diff --git "a/deduped/dedup_0716.jsonl" "b/deduped/dedup_0716.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0716.jsonl"
@@ -0,0 +1,76 @@
+{"text": "The concept of reentry within the sinus node is by no means new. In their 1943 report, Barker and co-workers postulated that \u201c\u2026a circus rhythm could be accommodated in auricular muscle and in one of the specialized nodes at known rates of conduction and with cycle lengths such as occur in paroxysmal tachycardia\u201d . In a suSymptoms of SART vary widely. Patients may present with paroxysmal palpitations, dyspnoea, dizziness, (near-) syncope, chest discomfort and other symptoms . Given tIn contrast to inappropriate sinus tachycardia and atrial tachycardias, SART rarely responds well to \u03b2-blockers. Digoxin, calcium channel blockers such as verapamil and amiodarone are the drugs of choice . In drugSinoatrial reentry tachycardia is a relatively uncommon arrhythmia in the literature, but may be prone to underdiagnosis due to electrocardiographic similarity to sinus tachycardia and misinterpretation of symptoms as psychosomatic. Awareness of the diagnosis, and hence differentiation of SART from inappropriate sinus tachycardia, atrial tachycardia or non-cardiac diagnoses paves the way for adequate therapy. While medication  may be successful or even desirable under certain conditions, radiofrequency catheter ablation offers curative therapy in most cases with few adverse effects."}
+{"text": "We report a 26-year-old woman with frequent episodes of palpitation and dizziness. Resting electrocardiography showed no evidence of ventricular preexcitation. During electrophysiologic study, a concealed right posteroseptal accessory pathway was detected and orthodromic atrioventricular reentrant tachycardia incorporating this pathway as a retrograde limb was reproducibly induced. After successful ablation of right posteroseptal accessory pathway, another tachycardia was induced using a concealed right posterolateral accessory pathway in tachycardia circuit. After loss of retrograde conduction of second accessory pathway with radiofrequency ablation, dual atrioventricular nodal physiology was detected and typical atrioventricular nodal reentrant tachycardia was repeatedly induced. Slow pathway ablation was done successfully. Finally sustained self-terminating atrial tachycardia was induced under isoproterenol infusion but no attempt was made for ablation. During 8-month follow-up, no recurrence of symptoms attributable to tachycardia was observed. Several reports demonstrated the existence of double tachycardia such as atrioventricular reentrant tachycardia (AVRT) and atrioventricular nodal reentrant tachycardia (AVNRT) -3, or AVA 26-year-old woman, with no evidence of structural heart disease, was referred to our center for evaluation of palpitation and dizziness. Despite frequent occurrence of palpitation, she had no chance to capture any 12-lead electrocardiogram (ECG) during palpitation. The only evidence of arrhythmia in this patient was a sustained SVT with heart rate about 185 beats/min recorded in one of her 24-hour holter monitoring. Two antiarrhythmic agents  were tried in our patient with no success.The baseline standard 12-lead ECG showed no any abnormality. The physical examination and transthoracic echocardiography were unremarkable.After obtaining of written informed consent, electrophysiological study (EPS) was done in post absorptive, and non-sedated state. All antiarrhythmic drugs were interrupted for at least five half-lives before procedure. Three 6F diagnostic catheters  were inserted via left femoral vein and placed in the high right atrium (HRA), His bundle position, and right ventricular apex (RVA), respectively. A 7F decapolar catheter with 2/2/2 mm electrode spacing  positioned retrogradely via right femoral vein into the coronary sinus (CS) for coronary sinus mapping. During programmed electrical stimulation (PES) from RVA, nondecremental retrograde conduction was seen with earliest atrial activity on the proximal pole of CS catheter (located at the ostium of CS). No ventricular preexcitation was observed on atrial incremental pacing, compatible with a concealed right posteroseptal (RPS) accessory pathway. During atrial extrastimulation, a sustained narrow complex tachycardia (cycle length=320 ms) was induced reproducibly with earliest retrograde atrial activity in the proximal CS . This taApplication of RF energy at right posteroseptal area resulted in loss of conduction over the accessory pathway (AP) Figure 2ADuring 8-month\u2019s follow-up, she was free of symptoms with no antiarrhythmic drugs and no recurrence of tachycardia was seen.The combination of AVNRT-AVRT -3 (incluAs atrioventricular (AV) bypass tract is a congenital abnormality due to developmental defect in the AV rings, it is not surprising that multiple bypass tracts can be present in the same patient. Incidence of multiple bypass tracts ranges from 3.1-30% -8, and tDual AV nodal physiology is known to occur in 8-40% of patients with AP, leading to a variety of possible reentrant circuits ,11. In tIn the study of 176 consecutive patients who underwent SP ablation for AVNRT, Sticherling et al . demonstBecause of easy and reproducible induction of AVNRT after successful ablation of bypass tracts and absence of clinically documented tachycardia compatible with one of the specific types of SVT, we decided to ablate SP in this patient. Because the majority of patients with inducible AT without clinically sustained AT do not experience symptomatic atrial tachycardia during follow-up , ablatioOur report demonstrated: 1) complexity of symptom origin in the patients with recurrent palpitations, 2) the importance of detailed electrophysiological assessment in the patients with AP before and after ablation, and 3) feasibility and efficacy of radiofrequency catheter ablation of multiple SVTs in single session."}
+{"text": "Incisional atrial tachycardias have been described most frequently in patients with previous corrective surgery for congenital heart defects and mitral valve disease. Less information is available on atrial tachycardias appearing late after isolated aortic valve surgery. We report the case of a patient who developed a left figure-8 tachycardia after undergoing aortic valve replacement. During electrophysiologic study the entire cycle length of the tachycardia was mapped within a low voltage area confined to the left anterior atrial wall. However, during ablation a transmural lesion could not be attained. The mapping and ablation strategy along with the mechanism of the tachycardia are discussed. A 57-year-old man with dilated cardiomyopathy and chronic heart failure, who had undergone aortic valve replacement 26 years ago, was referred to our department for a third attempt at radiofrequency (RF) catheter ablation of an atrial tachycardia. According to reports, during the previous two electrophysiologic (EP) studies both a typical atrial flutter and a left atrial reentrant tachycardia (cycle length 190 ms) could be induced with burst pacing. Nevertheless, RF catheter ablation had failed in both cases, either because it was not possible to attain bidirectional block across the cavotricuspid isthmus (despite a large number of RF applications), or due to transformation of left reentrant tachycardia into atrial fibrillation during entrainment mapping and the impossibility of reinducing the same tachycardia after DC cardioversion. The patient continued to have frequent, prolonged episodes of palpitations despite several antiarrhythmic drug trials. Twelve-lead ECG documented an atrial tachycardia with a p-p interval of 240-280 ms and a variable degree of AV block as well as atrial fibrillation. The patient underwent several successful DC cardioversions for both arrhythmias. Transthoracic echocardiography revealed left atrial and ventricular enlargement, left ventricular systolic and diastolic dysfunction, and mild mitral and moderate tricuspid regurgitation.At the time of the third EP study, a decapolar catheter was placed in the coronary sinus (CS) and a bipolar catheter was positioned in the right ventricle. An 8-French deflectable quadripolar irrigated-tip catheter  was used for mapping and ablation. Mapping was performed using the Carto system . RF current was delivered through a Cordis Stockert generator between the 4-mm tip of the catheter and an adhesive patch on the posterior chest wall. Ablation was performed in temperature-controlled mode with a target temperature of 50\u00b0C and a power limit of 50 W. Saline was infused at a rate of 3 ml/min between ablations and 30 ml/min during RF current delivery. After obtaining a right atrial activation map with an electroanatomical reconstruction of the right atrium during proximal CS pacing, a regular tachycardia, with ECG morphology similar to the clinically documented tachycardia, was induced with burst pacing . The CS Sequential mapping of the right atrium during tachycardia revealed a nonreentrant activation pattern with an early septal area. Mapping of the left atrium was performed through transeptal catheterization. Two discrete scars (areas with bipolar voltage \u22640.05 mV) (1-3) along with adjacent points displaying fragmented or double potentials were located on the left anterior wall. They were confined to a larger region of low voltage (\u22640.5 mV). The entire cycle length of the tachycardia was recorded within this region and the activation map was consistent with a figure-8 circuit. We hypothesized that activation propagated craniocaudally, through a common channel bordered by two lines of double potentials in its upper portion . In its Ablation targeted the common isthmus (isolated RF applications) and both the common channel and the medial turnaround of the circuit . Both attempts failed due to poor catheter stability. With the aim of continuing the ablation procedure under coronary sinus pacing, we attempted to interrupt the tachycardia by overdrive pacing, but this maneuver led to transformation into a second tachycardia with a CL of 190 ms (not shown in this paper). This tachycardia was DC-converted to sinus rhythm and the procedure continued afterwards under CS pacing. Nevertheless, the same technical difficulties further precluded the successful ablation of the circuit. Remapping the ablation points confirmed persistence of electrograms with the same configuration and the procedure was interrupted (long procedure time).Tachycardias with figure-8 activation pattern have been described both in the right and left atrium, most frequently in patients who have undergone surgery for congenital heart defects and valve disease -7. As wiIt is conceivable that a figure-8 activation pattern may be encountered in both reentrant and focal tachycardias . The latWe have found in the literature 5 patients with atrial tachycardias and a remote history of isolated aortic valve replacement  ,5-7. AllIn this report we describe a figure-8 tachycardia originating in the left anterior atrial wall in another patient with previous aortic valve replacement. The full cycle length of the tachycardia was mapped inside a low voltage zone containing electrically silent areas and multiple sites exhibiting  double- or fragmented potentials. This fact suggests a severely affected anatomical substrate. In order to avoid terminating or transforming the tachycardia, as reported during the previous two EP studies in this patient, we did not perform entrainment. Ablation targeted what was regarded as the common and medial channels  and, presumably, in order to avoid other secondary circuits, it should have been continued in the lateral channel as well. Tachycardia interruption along with its noninducibility after severance of these channels would have supported our hypothesis concerning the electrophysiological mechanism and the configuration of the circuit. However the instability and difficult maneuverability of the catheter, probably explained by the anatomical position of the targeted area, precluded a transmural ablation. Additional factors contributing to this outcome might be the structural changes of the anatomical substrate and the fact that we targeted first the common and medial channels. Shah et al. . noted tThis report confirms that patients with previous aortic valve replacement may have areas with abnormal electrophysiology in the left atrium that favor complex atrial tachycardias.  Participation of the left anterior atrial wall in such tachycardias  may be related to mechanical trauma during surgery (due to the proximity of this region to aortic root) as well as to intra- and postoperative atrial ischemia. In cases of figure-8 activation patterns, confirmation of the tachycardia mechanism and geometry of the circuit requires detailed activation mapping combined with entrainment and/or a successful ablation strategy ."}
+{"text": "Observation of Coincident arrhythmias is not uncommon but the co-existence of idiopathic verapamil sensitive left ventricular tachycardia (ILVT) with other arrhythmias is very rare. We hereby presented a 30 year old male patient with a history of frequent episodes of palpitations and sustained narrow complex tachycardia. During electrophysiologic study two arrhythmias, one with narrow complexes which was shown to be typical atrioventricular nodal re-entrant tachycardia and the other with wide QRS complexes and right bundle branch block and left axis morphology, compatible with ILVT, were inducible. Radiofrequency catheter ablation of both arrhythmias was done at two consecutive sessions. The patient has remained asymptomatic without antiarrhythmic therapy for the past six months. Idiopathic sustained ventricular tachycardia (VT) accounts for 10-20% of patients with sustained monomorphic VT , but coeWe hereby presented a 30 year old male patient with three years history of frequent episodes of palpitation. He had no structural heart disease. His previous medical records revealed several ECGs during arrhythmia all showing regular narrow complex tachycardia with a rate of 180beat/min. There was no documented wide complex tachycardia. During initial EP study a narrow complex tachycardia was reproducibly induced  which waearliest PP recording site  were introduced via left femoral vein and positioned at RV apex (and right ventricular outflow tract), His bundle and high right atrium. A 7F steerable decapolar catheter (2-5-2 mm) was introduced via left femoral artery  and positioned in LV on interventricular septum for recording intracardiac signals during sinus rhythm and tachycardia. This catheter was used as a guide for localization of earliest purkinje potential (PP) recording site by ablation catheter. A 7F ablation catheter  was introduced via right femoral artery and positioned in LV on septum for mapping and subsequent RF ablation. The ILVT was terminated by mechanical pressure at ing site . RF enerThis case describes the coincidence of AVNRT and ILVT. Occurrence of AVNRT in combination with idiopathic VT has been previously described. In patients with RVOT tachycardia the incidence of AVNRT has been reported to be as high as 15% . Our finearliest PP during tachycardia should be targeted.Wagshal AB, et al.  also repThis case represents the co-incidence of ILVT and AVNRT and underscores the importance of searching for dual AV node physiology and AVNRT in patients with ILVT."}
+{"text": "A 25 year old man underwent electrophysiology study for recurrent symptomatic paroxysmal palpitations. There were no documented episodes of supraventricular tachycardia on surface ECG.  Delta waves were absent on baseline ECG.A decapolar catheter was placed in the coronary sinus with the distal and proximal pair of electrodes configured as CS 1-2 and CS 9-10 respectively. Quadripolar catheters were positioned in the high right atrium, His-bundle region and right ventricular apex. During straight atrial pacing with a drive-cycle length of 340ms, the following arrhythmia was induced . The corThe surface ECG revealed a narrow complex supraventricular tachycardia with alternating R-R intervals at 310ms and 360ms . The int On close inspection of the intracardiac electrogram, two different alternating A-H intervals were observed, which presented as alternating R-R intervals on the surface ECG.The A-H intervals were 110ms and 160ms consecutively. We deduced that the antegrade limb of this macro-reentrant circuit involved both the fast and slow AV nodal pathways alternating with each other.Radiofrequency ablation of the left lateral pathway via a retrograde aortic approach was performed. The tachycardia was successfully terminated. Further electrophysiology studies confirmed the presence of dual AV nodal pathways. There were no further inducible arrhythmias even with isoproterenol infusion. The slow pathway was thus not ablated.The mechanism for this supraventricular tachycardia with alternating R-R intervals involved two alternating antegrade limbs  with different conduction times and a common retrograde concealed left sided accessory pathway. This electrophysiological mechanism had been postulated previously based on appearance of the surface ECG without intracardiac recordings ."}
+{"text": "Idiopathic fascicular ventricular tachycardia is an important cardiac arrhythmia with specific electrocardiographic features and therapeutic options. It is characterized by relatively narrow QRS complex and right bundle branch block pattern. The QRS axis depends on which fascicle is involved in the re-entry. Left axis deviation is noted with left posterior fascicular tachycardia and right axis deviation with left anterior fascicular tachycardia. A left septal fascicular tachycardia with normal axis has also been described. Fascicular tachycardia is usually seen in individuals without structural heart disease. Response to verapamil is an important feature of fascicular tachycardia.  Rare instances of termination with intravenous adenosine have also been noted. A presystolic or diastolic potential preceding the QRS, presumed to originate from the Purkinje fibers can be recorded during sinus rhythm and ventricular tachycardia in many patients with fascicular tachycardia. This potential  has been used as a guide to catheter ablation. Prompt recognition of fascicular tachycardia especially in the emergency department is very important. It is one of the eminently ablatable ventricular tachycardias. Primary ablation has been reported to have a higher success, lesser procedure time and fluoroscopy time. In general ventricular tachycardias have wide QRS complexes.  One of the earliest descriptions of ventricular tachycardia (VT) with a narrow QRS complex was by Cohen et al in 1972  This obsZipes et al postulated that the origin of the tachycardia was localized to a small region of reentry or triggered automaticity located in the posteroinferior left ventricle, close to the posterior fascicle of the left bundle branch.2Response to verapamil suggested a role for the slow inward calcium channel in the genesis of the arrhythmia. Endocardial mapping during tachycardia revealed the earliest activation at the ventricular apex and mid septum . The tacRecently Kuo et al has questioned the involvement of the fascicle of the left bundle branch in ILVT . They stFascicular tachycardia has been classified into three subtypes: (1) left posterior fascicular VT  with a rEndocardial activation mapping during VT identifies the earliest site in the region of the infero-posterior left ventricular septum. This finding, along with VT morphology and short retrograde VH interval suggests a left posterior fascicular origin. Nakagawa and colleagues  recordedSome date suggest that the tachycardia may originate from a false tendon or fibro- muscular band that extends from the posteroinferior left ventricle to the basal septum . HistoloFascicular tachycardia can be induced by programmed atrial or ventricular stimulation in most cases. Isoprenaline infusion may be required in certain cases; rarely there may be difficulty in induction despite isoprenaline infusion. Endocardial mapping identifies the earliest activation in the posteroapical left ventricular septum in patients with posterior fascicular tachycardia.A high frequency potential with short duration, preceding the QRS has been described as the Purkinje potential . This haIntravenous verapamil is effective in terminating the tachycardia. However the efficacy of oral verapamil in preventing tachycardia relapse is variable. Good response and resolution of tachycardiomyopathy with verapamil treatment was noted by Toivonen et al , while CThe young age of most patients with need for long-term antiarrhythmic treatment and attendant side effects prompted the search for curative therapies. Fontaine et al (1987) described successful treatment of ILVT by application of a high-energy DC shock (fulguration) between the catheter tip and a neutral plate placed under the patient's back . Klein eDifferent approaches for radiofrequency ablation have been described by various authors. Nakagawa et al preferred careful localization of the Purkinje potential in guiding ablation. They selected the area where a Purkinje potential precedes the QRS complex during tachycardia . WellensSince fascicular VT is sometimes difficult to induce despite pharmacological provocation, some workers  prefer primary ablation. In a recent report, seven cases of incessant fascicular VT were successfully ablated with no recurrence . They re"}
