. Sufficient Remune\u2122 was donated for use in 20 patients by Immune Response Corporation (IRC), Carlsbad, CA, USA. Patients were randomized at week 17 only if their viral load was <50 copies ml/plasma and CD4 T-cell count was \u2265 300 cells/\u03bcl blood at week 16. Treatment groups for randomization were as follows: A) ART alone (n = 9); B) ART plus IL-2 (Proleukin\u2122) (n = 11); C) ART plus IL-2 and Remune\u2122 (n = 7); and D) ART plus Remune\u2122 (n = 9). IL-2  and 100 IU/ml penicillin, 100 \u03bcg/ml streptomycin and 2 mM L-glutamine supplemented with 10% human AB plasma .PBMC were separated from whole blood by density gradient centrifugation and cultured in RPMI-1640 with NaCOPlasma viral load was measured using the Bayer HIV-1 RNA 3.0 assay (bDNA) (lower limit 50 copies/ml) . Whole blood lymphocytes were counted with monoclonal antibodies to: CD3, CD4, CD8, and CD45  on an Epics XL-MCL flow cytometer (Beckman Coulter).Recombinant HIV-1 and recall antigens  were used as described previously , at a fiProliferation assays and supernatant collection for IL-4 assessment were conducted as previously described . StimulaIL-4 bioassays were carried out as previously described  using ILIn vivo delayed-type hypersensitivity (DTH) skin tests to Remune\u2122 antigen were performed to assess HIV-1-specific cell-mediated immune responses as described elsewhere [lsewhere  in all pHLA haplotypes of patients were assessed by PCR-SSP .5 PBMC from individual patients who had been tissue typed were cultured with or without 10 \u03bcg/ml of appropriate HLA-restricted peptides or PHA (positive control) in 96-well anti-IFN-\u03b3  coated PVDF-backed plates . After overnight incubation IFN-\u03b3 spot-forming cells (SFC) were detected according to the manufacturer's instructions (Mabtech).IFN-\u03b3 ELIspots were conducted as described previously . BrieflySF162 for 1 hr at 37\u00b0C and then plated onto NP2/CD4+/CCR5+ cells. Infection was detected after 48 hrs by p24-immunostaining, as detailed before [Immunoglobulin (Ig)G was purified from patient and HIV-1 negative plasma using the MAbTrap kit , and quantified by Protein Assay . Two-fold serial dilutions of purified IgG, from 1 mg/ml, were incubated with 100 focus forming units (FFU) of HIV-1d before . The perChanges in lymphocyte subsets and viral load between week 0 and 16, weeks 0 and 65 and weeks 16 and 65, were assessed using the Wilcoxon Signed Rank test. Proliferation and IL-4 data were assessed with repeated measures analysis of variance using MIXED procedure in SAS statistical software. For log-transformed antigen-specific proliferative stimulation indices, between and within subject weeks 0 to 17, weeks 17 to 65 and weeks 0 to 65, adjusted separate slopes were estimated for each study arm with 95% confidence interval. Differences in overall viral load from week 18\u201326, between groups B and C were assessed using the Pearson Chi-squared test.Fifty two anti-retroviral na\u00efve patients were screened for this study which was carried out at the Chelsea and Westminster Hospital, London over a six year period. Of the screened patients 16 dropped out prior to randomisation at week 17. All the remaining 36 patients who were randomised completed the study. The mean age of patients at study entry was 38.75 years. There was one female patient (2.78%) and 100% of patients were of white European ethnicity.Median viral loads and CD4 T-cell counts for each group are depicted in Figure By week 17 the median viral load in all groups was less than 50 copies. All patients, except 5 , maintained viral suppression at the main study time points from week 17 onwards while receiving ongoing ART. One patient in Group C (patient 11) elected to discontinue ART at week 47 causing subsequent rebound in viraemia. At week 17 the median CD4 T-cell count in each complete group was as follows: Group A, 456 cells/\u03bcl (range 261\u2013673) Figure ; Group Bp = 0.005) was observed  and whole Remune\u2122 antigen (p = 0.005) from week 0 to 65. . Patient 8 in this group demonstrated a very large response to Remune\u2122 (SI = 261) and np24 (SI = 144) at week 29 following breakthrough of resistant virus at week 25  (data not shown). No other substantial increases in responses occurred between week 17 and 65 for any group or at any time point between the groups.HIV-1-specific proliferative responses increased transiently for many patients. Regression analysis of these responses revealed no significant changes in group A Fig. . In grouved Fig. . In grouved Fig. . Of note65. Fig. . The onlInduration size of hypersensitivity reactions to Remune\u2122 did not become positive (>9 mm diameter) in any patient at any of the time points tested .persistent recall antigens: For group A ; for group B , CMV responses increased p = 0.002 and Candida responses increased (p = 0.0006); in group C ; in group D . Responses to transient antigens were less apparent. In group A PPD and tetanus responses showed significant positive regressions over the 65 weeks (p = 0.018 and p = 0.018 respectively); in group B only the PPD response regression curve was significant (p = 0.044); and in group C only the tetanus response was significant (p = 0.0003). There were no significant differences in recall responses between treatment groups.Baseline to week 16 T-cell responses have been described in detail previously [A Figure  responseB Figure  HSV respC Figure  CMV and D Figure  HSV and p = 0.023), and group C (p = 0.032) and in response to gp120 in group D (p = 0.037)  Fig. . HIV-1-sWe observed an apparent relationship between IL-4 production and loss/lack of proliferation in 17 of 28 patients tested, distributed evenly between groups, evident from week 0 to 16 and week 17 to 65. Patient 11 (group C) is shown as an example, where HIV-1-specific proliferative responses to p24, gp120, nef and Remune\u2122 are high at week 29 Fig.  with absWhere possible we investigated CD8 T-cell IFN-\u03b3 production in response to characterised HLA class I restricted peptides .Secondary to the main study protocol, further viral load and lymphocyte subset analysis was conducted at additional time points \u2013 week 18, week 22 and week 26 \u2013 for a sub-group of 15 patients receiving IL-2 in groups B (n = 9) and C (n = 6) on the last day of each IL-2 cycle. Small, transient elevations in HIV-1 RNA load were apparent on 12 occasions for 7 of 9 (78%) patients in group-B, and 2 of 6 patients (33%) in group-C. All these viral load elevations had spontaneously resolved by the next viral load test 3 weeks later at weeks 21, 25 and 29. The difference in occurrence of these viral load elevations remains evident when comparing the median viral loads for all the patients in groups B and C as shown in Fig. SF162 at weeks 0, 16 and 65. There was no effect of immunotherapy or ART on virus neutralization (data not shown).As Remune\u2122 displays the transmembrane (gp41) envelope antigen with strong neutralization epitopes -35, it mIn this pilot study of combined immunotherapy with the therapeutic HIV-1 vaccine Remune\u2122 and subcutaneous IL-2 in the context of ART, neither IL-2 nor Remune\u2122 immunisation confered any substantial benefits to the effect of ART with regard to HIV-1-specific CD4 or CD8 T-cell responses, or neutralising antibodies. For the majority of these chronically HIV-1-infected patients responses to HIV-1 antigens remained negligible and there was little difference between the four immunotherapy arms. Possible reasons for this could be: the low CD4 T-cell counts of these patients when ART was initiated resulting in protracted immunosuppression and/or clonal dysfunction; a need for longer duration of ART before immunotherapeutic intervention, thus allowing greater immune recovery; the permanent depletion of HIV-1-specific CD4 T-cells by direct HIV-1 infection; and/or the timing of IL-2 therapy with immunisation which may have important consequences for induction or suppression of induced responses.Previous Remune\u2122 studies which induced proliferative responses comprised patients with higher pre-ART mean CD4 T-cell counts of 617 cells/\u03bcl  and 700 The fate of missing HIV-1-specific CD4 T-cell responses is unclear. HIV-1 preferentially infects and deletes many HIV-1-specific CD4 T-cells , while spersistent antigens. These increases were largely evident between week 0 and 65 with no differences between groups, suggesting immunotherapy was ineffective in this respect. While some significant increases in proliferative responses to HIV-1 antigens were apparent from week 0 to 65 (group B and D), the same cannot be said regarding the immunotherapy period between weeks 17 and 65. Nor were there any significant differences in responses between groups. These results suggest that any improvements were singularly attributable to duration of ART.Despite the lack of induced HIV-1-specific T-cell responses in these patients we report significant increases in recall antigen proliferative responses, particularly for Of note is one patient in group B, vaccinated with tetanus 4 weeks before receiving IL-2. High tetanus-specific proliferation was enhanced and sustained by subsequent IL-2, as reported separately . In contWe observed low-levels of transient self-limiting viraemia resulting from IL-2 therapy as previously reported . Despitein vivo DTH responses these results imply that induction of renewed HIV-1-specific cell-mediated responses by therapeutic immunisation, even when supplemented with IL-2, is extremely problematic in patients who initiate ART with lower CD4 T-cell counts. Although a recently reported clinical trial of the vCP1433 canary pox-based therapeutic vaccine elicited p24-specific responses which were significantly associated with time off therapy in a subsequent treatment discontinuation protocol, these responses also remained transient, diminishing at study end [Combined Remune\u2122 and IL-2 with ART in advanced HIV-1 infection conferred no immunological benefits to ART. Taking together the absence of induced HIV-1-specific lymphocyte proliferative responses, CD8 T-cell IFN-\u03b3 responses and tudy end . This untudy end  to whichtudy end . In our In these chronically infected treated patients, we found that immunotherapy was associated with increasing HIV-1-specific IL-4 production, which appears to negatively impact proliferative responses. HIV-1-specific IL-4 production may result from a general dysfunction of HIV-1-specific CD4 T-cells with pathological implications for induction of HIV-1-specific responses. We suggest that these results underscore the importance of early initiation of ART. As Remune\u2122 may have positive effects in less advanced patients , we suggART , CMV , cpm (counts per minute), DNA (Deoxyribonucleic Acid), HIV-1 (Human Immunodeficiency Virus type-1), HLA (Human Leukocyte Antigen), HSV (Herpes Simplex Virus), IgG (Immunoglobulin G), IFN (Interferon), IL (Interleukin), I/M (Intramuscular), PBMC , PCR (Polymerase Chain Reaction), RNA (Ribonucleic Acid), S/C (subcutaneous), SI (Stimulation Index).The author(s) declare that they have no competing interests.All authors have read and approved the final version of this manuscript. GH, FG, NI and BG conceived the study and co-coordinated the design of the study. GH and BG participated in the application for government and ethical approval, and in co-ordination of the study; he conducted laboratory work and cellular immunological assays, conducted data analysis and Interpretation, and preparation and completion of the manuscript. NI had responsibility for overall management and coordination of the study, she conducted laboratory work and cellular immunological assays, coordinated data analysis and interpretation, and participated in preparation of the manuscript. FG and NI secured funding for the study. FG participated in data analysis and interpretation, and in preparation of the manuscript. RM provided Remune\u2122 vaccine and Remune\u2122 antigen and its native p24 antigen and participated in study design. MAA conducted virus neutralisation assays. BG participated in the design of the study, co-coordinated application for government and ethical approval, and coordinated patient management. AS undertook patient care and management and participated in study co-ordination, and data interpretation. MN participated in patient care and management and data interpretation."}
+{"text": "Long-term survival of HIV-1 infected individuals is usually achieved by continuous administration of combination antiretroviral therapy (ART). An exception to this scenario is represented by HIV-1 infected nonprogressors (NP) which maintain relatively high circulating CD4+ T cells without clinical symptoms for several years in the absence of ART. Several lines of evidence indicate an important role of the T-cell response in the modulation of HIV-1 infection during the acute and chronic phase of the disease.neg MIP-1beta+ CD8+ T cells were not detected in HIV-1 infected individuals under ART or withdrawing from ART and experiencing a rebounding viral replication. In addition, we detected Nef-specific CD45RA+ IFN-gammaneg MIP-1beta+ CD8+ T cells in only 1 out of 10 HIV-1 infected individuals with untreated progressive disease.We analyzed the functional and the differentiation phenotype of Nef- and Tat-specific CD8+ T cells in a cohort of HIV-1 infected NP in comparison to progressors, ART-treated seropositive individuals and individuals undergoing a single cycle of ART interruption. We observed that a distinctive feature of NP is the presence of Nef-specific CD45RA+ CD8+ T cells secreting MIP-1beta but not IFN-gamma. This population was present in 7 out of 11 NP. CD45RA+ IFN-gammaneg MIP-1beta+ CD8+ T cell population represents a new candidate marker of long-term natural control of HIV-1 disease progression and a relevant functional T-cell subset in the evaluation of the immune responses induced by candidate HIV-1 vaccines.The novel antigen-specific CD45RA+ IFN-gamma Increasing evidence in humans and in nonhuman primate models of HIV-1 infection indicates that CD8+ T cells play a direct role in controlling or limiting HIV-1 replication. CD8+ T-cell depletion during acute  SIV infeEMRA, and the precursor CD45RAneg memory CD8+ T cells, subdivided into central memory, TCM and effector memory, TEM. By applying this experimental setting, we identified a population of HIV-1-specific CD8+ T cells which is significantly associated with the NP cohort, completely absent in the cohort of ART-treated patients and not related to the levels of viral replication.In order to improve our understanding of the relationship between cellular immune response and nonprogressive HIV-1 infection, we analyzed the CD8+ T-cell response in the peripheral blood compartment of HIV-1 infected individuals with different histories of infection. Eleven NP were compared to 10 progressors (PR) with unrestricted control of viral replication. All NP and PR had not received ART before. In addition, we analyzed 23 ART-treated patients in whom HIV-1 replication is pharmacologically controlled and the role of the immune system is less relevant. Finally, we characterized the immune response of 6 ART-treated patients who interrupted the assumption of ART investigating the effect of rebounding virus replication on the HIV-1-specific CD8+ T cell responses. We focused on the role of specific CD8+ T cells with respect to the non-structural HIV-1 proteins Nef and Tat. Indeed, these two nonstructural proteins are known to strongly influence HIV-1 replication, pathogenicity and the host immune response ,18. SincNef- and Tat-specific CD8+ T-cell responses were analyzed by multicolor flow cytometry in a cohort of NP and compared to responses observed in PR and ART-treated patients Table . Followineg CD8+ T cells. The staining panel was originally designed as routine immune-assay to evaluate simultaneously CD4+ and CD8+ T cell responses, and for this reason includes the measurement of CD154 [neg CD8+ T cells expressing MIP-1\u03b2 or MIP-1\u03b2 and IFN-\u03b3  Nef-specific CD45RA+ CD8+ T cells was significantly higher in NP  than in PR  or ART-treated individuals , whereas the proportion of polyfunctional CD45RAneg CD8+ T cells was significantly higher in ART-treated subjects  than in PR . On the other hand, monofunctional Nef-specific CD45RAneg IFN-\u03b3+ IL-2neg MIP-1\u03b2neg CD8+ T cells were detected in significantly higher proportion in PR  than in NP  and ART-treated individuals . Surprisingly, the proportion of responding CD45RA+ IFN-\u03b3neg IL-2neg MIP-1\u03b2+ CD8+ T cells in NP was significantly higher than in PR and ART-treated patients with extremely low p values  and 1 out of 10 PR (10%), whereas they were completely undetectable in the 22 ART-treated patients analyzed . Interestingly, Nef-specific CD45RA+ IFN-\u03b3neg IL-2neg MIP-1\u03b2+ CD8+ T cells in NP, when detectable, represented a high proportion of the total response (range: 10.7 to 49.9%). The same population detected in one PR (PR05) represented only 6.8% of the total response. As shown in figures neg IL-2neg MIP-1\u03b2+ CD8+ T cells and the NP cohort was a distinctive feature of this MIP-1\u03b2+ cell population and was not shared with other MIP-1\u03b2+ T-cell populations. In fact, although a significant higher proportion of CD45RA+ IFN-\u03b3+ IL-2neg MIP-1\u03b2+ responding CD8+ T cells was observed in NP in comparison to ART-treated individuals . In addition, NP showed detectable plasma viremia, although at low levels . As a consequence, antigen exposure could have played a direct role in generating CD45RA+ IFN-\u03b3neg IL-2neg MIP-1\u03b2+ CD8+ T cells. However, the analysis of the relationship between plasma viremia and Nef-specific CD45RA+ IFN-\u03b3neg IL-2neg MIP-1\u03b2+ CD8+ T cells expressed as percentage of the total Nef-specific response or as percentage of the total CD8+ T cells revealed no significant correlation (data not shown). Furthermore, only one PR (10%) showed detectable levels of Nef-specific CD45RA+ IFN-\u03b3neg IL-2neg MIP-1\u03b2+ CD8+ T cells, supporting the idea that this novel CD8 T-cell population is not directly driven by antigen levels.We next explored the potential effect of differences in the level of viremia on the presence of CD45RA+ IFN-\u03b3in vivo HIV-1 replication in generating CD45RA+ IFN-\u03b3neg IL-2neg MIP-1\u03b2+ CD8+ T cells, we analyzed Nef- and Tat-specific CD8+ T-cell responses in a longitudinal set-up. Six ART-treated patients with highly suppressed viremia  underwent a single cycle of therapy interruption (TI). Viremia became detectable in all patients between day 5 and 21 after TI. ART was resumed between day 27 and 185 when viremia levels reached >100,000 HIV-1 RNA copies/ml. A significant expansion of the Nef-specific CD8+ T-cell responses was observed in all the subjects analyzed . This observation indicates that IL-2 expression represents neither an essential marker of nonprogressive HIV-1 infection nor a distinctive feature of CD45RA+ IFN-\u03b3neg MIP-1\u03b2+ CD8+ T cells in NP.Since in our cohorts of HIV-1 infected patients IL-2-producing cells were rarely detected, we reanalyzed the data shown in Figure neg MIP-1\u03b2+ CD8+ T cells derived from one HIV-1 infected individual that following treatment interruption showed a partial control of viral replication . In this patient, Nef-specific CD45RA+ IFN-\u03b3neg MIP-1\u03b2+ CD8+ T cells were previously characterized (unpublished data). As shown in Figure neg MIP-1\u03b2+ CD8+ T cells were CCR7neg. In the same experiment, we additionally measured TNF-\u03b1 expression and observed that Nef-specific CD45RA+ IFN-\u03b3neg MIP-1\u03b2+ CD8+ T cells did not express TNF-\u03b1 upon antigenic peptide stimulation  antigenic peptide stimulation. Thus, only experienced (memory or effector T-cells) can be detected by this assay, since the number of circulating naive T-cells carrying a T-cell receptor specific for a given peptide is too low to be detected by short term assays. Nevertheless, we characterized the expression of CCR7 in CD45RA+ IFN-\u03b3n Figure .neg MIP-1\u03b2+ CD8+ T cells did not express the chemokine receptor CCR7 and are therefore classified as effector CD8+ T-cells  CD8+ T cells potentially represent a valuable immune correlate of disease progression, since they were detected in response to Nef stimulation in 7 out of 11 NP, in only 1 out of 10 PR and were completely absent in 22 ART-treated patients. We further demonstrated on 6 ART-treated patients undergoing single cycle TI that the presence of MIRA CD8+ T cells is independent of viral load. These observations render this novel population particularly interesting as a potential surrogate clinical marker of immunological reconstitution or maintenance after immune-based interventions.A fundamental prerequisite for the development of immune-based therapies and an effective vaccine against HIV/AIDS is the identification of solid immune correlates of disease progression. In order to identify such correlates, we compared Nef and Tat specific CD8+ T-cell immune responses in three cohorts of HIV-1 infected individuals with different degree of HIV-1 control: NP, PR and ART-treated patients. With this setting, we identified a novel population of CD8+ T cells associated with nonprogressive HIV-1 infection. CD45RA+ IFN-\u03b3CM (CD45RAneg CCR7+), TEM (CD45RAneg CCR7neg) or TEMRA (CD45RA+ CCR7neg) [EMRA population. The absence of CCR7 expression by MIRA CD8+ T cells was demonstrated in one representative sample, further supporting the TEMRA phenotype. Several studies have suggested a possible role of the fully differentiated HIV-1-specific TEMRA CD8+ T cells in the effective control of HIV-1 replication: IFN-\u03b3 producing TEMRA CD8+ T cells have been associated with the control of virus replication in NP [EMRA CD8+ T cells were preferentially detected in acutely infected individuals who achieved control of viremia either spontaneously or after structured TI [EM cells) has been reported for HIV-1-specific CD8+ T cells in therapy-naive viremic patients [in vivo. Here we support and extend the link between HIV-1-specific TEMRA CD8+ T cells and slow disease progression by identification of a novel HIV-1-specific population of effector cells specific for nonprogressive HIV-infection.According to the expression of CD45RA and CCR7, antigen-experienced CD8+ T cells are classified as TCCR7neg) . Since Mon in NP  and in ion in NP . Furthertured TI . A pre-tpatients ,24. The neg CD8+ T cells in ART-treated individuals in comparison to PR  CD45RAneg CD8+ T cells in PR in comparison to NP and ART-treated individuals  showed also the highest total Nef-specific response with a large proportion of Nef-specific MIRA CD8+ T cells (36.5%). These observations suggest that MIRA CD8+ T cells are not the direct consequence of ongoing in vivo antigen exposure, but possibly may represent a correlate of HIV-1 disease progression. However, it can be suggested that the prolonged exposure to low levels of plasma viremia in NP is responsible for the appearance of MIRA CD8+ T cells, and that MIRA CD8+ T cells do not appear following the short term exposure to high level of viremia during TI. To address this hypothesis it would be helpful to analyze elite controllers, who are characterized by controlled HIV infection with undetectable viral load. In addition, more detailed longitudinal studies will be necessary to definitively demonstrate the role of MIRA CD8+ T cells in HIV-1 infection.In chronic viral infections, the main obstacle to the definition of a correlate of disease progression is the ability to discriminate between phenotypes responsible for the control of viral replication and phenotypes that are the consequence of a different infection history . MIRA CDnef and p24 genes in comparison to other HIV-1 genes [http://www.avip-eu.org. A genome-wide analysis of the HIV-1-specific response using our intracellular cytokine staining analysis will aid in understanding the role of MIRA CD8+ T cells specific to p24 and other HIV-1 antigens in the control of viral replication.Several reports showed an exceptional HLA class I associated sequence polymorphism in the -1 genes ,27, sugg-1 genes . Our stuOur study demonstrated that the sole measurement of the Nef-specific response might be sufficient to define MIRA CD8+ T cells as a correlate of nonprogression in HIV-1 disease. In addition, the presence of MIRA CD8+ T cells in 2 Tat-responding NP and the absence of the same population in the Tat-responding PR and ART-treated patients suggest that MIRA CD8+ T cells may represent a correlate of nonprogression independently of the targeted viral protein. Since, it has been described that the use of autologous peptides allows the detection of stronger and broader T-cell responses , we cannHIV-1 infection causes hyperactivation of the immune system leading to immune exhaustion and disease progression -32. SincSince the present study was observational, it was not our objective to clarify whether MIRA CD8+ T cells exert a direct protective function. However, it has been shown, that MIP-1\u03b2 dominates HIV-1-specific CD8+ T-cell responses ,34 and tin vivo viral replication. MIRA CD8+ T cells may be useful to ameliorate the timing of ART initiation in HIV-1 infected individuals and represent a potential correlate to determine the efficacy of immune-based interventions.In conclusion, our study presents a novel population of Nef-specific effector CD8+ T cells associated with nonprogressive HIV-1 infection. This population, named MIRA, expresses CD45RA and produces MIP-1\u03b2 but not IFN-\u03b3. This T cell subset was shown to be independent of Eleven NP, 10 PR and 23 ART-treated patients were included in the present study. Of the 11 NP subjects, 10 matched the definition of long-term nonprogressors (LTNP), i.e. naive to ART with a documented HIV-1 infection of >9 years (median: 19.5 years), CD4+ T-cell counts ranging between 421 and 1,042 (median: 522 cells/\u03bcl). In comparison to the other NP, study subject NP11 had lower levels of CD4+ T-cell counts (274 cells/\u03bcl). Nevertheless he was included in the NP cohort because of 19 years of documented history of HIV-1 infection, with stable CD4+ T-cell counts over a one year follow-up post-sampling (range: 256-310 cells/\u03bcl). The median plasma viral load in the 11 NP was 900 HIV-1 RNA copies/ml (range: <50-10756). PR had poor restriction of viral replication (HIV-1 RNA copies/ml >99000) and declining CD4+ T-cell counts . All the PR were ART naive. PR05 was the only rapid progressor in the PR cohort. Already five month after putative HIV-1 infection (the timepoint of blood sampling) CD4+ T-cell counts dropped in this patient to 208 counts/ml without recovery and persistently high level viremia. The 23 ART-treated patients were on treatment for 2 or more years. Twenty ART-treated subjects had undetectable viral load, whereas subjects ART12, ART11 and ART23 had 36600, 3362 and 13965 HIV-1 RNA copies/ml, respectively. The median CD4+ T-cell count in the 23 ART-treated subjects was 488 cells/\u03bcl (range: 229-969). Study subjects ART12, ART14, ART15 and ART16 were previously classified as NP but initiated ART more than 4 years before blood sampling for the present study and therefore are here included in the ART-treated cohort. Six of the ART-treated individuals  underwent a single cycle of therapy interruption (TI). From these patients PBMC were obtained before TI . Written informed consent was obtained for all study participants.CD3-AmCyan, CD4-PerCP, CD45RA-PE-Cy7, CD154-FITC, IFN\u03b3-Al700, IL2-APC and MIP-1\u03b2-PE were obtained from Becton Dickinson. CD8-PacB was obtained from DAKO. CCR7-FITC and TNF\u03b1-PacB were obtained from R&D and NatuTec, respectively.Nef- and Tat-specific cellular responses were identified by using two sets of overlapping peptides covering the HIV-1 encoded Tat (BH10 strain) and Nef (BRU strain) antigens. Nef peptides were divided into 2 pools: Nef N-term (amino acids 1 to 101) and Nef C-term (amino acids 97 to 206). All pools were used at the final concentration of 2 \u03bcg/ml of each peptide. The Tat- and Nef-specific sets of overlapping peptides have been designed using a strategy termed Variable Overlapping Peptide Scanning Design (VOPSD)  that hasBriefly, all peptides were biased at the C-terminus avoiding 7 amino-acid residues never found among optimal CTL epitopes and MHC class I binding motifs . Optimal epitopes were placed in the N- or C-terminus of the peptides. Finally, conserved and variable regions were segregated in different peptides. In order to fit all the above mentioned design features the derived peptides were conceived to be variable in length (10 to 19 amino-acids) and degree of overlap . Moreover, the degree of overlap and the overall peptide length were empirically tuned according to the frequency of known T-cell epitopes . Peptides were obtained through the Centre for AIDS Reagents, National Institute for Biological Standards and Control, Hertfordshire, UK.6 PBMC per well were incubated with 1.3 \u03bcg/ml of anti-CD28 mAb and with 1.3 \u03bcg/ml of anti-CD49d mAb (Becton Dickinson) together with defined peptide pools. For each individual donor, a sample without peptides was included to calculate the background staining. Following 60 min incubation, 10 \u03bcg/ml of Brefeldin A (Sigma) were added to the cell suspension and the incubation was carried out for additional 4 h. Stimulated cells were then resuspended in Stain Buffer  and incubated with the photoreactive fluorescent label ethidium monoazide  to assess their viability. After washing, cells were fixed and permeabilized using the BD Cytofix/Cytoperm\u2122 Kit (Becton Dickinson). Then fluorochrome-conjugated Abs were added to the cell suspension. Incubation was carried out on ice for 30 min and after washing, cells were acquired using an LSRII flow cytometer (Becton Dickinson) equipped with a high throughput system. Sample analysis was performed using FlowJo version 8 (Tree Star). Lymphocytes were gated on a forward scatter area versus side scatter area pseudo-color dot plot and dead cells were removed according to EMA staining. Events were gated on CD3+ events versus IFN-\u03b3, IL-2, MIP-1\u03b2 and CD154 to account for down-regulation. CD3+ events were then combined together using the Boolean operator \"OR\". The same procedure was used to subsequently gate CD8+ events. CD4+ events were excluded before creating a gate for each function or phenotype as shown in Figure Cryopreserved samples were used throughout the study. The 9-color intracellular cytokine staining used in the present study has been previously described . Brieflyneg CD8+ T-cell populations were combined using SPICE software. SPICE version 4.1.5  and Prism version 5.01 (GraphPad Software) were used for graphical representation of the data and statistical analysis. To compare paired groups, the Wilcoxon signed-rank test was performed. To account for multiple comparisons, a closed testing procedure was applied in testing differences of all groups by the Kruskal-Wallis test followed by pair-wise comparisons with the Wilcoxon rank sum test. The SAS Version 9.1 was used to get exact P values for the statistical analysis.Since background levels varied between subpopulations, i.e. MIP-1\u03b2 staining showed a higher background than IFN-\u03b3, and the combination of 3 or more functions had extremely low background, we calculated a threshold level for each subpopulation. Following background subtraction, the threshold level was calculated using the 90th percentile of the negative values. Then, all the resulting negative values were set to zero and all values >0 were considered as positive responses. The frequency of the total CD8+ T cell response was calculated by summing each unique CD8+ T-cell population expressing at least one functional marker. Percentages of total responses were calculated by dividing the frequency of each subpopulation by the frequency of the total CD8+ T cell response. In order to analyze the quality of the response without considering the CD154 marker, the CD154+ and CD154AC, PL, GP, VE and MM are named as inventors on a provisional patent application based on this work. The patent has been filled by the Helmholtz Zentrum M\u00fcnchen - German Research Center for Environmental Health and the San Raffaele Scientific Institute.GP, VE, MM and AC conceived the study. CJD, SK, SA and AC established the flow cytometry based assays. CJD, SK, SH, SA and DH performed experiments. SG, EV, GT, JRB, HJS, ES, TV, FDG, RD, MT, GP and AC participated to the collection of patient samples. CJD, SH, SK, SA, PB, PR, MM and AC analyzed data. PL and UP contributed to research and critical discussion. AC wrote the paper. All authors read and approved the final manuscript."}
+{"text": "The intestinal mucosa displays robust virus replication and pronounced CD4+ T-cell loss during acute human immunodeficiency virus type 1 (HIV-1) infection. The ability of HIV-specific CD8+ T-cells to modulate disease course has prompted intensive study, yet the significance of virus-specific CD8+ T-cells in mucosal sites remains unclear.We evaluated five distinct effector functions of HIVgag-specific CD8+ T-cells in rectal mucosa and blood, individually and in combination, in relationship to clinical status and antiretroviral therapy (ART). In subjects not on ART, the percentage of rectal Gag-specific CD8+ T-cells capable of 3, 4 or 5 simultaneous effector functions was significantly related to blood CD4 count and inversely related to plasma viral load (PVL) (p<0.05). Polyfunctional rectal CD8+ T-cells expressed higher levels of MIP-1\u03b2 and CD107a on a per cell basis than mono- or bifunctional cells. The production of TNF\u03b1, IFN-\u03b3, and CD107a by Gag-specific rectal CD8+ T-cells each correlated inversely (p<0.05) with PVL, and MIP-1\u03b2 expression revealed a similar trend. CD107a and IFN-\u03b3 production were positively related to blood CD4 count (p<0.05), with MIP-1\u03b2 showing a similar trend. IL-2 production by rectal CD8+ T-cells was highly variable and generally low, and showed no relationship to viral load or blood CD4 count.The polyfunctionality of rectal Gag-specific CD8+ T-cells appears to be related to blood CD4 count and inversely related to PVL. The extent to which these associations reflect causality remains to be determined; nevertheless, our data suggest a potentially important role for mucosal T-cells in limiting virus replication during chronic infection. A significant body of work has demonstrated the contribution of HIV-specific CD8+ T-cell responses to immunological control of HIV infection Leishmania major is accompanied by T-helper type 1 cells that are able to produce multiple cytokines Given the ambiguous relationship between HIV-specific T-cell response magnitude and clinical parameters, investigators have sought new combinations of immunological markers whose expression might more reproducibly correlate with clinical status. The advent of multiparameter flow cytometry, allowing the simultaneous measurement of multiple effector molecules, has led to an emphasis on T-cell response \u201cquality\u201d or \u201cfunctional heterogeneity\u201d rather than \u201cquantity\u201d or \u201cmagnitude\u201d of IFN\u03b3 responses alone Most prior studies of HIV-specific cell-mediated immunity have assessed responses only in the peripheral blood compartment; little information is available concerning HIV-specific T-cell responses in mucosal tissues. In a previous study focused primarily on IFN-\u03b3 production, we reported that rectal CD8+ T-cell responses to Gag were immunodominant (as compared to Pol and Env) in chronically infected subjects not on antiretroviral therapy with a broad range of viral loads In the present work, we have analyzed paired blood and rectal biopsies from chronically infected patients for five distinct responses to HIVgag stimulation: production of the cytokines IFN-\u03b3, IL-2, TNF-\u03b1, the chemokine MIP-1\u03b2, and the cytolytic granule constituent CD107a, which is an indirect marker for cytotoxic potential Using an expanded panel of response parameters coupled with a new and rigorous statistical approach to evaluating when a response is significant see , here wep>0.05). The subject pool was primarily Caucasian (56%) and African American (33%), and the gender distribution was approximately two-thirds male and one-third female. Among seropositive subjects not on ART, viral loads ranged from <50 to 89,700 copies per ml plasma, and blood CD4 counts ranged from 304 to 883 cells per \u00b5l blood  between rectal CD4 percentage and plasma viral load (data not shown).The dynamics of CD4+ T-cell restoration in mucosal tissues following initiation of ART is an area of current interest All Gag-specific responses reported in this study were first evaluated for significance, in relation to responses associated with exposure to costimulatory antibodies alone, using a statistical test rather than a simple cutoff value see . Responsp<0.05). Furthermore, CD107a and IFN-\u03b3 responses in rectal mucosa were positively correlated with blood CD4 count (p<0.05). In contrast, Gag-specific response magnitudes in PBMC were not significantly related to viral load or to blood CD4, and rectal CD8+ T-cell responses did not show a significant relationship to rectal CD4 percentage (data not shown). These findings suggest that, in individuals with chronic infection in the absence of ART, HIV-specific T-cell responses measured in rectal mucosa may be a stronger correlate of viral replication and immune status than the corresponding responses measured in peripheral blood.As shown in In the subject group not on ART, the enhanced HIVgag responsiveness of rectal CD8+ T-cells in comparison to PBMC, and the significant relationship of rectal responses with plasma viral load and blood CD4 count , led us The mean total percentage of rectal CD8+ T-cells responding to HIVgag stimulation in any way  was 5.9% for the group not on ART. The pie charts and bar graphs provide finer details illustrating that nearly one-half of the rectal response in patients not on ART was comprised of polyfunctional cells capable of 3, 4, or 5 responses simultaneously. In contrast, in the group on ART, the mean percentage of rectal CD8+ T-cells responding to HIVgag stimulation was 2.9%. Even more strikingly, cells producing 3, 4, or 5 responses accounted for less than 10% of the responding population, as shown in the pie chart. Thus, in this cross-sectional comparison of patients on and off ART, ART was associated with a striking absence of polyfunctionality in rectal mucosa.In PBMC of patients not on ART, the mean percentage of HIVgag-specific CD8+ T-cells was lower than in rectal mucosa (3.8% vs. 5.9%), and approximately 30% of this response was derived from cells capable of at least 3 responses. In the ART group, the mean percentage of responding cells was 1.1%, fewer than 20% of which were polyfunctional. The utility of Boolean gating analysis lies not only in the ability to assemble a detailed view of responding CD8+ T-cell populations , but alsp\u200a=\u200a.024) and negatively correlated with plasma viral load . In contrast, the summed 1- and 2-function responses showed no relationship to blood CD4 or plasma viral load (not shown). Additional significant correlations (p<.05) included mucosal 4 and 3-function CD8 responses in relation to blood CD4 count; mucosal 4-function CD8 responses in relation to plasma viral load; and the summed 1+ through 5+ mucosal Gag-specific CD8 response in relation to blood CD4 count and plasma viral load (data not shown). Although similar statistical analyses were performed for blood CD8+ T-cell responses, we did not identify any significant relationships between total blood CD8 responses or any subset of blood CD8 responses and either plasma VL or blood CD4 count (not shown). In addition, functionality of rectal CD8+ T-cell responses failed to exhibit any significant correlation with rectal CD4 frequency as a percent of CD3+ T-cells (not shown).Rectal, but not peripheral, Gag-specific CD8+ T-cell responses within certain functional categories showed significant correlations with clinical status. The strongest of these relationships was observed when the percent response was summed across the three predominant polyfunctional categories and the summed values were plotted against blood CD4 count or plasma viral load. Polyfunctional CD8+ T-cells have previously been demonstrated to produce more IFN-\u03b3 on a per-cell basis than cells of lower functionality Typical lymphocyte activation markers were generally expressed at higher levels by CD8+ T-cells in rectum than in PBMC . In agreAs previously reported, perforin expression was extremely low in rectal CD8+ T-cells as compared to PBMC In this study we introduce the use of a statistical approach to establish when an antigen-specific response is significantly different from the response elicited by costimulatory antibodies alone see . While tVirions in circulation are thought to originate from tissue sites of active virus replication. As the intestinal tract is a major lymphoid organ that supports high levels of virus replication during acute infection, it may also serve as a significant source of viremia during chronic infection. In a previous study of a more limited patient group, we observed that plasma viremia was inversely, though not significantly, associated with IFN\u03b3 production by Gag-specific rectal CD8+ T-cells, while blood CD4 count showed a significant positive correlation with Gag-specific rectal responses Others have observed that peripheral Gag-specific CD8+ T-cell responses have clinical relevance as suggested by high-magnitude and complex Gag-specific responses in HIV controllers Our finding of enhanced production of MIP-1\u03b2 and CD107a on a per-cell basis as functionality increases is the first observation of this kind for mucosal CD8+ T-cells yet is consistent with other studies reporting increased IFN-\u03b3 production by polyfunctional T-cells in peripheral blood It has been known for some time that the magnitude of HIV-specific CD8+ T-cell responses in peripheral blood declines rapidly when individuals begin ART Immune reconstitution in the context of ART, particularly as defined by CD4 repopulation in the intestinal tract and peripheral blood, is of intense current interest. Previously we reported a significant positive correlation between CD4 percentages in these two compartments In summary, we have shown here that rectal HIVgag-specific CD8+ T-cells from chronically infected subjects not on ART are able to mount robust and diverse effector responses which correlate positively with blood CD4 count and inversely with plasma viral load. These associations were not evident for peripheral blood CD8+ T-cells, suggesting a unique status for mucosal HIV-specific CD8+ T-cells which remains to be fully defined. In the context of ART, a predictable drop in the total responding CD8+ T-cells in both tissues was accompanied by a marked loss of response complexity in rectal mucosa. The provision of ART was also linked to the observation that peripheral and rectal CD4+ T-cell percentages are tightly positively correlated.Although a role for mucosal T-cell responses in limiting viral dissemination during early/acute infection has been postulated, the contribution of mucosal effector cells to the immune control of viral replication during chronic infection has not been addressed. The results presented here suggest that, when individuals throughout a broad range of viral loads and blood CD4 counts are evaluated, there are significant relationships between antiviral mucosal effector responses , and both VL and CD4. However, a cause/effect relationship between mucosal CD8+ T-cells and clinical status cannot be definitively established due to the cross-sectional nature of this study; indeed, it is possible that polyfunctional responses are a consequence of an intact immune system in individuals with low viral replication, rather than the cause of low virus replication. Additional studies will be required to address the relationship between mucosal T-cell responses and tissue viral loads.Subjects were chronically HIV-infected patients and seronegative volunteers and at the Center for AIDS Research, Education and Services (CARES), Sacramento, CA. Patients taking and not taking antiretroviral drugs were enrolled in the study. This patient cohort has been described previously PBMC were isolated from blood using Ficoll-Paque\u2122 . Isolation of mononuclear cells from rectal biopsies was done using an optimized collagenase digestion procedure as previously described Flow cytometry data were acquired on an LSRII  equipped with 405, 488, and 643 nm lasers and utilizing FACSDIVA software (BDIS). Analysis of cytometry data was done with FlowJo software ; for experiments measuring five functional responses, individual cytokine gates were evaluated alone and also processed through Boolean combinations to partition responding cells into one of 31 possible specific response categories. Cytometry data were biexponentially transformed in order to include all events. SPICE software  was used to graph response data.Blood CD4 count was determined by the clinical laboratory at University of California, Davis, Medical Center. Plasma viral load was measured by the California Department of Health Services, Viral and Rickettsial Disease Laboratory using the Roche COBAS HIV-1 Monitor v1.5 test. This method has a sensitivity cutoff of 50 HIV-1 RNA copies per ml plasma.Fluorochrome-labeled monoclonal antibodies to CD3 (clone UCHT1), CD107a (clone H4A3), IFN\u03b3 (clone B27), TNF-\u03b1 (clone MAb11), IL-2 (clone 6344.111), MIP-1\u03b2 (clone D21-1351), Granzyme B (clone GB11), and CD25 (clone M-A251) were purchased from Pharmingen , as were unlabeled CD28 (clone L293) and CD49d (clone L25), and 7-Amino-Actinomycin D (7-AAD). Fluorochrome-labeled aniti-CD8 (clone 3B5), CD4 (clone S3.5), HLA-DR (clone TU36), and CD69 (clone CH/4) were purchased from Invitrogen. Anti-CD4 (clone SFCI12T4D11) was obtained from Beckman Coulter  and anti-Human Perforin (clone PF-164) was obtained from MABTECH. The HIVgag peptide pool  consisted of 15-mers with an 11 amino acid overlap .2 prior to analysis. For ICS, cells were stimulated with pooled HIVgag peptides (3.5 \u00b5g/ml) plus costimulatory antibodies (CD28 and CD49d). Negative and positive controls were media containing peptide vehicle (DMSO) plus costimulatory antibodies, and staphylococcus enterotoxin B , respectively. The expression of CD107a, MIP-1\u03b2, IL-2, TNF-\u03b1 and IFN-\u03b3 were measured using a modification of a previously described method 6 cells in 200 \u00b5l complete medium were treated with anti-CD28 (2.5 \u00b5g/ml), anti-CD49d (5 \u00b5g/ml), anti-CD107a, monensin , brefeldin A , and HIVgag peptide pool or DMSO. Following a 5 hour incubation, cells were incubated for 5 minutes in PBS/2% FCS/0.5 mM/EDTA, stained for surface markers and 7-AAD (Pharmingen) in PBS/2% FCS for 20 min at 4\u00b0C, fixed in 4% formaldehyde, then permeabilized using FACS Perm 2 (BD Biosciences). Cells were then washed in PBS/2% FCS, stained for intracellular markers and CD3, washed again, then stored at 4\u00b0 C in PBS/1% formaldehyde until analysis (within 24 hours). Non-fluorescent Actinomycin D (2 \u00b5g/ml) was included in reagents after the 7-AAD staining step to saturate sites that could bind residual 7-AAD ICS assays and phenotypic staining were carried out on freshly isolated PBMC and RMC that were rested overnight at 37\u00b0C, 5% COPhenotypic staining of unstimulated peripheral and rectal CD8+ T-cells for surface and intracellular antigens was carried out using Caltag Fix and Perm (Invitrogen) according to the manufacturer's protocol. Stained cells were stored at 4\u00b0 C in PBS/1% formaldehyde until analysis (within 24 hours). Flow cytometry gating was as shown in in vivo and frequently exhibit elevated cytokine production relative to PBMC 1X is the number of cells  responding to peptide plus costimulation within a total CD8+ T-cell population designated as 1n. Similarly, 0X is the number of events associated with costimulation alone within a total CD8+ T-cell population designated as 0n. The test was carried out as follows: (1) If one or both of 0X and 1X was equal to zero, then the value was set to 0.5; (2) the test statistic 3W was calculated; (3) the test statistic 3W was referred to a standard normal distribution and the p-value was calculated; (4) If the p-value was less than the significance level (0.05), this indicated that the background cytokine response and the Gag-stimulated cytokine response were statistically different. In this case, the background response was subtracted from the Gag-specific response to yield a statistically meaningful net response. If, on the other hand, the p-value was equal to or greater than 0.05, this indicated that the background cytokine response and the Gag-stimulated response were not statistically different. In this case, the net Gag-specific response was set to zero.Net antigen-specific responses were evaluated using a statistical test For comparisons of T-cell function between tissues within the same patients, paired T-tests (two-tailed) were used. Mann Whitney (two-tailed) tests were used to compare T-cell function data between subjects  within a given tissue type. Expression of phenotypic markers was compared between tissues within the same patients using a paired T-test, and between patient groups using a Kruskal-Wallis test followed by Dunn's Multiple Comparison Test. Correlations between CD8+ T-cell response magnitudes and plasma viral load, CD4+ T-cell count (blood) and CD4+ T-cell frequency  were determined using Spearman Correlation . Linear regression analysis was used to display a best fit line to the data.T-cell responses to antigenic stimulation were evaluated by Boolean partitioning of responses into 31 distinct responding populations"}
+{"text": "Most HIV-infected patients receiving virologically suppressive antiretroviral therapy continue to have abnormal, generalized T cell activation. We explored whether the degree of ongoing cytomegalovirus (CMV), Epstein-Barr virus (EBV) and Kaposi's sarcoma herpesvirus (KSHV) replication was associated with higher virus-specific T cell activation and the failure to achieve normal absolute CD4+ T cell counts in the face of long-term suppressive antiretroviral therapy.Longitudinally collected PBMC and saliva specimens obtained from HIV-infected patients on effective antiretroviral therapy for at least one year (plasma HIV RNA <75 copies/mL) were examined using a multiplex CMV, EBV and KSHV DNA PCR assay. Eleven cases were chosen who had CD8+ T cell CD38+HLA-DR+ expression >10% and plateau absolute CD4+ T cell counts <500 cells/\u00b5L. Five controls from the same study had CD8+ T cell CD38 expression <10% and plateau absolute CD4+ T cell counts >500 cells/\u00b5L.Among all subjects combined, 18% of PMBC samples were positive for CMV DNA, and 27%, 73% and 24% of saliva samples were positive for CMV, EBV and KSHV DNA, respectively. No significant differences or trends were observed between cases and controls in proportions of all CMV, EBV or KSHV DNA positive specimens, proportions of subjects in each group that intermittently or continuously shed CMV, EBV or KSHV DNA in saliva, or the median number of genome copies of CMV, EBV and KSHV DNA in saliva. Overall, number of genome copies in saliva were lower for KSHV than for CMV and lower for CMV than for EBV. Although replication of CMV, EBV and KSHV persists in many antiretroviral-suppressed, HIV-infected patients, we observed no evidence in this pilot case-control study that the magnitude of such human herpesvirus replication is associated with abnormally increased CD8+ T cell activation and sub-normal plateau absolute CD4+ T cell counts following virologically suppressive antiretroviral therapy. Currently available highly active antiretroviral therapy (HAART) regimens are able to dramatically decrease plasma HIV RNA levels in the majority of patients with chronic HIV infection, leading to sustained increases in absolute CD4+ T cell counts and decreased risk of progression to AIDS and death. These antiretroviral regimens, however, have limitations in terms of immunologic efficacy The reasons underlying persistent T and B cell activation, in the face of effective antiretroviral therapy, are unknown. Potential causes include 1) persistent HIV replication, at levels below those detectable using currently available commercial plasma HIV RNA assays, 2) persistent systemic replication of a co-infecting virus such as human herpes or hepatitis viruses, 3) persistent microbial translocation We chose saliva as a compartment to monitor active CMV replication because of the expectation that this body fluid would provide a sensitive source of this virus in antiretroviral-suppressed HIV-infected patients Finally, given the fact that both EBV or KSHV are also shed in increased amounts in saliva in HIV-infected patients This study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by the Institutional Review Board of the University of California San Francisco. All patients provided written informed consent for the collection of samples and subsequent analysis.PMBC and saliva specimens were obtained from a prospective observational study of HAART (SCOPE). In SCOPE, subjects are evaluated by medical history and measurement of plasma HIV viral load and absolute CD4+ T cell count every 4 months. At each of these visits, samples of blood for plasma and PBMC separation and of unstimulated whole saliva are obtained and stored at \u221280\u00b0C. For this study we identified specimens from SCOPE participants who met the following criteria:On HAART with at least one year of sequential plasma HIV RNA levels consistently sustained at levels <75 copies/mL before the time the first specimens tested were obtained.Paired stored PBMC and saliva specimens were available from at least 2 separate visits spanning a minimum 6 month period while the subject remained on HAART with a HIV RNA level consistently <75 copies/mL and during which the percentage of circulating CD8+ T cells co-expressing CD38 and HLA-DR was measured.Among the specimens from these participants, we selected \u201ccases\u201d who had high CD8+ T cell activation and low absolute CD4+ T cell counts at the time specimens tested were obtained, and were defined as:Percentage of circulating CD8+ T cells co-expressing CD38 and HLA-DR was >10%.Absolute CD4+ T cell counts were consistently <500 cells/\u00b5L.In addition, since chronic hepatitis C infection has been reported to cause abnormally increased CD8+ T cell activation and low absolute CD4+ T cell count in HIV-coinfected patients We also identified a group of controls who had low CD8+ T cell activation and high absolute CD4+ T cell counts at the time specimens tested were obtained, defined as:Percentage of circulating CD8+ T co-expressing CD38 and HLA-DR was <10%Absolute CD4+ T cell counts were consistently >500 cells/\u00b5L.Freshly drawn EDTA anti-coagulated whole blood was stained, lysed and fixed as previously described 5 cell equivalents. Aliquots of 106 freshly separated PBMC were lysed, boiled for 5 min, cooled on ice, and stored at \u221280\u00b0C until use. DNA was isolated from samples using the QIAGEN DNeasy Tissue kit  according to the manufacturer's instructions. The initial amplification of DNA was with primers IEP2AII (5\u2032ATGGAGTCCTCTGCCAAGAGAAAGATGGAC3\u2032) and IEP4BII (5\u2032CAATACACTTCATCTCCTCGAAAGG3\u2032), followed by IEP3B (5\u2032TCTGCCAGGACATCTTTCTC3\u2032 and IEP3A (5\u2032GTGACCAAGGCCACGACGTT3\u2032). For the initial qualPCR, 5 \u00b5l  of extracted PBMC and PMN DNA or 50 ng EMB DNA was added to 45 \u00b5l reaction mixtures containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 \u00b5M of each deoxynucleotide triphosphate (Invitrogen Corporation), 1 U Taq polymerase (Roche Diagnostics Corporation), and 1 \u00b5M of each primer. For the second qualPCR, 5 \u00b5l out of the first reaction mixture was added to a 45 \u00b5l reaction mixture as used for the initial qualPCR. qualPCR mixtures were layered with 50 \u00b5l of mineral oil and subjected to one cycle of 94\u00b0C for 3 min, followed by 30 cycles of 1 min of denaturation at 94\u00b0C, 1 min of annealing at 62\u00b0C, and 2 min of extension at 72\u00b0C, and a final extension step of 7 min at 72\u00b0C. Positive and negative controls were included in each run, and, after qualPCR, each sample was electrophoresed through a 2% agarose gel containing 0.2 \u00b5g/ml ethidium bromide with appropriate DNA size markers. Amplicons were visualized on a UV transilluminator and photographed.As previously described 5 cells. Real-time PCR was performed in a GeneAmp 5700 Sequence Detection System . Five \u00b5l of sample was added to 45 \u00b5l of reaction mix containing 25 \u00b5l SYBR green PCR Master Mix (Applied Biosystems) and 10 pmol of each primer. The primers used for the real-time PCR were also located in the gene encoding the IE1 protein, exon 2 . Conditions for the real-time PCR were established empirically and included incubation at 50\u00b0C for 2 min to enable uracil-DNA-glycosylase (in Master Mix) to act on samples and 94\u00b0C for 10 min to activate AmpliTaq Gold polymerase, followed by 40 cycles of 15 s of denaturation at 94\u00b0C and 1 min of annealing and extension at 60\u00b0C. A standard curve of serial dilutions of known amounts of plasmid DNA was used in each run as an internal control and to determine the copy number in the samples. In addition, a natural CMV DNA positive sample was run to assess consistency. The detection limit of this test was 5 CMV DNA copies/105 cells, and positive samples were quantitated as copies/5 \u00b5L of lysed cells. Each run included positive and negative samples, and specificity of the amplified products was assessed on each run by dissociation curve analysis to ensure that all products had an expected, uniform melting temperature.To quantify viral load in the qual-PCR-positive samples, we used SYBR green detection of real-time PCR products able to detect a range of 3 to 100,000 CMV genome copies/105\u2032- AAGGTGCATTTACCCCACTG, EBNA3cR, 5\u2032- AGCAGTAGCTTGGGAACACC5\u2032- GGAAGAGCCCATAATCTTGC, LANA78r 5\u2032- GCCTCATACGAACTCCAGGT, FOR HCMV GlyBcmvF 5\u2032-AAGTACCCCTATCGCGTGTG, GlyBcmvR 5\u2032-ATGATGCCCTGATCCAAGTCDNA was isolated from 250 \u00b5l saliva (diluted to 1000 \u00b5l with PBS) using the QIAGEN QIAamp UltraSens Virus Kit  according to the manufacturer's instructions. DNA was eluted in 80 \u00b5l 0.1\u00d7 TE pH 7.8 (Fisher Inc.). A single QPCR reaction contained 14 \u00b5l 2\u00d7SYBR (Roche Inc.), 1 \u00b5l primer , 7 \u00b5l PCR grade water and 8 \u00b5l sample. Single plex reactions were set up on a RoboGo (MWG Inc.) pipetting station and analyzed on a MJR Opticon II machine. Cycle conditions were 56\u00b0C: 5 min, 95\u00b0C: 3 min, . The primers were for EBV: EBNA3cF 10 copies/ml (just below the lower limit of detection of 1.8 log10 copies/ml). Fisher's exact tests were used to compare the proportion of cases and controls with \u22651, \u22652, or all samples positive. The Spearman rank correlation test was used to test the association of subject's percent of activated CD8+ T cells with the amount of herpesvirus DNA in their saliva.For analyses including multiple observations per participant, we evaluated differences in categorical outcomes  between cases and controls with logistic regression for clustered data and differences in DNA copy number between cases and controls with generalized estimating equations. For analyses comparing DNA copy numbers between groups, undetectable levels were assigned a value of 1.79 logEleven SCOPE subjects meeting the criteria for inclusion were sampled as cases in the high CD8 T cell activation/low CD4 count group. The cases had 2\u20134 saliva and PMBC specimens assayed which spanned a 6\u201312 month period. The cases had a median (range) absolute CD4+ T cell count of 279 (112\u2013450) cells/\u00b5L and percentage of activated (CD38+HLA-DR+) CD8+ T cells of 17.9% (11\u201338%) during this study period. Five subjects met the criteria for inclusion as controls in the lower CD8 T cell activation/higher CD4 count group, had 4 PMBC and saliva specimens assayed which spanned a 12 month period, and had a median (range) absolute CD4+ T cell count of 687 (519\u2013858) cells/\u00b5L and percentage of activated (CD38+HLA-DR+) CD8+ T cells of 5.4% (4\u20137.6%) during this study period. Demographics and characteristics of the subjects studied are summarized in 5 cells in PBMC), as well as comparisons of the proportion of case and control subjects who had \u22651, \u22652 or all saliva specimens positive. In addition, salivary herpesvirus DNA levels (log10 copies/mL) were compared between cases and controls using generalized estimating equations.Among all subjects combined, 18% of PMBC samples were positive for CMV DNA and 27%, 73% and 24% of saliva samples were positive for CMV, EBV and KSHV DNA, respectively. However, all categorical comparisons between the case and control groups were non-significant with p values >0.5, and all comparisons of median DNA copy number between cases and controls were non-significant with p values >0.9.As there was no consistent difference between the cases and controls in terms of any of the herpesviruses measured, we combined the groups to determine if the level of CMV, EBV or KSHV DNA in saliva was associated with the level of CD8+ T cell activation. The time point of saliva collection temporally closest to that of a CD8+ T cell CD38/HLA-DR expression measurement was used. We found no correlation between the percentage of activated CD8+ T cells and the amount of CMV DNA , EBV DNA , or KSHV DNA  in saliva.In general, positive readings tended to occur within subjects, suggesting that the \u201csteady-state\u201d levels varied by subject. Of note, all positive PBMC samples had very low copy numbers, <3 CMV DNA copies per 5 \u00b5L of lysed cells. Also, the number of genome copies in saliva overall were lower for KSHV than for CMV and lower for CMV than for EBV.Replication of CMV, EBV and KSHV persists in many antiretroviral-suppressed, HIV-infected patients to a greater degree than in HIV-uninfected adults Miller, et al, previously reported results using a similar PCR assay to detect CMV, EBV and KSHV in similar unstimulated whole saliva specimens from 58 HIV-infected patients, most of whom had HIV replication suppressed by antiretroviral therapy Similar to the results from Miller et al, we noticed that median CMV levels were lower than median KSHV levels, which in turn were lower than median EBV levels . This suThis pilot study has several important limitations. First and foremost, the sample size was small, and thus the potential Type II error is likely substantial. However, we avoided confounding factors by requiring prolonged HIV RNA undetectability in plasma for study eligibility and excluding patients with chronic HCV infection. Second, we selected our cases and controls based on more than one factor . This study design would have been particularly problematic had we observed differences between the two groups. Since it is unlikely that low absolute CD4+ T cell counts may have blunted the impact of herpes viruses on immune activation, it is also unlikely that the negative results observed in this study were due to our study design. Third, we only measured human herpesvirus replication in two reservoirs, saliva and PBMC. Assaying specimens from other reservoirs  may have demonstrated a difference between the two groups. In addition, the saliva and PBMC specimens we assayed were obtained infrequently (only once every four months). Sampling more frequently, for example by daily oral swabs Given the strong association between inflammation/immune activation and disease outcomes in treated HIV disease, defining the mechanisms associated with HIV-associated inflammation is of high importance. Our preliminary data do not provide strong evidence for a role of persistent high level herpesvirus replication.Other possible mechanisms includes the following:Persistent microbial translocation. It is now well-appreciated that HIV causes irreversible damage to the gut mucosal integrity early in the course of disease, leading to translocation of gut microbial products into the system circulation Residual HIV viremia. Another factor leading to persistent abnormal immune activation in antiretroviral-suppressed patients could be persistent low level replication of HIV. Several studies have reported that by using an ultra-ultrasensitive HIV RNA PCR assay, low levels of plasma HIV viremia  can be detected in the majority of HIV-infected patients successfully treated with antiretroviral therapy Persistant immune dysregulation. Finally, the damage to the immune system done by uncontrolled HIV replication before antiretroviral therapy is initiated, for example in altering T cell diversity in adults with limited thymic reserve for repopulating diverse na\u00efve T cells In summary, future studies to examine the effect of suppressing CMV, EBV and KSHV with drugs such as valganciclovir"}
+{"text": "In vitro studies have shown that natural killer (NK) cells purified from healthy donors can kill heterologous cell lines or autologous CD4+ T cell blasts exogenously infected with several strains of HIV-1. However, it is not known whether the deleterious effects of high HIV-1 viremia interferes with the NK cell-mediated cytolysis of autologous, endogenously HIV-1-infected CD4+ T cells. Here, we stimulate primary CD4+ T cells, purified ex vivo from HIV-1-infected viremic patients, with PHA and rIL2 (with or without rIL-7). This experimental procedure allows for the significant expansion and isolation of endogenously infected CD4+ T cell blasts detected by intracellular staining of p24 HIV-1 core antigen. We show that, subsequent to the selective down-modulation of MHC class-I (MHC-I) molecules, HIV-1-infected p24pos blasts become partially susceptible to lysis by rIL-2-activated NK cells, while uninfected p24neg blasts are spared from killing. This NK cell-mediated killing occurs mainly through the NKG2D activation pathway. However, the degree of NK cell cytolytic activity against autologous, endogenously HIV-1-infected CD4+ T cell blasts that down-modulate HLA-A and \u2013B alleles and against heterologous MHC-Ineg cell lines is particularly low. This phenomenon is associated with the defective surface expression and engagement of natural cytotoxicity receptors (NCRs) and with the high frequency of the anergic CD56neg/CD16pos subsets of highly dysfunctional NK cells from HIV-1-infected viremic patients. Collectively, our data demonstrate that the chronic viral replication of HIV-1 in infected individuals results in several phenotypic and functional aberrancies that interfere with the NK cell-mediated killing of autologous p24pos blasts derived from primary T cells.Understanding the cellular mechanisms that ensure an appropriate innate immune response against viral pathogens is an important challenge of biomedical research.  In vitro studies with exogenously infected CD4+ T cell blasts from healthy donors have demonstrated that NK cells can kill autologous HIV-1-infected target cells. However, the ability of NK cells from HIV-1-infected viremic patients to kill autologous, endogenously infected CD4+ T cells had never been examined and remains uncertain. Given the reported abnormalities in phenotype and functions of NK cells from HIV-infected viremic individuals, we determined the function of NK cells in killing HIV-1-infected target cells under conditions that more closely mimic the in vivo environment in HIV-infected individuals. We show that NK cells from HIV-1-infected viremic patients display a variable although generally low ability to selectively eliminate autologous and endogenously HIV-1-infected CD4+ T cell blasts expanded ex vivo from peripheral blood. Various factors, including the markedly defective engagement of important NK cell activation pathways and high frequencies of the pathologic CD56neg/CD16pos NK cell subset in HIV-1-infected viremic patients, influenced NK cell\u2013mediated cytolysis of endogenously infected CD4+ T cell blasts.Natural killer (NK) cells represent an important line of defense against viral infections.  Natural killer (NK) cells are important effectors of innate immune responses and are capable of providing cellular immunity against tumor-transformed and virally-infected cells, without prior antigen sensitization neg/CD16pos (CD56neg) NK cell subset that is preferentially expanded in HIV-1 infected viremic patients Several studies have already described numerous aberrancies of NK cell phenotype and function in chronically HIV-1 infected patients with high levels of ongoing viral replication. These abnormalities include aberrant expression and function of several iNKRs and natural cytotoxicity receptors (NCRs), markedly impaired cytolytic activity against tumor cell targets, defective production of important antiviral cytokines Because the frequency of peripheral blood CD4+ T cells that harbor replication-competent virus is extremely low in HIV-1 infected patients in vitro infection with different HIV-1 strains have been developed. Through these experimental methods, several reports show that HIV-1 selectively down-modulates HLA-A and -B alleles in both cell lines and CD4+ T cell-derived blasts in vitro infection have significantly contributed to understanding the cellular interactions between NK cells and autologous HIV-1 infected CD4+ T cell blasts, it is still unclear what role, if any, NK cells obtained from HIV-1 infected viremic patients play in the clearance of endogenously infected autologous CD4+ T cells ex vivo.In order to further understand the direct effects of HIV-1 on CD4+ T cells and other cell types, several models of In the present study, we describe the killing of endogenously infected CD4+ T cell blasts by autologous NK cells from HIV-1 infected viremic individuals. In addition, we describe several mechanisms involved in the regulation of this NK cell-mediated killing. Finally, we characterize phenotypically the endogenously HIV-1 infected CD4+ T cell blasts used as targets in this experimental system.in vitro with different stimuli of either total PBMCs or purified CD4+ T cells from HIV-1 infected individuals induces viral expression and replication in vitro  and started to decrease progressively after this time point  with a simultaneous down-modulation of cell surface CD4 . In contrast, the expression of HLA-C and HLA-E molecules did not substantially differ between p24neg and p24neg blasts   . To furts blasts .pos/CD4neg cell blasts was still relatively low and variable from patient to patient . Even when interactions between iNKRs and MHC-I were completely blocked, NK cells only partially eliminated both p24pos and p24neg autologous CD4+ T cell blasts   . In orde: 38.4%) . A possiIf the dominant and negative effect of interactions between iNKRs and MHC-I molecules is partially overcome by the HIV-1 induced selective down-modulation of HLA-A and \u2013B alleles, NK cell killing of autologous and endogenously infected CD4+ T cell blasts must occur through activating NK cell receptors. In order to identify those NK receptor(s) that trigger this NK cell-mediated lysis, we analyzed the phenotype and functions of NCRs and NKG2D that, under physiological conditions, represent the major activating receptors that regulate NK cell cytotoxicity.pos/CD4neg cell blasts, indicating that the NCRs were not playing a substantial role in this killing . These data raise the question of whether soluble human Ig fusion proteins may be sensitive enough in detecting all ligands for NCRs.We also analyzed the expression of cellular ligands for NCRs using soluble human NCR-Ig fusion proteins. We found that the surface levels of NCR ligands on p24 ligands . The facneg subset of NK cells in which surface expression of NKp46 and NKp30 and cytolytic activitiy against tumor cell line targets were found to be very low pos blasts is inversely correlated with the frequencies of anergic CD56neg NK cells   plays an important role in the NK cell killing of endogenously HIV-1 infected CD4+ T cell blasts As previously demonstrated for NCRs, we then performed masking experiments to understand the extent of the contribution of NKG2D to the NK cell-mediated killing of infected p24<0.0001) . Moreovel blasts . Consistpos CD4+ T cell blasts   .pos blasts become partially susceptible to lysis by rIL-2 activated NK cells, while p24neg blasts are spared from killing. This NK cell-mediated killing occurs mainly through the NKG2D activation pathway. However, decreased NK cell expressions of NCRs contribute to the low level of NK cell cytolytic activity. In addition, the unusually high frequency of dysfunctional CD56neg NK cell subsets among HIV-1 infected viremic patients was shown to strongly correlate with the low degree of NK cell cytolytic responses against infected p24pos cell blasts.In the present study we demonstrate the ability of NK cells from HIV-1 infected viremic patients to kill endogenously HIV-1-infected autologous CD4+ T cell blasts derived from viremic patients. We show that, subsequent to the selective down-modulation of MHC-I molecules, infected p24in vitro with exogenously infected CD4+ T cell blasts from healthy donors in vivo situation in HIV-infected individuals. Our experimental system relied on rIL-2 activated NK cells instead of freshly purified NK cells. We previously reported that prolonged activation with rIL-2 did not restore phenotype and function of highly dysfunctional NK cells from HIV-1 infected viremic individuals. Only CD56 expression was recovered upon activation with rIL-2 after 3 weeks of culture. Despite the reversion of the CD56neg to a CD56pos phenotype, rIL-2 stimulated CD56neg-derived NK cell populations still expressed very high percentages of iNKRs and extremely low levels of NCRs, similar to results from experiments performed with freshly purified CD56neg NK cell subsets. Even after 21 days of activation with rIL-2 the cytolytic potential of these highly dysfunctional NK cells from HIV-1 infected viremic patients did not improve and remained significantly lower compared to that of NK cells from uninfected individualsThe ability of NK cells to kill autologous HIV-1 infected target cells mainly through the NKG2D pathway has been previously demonstrated in vitro with several and multiple stimuli enhanced viral replication in CD4+ T cells from HIV-1 infected patients. The in vitro induced replication of HIV-1 was measured by the release of p24 HIV-1 core antigen in culture-supernatant pos cell blasts differed among samples from the 30 HIV-1 infected viremic patients analyzed in the present study. The reasons for such heterogeneous results are unclear and many variables such as cellular or soluble suppressive factors, different numbers of circulating latently HIV-1 infected cells, different viral strains, culture conditions or other factors could contribute to this variability. Further investigations are needed to extensively characterize the kinetics of HIV-1 in endogenously infected cells and the replication cycle of these p24pos/CD4neg cell blasts. Our aim in the present study was restricted to an examination of the interactions between endogenously HIV-1 infected CD4+ T cell blasts and autologous NK cells from HIV-1 infected viremic patients.Circulating CD4+ T cells from HIV-infected individuals harbor very low frequencies of replication-competent virus pos from uninfected p24neg T cell blasts.In the preparation of target cells, we separated infected from uninfected cells on the basis of the lack of expression of CD4 together with intracellular expression of p24 on certain cells (infected) and the expression of CD4 and lack of intracellular expression of p24 on other cells (uninfected). It has been reported that HIV-1 is able to down-modulate the expression of CD4 on T cell surfaces, a phenomenon induced either by Nef, which enhances the internalization and degradation of CD4, or by Vpu and Env, which interfere with the transport of newly synthesized CD4 to cell surface in vitropos/CD4neg cell blasts susceptible to NK cell-mediated killing. In fact, although the surface levels of HLA-C and -E may still protect infected cell blasts from the cytolysis exerted by autologous NK cells expressing iNKRs specific for these conserved alleles of MHC-I pos/CD4neg blasts was significantly higher compared with that of p24neg/CD4pos blasts. Moreover, masking experiments highlighted the important role of the selective down-modulation of HLA-I molecules, because only the complete blocking of all MHC-I alleles rendered infected p24pos and uninfected p24neg cell blasts equally susceptible to NK cell-mediated lysis.In line with results previously reported with HIV-1 infection pos NK cell subset is greatly decreased in chronic HIV-1 infected viremic patients compared to that of healthy donors pos blasts (data not shown). The reason for the discrepancy in the role of NKG2A/HLA-E interactions between these previous studies and our data may be the fact that the effector cells used in those previous studies were heterologous NK cell lines expressing high levels of NKG2A against HLA-E transfected target cell lines.Other studies reported that conserved or even up-regulated levels of HLA-E on HIV-1 infected cells are able to inhibit NK cell-mediated cytolysis of HIV-1 infected cells through binding to its specific inhibitory receptor NKG2A pos/CD4neg cell blasts was found to be mainly NKG2D-dependent. These results are in line with the highly conserved expression of NKG2D on NK cells from HIV-1 infected viremic individuals and with the relatively high percentages of p24pos blasts expressing NKG2D ligands. The direct effect of HIV-1 on the positive or negative modulation of NKG2D ligands on the surfaces of primary CD4+ T cells infected in vitro with HIV-1 is controversial pos/CD4neg blasts, play an important role in NK cell-mediated killing of autologous infected cells. Several groups previously reported that HIV-1 viremia affects several functions of NK cells and dramatically influences their phenotype As mentioned above, the engagement of activating NK cell receptors should be able to trigger the cytolytic activity in NK cells expressing iNKRs specific for HLA-A and -B and lacking iNKRs for HLA-C and-E. In this regard, NK cell-mediated killing of infected p24pos/CD4neg blasts remain still poorly sensitive to killing exerted by autologous NK cells. This is partly the result of inhibitory interactions between iNKRs and conserved HLA-C molecules, as demonstrated by the relatively low levels of killing of both infected and uninfected autologous blasts even in the presence of anti-MHC-I mAbs which completely block the interactions between MHC-I molecules and iNKRs. The relatively low degree of NK cell cytolytic activity against endogenously HIV-1 infected CD4+ T cell blasts might be secondary to aberrancies in NK cell triggering through important activating receptors other than NKG2D. This concept is further supported by the finding that NK cells from HIV-1 infected viremic patients were markedly impaired, compared to that from healthy donors, in their ability to kill highly susceptible target cells such as K562 and 221 tumor cell lines that do not express MHC-I molecules. Moreover, if we compare these experimental data with our previously reported results obtained with HIV-1 infection in vitroneg K562 and 221 cell lines (data not shown) and of endogenously HIV-1 infected autologous CD4+ T cell blasts. These data suggest that the negative effect of HIV-1 viremia on NKp46 and NKp30 expression interfere with the NK cell lysis of endogenously HIV-1 infected autologous CD4+ T cell blasts. HIV-1 infected autologous CD4+ T cell blasts. Our finding of the negative contribution of NCRs in the killing of endogenously infected targets in HIV-infected viremic individuals differs from the findings of a previous study in which we described that NKG2D was important in NK lysis of infected targets, but that NCRs played no demonstrable role in vitro with several viral strains, whereas the present study employed NK cells from HIV-infected viremic individuals and endogenously infected target cells.Although defective in HLA-A and \u2013B expression, p24in vitroex vivo  and the median viremia was 32,677 HIV-1 RNA copies  per ml of plasma as detected by an ultrasensitive branched DNA (bDNA) assay (Chiron) with a lower limit of detection of 50 copies per ml. Patients were either na\u00efve to antiretroviral therpay (ART) or had formerly been receiving ART, but were not receiving therapy at the time of the study. Leukapheresis was conducted in accordance with protocols approved by the Institutional Review Boards (IRBs) of the University of Toronto, Ontario, Canada and the National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH), Bethesda, Maryland, USA. Each patient signed a consent form that was approved by the above IRBs. As negative controls, cells from 30 healthy donors seronegative for HIV-1 were obtained by apheresis generously provided by the Transfusion Medicine Department of the Mark O. Hatfied Clinical Research Center of the NIH as a part of IRB approved clinical studies.PBMCs were obtained from leukapheresis packs by Ficoll-Hypaque density gradient centrigugation . CD4+ T cells and NK cells were freshly isolated by negative selection (Stem Cell Technologies) according to the protocol provided by the manufacturer. The purity of CD3+/CD4+ T cells was \u226597%. Purified NK cells contained \u2264 3% contamination with other PBMC subsets, as determined by expression of CD3, TCR-a/b, TCR-g/d, CD19 or CD14.6/ml) with different stimuli, as shown in 6/ml.In order to expand CD4+ T cell blasts productively and endogenously infected with HIV-1, we activated freshly purified CD4+ T cells  were used in this study: mAbs 289 (IgG2a anti-CD3), C218 and A6-220 , KD1 (IgG2a anti-CD16), AZZ20 and F252 , BAB281 and KL247 , Z231 and KS38 , ON72 and Bat221 (IgG1 anti-NKG2D), MA127 and ON56 , pp35 and Co54 , Ma152 and CER1 , KRA236 and F5 , L14 (IgG2a anti-Nectin 2), L95 (IgG1 anti-poliovirus receptor), Z270 (IgG1 anti-NKG2A), Y9 (IgM anti-CD94), EB6 (IgG1 anti-p58.1/KIR2DL1), Gl183 (IgG1 anti p58.2/KIR2DL2), Z276 (IgG1 anti-p70/KIR3DL1), F278 (IgG1 anti-LIR-1ILT2) and A6.136 . FITC-, PE- or APC-labeled anti-CD3, anti-CD4, anti-CD8, anti-TCR\u03b1/\u03b2, anti-TCR\u03b3/\u03b4, anti-CD14, anti-CD19, anti-CD56, anti-MICA/B and anti-CD48 mAbs were purchased from BD Biosciences. Soluble fusion proteins for NKp30, NKp46, NKp44 and NKG2D with the Fc portion of human IgG and anti-human ULBP-1,-2 and -3 mAbs were purchased from R&D Systems. PE-labeled anti-human Fc fragment mAb was purchased from Jackson ImmunoResearch Laboratories. FITC- and PE- anti human anti-HIV-1 p24 mAb (clone KC57) used for intracellular flow cytometry staining was purchased from Coulter Clone. PE-labeled anti-HLA-A mAbs were purchased from Lab Vision Corporation. Anti-human HLA-C mAb (clone L31) was kindly provided by Dr. Patrizio Giacomini  and used in flow cytometry as previously describedFor one-, two- or three-color cytofluorimetric analysis , cells were stained with the appropriate FITC-, PE- or APC-labeled mAbs. For indirect staining, cells were stained with appropriate unlabeled mAbs followed by FITC- or PE-conjugated isotype-specific goat anti-mouse second reagent (Southern Biotechnology Associates). Second appropriate anti-isotypic mAbs stained with FITC and/or PE and/or APC were used as negative controls. For intracellular staining, samples were fixed and permeabilized by cytofix/cytoperm solution and washed with perm-wash solution 1X (BD-Pharmigen) according to the protocol provided from the manufacturer. The data were analyzed using FlowJo software (Tree Star Inc.).The percentages of HIV-1 infected CD4+ T cell blasts were detected by intracellular flow cytometry with an anti-p24 core virus antigen mAb.Cells undergo cell cycling were evaluated by detecting the intra-nuclear expression of Ki67 (BD-Pharmigen).3[H]thymidine uptake assay (16 hours). Cellular proliferation was also evaluated by dilution of the vital dye CFSE (Molecular Probes) according to the supplier's instructions.CD4-derived T cell blast proliferation was detected by ) followed by a biotin conjugated mouse anti R-PE mAb (BD). Infected p24pos CD4+ T cell blasts were detected by a Pacific Blue fluorescent-dye conjugate of streptavidin (Molecular probes) according to the supplier's instructions. Fluorescent cells were then washed in PBS, suspended in medium, and sealed on the slides with cover slips. Images were collected on a Leica TCS-NT/SP confocal microscope (Leica) using a 63x oil immersion objective NA 1.32. Pacific Blue was excited using an Argon laser at 364 nm. DIC  images were collected simultaneously with the fluorescence images using the transmitted light detector. Images were processed using Leica TCS-NT/SP software (version 1.6.587), Imaris 3.3.2 (Bitplane AG), and Adobe Photoshop 7.0 (Adobe systems).After 10\u201312 days of activation with PHA and rIL-2, unfractionated CD4+ T cell blasts were permeabilized by cytofix/cytoperm solution and stained with an PE-labeled anti-p24 HIV-1 core antigen mAb . As a result, we obtained a highly purified population of CD4+ T cell-derived blasts containing \u22645% contamination of other lymphocyte subsets . HIV-1 infected CD4+ T cell blasts were then separated from uninfected blasts on the basis of CD4 surface expression through magnetic microbeads conjugated with an anti-human CD4 mAb , according to the protocol provided by the manufacturer. The purities of fractions of uninfected CD4pos and infected CD4neg blasts , as assessed by intracellular staining with HIV-1 p24 core antigens, was \u226597% and \u226570%, respectively. p24neg/CD4pos and p24pos/CD4neg cell blasts were then used as target cells against autologous rIL-2 activated NK cells in a 4-hour 51Cr release assay as described previouslyIn line with the timeframe of maximal expansion of p2451Cr release assay against MHC-Ineg erythroleukemia K562 and MHC-Ineg B-EBV cell line 721.221 (thereafter termed 221). E/T ratios are indicated in the figures.Polyclonal NK cells were also tested in a 4-hour 51Cr release cytolytic assay were performed on cells from 15 HIV-1 infected viremic patients.pos and p24neg blasts from HIV-1 infected individuals were evaluated using the Wilcoxon signed ranks test. The functional differences between NK cell-mediated baseline lysis and lysis in masking experiments were evaluated using the Wilcoxon signed ranks test. All p-values are 2-sided and unadjusted. All statistical associations between different immune parameters were determined by the Spearman rank test for correlation. To estimate the time of maximal infection, the mean outcome of infected p24pos over time was modeled as a polynomial function of time and estimated using least squares. The maximum of this function was then determined and a bootstrap procedure was used to provide a confidence interval \u226595% for the maximum.Immune response distributions between healthy donors and HIV-1 infected viremic patients were compared using the Mann-Whitney test. The phenotypic and functional differences between p24Figure S1pos blasts were expanded from total PBMCs obtained from HIV-1 infected viremic patients and used as targets for autologous rIL-2 activated NK cellsMethodology. p24(0.05 MB PDF)Click here for additional data file.Figure S2ex vivo of HIV-1 infected CD4+ T cell-derived blasts by using different stimuli. Percentages of p24pos blasts (open squares) expanded at day 12 after activation with rIL-2 or rIL7 alone, with PHA plus rIL-7 or rIL-2\u00b1rIL-7 and with anti-CD3 plus anti CD28 mAbs from a representative HIV-1 infected viremic patient.Expansion (0.04 MB PDF)Click here for additional data file.Figure S3pos from p24neg blasts through magnetic microbeads conjugated with an anti-CD4 mAb. Purities of sorted uninfected CD4pos and infected CD4neg T cell blast fractions were assessed by intracellular staining with HIV-1 p24 core antigens in a double color flow cytometric analysis.Sorting of HIV-1 infected and uninfected CD4+ T cell-derived blasts. Representative example of separation of p24(0.04 MB PDF)Click here for additional data file.Figure S4neg tumor target cell lines. Spontaneous killing of K562 (A) and 221 (B) tumor cell lines by rIL-2 activated NK cells-. Data are presented as the average of experiments conducted on 15 healthy donors (black squares) and 15 HIV-1 infected viremic patients (red diamonds).Cytolytic Activity of NK cells against HLA-I(0.01 MB PDF)Click here for additional data file.Figure S5neg (upper left quadrants of dot plot graphs and green lines in histogram graphs) and p24pos (upper right quadrants of dot plot graphs and red lines in histogram graphs) blasts derived from a representative HIV-1 infected viremic patient. Data are indicated as percentage of expression (A) and as MFI (b). (C) Cytolysis (in triplicate \u00b1SD) of autologous p24neg/CD4pos blasts exerted by rIL-2 activated NK cells purified from a representative HIV-1 infected viremic patient. Cells were incubated either in the absence (baseline lysis) or in the presence of specific mAbs masking 2B4 and NTBA. We used an anti-human CD56 IgM mAb as an isotype control for masking experiments. The NK cell:CD4-derived blast ratio in all experiments was 10\u22361.NK cell-mediated killing of autologous HIV-1 infected CD4+ T cell-derived blasts: role of 2B4 and NTBA and expression of their ligands on cell targets. (A-B) Surface expression of CD48 and NTBA in p24(0.04 MB PDF)Click here for additional data file."}
+{"text": "Expression levels of cell surface antigens such as CD38 and HLA-DR are related to HIV disease stages. To date, the immunophenotyping of cell surface antigens relies on flow cytometry, allowing estimation of 3\u20136 markers at a time. The recently described DotScan antibody microarray technology enables the simultaneous analysis of a large number of cell surface antigens. This new technology provides new opportunities to identify novel differential markers expressed or co-expressed on CD4+ and CD8+ T cells, which could aid in defining the stage of evolution of HIV infection and the immune status of the patient.Using this new technology, we compared cell surface antigen expression on purified CD4+ and CD8+ T cells between 3 HIV disease groups  with HIV plasma viral loads <50 copies/ml; and HIV+ patients with viremia during HAART) and uninfected controls. Pairwise comparisons identified 17 statistically differential cell surface antigens including 5 novel ones , not previously reported. Notably, changes in activation marker expression were more pronounced in CD8+ T cells, whereas changes in the expression of cell membrane receptors for cytokines and chemokines were more pronounced in CD4+ T cells.Our study not only confirmed cell surface antigens previously reported to be related to HIV disease stages, but also identified 5 novel ones. Of these five, three markers point to major changes in responsiveness to certain cytokines, which are involved in Th1 responses. For the first time our study shows how density of cell surface antigens could be efficiently exploited in an array manner in relation to HIV disease stages. This new platform of identifying disease markers can be further extended to study other diseases. Pneumocystis carinii pneumonia [HIV infection leads to characteristic alterations in the subset composition of circulating CD4+ and CD8+ T lymphocytes. The activation marker CD38, in particular, and its level of expression on CD8+ T cells is a marker that is strongly associated with immune activation, particularly during primary HIV-1 infection and progression to AIDS, respectively . The enuneumonia . Howeveret al. [To date, the immunophenotyping of CD antigens relies on flow cytometry. Although very reliable, the flow cytometry only allows estimation of 3\u20136 markers in a given assay. The recently developed antibody microarray technology enables the simultaneous analysis of a large number of cell surface antigens on a single chip. This new technology may permit the identification of novel differential markers expressed or co-expressed on CD4+ and CD8+ T cells, which could aid in defining the stage of evolution of HIV infection and the immune status of the patient . This anet al. , who useHere, we have used an antibody microarray constructed on the surface of a nitrocellulose coated slide to simultaneously analyze 135 different cell surface antigens (128 cluster of differentiation antigens plus 7 other surface antigens) on peripheral blood CD4+ and CD8+ T cell subsets from HIV+ and HIV- individuals. A comparison of CD4+ and CD8+ T cells purified from peripheral blood of three different HIV-infected patient groups . LTNP-CD4 differed from BDL and/or VIR groups in that CD71, HLA-DR, CD38, CD3epsilon and CD183 were significantly upregulated.The signature pattern for each group and representative dot pattern from which the raw data were derived are shown in Figure To date the analysis of cell surface antigens on peripheral blood lymphocytes of HIV infected individuals has been largely carried out with whole PBMC using flow cytometry. In this study we used DotScan antibody microarray technology  to simultaneously analyze CD4+ and CD8+ T cell subsets obtained from HIV+ individuals at different stages of HIV disease for the expression of 135 different cell surface antigens. For the first time, our study shows how the immunophenotype of diverse blood cell types (in this case CD4+ and CD8+ T cells) can be exploited to study various HIV disease stages using antibody microarray technology. Our analyses identified 17 statistically significant (p < 0.05) differentiating CD antigens distributed between CD4+ and CD8+ T cells. Of these, 11  were differential for CD4+ T cells, while 10  for CD8+ T cells. Among these, CD212b1, CD218a, CD183, CD3epsilon and CD9 have not been previously described in relation to HIV disease.For the activation markers, the results are in accordance with previous studies using flow cytometry, confirming the utility of this new technology. As previously reported ,14, HLA-In addition, CD27 was significantly downregulated on CD8+ T cells in the LTNP group compared to the NEG group. It has been suggested in one study that HIV-specific CD8+ T cells that have differentiated to the CD27- stage are related to the delayed disease progression , while aWe also observed significantly increased CD95 expression on both CD4+ and CD8+ T cells in the VIR group. Although partially elevated CD95 levels were also observed in BDL on HAART and LTNP groups, the increases were not significant, which is consistent with reduced immune activation in patients with reduced viral replication. Increased Fas-receptor (CD95) expression on CD4+ and CD8+ lymphocytes has previously been demonstrated in a large group of HIV-1-infected patients when compared against normal controls , and eviThe most notable feature for the activation markers was significant downregulation of CD9 expression on CD8+ T cells in the VIR group compared to the NEG group. CD9 belongs to a transmembrane protein family known as the tetraspanin family. It has been proposed that these proteins act as scaffolding proteins by laterally organizing cellular membranes via specific associations with each other and distinct integrins. A recent study has shown that the tetraspanin-enriched microdomains on the cell membrane can function as gateways for HIV egress . The oveIt has been suggested that CD57 is a marker for replicative senescence ,22. We fThree cytokine receptors  were found to be significantly upregulated on CD4+ T cells in LTNP group, indicating a polarized Th1 cell immune response in LTNP group in HIV infection. The CD4+ T cells of the LTNP group expressed higher levels of CD183 (CXCR3) than those of the BDL and VIR groups. Since CD183 is reported to be preferentially expressed on Th1 versus Th2 cells in peripheral blood ,31 and tWith regard to cell signaling, CD3epsilon expression on CD4+ T cells was found to be significantly lower in the VIR group than in LTNP, which indicates that the expression level of CD3epsilon can be used to differentiate VIR and LTNP groups. A previous study on HIV+ patients has shown that the expression of CD3 complex  is downregulated on T cells compared to healthy control , while oSignificant group-specific differences were also found for 3 cell adhesion molecules , which may have significant implications for the pathogenesis of HIV disease, since adhesion molecules can affect cell distribution, migration and immune response. CD11b was significantly upregulated on CD4+ T cells in the VIR group compared with the NEG group. This increase was also seen in the BDL and LTNP groups, but was not statistically significant. Although there is evidence for increases in CD8+/CD11b+ T cells during progression of HIV infection in asymptomatic patients , we are Interestingly, the expression levels of two NK associated receptors on CD8+ T cells, CD16 and CD56 were significantly higher for LTNP than for BDL and VIR groups, though not all detected differences reached statistical significance (p = 0.0093 to 0.0871). CD56 is expressed on a subset of CD8+ T cells (mature cytolytic effector cells) and it has previously been suggested that the defective expression of CD56 on these cells in HIV-infected individuals could contribute to the decreased peripheral blood T-cell cytotoxicity found in HIV infection . These fDotScan antibody microarray technology enabled the identification of 3 distinct HIV disease groups based on an extensive immunophenotypic characterization of the patients' CD4+ and CD8+ peripheral blood T cells. This research not only confirmed previously reported findings from flow cytometric investigations, but also demonstrated the power of the antibody microarray technology, by identifying 5 new cell surface antigens that may potentially be associated with HIV disease stages. Simultaneous screening for a large number of cell surface antigens revealed that changes in the expression of activation markers were more pronounced in CD8+ T cells, whereas changes in the expression of cell membrane receptors for cytokines and chemokines were more pronounced in CD4+ T cells.Since these changes were shown to be related to the disease status, we suggest that the use of this technology will facilitate further investigation of the causes and control of HIV disease progression and eventually lead to a better understanding of the pathogenesis of the disease. Our study is the first to demonstrate how density of cell surface antigens can be efficiently exploited in an array manner in relation to disease stages. This new platform of identifying disease markers can be further extended to study other diseases. Increasing patient group size should correspondingly improve the statistical significance of the observed differences in antigen expression associated with disease stage. A simplified protocol of direct purification of CD4+ or CD8+ T cells from whole blood may also allow a broader diagnostic utility. Serial time course studies of patients during their disease progression should also provide useful information on the modulation of cell surface antigens over time and could potentially identify new prognostic and therapeutic markers relevant to HIV disease, enabling prediction of patient responsiveness to therapy.1) Healthy HIV- individuals ; (2) HIV+ individuals on HAART with \"below detectable levels\" of plasma viremia and classed as patients controlling viremia with HAART ; (3) HIV+ individuals on HAART with detectable plasma viremia ; (4) Treatment na\u00efve HIV+ long-term non-progressors , who have maintained high CD4+ T cell counts (>500 cells/\u03bcl), with the average infection time of >20 years and natural control of plasma viremia to below detectable levels. One of the 5 LTNP patients (patient 26) in this category did show very low plasma viremia (128 HIV RNA copies/ml of plasma), but was included because this patient met all the other selection criteria.Blood (20 ml EDTA) was obtained from 26 HIV+ individuals attending HIV clinic at the Westmead Hospital Table  and 5 HIvice versa further confirmed that cross contamination was negligible and would not compromise assay specificity.A single blood sample (20 ml) was obtained from each patient. After separation of plasma, PBMC were isolated by Ficoll-gradient centrifugation and then purified. CD4+ and CD8+ T cells, respectively, were obtained by positive isolation with antibody-conjugated magnetic beads according to the manufacturer's instructions . Flow-cytometric analysis performed on separated CD4+ and CD8+ T cell populations demonstrated that in CD4+ T cell isolations 99.2% \u00b1 0.165% (mean \u00b1 SD) of cells were single positive for CD4 marker, while 99.1% \u00b1 0.128 (mean \u00b1 SD) of purified CD8+ cells were single positive for CD8 marker . AbsenceTM microarrays, prepared as previously described [Medsaic Pty. Ltd.  provided the DotScanescribed . Monoclo6 cells) was incubated for 30 min on the microarray chip, after which unbound cells were removed by gentle immersion in PBS. Captured cells were fixed and imaged using a Medsaic DotReader\u2122 and dot intensities were quantified for each antigen in duplicate using Dotscan data analysis software on an 8-bit pixel grey scale from 0\u2013255 that reflects the level of expression of a particular antigen as well as the proportion of cells expressing that antigen [Purified CD4+ and CD8+ T cell populations were tested on antibody microarrays using DotScan technology as previously described . Briefly antigen . The limThe main strength of antibody microarray is its capacity to rapidly screen for a large number of antigens, producing an extensive immunophenotype using a relatively small number of cells in a single assay. However, it would not provide all of the information obtained by flow cytometry such as multiparameter analysis on single cells and level of antigen expression per cell. When the same sample is tested by the same operator on 3 different arrays (unpublished data), the coefficient of variation (CV) for binding densities tends to be low (8.3%) for dots of high density (>50 pixels), but higher (33.3%) for dots of low density (2\u201350 pixels). Reproducible dot binding patterns can be achieved if a technically consistent standard assay protocol is followed for all assays.a priori. No fewer than 5 samples per group were included for statistical analysis, as required for the application of Medsaic's standard bioinformatics tools used in this study. Data were log transformed and log transformed antibody bindings have a symmetrical distribution which shows reasonable stability of variance with mean expression. Following transformation, the distributional properties for individual antibodies were examined using box plots and kernel density estimators. Differential expression was analysed on an antibody-by-antibody basis. Individual intra-group comparisons were first carried out, followed by pairwise inter-group comparisons between the four study groups. The \"Antibody Ranking\" analysis of the array binding results was carried out as a one way analysis of variance, which provided p values and adjusted p values for each antibody and ranked the antibodies in order of significance. P values were adjusted using Holm's method, a conservative approach to maintain strong control of an inflated type I error rate [The objective of this analysis was to identify antibody dots showing differential levels of binding of cells derived from different disease categories, where the sample categories had been established ror rate . DiffereAbbreviations used in this paper: BDL, below detection level;HAART, highly active antiretroviral therapy;   LTNP, long-term non-progressor;NEG, HIV seronegative individuals; VIR, viremic patients.The author(s) declare that they have no competing interests.JQW fully performed the work, analyzed data and wrote the paper. BW contributed to the writing. LB and JC analyzed data, did statistical evaluation, contributed to the technology and the writing. JL and DED contributed to vital patient samples and immunological interpretation of findings. WBD, JZ, ALC, NKS designed the research project, supervised this work and contributed to the writing. All authors read and approved the final manuscript."}
+{"text": "The mucosal pathogenesis of HIV has been shown to be an important feature of infection and disease progression. HIV-1 infection causes depletion of intestinal lamina propria CD4+ T cells (LPL), therefore, intestinal CD4+ T cell preservation may be a useful correlate of protection in evaluating vaccine candidates. Vaccine studies employing the cat/FIV and macaque/SIV models frequently use high doses of parenterally administered challenge virus to ensure high plasma viremia in control animals. However, it is unclear if loss of mucosal T cells would occur regardless of initial viral inoculum dose. The objective of this study was to determine the acute effect of viral dose on mucosal leukocytes and associated innate and adaptive immune responses.Cats were vaginally inoculated with a high, middle or low dose of cell-associated and cell-free FIV. PBMC, serum and plasma were assessed every two weeks with tissues assessed eight weeks following infection. We found that irrespective of mucosally administered viral dose, FIV infection was induced in all cats. However, viremia was present in only half of the cats, and viral dose was unrelated to the development of viremia. Importantly, regardless of viral dose, all cats experienced significant losses of intestinal CD4+ LPL and CD8+ intraepithelial lymphocytes (IEL). Innate immune responses by CD56+CD3- NK cells correlated with aviremia and apparent occult infection but did not protect mucosal T cells. CD4+ and CD8+ T cells in viremic cats were more likely to produce cytokines in response to Gag stimulation, whereas aviremic cats T cells tended to produce cytokines in response to Env stimulation. However, while cell-mediated immune responses in aviremic cats may have helped reduce viral replication, they could not be correlated to the levels of viremia. Robust production of anti-FIV antibodies was positively correlated with the magnitude of viremia.Our results indicate that mucosal immune pathogenesis could be used as a rapid indicator of vaccine success or failure when combined with a physiologically relevant low dose mucosal challenge. We also show that innate immune responses may play an important role in controlling viral replication following acute mucosal infection, which has not been previously identified. Identification of appropriate and reliable correlates of protection has been elusive in pathogenesis and vaccine studies. Many potential immunologic correlates have been suggested including cytotoxic CD8+ T cells, neutralizing antibodies, and preservation of memory and effector lymphocyte populations in the gastrointestinal mucosa [The recent failure of the STEP clinical trial of the MRKAd5 HIV-1 gag/pol/nef vaccine has raised important questions about vaccine development for HIV-1. Particil mucosa . Howeverl mucosa -12, havel mucosa -16.Collectively, these observations raise new questions about defining correlates of protection and how they could be more clearly distinguished in the context of future vaccine trials ,18. FurtVaccine studies using animal models often employ high doses of challenge virus to ensure a high viral set point in control animals so that a reduction of viral burden in vaccinated animals can be used as an indicator of efficacy. Unfortunately, high challenge doses do not mimic natural infection and could lead to flawed conclusions about the true efficacy of a vaccine . The majIn the present study, we employed the well-described cat/feline immunodeficiency virus (FIV) model -39 to in4 to 2.0 \u00d7 103 copies/ml plasma), 3/6 middle  and 2/5 low  dose inoculated cats. Provirus in PBMC was detected in 3/6 high, 1/6 middle and 2/5 low dose inoculated cats. Virus was isolated from unfractionated bone marrow in 5/6 high, 5/6 middle, and 5/5 low dose inoculated cats. By at least one of these measures, each cat, regardless of inoculum dose, was infected with FIV. Interestingly, although shown to be infected, eight cats did not have detectible plasma viremia.Cats vaginally infected with high, middle, or low doses of cell-associated and cell-free virus were evaluated for viral load by PCR and virus isolation. Figure Two weeks post-infection, absolute CD4+ T cell numbers in PBMC Figure  were dec7 vs. FIV-infected LPL yield of 3.94 \u00d7 107, p = 0.00037). Furthermore, a significant decrease in the percentage of CD8\u03b1+ and CD8\u03b2+ T cells was found in IEL from all dose groups as compared to controls , classic NK cells (CD56+CD3-) and NKT cells (CD56+CD3+) in blood, draining lymph node (data not shown), spleen, and IEL. Total CD56+ NK cell expression was significantly decreased in FIV-infected cats as compared to control cats in each site at eight weeks post infection Figure. . Figure Anti-Gag and anti-Env specific CD4+ and CD8+ T cell responses were assessed in PBMC, peripheral and draining lymph nodes, spleen, IEL and LPL  and Env peptides. Significant differences were noted in viremic cats when comparing the production of IFN\u03b3 by CD4+ and CD8+ T cells from the lamina propria in response to Gag versus Env peptides. This trend was also evident in CD4+ and CD8+ LPL, which produced both IL-2 and IFN\u03b3 against Gag peptides, but not Env peptides.FIV-infected, non-viremic cats were more likely to produce cytokines in response to Env peptide stimulation as compared to viremic cats. This was evident in CD4+ and CD8+ IFN\u03b3 specific responses in LPL, IL-2 responses in the draining lymph node (ILN), and IL-2+IFN\u03b3+ producing cells in the ILN. Compared to viremia positive cats, non-viremic cats also showed significant differences in anti-Env responses in CD4+ IL-2 producing PBMC. CD8+ IL-2 producing PBMC also showed a marked difference (p = 0.06). The trend of anti-Env responses was also identified in CD4+IL-2+IFN\u03b3+ LPL and CD8+IL-2+IFN\u03b3+ splenocytes.To understand the contribution humoral immunity may have played in control of viremia, we assessed anti-Gag and anti-Env responses in serum and vaginal wash samples using a highly sensitive chemiluminescent ELISA assay. Two cats did not produce antibodies against either Gag or Env, three cats produced antibodies only to Env, and six cats produced anti-Gag antibodies at levels that would not be detectable using a commercial diagnostic test for FIV. The remaining six cats produced substantial titers to Gag and/or Env Table . Almost Given the trends identified for innate, cell-mediated and humoral responses, we next determined if any of these responses correlated with control of viremia. In Figure Significant inverse correlations to viremia were identified in both PBMC and Spleen CD56+CD3- NK cells, with r = -0.51 and r = -0.52 respectively Figure . Cell me4 to 1.0 \u00d7 108, resulting in a potentially significant number of HIV-infected leukocytes in seminal fluid [Parameters of viral challenge are an important consideration in animal model pathogenesis and vaccine studies. The majority of human HIV-1 infections occur via the reproductive mucosa and frequently involve cell-associated and cell-free forms of virus -43. Furtal fluid -46. The al fluid . A goal For obvious reasons there is great interest in individuals with transient or controlled HIV-1 infection (thoroughly reviewed by Shacklett). Some stOf course, determination of virologic status depends on the sensitivity of methods used and tissue compartments that are evaluated. Clinically measurable seroconversion was only evident in 1/8 non-viremic cats, suggesting that these cats have occult infection. In this study, we used whole bone marrow, which has been shown to be a site of latency in FIV and other retroviral infections -51, to iin vitro NK cell function of elite controllers suggested a more limited role for NK cells in control of viral replication [This study also comprehensively evaluated innate, cell-mediated and humoral immunity. NK cells are an important innate immune defense, particularly against intracellular pathogens , as theylication . A limitAs numerous studies have shown an important role for cell-mediated immunity in HIV-1 control, we anticipated T cell function would be correlated with reduced viremia. However, correlation of IFN-\u03b3 and IL-2 production by CD4+ and CD8+ T cells yielded surprising results. A positive correlation to viremia was found for LPL CD4+ T cell production of IL-2 in response to Gag stimulation, with a similar trend observed for CD8+ LPL producing IL-2. In addition, while trends for inverse correlation with viremia were present for draining lymph node and LPL responses to Env stimulation, none were significant. This is in spite of significant differences in cytokine production when comparing viremic and non-viremic cats. Further, tissue specific cytokine responses in LPL were evident. Viremic cats were more likely to produce IFN\u03b3 and IL-2 against Gag peptides, whereas non-viremic cats produced IFN\u03b3 and IL-2 against Env peptides. However, these responses were insufficient to prevent the loss of CD4+ LPL and CD8+ IEL in non-viremic cats. However, we cannot dismiss the possibility that these cytokine responses may have helped reduce mucosal viral reservoirs, preventing widespread viral dissemination and viremia. As has been previously reported, control of viremia or lower viral set points are typically associated with the production of IFN\u03b3 and IL-2 within the same cell, or are typically associated with the continued ability to produce IL-2 upon stimulation ,61,62. OAnother surprising result was the strong positive correlation between anti-Env antibody production and the level of viremia. Studies of HIV-1 infected patients and SIV-infected non-human primates have divergent results with respect to anti-Env antibody responses and their role in altering progression of disease course. Some have shown that individuals with profound antibody responses progressed rapidly to AIDS -69. HoweSeveral studies of mucosal pathogenesis in HIV-1 infected humans and SIV infected macaques have focused on depletion of CD4+ LPL, as they are a primary target of infection -78. HoweA key observation in this study was that all cats, regardless of initial viral dose, experienced profound acute losses in mucosal lymphocyte populations. In a previous study we demonstrated that protected vaccinated cats had mucosal immune populations similar to control cats one year after FIV infection, while unvaccinated cats that were non-viremic had disruptions in their mucosal lymphoid compartment . In addiIn summary, this study provides valuable insight into the immune responses associated with early viral control in FIV infection. We found that NK cells may play a greater role in acute viral control than previously believed; however, other immune responses were associated with the ability of some of these cats to control viremia, and prevent seroconversion. We also show that more attention must be directed to dissecting immune responses not previously addressed in acute pathogenesis, with particular attention to innate immunity. Further, we identified the intestinal mucosa as a very sensitive indicator of retroviral infection that is independent of viral dose and seroconversion. Collectively, our data suggest that low dose challenge may be sufficient to test vaccine efficacy when considering mucosal immune integrity as a primary correlate of protection.1, a FIV pathogenic sub-group A virus [5 FIV positive cells and 9.75 \u00d7 104 TCID50 cell-free FIV (high dose), 1.88 \u00d7 105, FIV positive cells and 4.87 \u00d7 104 TCID50 cell-free FIV (middle dose) or 9.3 \u00d7 104 FIV positive cells and 2.43 \u00d7 104 TCID50 cell-free inoculum in RPMI, or were unexposed controls. Briefly, cats were sedated and placed in sternal recumbency with a small rolled towel placed under their caudal abdomen to elevate the reproductive tract. Cell-associated and cell-free viral inoculums were combined immediately prior to administration in a sterile microcentrifuge tube. The inoculum was atraumatically deposited on the mucosal surface of the vaginal vault using using a pipettor with a blunt polypropylene pipette tip and was completely absorbed in approximately five minutes.Twenty-three specific pathogen free (SPF) cats were obtained from Liberty Labs , group housed and cared for in accordance with AAALAC standards and IACUC guidelines. FIV-infected female cats included high dose (n = 6), middle dose (n = 6) and low dose (n = 5); control cats (n = 6) included 4 female and 2 neutered males. Age was six to eighteen months at euthanasia.Cats were infected with cell-associated and cell-free NCSU A virus . Cell-as4 FIV positive cells and 7.5 \u00d7 104 TCID50 cell-free and infected 6/10 control cats [1 showed that all cats vaginally inoculated with 104 - 106 FIV-positive cells became FIV-positive, whereas those infected with 103 - 102 FIV-positive cells were either negative or latently positive [5 but not 2.0 \u00d7 103 FIV-positive cells were infected three weeks post-inoculation [Inoculum dose was determined based upon the results of several mucosal inoculation studies. We have previously used a combined dose of 7.5 \u00d7 10rol cats . Other spositive . Anotherculation . Given tPlasma, serum and vaginal wash fluids were collected at weeks 0, 2, 4, 6, and 8 post-infection and processed . PeripheReal-time PCR to detect viral RNA in plasma was performed as previously described , with miReal time PCR was performed to quantify FIV provirus  using pr5 co-cultured with 3.0 \u00d7 105 FCD4-Ecells or Mya-1 cells, both of which are FIV susceptible cell lines, in triplicate in LBT medium supplemented with 100U/ml recombinant human IL-2 . Supernatants were analyzed for FIV p24 by antigen capture ELISA at 16 and 20 days of culture [Cryopreserved bone marrow samples were thawed, washed, counted and 1.5 \u00d7 10 culture . In addiMonoclonal antibodies (mAb) used for cell surface staining were directly conjugated to FITC, PE, biotin, PerCP, APC, PECy7, or Alexa 700. Previously described antibodies included anti-CD4 (3-4F4), anti-CD8\u03b1 (3.357), Streptavidin-PerCP, and Streptavidin-APC . Other aPBMC, spleen, PLN, ILN, IEL and LPL were cultured overnight in LBT medium without stimulation. Cells were then stimulated with either Gag or Env peptide pools, Con A, or media alone for six hours, with 1.5 \u03bcl/ml of 1x Monensin  present for the final five hours. Following culture, cells were washed with PBS and stained with antibodies to CD4 and CD8, washed, and fixed with 4% paraformaldehyde (PFA) for ten minutes, then washed and resuspended in PBS/2%FBS, covered and stored at -4\u00b0C. Within 24-48 hours of PFA fixation, cells were washed with Perm/Wash Buffer (BD Cytofix/Cytoperm), stained with antibodies to IFN\u03b3, IL-2, and TNF\u03b1 for 30 minutes, washed and analyzed immediately, collecting 100,000 gated events whenever possible. For analysis, cell populations were initially gated to identify the viable leukocyte population on FSC and SSC. Using this gate, CD4+ and CD8+ T cells were individually gated and CD4+ and CD8+ T cells producing IL-2, IFN\u03b3 and TNF\u03b1 in response to Gag or Env peptide stimulation identified  were coated with 1.0 \u03bcg/ml p24-GST fusion protein  and ELISAnti-envelope responses were measured using a previously described envelope fusion protein (gp95-FC) . Anti-EnComparison of viremic versus non-viremic FIV inoculated cats was completed using an unpaired t-test. Statistical analysis of differentially FIV-inoculated groups and control cats utilized a one-way analysis of variance (ANOVA) with a Tukey-Kramer multiple comparison post-test or nonparametric ANOVA  with Dunn's multiple comparison post-test. The choice of test was dictated by testing the assumptions necessary for parametric methods, such that if a parametric method was not appropriate, non-parametric testing was used. Significance was defined as p \u2264 0.05. Analyses were completed using GraphPad InStat version 3.05 .The authors declare that they have no competing interests.KH designed and coordinated the study, collected and processed biological samples, performed FACS assays and virus isolation, analyzed data, performed statistical analysis and drafted the manuscript. SR helped design the study, collected and processed biological samples, performed FACS assays and assisted in data analysis. EE collected and processed biological samples, performed PCR and ELISA assays and assisted in data analysis. GD helped design the study, critically reviewed the results and helped to draft the manuscript. All authors read and approved the final manuscript.Supplemental Figure 1. Gating strategy for intracellular cytokine assessment. Samples stained for surface and intracellular antigens were gated based on forward and side scatter (A). The gated population was used to identify CD4+ and CD8+ T cells (B). Using either CD4+ or CD8+ T cells as the parent gate, specific staining for IFN\u03b3 (y-axis) and IL-2 (x-axis) are shown for unstimulated (C) and stimulated samples (D) from the same medial iliac lymph node. For analysis, the percent of cells staining positively in unstimulated samples was subtracted from stimulated samples to determine net cytokine production reported in Figure Click here for file"}
+{"text": "Timely access to antiretroviral therapy is a key to controlling HIV infection. Late diagnosis and presentation to care diminish the benefits of antiretrovirals and increase risk of transmission. We aimed to identify late presenters in patients sent for first CD4 T cell count after HIV diagnosis, for therapy initiation evaluation. Further we aimed at identifying patient factors associated with higher risk of late presentation.Retrospective data collection and analysis was done for 3680 subjects visiting the laboratory for CD4 T cell counts between 2001 and 2007. We segregated the patients on basis of their CD4 T cell counts after first HIV diagnosis. Factors associated with risk of late presentation to CD4 T cell counts after HIV diagnosis were identified using univariate analysis, and the strength of association of individual factor was assessed by calculation of odds ratios.p < 0.001), and older age groups of 45 years and above (p = 0.0004) to late presentation. Female sex, children below 14 years of age and sexual contact with HIV positive spouse were associated with significantly lower risks to presenting late. Intravenous drug users were also associated with lower risks of late presentation, in comparison to heterosexual transmission route.Of 3680 subjects, 2936 (83.37%) were defined as late presenters. Late testing varied among age groups, transmission categories, and gender. Males were twice as likely to present late as compared to females. We found significant positive association of heterosexual transmission route (The study identifies HIV infected population groups at a higher risk of late presentation to care and treatment. The risk factors identified to be associated with late presentation should be utilised in formulating targeted public health interventions in order to improve early HIV diagnosis. AIDS is a dreaded disease, as even with recent advances in the field of medicine and public health, no effective vaccine or drug therapy is available to completely eliminate the infection. During the natural course of HIV infection, there is a progressive loss of CD4 T cells; the rate of this loss being variable in patients, but averaging around 60-100 cells/uL per year . This drIntroduction of highly effective antiretroviral therapy (HAART) has substantially improved patient prognosis over the past decade ,6. TestiRecent data indicates that early initiation of HAART is advantageous when opportunistic infections are present , as the India, with 2.27 million people living with HIV/AIDS and a disease prevalence of 0.29% (2008-09), accounts for roughly half of Asia's HIV prevalence. New Delhi, the area where the study was conducted, is a low prevalence state. However, being the nation's capital, the state sees a huge influx of immigrants and truckers, thereby increasing the high risk population. Most of the infections occur through the heterosexual route, though the major transmission route in north-eastern India is injection drug use. The first phase National AIDS Control Programme (NACP) was launched in 1992 with the objective of slowing down the HIV infections in order to reduce the morbidity, mortality and impact of HIV epidemic in the country. Since then, the third phase of NACP has been planned and implemented in 2007 with the objective of halting and reversing the HIV epidemic in India over a period of five years. The guiding principle of the NACP - III objectives is provision of universal access to HIV prevention, care, and support and treatment services. The current HIV testing guidelines states client initiated testing, except in case of pregnant females in which case HIV testing is provider initiated. HIV treatment and monitoring is universally accessible and free of cost at NACO designated clinics, and one such clinic is housed in the AIIMS, which is the study's focus. The institute's HIV division consists of an Integrated Counselling and Testing Centre, in addition to a CD4 monitoring laboratory and treatment clinic, all funded and supported by the national program and NACO. The CD4 monitoring laboratory at AIIMS, is housed in the Microbiology department, and provides the monitoring services to all patients referred to it through various OPDs, wards, and specialty clinics at AIIMS providing HIV treatment and care.This is a retrospective cross sectional study of all individuals coming for CD4 testing for the first time after HIV diagnosis , to the CD4 testing laboratory at the Department of Microbiology, All India Institute of Medical Sciences. Subjects included 3,680 HAART na\u00efve individuals with a confirmed diagnosis of HIV with or without clinical symptoms, coming to the laboratory between 2001 and 2007. Subjects on antiretroviral therapy at the time of first visit to the laboratory were excluded from the present study analysis. Similarly, subjects with a positive HIV diagnosis more than one month before entering the HIV care services at AIIMS were also excluded from the study in order to control for the time since first HIV diagnosis. The All India Institute of Medical Sciences Institute Ethics Committee (AIIMS IEC) approved routine HIV diagnosis and CD4 testing.For data analysis, as made classically all subjects with CD4 T+ cell count below 200 cells/uL were classified as 'late presenters to care\". Subjects were also stratified into late and very late presenters depending on their CD4 T cell counts being below 200 cells/uL and below 50 cells/uL respectively. Further, subjects with CD4 T cell counts above 200 cells/uL but with chronic clinical symptoms like fever, diarrhoea, weight loss etc, were also included in the category of late presenters to care and in need of immediate start of HAART.Laboratory CD4 test subject database was accessed to obtain following patient characteristics: age, sex, date of CD4 testing, HIV transmission route as reported by the patient, and clinical classification of patients on presence or absence of symptoms. Presence of TB, both pulmonary and extrapulmonary, and Sexually Transmitted Diseases (STDs) were also recorded.Medians were calculated for study variable: age, CD4 T cell counts, etc. Univariate regression analysis was performed to identify patient factors which varied among late presenters and non-late presenters. Multinomial logistic regression analysis was performed to identify independently associated patient factors with risk of presenting late for HIV related treatment and care. Confidence intervals at 95% level of confidence were calculated for each associated factor. A p value of 0.05 or less was considered significant.During 2001-2007, a total of 4,260 patients were tested for CD4 T cell counts at the laboratory. Of these subjects, 3,680 subjects coming for HAART initiation evaluation were retrospectively included in the study, excluding subjects coming for follow-up visit or subjects already on antiretroviral therapy at the time of first visit to laboratory. Patient characteristics according to CD4 T cell counts is summarized in Table Majority of subjects presented with one or more AIDS related and/or AIDS defining illnesses ,12 at thThe study group had a median CD4 T cell count of 242 cells/uL. Males had a lower median CD4 T cell count (207 cells/uL) as compared to females (243 cells/uL) with this difference being statistically significant (p < 0.001). Of the total study population, 2,113 (57.4%) had CD4 T cell counts more than 200 cells/uL, 1,214 (33%) had CD4 T cell count below 200 cells/uL, and 353 (9.6%) had less than 50 CD4 T cells/uL. Patient characteristics according to CD4 T cell counts are summarised in Table Subjects with less than 200 CD4 T cells/uL with (n = 1086) or without clinical symptoms (n = 120), and subjects with clinical HIV infection irrespective of CD4 T cell counts (1509), were together termed as \"late presenters to care\". Further, subjects with less than 50 CD4 T cells/uL were termed \"very late presenters\", of which 340 subjects were symptomatic and 13 subjects did not have any clinical symptoms. Four hundred and seventy three (473) late presenters (17.4% of 2723 late presenters) and 91 very late presenters  had clinically defined AIDS at the time of first presenting to the laboratory.Univariate analysis was performed for association between patient characteristics and late presentation, summarised in Table Multinomial logistic regression analysis was carried out to identify patient factors independently associated with late and very late presentation to care. In this analysis we found that females were at a significantly lower risk to present late or very late for CD4 testing as compared to their male counterparts . Similarly age groups 35-44 years , and age group of 45 years and above  were associated with higher frequency of late presentation.On analysing various transmission routes reported by subjects for their association with propensity for late presentation to care, transfusion of blood and blood products, homosexual transmission, occupational exposure and those unaware or unwilling to disclose probable route of HIV acquisition, were all found to increase the risk of late presentation. Further we observed that female sex, age at presentation less than 25, mother to child route of transmission, HIV transmission through sexual contact with infected spouse, and intravenous drug abuse, were all associated with decreased chances of delayed or late presentation to care with most associations statistically significant Table .Late presentation with low baseline CD4 T cell counts and presence of AIDS defining and/or AIDS associated symptoms is the strongest prognostic marker for early mortality in both low and high income countries. Generally late testing and presentation to HIV care centres and programs is a result of diagnostic testing as a consequence of symptoms, while earlier diagnosis is more typical of patient self-request for testing, self-perceived risk, or universal screening . An alarIn the present retrospective study, we set out to examine the level of late presentation to care of HIV infected Indian individuals in a tertiary health care setting and to identify the extent of immunosuppression in these subjects along with presence of opportunistic infections. The study population was mostly male of the reproductive age group of 25-44 years thereby highlighting the most affected population. The significantly low number of females coming to the laboratory for CD4 T cell count underscores the vast gap in health care uptake between males and females. Heterosexual route of transmission was the most common transmission route reported by patients as a possible mode of disease acquisition as is true for majority of HIV cases reported throughout India.Pneumocystis carinii pneumonia, along with patients having less than 200 CD4 T cells/uL of blood at the time of first CD4 T cell count, were classified as late presenters to care. We argued that the presence of chronic illnesses like fever and diarrhoea etc though not AIDS defining, are major pointers to raise suspicion of a possible HIV infection. Further such symptoms would highlight disease chronicity and thus should be labelled as a missed opportunity for early diagnosis and care. Nearly 80% of subjects were classified as late testers based on above criteria. This proportion is very high compared to other studies. As the setting for the study was one of the nation's largest tertiary health care facilities, majority of patients are referred here after efforts to treat them at primary and secondary health care levels and also at private settings. Therefore the proportion of sick and very sick patients is usually higher at the laboratory as compared to the clientele in private or secondary healthcare settings, and can partly explain the huge proportions of late presenters in our study. Also, our inclusion of chronic symptoms associated with HIV infection in addition to AIDS defining events and low CD4 T cell counts further increased this already large number of late presenters. A sizeable number of patients (15.4%) had CDC stage C HIV infection, ie clinical AIDS. This high number of AIDS cases at time of first presentation to care marks an alarming trend, clearly showing the lack of knowledge, and low risk perception of being possibly HIV infected and warrants further and renewed emphasis on health literacy.Several previous studies have reported various ways of characterising late presenters to care. In our study, patients having AIDS associated symptoms like chronic diarrhoea, chronic fever, unexplained weight loss, oral ulcers, etc and AIDS defining illnesses like pulmonary and extra-pulmonary Tuberculosis (TB), STDs, Bacterial diarrhoea, Of all subjects studied, 14.4% had a pulmonary or extrapulmonary TB event at first time presentation to care. Management of TB in late presenters with CD4 T cell counts less than 200 cells/mL is a challenge due to an increased risk of developing IRIS and additive drug toxicities and interactions resulting from antimycobacterial therapy. Treatment in case of suspected IRIS involves close monitoring and symptomatic administration of steroidsAt the time of first CD4 T cell count, 33% of subjects had a CD4 T cell count below 200 cells/uL with 9.5% subjects having CD4 T cell count below 50 cells/uL. This huge number of immunocompromised patients at first visit comprises subjects in need of immediate HAART initiation. Further when segregated on symptoms, 120 patients with CD4 T cell counts less that 200 cells/uL were found to be asymptomatic. As a sizeable part of the study population were ones who visited the laboratory before government of India roll out of free public sector ART and free CD4 testing facilities for HIV infected patients, many subjects without any apparent HIV related symptoms would have been missed for initiation of HAART. Further we observed in our study population, presence of patients with CD4 T cell counts well above 200 cells/uL and with chronic HIV associated symptoms without any AIDS defining illness. Treatment strategy for these patients is not clear in the currently available HIV-1 infection treatment guidelines, and thus most of them just get symptomatic treatment instead of initiation of HAART, thereby limiting the beneficial aspect of early HAART initiation. Men had a lower CD4 T cell count at first presentation to care for HAART evaluation as compared to females, which is consistent with previous study results. This can be attributed to the proportionately low utilization of health care facilities by men as compared to women.In order to identify patient factors associated with late presentation to care, we performed multinomial logistic regression analysis to check the strength of association of each factor independently with late and very late presentation events. The factors associated with a risk of delayed presentation to care as uncovered in present study are consistent with results in other such studies -19. HeteAssociation of higher age groups of 35-44 years ages 45 years and above seen in our study with late and very late presentation to care has been emphasized in literature ,22,23. HIn view of the results, there is a need for expanded routine testing of HIV infection with a stronger focus on men who are observed as most vulnerable population for late presentation. Also, emphasis should be given to testing for HIV in higher age group subjects as they are also more likely to be late presenters. The increased proportion of late presenters highlights the delay in treatment to these individuals, indicating the need to develop national level strategies effective in promoting early diagnosis and of HIV infection in order to increase the impact of universal access HAART. In view of the public health implication of early HIV diagnosis for reducing HIV transmission and preventing late presentation, HIV testing should be more frequently prescribed in all health care settings.The authors declare that they have no competing interests.KM and MV contributed to study inception. MV supervises the laboratory involved in HIV diagnosis and testing. KM, MV, NKC, and SM participated in data analysis, and interpretation. MV provided data analysis inputs. KM and MV drafted the manuscript. All authors read and approved the final manuscript. MV takes responsibility for the paper as a whole.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/416/prepub"}
+{"text": "Many HIV-infected patients only access health care once they have developed advanced symptomatic disease resulting from AIDS Defining Conditions (ADCs). We carried out a study to establish the effect of ADCs on immunological recovery among patients initiated on antiretroviral therapy (ART).A retrospective cohort of 427 HIV-1 patients who were initiated on ART between January 2002 and December 2006 was studied. Data on ADCs was retrieved from Joint Clinical Research Centre (JCRC) data base and backed up by chart reviews. We employed Kaplan-Meier survival curves to estimate median time to 50 CD4 cells/\u03bcl from the baseline value to indicate a good immunological recovery process. Cox proportional hazard models were used at multivariate analysis.3 . A low baseline CD4 count of \u2264 200 cells/\u03bcl  was associated with a longer time to immunological recovery. There was no interaction between low CD4 counts and ADC group.The median time to gaining 50 CD4 cells/\u03bcl from the baseline value after ART initiation was longer in the ADC (9.3 months) compared to the non-ADC group (6.9 months) . At multivariate analysis after adjusting for age, sex, baseline CD4 count, baseline HIV viral load, total lymphocyte count and adherence level, factors that shortened the median time to immunological recovery after ART initiation were belonging to the non-ADC group , adherence to ART of \u2265 95%  and a total lymphocyte count \u2265 1200 cells/mmPatients with ADCs take longer to regain their CD4 counts due to the defect in the immune system. This may prolong their risk of morbidity and mortality. During 2005, the World Health Organization (WHO) had estimated that there were over 1.3 million people receiving anti retroviral therapy (ART) in low and middle-income countries, representing 20% of 6.5 million estimated to need it [As the number of individuals able to access treatment is increasing, one of the challenges facing ART services in sub-Saharan Africa is that many HIV-infected patients only access healthcare once they have developed advanced symptomatic disease resulting from AIDS Defining Conditions (ADCs). The medThis study was a retrospective cohort. JCRC is one of the established centers providing ART and is located in Kampala, the capital city of Uganda. It was founded in 1991 and has been providing anti-retroviral therapy since1996. Combination ART (cART) became available in 1998 but was quite expensive at that time. Generic Fixed Drug cART which was much cheaper(about $50/month) and more accessible by 2002 under the UNAIDS/Ministry of Health (Uganda) HIV Drug Access Initiative Programme . We retrDiagnosis was done and documented in the charts by the attending physician. This depended on history from the patient, clinical examination, and backed up by laboratory results. HIV wasting syndrome was defined as more than 10% documented loss of body weight and either unexplained chronic diarrhea (> one month), or chronic weakness and unexplained prolonged fever (> one month) with pyrexia recorded on at least on one occasion . CryptosLaboratory measurements included a complete blood cell count, CD4 lymphocyte count, and quantitative measurement of HIV load. Quality control assurance was done in reference to international accredited laboratories; UK National External Quality Assessment Service (UKNEQAS) and College of American Pathologists (CAP).Viral load count was done with use of Amplicor monitor standard assay, version 1.5 (Roche Molecular Systems), with a minimum detection limit of 400 copies/ml. In 2006, an assay with a detection limit of 50 copies/ml was acquired by the unit. Viral load count was not consistently done.CD4 lymphocytes were analyzed by flow cytometry . This was periodically done every 6 months during the routine visit to the out-patient clinic. Frequently, this schedule was not routinely followed and depended upon the discretion of the attending physician during the interim visits when patients were sick. The time to immunological recovery was estimated to the nearest clinic visit and CD4 count. We right censored patients if they were lost to follow-up after a period exceeding 12 weeks or when failed to gain 50 CD4 cells/\u03bcl above the baseline value. A patient was considered lost to follow-up if did not make contact with JCRC out-patient clinic for a period exceeding 90 days during the study period. Adherence to ART was determined according to the patient's previous four days recall when visited the JCRC out-patient clinic and was considered when the patient took \u2265 95% of the prescribed medications .We aimed to achieve a sample size with a power of 90% to detect the differences between ADC and non-ADC group, and was estimated using formula for survival analysis . We set st 2002 and December 31st 2006, at JCRC out-patient clinic. This number excludes patients who are currently enrolled in ongoing clinical trials and patients who were monitored by physicians outside the JCRC facility but receiving ART at JCRC pharmacy, whose data is stored else where. A total of 182 records were excluded because the patients were seen once at ART initiation and lacked follow-up visits or had previous exposure to dual ART. The remaining 427 patients whose records were used for analysis, had baseline CD4 load count and had been seen on one or more subsequent visits within a period of 12 months follow-up  patients attained immunological recovery during the study period, giving an overall immunological recovery rate of 2.5 per 1000 patient-days. The proportions of patients achieving immunological recovery were 13.0% (18/138), 39.9% (55/138), 56.5% (78/138), 71.7% (99/138) in the ADC group at 3, 6, 9 and 12 months respectively. For the non-ADC group, the proportion of patients achieving immunological recovery were 13.1% (38/289), 40.8% (118/289), 64.0% (185/289), 77.2% (223/289) at 3, 6, 9 and 12 months respectively. The median time to immunological recovery in the ADC group was longer than that of the non-ADC group (271 vs 208 days),   were associated with reduced time to attain immunological recovery. A low baseline CD4 count (\u2264 200 cells/\u03bcl) and a high viral load count (\u2265 6.0 log copies/ml) were associated with a longer time to attain immunological recovery (Table Old age (> 40 years), having no ADC at ART initiation, a baseline total lymphocyte count of \u2265 1200 cells/mm3 and those with adherence to ART was equal or greater than 95%. A low baseline CD4 count of \u2264 200 cells/\u03bcl at ART initiation was associated with a longer time to immunological recovery  in the ADC group compared to 208 days (6.9 months) in the non-ADC group. The ADC group status was associated with a longer median time to immunological recovery after ART initiation in comparison to the non-ADC group. Factors that were independently associated with time to immunological recovery were group status (presence or absence of ADC), baseline CD4 count, baseline total lymphocyte count and adherence to ART. Although, immunological responses to ART have been estimated to be at least an increase of 50\u2013100 CD4 cells/\u03bcl/year after ART initiation, the median time to attain this CD4 cell threshold has not been documented ,16. We tThe differences in median times to immunological recovery between the ADC and non-ADC group found in our study may be a result of profound pre-treatment immuno-suppression which is a common feature of ADCs. The ADCs cause a loss of CD4 memory cells that represent a component of the T-cell repertoire that is specific to most ADC infections. The defect in the CD4 memory cells as a result of ADCs accounts for the inability of patients with ADCs to respond to recall antigens and evoke immunological responses leading to a slower immunological recovery process compared to patients without ADCs . Another3) and adherence to ART (\u2265 95%). The hazard of attaining immunological recovery reduced when comparing a patient with \u2264 200 CD4 cells/\u03bcl to a patient with > 200 cells/\u03bcl by 50%. Our results are consistent with other studies where immunological recovery is largely dependent on baseline CD4 count and thus the timing of ART initiation is important in order to maximize the CD4+ T-cell response to therapy [Other determinants that favored a good immunological recovery process after ART initiation were a baseline CD4 count (> 200 cells/\u03bcl), baseline total lymphocytes count  where increasing age was associated with a slower and lower immunological recovery due to age-related decreases in thymopoiesis . The 2 cWe also found no effect of sex on median time to immunological recovery. Our findings are similar to other findings else where that show that there are no gender differences between males and females regarding response to ART . On the We recognize our study had the following limitations;2 for men and < 18.5 kg/m2 for women is predictive of poor immunological recovery, increased morbidity and mortality [Our study design did not allow for the control of all possible confounders as it was retrospective cohort. We relied on measurements taken in the past and where a possible confounder was not measured we could not control for it. For example, we were not able to determine the effect of Body Mass Index (BMI) as height measurements were only available in about 35 patients. Although the baseline body weights were available, subsequent measurements during the follow-up visits were missing and only available in 40 patients. A baseline BMI of < 20.3 kg/mortality ,30. We wThe time taken to attain 50 CD4 cells/\u03bcl after ART initiation was estimated according nearest date of visit to JCRC outpatient clinic when the CD4 count was done. This estimation could have over or underestimated the true estimate. To minimize errors in estimation of time to attain 50 CD4 cells/\u03bcl both the principal investigator and data entrant independently calculated the time, and where differences arose an average was taken. Overall inter-observer kappa statistic was 0.68.Another bias could have resulted from under diagnosis of ADCs because of lack of diagnostic equipments, a common finding in resource limited settings. It is surprising that some of the ADCs were not diagnosed during 2002\u20132006 when we reviewed records, whereas had been found to be prevalent by other study sites. For example in a nearby main referral hospital, 18% of hospitalized patients presented with non-typhoid salmonella, as an ADC in blood stream . We miniSome of the immune responses after ART initiation were likely to have been evoked by immune reconstitution syndrome (IRS) and diagnosed as ADCs. This is an inflammatory response against infectious and non-infectious antigens and usually occurs within 12 weeks after ART initiation . HoweverWe could also not explain a big loss to follow-up of patients who had enrolled for ART as it was inadequately documented. Of 609 who were eligible and enrolled for ART, 182 (29.9%) could not come for second or subsequent review visits. We could explain the loss follow-up could have resulted from deaths due to profound immuno-suppression at ART initiation. Our findings may have overestimated individuals achieving immunological recovery, as those who died from an AIDS-defining disease shortly after starting ART were excluded from the analysis. It is also possible that these patients sought treatment in other treatment centers elsewhere. Since 2003, Uganda has benefited from roll-out program for ART services where more centers have been accredited to offer HIV services and treatment has been either subsided or become free. The loss to follow-up of 29.9% could have resulted into affecting the generalizability of the study findings. This was minimized by taking precautions to prevent under or over diagnose ADCs by chart review, and correct estimation of time to end points from baseline value by taking independent measurements. Secondly, the baseline characteristics of the patients who were lost to follow-up were similar to the patients who had a subsequent follow-up after the baseline visit . Lastly, findings of this study are strengthened by the relatively homogeneous study population receiving treatment at a single health facility using the national treatment protocols. Patients were all ART-na\u00efve and received a standard triple-drug regimen.We can draw the following conclusions from the study;Patients with ADCs take longer to regain their CD4 counts due to the defect in immune system. This may prolong their risk to morbidity and mortality as a result of opportunistic infections. This paper provides a very strong argument for earlier ART initiation in a Ugandan setting. A key challenge is how to identify and initiate ART among patients with less advanced disease. Early Voluntary Counseling and Testing (VCT), the promotion of VCT within community settings so that people know their HIV sero-status and those who are HIV positive are encouraged so seek early health interventions is one option. Another option would be starting ART at above the threshold of 200 CD4 cells/\u03bcl. Recently, the Ugandan ART guidelines has recommended initiating ART at 250 and to 350 cells/\u03bcl among pregnant women [The authors declare that they have no competing interests.BKK: Study concept and design, data analysis, interpretation of the study findings and wrote-up the manuscript. SS, MP, BN, CK, EK: Assisted in the interpretation of study findings and the critical revision the manuscript. JK: assisted in data analysis, interpretation of study findings and the critical revision of the final manuscript. MO: Queried and extracted data from JCRC database. PM: assisted in critical revision and the final approval of manuscript. FS: Assisted in the study concept and design, interpretation of the study findings and the critical revision of the manuscript."}
+{"text": "HIV controllers are rare individuals who spontaneously control HIV replication in the absence of antiretroviral treatment. Emerging evidence indicates that HIV control is mediated through very active cellular immune responses, though how such responses can persist over time without immune exhaustion is not yet understood. To investigate the nature of memory CD4+ T cells responsible for long-term anti-HIV responses, we characterized the growth kinetics, V\u03b2 repertoire, and avidity for antigen of patient-derived primary CD4+ T cell lines. Specific cell lines were obtained at a high rate for both HIV controllers (16/17) and efficiently treated patients (19/20) in response to the immunodominant Gag293 peptide. However, lines from controllers showed faster growth kinetics than those of treated patients. After normalizing for growth rates, IFN-\u03b3 responses directed against the immunodominant Gag293 peptide showed higher functional avidity in HIV controllers, indicating differentiation into highly efficient effector cells. In contrast, responses to Gag161, Gag263, or CMV peptides did not differ between groups. Gag293-specific CD4+ T cells were characterized by a diverse V\u03b2 repertoire, suggesting that multiple clones contributed to the high avidity CD4+ T cell population in controllers. The high functional avidity of the Gag293-specific response could be explained by a high avidity interaction between the TCR and the peptide-MHC complex, as demonstrated by MHC class II tetramer binding. Thus, HIV controllers harbor a pool of memory CD4+ T cells with the intrinsic ability to recognize minimal amounts of Gag antigen, which may explain how they maintain an active antiviral response in the face of very low viremia. HIV infection, if left untreated, leads to the progressive disruption of the immune system, the destruction of the CD4+ T cell population, and the occurrence of multiple opportunistic infections. However, a small fraction of HIV-infected individuals (less than 1%) avoid these deleterious effects by spontaneously controlling HIV replication to very low levels in the absence of antiretroviral therapy. Emerging evidence indicates that these rare patients, named HIV controllers, contain HIV through a very active T cell-mediated immune response. In this study, we found that memory CD4+ T cells from HIV controllers had the capacity to respond to minimal amounts of antigen derived from the viral protein Gag. This property was intrinsic to controller CD4+ T cells, and resulted from the expression of T cell receptors (TCRs) with high avidity for a particular Gag peptide. The presence of high avidity CD4+ T cells may explain how HIV controllers maintain the antiviral immune response in constant alert, even though the amount of virus inducing this response is minimal. Based on this study, we propose that future candidate vaccines against HIV should induce high avidity memory CD4+ T cells, to mimic the rapid and persistent antiviral response characteristic of HIV controllers. HIV controllers are rare individuals who spontaneously control HIV replication in the absence of antiretroviral treatment Emerging evidence indicates that controllers suppress HIV replication through a very active immunological process. HIV controllers harbor effector memory CD8+ T cells capable of rapidly killing infected autologous CD4+ T cells through a cytotoxic mechanism involving the upregulation of perforin and Granzyme B One element contributing to the persistence of an active immune response may be the quality of the HIV-specific central memory (CM) compartment. CM T cells are thought to be responsible for the long-term maintenance of immune memory, due to their long half-life, high proliferative potential, and capacity to replenish the pool of effector and effector memory (EM) T cells that directly control pathogens in vitro, comparing primary CD4+ T cell lines derived from HIV controllers and efficiently treated patients with equivalent duration of infection. We found that HIV controller harbored a pool of memory CD4+ T cells able to differentiate into effector cells with high functional avidity for an immunodominant Gag epitope. This heightened sensitivity to Gag antigen could be explained by a high avidity interaction between the TCR and the peptide/MHC complex, as measured by class II tetramer binding. The capacity to mount a CD4 recall response in the presence of minimal amounts of Gag antigen may help explain how HIV controllers maintain a continuously activated antiviral response in spite of very low viremia.We have previously shown that signs of CD4+ T cell immune activation could be detected in HIV controllers who nevertheless had an intact CM CD4+ T cell compartment, with preserved IL-2 secretion capacity and efficient proliferative responses Memory CD4+ T cell responses were compared in patients who spontaneously controlled HIV replication  and in patients who achieved viral control following successful antiretroviral therapy . Patients in both groups had viral loads <40 HIV RNA copies/ml plasma. The duration of infection and the CD4+ T cell count did not differ significantly between the two groups .Ex vivo IFN-\u03b3 ELISPOT responses to the 3 Gag peptides were low, as expected for CD4 responses directed to single HIV peptides (ex vivo response to Gag293 while only 1/13 Controller responded to Gag161 (P<0.05). This finding supported the notion of a higher frequency of Gag293-specific than Gag161-specific CD4+ T cells in Controller patients. Taken together, these observations suggested that the HIV controller status may be associated with a change in the immunodominance pattern of Gag CD4 epitopes.We analyzed the properties of memory CD4+ T cell precursors by determining their capacity to generate CD4+ T cell lines specific for three immunodominant HIV-1 Gag peptides . The peppeptides . HoweverAs controls, we generated CD4+ T cell lines specific for the CMV pp65 protein. Since the immunodominance pattern of CMV responses proved more variable than that observed for HIV-1, we optimized the generation of CMV-specific CD4+ T cell lines by choosing the pp65 peptide in function of the HLA DR genotype of the patients  [31]\u2013[33CD4+ T cell lines typically showed an initial loss of cells due to apoptosis, followed by growth due to multiplication of HIV- or CMV-specific cells. Measurement of the growth ratio at day 7 showed that viable CD4+ T cells lines from HIV controllers had a faster growth kinetics than those from treated patients, with a significant difference in response to the 3 Gag peptides but not in response to CMV peptides . Analysi6 cells\u200a=\u200a7,716), while most cell lines from treated patients remained negative. However, the fact that cell lines from treated patients had not yet entered the exponential growth phase could account for these differences. To compare CD4+ T cell lines at equivalent growth stages, all following measurements were made at doubling time . In these conditions, IFN-\u03b3 production remained higher in the HIC group compared to the HAART group in response to the immunodominant Gag293 peptide . However, we observed that the shapes of the response curves differed, with a marked trailing end in the HIC group, suggesting the presence of a high avidity component within the responding CD4+ T cell population . In contrast, functional avidities measured for Gag263, Gag161, and CMV peptides did not differ significantly between groups. These results pointed to a particular efficiency of CD4+ T cells specific for the immunodominant Gag293 in HIV controllers. Interestingly, the functional avidity of these cells correlated with the level of the IFN-\u03b3 response measured by ELISPOT assay at high peptide dose . Thus, CD4+ T cells responses to Gag293 appeared both sensitive and potent in the group of controller patients.This analysis revealed that the functional avidity of CD4+ T cells recognizing the immunodominant Gag293 peptide was higher in HIV controllers . In the Patients were genotyped for the HLA DRB1 gene at 4 digit resolution. 6 cells\u200a=\u200a2458, n\u200a=\u200a6) than DRB1*0701-negative individuals . Taken together, these findings suggest that the DRB1*0701 allele may confer an increased chance to acquire a controller phenotype upon HIV infection, but that once the controller phenotype is established, the presence of the DRB1*0701 allele does not confer further benefit in terms of CD4+ T cell function.To further explore the possibility that DRB7*0701 conferred an advantage in CD4+ T cell memory function, we compared functional parameters in DRB1*0701 positive versus DRB1*0701-negative individuals included in the study. We did not detect significant differences within the HIC group in terms of growth ratio, IFN-\u03b3 response, or functional avidity of CD4+ T cells following Gag293 stimulation. Within the HAART group, DRB1*0701-positive individuals showed lower IFN-\u03b3 responses  cells for all the patients tested, confirming the antigen specificity of the cell lines (representative examples in lo) was comparably high for the 3 HIC and 3 HAART cell lines analyzed  did not show significant differences between the HIC and HAART groups. However, the shape of the binding curves differed between groups, with a persistence of detectable binding at low tetramer concentrations in the HIC group . One should note that the growth ratio of CD4+ T cell lines depended on the intrinsic proliferative capacity of specific cells but also on the frequency of these specific cells at the initiation of culture. We have previously shown that the frequency of p24 Gag-specific cells measured ex vivo by intracellular cytokine staining was approximately 3 fold higher in HIV controllers than in efficiently treated patients et al.The genetic background may play a role in conferring a better ability to mount high avidity CD4+ T cell responses. The increased frequency of HLA DRB1*0701 in the controller group could suggest a beneficial effect of this allele on the development of anti-HIV CD4 responses. However, since we did not detect an association between the presence of HLA DRB1*0701 and the level or avidity of the CD4 response within the controller group, we speculate that this allele may play a role in initially facilitating viral control, rather than in maintaining high avidity CD4+ T cells. Alternatively, HLA DRB1*0701 may be in linkage disequilibrium with a protective MHC class I allele associated with viral control. A beneficial effect of the HLA DRB1*13 alleles on CD4 responses has also been suggested The selection of high avidity gag-specific CD4+ T cells may result from a lower exposure to HIV antigens during the acute infection stage, when the repertoire of responding T cells is initially shaped. The few reported cases of acute HIV-1 infection followed by spontaneous viral control support the notion of a lower viral peak in patients who acquire a controller status On the other hand, we cannot rule out that high avidity Gag-specific CD4+ T cells are selected but subsequently lost in progressor patients. Since high avidity CD4+ T cells are the first to respond in the presence of low HIV antigen amounts, they may be the first to get activated in the presence of replicating HIV, and may represent the initial wave of target cells available to the virus. HIV is known to preferentially infect HIV-specific cells In conclusion, this study provides evidence for the presence of high avidity CD4+ T cells directed against Gag in HIV controllers. It is remarkable that the distinctive properties of HIV-specific T cells in Controllers, including high proliferative potential HIV controllers  were recruited through the French \u201cObservatoire National des HIV Controllers\u201d established by ANRS. HIV controllers were defined as HIV-1 infected patients who had been seropositive for >10 years, had received no antiretroviral treatment, and for whom >90% of plasma viral load measurements were <400 copies of HIV RNA/ml. All HIV controllers included in the present study had current viral loads <40 copies/ml. Control groups included: (1) HAART group (n\u200a=\u200a20): HIV-1 infected patients successfully treated with antiretroviral therapy for more than 5 years and with a viral load <40 copies of HIV RNA/ml; (2) VIR group (n\u200a=\u200a10): viremic patients with viral loads >10,000 copies HIV RNA/ml. Viremic patients had been infected with HIV-1 for more than 1 year and had not received antiretroviral therapy. Patients from the HAART and VIR groups were recruited through the SEROCO-HEMOCO cohort and the Bic\u00eatre hospital.The study was promoted by ANRS under number EP36 and approved by the Comit\u00e9 de Protection des Personnes IDF VII under number 05\u201322. All participants gave written informed consent prior to blood sampling.6 cells per well in 24-well plates in the presence of one HIV-1 Gag or pp65 CMV peptide (10 \u00b5M) in RPMI 1640 supplemented with 10% human AB serum, 2 mM L-glutamine, 10 mM HEPES, 100 ug/ml penicillin/streptomycin, 0.5 \u00b5M AZT, 5 nM Saquinavir and 5 ng/ml recombinant IL-7 (Cytheris). The peptides used to stimulate the culture were highly purified 20-mers . Recombinant IL-2 was added after 2 days to a final concentration 100 U/ml. Cell lines were restimulated with IL-2 every 2 days until the end of culture. Starting from day 7, cells were counted every day by trypan blue exclusion to determine the growth ratio (GR: observed number of cells/number of input cells at day 0). The CD8+ T cell population represented a median of 5.9% (range: 0\u201322.7%) of the CD3+ population. CD8+ T cells were depleted with magnetic beads  at doubling time (GR\u200a=\u200a2), before performing functional assays. Less than 1% CD8+ T cells remained after CD8 depletion , according to the manufacturer's instructions. The kit covered approximately 70% of human V\u03b2 specificities. The V\u03b2 nomenclature is that of Wei Data are expressed as medians and range. Analyses were performed with the GraphPad Prism 5.0 software, using nonparametric statistical tests in all cases. Differences in variables between groups were analyzed with the Mann-Whitney U Test. Differences in percentages of response were analyzed with the Fisher's exact test. Correlations were analyzed with Spearman's coefficient R. All significant differences between groups (P<0.05) were reported on data plots.Text S1Supplementary methods and figure legends.(0.03 MB DOC)Click here for additional data file.Figure S1ex vivo IFN-\u03b3 ELISPOT responses in PBMC from HIV controllers and efficiently treated patients. Production of IFN-\u03b3 by PBMC stimulated with Gag293, Gag263, and Gag161 20-mer peptides was measured in HIV controllers  and treated patients . IFN-\u03b3 production was measured by ELISPOT assay on PBMC plated at 105 cells/well and stimulated with 4 \u00b5M peptide for 24 h. IFN-\u03b3 production was expressed as the number of spot forming cells (SFC) per million cells. Horizontal bars indicate medians. All statistically significant differences (P<0.05) evaluated by the Mann-Whitney U test are reported on graphs.Analysis of (0.31 MB EPS)Click here for additional data file.Figure S2Control experiments demonstrating that IFN-\u03b3 production is mediated by CD4+ T cells. (A) Representative examples of the efficacy of CD8+ T cell depletion: The expression of CD4 and CD8 within the CD3+ T cell population was evaluated in Gag293-specific cell lines from two HIV controllers (HIC1 and HIC2). CD8+ T cells present in cell lines at doubling time (top row) were depleted with anti-CD8 coated magnetic beads. Less than 1% CD8+ T cells remained in the CD3+ population after depletion (bottom row). (B) Comparison of ELISPOT responses before and after CD8 of CD4 depletion: Gag293-specific CD4+ T cells lines from one HIV controller (HIC) and one treated patient (HAART) were evaluated at doubling time for IFN-\u03b3 production by ELISPOT assay. ELISPOT responses were measured on cell lines before depletion (No depletion), after depletion of CD8+ cells (CD8\u2212), or after depletion of CD4+ cells (CD4\u2212). The cellular concentration was normalized to 30,000 cells per well prior to ELISPOT analysis. IFN-\u03b3 production was expressed as the number of spot forming cells (SFC) per million cells. (C) Additional examples demonstrating that CD4 depletion abrogated the ELISPOT response: Gag293-specific cells lines from 3 treated patients were depleted either for CD8 or for CD4 prior to evaluation of IFN-\u03b3 production by ELISPOT assay.(0.49 MB EPS)Click here for additional data file.Figure S3\u22126 M to 10\u221211 M). For each peptide dilution, IFN-\u03b3 production was expressed as the number of spot forming cells (SFC) per million cells. The functional avidity was defined as the last peptide dilution that gave a positive IFN-\u03b3 response at least 2 fold above background level. (B) Representative examples of functional avidity measurements in response to Gag263, Gag161 and CMV peptides. Cell lines from one HIV controller and one treated patient were analyzed in each case.Representative examples of functional avidity measurements in response to Gag and CMV peptides. (A) Functional avidity in Gag293-specific cell lines was evaluated at doubling time by ELISPOT assay. Representative examples are shown for 3 HIV controllers (HIC) and 3 treated patients (HAART). Functional avidity was measured by IFN-\u03b3 ELISPOT assay in the presence of decreasing peptide concentrations Click here for additional data file.Figure S4Analysis of the proliferative capacity of Gag293-specific cells. Gag293-specific CD4+ T cell lines from 3 treated patients (HAART) and 3 HIV controllers (HIC) were labeled at doubling time with CFSE. The Gag293-specific Tetramer+ CD4+ CD3+ population was analyzed 3 days later by flow cytometry. The number of generations was evaluated by the decrease in CFSE labeling. CFSE histograms were fitted with models that separated the populations into individual generations, using the FlowJo v8.8 software. The modeled generations are represented in dark blue, and the resulting curve fit is represented in red. \u201c% divided\u201d is the percentage of cells in the original sample which divided. \u201cProliferation index\u201d is the average number of divisions undergone by the cells which divided (it does not take into account generation 0). Also reported in red is the percentage of cells that have undergone 5 or more divisions. This parameter highlights the presence of a population of Gag293-specific cells with high proliferative capacity in HIV controller cell lines.(0.99 MB EPS)Click here for additional data file.Table S1Reproducibility of functional avidity measurements.(0.04 MB XLS)Click here for additional data file.Table S2Frequencies of amplified TCR V\u03b2 in CD4+ T cell lines specific for the Gag293 peptide.(0.03 MB XLS)Click here for additional data file."}
+{"text": "The mortality in patients with persistent low CD4 count despite several years of HAART with sustained viral suppression is poorly documented. We aimed to identify predictors for inadequate CD4 cell recovery and estimate mortality in patients with low CD4 count but otherwise successful HAART.In a nationwide cohort of HIV patients we identified all individuals who started HAART before 1 January 2005 with CD4 cell count \u2264 200 cells/\u03bcL and experienced three years with sustained viral suppression. Patients were categorized according to CD4 cell count after the three years suppressed period , >200 cells/\u03bcL; immunological responders (IRs)). We used logistic regression and Kaplan-Meier analysis to estimated risk factors and mortality for INRs compared to IRs.We identified 55 INRs and 236 IRs. In adjusted analysis age > 40 years and > one year from first CD4 cell count \u2264 200 cells/\u03bcL to start of the virologically suppressed period were associated with increased risk of INR. INRs had substantially higher mortality compared to IRs. The excess mortality was mainly seen in the INR group with > one year of immunological suppression prior to viral suppression and injection drug users (IDUs).Age and prolonged periods of immune deficiency prior to successful HAART are risk factors for incomplete CD4 cell recovery. INRs have substantially increased long-term mortality mainly associated with prolonged immunological suppression prior to viral suppression and IDU. The introduction of HAART has decreased morbidity and mortality in HIV patients due to viral load (VL) suppression and immunological recovery . Still, Within a nationwide cohort of HIV infected patients we identified all individuals who were on stable HAART, had been virally suppressed for more than three years and had a CD4 cell count \u2264 200 cells/\u03bcL prior to the virally suppressed period. In this population we identified immunologic non-responders who did not rise to a CD4 cell count > 200 cells/\u03bcL after the three years of sustained VL suppression. We aimed to identify predictors for inadequate CD4 cell recovery and to determine the mortality in the immunological non-responders compared to those with an adequate CD4 cell response.The study was performed as a nationwide cohort study. In the first part of the study we estimated risk factors for immunological non-response (CD4 cell count \u2264 200 cells/\u03bcL after three years of VL suppression). In the second part of the study we estimated mortality in immunological non-responders (INRs) versus immunological responders (IRs).Denmark had a population of 5.5 million as of 31 December 2008, with an estimated HIV prevalence of approximately 0.07% in the adult population ,11. PatiThe Danish HIV Cohort study (DHCS), described in details elsewhere, is a population-based prospective nationwide cohort study of all HIV-infected individuals 16 years or older at diagnosis and who are treated at Danish HIV centres after 1 January 1995 . DecembePrimary causes of death were obtained from The Danish Civil Registration System and The Danish Register of Causes of Death . Data onFrom DHCS we identified all HIV-1 positive patients, who 1) started HAART before 1 January 2005, 2) had a CD4 cell count \u2264 200 cells/\u03bcl at start of HAART, 3) had a VL < 50 copies/ml for more than three consecutive years before 1 January 2008, 4) had no intervals of more than seven months between VL tests in the suppressed period, and 5) had a CD4 cell count \u2264 200 cells/\u03bcl at start of the virally suppressed period.Patients were defined as IRs in case the first CD4 cell count measured after 3 years of viral suppression was > 200 cells/\u03bcL and INRs in case the CD4 count was \u2264 200 cells/\u03bcL. Mortality was also stratified for more differentiated CD4 cell strata after 3 years of viral suppression  but the prognosis differed little for all strata above 200 cells/\u03bcL why we chose to pool all CD4 responses above 200 cells/\u03bcL in one group (data not shown).2 test, Fisher's exact test and Kruskal-Wallis Test when appropriate.Differences in characteristics between groups were evaluated by the \u03c7We used binary logistic regression in order to identify predictors for immunological non-response. The following covariates were included in the model: Gender, age at start of the suppressed period (\u2264 40 years vs. > 40 years)  and INRs; 42.6 years ), race (Caucasian vs. non-Caucasian), route of HIV infection (men who have sex with men (MSM) vs. heterosexually vs. injection drug user (IDU) vs. other), chronic HCV infection (positive vs. negative PCR for HCV RNA), cancer prior to start of the suppressed period, one or more AIDS defining event before start of suppressed period, HIV diagnose before 1 January 1995, nadir CD4 cell count < 50 cells/\u03bcL and > one year from first CD4 \u2264 200 cells/\u03bcL to start of the virologically suppressed period  and INRs; 1.5 years ). Selection of potential confounders was performed using the \"change in estimate\" method with age and gender forced into the model .Index date was defined as date of first CD4 cell count measurement after three years of sustained viral suppression. We calculated person-years at risk from index date until death, 1 January 2008, emigration or lost to follow-up, whichever came first. We used Kaplan Meier analysis to construct survival curves for INRs vs. IRs and further stratified these by time from first CD4 measurement \u2264 200 cells/\u03bcL to start of the virologically suppressed period (\u2264 one year vs. > one year). Cox regression analyses were used to estimate mortality rate ratios (MRR). We further calculated MRRs stratified by cancer (no cancer diagnosed prior to index date vs. cancer diagnosed prior to index date), previous AIDS defining event (none vs. > one or more AIDS defining events prior to index date) and time from first CD4 measurement \u2264 200 cells/\u03bcL to start of the virologically suppressed period (\u2264 one year vs. > one year). The estimates were adjusted for gender and age.In a robustness analysis we used a cut-off value of 500 copies/ml in the virologically suppressed period to test the impact of VL cut-off on our estimates.Using a previously described method  we groupThe study was approved by the Danish Data Protection Agency . Data in the database is not publicly available. SPSS statistical software, Version 15.0  and R software, version 2.8.1, was used for data analysis.In The Danish HIV Cohort Study 3165 patients started HAART before 1 January 2005 (figure After three years of sustained VL 236 81.1%) patients reached a CD4 cell count above 200 cells/\u03bcl (IRs) and 55 (18.9%) of the HIV infected patients did not (INRs). Characteristics of IRs and INRs are shown in table .1% patieIn un-adjusted analysis age, Caucasian race and time from first CD4 cell count \u2264 200 cells/\u03bcL to start of the virologically suppressed period were associated with immunological non-response  patients died in the observation period, 11 (20.0%) in the INR group and 11 (4.7%) in the IR group. As shown in figure 128 patients (44.0%) had more than one year from first CD4 measurement \u2264 200 cells/\u03bcL to start of the virologically suppressed period. The un-adjusted MRR among these 128 patients was 3.9  and after adjustment for age and gender it was 3.6 . When excluding these patients from the analysis the unadjusted MRR was reduced to 3.1  and after adjustment for age and gender it was 1.8 . 90 (70.3%) of the 128 patients who had more than one year of immunological suppression prior to the virologically suppressed period were diagnosed before 1995. When excluding IDUs from our analysis the unadjusted MRR was 2.5  and the adjusted MRR was reduced to 1.8 . The un-adjusted MRR calculated exclusively for IDUs was 12.7  and 9.8  after adjustment for age and gender. Exclusion of patients with previous cancer or AIDS defining event, respectively, did not change the estimates substantially. Only one death in each group  appeared to be a classical HIV related cause of death. Other causes of death were: cancer , sudden death , liver related , suicide , opiate overdose , pneumonia  and cachexia (not HIV related) .80% of the INRs achieved a CD4 cell count > 200 cells/\u03bcL after six years of observation (i.e. more than nine years after starting HAART). However, only 20 (35.1%) of the INRs were still under observation six years after study inclusion. After six years of observation, 95.5% of the whole study population who were still alive had fully suppressed VL.When using a cut-off value of 500 copies/ml for viral suppression, 445 study subjects (372 IRs and 73 INRs) were identified, of whom 18 (4.5%) patients in the IR group and 15 in the INR group (20.5%) died during follow-up. In the un-adjusted analysis age, Caucasian race, IDU, time from first CD4 cell count \u2264 200 cells/\u03bcL to start of the virologically suppressed period and CD4 cell count at start of the suppressed period were associated with immunological non-response. However, after having adjusted for potential confounders only age, IDU and CD4 cell count at start of the suppressed period remained associated with increased risk of being INR. MRRs were 4.5  and 3.69  when adjusted for gender and age.In a population of HIV patients with initial low CD4 count we found that almost one out of five was INR after three years of successful HAART. Older age and more than one year of severe immune deficiency prior to start of sustained VL were associated with INR. The patients with insufficient immunological response had substantially increased long term mortality. The increased mortality was mainly seen in patients with more than one year of immunological deficiency prior to the period of sustained VL suppression and IDUs.The major strength of this study is the identification of a homogeneous group with stringent viral suppression, essentially eliminating the possibility that incomplete VL suppression explains our findings. The study had a nationwide design with long and almost complete follow-up including data on cancer as well as HCV status.A limitation of the study is the small study population (in part caused by the stringent definitions of INRs and IRs) and the small number of outcomes, which did not allow us to extend the logistic regressions analysis or to calculate cause specific rate ratios of death. The study population encompasses a highly selected group of patients surviving more than three years in spite of low initial CD4 cell count, and a healthy survivor effect may lead to underestimation of the excess mortality in the INRs. Still, by using an extended virally suppressed period we allowed the patients to reach a steadier CD4 plateau without the interference of CD4 cell redistribution as seen after HAART start. HCV testing in the cohort is \"intended\" and may only be performed yearly on known high risk groups in the cohort e.g IDU why chronic HCV may be underestimated in the cohort.19% of the study patients did not have an adequate immunological response to HAART. Our results corresponds to the findings of other studies who found a negative impact of low initial CD4 cell count on long-term CD4 recovery ,6,17-19.INRs were significantly older than the IRs and age predicted inadequate CD4 cell recovery which corresponds to the findings of several other studies ,9,19,20.The excess mortality seen among the INRs was mainly related to prolonged immunological suppression prior to successful HAART and IDU. The median time from start of HAART to start of the virologically suppressed period was less than half a year. A longer period of immunological suppression prior to the three years of sustained VL suppression is therefore explained by delayed initiation of HAART and not poor compliance. This is supported by the fact that most of the patients with more than one year of immunological suppression before start of the virologically suppressed period were diagnosed with HIV before 1995 when treatment options were scarce. As many of the INRs who died were patients who initiated HAART in the mid-nineties it could be hypothesized that resistance played a role, but the stringent design with full VL suppression eliminates that possibility. We find it unlikely that the late death of these patients were directly related to the toxicity of the antiretroviral agents, but cannot rule out that toxicity should interact with the immune reconstitution. The increased mortality in patients with delayed initiation of HAART is well documented  and the We only encountered two AIDS related deaths suggesting that these are rare after prolonged HAART even without adequate CD4 recovery. Thus, it seems that the INRs are not immune-suppressed in the classical sense where a low CD4 count leads to AIDS defining diseases and eventually death. Still, we cannot rule out that there is a biological cause of the increased mortality in immunological non-responders related to immunodeficiency and that our study simply do not have power enough to demonstrate an association.The risk factors for incomplete CD4 cell recovery and increased mortality points toward earlier diagnosis of HIV as the main prophylactic measure. Also, the increased mortality in these patients calls for increased concern in terms of treatment and screening for co-morbidity.We conclude that age and prolonged immunological suppression are risk factors for incomplete CD4 cell recovery in patients with otherwise successful HAART. Patients with insufficient immunological response have substantially increased long-term mortality compared to IRs, but the increased mortality is mainly associated with prolonged immunological suppression prior to VL suppression and IDU. We therefore presume that in the modern HAART era where patients are started early on HAART the prevalence of insufficient CD4 recovery will decrease substantially.Potential competing of interest: N Obel has received research funding from Roche, Bristol-Myers Squibb, Merck Sharp & Dohme, GlaxoSmithKline, Abbott, Boehringer Ingelheim, Janssen-Cilag and Swedish Orphan. F Engsig has received research funding from Merck Sharp & Dohme. J Gerstoft has received research funding from Abbott, Roche, Bristol-Myers Squibb, Merck Sharp & Dohme, Pharmasia, GlaxoSmithKline, Swedish Orphan and Boehringer Ingelheim.The study was financed by The Research Foundation at Copenhagen University Hospital, Rigshospitalet and Faculty of Health Science, Copenhagen University. The funders had no role in the study design; in the collection, management, analysis, and interpretation of data; in the preparation, review, or approval of the manuscript, or in the decision to submit the article for publication. The researchers are independent from the funders.The authors contributions are the following: FNE (MD) contributed with study design, data collection, data analysis, interpretation of findings and writing of the manuscript. JG  contributed with study design, data collection, interpretation of findings and critical edit of the manuscript. GK , CSL , GP (MD), BR , JJ (MD) and LNN (MD)contributed with data collection, study design, interpretation of findings and critical edit of the manuscript. NO  contributed with data collection, study design, critical review of data analyses, interpretation of findings and critical edit of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/318/prepubTable S1. Drugs included in the last HAART regimen prior to index date.Click here for file"}
+{"text": "T-cell responses were observed in the majority (78%) of samples. The frequency of CD4+ responders was far lower among those with progressive disease, indicating that the CD4+ T-cell response might be important in HPV clearance. CD8+ reactivity to E6 peptides was dominant across all disease grades, inferring that E6-specific CD8+ T cells are not vitally involved in disease clearance. T-cell responses were demonstrated in the majority (80%) of cervical cancer patients, but are obviously ineffective. Our study reveals significant differences in HPV16 immunity during progressive CIN. We conclude that the HPV-specific CD4+ T-cell response should be an important consideration in immunotherapy design, which should aim to target preinvasive disease.Infection with high-risk genital human papillomavirus (HPV) types is a major risk factor for the development of cervical intraepithelial neoplasia (CIN) and invasive cervical carcinoma. The design of effective immunotherapies requires a greater understanding of how HPV-specific T-cell responses are involved in disease clearance and/or progression. Here, we have investigated T-cell responses to five HPV16 proteins  in women with CIN or cervical carcinoma directly  Cervical carcinoma is the second most common female cancer worldwide, with 400\u2009000 new cases diagnosed each year , CD4 responses to HPV16 E6  in mediating regression of HPV-related disease has not been proven. Using a variety of restimulation protocols, HPV16 E2-, E6- and E7-specific CTLs can be detected in patients with previous  from a cohort of 41 women with varying grades of cervical disease. The frequency, magnitude and antigen specificity of the responses obtained are discussed in relation to disease severity.The link between HPV16 and cervical carcinoma opens up the possibility of immune T-cell intervention, either against the preinvasive lesions from which tumours arise, or against the virus antigen-positive tumour cells themselves. To effect such strategies will require a better understanding of the spectrum of T-cell responses induced by HPV16 antigens during the course of natural infection, and of their role in disease clearance and/or progression. Much of the work to date has understandably focused on responses to the E6 and E7 transforming proteins, since these are the only viral antigens constitutively expressed in HPV-positive tumour cells. By contrast, there has been no concerted effort to look at the totality of responses to a single agent, including responses to viral antigens that are expressed later in the replication cycle that may be useful targets for the treatment of preinvasive lesions. In this study, we have used CD4- and CD8-depleted populations of responder cells in an ELISPOT assay of IFN-A total of 41 women attending colposcopy clinics or undergoing surgery for cervical disease  were investigated. Ethical approval for this study was obtained from the South Birmingham Research Ethics Committee (Study Number 5147) and informed consent was obtained from all subjects. Abnormal cervical cytology was diagnosed and confirmed by histopathology. Patients were assigned to one of four groups according to the histology reports obtained from cervical tissue taken at the time they were bled: those reported to have no evidence of CIN, those with low-grade disease (CIN I), high-grade disease (CIN II/III) and those with cervical carcinoma. The clinical details are shown in The HPV genotype of patient biopsies obtained during the course of this study could not be established. However, the transient nature of genital HPV infections questions the validity of HPV typing at a single time point, since this may not necessarily reflect a past history of HPV infection in a significant proportion of women, especially those with low-grade disease  cells were separated from 40\u201360\u2009ml heparinised blood samples by isopycnic centrifugation on lymphocyte separation medium  and cryopreserved in liquid nitrogen. CD4+ and CD8+ T-cell depletions were carried out on UM cells using antibody-coated magnetic beads  according to the method previously described . HPV16 VLPs were produced following the infection of SF9 insect cells, and were purified on caesium chloride gradients according to published methods . The ELISPOT assay procedure has been published previously (5\u2009cells per well (in duplicate) and peptides were added to a final concentration of 10\u2009\u03bcg\u2009ml\u22121. A negative control well with no peptide or VLP and a positive control well containing cells and 0.2% PHA-P (Difco Laboratories) instead of peptide were included for every sample. The plates were counted using an automated system  and background counts obtained in the absence of peptide or VLP were subtracted. An ELISPOT response among the patient group was only considered positive if the number of spots obtained fell above a negative cutoff value. These were calculated for every peptide and the VLP preparation, and taken as 2 standard deviations (s.d.) above the mean of the counts obtained using the negative control group comprising nine age-matched female virgins.Overlapping synthetic peptides  covering the entire primary sequences of the HPV16 E6, E7 and E4 proteins  were used in an ELISA to determine HPV16-specific antibody levels in plasma samples obtained from each subject. This source of VLPs was unsuitable for use in the ELISPOT assay due to problems with toxicity. An ELISA method for detection of HPV1 VLP-specific antibodies has been published by us recently . The results of the ELISPOT assays are shown in To determine whether responding IFN-The majority of the control samples showed little or no T-cell reactivity, with the exception of numbers 5 and 9, both of which demonstrated responses to a few peptides, particularly those covering HPV16 E6 . AlthougThe results of the ELISPOT assays showed that CD8+ T-cell reactivity occurred at almost twice the frequency of CD4+ reactivity . CD4 res6 CD4+ T cells) was obtained from a woman with high-grade disease (patient 12), using an E6 peptide . In a CD8 response, the highest frequency of spots (1538 spots per 1 \u00d7 106 CD8+ T cells) was obtained from a patient with no CIN (patient 27), again in response to an E6 peptide .There was no significant difference in the magnitude of CD4 or CD8 responses obtained among patient groups . The greDifferences in the antigen specificities of the CD4 and CD8 responses were also observed in the ELISPOT assays, although this was not related to disease grade . A similP-values all greater than 0.187; Mann\u2013Whitney test). All of the patient groups had significantly higher titres than those obtained from the negative control group of female virgins , with the exception of those women with low-grade disease (P=0.091).The serological status of all subjects in the study was assessed in order to obtain additional information about HPV16 immune status. Antibodies to HPV16 VLPs were detected in 20 out of the 41 (48.7%) plasma samples overall . In womeOut of the 20 seropositives obtained in this study, 18 (90%) showed either CD4+ or CD8+ T-cell reactivity to HPV16 peptides in the ELISPOT assays. In all, 15 samples (71%) out of the 21 with negative serology also gave a T-cell response. These samples were from patients who fell predominantly into the no CIN or low-grade disease groups. Interestingly, the patients who demonstrated T-cell responses to multiple peptides and proteins   were ser\u03b3 release, to HPV16 E4, E6, E7, L1 and L2. Significantly, in this study, cells were used directly ex vivo in the ELISPOT assay, without undergoing any kind of in vitro restimulation. We demonstrated either CD4+ or CD8+ T-cell reactivity in the majority of the patient samples tested (78%), with 34% showing both CD4 and CD8 responses. There was little difference in the magnitude of the responses obtained between the CD4- or CD8-enriched populations  were seronegative, whereas those showing far fewer T-cell reactivities had the highest antibody titres . One explanation for these results is that the antibody response is slower than the T-cell response. Perhaps, the women showing multiple T-cell reactivities have only recently encountered the virus, and have large numbers of effector T cells, but the antibody response is not yet established. Conversely, in the other group of women with low T-cell reactivity and high antibody titres, the primary effector T-cell response may have subsided, but the serological response is still present and helping to prevent re-infection. It is difficult to define precisely the relationship between T-cell reactivity and antibody status; more knowledge is required about the relative timescales and roles of the T- and B-cell responses to HPV during natural infection.\u03b3 release are capable of revealing T-cell reactivities to HPV16 antigens in women with cervical dysplasia and can be used to establish the spectrum of T-cell responses induced during natural infection. The ELISPOT assay is becoming established as a good method for charting HPV-specific immunity, both during natural infection and following vaccination (ex vivo, which is more likely to be representative of the in vivo situation. The majority of the other studies employed an in vitro stimulation step prior to ELISPOT analysis. Secondly, we established negative cutoff values using a valid negative control group that obviously minimises the problems associated with nonspecificity. Thirdly, many of the published studies have concentrated on HPV-specific responses in normal individuals. By looking at the healthy population, these studies are likely to be detecting predominantly memory T-cell reactivity, whereas we were studying women with recent or current disease, and are therefore likely to be detecting effector populations as well as memory.In summary, we have shown that ELISPOT assays of IFN-The results from the current study suggest that there are differences in how viral antigens are handled by the immune system during progressive disease of the cervix. In order to define this more precisely, more noninterventional prospective studies will be required, although there are obvious ethical problems associated with this. The vast majority of women in this cohort underwent surgical excision that is likely to have an effect on HPV16 immunity, and so a prospective study would not be possible. Defining the role played by HPV16-specific T cells in the natural history of cervical disease will aid the development of immunological assays to determine the risk of CIN progression, and therefore the management of premalignant and malignant HPV-associated neoplasia."}
+{"text": "Given the pivotal role of T lymphocytes in the immune system, patients with septic shock may show T cell abnormalities. We have characterised the T cell compartment in septic shock and assess its clinical implications.T lymphocytes from the peripheral blood of 52 patients with septic shock and 36 healthy control subjects were analysed on admission to the intensive care unit, baseline, and 3, 7, 14 and 28 days later. T cell phenotypes  were assessed by quantitative flow cytometry.CD3+, CD3+CD4+ and CD3+CD8+ lymphocyte counts were significantly lower in patients with septic shock than control subjects. In surviving patients, CD3+CD4+ lymphocytes had normalised after 14 days, yet CD3+CD8+ numbers were still low. Non effector CD45RA+CD45RO- subsets of CD3+CD4+ and CD3+CD8+ were persistently low during patient follow up. CD3+CD8+CD28+ and CD3+CD8+CD62L+ were reduced in patients versus controls and survivors versus nonsurvivors in the first three days. A prediction receptor operative curve revealed that for the CD3+CD8+CD28+ subset, a cutoff of 136 cells/ml showed 70% sensitivity and 100% specificity for predicting death and the area under the curve was 0.84 at admission. Corresponding values for CD3+CD8+CD62L+ were 141 cells/ml, 60% sensitivity, 100% specificity and an area under the curve of 0.75.A severe redistribution of T lymphocyte subsets is found in septic shock patients. A different kinetic pattern of T cell subset involvement is observed in surviving and nonsurviving patients, with lower numbers of circulating CD3+CD8+CD28+ and CD3+CD8+CD62L+ associated with a better disease outcome. Sepsis has been defined as the systemic inflammatory response syndrome that occurs in response to bacterial infection . AlthougThe T cell compartment plays a pivotal role in regulating the effector stage of the immune response. CD3+CD4+ T cells are mainly involved in the regulation of the immune response, and CD3+CD8+ T cells are critical in the cytotoxic response . SeveralA role for T lymphocytes in severe systemic bacterial infections has been described in several studies -16 , andFifty-two consecutive patients admitted to the ICU of the University Hospital Pr\u00edncipe de Asturias, Madrid, Spain, with septic shock, diagnosed according to the criteria of the American College of Chest Physicians/Society of Critical Care Medicine , were enThirty-six age-matched and sex-matched healthy blood donors were studied in parallel with the patients (0 and 28 days of the follow up). They were studied to control the adequacy of the cytometric techniques as well as to characterise the normal range of the T lymphocyte compartment parameters analysed.\u00ae LH instrument .Blood was collected from the patients at baseline (ICU admission) and at 3, 7, 14 and 28 days of follow up, and at baseline and at 28 days in healthy controls. White blood cell differential counts were conducted in a COULTERPeripheral blood mononuclear cells (PBMC) were obtained from heparinised venous blood by Ficoll-Hypaque  density gradient centrifugation. Cells were resuspended (1 \u00d7 106 cells/ml) in RPMI-1640  supplemented with 10% heat-inactivated FBS , 25 mM Hepes  and 1% penicillin streptomycin .T cells were phenotypically analysed in PBMC by four-colour flow cytometry in a FACScalibur cytometer using CellQuest-3.3 software . PBMC were incubated with combinations of fluorescein isothiocyanate (FITC), phycoerythrin (PE), phycoerythrin-cyanine 5.5 (PE-cy5.5), peridinin chlorophyll protein (PerCP) and allophycocyanin (APC)-labelled monoclonal antibodies. The monoclonal antibodies were CD3-PerCP, CD3-FITC, CD45RA FITC, CD56-PE, CD28-PE, CD62L-PE , CD19-PE-CY5, CD8-APC, CD45RO PE .\u00ae. Next, we obtained the absolute number of CD4+ and CD8+ T lymphocytes by multiplying the total number of T lymphocytes previously calculated by the percentage of positive cells for each one of both antigens in CD3+ T cells. We simultaneously stained PBMC with CD3, CD4 and CD8 antibodies to obtain this data. Finally, we calculated the absolute number of the CD3+CD4+ and CD3+CD8+ T cells subsets defined by the expression of CD45 isoforms CD45RA+CD45RO-, CD45RO+CD45RA-, CD45RA+CD45RO+ and the expression of the antigens CD28+ and CD62L+. To calculate these numbers, we multiplied the percentage obtained of each subset in the parents' CD3+CD4+ or CD3+CD8+ populations by the absolute count of CD3+CD4+ and CD3+CD8+ T cells, respectively. All absolute numbers are expressed as cells/ml.The absolute numbers of T lymphocyte subsets were calculated according to standard flow cytometry criteria for lymphocyte subset identification and the lymphocytes obtained in conventional haemogram. First, we calculated the percentage of cells expressing CD3 in the total lymphocytes gate defined by forward and side scatter in PBMC. The absolute number of circulatory T lymphocytes was calculated by the percentage of CD3+ cells in peripheral blood lymphocytes multiplied by the total number of lymphocytes per microlitre measured by a CoulterP < 0.05.Analyses were performed using SPSS-11.0 software . Most variables did not fulfill the normality hypothesis, so the Mann Whitney U-test for non-parametric data was used to analyse differences between the groups, and analysis of variance followed by Wilcoxon Signed Ranks tests were used for within group analyses. The level of significance was set at There were ninety-two ICU admissions with a diagnosis of septic shock during the study period. Forty patients were excluded from the study: three patients were HIV-positive, 18 patients were taking corticosteroids on admission, 12 were on or had received chemotherapy, five patients suffered neoplasia, one had rheumatoid arthritis and one had anaphylactic shock in response to antibiotic therapy for sepsis. Mortality was 34.6%. The mean (\u00b1 standard error) Acute Physiology and Chronic Health Evaluation (APACHE) II  score waCounts and distributions of the main circulating T lymphocyte subsets were systematically examined in 52 patients with septic shock at admission to the ICU and at 3, 7, 14 and 28 days of follow up in the ICU. Furthermore, patients were classified as survivors or nonsurvivors according to their clinical outcome of sepsis during the four weeks of follow up. Thirty-six healthy blood donors who were age-matched and sex-matched  were studied in parallel with the patients as controls of the adequacy of the cytometric technique procedure as well as for characterisation of the normal range of the T lymphocyte compartment parameters analysed.Both surviving and nonsurviving patients showed significantly lower absolute CD3+ T lymphocyte numbers  than controls (1394 \u00b1 36 cells/\u03bcl) on admission and during the first 14 days of follow up . In survivors, CD3+ counts had significantly returned to normal by day 28 (1191 \u00b1 172 cells/\u03bcl). The CD3+CD4+ T cell subset was also reduced in surviving and nonsurviving patients with respect to healthy controls at baseline and during the first week of follow up. However, this dramatically decreased CD3+CD4+ T lymphocyte count had normalised in survivors by day 14 Figure . On admiThe activation stage of the CD3+CD4+ and CD3+CD8+ T lymphocytes was determined by examining the expression of the CD45 RA and RO isoforms. The retraction in circulating CD3+CD4+ and CD3+CD8+ T lymphocytes observed in the patients could be mainly explained by a decrease in the noneffector CD45RA+CD45RO- subset Figures . InteresWe also analysed the expression of CD28 and CD62L antigens on CD3+CD4+ and CD3+CD8+ T lymphocytes. When CD3+CD8+ T lymphocytes are activated, CD28 expression is lost ,20. The A prediction receptor operative curve (ROC) was then used to estimate the value of CD3+CD8+CD28+ and CD3+CD8+CD62L+ T cell counts for predicting death in the patients with septic shock at admission and days 3 and 7. We found that a cutoff value of 136 CD3+CD8+CD28+ T cells/ml on admission to the ICU of a patient with septic shock showed a sensitivity of 70% and 100% specificity for predicting the risk of death, and the area under the ROC curve was 0.84. For the CD3+CD8+CD62L+ T cells, the cut off on admission was 141 cells/ml, with a 60% sensitivity and 100% specificity for predicting the risk of death and an area under the curve of 0.75. The sensitivity and specificity of the data obtained at days 3 and 7 were worse than those found at admission (data not shown).The number of circulating CD3+CD4+CD28+ T cells was significantly lower in surviving and nonsurviving patients with septic shock compared with healthy controls on admission and on day 3 of follow-up Figure . In survIn this study, we show that surviving and nonsurviving patients with septic shock have different patterns of involvement in circulating T lymphocyte compartment. A drop in circulating CD3+CD4+ and CD3+CD8+ T cells has been described in patients with severe sepsis or septic shock at admission to the ICU . In our Plasmodium berghei develop a syndrome similar to septic shock and the depletion of CD3+CD8+ T cells also significantly ameliorates the complications that induce shock [In a mouse sepsis model of caecal ligation and puncture, the depletion of CD3+CD8+ T and natural killer cells was associated with a survival benefit with decreased blood bacterial concentrations, improved physiological function and an attenuated proinflammatory response . It has ce shock . In addice shock . In agreCD45 is a phosphatase that is essential in T cell development and antigen receptor signalling . The expCD28 is a costimulatory molecule that plays a key role in regulating the activation and survival of T lymphocytes . ActivatThe migration of circulating T lymphocytes to peripheral lymph nodes depends on the expression of the CD62L homing receptor . We founOur T lymphocyte phenotype data show a time difference, or shift, in the recirculation of T lymphocytes between patients who survive septic shock and those who do not. Taken together and analysing the phenotype of the circulating T cells according to the activation criteria (CD45RA+ and CD45RO+) related to CD28 (activation and co-stimulation) and CD62L (activation and migration) expression point to a slower migration of naive and effector cells in nonsurviving patients. This different T lymphocyte kinetics would mean a delayed tissue response that could determine the failure of the immune system and the fatal prognosis of the patient. In particular, the delay in the disappearance of CD45RA+, CD45RA+CD45RO+, CD28+, CD62L+, T CD4+ and CD8+ lymphocytes observed between days 3 and 7 of follow up in the nonsurvivors appears to be crucial to the final outcome. Accordingly, in surviving patients, effector cells would migrate more rapidly to tissues and this would in turn trigger the quick action of the immune system in combating the infection and thus determine the survival of the patient. It is known that cellular immune responses play a critical role in the defense against viral infections and strong T-cell responses have been reported in patients who clear infection . If the Not surprisingly, the survivor group had lower APACHE II, MODS and SOFA scores than nonsurvivors. An increasing APACHE II score reflects an increasing severity of illness and escalating risk of hospital death for multidiagnostic ICU patient groups. However, an APACHE II score cannot be directly equated with a specific risk of lower mortality than the same score for a patients with septic shock . In thisSeptic shock patients show a severe redistribution of circulating T lymphocyte subsets. We found that CD62L and CD28 expression on circulating T cells at ICU admission are good markers to predict the outcome of shock septic patients. T lymphocyte phenotype data show a time difference in the recirculation of T cells between survivors and nonsurvivors that might provoke a delayed tissue response of the immune system.\u2022 Septic shock patients show a severe redistribution of circulating T lymphocyte subsets.\u2022 CD62L and CD28 expression on circulating T cells at ICU admission are good markers for predicting the outcome of shock septic patients.\u2022 T lymphocyte phenotype data show in nonsurviving patients a slower migration of naive and effector cells that might provoke a delayed immune response.APACHE: Acute Physiology and Chronic Health Evaluation; APC: allophycocyanin; FBS: fetal bovine serum; FITC: fluorescein isothiocyanate; ICU: intensive care unit; MODS: multiple organ dysfunction syndrome; PBMC: peripheral blood mononuclear cells; PE: phycoerythrin; PerCP: peridinin chlorophyll protein; PE-cy5.5: phycoerythrin-cyanine 5.5; ROC: receptor operative curve; SOFA: Sequential Organ Failure Assessment.The authors declare that they have no competing interests.JM and RP are joint authors and contributed equally to this manuscript. AP, MAM, JM and RP contributed to the design of the study and drafted the manuscript. JM, DD and HB obtained the data. JM, RP, M\u00c1, AH, MRZ and ER participated in data analysis and interpretation of the results."}
+{"text": "The relationship of elevated T cell activation to altered T cell differentiation profiles, each defining features of HIV-1 infection, has not been extensively explored. We hypothesized that anti-retroviral suppression of T cell activation levels would lead to alterations in the T cell differentiation of total and HIV-1 specific CD8+ T cell responses among recently HIV-1 infected adults.We performed a longitudinal study simultaneously measuring T cell activation and maturation markers on both total and antigen-specific T cells in recently infected adults: prior to treatment; after the initiation of HAART; and after treatment was halted. Prior to treatment, HIV-1 Gag\u2013specific CD8+ T cells were predominantly of a highly activated, intermediate memory (CD27+CD28\u2212) phenotype, while CMV pp65-specific CD8+ T cells showed a late memory (CD27\u2212CD28\u2212), low activation phenotype. Participants with the highest fraction of late memory (CD27\u2212CD28\u2212) HIV-1-specific CD8+ T cells had higher CD4+ T cell counts . In turn, those with the highest fraction of intermediate memory (CD27+ CD28\u2212) HIV-1 specific CD8+ T cells had high total CD8+ T cell activation , indicating poorer long-term clinical outcomes. The HIV-1 specific T cell differentiation profile was not readily altered by suppression of T cell activation following HAART treatment.A more differentiated, less activated HIV-1 specific CD8+ T cell response may be clinically protective. Anti-retroviral treatment initiated two to four months after infection lowered T cell activation but had no effect on the differentiation profile of the HIV-1-specific response. Intervention during the first month of acute infection may be required to shift the differentiation phenotype of HIV-1 specific responses to a more clinically favorable profile. Elevated CD8+ T cell activation is established early in HIV-1 infection On encountering antigen CD8+ T cells differentiate from the least differentiated (na\u00efve or early memory) stage to the most mature (memory/effector) stage. In this process, cell surface receptors are progressively down-regulated  as CD8+ T cells differentiate and up-regulated or re-expressed . While there is broad general agreement on how to define a na\u00efve T cell, there is not yet a unified model that describes the process of human T cell differentiation  are shown in The magnitude of IFN-\u03b3 and IFN-\u03b3/IL-2 CD8+ T cell responses to HIV-1 Gag were lower than the response to CMV pp65 at visit 1 (prior to therapy), and subsequent study time points during and after anti-retroviral therapy . The magAt visit 1, prior to anti-retroviral therapy, the na\u00efve and early memory CD8+ T cell subset (EM:CD27+CD28+) was most frequent (median 43.3% Interquartile range (IQR) 41.4, 49.7) followed by the intermediate memory ) and late memory (LM:CD27\u2212CD28\u2212) median 16.3% ) subsets . FollowiWe observed that the maturation profiles of antigen-specific T cells differed from the profiles of total T cell populations. HIV-1 Gag-specific IFN-\u03b3 expressing CD8+ T cells were predominantly CD27+CD28\u2212, IM ), while the majority of CMV pp65-specific CD8+ T cells had a LM CD27\u2212CD28\u2212 phenotype ) . HIV-1 GTypical of early HIV-1 infection, the proportion of activated CD8+ T cells was high  than CMV pp65-specific CD8+ T cells; this was also true for each of the maturation subsets  . Of the At study visit 1, during early untreated HIV-1 infection, we examined the relationship between the CD8+ T cell activation level and maturation profile of total and HIV-1 Gag specific T cell responses . Among uThe size of any differentiation stage of the HIV-1 Gag IFN-\u03b3+ CD8+ T cell response was not associated with viral load (not shown). A higher fraction of HIV-1 Gag specific IFN-\u03b3 expressing CD8+ T cells in the LM pool was found to associate with higher CD4+ T cell counts .Although there was a sharp decline in the level of activation (CD38 MFI) on HIV-1 Gag specific CD8+ T cells, there was no significant drop in the fractional size of the CD8+ T cell HIV-1 Gag specific IM CD27+CD28\u2212 population , or incrIn an effort to understand the relationship of two key features of the early T cell response to HIV-1 we examined the simultaneous expression of both activation and differentiation markers on total and antigen-specific T cells from treatment na\u00efve adults in early HIV-1 infection before, during and after anti-retroviral therapy. Our data suggests that there may be a link between the activation and maturation stage of CD8+ T cells. The skewed, less differentiated maturation profile of HIV-1-specific T cells was more pronounced at higher CD8+ T cell activation levels. We also found that increased numbers of fully differentiated HIV-1-specific CD8+ T cells associated with higher CD4+ T cell counts suggesting that the presence of mature Gag-specific CD8+ T cells may be protective. However the HIV-1 Gag-specific T cell differentiation profile was not readily altered by suppression of T cell activation by anti-retroviral treatment.We compared CMV- and HIV-1-specific responses in early infection. Previous studies of differences between CMV- and HIV-specific-responses have suggested that the failure of HIV-specific cells to reach a more differentiated phenotype may explain their inability to fully control HIV replication It has been suggested that distinct T cell maturation profiles, associated with responses to different viruses, are established for the purpose of generating memory or maintaining latency We found that patients with the highest numbers of EM Gag-Specific CD4+ T cells had the lowest levels of T cell activation, suggesting that \u2013 in contrast to our findings on CD8+ T cell responses \u2013 that a less differentiated CD4+ T cell response may be associated with better clinical status. Our data is consistent with a report suggesting a less differentiated CD4+ T cell response marks long-term non-progression in HIV disease, a state of low CD8+ T cell activation Repeated stimulation of Gag-specific T cells, by persistent HIV-1 replication, may induce high levels of activation and block maturation into a mature effector phenotype. Based on our model linking activation to maturation impairment, we reasoned that in the absence of repeated antigen stimulation the proportion of Gag-specific T cells with a low activation, LM phenotype may increase. We therefore examined maturation and activation following anti-retroviral therapy and reduction of circulating virus to undetectable levels. While a significant decline in activation levels on all CD8+ T cell subsets was apparent, reduced antigen load had different effects on total, CMV- and HIV-1-specific T cell differentiation profiles. Following therapy, the CMV-specific CD4+ IM T cell pool did expand as the LM pool shrunk. This suggests that HIV-1 viremia, or generalized immune activation may influence the differentiation profile of CMV specific CD4+ T cell responses. Among total CD8+ T cells there was a significant reduction in the IM and a corresponding increase in the LM fraction. As activation declines the total IM CD8+ T cell fraction may mature, or die by apoptosis, shifting the population to an LM profile. In contrast, despite a significant reduction of activation levels on Gag-specific CD8+ T cells, there was no corresponding shift in the maturation profile of Gag specific CD8+ T cells. Taken together, these data suggest that high activation and viral load does not prevent the maturation of Gag-specific cells, although these effects may be apparent on T cells of other specificities. The Gag-specific T cells that we measured may have already become replicatively senescent due to repeated stimulation The mechanism by which maturation and activation are associated prior to treatment is not clear from our results. The relative paucity of LM HIV-specific CD8+ T cells may be due to increased susceptibility of these to apoptosis, even after ART suppression of activation. That said, the failure of CD8+ T cells to mature may result from manipulation of signaling pathways in responding HIV-1 specific CD8+ T cells by a viral product, such as secreted Nef, which has been shown to upregulate PD-1 We observed that HIV-specific T cells are predominantly immature and highly activated at early stages of infection. Although activation is reduced by anti-retroviral therapy immature Gag-specific cells continue to predominate. In a previous report we demonstrated that initiation of anti-retroviral therapy within the first month of HIV-1 infection associated with improved viral control and clinical outcomes once therapy was halted, compared to those who start anti-retroviral therapy one month or later into infection Thirteen treatment na\u00efve adults in early HIV infection were studied for T cell responses and phenotypes at 1) study entry (within 2\u20134 months of acquiring infection), 2) after having reached complete virologic suppression on a first anti-retroviral regimen  and 3) several months after having halted anti-retroviral therapy.All specimens were drawn from persons enrolled in the Options study of early HIV-1 infection conducted in a university based research clinic. Among those enrolled in OPTIONS, approximately 90% are within 6 months of acquiring HIV-1 infection 6\u20132\u00d7106 cells/mL in the same medium, and rested overnight in slanted 15-mL conical tubes with loosened caps, in a CO2 incubator at 37\u00b0C. For phenotyping assays cells were washed in FACS buffer  for staining the same day.PBMC were isolated, cyropreserved and stored by the UCSF/ARI AIDS Specimen Bank, then transported to the Core Immunology Laboratory for analysis. Cryopreserved PBMCS were rapidly thawed in to warm RPMI 1640 with 10% fetal bovine serum (UCSF Cell Culture Facility) and counted using the Viacount assay on a Guava Personal Cell Analysis system (Guava Technologies). For Cytokine Flow Cytometry (CFC) assays PBMC were re-suspended at 1\u00d710Thawed PBMCS were surfaced stained with the following combination of fluorescently labeled antibodies: CD3 Pacific Blue, CD4-AmCyan, CD8-Alexa 700, CD38-PE-CY7, CD27-APC, CD28-APC-CY7, and HLADR FITC  in the presence of 5 \u00b5g/ml ethidium monoazide bromide . After a 50 minute incubation in the dark at 4\u00b0C cells were exposed to a 40-W fluorescent light for 10 min at room temperature to cross-link the EMA. FMO (Fluorescent minus-one) controls were run with each experiment to ensure that breakdown of tandem conjugates (e.g. APC-CY7 to APC) was not occurring and to assist with setting gates. Following staining, PBMCs were washed in FACS buffer, fixed in 0.5% formaldehyde (Polyscience), stored at 4\u00b0C until analysis.Thawed and rested PBMC were stimulated with overlapping peptide pools  in the presence of 10 \u00b5g/ml Brefeldin A (Sigma Aldrich) for 18 hours at 37\u00b0C. Peptide pools were HIV-1 SF2 GAG  and CMV pp65 . Unstimulated cells were run in parallel as a negative control for each subject. Following stimulation PBMCs were treated with 2 mmol/L EDTA, washed in PBS, then stained with anti-CD4, CD8, CD38, CD27, and CD28 in the presence of EMA, as described above. Cells were then washed in FACS buffer, fixed and permeabilized by a 10 minute incubation in FACS lyse, and a 10 minute incubation in FACS Perm (both from BD Biosciences) before staining with fluorescently conjugated antibodies: IFN-\u03b3-FITC, IL-2-PE and CD3-Pacific Blue . Cells were washed, re-suspended in FACS buffer, stored at 4\u00b0C until analysis.All samples were run on a customized BD LSR II Flow cytometer within 18 hours of staining. Rainbow beads (Spherotec) were used to standardize instrument settings between runs. Between 900,000 and 1 million lymphocytes were collected for each sample. Data was compensated and analyzed by using Flowjo Software (Treestar Inc). The gating strategies used to define CD4+ and CD8+ T cell maturation and activation populations, to define antigen-specific T cells, and to subset these cells for activation and maturation markers are shown in All statistical analyses were performed in the SAS System Version 9.1 for Windows XP. Non-parametric statistical tests were employed in all cases. Spearman rank correlations were generated for all correlation tests. Signed Rank tests were used to test significance of change in values between study time-points. The Wilcoxon Two Sample test was used to compare different values at a given study time-points."}
+{"text": "HIV DNA and RNA levels in the gut exceed those in the blood up to 10-fold. The ileum and rectum differ in HIV levels and responses to intensification, suggesting that mechanisms of persistence may vary between sites. HIV persistence could be impacted by T cell activation, absolute CD4 levels, or composition of memory T cell subsets.Mucosal biopsies were obtained from the ileums and rectums of eight HIV-negative controls and 10 ART-suppressed HIV-positive patients. Isolated cells were analyzed for T cell composition , activation , and memory subpopulations  using flow cytometry. CD4 numbers were also measured by immunohistochemistry. In two patients, HIV DNA was measured in sorted subpopulations of memory CD4+ T cells.CD4 reconstitution appears to reach normal levels in the rectum , but not the ileum . Ileal CD4 numbers appear normal in the lymphoid aggregates, but not the lamina propria. In both the ileum and rectum, T cell activation remains higher than in HIV-negative controls  CD4+ T cells (mean 41.6% of CD4+ T cells) than the PBMC (15.4%), but similar numbers of transitional memory (TM) CD4+ T cells . HIV DNA concentrations in ileal EM (1 copy/2100 cells) were 25-fold higher than in blood EM .T cell reconstitution and activation differ between gut sites. The higher concentration of HIV DNA in the gut is not due to increased TM cell%, but could reflect differences in the rate of infection of memory subtypes. The abnormal immune activation and lack of CD4 reconstitution in the ileum could reflect ongoing replication or chronic virus production."}
+{"text": "However, the cause-effect relationship between HIV-specific cellular immunity and disease progression is unknown. We investigated in a large prospective cohort study involving 96 individuals of the Amsterdam Cohort Studies with a known date of seroconversion whether the presence of cytokine-producing HIV-specific CD8+ T cells early in infection was associated with AIDS-free survival time.T-cell immunity is thought to play an important role in controlling HIV infection, and is a main target for HIV vaccine development. HIV-specific central memory CD8+ T cells was measured after in vitro stimulation with an overlapping Gag-peptide pool in T cells sampled approximately one year after seroconversion. Kaplan-Meier survival analysis and Cox proportional hazard models showed that frequencies of cytokine-producing Gag-specific CD8+ T cells  shortly after seroconversion were neither associated with time to AIDS nor with the rate of CD4+ T-cell decline.The number and percentage of IFN\u03b3 and IL-2 producing CD8+ T cells can be found early in HIV infection, irrespective of subsequent clinical outcome. The fact that both progressors and long-term non-progressors have abundant T cell immunity of the specificity associated with low viral load shortly after seroconversion suggests that the more rapid loss of T cell immunity observed in progressors may be a consequence rather than a cause of disease progression.These data show that high numbers of functional HIV-specific CD8 With an estimated 3 million human immunodeficiency virus (HIV)-related deaths each year, an effective treatment for HIV is urgently needed. Highly active antiretroviral therapy (HAART) results in significant suppression of HIV viral load, but is unable to eradicate the virus from the body, has severe side effects and may lead to resistance. An alternative option to prevent HIV infection and progression to acquired immunodeficiency syndrome (AIDS) might be therapeutic or prophylactic vaccination.+ T cells play an important role in controlling HIV replication. The fact that i) the decline in viral load in acute infection coincides with the peak in HIV-specific CD8+ T-cell numbers + T cells in macaques results in higher viral load + T cells may be unrealistic, a T cell-based vaccine might limit early viral dissemination and immune damage by controlling HIV more effectively during initial infection, thereby leading to slower progression to AIDS It is generally accepted that CD8+ T cells control HIV, the mechanism by which these cells can do so is still poorly understood. Consequently, it is not known what functions will be required of vaccine-induced CD8+ T cells to protect against progression to AIDS. At present, virus-specific CD8+ T cells are mostly quantified using the IFN\u03b3 ELISpot assay when evaluating potential therapeutic and prophylactic vaccines + T cells upon recognition of viral peptides presented on HLA class I molecules. It has been shown that IFN\u03b3 production by HIV-specific CD8+ T cells correlates with tetramer staining  and anti-viral cytotoxicity as measured by chromium release assays + T cells has been associated with low viral load and sustained CD4+ T-cell counts + T cells are able to produce multiple cytokines  and are able to proliferate and degranulate upon in vitro peptide stimulation + T cells is necessary for proliferation and differentiation into effector T cells. In contrast to long-term non-progressors, central memory CD8+ T cells capable of producing IL-2 are only rarely detected in viremic individuals progressing rapidly to AIDS + T cell function. Interestingly Gag, but not Env, specific responses were reported to correlate with low viral load Although there is evidence that CD8+ T cells and low viremia + T cells early in infection, suggesting that these cells are deleted or become functionally impaired as HIV infection progresses Cross-sectional studies have shown a striking relation between functional CD8+ T cells in HIV infection thus far are often limited by small numbers of patients and/or a cross-sectional nature. To reveal the effect of HIV-specific CD8+ T cells on progression to AIDS, we therefore investigated in a large prospective cohort study whether the frequency of HIV-specific cytokine-producing CD8+ T cells approximately one year after seroconversion, when the viral set point has been established Studies evaluating the role of CD8st 1996, ensuring that none of the subjects received highly active anti-retroviral therapy (HAART). Median follow-up to AIDS diagnosis or censoring was 82.7 months (range 14.9\u2013153.9). Forty of the 96 participants (42%) progressed to AIDS during follow-up. Details on inclusion criteria, enrolment and baseline characteristics of ACS participants can be obtained at www.amsterdamcohortstudies.org. Informed written consent was obtained from all participants and the study was approved by the Medical Ethical Committee of the Academic Medical Center.Ninety-six participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS with a known date of seroconversion were selected based on availability of cryopreserved PBMC approximately one year after seroconversion . Follow-up time was censored at July 16 cells per ml in round bottom tubes and stimulated with a Gag-peptide pool  in the presence of co-stimulation  and 2 \u00b5g/ml \u03b1CD49d ) for 6 hours at 37\u00b0C, 5% CO2. As a positive control, cells were stimulated with a combination of PMA and Ionomycin . After one hour, Brefeldin A (Becton Dickinson (BD), San Jos\u00e9, California, United States) was added. After fixation and permeabilisation  cells were stained for 20 minutes at 4\u00b0C with \u03b1CD3-PerCP, \u03b1CD4-APC, \u03b1IL-2-PE and \u03b1IFN\u03b3-FITC monoclonal antibodies (BD), after which cells were fixed in Cellfix (BD) and flow cytometry was performed. First, lymphocytes were gated based on forward scatter and side scatter. Next, cytokine production  was measured in CD3+ CD4\u2212 T cells. At least 300.000 events were acquired and the data was analysed using the software program CELL Quest (BD). Frequencies of IFN\u03b3 and IL-2 producing cells were reported after subtraction of the frequencies in medium controls. Absolute numbers per volume blood were calculated by multiplication of the fraction of cytokine-positive CD8+ T cells with the absolute CD8+ T-cell count per microliter of blood.Intracellular cytokine staining was performed as previously described + T cells for progression to AIDS was tested using Cox proportional hazards analyses and Kaplan-Meier survival curves. Individual markers were first tested univariately. In multivariate analyses, each marker was adjusted for plasma HIV-1 RNA and CD4+ T-cell counts + T cells, or co-expression of CD38 and HLA-DR on CD8+ T cells, all markers known to be predictive for progression to AIDS The effect of HIV-specific cytokine-producing CD8+ T cells early after HIV infection, we analysed the capability of Gag-specific CD8+ T cells to produce cytokines upon in vitro stimulation of T cells sampled approximately one year after seroconversion in each individual , when the viral set point has been established. HLA class I typing was performed for all study participants. This revealed no selection of the HLA alleles known to be associated with either faster (e.g. HLA-B35) or slower  progression to AIDS . Forty of the 96 participants (42%) progressed to AIDS during follow-up. In this prospective cohort study, 96 participants of the Amsterdam Cohort Studies on HIV-1 infection and AIDS (ACS) with a known date of HIV-1 seroconversion were included. Since we aimed to investigate the potential prognostic effect of functional CD8 to AIDS . Detaile+ T cells approximately one year after seroconversion was associated with AIDS-free survival, we measured the number and percentage of IFN\u03b3 and/or IL-2 secreting CD8+ T cells after in vitro stimulation with an overlapping Gag-peptide pool  were comparable to previously reported results by us and others in treatment-na\u00efve patients To test if the presence of HIV-specific cytokine-producing CD8ide pool . We exam+ T cells was plotted against the AIDS-free survival time of the study participants. No correlation could be found for any of the three cytokine profiles with AIDS-free survival time . Furthermore, no correlation was observed between IL-2 and/or IFN\u03b3 producing Gag-specific CD8+ T cells and set point HIV RNA load  we first categorized each study participant in one of three equally-sized groups corresponding to the level of production of the specific cytokine  relative to the overall study population. One year after seroconversion, neither the absolute number of single IFN\u03b3 producing .To investigate the potential prognostic value of cytokine-producing CD8roducing , nor of roducing  nor of droducing  Gag-spec+ T cells, we also performed multivariate analyses using Cox proportional hazard analysis. When adjusted, respectively, for HIV-1 RNA load, total CD4+ T-cell counts, Ki67 expression on CD4+ T cells, and/or the activation status of CD4+ or CD8+ T cells, high numbers of cytokine-producing Gag-specific CD8+ T cells one year after seroconversion were again not associated with slow disease progression .Alternatively we analyzed CD4+ and high CD8+ T-cell responses one year after seroconversion was associated with slow progression to AIDS. This revealed that individuals whose CD4+and CD8+ Gag-specific T-cell response were in the highest tertile had a tendency for prolonged AIDS-free survival. This result was not significant, however, which might be due to the low number of individuals who met these criteria .Finally, we analyzed whether a combination of relatively high CD4+ T cells measured approximately one year after seroconversion for progression towards AIDS, although at least two previous studies have suggested that high frequencies of HIV-specific T cells are associated with subsequent long-term non-progression It has been suggested that strong CTL responses might be capable of controlling HIV replication in individuals with a long-term non-progressive disease course. In the present study we did not find any prognostic value of cytokine-producing HIV-specific CD8+ T cells to investigate their prognostic value for AIDS-free survival. The individuals included in this study were infected in the late nineteen-eighties in Amsterdam, The Netherlands, therefore, we decided to use an overlapping peptide pool based on Gag sequences from the in 1983 isolated reference strain HXB2. There is always a risk of missing responses when using peptides that are not based on the autologous sequence. However, it has been shown that a large proportion of all T cell responses detected using autologous peptides was detected using consensus sequences as well + T-cell responses are most important in containing HIV infection. Kiepiela et al have shown a clear negative correlation between the number of epitopes targeted in Gag and HIV viral load, which was not seen for other HIV proteins et al have shown that the latter HLA alleles have an intrinsic preference to present Gag P24-derived epitopes, in contrast to other HLA alleles not associated with low viral load and slow disease progression + T-cell responses are implicated and would be the first to show an effect. Even using this potentially important protein we did not observe an association with AIDS-free survival. We cannot rule out the possibility, however that, in the early phase of chronic HIV infection, responses to early HIV-1 proteins dominate and might in part determine viral set point We quantified Gag-specific CD8+ T-cell responses one year after seroconversion might not be early enough to reveal a possible cause-effect relationship between HIV-specific cellular immunity and disease progression. However, since i) at that time all individuals have established their viral load set point and the immune system has largely rebounded from the initial effects of acute infection, ii) measuring CD8+ T cell responses too early after seroconversion might lead to false negative responses since it has been shown that the magnitude of the HIV-specific CD8+ T cell response is much lower in primary infection than in the chronic phase + T cell capable of secreting cytokines , we did not find any correlation what so ever . Therefore, it appears that the exact time of sampling after seroconversion was not critical.One could argue that measuring CD8+ T cells one year after seroconversion has no prognostic value for the rate of disease progression does not imply that HIV-specific CD8+ T cells do not contribute to control during HIV infection. Their role in controlling viral load in both acute and chronic HIV infection has been firmly established + T cells can have on the virus + T cells can be found shortly after seroconversion.Our finding that the frequency of cytokine-producing HIV-specific CD8+ T cells producing IFN\u03b3, IL-2, or both, one year after seroconversion +and CD8+ Gag-specific T-cell response are particularly high have a tendency for longer AIDS-free survival. In the present study this holds true for only a small fraction of HIV-infected individuals, so it cannot explain the wide spectrum in HIV disease progression rates observed in untreated HIV infection. If neither CD4+ nor CD8+ HIV-specific T cells are associated with the rate of HIV-disease progression, the question remains what distinguishes individuals who progress rapidly or slowly to AIDS, and why typical progressors lose their functional HIV-specific CD8+ T cells faster compared to individuals with a long-term non-progressive disease course. It cannot be ruled out that other functions of CD8+ T cells than IFN\u03b3 or IL-2 production + T-cell repertoire may determine the clinical outcome of HIV infection. Since both progressors and long-term non-progressors have abundant T cell immunity of the type associated with low viral load early in infection, the more rapid loss of T cell immunity observed in progressors may be a consequence rather than a cause of disease progression, for which systemic immune activation might be a likely candidate We have previously reported a lack of prognostic value of the number of HIV-specific CD4+ T cell-inducing vaccine has failed in a phase IIB clinical trial + T-cell responses to the vaccine components  after vaccination. Although disappointing, these data are in line with our finding that the presence of high numbers of cytokine-producing HIV-specific CD8+ T cells does not guarantee a better clinical outcome.Recently, it became apparent that a CD8"}