+{"text": "Double tachycardia is a relatively rare condition. We describe a 21 year old woman with history of frequent palpitations. In one of these episodes, she had wide complex tachycardia with right bundle branch and inferior axis morphology. A typical atrioventricular nodal tachycardia was induced during electrophysiologic study, aimed at induction of clinically documented tachycardia. Initially no ventricular tachycardia was inducible. After successful ablation of slow pathway, a wide complex tachycardia was induced by programmed stimulation from right ventricular outflow tract. Mapping localized the focus of tachycardia in left ventricular outflow tract and successfully ablated via retrograde aortic approach. During 7 month's follow-up, she has been symptom free with no recurrence. This work describes successful ablation of rare combination of typical atrioventricular nodal tachycardia and left ventricular outflow tract tachycardia in the same patient during one session. Double tachycardia, defined as the simultaneous occurrence of atrial and ventricular ,2 or junA 21 year old woman with no evidence of structural heart disease referred to our center for evaluation of palpitation and dizziness. The structural heart disease was excluded by physical examination and transthoracic echocardiography. Transthoracic echocardiography showed normal cardiac chambers (including right ventricle), normal valvular function and ejection fraction (EF) without any wall motion abnormalities. During an episode of palpitation, the standard 12-lead electrocardiogram (ECG) showed documented wide complex tachycardia with a heart rate of 125 beats /min. The tachycardia was refractory to two intravenous antiarrhythmics . The wide complex tachycardia had inferior axis and right bundle branch block morphology compatible with LVOT-tachycardia . The basAfter obtaining written informed consent, electrophysiologic study was done in the postabsorptive and nonsedated state. During programmed electrical stimulation from atrium and ventricle, dual AV nodal physiology with nonsustained AVNRT was induced. Then programmed ventricular stimulation was performed with standard protocol at three cycle length  and three extrastimuli up to coupling interval of 200 ms from two sites . No ventricular tachycardia was induced with and without isoproterenol infusion. Repeat programmed atrial stimulation resulted in induction of sustained AVNRT under isoproterenol infusion . RadiofrDouble tachycardia was a relatively uncommon type of tachycardia in previous reports ,3,5. In Idiopathic VT most commonly arises from RV than LV (70% versus 30%) . IdiopatIn this patient, clinically documented arrhythmia was ventricular tachycardia arising from the LVOT area whereas AVNRT was the first tachycardia induced by programmed stimulation in the electrophysiologic laboratory, although this had not been documented clinically. Slow pathway ablation was done because of patient request and report of future recurrence of AVNRT in such patients . Then LVCo existence of AVNRT and LVOT-tachycardia may be a no more than chance association. This suggestion appears to be supported by presence of different mechanisms for both each type of tachycardia. On the other hand, some debate was made for this hypothesis in Kautzner study explaining this combination by presence of common trigger in patients with combination of AVNRT and RVOT-tachycardia .Our case demonstrated: 1) Presence of rare coexistence of AVNRT and LVOT-tachycardia 2) Feasibility of successful ablation of combination of AVNRT and LVOT-tachycardia in the same patient during one session."}
+{"text": "A 21-year old man with history of 8 year palpitation was referred for electrophysiologic study and possible radiofrequency ablation. Physical examination and transthoracic echocardiographic study did not disclose any abnormality. Baseline ECG showed normal sinus rhythm with normal PR and QRS intervals and no evidence of preexcitation. Antiarrhythmic drugs (propranolol and verapamil) were discontinued two days before the procedure. Baseline intervals in sinus rhythm were as follows: sinus cycle length=690 msec, AH=74 msec, HV=37 msec, QRS=90 msec, PR=133 msec. The minimal pacing cycle length maintaining 1:1 antegrade conduction (AVWP) was 320 msec and the minimal pacing cycle length maintaining 1:1 retrograde conduction (VAWP) was 400 msec. Single extrastimulus testing in the right atrium and the right ventricular apex leaded to a sustained narrow complex tachycardia. The arrhythmia was a short PR- long RP tachycardia with following characteristics: cycle length=376 msec, AH=141 msec, HV=42 msec, VA=200 msec, HA (HRA) =236 msec, HA (His) =243 msec and eccentric atrial activation during the arrhythmia . The arrA ventricular extrastimulus delivered at RV septum in the inflow region synchronous with His activation during the arrhythmia neither advanced nor delayed the subsequent atrial activation. Earlier ventricular premature beat at the RV septum terminated the arrhythmia (the His was not refractory) without conduction to the atrium. Right ventricular apical pacing at a cycle length just shorter than the tachycardia cycle length showed the same retrograde atrial activation sequence as during the arrhythmia.Subsequently, the right atrioventricular annulus was mapped in the tachycardia and the shortest VA interval was noted at the posterolateral of tricuspid annulus. The radiofrequency current was delivered to this site at the ventricular aspect of tricuspid annulus and resulted in termination of the arrhythmia within 5 seconds. The successful ablation site had a VA interval of 109 msec .Following this ablation, programmed atrial and ventricular stimulation failed to induce any arrhythmia and retrograde atrial activity sequence during burst ventricular pacing was concentric. Comparing retrograde atrial activity sequence before ablation with retrograde atrial activity sequence after ablation in the same pacing cycle length showed a significant decrease in VA interval after ablation of the accessory pathway . What isThe differential diagnosis of a short PR- long RP tachycardia should include atypical AVNRT, orthdromic AVRT involving a slowly conducting retrograde accessory pathway and atrial tachycardia.There are a variety of pacing maneuvers which can be useful in differentiating these arrhythmias. One of the most important methods of diagnosing the presence and participation of retrogradely conducting bypass tracts during SVT is the ability of a ventricular extrastimulus to depolarize the atrium, with the same atrial activation sequence as supraventricular tachycardia when the His bundle is refractory. The site of stimulation relative to the site of the bypass tract and the rate of the tachycardia are the main determinants of the ability to preexcite the atrium.  Because the slowly conducting bypass tracts have decremental conduction property, the response to premature ventricular stimuli results in slowing of VA conduction which can retard the return cycle .Burst pacing from the right ventricle at a cycle length just shorter than the tachycardia cycle length is another maneuver. If ventricular pacing produces the same retrograde activation sequence, a bypass tract can be diagnosed.  Also, measuring the delta H- A interval  can distinguish tachycardia that is due to AVNRT from septal bypass tract .Based on the electrophysiologic findings, the patient had a slowly conducting right posterolateral accessory pathway and the arrhythmia was an orthdromic AVRT. The concealed accessory pathway that conducts in retrograde fashion with a decremental property usually is located in posterior region near the posterior interatrial septum. In our case, the accessory pathway was located at posterolateral region of tricuspid annulus. Ticho et al reported four patients with the permanent form of junctional tachycardia in whom slowly conducting retrograde accessory pathways were located in sites other than the posteroseptal area. It was in the right free wall in two patients, in the right anterior septum in one patient and in the left free wall in one patient .In our case, eccentric atrial activation both during the arrhythmia and during ventricular pacing was diagnostic of a concealed bypass tract.The ventricular extrastimulus could not advance or delay the subsequent atrial activation. It might be due to the location or slow conduction property of the accessory pathway.Before ablation of the accessory pathway, retrograde atrial activation sequence had been eccentric and conduction had been via the accessory pathway with slowly conducting property but after that, retrograde atrial activation sequence was concentric with short VA interval. Since the retrograde His signal could not be seen, HA interval during RV pacing could not be determined. According to post-ablation study, VA conduction was decremental and no arrhythmia was inducible so the presence of another accessory pathway is unlikely and it seems that retrograde atrial conduction was via fast pathway. But, what is the reason that retrograde atrial conduction had been predominantly via the accessory pathway before we ablated it?We reviewed the intracardiac electrograms. During the procedure, we had to sedate the patient. Before sedation of the patient, retrograde atrial activation had been concentric with short VA interval but after that, retrograde atrial activation was eccentric. It could be related to the decrease of sympathetic activity and catecholamine release after sedation of the patient. Because sympathetic stimulation could enhance AV node conduction and shorten its effective refractory period, the impulses had been conducted to atrium via fast pathway. Although slowly conducting accessory pathways behave like AV node in many respects, they have quantitatively differing response to autonomic and pharmacologic manipulation. It is similar to different responses of slow and fast pathways to autonomic stimulation in patients with AVNRT. For example, adrenergic stimulation tends to shorten ERP of fast pathway (both antegrade and retrograde) to a greater extent that of the slow pathway .The persistence of conduction via the accessory pathway can be explained with repetitive concealed antegrade penetration of AV node by the impulse reaching the atrium, after being conducted retrogradely via the accessory pathway.In conclusion, post-ablation retrograde atrial activation sequence was concentric and conduction was via AV node (fast pathway) so after ablation of the accessory pathway, VA interval was shortened and it seems that atrial and ventricular electrograms were fused."}
+{"text": "Atrial flutter (AFL) is a common arrhythmia in clinical practice. Several experimental models such as tricuspid regurgitation model, tricuspid ring model, sterile pericarditis model and atrial crush injury model have provided important information about reentrant circuit and can test the effect of antiarrhythmic drugs. Human atrial flutter has typical and atypical forms. Typical atrial flutter rotates around tricuspid annulus and uses the crista terminalis and sometimes sinus venosa as the boundary. The IVC-tricuspid isthmus is a slow conduction zone and the target of radiofrequency ablation. Atypical atrial flutter may arise from the right or left atrium. Right atrial flutter includes upper loop reentry, free wall reentry and figure of eight reentry. Left atrial flutter includes mitral annular atrial flutter, pulmonary vein-related atrial flutter and left septal atrial flutter. Radiofrequency ablation of the isthmus between the boundaries can eliminate these arrhythmias. Atrial flutter (AFL) is a frequent arrhythmia second only to atrial fibrillation in clinical practice. Since Jolly and Ritchie first recorded AFL in 1910, over the next several decades there was surprisingly little progress in understanding its mechanisms . Using aBoyden et al cut the chorda tendineae of the anterior and septal leaflets of the tricuspid valve using a knife and produced some degree of tricuspid insufficiency and volume overload induced enlargement of the right atrium . From thFrame et al made an intercaval incision connected with a second incision in the right atrial free wall to create a Y-shaped lesion . The atrAfter pericardiotomy, the atrial surfaces were then generously dusted with sterile talcum powder, a single layer of gauze is then put on the right and left atrial free walls, and the pericardiotomy is repaired . The atrAtrial crush injury was created with a surgical clamp placed on the right atrial free wall, producing a lesion parallel to and 1.5 cm above the atrioventricular ring, extending from the base of the right atrial appendage 1.5 to 2.5 cm posteriorly toward the intercaval zone and 3 to 4 cm wide . Atrial Human AFL is defined by the undulating P wave in the ECG with saw-tooth appearance. Typical AFL has positive P waves in lead V1, negative P waves in lead V6, and negative P waves in lead II, III, and aVF. Activation mapping using the Halo catheter and 3-D mapping system showed the activation wave front goes downward in the free wall , travels through the cavotricuspid isthmus, spread upward in the septal wall, and crosses the crista terminalis to complete the reentrant circuit. Reverse typical FL has negative P waves in lead V1, positive P wave in lead V6, and positive P waves in lead II, III, and aVF. The action sequence was the reverse of typical AFL.In this laboratory, we have studied the electrophysiologic properties of typical AFL circuit. It was consistent with previous findings that the low right atrial isthmus, defined as a path bounded by the orifice of inferior vena cava, eustachian valve/ridge, coronary sinus ostium, and tricuspid annulus, is a zone of slow conduction during AFL -11. FurtUsing activation and entrainment mapping from closely spaced sites around the tricuspid annulus during typical AFL, Kalman et al confirmed that all sites around the circumference of the tricuspid annulus were a part of the flutter reentrant circuit, since the postpacing interval was equal to the flutter cycle length. Thus, tA flat resetting response was observed in most cases of typical AFL, signifying a fully excitable gap ,23. The Using the noncontact mapping system, we could demonstrate that some patients had a single incomplete line of block in the crista terminalis during typical atrial flutter. This resulted in double loop reentry during typical atrial flutter, one circulating around the tricuspid annulus, and the other rotating around a part of crista terminalis through the conduction gap . RF ablaAtypical AFL may arise from the right or left atrium. There are no consistent ECG characteristics. However, using three criteria  can differentiate left from right AFL .Using a noncontact, 3D mapping technique, we have demonstrated a macroreentrant circuit localized to the upper portion of the right atrium . The wavUsually there is a low voltage zone in the anterior free wall, which may be due to spontaneous scar formation. The activation wave front circulates around this low voltage zone and the electrograms at this zone show double potentials . RF ablaThe type I figure-of-eight reentry (n = 4) demonstrated simultaneous upper and lower loop reentry sharing a common pathway through conduction gap in the crista terminalis . The twoThis macroreentrant circuit rotates around the mitral annulus, either counterclockwise or clockwise . The bouMacroreentrant circuits can rotate around one or more pulmonary veins and a scar in the posterior wall or roof of the left atrium . These cThe macroreentrant circuit rotates around the left septum primum, either counterclockwise or clockwise ,30. The AFL is a reentrant arrhythmia and needs anatomic or functional barriers to maintain its activation. Typical AFL rotates around the tricuspid annulus with the crista terminalis and tricuspid annulus as barriers. Atypical AFL may originate from the right or left atrium without involving the cavotricuspid isthmus. The barriers may be scars, crista terminalis, mitral annulus, pulmonary veins, or septum primum. RF ablation of the isthmus between the boundaries can cure this arrhythmia."}
+{"text": "Supraventricular tachycardias are quite common in clinical practice. Medical treatment of supraventricular tachycardia often involves regular intake of drugs for several years. Problems of drug therapy include poor efficacy and bothersome side effects including proarrhythmia. This has lead to the development of non-pharmacological therapies. Arrhythmia surgery initially demonstrated that many types of supraventricular arrhythmias could be cured. However during the past decade arrhythmia surgery has been largely replaced by catheter ablation. Catheter ablation can be defined as the use of an electrode catheter to destroy small areas of myocardial tissue or conduction system, or both, that are critical to the initiation or maintenance of cardiac arrhythmias. Arrhythmias most likely to be amenable to cure with catheter ablation are those which have a focal origin or involve a narrow, anatomically defined isthmus . This reSupraventricular tachyarrhythmias have been classified into regular and irregular  . Atrial 1. Atrioventricular re-entry tachycardias (AVRT), using the ventricle as part of the circuit; these tachycardias are dependent on the presence of an accessory atrioventricular (AV) pathway.2. Atrioventricular nodal re-entry tachycardia (AVNRT), where the re-entry circuit is within the AV node and the ventricle plays no part in maintaining the arrhythmia.3. Atrial tachycardia, where the re-entry circuit does not involve any part of the AV junction e.g. atrial flutter, ectopic atrial tachycardia.Catheter ablations are performed in cardiac electrophysiology laboratories specially equipped with recorders, programmed stimulators and ablators. Ever since 1989, radiofrequency current has been used for ablation, while earlier attempts were with direct current. The procedure is typically performed using conscious sedation. Two to five multipolar electrode catheters are inserted percutaneously under local anaesthesia into a femoral, brachial, subclavian, or internal jugular veins and positioned in the heart under fluoroscopic guidance. Each electrode catheter has four or more electrodes. The most distal electrode pair is usually used for pacing and the delivery of critically timed extra stimuli, while all of the electrodes are used to record electrograms from localised regions within the heart. Up to 50 W of radiofrequency energy is delivered for 30-60 seconds as a continuous, unmodulated, sinusoidal waveform with a frequency of approximately 500,000 Hz, between the 4 mm tip of a deflectable ablation catheter and a ground plate positioned on the patient's back or chest. The temperature of the ablation electrode can be monitored and the power output automatically adjusted to achieve a targeted electrode temperature of between 60-70\u00b0C. Knowledge of the electrode temperature at a particular ablation site is useful in determining whether an unsuccessful application of radiofrequency energy failed because of inaccurate mapping or inadequate heating [AVRT utilizes accessory pathways which are anomalous extra nodal connections between the epicardial surface of the atrium and ventricle along the atrioventricular groove. Accessory pathways can be classified based on their location along the mitral or tricuspid annulus, type of conduction , and whether they are capable of antegrade conduction, retrograde conduction, or both. Accessory pathways which are capable only of retrograde conduction are concealed while those capable of antegrade conduction are manifest, demonstrating pre-excitation on a standard ECG. AVRT is the most common arrhythmia in patients with a manifest accessory pathway, occurring in 75% of cases.An electrophysiological study is performed to localise the accessory pathway and determine its conduction characteristics prior to ablation. Accurate localisation of an accessory pathway is critical to the success of catheter ablation procedures. Preliminary localisation of the accessory pathway can be determined based on the delta wave and QRS morphology on the surface ECG in patients with manifest pre-excitation. Mapping of concealed accessory pathways and more accurate localisation of manifest accessory pathways require analysis of the retrograde atrial activation sequence and/or antegrade ventricular activation sequence. Right sided and posteroseptal accessory pathways are typically localised and ablated using a steerable electrode catheter with a 4 mm distal electrode positioned along the tricuspid annulus or in the coronary sinus os from the inferior vena cava. The location of left sided accessory pathways can be determined using a multipolar electrode catheter positioned in the coronary sinus, which runs parallel to the left atrioventricular groove or with a steerable catheter positioned in the left atrium or ventricle. Once localised to a region of the heart, precise mapping and ablation is performed using a steerable 4 mm tipped electrode catheter positioned along the mitral annulus using either the transeptal or retrograde aortic approach. These two approaches for ablation of left sided accessory pathways are associated with a similar rate of success and incidence of complications . The decAppropriate sites for radiofrequency energy delivery during ablation of manifest accessory pathways are characterised by early ventricular activation, the presence of an accessory pathway potential, and stability of the local electrogram . ApproprEfficacy of catheter ablation of accessory pathways varies from 89-99% -9. The sAtrioventricular nodal re-entrant tachycardia (AVNRT) occurs in patients with dual AV nodal physiology. They have two functionally distinct pathways known as the slow and fast pathway. The slow pathway has a shorter refractory period. During the common form of AVNRT, an atrial premature beat travels down the slow pathway and gets conducted back by the fast pathway to depolarise the atrium. In the uncommon variety, the reverse pattern occurs. The fast pathway is located anteriorly along the septal portion of the tricuspid annulus, near the compact atrioventricular node, whereas the atrial insertion of the slow pathway is located more posteriorly along the tricuspid annulus, closer to the coronary sinus ostium.AVNRT can be cured by ablating either the fast pathway or the slow pathway. However, it has clearly been shown that catheter ablation of the slow pathway using a \"posterior approach\" is associated with greater safety and efficacy. For this reason, the \"anterior approach\" is merely of historical interest. Fast pathway ablation is by an \"anterior\" approach. Catheter ablation is performed by locating an electrogram with a large His potential and then withdrawing the ablation catheter into the right atrium until the atrial signal is at least twice that of the ventricular signal (A:V ratio > 2) with a His potential no larger than 50 \u03bcV. Radiofrequency energy is then applied during sinus rhythm for 30-60 seconds while watching for prolongation in the PR interval. Energy delivery is immediately terminated if atrioventricular block occurs. Successful ablation of AVNRT is characterised by lengthening of the PR interval and the inability to induce the tachycardia. There is elimination or pronounced attenuation of retrograde conduction during ventricular pacing. The atrioventricular block cycle length and the atrioventricular node effective refractory period are not usually altered during ablation by the anterior approach. Anterior approach is successful in about 90% of cases. Inadvertent atrioventricular block occurs in approximately 7% of patients. Recurrence rate is about 9% .Slow pathway ablation is by the \"posterior\" approach. The ablation catheter is directed into the right ventricle low near the posterior septum and is then withdrawn until an electrogram is recorded with a small atrial electrogram and a large ventricular electrogram (A:V ratio < 0.5). Specific ablation sites along the posterior portion of the tricuspid annulus can be selected based either on the appearance of the local atrial electrogram or based strictly on anatomic factors. While using the electrogram guided approach, fractionated atrial electrograms with a late \"slow potential\" are targeted. In the anatomic approach, the initial applications are delivered at the level of the coronary sinus ostium and subsequent applications at more superior sites. Junctional beats occurring during the application of radiofrequency energy are a marker for successful ablation. Successful ablation is characterised by an increase in the atrioventricular block cycle length and in the atrioventricular node effective refractory period and elimination of inducible AVNRT. The posterior approach for ablation of AVNRT is effective in greater than 95-97% of patients .  AtriovCatheter ablation of sustained regular atrial tachycardias can also be performed with high safety and efficacy. Focal atrial tachycardia, whether reentrant, automatic, or triggered can be ablated with success rates greater than 90%. The site for ablation is generally chosen based on early activation. Typical atrial flutter is also amenable to cure with catheter ablation. This macroreentrant arrhythmias is localized to the right atrium. Atrial flutter can be cured by creating a continuous, transmural, linear lesion between the tricuspid annulus and the inferior vena cava. This procedure is generally referred to as an \"isthmus\" ablation. Catheter ablation of atrial flutter can be performed with an efficacy greater than 90% and a < 5% risk of recurrence of atrial flutter. Non-isthmus dependant atrial flutter can also be treated with catheter ablation. These regular atrial tachycardias, with rates between 250 and 350 bpm often involve scars created during prior cardiac surgery. The procedure can be accomplished by defining a critical region of conduction which is necessary for maintenance of the arrhythmia. The creation of a linear lesion in this region can result in cure of the tachycardia. Catheter ablation of non-isthmus dependant atrial flutter can be accomplished with an efficacy of greater than 80% and a < 5% risk of major complications.Because of the remarkable safety and efficacy of catheter ablation, it is now considered as first line therapy for most types of supraventricular arrhythmias. These include AVNRT, AVRT, atrial tachycardia, and atrial flutter. It is anticipated that the dream of curing atrial fibrillation with ablation techniques will also be realized sometime during the next five years."}
+{"text": "A 15-year-old girl, previously asymptomatic for palpitations, underwent a successful atrial septal defect (ASD) device closure. Twelve weeks after the procedure, the patient was admitted complaining of dyspnoea on effort and palpitations. The twelve-lead ECG showed a narrow QRS tachycardia with slight heart rate irregularity, with a mean HR of 170bpm. P waves were not clearly identified with a suspicious of negative P-waves in II, III and aVF leads. No clear relationship could be observed between the suspected P waves and QRS complexes .Echocardiographic evaluation showed normal position of ASD Device, with no residual shunts, mild dilatation of right atrium and right ventricle with a moderate biventricular systolic function impairment. Transesophageal electrophysiological study showed an atrial tachycardia with a regular A-A interval of 220ms and an A-V conduction delay with a A-V nodal Wenckebach periodicity, leading to an irregular V-V interval ranging between 375 and 300ms . OverdriThe case represents a rare form of intra-atrial re-entry tachycardia with an A-V nodal Wenckebach periodicity. It has been already shown that in intra-atrial re-entry tachycardia, variables degrees of block may be present throughout the entire episode of sustained tachycardia. Neither the ventricles nor the A-V node are required for this arrhythmia. It is the appearance of AV block with maintenance of the supraventricular tachycardia that strongly suggests a supranodal origin. The presence of persistent termination of the arrhythmia through atrial pacing excluded an automatic origin."}
+{"text": "Pacemapping (PM) is an electrophysiologic technique designed to help locating tachycardia sources by stimulating at different endocardial sites in order to reproduce the clinical tachycardia characteristics. A recorded electrocardiogram (ECG) during the clinical tachycardia has been conventionally used as reference. Yet, endocardial activation pattern during tachycardia may be utilized as well to guide the procedure. In focal tachycardia ablation, PM guide has consistently provided remarkable outcomes , while oAn important issue regarding PM is the electrical configuration of the stimulation catheter, bipolar or unipolar. During bipolar pacing, stimulation poles (anode and cathode) are located at the distal tip of the catheter and usually both are contacting the endocardium. Using this configuration, myocardium can be captured at the cathode, anode or both sites simultaneously decreasing mapping accuracy. On the contrary, unipolar pacing captures exclusively local myocardium next to the distal electrode . Thus, uConduction properties of paced stimuli seem to depend on myocardial conditions. Pacing ventricular scar tissue, as in patients with prior myocardial infarction (MI), shows a delay between the electrical stimulus and the QRS onset, suggesting local slow conduction. These impaired conduction zones may represent potential substrates for reentrant circuits involved in ventricular tachycardia (VT).Regarding atrial PM, it is unclear whether the conduction pattern of an atrial stimulus depend on the paced site, electrical voltage or the stimulating rate. This issue was recently addressed by Perez-Castellano el al . Pacing A PM limitation is that pacing at two different points may induce similar surface ECG or endocavitary recordings. An optimal spatial PM resolution requires a short maximum distance between two points generating similar ECG. Usually, the spatial resolution of unipolar stimulation is shorter than 5 mm . SpatialThe highest benefit of PM has been found in focal tachycardia mapping, especially in idiopathic VT. However, PM has been reported in a broad variety of arrhythmias. In the following sections we will review its usefulness and feasibility sorted by type of arrhythmia.Atrial tachycardia (AT) is defined as focal when its source is a precise point at the atria. Focal AT are due to triggered activity, increased automatism or microreentry. The precise origin of a focal AT can be readily determined using PM by pacing at different sites of the atria to emulate the P waveform of the tachycardia  or the aMcLean et al  reportedSippensGroenewegen et al  used a mAnother tool for targeting AT ablation is PM guided by endocavitary recordings. This technique compares the atrial activation sequence during tachycardia, as shown by endocavitary recordings, and the sequence obtained during pacing with a mapping catheter at different atrial sites. Tracy et al reported excellent results using this technique in 10 focal AT ablation procedures [A focal origin has been reported in most patients with paroxysmal atrial fibrillation (AF). These foci are usually located in the pulmonary veins (PV) and its ablation is becoming a curative therapy. Ablation strategies include empirical electric isolation of the four PV or a selective approach ablating only the culprit PV. The latter can be extraordinarily demanding as finding the culprit vein is frequently challenging. Deen et al  reportedActivation patterns at CT and CS differed at every paced PV. In order to measure activation times they considered the CS proximal electrodes (CS 9-10) as a reference, corresponding to time zero. According to their findings they concluded:1.- Pacing of right PVs showed activation of CS was from proximal to distal: reaching CS 9-10 15.8 ms and 24 ms before CS 1-2 in right superior PV (RSPV) and right inferior PV (RIPV), respectively. Pacing of left PVs showed activation of CS from distal to proximal: reaching CS 1-2 23.8 ms and 20.1 ms before CS 9-10 in left superior PV (LSPV) and left inferior PV (LIPV), respectively.2.- Activation of CT was earlier in CT 5-6 and CT 11-12 during pacing of  RSPV and RIPV, respectively. Pacing of left PVs showed earlier activation at CT 3-4 with activation pattern from top to bottom. Total activation time of CT was longer for the LSPV (33.7 ms) than for the LIPV (19.3 ms).An excellent correlation was observed between atrial activation sequence obtained by PM and the location of the focus at the PV under traditional electrophysiological criteria.Conventional strategies for accesory pathway (AcP) mapping face certain limitations, leading to prolonged procedures and the need for multiple RF applications during ablation. Perez-Castellano et al reported a new mapping approach to help localize the atrial insertion of AcP by reproducing the atrial activation sequence during orthodromic tachycardia through atrial pacing at the mapping catheter .This method is based on the relative timing of activation between two stable reference electrograms, used to estimate the atrial activation sequence during tachycardia and during pacing . The autThis method is complementary with traditional mapping criteria  and its In patients with preexcited tachycardia implicating Mahaim fibers underwent attempted catheter ablation of the accessory pathway is possible to locate the accessory pathway ventricular insertion site used the criteria of concordance between paced and spontaneous QRS morphologies during pace mapping . This crThe right ventricular outflow tract (RVOT) tachycardia is the most frequent idiopatic VT, it origin is usually a single and well-limited focus. In the majority of patients this focus is located in RVOT\u2019s anterior septal wall below the pulmonary valve; occasionally, the posterior septal and free walls are involved. These patients do not show overt structural heart disease, thus ventricular excitation and conduction properties are preserved. These conditions, as opposed to scar tissue, facilitate identifying the origin of the VT using PM.Conventionally, ventricular PM is performed in sinus rhythm, pacing at a cycle length similar to the clinical VT, trying to reproduce the QRS morphology during VT . Paced aFar-field capture may interfere with an adequate PM evaluation by distorting the paced QRS morphology. In order to reduce this detrimental effect, unipolar or bipolar with a distance between poles no longer than 5 mm are the recommended pacing configurations . RegardiActivation mapping constitutes an additional tool for idiopathic VT mapping. As an example, in a recently published series of six RVOT tachycardia cases, Timmermans et al using activation mapping located the origin of the tachycardia in the pulmonary artery, followed by successful ablation . PresystSome ECG patterns may suggest the primary location of a VT within the RVOT. The presence of Q waves in DI suggests an anterior septal origin, while R waves in DI suggest a more posterior source. When the R wave transition occurs early in precordial leads suggests an origin in the upper RVOT, a later transition (from V2) points to a lower location, below the pulmonary valve. Digit et al performed PM at the RVOT in healthy individuals in order to define ECG patterns from the different stimulated points to suggest the origin of RVOT tachycardias . The autOther idiopathic VT is the fascicular VT, is usually verapamil-sensible and has been demonstrated to arise from the left posterior or left anterior fascicle, with a right bundle branch block configuration and left-axis deviation or right-axis deviation, respectively. The ablation of a fascicular VT can be guided by activation mapping and/or Purkinje potential preceded the QRS during VT, behind VT exit to be associated with an optimal match between the paced rhythm and the clinical VT . TherefoMyocardial infarction is the leading substrate for monomorphic sustained VT. In hemodinamically tolerated VT, radiofrequency ablation constitutes a major therapeutic option associated or not to implantable cardioverter defibrillators. Percutaneous VT ablation reduces the rate of recurrences, avoids potential toxic effects of antiarrhythmic drugs and it is associated to a lower risk than EP-guided surgical resection procedures. Gonska et al performing a single morphology VT ablation reported an acute success rate close to 75% . AblatioUsefulness of PM in this subset of patients is limited. Scar tissue impairs ventricular conduction properties and favours conduction blockade. Thus, in this context, pacing in sinus rhythm to reproduce an exact VT QRS morphology is usually challenging or unsuccessful.The electrocardiographic VT morphology is determined by the initial activation site (circuit exit), and by the ventricular activation pathway. When PM is performed at or near the exit of a reentrant circuit, the induced QRS morphology may resemble the VT QRS . HoweverAs mentioned before, PM spatial resolution worsens with bipolar stimulation by inducing electrical capture at both electrodes. Kadish and coworkers  demonstrPM also helps to characterize slow conduction zones usually located within scars, manifested as a delay between the stimulus and the QRS onset . In normal hearts the S-QRS interval is shorter than 40 ms, while most of myocardial areas with abnormal fractionated EGM in sinus rhythm show a S-QRS delay longer than 40 ms. Demonstrating the presence of slow conduction zones is not enough to guide an ablation procedure, as they constitute a regular finding in infarcted areas . However"}
+{"text": "Sudden death might complicate the follow-up of symptomatic patients with the Wolff-Parkinson-White syndrome (WPW) and might be the first event in patients with asymptomatic WPW. The risk of sudden death is increased in some clinical situations. Generally, the noninvasive studies are unable to predict the risk of sudden death correctly . The electrophysiological study is the best means to detect the risk of sudden death and to evaluate the nature of  symptoms. Methods used to define the prognosis of WPW are well-defined. At first the maximal rate of conduction through the accessory pathway  is evaluated; programmed atrial stimulation using 1 and 2 extrastimuli delivered at different cycle lengths is then used to determine the accessory pathway refractory period and to induce a supraventricular tachycardia. These methods should be performed in the control state and repeated in adrenergic situations either during exercise test or more simply during a perfusion of small doses of isoproterenol. The induction of an atrial fibrillation with rapid conduction through the accessory pathway  is the sign of a form of WPW at risk of sudden death. At the time of the curative treatment of Wolff-Parkinson-White syndrome (WPW) by radiofrequency ablation ,2, it isThe exact risk of patients with the WPW syndrome to develop this complication is not known. It was relatively high in old studies in symptomatic patients ,4 1.5%)%5-7]. ThThe pattern of WPW syndrome on 12 lead surface ECG, the permanent or intermittent feature are not specific, although posteroseptal location and permanent forms are more frequently noted in patients at risk of rapid arrhythmias ,10. Several non invasive studies were proposed but their diagnostic value is low :- The abrupt disappearance of WPW syndrome during an exercise stress testing was proposed as a sign of accessory pathway with long refractory period -13; howe- Pharmacological tests  were also proposed : the disappearance of the pattern of WPW syndrome was reported as a sign of accessory pathway with long refractory period ; howeverElectrophysiologic study appears to be the most reliable method to establish the prognosis of WPW syndrome Patients might be studied by transesophageal route ,19 or inIt should be noted that all electrophysiologic studies in WPW syndrome might be dangerous and should be performed with an external defibrillator ready to be used, because a ventricular fibrillation can be induced in asymptomatic or symptomatic patients  Figure .Surface electrocardiograms and esophageal electrogram are simultaneously recorded on paper at speeds of 25 or 100 mm/sec. Cardiac stimulation is performed with a programmable stimulator which is connected to a pulse amplifier that can deliver pulses at width of 16 ms with a 29 mA output in the case of esophageal stimulation. For a simple electrophysiological study, only one catheter is needed : a bipolar silicone esophageal lead or one bipolar intracardiac catheter. A multipolar catheter electrode is  used only for the mapping of left atrium in patients who need a catheter ablation of the accessory pathway.The classical protocol is as follows:- Incremental atrial pacing is performed until second degree atrioventricular block occurs. The maximal rate of 1/1 conduction trough the accessory should be noted.- Programmed atrial stimulation at  basic cycle lengths of 600 ms and 400 ms with the introduction of one and two extrastimuli is performed : the disappearance of WPW syndrome indicates the accessory pathway refractory period. The method  is also used to induce a supraventricular tachycardia, generally an orthodromic tachycardia, rarely an antidromic tachycardia or an atrial tachycardia or fibrillation.- These data should be studied under adrenergic situations, except in patients who have a risk of sudden death in control state. Two methods are used : atrial pacing might be repeated during an exercise testing  ,22 which- Sustained atrial fibrillation or reciprocating tachycardia is defined as a tachycardia that is longer than 1 minute. The exact duration of induced tachycardia to be considered as pathological is still controversed and varies from 30 sec up to 5 minutes .- Conduction over the accessory atrioventricular connection is evaluated by the measurement of the shortest atrial cycle length at which there is 1 to 1 conduction over the accessory connection and the shortest atrial tachycardia cycle length at which there is 1 to 1 conduction over the accessory connection.- The Wolff-Parkinson-White syndrome is considered as representing a risk of sudden death when the following association is observed : sustained atrial fibrillation is induced and the shortest RR interval between preexcited beats is < 250 ms in the control state in adults, < 220 ms in children  Figure .- The exact nature of the prexcitation syndrome is assessed. Most of the WPW syndrome are related to a atrioventricular accessory connection or Kent bundle : the degree of prexcitation increases during premature atrial stimulation until the refractory period of accessory pathway is reached, because the conduction time does not change in accessory pathway with the shortening of atrial cycle length while it increases in the AV node. Rarely the WPW syndrome is related to a nodoventricular accessory pathway or Mahaim bundle and the degree of preexcitation remains unchanged during premature atrial stimulation.- The accessory pathway refractory period depends on the driven cycle length. Refractory period of the accessory pathway decreases as the driven cycle length shortens.- Beta adrenergic stimulation results in shortening of the anterograde refractory period of the accessory pathway  and an increase in ventricular rates during atrial pacing and atrial fibrillation . Isoprot- Atrial fibrillation is easily induced during intracardiac studies by salvos of rapid atrial stimulation and is not specific . The ind- Ventricular tachyarrhythmias also are easily induced in asymptomatic or symptomatic patients by programmed ventricular stimulation and are not specific in patients with WPW syndrome : the induction of a ventricular fibrillation is noted in 4 % of WPW syndrome and the induction of nonsustained multiform ventricular tachycardia in 37 % of them .- Antidromic tachycardia which is a reciprocating tachycardia using the accessory pathway for the anterograde conduction and the normal AV conduction system for retrograde conduction, is a rare finding (5%), more frequently noted in young patients with a good retrograde normal VA conduction or in patients with several accessory pathways and seems more frequent in patients at risk of rapid arrhythmias.- Orthodromic tachycardia which is a reciprocating tachycardia using the normal AV conduction system for the anterograde conduction and the accessory pathway for the retrograde conduction, is rarely induced in asymptomatic patients (< 10%) ,34, but - The incidence of forms considered at risk of rapid arrhythmias is similar in patients with symptomatic and asymptomatic patients and concerns 10 % of the total population with WPW syndrome  ,34, indeMoreover, the presence of syncope does not increase the chance to find a potentially dangerous form in adults ; in youn- The indications of electrophysiological study are now large in symptomatic patients to perform in a second time the catheter ablation of patients complaining frequent sustained tachycardias. The study should be performed by catheterisation.- In patients with syncope, but no documented tachycardia, electrophysiological study is necessary and might be performed by transesophageal route because the role of the accessory pathway in the occurrence of syncope remains rare in adults .- In patients who have a documented rapid or syncopal atrial fibrillation, electrophysiological study is not indicated, because direct catheter ablation of the accessory pathway is recommended. The location of the Kent bundle is easier in sinus rhythm and the induction of an atrial fibrillation should be avoided.- In asymptomatic patients, the indications of electrophysiolgical study are more debatable . At firsSome indications of a systematic electrophysiological are actually recommended :1) most of sudden deaths have the peculiarity to occur during exercise . Because2) the second indication is the detection of a WPW syndrome in a patient with high responsibility profession such as professional pilot While these indications are largely in teenagers and adults less than 40 years of age, the indications in children or elderly are more controversial :- in children, the conduction in accessory pathway and normal AV conduction system are more rapid, probably without  a clinical significance : in the study of Bromberg   a cycle - in elderly, the shortest atrial pacing cycle length with 1:1 anterograde conduction via the bypass tract increased progressively with age -44. HoweTherefore, because of the increase of the sport in all ranges of age and particularly in young children or after 60 years, the risk of occurrence of a potentially severe arrhythmia in an asymptomatic WPW patient should be not underestimated. The reliability and the simplicity of transesophageal study in WPW permits easy detection of forms at risk of severe arrhythmia.In conclusion, electrophysiological study is the best means to define the prognosis of a patient with the WPW syndrome. The study is easily performed by the transesophageal route. The indications should be large to avoid the misdiagnosis of a form at risk of rapid arrhythmias. This dangerous form is relatively rare in  asymptomatic patients or symptomatic patients with unexplained syncope. Most of these patients (>85%) would be allowed to continue their activities, without specific treatment, because they have a benign form of Wolff-Parkinson-White syndrome. In remaining patients, the development of the curative treatment of this disease by radiofrequency application on the accessory pathway  permits"}