+{"text": "However, the trajectories of these two laboratory markers are influenced, in part, by polymorphisms in CCR5, the major HIV coreceptor, and the gene copy number of CCL3L1, a potent CCR5 ligand and HIV-suppressive chemokine. Therefore, we determined whether accounting for both genetic and laboratory markers provided an improved means of assessing AIDS risk.Whether vexing clinical decision-making dilemmas can be partly addressed by recent advances in genomics is unclear. For example, when to initiate highly active antiretroviral therapy (HAART) during HIV-1 infection remains a clinical dilemma. This decision relies heavily on assessing AIDS risk based on the CD4CCL3L1 and CCR5. The predictive value of the CCL3L1-CCR5 GRGs, as estimated by likelihood ratios, was equivalent to that of the laboratory markers. GRG status also predicted AIDS development when the laboratory markers conveyed a contrary risk. Additionally, in two separate and large groups of HIV+ subjects from a natural history cohort, the results from additive risk-scoring systems and classification and regression tree (CART) analysis revealed that the laboratory and CCL3L1-CCR5 genetic markers together provided more prognostic information than either marker alone. Furthermore, GRGs independently predicted the time interval from seroconversion to CD4+ cell count thresholds used to guide HAART initiation.In a prospective, single-site, ethnically-mixed cohort of 1,132 HIV-positive subjects, we determined the AIDS risk conveyed by the laboratory and genetic markers separately and in combination. Subjects were assigned to a low, moderate or high genetic risk group (GRG) based on variations in CCL3L1-CCR5 genotypes may have utility in HIV clinical management. These findings illustrate how genomic information might be applied to achieve practical benefits of personalized medicine.The combination of the laboratory and genetic markers captures a broader spectrum of AIDS risk than either marker alone. By tracking a unique aspect of AIDS risk distinct from that captured by the laboratory parameters,  Concurrently there is strong interest in developing ways to use this genetic information to provide \u201cindividualized medicine\u201d, i.e., tailor the clinical care of patients according to specific elements of their genetic constitution that can convey independent predictive capacity with respect to disease prognostication. However, a framework of how to assess fully whether such genetic information might help improve the clinical management of patients remains unclear, especially when compared to laboratory markers that are considered the gold standard in evaluating disease prognosis. To address this gap in knowledge we used (i) HIV infection, (ii) variations in the genes encoding CC chemokine receptor 5 (CCR5), the major coreceptor for HIV-1 + T cell count reaches a threshold below which their risk for developing AIDS increases significantly + T cell count thresholds vary depending on the clinical and economic settings, but are typically between 200 and 350 CD4+ T cells/mm3+ T cell counts above 350. Those favoring early initiation cite, among other reasons, the risk that progressive immunologic damage will be incompletely reversible after initiation of HAART + T cells before and after receipt of HAART, respectively. Consequently, identifying subjects who, despite HAART, are at greater risk of persistent immunologic damage, or predicting how soon an HIV-infected individual might arrive at a predetermined HAART\u2013initiating CD4+ T cell count poses a diagnostic challenge. Furthermore, although a CD4+ T cell count and plasma viral load provides an excellent snapshot of the immunological and virological status of the infected host at the time of their clinical assessment, they are imperfect surrogates of AIDS risk. This is because both reside downstream of the causal pathways that mediate the extent of CD4+ cell loss and viral replication HIV-1-infected subjects are typically started on highly active antiretroviral therapy (HAART) when their CD4+ T cell counts before and during HAART are likely to be dependent on host-viral interactions + T cell counts, despite suppression of viral replication + nadir (<200 cells/mm3) fail to normalize CD4+ counts, despite HIV-suppressive HAART + T cell depletion before HAART and the immune reconstitution  during HAART might provide a measure of genetic risk that could aid in the clinical assessment and management of HIV-infected subjects. Conceivably, those subjects whose genetic constitution confers a greater risk of progressing rapidly to AIDS as well as impaired recovery during HAART might benefit from earlier initiation of therapy and possibly also from adjuvant therapies that promote immunological recovery  susceptibility to HIV acquisition in European-, African-, Hispanic-American adults, intravenous drug users from Estonia and hemophiliacs from Japan + women from South Africa + and CD8+ T cell responses + T cell counts in subjects who received HAART during chronic or acute/early HIV infection CCL3L1 copy number and CCR5 genotypes that were associated with reduced cell mediated immune responses in HIV-negative individuals of European descent were similar to those that were associated with a rapid rate of disease progression in HIV+ European Americans in vivo parameter of T cell and cell mediated immune responses, and the strength of DTH responses are an independent determinant of AIDS susceptibility CCL3-like genes is also present in chimpanzee CCL3L-like genes in humans and non-human primates.In this study, we focused on evaluating the prognostication capacity of genetic variations in CCL3L1 and CCR5, we assigned subjects to low, moderate and high CCL3L1-CCR5 genetic risk groups (GRGs), defined according to different combinations of specific CCR5 polymorphisms and CCL3L1 gene copy number CCL3L1-CCR5 GRG status was associated with a step-wise increase in susceptibility to depletion of CD4+ T cells during HIV-1 infection, as well as impaired CD4+ T cell recovery during HAART CCL3L1-CCR5 GRG status and CD4+ T cell loss and/or AIDS susceptibility was observed in two separate groups of subjects who were followed from the early stages of their infection within the context of a natural history cohort as well as in a separate cohort of subjects who were recruited during acute/early infection CCL3L1-CCR5 genotypes in subjects from a natural HIV-1 history cohort who were AIDS-free for more than 10 years, as well as in individuals from two different cohorts who were categorized as spontaneous HIV-1 controllers, i.e., elite or viremic controllers CCL3L1-CCR5 GRG status and immune recovery was assessed in subjects who received HAART during chronic infection using two separate phenotypic endpoints: CD4+ T cell count CCL3L1-CCR5 genotype and recovery of CD4+ T cell counts were also observed in subjects who received HAART during acute/early infection To evaluate the genotype-phenotype associations for the combined effects of variations in CCL3L1-CCR5 genetic markers may have dual prognostic capacities, i.e., for both CD4+ T cell loss and recovery. A possible role for these genetic markers in evaluation of AIDS risk was underscored by the observation that CCL3L1-CCR5 GRG status predicted HIV disease course independent of the viral load and CD4+ T cell count as well as other explanatory variables that were in themselves independent markers of disease progression  CCL3L1-CCR5 genetic variations which may not be captured fully by the laboratory markers. The consistency of the disease-influencing associations for CCL3L1-CCR5 GRG status that were independent of viral load and CD4+ T cell count as well as other explanatory variables in two separate groups of HIV-positive subjects prompted us to examine whether CCL3L1-CCR5 genetic factors might have utility in the clinical management of HIV-infected subjects.Collectively, these findings suggested that CCL3L1-CCR5 GRG status to have utility in the clinical management of HIV, in addition to an influence of CCL3L1-CCR5 genotypes on CD4+ cell recovery during HAART, we surmised that the following four criteria would have to be met. First, the prognostic strength of the GRGs for rates of disease progression should be comparable to that of the CD4+ cell count and plasma HIV viral load, contemporary laboratory markers used to assess AIDS prognosis in HIV-positive patients. Second, GRG status should accurately predict an increased risk of developing or progressing rapidly to AIDS when the laboratory markers may fail to do so. Third, the AIDS risk conveyed by the laboratory and genetic markers together, namely the CD4+ T cell count plus viral load plus GRG status, should exceed that conveyed by the two laboratory markers, especially during the early stages of infection when subjects have high CD4+ T cell counts. Fourth, GRG status should serve as independent determinants of the time interval from seroconversion to CD4+ cell count thresholds that are used to guide initiation of HAART. Here, in a large, well-characterized cohort of HIV-1-infected subjects, we investigated whether CCL3L1-CCR5 GRG status met each of these criteria. The sum of our findings using different analytical approaches suggests that the CCL3L1-CCR5 GRG status meet these criteria. These findings have broader translational value as they indicate that AIDS risk is an individual characteristic that might be estimated with an increased level of confidence if one also considers the genetic make-up of the host.For CCL3L1 gene CCR5 genotype data + subjects followed at the Wilford Hall United States Air Force Medical Center (WHMC), San Antonio, TX. This prospective observational cohort is a component of the United States Military's Tri-Service AIDS Clinical Consortium (TACC) Natural History Study + cohort is such that both the seroconverting and seroprevalent groups of patients were followed prospectively from the time of their diagnosis during the early stages of their disease, albeit the approximate time of seroconversion was estimable only in the former group. However, consistent with this recruitment pattern during the early stages of their disease we found that the genotype-phenotype associations detected in these two groups of patients were very similar In this study, we used the copy number of CCL3L1CCR5 haplotype pairs were categorized into three risk categories, and we labeled a patients' CCL3L1-CCR5 genotype as a low, moderate or a high GRG. The prevalence of the low (highCCR5non-detCCL3L1), moderate (highCCR5detCCL3L1 and lowCCR5non-detCCL3L1) and high (lowCCR5detCCL3L1) GRG in the WHMC cohort is 50, 42, and 8%, respectively CCL3L1-CCR5 genotype data for this study was available from 1,103 HIV+ subjects and they were 624, 410 and 69 European-, African- and Hispanic-Americans, respectively The copy number of in vivo (e.g. IL-2 production) and is an independent predictor of disease outcome The outcomes analyzed were risk of development of AIDS, and rate of progression to AIDS as well as to CD4 cell count thresholds used to guide initiation of HAART As described previously To address our study questions/criteria, we used the following statistical approaches.CCL3L1-CCR5 GRGs conveyed a reduced or increased AIDS risk in settings when the laboratory markers would have suggested an opposite risk, we employed the likelihood ratio (LR) statistic. We used this statistic as it more directly describes the effect of a test result (in this case GRG status) on the odds of disease 3, and for the viral load they were < or \u226555,000 copies/ml. These cut-offs were based on published guidelines for assessing AIDS risk that were prevalent during the time these analyses were being conducted. LR was estimated as the ratio of the incidence of AIDS in subjects with a given GRG, CD4 or viral load stratum  and the overall incidence of AIDS in the entire cohort . Thus, the LR represents an altered risk in the possibility of developing AIDS in the future based on a subjects' GRG and specific stratum of CD4 or viral load (or the indicated combinations thereof) divided by the overall likelihood of developing AIDS in the HIV+ subjects in the WHMC cohort during the study period.First, to determine whether the Second, in addition to the LR, we also estimated the pre- and post-test probabilities of developing AIDS during the study period. The LR and probabilities of developing AIDS during the study period were assessed at two levels: we initially calculated LRs and the pretest probability for the laboratory and genetic markers separately , and then in the different CD4 and viral load strata in subjects with specific GRGs .Third, using a Poisson regression model, we estimated the annual incidence of AIDS in the seroconverting component of the WHMC cohort according to a subjects' laboratory and genetic markers.n and It represent the estimated incidence of AIDS in the no therapy era (n) and therapy (t) era from the Poisson regression models, respectively, then NNT\u200a=\u200a1/(In\u2212It). The estimate of NNT obtained was then rounded to the nearest integer.Fourth, we derived an estimate of the number of subjects one would need to treat to prevent the occurrence of one case of AIDS . For this, we applied separate Poisson regression models to data from seroconverters who were recruited in eras when antiretroviral therapy (ART) was available (therapy era) or was not available (no therapy era). From these results, the NNT was calculated as follows: If I3 and for the viral load it was at 55,000 copies/ml; a CD4 cell count of 450 cells/mm3 was used as a threshold to determine the relative prognostic value of the laboratory and genetic markers during the early stages of the infection and was an arbitrary cut-off used to reflect early stage disease. Kaplan Meier (KM) survival curves were constructed to graphically illustrate the rate of progression to AIDS, and the log-rank test was used for between-group analysis. We used Cox proportional hazards models to estimate the relative hazards ) after testing for the assumption of proportional hazards by plotting the Schoenfeld residuals. Schoenfeld residuals were calculated for each Cox proportional hazards model studied by using the Breslow-Peto approach. Model fit was assessed using the likelihood ratio chi-square (LR \u03c72) and Akaike information criterion (AIC). The critical \u03c72 was estimated by dividing the logrank \u03c72 by its degrees of freedom. The risk-scoring systems were first applied to the seroconverting component of the cohort and then for purposes of replication, we also estimated the LR \u03c72 and AIC estimates in the seroprevalent group of subjects in the WHMC cohort. In the second risk-scoring approach, we used the classification and regression trees (CART) that are commonly used as a method of deductive reasoning for the purposes of data mining and extracting relationships among the predictor variables Fifth, we used two distinct yet complementary approaches to assess whether the GRGs provided additive value for prognostication of AIDS over and above that provided by the CD4 cell count and viral load. In the first approach, we used a risk scoring system based on cut-offs for CD4 cell counts and the viral load, and conducted survival analyses for time to AIDS. The cut-offs used were based on CD4 cell count and viral load thresholds at which one might consider initiation of therapy. In the risk scoring systems, the cut-offs for CD4 cell counts were at 200, 350 and 450 cells/mm3. We used Stata 7.0  software for all statistical analyses and the program DTREG  for generation of the classification trees.Finally, KM survival curves were used to determine time-from-seroconversion to the CD4 cell count thresholds that might be used to decide when to initiate HAART. We used the thresholds of 200 and 350 as well as 450 cells/mmCCL3L1-CCR5 GRG status in the clinical management of HIV-infected subjects were addressed as follows.The four criteria that might provide a framework for considering CCL3L1-CCR5 genotype was determined was 39% and 27%, respectively. However, the post-test probabilities of developing AIDS differed according to a person's GRG or CD4 cell count  of developing AIDS based on a subject's baseline CD4 or steady-state viral load stratum before accounting for that person's GRG. Similar estimates for the GRGs were computed before accounting for a subject's CD4 or viral load . The prell count . Notably3  and viral load  profile ; and (iii) higher likelihood ratio \u03c72 and lower AIC values in models that included the GRGs . However, the use of these cut-offs has the limitation of potentially biasing the risk-scoring system towards an improved discrimination of AIDS risk. For this reason, we used an additional approach to address criterion 3 and assessed the role of the GRGs in AIDS prognostication by using a classification and regression tree (CART) approach  and low steady-state viral load ) was associated with a 15% reduced probability of developing AIDS in the future (3) was associated the slowest rate of disease progression  and 2I (\u03c72\u200a=\u200a46.78), showing higher values when GRG status is included in the model).To validate that GRG status provided additional predictive value in the decision tree, we excluded GRG status from the analysis, and determined the risk and rate of progressing to AIDS for the four risk groups defined by the CD4 cell count and viral load cut-offs generated by CART . A compa+ cohort, and we replicated these observations in the seroprevalent component of this cohort . However, those with a low GRG status took nearly seven years longer to progress from <450 to <200 cells/mm3 than all other subjects , the inclusion of a measure of genetic risk might offer an adjunctive, and complementary risk-stratification tool that may provide an improved method for identifying persons at high risk for future AIDS related events. These HIV vulnerable individuals may be ideal candidates for preventive AIDS care such as a closer follow-up, and potentially, earlier initiation of HAART. This inference is based on the following four principal findings.In this study, we tested the hypothesis that in conjunction with laboratory markers currently used to assess AIDS risk, the complex patterns of genetic variations in the human genome may have utility as tools for improved risk assessment of patients infected with HIV-1. The results of this study conducted in a large, and well-characterized natural history cohort of HIV-infected individuals indicate that in addition to the traditional markers of vulnerability  independence from the AIDS risk conveyed by the viral load and CD4 cell count; (ii) equivalence in magnitude to the laboratory markers; and (iii) ability to correctly predict AIDS risk in spite of contrary information imparted in some instances by the viral load and CD4 cell count.3. It is especially noteworthy that in subjects with CD4\u2265453 cells/mm3 and viral load of \u226517,500 copies/ml (\u223c15% of the study cohort), a moderate or high GRG status was associated with a nearly seven-fold increased risk of progressing rapidly to AIDS.Third, the results from several complementary but distinct approaches demonstrated that the genetic and laboratory markers provide additive prognostic information that gauges the continuum of the risk of AIDS and disease progression more accurately than either marker alone. Importantly, the additive predictive capacity of the GRGs was evident during the early stages of the infection such as when the CD4 cell count was greater than 450 cells/mmCCL3L1-CCR5 GRG status served as an independent determinant of how quickly HIV-infected subjects progressed to thresholds of CD4 cell counts that are currently used to decide when to initiate HAART. As a general rule, subjects with a moderate or high GRG progressed to these HAART-initiating CD4 cell count thresholds two to three times faster than those with a low GRG.Fourth, CCL3L1-CCR5 genotypes are not only independent determinants of disease, but more importantly, they are also capturing different aspects of AIDS risk than the traditional components of AIDS risk reflected in the laboratory markers currently used to assess disease status. Second, the time-insensitive nature of the genetic markers and the capacity of the GRGs to assess genetically-defined AIDS risk, especially during the proximal stages of infection, is appealing because there is substantial data suggesting that it is the magnitude of early immune damage that dictates, in part, steady-state viral load, initial CD4+ loss, and subsequently, pace of HIV disease course Genetic risk stratification of HIV-infected patients is especially attractive for three reasons. First, CCL3L1-CCR5 GRG status is suggested by several observations. First, concordant results were obtained when using different analytical approaches and when using a stringent clinical phenotypic endpoint namely AIDS (1987 CDC criteria). The finding that the copy number of CCL3L1 and CCR5 genotypes together provided prognostication during the early stages of the disease (CD4 cell counts of >450 cells/mm3) was detected using two separate approaches: risk-scoring systems  or decreased (HHC or HHG*2) gene/protein expression of CCR5 One needs to be cognizant of an important point with regards to the interpretation of our results. The genetic variations in CCL3L1-CCR5 genetic pathway may regulate the balance between pathogenic and reparative processes from the early stages of the disease course CCL3L1-CCR5-dependent immune responses on HIV-AIDS pathogenesis may differ depending on disease stage. Furthermore, the influence of CCL3L1-CCR5 genotypes on HIV-AIDS pathogenesis is evident at time of viral exposure  and soon after seroconversion CCL3L1 copy number and CCR5 genotype may differ significantly depending on the characteristics and disease stage of the subjects evaluated .These findings also have value for improving our understanding of the factors that influence HIV-AIDS pathogenesis and for the interpretation of genotype-phenotype association studies in general. The ability of the GRGs to provide an additive measure of AIDS risk, including in those with high CD4 cell counts, suggests that the impact of these host factors during chronic infection is partly through viral load-independent mechanisms that are likely operative in the proximal end of the causal pathways that affect CD4 cell loss and establishment of the steady-state viral load. This inference is consistent with those derived from the results our previous studies where we suggested that a common CCL3L1-CCR5 GRG status each explained \u223c9% and \u223c6%, respectively, of the variability in rate of progression to AIDS + cell counts CCL3L1-CCR5 GRGs influence AIDS pathogenesis partly independent of the viral load suggests that strategies to block viral load-independent pathways, such as those linked to the CCL3L1-CCR5 axis, might provide a novel means to curb CD4 cell loss during infection and aid immune reconstitution. Whether this can be accomplished with the current generation of CCR5 blockers needs to be carefully evaluated because studies with a small molecule CCR5 blocker + T cell recovery during HAART, in instances when the prevailing viral strain is X4-tropic and independent of viral load suppression, respectively.The notion that a large component of AIDS pathogenesis might be conveyed by parameters that are independent of the viral load is suggested by our previous findings where we found that steady-state viral load and CCL3L1- and CCR5-based genetic risk stratification was not only independent of, but more importantly, comparable to the prognostic information provided by currently used predictors of AIDS risk. Thus, additional studies will be required to determine whether in a manner analogous to the use of HIV genotype, when applied judiciously along with knowledge of the clinical and laboratory parameters, host genotypes  that associate with different aspects of HIV disease pathogenesis, independent of CD4 cell count and viral load, might have practical utility in guiding the care of infected individuals. Of broad relevance, using HIV as a model system, we outline a series of analyses that might have application to other diseases when assessing whether genetic information can be used to improve the clinical care of patients afflicted with these diseases.In summary, we have conducted proof-of-concept analyses to determine whether genetic information can be used to bring us one step closer towards personalized HIV medicine. Using several different approaches, in this prospective study of HIV-1 infected individuals, the predictive capacity of Text S1Supplemental Online Materials - Text(0.07 MB DOC)Click here for additional data file.Figure S1Classification trees and their clinical application in the HIV+ WHMC cohort.(0.35 MB TIF)Click here for additional data file.Figure S2Replication of results of CART analysis in the seroprevalent component of the WHMC HIV+ cohort.(0.31 MB TIF)Click here for additional data file.Table S1(0.04 MB DOC)Click here for additional data file."}
+{"text": "Viral load monitoring is not available for the vast majority of patients receiving antiretroviral therapy in resource-limited settings. However, the practical utility of CD4 cell count measurements as an alternative monitoring strategy has not been rigorously assessed.In this study, we used a novel modelling approach that accounted for all CD4 cell count and VL values measured during follow-up from the first date that VL suppression was achieved. We determined the associations between CD4 counts , VL measurements and risk of virological failure  following initial VL suppression in 330 patients in South Africa. CD4 count changes were modelled both as the difference from baseline (\u0394CD4 count) and the difference between consecutive values (CD4 count slope) using all 3-monthly CD4 count measurements during follow-up.P = 0.003), \u0394CD4 counts , and most strongly with CD4 count slopes . However, the distributions of the absolute CD4 counts, \u0394CD4 counts and CD4 count slopes at the time of virological failure did not differ significantly from the corresponding distributions in those without virological failure . Moreover, in a receiver operating characteristic (ROC) curve, the association between a negative CD4 count slope and virological failure was poor .During 7093.2 patient-months of observation 3756 paired CD4 count and VL measurements were made. In patients who developed virological failure (n = 179), VL correlated significantly with absolute CD4 counts (r = - 0.08, CD4 count changes correlated significantly with VL at group level but had very limited utility in identifying virological failure in individual patients. CD4 count is an inadequate alternative to VL measurement for early detection of virological failure. Access to antiretroviral therapy (ART) is expanding in low- and middle-income countries with over 2 million people receiving treatment by December 2006, representing 28% of the 7.1 million estimated to be in need . Over 1.Plasma viral load (VL) monitoring, the gold standard used in high-income countries for diagnosing virological failure, is not available in many resource-limited settings. Currently a single World Health Organisation (WHO)-recommended second-line regimen is the only therapeutic option available for HIV-infected patients in sub-Saharan Africa who develop virological failure during their first-line regimen . AlthougRoutine VL monitoring in resource-limited settings requires significant infrastructure and expertise and remains prohibitively expensive in most settings. Other low-cost means of detecting virological failure must therefore be considered. Colebunders and colleagues, for example, proposed an algorithm based on clinical and treatment history and inexpensive laboratory indices such as haemoglobin level and total lymphocyte count . HoweverWhen considering the utility of CD4 cell counts as a surrogate for virological failure, the critical issue is whether the variability in CD4 cell count measurements adequately reflects the variability in viral load. A number of previous observations suggest that this may be limited. Firstly, in a study of untreated patients in the USA, higher VLs were associated with greater rates of CD4 cell decline at a group level, but had minimal value for predicting the rate of CD4 cell decline in individual patients; only 4%\u20136% of the variability in CD4 cell losses could be explained by plasma VL . SecondlA number of studies have previously examined factors associated with virological treatment failure in high-income settings -23. HoweThe Cape Town AIDS Cohort (CTAC) has been described in detail previously . In brie\u00ae, Roche Molecular Systems, Branchburg, New Jersey, USA) and CD4 counts were measured by flow cytometry . Blood CD4 cell counts and plasma VL were measured every 2\u20133 months when patients were routinely reviewed. Clinical stage of disease was assessed using WHO criteria. Demographic data were recorded and the socioeconomic status of each patient was defined using the Cape Metropolitan Council suburbs composite index, which has been described previously [Viral load was determined by reverse transcriptase-polymerase chain reaction . In this analysis virological failure-free survival was defined as the time from the date of first virological suppression to when viral load was confirmed to reach > 1,000 copies/ml, death or last known clinic visit. Risk factors considered in the analysis were prevalent AIDS  and incident AIDS , socio-demographic variables , baseline CD4 cell count and follow-up CD4 cell count (categorized a priori as a < 100 or \u2265 100 cells/\u03bcl increase at any time-point during follow-up). Follow-up CD4 cell count measurements were modelled as a time varying covariate. At each time-point in the modelling process, the CD4 cell count value considered was the value recorded at that specific time-point, if available. Otherwise, the most recent recorded value (within 2\u20133 months) was considered. Variables significantly associated with the likelihood of occurrence of virological failure in univariate models (P < 0.05) were considered for inclusion in a multivariate model.The Wilcoxon matched pairs test was used to compare continuous variables and the \u03c710 copies/ml) done during follow-up and either the concurrently measured absolute CD4 counts, \u0394CD4 count values or CD4 count slopes at each time-point. In these analyses the strength of association was assessed by calculating Pearson correlation coefficients.Different strategies were employed to comprehensively assess the strength of the association between treatment-induced changes in CD4 cell count and virological failure. Firstly, for patients who failed virologically, we fitted three separate scatter-plots of all VL measurements  curve. The area under the ROC curve was assessed with the use of the C statistic. Sensitivity, specificity, positive predictive value, negative predictive value estimates were calculated, with 95% confidence interval (CI), using Clopper-Pearson exact method or Fleiss approximation as appropriate.Of 360 patients who started ART during the study period, 330 (91.7%) achieved initial viral load suppression during follow-up and were therefore included in the analyses of virological failure. All treatment regimens incorporated at least 3 drugs; the numbers of patients receiving regimens based on triple nucleosides, a non-nucleoside reverse transcriptase inhibitor or a protease inhibitor were 51 (15%), 115 (35%) and 164 (50%), respectively. Patients were followed for a median of 24.7 patient-months  of observation. During this time, 15 (4.5%) patients died.Overall, a total of 3756 paired CD4 cell count and VL measurements were made during 7093.2 patient-months of observation. 179 (54.2%) patients developed virological failure with an incidence of 30.3 (95%CI 26.2\u201334.2) cases per 100 patient-years. Virological suppression was maintained in the remaining 151 (45.8%) patients. Kaplan-Meier analysis showed that risk of virological failure decreased with increasing duration of follow-up Figure . The medThe baseline clinical and socio-demographic characteristics are reported in Table P = 0.32), baseline CD4 cell count , baseline WHO stage , incident AIDS , age , gender , and socio-economic status . The lack of association with baseline CD4 cell count was further confirmed using a stratified Kaplan-Meier plot , \u0394CD4 cell count , and most strongly with CD4 count slope . This suggests that the CD4 count slope at a given time-point would be the strongest indicator of the likelihood of virological failure.We next examined in greater detail the associations between all viral load and CD4 cell count values measured concurrently during follow-up. Correlations between VL and absolute CD4 count, \u0394CD4 cell counts and CD4 cell slopes were calculated for those patients who developed virological failure Figure . SignifiP = 0.99, P = 0.92 and P = 0.75, respectively).CD4 cell counts measured at the time of virological failure were also compared with the distribution of all CD4 cell count measurements obtained from patients who did not develop failure Figure . These a10 VL among those who developed virological failure, we fitted a receiver operating characteristic curve (ROC) using data from all the patients to examine this association further    of the total of 360 patients treated in this cohort during follow-up and were therefore not included in the above analyses. Separate analysis of data from these patients showed that a significant correlation was similarly observed between all measurements of absolute CD4 counts and the corresponding log001) Fig . Howeverely) Fig . This shEarly detection of virological failure is important for optimal management of HIV-infected patients receiving ART. Patients who continue to receive a failing regimen are at risk of immunological failure, morbidity and death. Moreover, accumulation of multiple antiretroviral drug resistance mutations may compromise the response to future drugs and fuel the spread of primary drug resistance within communities. Since VL monitoring is not available in most resource-limited settings, we investigated the utility of CD4 cell count measurements for predicting virological failure in a cohort of South African patients. Baseline absolute CD4 cell counts as well as clinical and socio-demographic characteristics were not predictive of virological failure. Analyses of longitudinal data from those who developed virological failure revealed that absolute CD4 cell counts and CD4 cell count changes (\u0394CD4 cell counts and CD4 cell count slopes) were significantly correlated with viral load measurements at a group level. However, subsequent analysis showed that none of these methods of analysing CD4 cell counts could be used to identify individual patients at the time they developed virological failure. Since the distributions of CD4 cell counts and CD4 cell count changes among those with virological failure did not differ significantly from those of patients who maintained virological suppression, these could not be used to provide a clinically useful means for individual patient assessment for virological failure.a priori. Other studies assessing factors associated with virological failure did not account for all CD4 cell count measurements performed during follow-up [A unique feature of our study is that we used a novel modelling approach that accounted for all CD4 cell count and VL values measured during follow-up from the first date that VL suppression was achieved. Some previous studies have modelled the difference between the CD4 cell counts measured at initiation of treatment and at a single arbitrary point during ART defined ollow-up -23. Neitollow-up .Baseline CD4 cell count was not predictive of virological failure in this ART-na\u00efve population. However, in patients who developed virological failure, absolute CD4 cell count measurements, \u0394CD4 cell counts and CD4 cell count slopes during ART each correlated significantly with VL measurements taken at the same time-points. Of these three parameters, the CD4 cell count slope was the most strongly correlated. This indicates that the rate of increase or decrease of CD4 cell count at a given time-point was the parameter that was most strongly associated with current VL. However, the distributions of \u0394CD4 cell count and CD4 cell count slope values were very broad even among patients who maintained virological suppression. This suggests that considerable fluctuations in CD4 cell counts occur among patients despite sustained virological control. When these distributions were compared with the distributions of data from patients who had current virological failure, they almost completely overlapped. This demonstrated that absolute CD4 cell counts and CD4 cell count changes could not be used to identify patients who have developed virological failure. These findings were further corroborated by the observation that the distributions of CD4 cell count changes in the 30 patients who never achieved virological suppression were also broadly overlapping with the distributions of data from those who maintained virological suppression.To investigate these associations further, we focussed on the use of CD4 cell count slopes since this was the parameter most strongly associated with VL at a group level. However, ROC curve analysis confirmed that use of CD4 slopes provided very poor test characteristics for predicting virological failure. The specificity and sensitivity of a negative CD4 cell count slope was low, showing that this parameter was not of practical utility in this clinical setting. Furthermore, the data show that a negative CD4 cell count slope could not even be used as a screen to identify those at high risk of virological failure as a means of rationing scarce viral load monitoring resources.A strength of this study is that patients were closely followed in a multicentre clinical trials unit with strict protocols for regular clinical and laboratory monitoring every 2\u20133 months, leading to reliable identification of virological failure. As soon as a VL > 1,000 copies/ml was first detected, confirmatory viral load testing was done. The cohort characteristics were diverse and so the data are not only relevant to those with advanced immunodeficiency. Despite differing cohort characteristics, follow-up procedures and analytic approaches, our data are consistent with and extend previous studies that have found a poor association between CD4 cell counts and the development of virological failure ,15.We acknowledge the limitations of this study. An important potential limitation is that all patients studied were ART-na\u00efve. Therefore these findings may not be generalisable to treatment-experienced patients. Our patients participated in international multicentre clinical trials. Their experience may differ from that of patients accessing treatment in a community-based setting. We do not have good assessments of treatment compliance although the mechanism underlying virological failure is unlikely to affect the relationship between CD4 cell counts and viral load. Despite a limited cohort size, follow-up in this study was prolonged, a substantial proportion developed virological failure and the number of paired CD4 cell counts and VL measurements was large.In conclusion, we have shown that although changes in CD4 cell count correlated significantly with VL at a group level, they had very poor predictive value when being used to assess individual patients. Thus, CD4 cell count measurements cannot be used as a substitute for virological failure monitoring. Rigorous cost benefit analyses are required to further evaluate use of VL monitoring in this setting. Furthermore, there is a great need for development of simplified techniques to measure VL and for exploration of alternative low-cost assays for monitoring .The authors declare that they have no competing interests.All the authors participated in the design of the analyses and the writing and revising of the manuscript. MB did the analyses.The pre-publication history for this paper can be accessed here:"}
+{"text": "It has become increasingly apparent that anti-tumor efficacy using adoptively transferred T cells is linked to their duration of in vivo persistence and can only be achieved when combined with some form of pre-infusion patient conditioning regimen. An optimal conditioning regimen that provides a positive benefit without serious toxicities has yet to be defined. We have established a unique clinical model that allows for evaluation of a given conditioning regimen on adoptively transferred T cells in humans. In this first-in-human study (FHCRC #1796), we evaluate the use of fludarabine, an FDA-approved reagent with predictable lymphodepleting kinetics and duration of action, as a conditioning regimen that promotes homeostatic upregulation of cytokines and growth signals contributing to in vivo T cell persistence.Adoptive T cell therapy involving the use of 10/m2; the first infusion was given without fludarabine conditioning, and the second CTL infusion was given after a course of fludarabine (25 mg/m2/day\u00d75 days). This design permits intra-patient comparison of in vivo T cell persistence pre- and post-fludarabine. Nineteen CTL infusions were administered to ten patients. No serious toxicities were observed. Three of nine evaluable patients experienced minor response or stable disease for periods of 5.8\u201311.0 months with two additional patients demonstrating delayed disease stabilization. The median overall survival in this heavily pre-treated population was 9.7 months. Fludarabine led to a 2.9 fold improvement in the in vivo persistence of transferred CTL clones from a median of 4.5 days (range 0\u201338+) to 13.0 days (range 2\u201363+) (p<0.05). Fludarabine lymphodepletion increased plasma levels of the homeostatic cytokines IL-7 and IL-15. Surprisingly, fludarabine also increased the relative percentage of CD4+ T cells expressing the regulatory protein Foxp3.We conducted a phase I study in patients with refractory metastatic melanoma. Patients received two infusions of a single tumor-reactive antigen-specific CTL clone expanded to 10Lymphodepletion with fludarabine enhances transferred T cell persistence but suggest that additional improvements to optimize T cell survival and address regulatory T cells are critical in providing anti-tumor efficacy.NCT00317759ClinicalTrials.gov  Tumor-reactive effector cells of desired specificity and phenotype can be identified in vitro, selected based on expression of a high affinity receptor and specific surface markers and expanded to several billion in number. The use of a well-defined, uniform population of T cell clones facilitates in vivo tracking and provides a means of rigorously evaluating the influence of extrinsic immunomodulatory factors on the anti-tumor T cell response.Adoptive T cell therapy involves the in vivo persistence and the duration of in vivo persistence has been closely linked to the clinical responseIn phase I clinical trials, transfer of antigen specific CD8+ T (CTL) cells for the treatment of patients with metastatic melanoma led to encouraging clinical responsesin vivo through a variety of mechanisms including recruitment of homeostatic proliferative cytokines such as IL-7 and IL-15In murine models, pre-infusion conditioning (in the form of chemotherapy or radiation-induced lymphodepletion) may extend the survival and function of transferred T cell in vivo T cell expansion and in some cases, virtual replacement of the entire peripheral T cell repertoire with the infused clone. It is not clear, however, that such a skewed reconstitution of the immune system is required for optimizing T cell persistence nor that such a profound level of immuno-depletion which was accompanied by serious and potentially life-threatening toxicities, is essential. We postulated that induction of a relative lymphopenia without attendant serious toxicities may be sufficient to upregulate in vivo homeostatic cytokines to the benefit of transferred T cells.In a recent study reported by investigators at NIHFludarabine is a purine analog which induces lymphopenia when administered in a standard five day course. It reduces the reduces the average CD4 counts by \u223c80%, with sustained lymphodepletion for approximately 4 weeks. While some risk associated with lymphopenia is observed in patients receiving multiple cycles of fludarabine therapy, the frequency and severity of infectious complications is significantly less and the period of lymphopenia is well-defined in patients receiving a single five-day course of fludarabine10 cells/m2 is used for both a first infusion given to patients without conditioning, and then, for a second infusion, following patient conditioning. This strategy allows intra-patient comparisons and eliminates any confounding variability associated with disparate behavior among T cell clones in different recipients. In this study, we evaluate the use of fludarabine, a lymphodepleting agent with predictable kinetics and duration of action, as a conditioning regimen to enhance the in vivo persistence of transferred T cells. We report the results of a phase I study, Fred Hutchison Cancer Research Center (FHCRC) Protocol #1796, in ten patients with refractory, metastatic melanoma receiving autologous CD8+ T cell clones targeting a melanoma-associated antigen , without and with prior fludarabine lymphodepletion.To evaluate the influence of fludarabine lymphodepletion, we established a unique clinical model that allows for rigorous evaluation of the influence of a given conditioning regimen on T cell therapy in humans. A single tumor-reactive antigen-specific CTL clone expanded to 10This study was conducted according to the principles expressed in the Declaration of Helsinki. FHCRC protocol #1796 received prior approval by the institutional review board at the Fred Hutchison Cancer Research Center. All patients provided written informed consent for the collection of samples and subsequent analysis.in vitro testing. CTL clones demonstrating rapid in vitro growth and specific lysis of antigen-positive tumor targets in a Cr51 release assay were selected for expansion. Clones were expanded in a 14 day cycles using anti-CD3 antibody (OKT3) at 30 ng/ml, irradiated allogeneic PBMCs at 106/ml, irradiated allogeneic lymphoblastoid cell lines (2\u00d7105/ml), and serial IL-2 at 50 U/ml every 2\u20133 days as described previouslyThe protocol for this trial and supporting CONSORT checklist are available as supporting information; see in vitro and cryopreserved until needed. Antigen specific T cell infusions were administered at 1010 cells/m2 intravenously for both infusion#1 and #2 according to the study schema in 5 U/m2 twice-daily s.c. for 14 days following each T cell infusion as a source of helper support. The dose of IL-2 used is sufficient to saturate the high-affinity IL-2 receptor in vivo, and, when administered alone, has no anti-melanoma effect and minimal toxicity2/day consecutively for five days. Two days following the last dose of fludarabine, a second infusion of T cells was administered. In previous studiesin vivo persistence before the second infusion. Clinical trial data was analyzed by HW and CY, and reviewed by all authors.Ten patients were underwent treatment in a phase I study of adoptive T cell therapy. The procotol was open for recruitment from May 2003 through June 2006. All patients met the following entry criteria: histopathologic diagnosis of metastatic (stage IV) melanoma expressing antigens Mart-1, gp100, or tyrosinase by immunohistochemistry, HLA-A0201+, age<75, well-controlled CNS disease or absence of CNS disease, and no clinically significant cardiac, hepatic, renal, or pulmonary dysfunction. All patients had measurable disease refractory to standard or investigational treatments. 38 patients were initially screened and 17 patients met entry criteria for study (21 patients excluded were non-HLA02). Subsequently 6 patients were excluded for metastatic progressive disease in the brain. We were unable to generate T cells for one of the patients meeting entry criteria. Patients underwent leukapheresis before initiating other therapies in order that T cell clones could be generated Patients were monitored for toxicities based upon Common Toxicity Criteria v3.0in vivo persistence of T cells in peripheral blood, PBMCs were prepared from samples drawn on day 0 (pre-infusion), and days 1, 3, 7, and weekly until at least day 28. Phlebotomy maybe delayed for one day due to logistical or technical reasons. After completion of the study, PBMC samples were thawed and analyzed simultaneously by staining with peptide-MHC tetramer-APC or PE (25\u201350 ug/ml), anti-CD8-PE-Cy7, anti-CD3PE or APC, and \u201cdump\u201d antibodies. Flow cytometric analyses were carried out on a minimum of 50,000 cells. The frequency of antigen-specific CTL is presented as the fraction of tetramer+CD8+ lymphocytes divided by the total number of CD8+ cells. The duration of persistence is defined as the duration of an increase in tetramer+ CTL frequency at least two fold greater than the frequency in the pre-T cell infusion sample. All patient samples were tested in duplicate. This method detects with high specificity a frequency of antigen-specific T cells as low as 0.1% CD8+ cells.Tetramers were generated according to the protocol of Altman5 cells were stained for surface markers for 30 minutes at 22\u00b0C, fixed for 30 minutes with 1\u00d7 Fix/Perm buffer. After three washes, cells were permealized in Perm buffer with DNase I (100 U) for 30 minutes followed by three washes. Then cells were blocked with 2% fetal calf serum and stained with PE-conjugated anti-human foxp3 . The frequency of Foxp3+ CD4+ cells is presented as a fraction of the total number of CD4+ cells after gating on CD3+ cells.The human antibodies APC and PE-conjugated anti-CD3, FITC and PE-Cy7 conjugated anti-CD8, FITC-conjugated anti-CD4, and FITC-conjugated anti-CD14/16/19 \u201cdump antibodies,\u201d were obtained from BD biosciences. PE-conjugated anti-Foxp3 (Ebiosciences) and intracellular staining was performed according to the manufacturer's instructions and modified as follows: 5\u00d710Plasma samples were drawn prior to the first T cell infusion, immediately prior to the second T cell infusion (corresponding to 48 hours post-fludarabine), and timepoints 7, 14, and 21 days after the second T cell infusion. Plasma samples were frozen, thawed, and analyzed simultaneously by the Cytokine Analysis Facility at the FHCRC for IL-7, IL-15, and in selected cases IL-2 by sandwich ELISA. This assay was capable of detecting at least 0.4 pg/ml of IL-7 or IL-15.5 cells per well and co-cultivated with stimulator monocytes for 24 h. The plates were analyzed using an automated ImmunoSpot Analyzer (Cellular Technology). Results are presented as the mean number of spot forming cells/105 PBMCs.Human IFN-\u03b3 ELISPOT assays were performed as previously describedSignificance of variation between two groups was evaluated using a two-tailed paired t test, with p<0.05 considered significant. The Wilcoxon signed rank test was used to compare T cell persistence before and after fludarabine. Linear regression for best-fit analysis, paired t tests, and Wilcoxon signed rank test were performed on a GraphPad Prism\u2122 4.0a software.Nine of the patients presented with cutaneous melanoma and one with anal mucosal melanoma Table 1.Patients were monitored for signs or symptoms of toxicity including autoimmune disorders since Mart-1, gp100, or tyrosinase are found in normal melanocytes and uveal tissue. No grade III or IV toxicity was observedAll patients at the time of T cell infusion had progressive metastatic disease. One patient received only one infusion of T cells. Of the nine patients who were able to receive both planned infusions, disease stabilization was observed in two patients for a period of 5.8 and 7.0 months, and one minor pulmonary response with disease progression at 11.0 months Table 2.3 (range 280\u20131350/mm3). CD4 counts declined to a median of 150 cells/mm3 (50\u2013220) after fludarabine and remained below normal for at least four weeks (3 (160\u2013511), and in two cases remained <500/mm3 for up to 8 weeks after conditioning. As anticipated, this period of relative CD4 lymphopenia was accompanied by an elevation in IL-7 and IL-15 plasma levels (compared to baseline pre-infusion levels). Analyses for homeostatic cytokines IL-7 and IL-15 were obtained in serial plasma samples prior to the first T cell infusion, just prior to the second T cell infusion, and weekly thereafter. Median plasma IL-7 levels rose from undetectable levels at baseline to 2.9 pg/ml (0\u201324.2) at day 0 of the second infusion (p\u200a=\u200a0.053). Median plasma IL-15 levels rose from undetectable levels at baseline to 5.5 pg/ml (0\u20138.9) at day 0 of the second infusion (p<0.01).Median pre-infusion (baseline) absolute CD4+ cell count was 770/mmur weeks Fig. 2. in vivo survival of transferred T cells was determined by measuring the frequency of tetramer+ CD8 T cells in peripheral blood samples (see in vivo persistence of transferred T cells was 4.5 days (range 0\u201338+) after the first T cell infusion and extended to 13.0 days (2\u201363+) after the second infusion . Overall, fludarabine improved the in vivo persistence of transferred T cells by an average of 2.9 fold. Tetramer+ CTL frequency peaked on days 1\u20133 post-infusion at a median of 0.41% (0.10\u20137.98) of CD8+ T cells after the first infusion and increased to 2.32% (0.18\u201314.1) after the second infusion. Three patients  did not have an appreciable presence of transferred T cells after the first infusion in peripheral blood by our criteria, however, they clearly developed a measurable and significant tetramer+ population after fludarabine conditioning and second infusion. Among the three patients who had received therapy with CD8+ T cell clones on our previous T cell trial, there was no evidence of a residual infused T cell population at baseline. Patient #7 received only the first infusion, yet tetramer+ T cells were detectable at >2% of CD8+ T cells for at least 38 days. In patient #8, the presence of tetramer+ population was observable for at least 63 days at a level of >1% of CD8 cells . In general, approximately 30% of the infused CTL clones identified in vivo by tetramer analysis were capable of secreting IFN-\u03b3 by ELISPOT analysis (adjusted for CD8+/PBMC ratio). When these clones are tested in vitro under optimal conditions, a comparable fraction (25 to 30%) of T cells are producing IFN-\u03b3 at any one time suggesting that the infused clones retain functional responsiveness in vivo.We measured the functional capacity of adoptively transferred CTL clones to produce IFN-\u03b3 in response to in vivo effect of corticosteroids clearly diminished the capacity of the CTL clone to produce IFN-\u03b3 in response to antigen stimulation.Patient #7 received high dose corticosteroids four days after his first T cell infusion for a recurrent CNS metastasis Fig. 3B.Following fludarbine lymphodepletion, the percentage of CD4+ cells expressing Foxp3 rose from a median pre-therapy level of 7.4% (range 0.5\u201311.8%), to 18.0% (11.9\u201326.6%) just prior to the second T cell infusion (p<0.01), and remained elevated at 12.0% (7.72\u201319.7%) on day 21 after the second infusion (p<0.01) Fig. 4. Limited results of functional analysis from post-infusion PBMC samples of flow cytometry sorted CD4+CD127lo cells were explored in two patients see Fig. S1.ex vivo generated antigen specific T cell clones permits selection of a uniform population of well-defined cytotoxic T cell clones for infusion with known in vitro functional performance characteristics. In our previous studies, we have shown that adoptively transferred antigen-specific CD8+ CTL clones are detectable post-infusion, persist in the presence of IL-2 supplementation, are able to traffic to tumor sites, and effect anti-tumor responsesUse of in vivo persistence of transferred T cells by almost 3-fold. IL-15 is well described as a homeostatic cytokine promoting CD8+ T cell survival and proliferationOur studies reveal that fludarabine mediated lymphodepletion was modest (median CD4+ nadir \u223c150cells/ul), but sufficient for the upregulation of detectable levels of homeostatic cytokines (IL-7 and IL-15) and enhancement in the duration of Transferred T cells after fludarabine conditioning were detectable at high frequencies. In six patients, they comprised >2% of the CD8+ compartment in the peripheral blood from days 1\u20133 post-infusion. In two of the patients, (Patients 7 and 8), they were present in >1% frequency of CD8+ cells at day 38 and 63 after infusion. In our previous study (1), the median persistence of T cells in the presence of IL-2 was nearly 17 days compared to 4.5 days (without conditioning) and 13 days (post-fludarabine) in this present study. In contrast to our previous study, in order to administer identical T cells in the two infusions, T cells were cryopreserved until needed and thawed prior to infusion. Although viability of T cells immediately prior to infusion was excellent (>90%), this process may have affected the ultimate survival and proliferative ability of T cell clones.This study was designed to reduce the interpatient variability by examining T cell persistence before and after administration of fludarabine. The median T cell persistence after the first infusion was 4.5 days. Only one patient had any detectable level of transferred T cells at the time of fludarabine adminstration (given on days 21\u201325 after first T cell infusion). Fludarabine rapidly resulted in lymphodepletion and elimination of any residual T cells in that patient (#8). At the time of the second T cell infusion, none of the T cells from the first infusion were detectable with tetramer monitoring. However, one limitation of this study is that we cannot fully rule out the possibility of a sub-detectable population from the first T cell infusion involved in altering the immunologic milieu for the second infusion. Because fludarabine rapidly and effectively depletes 80\u201390% of endogenous T cells, a cross-over effect from the first infusion is very unlikely.in vivo demonstration of corticosteroid's deleterious effects upon the functional capacity but not survival of CD8+ T cells in a patient who received high-dose dexamethasone shortly after his T cell infusion. Activation of the glucocorticoid receptor on T cells is known to selectively inhibit expression of IFN-\u03b3 and other Th1 cytokines, possibly by direct interaction with the Th1-specific transcription factor T-betin vitro, this example would be the first demonstration that corticosteroids can modulate the functional capacity of adoptively transferred human effector T cell clones in vivo, underlining the importance of evaluating both numeric and functional persistence when tracking T cells in vivo for efficacy and toxicity.Transferred T cell clones also remain functional after infusion, capable of producing IFN-\u03b3 in response to antigen specific stimulation with one exception. One serendipitous result of using a well-defined clonal T cell population for adoptive therapy, was a dramatic hi cellshi Treg in vivo is regulated by both IL-2 and lymphopeniaIn addition to upregulating homeostatic cytokines, fludarabine conditioning was postulated to reduce regulatory Foxp3+ CD4+ cells (Treg). Treg cells, characterized as CD4+/CD25hi/foxp3+ are known to be expanded in a variety of hematologicFurthermore, there are safety concerns regarding fludarabine when combined with other severe lymphodepleting modalities. Fludarabine may contribute to a number of serious complications observed in other studiesWhile the clinical responses in this trial are modest, this treatment was undertaken in a very heavily pretreated population. Three of the patients in this protocol had previously received adoptive T cell targeted therapy on other trials and had progressed. Median overall survival for all ten patients is 9.7 months. This fares very favorably compared to historical control of \u223c4 months for patients with refractory metastatic melanomaThis first study of involving lymphodepletion and CD8+ T cell clones was designed to limit toxicity of lymphodepletion while balanced to promote homeostatic cytokines and reduce regulatory T cells. We acknowledge that higher degrees of lymphodepletion may increase the availability of homeostatic cytokines and further reduce regulatory T cells. However, the prolonged CD4 lymphopenia observed with fludarabine may be counterproductive from the depletion of helper CD4+ cells. Other lymphodepleting agents, such as cyclophosphamide (when given in high doses), result in greater, but transient degree of lymphodepletion and may provide a selective advantage.Potential opportunities to further improve T cell persistence and clinical response, include, achieving a greater degree of lymphodepletion and enhanced homeostatic cytokine availability with the use of high dose cyclophosphamide, selective depletion of regulatory CD4 T cellsChecklist S1(0.05 MB DOC)Click here for additional data file.Flow Diagram S1(0.03 MB DOC)Click here for additional data file.Protocol S1(0.76 MB PDF)Click here for additional data file.IRB approval S1(0.23 MB PDF)Click here for additional data file.Figure S1Fludarabine induced regulatory T cells have suppressive capability. Functional analysis from post-infusion PBMC samples of flow cytometry sorted CD4+CD127lo cells. CD4+CD127lo and CD4+CD127hi cells were sorted by flow cytometry in two patients 14 days after T cell infusion. We compared CD127lo and CD127hi subsets in a mixed lymphocyte reaction with autologous responder and irradiated allogeneic stimulator cells. CD127low cells suppress thymidine incorporation in a proliferation assay by 36% in one patient and 18% in another .(0.23 MB TIF)Click here for additional data file."}
+{"text": "The evolution of plasma viral load after HIV infection has been described as reaching a setpoint, only to start rising again shortly before AIDS diagnosis. In contrast, CD4 T-cell count is considered to show a stable decrease. However, characteristics of marker evolution over time depend on the scale that is used to visualize trends. In reconsidering the setpoint theory for HIV RNA, we analyzed the evolution of CD4 T-cell count and HIV-1 RNA level from HIV seroconversion to AIDS diagnosis. Follow-up data were used from two cohort studies among homosexual men (N = 400), restricting to the period before highly active antiretroviral therapy became widely available (1984 until 1996). Individual trajectories of both markers were fitted and averaged, both from seroconversion onwards and in the four years preceding AIDS diagnosis, using a bivariate random effects model. Both markers were evaluated on a scale that is directly related to AIDS risk.Individuals with faster AIDS progression had higher HIV RNA level six months after seroconversion. For CD4 T-cell count, this ordering was less clearly present. However, HIV RNA level and CD4 T-cell count showed qualitatively similar evolution over time after seroconversion, also when stratified by rate of progression to AIDS. In the four years preceding AIDS diagnosis, a non-significant change in HIV RNA increase was seen, whereas a significant biphasic pattern was present for CD4 T-cell decline.HIV RNA level has more setpoint behaviour than CD4 T-cell count as far as the level shortly after seroconversion is concerned. However, with respect to the, clinically more relevant, marker evolution over time after seroconversion, a setpoint theory holds as much for CD4 T-cell count as for HIV RNA level. CD4 T-cell count and HIV RNA level  are the most widely used markers of progression to AIDS and death in HIV-1 infected persons. Investigating their natural course after infection and the effect of covariates on this natural course is of great importance for prognosis, deciding when to start highly active antiretroviral therapy (HAART), and the understanding of marker dynamics after HAART interruption. It is generally agreed that CD4 T-cell count shows a consistent decline after HIV infection. For the evolution of viral load, the setpoint theory was introduced soon after the implementation of HIV RNA assays . Three cThe predictive value of the level in viral load reached shortly after seroconversion has been shown convincingly before ,12. The The 400 persons contributed 2192 person-years of follow-up and 166 AIDS events. Average follow-up time was 6.0 years for the Amsterdam cohort (maximum 14.0 years) and 5.4 years for the French cohort (maximum 9.3 years). We had 6761 CD4 and 3807 HIV RNA measurements. Of the latter, 9% (n = 344) were below the detection limit. Only 183 individuals had HIV RNA measurements in the first six months after seroconversion . For individuals who started ART during follow-up (n = 202), the average time from seroconversion to ART administration was 4.1 years. Six percent of the records were obtained from individuals receiving ART with at least two drugs (mainly Zidovudine (AZT), Didanosine (ddI) or Zalcitabine (ddC) and 0.5% from patients receiving more than two drugs); 22% were obtained under monotherapy (mainly AZT), and the remaining 72% were obtained from persons while not on ART. ART had no significant effect on CD4 T-cell count, but did affect HIV RNA level , but of course they trend in opposite directions. Both curves remain fairly stable during the first few years after seroconversion, but curves become increasingly steeper over time. Similarly, for both markers, evolution differs by subgroup as classified by their disease progression: AIDS occurring <3.5 years (N = 40), 3.5 to 7 years (N = 103), >7 years after seroconversion (N = 23), and AIDS-free for more than 9 years after seroconversion (N = 36). Individuals with fast progression to AIDS \u2013 i.e., within 3.5 years after seroconversion and, to a lesser extent, between 3.5 and 7 years \u2013 do not have a stable plateau phase for either marker. The trends in average value, derived from the repeated cross-sectional approach (thin grey lines), are very different from the averaged patterns. Only a modest decrease in CD4 T-cell count is seen, which levels off at a value of around 300 cells/\u03bcL after eight years. For viral load, a very small increase in average value is seen (from 4.32 to 4.54). However, the estimated curve at later time points suffers from survivorship bias, since individuals with fast disease progression do not contribute to the estimate.Individuals with faster AIDS progression have higher HIV RNA level six months after seroconversion. For CD4 T-cell count, this ordering is less clearly present. However, the averaged individual \u03bcL to 364 cells/\u03bcL, which implies a drop of 6561/3 \u2013 3641/3 = 1.55 on the cube root scale. This corresponds to a exp(0.5801 \u00d7 1.55) = 2.46-fold increase in AIDS risk. The average viral load over the same time span shows an increase by 0.19, corresponding to an exp(1.422 \u00d7 0.19) = 1.3-fold increase in risk. In order to double the AIDS risk, the cube root of the CD4 T-cell count should decrease by log(2)/0.5801 = 1.19 (since exp(0.5801 \u00d7 1.19) = 2), whereas the base-10 logarithm of viral load should increase by log(2)/1.422 = 0.49. On the right y-axis, the values of CD4 count  and viral load  corresponding with changes in relative risk are shown . It is seen that the average decrease in CD4 T-cell count over the first ten years induces a much stronger increase in AIDS risk than does the average increase in viral load. Since average viral load remains more stable than CD4 T-cell count on the AIDS-risk scale, one may say that it exhibits more setpoint behavior. However, this difference between the curves actually increases over time after seroconversion: the relative risk ratio RR(CD4)/RR(RNA) increases from exp(0.5801 \u00d7 1.55)/exp(1.422 \u00d7 0.19) = 1.88 at four years to exp(4.126)/exp(1.919) = 9.09 at ten years after seroconversion.The effects of time-updated marker values on AIDS risk are used to directly compare average patterns of CD4 T-cell count and HIV RNA level on a common scale figure . NumbersFor a direct comparison of the form of both curves, we also show the CD4 trajectory, standardized to the HIV RNA level ten years after seroconversion . It is seen that, during the first years, average standardized CD4 T-cell count increases a little bit more than average viral load does, but differences are small and far from significant . For viral load, the variance of the residual error term was 0.49 . Hence, using that 95% of the short term variation and measurement error is between the range -1.96 \u00d7 standard deviation and +1.96 \u00d7 standard deviation, on the logarithmic relative AIDS risk scale, this corresponds to 1.422 \u00d7 2 \u00d7 1.96 \u00d7 0.49 = 3.9 for viral load and 0.5801 \u00d7 2 \u00d7 1.96 \u00d7 0.54 = 1.7 to 0.5801 \u00d7 2 \u00d7 1.96 \u00d7 0.91 = 2.2 for CD4 T-cell count. Hence, CD4 T-cell count can be measured more reliably than viral load.In the model of marker evolution during the four years preceding AIDS diagnosis, the fitted HIV RNA increase  was 0.167 (95% CI 0.101 to 0.231) per year from 4 to 1.5 years before AIDS diagnosis, and 0.223 (95% CI 0.138 to 0.314) per year for the last 1.5 years before AIDS diagnosis. The 0.057 change in slope between the two periods was not statistically significant (95% CI \u2013 0.065 to 0.182). For CD4 T-cell count, on the other hand, the decline  changed from -0.43 to -1.27 per year at 1.5 years before AIDS diagnosis, and this change in slope was significant (95% CI 0.66 to 1.02). When evaluated on the logarithmic relative AIDS risk scale, the RNA slope changes from 0.167 \u00d7 1.422 = 0.24 to 0.223 \u00d7 1.422 = 0.32, whereas the CD4 slope changes from 0.43 \u00d7 0.5801 = 0.25 to 1.27 \u00d7 0.5801 = 0.74. Hence, CD4 T-cell count and HIV RNA level show similar trends from 4 to 1.5 years before AIDS diagnosis, but during the last 1.5 years CD4 T-cell count changes more rapidly.The aim of the study was to reconsider the existence of a viral load setpoint and compare it with CD4 T-cell evolution after HIV seroconversion. This was done by modeling average trajectories for both markers and presenting results on a common scale as determined by AIDS risk. The HIV RNA setpoint theory has been characterized by three aspects: levels after the initial peak are predictive for subsequent disease progression, a stable plateau phase and an increase shortly before AIDS diagnosis.Higher predictive value of viral load shortly after seroconversion was not analysed here, since this has been shown convincingly before ,12. NoteWe modelled the longitudinal evolution of the markers using a scale that is related to AIDS progression. Our analysis showed that both markers revealed similar patterns over time after seroconversion: after a very gradual change in the first few years, the slope became increasingly steeper longer after seroconversion. The same similarity between both markers was found when patients were stratified by progression time. Persons with slower AIDS progression had more stable values for both markers during the first years. Although shapes were similar, the average decline in CD4 count corresponded to a much larger change in AIDS risk than the average increase in viral load did. This difference does not mean that CD4 count has the larger predictive value for AIDS progression. In our model, the markers were used as dependent variables and their evolution was modelled over time. Marker patterns were averaged over all individuals, also the ones who developed AIDS shortly after seroconversion. In a predictive model, a future AIDS event is the dependent variable, and prediction at some point after seroconversion is based on marker values for individuals who are still AIDS free. In the time-dependent Cox analysis table , the marWith respect to the third part of the setpoint theory, an increase in HIV RNA level was present already several years before AIDS diagnosis, and this slope did not change significantly at 1.5 years before AIDS diagnosis. On the other hand, a strong biphasic pattern was present for CD4 T-cell count.For the modeling of the CD4 trajectories, the cube root transformation was chosen for its better fit with the random effects model we used. As the same scale turned out to be useful when modeling AIDS risk as a function of CD4 count, it was employed also to present results in figure We argue against the use of cross-sectional methods and scatterplots to describe the marker evolution in situations where marker values affect dropout rate. Results were strikingly different from the longitudinal approach. Since HIV infected individuals with low CD4 T-cell count or high viral load have a higher probability to die of AIDS, slow progressors are overrepresented later after infection, such that curves are biased upwards for CD4 T-cell count and biased downwards for viral load. Also, for studies on the effects of cofactors on marker evolution, the longitudinal random effects approach is preferred. For example, the cross-sectional approach may find no difference in CD4 values between two groups due to cancellation of effects: AIDS mortality at low CD4 count may be higher in the group with the steepest decline, such that the average CD4 value is equal in both groups. Although statistical analyses of marker patterns usually use some sort of longitudinal model, the cross-sectional approach has been applied as well. This holds not only for natural history studies, but also for studies of treatment effect in which part of the study group dies during the trial .We modeled the simultaneous evolution of CD4 and viral load using follow-up data from seroconversion until AIDS diagnosis. The total follow-up is about equal to the median time to AIDS . Hence, our results show marker evolution only during the first half of the time-to-AIDS distribution. However, the setpoint theory for viral load was based on data with similar follow-up and introduction of HAART has prevented study of longer-term evolution in a natural history setting.In summary, by using a common event (AIDS), we were able to directly compare evolution of CD4 T-cell count and HIV RNA level after HIV-1 seroconversion. Shortly after seroconversion, HIV RNA level is more predictive than CD4 T-cell count. However, a definition of setpoint based on the level reached shortly after the primary infection phase has little clinical relevance, since a date of seroconversion is unknown for most diagnosed HIV infected individuals. Also, the effect of sequential treatment interruptions cannot be evaluated based on the return to the personal setpoint level, if such level only exists shortly after seroconversion. Since both markers are frequently monitored as part of clinical care, more recent information on marker evolution is available. A setpoint, if defined as a stable level for several years, holds as much for CD4 T-cell count as for viral load, and only for a subgroup of HIV infected individuals. Such a setpoint does not preclude the need for frequent monitoring of viral load in making the decision to start HAART, since the stable phase may end at any time. Since CD4 T-cell count can be measured more reliably than viral load (a maximum of 2.2 versus 3.9), the end of the stable phase may be more dificult to detect for viral load, which makes frequent monitoring even more important for viral load than for CD4 T-cell count. The third aspect of the setpoint concerns the change from a stable phase to an increase in viral load shortly before AIDS diagnosis. We did not find a stable phase for any of the markers in the last four years before AIDS, but the evolution of CD4 T cell count is more biphasic than the evolution of HIV RNA.We used data from two different sources, the Amsterdam Cohort Study (ACS) among homosexual men and the French ANRS SEROCO Cohort Study. Informed consent was obtained from all participants.Started in 1984, the ACS has required that participants be free of AIDS-defining conditions at entry. In our analysis, we included those with a period between the last HIV-seronegative test and the first HIV-seropositive test of not more than two years; we imputed their seroconversion date via conditional mean imputation . Follow-The French SEROCO cohort started in 1988, has enrolled HIV-infected, non-haemophiliac adults referred from 17 hospitals and a network of private practitioners. For reasons of homogeneity, we analyzed only homosexual men from the cohort. Like the ACS men, they had no more than two years between the date of last HIV-seronegative test and date of first HIV-seropositive test. Their date of seroconversion had been imputed as described in Hubert et al. .Data was drawn from the start of each study until HAART was widely introduced in the two countries: July 1st, 1996 in the Netherlands and February 1st, 1996 in France. In total, we used data from 400 persons (126 from Amsterdam and 274 from France). The same data were previously used to investigate the causal pathways of the effects of age and three genetic cofactors on AIDS development .All CD4 lymphocyte counts were obtained prospectively. In Amsterdam, they were measured in one laboratory, where single indirect immunofluorescence staining on Ficoll-isolated peripheral blood mononuclear cells was used until May 1988 and thereafter a double direct staining method. The Coulter Epics flow cytometer was used until 1991, then replaced by a FASCAN. Each day, CD4 samples were compared with values from healthy HIV-negative controls. In France, CD4 T-cell count measurements originated from 17 laboratories, so changes in method occurred more gradually. All HIV-1 RNA levels were determined retrospectively from stored sera. In France, the three participating university labs used reverse transcriptase-polymerase chain reaction . In Amsterdam, one laboratory performed all HIV RNA assays. Most (83.6%) of the measurements were based on the NASBA technique . The remaining were based on the Amplicor (2.4%) or the Nuclisens (14%) technique. Since the Amplicor test gives lower values, a correction factor was applied  error term. Changes in 1988 and 1991 for Amsterdam correspond with changes in laboratory methods. For France, where CD4 data originate from different laboratories, we assumed a change in 1991, resulting in about equal number of measurements in both periods. Moreover, we allowed each laboratory to measure, on average, a different value for CD4 T-cell count (random laboratory effect). Since HIV RNA values were measured retrospectively within a short time period in only a few laboratories, no change occurred in laboratory method. Therefore, we assumed the standard deviation for the residual error term of viral load to remain constant. However, we included a calendar period effect on the overall level, since viral load was measured retrospectively from stored samples that may yield different values depending on their age. To describe the simultaneous evolution of CD4 T-cell count and viral load in the four years preceding AIDS diagnosis, a linear random effects model was fitted to the marker data from the subset of individuals with an AIDS diagnosis. In order to detect a change in marker trend shortly before AIDS diagnosis, the slope was allowed to change at 1.5 years before AIDS diagnosis.A bivariate quadratic random effects model was used to describe the simultaneous evolution of CD4 T-cell count and viral load after HIV-1 seroconversion . The tret al. . Since t [et al. . Zidovud1/3) were used [In all random effects models, marker values were transformed in order to provide a better fit: the base-10 logarithm of viral load and the cube root of CD4 T-cell count . Finally, the effects of calendar period and ART use on CD4 T-cell count and HIV-1 RNA level are represented by and all The effect of the markers on the hazard of AIDS was described in a Cox model viag and h describe smooth trends on AIDS risk for CD4 T-cell count and HIV RNA level, using low-rank thin-plate splines [where  splines .The author(s) declare that they have no competing interests.RG: main author, substantial contributions to conception and design, analysis and interpretation of data MP: substantial contributions to conception and design, analysis and interpretation of data JH: substantial contributions to analysis and interpretation of data FM: substantial contributions to conception and design and acquisition of data BB: substantial contributions to conception and design and acquisition of data CR: substantial contributions to conception and design JD: substantial contributions to conception and design LM: substantial contributions to conception and design, acquisition of data, and interpretation of data All authors read and approved the final manuscript."}
+{"text": "Untreated human immunodeficiency virus (HIV) disease disrupts B cell populations causing reduced memory and reduced na\u00efve resting B cells leading to increases in specific co-infections and impaired responses to vaccines. To what extent antiretroviral treatment reverses these changes in an African population is uncertain.A cross-sectional study was performed. We recruited HIV-uninfected and HIV-infected Malawian adults both on and off antiretroviral therapy attending the Queen Elizabeth Central hospital in Malawi. Using flow cytometry, we enumerated B cells and characterized memory B cells and compared these measurements by the different recruitment groups.p = 0.008); reduced memory B cells (27 vs. 51 cells/\u03bcl p = 0.0008). The HIV+T adults had B-cell numbers similar to HIV- except for memory B cells that remained significantly lower (30 vs. 51 cells/\u03bcl p = 0.02). In the HIV+N group we did not find an association between CD4 count and B cell numbers.Overall 64 participants were recruited - 20 HIV uninfected (HIV-), 30 HIV infected ART na\u00efve (HIV+N) and 14 HIV-infected ART treated (HIV+T). ART treatment had been taken for a median of 33 months (Range 12-60 months). Compared to HIV- the HIV+N adults had low absolute number of na\u00efve resting B cells (111 vs. 180 cells/\u03bcl HIV infected Malawian adults have abnormal B-cell numbers. Individuals treated with ART show a return to normal in B-cell numbers but a persistent deficit in the memory subset is noted. This has important implications for long term susceptibility to co-infections and should be evaluated further in a larger cohort study. Untreated HIV infection leads to disruption of the immune system leading to an increased risk of many infections and in particular pneumococcal disease ,2. A cla+CD27+ memory B cells both in adult and paediatric groups [+CD21+ (naive mature B cells) on peripheral B cells [+CD21lowCD27-) in the peripheral blood [In addition to increased immunoglobulin secretion and a decrease in number of na\u00efve resting B cells , HIV leac groups . HIV alsc groups ,10, poor B cells  and haveal blood .It is now becoming clear that many of these B cell defects associated with HIV are reversed by anti retroviral therapy (ART) with the exception of memory B cells which remain low despite control of HIV load -16. HoweWe have measured B cell numbers and memory B cells numbers and relative percentages in adults in Blantyre, Malawi to see how far previously described HIV-associated abnormalities are present in our population of adults and how these abnormalities are changed after anti-retroviral therapy. This work was undertaken as part of a wider investigation of the cellular response to pneumococcal polysaccharides, results of which will be reported separately.3; 10 HIV-infected with CD4 \u2264 200 cells/mm3;10 HIV-infected adults on ART treatment for more than one year; and 10 HIV-infected adults convalescing from an invasive pneumococcal (IPD) event. Participants were recruited into a study investigating pneumococcal polysaccharide directed B-cell responses and no formal sample size calculation was undertaken. With the exception of the IPD cases, participants were recruited after volunteering following a public advertisement in the hospital. Individuals recovering from pneumococcal disease were identified from blood culture records and approached by a study team member for consent. Study participants underwent a structured clinical assessment and then provided 5 mls of blood in EDTA for phenotypic analysis. HIV-infected participants found to have low CD4 counts and not on ART were counselled and encouraged to attend the ART clinic.Participants for the study were identified through the Wellcome Trust adult clinical research clinic at Queen Elizabeth Central Hospital (QECH) in Blantyre. The study aimed to recruit a total of 60 adult participants in 5 groups: 20 HIV-uninfected; 10 HIV-infected with CD4 > 200 cells/mmAll participants gave signed informed consent before recruitment. The study was approved by the College of Medicine Research and Ethics Committee, Malawi under protocol number P 99/00/101.+ T cell count and full blood count to determine the absolute lymphocyte count and the white cell count were performed on a FACSCount\u2122 system  and a Coulter\u00ae HmX haematology analyser  respectively.Blood samples were processed within two hours of collection. CD4+) were investigated. The B cells and memory B cell subset were stained with the following monoclonal antibodies conjugated with fluorescein isothiocyanate (FITC), phycoerythrin (PE), and allophycocyanin (APC) suitable for three-colour flow cytometry. The following phenotypic markers were used: CD19-FITC, CD19-PE, CD19-APC (B cell markers), CD45-FITC, CD45-APC (leukocyte markers) CD3-APC (T cell marker), CD27-PE (memory B cell maker), . Immunoglobulin isotype-matched FITC-, PE-, APC-conjugated monoclonal antibodies  were used as negative controls to check for non specific staining. Briefly, the red blood cells were lysed for 20 minutes using BD lyse solution . The cells were washed twice with 1% faetal calf serum (FCS) in phosphate buffered saline (PBS). In between washes the cells were blocked for 15 minutes with 2 ml PBS/1%FSC/5 \u03bcg human polyclonal IgG (Sigma)/10 \u03bcl mouse polyclonal IgG /50 \u03bcl Immune human serum. The white blood cells were stained with the appropriate monoclonal antibody for 30 minutes in the dark. Afterwards, the cells were washed in PBS containing 1% foetal calf serum and fixed in 2% paraformaldehyde before analysis. The B cell subsets were analysed on FACSCalibur flow cytometer  with CellQuest-Pro\u2122 software  used for analysis.The absolute counts and the relative percentages of B cells and memory B cell subpopulation , HIV positive ART na\u00efve (HIV+N) and HIV positive on ART (HIV+T). Within the HIV+N, three secondary groups were also analysed namely: HIV positive with low CD4 T cell counts, HIV positive with high CD4 T cell counts and IPD cases. The data were not normally distributed  and two-way comparisons between the study groups were analysed by Mann-Whitney U test. Correlation between absolute B cell counts and CD4 counts in HIV positive adults ART naive and on ART was performed by Spearman's rank correlation test. The median and ranges (minimum and maximum) are used as summary statistics within the text and in the tables. p < 0.0001) but remained significantly less than the HIV- group (p = 0.006). Results of the memory B cell subset based on cell counts were similar to those based on percentages. Absolute counts of total B cells and memory B cell subset are thus presented in table A total of 64 participants were recruited to the study : 20 HIV-, 30 HIV+N and 14 HIV+T. Demographic and clinical characteristics of the study participants are summarised in Table p = 0.008). The absolute B cell count was also reduced in HIV+T participants but the difference was not significant . There were no significant differences in the median B cell counts between the HIV+N subgroups  but not in the HIV +N participants, Figure p = 0.31).Overall there was no significant association between CD4 T-cell count and absolute B-cell counts in the treated and non treated subgroups. However, there was a tendency to a direct association between CD4 T cell counts and absolute B cell counts, Figure p = 0.0008).Similar results were also obtained for percentages of memory B cells (p = 0.049).Compared to HIV- participants, HIV+N participants had lower absolute counts of memory B cells (p = 0.02 and p = 0.005 respectively). There were no significant differences in the absolute counts and percentages of the memory B cells between the HIV+N subgroups.The absolute counts and percentage of the memory B cells remained low in HIV+T participants compared to HIV- participants  and were actually lower than in the ART naive HIV positive adults. These data are consistent with findings reported by De Milito  B cells . However B cells . Our finThe study showed no relationship between CD4 T-cell count and B-cell numbers although in the treated HIV positive adults there appeared to be a tendency to a direct association. The failure to see an overall association may be a consequence of small study numbers. Plasma viral load, which we did not measure, may also be an important determinant of B-cell numbers and may confound any association, except in the case of the ART treated group when viral suppression allows the true relationship between B-cells and CD4 T-cells to become apparent.The study has a number of limitations. The sample size was small, forming part of a more detailed study of antigen-specific B-cell characteristics. Selection of patients was not random and relied on volunteers responding to a public announcement. The units well known association with respiratory disease research may have inadvertently biased recruitment in favour of individuals with previous concerns about respiratory health and perhaps a population biased towards abnormal B-cell function. Nevertheless, the study points to an important failure in recovering memory B-cell subsets and a larger study is now justified, to measure the size of this problem. Viral load measurements were not made and thus we cannot conclude that the investigated participants were receiving successful suppressive ART, although all were clinically well at the time of enrolment. A prospective cohort study is now planned to investigate these findings further.The study has shown that HIV-infected Malawian adults have significant quantitative defects in B cell numbers and memory B cells. ART use is associated with normalisation of these defects but a persistent deficiency in the memory subset appears to be retained. This has important implications for long term susceptibility to co-infections and co-infection prophylaxis. Our findings are limited by the small size and cross-sectional nature and need to be evaluated further in a larger cohort study specifically designed for this purpose.The authors declare that they have no competing interests.HL collected, analysed the data and wrote the paper. SG supervised data analysis and critically revised the manuscript. RM recruited, vaccinated and collected the blood samples from the subjects. NF originated the idea of the research, supervised the collection and analysis of data and revised the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/280/prepub"}
+{"text": "A proportion of individuals who start antiretroviral therapy (ART) fail to achieve adequate CD4 cell reconstitution despite sustained viral suppression. We determined the frequency and clinical significance of suboptimal CD4 reconstitution despite viral suppression (SO-CD4) in an urban HIV research cohort in Kampala, UgandaWe analyzed data from a prospective research cohort of 559 patients initiating ART between 04/04\u201304/05. We described the patterns of SO-CD4 both in terms of:- I) magnitude of CD4 cell increase  and II) failure to achieve a CD4 cell count above 200 cells/\u03bcl at 6,12 and 24 months of ART. Using criteria I) we used logistic regression to determine the predictors of SO-CD4. We compared the cumulative risk of clinical events (death and/or recurrent or new AIDS-defining illnesses) among patients with and without SO-CD4.Of 559 patients initiating ART, 386 (69%) were female. Median (IQR) age and baseline CD4 counts were 38 yrs (33\u201344) and 98 cells/\u03bcl (21\u2013163) respectively; 414 (74%) started a d4T-based regimen (D4T+3TC+NVP) and 145 (26%) a ZDV-based regimen (ZDV+3TC+EFV). After 6, 12 and 24 months of ART, 380 (68%), 339 (61%) and 309 (55%) had attained and sustained HIV-RNA viral suppression. Of these, 78 (21%), 151 (45%) and 166 (54%) respectively had SO-CD4 based on criteria I), and 165(43%), 143(42%) and 58(19%) respectively based on criteria II). With both criteria combined, 56 (15%) and 129 (38%) had SO-CD4 at 6 and 12 months respectively. A high proportion (82% and 58%) of those that had SO-CD4 at 6 months (using criteria I) maintained SO-CD4 at 12 and 24 months respectively. There were no statistically significant differences in the incidence of clinical events among patients with [19/100PYO (12\u201329)] and without SO-CD4 [23/100PYO (19\u201328)].Using criteria I), the frequency of SO-CD4 was 21% at 6 months. Majority of patients with SO-CD4 at 6 months maintained SO-CD4 up to 2 years. We recommend studies of CD4 T-cell functional recovery among patients with SO-CD4. There is considerable variability in the magnitude and rate of CD4 T cell count recovery in Human immunodeficiency virus type 1 (HIV-1)-infected individuals, receiving antiretroviral therapy (ART). Most patients show a progressive rise in CD4 T cell counts after initiation of ART , howeverThe Infectious Diseases Institute (IDI) is a private-public partnership institution that is a center of excellence in HIV care, training, and research at Makerere University Medical School and Mulago Teaching Hospital in Kampala, Uganda. Since 2004, the IDI clinic (IDC) has provided free care to HIV positive patients, and by December, 2007, IDC had enrolled 20,000 patients into HIV care, of whom 13,000 are in active follow-up and 4700 have initiated ART according to WHO and Uganda Ministry of Health guidelines. The clinic has 15 exam rooms and is staffed by 20 physicians, 30 nurses, and 10 counselors and patients are reviewed monthly. The drugs are provided by the Global Fund . Daily co-trimoxazole prophylaxis was provided and patients allergic to co-trimoxazole were given dapsone. Adherence to ART was encouraged by at least 3 individual and group counseling sessions. Patients are reviewed monthly by the general clinic physicians that evaluated among others; adherence to medication, toxicities and acute infections. Patients are evaluated by the study physicians every 3 months or earlier if they develop any illness. HIV RNA viral loads, complete blood counts and CD4 lymphocyte counts are tested at 6 monthly intervals.In this study, we used (i) previously used definitions of SO-CD4 in terms of the magnitude of the CD4 cell increase [a CD4 count increase of < 50 CD4 cells/\u03bcl after 6 months of ART [3-6]; <100 cells/\u03bcl increase after 12 months ; and <20Patients were included in the analysis if they had attained and sustained HIV-RNA viral load \u2264 400 copies per ml at 6, 12 and 24 months. The chi square test was used to compare the baseline clinical characteristics of patients with and without SO-CD4 and the level of significance was 0.05. Proportions of patients with SO-CD4 were calculated using the two criteria independently and with the two criteria combined. The combination of the two criteria was the intersection of patients with SO-CD4 on both criteria I) and II). Logistic regression by stepwise model selection was used to analyze predictors of SO-CD4. The independent variables included age, sex, baseline CD4 cell counts, body mass index (BMI), baseline hemoglobin, initial ART regimen, magnitude of CD4 increase in first 6 months and Hepatitis B surface Antigen sero-status. Variables were included in the multivariate model if they had a p value \u2264 0.25 on bivariate analysis. The proportions of clinical events were examined among patients with and without SO-CD4. In addition, the cumulative risk of development of AIDS-related clinical events was estimated by Kaplan-Meier analysis. Patients were censored on the occurrence of an AIDS-related clinical event (the primary outcome) as required by the survival analysis technique. Differences between the survival curves were tested using the log-rank test.Of 559 patients initiating ART, 386 (69%) were female, with a median age of 38 yrs (IQR 33\u201344), and a median CD4 count of 98 cells/\u03bcl IQR 21\u2013163). Half 283(51%) of the patients had severe immune suppression with CD4 counts below 100 cells/\u03bcl at initiation of ART. Majority of patients, 414 (74%) started a d4T-based regimen (D4T+3TC+NVP) and 145 (26%) a ZDV-based regimen (ZDV+3TC+EFV). Baseline characteristics were comparable among optimal and sub-optimal responders apart from the baseline CD4 count that was significantly higher among sub-optimal than optimal responders. Patients with a lower BMI at initiation of therapy were more likely to have SO-CD4 after 12 months although the difference was no longer significant after 24 months of ART. Similarly, patients that initiated a ZDV-based regimen were more likely to have SO-CD4 at 6 and 12 months although the difference was no longer significant after 24 months of ART , 339 (61%) and 309 (55%) had attained and sustained HIV-RNA viral suppression. Of these, 78 (21%), 151 (45%) and 166 (54%) respectively had SO-CD4 using the CD4 increase criteria (described in the methods section). Of the patients with SO-CD4 at 6 months, 64/78 (82%) and 45/78 (58%) still had SO-CD4 after 12 months and 24 months respectively. By the end of 2 years on ART the overall median change in CD4 cell count and percentage was 193(104\u2013273) and 11.5% (IQR 8.6\u201314.6) respectively though it was 77 [IQR 25\u2013127] cells/\u03bcl and 7.2% [IQR 4.1\u20139.6] respectively among patients with SO-CD4 , 143/339(42%) and 58/309 (19%) had SO-CD4 at 6, 12 and 24 months of ART respectively. Of the patients with SO-CD4 at 6 months, 112/165 (68%) and 46/165 (41%) still had SO-CD4 at 12 and 24 months respectively. By 2 years on ART the median change in CD4 cell count and percentage was 54 [IQR 22\u201399] cells/\u03bcl and 6.4% [IQR 3.5\u20138.1] among patients with SO-CD4 based on threshold definition , 129/339 (38%) and 3/309 (1%) had SO-CD4 after 6, 12 and 24 months of ART respectively. Of the patients with SO-CD4 at 6 months, 42/56 (75%) still had SO-CD4 after 12 months of therapy.Patients with baseline CD4 counts of 50\u2013199 cells/\u03bcl were more likely to have SO-CD4 than those with baseline CD4 counts of 0\u201349 cells/\u03bcl at 6 months [OR 2.5(1.1\u20135.5) P = 0.03] and at 12 months [OR 2.9(1.6\u20135.4) P = 0.001]. In addition, patients who initiated zidovudine-containing ART regimen were more likely to have SO-CD4 than patients on stavudine-containing ART at 6 months [OR 4.5(2.4\u20138.3) P < 0.001] and at 12 months [3.6(2.0\u20136.4) P < 0.001]. Other factors like age, sex, body mass index and hemoglobin level were not significant predictors of SO-CD4.Overall, there were 22 clinical events/100 PYO (18\u201326) among patients with sustained viral suppression. There were no statistically significant differences in the clinical events among patients with [19/100PYO (12\u201329)] and without SO-CD4 (using the CD4 increase criteria) [23/100PYO (19\u201328) p = 0.43] see Figure In this population with good rates of viral suppression as was previously reported , the freWe found that patients with baseline CD4 counts of 50\u2013199 cells/\u03bcl were about 3 times more likely to have SO-CD4 than those with baseline CD4 counts of 0\u201349 cells/\u03bcl. Our results are similar to reports from South Africa where patients in the lower CD4 stratum had a higher gradient of CD4 increase ,15. We aPatients that initiated therapy with a zidovudine-containing regimen were 3.6 times more likely to develop SO-CD4 than patients on a d4T-containing regimen and we attribute this to the myelosuppressive effects of zidovudine . We inteAge was not a significant predictor of SO-CD 4 in our study and this is consistent with what was reported in a US cohort . HoweverMajority of the patients with SO-CD4 after 6 months, using either of the criteria, still had SO-CD4 at 12 months despite sustained HIV-RNA viral suppression. Since patients with SO-CD4 at 6 months are likely to maintain the phenomenon, they may need evaluation of the recovery of CD4 cell function, more so in Africa where there is an increased background risk of opportunistic infections. It is possible that the CD4 cells do not recover both in absolute numbers and function because of the high levels of T-cell activation in Africans due to frequent infections by the various pathogens endemic in the region ,25,26.It is also likely that these patients may require extended periods of prophylaxis against opportunistic infections. Our analysis was however limited to recovery of peripheral CD4 T cell counts and not CD4 T cell function. We recommend studies to examine other markers of recovery of immunological function among patients with SO-CD4.We found that about a third of the opportunistic infections occurred among patients with SO-CD4 reconstitution as defined by either the CD4 increase or the threshold criteria. Similar to what has been reported in other cohorts, most of the AIDS-related events occurred in the first 6 months -29 and tThe findings in this study are strengthened by the relatively homogenous study population of ART-naive individuals receiving ART at a single facility using standardized clinical protocols. Our patients used NNRTI-based ART regimen that are used in most HIV care facilities in Africa so our results can be generalized to most patients in Africa however they are limited to patients with sustained HIV-RNA viral suppression which, among others, is the ultimate goal of ART. We need to design studies of interventions for patients on ART with poor immune reconstitution and minimize the time spent with CD4 counts below the 200 cells/\u03bcl critical threshold. It is important to note that adherence to ART and previous exposure to ART were not considered to contribute to SO-CD4 in our study since all patients were na\u00efve to ART and patients were included in the analysis only if they had HIV-RNA viral load < 400 copies/ml which we used as a proxy for good adherence.The frequency of SO-CD4 is high in SSA and many of the patients with SO-CD4 at 6 months maintain the phenomenon up to 2 years of therapy. However, the rates of AIDS-related clinical events were no higher in those with SO-CD4. We recommend studies of CD4 T-cell functional recovery among patients with SO-CD4.The authors declare that they have no competing interests.DN conceived of the study, and participated in the design, data analysis, interpretation of data, drafting and revising the paper. AK participated in the study design and statistical analysis. FI participated in the statistical analysis. BC participated in the acquisition of data, coordination of the study and in revising the paper. MRK made substantial contribution to the conception, design and coordination of the study. PJE made substantial contribution study design, statistical analysis and revision of the paper. All authors read and approved the final manuscript."}
+{"text": "Triticum monococcum (2n = 2x = 14) is an ancient diploid wheat with many useful traits and is used as a model for wheat gene discovery. DArT (Diversity Arrays Technology) employs a hybridisation-based approach to type thousands of genomic loci in parallel. DArT markers were developed for T. monococcum to assess genetic diversity, compare relationships with hexaploid genomes, and construct a genetic linkage map integrating DArT and microsatellite markers.T. monococcum as well as 1536 T. boeoticum representative genomic clones, was used to fingerprint 16 T. monococcum accessions of diverse geographical origins. In total, 846 polymorphic DArT markers were identified, of which 317 were of T. monococcum origin, 246 of hexaploid, 157 of tetraploid, and 126 of T. boeoticum genomes. The fingerprinting data indicated that the geographic origin of T. monococcum accessions was partially correlated with their genetic variation. DArT markers could also well distinguish the genetic differences amongst a panel of 23 hexaploid wheat and nine T. monococcum genomes. For the first time, 274 DArT markers were integrated with 82 simple sequence repeat (SSR) and two morphological trait loci in a genetic map spanning 1062.72 cM in T. monococcum. Six chromosomes were represented by single linkage groups, and chromosome 4Am was formed by three linkage groups. The DArT and SSR genetic loci tended to form independent clusters along the chromosomes. Segregation distortion was observed for one third of the DArT loci. The Ba (black awn) locus was refined to a 23.2 cM region between the DArT marker locus wPt-2584 and the microsatellite locus Xgwmd33 on 1Am; and the Hl (hairy leaf) locus to a 4.0 cM region between DArT loci 376589 and 469591 on 5Am.A DArT array, consisting of 2304 hexaploid wheat, 1536 tetraploid wheat, 1536 T. monococcum. The constructed genetic linkage map will facilitate localisation and map-based cloning of genes of interest, comparative mapping as well as genome organisation and evolution studies between this ancient diploid species and other crops.DArT is a rapid and efficient approach to develop many new molecular markers for genetic studies in  Triticum monococcum (2n = 2x = 14), generally known as einkorn wheat, is an ancient diploid species domesticated in the Fertile Crescent ~10,000 years ago  is closely related to T. urartu (AuAu), the donor of the A-genome of hexaploid wheat [T. monococcum has gradually been recognised as an attractive diploid model for exploitation of useful traits, discovery of novel genes and variant alleles, and functional genomics. Many traits have been examined in T. monococcum which can be useful for modern wheat breeding [T. monococcum has also been successfully used for gene discovery in a subgenome map-based cloning approach, as exemplified by the cloning of the leaf rust resistance gene Lr10 [VRN1 and VRN2 [Q [NAC gene family [T. monococcum populations have been made available and were used to identify and map genes of agronomic importance [; ). Thus, in the foreseeable future T. monococcum is expected to play an important role in wheat genetic and genomic studies.Wild relatives of hexaploid wheat are known to be important sources of traits for wheat genetic improvement. id wheat -6. Recenbreeding -9. T. moene Lr10 , the verand VRN2 ,13, the  VRN2 [Q ,15, and e family . Naturalportance ,18. FurtT. monococcum have been collected and retained in major germplasm stock centres. In order to use T. monococcum resources efficiently in programmes on genetic improvement of hexaploid wheat, it is necessary to assess diversity of this species at the genome level. For this, high-throughput molecular marker technologies are needed. T. monococcum has been shown to possess a high level of polymorphism at DNA marker loci[T. monococcum domestication [T. monococcum in comparison with hexaploid wheat and its A-genome donor diploid species T. urartu. This information has been used to produce a genetic map integrating RFLPs and SSRs [Globally, thousands of accessions of rker loci. RFLP  has been developed as a sequence-independent and micro-array hybridisation-based marker system . DArT geT. monococcum diversity array (DArT) for high-throughput genome-wide genotyping, (2) assess the utility of the DArT technology for analysis of genetic diversity in a representative collection of T. monococcum accessions, (3) compare the relationships between the Am-genome and other Triticum genomes using DArT markers, (4) produce a genetic linkage map for T. monococcum integrating DArT and SSR markers, and (5) refine the genome locations of two morphological trait loci.We report here the results of a study aimed to (1) develop a PstI/TaqI representation generated from a mixture of DNA of two T. monococcum accessions MDR002 and MDR308 [Triticum species with different ploidy levels . We combined clones from all projects to assemble a custom-designed array containing 1536 clones derived from the two T. monococcum accessions, 2304 clones derived from hexaploid wheats (including the Triticarte Wheat 2.3 array), 1536 clones derived from tetraploid durum wheat (including the Triticarte Durum 2.0 array), and 1536 clones derived from 15 Iranian accessions of T. boeoticum Boiss., which is the wild relative of T. monococcum  were in the 90-100% quality category with an average PIC value of 0.34 and call rate of 99.8%, respectively  values for these markers were relatively low, with only 35.5% of DArTs having PIC values of 0.4-0.5 and 34.6% with PIC values < 0.2  of Iranian origin was fairly distantly related to other accessions including most of the accessions of European origin. This accession is unique in its ability to produce fertile F1 hybrids with hexaploid wheat [T. monococcum and Triticum sinskajae [Triticum boeoticum and Triticum urartu .This set of polymorphic DArT markers was used to assess the genetic diversity of the 16 id wheat . MDR650 id wheat  and provid wheat . Furtherinskajae , whereasT. monococcum genome and clones derived from the genomes of other Triticum species. This allowed us to assess (1) the degree of genetic similarity/diversity between different T. monococcum accessions, and (2) the relationships between the genome of T. monococcum and the A-genomes of other closely related Triticum species. Analysis of the 16 T. monococcum accessions revealed that 317 of the 1536 of DArT markers (~20%) developed from T. monococcum accessions MDR002 and MDR308 were polymorphic . Overall, the DArT markers developed from T. monococcum genome were found to be more informative than those developed from the genomes of other related Triticum species.As described above, the custom-designed DArT array contained clones developed from the ic Table . In thisT. monococcum relationships, the 846 polymorphic DArT markers were split according to their genome origins and principal coordinate analyses were carried out using the four subset data. The percentages of total data variance explained by the first two coordinates were 27.75% in hexaploid wheat, 23.96% in tetraploid wheat, 35.26% in genomes of T. boeoticum, and 35.77% in T. monococcum, respectively .To test the power of the DArT markers of different origins in resolving the T. monococcum and those of hexaploid wheat, we simultaneously hybridised the genomes of nine T. monococcum accessions and 23 hexaploid wheat varieties of European, American and Chinese origins to a customised Triticarte DArT array , CFA and CFD - 39.3% (11 out of 28), BARC markers - 38.2% (21 out of 55), GDM and WMS - 33.7% (28 out of 83), and DuPw - 13.6% (3 out of 22). The data for DArT and microsatellite markers were merged for construction of a genetic linkage map for T. monococcum.To confirm that DArT markers were inherited in a Mendelian manner, we constructed a linkage map for a cross between ly Table . The samid wheat . Out of T. monococcum mapping population. Therefore, these traits are thought to be controlled by single genes Ba (black awn) and Hl (hairy leaf) and were also included in the linkage analysis (see below). The linkage map derived from the combined data set spanned 1062.72 cM, with an average length of 151.82 cM per chromosome and an average density of one marker per 2.97 cM. Each of the seven chromosomes contained both DArT and SSR markers. Six of the linkage groups corresponded to six T. monococcum chromosomes, but the chromosome 4Am was formed by three linkage groups.In total, 356 (274 DArTs and 82 SSRs) molecular markers were mapped and formed nine linkage groups  of the molecular markers, while the highest numbers (n = 68) were found on chromosome 7 Am. Kolmogorov-Smirnov tests were performed to compare nonparametrically the equality of the distributions of the DArT and SSR markers along individual chromosomes. The results showed that chromosomes 1Am, 3Am, 5Am, 6Am and 7Am had p-values smaller than 0.05 but chromosomes 2Am and 4Am had larger p-values. These results suggest that DArT and SSR tended to form independent clusters on chromosomes in T. monococcum.Various numbers of DArT and SSR markers were mapped to individual chromosome linkage groups Table . ChromosT. aestivum, T. durum, T. monococcum and T. boeoticum. Figure T. monococcum linkage groups showed that the distribution of DArT markers arising from different genomes and SSR markers was at random across chromosomes . However, in some cases, DArT markers of certain origins were either over- or under-numbered. For instance, the related A genome DArT markers were under-represented on chromosomes 3Am, but over-represented on 7Am.The mapped 274 polymorphic DArT markers were derived from Triticum species could provide substantial polymorphic information in the Am genome of T. monococcum. Each of the seven T. monococcum chromosomes carried loci of the DArT markers that were previously mapped to homoeologous chromosomes in the B- or D-genomes of Triticum species ; only 33 are of A-genome origins Table , suggests Figure . Also, tP < 0.05). These were more or less equally distributed across the genome , 43.5% (30/69), 46.2% (24/52), 38.2% (13/34), 30.4% (17/56), 30.9% (13/42) and 14.7% (10/68) of markers displaying strong allelic frequency distortion, respectively. For some markers the segregation distortion was in favour of alleles originating from the male parent MDR002, whereas for other markers the segregation distortion was in favour of alleles originating from the female parent MDR308  of the DArT markers developed from the two T. monococcum accessions were polymorphic. DArT markers developed from genomes of other Triticum species also displayed good polymorphism frequencies  in T. monococcum. In hexaploid wheat, 15.3% (788 out of 5137) of DArT markers were found to be polymorphic when assessing the genetic diversity of 13 Australian cultivars [T. monococcum accession genotyped in this study appeared to be more genetically diverse than the bread and durum wheat collections assayed in those studies. Furthermore, most of the DArT markers whose genome locations have been determined in previous studies were located on homoeologous chromosomes of T. monococcum. Thus, DArT markers from related genomes were also useful in probing genetic diversity in T. monococcum. The custom-designed DArT array developed here can be used in studies focusing on comparison of the T. monococcum genome with genomes of other Triticum species.The inclusion of DArT clones from various genomes meant the average PIC value of the data set (0.31) was lower than in comparable studies. For example, for barley, sorghum and cassava the values obtained were 0.38, 0.41 and 0.42, respectively ,33,34. Hultivars . Similarultivars ,36. ThusT. monococcum accession revealed that the site of collection is only partially correlated with genetic diversity. Most accessions used in this study have been genotyped with SSR markers in a previous study, and a similar pattern had been observed [T. monococcum as non-DArT based markers. One of the accessions, MDR650 (PI 355520) was found to be genetically distantly related to other T. monococcum accessions, which raised a question whether it is a true T. monococcum. However, MDR650 (PI 355520) possesses the three major traits of the domesticated einkorn wheat: larger and plumper seeds, a tough rachis preventing spikelets falling apart at maturity, and relatively easy threshing. These traits are absent in the wild species T. boeoticum. We have crossed MDR650 (PI 355520) with many other T. monococcum accessions and discovered that the crossability could reach 100% (data not shown). Furthermore, MDR650 (PI 355520) did not cluster with hexaploid wheat and was closer to the T. monococcum cluster. Thus, we still consider MDR650 (PI 355520) an accession of T. monococcum.Principal coordinate analysis of the 16 observed . Thus, Dm-genome of T. monococcum and those of hexaploid wheat T. aestivum and its sub-genome donor, T. urartu have been studied in different context. For instance, chromosome pairing and recombination were studied between homoeologous chromosomes 1A and 1Am, 3A and 3Am as well as 5A and 5Am and were shown to be collinear and differentiated at sub-structural level [T. monococcum [T. monococcum were either conserved or absent in hexaploid genomes, and vice versa, indicative of divergence of the Am-genome from the A-genome [T. monococcum genomes and provide the polymorphism information in T. monococcum. Thus, at the homoeologous genomes level, there is a complex relationship between T. monococcum and hexaploid wheat.The relationships between the Aal level ,46. Goodal level ,48. Othenococcum ,25. HoweT. monococcum genetic map has been previously constructed using MDR308 (DV92) as one of parental accessions by Dubcovsky et al (1996) [T. boeoticum \u00d7 T. monococcum RIL population to construct another genetic linkage map integrating 177 SSR and RFLP markers, and two morphological trait loci. The total length of this map is 1262 cM, the average chromosome length is 180.3 cM, and the average marker density is one marker per 7.05 cM. In comparison, our current genetic map derived from linkage analysis of an F2 population from a cross between MDR308 and MDR002 integrates 274 DArT markers, 82 SSR markers and two morphological trait loci. This map spans over 1062.7 cM, with six chromosomes represented by single linkage groups and chromosome 4Am by three groups of linked markers. The average chromosome length is 151.8 cM, and the average marker density in the genome is one marker per 2.97 cM. Observed differences in lengths and marker densities for the three T. monococcum linkage maps may well be related to differences in the mapping populations, the types and error-rates of the genetic marker systems used, and/or the algorithms and mapping functions used to compute genetic distances. For example, Singh et al (2007) [A l (1996) . This mal (1996)  used a Tl (2007)  used theThe current genetic linkage is also very similar in length and in marker densities to the A-genome maps of hexaploid wheat constructed using the Kosambi's map function. In one case, 369 SSR markers were mapped onto a 944 cM A-genome with the marker density of one marker per 2.56 cM . Recentlm-genome of T. monococcum is closely related to the Au-genome of T. urartu and to the A-genome of the hexaploid wheat [T. monococcum and the overall good colinearity of SSR arrangement along the chromosomes [m, 4Am and 7Am in T. monococcum. In contrast, in our current linkage map for T. monococcum there was only two gaps on chromosome 4Am. This suggests that DArT markers can be used to fill the gaps and help generate higher resolution genetic linkage maps.The Aid wheat -6. This omosomes ,24. Gapsomosomes -52. SimiT. monococcum. Over one third of the marker loci across the seven chromosomes displayed allele frequencies skewed from their Mendelian expectations. This was observed for both DArT and SSR markers, with preferences for both parental alleles. Segregation distortion has also been observed by Dubcovsky et al (1996) [m and 7Am, while in other study  [m. Strong segregation distortion has also been noted during the construction of durum wheat and bread wheat linkage maps integrating SSR and DArT markers [Strong segregation distortion was observed during construction of our current genetic linkage map for l (1996)  and Singl (1996)  during cl (1996)  15% of tal 2007)  two majo markers .T. monococcum lines, MDR308 and MDR002, used for developing the F2 mapping population had a number of contrasting traits including awn colour, leaf pubescence, grain hardness, salt tolerance, as well as resistance to the fungus Mycosphaerella graminicola and to soil-borne cereal mosaic viruses [Ba and Hl trait loci. Also, this map was recently used to refine the TmStb1 locus conferring resistance to M. graminicola isolate IPO323 on chromosome 7Am, and to identify and map new QTLs conferring salt tolerance .The two parental  viruses ,53. We d2 mapping population used in this study, has previously been used for developing a range of molecular tools including a genetic linkage map integrating RFLPs, AFLPs and seed storage proteins [. The availability of DArT marker information for MDR308 (DV92) further increases the utility of this accession.MDR308 , one of the parental lines of the Fproteins , a BAC lproteins , and sevT. monococcum thereby creating a frame work consensus map for wider applications in molecular genetics and genomics studies.In the near future it should be possible to link various available genetic linkage maps of T. monococcum. The constructed genetic linkage map will facilitate localisation and map-based cloning of genes of interest, comparative mapping as well as genome organisation and evolution studies between this ancient diploid species and other crops.DArT is a rapid and efficient approach to develop many new molecular markers for genetic studies in T. monococcum accessions and an F2 population of 98 individuals derived from a cross between accessions MDR002 and MDR308 [This study used 16 PstI/TaqI representation of the MDR002 and MDR308 accessions as described previously [T. boeoticum  according to manufacturer's instructions. A set of 1536 new DArT clones were generated from a eviously ,36. The protocol ,36.T. monococcum accessions MDR002 and MDR308. These SSRs originated from 5 groups: 57 BARC markers from the Beltsville Agricultural Research Centre, USA [A total of 279 SSR markers mapped to the A-genome of hexaploid wheat were tested for polymorphism between the tre, USA ,57, 29 Ctre, USA ,58,59, 2tre, USA  et al. 2tre, USA ,62, and tre, USA . For eacT. monococcum accessions were genotyped using the custom-built DArT array as described previously [T. monococcum accessions and 23 hexaploid wheat varieties were hybridised to a newly built DArT array and scored the same way. The ploidy levels did influence the scoring as envisaged in the raw data of the hybridisation intensity. Therefore, only the DArT markers which were not affected by this context-dependent scoring were scored. The nine T. monococcum accessions and 23 hexaploid wheat varieties were hybridised in duplicate.A group of 16 eviously . The polT. monococcum accessions MDR308, MDR002 and 94 F2 individuals derived from a cross between them were genotyped with the custom-built array as described previously [Ba, black awn; Hl, hairy leaf) were used for genetic linkage map construction using JoinMap\u00ae 4.0 . Because of the inherent dominant nature of DArT markers which separates the female and male markers in the repulsion phase, the linkage maps for maternal DArT markers  and for parental DArT markers  were initially constructed independently with SSR markers. The two maps for individual chromosomal linkage groups were then merged together using SSR markers as bridges. Assignment of markers to linkage groups was achieved using logarithm of the odds (LOD) threshold values ranging from 3.0 to 10.0. The Kosambi's map function was used to estimate genetic distances. In total, 358 markers including 274 DArT markers, 82 SSR markers and 2 morphological trait locus markers were integrated into nine linkage groups. Goodness of fit for all the loci to an expected 1:2:1 or 1:3 segregation ratio was tested using chi-square (\u03c72) analysis. The graphical representation of the map was drawn using GGT2.2 software [eviously . In totasoftware .th edition, VSN International, UK). For principal coordinate analysis Jaccard similarity matrices were generated using the DArT markers. Two-dimensional scores were calculated and used to generate scatter plot matrices of scores. For the Mantel test which looks for association between the off-diagonal values of two similarity (or distance) matrices, the correlation of the matrices were evaluated. The DArT markers were subdivided into four different categories depending on their genome origins and similarity matrices calculated. The similarity coefficients from these matrices were then compared pair by pair to form a new correlation matrix. The significance of each correlation was assessed using a randomisation test (with 1000 random permutations). The p-values were calculated and were always < 0.001 (where the null hypothesis is one of zero association). For the Kolmogorov-Smirnov test, the map position data of the DArT and SSR markers on individual chromosomes were fed into GenStat and the p-values were calculated. The Chi-square goodness-of-fit test was carried out to examine the random distribution of DArT markers of different origins across the genome, by calculating the association between the numbers of the markers of different origins the chromosomes.All statistical analyses were carried out using GenStat  provide DArT array commercial genotyping services for a range of crops and may benefit financially from this work.Triticum monococcum. PW, EH and AK developed the DArT array for T. monococcum, mapped DArT markers, and edited the manuscript. KHK raised the funds, initiated and supervised the whole project.All authors read and approved the final manuscript. KHK, HCJ and AK designed the study and coordinated the research activities. HCJ, KHK and KK drafted the manuscript. HCJ, CB, KK and SB developed SSR markers for Triticum boeoticum used to generate the customised DArT array used in this study.The 15 Iranian accessions of Click here for fileHexaploid wheat varieties used in comparative analysis using DArT markers.Click here for file"}
+{"text": "While female mate preference is very well studied, male preference has only recently begun to receive significant attention. Its existence is found in numerous taxa, but empirical research has mostly been limited to a descriptive level and does not fully address the factors influencing its evolution. We attempted to address this issue using preference functions by comparing the strength of male preference for females of different sizes in nine populations of four poeciliid species. Due to environmental constraints (water toxicity and surface versus cave habitat), females from these populations vary in the degree to which their size is correlated to their fecundity. Hence, they vary in how their size signals their quality as mates. Since female size is strongly correlated with fecundity in this subfamily, males were sequentially presented with conspecific females of three different size categories and the strength of their preference for each was measured. Males preferred larger females in all populations, as predicted. However, the degree to which males preferred each size category, as measured by association time, was not correlated with its fecundity. In addition, cave males discriminated against smaller females more than surface males. Assuming that male preference is correlated with female fitness, these results suggest that factors other than fecundity have a strong influence on female fitness in these species. These different relationships evolved as a response to living in different habitats  to test whether male preferences can be detected using preference functions, and (2) to see if male preference tracks changes in female fecundity in these populations. Our prediction was that male preference for larger females would be stronger in populations from nontoxic environments, where the relative increase in female fecundity is higher as compared to populations from toxic environments.Gambusia eurystoma is a surface species endemic to the sulfidic Ba\u00f1os del Azufre in Tabasco, Mexico . The mature females were then sorted into roughly equally sized groups according to size , and were then placed in different 38 L stock tanks. Males were randomly assigned an ID number that determined the order in which they would be tested, and they were housed in individual 5 L tanks that were out of sight of the females.Fish from the stock tanks were caught with a small seine and segregated by sex. Mature females were then selected using minimum standard length  as the criterion for sexual maturity. Due to natural size differences between species, the exact criterion used varied  made out of clear plexiglass were located in the center of each section of the tank. The cylinder in the center of the tank had solid walls, while the two outer cylinders were perforated with seven circular holes 6 mm in diameter to allow for chemical and mechanosensory signals. Chemical and mechanosensory signals have been found to be important factors in poeciliid mating behavior, influencing the repeatability of individual preferences as well as the overall preference . All thrA randomly selected female from the predetermined size category  was placed in the cylinder in one of the outer preference zones. The order of the females which each male would be presented with, as well as the side in which each female would be placed, were randomly determined. A male was then placed in the central cylinder for 5 min. After the 5 min of acclimation, the cylinder around the male was gently removed. Using two stopwatches, the amount of time the male spent in the preference zone containing the female was measured by the observer. This was done for 5 min, after which the fish were removed from the tank. The water was then stirred to homogenize any lingering chemical signals from affecting the results of future trials. Another pair of fish was then placed in their corresponding cylinders to acclimate. Every three pairs, a partial water change was also made previous to the acclimation period of the next fish. Male weight and standard length were also measured and used as covariates, but were not included in the final model because neither was significant.After checking the assumptions, a mixed between-within subjects ANOVA was performed to determine the effect of two habitat variables on male preference for small, medium, and large females. The two habitat variables used were \u201ccave habitat\u201d, whether the population originated from a cave or from a surface stream, and \u201ctoxicity\u201d, whether the population originated from a toxic or non-toxic stream. Because the raw results were not normally distributed, the male preference variables were reflected and square root transformed to meet the normality assumption.Experiments were approved by the University of Oklahoma IACUC (R09-030).p = 0.026). However, this violation was not deemed to be severe enough to invalidate the ANOVA. As expected, there was a significant main effect for time spent with larger females, regardless of the habitat of origin  = 5.99, p = 0.003, F = 0.047, p = 0.829, F = 1.043, p = 0.309, F = 0.011, p = 0.917, All statistical assumptions were met after the data transformation, with the exception of homogeneity of variances for the time males spent with medium females  = 4.36, p = 0.015, F = 0.26, p = 0.77, F = 8.86, p = 0.06, There was also a significant interaction between cave habitat and the time males spent with females from different size categories , and epigean or hypogean habitat (\u201ccave habitat\u201d). Previous studies have shown that in P. mexicana  and nontoxic  surface populations.This result suggests that the change in female fecundity experienced from benign to toxic habitats is only weakly correlated with the change female quality. The reason for this is unclear and could be due to a combination of factors. It is possible that female size in nontoxic habitats is correlated with increased female mortality and/or with a decrease in offspring quality. An alternative possibility is that female size and quality are highly correlated, but that there has been insufficient time for male preference to change as a response to female adaptation. It is currently unknown how long the populations in toxic habitats have been adapting to their environments, and how recently the changes in female fecundity have evolved. Since male preference is likely under weaker selection than other traits, it is possible that males from toxic populations have either not had a sufficient amount of time to adapt, or that the amount of gene flow from nontoxic populations has been able to counteract the effects of selection. It is currently unknown how much gene flow there is between toxic  and those in the surface  Cave habitat, independent of water toxicity, does affect male preference. Cave males had a relative lack of preference for small females. We suggest that this could be a result of differences in predation pressure which could lead to relatively increased mortality for small females in the caves, relatively increased mortality for medium and large females in the surface, or both. If true, this would highlight the role that predators play in the evolution of male mate choice.In summary, we have shown that (1) male preference for larger female size exists. This is consistent with previous research, indicating that absolute preference functions are a valid approach in this system. (2) Hydrogen sulphide does not affect the shape of male preference function for female size in this system. Since H10.7717/peerj.140/supp-1Supplemental Information 1w\u22ef columns) and transformed data (RefSqr.. columns) from all of the individual trials. Females were presented in a random order.Raw (TimeClick here for additional data file."}