+{"text": "Incisional sustained tachycardias are frequent in patients who have undergone a surgical repair of interatrial defect. A 43-year-old woman with drug refractory, highly symptomatic, persistent atrial tachycardia in the last year, was referred to our unit for catheter ablation. The patient had undergone a cardiac operation for repairing interatrial secundum ostium type defect with a patch five years before. A previous radiofrequency ablation procedure had been performed for common atrial flutter. We describe a case of incisional  atrial tachycardia ablation guided by the new EnSite NavX system equipped with a new electroanatomic mapping system. Incisional sustained tachycardias are frequent in patients who have undergone surgical repair of  an interatrial defects ,2. The mA 43-year-old woman with drug refractory, highly symptomatic, persistent atrial tachycardia in the last year, was referred to our unit for catheter ablation. Five years ago the patient was undergone  a cardiac operation for repairing an interatrial secundum ostium type defect. ECG showed an atrial tachycardia whose features resembled a common atrial flutter. Echocardiography images showed no  significant atrial dilation, no residual interatrial shunt and a normal ventricular systolic function.A quadripolar Josephson diagnostic catheter was inserted into the coronary sinus via left subclavian vein as a reference. A bipolar Cournard diagnostic catheter was inserted into the right ventricular apex. A  20-pole steerable catheter was placed around the tricuspid annulus. An 8 mm tip catheter (Boston Scientific EP Technologies) was used for mapping and ablation. The electrophysiological findings showed a stable atrial tachycardia of 230 ms cycle length which was firstly misunderstood as a common atrial flutter (counter clockwise) showing a caudocranial septal activation and craniocaudal activation along the right lateral atrial wall. The ablation catheter was therefore positioned on the cavo-tricuspid (CT) isthmus, considering this region crucial for the macroreentry circuit. But overdrive pacing at 210 ms cycle length from CT isthmus did not show any concealed entrainment. So we were inclined to believe that it was an incisional tachycardia and therefore we performed a reconstruction of the three-dimensional geometry of the right atrium  using the EnSite NavX system.An activation-voltage map was obtained moving the ablation catheter point by point inside the right atrium while the patient was still in stable atrial tachycardia. The voltage map showed a large no-signal area  on interatrial septum corresponding to a large patch used for repairing an interatrial defect . A largeRF application  in continuous way (70 Watts 55 \u00b0C) was then attempted along this isthmus drawing back the ablation catheter from the scar area to the tricuspid valve annulus, trying to connect the two areas of anatomic obstacles. We moved the ablation catheter along this line obtaining local electrogram disappearance or  voltage reduction more than 70%. EnSite NavX mapping system allowed us to move ablation catheter in  the right atrium without using fluoroscopy  during the procedure.After four RF applications along the isthmus between the patch on the atrial septum and the tricuspid valve annulus, atrial tachycardia was not yet interrupted though no significant local electrogram was still detectable along the ablation line we had performed. In order to verify ablation line continuity we performed an electroanatomic and activation remapping of the isthmus region which showed a gap on the ablation line  near theThe patient was followed up monthly after the procedure. Each month history, 12-lead ECG and 24 hour ECG Holter were analyzed. Ten months after the procedure though the patient had not taken any anti-arrhythmic drugs, there was no recurrence of palpitation or documented atrial tachycardia.The case shows that EnSite NavX system provides an excellent electroanatomic and activation map of any cardiac chamber and reliable monitoring of the ablation catheter. This system let us quickly made a diagnosis of incisional tachycardia with an anatomic circuit of macroreentry different from that of a common atrial flutter allowing us to identify a slow conduction isthmus in a place that was not the CT isthmus, though the electrocardiography feature of the atrial tachycardia was similar to a common atrial flutter. The Ensite NavX system rapidly identified a gap in the linear lesion we had performed, and allowed us to terminate the atrial tachycardia. NavX significantly reduces fluoroscopy time during ablation procedures and also allows to successfully perform difficult procedures with complex substrates. NavX supports detection of anatomic isthmus variations, particularly deep pouches or recesses ,14."}
+{"text": "Arrhythmogenic right ventricular dysplasia/cardiomyopathy is a disorder characterized by frequent ventricular tachycardia originating from the right ventricle and fibro-fatty replacement of right ventricular myocardium. Though the disorder was originally described during surgical ablation of refractory ventricular tachycardia, catheter ablation of tachycardia is one of the options for patients not responding to anti arrhythmic agents. Direct current fulguration was used in the initial phase followed by radiofrequency catheter ablation. In the present day scenario, all patients with risk for sudden cardiac death should receive an implantable cardioverter defibrillator. Radiofrequency catheter ablation remarkably reduces the frequency of defibrillator therapies. Direct current fulguration can still be considered in cases when radiofrequency ablation fails, though it requires higher expertise, general anesthesia and carries a higher morbidity. Newer mapping techniques have helped in identification of the site of ablation. In general, the success rate of ablation in arrhythmogenic right ventricular dysplasia is less than in other forms of right ventricular tachycardias like right ventricular outflow tract tachycardia. Arrhythmogenic right ventricular dysplasia/cardiomyopathy (ARVD) is a disorder characterized by fibro-fatty replacement of the right ventricular myocardium, frequent ventricular tachycardia originating from the right ventricle and right heart failure. It was originally described by Fontaine et al during surgical ablation of refractory ventricular tachycardia . The firThough historically the original description of ARVD was during surgical ablation, pharmacological therapy was the initial mode of treatment in most cases. Surgical ablation by right ventricular disconnection was resorted to in resistant cases . PeroperThe initial reports on catheter ablation in ARVD were using direct current fulguration -8. One oRadiofrequency catheter ablation for ARVD has been in use since early nineties . It has Entrainment mapping can be used to characterize reentry circuits in ARVD to guide ablation -15. The Endocardial mapping can detect abnormal fragmented electrograms with delayed potentials. Pacemapping confirms the ablation site by producing a QRS morphology identical to the clinical VT . RecentlThree dimensional Real-time Positioning Management System (RPM) has also been used for guiding ablation in ARVD . RPM useO'Donnell et al have highlighted the electrophysiological differences between patients with ARVD and right ventricular outflow tract tachycardia (RVOT VT) . Though Ablation of ventricular tachycardias in ARVD still remains a clinical challenge, though more and more cases are being reported in the literature -23."}
+{"text": "Wide complex tachycardia (WCT) refers to a cardiac rhythm of more than 100 beats per minute with a QRS duration of 120 ms or more on the surface electrocardiogram (ECG). It often presents a diagnostic dilemma for the physician particularly in determining its site of origin, which can be ventricular or supraventricular. In one series, only 32% of clinicians correctly diagnosed ventricular tachycardia (VT) in patients who presented with WCT [WCT that is grossly irregular typically represents atrial fibrillation with aberrant conduction or preexcitation. If its rate exceeds 200 beats per minute, the likelihood of atrial fibrillation with conduction over an accessory pathway should be entertained. In this article, we will discuss the approach to the evaluation and management of regular WCT.The differential diagnosis of regular wide complex tachycardia includes three major categories: ventricular tachycardia (VT), supraventricular tachycardia (SVT) with aberrance and preexcited tachycardia.Ventricular tachycardia is the most common etiology accounting for about 80 % of WCT -4. VentrSVT with aberrance accounts for a small portion of WCT. SVT typically originates in atrial tissue and/or AV junction and utilizes the normal atrioventricular (AV) conduction system for ventricular activation. Aberrance occurs when there is delay or block in the His-Purkinje system during antegrade conduction of impulses over the normal AV fascicles. Essentially, all types of SVT with aberrant conduction can present as a WCT. These include atrial tachycardias, atrioventricular nodal reentrant tachycardias, orthodromic reciprocating tachycardias, and other rare forms of SVT.Preexcited tachycardias are conducted antegradely over an accessory pathway (AP). Evidence for the presence of an AP can be manifest of the surface electrocardiogram (ECG) which can show intermittent or continuous presence of a delta wave associated with a short PR interval. The delta wave represents the part of the ventricular myocardium that is depolarized through the AP.An increasingly recognized cause of WCT is electrographic artifact . The cliVentricular paced rhythms represent a small portion of WCT. Sometimes the bipolar ventricular spike is small and difficult to see. The WCT is typically of LBBB pattern and superior leftward axis with right ventricular apical pacing. This pattern can vary significantly with the site of pacing. The tachycardia can be due to any form of SVT where the pacemaker is tracking sensed atrial activity and is pacing the ventricles at a fast rate. It can also represent a pacemaker-mediated tachycardia where the pacemaker is tracking retrogradely conducted atrial activity during ventricular pacing. A history and physical examination revealing the presence of a cardiac implantable device provide important clues to this diagnosis.A history of structural heart disease, particularly of coronary artery disease or prior myocardial infarction, strongly suggests a diagnosis of VT in patients presenting with WCT ,9. The oAlthough the blood pressure and heart rate are not particularly useful in differentiating WCT of ventricular versus supraventricular origin, certain physical signs such as the demonstration of AV dissociation strongly suggest a diagnosis of VT. These signs include the presence of cannon A waves on jugular vein examination, irregular intensity of the first heart sound by auscultation, and varying systolic blood pressure. These physical signs are highly specific and sensitive for the diagnosis of VT . Vagal mAn uncommon but sometimes useful semi-invasive procedure in the evaluation of patients with WCT is the placement of a transesophageal probe to record the atrial electrical activity and establish the diagnosis .The ECG remains a cornerstone in the diagnosis of WCT. A plethora of different diagnostic criteria have been suggested to distinguish between the various etiologies of WCT, each with different sensitivity and specificity -21.The most useful ECG criterion in establishing the diagnosis of VT is the presence of AV dissociation with more ventricular than atrial events. This practically rules out the possibility of the WCT representing an SVT. Fusion beats during WCT also imply the presence of AV dissociation, since they are the result of the simultaneous activation of the ventricular myocardium through both the normal conduction system and from an ectopic ventricular focus. A capture beat, also known as Dressler beat, is a narrow QRS complex resulting from a well-timed P wave capturing the ventricular myocardium through the normal conduction system during VT. A narrow complex beat, however, can also occur during WCT in patients with SVT and underlying bundle branch block (BBB). In this case, a ventricular premature beat originating from or close to the non-conducting bundle branch fuses with the impulses traveling down the contralateral bundle resulting in simultaneous ventricular activation on both sides of the septum and in a narrow QRS complex.The QRS duration has been proposed as a criterion to differentiate between WCT of ventricular and supraventricular origins. Wellens and colleagues found that 69% of VTs had QRS duration greater than 140 ms, whereas no SVT had QRS duration in this range . This crThe cardiac electrical axis during WCT is also useful to determine the origin of the abnormal rhythm. In the presence of a right superior (northwest) axis, the WCT is unlikely to represent an SVT, since this ECG pattern is inconsistent with any type of typical bundle-branch or fascicular block. Also, electrical concordance across the precordium  is rarely consistent with an SVT, and typically represents an anteroapical (negative concordance) or a posterobasal (positive concordance) left ventricular VT.Morphology is also often used to differentiate between WCT of ventricular from supraventricular origins . In the In certain situations, patient can have episodes of WCT that may require invasive electrophysiologic (EP) testing to make a diagnosis. The primary indication for EP testing in patients with WCT is if the correct diagnosis is unclear after analysis of available ECG tracings and the knowledge of the correct diagnosis is necessary for patient care. This is listed by the American College of Cardiology/American Heart Association task force as a class I indication for performing an EP study . Class IMost patients do not have spontaneous episodes of tachycardia during EP testing and have to be induced into the abnormal rhythm by burst pacing or premature stimulation at various sites and cycle lengths, with and without \u03b2-adrenergic stimulation. It is important however to make sure that the arrhythmia induced is the clinical arrhythmia responsible for the patient's presentation. This is achieved by careful comparison of the morphology and rate of the induced tachycardia with those of prior recordings obtained by ECG, holter monitors, or event monitors. Complete electrophysiologic testing is usually necessary not only to differentiate between VT and SVT but also to distinguish between the various forms of these arrhythmias.As mentioned before, AV dissociation is the hallmark of ventricular tachycardia. The difficulty arises when patients have retrograde 1:1 VA activation during VT. This can be difficult to distinguish from an SVT. In this situation, recording a His bundle electrogram and analyzing its relationship to the atrial and ventricular electrograms is essential for establishing the diagnosis. Also, performing electrophysiologic and pharmacologic maneuvers to try to dissociate the atria from the ventricles can be of great help.The initial approach to the management of the patient who presents with WCT depends primarily on the patient's hemodynamic status. Patients with low blood pressure, pulmonary edema, severe angina, or other evidence of poor perfusion associated with the WCT should be promptly cardioverted back into normal rhythm, using synchronized electrical direct current. Hitting the patient on the chest, also called \"thump version\" can sometimes terminate a WCT presumably by mechanically inducing a premature ventricular complex that interrupts the reentrant circuit of the tachycardia.For the hemodynamically stable patient, time should be spent on analyzing data from the history, physical examination, and ECG recordings to reach a diagnosis with a high degree of confidence. As mentioned above, from a statistical standpoint, the most likely diagnosis in patients with WCT is VT. Assuming this diagnosis even in the hemodynamically stable patient until proven otherwise is the safest approach to management.Because it can terminate both SVT and VT, Amiodarone (class III) is the agent of choice for stable WCT particularly if the etiology is uncertain. It is also particularly useful in patients with poor ejection fraction, since it has a favorable hemodynamic profile . ProcainAfter the acute management of an episode of WCT, long-term plans should be made to prevent the recurrence of the episodes, minimize their symptomatic impact, and protect the patient against sudden cardiac death. In general, the therapeutic options include pharmacological treatment with anti-arrhythmic drugs, device treatment with the automatic implantable cardioverter-defibrillator, and catheter ablation procedures. A combination of two or more of these modalities is sometimes necessary.In the patient with SVT, a catheter-based approach to therapy is curative in the overwhelming majority of patients and provides protection against sudden cardiac death in patients with the Wolf-Parkinson-White syndrome who have a rapidly conducting antegrade accessory pathway. In those patients whose ablation procedure fails or who choose not to undergo an invasive test, numerous antiarrhythmic medications can be used to suppress the SVT including b-blockers, calcium channel blockers, or class I and class III anti-arrhythmic drugs.In patients with poor ejection fraction and sustained ventricular tachycardia, device therapy is usually recommended. Pharmacologic therapy is used as an adjunctive therapy to minimize the episodes of VT and prevent defibrillator shocks. Occasionally, catheter ablation is needed as an adjunctive therapy for frequent or incessant VTs that fail to respond to medications.Not all VTs, however, are life-threatening and require device therapy. Idiopathic VTs occur in structurally normal hearts and carry a very good prognosis. These include right and left ventricular outflow tract VTs and left ventricular fascicular (verapamil-sensitive) VTs. Like SVTs, idiopathic VTs can also be cured with catheter ablation with good success rates ,26.Patients who present with WCT constitute a challenge to the diagnostic acumen of physicians. If misdiagnosed, these patients can be mismanaged, which can lead to lethal consequences. In the hemodynamically unstable patient, synchronized electrical cardioversion is the initial therapy. In the stable patient, physicians should use all clues provided by the history, physical examination, and ECG, in reaching the correct diagnosis. Until proven otherwise, any WCT should be managed as if it were VT, in keeping with the consideration of \"First, do no harm\". This implies that physicians should refrain from using long acting AV nodal blocking agents that can induce hypotension in an otherwise stable patient."}
+{"text": "Bundle branch reentrant (BBR) tachycardia is an uncommon form of ventricular tachycardia (VT) incorporating both bundle branches into the reentry circuit. The arrhythmia is usually seen in patients with an acquired heart disease and significant conduction system impairment, although patients with structurally normal heart have been described. Surface ECG in sinus rhythm (SR) characteristically shows intraventricular conduction defects. Patients typically present with presyncope, syncope or sudden death because of VT with fast rates frequently above 200 beats per minute. The QRS morphology during VT is a typical bundle branch block pattern, usually left bundle branch block, and may be identical to that in SR. Prolonged His-ventricular (H-V) interval in SR is found in the majority of patients with BBR VT, although some patients may have the H-V interval within normal limits. The diagnosis of BBR VT is based on electrophysiological findings and pacing maneuvers that prove participation of the His- Purkinje system in the tachycardia mechanism. Radiofrequency catheter ablation of a bundle branch can cure BBR VT and is currently regarded as the first line therapy. The technique of choice is ablation of the right bundle. The reported incidence of clinically significant conduction system impairment requiring implantation of a permanent pacemaker varies from 0% to 30%. Long-term outcome depends on the underlying cardiac disease. Patients with poor systolic left ventricular function are at risk of sudden death or death from progressive heart failure despite successful BBR VT ablation and should be considered for an implantable cardiovertor-defibrillator. Bundle branch reentrant (BBR) tachycardia is a form of ventricular tachycardia (VT) incorporating both bundle branches into the reentry circuit. Another variant of the His-Purkinje macro-reentry utilizing ramifications of the left bundle branch is referred to as interfascicular reentrant tachycardia.Reentry within the His-Purkinje system (HPS) in humans was first documented by Akhtar et al ,2 in stuBBR VT is usually seen in patients with an acquired structural heart disease and significant conduction system impairment -11. DilaSurface ECG in sinus rhythm characteristically shows intraventricular conduction defects with or without PR interval prolongation. The conduction defects are presented by non-specific or typical bundle branch block patterns with prolonged QRS duration-12. AlthPatients usually present with presyncope, syncope or sudden death because of VT with fast rates frequently above 200 beats per minute -12. The Prolonged His-ventricular (H-V) interval in sinus rhythm is found in the majority of patients with BBR VT -12. AlthBBR VT is usually inducible with conventional pacing protocols. Both atrial and ventricular programmed stimulation or burst pacing can be useful. In some patients, the arrhythmia may be inducible only with atrial pacing stressing the importance of using atrial stimulation for evaluation of patients with VT or syncope . Left veThe following electrophysiological features are consistent with the bundle branch reentry mechanism : (1) repRecording from both sides of the septum may help in the identification of the bundle branch reentry mechanism. Documentation of typical H-RB-V-LB (during VT with LBBB morphology) or H-LB-V-RB (during VT with RBBB morphology) activation sequence would further support BBR VT diagnosis. In addition, during VT with LBBB morphology right ventricular excitation must precede the left ventricular excitation. The opposite is true for the VT with RBBB morphology .Pacing maneuvers, if feasible, can be extremely helpful. Ability to dissociate His or, particularly, RB (LB) potential would strongly argue against bundle branch reentry mechanism. The combination of concealed entrainment  by atrial pacing and manifest entrainment (manifest QRS fusion) by ventricular pacing has been recently proposed as a useful diagnostic criterion for BBR VT with LBBB QRS morphology . AnalysiInterfascicular tachycardia has been less commonly reported ,28,32-34The differential diagnosis of BBR VT includes other mechanisms of VT and different types of supraventricular tachycardia with aberrant conduction. All electrophysiological findings and pacing maneuvers described above that prove participation of the HPS in the tachycardia mechanism and exclude passive retrograde activation of the HPS help to differentiate between bundle branch reentry and other mechanisms of VT. The exclusion of supraventricular tachycardia is particularly important because QRS morphology during BBR VT is a typical bundle branch block pattern and also may be similar to that in sinus rhythm. The differential diagnosis should be based on the complimentary use of the diagnostic criteria of bundle branch reentry as well as supraventricular tachycardia . Since APharmacologic antiarrhythmic therapy, both empiric and electrophysiologically guided, is usually ineffective. Radiofrequency catheter ablation of a bundle branch can cure BBR VT and is currently regarded as the first line therapy. The technique of choice is ablation of the RB -10. UsinAblation of interfascicular tachycardia is guided by fascicular potentials. Successful ablation of the arrhythmia can be performed by targeting either the left anterior or posterior fascicle ,19,32-34The available data on long-term outcome of patients with BBR VT treated by catheter ablation come from small retrospective series including predominantly patients with left ventricular dysfunction -11,24,27"}
+{"text": "Dr. Gallagher et al  wrote 22Baseline electrocardiogram of patients with atriofascicular or atrioventricular pathways (pseudo-Mahaim)  are charElectrocardiogram of fasciculoventricular pathway is characterized by normal frontal plane axis like an anteroseptal accessory pathway (0\u00b0 to +75\u00b0)  with a sThe major findings are the slow conducting and decremental properties that can be assessed during right atrial pacing: AH interval lengthens, HV interval shortens and QRS widens until a steady value is achieved. Faster atrial stimulation does not increase preexcitation, but can prolong AV conduction time until block occurs . DecremeVentricular stimulation usually discloses ventriculoatrial conduction from the A-V node. The vast majority of atriofascicular and atrioventricular pathways have only anterograde conduction ,31. AdenThere are plenty of electrophysiologic and anatomic data supporting the concept that at least atriofascicular pathways are accessory AV nodes. We have seen a patient with an electrophysiologic profile suggestive of the presence of an atriofascicular pathway without conduction through the AV node. This patient had unexplained syncope with a baseline ECG showing LBBB-like pattern with normal PR interval . Atrial Associated conditions: Mahaim fibers (AF/ AV) very often occurs in the setting of Ebstein's disease 10 to 40%) and associated accessory pathways are a commom finding (up to 30%). Fasciculoventricular pathways also occurs very often in association with accessory pathways. I have reviewed the cases reported since 1981 0 to 40% ,23,33,34\u00ae SR2 or SR3, which improves stability. The potential may be as large as the His bundle potential or small, narrow with low amplitude. Catheter ablation at a site with \"M\" potential is likely to be successful (Searching for the \"M\" (Mahaim) potential  along thccessful . We 20]\u00ae SR2 or ccessful , but ocaccessful . We haveActivation mapping of the earliest local ventricular potential is feasible in short atrioventricular pathways like in fast conducting AV accessory pathways. Atrioventricular decremental pathways with a long course often shows extensive arborization over a wide area of ventricular muscle . TargetiShortest stimulus-QRS interval as assessed by atrial stimulation at a constant pacing rate along the atrial aspect of the annulus was the gold standard mapping method before mapping of \"M\" potential had been reported. Stimulation sites remote from the atrial insertion of the accessory pathway result in long stimulus-QRS interval due to the amount of interposed atrial tissue. We do not use this method because it is time consuming and very inaccurate because it is difficult to stimulate from many sites at the same distance from the annulus and stimulating atrial tissue requires good contact with the tip, which is not always possible.Extrastimulus mapping during antidromic tachycardia. Finding an atrial site where the longest coupled premature extrastimulus causes resetting, or assessing the amount of advancement of the QRS following application of a fixed atrial extraestimulus coupling interval. Similar to the previous technique it looks for a site in the atrial annulus with the least interposing tissue separating it from the accessory pathway proximal insertion. Likewise shortest stimulus-QRS technique is an inaccurate and tedious method.Some authors ,37 reporElectroanatomic mapping (noncontact mapping) ,38 can bSome particular features are unique to Mahaim fibers: Mapping of the atrial insertion by ventricular stimulation is usually not possible because those decremental pathways do not conduct retrogradely. Atrioventricular connections can be located by mapping the site of earliest ventricular activation on the annulus, as with other anterogradely conducting accessory AV pathways. On the contrary, atriofascicular pathways or even the long atrioventricular pathways with distal (nonannular) insertion cannot be mapped in this way. To worse matters these decremental pathways are unusually sensitive to mechanical trauma. Inadvertent knocking of the ablation catheter against the annulus can result in transient abolition of conduction through the pathway from minutes to hours ,35. The Radiofrequency current should be applied during atrial pacing to enhance preexcitation and making it easier to assess conduction block at the AP. Stability is improved during atrial pacing as compared with ablation during antidromic tachycardia when catheter is likely to move with tachycardia termination. MAT is a common and expected event and can also cause catheter displacement. Before \"M\" potential mapping technique became the gold standard mapping technique some authors favored targeting the ventricular insertion to avoid MAT and maintain a better catheter stability .Catheter ablation have been very successful particularly when ablating at a site with \"M\" potential or assessing earliest delta-V interval in atrioventricular decremental pathways ."}
+{"text": "Fascicular ventricular tachycardia (VT) is an idiopathic VT with right bundle branch block morphology and left-axis deviation occuring predominantly in young males. Fascicular tachycardia has been classified into three subtypes namely, left posterior fascicular VT, left anterior fascicular VT and upper septal fascicular VT. The mechanism of this tachycardia is believed to be localized reentry close to the fascicle of the left bundle branch. The reentrant circuit is composed of a verapamil sensitive zone, activated antegradely during tachycardia and the fast conduction Purkinje fibers activated retrogradely  during tachycardia recorded as the pre Purkinje and the Purkinje potentials respectively. Catheter ablation is the preferred choice of therapy in patients with fascicular VT. Ablation is carried out during tachycardia, using conventional mapping techniques in majority of the patients, while three dimensional mapping and sinus rhythm ablation is reserved for patients with nonmappable tachycardia. The first report of fascicular ventricular tachycardia was in 1979 by Zipes et al  in 1981 Zipes et al  postulatFascicular tachycardia has been classified into three subtypes  (1) leftFascicular tachycardia can be induced by programmed atrial or ventricular stimulation. Administration of isoprenaline by infusion may be needed to facilitate induction in some cases; however this tachyarrhythmia may be non inducible in a significant number of patients ,11. It iThe tachycardia circuit can be constructed from the observations during VT. During tachycardia two distinct potentials can be observed before the ventricular electrogram, namely the purkinje potential (PP) and pre Purkinje potential (Pre-PP), also designated P2 and P1 respectively  13,14].,14.13,14During VT, the antegrade limb of the circuit proceeds through the specialized, verapamil sensitive zone from the basal to the apical site of the left ventricular septum, giving rise to the Pre PP. Therefore the earliest Pre-PP is seen in the basal septum and the latest pre-PP is seen in the apical septum. The lower turn around site of the reentrant circuit occurs in the lower third of the septum with the capture of the fast conduction Purkinje fibers which are rapidly activated in either direction during tachycardia. Antegrade activation occurs down the septum to break through in the posterior septal myocardium below, and retrograde activation occurs over the posterior fascicle from apical to basal septum forming the retrograde limb of the tachycardia. The reentrant circuit of fascicular tachycardia is completed by a zone of slow conduction between Pre PP and PP areas in the basal interventricular septum. The slow conduction zone which is the upper turn around point of the circuit is located close to the main trunk of the left bundle branch .  The opFascicular VT is frequently misdiagnosed as supraventricular tachycardia with aberrancy on account of the narrow-QRS duration during tachycardia (120 ms), responsiveness to intravenous verapamil, and the occurrence in young patients with structurally normal hearts . HoweverInterfascicular VT, which is a type of bundle branch reentrant VT, has a typical RBBB morphology and left or right axis deviation during VT mimicking fascicular VT. However, interfascicular VT is most commonly seen in patients with an anterior infarction and either left anterior or posterior hemi fascicular block. During EP study, the ventricular depolarization is preceded by His bundle depolarization in interfascicular VT which is not seen in fascicular VT .Idiopathic mitral annulus VT has RBBB morphology with right axis deviation of the frontal QRS vector and hence mimics anterior fascicular VT. Tada et al  describeThe first report of ablation of fascicular VT was in 1987 by Fontaine et al  by the aUsually ablation of this tachycardia is performed during VT because the electrophysiologic targets are clear and the end point of ablation is termination of tachycardia. Various investigators have used different targets for ablation during tachycardia.Nakagawa et al  preferreAiba et al  and NogaIn patients with non-inducible tachycardia and in those with ill sustained tachycardia during the study, mapping and ablation during tachycardia is not possible. Moreover, the critical substrate of the tachycardia is amenable to mechanical injury due to catheter manipulation, thus making the tachycardia non-inducible during the study. Various methods of mapping and ablation of fascicular VT in such patients have been described.In general, pace mapping is more useful in mapping focal tachycardias whereas outcomes in reentrant tachycardia ablation are less favourable ,24. In tAnatomic data gathered together with endocardial electrogram data by various electroanatomic mapping systems have facilitated ablation of this arrhythmia in sinus rhythm. Chen et al  reportedCatheter ablation is the preferred choice of therapy in patients with fascicular VT. The success rate for ablation is more than 80% and complications are infrequent. Most of the patients with fascicular VT can ablated during tachycardia, using conventional mapping techniques. Three dimensional electro anatomical mapping and sinus rhythm ablation is to be reserved for patients with non - inducible or illsustained tachycardia and in patients with recurrences."}
+{"text": "Although interventional electrophysiology and the use of radiofrequency energy to cure various arrhythmias primarily developed in the adult population, similar applications in children have grown dramatically over the last decade. The anatomic basis for various arrhythmias is critically important for the pediatric ablationists to appreciate. Such understanding allows the use of alternative technique to affect cure while avoiding complications. Further, because of the relatively small heart and less thick myocardium in children, without the appreciation of the underlying cardiac anatomic relationships, collateral injury, for example to the arterial system, may occur. In this review, the cardiac anatomic consideration important in approaching various supraventricular and ventricular arrhythmias in the normal heart is discussed. The last two decades have witnessed tremendous change in the care of children with symptomatic cardiac arrhythmia. The anatomic basis for various cardiac arrhythmias (in children and adults) has been much better understood, particularly for common supraventricular tachyarrhythmia.While cardiac electrophysiology still forms the basis for electrophysiological study and radiofrequency ablation for supraventricular arrhythmia, pure anatomic approaches are evolving with appropriate adjunctive electrophysiological maneuvers performed prior to energy delivery. Radiofrequency ablation for AV node reentry and paroxysmal atrial fibrillation is performed almost entirely as an anatomy-based ablation in many centers -2.Radiofrequency ablation was initially reported as a feasible, successful, and safe therapy that could be used in children as an alternative to drug therapy in 1991 . There aOver 90% of supraventricular arrhythmia in children is a result of a reentrant mechanism . The secwithout necessarily effecting the His bundle electrogram, yet either advancing or delaying the subsequent atrial electrogram [In the initial few decades of cardiac electrophysiology, AVNRT was thought to represent a reentrant arrhythmia arising entirely from the compact AV node. This was because there was nearly simultaneous activation of the ventricle and atrium observed from the earliest recorded demonstration of this arrhythmia. If this were to have been the case (entire circuit in AV node), radiofrequency ablation for this arrhythmia without heart block would not have been possible. It later became recognized that AV node reentry could be reset and entrained from the atrium particularly the posteroseptal annular atrial tissue . Importactrogram . PioneerThe circuit for this arrhythmia, however, is far from completely understood. While it is accepted that atrial inputs to the AV node are necessary components to the circuit (see below), certain less commonly observed phenomena do suggest a distinct difference from AVNRT and any other macroreentrant atrial tachycardia. AVNRT can be dissociated from the ventricle either with block occurring in an infra-Hisian location (more common) or above the bundle of His. Also clearly observed and well documented are cases of AV node reentry with dissociation of the tachycardia from all recorded atrial tissue .The sinus impulse originates epicardially at the junction of the crista terminalis and the superior vena cava, where as the atrioventricular conduction system is located anteriorly and septally on the annulus. Specifically, the penetrating bundle of His is consistently found at the junction of the noncoronary cusp and right coronary cusp of the aortic valve where it meets the commissure of the anterior and septal leaflets of the tricuspid valve (membranous intraventricular septum). The compact AV node itself is located relatively more atrial and more posteriorly (closer to the coronary sinus) in the mid-septal tricuspid annulus when compared to the penetrating bundle of His. Although the compact AV node is relatively atrial to the His bundle, it is always found ventricular to the Eustachian ridge and the underlying tendon of Todaro within the so-called triangle of Koch. This triangle is bounded anteriorly by the tricuspid annulus, posteriorly by the tendon of Todaro, and inferiorly by the coronary sinus.The atrial inputs into the AV node that carry the sinus node impulse (or paced impulse) are not diffuse but along distinct anatomic pathways. This is because of the anatomic obstacles in the atrium (particularly right atrium) that the impulse must circumvent to reach the AV node. The atrial myocardial input to the AV node that occurs superior to the fossa ovalis and through the apex of the triangle of Koch is referred to as the fast pathway. The posterior inputs to the AV node traverse to this structure along the interatrial septum. These posterior inputs may involve the myocardial sleeves along the coronary sinus and the posteroseptal right atrium in the region of the coronary sinus ostium. The posterior inputs are referred to as the slow pathway and may be more than one in number (right and left-sided slow pathways). The actual junction of these posterior inputs into the AV node is likely through extensions of compact AV nodal and transitional AV nodal tissue called the posterior horns. This anatomic distinction between the atrial myocardial inputs to the AV node forms the essential substrate for AV node reentrant tachycardia.fast pathway.It should be noted that the distinction between the fast and slow pathways, while although partially reflective of the different conduction and refractory properties, is fundamentally an anatomic distinction . In otheThis anatomic distinction of the fast and slow pathway is not easily ascertained in the antegrade direction and involves complex entrainment maneuvers during AV node reentry to provide evidence. On the other hand, retrograde activation of the atrium during AV node reentry or ventricular pacing is straightforward in demonstrating proof of the anatomic separation of the two limbs of the AVNRT circuit. During typical AV node reentry or during ventricular pacing with retrograde activation of the fast pathway, the earliest recordable site of atrial activation is just behind the tendon of Todaro, close to the apex of the triangle of Koch. Whereas with atypical AV node reentry or retrograde activation via the slow pathway during ventricular pacing, the earliest recorded atrial electrograms are in the region of the coronary sinus ostium (posterior).The fact that atrial myocardium is essential to the circuit of AV node reentry is more than semantics and forms the basis for all atrial AVNRT ablation procedures. While ablating either the anatomic fast or slow pathway will prevent future AVNRT, the exit site of the fast pathway is fairly close to the compact AV node and separated only from this structure by the tendon of Todaro. The slow pathway, however, (see below) can be ablated 4 of 5 cm from the compact AV node with little or no risk of AV block. This distinction in the anatomy of the two pathways to the AV node is critical for safe ablation in young children.It is important for ablationists to understand the fluoroscopic anatomy of the fast pathway. In the RAO projection as anticipated, the fast pathway site is more atrial (behind the Eustachian ridge) than the compact AV node and, of course, the penetrating bundle of His. The characteristic fluoroscopic appearance, however, when mapping the fast pathway, is best noted in the LAO projection . As the The slow pathway fibers are funnel-like and triangular in section with the apex of the triangle inserting into the compact AV node and the