+{"text": "This paper describes methods to analyze the brain's electric fields recorded with multichannel Electroencephalogram (EEG) and demonstrates their implementation in the software CARTOOL. It focuses on the analysis of the spatial properties of these fields and on quantitative assessment of changes of field topographies across time, experimental conditions, or populations. Topographic analyses are advantageous because they are reference independents and thus render statistically unambiguous results. Neurophysiologically, differences in topography directly indicate changes in the configuration of the active neuronal sources in the brain. We describe global measures of field strength and field similarities, temporal segmentation based on topographic variations, topographic analysis in the frequency domain, topographic statistical analysis, and source imaging based on distributed inverse solutions. All analysis methods are implemented in a freely available academic software package called CARTOOL. Besides providing these analysis tools, CARTOOL is particularly designed to visualize the data and the analysis results using 3-dimensional display routines that allow rapid manipulation and animation of 3D images. CARTOOL therefore is a helpful tool for researchers as well as for clinicians to interpret multichannel EEG and evoked potentials in a global, comprehensive, and unambiguous way. The traditional analysis of the electroencephalogram (EEG) and event-related potentials (ERPs) focuses on waveform morphology over time at certain electrode positions. Scalp sites of interest are selected and the time course of the potential recorded at any site is analyzed using a variety of signal processing tools in the time and frequency domains. While this approach has provided many important insights into normal and pathological neuronal activity, it disregards another important dimension that multichannel EEG offers: the spatial characteristics of the electric fields at the scalp and the temporal dynamics of these fields. Any distribution and orientation of the active neurons at a given moment in time will generate a certain electric field on the scalp surface due to volume conduction . While d With the program CARTOOL, which exists now since over 14 years with constantly increasing capabilities, we wanted to provide an analysis tool for those researchers and clinicians who are interested in such reference-free EEG mapping techniques. It started with dynamic displays of EEG maps and calculation of some basic quantitative topographic measures. Soon after, standard data preprocessing tools were implemented, such as interpolation of electrodes, filtering, averaging, rereferencing. The next versions implemented spatial analysis methods for spontaneous and event-related EEG, most importantly the spatial microstate segmentation, initially proposed by Lehmann and collaborators , and subIn the following we will describe some of the main methods for the spatial analysis of the scalp electric fields and how they are implemented in CARTOOL. Not all methods will be covered here, but they will give an impression of how multichannel EEG and ERP data can be analyzed in a comprehensive way. More details regarding the different spatial analysis methods can be found in the book \u201cElectrical Neuroimaging\u201d .Topographic analysis of the electric field at the scalp very crucially depends on the quality of the data at each channel. Contamination by bad or noisy electrodes can lead to steep local gradients that have no neurophysiologic basis, which can in turn obfuscate interpretability of results . Artifacts on one particular channel are not always easy to detect if only EEG waveforms are displayed. In contrast, contaminated channels are readily seen on time series of EEG maps because they behave differently from the neighboring channels and appear as isolated \u201cspots\u201d in the maps ,exporting single or multiple tracks before or after applying the above preprocessing steps.For evoked potential analysis, single or averaged epochs can be calculated for any combination of triggers or markers with or without baseline correction. Automatic artifact detection and epoch rejection using amplitude windows is available. CARTOOL puts a lot of emphasis in a flexible visualization of the EEG tracks during evoked potential analysis for manual determination of artifacts. During the evoked potential analysis, a trigger validation file is generated that can later be used to more rapidly redo the averaging with the same epochs.In addition to the epoching according to defined triggers, CARTOOL allows to set markers according to specific characteristics in certain channels. This allows, for example, one to set markers at the onset of a motor response recorded with the EMG or at the peak of epileptic spikes. Finally, a file calculator tool has been implemented in CARTOOL that allows applying preset as well as user-defined mathematical operations to different files in a batch-mode processing.In the default display mode, CARTOOL always shows two global topographic measures together with the waveforms and the maps . These tui is the voltage of the map u at the electrode i, u and N is the number of electrodes of the map u. Scalp potential fields with pronounced peaks and troughs and steep gradients will result in high GFP, while GFP is low in maps which have a \u201cflat\u201d appearance with shallow gradients. GFP is a one-number measure of the map at each moment in time. Displaying this measure over time allows to identify moments of high signal-to-noise ratio, corresponding to moments of high global neuronal synchronization [nization , 16. GFPThe Global Map Dissimilarity measure (GMD) is a measure of topographic differences of scalp potential maps. It is defined asui is the voltage of map u at the electrode i, vi is the voltage of map v at the electrode i, u, v, and N is the total number of electrodes. In order to assure that only topography differences are taken into account, the two maps that are compared are first normalized by dividing the potential values at each electrode of a given map by its GFP. The GMD is 0 when two maps are equal, and maximally reaches 2 for the case where the two maps have the same topography with reversed polarity. Figure 2 in [ure 2 in  illustraThe GMD is equivalent to the spatial Pearson's product-moment correlation coefficient between the potentials of the two maps to compare . The calfunctional microstates first described by Lehmann et al. [The display of the GMD across time has a very characteristic behavior which is similar for spontaneous EEG and for evoked potentials: the topography of the maps remains stable for several tens of milliseconds and then abruptly switches to a new configuration in which it remains stable again. This leads to periods of low GMD interrupted by sharp GMD peaks . This hin et al. , 20. Then et al. . This con et al. \u201325. Withn et al. . While sn et al. .In light of this interpretation of the observed sequential periods of map stability, different methods have been proposed to objectively and automatically define the different microstates and to statistically evaluate the specificity of certain microstates under given experimental conditions. CARTOOL has implemented these methods in the \u201cmicrostate segmentation\u201d and \u201cmap fitting\u201d modules. The microstate segmentation is based on cluster analysis using either a modified k-means cluster analysis  or an atThe cluster analysis can be applied to one data file or to different files of different experimental conditions and/or populations . The resThe cluster maps are finally fitted back to the original data and each time point is labeled with the cluster maps it correlated best with (in terms of GMD). In order to ensure a certain degree of continuity in time of the different a final relabeling step is performed which satisfies two requirements: (1) the correlation between the measurement and the cluster map should be high, and (2) the majority of the neighboring measurements should belong to the same microstate. Standard smoothing techniques, well-known in statistics, are used to fulfill this compromise between goodness of fit and smoothness . CARTOOLAnother method that has been proposed to define the most dominant evoked component topographies in a dataset is based on an independent component analysis . It hasThe cluster analysis of ERPs is usually applied to the group-averaged files. All experimental conditions/populations are entered into the cluster analysis, and the optimal number of clusters for the whole data set is determined , 32. TheIt is important to emphasize that the microstate segmentation on the grand mean data allows hypothesis generation and is not the final result. Changing the number of clusters might change the results at this level by proposing more or less map differences across time or between conditions. A second statistical step is needed to confirm these hypotheses and define those microstates that remain statistically significant. The \u201cmicrostate fitting\u201d module of CARTOOL allows to perform this test. The fitting procedure is the same as for the grand mean, but now the cluster maps are fitted to the individual ERPs of each subject and each condition/population  Figure . SeveralThe microstate segmentation using the cluster analysis can also be applied to spontaneous EEG. It leads to a reduction of the data to a stream of microstates of certain durations, on average around 80\u2013100\u2009msec . It is it-tests. At present, only univariate statistics are implemented in CARTOOL, but multivariate analysis procedures are currently under evaluation before formal inclusion. The univariate analysis can be applied to the potential at each electrode and each time point as a comprehensive exploratory analysis of the data [CARTOOL offers a variety of parametric and non-parametric statistical EEG mapping analysis procedures . Non-parthe data , 37, 38.the data . In orden participants is 2n. The GMD value from the actual group-average ERPs is then compared with the values from the empirical distribution to determine the likelihood that the empirical distribution has a value higher than the GMD from the actual group-average ERPs. In a within-subject design, the permutation of the maps is done within the subjects, while the permutation is done across subjects in group comparisons. In the example shown in Testing for differences in GFP at each time point is straightforward using the parametric or nonparametric tests. In order to test for differences in topography, CARTOOL implemented what has been called a \u201ctopographic ANOVA\u201d, or TANOVA , 40. SinThe statistical analysis can also be performed on the values that result from the microstate fitting procedure. Again, only univariate statistics are currently implemented. For multivariate analysis the spreadsheets have to be read into other statistical packages. Ongoing developments are underway for the implementation of multivariate statistics , 42 as wQuantitative analysis of spontaneous EEG has traditionally relied on Fourier-transformation based spectral analysis. Thereby, the power of the different frequencies or frequency bands is compared between different conditions/populations. In multichannel data, power maps are often used and statistical maps of power differences are calculated. This approach has been very successful and helped to characterize vigilance changes, sleep stages, drug effects and various neurological and psychiatric disorders . More reHowever, frequency power maps have two important problems. First, they are reference-dependent. In contrast to potential maps in the time domain, power maps in the frequency domain change when the position of the recording reference changes , 46. SecWhile the analysis of the scalp potential maps as described up to now has the advantage, as compared to waveform analysis, to be reference independent and considers the whole brain electrical activity, it does not provide any direct conclusions about the number, location and orientation of the intracranial generators . InverseA major breakthrough in the spatial analysis of multichannel EEG/MEG was the development of distributed inverse solution methods that allow the estimation of the 3-dimensional distribution of neuronal activity in the whole brain at each moment in time , 52. TheThe results of the inverse solutions (norm or vectors) are displayed 3-dimensionally in the real  MRI . Slices It is worthwhile to note that the segmentation of the brain surface and the grey matter is implemented in CARTOOL including manual correction tools to exclude incorrect classification of grey matter or exclude structures as brainstem and cerebellum if desired. Alternatively, already segmented brains can be read into CARTOOL if preferred, such as standard template brains. Also the warping transformations as well as the distribution of the solution points are done within CARTOOL. Thus, the whole source localization process can be performed within CARTOOL, starting with the original EEG and the original MRI.Besides source reconstruction in the individual MRI, CARTOOL can also use template brains such as the MNI brain. In this case the solution space remains the same for all subjects, allowing group studies on the source level. In the case of the MNI brain, all solution points are labeled with their Talairach coordinates as well as their anatomical labels. Time periods of interest  or regions of interest (ROI) can be created and the mean current density within these segments or ROI can be stored for further statistical analysis . FinallySeveral other analysis tools are available in CARTOOL. In addition to the analysis of scalp EEG, CARTOOL also allows to visualize and analyze intracranial EEG, to read and fusion 3D images of different imaging modalities, to create and work with 3D regions of interest, and to convert and manipulate MR images.The analysis of intracranial recordings includes the color-coded mapping of grids as well as along depth electrodes . IntracrCARTOOL can read any type of 3D volumes in Analyze format. In case of functional images (fMRI or PET) the activation areas are displayed as colored blobs within the MRI. Several different volumes can be overlapped and thus results of different imaging modalities (including the inverse solutions) can be displayed within the same MRI. MRIs can also be manipulated and converted in various ways and stored as new volumes.A large palette of 3D display tools is available in CARTOOL that allows flexible visualization of the data. Any 3D object can be inserted into another one by a single click, allowing the merging of different information instantly, while retaining the spatial coherence of the objects. Different windows can easily be synchronized, allowing the user to visualize the dynamic behavior of the data on traces, maps and inverse solutions simultaneously .CARTOOL is constantly implementing new analysis methods that appear as useful and have been published. Concerning the statistical analysis, multivariate methods will soon be implemented. The TANOVA described above can easily be extended to multivariate measures . Also teN-dimensional space, where N is the number of the electrodes. The computation is initialized by a K-means algorithm, which iteratively improves the estimation of means, covariances and priors of the Q Gaussians until the likelihood reaches a plateau. For each time point and trial it then provides Q conditional probabilities that relate the topographies to the clusters. Like in the labeling procedure described above, each time point and trial is then labeled with the cluster with which it has highest conditional probability. The method has been shown to reliably identify specific component maps in the single trial ERPs despite the clear dominance of the ongoing spontaneous EEG activity.Concerning microstate segmentation, De Lucia et al. , 62 propAn important new development in the field of EEG/MEG analysis is the measure of connectivity between different brain areas as a way to understand the organized behavior of different brain regions . The useMethods and Acknowledgements sections of their papers. Currently about 650 users from all over the world have registered and downloaded CARTOOL.CARTOOL is not an Open Source project; however the program is distributed freely to any nonprofit research group. Users need to register only once and will then be informed of any updates of the software. They are asked to cite the use of CARTOOL in the OpenGL, so it needs an OpenGL accelerated graphic card, and as much memory as possible for the most demanding operations. Matlab is not needed to run CARTOOL.CARTOOL runs only on Windows platforms (ranging from Windows 95 up to Windows 7) as a standalone compiled executable program, included with its complete documentation within a single installation program. It is fully written in C++ in order to attain the highest speed and compactness in memory use. The advanced display is completely done in Drag & Drop in CARTOOL, the landing of the drop usually conditioning the actions to be undertaken on the files.Interoperability is achieved mainly by exchanging intermediate results through files. Considerable efforts have been put in reading and writing standard files with a maximum of convenience for the user. For example, most of the operations can be done by Reference Guide, describing all the options and technical details for all processes, is included in the distribution in the form of compiled HTML (10\u2009MB chm file). In addition a CARTOOL Community group (Google Sites) has been built in order to offer a central access for the users, which includes a User's Guide, collaboratively edited as a Wiki, a Discussion Forum for all questions and announcements, some FAQs, and a few shared files. Finally, it is worth noting that CARTOOL updates, including Beta releases, can be easily assessed online through a Google Docs repository.Help is provided at different levels. A thorough Here are the main internet addresses for CARTOOL:http://brainmapping.unige.ch/cartoolhttp://cartoolcommunity.unige.ch Files formats read by CARTOOL include formats produced by the EEG systems form the companies Biologic, Biosemi, Brain Products, Deltamed, EGI, and Neuroscan. Also EDF format and standard text files can be read. Concerning MRI, Analyze and AVS formats are read. A complete list of file formats is included in the Reference Guide of Cartrool."}
+{"text": "The gold standard management for ureter transitional cell carcinoma (UTCC) is radical nephroureterectomy with excision of the bladder cuff. However, some patients cannot undergo this procedure for several reasons. In the case reports described herein, we performed stereotactic body radiotherapy (SBRT) on three patients with inoperable or surgery-rejected localized UTCC. Two out of the three patients did not develop local recurrence or distant metastasis during the observation period. However, recurrence was detected in the bladder of one patient 22 months after the treatment. No acute or late adverse events occurred in any of the three patients. SBRT may become one of the treatment options for inoperable or surgery-rejected UTCC patients. Ureter transitional cell carcinoma (UTCC) is rare, accounting for only 1\u20133% of urinary transitional cell carcinoma cases . HoweverAn 87-year-old woman with rheumatism presented with gross hematuria and dysuria. A cystoscopic examination showed a papillary tumor at the left ureteral orifice protuberating into the bladder. A histological examination confirmed transitional cell carcinoma grade 2. A CT scan revealed the mass at the distal ends of the left ureter with no lymphatic or distant metastasis. Therefore, this patient was diagnosed with ureter cancer T2N0M0. Radical nephroureterectomy was considered to be nonadaptive because of comorbidities of chronic kidney disease (CKD) and rheumatism; therefore, she was referred to our department. SBRT was performed by coplanar dynamic conformal radiotherapy with a linear accelerator (LINAC) . A total dose of 60\u2009Gy was delivered in 10 fractions at the center of planning target volume (PTV) using 10\u2009MV photons . No acutAn 87-year-old man presented with occult hematuria. A cystoscopic examination showed no abnormal findings. The result of urine cytology was class V, transitional cell carcinoma. A CT scan showed a small tumor at the distal one-third of the left ureter with dilation of the upper ureter and ipsilateral renal pelvis. There was no evidence of lymphatic or distant metastasis. Therefore, the patient was diagnosed with ureter cancer T2N0M0. The patient refused surgery and was referred to our department. SBRT was performed by noncoplanar dynamic arch radiotherapy with a LINAC. A total dose of 50\u2009Gy was delivered in 10 fractions at the center of PTV using 10\u2009MV photons . No acutAn 85-year-old woman presented with gross hematuria. A cystoscopic examination revealed a tumor in the left ureter. A histological examination confirmed transitional cell carcinoma grade 3. A CT scan showed the tumor at the distal ends of the left ureter with no lymphatic or distant metastasis . Therefo10 [The standard treatment of UTCC is surgical resection. In the present study, summarized in 10 . Based o10). In contrast, in case 2, the tumor was localized at the distal one-third of the ureter, and the small intestine was in close proximity to the tumor. Therefore, the tumor was treated with 50\u2009Gy in 10 fractions, equal to 75\u2009Gy on BED10, in order to suppress the exposure dose to the small intestine. However, there were no decisive differences of local control in all three cases.In the present study, the prescribed doses differed between cases. In cases 1 and 3, the tumor was localized at the distal end or orifice of the ureter, and 60\u2009Gy was delivered in 10 fractions, which was equal to 96\u2009Gy on a biological effective dose of 10 (BEDThere are various techniques of SBRT in sight of irradiation and image guidance. The most commonly used one is a linear accelerator (LINAC), and we performed SBRT with a CT-LINAC system in all three cases. Incidentally, SBRT with dedicated machines, including cyberknife, is also often performed especially for localized prostate cancer in genitourinary organs .The sizes of the tumors in all three cases had decreased within 3 months of the treatment. Furthermore, there was no evidence of recurrence in the observation period spanning between 13 and 24 months. Therefore, SBRT was considered sufficiently effective for local control. Cases 1 and 2 showed no evidence of local recurrence, lymph node relapse, or distant metastasis in the observation period . However, bladder relapse was detected in case 3 22 months after the treatment. Hall et al. examined 252 patients treated surgically for upper urinary tract TCC and reported 12 months as the median time of disease relapse in 67 patients (27%) . These fNo acute or late adverse events were observed in any of the three cases presented herein. However, a longer observation period may be needed to more accurately estimate late adverse events.In conclusion, SBRT may become one of the treatment choices for inoperable localized UTCC. Further studies including a larger number of cases and longer observation periods are needed."}
+{"text": "Radiative cooling technology utilizes the atmospheric transparency window (8\u201313\u2009\u03bcm) to passively dissipate heat from Earth into outer space (3\u2009K). This technology has attracted broad interests from both fundamental sciences and real world applications, ranging from passive building cooling, renewable energy harvesting and passive refrigeration in arid regions. However, the temperature reduction experimentally demonstrated, thus far, has been relatively modest. Here we theoretically show that ultra-large temperature reduction for as much as 60\u2009\u00b0C from ambient is achievable by using a selective thermal emitter and by eliminating parasitic thermal load, and experimentally demonstrate a temperature reduction that far exceeds previous works. In a populous area at sea level, we have achieved an average temperature reduction of 37\u2009\u00b0C from the ambient air temperature through a 24-h day\u2013night cycle, with a maximal reduction of 42\u2009\u00b0C that occurs when the experimental set-up enclosing the emitter is exposed to peak solar irradiance. Radiative cooling relies on the atmosphere's transparency window. Here the authors achieve up to 42\u2009\u00b0C drops in temperature for low thermal loads under diffuse sunlight by improving the selectivity of the emissivity and the thermal management of their devices. From fundamental thermodynamics considerations, high-efficiency conversion from heat to work requires both a high-temperature heat source and a low-temperature heat sink. The vast majority of energy conversion processes at present use our ambient surrounding here on Earth as the heat sink. On the other hand, outer space, at a temperature of 3\u2009K, provides a much colder heat sink. Moreover, Earth's atmosphere has a transparency window in the wavelength range from 8 to 13\u2009\u03bcm that coincides with the peak of the blackbody spectrum of typical terrestrial temperatures \u223c300\u2009K, enabling the process of radiative cooling, that is, radiative ejection of heat from Earth to outer space, and hence the direct radiative access to this colder heat sink. Exploitation of radiative cooling therefore has the potential to drastically improve a wide range of energy conversion and utilization processes on Earth.The study of radiative cooling has a long history12345678910111213141516171819203456789In this paper, we first theoretically show that ultra-large temperature reductions up to 60\u2009\u00b0C below ambient can be achieved. The key to such ultra-large temperature reduction is to use highly selective thermal emitter matched to the atmospheric transparency window, and to minimize parasitic heat losses. Experimentally, we demonstrate an apparatus, which exhibits continuous passive cooling throughout both day and night. In a 24\u2009h day\u2013night cycle in winter, the cooler is maintained at a temperature that is at least 33\u2009\u00b0C below ambient air temperature, with a maximal temperature reduction of 42\u2009\u00b0C, which occurs when the apparatus enclosing the cooler is exposed to peak solar irradiance.To illustrate the pathway towards achieving ultra-large temperature reduction, we first consider the ideal case, where the atmosphere is 100% transparent at a particular wavelength range outside the solar spectrum. In such a case, an emitter that has non-zero emissivity within this wavelength range, and zero emissivity outside, will reach the temperature of outer space of 3\u2009K in the absence of parasitic heat loss, since in such a case the emitter is undergoing thermal exchange only with outer space.For a more realistic case, we perform the theoretical analysis as illustrated in Qsample), the absorbed thermal radiation from the atmosphere (Qatm) and the parasitic heat losses (Qparasitic) characterized by a heat transfer coefficient h. We consider three different emitters: a black emitter, a near-ideal selective emitter  reaches zero. Here we fix the ambient temperature (Tambient) to be 20\u2009\u00b0C, and use a typical atmospheric transmittance at Stanford in winter .as a function of the temperature of the sample, n winter . For each=8\u2009Wm\u22122K\u22121), the difference in performance between the black and the selective emitter is relatively small. Both the black emitter and the near-ideal selective emitter are restricted to a temperature reduction |\u0394T|\u223c10\u2009\u00b0C. Second, when the parasitic heat loss is completely eliminated (h=0\u2009Wm\u22122K\u22121), there is a very large difference in terms of performance between the black and the selective emitter. Whereas the temperature reduction of the black emitter is limited to |\u0394T|\u223c20\u2009\u00b0C, the near-ideal selective emitter achieves a far higher temperature reduction |\u0394T|\u223c60\u2009\u00b0C. Thus, to approach the fundamental limit on radiative cooling, both selective emitter and ultra-low parasitic heat loss are essential. These considerations, together with the need to suppress solar irradiance during the daytime, motivate our design of the experimental apparatus and the selective emitter.\u22126\u2009Torr), which encloses 10 concentric reflective radiation shields, and 4 long-hollow ceramic pegs in addition to the thermal emitter. These pegs provide mechanical support, while minimizing conduction loss to the emitter  is well within the resolution of the thermocouple.3N4), amorphous silicon (Si) and aluminium (Al), with thickness of 70, 700 and 150\u2009nm, respectively  appears, when the apparatus enclosing the cooler is exposed to peak solar irradiance. This seemingly counter-intuitive observation points to the effectiveness of the sun-shade/mirror-cone for blocking sunlight, and arises from the high contrast between the ambient air temperature and the dew point, when the solar irradiance reaches its peak.We performed measurements by exposing the experimental apparatus to a clear sky throughout a 24-h day\u2013night cycle at Stanford, California in winter see  shows thhttps://www.wunderground.com/us/ca/stanford). In general, the experiment agrees well with the theory. The few outliers in Qatm) and the parasitic heat loss (Qparasitic). On the other hand, the use of the selective emitter and the vacuum chamber significantly reduces these two terms, and as a result the dependence of the steady-state temperature of the sample on the ambient air temperature becomes weaker. Thus, although the lowest sample temperature occurs when the ambient temperature is low, the maximal temperature reduction occurs at the maximal ambient temperature. To conclude from In summary, the experiments here provide a record-setting performance in radiative cooling during both day and night. The demonstrated steady-state temperature is far below the freezing point even though the apparatus enclosing the cooler is exposed to peak sunlight. Our work demonstrates the possibility of reaching the fundamental limit of radiative cooling by combining photonic and thermal design. From a practical point of view, radiative cooling is becoming important in a number of areas, including passive building coolingWe end by briefly commenting on the prospect for scaling up the present system. Commercial evacuated solar water collectorsThe data that support the findings of this study are available from the corresponding author on request.How to cite this article: Chen, Z. et al. Radiative cooling to deep sub-freezing temperatures through a 24-h day\u2013night cycle. Nat. Commun.7, 13729 doi: 10.1038/ncomms13729 (2016).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.Supplementary Figures, Supplementary Notes, Supplementary References."}
+{"text": "The recent progress on radiative cooling reveals its potential for applications in highly efficient passive cooling. This approach utilizes the maximized emission of infrared thermal radiation through the atmospheric window for releasing heat and minimized absorption of incoming atmospheric radiation. These simultaneous processes can lead to a device temperature substantially below the ambient temperature. Although the application of radiative cooling for nighttime cooling was demonstrated a few decades ago, significant cooling under direct sunlight has been achieved only recently, indicating its potential as a practical passive cooler during the day. In this article, the basic principles of radiative cooling and its performance characteristics for nonradiative contributions, solar radiation, and atmospheric conditions are discussed. The recent advancements over the traditional approaches and their material and structural characteristics are outlined. The key characteristics of the thermal radiators and solar reflectors of the current state\u2010of\u2010the\u2010art radiative coolers are evaluated and their benchmarks are remarked for the peak cooling ability. The scopes for further improvements on radiative cooling efficiency for optimized device characteristics are also theoretically estimated. Radiative cooling is such a promising cooling method with their ability to offer a cooling power of more than 100 W mIn this article, we seek to review the detailed characteristics, recent advancements, and the scope for further performance improvements of radiative coolers. In Section 2FigureThe Earth's atmosphere has a highly transparent window in the infrared (IR) wavelength range between 8 and13 \u03bcm, i.e., the atmosphere's radiative emission is very weak in that window. Outside the atmospheric window, the Earth's atmosphere is highly emissive. Coincidentally, the atmospheric window falls within the peak thermal radiation of a black body defined by Plank's law at the ambient temperature (at around 300 K). This feature permits for a passive cooling mechanism for a terrestrial body at the ambient temperature by eliminating heat via radiative emission through the atmospheric window. The emitted radiation escapes through the Earth's atmosphere to the outer space which acts as a gigantic thermal reservoir. The atmospheric window allows the terrestrial body's outgoing radiative emission to exceed its absorbed incoming atmospheric radiation and thus to passively cool below the ambient temperature. Along with the effect of the incoming atmospheric radiation, the cooling performance of a radiator depends on other factors, such as, the nonradiative (conductive and convective) heat gain from the surrounding media and the incoming solar radiation during the daytime. In addition, the cooling efficiency can heavily be affected by the emission profile of the radiator in use, i.e., a broadband radiator or a selective radiator. The IR window transmittance for certain atmospheric conditions can also significantly influence the cooing potential. The following subsections discuss the theoretical aspects of a radiative cooler and the associated factors affecting the cooling efficiency.2.1Taking into account all the heat exchange processes, the net cooling power of a radiative cooler can be defined asUB=2hc2\u03bb51ehc/\u03bbkBT\u22121 is the spectral radiance of a black body defined by Planck's law at any temperature T, where h is Planck's constant, kB is the Boltzmann constant, c is the speed of light in vacuum, and \u03bb is the wavelength. The emissivity of the radiator can be defined by its absorptivity er according to Kirchhoff's law. The angle dependent emissivity of the atmosphere is given byea=1\u2212t(\u03bb)1/cos\u03b8, where t(\u03bb) is the atmospheric transmittance in the zenith direction. Tr is the temperature of the radiator and Ta is the ambient temperature.Here, q=qcond+qconv is the combined nonradiative heat coefficient stemming from the conductive and convective heat exchange of the radiator with the surrounding air. Without any insulation for the nonradiative heat gain, the cooling power of the radiator is limited. In most of the experimental demonstrations, the radiators were insulated by polystyrene foam to suppress the conductive heat gain from the back surface and side walls and highly IR transparent low\u2010density polyethylene film was used as convection cover on top of the radiator with sufficient air gap.\u22122 \u00b0C\u22121 were estimated in several reports for radiative cooling which indicate effective suppression of nonradiative heat gain.The third term of the right hand side of Equation \u22122 and a significant absorption of this amount of power can easily diminish any cooling effect of the radiator. To avoid the adverse effects of solar radiation, IR transparent solar reflectors can either be integrated on the top of the thermal radiators or suitable cooling devices can be designed to serve as a simultaneous solar reflector and an IR radiator. The recent demonstrations of the daytime radiative coolers utilized the latter, where the cooling device reflected 97% of the incident solar radiation while providing significant IR emission within the 8\u201313 \u03bcm wavelengths range.The last term on the right hand side of Equation Pnet at the ambient temperature Ta in Equation Tr drops below Ta and reaches a steady state temperature Tss, (Tr = Tss < Ta) where the outgoing power balances the absorbed incoming power, i.e., Pnet (Tss) = 0. Thus, to achieve a state where Tss is significantly below Ta, the radiative emission within the 8\u201313 \u03bcm wavelength region must be maximized and the absorbed power from the incoming atmospheric radiation, nonradiative contributions, and absorption of solar power must be minimized. FigureA radiator can provide with practical cooling only when the radiated output power exceeds the net absorbed power. With a positive value of 2.2Ta\u2013Tr) of selective and broadband radiators with and without the presence of solar and nonradiative contributions are shown in Figure Ta = 25 \u00b0C. A practical cooling device with 50 W m\u22122 cooling power at the ambient temperature and covering only a surface area of 50 m2 on the rooftop of a residential building would allow removing heat equivalent to a net cooling load of 15 kWh for a peak daytime between 11 am and 5 pm. An estimate of energy savings (in kWh) by radiative coolers on rooftop operating over the course of a year has also been reported in ref. [3].The performance of radiative coolers is highly related to the spectral emissivity profiles of the different kinds of radiators. The first one is a broadband radiator which has emissivity like a blackbody within the entire emission band of the atmosphere except the main solar spectral band from 300 nm to 2.5 \u03bcm. The second one is a selective radiator comprising unity emissions only within the wavelengths of 8\u201313 \u03bcm, selectively spanning over the atmospheric window. The ability of the selective radiator for cooling below the ambient temperature is vastly superior to that of a broadband radiator. As a comparison, the cooling power and the achievable cooling temperatures (Ta\u2013Tr) in practice. The reason behind is that a broadband radiator operating considerably below the ambient temperature, may emit the less radiative power than it receives from the incoming atmospheric radiation at the ambient temperature inhibiting it to cool further without any net cooling power. An ideal emitter thus should selectively and strongly emit within the entire 8\u201313 \u03bcm wavelengths range. This has important consequences. The emitter does not absorb radiation outside the 8\u201313 \u03bcm window where the atmosphere is highly emissive which allows a minimal radiative heat exchange with the atmosphere. The impact of this becomes highly important to achieve cooling significantly below the ambient temperature. In addition, a strong emission within the 8\u201313 \u03bcm window ensures a high emitted power to overcome the nonradiative and solar heat contributions to reach a steady state temperature significantly below the ambient temperature. To understand this further we consider the cooling powers of broadband and selective radiators in Figure FigureTa = 25 \u00b0C (integrated over the entire hemisphere) by the broadband and selective radiators  and thus has a net cooling power. However, it may not be able to provide with a cooling temperature well below the ambient temperature  and using IR transparent polyethylene cover, the nonradiative heat transfer can be significantly minimized.Catalanotti et al. and Bartoli et al. utilized a commercially available polyvinyl\u2010fluoride polymer film (TEDLAR) as the radiative emitter which possesses somewhat selective and high IR absorption from 9 to 13 \u03bcm wavelengths range.2) was coated on aluminum plates and was used as the IR radiator. Although realistic cooling was not achieved directly under the sun at mid noon, a steady cooling of around 10 \u00b0C below the ambient temperature under clear sky conditions was reported during the night. On a relatively low humid day a maximum cooling 15 \u00b0C below the ambient was also demonstrated. In later works, B. Orel et al. reported that mixing barium sulfate (BaSO4) with TiO2 as pigments in the white paint can improve the cooling performances even further, which is due to the enhanced absorption in the 8\u201313 \u03bcm wavelengths range by the SO4 stretching vibrations of the BaSO4 content.3N4) possessing similar selective emission properties as SiO films were also radiative for potential radiative cooling.2 nanoparticles together in polyethylene films deposited on Al can yield high IR emission with better selectivity.Apart from the polymer films, pigmented paints, naturally available inorganic compounds and gases with IR emission were also investigated for nocturnal radiative cooling applications.2H2) gas to demonstrate a maximum cooling of 10 \u00b0C below the ambient temperature at daytime but avoiding direct exposure to sunlight. Further reports on radiative cooling by other potential gases such as, ammonia (NH3) and ethylene oxide (C2H4O) were also investigated.In addition to solid materials, radiative cooling with gases containing selective IR emission was also reported.3.22) white pigments and carbon black particles as a cover material for the IR radiative emitter.To achieve daytime radiative cooling, several kinds of solar reflecting materials were investigated in combination with IR emitters.Pr \u2212 Pa) is higher than the absorbed solar power , the device can yield a temperature well below the ambient temperature provided that convective heat gain is suppressed. On the other hand, if the absorbed solar power is higher than the net radiated power, the device temperature can be higher than the ambient air temperature. In this circumstance, the use of convective covers is undesirable as natural convection can aid to release heat from the cooling device. In the absence of direct solar radiation convection covers can greatly improve the performances for maximum cooling.Apart from solar reflectors, convection covers can also play important role to optimize the performance of the radiative cooler. For daytime applications, if the cooling device's net radiated power  and SiO2 with varying thickness. The top three thick layers mainly contributed to the IR emissivity including the 8\u201313 \u03bcm wavelengths range and the four thinner bottom layers deposited on Al coated Si wafer worked as chirped 1D photonic crystal for a maximum of 97% solar reflection ,Ta\u2212Tr > 15 \u00b0C) than a broadband radiator. For increasing bandwidth of the radiator, the cooling performance decreases and becomes almost stable for bandwidth >11 \u03bcm, where it starts to behave like a blackbody radiator. There is a sudden small increase of the cooling performance for a radiator emission bandwidth >12 \u03bcm where the radiator starts to interact with the weak secondary atmospheric window from 16 to 23 \u03bcm wavelengths range. For decreasing emission bandwidths, i.e., for bandwidths <|8\u201313| \u03bcm, Ta\u2212Tr rapidly decreases and does not provide any effective cooling for a bandwidth <1.25 \u03bcm. As discussed in Section From the analysis in the previous sections, it is clear that the radiative cooling performance depends on the maximized thermal radiation within the atmospheric window, the radiator emissivity profile, the nonradiative heat gains, solar power absorption, and atmospheric conditions. To further estimate the variation of cooling performance on the emissivity profile of the radiator, we consider a selective radiator with a varying emission bandwidth where the center emission band is at 10.5 \u03bcm fitting within the mid of 8\u201313 \u03bcm window range. The atmospheric model for Perth with transmittance within atmospheric window Figure a is adop\u22122 \u00b0C\u22121),Ta\u2212Tr for both the ideal selective and broadband radiator for varying nonradiative heat gains with a practical 3% solar power absorptionq = 10 W m\u22122 \u00b0C\u22121, the selective radiator does not provide any substantial cooling advantage and the radiator temperature falls only a few degrees below the ambient temperature. Indeed, this points to the recent demonstration of daytime radiative cooling without any nonradiative insulations,In the presence of significant nonradiative heat gain (7 W m6Radiative cooling promises a vital impact with its highly efficient passive cooling potential. In particular, the recent demonstrations for daytime radiative cooling below the ambient temperature"}
+{"text": "Colorectal cancer (CRC) has been the fourth leading cause of cancer-related mortality worldwide. Owing to clonal evolution and selection, CRC treatment needs multimodal therapeutic approaches and due monitoring of tumor progression and therapeutic efficacy. Liquid biopsy, involving the use of circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), and exosomes, may offer a promising noninvasive alternative for diagnosis and for real-time monitoring of tumor evolution and therapeutic response compared to traditional tissue biopsy. Monitoring of the disease processes can enable clinicians to readily adopt a strategy based on optimal therapeutic decision-making. This article provides an overview of the significant advances and the current clinical and biological significance of CTCs, ctDNA, and exosomes in CRC, as well as a comparison of the main merits and demerits of these three components. The hurdles that need to be resolved and potential directions to be followed with respect to liquid biopsies for detection and therapy of CRC are also discussed. With a global incidence of about 1.4 million individuals and 693,900 deaths reported in 2012, colorectal cancer (CRC) is the third most common type of cancer and the fourth most common cause of cancer deaths worldwide , 6. WithTherefore, screening and early detection of CRC remain clinical dilemmas and are critically important for raising the chances of a more suitable treatment leading to better long-term survival. Several approaches involving colonoscopy, sigmoidoscopy, fecal occult blood test (FOBT) , 8, seruTherefore, it is necessary to identify ideal bio-markers that can be used for the early diagnosis, detection of recurrence, and monitoring of metastasis for CRC. Using body fluid samples, liquid biopsies may be the ideal approach for the detection of CTCs or for the products of primary or metastatic tumors. The advent of liquid biopsy as an alternate, easy, quick, convenient, and minimally invasive method has shown tremendous potential to help clinicians achieve early diagnosis of cancer and guide decision-making during the course of treatment. It is expected to be an informative or easily accessible tool to provide comprehensive information of tumors beyond the invasive tissue biopsies. The main approaches to liquid biopsies include the detection of CTCs , analysiThis review summarizes and discusses the current clinical and biological significance of CTCs, ctDNA, and exosomes in CRC. Additionally, the review covers significant advances and limitations of liquid biopsy in the clinical applications, discusses the hurdles that need to be resolved, and provides potential directions for the detection and therapy of CRC.Over the past few decades, many procedures have been developed for liquid biopsy ranging from the use of CTCs and ctDNA or RNA to that of exosomes and platelets , 17 detein situ, contributed to the metastasis through plakoglobin-dependent intercellular adhesion [CTCs are circulating tumor cells that are shed into the bloodstream from tumors and have the potential to cause metastatic lesions , 19. Theadhesion .Although the underlying advantages of CTCs make it a promising tool to help monitor the dynamic course of disease, there are some potential limitations in the existing detection techniques \u201329 and fCirculating free DNA (cfDNA) is a natural phenomenon and is thought to originate from the apoptosis and necrosis of normal and tumor cells, and secretion of tumor cells has also been suggested as a potential source , 35. TheSEPT9 DNA (mSEPT9) for detecting CRC in a screening population was conducted by Church et al. [Many studies have demonstrated that the level of cfDNA is substantially higher in patients with cancer than that in healthy individuals or patients with benign diseases, and it seems to increase with tumor stage , 42. ctDh et al. . Resultsh et al. . Although et al. . Therefoh et al. .Exosomes, which are well known for intercellular communication, are small membrane vesicles (30\u2013100 nm) released from diverse cell types under both normal and pathological conditions, that can horizontally transfer functional biomolecules  to recipient cells \u201350. The 9 vesicles/mL in blood, the number of exosomes secreted by tumor cells correlates to their malignant behavior [BRAF (V600E) mutation and anti-epidermal growth factor receptor (EGFR) mutation, using allele-specific polymerase chain reaction (AS-PCR). The findings demonstrated that exoDNA could reflect the mutational status of the parental cell lines [Previous studies by Peinado and colleagues have demonstrated that exosomes played vital roles in vascular leakiness, inflammation, and bone-marrow progenitor cell recruitment during pre-metastatic niche formation and metastasis itself . Subsequbehavior , 53. Thell lines . HoweverHaving discussed the advantages and disadvantages of CTCs, ctDNA, and exosomes in different aspects, it is clear that these hold promise for researchers attempting to monitor tumor-specific changes during the course of cancer. This may also help clinicians to carry out noninvasive real-time assessment in various clinical settings, including diagnosis, therapy monitoring, and prognosis Table .A milestone in CTC research (CellSearch\u2122) in patients with metastatic breast cancer (MBC) was reported in The New England Journal of Medicine in 2004 . The resDeneve et al. demonstrated that the CTC counts were significantly higher in mesenteric blood than in the peripheral blood, which meant that the liver acts as a filter for CTCs, and the follow-up analysis showed that localized colon-cancer patients with high CTC counts have an unfavorable outcome n =60) . By cont . By conTM CTC technique. Biophenotypic  CTCs as well as mesenchymal CTCs positively correlated with both clinical stage and lymph node metastasis and distant metastasis, suggesting that CTCs displaying a mesenchymal phenotype would denote a more aggressive and metastatic potential [Recently, a large cohort of 1203 patients was evaluated for the expression of EMT markers in CTCs by using CanPatrolotential . Their fotential .in vitro angiogenesis and tumors in immune-deficient mice [in vitro culture, and molecular characterization of CTCs should divulge the prognosis of mCRC as well as monitor the drug response, in addition to early detection of disease progression with new metastasis.Cancer stem cells are capable of seeding, recirculation, and evolution in metastatic clones, which causes clinical progression of the disease . The firent mice . By estaent mice . The cytent mice . TherefoRAS or BRAF mutation status in primary or metastatic tumors. The mutation status of KRAS, BRAF, and PI3KCA could affect the treatment response to EGFR monoclonal antibodies or small molecule inhibitors and have treatment-independent prognostic value [KRAS discordance between CTCs and primary tissue cancer after 100% pure cell recovery and sequencing [KRAS, BRAF, and PIK3CA hotspot mutations were analyzed by a label-free platform. Researchers found a concordance of 78.2% for KRAS, 73.9% for BRAF, and 91.3% for PIK3CA mutations [National Comprehensive Cancer Network (NCCN) highly recommends that patients with mCRC should be tested for the ic value , 64, 65.quencing . The unequencing . In a reutations . In geneThus, in primary or non-metastatic CRC, the existence of CTCs might indicate poor prognosis; while in advanced or metastatic CRC, there should be a positive correlation between the level of CTCs with the tumor progression and poor outcomes; CTCs can guide treatment decisions and assess treatment responses during the course of therapy; the molecular analysis of CTCs may predict drug resistance and the selection of anticancer drugs . GazzaniDiehl et al. applied BEAMing to quantify ctDNA in CRC patients undergoing multimodality therapy. Compared to CEA, the levels of ctDNA were more impressive in the prediction of recurrence (P=0.03), which certified that fluctuations of ctDNA could be used to monitor the course of therapy in patients with mCRC undergoing surgery or chemotherapy . In anotWIF1 (WNT inhibitory factor 1) and NPY (neuropeptide Y) was significantly higher in the tumor tissue compared to that in normal tissue and these methylated ctDNA (Met ctDNA) were detectable throughout the tumor progression, with their fraction being correlated to the tumor stage [WIF1 and NPY could instead be tumor-specific mutations. Recently, Bedin et al. found that the adenoma and methylated cfDNA in patients with CRC, showed a higher quantity of ALU83 and ALU244 [OSMR and SFRP1 methylation of cfDNA was also significantly higher in advanced CRC compared to that in the adenoma and control samples. This combination can improve the diagnostic efficiency and prognosis for CRC.Until date, several studies have focused on the detection of methylated DNA in patients with CRC. Garrigou and colleagues reported that hypermethylation of or stage . Therefod ALU244 . In thisKRAS mutations are frequent drivers of acquired resistance to cetuximab in CRC, and indicated that the emergence of KRAS mutant clones can be detected, non-invasively, months prior to radiographic progression [KRAS and BRAF in CRC tumor tissue, using routine gold-standard methods, and in ctDNA, using a quantitative PCR-based method. cfDNA analysis showed 100% specificity and sensitivity for the BRAF V600E mutation and 98% specificity and 92% sensitivity with a concordance value of 96% for the KRAS mutation, compared with a tumor-tissue analysis [Misale et al. demonstrated, for the first time, that gression . They algression . The samgression . They algression . The firanalysis . To concanalysis .EGFR antibodies, exhibit pulsatile levels of mutant KRAS. Results revealed that the CRC genome adapts dynamically intermittent drug schedules and provided a molecular explanation for the efficacy of rechallenge therapies based on EGFR blockade [KRAS gene, KRAS wild type status in the primary tumor is a prerequisite for treatment modality of patients with mCRC with targeted therapy apart from the best supportive care alone [KRAS or BRAF alleles in the plasma at baseline and before each cycle of the third-line treatment with cetuximab and irinotecan. cfDNA and KRAS levels was found to decrease from baseline to cycle 3 and increased in progress (P = 0.08), while the loss of mutations was associated to the benefit of treatment, whereas the appearance of mutations during therapy may be correlated to acquired resistance in primary wild-type disease [KRAS mutation in wild-type tumors indicated a shift for the poor progression, while some patients with CRC had tumors that contained mutation but wild-type KRAS in plasma proved to have responded better to the therapy [As a result of clonal evolution and selection , the ctDblockade . Becausere alone , 73. The disease . The app therapy .Most published studies of ctDNA have evaluated a single type of tumor mutation; however, numerous cancers have been reported with several undefined mutations. Further, the detection of a known anomalous gene could not completely reflect the heterogeneity of the tumor or replace the gold standard for tissue biopsy. A study explored the feasibility of Ion Torrent PGM (IonPGM) targeted NGS on cfDNA of mCRC patients undergoing colorectal liver metastasectomy . The panAlthough increasing the sequencing depth of NGS could make the results more accurate, such an approach will be more time-consuming and costly, which is an obstacle for practical clinical application. However, whole genome sequencing with an appropriate depth of cfDNA could be available for clinical purposes, which can remedy the restrictions of dPCR. Because of the 0.01% error rate of DNA polymerases in the process of amplification, PCR or NGS-based methods that depend on amplification are limited. The newer sequencing technologies such as nanopore sequencing do not require nucleotides, polymerases, or ligases and have the potential of generating very long read-lengths , which might be a more competitive and portable technology for clinical applications , 79.in vitro [Lately, exosomes have greatly attracted researchers\u2019 attention as potential biomarkers of cancer. A study, performed at Kanazawa University on microarray-based profiling of exosomal microRNAs (miRNAs) in sera from patients with primary CRC, healthy controls and cancer cell lines, validated CRC-associated exosomal miRNAs in an independent sample set using quantitative real-time RT-PCR . They foin vitro . To summin vitro . The stuin vitro .TP53 changes the tumor microenvironment and promotes canceration via the endosomal sorting complex required for transport (ESCRT)-dependent exosome secretory machinery [Recently, Yanyu Chen et al. presented a quantitative proteomics analysis of purified exosomes from the serum of patients with CRC and normal volunteers, and identified 918 proteins with an overlap of 725 Gene IDs in the Exocarta proteins list . There wachinery . A comprachinery .KRAS CRC cells can be transferred to wild-type cells to induce cell growth and migration [KRAS regulates the composition of the secreted miRNAs, researchers compared small RNAs of cells and matched exosomes from isogenic CRC cell lines differing only in the KRAS status [KRAS status prominently affects the miRNA profile in cells and their corresponding exosomes, and cellular trafficking of miRNAs is sensitive to neutral sphingomyelinase (nSMase) inhibition in mutant KRAS cells as well as that the transfer of miRNAs between cells can functionally alter gene expression in recipient cells [KRAS mutations, which indicated a widespread effect of mutant KRAS on circRNA abundance [The delivery of exosomes to recipient cells could induce cell migration, inflammation, immune responses, angiogenesis, invasion, pre-metastatic niche formation, and metastasis , 84, 85.igration , 87. To bundance . CircRNAbundance . Exosomebundance .\u2122 Lung (ALK) from Exosome Diagnostics Company has been approved by the FDA in the United States and has become the world's first noninvasive test using exosomal RNA-based liquid biopsy. As one of the promising diagnostic and therapeutic tools for CRC in future, research on the mechanism of exosomes will lay the foundation for a better clinical application.As miRNAs may find applications in molecular therapies for the treatment of CRC , exosomeTumorigenesis is the result of multiple factors implicated in the destruction of balance between oncogenes and anti-oncogenes. With approaches such as that of liquid biopsy, which are rapid, convenient, and minimally invasive, cancers can be detected from body fluid samples repeatedly, bypassing the need of tumor tissue biopsy while allowing clinicians to monitor the response to therapies and recurrence in real-time.Although the early detection strategies and the guidance for decision-making during therapies based on liquid biopsy are promising, there have several drawbacks that need to be overcome before they can be applied clinically: 1) The surge in various detection technologies to identify CTCs, ctDNA, or exosomes, urgently calls for the implementation of standard guidelines, internal quality control (IQC) and external quality assessment (EQA). 2) Researchers need to find universal signatures from CTCs that cover any stage or type of cancer, thereby improving the sensitivity and specificity of the detection methods. 3) Large prospective clinical trials involving multicenter studies are needed to validate the clinical significance for detection and prognosis. 4) Complementary assessment of both CTCs and ctDNA will be more superior for the noninvasive diagnosis and prognosis monitoring of CRC. 5) There is an imposing need to explain the inconsistent results between liquid biopsy results and imaging examinations or tissue biopsies. Thus, liquid biopsies could help clinicians make better treatment-related decisions, provided that the above mentioned hurdles are overcome.Fortunately, investigators have found that platelets might play a role in tumorigenesis and progression. Ratajczak and colleagues demonstrated that microparticles secreted by platelets induce angiogenesis and metastasis in both lung and breast cancer , 17. SomIn summary, owing to its significant benefits, liquid biopsy can be used as a feasible detection method for a variety of solid tumors and clinical diseases. Despite the existence of several challenges, we believe that the development of ideal detection methods is in progress. Our group has designed and conducted the first nationwide EQA of NGS-based targeted sequencing by laboratories in China in 2015 . In addi"}
+{"text": "Antimicrobial resistance is a public health challenge supplemented by inappropriate prescribing, especially for an upper respiratory tract infection in primary care. Patient/carer expectations have been identified as one of the main drivers for inappropriate antibiotics prescribing by primary care physicians. The aim of this study was to understand who is more likely to expect an antibiotic for an upper respiratory tract infection from their doctor and the reasons underlying it.n\u2009=\u20091509) and four focus groups. The outcome of interest was expectation and demand for an antibiotic from a doctor when presenting with a cold or flu.This study used a sequential mixed methods approach: a nationally representative cross sectional survey  contains supplementary material, which is available to authorized users. Antibiotic resistance is a serious and growing problem, caused in part through overuse and misuse of antibiotics . There iStudies suggest prescribers are influenced by a desire to maintain or establish positive relationships with patients, and prescribe according to their perceptions of patient expectations , 13. PatLow education levels, age, low socioeconomic status and ethnicity was found to be associated with variations in knowledge, attitudes and behaviours regarding antibiotic use , 13, 14.Several studies indicated that a high proportion of patients (ranging from 33.5 to 53.1\u00a0%) expected an antibiotic prescription for a URTI , 15. ExpIn Australia, NPS MedicineWise plays a role in developing health education and campaigns for health professionals and consumers. In 2012, NPS MedicineWise implemented a five-year program to encourage prudent use of antibiotics in the community. Continuous evaluation of this program shows that although there is a high overall knowledge of antibiotic resistance, inappropriate prescribing remains high. There is a need to understand the factors and circumstances that influence patient expectations and demands in the Australian context to develop future public health campaigns. The aim of this study was to understand who expects an antibiotic for an URTI from their doctor and the reasons underlying it.We used a sequential mixed methods approach to understand the characteristics of patients who expect antibiotics for an URTI and the underlying reasons for this expectation. The preliminary phase used a cross sectional survey to estimate the proportion and the characteristics of the population that expect an antibiotic from their doctor for an URTI. The second phase employed focus groups with a purposefully selected sample in an effort to further explore common themes related to expectations for an antibiotics and socio-cultural norms as well as possible communication messages. The use of a mixed methods approach strengthened the validation of the study.The NPS MedicineWise National Consumer Survey is an annual cross-sectional survey conducted with a random sample from the Australian population to assess general public knowledge and awareness of a range of quality use of medicines and medical tests issues. For this study, the results from the survey conducted between April and May 2014 were used. The survey was conducted using an online panel. Invitation emails were sent to a selection on the external panel with a link to the online survey. This process was repeated over five batches until sample size was reached. A random sample of 1,509 Australian consumers aged 16+ years were selected proportionate to geographic location. Quotas were used to ensure representative distribution across geographic locations, gender and age categories.The survey consisted of 22 questions about health and medicines. Respondents were asked questions about demographics and medicines they take, and then were asked several questions about their knowledge, beliefs and expectations for an antibiotic. The outcome of interest was self-reported expectation for an antibiotic from a doctor if presenting with a cold or flu. The survey questions are available in Additional file Four semi-structured focus group interviews were conducted in August 2014. Focus groups were conducted with groups that were more likely to ask for antibiotics in the quantitative survey results and those identified by general practitioners as more \u2018demanding patients\u2019 in a previous study. The discussion guide is available in Additional file The response rate for the survey was 22\u00a0%. Table\u00a0n\u2009=\u20091057), agreed that antibiotics kill bacteria. However, 33\u00a0% (n\u2009=\u2009497) also agreed that antibiotics kill viruses  correctly identified antibiotics as effective against bacteria and not viral infections.Most respondents, 70\u00a0% n\u2009=\u2009057, agren\u2009=\u20091053) reported having heard of the term antibiotic resistance, whilst 10.2\u00a0% were unsure (n\u2009=\u2009154). Age and educational level were associated with having heard of antibiotic resistance (p\u2009<\u20090.001). A higher proportion  correctly agreed or strongly agreed with the statement \u2018Bacteria can become resistant to antibiotics\u2019 .Overall 69.8\u00a0% of respondents n\u2009=\u2009053 reporn\u2009=\u20091112) were aware that taking antibiotics when they don\u2019t need them means that they are less likely to work in the future  agreed that they have to take a full course of antibiotics or they may not work in the future, and the proportion agreeing increased with age.Among respondents 73.7\u00a0% n\u2009=\u2009112 were n\u2009=\u2009284) of respondents reported that they expect their doctor to prescribe antibiotics if they have a cold or flu, with the most significant predictors including speaking a language other than English at home (p\u2009<\u20090.002) and younger age groups (p\u2009<\u20090.028). Of these patients, not all voiced their expectation for a prescription to their doctor. Overall only 16.9\u00a0% (n\u2009=\u2009254) of respondents say they would directly ask their doctor for antibiotics when they have a flu or cold. However the proportion is higher among those that speak a language other than English at home (p\u2009<\u20090.01). The proportion of respondents who would directly ask their doctor for antibiotics is positively associated with educational level (p\u2009<\u20090.048) and age. In terms of knowledge, people who knew antibiotics didn\u2019t kill viruses and agreed that taking an antibiotic when one is not needed means they won\u2019t work in the future were also less likely to expect or demand antibiotics .Only 19.5\u00a0% The low socioeconomic group showed a low level of understanding of how antibiotics work for what conditions, and the difference between viral and bacterial induced illnesses. No one in the group knew what antibiotic resistance was but they all had heard of the term before the focus group. This group believed that antibiotics in general are more efficacious and cheaper compared to over the counter cold and flu medication and they did not understand why they would not ask for antibiotics if they were ill. Furthermore, they expressed that if the doctor withheld antibiotics, it was not because of medical reasons but rather that the doctors disliked antibiotics or wanted to save the government money.\u201cAntibiotics, Love it. Shame, you have to go to a doctor to get prescribed them, you can\u2019t just go to the pharmacist. Because it kills things very quickly. When you see them go green then you know they need antibiotics. Because you know they have an infection. I run to the doctor because I know they need antibiotics and that is what will treat them. In 2\u00a0days they will be fine.\u201d \u201cMy mother, she\u2019ll wake up, and if she feels sick she takes antibiotics. She is always at the pharmacy, and has a whole cupboard full. She will take it when there is nothing seriously wrong with her, as in no temperature. And she gives me a hard time when I don\u2019t give my kids antibiotics.\u201d The Arabic speaking group also showed a low understanding of antibiotics and thought antibiotics were for general illnesses. There was also a low level of understanding of antibiotic resistance in that the group, who also strongly believed that the body becomes resistant and there will always be other stronger antibiotics for them to switch to later if they developed resistance.\u201cThey (antibiotics) kill the germs and make you feel better. They give you your strength back a lot quicker. You\u2019re not sick for too long. It cuts the length of the germ that\u2019s in your body so you are re-gaining your health a lot quicker. You are feeling a lot better about yourself and you\u2019re not taking too much time off work. If the kids aren\u2019t sick they aren\u2019t missing out on school and they aren\u2019t having to catch up. There are a lot of benefits to it \u2026\u201d \u201cIf you take it too often then you become resistant to it and there\u2019s always that thought in my mind that I might really need it one day. You kind of do need to power on and so that\u2019s in the back of my mind.\u201d All the participants in the mothers with young children group knew that antibiotics killed bacteria only and had some understanding of antibiotic resistance. However, they expected, and at times demanded, antibiotics for their children, especially if their child had a similar illness previously or the child was sick for longer than expected. There was also a common belief in this group that an antibiotic prescription would prevent the other children falling ill and will shorten the duration of the child\u2019s illness.\u201cThe last time was a year ago, I had a really, really bad throat infection. I went to see a doctor to check it\u2019s a throat infection and she said yes. This is a doctor that tends not to prescribe antibiotics. You talk about it all with your friends and the general belief is that antibiotics would kill the bad bacteria but it might also take away your good bacteria as well but at the same time you need to fix the problem. A colleague of mine would say while taking antibiotics it\u2019s good to take other stuff like yoghurt and for her it works but for other people it may not work. So I had a very bad throat infection and I had a temperature and so I went to see the same doctor and she said my throat was bad. It could be bacterial but it could be viral, she said if it is causing you discomfort you may\u2019s well take it because there is a 50\u00a0% chance that you could get fixed which she prescribed to me and I took it and it was only a weak one and it did work. It got rid of my throat infection and it did work and of course it could work on others but you eat nutritious food, pick up information about yoghurt and stuff like that. For me it did work, there are times when I\u2019m sure I need antibiotics but I\u2019d rather be cautious and go without it.\u201d All the participants in the Chinese speaking group knew that antibiotics killed bacteria only and had a reasonable understanding of antibiotic resistance. They expected antibiotics if they had a serious illness or there was a chance of a bacterial infection. For this group, the belief that their illness is serious and they have a chance of developing an additional infection were their main reasons for expecting an antibiotic.\u201cIf you go to a doctor you want to walk away with something. It\u2019s not just advice and to go home and rest. I don\u2019t have to see the doctor to do that.\u201d Some doctors push antibiotics all the time, some refuse to give it. I don\u2019t really understand the reasons. They always say it\u2019s viral. It frustrates me I have to tell my GP I\u2019ve waited for an hour to see him and I don\u2019t want to have to come back again in a few days and wait again! I really need a script for myself or my kids. They will give me a script anyway, and sometimes say don\u2019t fill it unless you get worse. To be honest, I fill it straight away. Why take the risk of getting worse? I want myself or my kids to get well quickly!\u201d \u201cA script for antibiotics was considered a necessary tangible benefit to compensate for the time and effort invested to visit the doctor and waiting in the waiting area. This was one of the reasons patients demanded antibiotics as it meant the patient could avoid the inconvenience of visiting the doctor again if their condition deteriorated. This theme was common across the four groups.We found in all four groups communication gaps between GPs\u2019 advice and participants\u2019 understanding. This was evident mainly in two areas: the viral nature of their condition and delayed prescribing.\u201cThe GP doesn\u2019t know what illness I have, I have to insist on antibiotics.\u201d hen the GP doesn\u2019t know what is wrong with me or my child they just say \u2018it\u2019s viral\u2019.\u201d \u2018WConsumers were confused about what symptoms required antibiotics and what a viral condition was. Most participants reported that they couldn\u2019t understand why their doctor wouldn\u2019t prescribe them antibiotics and suggested that their condition was viral. There was also skepticism among the participants that because the doctor wasn\u2019t able to diagnose them appropriately; hence the diagnosis with a viral condition.There was further confusion among the groups regarding delayed prescribing around the reason for the delay or waiting period. All reported that they filled the prescription straight away and couldn\u2019t understand the logic behind the request to delay.\u201cNo I fill the script straight away because I have always had trouble with my throat.\u201d \u201cTo be honest, I go straight to the chemist. I don\u2019t listen to him because I want to get out of the terrible sickness. I get the antibiotics cause I know it helps me.\u201d Examples of responses given when GPs tell them not to fill the prescription until they\u2019re worse or in a few days:\u201cI was thinking of the person over-using and not the community. It\u2019s more like drugs. That person over used (it) and so he is going to get the problem (antibiotic resistance), it\u2019s not everyone else is going to get the problem.\u201d \u201cIn future, if (antibiotics) doesn\u2019t help anymore. You need to take a stronger pill. But that\u2019s in the future; you have to focus on this point in time.\u201d \u201cI know about it (antibiotic resistance) but antibiotics work for me. Is there an alternative for antibiotics? But as long as there is no other option and it works for me, I\u2019m going to keep taking it.\u201d \u201cIf it\u2019s (antibiotic resistance) true I wonder if it\u2019s worldwide or Australia wide. I think it would be worldwide. But in third world country they don\u2019t have antibiotics so they would have basic bugs but they would be stronger too.\u201d All the participants mentioned side effects as a consequence of taking antibiotics but this didn\u2019t deter them. No one mentioned antibiotic resistance until prompted and didn\u2019t realise that they personally could contribute or be affected by the issue. They perceived that personally they and their families had a low or negligible risk from antibiotic resistance. The issue of antibiotic resistance was an issue for future generations or an issue in developing countries and they themselves or their families would never be affected by its consequences.This sequential mixed methods approach combines survey and focus group data to understand the characteristics of patients who expect antibiotics for an URTI and the reasons underlying their expectation. Despite good levels of knowledge with regards to the effect of antibiotics and the risks of developing antibiotic resistance, we found 19.5\u00a0% of surveyed consumers reported that they would still expect the doctor to prescribe antibiotics for a cold or flu and 16.9\u00a0% would ask a doctor to prescribe antibiotics. The reason for this remains unclear and requires further study, but anecdotal evidence suggests that this may be associated with a long standing culture of not leaving the doctor empty handed.The survey results indicated that people under 65\u00a0years of age, never attended university/technical college and who speak a language other than English at home were more likely to expect or demand antibiotics for a cold; although this was lower than in other studies. This could be due to the significant underrepresentation of CALD groups in our survey sample and the slight over representation of respondents who had attended university or technical college. However, this would be an issue affecting other surveys as well.Three of the four groups had a clear expectation of receiving antibiotics for a cold or flu if presenting to a doctor. The main reasons given for this expectation is antibiotics help them feel better, prevention of potential deterioration of illness, previous successful experience and investment of time and money to consult a doctor. This is in keeping with other studies that found patients/carers lack an accurate understanding of the nature of antibiotics and the development of antibiotic resistance , 15\u201317. There was evidence of misconceptions among patients about what doctors mean. Most respondents felt that if the GP said that their illness was viral it indicated that the doctor didn\u2019t know what was wrong with them and or didn\u2019t want to give them a prescription. One study found that some expectations are shaped by their experience of widespread availability of antibiotics in their home country and that they hold substantial misconceptions about antibiotics use .Misconceptions concerning delayed prescribing and the need to wait before using the prescription were reported in this study and have been described elsewhere  AdvocateRespondents\u2019 misconception that the human body can become resistant to antibiotics has been reported in other studies , 16. ThiThe study has several limitations. The consumer survey was based on an online panel and therefore is limited to participants on the panel population. However, sampling methods ensured the participants were representative of the general population. Another potential limitation of the study is that the number of respondents rating their experienced state of health as excellent is lower than the general population. This can indicate that the respondents are more frequently exposed to the health care system and therefore more frequently in need of antibiotics. The response rate was only 22\u00a0%, but this is considered typical for online population surveys in Australia . The selTo our knowledge, this is currently the largest Australian study exploring consumers\u2019 knowledge and expectations for antibiotics when presenting with an URTI. This study has identified several key motivations for why patients expect antibiotics and their lack of understanding of personal consequences of antibiotic resistance that have not been addressed by recent public health campaigns. Several misconceptions amongst patients and their understanding of why GPs do or do not prescribe antibiotics indicate an urgent need to bridge the communication gap.Primary care physicians will need to be trained to develop better communication strategies for dealing with patients. There is an urgent need for the core message of future public health campaigns to be focused on the personal consequences of taking antibiotics inappropriately and the implications of antibiotic resistance for the general public. Key messages should focus on the immediate and dire repercussions of antibiotic resistance for individuals and their families in the short term."}
+{"text": "In recent decades, the Kingdom of Saudi Arabia has seen an exponentially growing antibiotic resistance, which is exacerbated by the use of antibiotics without a prescription and other various factors. However, no published data are available on factors influencing non-prescription use of antibiotics among the general public in Saudi Arabia using an in-depth interview technique.Semi-structured interviews were carried out with 40 Saudi participants from the Eastern Province of Saudi Arabia, selected via snowball sampling technique. Participants were enrolled based on the following inclusion criteria: 18\u00a0years of age or older and had self-medicated themselves with antibiotics in the past two years. Data collection was continued until data saturation was attained. Interviews were audiotaped, transcribed verbatim and analysed using NVivo 10 software.Participants  had a mean (SD) age of 30\u00a0years (10.2). Self-medication with antibiotics was associated with various inappropriate antibiotic use behaviours and negative outcomes such as antibiotic resistance, treatment failures and adverse events. Interviews revealed that different reasons contribute to the rise of self-medication with antibiotics, ranging from difficulty accessing healthcare services, participant\u2019s cultural beliefs and practices, lack of knowledge about antibiotics and antibiotic resistance, and weak regulatory enforcement.The findings of the present study will aid in generating data that may provide an insight when designing future interventions to promote public health awareness regarding safe and effective use of antibiotics.The online version of this article (10.1186/s12889-018-6088-z) contains supplementary material, which is available to authorized users. Although antibiotics represent one of the major improvements in public health, their misuse and overuse, as a result of self-medication and irrational prescribing and dispensing, may lead to an increased risk of antibiotic resistance \u20133. Self-Inappropriate self-medication practices with antibiotics may include insufficient dosage and/or frequency, the antibiotic spectrum being either too narrow or too broad, delayed antibiotic therapy in critical patients, unnecessary use of antibiotic for the wrong ailments, and receiving antibiotics from different sources such as patient\u2019s stock, friends and family, without a medical consultation. Patients/consumers may mistakenly make self-diagnosis, with consequences such as failure to recognise symptoms that may be an indication for another disease, and failure to treat the disease effectively. In addition, when a bacterial infection is not presented, patients can expose themselves to the risks associated with antibiotics. Inappropriate utilisation of antibiotics can also lead to increased healthcare costs, poor health outcomes and increased risk of antibiotic resistance, adverse drug reactions and contraindications , 8.Although self-medication with antibiotics (SMA) is common in developing countries, with an overall prevalence of 38.8% (95% CI: 29.5\u201348.1)  and in two days you will be fine.\u201d [P5].\u201cAugmentin can be used for everything.\u201d [P8].Another participant assumed that the power of antibiotics could deal with all her health problems:\u201cI take Augmentin with me when I travel just in case me or my family get sick [laughs].\u201d [P11].This belief led some participants to take antibiotics with them when travelling abroad \u201cjust in case\u201d they or their family get sick:\u201cIt\u2019s a 100% immunity booster and can provide quick relief.\u201d [P25].For one participant, it was particularly interesting to find that he completely believed that antibiotics increase a person\u2019s immunity and are effective in providing immediate relief:\u201cWhen I travel, [in case] I get sick, especially in countries that do not allow people to buy antibiotics without a prescription, I bring along with me from home an antibiotic which has a short-course duration to help me recover quickly.\u201d [P12].Another participant said that she always considered packing a short course of antibiotics in order to treat or prevent any possible infection that could ruin her holiday, especially when visiting countries that do not allow travellers to buy antibiotics without a prescription:\u201cWhen I encounter an infection which requires an antibiotic during the holy month of Ramadan, I use Azithromycin [as] this will help me to recover quickly and continue my fasting.\u201d [P12].Having a strong belief in the curative power of antibiotics had led one participant to use a short course of antibiotics during the holy month of Ramadan when she became ill, since this approach enabled her to recover quickly without the need to break her fasting:\u201cI got flu while travelling and I bought some Augmentin. I used it for 10 \u2013 14 days without benefit because it was manufactured in the United Arab Emirates and it was not original [it was generic]. When I came back to my country, I went to buy original Augmentin from the pharmacy.\u201d [P1].An interesting cultural belief which emerged related to certain brands of antibiotics having a better quality and more curative power than others. For example, some participants believed that Western brands of antibiotics were somehow more effective at relieving symptoms than the local alternatives, which in the end led to inappropriate use of antibiotics:People wanting to store antibiotics at home for later use and sharing them with family members were common practices among study participants. Sharing of antibiotics allowed people to demonstrate care for one another and tackle the issue of sickness as a unit. It also allowed them to bypass accessing healthcare services in an effort to obtain treatment for common problems. Participants indicated that they shared antibiotics usually with close family members and less usually with neighbours, friends and work colleagues. Participants seemed to recognise that buying antibiotics without a medical consultation was against Saudi law, but, because the behaviour was consistent with Saudi culture, they did not seem troubled by this. Two participants made the following observations in relation to this:\u201cI had flu and the doctor gave me an antibiotic and it worked for me. Then, I went back and recommended it to my family. It is not only me, even my mother tried an antibiotic two years ago and she found it useful, and then she advised the whole family to use it.\u201d [P36].\u201cNo need to see a doctor over a minor thing that I experienced before. Well, I can\u2019t remember exactly what the antibiotic is but my whole family use it and [it] is always available at home; its\u2019 a big box with white and purple colours [Augmentin].\u201d [P24].The third sub-theme to emerge was related to participants\u2019 previous success with antibiotics. When they experienced symptoms that they had experienced before, they sought the treatment that had been successful previously. The participants reported that they had usually sought medical advice from a healthcare provider, often a doctor, for the first episode of a specific illness. If they had a subsequent episode with a similar symptom complex, they felt comfortable with a self-diagnosis. Therefore, because they are relying on previous experience with similar symptoms to identify the condition, diagnosis and treatment, self-medication seems appropriate, a behaviour which may have substantial public health implications. This is illustrated in the following scenarios:\u201cI used to go to the doctor but later I treat myself by my own experience. Let\u2019s say that I went to a doctor once and he gave me an antibiotic and I found it effective, I use it again if needed. No need to go to the doctor again.\u201d [P3].\u201cIt is pink but I don\u2019t remember the name. The doctor a long time ago gave it to me and I started to buy it from the pharmacy whenever I have a sore throat.\u201d [P23].\u201cI remember that I bought Augmentin over the counter and [it] caused an allergy for my son and I stopped it immediately.\u201d [P5].\u201cOnce, I used an antibiotic and I had a fast heart rate after taking it. Well, I [was] supposed to take it for seven days but I used it only for five days.\u201d [P2].Such practice has led to the development of intolerable side effects and allergies among some of the study participants, which they reacted to and dealt with in different ways \u2013 by early discontinuation of antibiotics before completing the course or by modifying the way they took their antibiotics. These reactions were always self-guided:\u201cIf I used the antibiotics without a prescription and it is written that you should take three tablets, I used to take two tablets to be on the safe side and avoid the side effects.\u201d [P16].Fear of side effects had led some of the participants to deliberately take less of their antibiotics without consulting a doctor, in order to avoid these adverse effects. One participant declared:\u201cOnce I took a topical antibiotic for my skin infection; I used it all the time. I thought that because it is topical would have [fewer] side effects than oral. So, it would be OK if I used it as much as I wanted.\u201d [P13].Another two participants reported that they tend to use topical antibiotics to avoid side effects because they believed that applying antibiotics to the skin does not cause as many side effects as swallowing antibiotics that circulate through the body. One participant stated:\u201cOnce I feel better, I stop the antibiotic although the person has to take the whole course.\u201d [P8].Stopping antibiotics when feeling better or as soon as symptoms disappeared was also a common practice among some study participants in order to avoid side effects. One participant said:\u201cAntibiotics are medicines that are used to treat different infections. Some are used to treat influenza and other are used to treat infections, etc.\u201d [P21].Based on the knowledge part of the questionnaire (i.e. section number 2) that assesses knowledge about antibiotics and antibiotic resistance, 60% (24/40) of participants reported sub-optimal knowledge (i.e. where intermediate and poor knowledge were combined) of antibiotics. More than half of the participants  had misconceptions about antibiotics as they believed that they are effective in treating viral infections. One participant voiced:\u201cI sometimes don\u2019t take the full treatment course; for example, if the treatment is for five days, I take the antibiotic for three days and then I stop it once I feel better.\u201d [P21].A majority of participants  held misconceptions that antibiotics can be purchased and taken without a doctor\u2019s prescription. Thirty-eight percent (15/40) of participants incorrectly believed that it is safe to switch between antibiotics during the course of a single infectious disease. Fifty-five percent of participants (22/40) did not know that they should not stop taking a course of antibiotics as soon as they feel better. One participant declared:One-third (12/40) of participants thought that it is fine to take a missed antibiotic dose with the next dose. Others  incorrectly believed that taking many types of antibiotics at the same time during the course of a single illness will result in quick recovery. Forty percent of participants (16/40) held the misconception that antibiotics are the same as anti-inflammatories.\u201cWe should not repeat using the same antibiotic again if we experience another [case of] flu, because our body will get used to it, so we have to change it.\u201d [P22].Many participants  were not very sure about what antibiotic resistance is, nor its causes or consequences, when they were asked what they know about antibiotic resistance. Some  thought that over-use of antibiotics might be the cause of antibiotic resistance and reduction of their future effectiveness. Others  believed that bacterial resistance would be increased when using antibiotics not according to the doctor\u2019s advice. One participant mistakenly believed that using the same antibiotic again for flu symptoms would increase antibiotic resistance:\u201cI know that, if you do not take [an] antibiotic as instructed, you might develop antibiotic resistance. So, what you have to do is either you change [the] antibiotic to another one or you reduce the strength of [the] antibiotic, say from 500 to 250 mg.\u201d [P37].Another participant thought that changing from one antibiotic to another or reducing the strength of an antibiotic will help in reducing antibiotic resistance:Long waiting time for consultation and difficulty getting appointments were barriers weighted against the benefits of visiting a doctor for these seemingly uncomplicated and common infections. The participants reported that they would consult a physician in case of emergency situations or critical conditions. Some participants noted that they called family members who were healthcare professionals to provide an expert opinion when they had concerns about the accuracy of their self-diagnosis. This was still seen as a less-time consuming and easier approach than consulting a physician, as outlined in the following quotes:\u201cWhen you go to the government hospitals, you need a long time to see a doctor, either waiting during or waiting for the appointment. Sometimes, [it takes] one or two months to see a doctor.\u201d [P3].\u201cMy father is a pharmacist so, when I have an infection, I do consult my father. It is faster and less time consuming than seeing a doctor.\u201d [P1].Some participants perceived their doctors to take full charge during the consultation process, making the ultimate decision about therapy without explaining the process or considering the views/preferences of the patient, which led them to self-medicate. This is illustrated in the following scenario:\u201cThe doctor doesn\u2019t say much; he would only prescribe the medicine and that\u2019s it! He does not look at my medical file. Even when I try to discuss something with him, he just doesn\u2019t care or pay attention. So, my family and I decided to go directly to the pharmacy and get what we need from there.\u201d [P13].Some women reported that they could not access healthcare services easily to consult a doctor due to transportation issues because, until recently, women in Saudi were not allowed to drive. One participant reported that she usually depends on her husband to bring a certain antibiotic for her:\u201cI cannot remember the name of the antibiotic, but we always use it. My husband usually brings it for me since he has the experience and he has the car as well [laughs]. I just tell him to bring the antibiotic from the pharmacy and he brings it for me.\u201d [P6].\u201cSince I live in Qatif and the hospital is in Khobar and I don\u2019t have transportation, I usually buy the antibiotic from the pharmacy that is beside my home.\u201d [P9].Another participant said that she used to buy antibiotics from the pharmacy since the hospital is far away from her home and she might not always have proper transportation to go there:Some participants indicated that, since antibiotics are available and easily accessible in the pharmacies, people will buy them directly from there without consulting a doctor, because the enforcement of regulations is weak and antibiotics are often sold without a prescription:\u201cSince it is readily available in pharmacies and once you request it, you receive it just like in a grocery store, I will buy it from the pharmacy or I will just send my driver to bring it.\u201d [P19].\u201cThey are available everywhere and you can get them easily. The law is not strictly enforced to prevent [the] selling [of] antibiotics without prescriptions.\u201d [P23].\u201cI said, \u2018If I\u2019m feeling OK, why do I have to get an antibiotic from the pharmacy?\u2019 He said, \u2018Why not? You have insurance; you can keep the antibiotic with you just in case you need it for later use.\u2019 I was really surprised when he said this.\u201d [P28].For one participant, it was particularly interesting to find that a pharmacist encouraged her to get an antibiotic from his pharmacy without prescription, despite the fact that she did not need it, just because she has insurance \u2013 as illustrated in the following quote:Some participants declared that one of the reasons influencing people to self-medicate with antibiotics is low economic status and lack of health insurance, which might be contributing further to the difficulty in accessing the healthcare system. They explained that people lacking health insurance or those who have a low income tend to buy antibiotics directly from community pharmacies to avoid the trouble and costs of visiting a doctor, although this might be a burden on their budgets. They observed that the cost of a hospital visit is more expensive than that of an antibiotic, although the antibiotics are not cheap:\u201cI\u2019m not going to go to the physician, if I already know my symptoms and what medicine heals me. If I go, they will charge me just for the consultation, and then I have to buy the prescription and that\u2019s another cost with more money. It is easier and cheaper to go and buy an antibiotic straightway, if I know what medication I\u2019m going to take and will work for me.\u201d [P12].\u201cI think, nowadays, most people go to self-medication either because they don\u2019t have health insurance, and they have to pay money sometimes that they cannot afford, and sometimes it is a burden on their budget and so they self-medicate.\u201d [P3].Another reason which reflects a cultural norm and contributes to self-medication with antibiotics is the stigma of getting an infection upon going to hospital, making people less likely to access the healthcare system. This was mentioned by one of the participants who believed that a person might develop a more severe infection when going to a hospital, which enhances her tendency to self-medicate with antibiotics:\u201cOnce [upon] a time, there was a period when you got an infection such as corona etc. upon going to the hospital, which enhances my desire to avoid visiting a doctor and getting an avoidable infection.\u201d [P7].This article presents the first study exploring a wide range of factors influencing self-medication practice, and providing a more inclusive picture of such practices and the circumstances in which they arise, providing novel evidence that SMA among this particular population is problematic in Saudi Arabia. Only four other studies have addressed the problem of SMA in Saudi Arabia \u201318; howeIn this study, the frequency of SMA among participants was high and it was associated with various inappropriate antibiotic use behaviours such as altering or stopping antibiotic-taking, either when feeling better (to relieve the body) or when feeling worse . This shows that customers are not passive recipients of care. Rather, they sometimes develop their own way of taking their antibiotics based on their circumstances or what makes sense to them. Thus, assessing participants\u2019 beliefs, fears and expectations and exploring their practices regarding antibiotic use are necessary to prevent irrational use of antibiotics.An exploration of factors influencing self-medication behaviour among study participants revealed many similarities with evidence from the Middle Eastern literature , althougIn terms of reasons for SMA specific to this particular population, the current study identified some beliefs and practices about antibiotic use that have not been adequately described in the literature to date, such as beliefs participants held about Western brands of antibiotics and topical antibiotics, taking antibiotics while travelling abroad or being away from home for \u2018just in case\u2019 purposes, and using a short course of antibiotics during the holy month of Ramadan or while travelling abroad to enable quick recovery. In addition to these beliefs and practices, the stigma of getting an infection upon going to hospital to consult a doctor, and perceptions about healthcare providers and healthcare system, such as paternalism and ignoring the patient\u2019s perspective during medical consultations, issues relating to the organisation of the healthcare system and the impact of this on access to healthcare services or antibiotic supply appeared to be findings specific to the Saudi population. If not addressed, these factors may lead to unanticipated adverse events, complications of incorrect use or misuse, delay in seeking professional help and antibiotic resistance. By uncovering factors influencing self-medication behaviour, the study can provide insight when designing future interventions to promote safe, rational and effective use of antibiotics.Strengthening the role of pharmacists from traditional drug dispenser to more effective healthcare provider is required to improve the rational use of antibiotics. Pharmacists are the key healthcare providers with the training, skills and knowledge associated with the profession required to minimise self-medication behaviours. Thus, it is vital to recognise and use their potential. Pharmacists in many European countries already have the ability to take on additional responsibilities and roles to promote the rational use of antibiotics. For example, many new forms of rapid diagnostics/point-of-care testing (PoCT) are being developed that will give simple-to-use and inexpensive approaches of deoxyribonucleic acid/ribonucleic acid (DNA/RNA)-based recognition of potentially multiple pathogens from a single sample . These nThis study provided evidence that 60% of participants had insufficient knowledge about antibiotics. There was also no or little recognition of the impact of SMA on antibiotic resistance. The insufficient knowledge about antibiotics could be translated into various inappropriate antibiotic use practices and negative outcomes such as antibiotic resistance, treatment failures and toxicity. Studies from the Middle Eastern literature have reported similar knowledge deficits among Middle Eastern populations . The insSince patients frequently visit pharmacies to obtain antibiotics for self-medication, pharmacists are well placed to improve rational use of antibiotics among pharmacy customers. The community pharmacists should take an active role in different public-health initiatives relating, for instance, to the restriction of irrational dispensing of antibiotics and enhancing public awareness of the importance of stopping self-medication without correct diagnosis and of the rising issue of antibiotic resistance infection in the society , 24. WitSince antibiotics in Middle Eastern countries can be obtained without prescription, research on effective strategies to limit unnecessary antibiotic use should target doctors\u2019, pharmacists\u2019 and patients\u2019 knowledge and behaviours. Thus, addressing the knowledge gap and implementing multifaceted behaviour change interventions are likely to be effective. Malta, for example, has introduced a European Antibiotic Awareness Day  in an atThe key to successful strategies for managing antibiotic resistance is to promote behaviour modification besides providing relevant information on proper antibiotic use . BehavioPre-contemplation: where an individual is unaware that his/her current behaviour (e.g. SMA) constitutes a problem and thus has no intention of changing it.Contemplation: the individual is thinking about changing the risky behaviour but is not yet committed.Preparation: the individual has an intention to change the behaviour and is starting to make plans about how to change it.Action: the individual is actually attempting to change the behaviour.Maintenance: the individual is six months abstinent from the risky behaviour and is attempting to prevent relapse.A well-studied model that can be used to explain or predict behaviour change is the Transtheoretical Model (TTM) . A wide After classifying a patient into one of these stages, the pharmacist can develop appropriate interventions to assist the patient in moving towards the next stage. Individuals may cycle through the stages several times before achieving long-term behaviour change. Rewards, reminders and monitoring techniques may be needed for individuals in later stages of behaviour change, but, for patients in earlier stages, discussion of available OTC alternatives and consciousness raising that focuses on the disadvantages of SMA and advantages of stopping this \u2018habit\u2019 are needed. However, the application of TTM to influence self-medication practice among the general public is limited, and its efficacy within this context remains unclear. When applied correctly, TTM may provide the necessary approach to promote sustained behaviour change among targeted populations.This study also detected the important role of patients\u2019 families in their infection management in general and in antibiotic-taking in particular. Families were frequently quoted as an important source of support, providing advice and supply of antibiotics to participants. In line with published studies in Kuwaiti culture , Saudi pLaw enforcement and stricter governmental policy regarding the sale of antibiotics without prescription in retail pharmacies and irrational antibiotic usage are also needed. In Chile, for example, after drawing up prescription-only regulations, consumption of oral antibiotics in the community pharmacies remarkably decreased . In SaudRobust antimicrobial use surveillance systems are essential to combat antibiotic resistance. In most European countries, there is a long tradition of monitoring the use of medicines but this should also be implemented in Middle Eastern countries. Antimicrobial stewardship courses in the pharmaceutical and medical postgraduate and undergraduate curricula are also required. The information provided in these courses should stress the importance of the roles of the pharmaceutical and medical professions in fostering the rational use of antibiotics.Strengths: (1) this article has presented the first study exploring a wide range of factors affecting self-medication practice, and providing a more comprehensive picture of such practices and the circumstance in which they arise. Limitations: (1) the sample of this research comprised Saudi participants living in the Eastern Province of Saudi Arabia; therefore, results may not be transferrable to the whole country, or to non-Saudis; (2) this study only involved the general public or community members and did not include other suppliers of antibiotics, such as pharmacists and doctors; (3) some participants were a little anxious about being recorded. This was apparent with a few participants who were anxious about the digital recorder for cultural reasons as they were not sure who would be listening to their voice. However, the researcher reassured them that she was the only one who would listen to the recording, and explained to them that data would be anonymous and confidential, and that it would be destroyed upon completion of the study. Once participants realised this, they were happy for the interview to be recorded. It is worth noting that, for future research purposes, careful attention must be paid to this issue as some patients may find it intimidating to be recorded and may not feel free to provide their honest views in such circumstances.Further studies are needed to design, implement and then evaluate culturally sensitive and effective interventions that are tailored to the target audience in whom behaviour change is required in order to decrease antibiotic self-medication practices. Currently, there are no published results of interventions to prevent this practice, which has important implications for public health and the development of antibiotic resistance . This caThe study indicates that SMA is common practice in Saudi Arabia. By uncovering factors influencing self-medication behaviour among the public, the study can provide insight when developing future interventions to improve prudent, safe and effective use of antibiotics.Additional file 1:Interview schedule or interview guide. (DOCX 63 kb)"}
+{"text": "Cre-mediated genetic lineage tracing in nr2f1a; nr2f2 double mutants reveals that tcf21+ progenitor cells, which can give rise to ventricular CMs and PM, more frequently become ventricular CMs potentially at the expense of posterior PMs in nr2f1a; nr2f2 mutants. Our studies reveal insights into the molecular etiology that may underlie developmental syndromes that share heart, neck and facial defects as well as the phenotypic variability of congenital heart defects associated with NR2F mutations in humans.Multiple syndromes share congenital heart and craniofacial muscle defects, indicating there is an intimate relationship between the adjacent cardiac and pharyngeal muscle (PM) progenitor fields. However, mechanisms that direct antagonistic lineage decisions of the cardiac and PM progenitors within the anterior mesoderm of vertebrates are not understood. Here, we identify that retinoic acid (RA) signaling directly promotes the expression of the transcription factor Nr2f1a within the anterior lateral plate mesoderm. Using zebrafish  NR2F2 are associated with variable types of congenital heart defects in humans. Our recent work demonstrates that zebrafish Nr2f1a is the functional equivalent to Nr2f2 in mammals and promotes atrial development. Here, we identify that zebrafish nr2f1a and nr2f2 have redundant requirements at earlier stages of development than nr2f1a alone to restrict the number of ventricular CMs in the heart and promote posterior pharyngeal muscle development. Therefore, we have identified an antagonistic mechanism that is necessary to generate the proper number of cardiac and pharyngeal muscle progenitors in vertebrates. These studies provide evidence to help explain the variability of congenital heart defects from NR2F2 mutations in humans and a novel molecular framework for understanding developmental syndromes with heart and craniofacial defects.Many developmental syndromes include both congenital heart and craniofacial defects, necessitating a better understanding of the mechanisms underlying the correlation of these defects. During early vertebrate development, cardiac and pharyngeal muscle cells originate from adjacent, partially overlapping progenitor fields within the anterior mesoderm. However, signals that allocate the cells from the adjacent cardiac and pharyngeal muscle progenitor fields are not understood. Mutations in the gene  In vectively , 7, whicectively , 10. Howectively . Thus, tTBX1 underlies DiGeorge Syndrome, which is characterized by congenital outflow tract and craniofacial defects [Tbx1, loss of Tcf21 in mice results in less severe outflow tract and PM defects [Musculin/MyoR [tbx1 mutants have outflow tract and craniofacial defects [tcf21+ progenitors contribute to both ventricular cardiomyocytes (CMs) and PMs [tcf21 in zebrafish is required for the development of almost all PMs [Given the proximity of the cardiac and PM progenitor fields within the anterior mesoderm of vertebrates, there is significant overlap in the expression of conserved regulators of these lineages. The transcription factors Tbx1 and Tcf21, in particular, share expression in cardiac and PM progenitors and are required to promote their development \u201314. In h defects . Further defects , 12. Witlin/MyoR . As in m defects , 18. Fur and PMs . However all PMs . Thus, aCiona has shed some light on transcriptional signals that drive cardiac and PM fate decisions within distinct precursors of the SHF [There is evidence that the origin of bi-potent SHF cardiac and PM progenitors is conserved in chordates . Work in the SHF . Despite the SHF \u201326. HoweNR2F1 and NR2F2, overlaps during early embryonic development as well as later in atrial CMs of the heart [Nr2f1 and Nr2f2 becoming predominantly expressed in neural and mesendodermal tissues, respectively [Nr2f2 knockout (KO) mice have morphologically smaller atria and sinus venosus [Nr2f2 KO mice studies using a Myh6:Cre suggest a later role for Nr2f2 in maintaining atrial CM identity [nr2f2 mutants are not early embryonic lethal and do not have overt cardiovascular defects through at least two weeks of development [nr2f1a mutants indicates that it is the functional homolog of Nr2f2 in mammals with respect to early heart development [nr2f1a mutants have smaller atria due to a requirement within atrial CMs to concomitantly promote atrial differentiation and limit the size of the atrioventricular canal (AVC) [NR2F1 and NR2F2 are redundantly required for atrial differentiation in human iPSC-derived atrial cells [NR2F2 have been associated with variable types of human congenital heart defects (CHDs), in particular atrial septal defects (ASDs) and atrioventricular septal defects (AVSDs), but surprisingly also left ventricular outflow tract obstruction (LVOTO) [Nr2f mutant models has provided insight into the molecular etiology of CHDs affecting the atria and AVC, the mechanisms underlying the observed phenotypic variability of CHDs, in particular the origins of ventricular malformations, in humans with NR2F2 mutations are not understood.NR2F proteins  are highly conserved orphan nuclear receptor transcription factors whose expression is RA-responsive in many tissues of all vertebrates \u201330. In mhe heart \u201332. Despectively , 29. Anaectively \u201336. With venosus . Conditielopment , 38, ourelopment . Specifial (AVC) . NR2F1 a (LVOTO) , 41. Thenr2f1a expression within the ALPM of zebrafish embryos and that retinoic acid receptors (RARs) can bind an absolutely conserved, yet unconventionally localized, response element. Using zebrafish mutants for both nr2f1a and nr2f2, we find redundant functions at earlier developmental stages in restricting ventricular CM and promoting PM specification, independent of the later requirement for nr2f1a in promoting atrial differentiation. Cre-mediated genetic lineage tracing shows that tcf21+ progenitors more frequently become ventricular CMs and less frequently contribute to skeletal muscle within the posterior PM in nr2f1a; nr2f2 mutant embryos. Our results support a novel antagonistic mechanism that controls allocation of ventricular CM and PM progenitors within the anterior mesoderm of vertebrates and may help explain the correlation of craniofacial and heart defects as well as the variability found in CHDs associated with NR2F2 mutations in humans.Here, we identify that RA signaling directly regulates nr2f1a as an RA-responsive gene within the ALPM of zebrafish embryos  treatment  of nr2f1a , was increased at the 20s stage  and PMs, since their progenitors intermingle with the cardiac progenitor population within the anterior mesoderm of zebrafish [nr2f1a; nr2f2 mutants at 48 hpf and 96 hpf, developmental time points when these cells have respectively differentiated [nr2f1a; nr2f2 mutant embryos carrying the kdrl:EGFP transgene  and hyoid (2nd) arch derived muscles were also often smaller and disorganized compared to WT and nr2f1a mutant siblings  to permanently label cells that have expressed tcf21+ (nr2f1a homozygous mutants (nr2f1amut) coupled with nr2f2 heterozygosity (nr2f2het) or nr2f2 mutant homozygosity (nr2f2mut) were analyzed together (referred to as nr2f1a-2mut), because our data suggest loss of a single WT nr2f2 allele in nr2f1a mutants produces similar ventricular CM and PM defects as loss of both WT alleles in nr2f1a mutants. Consistent with what has been reported [st and 2nd arches, we found a decrease in the frequency of contribution to the pp in the nr2f1a-2mut embryos  mutant embryos that are indistinguishable from nr2f1a mutant embryos with respect to the heart and blood pooling. We also have not found evidence for compensatory expression of any nr2f genes in the nr2f1a mutants , which has been proposed to be homologous to the ALPM-derived trapezius neck muscles in mammals [Recent clonal analysis in mice has suggested there are common cardio-pharyngeal progenitors that contribute progeny to the neck muscles, the arterial pole and atria that are distinct from other cardio-pharyngeal populations of the SHF . Our dat mammals \u201360. Ther mammals , these rCiona [tcf21+, as well as nkx2.5+ progenitors, can give rise to ventricular CMs and PMs [nr2f1a; nr2f2 mutant embryos are less dramatic than with loss of RA signaling, in neither case are the defects subtle enough that a very rare population of bi-potent progenitors is likely being affected. Instead, we favor a model where there is a larger population of progenitors within the ALPM that have the potential to become either ventricular CMs and PM, with signals such as Nr2f proteins functioning downstream of RA signaling to influence their allocation into one of these populations.Given the existence of bi-potent cardio-pharyngeal progenitors in mice and Ciona , 19, 20,Ciona \u20138. While and PMs , it is nOverall, our study provides valuable insight into the requirements of Nr2f genes in vertebrate cardiac and cranial muscle development. These studies may help us to further understand molecular and genetic etiology controlling phenotypic variability of CHDs as well as developmental syndromes that have congenital malformations concomitantly affecting the heart, head, and neck muscles in humans.All zebrafish husbandry and experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Cincinnati Children's Hospital Medical Center.Tg(kdrl:nlsEGFP)ubs1 [Tg(kdrl:EGFP)la116, TgBAC(\u221236nkx2.5:ZsYellow)fb7 [Tg(actc1b:GFP)zf13 [Tg(tcf21:nucEGFP)pd41 [Tg(tcf21:CreERT2)pd42 [Tg(ubi:LOXP-AmCyan-STOP-LOXP-ZsYellow)fb5 [Tg(myl7: LOXP-AmCyan-STOP-LOXP-ZsYellow)fb2 [Tg(myl7:h2afva-mCherry)sd12 [Tg(hsp70l:EGFP-VP16-RAR-)c1004 [nr2f1ael512 and nr2f2el506 [Adult zebrafish were raised and maintained under standard laboratory conditions. Transgenic lines used were: GFP)ubs1 , Tg(kdrlllow)fb7 , Tg(actcGFP)zf13 , Tg(tcf2GFP)pd41 , Tg(tcf2RT2)pd42 , Tg(ubi:llow)fb5 , Tg(myl7llow)fb2 , Tg(myl7rry)sd12  and Tg(hR-)c1004 . Mutant 2f2el506 , 39.zsyellow (ZDB-EFG-110824-1), egfp (ZDB-EFG-070117-1), nr2f1a (ZDB-GENE-980526-115), nr2f2 (ZDB-GENE-990415-252), vmhc (ZDB-GENE-991123-5), nkx2.5 (ZDB-GENE-980526-321), dlx2a (ZDB-GENE-980526-212), tbx1 (ZDB-GENE-030805-5), tcf21(ZDB-GENE-051113-88), and klf2a (ZDB-GENE-011109-1) were used. Area measurements were performed using ImageJ.Single and two-color whole mount ISH were performed using NBT/BCIP (Roche) and INT/BCIP (Roche), as previously reported . DigoxygNr2f genes plus a 10kb region 5\u2019 and 3\u2019 to the genes were taken from Ensembl (ensembl.org) and aligned using mVista (http://genome.lbl.gov/vista/mvista/submit.shtml). Locations, excluding exons, in which there was over 50% conservation between any of the sequences were analyzed for the presence of RARs. Conserved sequences were input into NHRscan (http://www.cisreg.ca/cgi-bin/NHR-scan/nhr_scan.cgi) to identify potential RAR binding sites.Sequences for zebrafish, mouse, and human \u03b2-actin expression and data were analyzed using the 2-\u0394\u0394CT Livak Method. All experiments were performed in triplicate. Primer sequences for \u03b2-actin were reported previously [Total RNA isolation and RT-qPCR was performed using previously reported methods . Brieflyeviously , 75. Allnr2f1a and nr2f2 expression, embryos were treated with CHX , RA , and DEAB  at tailbud stage for 1 hour. For analysis of vmhc expression in nr2f1a; nr2f2 mutants, embryos were treated with 0.05 \u03bcM RA at the 3s stage until the 20s stage. Drugs were washed out 3X with embryo water then the embryos were fixed in 4% formaldehyde for analysis. Vmhc-stained embryos were genotyped following imaging. Tamoxifen  was administered in 30 mL of blue water with 0.003% PTU in petri dishes to embryos at 30%-50% epiboly until embryos were analyzed or through 2 days of development.All drug treatments were administered to embryos in 2 mL of blue water with drug at specified concentrations in a glass vial with 25\u201330 embryos/vial at 28.5\u00b0C. For analysis of Tg(hsp70l:VP16-RAR:EGFP)c1004 adults were crossed to WT adult zebrafish. The resulting embryos were collected at tailbud stage and heat-shocked at 37\u00b0C for 30 minutes. Transgenic embryos were sorted from their non-transgenic control siblings by the presence of GFP. Embryos (n = 100) were dechorionated and fixed in 1% formaldehyde 2 hours after heat-shock. Cells were lysed by gentle pipetting in cell lysis buffer. Nuclei were lysed and DNA was sheered by sonication with glass beads to 200-600bp fragments. Dynabeads (Invitrogen) were used to pull down GFP tagged proteins with ChIP-grade polyclonal anti-GFP antibody (Abcam ab290) per manufactures instructions. Samples were de-crosslinked and qPCR was used to quantify the fold difference in enrichment of the DR1 RARE in the nr2f1a promoter and the known DR5 RARE in the Cyp26a1 promoter as compared to a nr2f1a promoter region not containing a RARE. Expression levels were standardized to the no antibody control signal and data were analyzed using the 2-\u0394\u0394CT Livak Method. Primer sequences for cyp26a1 ChIP-PCR were reported previously [nr2f1a DR1 ChIP-PCR and control are indicated in ChIP-qPCR was performed essentially as previously reported . Hemizygeviously . Primer nr2f1a DR1 site (GTGTCAAAGTTCA), the nr2f1a DR1 site with a targeted mutation in the second half site of the DR1 abolishing the direct repeat (GTGTCAAAGTCAT), and a previously reported Cyp26a1 DR5 site [myc-rarab was in the pCS2+MT. Zebrafish RXRba was cloned into pCS2p+. Proteins for EMSA were made using the TnT SP6 Quick Coupled Transcription/Translation System (Promega). Protein samples were gently mixed with LI-COR tagged probes and incubated at room temperature for 20 minutes. 4% polyacrylamide gels were run for 2 hours at 150 V. Gels were imaged using an Odyssey CLx LI-COR imager.EMSA was performed essentially as previously reported . OligonuDR5 site . A complEmbryos were fixed for 1 hour at room temperature in 1% formaldehyde in PBS in 3 ml glass vials. Embryos were washed 1X in PBS and then 2X in 0.2% saponin/1X PBS, followed by blocking in 0.2% saponin/0.5%sheep serum/1X PBS (Saponin blocking solution) for one hour. AMHC (S46) and MHC  primary antibodies  were incubated at 1:10 in Saponin blocking solution. Rabbit polyclonal DsRed antibody (Clontech), to detect mCherry, and Living colors anti-RCFP (Clontech), to detect ZsYellow, were used at a 1:1000 dilution. Rabbit anti-GFP (Abcam) was used at 1:500. Rabbit anti-Nkx2.5 (Gene Tex) was used at 1:250. Mouse anti-pHH3 (Abcam) was used at 1:1000. All secondary antibodies were used at dilutions of 1:100. Antibody information is also listed in DR1-ef1a construct contains 165 base pairs (bp) of the nr2f1a promoter and 5\u2019UTR adjacent to 193 bp of a minimal elongation factor 1a (ef1a) promoter (green). The nr2f1a-DR1 construct contains 371 bp that include the promoter and 5\u2019UTR containing the conserved DR1 site. The pGL3-12XRARE-tk vector and dual luciferase assays were reported and performed in HEK293 cells as described previously [The promoter fragments for both reporters used were cloned into the Kpn and HindIII sites of the pGL3 (Promega) multiple cloning site. The eviously .t-test or Mann-Whitney test. To compare 3 or more conditions are different, we performed ANOVA analysis. To determine if two proportions were statistically distinct we performed a Chi-squared test or Fisher\u2019s exact test. Statistical analysis was performed using GraphPad Prism. A p value < 0.05 was considered statistically significant for all analysis.To compare two groups, we performed a Student\u2019s S1 FigpGL3-DR1-ef1a construct has nucleotides -60 of the nr2f1a promoter (blue) through +105 of 5\u2019UTR (gray), which includes the including the DR1 site (yellow box) cloned adjacent to a minimal elongation factor 1a (ef1a) promoter (green) (358 bp). The pGL3-nr2f1a-DR1 construct contains nucleotides -266 through +105 (371 bp) of the promoter and 5\u2019UTR containing the conserved DR1 site. Blue indicates nr2f1a promoter sequences. Red boxes indicate predicted TATA boxes. (B) Luciferase assays testing RA responsiveness in HEK 293 cells. FF\u2013firefly luciferase. RL\u2014renilla luciferase. The previously reported pGL3-12XRARE-tk plasmid [(A) Schematic of the two constructs placed into pGL3. The  plasmid  was used(TIF)Click here for additional data file.S2 FigNr2f2 expression in the ALPM of control, DEAB-treated, and RA-treated embryos. View is dorsal with anterior left. Arrows indicated anterior and posterior limits of expression in control and RA-treated embryos.(A-C) (TIF)Click here for additional data file.S3 Figklf2a. Frontal views of hearts in nr2f1awt; nr2f2wt, nr2f1amut; nr2f2wt, nr2f1amut; nr2f2het, and nr2f1amut; nr2f2mut embryos. v\u2013ventricle. a\u2013atrium. Arrows indicate the length of klf2a expression within the hearts.(A-D) ISH for the endocardial atrioventricular canal marker (TIF)Click here for additional data file.S4 Fignkx2.5 in nr2f1awt; nr2f2wt, nr2f1amut; nr2f2wt, nr2f1amut; nr2f2het, and nr2f1amut; nr2f2mut embryos at the 16s stage. Dorsal view with anterior up. 160 embryos were examined with \u22659 embryos examined for each condition. Although we observed a trend in the expansion of nkx2.5 expression when assaying area of expression similar to vmhc, due to inherent variability in nkx2.5 expression and the low numbers of embryos, it was not statistically significant.  IHC for Nkx2.5 and pHH3 in nr2f1awt; nr2f2het and nr2f1amut; nr2f2mut embryos at the 16s stage. Confocal images of the ventro-lateral side of the embryo. Dorsal is right and anterior up. A single side of each embryo was used for analysis. (G) Number of Nkx2.5+ cells in control and nr2f1a; nr2f2 mutant embryos. (H) Percentage of pHH3+/Nkx2.5+ in control and nr2f1a; nr2f2 mutant embryos. For quantification of Nkx2.5+ and pHH3+/Nkx2.5+ cells, nr2f1a homozygous mutants (nr2f1amut) coupled with nr2f2 heterozygosity (nr2f2het) or nr2f2 mutant homozygosity (nr2f2mut) were analyzed together (referred to as nr2f1a-2mut), because our data suggest loss of a single WT nr2f2 allele in nr2f1a mutants produces a similar increase in ventricular CMs as double mutants. Nr2f1a-2ctrl includes any combination of nr2f1a and nr2f2 WT and heterozygous alleles. nr2f1a-2ctrl (n = 23) and nr2f1a-2mut (n = 9) for G and H.(A-D) ISH for the cardiac progenitor marker (TIF)Click here for additional data file.S5 Figvmhc in control (untreated), RA-treated nr2f1awt; nr2f2het, and RA-treated nr2f1amut; nr2f2mut embryos at the 20s stage. Control embryos were not genotyped. (D) Percentage of embryos with the genotypes found that lacked vmhc expression (n = 16) or had vmhc expression (n = 16). Although a RA-treated nr2f1awt; nr2f2het is shown in B, nr2f1a-2ctrl includes any combination of nr2f1a and nr2f2 WT and heterozygous alleles. Fisher\u2019s exact test was used to compare the frequency of embryos with two nr2f1amut alleles found in each condition.(A-C) ISH for (TIF)Click here for additional data file.S6 Fignr2f1a-2ctrl and nr2f1a-2mut embryos. Numbers indicated arches. Anterior is to the right. PAAs in (TIF)Click here for additional data file.S7 Fignr2f1awt; nr2f2wt, nr2f1amut; nr2f2wt, nr2f1amut; nr2f2het, and nr2f1amut; nr2f2mut embryos at 75 hpf. Views are lateral with anterior to the left and dorsal up. (E) Percentage of nr2f1actrl; nr2f2ctrl (n = 7), nr2f1amut; nr2f2wt (n = 16), nr2f1amut; nr2f2het (n = 28), and nr2f1amut; nr2f2mut (n = 28) embryos with loss of posterior and malformed PMs at 75 hpf.(A-D) PMs in (TIF)Click here for additional data file.S8 Figtbx1 (red) and nr2f1a (blue) in the ALPM of an embryo at the 8s stage. Image is a dorsal view with anterior rightward of a flat-mounted embryo. (B-E) ISH for tcf21 in the ALPM of nr2f1awt; nr2f2wt, nr2f1amut; nr2f2wt, nr2f1amut; nr2f2het, and nr2f1amut; nr2f2mut embryos at the 18s stage. (F-I) ISH for the neural crest marker dlx2a in nr2f1awt; nr2f2wt, nr2f1amut; nr2f2wt, nr2f1amut; nr2f2het, and nr2f1amut; nr2f2mut embryos at the 18s stage. For B-I, views are dorsal with anterior up.(A) ISH for (TIF)Click here for additional data file.S9 Fignr2f1a-2ctrl and nr2f1a-2mut embryos.(A) Percentage of embryos with 1 and >1 ventricular CM. (B) Percentage of embryos with labeled CMs that had labeled atrial CMs. (C) Mean number of labeled atrial CMs in (TIF)Click here for additional data file.S10 Fignr2f1b, nr2f2, nr2f5, nr2f6a, and nr2f6b in nr2f1a mutants at 48 hpf does not show compensatory expression.RT-qPCR for (TIF)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file."}