base fanning out into the posterior interatrial septum both involving the fibers of the coronary sinus and the right posterior septal atrium . Thus, tBecause of the relatively smaller hearts and thus closer proximity of the compact AV node to the atrial input sites, ablation in children should be performed as far away from the compact AV node as possible ,7. UnderBecause of relatively rapid conduction times in children, it can be difficult to distinguish whether retrograde activation is via the slow pathway or fast pathway. Thus, there is often simultaneous activation of the atrium as recorded on the His bundle catheter and the proximal coronary sinus catheter. Specific mapping, understanding the fluoroscopic anatomy as detailed above of the fast pathway will clarify the situation.In children who have a persistent left superior vena cava, the coronary sinus including the ostium can be very large. This can make ablation of the slow pathway difficult. This difficulty is because of the lack of catheter stability created by the large coronary sinus ostium and the fact that multiple slow pathway inputs related to the diverse musculature of the enlarged coronary sinus will require attention. Again, linear ablation including careful ablation within the coronary sinus is most likely to be effective .In children, because of relatively rapid conduction times through the fast pathway, typically AVNRT may present as a long R-P tachycardia. This is because in AVNRT, activation of the atria and ventricle occur from a common turnaround point likely within the compact AV node or next to it (slower common pathway). When fast pathway activation is rapid, then atrial activation proceeds ventricular activation, giving rise to a long R-P interval. The P wave will be narrow and negative in leads 2, 3, and aVF unlike the wide P waves that result from slow pathway activation . Once catheters are placed, specific mapping of the fast pathway will show earlier activation than the anatomic slow pathway region .Activation of the left atrium in sinus rhythm or any right atrial rhythm occurs primarily through Bachmann's bundle and through the coronary sinus musculature. In children, Bachmann's bundle activation can be rapid. This occurrence can give rise to unusual activation patterns in the coronary sinus in children with typical AVNRT . If one Wolff-Parkinson-White syndrome results when an accessory pathway is present that electrically connects ventricular and atrial myocardium and gives rise to reentrant supraventricular tachycardia. The electrocardiographic recognition and electrophysiological approach to management of this syndrome in children is discussed elsewhere . SpecifiAccessory pathways in children, as well as adults, is sometimes classified into endocardial and epicardial types. In a strict anatomic sense pathways are always epicardial. That is the atrioventricular connection occurs exterior to the fibrous annulus . However, most of these pathways can be ablated either on the pathway itself or its atrial or ventricular insertion with standard endocardial techniques. In a few exceptional circumstances the pathway is truly epicardial in that the atriovenous connection occurs through another epicardial structure . In an analogous fashion, pathways that course through the fibrous trigone represent situations where standard endocardial ablation is unlikely to be successful for an anatomic reason.Muscular extensions  into most cardiac veins including the superior vena cava, pulmonary veins and the coronary sinus exist ,12. ThisWhile technically atrioventricular connections (accessory pathways) should be possible at any point along the atrioventricular annulus, an exception occurs in the region of the aortic mitral continuity. Thus, left anteroseptal accessory pathways (and left anterior) are exceedingly rare compared to other locations. This is because of the unique position of the aortic valve preventing direct atrioventricular connections as could occur across the annulus in other locations. For accessory pathways to occur here, the cardiac muscle (pathway) would have to apparently cross the central fibrous trigone. While this may occur another possibility more evident from recent case description is a connection from the atrial myocardium to the supra-aortic valvar myocardial extension (see below) under ventricular tachycardia and from there to the ventricular myocardium . The sitAnother non-annular anatomic situation where atrial and ventricular myocardial tissue is apposed is with respect to the appendages. Accessory pathways that involve electrically active myocardial connection occur between the appendages and the underlying ventricle. Although rare, when seen, these connections constitute an accessory bypass tract as conduction can proceed through these fibers independent of the AV node. When such tracts are diagnosed in children, the optimal approach is to ablate in a circumferential manner isolating a portion of the left or right atrial appendage close to its ostium. While the actual connection may also be targeted deep in the appendage, the risk of perforation in children is high. Targeting the ventricular insertion is typically futile as it is often multiple.Some accessory pathways may be located in the typical atrioventricular annular location, however, demonstrate unusual physiological properties such as decremental conduction or lack of typical responses to decremental atrial pacing etc. The nomenclature for these pathways is confusing with historical and contemporary usage significantly different . The anaIn present electrophysiology terminology, a Mahaim fiber is a true accessory bypass tract connecting the free wall of the right atrium to either ventricular myocardium or the infra-Hisian conduction system. Unlike a typical accessory pathway, however, Mahaim fibers have AV node-like characteristics near the annulus and connect to relatively apical myocardium or the infra-Hisian right bundle-branch system through an insulated fascicle similar to the His bundle/right bundle-branch.These pathways, when they occur in children with relatively rapid AV nodal conduction, can be exceedingly difficult to recognize as accessory pathways ,16. TheyWhile Mahaim fibers do not conduct retrograde, pathways that conduct either exclusively retrograde or bidirectionally occur and are responsible for the syndrome labeled PJRT . These pathways are distinguished from Mahaim fibers by having the ventricular and atrial insertions close to the annulus and conducting retrograde. There is no relationship anatomically with these pathways and the normal conduction system. For unclear reasons, retrograde decremental pathways are often found in the region of the pyramidal space, close to the coronary sinus ostium in the posterior right or left atrium . PathwayUnlike a Mahaim fiber that connects atrial myocardium to the ventricular myocardium, nodoventricular pathways connect compact AV nodal tissue either to the fascicular system (right or left bundle branch) or the ventricular myocardium. For these pathways to occur and participate in tachycardia, some form of longitudinal dissociation in the AV node is required, that is antegrade conduction through the AV node and then down the nodoventricular/fascicular tract and then retrograde to AV nodal tissue occurs over a conduction interval too short to be allowed by the usual refractory period of the AV node. The anatomic basis for such dissociation or in fact a convincing example of the anatomy/pathology of these connections is lacking and has prompted some electrophysiologists to question their existence ,20. AlthNormally, there is a fibrous sleeve of insulation on the penetrating bundle of His and the right and left bundle branches until this sleeve disappears and the bundle branch tissue connects to the ventricular myocardium (bundle branch exit). In some patients, there is a breach in this insulation and ventricular excitation occurs closer to the base on the septum either directly from the His bundle or from the proximal bundle branches. This is termed a fasciculoventricular connection or pathway. The reader should note that these do not represent true atrioventricular accessory bypass tracts since anatomically there is no direct connection from the atrium to ventricular myocardium. Importantly, when the AV node blocks, there is no pre-excitation and progressive decrement in AV nodal conduction is not associated with progressive pre-excitation as seen with typical atrioventricular bypass tracts. The pediatric electrophysiologist should be cognizant of this anatomic variant and differentiate these electrophysiologically from true bypass tracts since fasciculoventricular tracts are not associated with tachycardia and should not be targeted for ablation.In the pediatric population, in patients without prior cardiac surgery or congenital heart disease, atrial flutter and atrial fibrillation are uncommon. While atrial flutter is one of the most frequent causes of fetal tachycardia, after birth, the arrhythmia is rarely seen without coexisting cardiac disease. Similarly, atrial fibrillation in the pediatric age group is unusual without coexisting disease such as the Holt-Oram syndrome or with familial/inherited atrial fibrillation. From the anatomic perspective, a few important differences are significant with pediatric ablation and are outlined below .The cavo-tricuspid isthmus also referred to as the subeustachian isthmus is the critical zone for the typical atrial flutter circuit . This isRecognizing the occurrence of this pouch is also important when attempting to cannulate the coronary sinus including for cardiac resynchronization procedures, and this issue if explained more fully in another manuscript in this series.When ablating atrial fibrillation in children, the pulmonary veins are typically isolated. However, the veins tend to be smaller in children and the sleeve of myocardium entering the vein is also smaller . FurtherBecause of the small pulmonary veins and branches, acute occlusion of one of the venous branches may occur during ablation. When venography is performed, it can be difficult to know whether a branch has been occluded or did not exist at all. A simple anatomic rule of pulmonary vein branching can assist the operator in making this decision. Daughter veins that tend to coalesce into a parent trunk have a consistent relationship in terms of the diameter or circumference. The diameter (or circumference) of the daughter veins (tributaries) when added up always is greater (110%) than the diameter (or circumference) of the main vein .Although ventricular tachycardia ablation in children has gone from a rarely performed procedure to more frequently done, it still remains most likely required in children with congenital heart disease or other structural abnormalities. When significant structural abnormality is present , a defibrillator has often been placed, and the ablation procedure performed to minimize frequent shocks. The use of defibrillators in children and principles of radiofrequency ablation in pediatric scar-related VT are covered elsewhere in these discussions and this supplement. In this paper, we will expand on the anatomic basis of the two most common ventricular tachyarrhythmias found in children with otherwise structurally normal hearts.Outflow tract ventricular tachycardia is characterized by exercise-related wide QRS tachycardia that mostly occurs in active older boys and less commonly as paroxysmal VT in postmenarchal girls. In a few children with right ventricular outflow tract tachycardia, underlying cardiomyopathy, particularly arrhythmogenic right ventricular cardiomyopathy is found, but the vast majority have no obvious structural heart disease. An accurate understanding of the underlying anatomy of the outflow tracts is critical to safe catheter manipulation, mapping, and ablation of this arrhythmia in children. Pediatric ablationists should familiarize themselves with the relative positions of the right and left ventricular outflow tracts, myocardial sleeves that extend beyond the semilunar valves, and knowledge of the coronary arterial systems relative to both the left and right ventricular outflow tracts.rightward and posteriorly should prompt consideration of left ventricular outflow tract mapping. Similarly, when mapping the left ventricular outflow tract, leftward and anterior activation sites should prompt reconsideration of meticulous mapping of the posterior right ventricular outflow (a site where catheter positioning is not straightforward)  .Myocardial sleeves have been well described that extend beyond the semilunar valves to various lengths endocardial to the great arteries. While these occur in all age groups, the relative lengths of these myocardial sleeves appear to be longer in infants and young children . When maleft main coronary artery. While it is common for ablationists to consider performing coronary angiography when ablating in the left ventricular outflow tract, the proximity of the ostium and initial course of the left main coronary artery is closer to the a catheter position to deliver radiofrequency energy in the posterior right ventricular outflow tract close to the pulmonic valve. Because of the relatively shorter angle formed in very young patients and the lack of thick myocardial separation, particular care when ablating at these locations in children is required. When doubt exists, either intracardiac echocardiography to carefully document the separation between the ablating catheter and the coronary arteries  or coronary angiography should be performed [Because the pulmonic valve is cephalad and leftward of the aortic valve, the posterior portion of the right ventricular outflow tract just above and at the level of the pulmonic valve is very close to the erformed .Exercise-related ventricular tachycardia in structurally normal hearts that exhibit a right bundle branch block superior access morphology is usually mapped and ablated in the region of the left posterior fascicle (Belhassen's VT). While the heart is typically structurally normal, tissue that traverses the left ventricular cavity from the septum to the free wall is sometimes found close to the region of successful ablation. These have been variously referred to as false tendons, interpapillary muscle chords, left ventricular chords, or lancisi fibers. While such structures are commonly found even in patients without ventricular tachycardia that has been documented when clearly recognized with an imaging modality (echocardiography), their presence can guide the ablationist, particularly when tachycardia has been difficult to induce.An important trend in contemporary electrophysiology is anatomy-based ablation. Although the pediatric electrophysiologist still needs to clearly understand the physiological principles underlying various mapping, diagnostic, and ablation maneuvers, an appreciation of the underlying cardiac anatomy has become critical.Understanding cardiac anatomy will help minimize complications including collateral damage to the AV conduction system, pulmonary veins, and neighboring structures in the pyramidal space of the heart. Further, an appreciation of the complex anatomy of the ventricular outflow tracts, particularly in children allows accurate correlation between mapping, electrocardiographic, and imaging data. Such understanding again decreases the likelihood of damage to the coronary arteries while facilitating successful ablation."}
+{"text": "Retrograde ventriculoatrial conduction in persons with implanted dual chamber pacemakers can cause two types of responses. One is the familiar pacemaker mediated endless loop tachycardia. Another less known response is the repititive non-rentrant ventriculoatrial synchrony (RNRVAS). Both conditions produce similar symptoms due to the loss of atrial booster function and the presence of the reverse atrial kick, which initiates neurocardiogenic responses.In this form of tachycardia, the pacemaker actively participates in the tachycardia circuit. Retrograde conduction of a ventricular beat causes a P wave which is sensed by the the pacemaker circuit, triggering off the next ventricular stimulus at the end of the programmed AV delay. This cycle is repeated and results in an endless loop tachycardia at the programmed upper rate of the dual chamber pacemaker. This situation is more common in those who have been implanted a pacemaker for sinus node dysfunction, though retrograde conduction can be rarely intact in those with anterograde AV block. The trigger for the tachycardia is usually an appropriately timed ventricular premature beat. Occasionally it could be triggered by an atrial premature beat occurring within the post ventricular atrial refractory period. Pacemaker mediated endless loop tachycardia can be terminated by the application of a magnet and prevented by re-reprogramming the post ventricular atrial refractory period (PVARP). Interestingly, Barold et al  have repRNRVAS  is less A long AV interval as well as a fairly fast programmed lower rate favour the development of RNRVAS . The fas"}
+{"text": "Forty-four-year-old male patient with surgical closure of ostium secundum type atrial septal defect at the age of 9 years had undergone radiofrequency catheter ablation of the cavotricuspid isthmus because of recurrent drug-resistant typical isthmus-dependent atrial flutter, with bi-directional isthmus block achieved. Only few days later he started to suffer again high-rate tachycardia. An atypical atrial flutter was diagnosed on ECG . This onA second ablation was attempted, with 20-polar catheter deployed in the right atrium around the tricuspid annulus such that its tip was in the inferolateral part of the cavotricuspid isthmus, 6-polar catheter in the coronary sinus, and use of EnSite NavX electroanatomic mapping system . Surprisingly, the intracardiac recordings showed activation sequence resembling the same counter-clockwise atrial flutter that was previously ablated , althoug Electroanatomic activation map showed macroreentrant atrial tachycardia with the wave-front circulating around the presumed post-operative scar on the right atrial free wall . The volPatients with previous congenital heart surgery not infrequently develop atrial tachycardias late after the operation. These tachycardias are predominantly macroreentrant and the cavotricuspid isthmus often is part of the reentrant circuit. The incisional scar in the right atrial free wall and the cavotricuspid isthmus make together long protected corridor potentiating the occurrence and the perpetuation of peritricuspid reentry. Gaps in the scar predispose to the occurrence of reentrant tachycardias in the right atrial free wall with the scar acting as the central obstacle of the circuit . The sam"}
+{"text": "Arias et al in the article 'A narrow QRS complex tachycardia with an apparently concentric retrograde atrial activation sequence' describe a case with spontaneous intra atrial block along the mitral isthmus to explain the change in atrial activation . This ph"}
+{"text": "We report an unusual presentation of supraventricular tachycardia, in an infant, with cyanosis. The child had atrial septal defect with hypoplastic right ventricle. Radiofrequency ablation was performed in view of drug resistant SVT Cardiac arrhythmias are relatively uncommon in the younger population, accounting for approximately 5% of all emergency cardiac admissions. ParoxysmA 10-month-old male born at full term of non-consanguineous marriage presented with episodic listlessness associated with bluish discoloration of the lips. He had recurrent respiratory tract infections and a failure to thrive.2 saturation of 95% at rest); a normal-sized heart; quiet precordium, and a Grade II/VI short ejection systolic murmur in the left parasternal region. A chest X-ray showed mild cardiomegaly with normal vascularity. An echocardiography revealed a large ostium secundum atrial septal defect (ASD) with bidirectional shunt. There was no pulmonic stenosis or pulmonary hypertension. However, the right ventricle was hypoplastic [During one such episode, the pediatrician noted rapid heart beats and an ECG revealed narrow QRS tachycardia at the rate of 260 beats per minute. Oxygen saturation was 80% on room air. Adenosine terminated the tachycardia. A post-termination ECG in sinus rhythm did not reveal preexcitation. A clinical examination during sinus rhythm revealed an absence of cyanosis  study with a view to radiofrequency (RF) ablation. Amiodarone was omitted for 10 days prior to the EP study. At the time of the procedure, the child was 1 year old and weighed 7.2 kg. The procedure was performed under general anesthesia.A 5F sheath was introduced in the left femoral vein through which a 5F deflectable decapolar catheter was introduced in the coronary sinus. A 4F sheath was used in the right femoral vein and a 4F quadripolar catheter was introduced in the bundle region. The HV interval was normal. The ventriculo-atrial (VA) conduction was eccentric via a concealed left lateral accessory pathway (AP). An orthodromic AVRT  could beAn additional 5F sheath was introduced in the right femoral vein. A 5F radiofrequency ablation catheter was used. Mapping was performed during left ventricular pacing (via the ASD) using the quadripolar catheter. The mitral annulus was mapped and the site of AP identified. Radiofrequency energy was applied in the temperature controlled mode with a cut-off of 60 degrees centigrade and power limit of 25 watts. Successful RF ablation  was perfAccessory pathway mediated tachycardias constitute 80% of all the tachyarrhythmias during infancy. In some infants they resolve as the child grows. Most SVTRadiofrequency ablation is uncommonly performed under 5 years of age. This is because some SVTs resolve spontaneously. Also, arrhythmias may get suppressed under the influence of anesthesia at the time of RF ablation. Patient size poses limitations in using multiple electrode catheters and there is an increased possibility of cardiac/valve damage with ablation. The risks of ablation are acceptable only if the child has recurrent, drug-resistant SVT especially if it results in tachycardiomyopathy or life-threatening cardiovascular compromise.\u20108Our case of SVT is unique in its presentation with cyanosis. This 1-year-old child had recurrent, drug-resistant SVT. The large ASD and hypoplastic RV resulted in hypoxia during SVT. The right to left shunt may have increased during rapid heart rates because of the shortening of diastole and increased trans-tricuspid gradient-almost similar to what one sees during tachycardia in mitral stenosis. Propafenone or flecainide are probably more effective agents for managing these tachycardias; however, these are not easily available in India. Adenosine responsiveness of the tachycardia suggested AV node dependant SVT and therefore is more likely to be successfully ablated. The large ASD provided easy access to the left heart for ablation without the need for arterial access.Left-sided accessory pathways has been accessed by the antegrade  or the retrograde trans-aortic route (via the aorta and left ventricle). In young children, the antegrade approach is preferred to avoid damage to the aortic/mitral valves and also avoiding arterial access. Radiofrequency ablation by the antegrade approach was facilitated in our patient because of the ASD. Tackling the SVT before ASD closure in patients with left-sided AP avoids the inconvenience of a septal puncture through the ASD patch. Mapping and RF ablation was performed in our patient during LV pacing. The latter allowed VA conduction exclusively over the left lateral AP.The current case highlights a rather unusual presentation of SVT with cyanosis. The resistant nature of the tachycardia and non availability of a certain group of anti-arrhythmics prompted us to undertake RF ablation in this young child. The presence of an ASD certainly facilitated the approach to the AP located on the left lateral wall."}
+{"text": "Cardiac rhythm disturbances such as bradycardia (heart rate < 50/min) and tachycardia (heart rate > 100/min) require rapid therapeutic intervention. The supraventricular tachycardias (SVTs) are sinus tachycardia, atrial tachycardia, AV-nodal reentrant tachycardia, and tachycardia due to accessory pathways. All SVTs are characterized by a ventricular heart rate > 100/min and small QRS complexes (QRS width < 0.12 ms) during the tachycardia. It is essential to evaluate the arrhythmia history, to perform a good physical examination, and to accurately analyze the 12-lead electrocardiogram. A precise diagnosis of the SVT is then possible in more than 90% of patients. In ventricular tachycardia (VT) there are broad QRS complexes (QRS width > 0.12 s). Ventricular flutter and ventricular fibrillation are associated with chaotic electrophysiologic findings. For acute therapy, we will present the new concept of the five \u2018A's, which refers to adenosine, adrenaline, ajmaline, amiodarone, and atropine. Additionally, there are the \u2018B,\u2019 \u2018C,\u2019 and \u2018D\u2019 strategies, which refer to beta-blockers, cardioversion, and defibrillation, respectively. The five \u2018A\u2019 concept allows a safe and effective antiarrhythmic treatment of all bradycardias, tachycardias, SVTs, VT, ventricular flutter, and ventricular fibrillation, as well as of asystole. Emergency medicine and critical care are fields that call for rapid diagnosis and intervention in specific situations. In cardi3Bradycardia, defined as a heart rate < 50 beats/min, may be caused by different mechanisms and have various etiologies . Sinoatr5Narrow-QRS tachycardia is a cardiac rhythm with a rate faster than 100 beats per minute and a QRS duration of less than 0.12 s. The patient with narrow-QRS tachycardia usually seeks medical attention because of palpitations, light-headedness, shortness of breath, or anxiety. In many patients with narrow-QRS tachycardia, the heart rate is very high (180-240 beats per min) and therefore, after onset of the tachycardia, the patient will arrive very soon in an intensive care unit for diagnosis and treatment.The narrow-QRS complex indicates that AV conduction occurs through the AV node. ECG documentation of the tachycardia is extremely important so that the mechanism of the tachycardia can be diagnosed and the patient can be given the correct emergency treatment. Causes of narrow QRS tachycardia are sinus tachycardia, atrial tachycardia, atrial flutter, atrial fibrillation, AV nodal reentry tachycardia (AVNRT), and orthodromic circus movement tachycardia (CMT) . There aBecause a drug given for the treatment of SVT may be deleterious to a patient with ventricular tachycardia (VT), the differential diagnosis in broad-QRS tachycardia is critical. Wide-QRS complex tachycardias (QRS duration > 0.12 s) often pose a difficult diagnostic and therapeutic problem . Errors Approximately 1,000 people suffer from cardiac arrest each day in the US, most often as a complication of an acute myocardial infarction with accompanying ventricular fibrillation (VF) or unstable VT . In 200510In emergencies due to arrhythmias, rapid and correct diagnosis is necessary for adequate therapy. The clinical symptoms, the physical examination, and the 12-lead electrocardiogram are important sources of information for making a correct diagnosis . Of courIn patients with ventricular flutter or ventricular fibrillation, syncope following cardiac arrest is the leading clinical sign.ECG documentation is one of the most important steps for correct diagnosis and treatment. It is necessary to divide tachycardias into those with narrow QRS complexes (QRS < 0.12 s) and those with wide QRS complexes (QRS > 0.12 s) Figures  and 4. SSometimes, in emergencies, treatment of bradyarrhythmias, tachyarrhythmias, ventricular flutter, or ventricular fibrillation can be difficult. Younger colleagues and those not familiar with clinical electrophysiology sometimes do not know what to do when a patient develops an arrhythmia. Therefore, we would like to present a new concept for the treatment of arrhythmias in an emergency, a concept that involves only five drugs, all beginning with \u2018A\u2019 - adenosine, ajmaline, amiodarone, adrenaline, and atropine - the five \u2018A\u2019 concept .vs 91%, P = ns).[In regular narrow-QRS complex tachycardia, vagal maneuvers should be initiated to terminate the arrhythmia or to modify AV conduction. If this fails, intravenous antiarrhythmic drugs should be administered for arrhythmia termination in hemodynamically stable patients. Adenosine, calcium channel blockers, or beta- blocking agents are the drugs of first choice. Adenosine was approved by the Food and Drug Administration in 1990 and is today the treatment of choice for acute therapy of SVT . Adenosi16 P = ns). Higher dThe initial approach in patients with wide-QRS complex tachycardia depends on the hemodynamic stability and the symptoms associated with the tachycardia. When the patient is hemodynamically unstable or has pulmonary edema, the tachycardia should be promptly cardioverted with a direct current (DC), synchronized shock. Once the hemodynamically stable patient has been cardioverted and stabilized, it is important to evaluate the preconversion 12-lead ECG for the QRS configuration and signs of AV dissociation as described elsewhere in this manuscript. In patients with sustained (duration > 30 s), hemodynamically stable, monomorphic VT, amiodarone  plays an important role in terminating the arrhythmia; this drug is discussed in detail later. An alternative treatment is the administration of procainamide (10 mg/kg i.v.) or ajmaline (50-100 mg i.v. over 5 min), both of which can provide high termination rates . In patiP = 0.03).[Amiodarone is currently regarded as the most effective antiarrhythmic drug available for the treatment of patients with both supraventricular and ventricular tachyarrhythmias. It is considered to be particularly useful in patients with life-threatening ventricular tachyarrhythmias . The mos = 0.03). The role = 0.03). Today, a = 0.03).24 Despitet al.[P = 0.84), basic life support  and time to first defibrillation  were significantly correlated with good neurologic outcome. In addition to the better neurologic outcome, among the patients who did not receive basic life support, the average cost per patient with good neurologic outcome significantly increased with the delay of the first defibrillation (P < 0.001). The importance of cerebral perfusion and pressure and cerebral tissue oxygen tension during cardiopulmonary resuscitation has been described elsewhere.[1 and \u03b12 receptors almost equally, and \u03b21 and \u03b22 receptors in a ratio of approximately 1: 4.[et al.[The importance of vital organ perfusion in patients suffering cardiac arrest makes arterial vasomotor tone, and the resultant perfusion pressure, critical in resuscitation from sudden death. After failure of DC countershock, ventilation, and oxygenation, the target organ for resuscitation pharmacotherapy is the arterial vascular smooth muscle cell. There is general agreement that bystander first aid, defibrillation, and advanced life support are essential for good neurologic outcome in patients after a cardiac arrest. Bur et al. evaluatelsewhere. Over theely 1: 4. The Amerely 1: 4. Few of tely 1: 4. This sol4.[et al. They com1 receptors. Wenzel et al.[vs 43.0%) or pulseless electrical activity were present (33.7% vs 30.5%) (P = ns). In accordance with these results, the guidelines of the American Heart Association and European Resuscitation Council recommended 40 units vasopressin intravenously and 1 mg adrenaline intravenously as equally effective for the treatment of patients with ventricular fibrillation [Another important vasopressor drug is vasopressin. It acts directly on contractile elements by way of Vel et al. studied illation . There i33.7% vs .5% (P = Atropa belladonna), jimsonweed (Datura stramonium), mandrake (Mandragora officinarum), and other plants of the family Solanaceae. It is a secondary metabolite of these plants and serves as a drug with a wide variety of effects. It is a competitive antagonist for the muscarinic acetylcholine receptor. It is classified as an anticholinergic drug. Atropine increases firing of the SA node and conduction through the AV node, opposes the actions of the vagus nerve, blocks acetylcholine receptors, and decreases bronchiole secretions. In general, atropine lowers the parasympathetic activity of all muscles and glands regulated by the parasympathetic nervous system. This occurs because atropine is a competitive antagonist of the muscarinic acetylcholine receptors. Acetylcholine is the main neurotransmitter used by the parasympathetic nervous system. Atropine may cause swallowing difficulties and reduced secretions. Atropine works because the main action of the vagus nerve of the parasympathetic system on the heart is to decrease the heart rate. Atropine blocks this action and, therefore, may increase the heart rate. Indications for atropine administration are vagus-mediated sinus bradycardia, blocks in the AV node, and vagus-mediated asystole.[Atropine is a tropane alkaloid extracted from deadly nightshade (asystole. For sympasystole.. Atropinasystole.Emergency medicine and critical care are fields that often require rapid diagnosis and intervention for specific situations. It is well known that in all patients with tachyarrhythmias, evaluation of the underlying etiology and the degree of left ventricular dysfunction is essential. Correct treatment of arrhythmias in the intensive care setting is based on an understanding of the mechanisms that cause the situation. The therapeutic role of antiarrhythmic drugs in the management of atrial fibrillation or cardiac arrest is debatable. For acute therapy, there is the new concept of the five \u2018A's, which refers to adenosine, adrenaline, ajmaline, amiodarone, and atropine. The five \u2018A's concept will enable safe and effective treatment of all bradycardias, tachycardias, SVTs, VT, ventricular flutter, ventricular fibrillation, and of asystole."}
+{"text": "Primary tumors of the heart are rare, but they are often associated with refractory arrhythmias. Vascular tumors of the heart comprise a small minority of primary cardiac tumors. In patients with structurally normal hearts, ventricular tachycardia (VT) originating from the right ventricular outflow tract (RVOT) can be sensitive to adenosine, vagal maneuvers, and calcium channel blockers. In this report, we describe a case of ventricular tachycardia originating from within a hemangioma in the RVOT that was ultimately controlled with verapamil. A 15 year old girl presented with a recurrence of ventricular tachycardia after having been externally cardioverted twice in a 24 hour period at a referring hospital. She had been diagnosed with a cardiac hemangioma when a murmur was noted at 5 years of age on a routine physical exam. Echocardiogram at that time showed a large mass in the RVOT with mild obstruction. Endomyocardial biopsy showed a non-specific vascular proliferation. A histopathologic diagnosis was confirmed when the tumor was resected shortly after the initial presentation. The tumor was infiltrative and encroached on the RVOT free wall and tricuspid valve, and hence was only incompletely resected. She continued to do well, and at 10 years of age, non-sustained polymorphic VT was noted on a routine screening Holter monitor. An EP study was performed and ventricular double extrastimuli (600:290:270) provoked sustained polymorphic VT. At that time, a transvenous single-chamber internal cardioverter defibrillator (ICD) was placed for primary prevention and the patient was started on Nadolol.She remained asymptomatic for the next five years. Frequent episodes of non-sustained polymorphic VT were noted, but there were no ICD therapies or episodes of sustained VT. At 15 years of age, she presented to the emergency room with palpitations and 12-lead ECG demonstrated wide complex tachycardia at 180 bpm .During sustained ventricular tachycardia, 3D mapping with CARTO was initially performed using a Biosense Webster EZ Steer catheter (4mm tip). Earliest areas of ventricular activation in tachycardia were noted along the border of the tumor, and earliest ventricular activation preceeded the QRS by 41 msec. Initial lesions placed along the tumor border were unsuccessful. Pace mapping from these sites showed paced QRS morphology similar to VT morphology in 11 of 12 surface leads. With similar findings at several points on the tumor border, the conclusion was made that tachycardia originated from within the tumor. Attempts to isolate the tumor with a series of lesions using an irrigated Navistar ThermoCool catheter were ultimately unsuccessful and tachycardia persisted. The case was ended and the patient was transferred back to the PICU in sinus rhythm. She underwent an upgrade to a dual chamber ICD with the intention of giving aggressive beta-blocker therapy.Sustained tachycardia recurred and intravenous verapamil, which had previously not been tried, was given and tachycardia terminated.  Oral verapamil was continued and there were no further tachycardia recurrences. She was started on oral Verapamil SR 240 mg daily and discharged from the hospital. She continued on Verapamil and did not have any recurrent episodes for one year. Subsequently, during a vigorous exercise the patient experienced two appropriate shocks. She had been noncompliant and was not taking verapamil at the time. Electrograms from the device demonstrated sinus tachycardia prior to an episode of VT .Cardiac hemangiomas are composed of a benign proliferation of endothelial cells and blood vessels, and they are histologically identical to hemangiomas found elsewhere in the body. Hemangiomas account for less than 3% of primary cardiac tumors ,2.Ventricular arrhythmias and sudden cardiac death are associated with a variety of cardiac tumors and are independent of tumor size ,4. TumorVentricular tachycardia arising from the RVOT in patients with structurally normal hearts has been characterized by cAMP-mediated triggered activity . These aThis case illustrates that ventricular tachycardia arising from a hemangioma in the RVOT can act similar to VT arising from the RVOT in patients with structurally normal hearts. Tumor-associated ventricular tachycardias can be difficult to control with medication, and can also be difficult to treat with radiofrequency ablation. Verapamil should be considered before proceeding to tumor resection or other invasive therapies."}
+{"text": "We report an unusual association of persistent atrial flutter and bundle branch re-entrant ventricular tachycardia in a young patient without structural heart disease. Atrial flutter masked the infra-Hisian conduction disease, was fundamentally dependent on a long PR interval, and could be a possible trigger of ventricular tachycardia. A 28-year-old female with a recent diagnosis of persistent atrial flutter (AFL) and no structural heart disease, was undergoing treatment with betablocker while waiting for ablation . She wasDuring the EPS, the patient was in persistent AFL with a cycle length of 255 ms associated with a typical isthmus-dependent circuit. The AV conduction was variable with a HV interval 90 msec. Cavotricuspid isthmus ablation stopped the tachycardia  restorinBBR VT is often encountered in patients with dilated cardiomyopathy and with less frequency in valvular, ischemic and other structural heart disease, but is rarely seen in patients with a normal heart . The tacIn our patient, without structural heart disease or bundle branch block and with persistent AFL, His-Purkinje system disease could be suspected only by a mild non-specific intraventricular conduction delay. This is highly unusual, the absence of the typical clinical and ECG features in this setting makes it difficult to consider the final diagnosis, and invasive testing is essential. Several reports have related BBR VT induction with atrial stimulation as well as with AFL/fibrillation . We supp"}
+{"text": "We report a patient with an implantable cardioverter defibrillator (ICD) for arrhythmogenic right ventricular dysplasia (ARVD) who received inappropriate shocks for atrioventricular node reentry tachycardia (AVRNT). Patient had multiple shocks for tachycardia with EGM characteristics of very short VA interval and CL of 300 msec. An electrophysiologic (EP) study reproducibly induced typical AVNRT with similar features. The slow AV nodal pathway ablation resolved the ICD shocks. Despite increasingly sophisticated discrimination algorithms available in modern ICDs, the ability to differentiate SVT from VT can be challenging. Our patient received inappropriate shocks for AVNRT. When device interrogation alone is not conclusive, an EP study may be necessary to determine the appropriate therapeutic course. Arrhythmogenic right ventricular dysplasia (ARVD) is an inherited degenerative disorder involving progressive replacement of the myocardium by fibro fatty tissue. This is seen predominantly in the right ventricle though left ventricular involvement is not uncommon. The fibrofatty replacement provides the substrate for life threatening arrhythmias such as monomorphic ventricular tachycardia, polymorphic ventricular tachycardia (torsades de pointes), ventricular fibrillation and / or electrical storm  are sophisticated devices with arrhythmia discrimination algorithms that reliably differentiate SVT from VT and provide appropriate therapy. We report a patient with ARVD who had inappropriate shocks for AVNRT.A 47-year old male presented with 3 ICD shocks for persistent ventricular tachycardia. He had known history of polysubstance abuse and coronary artery disease with angioplasty. Eight months prior to this admission he had presented with symptomatic monomorphic ventricular tachycardia (Cycle length 360 msec). A 2D-echo showed an ejection fraction of 40% followed by a coronary angiogram which showed non-obstructive disease with previously placed patent right coronary stent. Cardiac MRI confirmed a diagnosis of ARVD. He received a Biotronik Lexos DR ICD (model # 347000). Device interrogation during the current admission revealed a wide complex tachycardia (WCT) that received 3 ineffective shocks but resolved spontaneously. The WCT as shown by the Electrograms (EGMs) during ICD interrogation showed a short VA interval, a Cycle length (CL) of 300msec which were completely different from the VT seen during his initial clinical presentation . ICD shoDuring EP study, no arrhythmia was inducible at baseline. With RV stimulation and Isoproterenol (2mcg) provocation, a typical AVNRT with a pacing cycle length of 500 msecs and 3 extra stimuli of 290-280-270 ms, identical to the arrhythmia seen on ICD interrogation strips was easily and reproducibly induced . PresencOur patient presented with sustained monmorphic VT, was diagnosed as ARVD by cardiac MRI, requiring ICD implantation. Subsequently he had inappropriate shocks due to AVNRT . Due to differences in the characteristics of the two arrhythmias an appropriate diagnosis of the arrhythmia responsible for the inappropriate shocks could be established only with programmed electrical stimulation during an EP study.ARVD has an increased incidence of ventricular arrhythmias and SCD requiring ICD implantation. It has been estimated that about 20 percent of SCD among patients <35 years is due to ARVD .In spite of a high specificity, inappropriate shocks have been seen in ARVD patients with ICD especially with atrial arrhythmias. In a study of 653 arrhythmia episodes in patients with dual chamber ICDs, inappropriate detection of atrial arrhythmias (with a stable atrioventricular relationship) was seen in 42% of patients, of which atrial flutter or fibrillation were more often misdiagnosed [Most modern ICDs have sophisticated discrimination algorithms to differentiate atrial and ventricular arrhythmias. While ventricular arrhythmias are recognized and treated with precision, atrial arrhythmias can be misdiagnosed and receive inappropriate shock therapy. An EP study may thus be necessary in establishing an accurate diagnosis and delivering appropriate therapy."}