+{"text": "We apply in-plane and out-of-plane magnetic fields to proximity-coupled Bi2Se3 and find that the in-plane field creates a spatially oscillating superconducting order parameter in the junction as evidenced by the emergence of an anomalous Fraunhofer pattern. We describe how the anomalous Fraunhofer patterns evolve for different device parameters, and we use this to understand the microscopic origin of the oscillating order parameter. The agreement between the experimental data and simulations shows that the finite momentum pairing originates from the coexistence of the Zeeman effect and Aharonov\u2013Bohm flux.Unconventional superconductivity arising from the interplay between strong spin\u2013orbit coupling and magnetism is an intensive area of research. One form of unconventional superconductivity arises when Cooper pairs subjected to a magnetic exchange coupling acquire a finite momentum. Here, we report on a signature of finite momentum Cooper pairing in the three-dimensional topological insulator Bi 2Se3 and attribute it as a signature of finite momentum Cooper pairing.Unconventional superconductivity may emerge from the interplay between strong spin\u2013orbit coupling and magnetism. Here, Chen et al. report an anomalous Fraunhofer pattern in three-dimensional topological insulator Bi However, introducing magnetism can change the stability of the BCS superconducting state, thereby destroying superconductivity or, as in unconventional superconductors, altering the pairing symmetry2. The potential for unconventional superconductivity at the confluence of magnetism and superconductivity has made it an area of great theoretical and experimental interest. One such example of an unconventional superconducting state is Fulde\u2013Ferrell\u2013Larkin\u2013Ovchinnikov (FFLO) superconductivity, which was proposed as a way for maintaining superconductivity even beyond the critical Zeeman field4. Despite the intensive search for an FFLO superconductor in various types of materials such as heavy fermion compound CeCoIn56 and BEDTTTF-based organic superconductors9, FFLO superconductivity still remains a controversial subject12.In the conventional Bardeen\u2013Cooper\u2013Schrieffer (BCS) theory of superconductivity, Cooper pairs form an isotropic condensate with a zero center-of-mass momentum15. In particular, time-reversal invariant topological insulators (TIs), whose surface states are massless Dirac fermions, are proposed to be an attractive candidate for unconventional superconductivity that carries finite momentum pairing16. To the best of our knowledge, experimental signatures of finite momentum Cooper pairs in TIs have mainly been sought after in the electron-doped regime of the two-dimensional (2D) TI HgTe quantum wells17, but the surface states of three-dimensional (3D) TIs also provide unique advantages to engineering finite momentum pairing. The Dirac cones on the surfaces are non-degenerate and have spin-momentum locking. As a consequence, the Fermi surface of the Dirac cone shifts uni-directionally under the application of an in-plane magnetic field to the surface, which can lead to an FFLO state16. Even though transport measurements in normal 3D TIs are often complicated by the presence of bulk carriers, there is experimental consensus that the metallic surface state dominates transport in a proximity-coupled TI even when the bulk is not depleted22.To better hunt for unconventional superconductivity, there have been proposals for utilizing materials with strong spin\u2013orbit interaction coupled to a conventional s-wave superconductor. This is predicted to stabilize an FFLO superconducting state: the spin\u2013orbit coupling lifts the degeneracy in the Fermi surfaces of the material and introduces an anisotropy to the surfaces that makes it more amenable to a finite momentum phaseBz\u2009=\u20090 out to finite magnetic field values and (2) introducing asymmetries between positive and negative values of Bz in the Fraunhofer patterns. We show that the intensity transfer is suggestive of a spatially oscillating superconducting order parameter phase, which we call a finite momentum shift; we propose two potential origins for this finite momentum shift; and we demonstrate that asymmetries in the transport signal come from the sample geometry. Simulations show a close match between experimental data and finite momentum Cooper pair theory.To this end, we study the experimental signatures of Cooper pairs in a superconductor (S)-3D TI-S Josephson junction subjected to in-plane and out-of-plane magnetic fields. We probe the phase of Cooper pairs by generating Fraunhofer patterns with an out-of-plane field, and we find that adding an in-plane field distorts the Fraunhofer patterns by (1) transferring the intensity of superconductivity from the central Fraunhofer peak at 2Se3 flakes that are mechanically exfoliated from crystals with a bulk carrier density n\u2009~\u20095\u2009\u00d7\u20091017\u2009cm\u22123  as the superconducting material.Our devices consist of BiBz is applied to the superconducting junction to generate a Fraunhofer pattern. In the absence of any in-plane fields, the devices exhibit a central peak with maximum critical current Ic and decaying side peaks, as is expected for a conventional Fraunhofer pattern. The nodes of our Fraunhofer pattern are at d is the effective electrode spacing that takes into account flux focusing  and measure the differential resistance dV/dI as a function of Bz and By, where lower resistance corresponds to higher critical current, similar to in ref. 17. The evolution of the Fraunhofer pattern for device 1 is shown in Fig.\u00a0By is applied, the Fraunhofer pattern is shifted along Bz. This is evident as an overall tilt of the 2D differential resistance map in Fig.\u00a0By\u2013Bz plane, this type of misalignment would cause a similar shift in the Fraunhofer pattern when a field is applied in any in-plane direction. Because we do not see a corresponding shift when an in-plane field perpendicular to current direction Bx is applied, we can exclude sample misalignment as a cause for the shift of the Fraunhofer pattern.When an in-plane field along the current direction By\u2009=\u20090, the intensity of superconductivity is maximum at the central lobe, but as By is increased, the intensity is transferred outwards to higher values of Bz. The emergence of this anomalous side branch becomes more evident if the tilt in the 2D differential resistance map is removed by rotating the graph until the lobe minima are vertical, as shown in Fig.\u00a0Besides the shift to the Fraunhofer pattern, we also observe additional side branch features in the evolution of the Fraunhofer pattern: at Bz and By on the superconducting order parameter phase. For the following discussion we look primarily at the surface contribution because we find that the bulk order parameter decays much more rapidly than the surface contributions in the junction, which means the supercurrent is predominantly carried by the surface states .To determine the origin of the evolution of the Fraunhofer pattern, we begin by considering the mesoscopic effects of magnetic fields By results in a phase modulation given by an Aharonov\u2013Bohm phase 26. For a bulk electron, the phase will be determined by its trajectory inside the flake, and we find that the bulk electrons will acquire a negligible net phase modulation  and \u03d52(x2) are the phases of the order parameters of superconductor 1 and 2 at the coordinates x1 and x2, respectively, along the width of the junction. Based on the phase difference between the two leads, we can model the total transport current along the 27. This analysis is equivalent to summing up all possible quasi-classical trajectories of electron transport, so the total transport current isW1(2) is the width of the superconducting lead 1(2), \u0394\u03d5 is the overall phase difference between the superconductors, and d is the distance between the two superconductors. Using Eq.  in the differential resistance map with slope m. These side branches are visible in the simulation for a symmetric Josephson junction in Fig.\u00a0By. This feature is known to be a key signature of finite momentum pairing and distinguishes the system from typical BCS superconductivity29.Figure\u00a0sing Eq.  and illum of the side branches reflects the relative contributions of finite momentum pairing due to ZME and FME as a function of By. In the simulations, the slope is defined by a line between the origin and the nth side lobe as n becomes large  on thickness, where m is extracted from the data (black) and calculated using theoretical predictions for finite momentum pairing due to ZME alone (red), FME alone (blue), and ZME and FME together (purple).We examine the slope dependence on TI thickness across multiple samples, where devices 2\u20134 are shown in Fig.\u00a0sing Eq. . Figure\u00a0It is clear that the dominant contribution to the finite momentum shift comes from the FME. In the thickest sample, in particular, the FME closely predicts the slope in the experiment since more flux is enclosed in the flake and the orbital effect therefore has a more significant contribution. However, there are some deviations between the data and the FME curves. First, some of the normalized slopes do not follow the monotonically decreasing trend predicted by the FME theory. The deviations are caused by variations in the sample: in real samples, there are variations in chemical potentials, which would result in the We also find that the FME is not enough to predict the observed slope from the experiment on its own even when the error bars of slope calculation are taken into account. In fact, the ZME contribution needs to be considered for the theory to more closely match the data, which means that the finite momentum pairing due to the shifted Dirac cones is non-negligible. We calculate a curve that takes into account an additional ZME value (purple) that demonstrates that by introducing the ZME contribution to the theory, the theory curve is shifted closer to the experimental data. Therefore, our data are generally better explained by the coexistence of both FME and the unconventional ZME, which is more closely related to the FFLO state.17, it was found that a flux through the electrode seemed to contribute to the phase modulation in the system. However, the normalized slopes are not correlated with the thickness of the device leads in our experiment. This suggests that the relevant flux for the finite momentum pairing is the flux through the flake.We also looked at the potential phase contribution from inserting a flux through the superconducting leads. In the supplementary section of a previous workBy is applied to an ideal junction, we also consider the effect of asymmetries in the junction geometry and on the evolution of the Fraunhofer pattern. Due to the fact that typical sample fabrication can result in imperfect device configurations and flux focusing effects, it is important to understand what happens to the Fraunhofer pattern as the devices deviate from the ideal junction. For example, as reported in ref. 30, asymmetric features between positive and negative values of Bz often appear in Fraunhofer patterns and can be attributed to a combination of device-dependent factors such as disorder and the microscopic structure of the device. We consider some sources of asymmetries in the device configuration to model the effect of these asymmetries on the transport signal.In addition to simulating the Fraunhofer evolution as W1 and W2. To model this effect, we introduce the width asymmetry factor \u03b1, which is the ratio of the two superconducting lead widths and satisfies W1\u00a0=\u00a0\u03b1W2 in Eq.  in Eq. :J0:After deriving the eigenstate and the energies and taking just the positive eigenstate , we can use these results to solve for the surface propagator, In the canonical quasi-classical approximation, we assume that axi term represents oscillations in the surface propagator due to the Zeeman effect.This is the final expression for the surface propagator, where the e\u03b2\u2009=\u2009g\u03bcB. The bulk energy eigenvalue is given asWe now solve for the bulk propagator. To do so, we follow a similar procedure to the one used to solve for the surface propagator. Using Supplementary Eq.  a phase due to a trajectory with no reflections so that the quasiparticle is transferred directly from one superconducting contact into the other and (2) a phase due to a trajectory that reflects off of the bottom surface more than once before being transferred into the other contact. If there are no reflections, the bulk quasiparticle will follow the same trajectory as the surface quasiparticles. In this case, the bulk electron should gain the same phase as the surface electron:Unlike the surface electrons, the set of classical trajectories of the bulk electrons can be characterized by the number of reflections off the bottom surface (Supplementary Figure\u00a0z\u2009=\u20090 to z\u2009=\u2009t and the bottom half will have the opposite modulation from the top half of the flake. In this case, the net phase cancels each other out:If the bulk quasiparticle is reflected from the bottom surface at least one time, it will follow a continuous path from As a result, bulk electrons with reflection-less trajectories gain the same FME effect as surface electrons while the bulk electrons with reflected trajectories do not experience the FME and only contribute to the conventional Fraunhofer pattern.The data that support the findings of this study are available from the corresponding author on reasonable request.Supplementary Information"}
+{"text": "This study aimed to explore the related factors and strengths of hepatic cirrhosis complicated with hepatic encephalopathy (HE) by multivariate logistic regression analysis and tabu search-based Bayesian networks (BNs), and to deduce the probability of HE in patients with cirrhosis under different conditions through BN reasoning. Multivariate logistic regression analysis indicated that electrolyte disorders, infections, poor spirits, hepatorenal syndrome, hepatic diabetes, prothrombin time, and total bilirubin are associated with HE. Inferences by BNs found that infection, electrolyte disorder and hepatorenal syndrome are closely related to HE. Those three variables are also related to each other, indicating that the occurrence of any of those three complications may induce the other two complications. When those three complications occur simultaneously, the probability of HE may reach 0.90 or more. The BN constructed by the tabu search algorithm can analyze not only how the correlative factors affect HE but also their interrelationships. Reasoning using BNs can describe how HE is induced on the basis of the order in which doctors acquire patient information, which is consistent with the sequential process of clinical diagnosis and treatment. Most patients with cirrhosis have different degrees of HE at varying stages of the disease, the mortality rate of which is extremely high3. The 1-year survival rate of patients who have chronic liver disease complicated with HE is 0.42, and their 3-year survival rate is 0.234. HE is divided into dominant and occult types1: dominant HE has obvious clinical manifestations, such as disturbance of consciousness, behavioral disorders, and coma5; whereas the clinical signs of occult HE are difficult to detect. Thus, prevention and early identification of HE could be a reasonable and effective way to reduce HE harm. At present, there is no \u201cgold standard\u201d for HE diagnosis. Clinicians can only conduct auxiliary diagnostic evaluation of HE from different angles such as liver function tests, imaging examinations, and neuropsychiatric abnormalities. Occult HE often has no clinical symptoms, and only through careful neuropsychological or neurophysiological examination can patients be found to have cognitive dysfunction. However, the neuropsychological testing process is cumbersome, can consume too much time, and is easily susceptible to the patient\u2019s condition, educational level, and cultural background. Neurophysiological tests are inaccurate and require complex instruments, and their routine clinical applicability is relatively limited6. In short, the pathogenesis of HE is complex and diverse, and its clinical symptoms are variable and sometimes difficult to find. There are no clear diagnosis or treatment guides for it at home or abroad. Therefore, search methods for clinical diagnosis and treatment of patients with cirrhosis use patients\u2019 clinical manifestations and factors that affect the occurrence of HE to identify HE, which has important clinical diagnostic value and is worthy of our research.Hepatic encephalopathy (HE) is a very serious complication of liver disease. It is a comprehensive symptom of central nervous system dysfunction based on metabolic disorders, caused by acute or chronic severe liver function disorder, or abnormal portal-systematic circulation8. Full and reasonable use of these data is an important basis for current big data analysis. We can use traditional logistic regression on the big data generated during clinical diagnosis and treatment of patients with cirrhosis to establish a prediction model for the incidence of HE in patients with cirrhosis9, and finally make judgments based on clinical expertise. Logistic regression requires that the independent variables be independent9, but the clinical manifestations of HE and the factors affecting the occurrence of HE are not independent, and there may be interactions that form complex networks of relationships. Therefore, it is difficult for logistic regression to accurately reveal the potential overall information in the data, and it is impossible for logistic regression to infer which factors play a role in the occurrence and development of HE. In addition, any logistic regression model that is applied must predict the probability of developing HE when the state of each variable is known. In clinical practice, the factors used for model prediction may be missing: patients may conceal certain information, or some items may not be detected in clinical diagnosis, which could lead to the failure of logistic prediction.In recent years, with the development of hospital information technology, hospital information systems contain large amounts of patient and medical data such as patient sociodemographic characteristics, clinical symptoms, physiological and biochemical indicators, and auxiliary examinations, which have formed large datasets10. BNs do not have strict requirements for statistical assumptions in the modeling process11. Although BNs do not extract variables\u2019 main effects and interaction effects, they comprehensively reflect the complex relationships between variables according to the overall structure of the network and can accurately reveal potential overall information in the data12. BNs can use missing data to identify patients13 in a manner that reasonably reflects the sequentiality of clinical diagnosis and treatment15. The advantages of BNs in clinical applications have also been demonstrated in our previous studies. Because there were too many initial variables in this study\u2019s initial cirrhosis data, some variables were only weakly related to the occurrence and development of HE. The direct use of a BN to establish the model leads to the selection of all variables, which is not conducive to accurate analysis. To simplify the network\u2019s relationships and improve network performance, in this study we employed univariate and multivariate logistic regression analysis to screen for related factors of cirrhosis with HE16, and then constructed a BN to explore the related factors of cirrhosis complicated with HE, revealing the complex network relationships among related factors17. During the care process of patients with cirrhosis, we can continuously update the network probabilities according to the patient information obtained by doctors. We also adopt BNs to conduct risk reasoning about the probability of HE in patients with cirrhosis19.Bayesian networks (BNs), proposed by Judea Pear in the 1980s, reflect the potential relationships and relationship strengths between factors by constructing directed acyclic graphs (DAGs) and conditional probability distribution tablesWe collected information about patients with cirrhosis who were hospitalized in the Department of Gastroenterology, First Hospital of Shanxi Medical University from January 2006 to December 2015 and who had complete medical records. We consulted a large number of documents and carefully analyzed the cases\u2019 structure and content and selected indicators that may be related to the progression of cirrhosis. Biochemical indicators were taken as the results of the first test within 24\u2009hours after admission. After the data were sorted, 950 cases were effective, of which 68 were complicated by HE.There are 23 factors in the survey: demographic characteristics , lifestyle , past medical history , clinical manifestations , and biochemical indicators . All of this study\u2019s methods were carried out in accordance with relevant guidelines and regulations.This study was approved by the First Hospital of Shanxi Medical University Ethics Committee. Informed consent was signed by all study participants or their agents. The present study was conducted according to the Declaration of Helsinki.This study\u2019s investigators were clinicians and graduate students. Before the start of the survey, the clinicians instructed the graduate students to familiarize themselves with clinical records and to determine the location of the information to be collected in the medical records. Finally, the clinicians normalized the course of looking up medical records. Data entry was performed by double entry, and a person reviewed both sets of entries. If anomalous values were discovered during the review process, the original case was extracted and the erroneous information was corrected.20. As a reasoning method that employs probabilistic uncertainty, BNs have served in intelligent systems and have been successfully applied in medical diagnosis, expert systems, statistical decision making, learning, and prediction21.BNs are increasingly popular data-mining techniques that are used with categorical data and effective theoretical models to represent uncertain knowledge and reasoning22. The DAG\u2019s nodes represent random variables U\u2009=\u2009{24. If there is a directional arc from X\u2009=\u2009BNs represent a set of random variables and their conditional interdependencies via a Directed Acyclic Graph (DAG)The first step of constructing a BN is to determine the nodes. To avoid including too many nodes and introducing excessive complexity to the network structure, we should initially filter the nodes in combination with prior expert knowledge or traditional statistical methods. Then, we should find the optimal model based on the tabu search algorithm. Finally, on the basis of structural learning, we should calculate the network node conditions using the maximum likelihood estimation method.25.The tabu search algorithm is a sub-heuristic algorithm that simulates human memory function. It has the characteristics of few parameters, simple structure, and robust global optimization ability. For a given current network structure, the algorithm uses three operations to generate neighborhoods without generating a network loop: add edges, reduce edges, and reverse edges, and then it searches for a local optimal solution in the neighborhood and puts it into a tabu table. The tabu table is then used to search for the local optimal solution, so that the next search is as far as possible from the current one to avoid duplication of the search process. In conjunction with the use of contempt criteria to amnesty some of the optimal solutions in the tabu table, the tabu restrictions are ignored. When these two steps iterate and search in a circular way, it results in a taboo table that is updated constantly, and ultimately, we obtain the global optimal solution1; (2) HE: refers to the \u201cdefinition of HE definition, diagnosis, and quantification\u201d standard issued by the 11th World Conference on Gastroenterology Work Group in March 2003, with the diagnosis mainly based on cirrhosis history, neurological abnormalities, liver function tests, image examination, and other auxiliary examination, excluding nerve abnormalities caused by other diseases26; (3) Hypertension: according to the World Health Organization (WHO) standards, systolic blood pressure SBP\u2009\u2265\u2009140\u2009mmHg and/or diastolic blood pressure DBP\u2009\u2265\u200990\u2009mmHg, or having a previous history of hypertension and currently taking antihypertensive drugs27; (5) Diabetes mellitus: fasting blood glucose (FBG)\u2009\u2265\u20097.0\u2009mmol/L or 2-hour postprandial plasma glucose\u2009\u2265\u200911.1\u2009mmol/L or reporting diagnosed diabetes mellitus28; (6) Smoker: smoking\u2009\u2265\u20091 cigarette daily on average over the previous 6 months; (7) Drinker: drinking at least once per week regularly for 6 consecutive months with average intake quantity of more than 50 g29.(1) Cirrhosis: comply with the diagnostic criteria jointly revised by the Chinese Medical Association\u2019s Infectious Diseases and Parasitic Diseases Branch and the Hepatology Branch in 2000In our study, we used Epidata to build a database and enter data. Statistical Analysis System (SAS) version 9.2 software  was used for data pretreatment. Descriptive statistics and logistic regression analysis of the data was performed with SPSS Version 22 . Significance for all statistical tests was set a priori at P\u2009<\u20090.05, and all P values were two-tailed. Weka 3.8.0  was used for structural learning of BNs and parameter estimation of BNs using the maximum likelihood estimation method. The BNs\u2019 topology and conditional probability distribution tables were drawn using Netica .The total enrollment was 950 patients with liver cirrhosis, including 508 male (53.5%) and 442 female (46.5%) individuals ranging 17\u201388 years old, with a negatively skewed distribution. The overall median age was 58.0 years (QR\u2009=\u200920.3). Among the subjects, 156, 357, and 437 were aged <45, 45\u201359, and \u226560 years, respectively , hepatorenal syndrome (RR\u2009=\u20093.467), and infection (RR\u2009=\u20093.021) were the major risk factors for HE in patients with cirrhosis. The relationships between hepatic diabetes, poor spirits, increased total bilirubin, prothrombin time prolongation, and HE were relatively weak, with RR values ranging 2.1\u20132.7  curve as the evaluation index. Figure\u00a0BN reasoning refers to calculating the probability of an event in a given network structure, given the available evidence. Its biggest advantage is automatic updating of network probabilities according to different degrees of information mastery.According to the patients\u2019 visiting process and the order in which information was obtained by the doctors, we used the BN to predict which patients would have concurrent HE. When a patient with cirrhosis does not attend a clinical examination, the likelihood of HE is 0.0736 by a priori information about the BN. If a clinical examination reveals that the patient is in poor spirits and has hepatic diabetes, then the BN shows that the likelihood that the patient has HE is 0.155 . Infection, electrolyte disorders, and hepatorenal syndrome are closely related to HE: if the patient had all three conditions, the probability of concurrent HE was 0.968. The results show that the BN constructed by the tabu search algorithm has a flexible reasoning mechanism, which is helpful for disease identification and diagnosis. It has important clinical diagnostic value and could serve as an effective method to reduce harm from HE.42. BNs are also suitable for datasets with a variety of uncertain information and excessive numbers of variables11: they facilitate easy understanding and explanation through visual images of the results. However, BNs also have shortcomings: for example, the edges between variables only represent probability dependencies and do not represent causal relationships. Therefore, we cannot perform causal analysis from only the BN\u2019s directed edges. It is necessary to combine various aspects of professional knowledge to determine causality43. The data in this study are unbalanced, which may cause incorrect classification. In future research, we intend to deal with the impact of data imbalance on the classification model at the data and algorithm levels and hope to achieve better results. For example, we can expand the scope of data collection to increase the number of HE-positive cases and continuously verify and improve the accuracy and applicability of model classification identification. In addition, this study is based on a cross-sectional survey; thus, the BN can only reveal the relevant factors related to the occurrence of HE, and the causal relationship needs further verification. Only in a BN built making use of causal relationships do the directed edges between the variables represent causal relationships44.The complex network of relationships between HE-related factors revealed by the BN is in line with clinical practice. By constructing the BN model, the clinical manifestations of patients with cirrhosis and the factors affecting their probability of occurrence of HE are used to identify the cirrhosis with HE, and the network probabilities can be updated as the doctor receives increasing amounts of patient information. Although this study lists only some of the key issues, it shows that compared with a logistic probability prediction model, the BN is more in line with the sequential process of clinical diagnosis and treatment. BNs have other advantages, including their ability to combine prior information and sample information. Subjective bias caused by the application of prior information and bias caused by using only sample information can be avoidedSupplementary informationDataset"}
+{"text": "Younger children (up to 12) are less likely to abandon the diet . In this age group non-intentional diet failure prevails, while teenagers interrupt their diet intentionally ). Currently, the most common causes of teenage diet failure are the absence of symptoms after consuming a small amount of gluten and, even more often, troublesome diet administration. Previously, the absence of peer acceptance prevailed. With this study we found that: 1. In West Pomerania, every fourth CD child does not follow GFD. 2. For years, teenagers have failed to follow GFD due to the absence of symptoms after consuming small amounts of gluten. 3. The incidence of non-intentional failure to follow GFD has significantly decreased over years, which indicates better dietary care.Celiac disease (CD) can only be treated by rigorous life-long gluten-free diet (GFD). The study included 102 mothers and their CD children treated with GFD for at least two years. Frequency and cause of diet failure in children treated at present (54 children) and 10 years ago (48 children) were compared. Dietary adherence was evaluated serologically (tTG), while diet management difficulties were examined by means of a questionnaire. The study shows that one-third of patients fail to follow GFD, more often 10 years ago than now (40% vs. 26%;  Celiac disease (CD) is a genetically conditioned, immunologically mediated chronic intestinal disease, in which in genetically predisposed people the consumption of gluten leads to the disappearance of intestinal flora . This reThe most reliable method to control GFD adherence are serological tests and small intestine biopsy . It is rSome researchers suggest using nutritional history to assess the GFD adherence. However, it does not allow to identify patients who non-intentionally fail to adhere to GFD, therefore its importance for monitoring procedures is low. Leffler et al. proposed a seven-point questionnaire to identify patients who did not adhere to GFD . The test assesses their knowledge of the disease, which, according to Leffler, is highly correlated with serological test results . In 2017Adherence to GFD is troublesome . The patIn the opinion of some authors, the following factors contribute to the better adherence to GFD: good knowledge of the disease and its treatment, higher education level, better social situation of the family, female sex, young age, high self-esteem, good grades at school, good availability and labelling of products, good contact with a doctor and a dietitian, and finally, membership in the Coeliac Society ,11,12,13The factors responsible for not adhering to GFD are: poor taste of gluten-free products, their high price and low availability , the patient's adolescence, the absence of immediate symptoms after consuming small amounts of gluten, and low awareness of the disease ,11,13. Better awareness of the factors that have significant impact on the GFD adherence can improve the supervision of CD patients.The aim of this study was to determine the incidence and causes of non-adherence to GFD by children with CD treated now and 10 years ago.The first analysis of the causes of failure to adhere to GFD was carried out in 2006\u20132007 with a view to improving the effectiveness of CD treatment, as it had been observed that many patients discontinued GDF after years of adherence. In recent years, GFD has become popular in Poland and therefore the conclusions concerning the patients\u2019 failure to adhere to GFD 10 years ago are no longer relevant. Unfortunately, it has been observed that teenagers still tend to discontinue their GFD. Therefore, in the 2016\u20132017 study, the questions about the reason for failure to follow GFD were again included in the CD patients\u2019 medical history.The study covered 102 children (64 girls) with coeliac disease (CD) treated with GFD. All patients were diagnosed in accordance with the applicable criteria: elevated antibodies anti\u2013endomysium (EMA) and anti-tissue transglutaminase (tTG) as well as duodenal atrophy of intestinal mucosa . The patients were recruited during their GFD treatment, two years or more after the diagnosis, during control tests performed routinely twice a year. The mean time of the GFD treatment before their inclusion in the study was 104 months (28 months\u2013208 months). During the medical interview, patients made a declaration concerning their dietary adherence. If they reported that they did not follow the diet, they were asked to give reasons. Five probable causes were specified: poor taste of the diet, its high price, troublesome dietary regime , difficulties in relationships with peers (due to being rejected by the peer group) and the absence of symptoms after consuming gluten products. Each patient was asked to choose which of the reasons was the most relevant to them, i.e., which led to deliberately abandoning of GFD. In the case of the youngest children (under seven years of age), dietary declarations were made by their guardians . Older children with CD and their guardians jointly chose the most important reason for their failure to follow GFD.The tests performed during each control visit included serum assays of tissue transglutaminase (tTG) in the IgA class. The presence of tTG antibodies in serum confirmed that the CD patient had consumed gluten. Patients who claimed to adhere to GFD and in whose blood tTG antibodies were found were considered as those who non-intentionally failed to adhere to GFD. In 33 children who did not follow GFD, the average IgA-tTG concentration was 126 RU/mL (264 RU/mL\u201322 RU/mL). In children adhering to GFD the IgA-tTG concentration was below 20 RU/mL. Patients were divided into two groups: children (0\u201312 years old) and teenagers (13\u201318 years old) . The fret-test was used for independent trials.EMA was determined by indirect immunofluorescence test (standard < 1:10), while IgA-tTG was assayed by ELISA (standard < 20 RU/mL). The obtained results were subjected to statistical analysis. The Student\u2019s The survey did not require the permission of the PUM  Bioethical Committee. The relevant opinion was obtained from the Chairman of the Committee in 2006. All subjects had given their informed consent for inclusion before they were included in the study.p < 0.05) (p < 0.05). Younger children (up to 12 years) were less likely to miss the diet . At that age, the incidence of non-intentional GFD failure was larger: 4% at present (1 of 24 children) and 19% previously (5 of 26 children)  . Those whildren) . Teenagehildren) . Currenthildren) . In 2006hildren) .The analysis shows that currently every fourth child with CD does not adhere to GFD . Ten yeaCurrently, teenagers are five times more likely not to adhere to GFD than younger children (40% vs. 8%). In 2006\u20132007, teenagers consumed gluten only twice as often as younger children (54% vs. 27%). Similar observations were made by other researchers ,18. WhatBoth 10 years ago and now, the majority of CD teenagers intentionally fail to adhere to GFD , which hIn younger children (<3 years), the consumption of even the smallest amounts of gluten usually result in intestinal symptoms, most commonly abdominal pain or abnormal stools. Teenagers, seeing that such a co-incidence no longer occurs, start to believe that they can consume gluten in small amounts. There are patients who are able to precisely define the amount of gluten that cause the symptoms. Therefore, they try to consume smaller amounts, which in their opinion does not harm their health. In this group of patients, dietary errors are caused by insufficient knowledge of CD and its treatment. They need to be informed about the CD again. It seems that such information should be provided to every juvenile patient once they enter adolescence. It should be particularly pointed out that, at this age, eating small amounts of gluten may not cause such intestinal discomfort as previously, but it still remains detrimental to their health. We try to persuade these patients to adhere strictly to GFD by showing them that their growth rate has been slowed down, anemia induced by iron deficiency has occurred, bone density has decreased , and antibodies indicating CD activity have appeared in serum. In some cases, we repeat endoscopic tests of fragments from the duodenum in order to show that intestinal villi atrophy has reoccurred in their duodenum. We explain that these are the complications due to the young patient's failure to adhere to GFD and that they have appeared independently from the absence of intestinal discomfort. Systematic monitoring of teenagers' dietary adherence is absolutely essential, even if they have had a history of strict GFD adherence. Other authors also believe that the lack of immediate symptoms after consumption of small amounts of gluten is an important factor in teenagers' failure to adhere to GFD .Ten years earlier, in 2006\u20132007, the main cause of non-adherence to GFD by teenagers was peer rejection due to their different dietary regime. These children were stigmatized by other children and isolated from the group. In order not to be socially excluded, teenagers with CD intentionally consumed gluten products while in social situations. None of these children changed their behavior throughout the treatment period (up to 18 years), despite having been informed about the adverse effects of such behavior. Similar teenagers\u2019 attitudes have also been described by other authors ,6,16,19.In our 2016\u20132017 study, none of the children reported the above as a reason for non-adherence to GFD. This is a consequence of a change in social customs. Today, GFD has become popular in Poland and it is used by many people who do not suffer from CD. Similar trends have also been observed in other countries where the frequency of GFD consumption far exceeds the number of CD patients ,21,22.Younger children have never reported this problem. In kindergartens and schools, they consumed gluten-free products and that fact did not have any negative impact on their peer relations.At present, just like 10 years ago, the second most frequent reason for non-adherence to GFD is its troublesome administration, as reported by both younger children and adolescents . By the When buying gluten-free products, patients can benefit from a mobile application containing an inventory of gluten-free products available in a given country . Such anIn our studies none of the CD patients gave a high GFD price as the main reason for not following it. That was another, but not the most important, reason. During the 2006\u20132007 study, all Polish children with CD received a cash allowance to buy GFD. Unfortunately, today the allowance is not available to the majority of children. Many authors point out that the high price of GFD is an important reason for not adhering to GFD by many patients ,13,26. INone of the examined groups of children indicated the illegible labelling of the gluten-free products as the most important reason for not adhering to GFD, which has also been reported by other researchers ,8,13. Strict adherence to GFD is most common among patients with greater knowledge of their disease . They arOver the last 10 years, an increase in the number of children with celiac disease adhering to the gluten-free diet has been observed in the West Pomeranian region. Similarly, to other countries, today every fourth child with celiac disease does not follow a gluten-free diet. For years, it was teenagers who most often failed to adhere to the gluten-free diet. The lack of awareness of the course of the disease, the increasing independence from parents, the need to buy food and prepare meals for themselves, the need to better organize everyday life as well as the environmental pressure are the factors resulting in more frequent failure to follow GFD. Teenagers require psychological support and repeated instruction explaining to them that they cannot eat even the smallest amounts of gluten, even though it does not cause any intestinal symptoms at this age, but unfortunately is harmful to their health.Over the years, the frequency of non-intentional non-adherence to the gluten-free diet has significantly decreased as a result of better dietary care.Systematic medical and dietary supervision contributes to more effective treatment of children with celiac disease, which in turn ensures their proper development and prevents complications."}
+{"text": "In the past, only people diagnosed with celiac disease, approximately 1% of the population, avoided gluten consumption through all their meals. However, popular media often now mistakenly present gluten-free foods as being a healthier choice, and more people have now concluded that gluten is a harmful part of the diet. A review of literature on gluten-free diets, gluten sensitivity, celiac disease, and attitudes toward gluten consumption was undertaken to examine the prevalence and consequences of adopting a gluten-free diet and to provide guidance to healthcare practitioners whose patients are now often adopting this diet without medical input. Aside from celiac disease, nonceliac gluten sensitivity (NCGS) occurs in those persons in which gluten ingestion leads to symptomatic manifestations in the absence of celiac disease or wheat allergy but who report a remission of certain symptoms after removing gluten from their diet. However, it was been shown that a large percentage of people who claim NCGS do not feel those manifestations under a double-blind challenge to gluten. Moreover, some parents, believing that ingesting gluten is detrimental for their health, adopt gluten-free diets for their children. A review of existing data shows that there are detrimental effects to going gluten free, including loss of the dietary fiber, deficiencies in dietary minerals and vitamins, and potential heavy metal exposure. Healthcare practitioners should query patients about their dietary choices, and in cases of questionable adoption of gluten-free diet, patients and parents are educated about the detriments of a gluten-free diet, and in cases where patients continue to insist on gluten-free foods, referrals to nutritional counseling are warranted in order to minimize potential harm. There is an increasing body of evidence that a significant proportion of individuals, including not only persons with celiac disease (CD) or nonceliac gluten sensitivity (NCGS), are following a gluten-free diet (GFD). \u201cGluten free\u201d was defined by the US Food and Drug Administration in 2013 as foods containing less than 20\u2009parts per million of gluten or 20\u2009mg/kg , compareGluten is a high-molecular-weight seed storage protein commonly found in grass-related grains, such as wheat, barley, and rye. The natural role of these seed storage proteins is to nourish seeds during flowering and germination, thereby contributing to the successful reproduction of the species . Gluten Celiac disease (CD) affects approximately 1% of the population \u201310 and iNonceliac gluten sensitivity (NCGS) occurs in those persons in which gluten ingestion leads to symptomatic manifestations in the absence of celiac disease or wheat allergy (WA) but who report a remission of certain symptoms after removing gluten from their diet , 17. SymThe Salerno Expert's Criteria provide guidance on how to test someone for NCGS. It is based on symptoms but follows a single- or double-blind placebo-controlled challenge . A key eLioneti et al.  found thbonafide need to avoid gluten. It has even been suggested that it may be more appropriate to describe these patients as having \u201cnonceliac wheat sensitivity\u201d or \u201cself-reported NCGS\u201d in the absence of clinically confirmed gluten insensitivity [Diagnosis of NCGS is very difficult, mostly because of the lack of validated diagnostic criteria and the high nocebo and placebo effects of gluten . The trusitivity , 26.For those individuals that truly suffer from NCGS, the manifestations can be intestinal or extraintestinal. Intestinal manifestations include abdominal pain, bloating, and stool inconsistency, while extraintestinal manifestations can include fatigue, joint and muscle pain, and limb numbness. Moreover, neuronal manifestations can also present due to ingestion of gluten in some people. These manifestations include foggy mind, headache, gluten neuropathy, gluten encephalopathy, and gluten ataxia .Numerous studies have demonstrated that adherence to a GFD significantly increases the cost of food for adherents, with prices 2 to 3 times greater than for similar nongluten-free products \u201330. OverGFD can lead to nutritional deficiencies of macronutrients and micronutrients. Gluten-free foods, when compared to equivalent wheat-based foods, show deficiencies in minerals, including calcium, iron, magnesium, and zinc, and in vitamins, including vitamin B12, folate, and vitamin D, as well as significantly reduced fiber . A 2013 Notably, some food components known to be detrimental to health are higher in the GFD than in a regular diet. For example, a GFD increases dietary exposure to arsenic , and theFor patients diagnosed with CD, a gluten-free diet is the only treatment. Ingestion of gluten in these genetically predisposed individuals results in a T-cell-mediated immune reaction, leading to villous atrophy and clinical symptoms. Avoiding gluten prevents this response, and as such, for CD patients, a gluten-free diet is critical to their well-being.For sufferers of CD, the increase in popularity of a GFD among the general population has led to dramatically more selections of foods devoid of gluten, which are likely more palatable and more likely to be enriched with vitamins and minerals to meet the demands of an expanded marketplace. Also, more studies are aimed at finding those food sources that are still gluten free but higher in nutrients missing in a GFD.For individuals who do not suffer from CD, benefits of a GFD are less obvious. The positive outcomes of a nocebo/placebo effect for those with NCGS, even if it is not the gluten component of wheat that leads to their symptoms, cannot be discounted. For some individuals, this may justify the detriments of a GFD.The benefits of GFD continue to have an increased interest among researchers and practitioners working on the improvement of behavior in children with autism and other spectrum disorders. Even though some research informed that there was not significant evidence of improvement of functioning in children with autism, GFD was reported as well tolerated and safe . Lee et As outlined above, there is a risk of nutritional deficiencies when either adults or children are subject to a GFD. As such, it is imperative to have the right diagnosis before placing any child on a GFD. For children with celiac disease, there is no other diet to follow than the GFD, yet diagnosis of CD requires that an individual continue to eat gluten prior to the diagnosis. After diagnosis, having a diet without gluten will help those children to heal their intestine and absorb more nutrients than if they are ingesting gluten.In children that are diagnosed with NCGS, extra precaution needs to be taken because of the dangers of nutritional deficiency and the difficulty in achieving an accurate diagnosis absent a double-blind challenge, which is not typically achievable through a primary care healthcare provider. Tanpowpong et al.  found thThus, the actual prevalence of NCGS does not appear to justify the commonality of a GFD in children, given the potential detriments of a GFD. In fact, there is currently no evidence to support the imposition of a GFD in asymptomatic children in the absence of CD or documented wheat allergy .It is necessary for pediatricians, nurse practitioners, and other health professionals working with children to query parents about their choice of diet for their children. As a sizable slice of the population has misidentified limiting gluten intake as being beneficial to their health, it seems to follow that those who subscribe to this belief and who become parents may feel similarly about what their children eat. It is common during routine exams for healthcare practitioners to ask about whether kids eat vegetables and fruits to get a sense of their diet. It is also important to establish whether kids eat grains to determine whether parents might be unnecessarily limiting their children to a GFD.Although the long-term health effects of a GFD have not been established, a systematic review of prior studies has identified increased total cholesterol, high density lipoprotein, fasting glycemia, and body mass index as consistent findings . SimilarFor parents of children with CD, it is a common practice for gastroenterologists and/or nutritionists to consult with parents to teach them the limitations of a GFD and to ensure that their children not only avoid gluten but also to teach parents how to secure the nutrients that are likely to be missing from their child's diet. Similarly, with the risk of a GFD in the general population, healthcare practitioners need to proactively question whether their patients, whether children or adults, are following a gluten-free diet of their own volition.If patients, either adults or children, are suffering from symptoms that may be associated with CD, then referral to a gastroenterologist for proper diagnosis is critical. However, in the absence of symptoms, or vague descriptions of \u201cgluten allergy\u201d or other unrecognized disorders, patients who follow a GFD first need education on the true prevalence of CD and NCGS. They need to be taught of the need to secure sources of nutrients that may be limited in a GFD, and they need to know that following a GFD blindly may be harming themselves or their children. In the end, only persons with CD, WA, or confirmed NCGS should follow a GFD, and they should do so under medical supervision.Adults who self-administer a GFD and cite physical symptoms should be referred for CD testing. Adults who do not have CD but continue to insist on a GFD should be referred for nutritional counseling to ensure they are meeting their dietary needs and avoiding unnecessary hazards. Multivitamin/mineral and fiber supplements are a good idea for anyone attempting to avoid gluten to ensure adequate nutrition and to ensure proper bowel function.For children who are put on a GFD, often by well-meaning parents, in the absence of a clinically relevant diagnosis, it is important that the parent be educated on the risks of a GFD, the need for CD testing if the parents claim symptoms in the child, and the potential hazards to their child of a GFD. If they insist, a referral to nutritional counseling is warranted.While celiac disease patients must permanently remove gluten from their diet, the literature suggests that many individuals who claim to suffer from NCGS may in fact have no actual sensitivity to gluten although it is possible they are sensitive to other components of wheat. Alternatively, these individuals may be benefitting from a nocebo/placebo effect when it comes to adopting a GFD. It is likely, however, that the majority of persons adopting a GFD have no medical basis for doing so.The choice to adopt a GFD is often made by individuals without medical input, in the belief that they are adopting a healthier diet. Unfortunately, choosing GFD, irrespective of whether it is medically indicated, generally entails increased food costs, a decrease in fiber consumption, potential decreases in mineral and vitamin consumption, including calcium, magnesium, zinc, vitamin B12, folate, and vitamin D, and potentially increased exposure to dietary hydrogenated and saturated fatty acids, and arsenic. Clearly, adopting a GFD does not come without risk.In the end, only persons with CD, WA, or confirmed NCGS should follow a GFD, and they should do so under medical supervision. For individuals who insist on a GFD in the absence of a diagnosis that suggests its benefits outweighs its risks, nutritional counseling is recommended to ensure that these individuals can minimize the risks to themselves while still choosing the diet they prefer."}
+{"text": "There is accumulating evidence that deregulated Notch signaling affects cancer development, and specifically pancreatic cancer (PC) progression. Notch canonical and non-canonical signaling has diverse impact on PC. Moreover, the actions of RBP-Jk (nuclear partner of activated Notch) independent of Notch signaling pathway seem to affect differently cancer progression. Recent data show that in PC and other cancer types the adipokine leptin can modulate Notch/RBP-Jk signaling, thereby, linking the pandemic obesity with cancer and chemoresistance. The potential pivotal role of leptin on PC, and its connection with Notch signaling and chemoresistance are still not completely understood. In this review, we will describe the most important aspects of Notch-RBP-Jk signaling in PC. Further, we will discuss on studies related to RBP-Jk-independent Notch and Notch-independent RPB-Jk signaling. We will also discuss on the novel crosstalk between leptin and Notch in PC and its implications in chemoresistance. The effects of leptin-Notch/RBP-Jk signaling on cancer cell proliferation, apoptosis, and drug resistance require more investigation. Data from these investigations could help to open unexplored ways to improve PC treatment success that has shown little progress for many years. PC is one of the most malignant and chemotherapy-resistant tumors. That is mainly due to the lack of effective diagnosis at an early stage of tumor development and ineffective therapy. Resectable tumors at detection time comprise a low percentage of PC. Majority of PC are treated with non-specific target therapies, i.e., chemotherapeutic drugs, but its effectiveness is limited due to the dense tumor stroma (desmoplasia) and the acquisition of drug resistance. Multiple mechanisms are involved in PC chemoresistance, including aberrant gene expression, deregulation of key signaling pathways, development of the epithelial-mesenchymal transition (EMT), cancer stem cells and desmoplasia .A factor involved in cancer chemoresistance is the activation and deregulation of the Notch signaling pathway. Notch signaling has been recently linked to 5-FU resistance in PC . This emNgn3 gene, which antagonizes Hes1 and suspends Notch control , EMT  and PC stem cells (PCSC) .The expression of ABC family of proteins impairs the effects of chemotherapeutics by increasing the efflux of drugs from the cells. Several ABC transporters were upregulated in PC compared to non-neoplastic tissue . AdditioEMT induces higher migratory, invasive, anti-apoptotic and extracellular matrix degradation capacities that characterized the mesenchymal phenotype. EMT was associated with overexpression of Notch signaling components that correlated to higher migration and invasion of PC cells. Notably, EMT phenotype was reverted via Notch inhibition, which reduced the expression of ZEB1, Snail, Slug and Vimentin in PC cell lines ,71. MoreDCAMKL-1 is a microtubule-associated kinase that downregulates pluripotent cancer stem cell markers , but induces microRNA200 (miRNA200a). DCAMKL-1 was overexpressed in a subset of PanIN and PC cells. EMT was inhibited via knockdown of DCAMKL-1 that also inhibited Notch1 via miR-144 .The Notch signaling pathway is a component of the stem cell signaling network (SCSN) together with Wnt, FGF, BMP and Hedgehog signaling pathways . SCSN isCancer stem cells are commonly more resistant to chemotherapeutics, which preferably target the bulk of the tumor. Therefore, chemotherapeutic actions spare stem cells, which show higher expression of ABC proteins, detoxification proteins and survival pathways (NF-\u03baB and PI-3K) and diminished apoptosis rate . EarlierA wide-used PC drug, gemcitabine, increased PCSC expressing CD24+ and CD133+, stemness-associated genes , cell migration, chemoresistance, and tumorigenesis . GemcitaMicroRNAs (miRNA or miR) are noncoding endogenous RNA of 14-24 nucleotides that can regulate protein expression at the post-transcriptional level. Many studies have found strong correlations between deregulated miRNA and cancer. Decreased expression of microRNA (miRNA34 and miR200) families was early associated with PC progression and PCSC . It has MiRNA200 family , miR429, and miR141 have been implicated in PC chemoresistance. miR200c expression correlated with chemoresistance and less cancer invasion via repression of cancer stem cell self-renewal and differentiation, inhibition of EMT and attenuation of apoptosis. In PC, miR200 repressed self-renewal and differentiation of stem cells, and inhibited EMT by interacting with ZEB1/2 and the Notch pathway . MoreoveAdipokines (leptin and adiponectin) are adipose tissue-derived cytokines that can act in opposing manner: leptin contributes to a pro-tumorigenic phenotype, while adiponectin acts as anti-tumorigenic factor. The pluripotential actions of leptin as an inflammatory, mitogenic and proangiogenic factor, have been linked to cancer cell proliferation, recurrence, tumor angiogenesis and chemoresistance. We firstly reported that leptin induces the expression of Notch family components in breast cancer, which was linked to IL-1 signaling ,92,93. LRNA knockdown and pharmacological inhibitors of leptin signaling significantly abrogated the activity of reporter gene-luciferase CSL (RBP-Jk) promoter, showing that its activity was linked to JAK2/STAT3, MAPK, PI-3K/mTOR, p38 and JNK signaling pathways. DAPT (a GSI) and siRNA RBP-Jk abrogated leptin\u2019s effects on cell proliferation/migration, Notch, IL-1 and VEGF/VEGFR-2 . FurtherIt is known that leptin and Notch signaling mediate the activation of cancer stem cells that can affect drug resistance ,54,95. WOur published data also show that leptin is a survival factor for PC cells treated with chemotherapeutics. Interestingly, 5-FU\u2019s toxic effects on PC cells were impaired by leptin. PC cells treated with 5-FU in presence of leptin showed significantly higher proliferation rate and colony forming ability. In addition, these cells expressed higher levels of EMT, pluripotency and PCSC markers. Notably, leptin increased the expression of ABC proteins (ABCC5 and ABCC11), and Notch in PC cells treated with 5-FU. Moreover, leptin impaired 5-FU-induced apoptotic effects by increasing RIP and Bcl-XL and reducing Caspase-3 activation, PARP degradation and Bax expression. Remarkably, these leptin effects on PC cells treated with 5-FU were dependent of Notch signaling . In addiThe Notch signaling pathway can be inhibited pharmacologically, via GSI, anti-Notch antibodies, etc. GSI have been tested in clinical trials for many cancers, including PC. The agent RO4929097 in combination with gemcitabine was safely tolerated, achieved clinical antitumor activity and more than four months stable disease in PC, tracheal, and breast cancers . Dual trPC has also been treated with monoclonal antibody-based therapies. A fully humanized anti-Notch2 and Notch3 antibody (Tarextumab or OMP-59R5) reduced the growth of PC xenografts in mice when combined with cytotoxic drugs. Tarextumab  in combination with gemcitabine and nab-paclitaxel (Abraxane) was applied to untreated metastatic PC patients. The monoclonal antibody-based therapy allowed 5.6 months of median time of progression-free survival and 11.6 months of overall survival. PC patients with high levels of Notch3 showed better response . In anotRecent reports suggested that inhibitors of other components of Notch signaling , could open new targeted therapy opportunities. Indeed, the inhibition of ADAM10 (overexpressed in PC) via a calcium channel blocker (Fendiline) significantly reduced proliferation and tumorigenesis of PC cells . AdditioObesity, characterized by high levels of leptin, is a PC risk factor . In viewPre-clinical data from our laboratory have shown a potential for leptin signaling inhibition  as adjuvant for chemotherapeutic treatment of PC ,52,96,97PC dismal survival and poor treatment outcomes have been steady over years. Reported data underline the role of Notch in PC and other cancers development. However, the activation and regulation of Notch signaling in PC are still not completely understood. The specific contribution and regulation of Notch canonical and non-canonical signaling as well as the less investigated RBP-Jk signaling independent of Notch to oncogenesis and progression of PC remain scientific challenges. Leptin is a factor that could affect Notch signaling. Leptin\u2019s levels are increased in obesity that is pandemic and strongly linked to incidence of PC and other cancers. Analysis of recent data shows strong relationships between leptin and Notch/RBP-Jk signaling that could open new opportunities of research and potentially increase the success of PC treatment and decrease chemoresistance. The crosstalk between leptin, Notch and RBP-Jk signaling in PC warrants further investigations."}
+{"text": "Biological soil crusts (biocrusts) accommodate diverse communities of phototrophic and heterotrophic microorganisms. Heterotrophic protists have critical roles in the microbial food webs of soils, with Cercozoa and Endomyxa often being dominant groups. Still, the diversity, community composition, and functions of Cercozoa and Endomyxa in biocrusts have been little explored. In this study, using a high-throughput sequencing method with taxon-specific barcoded primers, we studied cercozoan and endomyxan communities in biocrusts from two unique habitats (subarctic grassland and temperate dunes). The communities differed strongly, with the grassland and dunes being dominated by Sarcomonadea (69%) and Thecofilosea (43%), respectively. Endomyxa and Phytomyxea were the minor components in dunes. Sandonidae, Allapsidae, and Rhogostomidae were the most abundant taxa in both habitats. In terms of functionality, up to 69% of the grassland community was constituted by bacterivorous Cercozoa. In contrast, cercozoan and endomyxan communities in dunes consisted of 31% bacterivores, 25% omnivores, and 20% eukaryvores. Facultative and obligate eukaryvores mostly belonged to the families Rhogostomidae, Fiscullidae, Euglyphidae, Leptophryidae, and Cercomonadidae, most of which are known to feed mainly on algae. Biocrust edaphic parameters such as pH, total organic carbon, nitrogen, and phosphorus did not have any significant influence on shaping cercozoan communities within each habitat, which confirms previous results from dunes. Globally distributed biocrusts entail an aggregation of soil particles and host diverse communities of terrestrial phototrophic and heterotrophic organisms ,2. HeterBiocrust consumers such as heterotrophic protists, rotifers, tardigrades, nematodes, and micro-arthropods are vital players in the soil food web . While pCercozoa and Endomyxa are considered as dominant groups of protists in soil ecosystems ,11,12,13Several studies were done on the diversity and community composition of Cercozoa in various soil habitats ,16,17,18The current study continues the previous work of Khanipour Roshan et al.  by focusIn this study using a high-throughput sequencing approach with specific barcoded primers , we asseThe studied areas are located in Germany  and Iceland. Biocrust samples were collected in dunes along the Baltic Sea shoreline of the German Federal State of Mecklenburg-Western Pomerania. The Baltic Sea coastline is influenced by a temperate continental climate. Climate parameters for the area were obtained from two nearby meteorological stations (Warnem\u00fcnde and Karlshagen) . Total pThe sampling locations in Iceland were established around Litla-Skard, which is situated in the west of the island, about 100 km north of Reykjav\u00edk. Iceland is a volcanic island with a subpolar oceanic climate featuring an annual average temperature of 3.1 \u00b0C. The average annual precipitation in the form of rain and snow is 930 and 100 mm, respectively (data are from the climate station Borgarnes) . The vegBiocrusts sampling took place in Germany  and Iceland . Along the Baltic Sea shoreline of the German Federal State of Mecklenburg-Western Pomerania, twenty samples of cyanobacterial-algal biocrusts were collected in coastal dunes on sun exposed slopes  were sampled  29]. Th. Th29]. For biocrust sampling, a column soil sampler (collector) was pushed 1 cm deep into the respective biocrusts and carefully lifted. Samples were gently transferred from the sampler to centrifuge tubes and immediately frozen in the field.DNA was extracted from about 0.25 g biocrust by using the MoBio Power Soil DNA isolation kit  and kept frozen until processing. To amplify a DNA fragment of about 350 base pairs from the variable nuclear 18S V4 region, a two-step PCR with barcoded primers specifically designed for Cercozoa was performed . In the As an internal standard, a mock community from known species of Cercozoa (ten cultures) was created for the bioinformatics pipeline . Aft\u221250 and keeping only the best hit, sequences were identified in the PR2 database [Paired reads were assembled using MOTHUR v.3.9 , allowindatabase , and nondatabase  as impledatabase ). Sequendatabase , with abdatabase . Finallydatabase . In thei2 (0.01 M) solution. Total organic carbon (TOC), total nitrogen (TN), and total phosphorus (TP) were determined from dried and milled biocrust material. TOC and TN were determined after acidification (10% HCl) to remove inorganic C, using a CHNS-Analyzer  [2S2O8 (0.2 mM) and 5 mL 9 N H2SO4 (50%) in 100 mL ultrapure water) in an oven (90 \u00b0C) for 24 h. After neutralization with 1 N HCl, the samples were alkalized with nitrophenol (0.8 g in 100 mL distilled water) (two to three drops), titrated with NaOH (1 M), and HCl (1 M), filled up to 100 mL with ultrapure water and filtered . With a spectral photometer , TP was measured at 885 nm [In the current study, the following chemical properties were determined in the biocrust samples. The pH was measured in a 1:2.5 soil/aqueous CaClGermany) ,37. TP wGermany)  after dit 885 nm  in compat 885 nm  . At a high taxonomic level, 85% of the sequences could be assigned to Cercozoa, 13% to Endomyxa, and 2% to novel-clade-10-12. Both habitats, the subarctic grasslands and temperate coastal dunes, shared 96.3% of OTUs, with only two unique OTUs (1.8%) detected in each , but thestomidae .At the family level, in the dune biocrusts, Rhogostomidae and Allapsidae occurred in almost similar proportions of 14% and 15%, respectively, followed by Euglyphidae (10%), the CCW10-lineage, unknown Thecofilosea, and undescribed Glissomonadida (8% each) . In contp = 0.03) (p = 0.02)  (p > 0.05) , H\u2019dunes = 2.14, H\u2019grassland = 2.43)  a. While  = 0.02) b. Variatctively) . At the  > 0.05) .2 = 0.14, p = 0.001, 2 = 0.08, p = 0.02) and the CN ratio  have a significant influence on the cercozoan and endomyxan community composition between these two habitats. Noteworthy, the factors organic C and CN ratio also differed clearly between Iceland and the German dunes . Biocrusts of the grasslands were dominated by bacterivores (70%) , while only 31% of the cercozoans in dune biocrust were bacterivores. The communities showed a comparatively high level of omnivory  and eukaryvory . Omnivory was mostly related to the families Rhogostomidae, Euglyphidae, and Cercomonadidae, and eukaryvory to the families Fiscullidae, Protaspa-lineage and, Leptophryidae. Omnivorous and eukaryvorous Cercozoa included potential and known algivores. Plant parasites (Phytomyxea) constituted 4% of the grassland communities, while in the dune communities, this trophic group was found in very low abundance . According to Seppey et al. [Rhogostoma may be the most abundant terrestrial algivorous protists. Therefore, it is not surprising that the third-most abundant cercozoan taxon in the present study was the algivorous Rhogostomidae (Thecofilosea), which was found in dune biocrusts with a proportion of 14%.In comparison to other habitats ,18,19,30y et al. , speciesLess abundant thecofilosean taxa in our survey were undescribed species of the Protaspididae, the CCW10_lineage, Fiscullidae, and Pseudodifflugiidae. Although the prey range of these taxa has not yet been determined, from their evolutionary position, it is likely that they feed on algae as well.In comparison with other studies ,67, the Another possible explanation of competition among taxa is the ecological preferences and adaptations of Cercozoa to habitat conditions, in a way that the theca (shell) of Thecofiloseans well protects against evaporation. This has long been hypothesized and was finally supported by a strong negative correlation between soil moisture and the abundance of sequence reads assigned to shell-bearing amoebae in Fiore-Donno et al. . As a coIn the current study, another dominant group belonged to the omnivorous order of Euglyphida . TraditiSpongospora nasturtii, Spongospora sp., and Plasmodiophora brassicae could be identified [The exceptionally low abundance of plant parasites sequences (Phytomyxea), especially in coastal dunes, can be explained by the low abundance of roots from vascular plants, whereas in the grassland with some coverage of higher plants, low abundances of OTUs assigned to entified .In this study, we discovered diverse communities of Cercozoa and Endomyxa in biocrusts from two contrasting habitats using a high-throughput sequencing method. In both habitats, we observed similar OTU richness but different alpha and beta diversity, and evenness. The composition of cercozoan and endomyxan communities within each habitat did not change under the influence of biocrust chemical properties, as at higher trophic levels, dependency on edaphic factors decreases. This suggests that other factors are responsible for shaping the community, such as prey communities or other habitat properties . As the OTU richness was found to be similar, it is likely that different microclimatic conditions in dunes and grassland caused most of the detected taxa to grow in different proportions. At a geographic level, soil organic carbon and CN ratio influenced the cercozoan and endomyxan community composition between the grassland and dune habitats, which suggests these factors as possible drivers for the observed difference.The dominance of bacterivores in grassland biocrusts suggests bacteria as the main food source, which growth is known to be stimulated by root exudates of the dominant vegetation. It seems that in dunes, a variety of food sources such as algae created an opportunity for a more pronounced community of algivores. For a better understanding of eukaryvory in biocrust food webs, the co-occurrence of algal and other eukaryotes  in different crust types with protists deserves more attention in future studies."}
+{"text": "Ser129\u03b1-Syn) is known to be closely associated with \u03b1-Synucleinopathies, especially Parkinson's disease (PD). The present study aimed to explore the \u03b1-Syn accumulation and its phosphorylation in the enteric nervous system (ENS) in patients without neurodegeneration. Patients who underwent colorectal surgery for either malignant or benign tumors that were not suitable for endoscopic resection (n = 19) were recruited to obtain normal intestinal specimens, which were used to assess \u03b1-Syn immunoreactivity patterns using \u03b1-Syn and pSer129\u03b1-Syn antibodies. Furthermore, the sub-location of \u03b1-Syn in neurons was identified by \u03b1-Syn/neurofilament double staining. Semi-quantitative counting was used to evaluate the expression of \u03b1-Syn and pSer129\u03b1-Syn in the ENS. Positive staining of \u03b1-Syn was detected in all intestinal layers in patients with non-neurodegenerative diseases. There was no significant correlation between the distribution of \u03b1-Syn and age (p = 0.554) or tumor stage (p = 0.751). Positive staining for pSer129\u03b1-Syn was only observed in the submucosa and myenteric plexus layers. The accumulation of pSer129\u03b1-Syn increased with age. In addition, we found that the degenerative changes of the ENS were related to the degree of tumor malignancy (p = 0.022). The deposits of \u03b1-Syn were present in the ENS of patients with non-neurodegenerative disorders; particularly the age-dependent expression of pSer129\u03b1-Syn in the submucosa and myenteric plexus. The current findings of \u03b1-Syn immunostaining in the ENS under near non-pathological conditions weaken the basis of using \u03b1-Syn pathology as a suitable hallmark to diagnose \u03b1-Synucleinopathies including PD. However, our data provided unique perspectives to study gastrointestinal dysfunction in non-neurodegenerative disorders. These findings provide new evidence to elucidate the neuropathological characteristics and \u03b1-Syn pathology pattern of the ENS in non-neurodegenerative conditions.Alpha-synuclein (\u03b1-Syn) is widely distributed and involved in the regulation of the nervous system. The phosphorylation of \u03b1-Syn at serine 129 (p Alpha-synuclein (\u03b1-Syn) is widely distributed in the nervous system and is involved in the regulation of synaptic plasticity, as well as the packaging and trafficking of vesicles  has been shown to be the most abundant form in intracellular inclusion bodies in the brain of patients with PD , leading to neurotoxicity . All the involved patients  attended Sun Yat-sen Memorial Hospital. Written informed consent for this research was obtained from all individuals prior to surgery. Intestinal specimens were obtained from patients who underwent colorectal surgery for malignant or benign tumors that were not suitable for endoscopic resection. A 2 cm-wide sample of the intestinal tract was taken as the initial specimen within a safe distance (10 cm) from the tumor , \u03b1-Syn and pathologic \u03b1-Syn were employed to assess their distribution patterns. For immunohistochemical staining, the initial tissue was immersed in 4% neutral formalin solution for fixation within 1 h after tissue extraction. All specimens were fixed for more than 48 h. Then, a 1.5 cm \u00d7 1.5 cm full-thickness intestinal sample was selected for paraffin embedding and preparation. Continuous sectioning was performed, and the thickness of each section was 4 \u03bcm.After baking , xylene dewaxing, and gradient alcohol (100\u201390\u201375%) dehydration, antigen retrieval of the samples on the slides was performed in a microwave oven with high fire for 10 min and medium-high fire for 10 min, using sodium citrate solution . Then, the sections were blocked using an endogenous peroxidase blocker (10 min) and 5% goat serum (15 min). They were then incubated with primary antibodies  antibody, 1:500, MABN826, Millipore, Billerica, MA, USA) at 4\u00b0C overnight, followed by incubation with a biotin-conjugated secondary antibody  for 15 min at room temperature (RT) and horseradish peroxidase (HRP)-labeled streptavidin  for 10 min at RT. After reaction with 3,3\u2032-Diaminobenzidine (DAB) peroxidase substrate , the slides were stained with hematoxylin, dried, and sealed with neutral resin. Detailed steps of immunohistochemistry are provided in the Ser129\u03b1-Syn. In a high power field of view, starting from one end of the myenteric plexus of the specimen, we obtained the visual fields of the specimen covering the entire myenteric plexus without overlap. Five visual fields across the plexus were assigned at random for counting, and the ratio of pSer129\u03b1-Syn positive neurons was generated from the mean of the number of pSer129\u03b1-Syn positive neurons divided by the total number of neurons across the five inspected fields was calculated.The immunohistochemically-stained sections were imaged using a Nikon eclipse 80 microscope and counted as follows: 1. The NF positive neuron count. The number of positive neurons in the myenteric plexus were counted at high magnification (20\u00d7) and the NF statistic was determined by the number of neurons observed and divided by the number of visual fields observed; 2. \u03b1-Syn expression. A semi-quantitative counting method was used to record the frequency of \u03b1-Syn expression, as 0- absence, 1- sparse (\u2264 1/4 positive staining area), and 2- small amount (\u2264 2/4 positive staining area), 3- common (\u2264 3/4 positive staining area), 4- rich (> 3/4 positive staining area) according to criteria from a previous study ; right colon group (Rc); left colon group (Lc), including the descending colon and sigmoid colon; and the rectum group (Re). This was done to exclude the influence of different sampling sites and to verify the rostro caudal gradient.t-test was used for multiple comparisons, including the inter-group comparison of NF and pSer129\u03b1-Syn. For semi-quantitative analysis, the Kruskal\u2013Wallis test was used to compare multiple samples between groups. The correlations were analyzed using Pearson correlation, except for the correlation analysis involving \u03b1-Syn and tumor staging, which was analyzed using the Spearman correlation test. The statistical significance was set at *P < 0.05, **P < 0.01, and ***P < 0.001).All experiments were performed in triplicate. Data are expressed as the mean \u00b1 SD. Data normality was tested using the Kolmogorov-Smirnov test. Differences between means were evaluated using a one-way analysis of variance (ANOVA) test followed by a homogeneity test using IBM SPSS Statistics 20 software . A least significant difference (LSD)-A total of 11 male and 8 female patients, aged between 39 and 84 years old, consented to participate and were enrolled in this study. They underwent colorectal surgery for either malignant tumors of the intestinal tract or benign tumors and were not suitable for endoscopic resection. The basic demographic data of patients in this study are shown in p = 0.822). There were inter-group differences in the NF counts among the Rc, Lc, and Re groups  (p = 0.281) . However, neurons in the mucosa and submucosa were too scattered to count and rate. The myenteric plexus was selected for comparison among the groups. Representative immunostaining of NFs in the myenteric plexus is shown in = 0.017) . The neu= 0.281) .p = 0.812) (p = 0.554)   . Figure = 0.812) . The dep= 0.554) , whereas= 0.008) . Semi-quS129\u03b1-Syn was observed only in the submucosa and the myenteric plexus and was detected in the cytoplasm of neurons. We used serial section staining to analyze co-localization. The representative distribution and expression of pathological \u03b1-Syn were observed, as shown in S129\u03b1-Syn deposits. No significant difference was observed in the deposition of pS129\u03b1-Syn between groups    (The deposition of p= 0.720) . Correla= 0.004) , suggest= 0.958) .p = 0.751). Spearman correlation analysis suggested a negative correlation between the tumor stage and the NF counts in the myenteric plexus of the ENS  (p = 0.095)   . There w= 0.095) . Further= 0.566) . Taken tSer129\u03b1-Syn were detected within the submucosal and myenteric plexus, as well as in enteric nerve fibers. This evidence argues against the role of ENS immunostaining of \u03b1-Syn as a diagnostic hallmark for \u03b1-Synucleinopathies and related neurodegenerative disorders. Our findings indicated that the level of pSer129\u03b1-Syn was age-dependent in the myenteric plexus, suggesting that the accumulation of \u03b1-Syn in the ENS might be a physiological change.In the present study, we explored the distribution of \u03b1-Syn and its phosphorylation modification in the non-neurodegenerative intestinal tracts. We employed full-thickness normal intestinal tissues from 19 patients with non-neurodegenerative diseases to explore the levels of \u03b1-Syn and phosphorylated \u03b1-Syn via immunohistochemistry staining. We found that in the intestinal tissues of patients without neurodegeneration, accumulation of \u03b1-Syn and pSer129\u03b1-Syn were present in individuals with and without PD . It is also supported the hypothesis that the accumulation of \u03b1-Syn is a physiological phenomenon.Our study is consistent with previous immunohistochemical studies on intestinal biopsies, in which \u03b1-Syn pathology in the ENS is not a proper indicator of \u03b1-Synucleinopathies. The presence of \u03b1-Syn in the human ENS appears to be a normal finding. In contrast to native \u03b1-Syn immunoreactivity, which remained uniform regardless of the patients' age, we found that the level of pSer129\u03b1-Syn occurs in the adult brain physiologically  between non-neurodegenerative cases and neurodegenerative cases might also cause different results. However, in the current study, we only focused on exploring the \u03b1-Syn status in the nearly normal ENS. Further studies involving larger samples and patients with neurodegeneration patients are required to provide stronger evidence for our conclusions.Ser129\u03b1-Syn was observed in the submucosa and myenteric plexus. This finding weakens the basis and reliability of gastrointestinal pathology as an auxiliary diagnosis for \u03b1-Synucleinopathies, including PD.Overall, we found that deposits of \u03b1-Syn in the ENS were presented in people with non-neurodegenerative disorders in a physiological state. In particular, the age-dependent appearance of pThe original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by Ethics Committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, China. The patients/participants provided their written informed consent to participate in this study.E-XT, Y-RL, and X-NJ designed the experiments and critically revised the manuscript. K-XH and D-ZZ performed the experiments. L-LB and D-YL collected patient information and specimens. L-LB, YC, and X-NJ analyzed and interpreted the data. L-LB and X-NJ wrote the manuscript. All authors read and approved the final manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Alpha-synuclein (\u03b1-syn) aggregation is the hallmark pathological lesion in brains of patients with Parkinson\u2019s disease (PD) and related neurological disorders characterized as synucleinopathies. Accumulating evidence now indicates that \u03b1-syn deposition is also present within the gut and other peripheral organs outside the central nervous system (CNS). In the current study, we demonstrate for the first time that \u03b1-syn pathology also accumulates within the liver, the main organ responsible for substance\u00a0clearance and detoxification. We further demonstrate that cultured human hepatocytes readily internalize oligomeric \u03b1-syn assemblies mediated, at least in part, by the gap junction protein connexin-32 (Cx32). Moreover, we identified a time-dependent accumulation of \u03b1-syn within the liver of three different transgenic (tg)\u00a0mouse models expressing human \u03b1-syn under CNS-specific promoters, despite the lack of \u03b1-syn mRNA expression within the liver. Such a brain-to-liver transmission route could be further corroborated by detection of \u03b1-syn pathology within the liver of wild type mice one month after a single striatal \u03b1-syn injection. In contrast to the synucleinopathy models, aged mice modeling AD rarely show any amyloid-beta (A\u00df) deposition within the liver. In human post-mortem liver tissue, we identified cases with neuropathologically confirmed \u03b1-syn pathology containing \u03b1-syn within hepatocellular structures to a higher degree (75%) than control subjects without \u03b1-syn accumulation in the brain (57%). Our results reveal that \u03b1-syn accumulates within the liver and may be derived from the brain or other peripheral sources. Collectively, our findings indicate that the liver may play a role in the clearance and detoxification of pathological proteins in PD and related synucleinopathies.The online version contains supplementary material available at 10.1186/s40478-021-01136-3. SNCA) have been genetically linked to autosomal dominant forms of PD  \u03b1\u2010syn tg and wild type (WT) control mice were isolated [n\u2009=\u20094, tg n\u2009=\u20096) and aged male mice  expressing the human wild type form of \u03b1\u2010syn (Thy-1-L61) were also used for this study. For tg\u00a0mice modeling MSA (MBP29) [n\u2009=\u20094, tg: n\u2009=\u20094). For App knock-in mice harboring Beyreuther/Iberian mutation (AppNL\u2212F mice) modeling AD, only brain and aged livers were used . All animals were housed in open cages on a 12:12\u00a0h reversed dark: light cycle in a temperature\u2010 and humidity\u2010controlled room and properly cared by the animal facility. All experiments involving mice were approved by the Local Animal Ethics Committees. The use and care of the animals were conducted in accordance with the EU Directive 2010/63/EU for animal experiments.Male mice used for this study were anesthetized with isoflurane before being transcardially perfused with 0.9% saline. After perfusion, the brain and liver were isolated then fixed in 4% PFA, followed by 70% ethanol before the tissue was paraffin embedded. Samples from young  , only brn\u2009=\u20094) were used for the study. Mice were anesthetized with isoflurane and were stereotactically injected with 5\u00a0\u03bcg total protein per brain . Material was injected with a Hamilton syringe at a rate of 0.1\u00a0\u03bcl per min into the right dorsal striatum  at a depth of 2.6\u00a0mm below the dura, with the needle in place for 10\u00a0min at target. After recovery from surgery, animals were monitored regularly for weight loss and general health status. Animals were sacrificed at 1-month post-protein injection by isoflurane anesthesia followed by transcardial perfusion with 0.9% saline. Brains and livers were then isolated and fixed in 4% PFA, followed by 70% ethanol and subsequent paraffin embedding as described above.The o\u03b1-syn preparations were diluted into sterile PBS and sonicated briefly before intracerebral injection. Male C57bl/6\u00a0N mice  used for excitation to acquire Z-stacks of consecutive confocal images. Overview images were taken using a Zeiss LSM 780 equipped with 405-, 488-, 559-, and 633\u00a0nm laser lines or a LSM 700 (see above) confocal laser-scanning microscope or with a Leica SP5 TCS MP inverted point-scanning confocal equipped with multiphoton for two photon excitations (710\u20131040\u00a0nm) equipped with a digital camera for widefield imaging.t-test when comparing two genotypes or two-way ANOVA with Tukey\u2019s test when comparing multiple samples and genotypes. For Western blot analyses, band intensities were quantified using ImageJ software (Fiji) software, and values with arbitrary units were normalized to the signal obtained from the protein loading control. In each data group, the results are expressed as the mean\u2009\u00b1\u2009SEM. For semi-quantitative RT-PCR, statistics were calculated using 2\u2212ddCt values, using One-way ANOVA with Tukey analysis for multiple comparisons. All data analyses were performed with GraphPad Prism 7.0 . Findings were regarded as significant when *p\u2009<\u20090.05, ****p\u2009<\u20090.0001.Statistical analyses were performed using a two-tailed unpaired Student\u2019s Given the abundant expression of Cx32 within liver hepatocytes and its recently identified role in promoting oligomeric \u03b1-syn uptake, we assessed whether the liver is susceptible to \u03b1-syn accumulation in PD. Therefore, we first investigated whether human hepatocytes could take up \u03b1-syn protein assemblies associated with PD . Thus, wTo further assess o\u03b1-syn uptake in primary human hepatocytes, we immunolabeled o\u03b1-syn with a pan-specific human \u03b1-syn antibody (14H2L1 (14H)) targeting the C-terminal region of the \u03b1-syn molecule (amino acids 121\u2013140)  on Tg brain and liver samples as well as non-Tg tissue sample controls (18\u00a0months). Using specific probes targeting human \u03b1-syn  under control of the neuronal Thy-1 promoter  antibody which recognizes \u03b1-syn pathology in PD brain . Using cWe next investigated the aggregation state of \u03b1-syn within the liver using Thioflavin T, a molecular probe known to stain fully mature amyloid structures in multiple neurological conditions. In our hands, however, Thioflavin T failed to label any of the \u03b1-syn deposits within aged A30P liver (data not shown), suggesting a limited sensitivity of the probe and/or the lack of fully mature \u03b1-syn amyloidogenic structures within the liver. To overcome this technical limitation, we next stained tissue sections with a highly sensitive class of amyloid dyes commonly known as luminescent conjugated oligothiophenes (LCOs), which are ligands identified to stain protein aggregates that are formed early in the aggregation process \u201340, 55. Given that the emission spectra of LCOs provide clues into the amylogenic state of its target , we nextTo further explore whether \u03b1-syn is transported from the brain to the liver, we took advantage of a widely established mouse model of PD involving \u03b1-syn injections in the brain leading to \u03b1-syn self-assembly and accumulation that is detected within the brain approximately within 20\u201330\u00a0days post-protein injection , 58. ThuGiven the inflammatory response generated by \u03b1-syn deposition in the brain and other organs outside the CNS, we next investigated whether the A30P liver is susceptible to inflammation as a result of a progressive \u03b1-syn deposition. We therefore performed hematoxylin and eosin (H&E) staining on young (3 months) and aged (18 months) liver tissue sections from WT and A30P mice. In WT mice, we observed no clear signs of inflammation regardless of age Fig.\u00a0C, D. IndGiven the progressive inflammatory state of the A30P liver compared to livers from wild type mice, we next assessed whether inflammatory cells co-localize with \u03b1-syn following its transport to the liver. Thus, we performed confocal image analyses on tissue sections from aged A30P mice and identified the presence of CD45-positve leukocytes Fig.\u00a0A\u2013D, CD11To further determine whether the accumulation of \u03b1-syn in the liver is not specific to the A30P model but rather a general phenomenon of synucleinopathies, we investigated the presence of human \u03b1-syn within the liver in a model of synucleinopathy overexpressing normal WT \u03b1-syn also under control of the Thy-1 promoter  thus modeling AD [AppNL\u2212F mice (20 months) lacked any detectable age-dependent A\u03b2 accumulation within the liver (data not shown). In mice of advanced age, however (24 months), we observed the presence of rare A\u03b2 inclusions within the liver positive for an array of widely used human specific A\u03b2 antibodies  harboring the Beyreuther/Iberian mutation  with confirmed \u03b1-syn deposition in the brain . In a double-blinded setting, we identified the presence of \u03b1-syn within the liver that was detected by human-specific \u03b1-syn antibodies in several neuropathologically confirmed cases as well as in age-matched control tissues . Although \u03b1-syn protein expression in neurons is under control of the same neuronal promoter in both A30P and L61 mice (Thy-1), the distinct degrees of \u03b1-syn liver accumulation may be due either to the different forms of human \u03b1-syn expressed (A30P vs wild-type) or to the differences in transgenic copies between these models. Thus, suggesting that \u03b1-syn deposition within the liver may be dependent on the brain region expressed, protein expression levels, the amount of \u03b1-syn deposits in the brain and/or the susceptibility of aggregation of the molecule (mutant vs WT), as well as the cell type in which \u03b1-syn is expressed (neurons vs oligodendrocytes) . In contSNCA mutations have been described to cause early onset forms of PD  [Currently five E/G/T/V) , 67. WhiE/G/T/V) . SimilarE/G/T/V) , 69. It E/G/T/V) . HoweverWhile we corroborated brain to liver transport following a single stereotactic injection of \u03b1-syn oligomers into the striatum of wild type mice 1-month post-protein injection, the route of delivery from the brain to liver remains unknown for both mice and humans. It is possible that the nodosa ganglia efferent neurons which connect the portal veins and hepatic arteries play a role in this process. Indeed, branches of both the vagal and splanchnic nerves directly innervate the liver via the portal area, and these connections are associated with the portal vein and bile ducts (for review please see ). FurtheAlthough we could identify \u03b1-syn pathology in the human liver, we were not able to pinpoint any significant differences on the location, accumulation (fluorescence intensity) or cellular morphology between neuropathologically confirmed cases and controls. Moreover, we could not explain why certain clinically diagnosed PD liver cases with high \u03b1-syn burden in the brain  had no detectable \u03b1-syn pathology in the liver. However, we cannot rule out the presence of \u03b1-syn pathology in other parts of the liver, given the size of the human liver and the random distribution of \u03b1-syn pathology. On the other hand, we also observed aged-matched control cases without evidence of neurodegeneration but with \u03b1-syn pathology in the liver (8 out of 14). The discrepancy to the findings in the animal models might be explained by the pure, brain-only expression of the \u03b1-syn driven by CNS-specific promoters in these models. While in the human cases \u03b1-syn could potentially reach the liver both from the brain and the periphery in line with bottom-up transmission hypothesis which indicates that the enteric/gut region is first affected with \u03b1-syn pathology, before the pathology progresses to the brain . HoweverIt is worth noting that over a decade ago, Ltic and colleagues reported the presence of multiple endogenous protein \u03b1-syn isoforms within the liver, kidney, lung, heart, adrenal gland and testis of both fetal and adult rat as well as human tissue samples . The ideTaken together, while multiple organs outside the CNS in PD cases have been reported to contain \u03b1-syn deposits, our study is the first to identify the presence of \u03b1-syn within liver hepatocytes in both cellular and animal models of PD as well as in humans. While we could identify \u03b1-syn deposition both in PD cases and non-diseased control subjects, the pathology was more common in PD patients. Together with our findings from the cell and animal experiments it is reasonable to conclude that liver \u03b1-syn could originate from the brain in the LBD-cases.Although the role of \u03b1-syn deposition within the liver both in humans and mice remains unknown, we hypothesize that \u03b1-syn is delivered from either the gut/peripheral tissues or brain to the liver before being cleared out of the body, as part of the organ\u2019s detoxification and clearance process. Indeed, we showed that human hepatocytes are capable of lowering the levels of \u03b1-syn over time. Moreover, the increase in the inflammatory state observed in aged A30P mouse model suggests that if the capacity of pathological protein clearance is insufficient,accumulated \u03b1-syn can lead to liver toxicity. In conclusion, we hypothesize that the liver is involved in the clearance of pathological protein aggregates, which may be a crucial mechanism in the removal of neurotoxic \u03b1-syn in PD and related synucleinopathies.Additional file 1: Figure 1. Primary human hepatocytes take up oligomeric \u03b1-syn assemblies in vitro. A\u2013F) Confocal image analysis of primary hepatocytes incubated with ATTO-550 labeled oa-syn (red) and then immunolabeled with Cx32 (green) demonstrate the internalization of o\u03b1-syn and a partial co-localization between the gap junction protein Cx32 . All cells were counterstained with DAPI (blue). Bars = 10 \u03bcm.Additional file 2: Figure 2. Immunoprecipitation of human \u03b1-syn oligomers pulls down Cx32. A\u2013D) Immunolabeling on primary human hepatocytes or E\u2013H) HuH-7 cells expressing Cx32 (red) using the human specific 14H antibody show no \u03b1-syn reactivity in the absence of \u03b1-syn treatment. I) Immunoprecipitation of human \u03b1-syn oligomers in HuH-7-Cx32 cells treated with \u03b1-syn oligomers pulls down Cx32 whereas untreated cells show no Cx32 pulldown and only the low and heavy chains of the antibody used are shown. J) Confocal image analysis of HuH-7 and HuH-Cx32 cells showing the morphology with or without Cx32 expression. Bars A\u2013H = 20 \u03bcm and J= 50 \u03bcm.Additional file 3: Figure 3. Cx32 expression in HuH-7 cells promote \u03b1-syn uptake. A, B) o\u03b1- syn uptake in WT HuH-7 cells (white bars) or HuH-7 cells expressing Cx32 (dotted bars) for different time periods using Western blot analysis. C) Quantification of human \u03b1-syn deposits in young (3 months) and aged (18 months) A30P liver tissue sections demonstrates a progressive accumulation \u03b1-syn over time. *p<0.05.Additional file 4: Figure 4. Human and mouse \u03b1-syn expression is restricted to the brain. A\u2013C) Confocal image analysis of liver tissue sections from aged A30P show no immunoreactivity to \u03b1-syn D\u2013F) WT livers in the presence or absence of primary antibody (14H) show no immunoreactivity to mouse \u03b1-syn. G) qRT-PCR analysis of human \u03b1-syn in A30P brain, liver and normal wild type brains. H) qRT-PCR analysis of endogenous m\u03b1-syn in A30P brain, liver and normal wild type brain and liver. n.s.= non-significant. ****p<0.0001, Bars = 20 \u03bcm.Additional file 5: Figure 5. Age dependent accumulation of human \u03b1-syn deposits within the liver of the L61 model of PD. A\u2013F) Confocal image analysis using the 14H antibody shows the presence of human \u03b1-syn deposits (red) in young liver sections (3 months) as small puncta located within the portal tracts and liver parenchyma. Insert within panel (A) shows the deposition of \u03b1-syn within the brain of the L61 mice at 3 months of age immunostained with pS129 antibodies (green). G\u2013L) Aged liver tissue sections (12 months) showing the progressive accumulation of human \u03b1-syn deposits within the portal tracts and liver parenchyma within the L61 model. Insert within panel (H) shows the deposition of \u03b1-syn at 12 months of age immunostained with pS129 antibodies (green). All tissue sections were counterstained with DAPI (blue). Bars = 20 \u03bcm.Additional file 6: Figure 6. Identification of human \u03b1-syn deposits within the MBP29 liver modeling MSA. A\u2013C) Confocal image analysis using the 14H antibody shows the presence of human \u03b1-syn deposits (red) in young liver sections (4 months) as small puncta located within the portal tracts and liver parenchyma. Insert within panel A shows the deposition of \u03b1-syn within the brain of the MBP29 mice at 4 months of age immunostained for total \u03b1-syn (green). D\u2013F) In some instances, we identified the presence of human \u03b1-syn within the sinusoidal region likely surrounding inflammatory cells. G\u2013I) Tissue sections lacking primary antibody (14H) show no human \u03b1-syn immunoreactivity. All tissue sections were counterstained with DAPI (blue). Bars = 20 \u03bcm.Additional file 7: Figure 7. Human and mouse \u03b1-syn expression in MBP29 mice is restricted to the brain. A) qRT-PCR analysis of human \u03b1-syn in MBP29 brain, liver as well as non- transgenic (non-Tg) wild type brains and liver samples. n.s.= non-significant. ****p<0.0001.Additional file 8: Figure 8. Identification of amyloid beta (A\u00df) deposits within the liver of NL-F mice liver modeling AD. A\u2013C) Confocal image analysis of NL-F livers (24-month) using the antibody 6E10. Insert within panel A shows the deposition of \u03b1-syn within the brain of the NL-F mice at 24 months of age immune-stained with N82E antibodies (green). D\u2013F) N82E shows the presence of human A\u00df inclusions (green) which co-localize with the rabbit monoclonal mOC65 antibody (red) within the liver parenchyma. G\u2013I) Tissue sections lacking primary antibody  show no A\u00df immunoreactivity. Bars = 20 \u03bcm.Additional file 9: Figure 9. Accumulation of \u03b1-syn within the human liver lacks pS129 immunoreactivity. Confocal image analysis on human liver tissue sections immunolabeled with the 211 human-specific antibody (green) demonstrates the presence of human \u03b1-syn deposits within human hepatocytes, portal tracts, and liver parenchyma, however, negative for pS129 immunoreactivity both in PD (A\u2013F) and aged-matched controls (CON) (G\u2013L). Bars = 20 \u03bcm.Additional file 10:\u00a0Table I. Primary antibodies and primers used in this study.Additional file 11:\u00a0Table II. Description of animal models of neurodegeneration used in this study.Additional file 12:\u00a0Table III. \u00a0Liver characterization of animal models of PD and MSA.Additional file 13:\u00a0Table IV. Clinical and pathological characterization of human cases included in this study."}
+{"text": "SNCA gene, which encodes \u03b1-Syn, cause familial forms of PD and are the basis of sporadic PD risk. Given the role of the \u03b1-Syn protein in the pathology of PD, animal models that reflect the dopaminergic neuronal loss and the widespread and progressive formation of \u03b1-Syn aggregates in different areas of the brain constitute a valuable tool. Indeed, animal models of PD are important for understanding the molecular mechanisms of the disease and might contribute to the development and validation of new therapies. In the absence of animal models that faithfully reproduce human PD, in recent years, numerous animal models of PD based on \u03b1-Syn have been generated. In this review, we summarize the main features of the \u03b1-Syn pre-formed fibrils (PFFs) model and recombinant adeno-associated virus vector (rAAV) mediated \u03b1-Syn overexpression models, providing a detailed comparative analysis of both models. Here, we discuss how each model has contributed to our understanding of PD pathology and the advantages and weakness of each of them.Alpha-synuclein (\u03b1-Syn) is a key protein involved in Parkinson's disease (PD) pathology. PD is characterized by the loss of dopaminergic neuronal cells in the substantia nigra pars compacta and the abnormal accumulation and aggregation of \u03b1-Syn in the form of Lewy bodies and Lewy neurites. More precisely, the aggregation of \u03b1-Syn is associated with the dysfunctionality and degeneration of neurons in PD. Moreover, mutations in the Here, we show that injection of \u03b1-Syn PFFs and overexpression of \u03b1-Syn mediated by rAAV lead to a different pattern of PD pathology in rodents. First, \u03b1-Syn PFFs models trigger the Lewy body-like inclusions formation in brain regions directly interconnected with the injection site, suggesting that there is an inter-neuronal transmission of the \u03b1-Syn pathology. In contrast, rAAV-mediated \u03b1-Syn overexpression in the brain limits the \u03b1-Syn aggregates within the transduced neurons. Second, phosphorylated \u03b1-Syn inclusions obtained with rAAV are predominantly nuclear with a punctate appearance that becomes diffuse along the neuronal fibers, whereas \u03b1-Syn PFFs models lead to the formation of cytoplasmic aggregates of phosphorylated \u03b1-Syn reminiscent of Lewy bodies and Lewy neurites. Parkinson's Disease (PD) is the second most common neurodegenerative disorder after Alzheimer's disease. Currently, PD affects 1%\u20132% of people over the age of 60 years, rising to 4% at age 80 years . PD is mThe neuropathological mechanisms underlying non-motor symptoms of PD are still poorly understood, but growing evidence suggests that the evolution of these symptoms may arise from the disruption of both dopaminergic and non-dopaminergic systems, and the involvement of diverse structures outside the nigrostriatal system . BesidesThe neuropathological hallmark of PD is the abnormal accumulation and aggregation of alpha synuclein protein (\u03b1-Syn) in form of Lewy bodies and Lewy neurites . It is wParkin gene, and some of those with the LRRK2 G2019S mutation, show neuronal degeneration but do not develop Lewy bodies  polyathic PD ; and 3) athic PD .Under normal conditions, native \u03b1-Syn exists in a dynamic equilibrium between unfolded monomers and \u03b1-helically folded tetramers with a low propensity to aggregation . The dec\u03b1-Syn undergoes various post-translational modifications, such as phosphorylation, truncation, ubiquitination, and nitration. Phosphorylation of \u03b1-Syn at the serine 129 residue is one of the major pathological markers of PD; 90% of \u03b1-Syn is phosphorylated in the brain of patients with PD while only 4% of \u03b1-Syn is phosphorylated in healthy brains . HoweverIn vivo amperometry recordings in rodents injected with \u03b1-Syn PFFs in combination with AAV-mediated overexpression of \u03b1-Syn reveal a reduction in dopamine release and reuptake rates in the striatum  the ability of propagation of \u03b1-Syn protein. These models can be classified as (a) neural stem cell transplantation into transgenic mice expressing human \u03b1-Syn  adman \u03b1-Syn  or \u03b1-Synan \u03b1-Syn , and (c)an \u03b1-Syn . Among tAlthough many studies support the prion-like nature of \u03b1-Syn and show that its propagation determines the temporal course of the disease, some observations have recently challenged this theory. The Braak staging is neither a proof nor an argument of the spreading hypothesis, it might be rather that certain subsets of neurons are affected by Lewy bodies much earlier than others and that, therefore, the intraneuronal lesions evolve sequentially . AnotherAnother crucial question that is not clear is whether the spreading of \u03b1-Syn is a driving factor for neuronal degeneration and progression of PD, or if it is an epiphenomenon that appears as a result of other alterations, such as lysosomal dysfunction . DespiteGBA1 gene are the main genetic risk factor for PD. The GBA1 gene encodes for GCase1, a lysosomal enzyme responsible for degrading the lipid glucosylceramide into ceramide and glucose , whereas others correspond to proteins that are involved in the transport to the lysosome (e.g. VPS35), mitophagy , or other autophagic-related functions , giving special interest to the differences observed between these two models. These observations are based on results obtained by our group and which are in line with the findings of previous studies.in vitro from recombinant \u03b1-Syn monomers. Subsequently, the aggregation of monomers into fibrils is induced and the fibrils are sonicated to generate short fibrils which after injection, trigger the aggregation, hyperphosphorylation and ubiquitination of endogenous \u03b1-Syn  or brain extracts containing Lewy bodies and \u03b1-Syn derived from PD patients or transgenic mice exhibiting \u03b1-Syn pathology. PFFs are generated us \u03b1-Syn . Intraceus \u03b1-Syn  and ratsus \u03b1-Syn  and non-us \u03b1-Syn . PFFs haus \u03b1-Syn , the subus \u03b1-Syn  and the us \u03b1-Syn . Similarus \u03b1-Syn . Most ofus \u03b1-Syn . It is wus \u03b1-Syn . Some stus \u03b1-Syn , and theus \u03b1-Syn . Our grous \u03b1-Syn Figure 1Also, these models have shown that pathological \u03b1-Syn can spread from the injection site to other anatomically interconnected brain regions following a fibrillary retrograde transport Figure 4Snca (i.e. \u03b1-Syn KO mice) does not lead to the formation of \u03b1-Syn inclusions or degeneration; an observation which supports that endogenous \u03b1-Syn is required for the development of the pathology , the sonicated \u03b1-Syn PFFs are heterogenous in nature and have different conformational features and biological effects . Rodents injected with different PFFs strains manifest different pathological severity and behavioral phenotypes, reflecting the great variability of the results, especially among different research studies . rAAV are an efficient vehicle for gene delivery in the brain area of interest and offer some characteristics that favor their use in modeling PD. rAAV efficiently transduce various cell types, confer long-lasting transgene expression, and can transduce dividing and non-dividing cells in the absence of an immune reaction . Given tOverexpression of wild type \u03b1-Syn or PD-associated mutants (A53T or A30P \u03b1-Syn) utilizing rAAV leads to a progressive loss of dopaminergic neurons in the SNc, a loss of dopamine terminals in the striatum , and a rIn the rAAV-\u03b1-Syn model, the presence of p\u03b1-Syn inclusions in the nigrostriatal system is concomitant with a significant loss of nigral dopaminergic neurons and the reduction in tyrosine hydroxylase immunoreactivity in the striatum. Overexpression of wild type or A53T human \u03b1-Syn induces a progressive loss of dopaminergic neurons in the SN over time . At 5 daSome studies show that rAAV-\u03b1-Syn expression causes the development of motor alterations, such as an increased apomorphine or amphetamine-induced rotation, defects in the stepping test or increased forepaw asymmetry in the cylinder test . These mIn the rAAV-\u03b1-Syn models, the transgene expression is dependent on the serotype, the promoter, the injection site, and the titer of rAAV. The serotype rAAV2 is the most extensively used to date, probably because its production and purification methods are well-established . HoweverThe efficiency of transgene expression is also determined by the design of the vector construct, and the promoter used to control the transgene expression. The most common promoters used are hybrid cytomegalovirus (CMV), chicken \u03b2-actin (CBA), phosphoglycerate kinase (PGK), and human synapsin I (Syn-1). These promoters provide high levels of transgene expression. In addition, some studies use post-transcriptional regulatory elements to improve the transgene expression, such as woodchuck hepatitis virus posttranscriptional regulatory element or polyadenylation sequence .SNCA multiplications  exacerbates the neurodegeneration and neuroinflammation induced by overexpression of A53T human \u03b1-Syn, reflecting the importance of genetic background , which facilitates the identification of new therapeutic targets . These mMore than two decades ago, \u03b1-Syn was identified as the main component of Lewy bodies. Since then, this protein has become established as a possible diagnostic biomarker in PD and therapeutic target. Also, numerous animal models have used this protein in attempts to reproduce PD. Each animal model offers specific aspects of the pathology of human PD, although none of them reproduce all the defining pathological and clinical features of the disease. The lack of comparable phenotypes between rodents overexpressing \u03b1-Syn or rodents injected with toxic \u03b1-Syn species reflects the difficulty of reproducing PD in animal models. Therefore, a thorough knowledge of the key features of these models is essential to choose the model that best suits the scientific questions that we want to solve. Here, we show that \u03b1-Syn PFFs models are suitable for studying the prion-like behavior of \u03b1-Syn and its propagation through the brain. While viral \u03b1-Syn overexpression models are especially useful to determine the mechanisms of \u03b1-Syn-induced toxicity but do not allow the study of their prion-like behavior. Despite these differences, both models are valuable tools for identifying novel therapeutic targets and the design and evaluation of potential therapies aimed at reducing the aggregation of \u03b1-Syn to alter disease progression.All experimental procedures were approved by Cajal Institute\u00b4s Bioethics Committee in accordance with the guidelines of the European Union Council Directive (DC86/609/CEE).RM conceptualized, arranged the review, and provided funding. MG-B generated the first draft, performed the experiments, and provided the figures. NG performed the experiments and supervised and approved the figures. PG-S contributed with the experiments and provided critical feedback. AM synthetized the \u03b1-Syn PFFs and provided mice injected with PFFs, and MD provided antibodies and tools for the experiments.This work was supported by grants from the Spanish Ministries of Science and Innovation (SAF2016-78207-R) and of Health, Consumption and Social Welfare, Instituto de Salud Carlos III (ISCIII), Centro de Investigaci\u00f3n Biom\u00e9dica en Red sobre Enfermedades Neurodegenerativas [CIBERNED] (CB06/05/00559 and PNSD2016I033) and from Ram\u00f3n Areces Foundation (172275) and from Europan Union\u00b4s Horizon 2020, research and innovation program, AND-PD project, grant agreement n\u00b0 848002 to RM and from the ERA-Net Euronanomed II JTC2015-DiaSyn project through the Spanish Ministries of Innovation, Science and Universities (PCIN-2015-98) to RM and the Walloon Region  to AM and MD (project N\u00b0 n\u00b01510352). MG-B was supported by a fellowship JAE-Intro 2019 from Consejo Superior de Investigaciones Cient\u00edficas. The authors acknowledge support of the publication fee by the CSIC Open Access Publication Support Initiative through its Unit of Information Resources for Research (URICI).AM is working as UCB Biopharma employee.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The aim of this systematic review was to analyze the types of human chewing simulator described in scientific literature. in vitro\u201d; \u201cdental materials\u201d; \u201cshear strength\u201d; \u201cfatigue fracture\u201d; \u201cbite force\u201d; \u201cprosthetic materials\u201d; \u201cchewing simulator\u201d; \u201cchewing machine\u201d; \u201csimulated mastication\u201d; and \u201cdental wear simulator.\u201d Two researchers worked independently to assess the titles and abstracts of the articles. The quality of the in vitro trials selected was evaluated by means of the Consolidated Standards of Reporting Trials scale. An electronic search was conducted in the databases PubMed, Embase and Scopus. The search strategy included 10 search terms: \u201cThe electronic search identified 80 articles related to the topic of interest. After reading the full texts, ten works were selected. The articles focused mainly on the design of chewing simulators. Most of them were considered of moderate quality. Regarding the characteristics that an ideal chewing simulator should encompass, the devices described in articles varied greatly in terms of movement, periodontal ligament simulation, force sensors, and the materials tested. No chewing simulator offers all the characteristics necessary to reproduce human masticatory movements and forces under the humidity and pH conditions of the oral cavity. A simulator that encompasses all these characteristics would make it possible to standardize trials involving simulated mastication. Key words:In vitro, dental materials, dental wear simulator. The mechanical properties of the materials used in dentistry must be thoroughly tested under laboratory conditions before they can enter clinical use. Trials of mechanical resistance  must be complemented by wear and fatigue testing.Wear means \u201cto damage, erode, or destroy by friction or use,\u201d while fatigue means \u201cweakness in metal or other materials caused by repeated variations of stress.\u201d In dentistry the usual terms used to describe these scenarios are aging and fatigue  has established a series of directives for good laboratory practice. But to date, no single standardized system has been determined for measuring wear and aging, as is the case when measuring traction and fracture resistance. In the currently available chewing simulators, variability in terms of the control and regulation of forces impacts negatively on the reproducibility and variability of results, and the difficulty of extrapolating l cavity .The aim of the present systematic review was to analyze the types of chewing simulator described in scientific literature.in vitro studies.This systematic review was conducted in accordance with Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) . It coulin vitro mastication; C = analysis; and O = human mastication.The review\u2019s PICO  question was: Which chewing simulator most resembles human mastication, in which P= chewing simulators; I = in vitro wear resulting from the action of chewing simulators. Inclusion criteria were: chewing device design was described, and test samples were described (teeth studied/antagonist teeth). These criteria were chosen to center the review on articles involving chewing simulation and oral conditions.The search identified articles that analyzed in vitro\u201d; \u201cdental materials\u201d; \u201cshear strength\u201d; \u201cfatigue fracture\u201d; \u201cbite force\u201d; \u201cprosthetic materials\u201d; \u201cchewing simulator\u201d; \u201cchewing machine\u201d; \u201csimulated mastication\u201d; and \u201cdental wear simulator\u201d. Boolean operators (\u201cOR\u201d and \u201cAND\u201d) were applied to link search terms to the research question  to assess the titles and abstracts of the articles identified in the initial search. The following variables were recorded for each article: author and year of publication, device, study teeth/antagonist teeth, simulated mastication movement, force sensors.in vitro studies included in analysis, their quality was evaluated by means of the Consolidated Standards of Reporting Trials (CONSORT) scale, modified to assess the quality of in vitro trials of dental materials  of load sensors for measuring the forces exerted. Seven articles stated the force applied. Conserva et al.  used a b , made from materials that exhibit resilient rather than rigid behavior. In this context, silicon and acrylic resin have been used to imitate periodontal ligament and alveolar bone, respectively .The simulator must be able to generate movements that imitate human mastication as far as a machine is able to. In mastication, the mandible moves in vertical and horizontal direction, making a bidirectional motion ,17. HoweIf wear testing is to be standardized and obtain comparable results, it is essential for the magnitude of forces generated by chewing simulators to be controlled to create specific test conditions, and for these to be identical for each specimen tested. For this reason, the simulator must be equipped with load sensors to record the loads applied, as in some of the studies reviewed ,8,11-14.In vitro studies may use human saliva or de-ionized water, among other liquids, as a lubricant or even as an abrasive/erosive medium (To simulate conditions in the oral medium, some studies have attended to environmental factors such as humidity/wetness, temperature and pH, which can also influence the mechanical properties and behavior of dental materials in the mouth. The body acts as a heat pump that maintains the temperature in the oral cavity at 37\u00baC. Teeth and any restoration material are continuously bathed in saliva with a pH of around 7. Humidity in the cavity is 100%. However, the introduction of different foods in the mouth can alter environmental conditions to a large degree, causing fluctuations in pH and temperature. An artificial oral environment should be able to reproduce normal conditions in the oral cavity, and to manage the temperature and pH fluctuations that may occur. e medium ,13,15,18et al. (There are few bibliographic references regarding the design of models for use in chewing simulators for trials involving simulated mastication. Several parameters have not been sufficiently investigated, including the curve of Spee and the curve of Wilson. Alemzadeh et al.  analyzedin vitro study that was the subject of the review. The search did not include the Cochrane database as it does not admit in vitro research. The quality of most of the studies was moderate as it is hard for this type of in vitro research to meet the criteria that would deem it of high quality.The present systematic review suffered certain limitations. Despite conducting a search in the databases, only a small number of relevant articles were identified, which might be explained by the difficulties involved in carrying out the type of The present systematic review did not identify any chewing simulator that includes all the characteristics that would make it possible for complete upper and lower dental arches to reproduce the movements of human mastication under the actual humidity and pH conditions in the oral cavity. There is need for a simulator that meets all these requirements in order to standardize future trials involving simulated mastication."}
+{"text": "Autosomal dominant mutations in LRRK2 that enhance kinase activity cause Parkinson's disease. LRRK2 phosphorylates a subset of Rab GTPases including Rab8A and Rab10 within its effector binding motif. Here, we explore whether LRRK1, a less studied homolog of LRRK2 that regulates growth factor receptor trafficking and osteoclast biology might also phosphorylate Rab proteins. Using mass spectrometry, we found that in LRRK1 knock-out cells, phosphorylation of Rab7A at Ser72 was most impacted. This residue lies at the equivalent site targeted by LRRK2 on Rab8A and Rab10. Accordingly, recombinant LRRK1 efficiently phosphorylated Rab7A at Ser72, but not Rab8A or Rab10. Employing a novel phospho-specific antibody, we found that phorbol ester stimulation of mouse embryonic fibroblasts markedly enhanced phosphorylation of Rab7A at Ser72 via LRRK1. We identify two LRRK1 mutations (K746G and I1412T), equivalent to the LRRK2 R1441G and I2020T Parkinson's mutations, that enhance LRRK1 mediated phosphorylation of Rab7A. We demonstrate that two regulators of LRRK2 namely Rab29 and VPS35[D620N], do not influence LRRK1. Widely used LRRK2 inhibitors do not inhibit LRRK1, but we identify a promiscuous inhibitor termed GZD-824 that inhibits both LRRK1 and LRRK2. The PPM1H Rab phosphatase when overexpressed dephosphorylates Rab7A. Finally, the interaction of Rab7A with its effector RILP is not affected by LRRK1 phosphorylation and we observe that maximal stimulation of the TBK1 or PINK1 pathway does not elevate Rab7A phosphorylation. Altogether, these findings reinforce the idea that the LRRK enzymes have evolved as major regulators of Rab biology with distinct substrate specificity. Mammals possess two homologs of the leucine-rich repeat protein kinase termed LRRK1 and LRRK2 . Both enDespite overall domain similarity, LRRK1 and LRRK2 appear to possess distinct physiological functions. Genetic evidence in humans, points towards LRRK1 regulating bone biology and LRRK2 contributing to Parkinson's disease. Autosomal recessive variants that induce frameshift or truncating mutations within the C-terminal domain of LRRK1, that are likely loss of function, cause a severe metabolic bone disorder termed osteosclerotic metaphyseal dysplasia (OSMD) . This isLRRK2 phosphorylates a subgroup of Rab proteins  at a conserved Thr/Ser residue (Thr73 for Rab10), located within the effector binding switch-II motif . As mentCo-immunoprecipitation studies revealed that LRRK1 interacts with numerous components of the EGF Receptor signaling pathway . EGF stiOther work has suggested that LRRK1 is recruited to the autolysosome during autophagy, where it activates the Rab7 GTPase-activating protein termed TBC1D2, thereby switching off Rab7A function . LRRK1 h32P]ATP was purchased from PerkinElmer. HG-10-102-01, MLi-2, GSK2578215A, LRRK2-IN1, MRT67307, GDC0941, AG1478, BID1870, H-89, PD0325901, UO1216, Rapamycin and Phos-tag acrylamide were all synthesized by Natalia Shpiro (University of Dundee). Phos-tag acrylamide stocks are stored in aliquots at \u221280\u00b0C and working stocks are stored for a few weeks at 5\u2005mM aqueous solution at 4\u00b0C in opaque tubes given the photo-sensitive nature of this reagent. iN04 was purchased from ChemBridge Corporation (#7989904). Full-length recombinant human LRRK2[G2019S] was purchased from Invitrogen (#A15202). GZD-824 was purchased from Cayman Chemical (#21508) and calyculin A (#ab141784) was purchased from Abcam, Inc. Phorbol 12-myristate 13-acetate (PMA) (#P8139), interleukin-1A (#I2778), oligomycin (#75351), antimycin A (#A8674), AICAR (#A9978) and forskolin (#F6886) were all purchased from Sigma\u2013Aldrich. Human EGF (#8916), and human IGF-1 (#3093) were purchased from cell signaling technology (CST). PKC-specific inhibitor GO6983 was purchased from Selleckchem (#S2911). ON-TARGETplus SMARTpool human LRRK1 (#L-005320-00-0005), human LRRK2 (#L-049666-00-0005) and non-targeting control pool (#D-001810-10-20) siRNA were purchased from Horizon Discovery. (DU24813), HA-Rab29 (DU50222), GFP-Empty (DU44062), GFP-Rab7A wt (DU24785), GFP-Rab7A[S72A] (DU24814), GFP-LRRK2 wt (DU48062), GFP-LRRK2[D2017A] (DU48063), GFP-LRRK1 wt (DU30382), GFP-LRRK1[D1409A] (DU67084), GFP-LRRK1 [K746G] (DU67083), GFP-LRRK1[Y971F] (DU67289), GFP-LRRK1[K746G\u2009+\u2009Y971F] (DU66249), GFP-LRRK1[F1022C] (DU67082), GFP-LRRK1[G1411S] (DU67099), GFP-LRRK1[E929*] (DU66390), GFP-LRRK1[E929K] (DU66384), GFP-LRRK1[E929Q] (DU66391), GFP-LRRK1[Y971C] (DU66385), GFP-LRRK1[I1412F] (DU66395), GFP-LRRK1[E1980A-FS] (DU68320), FLAG-LRRK1[D1409A] (DU17400), FLAG-LRRK1[K746G] (DU67104), GFP-RILP (DU27496), HA-PPM1H wt (DU62789), HA-PPM1H[H153D] (DU62928), HA-PPM1J wt (DU68077), HA-PPM1J[H160D] (DU68170), HA-PPM1M wt (DU68124), and HA-PPM1M[H127D] (DU68165). These are available from MRC PPU Reagents and Services . The rabbits were immunized with peptides C-Ahx-AGQERFQS*LGVAFYR-amide and Ac-AGQERFQS*LGVAFYR-Ahx-C. Three subcutaneous injections were performed using the KLH immunogens, followed by two subcutaneous injections using the ovalbumin immunogens. At the time of each injection, an immunogen aliquot was thawed and combined with Freund's Complete  Adjuvant or Freund's incomplete Adjuvant (for the subsequent injections). Serum bleeds were obtained after the fourth and fifth immunizations. Antibodies were affinity-purified using the phosphorylated epitopes as a positive selection and also passed through a column containing the dephosphorylated peptide as a negative selection step. The affinity-purified antibodies were evaluated in parallel with serum. The subsequent rabbit polyclonal antibodies were diluted in 5% (by mass) BSA  in TBST Buffer  Tween-20) and used for immunoblotting analysis at a final concentration of 1\u2005\u00b5g/ml. The antibody was generated by The Michael J. Fox Foundation's research tools program in partnership with Abcam. Development of a monoclonal antibody is underway. Please contact https://mrcppureagents.dundee.ac.uk/). anti-LRRK1 was produced by immunization with C-terminal LRRK1 protein  followed by three further injections 28 days apart, with bleeds performed seven days after each injection. Antibodies were affinity-purified from serum using LRRK1 antigen. For immunoblotting analysis, all sheep polyclonal antibodies were diluted in 5% (by mass) milk in TBST buffer. Rabbit monoclonal phospho-Ser935 LRRK2 (UDD2) was expressed and purified at University of Dundee as described previously  (Novex) and heated at 95\u00b0C for 5\u2005min. For normal SDS\u2013PAGE, 10\u201320\u2005\u00b5g samples were loaded on to 4\u201312% Bis-tris gradient gels and electrophoresed at 180\u2005V for 90\u2005min. Proteins were transferred onto nitrocellulose membranes at 90\u2005V for 90\u2005min on ice in transfer buffer . Transferred membranes were blocked with 5% (by mass) milk in TBST Buffer at room temperature for 60\u2005min. Membranes were then incubated with primary antibodies diluted in blocking buffer overnight at 4\u00b0C. After washing in TBST, membranes were incubated at room temperature for 1\u2005h with near-infrared fluorescent IRDye antibodies (LI-COR) diluted 1\u2009:\u200910\u2009000 in TBST and developed using the LI-COR Odyssey CLx Western Blot imaging system and signal quantified using the Image Studio software2 before loading. Gels for Phos-tag SDS\u2013PAGE consisted of a stacking gel  and a separating gel . An amount of 10\u201330\u2005\u00b5g of samples were loaded and electrophoresed at 70\u2005V for 30\u2005min and at 120\u2005V for 2\u2005h in running buffer . Gels were washed in transfer buffer containing 10\u2005mM EDTA and 0.05% (by mass) SDS three times for 10\u2005min, followed by one wash in transfer buffer containing 0.05% (by mass) SDS for 10\u2005min. Proteins were transferred onto nitrocellulose membranes  at 100\u2005V for 180\u2005min on ice in the transfer buffer without SDS/EDTA. Subsequent immunoblotting was performed as previously described.Phos-tag SDS\u2013PAGE was carried out as described previously . Samples2HPO4, 1.8 KH2PO4, pH 7.4) for 1\u2005h at room temperature followed with three times for 15\u2005min washes with 0.2% (by mass) BSA in PBS . Then slides were incubated with Alexa Fluor\u00ae 405 goat anti-mouse secondary antibody (Invitrogen A-31553) diluted 1\u2009:\u2009500 and HCS CellMask\u2122 Deep Red Stain  at 0.5\u2005\u00b5g/ml dilution in 1% (by mass) BSA in PBS for 1\u2005h. Slides were washed three times for 15\u2005min with 0.2% (by mass) BSA in PBS and rinsed with distilled water just before mounting. VECTASHIELD\u00ae HardSet\u2122 Antifade Mounting Medium  was used to mount the coverslips on glass slides . Slides were then imaged using Leica TCS SP8 MP Multiphoton Microscope using a 40\u00d7 oil immersion lens choosing the optimal imaging resolution with 1-pixel size of 63.3\u2005nm\u2009\u00d7\u200963.3\u2005nm.For analysis of Rab29 co-localization with LRRK1 and LRRK2, HeLa cells were seeded in six-well plates on glass coverslips . Cells were transfected using Polyethylenimine method  employinE. coli transformed with plasmids encoding for the expression of His-SUMO-Rab7A[wt] (Plasmid DU24781), His-SUMO-Rab7A[S72A] (DU24808) or His-SUMO-Rab10[wt] (Plasmid DU51062). Bacteria were cultured at 37\u00b0C to an OD600 of 0.4\u20130.6, then temperature reduced to 15\u00b0C and protein expression was induced by addition of Isopropyl \u03b2-d-1-thiogalactopyranoside at 250\u2005\u00b5M. Cells were cultured for 16\u2005h before harvesting by centrifugation at 4200\u2009\u00d7\u2009g for 20\u2005min at 4\u00b0C. The pellet was resuspended in 200\u2005ml ice cold E. coli lysis buffer . Cells were lysed using a cell disruptor (passing sample through twice) and extracts clarified by centrifugation at 15\u2009000\u2005rpm for 20\u2005min at 4\u00b0C. Subsequent supernatants were run on 15\u2005ml of Cobalt-Agarose resin , previously equilibrated in E. coli lysis buffer, at 4\u00b0C for 90\u2005min. The column was then washed with 20 column volumes of High Salt Wash Buffer  until no unbound protein was present in the flow-through. The column was then washed with five column volumes of Low Salt Wash buffer . His-SENP1 (DU39129) (1\u2009:\u200930 dilution) was then added to the column overnight at 4\u00b0C to cleave the His-SUMO tag. Cleaved protein was collected and subjected to gel filtration on a Superdex 75 Hi load column, previously equilibrated in Equilibration buffer . An amount of 0.2\u2005ml fractions were collected at a flow rate of 0.2\u2005ml/min, with protein-containing fractions pooled, subjected to spin concentration using an Amicon Ultra 15 10\u2005KDa and finally snap frozen.4\u2009\u00d7\u2009500\u2005ml of Lysogeny broth containing 100\u2005\u00b5g/ml ampicillin antibiotic was inoculated with a single colony of BL21-CodonPlus(DE3)-RIPL strain of 06 cells/ml in Lonza Insect-XPRESS medium) were infected with high-titre Baculovirus suspension. After 66\u2005h of incubation (27\u00b0C and 90\u2005rpm), cells were harvested by centrifugation. The expressed protein construct contained an N-terminal His6-Z-tag, cleavable with TEV protease. For LRRK1 purification, the pelleted Sf9 cells were washed with PBS, re-suspended in lysis buffer  glycerol) and lysed by sonication. The lysate was cleared by centrifugation and loaded onto a Ni NTA column. After vigorous rinsing with lysis buffer the His6-Z-tagged protein was eluted in lysis buffer containing 300\u2005mM imidazole. Immediately thereafter, the eluate was diluted with buffer containing no NaCl, to reduce NaCl to 250\u2005mM and loaded onto an SP-Sepharose column. His6-Z-TEV-LRRK1 was eluted with a 250\u2005mM to 2.5\u2005M NaCl gradient and treated with TEV protease overnight to cleave the His6-Z-tag. Contaminating proteins, the cleaved tag, uncleaved protein and TEV protease were removed by another combined SP-Sepharose Ni NTA step. Finally, LRRK1 was concentrated and subjected to gel filtration in storage buffer  using an AKTA Xpress system combined with an S200 gel filtration column. The final yield as calculated from UV absorbance was 0.1\u2005mg/L.The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC. The T4 polymerase-treated amplicon was inserted into the transfer vector pFB-6HZB (SGC) by ligation-independent cloning. The resulting plasmid was utilized for the generation of recombinant Baculoviruses according to the Bac-to-Bac expression system protocol (Invitrogen). Exponentially growing Sf9 cells (2\u2009\u00d7\u2009102 and 1\u2005mM ATP. The kinase reactions were carried out at 30\u00b0C for the indicated times and reactions terminated by the addition of 4\u00d7 SDS\u2013PAGE sample buffer containing 1% (by vol) 2-mercaptoethanol. Twenty percent of total reaction volume was used for Phos-tag Coomassie staining analysis; <10% was used for conventional immunoblot analysis.Kinase assays were set in a 20\u2005\u00b5l final reaction mixture containing purified Rab proteins , recombinant LRRK1  or full-length LRRK2[G2019S]  and 50\u2005mM Tris\u2013HCl pH 7.5, 0.1\u2005mM EGTA, 10\u2005mM MgCl32P]ATP (specific activity: \u223c3000\u2005Ci/pmol) for 1\u2005h at 30\u00b0C. The reactions were stopped by the addition of 4\u00d7 SDS\u2013PAGE sample buffer containing 1% (by vol) 2-mercaptoethanol, and samples were subjected to electrophoresis on a 4\u201312% SDS\u2013PAGE gels. The gels were was stained with Coomassie blue and the band corresponding to Rab7A was excised and washed with water (10\u2005min) and subsequently subjected to two rounds of washes with 100% acetonitrile and 50\u2005mM Tris\u2013HCl pH 8.0 (5\u2005min per wash). Gel pieces were then reduced by incubation in 5\u2005mM DTT in 50\u2005mM Tris\u2013HCl pH 8.0 at 65\u00b0C for 20\u2005min. This was followed by alkylation of the samples by addition of 20\u2005mM iodoacetamide in 50\u2005mM Tris\u2013HCl pH 8.0 for 20\u2005min. The gel pieces were then washed with 100% acetonitrile, 50\u2005mM Triethylammonium bicarbonate and again 100% acetonitrile (5\u2005min each). Any remaining acetonitrile was removed with a pipette before adding trypsin (5\u2005mg/ml in 50\u2005mM Triethylammonium bicarbonate in a volume sufficient to cover the gel pieces) for overnight digestion at 30\u00b0C. The resulting tryptic peptides were extracted from the gel pieces by addition of 100% acetonitrile. These were subsequently resuspended in 0.1% (by vol) trifluoroacetate (TFA) in 5% (by vol) acetonitrile before being separated on a reverse-phase HPLC Vydac C18 column (Separations Group) with an on-line radioactivity detector. The column was equilibrated in 0.1% (v/v) trifluoroacetic acid and developed with a linear acetonitrile gradient at a flow rate of 0.2\u2005ml/min. Fractions (0.1\u2005ml each) were collected and analyzed for 32P radioactivity by Cerenkov counting with a tricarb scintillation counter. All the identified phosphopeptide fractions were analyzed by liquid chromatography (LC)\u2013MS/MS using a Thermo U3000 RSLC nano liquid chromatography system (Thermo Fisher Scientific) coupled to a Thermo LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific) to determine the primary sequence of the phosphopeptides. Data files were searched using Mascot (www.matrixscience.com) run on an in-house system against a database containing the appropriate Rab sequences, with a 10\u2005ppm mass accuracy for precursor ions, a 0.6\u2005Da tolerance for fragment ions, and allowing for Phospho (ST), Phospho (Y), Oxidation (M), and Dioxidation (M) as variable modifications. Individual MS/MS spectra were inspected using Xcalibur 2.2 (Thermo Fisher Scientific), and Proteome Discoverer with phosphoRS 3.1 (Thermo Fisher Scientific) was used to assist with phosphosite assignment. The site of phosphorylation of 32P-labeled peptides was determined by solid-phase Edman degradation on a Shimadzu PPSQ33A Sequencer of the peptide coupled to Sequelon-AA membrane (Applied Biosystems) as described previously  mutant with Rab7A in HEK293 cells. Immunoblot analysis of cell extracts revealed that wild type LRRK1 but not kinase inactive LRRK1[D1409A] induced significant phosphorylation of Rab7A . In para32P-ATP  in Sf9 insect cells . We also32P-ATP  and subjly Ser72 . We alsote Rab7A . These rAs previous work had demonstrated that LRRK1 co-immunoprecipitates with components of the EGF receptor signaling pathway , we testin vivo, especially after short time points following mitochondrial depolarization  , LRRK1[F1022C] , LRRK1[G1411S]  and LRRK1[I1412T]  . In addihttps://www.ncbi.nlm.nih.gov/snp/;   and LRRK1[I1412T]  promoted Rab7A phosphorylation also indicates that LRRK1 could be regulated similarly to LRRK2. The LRRK2[R1441G] mutation in the ROC domain increases LRRK2 mediated phosphorylation of Rab10, 3 to 4-fold. The LRRK2[R1441G] mutation also enhances affinity of LRRK2 towards its upstream activator, Rab29 . The LRRMutations that delete the C-terminal eight residues of LRRK2 ablate kinase activity . Recent Previous work indicated that Rab7A phosphorylation is mediated by the PINK1/TBK1 signaling pathways in experiments undertaken in HeLa cells overexpressing Parkin . These sOur data show that the PPM1H protein phosphatase previously shown to dephosphorylate Rab proteins phosphorylated by LRRK2 , was alsIn future work it would be also be important to probe the functional consequences of Rab7A Ser72 phosphorylation. In a previous study where stoichiometry of Rab7A was not verified, it was reported that overexpression of LRRK1[Y971F] mutant enhanced binding of Rab7A to one of its well characterized receptors termed RILP . In our d.r.alessi@dundee.ac.uk). All reagents (and associated datasheets) generated at the MRC Protein Phosphorylation and Ubiquitylation Unit at the University of Dundee can be requested through our reagent's website https://mrcppureagents.dundee.ac.uk/.All of the primary data that is presented in this study can be requested in electronic form by contacting Dario Alessi ("}
+{"text": "In the paper, we provide a detailed description of the enzyme catalytic cycle, model calibration based on a series of in vitro kinetic data, and model validation using experimental data on the regulatory properties of PGHS-1. The validated model of PGHS-1 with a unified set of kinetic parameters is applicable for in silico screening and prediction of the inhibition effects of NSAIDs and their combination on the balance of pro-thrombotic (thromboxane) and anti-thrombotic (prostacyclin) prostaglandin biosynthesis in platelets and endothelial cells expressing PGHS-1.The kinetic model of Prostaglandin H Synthase-1 (PGHS-1) was developed to investigate its complex network kinetics and non-steroidal anti-inflammatory drugs (NSAIDs) efficacy in different in vitro and in vivo conditions. To correctly describe the complex mechanism of PGHS-1 catalysis, we developed a microscopic approach to modelling of intricate network dynamics of 35 intraenzyme reactions among 24 intermediate states of the enzyme. The developed model quantitatively describes interconnection between cyclooxygenase and peroxidase enzyme activities; substrate  and reducing cosubstrate competitive consumption; enzyme self-inactivation; autocatalytic role of AA; enzyme activation threshold; and synthesis of intermediate prostaglandin G The enzyme state containing heme with two oxidizing equivalents\u2014one on the iron and another one on the porphyrin radical cation\u2014is referred to as Intermediate 1  state. The E2 state can be converted back to the resting state E1 by 2 consecutive reactions with RC by followed release of oxidized cosubstrate, OC (reactions 12 and 10). Alternatively, the E2 state can undergo one-electron internal reduction via intramolecular electron transfer from Tyr385 residue in the COX site to protoporphyrin (reaction 13) resulting in the formation of the E5 state  containing Tyr385 radical (Tyr385*) and a ferryl heme. This state is referred to as Intermediate II  referred to as Intermediate II  (E9), containing AA in the COX site. Reaction 2 corresponds to the abstraction of a hydrogen atom from AA by Tyr385 radical and formation of the E13 state containing AA radical in the COX site, . Further, AA* reacts with two oxygen molecules, and the intermediate product PGG2 radical (PGG2*) is produced (reaction 3). We assumed that binding of the first and second oxygen molecules is a rapid process, during which the redox state of the heme remains unchanged  with one oxidising equivalent on iron, and therefore, each of the enzyme states E5, E8, E9, and E13 can potentially participate in redox reactions with RC , producing catalytic states E12, E15, E16, and E20. The later states can be considered as intermediates of an additional COX2 cycle. Note that similar COX cycle was included in the model developed by Kulmacz et al.  (state E11). Note, that similar COX cycle was considered in the extended BC mechanism model , which further converts into intermediate,  (E13), containing the arachidonyl radical AA* (reaction 56). Consideration of two alternative mechanisms of AA radical formation in our model allowed us to analyse their possible contributions to overall COX activity.In our model, we also included an alternative route for initiation of COX reactions, which was proposed in an early version of the TC mechanism of PGHS-1 function \u2014a directPGHS-1 activity undergoes irreversible self-inactivation (SI) during catalysis . The exaBased on the experimental data, we considered several possible mechanisms for enzyme SI in our model. These mechanisms included separate inactivation of the COX and POX activities, originating from enzyme intermediates with different redox state of heme group and containing one or two radicals in the catalytic domains . All theFirst, inactivation of POX activity resulting in fully inactivation enzyme  Reactions 38\u201342, 53, and 67 originate from Intermediate I and lead to POX and further COX inactivation due to radical state of heme prosthetic group () ,22. In o5, E9, E15, and E20) and lead to POX and further COX inactivation due to the presence of oxidising equivalent Fe(IV) in heme.(b) Reactions 43\u201346 originate from Intermediate II (states E5 cycle (reactions 25\u201327). A similar POX cycle was considered in the model developed by Kulmacz et al.  (E17) and  (E4). It should be noted that the remaining POX activity can also further be inactivated due to damage caused by the presence of the radical state in heme (reaction 42).Second, we considered the direct inactivation of COX activity with remaining POX activity which can be caused by the presence of radical states in the COX site in the model . In our z et al. . AccordiAs a result of the joint fitting of three series of the experimental data (see Methods), a unified set of kinetic parameters was determined. The results of fitting are shown in 2 and PGH2 production by PGHS-1 treated by AA and phenol as RC , E2) by RC was obtained to be about zero 8k (0.001 \u03bcM\u22121 s\u22121); that means that the Intermediate I is rather reduced by intramolecular process of electron abstraction from Tyr385 with radical formation than by exogenous RC.A small value of reaction rate 12k of AA binding to the states in the POX2 cycle , while it is sensitive to the dissociation constant d,12K of the same reactions. The model also showed weak sensitivity to parameter in2k, which corresponds to one of the SI reactions of the enzyme, but it is highly sensitive to parameters in1k and ink characterising the other SI reactions considered in the model.To estimate uncertainty of the parameters obtained in the fitting procedure of the model against experimental data, we carried out global sensitivity analysis (GSA) of the model (see Methods). GSA revealed that the calibrated model showed uniform sensitivity to the most kinetic parameters . The mod2O2 and adrenalin as RC  (Ection 18 .5) state much more effectively than to the resting state (E1), Intermediate I (E2), and E3 state. Maximum flux 1(t)V exceeds maximum values of 30(t)V, 31(t)V, and 32(t)V by an order of magnitude (see comparison of 1(t)V and 31(t)V in 31V) has a high peak in an initial stage of the COX reaction, but its contribution to overall catalysis is negligible because of the short duration of the peak (1 ms).The performed flux analysis showed that AA binds to the Intermediate II . Thus, reduction of the heme group due to Tyr385 radical formation in the presence of AA in the COX site is weaker than that in the case of the empty COX site. Therefore, substrate\u2013enzyme complex  (E9) is formed mainly from Intermediate II according to the experimental data , as opposed to the kinetic models of PGHS-1 , being common for the COX2 and POX4 cycles, participates simultaneously in the production of the intermediate product PGG2 (reaction 23) and the final product PGH2 (reaction 8). As discussed above, these reactions make maximum contributions to the synthesis of PGG2 and PGH2 . For this, we first calculated the kinetics of the oxygen consumption rate O2V(t) and compared the results with the experimental data  (E15). This conclusion contradicts the models where only the ferril state  (E5) was considered in the COX reactions  E1. This coeactions . To remo14 state in POX4 cycle) occurs, when AA is in the COX site. The flux analysis allowed us to compare this mechanism of AA radical formation with the alternative mechanism through Tyr385 radical, proposed in framework of the BC mechanism   and ferryl states  and  . Alternatively, AA can bind to the enzyme state containing Tyr385 radical . Therefore, it was assumed that the reactions of a similar type would have similar rate constants.In general, all the reactions in the developed catalytic cycle shown in However, in general case, kinetic constants of the elementary reactions taking place in one of the catalytic sites can depend on the state of all other catalytic components, located in the nearest proximity and involved in the further catalytic steps. For example, there is experimental evidence that AA binding to the COX site may depend on the presence/absence of the radical on Tyr385 . PGHS-1 We tried different approaches in grouping the model parameters and analysed the results of fitting of the corresponding models to the same set of experimental data. Analysis of the fitting results allowed us to hypothesise which reaction rates do not depend much on the processes taking place in the neighbour site and therefore which kinetic constants can be assumed to be equal to each other. This analysis also allowed us to make conclusions on the cooperativity between COX and POX activities. The approach we used allowed us to significantly reduce the number of parameters subject to fitting. The best fitting of the model to experimental data was achieved with the set of 18 parameters given in When identifying the model parameters, we were trying to find a unified set of parameters which would allow us to consistently describe a majority of the in vitro kinetic data known for PGHS-1 catalysis. Identification of the model parameters and their further validation was performed as follows. We chose several experimental data sets obtained in different research laboratories to fit the model parameters against the data and then validated the calibrated model by checking its applicability to the description of experimental data which were not taken in the fitting procedure.2 and PGH2 production .To avoid ambiguity, for the initial stage of the fitting, among all kinetic information available for PGHS-1, we chose three homogeneous datasets which were obtained for the same object\u2014purified PGHS-1 from sheep seminal vesicles\u2014under approximately the same experimental conditions (temperature and pH). The first set included kinetic data on PGGd AA see . Note th\u03bc and \u03c3 are two sensitivity measures in the Morris GSA method, i.e., \u03bc assesses the impact of a parameter on the model output, and \u03c3 describes the non-linear effects and interactions of the parameters. As the model output in the calculation, we took an area under the curve (AUC) of PGH2 time course.Global sensitivity analysis (GSA) of the model to the kinetic parameters obtained in the fitting procedure was based on the Morris GSA method for the calculation of elementary effects ,33. The The key aim of this work was the development of a reliable and validated kinetic model of PGHS-1 which reproduces the main features of its complex kinetics and can be used as a computational tool for accurate prediction of inhibition effect of NSAIDs and their combinations in a range of cellular conditions. The cycle-based network model integrates both the current models of the molecular mechanism of PGHS-1 catalysis and a large dataset of experimental data on the kinetics and regulatory properties of PGHS-1. This integrative approach helped us to overcome the limitation of the previously developed PGHS-1 models mainly applicable to the description of individual in vitro data in a specific range of substrate and cosubstrate concentrations.The developed model of PGHS-1 catalysis is a platform for the further development of a kinetic model of inducible isoform PGHS-2 (COX-2) which is expressed together with PGHS-1 in vascular endothelia cells and other organs and is a target of COX-2 selective NSAIDs. Development of the kinetics models of two isoforms within a unified integrative approach would allow for the investigation of the different physiological roles of these isoforms in the same cells and analysis of the effect of NSAID inhibition on the balance of pro-thrombotic (thromboxane) and anti-thrombotic (prostacyclin) prostaglandins in platelets and endothelial cells."}
+{"text": "Immobilization of photocatalysts on supports is an important method of adding highly active photocatalysts to a continuous flowing system without the need for photocatalyst recovery. However, direct immobilization prevents exposure to all photocatalytically active surfaces. Therefore, to immobilize particulate photocatalysts, while exposing the photocatalytic surface to organic pollutant water in a continuous flowing system, in this study, we employed double-inverse-opal (DIO) with periodically arranged, interconnected macropores, each containing a single photocatalytic particle. Increasing the macropore size successfully enhanced the decomposition rate of organic dye due to the high diffusion rate of dye molecules in the macropores of thin DIOs. However, an excessive increase in macropore size lowered the decomposition rate of dye molecules because an increase in DIO thickness caused the attenuation of light used to excite the photocatalytic particles. This study presents novel, immobilized photocatalytic DIO-structured particles that can be employed in continuous flowing reaction systems by tuning the photocatalytic particle size, macropore size, and DIO thickness. In theO2 cores d. To pret 500 \u00b0C .\u03d5 = 28 mm and height = 2 mm , 162\u20131100). As shown in 2 particles, we conducted the circulation of the MB solution for 1.5 h in the dark (without UV light irradiation). It was confirmed that the adsorption equilibrium of MB was attained within 1.5 h in this preliminary experiment (see C0) was examined on the basis of the absorption peak intensity at 664 nm, which was measured using a UV\u2013VIS spectrophotometer . The photocatalytic reaction was initiated by the irradiation of the assembly with UV light . After initiating UV irradiation, we withdrew 1.5 mL of the solution from the reactor at various times throughout the reaction (0.5\u20135 h), and we determined the residual MB concentration (C) using the 664 nm peak. A xenon lamp  with a band-pass filter , HQBP-UV \u03d525) that shields visible light was used as the UV light source. During the reaction, the MB solution was continuously circulated at a flow rate of 20 mL/min, a figure chosen due to the results of a preliminary photocatalytic experiment  was determined using the following equation:dV was determined by measuring the diameters of more than 200 particles using TEM images. The size of the macropores in the DIO assemblies (dp) was estimated by direct measurement of macropores in SEM images. The average thickness of the assemblies (T) was determined by measuring more than 50 spots in the cross-sectional SEM images of each assembly.The obtained particles and particle assemblies were observed via field-emission scanning transmission electron microscopy  and field-emission scanning electron microscopy , respectively. The transmittance of the particle assemblies was measured using the UV\u2013VIS spectrophotometer mentioned previously. The volume-averaged diameter  is shown in 2 inverse opal frame because of scattering by the TiO2 particles within the DIO. In the UV region, the transmittance of the DIO assembly was lower than it was in the visible light region. This suggests that the TiO2 particles inside the DIO assembly can be excited through UV light absorption.An SEM image of the DIO photocatalytic assembly is shown in EM image , the voi2 core and the SiO2 frame) on the photocatalytic activity of the DIO assembly, we fabricated a TiO2 particle assembly (TiO2 in 2 particle assembly immobilized by a SiO2 frame without voids (TiO2/SiO2 in (C/C0) plotted against irradiation time for each assembly. The TiO2 particle assembly was highly fragile; under the flow of MB aqueous solution, the assembly collapsed within 2 h of initiating UV irradiation, and almost all the assembled particles flowed out of the substrate. In contrast, the TiO2/SiO2 assembly was sufficiently strong, withstanding the flow of the MB solution for 5 h, owing to immobilization with the SiO2 frame. The MB molecules in the solution were initially decomposed, similar to those in the solution employed for the TiO2 assembly, indicating almost no contact between the MB molecules and the TiO2 interface in the assemblies. The DIO assembly developed for the continuous photocatalytic system possessed a mechanical strength similar to that of the TiO2/SiO2 assembly and exhibited a higher activity than those of both the TiO2 and TiO2/SiO2 assemblies.The photocatalytic activity of the DIO assembly was examined on the basis of the decomposition of MB under UV irradiation. To investigate the effect of voids  of macropores were prepared by tuning the PSt shell thickness on a TiO2 core. The variation in the thickness of the PSt shell increased the macropore diameter from 400 to 730 nm. In 2 core and the SiO2 frame, which simultaneously affects the diffusion of the MB molecules and the propagation of UV light in a macropore, should be considered.DIO photocatalytic assemblies with four different diameters  incorporated in them; the thickness of the DIO assemblies increased from 7.2 \u00b5m for V400 to 29 \u00b5m for V730. The increase in thickness of the DIO assemblies attenuates the irradiation because of the increased optical length. To examine the two factors separately, we fabricated DIO assemblies with varying thicknesses using core-shell particles with similar PSt shells.The larger spaces in V450, when compared with V400, for the diffusion of MB could prolong the presence of MB in the former, thus offering a high frequency of contact between the MB and the TiO2 precursor. A macropore diameter of 450 nm was confirmed by direct measurement of their sizes in SEM images. The photocatalytic activities of the DIO assemblies are shown on the left side of 2 components in the assembly increased with an increase in the thickness of the DIO. The amount of MB molecules that decomposed for each particle are presented in 2 particle in T10, T19, and T29 were 9.5 \u00d7 10\u221219, 7.3 \u00d7 10\u221219, and 5.6 \u00d7 10\u221219 mol/particle, respectively. This suggests the inhomogeneous excitation of the TiO2 particles due to the attenuation of light propagation in the thick DIO assemblies. A similar trend of non-proportionality in the decomposition rate for photocatalyst-supported films has been reported [The SEM images on the right side of reported ,43. The 2 particle number, the decomposition amount of MB in V730 with a DIO thickness of 29 \u03bcm . This indicates that the thickness of the DIO assemblies is an important factor in determining the decomposition rate of the MB molecules, and the time spent inside the macropores is less important in DIOs with sufficient space for MB diffusion.When the photocatalytic activity was normalized by TiOof 29 \u03bcm  was 5.3 2 cores in the DIO. A precise design\u2014for the efficient use of light energy\u2014is required for the development of a continuous photocatalytic system that is practical for industry use . Another possible option is the employment of the \u201cslow photon effect\u201d. This is a phenomenon that slows down the propagation of light with wavelengths near the photonic band gap in certain photonic crystals [On the basis of the results, an increase in the macropore size in this novel DIO assembly could promote the diffusion of reactants; however, it simultaneously attenuated the incident light meant to excite the TiOcrystals ,44. Ther2 particles encapsulated within macropores of a SiO2 frame was developed as a new type of immobilized photocatalyst. The fabricated DIO assembly exhibited higher photocatalytic activity than that of TiO2 particles immobilized within the SiO2 frame without voids. The SiO2 frame played an important role in preventing TiO2 particles from flowing out of the assembly. The interconnecting pores between the macropores provided a channel for the reactant solution to flow from one macropore to another with a single TiO2 particle. DIO assemblies with large macropores can increase the contact frequency of the reactant molecules with the photocatalytic surface exposed in the assembly. However, the increase in macropore size causes thickening of the DIO assembly, resulting in the inhomogeneous excitation of TiO2 particles in the assembly caused by attenuation of light propagation. This novel DIO offers a new type of immobilized photocatalytic structure to be applied to continuous photocatalytic reaction systems. To optimize the performance of DIO assembly system, the following factors should be considered: the photocatalytic particle sizes, macropore sizes, and film thickness.In this study, a DIO photocatalytic assembly of crystallized TiO"}
+{"text": "The presence of residual cardiovascular disease (CVD) risk is a current dilemma in clinical practice; indeed, despite optimal management and treatment, a considerable proportion of patients still undergo major CV events. Novel lipoprotein biomarkers are suggested as possible targets for improving the outcomes of patients at higher risk for CVD, and their impact on major CV events and mortality have previously been investigated. Innovative antidiabetic therapies have recently shown a significant reduction in atherogenic lipoproteins, beyond their effects on glucose parameters; it has also been suggested that such anti-atherogenic effect may represent a valuable mechanistic explanation for the cardiovascular benefit of, at least, some of the novel antidiabetic agents, such as glucagon-like peptide-1 receptor agonists. This emphasizes the need for further research in the field in order to clearly assess the effects of innovative treatments on different novel biomarkers, including atherogenic lipoproteins, such as small dense low-density lipoprotein (LDL), lipoprotein(a) (Lp(a)) and dysfunctional high-density lipoprotein (HDL). The current article discusses the clinical importance of novel lipid biomarkers for better management of patients in order to overcome residual cardiovascular risk. A body of evidence from epidemiological, genetic and interventional studies strongly supports causality between low-density lipoprotein cholesterol (LDL-C) and CVD risk, emphasizing LDL-C level as a major risk factor and principal therapeutic target . We are In contrast to elevated LDL-C concentrations, there is no definitive evidence of whether low high-density lipoprotein cholesterol (HDL-C) levels should be treated , althougThe main characteristics of an ideal lipid biomarker include its ability to predict clinically significant outcomes and the patients\u2019 response to therapy in a cost-effective manner . HoweverCirculating LDL particles consist of several discrete subclasses, differing in size, density, composition and metabolic origin, and sdLDL is the most atherogenic fraction as a consequence of their prolonged residence in plasma, easier penetration in subendothelial space and increased susceptibility to oxidative and glycation modifications . The chaStatins are able to favourably modulate LDL subclass distribution  and, morAs already mentioned, the atherogenic lipoprotein phenotype is a cluster of lipid abnormalities, including the elevation of triglyceride-rich lipoproteins . As a coThe results from the TNT trial clearly showed the greatest benefit of intensive statin treatment on major adverse cardiovascular events (MACE) in CVD patients with the highest remnant cholesterol levels . Data frAnother important aspect of residual risk is elevated Lp(a). The structure of this lipoprotein particle resembles LDL, with the addition of apo(a), a polymorphic apolipoprotein with several isoforms of different sizes ,41. FurtAs reported by the investigators of the ODYSSEY Outcomes trial, the greatest benefit of PCSK9i on MACE risk among patients with recent acute coronary syndrome were those with optimal LDL-C levels and mildly elevated Lp(a) . Taking Overall, the data discussed here suggest a clear benefit of targeting atherogenic lipoproteins for further reduction of residual risk , which iRecent findings of the CANHEART Study  have demThe term \u201cdysfunctional HDL\u201d has been forged with an aim to illustrate the incapability of HDL particles to perform protective, anti-atherosclerotic activities . It has Previous studies demonstrated that S1P exhibits atheroprotective effects by regulation of survival, proliferation, differentiation, and mobility of different types of cells, which participate in maintaining vascular homeostasis ,51. S1P Besides lipid species, numerous protein constituents of HDL are responsible for its antioxidative, anti-inflammatory, anti-apoptotic and endothelium-protective effects . In addiOne interesting constraint should be noted with respect to the proposed antiatherogenic characteristics of HDL and its capacity as a biomarker. As recently summarized by Beazer et al. , given tFinally, it should be noted that, in parallel with futile attempts to decisively confirm the independent contribution of low HDL-C to CVD development, a plethora of evidence suggest modulatory roles of HDL in non-cardiovascular diseases, such as diabetes, disorders of the central nervous system, infections, kidney diseases or cancer ,61,62,63There is increasing interest in the effects of novel antidiabetic treatments on atherogenic lipoproteins since such therapies significantly impact the cardiovascular outcome in patients with type-2 diabetes; sodium-glucose cotransporter-2 inhibitors (SGLT-2i) and glucagon-like peptide-1 receptor agonists (GLP-1RAs) have been shown over the last few years to reduce cardiovascular events and mortality, while dipeptidyl peptidase-4 inhibitors (DPP-4i) have a neutral effect with cardiovascular safety, although with no benefit ,65. The Agents in both classes of SGLT-2i and GLP1-RAs, including dapagliflozin, exenatide and liraglutide, have shown the ability to significantly reduce levels of small, dense LDL in patients with type-2 diabetes ,69,70,71All the above suggest a divergent effect of novel antidiabetic therapies on atherogenic small, dense LDL: SGLT-2i and GLP1-RAs reduce their levels, while DPP-4i do not. This is fully in line with the divergent effect of such therapies on the cardiovascular outcome, as previously discussed. Of interest, some of the agents able to reduce small dense LDL, such as exenatide and liraglutide, are also concomitantly reducing the concentrations of the pro-atherogenic adipokine resistin ,78; sincHowever, it is somewhat puzzling that findings on Lp(a) are totally oppositive: agents in both classes of SGLT-2i and GLP1-RAs, such as empagliflozin and liraglutide, have shown no significant effect ,81 whileThe presence of residual cardiovascular risk is a current dilemma in clinical practice; indeed, despite optimal management and treatment, a considerable proportion of patients still undergo major cardiovascular events. This emphasizes the need for further research in the field in order to clearly assess the effects of innovative treatments on different novel biomarkers, including atherogenic lipoproteins, such as small dense LDL, Lp(a) and dysfunctional HDL. This is particularly important during the current coronavirus COVID-19 pandemic since a higher number of cardiovascular diseases, such as acute myocardial infarction, have been reported . Insight"}
+{"text": "Nitrene transfer reactions represent one of the key reactions to rapidly construct new carbon-nitrogen bonds and typically require transition metal catalysts to control the reactivity of the pivotal nitrene intermediate. Herein, we report on the application of iminoiodinanes in amination reactions under visible light photochemical conditions. While a triplet nitrene can be accessed under catalyst-free conditions, the use of a suitable photosensitizer allows the access of a nitrene radical anion. Computational and mechanistic studies rationalize the access and reactivity of triplet nitrene and nitrene radical anion and allow the direct comparison of both amination reagents. We conclude with applications of both reagents in organic synthesis and showcase their reactivity in the reaction with olefins, which underline their markedly distinct reactivity. Both reagents can be accessed under mild reaction conditions at room temperature without the necessity to exclude moisture or air, which renders these metal-free, photochemical amination reactions highly practical. Gaining in-depth understanding of photochemical processes is key for developing more sustainable and efficient chemical transformations. Here the authors show that under visible light photochemical conditions, iminoiodinanes undergo formation of triplet nitrenes or nitrene radical anions, depending on the use of a photosensitizer; These reagents are studied in amination reactions with olefins. It features light as the main source of energy to conduct chemical transformations and can thus be regarded as a key pillar in the development of sustainable approaches and reduced ecological footprint. Today, photochemistry is one of the most rapidly developing fields in chemistry and the past decades witnessed the development of major milestones and concepts, such as dye-sensitized solar cells2, polymerization chemistry3, protein labeling4, photoredox catalysis8, and classic photochemical applications11 that leverage photochemistry as one of the key technologies in the advancement of all chemical disciplines.Photochemistry is a classic discipline in chemistry and early reports date back even to the beginning of the 208 or reagents14. Significant advances have been made in the context of organic synthesis methodology, for example in the utilization of radicals in the presence of photoredox catalysts8 or carbenes via the photolysis reaction of appropriate reagents14. The access and application of nitrenes22 or analogs therof23 under visible light photochemical conditions however remains largely underestimated although it would allow for direct amination reactions with vast potential in modern drug synthesis22. Such photochemical nitrene transfer reactions would significantly expand currently available concepts in classic metal-catalyzed nitrene transfer reactions , relying on strong UV-light for their photolysis29. UV-light can however significantly reduce reaction efficiency and increase by-product formation. Yet, UV light still remains a prerequisite to access pivotal nitrene intermediate under photochemical conditions . Other light sources proved by far less efficient, which might be related to weaker absorption or side-reactions due to the high-energy UV light. A surprising observation was made when switching to photocatalytic reaction conditions. Using simple [Ru(bpy)3]Cl2 as photocatalyst, a complete reversal of reactivity was observed and selective aziridination reaction to yield 11a occurred. Other photocatalysts, such as [Ru(bpz)3](PF6)2, iridium-based photocatalysts, or organic dyes did not alter the reactivity and the C-H functionalization product 10a was formed selectively. Only in the case of Eosin Y as photocatalyst, a mixture of C-H amination (10a) and aziridination (11a) was observed. Further optimization steps included investigations on the solvent, concentration, reaction stoichiometry, yet no further improvements were observed  relaxation on the singlet spin surface leads to the direct formation of a singlet nitrene that features a very short N-O distance, which can be interpreted as a stabilization of the low-valent nitrene with the lone pair of an oxygen atom of the pendant sulfonyl group. B) relaxation involving intersystem crossing (ISC) results in the formation of a triplet intermediate 1a-T, which features a very long N-I bond, close to a non-bonding situation. Scanning of different N-I bond lengths indicated that further elongation of the N-I bond proceeds in a barrier-free fashion to directly lead to a triplet nitrene intermediate. This triplet nitrene intermediate is the energetically favored intermediate and can alternatively be accessed from the high-lying singlet nitrene via intersystem crossing. This theoretical analysis of the photochemistry of iminioiodinane 1a now rationalizes for the formation of a triplet nitrene intermediate under photochemical conditions and shows a marked difference to the ground state reactivity31. Under photocatalytic conditions, calculations are in line with our previous report30 and a very facile reduction of the iodinane, leading to iodinane radical anion INT1. This anion features a very long N-I bond that is close to non-existent and therefore a rapid cleavage of the N-I bond can occur in a barrierless process to give a nitrene radical anion.Further studies on the reaction mechanism involved theoretical calculations to better rationalize this photochemical nitrene transfer reaction Fig.\u00a0. We therFor further analysis and understanding of the reactivity of triplet nitrene and nitrene radical anion, we examined their structural and electronic properties. The calculations show that the nitrene radical anion possesses a higher electron density at the nitrogen atom compared to the triplet nitrene, which in turn leads to higher nucleophilicty of the nitrene radical anion . A second pathway involves the addition of the triplet nitrene to \u03b1-methyl styrene via a TS3 with an activation free energy of only 6.1\u2009kcal\u2009mol\u22121, which is significantly favored over the hydrogen transfer pathway. This addition product can undergo intersystem crossing to give an open shell singlet species that can either cyclize to give the aziridine 11a, or undergo hydrogen atom transfer to give the C-H functionalization product 10a. Analysis of the respective transition states reveals significant steric hindrance of rotation around the central C-C bond, which renders cyclization energetically unfavorable over hydrogen atom transfer. The latter is favored by 2.5\u2009kcal\u2009mol\u22121 and now reasons the reactivity of triplet nitrene intermediates with \u03b1-methyl styrene to yield the C-H functionalization product 10a. Further studies concerned the reaction of the nitrene radical anion  that can arise from an addition \u2013 hydrogen atom transfer mechanism were observed under photochemical conditions. The theoretical analysis of reaction pathways for the hydrogen atom transfer revealed that pathways involving different hydrogen atom transfer can occur due to the presence of the ethyl group. These are very similar in energy and thus reason the unselective reaction and represent a limitation of the present C-H amination method in the case different hydrogen atom transfer reactions are possible , we could observe a selective reaction towards the trans-aziridine 20, which is indicative of a stepwise mechanism under both photochemical and photocatalytic reaction conditions. Further control experiments involved the use of spin trapping reagents, such as 2,2,6,6-Tetramethylpiperidinyloxyl (TEMPO), 5,5-dimethyl-1-pyrroline-1-oxide (DMPO), or DNP, and in all cases a complete suppression of the photochemical and photocatalytic reactions were observed, which is indicative of radical intermediates or participating in the reaction mechanism . Importantly, ortho-substitution  had a slightly detrimental effect on the product yield. Similarly, different sulfonyl groups were tolerated under the present photochemical reaction conditions and the allyl amines products were obtained in high isolated yield . When applying this photochemical protocol to cyclic, trisubstitued, cyclic olefins, 1-alkynyl-1-methyl or aliphatic 1,2-disubstituted olefins, the C-H amination products 10r\u2013v were selectively obtained in good isolated yield. Then, the photocatalytic protocol was employed in the aziridination of \u03b1-methyl styrenes . Most notably, in this case also different \u03b1-alkyl-substituted styrene derivatives, such as a very bulky tert.-butyl group (11s), and nucleophilic N-heterocycles  were well tolerated to yield the corresponding aziridines in high yield, which are commonly very challenging substrates in aziridination reactions. Furthermore, a range of trisubstitued, cyclic olefins, and further examples of 1,1-disusbtituted olefins were studied under the present photocatalytic conditions to yield the aziridine products 11t\u201311ad.We next turned our attention towards applications of the above protocols in amination reactions Fig.\u00a0. The phoion Fig.\u00a0. Halogennes Fig.\u00a0. We exam22a\u2013t). Most notably, even in the presence of two sterically demanding ortho-chloro substituents (22t) the desired aziridine product was obtained in good isolated yield. Further studies involved the reaction of cyclic olefins, such as indene, which smoothly reacted to the aziridine product (22u) in high isolated yield. An important difference in the reactivity of nitrene and nitrene radical anion was however observed in the reaction with aliphatic olefins . Further examples under investigation concerned the utilization of 1,2-disubstituted olefins. In this case, different aryl-alkyl and alkyl-alkyl disubstituted olefins smoothly underwent selective aziridination reaction to afford the trans-azridines 20a\u2013i in high yield.Finally, we embarked on the reaction of simple styrene derivatives under both photochemical and photocatalytic conditions Fig.\u00a0. In bothins Fig.\u00a0. While oINT3S , equipped with a magnetic stirring bar, iminoiodinane  and alkene (5.0 equiv) are dissolved in 2\u2009mL DCM under air atmosphere. The reaction is stirred and irradiated with a 3\u2009W LED lamp (5\u2009cm distance) for 4\u2009h. A cooling fan is used to maintain room temperature (25\u201328\u2009\u00b0C). The product was obtained after column chromatography using n-hexane/EtOAc as eluent.In an oven-dried tube (10\u2009mL), equipped with a magnetic stirring bar, iminoiodinane , alkene (5.0 equiv), and catalyst (1\u2009mol%) are dissolved in 2\u2009mL DCM under air atmosphere. The reaction is stirred and irradiated with a 3\u2009W LED lamp (5\u2009cm distance) for 4\u2009h. A cooling fan is used to maintain room temperature (25\u201328\u2009\u00b0C). The product was obtained after column chromatography using 32. All structures were optimized at the (U)M06-2X level33 of theory in combination with D3 dispersion corrections34, in which all atoms were described with the def2-SVP basis set35. Analytical frequency calculations were carried out at the same level of theory in order to confirm each stationary point as either an intermediate (no imaginary frequencies) or a transition state (only one imaginary frequency). Key transition-state structures were confirmed to connect corresponding reactants and products by intrinsic reaction coordinate (IRC) calculations37. The electronic energy was then refined using def2-TZVP basis set35 at the (U)M06-2X level on the optimized geometries in combination with D3 dispersion corrections. Solvation energies in dichloromethane  were evaluated by IEFPCM calculations with radii and non-electrostatic terms for SMD solvation model38 based on the optimized structures. Time-dependent (TD)-DFT calculations were carried out on the optimized structures of the PhINTs to obtain the absorption wavelength.All calculations were performed using the Gaussian 16 series of programsSupplementary Information"}
+{"text": "A new data transformation method for micro-manufacturing using a topological model for a micro-/nano-texture was proposed for a surface-decorated product. Femtosecond laser printing was utilized to form the micro-/nano-textures into the hardened thick layer of dies by plasma nitriding. At first, the plasma-nitrided AISI316L flat substrate was laser-printed as a punch to imprint the tailored nano-textures onto the AA1060 aluminum plate for its surface decoration with topological emblems. Second, the plasma-nitrided SKD11 cylindrical punch was laser-trimmed to form the nanostructures on its side surface. This nano-texture was imprinted onto the hole surface concurrently with piercing a circular hole into electrical steel sheet. The fully burnished surface had a shiny, metallic quality due to the nano-texturing. The plasma nitriding, the laser printing and the CNC  imprinting provided a way of transforming the tailored textures on the metallic product. Digital manufacturing requires innovative changes to the tools used on the production-line . The taiIn the latter, a mother punch works as a tailored tool to transform a perfect shearing process design onto highly qualified product surfaces with use of the nano-texturing method, as shown in Femtosecond laser processing is commonly employed as tooling to perform the laser printing of micro-/nano-textures onto mother dies ,5. AmongIn the present paper, a three-step procedure is proposed to design micro-/nano-textures for the surface decoration of products, to apply tailored textures onto the surface of nitrided punch for micro-embossing and for micro-piercing, respectively, and to imprint them onto product surfaces. These formed nano-textures on the surface of punch are imprinted onto an AA1060 plate surface as well as the pierced hole surface of an electrical steel sheet by using the CNC  stamper. The product quality is improved by these imprinted micro-/nano-textures.The three-step procedure is depicted by a scheme in In the third stage, this laser-printed die is fixed into a die set and loaded to imprint the designed textures onto the product surface. The flow stress of the product materials and the loading sequence in the stamping have a significant influence on the dimensional accuracy of micro-/nano-textures in duplication by stamping. Various product materials are also selected for this imprinting procedure.Nano-textures induced by LIPSS are controllable through optical path control. The six orientations above, in This qualitative correlation between the nano-textures by LIPSS and the surface plasmonic colors is employed to identify the presence of nano-textures on the laser-processed surfaces on the nitrided punch as well as the replica surfaces on the products. Through this nano-texturing together with color-grating though micro-texturing, the laser-printed die surfaces and the imprinted product surfaces develop surface plasmonic brilliance.The insertion of a thick, hardened surface layer into the punch and die is necessary to make laser printing with a sufficient depth. The low-temperature plasma nitriding system  in The femtosecond laser machining system  in The CNC stamping system  in Two types of nitrided punches are prepared for the CNC imprinting of seven micro-textured emblems to the metallic plate and for nano-texturing the metallic sheets with piercing. SEM (scanning electron microscopy)\u2013EDX (electron dispersive X-ray spectroscopy) was utilized to perform the microstructure analysis and nitrogen mapping, respectively.High-density RF (radio frequency)\u2013DC (direct current) plasma nitriding was employed to harden and strengthen the AISI316L flat and SKD11 cylindrical punches. Two types of stamping punch were fabricated, as depicted in The average nitrogen content in the nitrided layer reaches 3.4 mass%. Its surface roughness remains as it was before nitriding. The nitrided layer has a fine microstructure, in which the average grain size is reduced to 0.1 \u03bcm.These two punches were processed by femtosecond laser printing to form the tailored micro-/nano-textures onto them. The nitrided flat AISI316L punch in This M6 emblem is composed of 5 \u00d7 6 = 30 triangular segments by repeating the micro-texturing five times process to form six different segments, as depicted in Both the head and the side surfaces of the plasma-nitrided cylindrical SKD11 punch with a diameter of 2 mm were trimmed by the femtosecond laser processing to sharpen their edges and to reduce the surface roughness. An AA1060 aluminum plate with a thickness of 1mm with a normal flow stress of 200 MPa was employed. The CNC stamping system was utilized to imprint seven micro-textures with the tailored nano-textures onto this substrate. A single-mode loading sequence was used to compress the upper punch with a constant velocity. We will now describe the CNC-imprinting behavior of each emblem on the laser-printed die onto the aluminum plate. An M6 emblem was also employed for this comparison. As shown in An SEM analysis with high magnification was performed to describe the nano-texture imprinting onto the aluminium plate together with the transcription of the micro-texture M6 in The laser-trimmed SKD11 punch was fixed into the upper die set for piercing the electrical steel sheet with a thickness of 0.15 mm. The core die was also cemented to the lower die set. The CNC stamping system was also utilized for the fine piercing experiment. We experimentally evaluated the laser-trimmed SKD11 punch life and, here, we describe the debris particle deposition\u2019s behavior. With respect to the former, the recent demand for highly cost-competitive motor cores has resulted in the prolongation of punch life together with the high qualification of the pierced electrical steel sheets. In the latter, chipping and micro-cracking was expected to occur through the severe deposition of debris particles from the work. The original nano-texture was designed to have a straight orientation along the piercing direction in order to visualize the deposition process.Plasma nitriding, femtosecond laser printing, and the CNC imprinting were employed as a three-step procedure to improve the design flexibility of the micro-/nano-textures of products and to prolong the tool life, in order to ensure high cost-competitiveness. The plasma nitriding process is the first step in the formation of thick, hardened layers into stainless steel and tool steel die, roll and tool substrates. Owing to the low-temperature plasma nitriding, this layer is uniformly nitrogen-supersaturated without nitride precipitates ; the dieThe data transformation from the tailored model in CAD (computer-aided design) to the surface-decorated product by using the three-step procedure becomes a key process to improve the quality of metal and polymer products. The original color grating by micro-texturing and the surface plasmonic brilliance by nano-texturing are duplicated onto the product surface. The colored emblems, symbols, codes, and fonts are embedded into the product surface, as tailored in CAD. In particular, their topology and geometry work as functional convex and concave textures to control the surface properties and to stimulate the engineering performance across the textured interface.In addition to aluminum and aluminum alloy works, low-flow-stress metals and alloys, such as tin and copper, as well as polymers, such as PET  and PMMA (polymethyl methacrylate) can be employed as work materials for cold and warm imprinting. When using the aluminum alloy, the micro-textures are nearly fully imprinted by embossing the tool surface; the nano-textures are often partially transcribed. These metals with low flow stress and polymers are suitable for the full transcription of micro- and nano-textures onto their surfaces.The fine piercing and punching of metals and alloys requires their sharp separation without the formation of fractured surfaces . As repoThe present three-step procedure provides a hardened SKD11 punch and die with a sharpened edge and micro-/nano-textured side surfaces. As discovered in , the useThe laser nano-texturing process works directly as a tool to build up a master-piece for the duplication of tailored nano-textures onto metallic and polymer products. Owing to the nitrogen supersaturation of the die substrate at 673 K, the laser-nano-textured die is responsible for long-term usage in this duplication processes. In particular, this nitrided die has sufficient chemical stability and heat resistance to perform high-temperature injection molding and mold stamping for repetitive duplication operations. Femtosecond laser nano-texturing also works to form the unidirectional nano-textures onto the trimmed punch side surface. The laser trimming and nano-texturing processes work simultaneously to adjust the surface roughness and geometric irregularities by trimming and to superpose the nano-textures onto the trimmed surface."}
+{"text": "The development of high-throughput techniques has enabled profiling a large number of biomolecules across a number of molecular compartments. The challenge then becomes to integrate such multimodal Omics data to gain insights into biological processes and disease onset and progression mechanisms. Further, given the high dimensionality of such data, incorporating prior biological information on interactions between molecular compartments when developing statistical models for data integration is beneficial, especially in settings involving a small number of samples.cis-regulatory quantitative effects in the proposed model. The model, coined Cox-sMBPLS, exhibits superior prediction performance and improved feature selection based on both simulation studies and analysis of data from heart failure patients.We develop a supervised model for time to event data  that simultaneously accounts for redundant information within Omics profiles and leverages prior biological associations between them through a multi-block PLS framework. The interactions between data from different molecular compartments  were captured by using The proposed supervised Cox-sMBPLS model can effectively incorporate prior biological information in the survival prediction system, leading to improved prediction performance and feature selection. It also enables the identification of multi-Omics modules of biomolecules that impact the patients\u2019 survival probability and also provides insights into potential relevant risk factors that merit further investigation. Therefore, the lasso method can poorly indicate this grouping information in the multi-Omics setting. Theoretical and practical explanations of this limitation are given in L1, L2) penalties on the regression coefficients including Cox model. A recent benchmark analysis  to integrate additional biological information to the training of the model. Note that the model and integrative strategy are general and can be easily adapted to other molecular compartments with appropriate modifications.In this paper, we propose a new integrative survival prediction model named supervised Cox sparse Multi-Block Partial Least Squares (Cox-sMBPLS) by simultaneously controlling the redundancy between Omics profiles from different molecular compartments, focusing on epigenomics, genomics and transcriptomics and incorporating To handle censoring in the survival outcome data, we employ a reweighting technique described in the section \u201cMaterials and Methods.\u201d The high dimensionality of the Omics data under consideration is dealt with the use of regularization. The key objective of Cox-sMBPLS is to determine multi-Omics modules , that are most associated with disease progression and patient\u2019s survival.cis-regulatory quantitative effects  to extract low dimensional Omics modules that are predictive of survival times is depicted in An overview of the multi-block data structure used as input, together with how associations between molecular compartments are captured through cis-regulatory quantitative effects  and updating Omics-blocks \u03c4 = [\u03c43.53.63.7b)( as jb)*( (updated based on \u03a9b) and y* in each block  using k number of latent components.Fit PLS regression to 3.9y* as Update 4. Final Cox-sMBPLS model: Fit a Cox-PH model with  and remaining latent components from the sMBPLS algorithm.iC indicate the independent true survival time and censoring time for the ith subject , respectively. The observed data consist of pairs {|i = 1, \u2026, n} where i = 1 . To deal with the right censoring in the MBPLS algorithm, we use the reweighting method  = P(C > t), t \u2265 0. Then,Let g method  to constCS will be calculated using the intercept-only Cox-PH model (Kaplan-Meier) with the status indicator 1\u2212\u03b4i (using survfit R function)1.This identity can be taken as the theoretical basis for estimating the mean observed survival time by the (weighted) sample average X (a n \u00d7 p matrix of covariates) and y (a n \u00d7 1 matrix of response variable in a univariate case). In contrast to PCA, PLS uses both X and y to construct the latent components (T = XW) by maximizing a successive maximization problem. The objective function to find the weight vectors  is as follows:Partial least squares (PLS) regression, originally introduced by k is the number of the latent components (tuning parameter or fixed by user), and W is a p \u00d7 k matrix of weights . The latent component T (a n \u00d7 k matrix) is then calculated as T = XW.where Genome-wide quantitative trait loci (QTL) mapping enables the determination of genetic loci affecting other Omics, i.e., transcriptome, proteome, and metabolome. Some Omics markers do not directly contribute to the phenotype and affect the disease through other intermediates-Omics. Therefore, considering these QTL associations in each Omics layer can provide more functional information about disease-associated markers. In fact, a QTL-pair is a pair of different Omics  that are (highly) associated regarding their effects on the underlying disease (outcome). Hence involving both elements of a QTL-pair  in a regression model will not add much more information than involving only one of these elements (at the cost of degrees of freedom and multi-collinearity). One way around this is to consider one element of a QTL-pair in the regression model (such as SNP in an eQTL-pair), then regress out the effect of this element and replace the second element with the residuals. This way, we are considering unwanted/uncorrelated information besides the QTL information in the regression model, avoiding multicollinearity.As shown in b , a matrix of bp features/covariates measured for n samples. For ease of presentation, we consider the following B = 3 blocks . However, the proposed modeling framework can accommodate a larger number of blocks and thus other Omics types (such as proteomics and metabolomics) with minor modifications. Thus, let p1 genes, genotypes of p2 SNPs, and DNA methylation of p3 CpGs for n samples, respectively. Next, we split each Xb) is split by utilizing the eQTL information as follows:Let q1 is the number of the eQTL-genes . Whole blood eQTL data are extracted from the Genotype-Tissue Expression Project (GTEx)  and jth eQTL-gene (where t (GTEx)  that areWe then update The second block (genotypes) is split by utilizing the meQTL information as follows:q2 is the number of the meQTL-SNPs . Whole blood cis-meQTL data were extracted from BIOS QTL (where BIOS QTL  that areWe then update The third block (DNA methylations) is split by utilizing the eQTM information as follows:q3 is the number of the eQTM-CpGs . Whole blood cis-eQTM data were extracted from BIOS QTL . By regressing out the effect of these genes, the so-called \u201ceQTM residuals\u201d (jth\" eQTM-CpG (where BIOS QTL  that areWe then update The illustration of the multi-Omics data structure and Omics-block updating procedure is presented in Xb)( = Xb)*( as explained in section \u201cIntegrating Cis-regulatory Quantitative Effects\u201d) and y  be the covariate matrices (blocks) and response vector on the same n samples, respectively. In each block, the dimensionality of the block can be reduced by taking a linear combination of the covariates \u03c4b)( = Xb)(wb) that express the importance of each covariate on the latent component \u03c4b)( (a n\u00d71 matrix). b)( (\u03c9b)( > 0) is the weight for block b, which indicates the contribution of this block to the covariance structure of the input and response (y) data. We can then posit the following optimization problem for calculating the latent components across all blocks:Let L1 penalty on direction vector wb) to the sparse version could be obtained by adding an L1 constraint onto a surrogate of the direction vector. Therefore, a generalized version of the optimization problem using a combined L1&L2 regularization component becomes:In the case of PLS, 1 and \u03bb2. cb) does not depend on and often needs a large \u03bb2 value to be solved. Therefore, we use \u03bb2 \u2192 \u221e which yields the special case of the elastic-net regularization, called univariate soft-thresholding . The algorithm is then followed by a PLS regression on the selected variables, and iterated with updating the response variable, y. The proof for the solution in equation (3) is provided in where X-space of selected variables (Xb)( \u2208 \u03a9b)  is addressed by keeping the Krylov subsequence structure of the direction vectors in a restricted  \u2208 \u03a9(b)) . Specifi \u2208 \u03a9(b)) .Tn\u00d71) in step 3.6. Blocks\u2019 weight (\u03c9) are calculated in Step 3.5. The so-called active variables set (\u03a9b) is then updated in step 3.7 followed by a PLS regression using active variables Xb)*( \u2208 \u03a9b) is then updated in step 3.9. Note that Xb)*( and y* (step 3.9). The solution to the optimization function (2) also enables us to identify multi-Omics modules. These modules are linear combinations of multiple Omics profiles with large absolute values of wb) vectors are calculated in step 3.2 where \u03bb is a non-negative (sparsity) tuning parameter which is tuned using a k-fold cross-validation . In step 3.3 the latent components for each block are calculated (k) and the sparsity (\u03bb) hyper-parameters that lead to the best prediction performance. In principle, we can try different combinations of k (number of the latent components) and \u03bb (sparsity). The chosen k and \u03bb are the ones giving the highest model performance measures. For the real data analysis, we considered p is the total number of the covariates, \u03bd is the fold number in the (k-fold) CV, and n is the sample size. This upper bound for the number of the latent components is suggested by Cross-validation (CV) is used to tune the number of components  at the University of Illinois at Chicago (UIC). All patients provided written, informed consent ; namely, with preserved ejection fraction (HFpEF) and reduced ejection fraction (HFrEF). Further, 47% of them experienced death or a hospitalization event. The original discovery cohort included 103 HF (HFpEF and HFrEF) patients with complete data of all Omics types , 12 of which were removed due to sex mismatch and  consent .R2 = 80% were excluded to keep only high-quality imputed profiles. We then performed linkage disequilibrium pruning (LDP). Thereafter, whole blood cis-eQTL data from the Genotype-Tissue Expression Project (GTEx) . We excluded SNPs with a missing rate \u226510%, monomorphic SNPs with MAF < 0.01% and SNPs on the negative strands. Additional genotypes were imputed based on a two-step approach. First, the samples were phased into a series of estimated haplotypes, and then, imputation was performed on them. After imputation, genotypes with t (GTEx)  were uset (GTEx) . In totaBIOS QTL  were thecis-regulatory quantitative effects), and the relevance of each Omics profile or a combination of them to explain the survival probabilities. We compared the proposed model to elastic-net Cox-PH (El-net Cox) , the association between the Omics profiles (via net Cox) , random net Cox) , Block Fnet Cox) , and mulnet Cox) . All modb = 1, 2, 3) of dimension bn = p, with fixed sample size n = 91. Matrices b = 1, 2, 3) are random samples (without replacement) from the real Omics data presented in the next section. For the construction of true latent components (\u03c4T), we assume that some of the features in each block have small or no effect on the response variable by specifying sparse (true) direction vector (wT). These weights are sampled from the distribution of the weights collected from a standard sparse PLS on a random sample of the Omics data. Therefore, true latent components are sparse across all simulations. The response variable  for sample i  is simulated using a flexible-hazard model . See k = 10). The results of the moderate and high levels of dimensionality are presented in We sample true predictor matrices rd model . We simuk = 2, 4% for k = 5 and k = 10; in El-net Cox decreased by 8%, 7%, and 11% for k = 2, 5, 10, respectively; in RSF decreased by 11%, 3%, and 10% for k = 2, 5, 10, respectively; in Block Forest decreased by 6%, 5%, and 5% for k = 2, 5, 10, respectively; in MCIA decreased by 3% and 0% for k = 2, 5, respectively, and increased by 2% for k = 10. Amongst these models, the proposed Cox-sMBPLS (2\u20134% decrease) and Block Forest (5\u20136% decrease) are more stable than El-net Cox (7-11% decrease), RSF (3\u201311% decrease), and MCIA (0\u20133% decrease and/or 2% increase) against the censoring rate. The feature selection results showed less stability against censoring rate using other performance measures . I/D AUC, and Uno\u2019s AUC tended to increase while increasing the censoring rate. This may be due to the relatively low number of events and the following low number of patient-pairs used to estimate the measures. k  and feature-selection performance (AUCs) of the proposed Cox-sMBPLS model remained higher than other models regardless of the different changing parameters. When increasing the censoring rate from 10 to 60%, the feature-selection performance (C/D AUC) of all models decreased (except for MCIA) : in Cox-s. k see \u20133. In mos. k see . In Tabls. k see  of lassoOverall, the proposed supervised Cox-sMBPLS method outperformed all competing methods  regarding the exact survival prediction and feature-selection power. Moreover, this method showed less sensitivity to the selection of the tuning parameters and censoring rate compared to competing methods.k = 15 multi-Omics modules . k is tuned using a 5-fold CV within the range of 1 = k = 73. The upper boundary (k=73) is calculated based on p is the total number of the covariates, \u03bd is the fold number in the (k-fold) CV, and n is the sample size. Results are provided in p-value < 0.1) in detail. Module 10 contains 375 features  and module 13 contains 497 features . There are 122 Omics profiles , included in module 13 but not module 10. Details for these 122 features are also included in The supervised Cox-sMBPLS model (on HF cohort) retained We also compared the prediction performance of the Cox-sMBPLS model to El-net Cox , RSF Is, Block Fp = 0.097) and 13 (p = 0.059) are the two significant modules  also confirms the role of these genes in heart complications. Disease enrichment results similarly show that the genes in the multi-Omics modules are mainly enriched for heart disease, such as heart failure, cardiac hypertrophy, and myocardial failure. A brief discussion of the common genes follows.To interpret the biological relevance of the significant multi-Omics modules enrichment analysis of their Omics profiles using network-based resources and disease ontology is undertaken. Specifically, we performed a gene-set network analysis  using Geules see . There iPDPK1 (Phosphoinositide-dependent protein kinase-1) is the PDK1 protein coding gene and also a part of the AGC super family of protein kinases which have been well documented for playing a crucial role in heart complications (HRC) can affect Ca2+ cycling in the sarcoplasmic reticulum (SR) that could cause the mitochondrial death pathway and enhance cardiac function in failure heart (TAB2 (TAK1 binding protein-2) is known to play an important role in cardiac development and has recently received more attention in heart diseases. There has been recent research suggesting TAB2 and its signaling network (TAB2-TAK1) as novel therapeutic targets in heart complications  are required to identify novel biomarkers.These follow-up analyses suggest the biological relevance of the multi-Omics modules resulted from the proposed Cox-sMBPLS algorithm. However, further functional and validation studies  was developed. It also enables identification of multi-Omics modules -combinations of different Omics features- exhibiting a large effect on survival probabilities. The proposed modeling framework can easily accommodate a large number of blocks and thus other Omics types with minor modifications.A survival prediction model (Cox-sMBPLS) based on leveraging and integrating information across multi-Omics compartments via the cis-regulatory information and a censoring-reweighting technique in our proposed algorithm. The key output of the Cox-sMBPLS is to determine multi-Omics modules that are most associated with disease progression and patient survival.In the past decade, a large body of literature was developed to introduce methods relating Omics profiles and time to an event such as recurrence in cancer patients, death, etc. Cox-PH  is the mPDPK1 and TAB2 associated with HF which have been well documented for playing a crucial role in heart complications (Simulation studies showed that both the prediction and feature-selection performance of Cox-sMBPLS is significantly better than competing procedures (El-net Cox and RSF) across multiple settings , 2 and iications .A direction of future research is to enhance the incorporation of additional prior biological knowledge; e.g., include functional pathway information. On the validation front, analysis of data from animal studies can assist in identifying novel non-coding features prioritized by significant multi-Omics modules.juliod@cop.ufl.edu.The data analyzed in this study is subject to the following licenses/restrictions: Data are available from JD upon reasonable request. Requests to access these datasets should be directed to JD, The studies involving human participants were reviewed and approved by The University of Illinois at Chicago (UIC). The patients/participants provided their written informed consent to participate in this study.NV and GM designed the study and wrote the manuscript. NV, CM, AD, LC, and JD performed the multi-Omics data preparation and quality control. NV and JD implemented the analysis. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer HQ declared a shared affiliation with the authors NV, CM, LC, JD, and GM to the handling Editor at time of review.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Electronic cigarettes (e-cigarettes) are being increasingly used as a \u201csafer\u201d alternative to regular cigarettes as a method of de-addiction or a bridge to nicotine cessation. However, a multitude of pulmonary pathologies have been described associated with its use and have been clubbed under the category of e-cigarette or vaping use-associated lung injury (EVALI). This case describes a patient who started e-cigarette smoking in order to quit combustible cigarette smoking and developed adult-onset severe asthma. The clinical effect was initially reversible but later developed into persistent symptoms requiring inhaled and systemic therapy. Electronic cigarettes (e-cigarettes) have become a mainstay in today\u2019s culture with many smokers utilizing them in their pursuit of smoking cessation or a \u201csafer\u201d alternative to traditional combustible cigarettes. E-cigarettes offer flexibility on the quantity of nicotine being used. The safety of e-cigarettes was called into question by the numerous cases of e-cigarette or vaping use-associated lung injury (EVALI), some of which were fatal. These cases highlighted the reality that e-cigarettes may not be the benign alternative to cigarettes that many were seeking . While EA 59-year-old female was referred to the pulmonary clinic for evaluation of wheezing, shortness of breath with exertion, and cough ongoing for the last five months. She was apparently asymptomatic before that. She denied chest pain, orthopnea, leg swelling, heartburn, sinus drainage, known environmental allergies, or any other complaints. The patient admitted to gaining 5 pounds (Lbs) of weight since the symptoms started (BMI 34.9). She started smoking cigarettes at the age of 16 and had smoked one1 pack per day since then till about six months ago (42 pack-years) when she started smoking e-cigarettes in a successful attempt to quit cigarette smoking. Incidentally, her partner continued to smoke cigarettes in the house. The patient\u2019s indoor environment also consisted of three dogs and three cats, which she has had for at least five years. No indoor plants. She used to work as a beauty technician and had retired about a year back. No previous history of asthma or allergies. No family history of asthma or other lung-related ailments. No history of other significant organic or inorganic material exposures. The patient\u2019s past medical history was significant for hypothyroidism, Asperger\u2019s syndrome, Type II diabetes mellitus, peripheral neuropathy, dyslipidemia, endometriosis, and hypertension. The patient was diagnosed with asthma/chronic obstructive pulmonary disease (COPD) by her primary care physician and started on a tiotropium inhaler 18 mcg inhalation daily, beclomethasone 80 mcg inhaler, two puffs twice daily, and albuterol inhaler as needed for breakthrough symptoms. The patient was found eligible and enrolled in the lung cancer screening program. Her low dose computerized tomography scan of the chest\u00a0(LDCT chest) showed mild emphysematous changes with no lung nodules. Pulmonary function testing (PFT) results are displayed in Table \u00a0Upon evaluation in the Pulmonary Clinic, her treatment regimen was optimized to include high dose inhaled corticosteroids (ICS), inhaled long-acting beta-agonists (LABA), inhaled long-acting muscarinic antagonists (LAMA), and short-acting inhaled beta-agonists (SABA). She was advised to discontinue e-cigarette use immediately and was started on nicotine patches as replacement therapy.At the one month follow-up clinic visit, the patient said that she had quit smoking e-cigarettes but had relapsed into conventional cigarette smoking. She denied the use of nicotine patches. Her symptoms were persistent despite new inhaler therapy after the last visit, which led her to quit e-cigarette use. After cessation, her symptoms had completely resolved. She was advised to continue regular use of the current asthma regimen till the next visit, where a step-down of therapy would be started if symptoms remained well controlled. She was counseled on smoking cessation.The patient missed her next follow-up visit and came back to the clinic five months later. She had restarted e-cigarette smoking. She complained of worsening respiratory symptoms despite being on the same bronchodilator regimen. ICS dose was increased, and the patient was given a taper of oral corticosteroid as a bridge. Counseling was provided to quit e-cigarette use using nicotine patches and behavioral therapy.Aspergillus fumigatus, and alder and birch trees. Total IgE was elevated at 615 kU/L. The absolute eosinophil count in peripheral blood was 210/ml. Due to persistent symptoms with multiple exacerbations requiring oral corticosteroid (OCS), the patient was started on scheduled OCS with a plan to switch to a biologic agent pending insurance approval. Unfortunately, she still continues to smoke cigarettes despite numerous attempts at smoking cessation with various modalities.\u00a0Over the course of the next two years, montelukast and fluticasone nasal spray were added for asthma control in addition to inhaled therapies and several courses of oral corticosteroid. The patient had missed clinic appointments a number of times. For further workup, cardiac etiologies of dyspnea were ruled out. Sleep evaluation was done and the patient was started on bilevel positive airway pressure (BiPAP) therapy for obstructive sleep apnea and hypoventilation syndrome. Weight had fluctuated within 10 Lbs. The patient switched from e-cigarettes to cigarette smoking again and the symptoms did not improve this time. Follow-up PFT did not show any significant change. Serum allergen panel targeted towards common local allergens showed Immunoglobulin E (IgE) response to Despite the rising popularity of e-cigarettes as a commonly perceived safer alternative to tobacco cigarettes, the risks of harmful outcomes are not fully recognized by the majority of the population. Numerous studies have suggested that the use of e-liquid, with or without nicotine, decreases lung function, most likely due to the toxins and irritants found in the liquid itself. Furthermore, the metal coils used in the heating and cooling process of the e-liquid are a source of chromium, manganese, nickel, and lead, ultimately emitted as metallic nanoparticles and then inhaled . In our The use of e-cigarettes is not a safer alternative to combustible cigarette smoking and can lead to short and long-term implications, some of which can be refractory to conventional therapies. Our patient developed adult-onset asthma likely as a result of e-cigarette use, which initially was reversible, but later transformed into a refractory process\u00a0requiring systemic corticosteroid use in addition to conventional inhaled therapies."}
+{"text": "While dysplastic liver nodules in cirrhosis are pre-malignant, little is known about the predictors of hepatocarcinogenesis of these lesions. This was a retrospective observational study of subjects with cirrhosis who had at least one hypervascular, non-malignant intrahepatic nodule on imaging while undergoing outpatient management by a tertiary hepatology referral centre between Jan 2009 and Jan 2019. Clinical and biochemical parameters were collected. The primary endpoint was transformation to hepatocellular carcinoma (HCC) as determined by Liver Imaging Reporting and Data System. During the study period, 163 non-malignant hypervascular nodules were identified in 77 patients; 147 had at least 6\u00a0months of follow up imaging and 16 received upfront radiofrequency ablation upon detection. During a median follow up of 38.5\u00a0months (IQR 16.5\u201374.5), 25 (17%) of the 147 hypervascular nodules being monitored transformed to HCC. On multivariate analysis, Child\u2013Pugh grade was found to be the only independent predictor of nodule transformation into HCC (p\u2009=\u20090.02). Those with Child\u2013Pugh B and C liver disease had a 10.1  and 32.6-fold  increased risk respectively for HCC transformation compared to Child\u2013Pugh A subjects. This large, single centre study demonstrates that around 20% of dysplastic nodules in cirrhotic patients undergo hepatocarcinogenesis during follow up, and that Child Pugh grade is the only independent predictor of transformation to HCC. Additional prospective studies are warranted to better understand the risk profile of these nodules, and how best they should be managed. Around 90% of HCC cases arise in patients with liver cirrhosis5 with the annual incidence of HCC in cirrhosis being as high as 7%8. Although the independent predictors of HCC overall are well understood, these have not been well elucidated in the literature with specific reference to a cohort of cirrhotic patients. Nevertheless, retrospective studies have identified several clinical parameters that confer an increased risk of HCC in cirrhotic liver including the presence of dysplastic nodules10.Primary liver cancer is a leading cause of cancer-related death and the the seventh most common cancer worldwide14. They may be defined as focal and distinctly nodular lesions without clear malignant features based on imaging and/or histopathology17. However, there is no universally accepted definition of DN in the literature while the rate of malignant transformation remains poorly understood17. Radiologically, DN present as arterially enhancing (i.e. hypervascular) nodules on contrast imaging with computed tomography (CT) or magnetic resonance imaging (MRI) but without the salient feature of washout during the portal venous and/or delayed phases to connote HCC19. They are however often difficult to distinguish from early HCC\u2019s predominantly due to both being vaguely nodular and having similar histologic features with the exact point of carcinogenesis not readily identifiable18.Dysplastic nodules (DN) are pre-neoplastic lesions that occur relatively commonly in cirrhosis with the reported prevalence being 14\u201337% and the annual incidence being around 1.5%20. Gadoxetic acid enhanced MRI was shown in a comparative 13\u00a0year systematic review and meta-analysis to have a high per-lesion sensitivity and positive predictive value of up to 85.6% and 94.2% respectively21. Similarly, contrast enhanced ultrasonography (CEUS) has been suggested as an option for further investigaton of indeterminate lesions22, having demonstrated overall per lesion sensitivity of 84.4% and positive predictive value of 89.3% for HCC21. Although CEUS is yet to be endorsed by current guidelines24 it can be considered as an advanced diagnostic tool in indeterminate lesions.In this context, the availability of MRI with newer contrast agents such as gadoxetic acid has been a major advancement in this field by enabling a better differentiation of dysplastic nodules from early HCC29. Small studies have suggested nodule characteristics such as size and morphology and change in size and/or vascular pattern throughout follow up are predictive, as is patient age32. In 2013 Iavarone et al.33 demonstrated a positive correlation toward hepatocarcinogenesis in histologically proven high grade nodules vs low grade nodules, but no significant clinical risk factors. Hence, there is insufficient published data overall to substantiate any clinical risk factors for hepatocarcinogenesis of these nodules.Currently, there is a paucity of information on the clinical and tumour risk factors for neoplastic change of premalignant lesions36. The most widely accepted course is close surveillance of these in order to monitor for malignant transformation over time. Similarly, there is no tangible data to assess whether these nodules should be actively managed when identified such as with local thermal ablation in order to prevent hepatocarcinogenesis. Thus, we undertook this observational study to evaluate a) the epidemiology and clinical course of de novo non-malignant hypervascular nodules in patients with cirrhosis, particularly in relation to malignant transformation, and b) the baseline factors predictive of the development of HCC in hypervascular nodules detected on contrast CT or MRI.In addition, there is limited data to determine how best to manage dysplastic nodules when newly identified in patients with cirrhosisst 2009 and January 31st 2019. Patients were identified from electronic medical records using coding for the terms \u201carterially enhancing\u201d, \u201cdysplastic\u201d, or \u201chyper-vascular\u201d and \u201chepatic nodule\u201d or \u201cliver nodule\u201d on radiology reports related to multiphasic contrast scans with computed tomography (CT) or magnetic resonance imaging (MRI). The protocol and any amendments received Institutional Review Board approval prior to initiation of the study with submission being undertaken via a low risk ethics application.This was a retrospective, single-centre, observational study of subjects with cirrhosis who were found to have at least one hypervascular, non-malignant intrahepatic nodule while undergoing management of their liver disease by the hepatology service over a 10-year period between January 31To be eligible for study inclusion subjects needed to meet all the following eligibility criteria: (a) male and female patients at least 18\u00a0years of age; (b) documented history of cirrhosis; (c) presence of at least one non-malignant hypervascular intrahepatic nodule confirmed on abdominal imaging with multiphasic contrast CT and/or MRI, either at baseline or during follow up; and (d) be undergoing regular surveillance of the hypervascular nodule with imaging at 3\u20136 monthly intervals with at least 6\u00a0months of follow up on imaging. Subjects were excluded if they met any of the following exclusion criteria: (a) absence of cirrhosis; (b) undergone liver transplant within 6\u00a0months following detection of hyper-vascular nodule; (c) the presence of advanced HCC (macrovascular invasion and/or extrahepatic spread); and d) insufficient follow up of the nodule of\u2009<\u20096\u00a0months from initial detection unless treated prior. All cases with hypervascular nodules were discussed at a multi-disciplinary team meeting comprising hepatologists, diagnostic and interventional radiologists, and dedicated HCC nurse to confirm the diagnosis and determine initial management that in the vast majority of cases involved close observation and in select cases upfront ablation with RFA.37. Nodules that met the above radiologic criteria were only considered benign and included if they had shown stability in size and appearance for at least 6\u00a0months following detection. This reflects current international guidelines on the surveillance of a liver nodule thought to be benign36. Past HCC was defined as evidence of HCC being definitively treated without macrovascular invasion and/or extrahepatic spread prior to detection of a benign hypervascular nodule. Current HCC was defined as evidence of a hypervascular hepatic nodule(s) with evidence of washout on CT or MRI with primovist occurring either prior to or at the time of occurrence of the non-malignant nodule being included in the study. For this study definite HCC and probable HCC were defined in cirrhotics as a lesion that was LiRADS-5 and LiRADS-4 respectively.Cirrhosis was defined based on either (a) the combination of clinical, radiologic and laboratory criteria indicative of cirrhosis; (b) a liver stiffness measurement (LSM)\u2009>\u200912.5\u00a0kPa via vibration-controlled transient elastography (VCTE); or c) liver histology. Non-malignant hypervascular \u201cdysplastic\u201d nodules were defined on contrast-enhanced triphasic liver CT as hyperattenuating masses in the arterial phase with no washout on portal venous or delayed phases, and/or on MRI liver with primovist as the presence of a hyperattenuating mass post contrast and the absence of an increased T2 signal, restricted diffusion and washout on multiphasic post contrast imaging as described38.Data was extracted from electronic medical records and recorded on a standardised form. Data collection included: (1) Patient characteristics: age, gender, body mass index (BMI), diabetes history; (2) Liver disease: aetiology, Child\u2013Pugh score, Model of End-stage Liver disease (MELD) score, ALBI score; (3) Laboratory parameters: serum alpha-fetoprotein (AFP), platelet count, serum albumin, INR, creatinine, bilirubin; (4) Nodule(s) characteristics: size (mm), location, number, imaging features including LiRADS status at baseline and during follow up; (5) Treatment received to nodules; (6) HCC status: past or current; and (7) Follow up details: patient survival, HCC status, nodule status . Transformation of nodules to HCC was determined by one of three experienced diagnostic radiologists  according to LiRADS criteriaThe primary end point of this study was the rate of malignant transformation to HCC in de novo hypervascular nodules in patients with cirrhosis. Further analysis was undertaken to determine the baseline factors predictive of the development of HCC in hypervascular nodules. The secondary endpoint was the role of radiofrequency ablation (RFA) at the time of identification of hypervascular nodules.Descriptive statistics of the cohort were performed with continuous variables assessed for normality and expressed as mean\u2009\u00b1\u2009standard deviation (SD) or median (inter-quartile range) depending on the underlying data distribution. Categorical variables were summarized using frequencies or proportions. Variables were compared using Mann\u2013Whitney test for continuous variables and Fishers exact test for categorical ones. Univariate and multivariate stepwise Cox regression were used to evaluate the baseline factors associated with development of HCC in the nodule. As an individual patient could have more than one dysplastic nodule, the Cox model was constructed with nodules nested within individual patients, with patients treated as a random variable . In addition, cumulative failure probability curves were used to examine malignant transformation of nodules among patients with cirrhosis according to baseline factors found to be significant on Cox proportional hazards analysis.This article does not contain any studies with animal subjects.All procedures followed were in accordance with the ethical standards of the responsible committee on human The protocol and any amendments received Institutional Review Board approval prior to initiation of the study with submission being undertaken via a low risk ethics application. This included a waiver of informed consent from all patients included in the study.The protocol and amendments received approval by The Alfred Hospital Human Research Ethics Committee prior to initiation of the study with submission being undertaken via a low risk ethics application. This include permission for publication of the data.This article does not contain any studies with plants.This was a retrospective cohort study that did not require clinical trials registration.2. A current or past history of HCC was present in 24 (14.7%) and 18 (11.0%) subjects respectively, while HCV infection was the most common aetiology for cirrhosis (46.3%) followed by HBV infection (25.2%) and alcohol (6.7%). Five (3.4%) nodules occurred in patients with dual HCV and HBV aetiology, and six cases (4.1%) with mixed alcohol and HCV liver disease. Median nodule size was 10.0\u00a0mm (IQR 7.0\u201313.0).We identified 163 eligible nodules in 77 patients. The baseline demographic, clinical and liver disease characteristics of the cohort at the time of the index liver nodule detection are shown in Table Sixteen 10%) of the 163 hypervascular nodules underwent definitive initial treatment with RFA. There were key differences between subjects with nodules that did and did not receive RFA at detection (see supplementary Table 0% of theDuring a median follow up of 38.5\u00a0months IQR 16.5\u201374.5), 25 (17%) of the 147 hypervascular nodules not receiving initial RFA transformed to HCC. The median time to transformation was 29.0\u00a0months (IQR 12.5\u201338.0\u00a0months). The 1-, 2-, and 3-year rate of transformation of dysplastic nodules to HCC was 4.3%, 9.5% and 15.7% respectively. The cumulative probability of progression to HCC of the overall cohort is shown in Fig.\u00a06.5\u201374.5,The baseline clinical and liver disease characteristics of subjects according to whether transformation to HCC occurred over time or not are shown in Table On univariate analysis, dysplastic nodule transformation to HCC was associated with Child\u2013Pugh score (p\u2009<\u20090.001) and grade (p\u2009<\u20090.001), MELD p\u2009=\u20090.002) and ALBI scores (p\u2009<\u20090.001). Notably, median AFP level at nodule diagnosis was not associated with malignant transformation . Other clinical parameters not significant on univariate analysis were age, sex, BMI, aetiology of liver disease, size of lesion, HCC status, and diabetes Table . On mult and ALBIOf the 122 nodules that did not transform, 47 (38.5%) spontaneously disappeared with a median time to disappearance of 31.0\u00a0months (IQR 12.0\u201336.5) while 75 (61.5%) remained stable, over a median follow up time of 59.0\u00a0months (IQR 33.0\u201395.0). Although the median MELD score was not dissimilar between the two groups (median 6 vs 8 respectively), nodules were more likely to disappear or remain stable throughout follow up with a lower MELD score (p\u2009=\u20090.02). Similarly, a lower ALBI Grade conferred a higher chance of spontaneous disappearance or stability of a nodule (p\u2009=\u2009<\u20090.001).In this real-world observational study, we evaluated the clinical course of de novo non-malignant hypervascular nodules in patients with cirrhosis particularly in relation to malignant transformation to HCC. Our clinical experience demonstrates that around one-fifth of these nodules transformed into HCC over time with the 1-, 2-, and 3-year rate of dysplastic nodule transformation to HCC being 4.3%, 9.5% and 15.7% respectively. In addition, we found that Child Pugh grade was the only independent predictor of nodule transformation into HCC (p\u2009=\u20090.02).25 who reported an overall HCC transformation rate of 18.8% over a median follow up time of 33.6\u00a0months. Similarly, Sato et al.27 found that 13.6% of dysplastic nodules transformed over a median follow up time of 31.9\u00a0months, while Seki et al.29 a rate of 12.5% over a median follow up period of 25\u00a0months. Our annual rate of HCC transformation of around 5% was lower than that of Iavarone et al.28 who reported a yearly rate of 9.2% over a similar follow up period of 39\u00a0months. Thus, it appears from published data that the annual incidence of HCC from these hypervascular at-risk nodules is somewhere between 5 and 9%.In our cohort, we found that 17% of dysplastic nodules that did not undergo RFA at detection transformed into HCC over a median follow up time of 38.5\u00a0months with the median time to hepatocarcinogenesis being 28\u00a0months. Given this represented 15.3% of the entire cohort, the results are similar to those of Kobayashi et al.33. In our study, we found that Child\u2013Pugh grade was the only independent predictor of hepatocarcinogenesis on multivariate analysis although other markers of liver disease severity including MELD and ALBI were associated with HCC transformation on univariate analysis. Indeed, the risk of developing HCC in those with Child\u2013Pugh C cirrhosis was around 30-fold higher compared to those with compensated Child\u2013Pugh A cirrhosis. Moreover, Child\u2013Pugh grade correlated with higher rates of hepatocarcinogenesis  of nodules disappear during follow up. While we did find an association between ALBI grade and nodule disappearance, currently there are no reliable predictor(s) of nodule disappearance, so consequently, all need follow-up imaging over time to monitor for malignant transformation.Another important finding of our study that is relatively under-appreciated in the literature is the disappearance on imaging of these seemingly \u201cat-risk\u201d nodules. We found that 38.5% of nodules disappeared on follow up ultrasound or CT with a median time to disappearance of 31\u00a0months. This is similar to that of Sato et al.vis a vis definitive management versus watchful observation40. While it appears intuitively obvious to ablate high-risk lesions when identified, Cho et al.34 found no distinct survival benefit of RFA of high grade dysplastic nodules that would support such an approach. In our cohort, sixteen hepatic nodules underwent definitive thermal ablation upon detection, many of whom occurred in patients with an active history of HCC at a separate site. During a median follow up of 13\u00a0months, none of nodules that were initially treated with RFA developed HCC at the ablation zone. However, eight (50%) of the nodules occurred in five (31%) individual patients with active HCC at a separate site and ten (62.5%) nodules occurred in patients with either past or current HCC. This highlights their high-risk status. In the absence of past HCC, upfront thermal ablation of an indeterminate or suspicious nodule could be curative for some patients and prevent the development of HCC. However, this invasive therapy must be carefully weighed up against its potential risks and there is currently no role for thermal ablation in patients with no past history of HCC. Clearly, more robust data is needed to guide clinical management in this space, and specifically, taking into account clinical risk factors of Child\u2013Pugh status and past or current history of HCC. There is a randomised clinical trial underway to address the role of active therapy of dysplastic nodules43.To date, there is no consensus on the optimal management of hypervascular pre-malignant liver nodules when detected The strengths of this study include its sizeable cohort, well-established criteria for benign nodule inclusion and HCC transformation, independent radiological review using LiRADS to enhance diagnostic accuracy of HCC transformation, management of nodules via a multi-disciplinary team and appreciable follow up period that enabled a large number of nodules to be captured and assessed. In addition, it assessed the clinical and biochemical parameters influencing HCC transformation in a real-world context. However, there were important limitations to the study notwithstanding it\u2019s retrospective design. This included the requirement for data retrieval on nodules, cirrhosis and hepatocellular carcinoma status from electronic medical records as opposed to predetermined criteria for the purposes of the study. In addition, there were no pre-defined protocolized criteria for management of these nodules in terms of ablation versus surveillance including monitoring frequency, although in all cases it was based on the opinion of the multi-disciplinary team managing these patients. Finally, being retrospective not all data was complete on clinical and biochemical parameters.In conclusion, this study has demonstrated for the first time a strong relationship between liver disease severity and hepatocarcinogenesis of dysplastic/ hypervascular liver nodules in patients with cirrhosis. Given the absence of clinical practice guidelines to inform clinicians of how dysplastic nodules should be managed, our findings highlight an urgent need for prospective studies of these nodules including randomised clinical trials particularly in those with advanced liver disease to determine the most appropriate course of action when they are detected.Supplementary Information."}
+{"text": "The envelope (E) protein of the avian coronavirus infectious bronchitis virus (IBV) is a small-membrane protein present in two forms during infection: a monomer and a pentameric ion channel. Each form has an independent role during replication; the monomer disrupts the secretory pathway, and the pentamer facilitates virion production. The presence of a T16A or A26F mutation within E exclusively generates the pentameric or monomeric form, respectively. We generated two recombinant IBVs (rIBVs) based on the apathogenic molecular clone Beau-R, containing either a T16A or A26F mutation, denoted as BeauR-T16A and BeauR-A26F. The replication and genetic stability of the rIBVs were assessed in several different cell types, including primary and continuous cells, ex vivo tracheal organ cultures (TOCs) and in ovo. Different replication profiles were observed between cell cultures of different origins. BeauR-A26F replicated to a lower level than Beau-R in Vero cells and in ovo but not in DF1, primary chicken kidney (CK) cells or TOCs. Genetic stability and cytopathic effects were found to differ depending on the cell system. The effect of the T16A and A26F mutations appear to be cell-type dependent, which, therefore, highlights the importance of cell type in the investigation of the IBV E protein. Nidovirales, suborder Coronavirinae, family Coronaviridae, subfamily Orthocoronavirinae. Within the subfamily, there are four genera, Alphacoronavirus, Betacoronavirus, Gammacoronavirus and Deltacoronavirus. In humans, the Alphacoronavirus human coronavirus (HCoV) 229E and related coronaviruses are responsible for 18% of common cold cases -2-aminoethanesulfonic acid (BES) media [CK or Vero cells were seeded into 6-well plates to confluency. Cells were infected with 500 \u00b5L of Beau-R, BeauR-T16A or BeauR-A26F isolates at a titre of 1 \u00d7 10S) media . At 24 h4 or 1 \u00d7 105 PFU and incubated at 37 \u00b0C for 1 h with 5% CO2. The virus was removed, and the cells were washed twice with PBS followed by the addition of 3 mL BES media. The supernatant containing the infectious progeny was harvested at either 1, 24, 48, 72 and 96 hpi, to establish replication over multiple rounds of viral replication, or at 1, 2, 4, 6, 8, 10 and 11 hpi, to assess replication over the first round of viral replication. The quantity of infectious progeny was quantified in triplicate via plaque assay in CK cells.Confluent CK, DF1 or Vero cells, seeded in 6-well plates were infected with 500 \u00b5L of Beau-R, BeauR-T16A or BeauR-A26F isolates at a titre of either 1 \u00d7 104 PFU of Beau-R, BeauR-T16A or BeauR-A26F isolates. Mock infected TOCs were inoculated with 500 \u00b5L TOC medium. Tubes were incubated upright for 1 h at 37 \u00b0C, after which the inoculum was removed and the TOCs washed twice with PBS. 1ml of TOC infection media was added per tube, and the TOCs were incubated at 37 \u00b0C, 1 revolution per 7 min. The ciliary activity of each TOC was assessed at 24 h intervals using a light microscope, and the percentage of cilia beating was calculated as described [TOCs, singly plated in glass tubes, were washed twice with PBS. In replicates of ten, each TOC was inoculated with 500 \u00b5L TOC infection medium , containescribed ,39.4 PFU of Beau-R, BeauR-T16A-1, or BeauR-A26F-3. Tubes were incubated upright for 1 h at 37 \u00b0C after which the inoculum was removed and the TOCs washed twice with PBS. 1 mL of TOC infection media was added per tube, and the TOCs were incubated at 37 \u00b0C, 1 revolution per 7 min. The supernatant from each tube was harvested at 1, 24, 48, 72 and 96 hpi, and the quantity of infectious progeny was quantified in triplicate via plaque assay in CK cells.Six TOCs were plated per glass tube and were washed twice in PBS. Each tube was inoculated with 500 \u00b5L TOC infection medium containing 1 \u00d7 104 or 1 \u00d7 105 PFU of either Beau-R, BeauR-T16A or BeauR-A26F isolates. After 24 h, embryos were culled by refrigeration for a minimum of 4 h, and the allantoic fluid from each egg was harvested. The allantoic fluid was clarified using low-speed centrifugation. The quantity of infectious progeny was determined via plaque assay in triplicate in CK cells. The sequence of the E gene was determined as described in A protocol for propagation of IBV in eggs has been described . In replConfluent CK cells seeded into 6-well plates were washed once with PBS. In replicates of four, 500 \u03bcL of BES medium containing neat rIBV was added per well and incubated for 1 h at 37 \u00b0C. The inoculum was removed and replaced with 3 mL BES media and incubated for a further 23 h. The supernatant was harvested and diluted 1 in 10 for subsequent inoculation of the CK cells. The E gene of the resulting passaged isolates was Sanger sequenced at passage 5, 10 and 15 as described in RNA was extracted from either the cell supernatant or allantoic fluid using the Qiagen RNeasy kit following the manufacturer\u2019s protocol for RNA clean up. RNA was reverse transcribed using random primer, 5\u2032 GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN 3\u2032 and a SuperScript IV reverse transcription kit following the manufacturer\u2019s protocol (Life Technologies). The E gene was amplified using recombinant Taq Polymerase (Life Technologies) using primers 5\u2032-GCTGAAGATTGTTCAGGTGA-3\u2032 and 5\u2032-GCTGAACTGACTGTTCAAAG-3\u2032. The PCR products were Sanger sequenced by Eurofins, and the resulting sequencing data was analysed using the Staden Package 2.0.0b11.5 PFU of Beau-R, BeauR-T16A or BeauR-A26F isolates or mock infected with BES media. At 24 hpi, the inoculated CK cells were imaged with an AMG EVOSTM XL Core microscope.CK cells seeded into 6-well plates were inoculated with 1 \u00d7 105 PFU. Mock infected cells were inoculated with the BES medium. At 24 h intervals, the viability of the cells was assessed using the luciferase assay CellTiter-Glo\u00ae kit (Promega), which measures the quantity of ATP present to quantify the number of viable cells following the manufacturer\u2019s instructions, detailed in [Cells were seeded to confluency in 96-well plates and washed once with PBS prior to inoculation with a two-fold serial dilution, in BES medium, of Beau-R, BeauR-T16A or BeauR-A26F isolates starting at 1 \u00d7 10ailed in . The per5 PFU in BES medium. At 6 and 24 hpi, the cells were harvested, and RNA extracted using the Qiagen RNeasy kit including an on-column DNAse treatment, following the manufacturer\u2019s (Qiagen) instructions. Reverse transcription was carried out using 1.25 \u00b5g of total RNA using Superscript IV reverse transcription kit according to the manufacturer\u2019s protocol using random primer (5\u2032 GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN 3\u2032). The resulting cDNA was diluted to ensure 100 \u00b5g was added per qRT-PCR reaction. TaqMan qPCR reagents were used to perform qPCR, using either TaqMan \u00ae Fast Advance Master Mix or TaqMan \u00ae Multiplex Mastermix (Life Technologies). Primers were used at 10 \u03bcM, and hydrolysis probes were diluted to 5 \u03bcM. A GeNorm was carried out and Beta-Actin was selected as an endogenous control; this control has been used in CK cells previously [CK cells were seeded to confluency in 6-well plates and were washed once with PBS. Cells were mock infected with BES media or inoculated with 500 \u00b5L of Beau-R, BeauR-T16A or BeauR-A26F isolates at a titre of 1 \u00d7 10eviously . SequencThe statistical analysis was assessed using GraphPad Prism 8.0. The standard deviation and normality were assessed prior to any statistical analysis.The E protein is divided into three domains; a short hydrophilic N terminal domain, a transmembrane domain, which is the focus of this study, and a long hydrophilic C terminal domain . A compaComplete genome sequences of the three isolates representing rIBVs BeauR-T16A and BeauR-A26F were assembled using NGS technologies. Consensus genomic sequences generated from stock viruses of all three isolates of both BeauR-T16A and BeauR-A26F were assembled and compared to the Beau-CK reference sequence (GenBank Accession number AJ311317). The stocks of BeauR-T16A and BeauR-A26F were generated at passages 4 and 3 in CK cells, respectively. In all isolates of both BeauR-T16A and BeauR-A26F, the consensus sequences generated confirmed the presence of the mutations T16A and A26F, respectively . In BeauThe replication of all isolates of BeauR-T16A and BeauR-A26F were investigated in primary CK cells A,B. All 9 PFU, which, although unusual, has previously been observed [The Beaudette strain of IBV has extended cell tropism ,45. The Beaudette rIBVs containing either the T16A or A26F mutations showed reduced plaque size in comparison to WT in Vero cells . ConversTo et al. indicated that, in Vero cells, the T16A and A26F mutations impede viral release . To estaIn vivo, IBV replication primarily occurs in ciliated tracheal epithelial cells . TOCs arTo investigate the genetic stability of both the T16A and A26F mutations, four replicates of Beau-R and the three independent isolates of BeauR-T16A and BeauR-A26F were serially passaged 15 times in CK cells. The E gene of progeny viruses was Sanger sequenced at passages 5, 10 and 15 .All isolates of BeauR-T16A maintained the T16A mutation at passage 5 and generated no other mutations within the E gene; however, mutations were observed at passage 10 A. A singThe BeauR-A26F isolates showed greater genetic stability than BeauR-T16A. Isolates BeauR-A26F-2 and BeauR-A26F-3 maintained the A26F mutation over all 15 passages and generated no compensatory mutations within the E gene B. BeauR-50) [4 or 105 PFU of either Beau-R, BeauR-T16A or BeauR-A26F were inoculated into allantoic cavities of 10-day-old SPF embryonated hen\u2019s eggs. The quantity of infectious progeny present, within the allantoic fluid at 24 hpi was determined via titration in CK cells. Additionally, the sequence of the E gene of the isolated passaged viruses was determined via Sanger sequencing.The IBV strain Beaudette exhibits a non-pathogenic phenotype in birds . This is50) . To inveIn contradiction to previous research , all iso5 PFU of either Beau-R, BeauR-T16A or BeauR-A26F, and the CPE was observed. CK cells infected with the IBV show a prominent CPE, including syncytium formation (the fusion of virus infected cells with neighbouring cells resulting in a multinucleated cell) [To further examine the effect of the T16A and A26F mutations in a relevant cell type, CK cells were inoculated with 10ed cell) , cell roed cell) . Syncytied cell) . In CK c\u00ae, which measures ATP levels to quantify the number of metabolically active, and therefore viable, cells [5 PFU and serially diluted twofold. Cell viability was measured at 24 h intervals. At all the time points assessed, the cell viability was observed to be comparable between both rIBVs and the parental Beau-R, indicating infection results in equivalent cell cytotoxicity -1B and IL-6 [The E protein IC has been shown to be a pathogenicity factor in and IL-6 . In IBV,and IL-6 . The uprand IL-6 ,54,55,56The ability to successfully rescue rIBVs with either the mutation T16A or A26F within the E protein suggests that these residues are not required for viral replication in vitro, in line with earlier reports . It mustThe replication of BeauR-A26F was reduced in Vero cells in comparison to unmodified Beau-R C. This iThe potential for the different mechanistic actions of either the T16A or A26F mutations is further illustrated, as BeauR-A26F exhibited reduced replication in ovo in comparison to both BeauR-T16A and Beau-R A. SequenThe E protein is thought to play a key role in the assembly ,14,15 anA classical characteristic of viroporin activity is the modulation of the host response to infection. It has been shown that IC inactive mutants of both SARS-CoV  and IBV In conclusion, we have generated and characterised the T16A and A26F mutations within the hydrophobic domain of the E gene in the rIBV Beau-R. The rIBVs BeauR-T16A and BeauR-A26F are replication-competent, demonstrating that these residues are not essential for viral replication. The genetic stability of the T16A and A26F mutations, the replication of the rIBVs and the cytopathogenicity induced were assessed in a variety of systems, ranging from avian primary cell lines, continuous cell lines of both avian and mammalian origin, and in ovo and avian ex vivo TOCs. Differing results were observed through the assessment of the same parameter within different systems, highlighting the importance of cell-type or cell-system selection during IBV E protein research. Further studies in biologically relevant systems are therefore required to further elucidate the role of the IBV E protein during infection."}
+{"text": "Background: In this study, we use the case of medical doctors in the public health system in rural India to illustrate the nuances of how and why gaps in policy implementation occur at the frontline. Drawing on Lipsky\u2019s Street Level Bureaucracy (SLB) theory, we consider doctors not as mechanical implementors of policies, but as having agency to implement modified policies that are better suited to their contexts.Methods: We collected data from primary care doctors who worked in the public health system in rural Maharashtra, India between April and September 2018 . We first sorted the data inductively into themes. Then we used the SLB theoretical framework to categorise and visualise relationships between the extracted themes and deepen the analysis.Results: Doctors reported facing several constraints in the implementation of primary care- including the lack of resources, the top-down imposition of programs that were not meaningful to them, limited support from the organization to improve processes as well as professional disinterest in their assigned roles. In response to these constraints, many doctors \u2018routinized\u2019 care, and became resigned and risk-averse. Most doctors felt a deep loss of professional identity, and accepted this loss as an inevitable part of a public sector job. Such attitudes and behaviours were not conducive to the delivery of good primary care.Conclusion: This study adds to empirical literature on doctors as Street Level Bureaucrats in lower and middle income countries. Doctors from these settings have often been blamed for not living up to their professional standards and implementing policies with rigour. This study highlights that doctors\u2019 behaviours in these settings are ways through which they \u2018cope\u2019 with their loss of professional identity and organizational constraints; and highlights the need for appropriate interventions to counter their weak motivation. SLB theory posits that people at the frontline do not mechanistically comply to all imposed policy mandates. Nor do they implement these mandates in a vacuum. Instead, they implement a version of the policy mandate that appears to fit in with their everyday realities and contextual constraints. To cope with the wide range of contextual complexities they encounter, people at the frontline of policy delivery develop informal routines and practices. These routines and practices can be called \u2018coping behaviours\u2019 and lead to policies being implemented in ways that are different from the written policy rhetoric. Hence, people in the frontline of policy delivery have been called \u2018Street Level Bureaucrats\u2019 who create \u2018policies as performed.\u2019 It is this version of policies that the public ultimately experiences.Not all policy rhetoric translates into practice as originally intended. Even when top-down policy mandates are firmly imposed, gaps in implementation of policies can occur in the frontlines of service delivery. Why such gaps occur \u2013 and what can be done about these \u2013 have been questions of interest to policy analysts. Theories such as Lipsky\u2019s Street Level Bureaucracy (SLB)enable policy analysts to deepen their understanding of such gaps better.In this paper, we have drawn on SLB theory to examine how medical doctors in public primary health centers  in one rural area in India delivered routine primary care. We have asked two specific questions:coping behaviours\u2019 exhibited by doctors in primary health facilities in rural India?What were the \u2018coping behaviours\u2019?In what ways did the professional identities of doctors vis-\u00e0-vis the organisational constraints they faced shape these \u2018 However, within LMIC literature, medical doctors working at the frontlines of care delivery have been less frequently been examined using SLB theory . In this paper, we have explicitly focussed on understanding the perspectives of medical doctors. This focus is particularly interesting since doctors often experience tensions between their twin identities as \u2018professionals\u2019 and as \u2018bureaucrats,\u2019 and struggle to balance these different identities in their actions.This paper is an attempt to add to theory-driven, actor-centric, empirical studies in the field of health policy implementation in low- and middle-income countries (LMICs). There has been a growing interest in understanding frontline health workers behaviours  in such settings. In this study, wehave treated the delivery of primary care by doctors as a \u201croutine\u201d policy, and have focussed on the decisions made by doctors in their day-to-day work.Another contribution of this study is its focus on the implementation of day-to-day primary care. Most studies from LMICs that have engaged with SLB theory focus on how staff in the frontline deal with newly instituted health policies. Very few studies have examined the implementation of policies long in existence and looked at routine practices within health systems (termed \u201ccoping\u201d in this study) as important influencers of policy success on the ground. Located in peripheral areas, these centers are intended to deliver preventive as well as basic curative care in the public health system .The doctor at a primary health center  is considered as a social physician, responsible for the health of the entire service area under a primary health center. As the medical officer-in-charge, the doctor also serves as the administrative head of the health center, and manages the support staff . Other roles include the provision of primary-level clinical care, oversight of outreach care, implementation of all programs and schemes, and overall management of staff. and Indian Public Health Standards, 2012.Source: Bulletin of rural health statistics, 2017high production\u2019 states for allopathic doctors in India, having 52 medical colleges of which 23 are public. A one-year rural service stint is compulsory for all undergraduate medical students from public colleges and this policy, to some extent, has enabled the filling of allopathic doctors\u2019 posts at primary health centers in the state (unlike many other Indian states). Despite filled posts, primary health centers in Maharashtra often do not serve as first access care to communities. A 2014 national survey found that in Maharashtra, only 7.5% of people seeking ambulatory care utilized primary-level tiers in the public health system.This study was conducted in rural Maharashtra, a state in western India. Maharashtra is considered as one of the five \u2018This study was undertaken in one small rural area. The name of the area as well as the district have been masked to protect the participants. This area had access to approximately 80 primary-level facilities, one district-level (secondary care) hospital and one non-for-profit tertiary care hospital. This area was chosen for the study since it had a mix of facilities with \u2018good\u2019 and \u2018poor\u2019 infrastructure  and posts for allopathic doctors was filled in most of the facilities. Process indicators from the health centers in this rural area for services like antenatal care and immunization were slightly better than that of state averages; and the area was considered to be overall, a \u2018medium\u2019 performing region (according to the state and district level authorities).). We also sought the opinion of 5 doctors who had earlier worked in primary care roles and had now moved on to other roles- to offer comparative perspectives on the different roles they performed.We visited 21 health facilities and interviewed 29 public sector doctors from the rural area we selected  appeared to resonate well with the theoretical lens of SLB, so we used concepts from this theory to deepen the analysis. We worked iteratively with the list of themes that emerged and constructed data displays (tables and charts) to organize and detect patterns of relationships in the data. We used NVivo version 12 to aid the coding process. The first author led the analysis, but the preliminary analytical summaries and data displays were shared with the other authors to allow for interpretation. During the last iteration of data collection, these summaries were shared with 2 additional doctors from the public system for further validation.Consent from all participants was taken; but ten doctors preferred to give verbal rather than written consent for the interviews (the doctors were willing to participate but did not want to sign a form). When given permission to record, interviews were audio-recorded. All recordings were deleted after being transcribed. All data in the transcripts has been anonymised. In the paper, we have not mentioned the name of the rural area or of the particular health centers so as to protect the identity of health system staff. Permissions for the study were granted by the state of Maharashtra as well as district-level authorities. These reactions were, thus, not \u201crandom acts of noncompliant behaviour,\u201d but ways through which the doctors used their discretionary power and \u2018coped.\u2019 Lipksy originally categorised the coping behaviours of frontline workers as those pertaining to modifying client demands (thus maximising use of resources), modifying job objectives  and modifying perceptions of clients . Subsequent literature has tried to expand on these categories. For instance, Brehm and Gates categorised the behaviours of bureaucrats into three categories \u2013 \u2018working\u2019 , \u2018sabotaging\u2019  and \u2018shirking\u2019 . More recently, Tummers et al had put forth a typology of coping behaviours, synthesized from literature across several disciplines. Here, coping was defined as \u201cthe cognitive and behavioural efforts made by frontline workers to master, tolerate, or reduce external and internal demands and conflicts among them during policy implementation.\u201d We found this typology to be comprehensive; and the categorization of coping behaviours used here seemed to fit well with the initial analytical themes that we had inductively extracted. We have adapted this typology for this study and have looked at coping in terms of:Lipsky\u2019s original theory- set in contexts where frontline workers were blamed for being aggressive and irresponsive to client needs- contended that frontline workers exhibited these behaviours as responses to challenges in the public sector bureaucracy.specific instances of coping\u2013 specific examples of action observed or reported by doctors (like a doctor not doing an out-patient clinic that is mandated)coping strategies \u2013 mechanisms that surround coping instances (like a doctor rationing and routinising care) andadaptive processes \u2013 broader attitudes and behaviours that have become routine among doctors in the public primary care sector (like doctors becoming risk-averse or learning to game the system). We could not find instances of coping behaviours that moved against clients in our data, so we have used only the other two groups to report our findings.Tummers et al had also grouped coping behaviours as those that moved towards clients (made pragmatic adjustments to aid client needs), those that moved away from clients (actions that avoided meaningful interactions that can benefit clients) and those that moved against clients . Derived from these ideas, many efforts have been made to systematically understand factors that influenced street-level action. Previous literature from LMICs has categorised factors shaping coping behaviours of street level bureaucrats as: individual characteristics ; organizational characteristics ; community or patient characteristics ; and other broader socio-political systems. We have used similar categories to examine our findings. We have also looked specifically at the interactions between doctors\u2019 professional identities and issues in the organizational context- for these interactions played out strongly in our data.After delineating the nature of coping behaviours by doctors, we also examined why such behaviours persisted in the frontlines of the public health system. Lipsky included constraints of resources, ambiguous policies, increased work burden and work stress as some of the issues encountered at the frontline.We have reported the findings of this paper in two sections. First, we have described various coping attitudes and behaviours exhibited by doctors in primary health centers (section 1). Then, we have examined why such coping behaviours persist in health system, thereby contributing to gaps in service delivery at primary health centers (section 2). Adapting from Tummers et al classification, we have discussed coping behaviours in terms of \u201cmoving away from patients\u201d (doing actions/interactions that are less meaningful to the community) and \u201cmoving towards patients\u201d  see .Our discussions with doctors revealed several coping behaviours at primary health centers that moved away from patients  in implementing these programs .\u201cBut then this is way the system is. Nothing works. Who will make things better? Why? Best to keep quiet and work with what the government gives\u201d .\u201cclinician\u201d hats. As one doctor put it, the work in primary health centers had become aboutFurther, most doctors got used to taking risk-averse decisions in primary health centers, as well as making professional compromises in the day-to-day work .What were the implications of doctors\u2019 coping behaviours on the work of primary health centers? The resigned attitudes of doctors, their distancing from patients, the rationing and routinising of care along with the adoption of a risk-averse approach contributed to the delivery of poor-quality outpatient care. Further, the same attitudes of resignation and inability to change things for the better contributed to the perfunctory and diluted implementation of programs at primary health centers.\u201csafe mode.\u201d For instance, in We found only a few doctors who reported behaviours that moved towards patients. These doctors bent rules for the sake of patients rather than for personal benefit and tried to retain their professional identities  even when the situation demanded it; and often took risk-averse decisions. They referred more cases than clinically necessary \u2013 for doctors shared that a clinical mishap \u201cgave the government a bad name,\u201d following which they would be blamed for their actions not only by the patients, but also by the higher authorities. Disillusioned by their lack of support for being \u2018good\u2019 professionals, doctors felt helpless and unable to help the community. Hence, they often stopped trying to live up to the professional standards they had once recognised for themselves. In the course of doing so, they sacrificed their clinician hats. For most doctors, this was a great burden to bear .\u201cSome instruction will come from above\u2026people from the top pick up the phone and say \u2018send this report it, that report\u2019 that all has to be done at (name of the center). Nothing that uses my doctor skills\u201d.\u201cDown in the system, people create trouble, politicians create trouble and you can\u2019t work. I so much prefer the (district level) hospital\u201d.\u201cSometimes I feel really bad\u2026with so much difficulty I have obtained this qualification\u2026this big degree\u2026and after this, what kind of service I am giving people? No medicines, no investigations\u2026I don\u2019t even have a IV line\u2026why will a patient come to me? What can I do for them?\u201d.\u201cWhat change? Better to let things be as they are\u2026how things are going on, let them go on the same way. Nothing is in our hands, right? See, like today, we have given a demand for drugs, I know nothing will come\u2026still I demand\u2026and we adjust with what is there\u201d.paper-work\u201d person). But such doctors were few, and most doctors in the public system appeared to have accepted their diminished professional status.However, we also encountered a few doctors in the system who had managed to retain vestiges of their professional identity and tried to \u2018cope\u2019 with the situation by adopting positive behaviours .\u201cThere are so many lacunae in government\u2026so what can we do, you tell me? Medicines are not there\u2026equipment is not there\u2026we can do nothing. We are like you only\u2026we can do nothing. It\u2019s a bigger pattern outside of our control\u2026\u201d.\u201cThe issue is that once you get into the government, there is a danger of you getting institutionalised. The more time you spend in certain settings, you become like that\u2026one has to be very careful not to fall into the rut of doing nothing\u201d.\u201cIt is all government policy to make which policy, which scheme\u2026and how to implement it\u2026it has nothing to go with me\u2026I just follow\u2026I do my work\u201d.make do with what he had\u2019 and not to improve the implementation of programs. In fact, we encountered the idea that it was not the doctor\u2019s job to improve implementation processes, many times during our conversations. Doctors also shared that doing anything \u201cextra\u201d while managing programs (that was beyond their reporting mandates) posed a \u201crisk;\u201d and such actions, though not formally prohibited, were not encouraged or supported in the public system. A few doctors reported failed attempts to improve this state of affairs. One doctor had tried to send a memo to district authorities for the suspension of a support staff member who had refused to do outreach work; but there was no action taken on his memo despite many reminders. That experience had taught him that his job was to \u2018happy\u2019 as long as some version of the NCD policy directive was getting implemented on the ground. One doctor said that improving implementation processes was subtly discouraged in the public system and he had learnt through experience that it was \u201cnot his business\u201d to improve implementation. Most doctors had worked out a way to implement the scheme for \u201cname-sake\u201d only- that is, superficially, by completing minimally required screening targets.During the time of our discussions, doctors were asked to participate in a massive screening campaign for non-communicable diseases (NCDs); but no treatment was available post-diagnosis for patients as per policy. Many doctors felt that screening without providing drugs was unethical; some shared that they were not trained to screen; others said that the diagnosis of NCDs was beyond the scope of primary-level care. However, these implementation concerns were rarely discussed with higher-level managers. It was generally acknowledged that top-level administrators were \u2018\u2018taught\u2019by the more senior doctors that making efforts to change the way things worked in the public system was essentially pointless. More experienced doctors shared they had become used to this work and hence felt little distress when they compromised in care provision; for they had accepted these issues as an integral part of the job.Younger doctors sometimes shared that they felt uncomfortable not doing anything about the routine compromises they had to made during their work at primary health centers. However, they had been Below, we summarise the study findings from section 1 and 2. Doctors reported several challenges in delivering primary healthcare-including the lack of resources, the top-down imposition of programs that were not meaningful to them, limited support from the organization to improve processes as well as professional disinterest. These challenges contributed to the adoption of a range of coping attitudes and behaviours. Most doctors routinized and rationed care, and often became resigned and risk-averse. Most of them felt a deep loss of their professional identity, and accepted this loss as an inevitable part of a public sector job. Further, most doctors felt that they could not do justice to the administrative roles that they had been assigned. Such coping behaviours, on balance are likely to impact negatively on the quality of care provided from primary health centers.; allowing their bureaucratic identity to be subsumed into their professional one. Our study shows, however, that there is merit in looking at doctors\u2019 actions using SLB theory. Through the SLB lens, doctors\u2019 actions are not treated solely as professional decisions. Instead, the actions are seen as ways through which these professionals \u2018cope\u2019 with a wide range of contextual factors; and \u2018coping\u2019 causes them to sustain particular attitudes and work-routines in the long-run. Thus, the use of the SLB lens expands the understanding of doctors\u2019 actions as contextually situated routines.While the volume of actor-centric, empirical studies in the field of policy implementation has been growing recently in LMICs, few studies have looked at explicitly at doctors - as Street Level Bureaucrats. One reason for this could be that doctors have typically been considered a group of highly-skilled professionals with inherent discretionary power and some empirical LMIC literature does touch on how frontline health staff \u2018cope\u2019 by adopting certain attitudes and actions  during policy implementation. However, the knowledge base is still limited and more studies that systematically categorise coping behaviours and elicit nuanced accounts of these behaviours are needed from LMIC health contexts. In this study, the consideration of coping at various levels- as specific instances, as strategies that surround these instances, and also as aggregated adaptive processes (adapted from Tummers and colleagues\u2019 framework) \u2013 has enabled a systematic and detailed understanding of doctors\u2019 coping behaviours in primary healthcare settings. To elaborate, examining individual coping instances helped to dissect doctors\u2019 actions and these instances have served as illustrative ideas around which to deepen discussion. Coping strategies that are more abstract than instances  have also helped to understand the mechanisms that define coping instances. Broader adaptive processes clarified how certain patterns of attitudes and behaviours eventually become part of work-routines at primary health centers. Overall, examining coping through these three levels has added depth as well as clarity to our understanding of doctors\u2019 actions. Our analysis suggests the usefulness of further empirical work from LMICs that similarly considers coping behaviours in this layered way.\u2018Coping\u2019 has always been a central concept in SLB theory,practical norms\u201d \u2013 that develop over time and persist in public sector organizations. Our findings indicate that these adaptive processes are not specific to any particular scheme or policy; rather, they underlie all activities implemented from primary health centers and form the basis for de facto policy. Other studies have also touched upon such adaptive behaviours. Health providers in public health systems have expressed concerns about being used as \u201cscapegoats\u201d by the system, have reported being scared of being subjected to censure by the media and the community; and also have expressed feeling \u201cpursued rather than protected in the exercise of medical care;\u201d all of which contributes to the risk-averse coping routines that persist in public health systems.In this study, we have paid particular attention to the broader adaptive processes of coping- resignation, risk-averseness and the sacrifice of professional ideals. This is because such processes present a window for understanding informal routines \u2013 the \u201ccollective divergence\u201d of doctors from intended policy goals. Over time, most doctors seem to have learnt that survival in the system implies working mainly with formally imposed and heavily monitored policy mandates  and ignoring other services; and, as a result, have, over time, \u201cdrifted towards compatibility with the way (things are) evaluated\u201d in the public sector. However, it is important to note that these imposed policy mandates appear only to influence \u201cwhat\u201d must be done at primary health centers, rather than the more nuanced \u201chow\u201d of the tasks involved- which is often, inevitably, left to the discretion of doctors. Thus, in a risk-averse environment with resigned attitudes and low levels of professional enthusiasm, policy mandates are often carried out in perfunctory ways. There is little ownership of tasks beyond obligatory reporting requirements; and as Stone puts it, there always seems to exist a \u201cfelt need to go on to the next client, the next report, or the next item of business.\u201dEven exceptional providers who try hard to take ownership of tasks are limited by resources, lack of organizational support, and the constant informal pressure to be risk-averse; and these limitations often leaves them frustrated. These experiences result in the perfunctory and diluted implementation of primary healthcare policies.In our study, adaptive coping processes often seemed to form the basis for the \u201c Many of the organizational and local socio-political factors elicited in this study \u2013 resource constraints, structural deficits, issues with organizational culture and relationships, and lack of connect with the community - have been noted in other empirical studies on frontline policy implementation that involve doctors, as well as other cadres of frontline staff.This study also highlights a range of factors as influencing doctors\u2019 practices in Indian primary health centers. We have categorised these as the underlying beliefs of doctors , professional , organizational  and local socio-political  factors. Similar categorizations of influencing factors have been used by others as well. most SLB studies underplay the influence of professional factors over frontline worker actions. Lipsky in his original work does refer to professional identities as playing a role in shaping frontline worker response, but studies from the LMIC health sector that use SLB theory have usually placed less emphasis on this aspect. Our findings underscore the importance of examining both roles  when considering frontline cadres (like doctors) that have a strong sense of professional identity. In our study, we found that most doctors felt they could not do justice to either of these roles due to the many organizational constraints they faced. This has led to long-term demotivation and inculcated the attitudes of resignation among doctors that seem to have contributed to the delivery of poor quality care.In our findings, the set of \u2018professional\u2019 factors play out strongly, and these interact in various ways with \u2018organizational\u2019 factors to shape doctors\u2019 actions. Although one other study has noted these interactions, as well as the challenges that doctors face in dealing with the duality of being a professional (a clinician) as well as a bureaucrat, that were not fully discussed by study participants, and so have not been reported in this paper. One important point that aided frank conversations was the fact that the first author who conducted the interviews was a doctoral student. A letter from the university seemed to assure doctors that they were not being tested for their competence or being evaluated by the organization secretly. Although we observed doctors while waiting at primary health centers, the evidence presented in this paper is mostly self-reported actions which could not be triangulated with observations. Finally, although we did purposefully select female doctor respondents, the majority of doctors available in these rural regions are men and so the opinions we report are male-dominated.Some limitations of this study are noted. First, it was not easy to collect data on street-level coping behaviours. While doctors were often willing to talk about general challenges faced during work in the public system, it was not always easy for doctors to talk about specific instances. Some doctors preferred to speak in third person (about difficult situations faced by a colleague) rather than about themselves. Conversations that were not tape-recorded in general yielded better information, especially on certain themes pertaining to the public sector organization. However, even during untaped conversations, there were certain themes- corruption, taking and giving of bribes by doctors and private practice - known to exist in similar settings,This study was done in one rural area, and we do not claim that the experiences we have reported here are representative of all doctors in rural primary healthcare settings. However, the rich, in-depth data from our study offers interesting insights into the nature of coping behaviours in such settings and factors that shape these behaviours. Based on these insights, we reflect below on what the study findings could mean for primary healthcare policies in India and other similar LMIC health contexts. Even among those who work at primary health centers, frustration and lack of motivation has been documented. However, there have been few interventions in the public sector in India to remedy the situation, besides technical training and structured incentives. Our evidence clearly points to the need for a different set of interventions; those that can deal with the fear of blame and frustration, help deal with challenging relationships and institute oversight mechanisms beyond measurement of specific performance indicators.Policies in India have historically been concerned about the challenge of recruiting doctors for work at primary health centers; as many doctors prefer to opt for private practice.advocacy, awareness-raising, and debate at the frontline,\u2019 thereby making policies more meaningful to health providers. Interventions suggested in the literature from other LMICs include values\u2019 clarification workshops, supportive supervision, engaging staff in reflection, consulting with staff regarding policy changes rather than imposing them top-down, using appreciative enquiry techniques and generally strengthening leadership at the frontline. The need to create spaces for deliberative and reflective practice has been pointed out. Recognising informal practices among frontline health workers and bringing about changes in the organizational culture that allow frontline health providers better access to and control over resources has also been shown as important. In summary, the need for \u2018new and more creative strategies\u2019for motivating healthcare workers has been emphasized.While the exact nature of these interventions needs to be context-specific, the general principles that surround a set of interventions to improve provider behaviour would likely remain the same across resource-constrained settings. Other LMIC studies using the SLB lens have pointed out the need for interventions that deal with \u2018To conclude, this study attempts to adds to the policy implementation literature in LMICs that applies the SLB lens. It illustrates that doctors\u2019 decisions at primary health centers are shaped by their professional values as well as by formal and informal organizational requirements. It highlights that a range of informal practices have become \u2018routinised\u2019 in the health system, and that these can contribute to the disjuncture between policy goals and frontline realities. Thus, this study confirms the usefulness of the SLB lens in studying routine health policy implementation in LMICs.This paper has been funded through the Health Policy Analysis Fellowship programme, supported by the Alliance for Health Policy and Systems Research, Switzerland. We acknowledge the mentor team of the fellowship program-Maylene Shung-king, Irene Agyepong, Jeremy Shiffman and Zubin Shroff; and all the fellows of the program for their reviews and comments on this work. We thank the Center for Social Medicine, Pravara Institute of Medical Sciences, in Ahmad Nagar, Maharashtra, for logistical support during data collection- in particular, the interns who worked with us and faculty of the school, Dr. Somasundaram and Dr. Thitame. We thank the health staff who shared their valuable thoughts with us during the study. We particularly thank Professor T. Sundararaman, Independent consultant and former dean, School of Health Systems Studies, Tata Institute of Social Sciences, Mumbai and Professor Surinder Jaswal, Deputy Director (Research), Tata Institute of Social Sciences, Mumbai, for their inputs on the results of this study.Ethical approval for the study was taken from the Institutional Review Board at the Tata Institute of Social Sciences, Mumbai, India- in April 2018.Authors declare that they have no competing interests.SR designed this part of the study, with mentorship from LG and SM. Data collection was done by SR, and LG, SM, and NG commented on the analysis. The first draft of the paper was written by SR, and reviewed by LG, SM, and NG. The final draft of this paper has been reviewed by all four authors. SR is the guarantor of the paper.1School of Health Systems Studies, Tata Institute of Social Sciences, Mumbai, India. 2Division of Health Policy and Systems, University of Cape Town, Cape Town, South Africa. 3Department of Global Health and Development, London School of Hygiene and Tropical Medicine, London, UK. 4Center for Health and Social Sciences, School of Health Systems Studies, Tata Institute of Social Sciences, Mumbai, India.This study contributes to empirical literature from low- and middle-income countries (LMICs) that explains how the attitudes and behaviours of frontline health providers shape policies. In such settings, doctors have often been blamed for not implementing policies well and for not living up to professional expectations. But an alternate way of looking at these actions is by considering these as ways in which doctors \u2018cope\u2019 with the challenging situations they face during day-to-day work. Doctors face several constraints in the implementation of primary care \u2013 lack of professional interest in primary care roles, top-down policy mandates imposed on them, lack of community trust and systemically-engendered risk aversion. These constraints lead to demotivation, resignation and a loss of professional identity among doctors. Ultimately, they deliver a compromised version of primary care, different from that of policy expectations. Further technical training of doctors has often been offered as a means of improving the delivery of primary care in public health settings in LMICs. This study suggests that other interventions - such as supportive supervision, the use of appreciative enquiry techniques, as well as consultations and deliberation with staff regarding policy implementation-would also be important to improve care. In this study, we look at how health providers\u2019 attitudes and behaviours shape policies, through the example of doctors who work in the public, primary health sector in India. Doctors reported that they had limited professional interest in delivering primary care, and were constrained by other issues such as the lack of infrastructure, the imposition of too many targets and a lack of connection with the community. Doctors\u2019 also acknowledged that such constraints led them to adopt behaviours that could potentially comprise the delivery of primary care. These findings suggest that the provision of technical training or the mere imposition of top-down targets on health providers are not adequate to make policies succeed. To ensure policy success, people in the frontline have to be supported and motivated in other ways."}
+{"text": "Alternative splicing (AS) and transcription elongation are vital biological processes, and their dysregulation causes multiple diseases, including tumors. However, the coregulatory mechanism of AS and transcription elongation in tumors remains unclear. This study demonstrates a novel AS pattern of tight junction protein 1 (ZO1) regulated by the RNA polymerase II elongation rate in colorectal cancer (CRC). Glioma tumor suppressor candidate region gene 1 (GLTSCR1) decreases the transcription elongation rate of ZO1 to provide a time window for binding of the splicing factor HuR to the specific motif in intron 22 of ZO1 and spliceosome recognition of the weak 3\u2032 and 5\u2032 splice sites in exon 23 to promote exon 23 inclusion. Since exon 23 inclusion in ZO1 suppresses migration and invasion of CRC cells, our findings suggest a novel potential therapeutic target for CRC. Cis-regulatory sequences include intronic or exonic splicing enhancers and silencers, while trans-acting factors bind to cis-regulatory sequences to regulate AS (Alternative splicing (AS) is a key biological event that increases the coding efficiency of eukaryotic genes and increases protein diversity . The sysulate AS . To dateulate AS ; thus, tulate AS . Two difulate AS ; in the ulate AS . AlthougAbundant aberrant AS events have been discovered in multiple types of cancer and contribute to tumor development. These splicing variants might be considered a reservoir of new cancer-specific markers and neoantigens . Tight jGlioma tumor suppressor candidate region gene 1 (GLTSCR1) is located on chromosome 19q13.33 and exhibits frequent allelic loss in human diffuse gliomas . GLTSCR1To discover AS events regulated by GLTSCR1, we reanalyzed our previous RNA sequencing (RNA-seq) data (PRJNA517374) from GLTSCR1-knockout (KO) CRC cells. GLTSCR1 KO resulted in 1011 genes with upregulated isoforms and 800 genes with downregulated isoforms. Among these genes, 247 had two different isoforms that displayed opposite expression patterns. Then, 67 genes with no significant change in the total mRNA level were selected for further analysis . MoreoveAs a major component of the tight junction complex, ZO1 prevents cell migration and tumor metastasis in breast cancer , pancreain vivo, we established a mouse model with conditional deletion of GLTSCR1 in intestinal epithelial cells (GLTSCR\u0394IEC) by breeding GLTSCR1fl/fl mice with Villin-Cre mice (GLTSCR1fl/fl-Villin-Cre), which start to express Cre recombinase on approximately embryonic day 10  staining showed that more and larger tumors formed in the colorectum when GLTSCR1 was conditionally deleted in intestinal epithelial cells . ZO1 E23+ variant expression was significantly reduced and E23\u2212 variant expression was increased in tumor samples  and RBPmap (a tool for mapping RBPs), two web servers for mapping binding sites of RBPs , to scanGLTSCR1 decreases the transcription elongation rate of ZO1 to provide a time window for spliceosome recognition of the weak 3\u2032 and 5\u2032 splice sites in E23 and may also provide a time window for HuR to bind to the specific motif in ZO1 intron 22 to promote E23 inclusion. To verify this hypothesis, we used a mouse monoclonal anti-HuR antibody to evaluate the binding ability of endogenous HuR to the specific motif in ZO1 pre-mRNA in MOCK and GLTSCR1-KO cells. The RIP assay showed that GLTSCR1 KO decreased the binding ability of HuR to ZO1 pre-mRNA, but partial HuR binding ability was retained in GLTSCR1-KO cells . This fiWe validated that GLTSCR1 decreases the transcription elongation rate of ZO1 to provide a time window for HuR to recognize its binding motif in intron 22 of ZO1 and then promote E23 inclusion, a mechanism that corresponds to the kinetic model. Furthermore, the recruitment model of cotranscriptional regulation of AS proposes that Pol II can enrich abundant splicing factors in the vicinity of the pre-mRNA. To investigate whether GLTSCR1-mediated cotranscriptional regulation of ZO1 AS also fits the recruitment model, we used a coimmunoprecipitation (co-IP) assay to detect the interaction between Pol II and HuR in MOCK and GLTSCR1-KO cells. GLTSCR1 KO did not affect the interaction between Pol II and HuR . Consisttrans-acting factors of cancer-associated genes, such as the well-characterized SR-rich proteins, hnRNP family members, and tissue-specific factors. The ability to study a specific genetic event without understanding its dynamic and spatial regulation is somewhat limited. Our data suggest a dynamic and spatial model for the regulation of AS by transcription elongation, allowing extensive study of AS regulation in CRC progression.As a key characteristic of cancer, aberrant AS can generate new cancer-specific markers and neoantigens, which have been considered important biomarkers for evaluating tumor progression and the therapeutic response . Along wCurrently, the SNPs rs1035938 and rs1052555 have been reported to be associated with the development and progression of oligodendroglioma . In addiZO1 is the major component of the tight junction complex and interacts with occludins and claudins, which form barriers between adjacent cells to control the transport of water, ions, and macromolecules . A previIn this study, we demonstrated a Pol II elongation rate-dependent ZO1 AS model in which GLTSCR1 reduced the elongation rate of ZO1, which provides a time window for recognition of the weak 3\u2032 and 5\u2032 splice sites in E23 by the spliceosome and the ZO1-specific splice factor HuR to promote ZO1 E23 inclusion. However, ZO1 E23 exclusion could promote CRC progression. Therefore, the splice sites in ZO1 E23 might be considered new therapeutic targets for CRC.n\u00a0=\u00a064) from patients undergoing surgery in Wuxi Cancer Institute, the Affiliated Hospital of Jiangnan University, were included in this study. The research was approved by the Ethics Committee of Department of Medicine, Zhejiang University (2018-018), and all participating patients were informed. Tumor and paired normal tissue samples were prospectively collected from 2003 to 2011.Colorectal carcinoma and paired normal tissue samples (2. HCT116 and HCT8 were purchased from the American Type Culture Collection (ATCC). HEK293T was purchased from the cell bank at the Chinese Academy of Sciences (Shanghai).Human CRC cell lines HCT116 and HCT8 were cultured in RPMI 1640 medium. Human HEK293T cell line was cultured in Dulbecco's modified Eagle's medium. All media were supplemented with glutamine, 10% fetal bovine serum (FBS), and penicillin/streptomycin. Cell lines were grown in a humidified atmosphere at 37\u00b0C\u00a0with 5% COHCT116 MOCK and HCT116 GLTSCR1-KO cell lines were cultured as mentioned above. Cells were first treated with 300\u00a0\u00b5M DRB  for 5\u00a0h and washed by phosphate-buffered saline (PBS) three times, and then fresh RPMI 1640 medium with 10% FBS and penicillin/streptomycin was added after DRB removal. Cells were harvested at 1-h intervals for RNA isolation and RT\u2013qPCR. HCT116 MOCK and HCT116 GLTSCR1-KO2 cells were also treated with 50, 100, or 200\u00a0\u00b5M DRB for 3\u00a0h, washed by PBS three times, and harvested for RNA isolation and RT\u2013qPCR.Plasmids were transfected with LipoD293 (SignaGen). The siRNAs were transfected by using GenMute siRNA Transfection Reagent according to the instruction .5 cells were loaded per transwell cultured with serum-free media in the upside of the membrane. The cells were fixed in methanol for 10\u00a0min after migrating to the underside of the membrane and stained with crystal violet. Then, 30% glacial acetic acid was used to elute crystal violet to measure the cells on the lower face of the filter. Three independent experiments were performed in triplicate.Cell motility and invasion were measured by transwell and Matrigel chamber plates, respectively . Briefly, 1\u00a0\u00d7\u00a010Mice colon and rectum samples were fixed with 4% formaldehyde and paraffin-embedded. The 4-\u00b5m-thick sections were stained with H&E.fl/fl (C57) mice were bred with Villin-Cre mice to generate GLTSCR1fl/fl-Villin-Cre mice. AOM was injected intraperitoneally at 10\u00a0mg/kg body weight on Day 1 and followed by three cycles of DSS treatment. Each DSS-treated cycle contained 3 weeks. During the first week, mice were treated with DSS-containing water (2.0%\u00a0w/v) and followed by two weeks of normal water. At the end of the three cycles, the mice were sacrificed (at the 11th week), and the colorectal tissues of the mice were dissected. After being cleaned by PBS, some of the tumor and normal tissues were stored in formalin for subsequent emplacement, while the others were taken for RNA extraction.All animal experiments were performed in accordance with a protocol approved by the Institutional Animal Care and Use Committee at Zhejiang University (Ethics Committee number: 12169). GLTSCR1\u00ae qPCR Master Mix . The data were analyzed using the \u0394\u0394CT method and were first normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers used for genomic qPCR are listed in Total RNA from cells or tissues was isolated using the TRIzol reagent (Invitrogen). Then RT\u2013qPCR was performed using Vazyme reagent (R223-01). After reverse transcription, qPCR analysis was performed using ChamQ\u2122 Universal SYBRCells were washed with PBS, fixed with 4% formaldehyde for 10\u00a0min, and permeabilized with 0.1% Triton X-100 for 10\u00a0min. Then, the cells were blocked with 10% normal goat serum for 30\u00a0min, incubated with antibody overnight at 4\u00b0C, and incubated with specific anti-mouse or anti-rabbit secondary fluorescence antibody for 1\u00a0h. The slides were added with 200\u00a0\u03bcl of 100\u00a0nM rhodamine phalloidin and incubated at room temperature in the dark for 30\u00a0min. The cells were washed three times in PBS and then incubated with DAPI (Thermo Fisher) for 20\u00a0min.P\u00a0<\u00a00.05 and log2 fold change >0 and <0 were defined as differentially expressed isoform candidates. In addition, genes without significant change at gene level were selected for further analysis. All raw and processed sequencing data generated in this study have been submitted to the NCBI Sequence Read Archive  under accession number PRJNA517374.HCT116 MOCK and GLTSCR1-KO2 cells were collected and total RNA was extracted, sequenced, and analyzed by RiboBio. Three biological replicates were used for condition. The cDNA libraries were prepared from high-quality RNA using an Illumina TruSeq RNA Sample Prep Kit following the manufacturer's instructions (Illumina). The individual RNA-seq libraries were pooled based on their respective sample-specific 6-bp adaptors and sequenced at 150\u00a0bp/sequence pair read using an Illumina HiSeq 3000 sequencer. Gene differential expression and transcript differential expression analyses were accomplished by the Cuffdiff program in the Cufflinks package. Genes with two different isoforms were selected, which displayed opposite expression patterns. Gene isoforms with \u00ae Enzymatic Chromatin IP Kit (Magnetic Beads)  according to the manufacturer's instructions. Samples were analyzed by real-time PCR using SYBR Green Power Master Mix following the manufacturer's protocol. ChIP\u2013PCR analysis was performed to detect the accumulation of RNA Pol II in ZO1. The DRB treatment was described above.HEK293T cells were cultured in a 10-cm culture dish. After 18\u00a0h, cells were transfected with Flag-GLTSCR1 by LipoD293 (SignaGen). Cells were prepared for ChIP assay by using anti-Flag antibody at 48\u00a0h after transfection. ChIP assays were performed by a SimpleChIPHCT116 MOCK and HCT116 GLTSCR1-KO2 cells were seeded in a 10-cm culture dish. After 18\u00a0h, cells were treated with bromouridine (Aldrich) at a final concentration of 2\u00a0mM for 2\u00a0h. The cells were washed with PBS three times, trypsinized, and collected. Total RNA from cells was isolated using the TRIzol reagent, and the BrdU-labelled nascent RNA was pulled down by anti-BrdU monoclonal antibodies  and then detected by RT\u2013qPCR.Magna RIP Kit  was used, but the beads in the kit were replaced with M2 magnetic beads (Sigma-Aldrich), to pull down the proteins with Flag-tagged HuR. Cells were seeded in 10-cm plates and washed twice with 5\u00a0ml ice-cold PBS. Cell pellet was collected and resuspended in complete RIP lysis buffer. After using RIP wash buffer to wash 50\u00a0\u00b5l of M2 magnetic beads twice, 100\u00a0\u00b5l of lysis and beads were incubated in 900\u00a0\u00b5l of RIP immunoprecipitation buffer at 4\u00b0C overnight. Then, beads were washed by RIP wash buffer five times and collected by a magnetic separator. The immunoprecipitate was resuspended in 150\u00a0\u00b5l proteinase K buffer and incubated at 55\u00b0C for 30\u00a0min. The supernatant was transferred into 250\u00a0\u00b5l of RIP wash buffer and 400\u00a0\u00b5l of phenol:isoamyl alcohol in the tube. Then, the aqueous phase was moved into a new tube and mixed with 400\u00a0\u00b5l chloroform. Salt solution was added to enhance the precipitation of RNA at \u221280\u00b0C overnight. Finally, the pellet was washed by 80% ethanol and resuspended in 15\u00a0\u00b5l of RNase-free water.Statistical specifications of each experiment precision measure and the statistical tests used are provided in figure legends. Kaplan\u2013Meier survival analysis was performed using the software IBM SPSS Statistics 20 with the log-rank (Mantel\u2013Cox) test.mjac009_Supplemental_FileClick here for additional data file."}
+{"text": "Observations at 6 field studies and 22 online followup studies spanning 5 years showed that self-reported transformative experiences at mass gatherings were common, increased over time, and were characterized by feelings of universal connectedness and new perceptions of others. Participants\u2019 circle of moral regard expanded with every passing day onsite\u2014an effect partially mediated by transformative experience and feelings of universal connectedness. Generosity was remarkably high across sites but did not change over time. Immediately and 6 months following event attendance, self-reported transformative experience persisted and predicted both generosity (directly) and moral expansion (indirectly). These findings highlight the prosocial qualities of transformative experiences at secular mass gatherings and suggest such experiences may be associated with lasting changes in moral orientation.Humans have long sought experiences that transcend or change their sense of self. By weakening boundaries between the self and others, such transformative experiences may lead to enduring changes in moral orientation. Here we investigated the psychological nature and prosocial correlates of transformative experiences by studying participants before ( Mass gatherings may elicit experiences of profound personal change. Here the authors show across six field sites that reporting of transformative experiences at mass gatherings are common, increase over time, and predict lasting increases in participants\u2019 circle of moral regard. Testimonial accounts from attendees of mass gatherings suggest that such self-transcendent experiences may be epistemically and personally transformative, resulting in lasting changes to the self3. The philosopher L.A. Paul articulates two key components of transformative experiences: they provide new knowledge that is impossible to attain without having the experience, and they produce changes in personal values and priorities that cannot be anticipated4. Here, we investigate the psychological qualities of transformative experiences at secular mass gatherings and test the possibility that such experiences are associated with enduring changes in moral orientation.The sociologist Emile Durkheim coined the term \u201ccollective effervescence\u201d to describe the feelings of self-transcendence that often arise at mass gatherings such as festivals, pilgrimages, and collective rituals5, ceremonies6, raves7, and sporting events9 are associated with feelings of self-expansion and \u201cgroup identity fusion\u201d13 a psychological state characterized by intense feelings of merging or oneness between the self and the group15. This phenomenon is well-documented across cultures16 and is associated with endorsement of group values18, enhanced group loyalty19, increased generosity26, and cooperation30. Such prosocial changes are thought to emerge from psychological processes whose original adaptive function lay in promoting the survival of the group at the expense of the self31. For example, anthropological accounts suggest that humans throughout history have often engaged in ritualistic behaviors  that amplify identity fusion before performing acts of extreme self-sacrifice32.Support for our hypothesis comes from research showing that collective gatherings such as rituals35. Recent research suggests that experiences of self-transcendent emotions are associated with increased identification with all humanity\u2014i.e., increased concern for all other human beings\u2014and motivations to help distant others37. Other work has shown that such experiences are associated with heightened feelings of social connectedness38. Building on this and other recent theoretical work4, we conceptualized transformative experiences at mass gatherings as precipitating events that may lead to changes in values and behavior characterized by an increased sense of connection to other human beings and an expanded moral circle. Thus, we tested whether self-reported transformative experiences at secular mass gatherings were accompanied by increased feelings of universal connectedness, and investigated whether such experiences would be associated with enduring changes in generosity and moral expansion.Past work on mass gatherings and identity fusion has tended to focus on how such experiences can amplify prosocial feelings and behavior directed toward the members of one\u2019s own social group. Here, by contrast, we investigated the potential for transformative experiences at mass gatherings to expand the boundaries of one\u2019s moral circle beyond the group to include all of humanity25, yet such approaches are subject to the vagaries of personal recollection. We sought to build on this work by studying the psychological qualities of transformative experiences as they occurred. To do this, we adopted a lab-in-the-field approach in which we collected data from participants as they attended one of six secular multi-day mass gatherings across five field sites in the US and the UK .We designed a variety of experimental procedures and methods appropriate for the mass gathering context, including measures of generosity and moral expansion that did not rely on the use of money, which was prohibited at some of our field sites (see SOM 4 for full descriptions of measures and verbatim participant instructions). We also collected detailed measures of participants\u2019 use of psychoactive substances, as past work has implicated psychedelic substance use in transformative experience and prosocial behavior46. While these concepts where originally conceived to understand the psychological consequences of psychedelic substance use47, we surmised they may have similarly meaningful consequences for mass gathering participation alone. Related to \u201cset\u201d , it is known that desires and expectations can have powerful effects on subsequent experiences, for example in the placebo effect48 and self-fulfilling prophecies49. Conversely, the absence of a desire or expectation for change may preclude actual change, a phenomenon known in clinical psychology as \u201cclient resistance\u201d50. Accordingly, we sought to characterize the relationships between expecting and desiring transformative experiences, on the one hand, and actual self-reported transformative experiences on the other, predicting that anticipation would positively predict transformative experience.Finally, we investigated whether the \u201cset and setting\u201d of transformative experiences is associated with the nature of prosocial change52. This question remains unexplored because, with some exceptions27, past research on transformative experiences and mass gatherings has focused largely on singular events. Here, we took a comparative approach, exploiting natural variation across field sites in the salience of communal norms. Specifically, some of our sites promoted communal norms by operating a gift economy that explicitly prohibited the use of money, while other sites promoted individualistic norms by operating a market economy where money could be exchanged for goods and services53. If setting matters, prosocial behavior may be more strongly associated with transformative experiences that occur within gifts as opposed to market economies.Setting may also be important: transformative experiences may be particularly associated with moral expansion when they occur in the context of explicitly communal event normsOverall, we set out to answer several questions about transformative experiences at secular multi-day mass gatherings, building upon and extending past work on mass gatherings, identity fusion, and prosocial behavior. First, we sought to describe the psychological qualities of transformative experiences as they unfolded over time and document how they relate to expectations and desires for transformation. Second, we examined the prosocial correlates of transformative experiences, investigating their potential to enhance generosity and expand the moral circle by engendering feelings of universal connectedness. Finally, we measured the persistence and evolution of transformative experiences and their prosocial correlates in the weeks and months following mass gathering attendance.n\u2009=\u2009473) and Burning Nest . Market-economy sites included Lightning in a Bottle , Latitude , and Dirty Bird Campout . See Table\u00a0t(1036)\u2009=\u200912.60, P\u2009<\u20090.001), received more gifts (t(1082)\u2009=\u200916.30, P\u2009<\u20090.001), and handled less money (t(576)\u2009=\u200911.80, P\u2009<\u20090.001), at gift economies than market economies.We collected data at six events across five field sites that varied on several key attributes, including the total number of attendees, location, and the presence of a gift versus market economy Table\u00a0. Over a n\u2009=\u2009600), 0\u20134 weeks after , and 6 months after  attendance, which allowed us to track relationships between transformative experience and moral orientation over time . Finally, we collected comparison data (n\u2009=\u200998) from a \u201cvirtual\u201d mass gathering that took place among Burning Man attendees in the context of the COVID-19 pandemic (see SOM 1.6 for details).We supplemented our onsite data with online surveys administered 0\u20132 weeks before , and one that compared responses from the \u201consite\u201d and \u201cimmediate follow-up\u201d samples . \u201cCross-sectional\u201d analyses refer to those occurring within a single time period ; \u201clongitudinal\u201d refer to those that examine relationships between variables collected over time within subjects  samples were obtained by combining datasets from multiple timepoints using an anonymous identifier code unique to each participant: one that compared responses from the \u201cpre-event\u201d and \u201cimmediate follow-up\u201d samples \u2009=\u20097.61, P\u2009<\u20090.001; Fig.\u00a0M\u2009=\u20094.08, SD\u2009=\u20092.06). Overall, then, these data show the prevalence of self-reported transformative experience at these events and suggest that rates of transformative experience increase over time.First, we assessed changes in self-reported transformative experience over time onsite. Regression analysis showed that, as predicted, rates of transformative experience increased significantly over time, Ps\u2009>\u20090.3). Transformative experience was negatively associated with educational attainment, B\u2009=\u2009\u22120.12, SE\u2009=\u20090.05, t(1177)\u2009=\u2009\u22122.52, P\u2009=\u20090.012 and the consumption of alcohol, B\u2009=\u20090.29, SE\u2009=\u20090.13, t(1177)\u2009=\u2009\u22122.24, P\u2009<\u20090.025. Transformative experience was positively associated with mood, B\u2009=\u20090.33, SE\u2009=\u20090.06, t(1178)\u2009=\u20095.19, P\u2009<\u20090.001, and the use of psychedelic substances, B\u2009=\u20090.37, SE\u2009=\u20090.13, t(1177)\u2009=\u20092.75, P\u2009=\u20090.006. We also built exploratory models to examine the contribution of additional behavioral variables to transformative experiences. These analyses suggested that increased reports of transformative experiences over time could be partially attributed to the formation of new social relationships, gift exchange, and dancing (see SOM 1.13 for details).Next, we examined demographic, affective, and behavioral predictors of transformative experience. In our main models, we did not observe associations between transformative experience and gender, age, or income  and perceiving something new about others . The least frequently reported qualities were feeling as though one\u2019s self had dissolved  and feeling like a different person than they were before . Figure\u00a0Ps\u2009<\u20090.05, with the exception of feeling spiritually connected to something larger than oneself and expressing one\u2019s true self (see SOM 1.8). Overall, this analysis suggests that the most prevalent attributes of transformative experiences were socially oriented . In contrast, psychedelic substance use most strongly predicted changes to perceptions of reality and oneself, suggesting that transformative experiences elicited by psychedelics may differ in certain key respects from those arising from mass gathering participation alone (see SOM 1.2 for details).To probe the qualities of participants\u2019 transformative experiences, we asked them a number of questions \u2009=\u20094.40, P\u2009<\u20090.001) and desiring \u2009=\u20096.83, P<\u20090.001) a transformative experience positively predicted participants\u2019 actually having one. It should be noted that, because these measures were collected at the same time as reports on transformative experience, it is possible that transformative experiences onsite subsequently increased reports of expectations and desires for one. Some evidence that speaks against this possibility is that self-reported expectations  and desires  collected onsite were, if anything, lower than those collected in the pre-attendance sample \u2009=\u200911.8, P\u2009<\u20090.001 and t(629)\u2009=\u200914.4, P\u2009<\u20090.001, respectively). We cannot, however, rule out the possibility that transformative experience impacted reports of anticipation.It is possible that people participate in mass gatherings with strong expectations and desires to be transformed, and these expectations and desires may create self-fulfilling prophecies. To test this question, we tested in a cross-sectional analysis whether expectations and desires for transformation predicted reported transformative experience. Consistent with this notion, both expecting (Ps\u2009>\u20090.4), suggesting that changes in such variables were not the result of anticipation . Finally, data collected at a \u201cvirtual\u201d mass gathering held during the COVID-19 pandemic showed that reports of transformative experience were significantly greater onsite than online, despite greater desires for transformation in the latter (see SOM 1.6). Overall, these results suggest that while anticipating a transformative experience is positively associated with having one, anticipation is neither a necessary nor sufficient condition for having a transformative experience.Notwithstanding the strong relationship between the likelihood of expecting or desiring a transformative experience and the likelihood of having one, there was some evidence the transformative experiences we observed onsite over time were not merely due to the self-fulfilling effects of anticipation. First, we found that, of the 49.6% of participants who did not even somewhat expect to be transformed, nearly half (46.7%) reported being at least somewhat transformed. Similarly, of the 41.5% of people who did not even somewhat desire to be transformed, 42.2% reported being at least somewhat transformed. These results show that considerable proportions of people who neither expected nor desired to be transformed nevertheless reported a transformative experience, thereby supporting the possibility that anticipation is not a necessary condition for transformation. In addition, expectations and desires did not correlate with any of our measures of prosocial attitudes behavior \u2009=\u2009 \u22120.86, P\u2009=\u20090.391, or as an interaction with time, B\u2009=\u20090.05, SE\u2009=\u20090.06, t(1176)\u2009=\u20090.76, P\u2009=\u20090.448. We also examined whether any of the qualities of transformation were more prevalent at gift economies than market economies by examining the main effect of setting on each quality. Results showed that participants of gift economies felt more socially connected to something larger than themselves, B\u2009=\u20090.38, SE\u2009=\u20090.15, t(762)\u2009=\u20092.48, P\u2009=\u20090.013. No other effects of cultural setting on transformation qualities were significant. This suggests that the majority of self-reported aspects of mass gathering attendance are consistent regardless of whether\u00a0or not the event operates a gift economy.Next, we tested whether reports of transformative experience varied across cultural settings. To do this, we included the cultural context variable (gift versus market economy) and its interaction with time (days onsite) as predictors of self-reported transformative experience, additionally controlling for event location (US versus UK). We then tested the significance of the main effect of setting and its interaction with time on a transformative experience. Results showed no significant effects of cultural context, either as a main effect, Next we sought to test the relationship between the self-reported transformative experience and prosocial orientation. Our analysis focused on two primary dependent variables: generosity and moral expansion. We tested whether these prosocial measures were correlated with self-reported transformative experience and whether they increased over time. In addition, because we hypothesized that changes in prosocial behavior would occur as a result of increased feelings of connectedness to other human beings, we also examined the relationship between these measures and the degree of overlap people reported feeling between themselves and all human beings .54. In the classic version of the game, participants are given a monetary endowment then given the opportunity to donate some portion of it to an anonymous stranger. In order to make the game suitable for gift economies (where the use of money is discouraged), we modified the game such that participants were endowed with ten tickets that could each be redeemed for a prize from a \u201cmystery box\u201d containing items of value for eventgoers. Without knowing the exact items in the box, participants decided how many tickets they wanted to give to an anonymous stranger by placing them in an envelope which was then handed to the experimenter. We observed an average donation of 62% of the tickets, a level that is notably higher than donations typically observed in dictator games, which average around 28%55 \u2009=\u20090.74, P\u2009=\u20090.448, and there was no significant relationship between transformative experience and generosity onsite, B\u2009=\u20090.11, SE\u2009=\u20090.06, t(762)\u2009=\u20091.63, P\u2009=\u20090.103 \u2009=\u20090.97, P\u2009=\u20090.334. Thus, while overall rates of generosity were substantially higher at multiday mass gatherings than typically observed in laboratory studies of dictator games, there was no evidence that generosity was positively associated with transformative experience or with time spent attending mass gatherings.To measure generosity at our field sites, we used a modified dictator gamesee Fig.\u00a0. Howeversee Fig.\u00a0. Further57. Supplementary analyses showed responses on this measure correlated with the classic, hypothetical money-based measure of social discounting, as well as with an incentivized measure of charitable giving across various social distances (see SOM 1.3).To measure moral expansion, we used a hypothetical social discounting measure where participants were asked to indicate how much free time they would be willing to spend doing a favor for people at different social distances. We indexed moral expansion by plotting the amount donated for each distance and calculating the area under the curve for each participantB\u2009=\u20090.07, SE\u2009=\u20090.02, t(862)\u2009=\u20092.94, P\u2009=\u20090.003, indicating that participants were willing to spend more time helping more socially distant strangers with every passing day spent at mass gatherings  =\u20093.43, P\u2009=\u20090.001, which itself positively associated with transformative experience, B\u2009=\u20090.08, SE\u2009=\u20090.03, t(1126) =\u20093.11, P\u2009=\u20090.002. These observations raised the possibility that the effect of time on moral expansion was mediated by its effect on the transformative experience and universal connectedness. To test this hypothesis, we constructed a mediation model testing the significance of the indirect effect from time to moral expansion through transformative experience and universal connectedness. Results showed that a significant indirect effect, B\u2009=\u20090.002, SE\u2009=\u20090.001, P\u2009=\u20090.028, CI95). The direct effect of time on moral expansion remained significant when including this effect in the model, B\u2009=\u20090.071, SE\u2009=\u20090.23, P\u2009=\u20090.002, CI95, consistent with partial mediation. A statistical model testing the relationship between time and moral expansion through universal connectedness and transformative experience  showed no significant effects of time on universal connectedness and no significant effects of transformative experience on moral expansion, lending credence to the originally hypothesized variable ordering (see SOM 1.11). Overall, these results suggest that moral expansion increases over time in part as a result of transformative experience and universal connectedness \u2009=\u20091.50, P\u2009=\u20090.135 versus B\u2009=\u20090.09, SE\u2009=\u20090.03, t(960)\u2009=\u20093.43, P\u2009=\u20090.001 for universal connectedness), and the indirect effect of time onsite to moral expansion through group identify fusion was not significant, B\u2009=\u20090.003, SE\u2009=\u20090.002, P\u2009=\u20090.155, CI95. Moreover, a model that allowed both variables to compete for variance by including both as covariates showed that universal connectedness predicted moral expansion even when controlling for group identity fusion \u2009=\u20093.13, P\u2009=\u20090.002). These results suggest that changes in moral expansion are due more to generalized increases in universal connectedness than to increased connection other eventgoers (see SOM 1.12). It is important to note that universal connectedness and the group identity fusion scales differed in their extremity, with the latter indicating total immersion of the self in the group, while the former indicated only a high degree of overlap, so means of\u00a0these measures cannot be compared directly. Nevertheless, these results are consistent with the idea that prosocial change at multiday mass gatherings may be the result of a form of universal identity fusion characterized by connectedness to all humanity59.In supplementary analyses, we explored the possibility that the relationship between time and moral expansion was mediated by group identity fusion\u2014a variable reflecting people\u2019s sense of overlap with other event attendees as opposed to other humans in general. First, we substituted group identity fusion for universal connectedness in the model predicting moral expansion from time onsite and transformative experience see Fig.\u00a0. Group iPs\u2009>\u20090.05. Thus we find no evidence that the effect of time on transformative experience and prosocial orientation is moderated by local event norms.We examined whether the effects of time on generosity and moral expansion varied for events with market versus gift economies by looking at interactions between time and setting on universal connectedness, moral expansion, and generosity. We found no main effects of cultural setting on these measures, nor any interactions between cultural setting and time, all Next, we examined the relationships between transformative experience, generosity, and moral expansion in the weeks and months following event attendance. Because we considered participants following the event to have received a \u201cfull dose\u201d of event attendance , we dropped \u201cdays onsite\u201d from these analyses and focused on the relationships between transformative experience, generosity, and moral expansion, with universal connectedness as a potential mediator. Because the majority of the follow-up samples consisted of Burning Man attendees, it was not possible to perform cross-event comparisons on these data.n\u2009=\u20098515), 19.5% of participants indicated they had \u201cabsolutely\u201d had a transformative experience and 71% said they had at least \u201csomewhat\u201d had a transformative experience. Similar figures were evident six months after attendance (n\u2009=\u2009696), when 27% of participants reported \u201cabsolutely\u201d having a transformative experience and 72.7% reported at least \u201csomewhat\u201d having a transformative experience \u2009=\u20093.26, P\u2009=\u20090.001 \u2009=\u20092.52, P\u2009=\u20090.012 \u2009=\u2009 1.60, P\u2009=\u20090.111, nor was the indirect pathway from transformative experience to generosity through universal connectedness, B\u2009=\u20090.005, SE\u2009=\u20090.004, P\u2009=\u20090.266, CI95. Similar results were observed in the 6-month follow-up data; there was no significant relationship between universal connectedness and generosity, B\u2009=\u20090.20, SE\u2009=\u20090.13, t(394)\u2009=\u20091.51, P\u2009=\u20090.131, and the indirect effect of transformative experience on generosity was not significant, B\u2009=\u20090.011, SE\u2009=\u20090.01, P\u2009=\u20090.30, CI95. Thus while we observed a relationship between transformative experience and generosity both immediately after event attendance and six months afterwards, we found no evidence for a mediating effect of universal connectedness.In contrast to the onsite data, in the immediate follow-up survey, transformative experience was positively associated with generosity, see Fig.\u00a0. This resee Fig.\u00a0. To probB\u2009=\u20090.12, SE\u2009=\u20090.02, t(1805) = 7.26, P\u2009<\u20090.001, as was the relationship between universal connectedness and moral expansion, B\u2009=\u20090.11, SE\u2009=\u20090.02, t(1275)\u2009=\u20094.90, P\u2009<\u20090.001. Mediation analysis showed a significant indirect effect from transformative experience to moral expansion through universal connectedness, B\u2009=\u20090.023, SE\u2009=\u20090.006, P\u2009<\u20090.001, CI95. Similarly, 6 months after attendance, we found a significant relationship between transformative experience on universal connectedness, B\u2009=\u20090.16, SE\u2009=\u20090.04, t(397)\u2009=\u20093.86, P\u2009<\u20090.001, a significant effect of universal connectedness on moral expansion, B\u2009=\u20090.14, SE\u2009=\u20090.04, t(347)\u2009=\u20093.25, P\u2009=\u20090.001, and a significant indirect effect between these variables, B\u2009=\u20090.032, SE\u2009=\u20090.013, P\u2009=\u20090.016, CI95. This shows that there was a significant indirect relationship between transformative experience and moral expansion through universal connectedness both immediately and 6 months following attendance. In supplementary analyses, we tested a hypothesis that transformative experience-reported onsite would predict moral expansion and universal connectedness following attendance in the same participants, 1\u20134 months and 6 months later. Although we found some evidence supporting the hypothesis, ultimately the longitudinal sample was not sufficiently powered to permit firm conclusions regarding the long-term effect of transformative experience on prosocial change (SOM 1.4).Next, we examined the relationship between transformative experience, universal connectedness, and moral expansion in the weeks and months following event attendance. Immediately following attendance, the relationship between transformative experience and universal connectedness was significant, Stories of profound personal transformation have long captured the human imagination, yet such experiences are difficult to recreate in the laboratory. Here, we adopted a lab-in-the-field approach to study transformative experiences as they were occurring at several secular multiday mass gatherings in the US and UK. Self-reports of such experiences at these events were common, increased over time, and endured at least six months following attendance. The most prevalent qualities of transformative experience were prosocial in nature and were correlated with increased feelings of connectedness between the self and all human beings. Consistent with these reports, participants showed an expanded moral circle with every passing day, an effect partially mediated by feelings of universal connectedness and transformative experience. Meanwhile, we observed high levels of generosity at mass gatherings, but generosity onsite did not increase over time and was unrelated to the transformative experience. These effects were robust to controlling for expectations and desires for transformative experience as well as substance use, and were consistent across mass gatherings with market economies as well as gift economies. In the weeks and months following event attendance, transformative experience directly predicted generosity and indirectly predicted moral expansion via universal connectedness.32. Some research suggests such prosocial behavior is psychologically mediated by experiences of personal transformation24 yet thus far research on the prosocial correlates of transformative experiences has mainly relied upon retrospective approaches, which are subject to the limitations of autobiographical memory. Here, in order to better understand how such experiences may be associated with prosocial change, we examined the qualities of transformative experiences as they occurred, and measured their association with prosocial behavior. We found that reports of such experiences did indeed increase over time, and were correlated with an expanded circle of moral regard. This shows not only that such experiences are associated with changes in moral orientation, but also that, in certain contexts at least, such changes may be characterized by feelings of universal moral inclusion11.Our results build upon and extend past work on collective effervescence and prosocial behavior, which suggests that mass gatherings played a functional role in human evolution by increasing people\u2019s willingness to make personal sacrifices on behalf of the group19 and increased group loyalty60. Much existing research on mass gatherings has focused on cultures that prioritize \u201cbinding\u201d values such as in-group conformity and loyalty62 . By contrast, our field sites were located in the US and UK and our samples skewed liberal. Past work shows that these populations prioritize more individualized or impersonal forms of morality 64. Thus our results, considered alongside observations from the prior literature, raise the intriguing possibility that transformative experiences at mass gatherings serve to amplify the moral orientation of the local culture. We speculate that in cultures dominated by impersonal or individualized morality, this could manifest as feelings of universal connectedness and moral expansion, whereas in cultures that emphasize binding values, transformative experiences may manifest as group identity fusion and greater generosity toward members of the group.Our findings also complement past research on the psychological consequences of collective rituals showing that such events are associated with a fusing of self and group identitiesOne possible explanation for our findings is that they represent a giant cultural placebo effect: that the kinds of people who attend secular multiday mass gatherings are especially likely to desire and expect transformative experiences from attending these events, and want their experiences to be socially meaningful. If this is the case, then our results would merely reflect participants' self-reporting they got exactly what they came for. This argument is supported by the fact that moral expansion but not generosity in the dictator game increased over time onsite. While the dictator game involved sharing of real personal resources, the moral expansion measure relied entirely on self-report, leaving open the possibility that participants demonstrated prosocial change only when the personal stakes were low.55 thus speaking against the view that generosity onsite was merely the result of self-presentational motivations. It is possible that high initial base rates created a ceiling effect from which further increases were statistically difficult to detect, thereby explaining the lack of change in generosity onsite over time. In addition, we observed a positive relationship between transformative experience and generosity in the follow-up surveys conducted 1\u20134 weeks and 6 months following event attendance. This delayed onset of generosity following transformative experiences is consistent with research showing that highly intense social experiences tend to be followed by periods of reflection in which the personal significance of such events is consolidated into the self-concept41. In this way, our research extends previous work on the sacrifices made by individuals on behalf of others following instances of personal transformation and subsequent feelings of identity fusion32. Further work is necessary to investigate the longer-term trajectories of transformative experience and prosocial change.We think this explanation is unlikely to account for all our observed effects, for several reasons. First, while generosity did not change onsite, it showed markedly high rates overall\u2014approximately twice as high as average levels of generosity measured in a recent meta-analysis of dictator game studiesOur data on expectations and desires for transformative experience also speak against the possibility that our participants merely reported getting what they came for. First, while expectations and desires did predict the likelihood of having a transformative experience, they were neither necessary nor sufficient conditions for doing so. Even many of those who did not expect or desire to be transformed nevertheless ended up reporting a transformative experience; about one in eight attendees who said they did \u201cnot at all\u201d expect to have a transformative experience ended responding that they \u201cabsolutely\u201d had one (see SOM 1.5). Furthermore, such expectations and desires did not predict moral expansion or generosity, and we controlled for expectations and desires in all analyses, suggesting that any positive associations reported emerged over and above the effects of anticipation. In addition, examining the temporal dynamics of transformative experiences and their prosocial correlates allowed us to control for potential effects of a general willingness to attend mass gatherings on all of our outcome variables. Because participants completed our study at relatively random timepoints during the mass gathering, we were able to show that reports of transformative experience and moral expansion increased over time at mass gatherings within our study population. Overall, this suggests that these observations are not purely the result of placebo or self-presentation effects.44. Yet here we find that transformative experiences at mass gatherings increase over time over and above that expected by psychedelic substance use. In supplementary analyses, we also explored the effects of psychedelics on psychological qualities of transformative experience (see SOM 1.2). While, controlling for substance use, feeling more socially connected to community, culture or history and perceiving something new about others were the most prevalent qualities of transformation reported in the onsite sample, psychedelic substance use was most strongly associated with changes to perceptions of reality and oneself, and least strongly associated with connection to community, culture, or history. This suggests that, while the use of psychedelic substances undoubtedly plays a significant role in eliciting transformative experiences7, such experiences might be psychologically distinct from those that emerge from mass gathering participation alone.Our research highlights both parallels and distinctions between the psychological effects of transformative experiences at secular mass gatherings and those triggered by the use of psychedelic substances. We previously reported that psychedelic substance use at mass gatherings predicts experiences of personal transformation, and that such experiences are associated with universal connectedness and positive moodOur research is subject to a number of important limitations. The most crucial one concerns the generalizability of our findings beyond our study population and field sites. Because most of our participants attended these mass gatherings because they chose to be there, we cannot speak to whether these results would hold for those who do not choose to attend such events, or for events that take place outside the US or UK. In addition, due to the self-selecting nature of the events we studied, our sample is not demographically representative of the country populations in which these events occurred (see SOM 3.2 for further details). More research will be needed to determine the extent to which our observations would apply beyond our study population. It is also possible that, because participants were not randomly assigned to participate, but instead volunteered, that self-selection effects could have led us to over- or under-sample participants having a transformative experience. Furthermore, because the data collected in the follow-up surveys were cross-sectional , it is not possible to determine from these data whether transformative experiences are causing prosocial behavior or merely associated with it. We also did not collect data on personality traits, like openness to experience, that might moderate these results in important ways. Investigating how personality traits interact with behavior at mass gatherings to produce transformative experiences will be an important topic for future research.41.It is also worth noting some inconsistencies in our research findings. First, while the indirect relationship between transformative experience and moral expansion was mediated by universal connectedness at all three timepoints, universal connectedness did not directly predict generosity at any timepoint. One possible explanation for this is that moral expansion entails a deepening sense of one\u2019s interrelatedness with distant others, which is reflected in the universal connectedness measure, while generosity, which was directed toward another anonymous eventgoer, reflected a more localized form of prosociality. Furthermore, while we predicted that time and transformative experience would be associated with increased generosity onsite, no such relationships emerged; instead, transformative experience predicted generosity only in the immediate and six-month follow-up surveys. As noted above, one potential explanation for the delayed onset of this relationship is that personal reflection is required for transformative experiences to take their effect on prosocial behavior65, practicing meditation66, or immersing oneself in nature67. Given the diversity of these settings, it remains unclear exactly which aspects of mass gathering attendance cause transformative experiences. While our study was not primarily designed to answer this question, our analyses suggest that activities such as dancing , giving and receiving gifts  partially mediated the relationship between time onsite and transformative experience (SOM 1.13 for more details). Other research has identified sleep deprivation and exposure to powerful rhythmic music as additional causes of transformative experience7. Additional research will be needed to better understand how these factors interact with aspects of the local event culture and individual differences to produce prosocial transformation.Finally, it is important to note that while our research focuses on transformative experiences at multiday secular mass gatherings, this is by no means the only environment where such experiences can occur. Apart from psychedelic experiences, these include interacting with literature and music70, and that pursuing such moral transformation, whether through educational or even biochemical means, is itself morally required71. While our findings cannot speak to whether transformative experiences are normatively desirable, they provide evidence for how such experiences at secular multiday mass gatherings persist over time and coincide with changes in moral orientation.As our world grows ever more connected, the fates of humans around the globe are becoming increasingly intertwined. Some philosophers have argued that moral progress in the age of globalization will require expanding our circle of moral regard beyond our immediate social group to encompass all of humanity including future generationsHere we summarize our procedures, participants, data collection strategy, and analytic strategy. Variables reported here were those used for primary analyses; see SOM Appendix A for a complete description of all variables collected. The project was approved by the University of Oxford Research Ethics Committee (#MS-IDREC-C1-2015-134).We identified a set of field sites that varied independently on several features of scientific interest  or on electronic tablets . Overall, the study took ~15\u2009min for each participant to complete. Following completion, participants were given an opportunity to collect a prize and thanked for their participation.A biweekly newsletter called Jack Rabbit Speaks is distributed amongst the Burning Man community. We posted an advertisement on this newsletter about the \u201cPsychology of Burning Man\u201d and invited volunteers to participate in a 10\u201315\u2009min survey about why they go to Burning Man and the effect it has on them. The survey contained all demographic questions, how many times people had previously attended Burning Man, whether people intended to go to this year, whether they were registered and had a ticket to attend, how many other multiday mass gatherings they had attended, whether they expected and desired to have a transformative experience at Burning Man that year. They also completed the universal connectedness measure and the moral expansion measure.Surveys immediately following event attendance were collected in three different ways, from 0 to 4 weeks following the events. First, we sent targeted e-mails to participants of both the pretest and onsite surveys who had provided us their contact information. This survey included the following questions: demographics, previous event attendance, universal connectedness, transformative experience (subjective and epistemic), and moral expansion.Next, we included a limited number of questions in the Burning Man Census, which is distributed to all attendees. This allowed us to collect data from a large number of participants. Survey questions included on the census were demographics, transformative experience , and universal connectedness.Finally, at the end of the census was a link that gave participants the opportunity to answer more questions about their experience at Burning Man. This \u201cappended\u201d survey included the following additional items: demographics, universal connectedness, and moral expansion.Targeted surveys were sent to onsite participants\u2019 e-mail addresses for longitudinal analysis. In addition, we invited readers of Jack Rabbit Speaks, a bimonthly newsletter to the Burning Man community, to take part in the follow-up, which allowed us to collect additional (untargeted) survey data.In order to be able to identify the same participants across time in longitudinal analyses while still maintaining participant anonymity, we developed a code that would allow them to input the same unique information that would allow them to remain anonymous. Accordingly, in all targeted versions of the survey , participants were asked to indicate the first three letters of the first road on which they ever lived, the two-digit calendar day of their birth, and the last two letters of their mother\u2019s maiden name. In order to match participants across surveys while allowing for the possibility of a typo, we took the Levenshtein distance between the two string variables inserted by participants, and matched participants at 80% similarity, then examined for matches in age and gender. All identifier matches above 80% that also matched in age and gender were considered within-participant subject matches and analyzed longitudinally.SD\u2009=\u200911.4) and age range of 17\u201375. Fifty-seven percent had college degrees, and 37% made over $50,000. The sample skewed liberal, with a mean of 2.6  on a 7-point scale . Some differences between the events should be noted. While most events had an average age in the mid-thirties, Lightning in Bottle attendees were significantly younger, with a mean age of 26. This is also reflected in the fact that fewer of them (47%) had graduated college. The event with the lowest income was Burning Nest , as contrasted with Burning Man, with an average of 56% at that income level. Overall, participants in the overall sample were not particularly religious, with a mean of 2.3 out of a religiosity scale of 7. The pre-attendance sample (n\u2009=\u2009600) had a makeup of 242 men, 347 women, 11\u2009=\u2009other/fluid, Mage\u2009=\u200942.2, SD\u2009=\u200913.5. The immediate follow-up sample (n\u2009=\u20091866) had a makeup of 962 men, 818 women, 86\u2009=\u2009other/fluid, Mage\u2009=\u200940.1, SD\u2009=\u200912.3. The six-month follow-up sample (n\u2009=\u2009697) had a makeup of 311 men, 367 women, 19\u2009=\u2009other/fluid, Mage\u2009=\u200944.1, SD\u2009=\u200914.7.Overall, the onsite sample included 625 men, 558 women, 32 fluid/other, with a mean age of 32.4 (n\u2009=\u200926). In addition, we excluded participants who reported having been at the event for more than 7 days  since these generally consisted of event organizers, staff, and committed event volunteers.Participants were excluded who responded anything other than \u201c0\u201d to the attention check \u201cHow many fatal heart attacks have you had?\u201d (n\u2009=\u20099), income (n\u2009=\u200913), education (n\u2009=\u20099), and religiosity (n\u2009=\u200911)), were estimated at event-level means. Missing gender data (n\u2009=\u200910) was coded as \u201cother.\u201d Missing values of expectations and desires of transformative experience , consisted mostly of participants (~75%) who had answered \u201cNot at all\u201d on the transformative experience question, so we inferred they had skipped these questions because they had not had a transformative experience. Thus, we estimated missing values of these questions at 1 if the transformative experience was 1, else at event-level means. Due to experimenter oversight, questions regarding transformative experience were not asked in the 6-month follow-up for Lightning in a Bottle; thus, analyses involving this measure at this timepoint were dropped using the listwise deletion method (n\u2009=\u200914); due to another oversight, measures of expecting and desiring a transformative experience were not collected in the immediate follow-up of Burning Man 2016; procedures for dealing with this missing data are described in SOM 1.5.2.In R, general linear models use the listwise deletion method, meaning that single missing value results in the elimination of a participant from the analysis. In order to maximize statistical power in the onsite sample, we estimate missing values using a series of inferential procedures. Missing onsite demographic variables ; mood; education (1-high school to 5-postgraduate degree); income (5\u2009k to over 100\u2009k), politics , religiosity . We note that asking about gender but having response options be labeled male and female isn\u2019t consistent with current best practices in measuring sex and gender. Since the question asked explicitly about gender, we interpret these data as reflecting gender identity rather than sex. In supplementary analyses, we additionally examine the effects of previous attendance on transformative experiences (SOM 1.9) as well as other potential moderators such as new social connections made and behavioral synchrony (SOM 1.13).To measure the effects of time on prosocial change and transformative experience, we asked participants how many days they had been in attendance. To maximize variance in this measure, we employed a distributed data collection plan in which we collected ~30% of the desired sample on days 0\u20132, 40% on days 3\u20134, and 30% on the remaining days. In order to account for different event durations, days onsite were standardized and centered on event-level means. An analysis of daily participant quantities showed this was successful in obtaining significant variance in time onsite in our onsite samples  rendering participants\u2019 responses non-self-incriminating. For each substance category, participants indicated whether they were currently under the influence, had taken in the last 24\u2009h, had taken at all that week, and had taken for the 1st time that week. Participants were binary-coded as using psychoactive substances if they selected any of those responses.We sought for our primary assessment of transformative experience to assess the degree to which participants themselves had had an experience they considered transformative without imposing an external definition. Accordingly, we asked \u201cHave you had a transformative experience at [field site]?\u201d . To assess the effects of anticipation of transformation, we measured the degree to which participants \u201cexpected\u201d and \u201cdesired\u201d to have a transformative experience .We assessed a variety of qualities of transformative experiences via thirteen follow-up questions, full wordings for which can be found in Fig.\u00a015. Typically, participants are presented with a series of seven sets of circles ranging from nonoverlapping to almost entirely overlapping, that represent the \u201cself\u201d and their romantic partner, and asked to indicate which set best describes their relationship. We changed the wording of this question by substituting the romantic partner with \u201cother human beings, in general\u201d. This measure was scored on a continuous scale from 1 to 7.We measured feelings of universal connectedness by adapting the \u201cinclusion of other in the self\u201d measure previously used in relationships research10 that shows participants a small circle and a large circle representing the self and the group, respectively. Circles are presented in five consecutive iterations ranging from completely nonoverlapping to the small circle being completely subsumed by the large circle and asked to indicate which set of circles best captured their relationship to the group.We employed a measure developed in previous research56, we operationalized moral expansion as the area under the curve (AUC) which enables a model-agnostic approach to analyzing discounting data and permits parametric analysis. Participants\u2019 degree of moral expansion was computed by plotting each target\u2019s social distance against time spent, calculating the resulting AUC, and log-transforming it to normalize it56.To measure moral expansion, we adapted an established measure of social discounting. In the established version of this measure, participants are asked to list eight individuals (\u201ctargets\u201d) at different social distances from the self, then asked to indicate how much money they would share with each target. Past work using this measure demonstrates people\u2019s tendency to exhibit diminishing generosity toward more socially distant others that typically follows a hyperbolic function. Pilot testing at Burning Man 2015 indicated that the established measure of social discounting was unsuitable for our study population, as participants expressed confusion regarding the use of money-based measures at an event that explicitly prohibited its use. We, therefore, developed a novel social discounting measure suitable for gift economies that asked participants to imagine they had 14\u2009h of free time. They were asked to list the initials of one individual at each of the following social distances from the self: 1, 2, 3, 5, 10, 20, 50, and 100, and then asked them how much time they would be willing to spend doing a personal favor for each of these individuals. In supplementary studies, we confirmed that this time-based measure shows the same hyperbolic discounting pattern as has been observed in the established money-based measure , each ticket was exchangeable for a single item. Data from these samples indicated that participants gave away an average of 72% of their endowment. We were concerned this would limit our ability to detect changes in generosity due to ceiling effects, so for subsequent data collection, we modified the measure to promote more self-interested choices by informing subjects that more desirable items in the mystery box cost more tickets, and increased the number of initially endowed tickets to ten. This was successful, leading to an average donation of 62%. All reported analyses of onsite generosity are based on samples using the modified ten-ticket dictator game.To measure generosity onsite, we used a modified dictator gameIn online follow-up surveys, participants were endowed with a ten \u201cvirtual tickets\u201d redeemable for the chance to win a $50 Amazon gift card. Participants decided the number of tickets they wanted to keep for themselves versus donate to another study participant (selected at random by the experimenters).lme4 and lmerTest packages in R. Component path analysis  included field site as a random intercept and controlled for demographics , and \u201cincidental variables\u201d . Mediation analyses  were modeled using linear regression via the lavaan package in R, controlling for all demographic and incidental variables. All mediation analyses report standardized betas and confidence intervals. Models testing the moderating effects of set (expectations and desires) and setting (gift vs. market economies) controlled for all incidental variables as well as event size and location. Follow-up studies and within-subjects effects were modeled using linear regression adjusting for demographics and incidental variables. See SOM 1.5 for more details regarding effects of expectations and desires.All onsite data were analyzed using multilevel linear regression models using the broom 0.7.11, cowplot 1.1.1, tidyverse 1.3.1, forcats 0.5.1, lavaan, 0.6-9, lm.beta 1.5-1, lme4 1.1-27.1, psych 2.1.9, and sjPlot 2.8.10. Analyses examining behavioral and attitudinal effects across events were performed with a mixed model regression using package lmerTest 3.1-3 in R with event set as random intercept and all other predictors as fixed factors. Mediation analyses were conducted using the lavaan package in R (version .5-23.1097). Online surveys were collected in Qualtrics 2015\u20132020. In all models, parameter estimates were obtained through \u201cnormal\u201d maximum likelihood estimation (using the biased sample covariance matrix), with standard errors based on the observed information matrices. Missing values were estimated using a full information maximum likelihood procedure (FIML).All data were cleaned and analyzed using R data analysis software with packages All significant effects are reported in complete regression tables in SOM 5. Small differences between the component path and mediation analyses are due to the fact that the former modeled event-level random effects while the mediation analyses pursued a simple linear approach. Differences in degrees of freedom across statistical tests are the result of missing data or of the fact that certain variables were not assessed at some of the earlier data collection efforts; all instances in which this is the case are noted in the Methods. All other variables and analyses are described in the SOM.Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting Summary"}
+{"text": "It is not entirely clear which amino acid (AA) residues and sites in the protein are preferred for binding. The understanding of NC-protein interactions and how they evolve in the polypeptide templates is the key to designing Au NCs. In this work, binding of gold ion Au+ and diatomic neutral gold nanocluster Au2 with a full set of \u03b1-proteinogenic amino acids is studied using Density Functional Theory (DFT) and the ab initio RI-MP2 method in order to find the preferred sites of gold interaction in proteins. We demonstrated that the interaction of gold cations and clusters with protonated and deprotonated amino acid residues do not differ greatly. The binding affinity of AAs to the Au2 cluster increases in the following order: Cys(\u2212H+) > Asp(\u2212H+) > Tyr(\u2212H+) > Glu(\u2212H+) > Arg > Gln, His, Met \u226b Asn, Pro, Trp > Lys, Tyr, Phe > His(+H+) > Asp > Lys(+H+) > Glu, Leu > Arg(+H+) > Ile, Val, Ala > Thr, Ser > Gly, Cys, which agrees with the available experimental data that gold cluster synthesis occurs in a wide range of pH \u2013 amino acid residues with different protonation states are involved in this process. The significant difference in the binding energy of metal atoms with nucleobases and amino acids apparently means that unlike on DNA templates, neutral metal atoms are strongly bound to amino acid residues and can't freely diffuse in a polypeptide globula. This fact allows one to conclude that formation of metal NCs in proteins occurs through the nucleation of reduced Au atoms bound to the neighboring amino acid residues, and the flexibility of the amino acid residue side-chains and protein chain as a whole plays a significant role in this process.Metal nanoclusters (NCs) have gained much attention in the last decade. In solution, metal nanoclusters can be stabilized by proteins, and, thus, exhibit many advantages in biocatalysis, biosensing, and bioimaging. In spite of much progress in the synthesis of polypeptide-stabilized gold (Au) clusters, their structure, as well as amino acid-cluster and amino acid\u2013Au Our calculations showed that amino acids stabilize gold nanoclusters; binding energy between organics and gold is higher than between organics and silver. In particular, DNA-stabilized8,9 and protein-protected6,7 NCs exhibit many advantages for biosensing and bioimaging: ultrasmall size, photostability, biocompatibility, and brightness. Noble metal NCs, in particular, silver (Ag) and gold (Au) clusters, in comparison with other NCs, exhibit excellent stability, facile synthesis, and low toxicity.10 Metal clusters emitting in the visible range have been synthesized using DNA,8,9 amino acids,11,12 peptides,13,14 and proteins such as bovine serum albumin,15\u201319 human serum albumin, egg albumin,20,21 lysozyme,22 and immunoglobulin.5Metal nanoclusters (NCs) have gained much attention in the last decade in biocatalysis, biosensing, and bioimaging due to their high biocompatibility, small size, and high sensitivity to molecular environment.23 We showed that deprotonated amino acid residues are preferable for binding with silver clusters, which is in line with experimental data: the formation of silver clusters on protein templates occurs predominantly at alkaline pH. On the contrary, gold clusters are synthesized in a wide range of pH.24 Several factors may influence this process: the ability of different amino acid functional groups to reduce gold, charge, and binding energy with gold.In spite of much progress in the synthesis of a wide variety of NCs, their structure, as well as ligand\u2013cluster interactions, remains poorly understood. For protein-stabilized NCs, it is not entirely clear which amino acid residues and sites in the polypeptide are preferred for binding. The understanding of NCs\u2013polypeptide interactions and how they evolve in the polypeptide matrices is the key to design the functional fluorescent biolabels. We have investigated earlier the interactions of amino acids with silver ions and clusters.2 cluster/amino acid (AA) interactions and on the Au+/AA interactions as a precursor of the cluster. In a typical synthesis, hydrogen tetrachloroaurate is usually taken as a source of gold Au3+ ions. At the first stage, proteins reduce most of the Au3+ to Au1+.25 It is generally believed that at the first step of Au NPs synthesis Au+\u2013thiolate complexes are formed.26\u201328 In proteins, Au ions may bind to various AAs able to interact with gold. Many AAs can reduce the ions.29\u201333This paper focuses on the Au34It is known that Au can interact with O, N and S atoms. At the same time, it is believed that gold in protein templates interacts most effectively with sulfur, especially with cysteine. Indeed, cysteine is considered as the preferential binding site for gold in proteins, which is confirmed by theoretical calculations.+) and gold nanoparticles with individual amino acids and proteins has been investigated earlier.29\u201333,35\u201337 It was shown experimentally that low temperature and acidic pH favors the growth of gold nanoparticles on protein template.35 On contrary, we showed that deprotonated amino acid residues are preferable for binding with silver clusters,23 which is in line with experimental data: the formation of silver clusters on protein templates occurs predominantly at alkaline pH.5,18,38\u201340 Gold clusters are synthesized in a wide range of pH.24,41\u201344 The synthesis of gold nanostructures through the photo-reduction of amino acids in water is also possible: the most stable structures are produced by arginine, cysteine, threonine, methionine, tryptophan, and phenylalanine.36 The interaction of gold cation (Au+), gold clusters, and nanoparticles with individual amino acids and proteins was investigated theoretically earlier.37,45\u201347 Using molecular dynamics, it was shown that negatively charged atoms play a significant role in adsorption of amino acids on the gold nanoparticles.37 It was shown that the interaction energy with neutral Au3 cluster is higher for the glycine bearing a negative charge than for glycine with charge 0 or +1, the same is true for cysteine.45 In the case of neutral and negatively charged glycine, the interaction occurs with the nitrogen atom, while in the case of protonated glycine interaction with Au3 cluster proceeds through the carboxyl. In the case of cysteine, neutral amino acid interacts with the cluster through the nitrogen, negatively charged amino acid forms a bond between Au and sulfur, while for positively charged Gly interaction with Au occurs through both sulfur and hydroxyl of the carboxyl group. They also showed that two major bonding factors are: (1) Au\u2013N, Au\u2013O, and Au\u2013S anchoring bonding; and (2) nonconventional OH\u22efAu and NH\u22efAu hydrogen bonding.45 Rai and co-authors performed theoretical calculations for proline and Au3 cluster. The interaction of gold cluster with proline occurred predominantly through amide terminal.46 Investigation of the interactions of Au8 and Au20 clusters with alanine and tryptophan showed that these clusters prefer single-site interactions through the amino-group for the amino acids.47 In these works, the authors regarded only alanine, cysteine, glycine, proline, and tryptophan interaction with gold nanoclusters and how the interplay of gold with the remaining 15 amino acids occurs was still unknown.The interaction of gold cation  analysis.In our quantum-chemical investigation we focused on the interactions of the neutral Au15\u201317,22 In contrast, DNA-stabilized NCs are positively charged clusters.50\u201352 We performed the calculations for gold and silver ions and clusters with cytosine and adenine, the preferred binding residues for Ag and Au clusters in DNA,53,54 and compared them with the literature data on Au and Ag interactions with DNA.There is a certain interest to compare the binding energies of gold and silver clusters with protein and DNA matrices. It was shown experimentally that both Au and Ag NCs on protein matrices consist mostly of neutral metal atoms.2.55 level, and resolution-of-the-identity second order Moller\u2013Plesset perturbation theory (RI-MP2) realized in Orca 3.0 program package.56 Since DFT does not include dispersion forces, the atom-pair wise dispersion correction with Becke\u2013Johnson damping was used.57 Karlsruhe basis set def2-TZVP was used in all the calculations, gold atoms were treated with def2-TZVP effective core potential (ECP).58 The initial geometries of amino acid\u2013Au2 complexes for optimization were constructed by placing gold atoms near the active sites of amino acids. The active sites of the amino acids are the amino group, the carboxyl group, and sulfur. These groups possess electron-rich nitrogen, oxygen, and sulfur, which may donate electron density to Au from their lone electron pairs. Binding Gibbs free energies (\u0394G) were calculated for the reactions:Equilibrium geometry optimizations and corresponding hessian calculations of complexes were done with usage of density functional theory (DFT) at the PBE59 was performed for the amino acid\u2013Au2 complexes using NBO.5 program at the RI-MP2/def2-TZVP level of theory. The NBO analysis was done in order to obtain natural charges and Wiberg bond indices. The NBO orbitals of several complexes were plotted using the Chemcraft program. The atoms-in-molecules (AIM) analysis was performed with the Multiwfn program package60 to calculate the properties of bond critical points (BCPs).The NBO analysis3.61 In our next study, we showed that PBE-D3 method along with RI-MP2 give fruitful results when calculating Gibbs free energy of interaction between silver and amino acid residues.23 Thus, in this study we used both PBE-D3 and RI-MP2 method with def2-TZVP basis set and def2-TZVP ECP for another noble metal\u2013gold.In our previous study, we showed that RI-MP2 method in combination with def2-TZVP basis set gives reasonable results predicting Gibbs free energy of interaction between simple organic molecules and silver.3.1+. Among the neutral amino acids, arginine had the highest binding free energy (\u0394G) with Au+: \u2212130.7 kcal mol\u22121 and \u2212140.7 kcal mol\u22121, according to RI-MP2/def2-TZVP and PBE-D3/def2-TZVP, respectively  while RI-MP2 was used for the precise calculation of the final geometries and Gibbs free energy.We started with the analysis of amino acid interactions with gold cation Auectively . \u0394G was +) had the highest \u0394G among all amino acids (see +) > Tyr(\u2212H+) > Asp(\u2212H+), Glu(\u2212H+) > Arg, Lys > Trp > Met > His > Tyr > Phe > Gln > Cys > Asn > Glu > Pro > Asp > Thr, Ser > Ile, Val, Leu, Ala > Gly. Obviously, we may conclude that Au2 will preferably bind to the deprotonated residues of the amino acids rather than to the protonated ones in a peptide or protein. Aliphatic AAs are less preferable for Au+ binding. It is also evident that the binding order (preferred binding sites) depends strongly on the pH conditions. Neutral cysteine attaches Au+ to both the nitrogen of the amino-group and the sulphur atom while deprotonated through the side-chain anionic cysteine (pK = 8.3) forms a monodentate complex with Au+ and attaches gold atom solely to the sulphur. \u0394G rises from \u221274.9 kcal mol\u22121  to \u2212194.1 kcal mol\u22121  during the deprotonation of the cysteine side-chain. Neutral Asp and Glu attach Au+ solely to the nitrogen of the amino-group while deprotonated anionic variants of these amino acids attach Au+ to the nitrogen and one of the oxygens of the carboxylate group  to \u2212169.8 kcal mol\u22121  during the deprotonation of the Asp side-chain (pK = 3.7). For Glu (pK = 4.3), \u0394G rises from \u221269.0 kcal mol\u22121  to \u2212150.0 kcal mol\u22121  upon deprotonation of the side-chain. Both neutral Tyr and Tyr(\u2212H+) with deprotonated side-chain (pK = 10.5) attach Au+ to the amino-group and form a cation\u2013pi interaction with the six-membered ring  to \u2212177.2 kcal mol\u22121  upon deprotonation.Cys, Asp, Glu, Pro, Ser, and Thr form a monodentate complex with Au+. Cys and Met form a bidentate complex while second bond occurs between sulphur and Au. For Arg, His, and Lys, the second site is the nitrogen of the radical side chain; this second site of Au+ attraction may become single in a polypeptide since the first site, amino-group, will participate in the formation of a peptide bond. Trp attaches Au+ to one of the carbon atoms of the six-membered ring. Phe, Tyr, and Tyr(\u2212H+) form a cation\u2013pi interaction between Au+ and a six-membered ring. Asn and Gln attach Au+ to the carbonyl of the side chain ), the Laplacian of electron density (\u22072\u03c1(r)), the Lagrangian kinetic energy term (G(r)), the potential energy density (V(r)), and the energy density (H(r)).Next, we used AIM analysis2\u03c1(r) indicates depletion of electronic charge along the bond, which is typical for electrostatic interaction, while a negative value of \u22072\u03c1(r) indicates that electronic charge is located between the nuclei, which is a feature of electron-sharing and covalent interaction. All bond critical points (BCPs) in 2\u03c1(r) value, which means that all interactions are electrostatic.A positive value of \u2207H(r) is a sum of kinetic and potential components:The electronic energy density term G(r) and V(r) are related to Laplacian through the equation:The virial theorem states that H(r) is positive then accumulation of charge at this point is destabilizing. If H(r) is negative then accumulation of charge is stabilizing. The negative value of H(r) indicates the presence of a covalent bond. From H(r) values are negative. The positive value of \u22072\u03c1(r) and negative value of H(r) mean that Au\u2013X bonds are partially covalent and partially electrostatic. That is true for the complexes with both neutral and deprotonated amino acids. For example, AIM parameters calculated for the Au\u2013N bond in the Gly\u2013Au+ complex are following: \u03c1 = 0.11226 hartree, \u22072\u03c1 = 0.40289 hartree, and V(r) = \u22120.17388 hartree. The V(r) values allow to calculate the energy of Au\u2013X bond as follows:63If \u22121 for the Au\u2013NH bond) among the regarded complexes. This in line with the Gibbs free energy calculations, which show that Au2\u2013Arg complex possesses the highest binding energy among neutral AAs. In Au2\u2013Arg complex Au interacts both with the nitrogen of the NH2 group  and with the NH group of the side chain  and 39.6 kcal mol\u22121 for Au+\u2013Cys, Au\u2013C bond energy was equal to 41.9 kcal mol\u22121 for Au+\u2013Tyr(\u2212H+) and 35.4 kcal mol\u22121 for Au+\u2013Tyr.As expected, arginine had the highest Au\u2013X bond energy value  was equal to 2.465 \u00c5, according to RI-MP2/def2-TZVP method. This bond length tends to slightly diminish in the complexes: for example, r(Au1\u2013Au2) was equal to 2.461 \u00c5 in Au2\u2013Gly.Next, we studied the complexes of amino acids with a minimal neutral cluster Au2 . Also, in the case of arginine gold plays the role of a proton acceptor and forms a nonconventional H-bond with the hydroxyl group (O\u2013H\u22efAu) of the carboxyl  undergoes a blue shift with respect to that of the uncoordinated C\u2013N group: from 1730.5 cm\u22121 to 1635.5 cm\u22121.Thus, arginine forms an Au\u2013N coordination bond with a length of 2.040 \u00c5 and a valence angle N\u2013Au\u2013Au equal to 170.5\u00b0 . For ArgG values of the neutral amino acids while Cys(\u2212H+) possesses the highest \u0394G among the deprotonated amino acids. Cys(\u2212H+) attaches the cluster through the sulfur atom. Cys(\u2212H+) forms the Au\u2013S bond with a length of 2.260 \u00c5 and a valence angle C\u2013S\u2013Au equal to 102.6\u00b0 (+)\u2013Au2 complex, the C\u2013S bond stays intact after the interaction with Au2 cluster: the C\u2013S bond is equal to 1.821 \u00c5 for the Cys(\u2212H+)\u2013Au2 complex and the same C\u2013S bond is equal to 1.821 \u00c5 for the free Cys(\u2212H+).Amino acids with deprotonated side chain surpass \u0394o 102.6\u00b0 . For Cys+) had the highest \u0394G among all amino acids (see 2 cluster increases in the following order: Cys(\u2212H+) > Asp(\u2212H+) > Tyr(\u2212H+) > Glu(\u2212H+) > Arg > Gln, His, Met \u226b Asn, Pro, Trp > Lys, Tyr, Phe > His(+H+) > Asp > Lys(+H+) > Glu, Leu > Arg(+H+) > Ile, Val, Ala > Thr, Ser > Gly, Cys. Obviously, we may conclude that Au2 will preferably bind to the deprotonated residues of the amino acids rather than to the protonated ones in a peptide or protein. Surprisingly, neutral cysteine has the lowest binding energy among all the amino acids, which results in the highest \u0394G difference between the neutral and deprotonated amino acid. Generally, the interaction of Au2 with protonated and deprotonated AAs do not differ greatly.Cys, and for deprotonated cysteine it was found to be \u221253.5 kcal mol\u22121  . The interaction energy of Au2 with methionine, which also occurs through the sulfur, was equal to \u221228.1 kcal mol\u22121 , which was one of the highest \u0394G among the neutral amino acids. The disulfide bond is less favorable for the formation of a complex with the gold cluster: the energy of the interaction between dimethyldisulfide and Au2 was equal to \u221223.4 kcal mol\u22121, according to RI-MP2/def2-TZVP method  . Cystein+), Glu(\u2212H+), and Tyr(\u2212H+) attach Au2 to the side chain namely to the oxygen atom and have high \u0394G values: \u221241.1 kcal mol\u22121 , \u221235.4 kcal mol\u22121 , and \u221239.4 kcal mol\u22121 , respectively  in the unionized form and that means that alkalization of the solution with Tyr and Au2 from neutral to alkaline pH would give an increase in the interaction energy equal to 16.3 kcal mol\u22121 . These data show why alkalization of the solution with the protein containing Tyr residues is advantageous when a gold cluster is formed.Deprotonated anionic amino acids Asp(\u2212Hectively . TyrosinKa 6.0) has \u0394G equal to \u221228.3 kcal mol\u22121  in the unionized form and \u221222.9 kcal mol\u22121  with the protonated side chain. Alkalization of the solution with His and Au2 from acid to alkaline and neutral pH would give the increase of interaction energy equal to 5.4 kcal mol\u22121 . For lysine (pKa 10.5) \u0394G rises from \u221222.2 kcal mol\u22121  for the cationic amino acid with protonated side chain to \u221223.3 kcal mol\u22121  for the neutral molecule. For arginine (pKa 12.5) \u0394G changes from \u221222.0 kcal mol\u22121  for the cationic form with the protonated side-chain to \u221234.3 kcal mol\u22121  for the unionized molecule.Histidine , Glu(\u2212H+) and chloroaurate anions frustrate the reduction reaction. However, some experimental protocols allow Asp and Glu residues to play significant role in the synthesis of gold nanoclusters.24 Moreover, the stability of Au2 complexes of all neutral and protonated amino acid residues is rather high , which indicates that all 20 proteinogenic AAs can stabilize gold NCs.In general, our results are in agreement with experimental results showing that gold nanoparticles have the highest binding affinity with the peptides containing Cys, His, Met, and Tyr residues.3.42 cluster in terms of electron density and its derivatives: the density of all electrons \u03c1(r), the Laplacian of electron density \u22072\u03c1(r), the Lagrangian kinetic energy term G(r), the potential energy density V(r), and the energy density H(r) are presented in We used Bader's AIM analysis to study the nature of amino acid interactions with AuH(r) value is negative. The positive value of \u22072\u03c1(r) and negative value of H(r) in all cases means that Au\u2013X bonds are partially covalent and partially electrostatic.One can see that in each case the electrostatic interaction is stabilizing since for each complex V(r) values we can calculate bond energies. Arginine had the highest Au\u2013X bond energy value equal to 63.1 kcal mol\u22121 . When Au and X both have positive charges (the case of Cys\u2013Au2 complex), it obliquely indicates that Au\u2013X bond has a covalent nature. When Au and X have opposite charges , it indicates that Au\u2013X bond has an electrostatic nature. In all the cases Au2 cluster had a negative charge (qcluster), which means that it oxidizes the coordinated amino acid. The bond orders were evaluated by using Wiberg's bond indices, which are presented in 2 than for the neutral complexes: WAu1\u2013X is equal to 0.366 for Cys\u2013Au2 and is 0.580 for Cys(\u2212H+)\u2013Au2, WAu1\u2013X is equal to 0.206 for Tyr\u2013Au2 and is 0.247 for Tyr(\u2212H+)\u2013Au2. On contrary, the Au\u2013Au bond order is lower for deprotonated amino acids.Next, we performed the NBO analysis. Natural charges of gold atom and amino acid atom to which the cluster is attached are presented in E(2) obtained from the second-order perturbation theory analysis, are reported in E(2) value, the more intensive the interaction between i electron donor orbital and j electron acceptor orbital, which means the more donating tendency from electron donor to electron acceptor. Delocalization of the electron density from occupied bonds or lone pair NBO orbitals to formally unoccupied antibond NBO orbitals indicates a stabilizing donor\u2013acceptor interaction. The intramolecular interaction is formed by the orbital overlap between n, n*, \u03c3 and \u03c3* bond orbitals, which leads to the intramolecular charge transfer (ICT) permitting the stabilization of the system. These interactions are observed as an increase in the electron density in anti\u2013bonding orbital that weakens the respective bonds.NBO analysis gives useful information when analyzing intramolecular bonding and interaction between bonds. The electron donor orbital and electron acceptor orbital occupancies, as well as the interacting stabilization energy E(2) of the i \u2192 j delocalization was calculated according to the following formula:ei and ej are NBO orbital energies, and F\u0302 is the Fock operator.For each i donor orbital and j acceptor orbital, the stabilization energy The amount of transferred charge from i donor orbital to j acceptor orbital was also calculated using the Fock operator and NBO orbital energies as follows:E(2) and qCT for the Au\u2013X and Au\u2013Au bonds of some complexes are presented. The charge is transferred from the lone pair of nitrogen and oxygen or \u03c3 Au\u2013Au bond to n* orbital of Au, Au\u2013S or Au\u2013Au \u03c3* anti-bond. In the case of Arg\u2013Au2 complex, the charge is transferred from the nitrogen lone pair to the lone pair of Au. In the Gly\u2013Au2 complex, the charge is transferred from the nitrogen lone pair to Au\u2013Au \u03c3* anti-bonding orbital \u2013Au2, the same ICT contributes to the stabilization energy of 65.1 kcal mol\u22121. In the Tyr\u2013Au2 complex, ICT of the electron from the nitrogen lone pair to the \u03c3* Au\u2013Au anti-bond leads to delocalization of 36.3 kcal mol\u22121. In the Tyr(\u2212H+)\u2013Au2 complex, ICT of the n electron of oxygen lone pair to the \u03c3* Au\u2013Au anti-bond leads to delocalization equal to 37.8 kcal mol\u22121.We focused on the complexes of cysteine and tyrosine with the gold nanocluster since deprotonation of these amino acids gives the strongest energy gain when the AA\u2013Aus formed . Moreove3.5+ and Au+), neutral metal atoms (Ag0 and Au0), and diatomic metal clusters (Ag2 and Au2) with nucleobases, namely cytosine (Cyt) and adenine (Ade). Later, we compared the interaction energies between silver and gold, between different types of metal particles, between nucleobases and selected amino acids ). Interestingly, Cyt(+H+) tends to form nonconventional hydrogen bonds with metal atoms Me0 and diatomic clusters (+) and Au0_Cyt(+H+) complexes have positive \u0394G values and highly likely are not formed: 1.9 kcal mol\u22121 and 1.1 kcal mol\u22121, respectively. \u0394G values are negative for Ag2_Cyt(+H+) and Au2_Cyt(+H+) complexes: \u22126.1 kcal mol\u22121 and \u22125.0 kcal mol\u22121, respectively. The latter complexes are stabilized by Me\u2013O bonds, as well as by nonconventional Me\u22efH hydrogen bonding.Also, we analyzed silver and gold complexes of protonated cytosine  while the binding energy of deprotonated cysteine with Au+ is equal to \u2212194.1 kcal mol\u22121. Probably, the reason is that negative charge of the amino acid residue is favorable for high \u0394G. For the neutral Cys, \u0394G is comparable with Cyt: \u221274.9 kcal mol\u22121 , \u22072\u03c1(r), G(r), V(r), and H(r) are presented in H(r) value is negative for most of the complexes, which means that the electrostatic interaction between metal atoms and cytosine is stabilizing. The positive value of the Laplacian of electron density \u22072\u03c1(r) and negative value of H(r) in most of the cases means that Me\u2013X bonds are partially covalent and partially electrostatic. In the case of Ag0_Cyt(+H+) with Ag\u22efHN1 interaction and Ag2_Cyt(+H+) with Ag\u2013O interaction the local kinetic energy G(r) outweighs V(r): internuclear charge concentration is destabilizing, which is typical for a nonbonded situation, which in the case of Ag0_Cyt(+H+) is also confirmed by positive \u0394G value .We used Bader's AIM analysis to study the nature of nucleobase interactions with metal ions, atoms, and nanoclusters in terms of electron density and its derivatives: +_Cyt complex attracted our interest since silver cation forms bonds with both nitrogen and oxygen atoms while Au+ forms a bond only with N1 atom of cytosine. The higher energy of potential energy density for Au\u2013N BCP results in the higher energy of the bond equal to 70.4 kcal mol\u22121 as compared with Ag\u2013N  and Ag\u2013O , which is supported by Gibbs energy calculations , which indicates that practically all 20 amino acids can stabilize gold NCs and nanoparticles. The binding affinity of AAs to the Au2 cluster increases in the following order: Cys(\u2212H+) > Asp(\u2212H+) > Tyr(\u2212H+) > Glu(\u2212H+) > Arg > Gln, His, Met > Asn, Pro, Trp > Lys, Tyr, Phe > His(+H+) > Asp > Lys(+H+) > Glu, Leu > Arg(+H+) > Ile, Val, Ala > Thr, Ser > Gly, Cys. Generally, the interaction of gold atoms with protonated and deprotonated amino acid residues do not differ greatly, which is in agreement with the experimental evidences that gold cluster synthesis occurs in a wide range of pH.24,67 The fact that deprotonated cysteine has the highest binding energy with both Au2 and Au+ among all the amino acids explains the fine synthesis of gold nanoclusters on thiolates.68,69Binding energies between 19 amino acids and gold nanoparticles have been studied previously using molecular dynamics.G is equal to \u22121 to \u22129 kcal mol\u22121) as compared to charged particles . This is in line with experimental fact that DNA-templated metal clusters are positively charged.50\u201352 The interaction between Au0 atoms and nucleobases is also rather weak ; however, the binding energy between diatomic cluster and DNA is higher . This obstacle explains the existence of neutral gold nanoclusters stabilized by poly-cytosine and poly-adenine.54Our results suggest that binding energy between neutral silver clusters and DNA is rather weak (\u039415\u201317,22Speaking about protein templates, the interaction of neutral metal atoms and diatomic clusters with amino acid residues is high for both silver and gold. This is in agreement with the fact that a large part of protein-templated nanoclusters consists of mostly reduced metal atoms.Moreover, the significant difference in the binding energy of neutral gold and silver atoms with nucleobases and amino acids apparently means that unlike DNA template neutral metal atoms are strongly bound to amino acid residues and can't freely diffuse in a polypeptide globula. This fact allows to make a conclusion that formation of metal nanoclusters in proteins occurs through the nucleation of Au atoms located on the neighboring amino acid residues, and the flexibility of the amino acid residue side chains and protein chain as a whole plays a significant role in this process.2 bonds are partially electrostatic and partially covalent, the same is true for amino acid complexes with Au+.Finally, based on the AIM analysis, we have found that for all complexes amino acid\u2013AuThere are no conflicts to declare.RA-010-D0RA06486F-s001"}
+{"text": "A stacked multi-layer substrate integrated waveguide (SIW) microstrip patch antenna with broadband operating bandwidth and low cross-polarization radiation is provided. A complete study on the propagating element bandwidth and cross polarization level is presented to demonstrate the importance of the design. The proposed antenna includes three stacked printed circuit board (PCB) layers, including one layer for the radiating 2 \u00d7 2 rectangular patch elements and two SIW PCB layers for the feeding network. There are two common methods for excitation in cavity-backed patch antennas: probe feeding (PF) and aperture coupling (AC). PF can be used to increase the bandwidth of the antenna. Although this method increases the antenna\u2019s bandwidth, it produces a strong cross-polarized field. The AC method can be used to suppress cross-polarized fields in microstrip patch antennas. As microstrip patch antennas are inherently narrowband, the AC method has little effect on their bandwidth. This paper proposes an antenna that is simultaneously fed by AC and PF. As a result of this innovation, the operating bandwidth of the antenna has increased, and cross-polarization has been reduced. Actually, the combination of probe feeding and aperture coupling schemes leads to achieving a broadband operating bandwidth. The arrangement of radiator elements and cavities implements a mirrored excitation technique while maintaining a low cross-polarization level. In both numerical and experimental solutions, a less than \u221230 dB cross-polarization level has been achieved for all of the main directions. A fractional impedance bandwidth of 29.8% (10.55\u201314.25 GHz) for  Microstrip patch antennas (MPAs) are broadly used in various types of applications. These antennas have many advantages like low profile, low cost, and easy integration with other devices ,4,5,6,7.The operating bandwidth of single-feed MPAs could be increased by using thick dielectric materials with low dielectric relative permittivity , creatinMicrostrip lines and coplanar waveguides (CPWs) are often used to feed conventional microstrip patch antenna arrays. The operating bandwidth of conventional MPAs with these planar feeding networks is usually less than 5%. By increasing operating frequency, these planar antennas often face many serious problems and challenges. In particular, in higher frequencies, unwanted radiations have suddenly appeared from the feeding network, and the antenna\u2019s efficiency has increasingly dropped ,20,21,22The radiation efficiency of wireless communication systems is one of the most important parameters that can increase their reliability. The antenna radiation efficiency in satellite and remote-sensing applications is essential due to the inherent losses in long-distance communications. Limiting the antenna\u2019s efficiency can have a direct impact on bandwidth ,24,25 anMPA arrays are commonly fed by microstrip lines. Microstrip lines are typically preferred because they facilitate the routing of low-profile feeding networks. They do, however, introduce unwanted radiation losses, which could have a significant impact on the antenna\u2019s radiation performance and reduce its radiation efficiency.Substrate integrated waveguide (SIW) technology is one of the best alternatives for microstrip lines and CPWs at higher frequencies. Despite the fact that SIWs require more space than microstrip networks, they provide reliable performance at a higher frequency. In recent years, SIW technology has been used for a wide variety of applications due to its advantages, such as low cost, low loss, and ease of integration. Compared to hollow rectangular waveguide structures, SIW structures have many of the same features and similar radiation characteristics, but they are much less expensive. SIW technology, therefore, could be an effective replacement for RWG. Various types of microwave and millimeter-wave components, such as antennas, feeding networks, filters, etc., have been implemented using SIWs ,30,31,32Different strategies have been used to feed MPA with SIW feeding networks. Vertical integration between MPA and an SIW cavity is one of the most effective methods ,34. ThisAlthough, by using the PF method, the impedance characters can be significantly improved, these structures still suffer from high cross-polarization levels ,36. SurfExciting patch radiator elements by the PF method leads to generating strong cross-polarized fields on the antenna surface. These strong cross-polarized fields can degrade antenna performance. Moreover, they may increase back lobe radiation in the radiation patterns or even decrease the antenna radiation efficiency .Using an AC method instead of PF can significantly suppress the cross-polarization levels . In comp0 element spacing, the 2 \u00d7 2 proposed array can be easily extended to a large array by using it as a sub-array. Hence, the proposed array could be useful in array applications requiring small element spacing, wide operating bandwidth, and lower cross-polarization levels. This structure has a geometric shape that allows it to be used in a variety of systems, such as monopulse systems, remote sensing, and satellite applications. This paper is organized as follows. In this paper, a microstrip patch array is presented that uses a combination of PF and AC techniques. Using these two techniques simultaneously increases the impedance bandwidth of the proposed design and suppresses its cross-polarization radiations. In the proposed structure, the radiation elements are surrounded by a small space, which results in a compacted structure and higher efficiency. With 0.5 \u03bb0, whereas distance in the H-plane is 11.2 mm, i.e., 0.36 \u03bb0, where \u03bb0 is the free space wavelength at 12.5 GHz.In the proposed design, by using the PF configuration, the microstrip patches are excited. On the common ground between layers 2 and 3, there is a slot, which splits the electromagnetic (EM) power into cavities on the middle layer. In this mechanism, the distance between center to center of adjacent radiating elements in the E-plane is 8.8 mm, i.e., 0.476 \u03bbA square topology is used for the EM power distribution network based on four SIW cavities. SIW cavities are formed by inductive windows. This feeding network is designed by considering several primary dimensions as follows. To control the leakage of the EM wave, the diameters of cylindrical metalized holes (vias) are selected by these conditions: S/d \u2264 2, and d/The resonance frequency is determined by the cavity dimensions. The following relationships could be used to calculate the SIW cavity\u2019s initial dimensions: (1)fmnp\u00a0mnp.f The designed cavities operate when m = n = 1 and p = 0.The resonant frequency of the proposed cavities is determined by r\u03b5 (=3.55) is the dielectric relative permittivity. The resonant mode for proposed cavities is TE110.Cavity dimensions are represented by the parameters To minimize the leakage in the SIW layers, vias are used with diameter d = 0.8 mm, and the center-to-center spacing between adjacent vias is S = 1.6 mm.After primary calculations, CST Microwave Studio was used to optimize the geometries of the proposed cavities in As shown in To validate the simulated performance of the proposed array, a prototype shown in The appearance of robust cross-polarized fields in the radiation characters of patch antennas is always a fundamental challenge for antenna designers. In the conventional patch antennas, excitation of higher modes with orthogonal polarization causes cross-polarized fields in the H-plane. A cross-polarized field in the H-plane is stronger than in the E-plane. Studies show that in the H-plane of patch antennas within the \u00b125\u00b0 beamwidth, the isolation between the co- and cross-polarization radiation is around 10\u201320 dB ,39.The EM radiation patterns of the proposed MPA are discussed in this section. The work is mainly focused on the study of cross-polarized fields. When investigating the cross-polarization behavior in the antennas, an important point must be considered. Only checking the isolation between co- and cross-polarization patterns in the two main cutting planes of E- and H- is not sufficient to confirm that an antenna has a low cross-polarization level. In antenna characteristics, the cross-polarization level could be extremely low in both the E- and H-planes, while on the other cutting planes, the cross-polarization level could be extremely high. This behavior can exist in various types of antennas. The distribution of the electric fields on the horn antenna\u2019s aperture clearly indicates that on the E- and H-cutting plane, the cross-polarization level is minimal, while on the other orthogonal cutting planes, strong cross-polarization radiation is observed . More riIn this paper, in order to accurately investigate cross-polarization behavior, as well as ensure its low level on all the planes, contour plots are presented. These contour plots indicate the cross-polarization level on different cutting planes. Then, the simulated and measured radiation patterns of the proposed antenna on the cutting planes \ud835\udf19 = 0\u00b0 (E-plane) and \ud835\udf19 = 90\u00b0 (H-plane) are presented. In reliable wireless communication systems, the antenna\u2019s efficiency is a significant feature. The impedance bandwidth and gain could be directly limited by this feature. Several single-feed MPA designs have already been proposed. Microstrip lines fed the majority of them. The designs based on microstrip lines present a feasible structure in which the feeding network production is easier while maintaining a low profile. However, as the antenna\u2019s operating frequency rises, the amount of unwanted energy transmission from these feeding lines rises dramatically. This unwanted energy transmission has a significant negative impact on the radiation pattern, resulting in a reduction in radiation efficiency.Antenna radiation efficiency is described by IEEE standards as \u201cthe ratio of the total power radiated by an antenna to the net power accepted by the antenna from the connected transmitter\u201d . Dielect2, and it has a maximum realized gain of 11 dBi at 13.5 GHz frequency.The radiation efficiency of large arrays is primarily affected by unwanted radiation and losses from the combinatory feeding structure . It is possible to achieve higher radiation efficiency when minimizing the length of the feeding networks, such as those in series feeding ,46. It dIn terms of frequency bandwidth, the proposed formation presents wideband radiation elements like the magneto-electric dipole , L-probeA single-element X-band patch antenna is presented in  and fed A comparison between various characteristics of the proposed design and previously reported results in terms of the number of layers, antenna size, operation frequency, impedance bandwidth, and cross-polarization level are provided in In , a 4 \u00d7 4In , the AP 20 to TE10. The impedance bandwidth of this five-layer antenna is 12.9%. The used feeding network in this structure is complex. Moreover, the number of PCB layers will be increased by developing this structure to a large array.In , a two-lThere are advantages of the proposed structure can overcome many of the challenges associated with previous designs. This manuscript presents a 2 \u00d7 2 array of a broadband MPA with low cross-polarization levels. The presented structure has several features. First, a combination of PF and AC methods has been used to feed this structure. PF allows us to control impedance characters and achieve a higher impedance matching. The experimental results indicate that the operating bandwidth of this MPA array is 29.8%. On the other hand, the aperture coupling method has helped us to provide a very effective mechanism for suppressing cross-polarization without the need to design complex power distribution networks. The reduced cross-polarization is studied for a 3-D half-power beamwidth space. The measured results show that the cross-polarization level for the presented MPA is less than 30 dB in the whole operating impedance bandwidth. The designed array can be easily used as a subarray to design larger arrays. This does not need to increase the number of PCB layers to design larger arrays. The proposed array does not require the use of blind screws or even internal connections and its fabrication process is simple.0 element spacing, the proposed 2 \u00d7 2 array can be easily used as a sub-array to design a large array. Hence, the proposed array could be useful in applications requiring small element spacing, wide operating bandwidth, and lower cross-polarization levels. It has good potential to use the proposed structure as a subarray in a larger array for a wide spectrum of practical applications such as satellite remote-sensing antennas.A successful combination of aperture coupling and probe feeding methods is demonstrated in this paper. The main advantages of this compact package are its broadband character and low cross-polarization levels. A mirrored geometry between radiating elements and the feeding network is used to create the 2 \u00d7 2 array. This design occupies less space around the radiation elements, which reduces the size of the antenna and improves its efficiency. In this study, the suppressed cross polarization is verified for a 3-D half power beamwidth area in the whole operating bandwidth (10.55\u201314.25 GHz). For all of the main directions, the cross-polarization level is less than \u221230 dB. With a 0.5 \u03bb"}
+{"text": "Simultaneously enhancing multiple antenna performance parameters is a demanding task, especially with a challenging set of design goals. In this paper, by carefully deriving a compatible set of enhancement techniques, we propose a compact/lightweight/low-cost high-performance L-band octagonal cavity-backed hybrid antenna with multiple attractive features: dual-polarization, wide impedance bandwidth, low cross-polarization, high gain, and high aperture efficiency. The ground cavity is octagonal, which allows the antenna to have a small footprint, and, more importantly, low cross-polarization and high aperture efficiencies when compared to a commonly-used square design. The hybrid design relies on the resonance merging of two radiating elements, i.e., radiating feedlines and a conductive open prism, to form a wide impedance bandwidth. To permit polarization diversity and low cross-polarization, it is differentially and orthogonally fed. Herein, a series of parametric simulation studies on antenna configurations provide information on how to improve the impedance bandwidth and cross-polarization performance. To verify the simulation studies, an antenna prototype was fabricated and tested. Excellent agreement between the simulated and measured results was reached. An antenna, as one of the key components in a wireless device, has a vital impact on device performance. To fulfill the requirements of the application for which the antenna is used, a certain set of antenna performance parameters needs to be met. Simultaneously enhancing multiple antenna performance parameters can be challenging but necessary for many applications. On an individual basis, performance enhancement on single parameters has been studied, and numerous enhancement techniques have been developed. However, it takes specialized methods, such as those discussed in this manuscript, to achieve high performance for multiple parameters while not sacrificing the gains made in the enhancement of individual factors. In this paper, we propose a compact/lightweight/low-cost, high-performance antenna with a challenging combination of qualities: polarization diversity, wide impedance bandwidth, high gain with stable broadside radiation, low cross-polarization, and high aperture efficiency. Such an antenna is desirable for many applications, including remote sensing and satellite communications.Impedance bandwidth enhancement is often one of the first steps in antenna optimization. Two of the most widely used techniques are parasitic element loading ,2,3,4 anGain enhancement approaches include: forming an array , using aExisting cross-polarization reduction techniques include feed designing ,17 and sThis paper proposes a novel high-performance dual-polarized antenna that can be used for many applications, such as remote sensing and satellite communication, where compact antennas with low cross-polarization are required. Alternatives are corrugated horns that are bulky, heavy, and very costly to fabricate. The key antenna parameters are determined to broaden the bandwidth of the antenna simultaneously for the impedance, high gain, high aperture efficiency, and low cross-polarization, which results in the most compact antenna size. Simultaneous improvement of multiple antenna performance parameters was achieved by carefully selecting and deriving a compatible set of performance enhancement techniques. The design considerations and the basic antenna configuration are presented in Our goal was to develop a novel dual-polarized antenna design that can provide wide impedance bandwidth, high gain with stable broadside radiation, low cross-polarization, and high aperture efficiency. Based on , we set A typical antenna design includes three major parts: ground, primary radiator, and feed. Based on the above-mentioned characteristics of interest, some of the basic design considerations are laid out below.Due to its capacity for providing high gain with stable broadside radiation across a wide operating frequency band, a cavity-backed configuration was adopted for this design . With a A basic ground cavity is formed by adding vertical sidewalls on all the edges of a conventional planar ground plane. Therefore, the shape of a ground cavity is dictated by that of the horizontal base of the cavity. One of the most frequently used planar ground planes is square in shape, and as a result, ground cavities with square ,11 apertTo achieve a wide impedance bandwidth, a hybrid design with multiple radiators was developed. To simplify the design, the feed structure was configured to serve as the extra radiator. Together with the primary radiator, they produce multiple adjacent resonances, which can be merged to form a wide bandwidth. The overall impedance bandwidth due to the resonance merging depends on the bandwidth of each individual radiator. Therefore, individual radiators having a wide bandwidth is advantageous to the overall bandwidth enhancement. To keep the design process simple, this work mainly focused on deriving a wideband primary radiator.For a compact antenna, the primary radiator needs to be compact while simultaneously providing sufficiently long current paths on the feedlines, thereby permitting them to be efficient radiators. This can be achieved using a 3D radiator instead of a planar one. Due to its folded sides, a 3D radiator has a smaller footprint but supports longer current paths. Since the primary radiator is backed by a ground cavity with sidewalls, the use of a 3D radiator does not necessarily lead to a bigger overall antenna profile . To support wideband or multiband operation, multiple current paths of different lengths should be allowed on the primary radiator . This reCommonly used feeding structures include coaxial probes and printed feedlines. Both types of feeding structures can excite an antenna through direct contact or proximity coupling. With proximity coupling, the primary radiator is excited through the gap between it and the feeding structure. This allows a higher degree of freedom for tuning the impedance matching of the primary radiator and the resonant frequency of the feedline. Therefore, proximity coupling was adopted. Compared to a coaxial probe, a printed feedline has additional degrees of freedom to match an antenna, such as the shape and the width of the feedline. In addition, a printed feedline with a potentially larger width can provide stronger coupling than a coaxial probe with a limited diameter. Hence, in this work, we used printed lines as the feeding structure. To realize dual-polarized operation, the feedlines are placed orthogonally along the X- and Y-axes. To suppress cross-polarization, differential feeding was implemented. By adjusting the excitation/matching conditions of the orthogonal differential pairs, three dual-polarization schemes, namely dual-linear, slant dual-linear, and dual-circular polarizations, could be realized.As established previously, in addition to its role in exciting the primary radiator, the feeding structure in this design needs to act as a broadside radiator at a close enough frequency to that of the primary radiator to allow resonance merging. The feedlines were suspended above the horizontal base of the ground cavity to provide broadside radiation. One end of each feedline is connected to an excitation port located in the ground cavity sidewall, while the other end is open to provide proximity coupling to the primary radiator . This way, the feedlines act as physically wide horizontal monopole antennas connected to a vertical ground plane and backed by a horizontal ground plane. Their large width makes them broadband capable. gL) was 165 mm, the cavity height (swH) was 80 mm, the gap between the lower dielectric layer and the ground plane (g) was 11 mm, and the spacing between the feedline and the radiating prism (s) was 3 mm. The feedline lengths and widths (l and w) were 53 mm and 30 mm, respectively. The transition feedline lengths and widths (l\u2019 and w\u2019) were 1 mm and 3.6 mm, respectively. These values were selected to make the antenna operate in the L-band (1\u20132 GHz) with a resonance merging effect.Based on the above design considerations, we propose a novel design\u2014a dual-polarized octagonal cavity-backed antenna with two orthogonal pairs of differential feedlines that excite a radiating open prism in the center of the cavity. We call this design an \u201coctagonal cavity-backed open radiating prism,\u201d or OCROP. Our antenna consists of four parts: (1) a conductive octagonal-shaped cavity, (2) a conductive radiating open prism, (3) two orthogonal pairs of differential feedlines, and (4) a supporting dielectric substrate. The geometry is shown in L = W, to allow geometrical symmetry and identical performance in two orthogonal polarizations of interest. For the antenna to operate in the L-band (1\u20132 GHz) around a center frequency of 1.5 GHz, the dimensions of the open prism were set to L = W = H = 51 mm, forming a cube with no bottom face . This value was found through simulation studies that are not included here for brevity.We considered numerous design configurations and performed parametric simulation studies to test the concepts. Since the antenna was designed for dual-polarized operation, the length and the width of the open prism needed to be the same, i.e., The numerical simulations throughout this study were performed using ANSYS Electronics Desktop 2021 R1\u00a9. Lumped port excitations with a constant full port impedance of 50 \u2126 were assigned to all four ports. In the following studies, only the Y-polarized differential pair was excited with equal amplitude and 180\u00b0 out-of-phase signals, while the X-polarized differential pair was terminated with 50 \u2126 matched loads. Since the antenna is symmetric, X- and Y-polarizations have identical performance.gL = 165 mm, swH = 80 mm, g = 11 mm, s = 3 mm, l = 53 mm, w = 30 mm, l\u2019 = 1 mm, and w\u2019 = 3.6 mm. dd11 \u2264 \u221210 dB impedance bandwidth: the one with the square ground cavity has an impedance bandwidth of 54.0%, and the one with the octagonal ground cavity has an impedance bandwidth of 54.3%. The gain and diagonal-plane cross-polarization of the two antennas are compared in To verify the superiority of an octagonal ground cavity a over a Our design attains wide impedance bandwidth by using multiple radiators that have adjacent resonances and similar radiation patterns . These radiators are the open prism and the feedlines. gL = 165 mm, swH = 80 mm, g = 11 mm, s = 3 mm, l = 53 mm, w = 30 mm, l\u2019 = 1 mm, and w\u2019 = 3.6 mm. As can be seen, the differential reflection coefficient for the antenna without the open prism  is much wider than the cross-polarization bandwidth . For instance, the -impedance bandwidth for the case As can be seen, at this stage, the impedance bandwidth  and cavity height (swH). Since the excitation ports of the antenna are located on the cavity sidewalls, the feedline length is directly correlated with the aperture length. In other words, the impedance bandwidth is very sensitive to changes in the aperture length. To improve the radiation performance with minimal impact on its impedance bandwidth, here, we only investigate the effect of the ground cavity sidewall height. To determine this, we varied the sidewall height swH from 70 mm to 140 mm in 10 mm increments while keeping all other antenna dimensions constant .For a cavity-backed antenna, its radiation performance is heavily dependent on the ground cavity . Two keydd11) results for different sidewall heights are shown in dd11 \u2264 \u221210 dB are Simulated differential reflection coefficient  cross-polarization ratio is shown in dd11 \u2264 \u221210 dB) decreases while cross-polarization bandwidth (for X-pol \u2264 \u221225 dB) increases. In column 4, we present the combined bandwidth, where we took the minimum and maximum frequencies that met both requirements. In all cases, the lower frequency bound, swH \u2264 90 mm and the cross-polarization bandwidth for swH \u2265 100 mm. Once the sidewall height reaches 90 mm, there is very little change in the overall operating bandwidth (42.7 \u00b1 0.7%).The bandwidth of operation is summarized in g = 11 mm and swH = 80 mm, at 1.5 GHz on a fictitious square surface with a length of 4 \u03bb, located 1 \u03bb above the aperture, as shown in The aperture field distribution for the antenna, with In this section, we present measurement results from a prototype of the OCROP antenna. We start by presenting the feeding network, which was formed with a 180\u00b0 hybrid coupler. Next, we present the reflection coefficient and radiation pattern measurements for the prototype antenna to verify their performance with respect to the simulations.In practice, we require a differential feed when using the antenna and measuring radiation patterns. Therefore, two types of measurements are required.First, we needed to establish the differential S-parameters to compare the simulated and fabricated designs. The two-port VNA in our lab only supports single-ended S-parameter measurements. Since two of the ports are fed simultaneously, we cannot simply use the standard S-parameter measurement approach . Additionally, we cannot measure the differential reflection coefficients in our lab using the two-port VNA. Therefore, to characterize the differential feed, we measured the single-ended S-parameters at all ports  and calculated the differential reflection coefficients using an established approach .Secondly, to use the antenna in practice, we need to provide a single input and a feed network. This is required in our facility to measure the radiation pattern, as the receiver has a single port for measurement. Therefore, we measured the input reflection coefficient, as seen at the input to the combination of the feeding network and antenna together. These results are presented in this section.Ideal differential feeding requires equal amplitude  and 180\u00b0 phase difference at the two differential ports. This was easily realized in HFSS simulation by setting up the correct amplitude/phase for each excitation port and assigning differential pairs. In measurement, a feed network shown in  was consSince the antenna ports are in the sidewalls of the ground cavity, we used 90\u00b0 angled SMA connectors to eliminate the stress of the cable mass on the prototype, and these were used to connect the antenna to the feed network. Without the phase trimmers, the phase difference between the signals from port 0\u00b0 and port 180\u00b0 of the coupler and cable combination exhibits relatively large deviations from the ideal value of 180\u00b0.A vector network analyzer  was used to evaluate the S-parameters of the feed network and the antennas. The magnitude imbalance at the end of the cables was \u22640.5 dB within the 1.05 to 2.0 GHz bandwidth. After adding the phase trimmers, the differential phase error within 1.05 to 1.9 GHz bandwidth was A prototype of the differentially-fed, dual-polarized OCROP antenna, as shown in dd11 and Sdd22 are Y- and X-polarized differential reflection coefficients, respectively. As can be seen, there is good agreement between the simulated and measured results in terms of the operating frequency range where Sdd11 and Sdd22 \u2264 \u221210 dB.To evaluate the differential reflection coefficients of the antenna, we conducted two types of measurements with a two-port VNA. The first type measured single-ended S-parameters at all antenna ports. The differential reflection coefficients were obtained from the post-processing of these data by assuming differential signals for one differential pair and matched loads for the other pair. In simulations, the reflection coefficients were calculated using the same post-processing approach  but with the single-ended S-parameters obtained numerically in HFSS. Both simulated and measured differential reflection coefficients using this method are shown in To provide differential feeding to the antenna, we used the feed network described in dd11 and Sdd22 would be slightly different if a different feeding network were to be used, and therefore, in practice, the feeding network must be carefully selected and designed.Radiation patterns were measured in a Compact Antenna Test Range. The simulated and measured results of the fabricated antenna are compared in In the measurement, there are two sources of errors for cross-polarization, i.e., the Compact Range reflector and the antenna mount. The Compact Range reflector is an offset reflector, and its cross-polarization is limited to \u221235 dB. The scattering from the antenna mount on the tower and the tower itself contributes to the cross-polarization. Despite the differences, the measured X-pols at 1.5 GHz still met the X-pol requirement of \u2264 \u221225 dB in both principal and diagonal planes. In addition to the excellent electrical performance, the fabricated antenna is also lightweight (197.0 g) and compact (0.825 \u03bb \u00d7 0.825 \u03bb \u00d7 0.4 \u03bb at the center frequency of 1.5 GHz).In this paper, the design procedure of a high-performance octagonal cavity-backed antenna was presented. The proposed antenna exhibits multiple attractive qualities: dual-polarization, wide impedance bandwidth, low cross-polarization, high gain, and high aperture efficiency. It can be used for many applications, such as remote sensing and satellite communication, where compact antennas with low cross-polarization are required. Alternatives are corrugated horns that are bulky, heavy, and very costly to fabricate. The cavity-backed configuration ensures that the antenna supports stable broadside radiation with relatively high gain and low cross-polarization. An octagonal ground cavity, instead of a more commonly seen square one, was used because it offers lower cross-polarization and higher aperture efficiency while being more compact. By merging the resonances from the open prism and the radiating feedlines, wide impedance bandwidth was realized. The bandwidth can reach over 60% by adjusting the air gap between the two radiators and the ground plane. Multiple design considerations were adopted to ensure low cross-polarization. Some basic ones include ensuring a symmetric antenna configuration, adopting a differential feed, and feeding the antenna from the ground sidewalls instead of the bottom ground plane. Further cross-polarization reduction can be realized by moderately increasing the cavity sidewall height. To verify the design and fabrication process, an antenna prototype was fabricated and tested with excellent agreement between the simulated and measured results. To demonstrate the superior performance of the proposed antenna, we compared it with three high-performance cavity-backed antennas with wide impedance bandwidth in It has shown that there is a small section of the operating band  that is not sensitive to the cross-polarization suppression techniques used here. We will propose an additional cross-polarization suppression technique to overcome this issue in the future. In addition, since some applications require higher gain than reported here, we will investigate different gain enhancement techniques that are compatible with our design."}
+{"text": "We use high-resolution LiDAR topography to characterize landforms, satellite images to classify the vegetation into forest types, and in-situ produced cosmogenic 10Be in the quartz extracted from soils and stream sediments to document spatial variations in soil erosion. The data document a strong correlation between forest type and topographic position , and a correlation between topographic position and 10Be-derived erosion rates over 103\u2212104 years. Erosion is faster in valleys, which are mostly covered by monocot Palm Forest, and slower on surrounding hills mostly covered by the dicot Palo Colorado Forest. Transition from one forest type to the next occurs across a break-in-slope that separates shallowly convex hilltops from deeply concave valleys (coves). The break-in-slope is the consequence of a longer-lasting erosional imbalance whereby coves erode faster than hills over landscape-shaping timescales. Such a deepening of the coves is usually spurred by external drivers, but such drivers are here absent. This implies that cove erosion is driven by a process originating within the coves themselves. We propose that vegetation is the primary driver of this imbalance, soil erosion being faster under Palm forest than under Palo Colorado forest. Concentration of the Palm forest in the deepening coves is reinforced by the better adaptation of Palm trees to the erosive processes that take place in the coves, once these develop steep slopes. At the current rate of landscape development, we find that the imbalance started within the past 0.1\u20131.5 My. The initiation of the process could correspond to time of settlement of these mountain slopes by the Palm and Palo Colorado forests.Topography is commonly viewed as a passive backdrop on which vegetation grows. Yet, in certain circumstances, a bidirectional feedback may develop between the control of topography and the spatial distribution of vegetation and landform development, because vegetation modulates the erosion of the land surface. Therefore, if reinforcing feedbacks are established between erosion and land cover distribution over timescales relevant to landform development, then the interactions between vegetation and topography may create distinctive landforms, shaped by vegetation. We expose here a strong correlation between the spatial distribution of vegetation, erosion rates, and topography at a characteristic length scale of 10 Here we document the distribution of landforms, vegetation, and erosion rates across the tropical montane forest of Luquillo, in Puerto Rico, over timescales relevant to landscape development.Topography affects the distribution of vegetation over a wide range of spatial scales. At the scale of mountain ranges  , albeit 10Be measurements in quartz collected in forest soils and river sands. The DEM and the satellite images are used to explore correlations between vegetation and topography. The 10Be data is combined to the DEM data to analyze the distribution of erosion rates across the topography over 103\u2212104 years. The geomorphological analysis of the DEM is used to identify landforms produced by longer (104\u2212106 years) imbalance in erosion across the landscape. The current imbalance in 10Be-derived erosion rates is used to calculate the time required to produce the current landscape over the timescale revealed by the DEM analysis. We then review the potential drivers of observed spatial variations in erosion rates. We propose that the variations are strongly influenced by the distribution of vegetation across the landscape.The study relies on three datasets: a high-resolution LiDAR digital elevation model (DEM), high-resolution satellite images, and in situ-produced cosmogenic 2 in the headwaters of R\u00edo Blanco, a river that drains the southern flank of the Luquillo Mountains in Puerto Rico (Prestoea Montana) forest and the Palo Colorado (Cyrilla Racemifolia) forest, which respectively cover 43% and 57% of the study area, located between 600 and 750 m.The study area covers 16.3 kmrto Rico . The R\u00edorto Rico . Forest rto Rico . In betw10Be method for quantifying erosion rates [The study area  featureson rates . The stoon rates ), the ston rates , 12, preAirborne LiDAR data were collected by the National Centre for Airborne Laser Mapping (NCALM) in May 2011 . Persist2 of forest located within the boundaries of the reliable LiDAR data [2 of the classified forest . However, the more thorough investigations conducted in the study area have shown that 10Be concentration there varies with sediment grain size [10Be concentrations into basin-wide erosion rates. Therefore, in order to capture the full range of apparent denudation rates introduced by this dependency, we measured the 10Be concentration in the finest and coarsest measurable sediment grain size fractions across 14 streams, wherever such fractions stood at least six phi units apart . They are systematically separated from surrounding coves by a break-in-slope, below which slopes reach values \u2265 30\u00b0 . A marginally better fit (AIC = 207 vs. 186) is obtained with elevation when using a non-linear relationship, but given that the relationship between rainfall and elevation is linear in the Luquillo Mountains, the use of a complex fitting is not justified. A much stronger correlation is observed for parameters that contrast hilltops and coves, such as slope steepness (2 = 0.89), or the depth of sheltering behind hilltops (2 = 0.90). They highlight the propensity of the Palm forest to occupy coves, while the Palo Colorado forest covers hilltops.Several years of field work on the site, and inspection of satellite images revealed that the distribution of the two main forest types that occupy the study area is controlled by several factors, and among them, topography . In orde10Be and soil denudation. Secular equilibrium is indeed expected on low-slope, shallow-curvature hilltops where diffusive processes dominate. In the Luquillo Mountains, it has been shown that the prevailing diffusive processes are soil creep, tree throw, and bioturbation [10Be concentration with soil depth. The assumption can be tested by fitting theoretical profiles of soil age and erosion rate to the observed concentrations [-1,  if we suppress our added correction for the effect of quartz enrichment in the topsoil [The erosion of the topsoil on hilltops  overlap with the lower range of soil erosion rates measured in the broad hilltops (~10\u201380 m\u2219My-1), possibly reflecting a slight additional accumulation of 10Be in the particles between their exhumation on the ridgelines and their arrival into the streams, during the slow, diffusive transport of quartz grains along the broad hilltop slopes. Erosion rates are higher in cove-dominated catchments, up to values of ~140 m\u2219My-1, according to the coarse fraction, and of ~80 m\u2219My-1 according to the fine fraction. These new stream data are consistent with earlier measurements that targeted larger catchments in the study area  and fine (73 \u00b1 40 m\u2219My-1) fractions respectively as the end-member minimum rate of cove erosion (because they incorporate a component of hilltop erosion), and the average of hilltop soil erosion rates (50 \u00b1 14 m\u2219My-1), we find that coves erode between >1.5 \u00b1 0.9 and >2.5 \u00b1 1.1. times faster than the hilltop soils, according to the fine fraction and coarse fraction, respectively  compared to the coves (1.6 \u00b1 0.2 MWH\u2219m-2), based on the ArcGIS solar insulation function. Insulation, in any case, probably does not affect the distribution of the Sierra Palm, which grows opportunistically from shaded under-canopy to fully exposed brakes [We interpret the correlation between topographic position (hilltop or cove) and forest type  as the result of a control of the distribution of vegetation by topography. This is a common observation, and in tropical areas, such a control exerts itself in a variety of ways that can act in concert , 3, 28. d brakes . The effd brakes , which ad brakes , 32. Pald brakes , whereasTopography further influences the distribution of forest types through the routing of surface and near-surface overland flow. Vegetation in the coves grows on steeper slopes (27\u00b19\u00b0) than on hilltops 17\u00b18\u00b0). Hilltops are therefore not as well drained as coves, and we observed that they commonly support water-logged hypoxic soils. Palm forest grows on well-drained steep terrain  but also\u00b18\u00b0. HillTopography also influences the distribution of forest types through nutrient routing. In the study area, bedrock weathers to an intensely nutrient-depleted saprolite, and the weathering front lies far below the surface , 35. Thi10Be-derived erosion rates, but would need to exert itself over a period of time much longer than the integration time of the 10Be record. Assuming that the topographic envelope used to calculate the sheltering of the forest behind surrounding hilltop represents a first-order approximation of the initial topography from which the current topography has differentiated, and using the present-day differences in 10Be erosion rates between coves and hilltops . They also started the simulation from an initially flat landscape. They found that topographic differentiation would have started at 1.3 Ma. Suppressing our corrections for environmental parameters we find that, according to their calculations, differentiation would have started between 0.11 \u00b1 0.7 Ma and 3.0 \u00b1 2.7 Ma , floodplains would be lowering at <11-31m\u2219My-1, that is, much more slowly that cove erosion, and even more slowly than hilltop erosion. Besides, it is more likely that the bedrock below the floodplains rises in the upstream direction, and this effect should be even smaller. Last, the rate of floodplain lowering should be unsteady to trigger a drop in base level susceptible to initiate faster incision of the coves, and there is no evidence, for an acceleration of the knickpoints over the past millions of years [The decoupling between hilltops and coves pervades the entire study area and therefore implies that valley deepening is a response to an event affecting the entire area. Valley deepening is most commonly caused by accelerated lowering of the base level of the rivers that drain the valleys. Here, however, the base levels of coves are shallow-gradient alluviated floodplains  that do -1 . The upsof years . InsteadSome coves host seeps in their headwaters. Seepage may contribute to cove growth , by grou-1 [The study area erodes quite slowly  con-1 , and the-1 . The str-1 , owing t-1 , where p-1 . It appe-1 . Given t-1 , one can-1 . We obse-1 .We propose that, at the start of the process of topographic differentiation, Palm trees were slightly more abundant in the valleys, promoting faster erosion of the soil on slopes that were not initially distinctively steeper than on ridgetops . The proIf topographic differentiation is thus originally and primarily driven by topographically-controlled vegetation, then topographic differentiation can be expected to have started when the study area, currently located at elevations of 600\u2013750 m, was settled by Palm and Palo Colorado forest. Our simple calculation, which assumes a linear development, suggests that such an event would have taken place between 0.11 \u00b1 0.03 and 1.4 \u00b1 0.3 Ma. This timing is consistent with the age of the Luquillo mountains, which started to rise < 4.5 My ago . Palm anAt the scale of the Luquillo Mountains as a whole, the preponderant role played by vegetation in landscape evolution is highlighted by the fact that the forest has protected the mountains from rapid hillslope erosion and stream incision, over the past millions of years . The forA strong correlation between topography and vegetation is observed at the scale of hilltops and valleys, within a slowly eroding part of the Luquillo Mountains. Hilltops tend to attract Palo Colorado forest, while the surrounding, deeply concave valleys (coves) tend to host Palm forest.Topography can control the distribution of these forest types in various ways. In landscapes strongly depleted in bedrock nutrients, such as here, fluxes of bedrock nutrients likely play a significant role in topographically-driven forest differentiation.10Be produced in quartz located in hilltop soils and stream sediments reveals that the coves are eroding faster than the hilltops, confirming, and expanding earlier observations.An inventory of the concentration of cosmogenic A systematic break-in-slope separates the shallow-dipping, low-curvature hilltops, from the surrounding, deeply concave coves. This topographic signature can be produced by perpetuation of the current imbalance in erosion between hilltops and coves over 0.1\u20131.5 My.We interpret the differences in erosion rates between hilltops and coves as driven initially by the difference in ground protection offered by sharp differences in subaerial and underground structure provided by the canopy-forming trees, their undercanopy, the litter, and the root mats between the two types of forests. Palo Colorado forest more efficiently suppresses soil saturation, slope wash, and landsliding than the Palm forest.Because these forest types are controlled by topography, a positive feedback exists that deepens the coves with respect to the hilltops over time, concentrates Palm forest in valleys and Palo Colorado forest on hilltops. The perpetuation of the process is ensured by the ability of the Palm forest to persist once the coves become steep, deeply confined between ridges, and struck by landslides.The initiation of the process may correspond to the time at which the study area was settled by the Palo Colorado and Palm forests. It also corresponds to the time at which local frog species, hosted by these forests, also started undergoing biodiversification.S1 File(PDF)Click here for additional data file.S2 File(PDF)Click here for additional data file.S3 File(PDF)Click here for additional data file."}
+{"text": "Ventricular septal defect (VSD) is a catastrophic acute myocardial infarction (MI) complication. Despite a significant reduction in the prevalence of post-MI VSD with the advancement of surgical techniques, it is still considered fatal with a high mortality rate. The trends in the clinical outcomes of patients with post-MI VSD show discretion due to the complexity of the disease. Therefore, the present analysis aimed to evaluate the surgical outcomes and associated risks in the patients of post-MI VSD. A thorough literature survey resulted in 40 studies of our interest. The pooled proportion of differential variables, including the incidence of cardiogenic shock, 30-day survival, and overall mortality, were estimated using Bayesian hierarchical models. The risk difference was estimated for the location of MI and VSD and mortality in patients with coronary artery bypass graft (CABG). In addition, the heterogeneity tests for inconsistency and publication biases using Egger\u2019s and Begg\u2019s tests were also estimated. The analysis revealed a significant risk difference of 0.23 and 0.27 for the anterior vs. posterior location of MI and VSD, respectively. Further, the pooled proportion of 30-day survival and mortality was found to be 54.43% : 52.88-55.98%) and 48.22% (95% CI: 4-12.3%), respectively.an I2\u00a0index of >90% (p<0.0001). Lastly, the publication bias results suggested no evidence of asymmetry and small-study effects. Conclusively, the surgical management of post-MI VSD patients is considered beneficial; however, the outcomes signify its fatal behavior.Moreover, the heterogeneity test revealed significant inconsistencies in all the datasets with\u00a0 Ventricular septal defect (VSD) or ventricular septal rupture (VSR) is a serious complication of acute myocardial infarction (MI) . During MethodsSearch ToolThe guidelines of the Cochrane Handbook and Meta-analysis of Observational Studies in Epidemiology , prepareData ExtractionThe following parameters were noted: age, gender, pre-procedures such as percutaneous coronary intervention (PCI), Qp: Qs and inotropes, ejection fraction and surgical procedures, timings of MI to VSD and VSD to repair in days, residual shunt and affected coronary artery. The analyzed parameters for the meta-analysis were: incidence of cardiogenic shock in PMI-VSD patients, anatomical location of MI, location of VSR, preoperative IABP and concomitant CABG, risk factors , 30-day survival, and overall mortality along with mortality associated with concomitant CABG, location of MI and location of VSR.Statistical AnalysisThe clinical and surgical outcomes data were retrieved from the selected publications or calculated after extracting the numeric data. Depending on the data, the pooled proportions of surgical outcomes and associated factors across studies were estimated from the exact number of patients with 95% credible intervals [CI] using the Bayesian hierarchical models or fixed-effects meta-regression of the natural logarithm of the risk difference was performed for comparative analysis. The results were depicted using forest plots. Further, heterogeneity tests for inconsistency (I2) levels and Egger\u2019s and Begg\u2019s tests for publication bias were performed across the selected publications. Publication bias is considered when deciding to publish a manuscript depending on statistically significant results. The statistical analysis was performed using MetaXL software.ResultsSearch ResultsDespite the declined incidence of post-MI VSD, the literature search resulted in 1795 articles; however, only 86 studies were identified as pertinent. Among the pertinent articles, 40 were considered for the final meta-analysis based on the data of interest  patients and posteriorly in 764 (46.17%) patients (28 studies). The analysis revealed a significant risk difference of 0.23 in the anterior vs. posterior location of MI . The I2 index was estimated to be 97.07% , which was significant. In addition, Egger\u2019s  and Begg\u2019s  tests showed non-significant results, stating no evidence of publication biases concerning the location of MI. The forest plot of risk difference estimation for the location of MI is given in Figure\u00a0Further, 15 studies reported VSD localization in the anterior wall of 319 (54.43%) patients and the posterior wall of 267 (45.57%). The risk difference of anterior vs. posterior location of VSD was estimated to be 0.27, which was significant . The heterogeneity tests revealed a significant I2 index of 94.39% . In contrast, Egger\u2019s  and Begg\u2019s  tests revealed no publication biases in specifying the location of VSD in the patients. The forest plot of risk difference estimation for the location of VSD is given in Figure\u00a0Associated Risk FactorsThe risk factors of coronary artery disease, such as smoking, dyslipidemia, smoking, and prior MI, were analyzed for their independent estimated proportions with respect to patients with post-MI VSD. Among 40 included studies, the data was mentioned in 15 studies for prior MI (161/1324 patients), 25 studies for diabetes 895/3527 patients), 27 studies for hypertension (2074/3571 patients), 21 for current smoking (667/2894 patients), and 11 for dyslipidemia (602/1840 patients). Figures\u00a0 patients IABP, and Concomitant CABG in Post-MI VSD SubjectsIncidence\u00a0of\u00a0Cardiogenic\u00a0Shock,\u00a0PreoperativeAmong 40 chosen studies with 4,028 patients, 22 studies with 3,234 patients, 30 studies with 3349 patients, and 21 studies with 3286 patients provided the data of cardiogenic shock, preoperative IABP, and concomitant CABG in Post-MI VSR subjects, respectively. The analysis revealed that the incidence of cardiogenic shock and preoperative IABP were observed in more than half of the post-MI VSR population with estimated pooled proportions of 50.19% (95% CI: 48.46-51.92%) and 66.99% (95% CI:65.37-68.57%) respectively. On the contrary, the pooled proportion of concomitant CABG was 42.23% (95% CI = 33.95 - 49.23). The forest plots of the respective variables are provided in Figures\u00a0Mortality as a Major OutcomeAll the 40 included studies provided the data of 30-day survival and overall mortality associated with post-MI VSD, which was found to be 2182/3996 and 1910/3996 with their estimated pooled proportions of 54.43% (95% CI: 52.88-55.98%) and 48.22% (95% CI: 4-12.3%)respectively, as shown in Figure\u00a0Furthermore, the mortality concerning the location of VSR and concomitant CABG was corroborated in five studies with 252 patients and 12 studies with 1129 patients, respectively. The risk difference in mortality concerning the location of VSR and concomitant CABG was found to be -0.039 (95% CI = -0.169-0.091) and 0.068 (95% CI = 0.031-0.11) with their significant I2index of 96.88 %  and 96.86 % . Lastly, the publication bias using Egger\u2019s and Begg\u2019s tests suggested no evidence of asymmetry and small-study effects for all the analyzed variables in post-MI VSD patients across selected studies. The forest plots for mortality concerning the location of VSR and concomitant CABG are shown in Figures\u00a0DiscussionPost-MI VSR poses a major clinical challenge due to high mortality -3. SeverIn the era of surgical interventions in patients with post-MI VSD, the incidence of post-MI VSD has significantly been reduced . EvidencIn most cases, delay in the surgical intervention occurs because surgeons wait for the formation and improvement of tissue scars -20. EarlAccumulating evidence in the literature suggests the association of various risk factors of coronary artery disease, such as smoking, dyslipidemia, smoking, and prior MI, with the development of post-MI VSD -6. The pThe localization of MI or VSR may be other considerable variables to elude worse outcomes. In the present data, we observed that the number of patients with anterior localization of disease was significantly higher than those with posterior wall or septum defects, signifying that the anterior wall or septum is more vulnerable than the posterior wall for both MI and VSR. Moreover, the risk difference in anterior vs. posterior location of both MI and VSR was found to be statistically significant. Furthermore, the mortality concerning the location of VSR was also assessed, and the risk difference in mortality with anterior or posterior localization of VSR was found to be statistically non-significant. The postoperative course is stormier in posterior VSR due to associated right ventricular dysfunction. The data suggest that the location of the defect did not influence the survival rate of patients with anterior or posterior defects. However, only 5 studies with 252 patients corroborated this data -30. MoreFurthermore, multi-vessel coronary artery disease patients underwent CABG during VSD repair -35. SubsLimitationsThe study has a few limitations. Firstly, the identified studies lacked information on the intervention techniques for the surgical management of patients with post-MI VSD, which is a major drawback. Secondly, no sufficient data was given on the interval between VSD diagnosis to repair and the location of MI in association with mortality.The present systematic review and meta-analysis evaluated the surgical outcomes and associated risks in the patients of post-MI VSD. A statistically significant risk difference was noted in the patients' anterior vs. posterior locations of MI and VSD. The 30-day survival rate remained low, while the mortality rate was higher even after better surgical interventions for the management of post-MI VSD. Our data suggest that concomitant CABG is an additional factor corroborating to mortality. We conclude that time from VSR diagnoses to repair should be considered for the timely management of patients with post-MI VSD that may provide better survival benefits."}
+{"text": "Crohn\u2019s disease (CD) is a subtype of inflammatory bowel disease (IBD). CD is a health problem in Western countries such as the US and European nations and is an idiopathic disease; however, certain cases of CD have been associated with intestinal dysbiosis. A systematic review with a meta-analysis was carried out to determine the efficacy of a diet rich in fiber with or without cointervention to improve remission rates for CD. The literature in the PubMed, Scopus, Web of Science, and ClinicalTrials databases was reviewed. The quality of the studies was evaluated using the Johanna Briggs Institute (JBI) scale. This review was conducted in accordance with the structure outlined in the PRISMA statement. In addition, a meta-analysis was performed with a 95% confidence interval (CI) and a random effects model. Eleven studies were included, totaling 2389 patients with CD. Applying a diet rich in fiber with or without the administration of routine therapies improved CD remission rates. Data regarding CD activity, remission time, and adverse effects derived from fiber consumption were analyzed. Consumption of fiber in the diet could improve remission rates for CD patients who receive or do not receive other treatment to maintain remission. Inflammatory bowel diseases (IBDs) are idiopathic pathologies, among which there are three subtypes: Crohn\u2019s disease (CD), ulcerative colitis (UC), and unclassified IBD (IBD-U), the latter being the least frequent, accounting for 4% of IBD cases in Western countries . SpecifiIn patients with IBD, quality of life is highly compromised compared with that in individuals who do not suffer from gastrointestinal diseases . The sigDespite being a set of idiopathic diseases, several factors that promote the appearance of IBDs have been detected, including the following examples: (1) genetic factors ; (2) environmental factors related to developed countries ; and (3) immune system issues, which include decreased intestinal mucus, the infiltration of T and B lymphocytes, and the overproduction of inflammatory mediators such as TNF\u03b1, IFN\u03b3, IL-1\u03b2, and IL-23, which in turn lead to abnormalities in the action of white cells such as macrophages, neutrophils, and NK T lymphocytes .Faecalibacterium prausnitzii (F. prausnitzii), Clostridium leptum (C. leptum), and Bacteroides have anti-inflammatory capacities at the intestinal level through the production of short-chain fatty acids (SCFAs), and these species are diminished in patients with IBDs [E. coli and Fusobacterium are more abundant [Another factor to consider in order to understand the pathogenesis of IBDs is the intestinal microbiota. Specifically, compared with individuals without IBD, those with IBD have imbalances in different commensal species at the intestinal level; this phenomenon is known as dysbiosis . In geneith IBDs . In contabundant .SCFAs are anti-inflammatory substances that are produced by the degradation of soluble fiber at the intestinal level by the aforementioned microbiota species . Some exAmong IBDs, CD is the most common. To control the symptoms of CD, there are multiple therapeutic options, of which those whose objective is to regulate intestinal inflammation by directly affecting the functioning of the immune system stand out . There aTo date, how the consumption of foods rich in fiber can exert beneficial effects on individuals with CD has been studied on other occasions; for example, a Cochrane review carried out in 2019 included 18 studies on dietary interventions for CD. However, not all the studies included in the review analyzed fiber consumption ,22.The objective of this study was to synthesize the scientific evidence available to date of a diet rich in fiber as a method to prevent acute flare-ups of CD as well as to analyze the effects regarding positive clinical improvements.This systematic review was carried out in accordance with the standards outlined in the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) statement . The detThe following databases were searched: PubMed, Scopus, Web of Science, and ClinicalTrials.The searches were conducted to answer the research question directly, which was developed in the population, intervention, comparison, and outcome (PICO) format . The seaComponents of the PICO research question are as follows: P: problem; I: intervention to be analyzed; C: comparison or control; and O: outcomes.The clinical question was as follows: in the population with CD, does an adequate consumption of fiber in the diet provide greater benefits than conventional therapies and normal diets to prevent CD recurrence and improve CD symptoms?The detailed search strategies for each database are listed in Observational studies;Clinical trials;Studies that analyzed the consumption of a diet rich in fiber to maintain CD remission;Studies in Spanish or English.The inclusion criteria used to select the studies that are part of this review were as follows:Studies that were conducted with animals;Studies that did not include patients with CD in their study population.The following types of studies were excluded:Study selection was carried out by two researchers, V.S.F. and M.S.P., using the inclusion and exclusion criteria mentioned above. The searches yielded 677 results (the Mendeley computer program was used to avoid duplicates); the selection process followed the flow chart detailed in the PRISMA statement . Once duTo assess the quality of the studies and detect biases, Johanna Briggs Institute (JBI) scales were used  for eachThe quality assessment was independently reviewed by two authors: V.S.F. and M.S.P. The interrater reliability was high, and any discrepancies were discussed between J-M.C.T. and J-A.L.A. until an agreement was reached.Data extraction was carried out by two researchers: V.S.F. and D-P.P.C. From each selected study, the following data were collected: (1) title and authors; (2) year and country; (3) study design; (4) sample characteristics: sample size, selection, and age of participants; (5) study objective; and (6) main results: type of fiber consumption and clinical remission rate.When interpreting the information found, the diet was considered effective when it contributed to maintaining the clinical remission of CD alone or in conjunction with other therapeutic strategies, and the intervention was considered safe as long as it did not produce adverse effects that were different from those produced by conventional therapies.For the studies selected for this review, a narrative synthesis was performed. The data were analyzed to compare results between patients who consumed a diet rich in fiber and patients who received the usual treatments or consumed common diets. Additionally, complications derived from consuming diets rich in fiber were recorded.2 statistic. I2 \u2264 25%, I2 between 26 and 50%, and I2 > 50% were used to define low, moderate, and statistically significant homogeneity, respectively [For the quantitative analysis, a meta-analysis was performed using the inverse variance method of random effects. The standard deviations (SDs) of the pre- and postparameters (high fiber diet + infliximab versus control) of each study were calculated. Statistical heterogeneity was evaluated with the IThe searches of the four databases yielded a total of 677 results. The Mendeley computer tool was used to eliminate duplicates and manage the references. After eliminating duplicates, a total of 659 results remained.Following the criteria established, 515 results were excluded. Eleven studies met the aforementioned inclusion criteria ,32,33,34All the selected studies were written in English and were either RCTs or observational studies that investigated diets rich in fiber and from which conclusions could be drawn regarding the maintenance of clinical remission in patients with CD. The characteristics of the included studies are presented in Of the 11 studies selected, 2 were RCTs ,34, 3 weThe selected studies included a total population of 5010 subjects, of whom 44% were men and 56% were women. This population ranged in age from 13 to 77 years.In the studies, there were 2389 patients with CD, and the remaining participants were patients with UC or healthy subjects. The sample included patients with all types of CD based on the Montreal classification  .Two of the eleven studies selected compared these types of diets. In general, the high-fiber diet was safer than the gluten-free diet . AdditioSpecifically, the study carried out by Schreiner P, et al.  comparedThe study carried out by Heaton K, et al.  comparedOf all the selected studies, six assessed the consumption of certain foods together with the risk of relapse or CD activity, of which five showed positive results from consuming a diet rich in fiber ,28,33,34The study published by Tasson, L, et al.  assessedThe study carried out by Dolovich C, et al.  evaluateAnother study by Mirmiran P, et al.  assessedThe study carried out by Opstelten J et al.  investigHowever, the study carried out by Brotherton C, et al.  yielded Finally, the trial carried out by Lacerda J et al.  analyzedDue to the heterogeneity of the outcome variables in these studies, it was not possible to carry out a quantitative analysis  of the benefits of a high-fiber diet alone.Three studies analyzed how the consumption of a diet rich in fiber influenced patients receiving infliximab as background therapy ,30,31. TA study conducted by Chiba M et al.  observedIn another study by the same author , 17 of tThe third study carried out by Chiba M et al.  investigp = 0.08; I2 = 0%).The results of the meta-analysis  showed aOf all the selected studies, only three showed any adverse effects. Two patients in the study by Chiba M et al.  had inteNotably, another study  reportedHowever, in the remaining studies analyzed ,31,33,34Based on the results obtained, high fiber intake through the diet is not only safe but also effective in maintaining remission in conjunction with other therapies for patients with CD.From a nutritional point of view, certain habits increase the risk of IBD flare-ups; for example, consuming red meat more than four times a week increases the risk of UC flare-ups . In the Although the efficacy of fiber in maintaining CD remission cannot be denied ,28,31,32By professional consensus, the consumption of fiber is recommended to all patients with IBD, as long as they do not have intestinal stenosis; insoluble fiber could act at the level of the intestinal lumen, producing an increase in fecal waste and increasing the risk of occlusive symptoms at the intestinal level ,40. LikeA Cochrane review reported how a diet rich in fiber produces an increase in SCFAs, promoting intestinal homeostasis and helping to control inflammation in patients with CD , as specThe consumption of dietary fiber by patients with CD was lower than that by healthy controls (4 g/day difference between groups), with a total fiber consumption of 14 g/day in patients with CD . HoweverFiber administered at controlled doses and in the form of a supplement is effective in controlling the symptoms of CD ,45. SpecTo clarify more accurately whether a nutritional intervention rich in fiber is adequate to maintain remission in patients, more RCTs are needed that compare control groups with conventional therapy groups and experimental groups and that specify the diet administered to the patients as well as the amount of fiber needed. Furthermore, such studies should be conducted for a sufficient time to ensure the reliability of the results obtained. Only two studies evaluated interventions long enough to identify the remission rates for patients clearly; the evaluation time was greater than 2 years ,31.Among the studies included in the analysis in this review ,30,31 arAmong the limitations of this review are the small number of RCTs included in the review and the lack of nutritional specifications of the diets used or investigated in the studies. In the studies included in this review, the type of fiber consumed by the subjects was not accounted for except in one study, which included soluble fiber in the participant diet . This maAnother limitation was the heterogeneity in the variables resulting from the included studies; this heterogeneity made it impossible to carry out the meta-analysis. In fact, in the meta-analysis conducted, diet interventions were different among selected studies , so it is difficult to compare them. Also, it is important to mention that these studies were low quality, and only two RCTs had a control group ,34.Furthermore, one study did not use analytical, or endoscopic criteria to measure CD activity . It is nAs strengths, the sample size in each study was sufficient to clearly reach the conclusions obtained. The studies were carried out in different parts of the world; therefore, information was collected from different populations.It seems that high dietary fiber intake can increase the remission time in patients with CD. It is a simple nutritional practice without risk for patients. However, adjuvant treatment with a diet rich in fiber should be supervised by a health professional because one of the functions of health personnel is to provide health education. Under these conditions, the consumption of a high-fiber diet is recommended.Dietary fiber intake could increase remission rates in patients with CD who achieve clinical remission with conventional therapies. Due to scarce evidence about the relationship between fiber intake and CD, we cannot recommend a specific dietary intervention. However, it can be stated that a fiber intake between 13.4 and 33.4 g/day is safe in CD patients. Also, a high-fiber diet should be an adjuvant treatment in conjunction with other therapeutic strategies to maintain remission.More studies are needed to evaluate the amount and type of fiber to improve remission rates for CD. Specifically, we believe it is necessary to conduct more RCTs that analyze conventional therapies and high-fiber diets in combination with conventional therapies, with analytical and endoscopic follow-up to determine the efficacy of the intervention."}
+{"text": "Additionally, leveraging data from the genome-wide association study (GWAS) catalog, we discovered >1.3 million paQTLs that overlap with known GWAS linkage disequilibrium regions. Remarkably, \u223c9324 paQTLs exhibited significant associations with patient prognosis. Moreover, investigating the impact of promoter activity on >1000 imputed antitumor therapy responses among pan-cancer patients revealed >43\u00a0000 million significant associations. Furthermore, \u223c25\u00a0000 significant associations were identified between promoter activity and immune cell abundance. Finally, a user-friendly data portal, Pancan-paQTL (https://www.hbpding.com/PancanPaQTL/), was constructed for users to browse, search and download data of interest. Pancan-paQTL serves as a comprehensive multidimensional database, enabling functional and clinical investigations into genetic variants associated with promoter activity, drug responses and immune infiltration across multiple cancer types.Altered promoter activity has been generally observed in diverse biological processes, including tumorigenesis. Accumulating evidence suggests that employing a quantitative trait locus mapping approach is effective in comprehending the genetic basis of promoter activity. By utilizing genotype data from The Cancer Genome Atlas and calculating corresponding promoter activity values using   Located upstream of transcription start sites, promoter elements play a crucial role in regulating the initiation and activity of transcription. They integrate signals from proximal epigenetic modifications and distal regulatory elements. In humans, the transcriptional initiation of most protein-coding genes is controlled by multiple promoters, leading to the production of distinct gene isoforms ,2. Unlikcis-regulatory mechanism of promoter activity has been studied in both cancer and normal human tissues. For example, an intergenic variant, rs8028374 (A/G), was identified as a paQTL associated with the outermost promoters of the TTC23 gene in Epstein\u2013Barr virus-transformed lymphoblastoid cell lines  (Single nucleotide polymorphisms (SNPs), the most common type of genetic variant, contribute to the diversity in human disease susceptibility . Genome-ll lines . Epigenoll lines . In addill lines . In spits (TCGA) . This mahttps://www.hbpding.com/PancanPaQTL/), to provide convenient browsing, searching and downloading of paQTL-related data of interest for users.To fill this gap, we developed a computational pipeline to conduct paQTL analysis across 33 cancer types in TCGA. Our study identified paQTLs associated with patient prognosis and paQTLs within linkage disequilibrium (LD) regions of GWAS. In addition, we investigated the paQTL\u2013drug associations and paQTL\u2013immune cell associations across different cancers. Finally, we constructed a user-friendly database, Pancan-paQTL . Promoter activity, defined as the total amount of transcription initiated at each promoter, was estimated using proActiv with aligned reads as input (https://github.com/GoekeLab/proActiv). We specifically employed the promoter activity associated with the primary or default promoter of genes with multiple alternative promoters. Distribution of absolute promoter activity across cancer types is displayed in TIMER, MCP-counter\u00a0and ImmuCellAI (https://www.cancerrxgene.org/) drug response from cancer cell lines to TCGA patient samples was estimated using oncoPredict R package  and junction files (level 2) quantified by STAR of >10\u00a0000 tumor samples were downloaded from the TCGA data portal , patient age and gender, and tumor grade and stage regarded as confounder factors were also estimated to decrease potential impacts from population structure, batch effect and clinical characteristics for each tumor type. The promoter activity matrix, genotype and covariates were then used to detect paQTLs based on a linear regression model by Matrix eQTL. We defined SNPs with false discovery rates (FDRs)\u00a0<0.05 as paQTLs. cis-paQTLs were ascertained when the SNP was located within 1 Mb from the specific promoter, and trans-paQTLs were identified when the SNP was beyond that location. On the basis of tag SNPs derived from the\u00a0GWAS Catalog website (http://www.ebi.ac.uk/gwas/) and the LD calculated by PLINK in the 1000 Genomes Phase 3 European population, cis- or trans-paQTLs that were in LD relation (r2\u00a0>\u00a00.5) with tag SNPs were defined as GWAS-paQTLs. Both cis- and trans-paQTLs were retrieved to investigate their potentially prognostic value by a log-rank test, with FDR <\u00a00.05 regarded as statistical significance  was used to impute genetic variants of TCGA tumor samples with the reference panel of the 1000 Genomes Project. The imputation parameters including minor allele frequency >5%, missing rate of SNPs\u00a0<5% and Hardy\u2013Weinberg equilibrium ificance .oncoPredict was used to predict in vivo drug responses in cancer patients on the basis of linear ridge regression analysis, which fits the gene expression matrix of samples into the half-maximal inhibitory concentration of antitumor drugs originated from GDSC (https://www.cancerrxgene.org/). Then, the associations between promoter activity of each cis- or trans-paQTL and imputed drug response were investigated by Spearman\u2019s correlation analysis with FDR <\u00a00.05 regarded as statistical significance .All data are available through our data portal  and tumor signaling pathways (e.g. NF-\u03baB and STING), indicating that paQTLs might impact patient prognosis by regulating promoter activity of cancer-related genes or cancer-related pathways. Number of paQTL pairs is significantly associated with the number of patient samples across cancers , most trans-paQTL pairs were identified in adrenocortical carcinoma  and most survival-associated paQTL pairs were detected in cholangiocarcinoma (n\u00a0=\u00a0981) (r2\u00a0\u2265\u00a00.5) of one or multiple human traits, of which the highest is 187\u00a0257 in pancreatic adenocarcinoma and the lowest is 22\u00a0441 in breast invasive carcinoma (Distance between QTLs and promoters <1\u00a0Mb is regarded as n\u00a0=\u00a0981) . In addiarcinoma .in vitro cell models. In total, 43\u00a0225 correlations between promoter activity and impute drug responses were identified in our analysis (Figure In anticancer drug response analysis, we calculated the correlations between promoter activity and imputed drug response across 33 TCGA cancer types, which offer much more direct and significant effect of promoter activity in anticancer therapy than s Figure .TIMER, 7891 associations from ImmuCellAI and 14055 associations based on MCP-counter (Figure http://www.hbpding.com/PancanPaQTL/download.Current studies have demonstrated the important function of promoter activity in modulating the infiltration of immune cells and the efficiency of checkpoints. The correlations between promoter activity and the infiltration of immune cells were also investigated in our analysis, which provides potential paQTL-based biomarkers for tumor immunotherapy. We identified 24\u00a0935 correlations between promoter activity and the infiltration of immune cells, including 2989 correlations from r Figure . All abot-stat value, P-value and FDR of paQTLs (Figure P-value and median prognostic time of different genotypes. For each query, a vector diagram of the Kaplan\u2013Meier plot was offered for illustrating the correlation between SNP genotypes and prognosis (Figure R2\u00a0and the associated traits (Figure cis-paQTL pairs, 33 GWAS-paQTL pairs, 14 drug\u2013paQTL pairs, 20 immune-associated paQTL pairs and related diagrams (cis-paQTL pair, one GWAS-paQTL pair, one drug\u2013paQTL pair, one immune-associated paQTL pair and related diagrams (Pancan-paQTL has six modules: Cis-paQTL, Trans-paQTL, Survival-paQTL, GWAS-paQTL, Drug-paQTL\u00a0and Immune-paQTL Figure . On the s Figure . For eacs Figure . On the s Figure . The Drus Figure . The Imms Figure . For exadiagrams . While tdiagrams .The outputs from all analyses, including tables and high-resolution figures, can be easily downloaded from the Pancan-paQTL database. The \u2018Help\u2019 page provides the basic information on database, pipeline of database construction, result summary and contact. Pancan-paQTL is open to any feedback with email address provided at the top of the \u2018Home\u00a0page\u2019.Alternative promoters play a crucial role in regulating transcription and have been found to be more accurate predictors of patient survival than gene expression in cancer . UnderstTo address these gaps, our analysis comprehensively integrated promoter activity with genetic variants, anticancer drug response and immune cell infiltration across human cancers, resulting in the identification of millions of promoter activity associations. To facilitate access to this valuable information, we developed the user-friendly Pancan-paQTL database, which allows users to query, browse and download promoter activity-correlated genetic variants, anticancer drug response and immune infiltration landscapes across multiple cancer types. The complex nature of gene modulation and the challenge of linking genetic variants to phenotypes necessitate further exploration. Within Pancan-paQTL, we identified >1 million paQTLs and evaluated their correlations with patient prognosis, offering a valuable resource for investigating human tumor genetics. This includes uncovering novel mediation mechanisms between variants and promoter activity to better understand the impact of variants on phenotypes, as well as shedding light on the role of genetic variants in promoter activity and their underlying functions in tumor prognosis and diagnosis.oncoPredict method to estimate drug response in cancer patients, leading to the identification of numerous paQTL\u2013drug correlations between paQTLs and imputed drug response across 33 cancer types. It is important to note that the TCGA data resource is useful for characterizing initial cohorts, but it may differ from the patient population in clinical trials, which often consists of heavily pretreated individuals with distinct molecular features.Increasing evidence indicated that promoter activity, or active promoters, may affect the response to anticancer therapy. However, the associations between drug response and promoter activity in a large number of cancer samples have not been extensively investigated. Estimating drug response in cancer patients can provide a more direct and significant measure for antitumor treatment. In our analysis, we utilized the Immunotherapy has demonstrated significant clinical benefits in various cancer types, and efforts are ongoing to enhance its effectiveness by understanding the tumor immune microenvironment and the underlying mechanisms of checkpoints ,22. ReceIn conclusion, Pancan-paQTL is a large-scale and multidimensional database that facilitates functional and clinical explorations of promoter activity across human cancers. We will continue to update Pancan-paQTL with the release of additional associated datasets, ensuring its relevance and usefulness for future research endeavors.zcad053_Supplemental_FilesClick here for additional data file."}
+{"text": "Apoptosis is a programmed cell death routine that plays an essential role in several biological processes, namely, embryonic development, tissue homeostasis, and immune response ,2. Its dEssential oils are natural plant compounds which are increasingly being used in the pharmaceutical and food industries due to their recognized biological properties, namely, antibacterial, antiseptic, antimutagenic, antioxidant, anti-inflammatory, and anticancer, and whose mechanisms of action include, among others, the induction of apoptosis. To safely ensure the use of eugenol and pulegone in humans and animals, Ribeiro-Silva et al.  evaluateSeveral studies have shown that dysregulation in the machinery of cell death by apoptosis is a hallmark of cancer. The observed alterations are responsible for both the development and progression of tumors, but also for their resistance to different therapies. Therefore, understanding the apoptotic components underlying their expression in carcinogenesis can help in tracking disease progression and in the development of new drugs and therapeutic approaches. Since the intratumoral heterogeneity of the prostate contributes to a limited response to treatments, the use of biomarkers is necessary to improve the prognostic survival of the patient. In this sense, Ionescu et al.  characteBreast cancer is the most common type of cancer diagnosed in women and the second leading cause of cancer-related death in women. The need to use autophagy inhibitors as a type of therapy against cancer stems from the fact that it promotes the survival of tumor cells, protecting them from apoptosis. Autophagy exhibits tumor-promoting and -suppressive properties, so a simultaneous approach to apoptosis and autophagy could be an interesting and effective strategy to eliminate resistance to anticancer drugs. Using several breast cancer cell lines, Nguyen et al.  reportedThe association of DNA damage and repair with aging processes is well known. Since this is a risk factor for the development of neurodegenerative diseases, the importance of understanding the role that DNA modifications play in the genesis of these diseases becomes evident. The histone variant H2AX is an essential component for nucleosome formation, chromatin remodeling, and DNA repair, and is also used in vitro as an assay for double-strand breaks in dsDNA. Cleaved caspase 3 (cCASP3) is one of several markers of apoptosis. The fully functional protease derives from an inactive precursor protein, becoming active by cleavage and, after a cascade of events, culminating in cell death by apoptosis. In this regard, Gionchiglia et al. , using uSome recent work has suggested that apoptosis may be involved in neuropathic pain, a chronic pain state caused by primary injury or dysfunction of the nervous system, although the details of the underlying molecular mechanisms are not yet fully understood. The objective of the article by Ribeiro et al.  was to rThe discovery of apoptosis has had a profound impact on several fields of research, including, but not limited to, cancer biology, immunology, developmental biology, and neuroscience. It has led to the identification of critical genes and pathways involved in cell death and has paved the way for the development of new therapeutic strategies for various diseases . This Sp"}
+{"text": "To assess the practical benefits of our modeling approach, we simulate the protection of 30 percent of US lands via government purchasing, modeled after the Biden administration\u2019s \u201c30x30\u201d initiative. Using our proposed modeling strategy, the purchasing agency saves approximately $15 million per year, or 4 percent of the USDA\u2019s annual land easement budget.Planning for cost-effective conservation requires reliable estimates of land costs, spatially-differentiated at high resolution. Nolte (2020) provides a county-by-county, parcel-level estimation approach that dramatically improves estimates of fair market value for undeveloped land across the contiguous Unites States. Much undeveloped land of conservation interest is under threat of conversion to agricultural use or is already agricultural. This paper demonstrates the value of accounting for additional variables that affect agricultural productivity and demand for undeveloped land, as well as the benefit of modeling at scales corresponding to regional agricultural markets. We find that countywide median home value, climatic variables, and several parcel-level soil type variables contribute substantially to predictive power. Enlarging the set of predictors and the geographical scale of modeling improves accuracy by approximately 15 percent and, relative to a more restricted modeling benchmark adapted from Nolte (2020), extends coverage into 376 counties occupying 1.35 million km Agencies and private organizations designing conservation efforts must contend with the fundamental scarcity of available resources, while simultaneously confronting a vast array of potential conservation strategies. Accurately predicting costs of competing strategies, then, is crucial to achieving the cost-effective use of scarce conservation dollars. Where conservation by fee simple acquisitions and land easement contracts is the dominant approach, the market value of land is a primary determinant of such costs. Yet, academics and planners have not often had access to reliable estimates of fair market land value, which constitute a high-priority resource for global change science and policy in general . Some stSeveral studies have attempted more accurate, higher-resolution land value estimates with national coverage. Larson 2015) uses a patchwork of USDA county-level agricultural land value estimates and existing hedonic estimates of urban land value  uses a p. UtiliziThere is reason to believe that expanding both the set of agriculturally and economically relevant predictors as well as the geographic scale of analysis could improve the coverage and quality of land value estimates. The market value of undeveloped land is in many cases driven by the value of its actual or potential use in agriculture. It can also be driven by demand in related, residential land markets. Climate and soil variables, absent from the set of predictors in Nolte , are welWhile many of the land quality attributes that determine economic value are fixed, or change only very slowly over time, many drivers of supply and demand\u2014income, preferences, technology, and the availability of substitutes\u2014vary over time. Failing to account for time-varying predictors can lead to an erosion of predictive power. When sales prices exhibit trends over time, not only will overall estimation accuracy suffer, but models might systematically over- or under-predict sales values for observations before or after the median sales year if they do not adequately control for such trends. To address these issues, we add median home price indices to our set of predictors. Home price indices capture changing dynamics in residential land markets that can exert pressure on (or otherwise correlate with) the price of undeveloped land. Accounting for variation in local home prices might thus improve the predictive power of models aimed at estimating the value of agricultural or other undeveloped land.Beyond incorporating additional predictors, we consider the possibility that modeling at scales larger than the county can ease local observation constraints, improving both the coverage and accuracy of resulting estimates. Many counties have few sales records in the ZTRAX database. Nolte (2020) implements a 1000-observation minimum for modeling parcel land values within a county, supplementing a focal county\u2019s observations with those drawn from neighboring counties where possible. In replicating this supplementation procedure with vacant, undeveloped, and agricultural parcels, we find that 27 percent of counties in the study sample fail to meet the threshold, and prediction accuracies for counties with sufficient-but-low observation densities are notably poorer than those for other counties.Indeed, national performance aggregations mask substantial heterogeneity across county characteristics. In particular, a county\u2019s observation density is strongly correlated with both performance measures. We attempt to resolve this trade-off between model size and observation homogeneity by specifying models at the scale of USDA farm resource regions . Farm refurther reduces prediction error by 5 percent . By modeling at the farm resource region level, we extend coverage in areas that were dropped in county modeling due to insufficient density by 376 counties while preserving comparable predictive accuracy to county-level approaches.Overall, our modeling approach, which both expands the set of predictors and models at a regional scale, reduces prediction error (MSE) by 15 percent. Decomposing this effect, we see that adding variables alone  reduces prediction error by approximately 9 percent, while modeling at a regional scale ex ante land value predictions can improve conservation outcomes by helping agencies achieve better targeted, more cost-effective contracting.In addition, we assess the practical benefits of our modeling approach by simulating the protection of 30 percent of US lands via government purchasing, modeled after the Biden administration\u2019s \u201c30x30\u201d initiative. Using our proposed modeling strategy saves the purchasing agency approximately $15 million per year, or 4 percent of the USDA\u2019s annual budget for land easements (a conservation strategy related to but distinct from direct land acquisition wherein property does not change hands but does become subject to certain land use restrictions and stewardship mandates). The provision of more accurate In short, our approach enhances the quality and quantity of parcel-level estimates of fair market value.p is the total set of predictive features, and a required minimum leaf size of 3. Nolte (2020) estimates models for the group of all parcels greater than 1 acre in size as well as separate models for the subset of stringently defined \u201cvacant\u201d (undeveloped) parcels. Parcels of interest in the present study include all \u201cvacant\u201d parcels plus any additional parcels coded as agricultural, even if they contain a building footprint. Our filter (fully described in n = 1.26 million) and training (n = 3.78 million) sets balanced on the outcome variable  , which tvariable . In counOur approach to dealing with insufficient county-level observations differs in two ways from that of Nolte (2020). First, Nolte (2020) accepts donations from all counties, beginning with those nearest the focal county and extending the search outward until 1000 observations are achieved. We suspend the search if the directly adjacent neighbors of the focal county cannot achieve 1000 observations. Second, we supply the focal county with exactly the difference between its native sample size and 1000, whereas Nolte (2020) donates the entirety of the sample from the neighboring county, regardless of the neighboring county\u2019s sample size. Further, because we restrict the generation of predictions to within each modeled county, our \u201cbase\u201d model  does not produce predictions for all counties in CONUS, unlike Nolte (2020), which estimates land values for all parcels, even if that requires the utilization of a model specified in a distant county. Our county-level modeling approach allows for the specification of 1571 county models. In speaking of the extension in prediction geography our region-scale modeling offers, this approach is the benchmark to which we compare the results of our farm resource region models.We restrict the benchmark modeling approach to each focal county and its immediately adjacent neighbors to better preserve the value of specifying models at the county level: the ability to capture locally specific dynamics. If county modeling did, in fact, perform better than modeling at the regional-scale, then this restricted approach would better evince such performance by not eroding the improvements from locally specific relationships by importing observations from great distances. Further, in counties with no sales observations, model validation is infeasible , hinderiAmong the set of predictors in Nolte (2020)  are variSoil classifications, indicating a map unit\u2019s suitability for agricultural use, were compiled from the Natural Resources Conservation Service (NRCS)\u2019s high-resolution SSURGO soil survey database . The NRCPrime. Optimal site composition and availability for producing agricultural product;Unique. Soil producing high-value crops ;Statewide Importance. State-defined agricultural land that fails to meet prime criteria;Local importance. Locally defined agricultural land that fails to meet prime or statewide criteriaConditional classes. Land that would be considered prime, of statewide importance, or of local importance conditional on a specified improvement We operationalize farmland classifications as the percent of each parcel containing a given classification . Aggregation is applied to overlapping classifications containing multiple conditions. For instance, \u201cPrime if drained or protected from flooding\u201d gets assigned to \u201cPrime if drained\u201d and \u201cPrime if protected from flooding.\u201d For sales records covering multiple parcels, our soil aggregation strategy is described in the To incorporate information on local real estate markets, we add yearly all-transaction house price index values at the county level . At the R code for all of the methods described above is available at https://github.com/binders1/fmv.Altogether, we estimate fair market value in four primary model runs, corresponding to different combinations of predictor set (our \u201cFull\u201d set of predictors or the \u201cRestricted\u201d set including only variables from Nolte (2020)) and geographic scale of analysis (county-level or farm resource region-level). To assess our model\u2019s comparability to the results of Nolte (2020), we predict the year-2020 fair market land value of all 31.35 million parcels in our base dataset, including those for which we do not have sales records . The pre2 hexagonal tessellation cells.Our results largely replicate geographic patterns in Nolte (2020)\u2019s CONUS-wide prediction map. Per-hectare values greatly increase in metropolitan areas, with the urban centers of Washington D.C., Boston, and Los Angeles reaching predicted prices of well over $1 million. Because the model predicts land value alone, not including built improvements, we observe a gentler gradient between rural and urban regions than is shown in Nolte (2020)\u2019s Fig 1. This gradient is further smoothed visually by our mapping method, which averages predicted values over 10 kmWhile the geographic pattern and general order of magnitude of our fair market value estimates roughly match the Nolte (2020) results, our added predictors and regional modeling strategy deliver important improvements in accuracy and coverage.Individually and collectively, the additional predictors in our \u201cFull\u201d set offer modest and meaningful improvements to model performance relative to the \u201cRestricted\u201d set. Figs Accounting for changes in related real estate markets plays an especially important role in better predicting fair market value. Altogether, our Full model offers modest but consistent improvements in model performance at the county level. 2 (the added properties make up 818.7 km2). Across these added counties, model performance remains well within the previously observed range, with a median mean squared error of 0.92 and a mean of 1.53.Specifying models at the scale of the farm resource region enhances accuracy and enables FMV predictions for parcels in counties that, even after drawing on observations from neighbors, do not meet the minimum observation threshold for county-level modeling. In MSE = 1.02 versus MSE = 1.07 using the Full predictor set). The benefits of modeling at the FRR scale remain even at higher observation densities. In counties with greater than 1,000 observations, the FRR model with the Full predictor set produces an average mean squared of error of 0.75, compared to 0.77 from the county model.Elsewhere, we see improvements to predictive accuracy. In counties with fewer than 1000 sales observations (before drawing on observations from neighbors), the farm resource region model outperforms the county model  and median home value (farm resource region models), capture broader market dynamics rather than capitalized attribute values. The consistent feature importance exhibited by both real estate predictors suggests that having access to high quality indicators of spatiotemporal variation in local and regional residential real estate markets may greatly improve conservation planners\u2019 ability to estimate the cost of non-residential properties, including the vacant, undeveloped, and agricultural parcels of interest to the present study.Regardless of predictor set, we observe that the farm resource region models improve model performance, relative to county modeling. Enlarging the geographic scale of modeling allows for the incorporation of more data points. The improvement in performance is likely due to the greater number of observations on which the models draw, consistent with sample size-performance relationships observed in county-level modeling in However, having more observations does not guarantee better performance. The predictive benefit of more observations will not always outweigh the predictive cost of pooling parcels across areas that could exhibit fundamentally different relationships among variables. That tension could explain the relatively similar performance of our models across regions of very different sizes . Take foThe broader coverage afforded by our farm resource region modeling allows for conservation planning in areas that would otherwise need to rely on cruder estimates. For instance, across the entire state of Montana, our sample contains only 507 observations, all of which are discarded under the county-level modeling paradigm. Farm resource region models allow for such observations to be grouped and modeled alongside observations in either the Basin and Range or Northern Great Plains which bear a resemblance to those otherwise discarded Montana observations. In the absence of the farm resource region approach, policy analysts and conservation planners would be forced to use lower-resolution estimates, which have been shown to lead to substantial mischaracterization of cost-effective conservation strategies (Nolte 2020). The expansion of model predictions into rural areas afforded by the farm resource region models , approaching the general problem of land value estimation, established a methodology and database that greatly improves value estimates of undeveloped land, employing parcel-level sales data and a large set of predictors. As developers and agricultural producers look to undeveloped or partially agricultural land for conversion to lucrative but environmentally damaging use, conservation planners require a thorough and reliable picture of property valuation in order to cost-effectively build conservation agendas.In this paper, we improve the accuracy and coverage of previous estimation models for undeveloped land value, leveraging an added set of economically-relevant, high resolution climatic and ecological predictors, as well as incorporating time series data on county-specific residential housing markets. Modeling at larger scales that correspond to regional agricultural markets expands spatial coverage and accuracy, offering a new standard for applications and further improvements.We test our modeling approach using one such exemplary application: the ambitious target of protecting 30 percent of US lands by 2030. Using the improved modeling methods introduced here, we find that an implementing agency could save approximately $15 million annually\u2013around 4 percent of the Agricultural Conservation Easement Program\u2019s annual budget\u2013from more cost-effective targeting of land purchases.S1 FigClimatic variables grouped for clarity. Features added by this paper denoted in bold. Each dot represents a single county.(TIF)Click here for additional data file.S2 FigClimatic variables grouped for clarity. Features added by this paper denoted in bold.(TIF)Click here for additional data file.S3 FigPrediction accuracy varies little across farm resource regions and shows no apparent correlation with the number of observations in a region.(TIF)Click here for additional data file.S1 Appendix(DOCX)Click here for additional data file.S2 Appendix(DOCX)Click here for additional data file."
\ No newline at end of file