+{"text": "Spontaneous pneumothorax is usually caused by the rupture of subpleural blebs/bullae in the underlying lung and is one of the most common elective applications of video-assisted thoracoscopic surgery (VATS). VATS has been used as an alternative to thoracotomy in the treatment of spontaneous pneumothorax. Recurrent pneumothorax and persistent air leakage are quite often indications for spontaneous pneumothorax, and bilateral spontaneous pneumothorax is also considered to be an indication for surgical intervention. The goals of surgical intervention are to eliminate intrapleural air collection and prevent recurrence. Diverse procedures have been reported in the surgical treatment for spontaneous pneumothorax. We review the literature regarding the VATS approach for spontaneous pneumothorax. With advances in videothoracoscopic equipment, most operations for spontaneous pneumothorax are usually performed with a minimally invasive technique that involves video-assisted thoracoscopic surgery (VATS) . AdditioPatients with spontaneous pneumothorax, which is usually caused by a rupture of a subpleural bleb or bulla in the underlying lung, most commonly present with ipsilateral sudden chest pain and dyspnea. Spontaneous pneumothoraces are classified as primary or secondary -7. PrimaThe generally accepted indications for surgical intervention in pneumothorax are as follows ,9,13-15:Randomized clinical trials that have compared the clinical results of a VATS procedure to thoracotomy for spontaneous pneumothorax have shown that the VATS procedure was superior to thoracotomy with regard to postoperative pain, hospital stay, and pulmonary function -46. VATSAccording to the recent development of technology in the videoscopic field, several reports have shown that needlescopic VATS is feasible in the treatment of spontaneous pneumothorax ,49. The Simultaneous bilateral spontaneous pneumothorax is an infrequent phenomenon that reportedly accounts for approximately 1% of all cases of spontaneous pneumothorax ,51. AlthMedian sternotomy or bilateral axillary thoracotomy has been traditionally performed for the bilateral treatment of pneumothorax ,60. WithRecently, a few researchers -66 have The author declares that they have no competing interests.The author performed a literature search, and wrote and approved the final manuscript."}
+{"text": "Unlike the adult population, arrhythmias occur less commonly in childhood. Only 5% of the emergency hospital admissions in the paediatric population is attributed to symptomatic arrhythmias . MajoritThe symptomatology of arrhythmias in children depends on the underlying rhythm disorder and the age at presentation. Typically, neonates and infants with arrhythmias tend to present with congestive cardiac failure secondary to tachycardiomyopathies. This is particularly known to occur following PJRT, AET and VT. Palpitation and or syncope are the mode of presentation in older children. Complete heart block is the bradyarrhythmia of significance seen in childhood. This is either of congenital etiology or a sequela to cardiac surgery. Infrequently, sudden cardiac death (SCD) occurs due to arrhythmias particularly when they are of ventricular origin. SCD of arrhythmogenic etiology in children is reported with HCM, LQTS, Type B WPW syndrome, complete heart block and ventricular arrhythmias post cardiac surgery.Atrioventricular reentry (AVRT) remains the most common mechanism for fetal tachyarrhythmias. Infrequently atrial reentry tachycardias are seen. With sustained tachycardia there is a 50% risk of the fetus developing congestive cardiac failure and 50% risk of fetal death with untreated hydrops . SustainThe supraventricular tachycardia (SVT) occurring in earlier life is commonly accessory pathway mediated. Atrioventricular reciprocating tachycardia (AVRT) represents 85% of the arrhythmias in fetal life and 82% of the arrhythmias occurring during infancy. In most cases tachycardia will resolve spontaneously by the end of infancy although there may be late recurrences . The incWolff-Parkinson-White (WPW) syndrome is a typical example of AVRT in children. The population prevalence of ventricular pre-excitation is around 1.5 per 1000 in the adolescent age group and probably lower during the early childhood [hildhood . A signihildhood . The ovehildhood . SCD in hildhood . Radio fhildhood .Permanent Junctional Reciprocating Tachycardia is the commonest form of incessant supraventricular tachycardia in children. This is an orthodromic AVRT with RP>PR and presents typically at 3-4 years of age. These are likely to persist for a long time and are known to cause tachycardiomyopathy. Although pharmacological control is possible with amiodarone or verapamil or in combination with digoxin, the best long-term management is reportedly by RF ablation [ablation .Atrial tachycardias in childhood are commonly seen as a result of postoperative atrial scarring, distortion of anatomy, changes in the wall stress and changes in the atrial refractoriness associated with sinus node dysfunction. Atrial tachycardia with one to one conduction can cause SCD. In a collaborative study of atrial flutter of 380 cases by electrophysiological study, significantly more young people with atrial flutter died when no drug control was achieved, compared to those with pharmacologically controlled atrial flutter. Surgical intervention to improve the cardiac haemodynamic function showed a significant decrease in the incidence of atrial flutter and this should be considered whenever feasible [feasible . Atrial Ventricular premature contractions (VPC) are the commonest ventricular conduction anomaly seen in neonates. Up to 33% of neonates have VPCs in the first week of life and these usually resolve by two weeks of age. However, if they persist beyond this period then further investigation is warranted to rule out an underlying structural heart defect. Ventricular arrhythmias are rare in childhood and may be benign or malignant. Benign VT is a condition diagnosed by exclusion and these children usually have normal ECG, chest X-Ray, and echocardiography and in some cases when performed, a normal EP study. The VT is suppressed by exercise and is usually refractory to medical management with a good long-term prognosis. Incessant idiopathic infant VT presents in the first two years of life with a male preponderance and is considered to be secondary to a left ventricular hamartoma. The children present with CCF or collapse. The VT best responds to pharmacological treatment with flecainide and amiodarone and usually resolves spontaneously by school age facilitating withdrawal of drugs. RVOT tachycardia is occasionally seen in teenagers and is distinct from arrhythmogenic right ventricular dysplasia or cardiomyopathy. The ECG shows LBBB with a vertical or right axis. This VT is usually produced by exertion or emotion, can be reproduced by isoprenaline or burst pacing and is amenable to RF ablation. Idiopathic LV tachycardia is rare and arises from the posterior fascicle of the left bundle branch and is thought to originate from the Purkinje network. It responds to treatment with verapamil and is also amenable to RF ablation. Catecholaminergic VT, first described by Coumel, is induced by emotion or exertion and can result in torsades associated with syncope. The resting ECG is normal. Isoprenaline administration or exercise testing can reproduce the VT. This is a dangerous form of VT and the prognosis is greatly improved by beta blocker therapy .Long QT syndrome (LQTS) is a familial disease characterized by prolonged and abnormal ventricular repolarisation and by the risk of life threatening ventricular arrhythmias. Recent molecular genetic studies in LQTS families have identified aberrations in genes encoding for cardiac ion channels. Dysfunction of these cardiac ion channels leads to prolongation and inhomogeneity of the action potential, which leads to arrhythmias, based on abnormal impulse propagation as well as sensitizes the heart to the arrhythmogenic effects of catecholamines. At least 5 genes located on chromosomes 11, 7,3,4 and 21 have been identified with aberrations in encoding for cardiac ion channels in families with LQTS. Romano-Ward syndrome, the autosomal dominant LQTS is sub classified in to LQT 1, which is the commonest form of LQTS and where the mutation is in the gene KVLQT1 on chromosome 11, LQT 2 in HERG on chromosome 7, LQT 3 in SCN5A on chromosome 3, LQT 4 in chromosome 4 and LQT 5 with mutation in Min K on chromosome 21. Jervell-Lange-Nielsen syndrome, the autosomal recessive LQTS is due to mutation in KVLQT1 on chromosome 11 and is associated with deafness. The main diagnostic criteria has been a prolonged QT on ECG but it is to be noted that genetically proven LQTS patients may have normal QT interval. Other diagnostic criteria include a slow heart rate for age, T wave alternans and abnormal T wave morphology. Patients usually present with syncope or cardiac arrest precipitated by emotional or physical stress. The syncope is usually due to \"torsade de pointes\" frequently degenerating in to ventricular fibrillation. Neonates with LQTS may be identified by a partial AV block and slow heart rate due to prolonged repolarisation. History of syncope, virulent family history, T wave alternans, a QTc exceeding 0.54 s and associated AV block in neonates carry a higher risk. The mortality among untreated symptomatic patients reaches 70% within 15 years from the time of the first syncopal episode. Treatment options include beta-blockade, other anti arrhythmic drugs, stellate ganglionectomy and automatic implantable cardiac defibrillator with marked improvement in survival [survival .Hypertrophic Obstructive Cardiomyopathy (HOCM) is much less prevalent in children than in adults. A Japanese screening programme estimates the prevalence in children at 1 in 15000 compared to an adult prevalence rate of 1 in 500. The overall risk of SCD in HOCM is low and is around one per million in the age specific population under 20 years. The mechanism of SCD in HOCM is believed not to be due to an arrhythmia but ventricular fibrillation has been implicated in some [ in some .Junctional Ectopic Tachycardia (JET) is the commonest (22%) arrhythmia seen in the immediate post-operative period following intracardiac repair mostly following Tetralogy of Fallot correction. The etiology is thought to be due to resection of right ventricular outflow tract (RVOT) muscle bundles, relief of RVOT obstruction through the right atrial approach and an extended bypass time. The risk factors predisposing to post-operative JET have been identified as lower age and body weight at the time of surgery, higher Aristotle basic score, longer cardiopulmonary bypass time and cross clamp time, use of deep hypothermia and total circulatory arrest [y arrest . The undLate post-operative arrhythmias are the commonest medical problem encountered after repair of congenital heart defects. The incidence relates to the complexity of the underlying heart defects and the clinical significance depends on the interaction between the arrhythmia and the cardiac status. The arrhythmias are attributed to variety of reasons.An underlying electrical substrate associated with specific structural heart defects such as atrial isomerisms, Ebsteins anomaly, corrected TGA.Acquired due to the pre-operative natural history as with myocardial fibrosis, cyanotic congenital heart diseaseDue to the surgical suture lines as in Sennings repairDue to post-operative haemodynamics as with right atrial dilatation following classical Fontan surgery, TOF repair.Up to 50% of adult patients who have undergone TOF repair reveal late non-sustained arrhythmias during ambulatory ECG monitoring. Occasionally, symptomatic sustained ventricular arrhythmia is documented in these patients. EP studies have shown these ventricular arrhythmias to be due to re-entry, which requires areas of slow conduction within the myocardium. Pulmonary valve regurgitation seen commonly after TOF repair, results in chronic right ventricular overload and diastolic dysfunction and this has been shown to correlate with QRS prolongation on the ECG. It has also been shown that right ventricular QRS prolongation correlates with a higher incidence of symptomatic arrhythmia and a QRS duration exceeding 180 ms on the resting ECG is the most sensitive predictor of life threatening ventricular arrhythmias .Congenital complete heart block (CCHB) is reported to occur with an incidence of 1 per 25000 live births. When it occurs without an associated underlying heart defect and the diagnosis is made at birth, then the mortality is reported at 15%. The risk of death is significantly less at 3.5% when the diagnosis is made beyond the first year of life. In this study by Michaelsson and Engle, the risk of dying is reportedly greatest in early infancy with half of all deaths occurring early in the first year of life. The overall survival rate was 92% in this group. However, the group with CCHB and associated structural heart defect exhibited a higher mortality of 42.4% in those diagnosed at birth [at birth . Anotherat birth . The ris"}
+{"text": "Dual ventricular response to a single supraventricular impulse is an interesting possibility in the  presence of dual atrioventricular nodal physiology. Double His bundle and ventricular responses to a single atrial impulse caused by a simultaneous fast and slow pathway conduction is the hallmark of this condition. One of the earliest descriptions of simultaneous conduction through both atrioventricular (AV) nodal pathways was by Csapo G , who desThe major determinants of simultaneous anterograde fast and slow pathway conduction during sinus rhythm are: 1) Retrograde unidirectional block in both pathways 2) Critical conduction delay in the slow pathway and a long enough His-A interval to allow sequential conduction of impulse from both pathways . The criA mistaken diagnosis of atrial fibrillation may be entertained if the dual response is intermittent. Dixit S et al  found thNon-reentrant supraventricular tachycardia due to 1:2 AV conduction has been described between 44 - 74 years of age and with duration of symptoms of up to 7 years . It may Even tachycardiomyopathy secondary to non-reentrant atrioventricular nodal tachycardia has been described recently . TreatmeIn this issue of the journal Laszlo R et al  describe"}
+{"text": "We report on an atrial tachycardia (AT), emanating from the non-coronary (NC) aortic cusp, ablated with the aid of an electro-anatomical navigation system. In this setting, the electrocardiographic, electrophysiologic (EP), anatomical, and ablative considerations are discussed.Although NC aortic cusp focal ATs are an uncommon EP finding, their ablation is effective and safe, especially from an atrio-ventricular (AV) conductive point of view. This origin of AT must be invoked and systematically disclosed when a peri-AV nodal AT origin is suspected, in order to avoid a potentially harmful energy application at the vicinity of the AV conductive tissue. A 37 year-old woman, without any structural heart disease, was referred to our institution for management of symptomatic supra-ventricular tachycardia. Three anti-arrhythmic drugs had failed before the patient was considered for catheter ablation. Baseline 12-lead electrocardiogram (ECG) and echocardiogram were both normal. After written informed consent was obtained, an EP study was undertaken. A narrow complex tachycardia was easily induced by simple catheter manipulation . Upon ceIt has been shown that the right and left aortic coronary cusps can give rise to ventricular tachycardia ,2 while On the other hand, the fact that the interatrial septum and the NC aortic cusp are immediately adjacent 5], led some investigators to postulate that some aborted AT ablations presumed to emerge from the peri-AV nodal region could have been in fact related to a NC aortic cusp origin . Accordi, led somWhen mapping the posterior and left-sided aspects of the NC aortic cusp, large atrial electrograms must be recorded whereas, when the catheter approaches the commissure with the right coronary cusp, His bundle electrograms and large ventricular electrograms appear. Although, atrial NC aortic cusp atrial electrograms have been described as fractionated ,7 in ourTypically, NC aortic cusp focal AT 12-lead ECG shows positive P waves in V1, while an anterior tricuspid valve origin or/and a RA appendage origin, both exhibit a negative P wave pattern in V1 . InteresRegarding the energy used for NC cusp ablation, recent publications, either experimental or clinical, have assessed the security of standard RF energy, cooled-tip RF energy and cryothermal ablation -8. In ouConcerning electroanatomical navigation systems, although non-indispensable, they can depict comfortably the activation of all the chambers mapped and allow the reproducible repositioning of the ablation catheter at the \"spot of interest\". These systems have therefore the potential to render easer the ablation procedures. Moreover, merging the computed tomography of the heart with the electro-anatomic reconstruction may add further information, enhance the understanding of the complex anatomic relationship between structures, and increase safety at the level of coronary cusps ,10.Finally, the distance between the ablation catheter and the origin of the coronary arteries should be absolutely disclosed by means of a prior coronary angiogram, in order to avoid a serious coronary complication .Although ATs originating from the NC aortic cusp are uncommon, their ablation is feasible and safe. NC aortic cusp ATs must be invoked and systematically disclosed when a peri-AV nodal AT origin is suspected, in order to avoid a potentially harmful energy application at the vicinity of the AV conductive tissue."}
+{"text": "Mahaim fiber exhibits atrio-ventricular node like properties and generally is localized at the lateral aspect of the tricuspid annulus. Of the varying methods for localization, ablation at the site of Mahaim potential is the most accepted and successful method. Radiofrequency ablation of Mahaim fiber has high success rates. Mahaim fiber tachycardia is not an uncommon cause of wide QRS tachycardia in young having no structural heart disease. Mahaim and Winston were the first to describe Mahaim fiber, as a tract, which connects the atrio-ventricular (AV) node to the ventricular myocardium . It was  Mahaim Fiber conducts only antegrade and has decremental conduction property. Due to its AV node like EP property it is also known as an ectopic AV node ,8. MahaiAnatomically Mahaim Fiber is located at the lateral tricuspid annulus in most instances. Location of the pathway in occasional cases may be variable along the tricuspid annulus especially when associated with Ebstein's anomaly which is a common associated structural anomaly along with Mahaim fiber tachycardia ,11,14-20Once Mahaim fiber related tachycardia is confirmed by EP study, mapping is generally performed along the lateral tricuspid annulus, which is the most common localization site. Because of their conduction properties and anatomic location, it is difficult to map both the proximal  and distal (ventricular) insertion of Mahaim fibers. Mahaim fibers do not conduct retrogradely so the proximal insertion cannot be identified by ventricular pacing. They tend to have generally a long course and often show extensive arborization over a wide area of ventricular muscle making ablation at the ventricular insertion site difficult . There a Mahaim (M) potentials  appear aMechanical trauma induced loss of conduction via Mahaim fiber has also been described. Mahaim fiber is located very close to the endocardium and thus catheter movement related mechanical trauma resulting transient loss of conduction is not uncommon. Mapping and RF ablation guided by this method has been useful ,20. UninActivation mapping of the earliest local ventricular potential targeting distal branches is a time consuming task. It is possible to ablate some of them using this technique but mostly a complete elimination is very unlikely. Some patients with atriofascicular pathway who underwent ablation at the distal insertion had developed a pro-arrhythmic response with facilitation of antidromic tachycardia occurrence due to slow conduction induced by radiofrequency ablation ,10. Also Shortest interval from stimulus to ventricular activation is defined as the shortest interval between the pacing sites at different sites at the RA side of the tricuspid annulus to the earliest preexcited QRS. The result of RF ablation at the site of the shortest interval has remained inconsistent as seen in various studies and varies from 0 to 100% -20.  ThiSimilar to the previous technique, atrial extra-stimulus mapping during antidromic tachycardia is a time consuming method for finding an atrial site where the longest coupled premature extra-stimulus causes resetting. The site in the atrial annulus with the least interposing tissue separating it from the accessory pathway proximal insertion is obtained which is a suitable site for attempting ablation.Electro-anatomic mapping ,24 can b \"Mahaim\" automatic tachycardia (MAT), is generally brought about during radiofrequency current delivery , though Ablation catheter should be moved slowly and carefully along the annulus, avoiding bumps on the tissue so as to avoid a mechanical trauma and accidental loss of preexcitation, for which long sheaths can be used for improving stability. Ablation, if possible, should be done during atrial pacing. Stability is improved during atrial pacing as compared with ablation during antidromic tachycardia when catheter is likely to move with tachycardia termination. MAT can also cause catheter displacement and therefore atrial pacing during ablation is beneficial. Also radiofrequency current applied during atrial pacing increases preexcitation and hence make it easier to assess conduction block.In occasional patients in spite of all attempts to localize the pathway, ablation may not be successful ,20. This Coexistence of other tachycardias, especially atrioventricular nodal reentrant tachycardia (association of up to 10-40%) and WPW syndrome due to Kent bundle has been described in literature ,14,16-20Summarizing, Mahaim fiber exhibits AV node like properties and generally is localized at the lateral aspect of the tricuspid annulus. Successful ablation of the accessory pathway is achieved using varying methods, the most successful being the site of the M Potential. MAT is generally obtained along with a successful ablation. Radiofrequency ablation of Mahaim Fiber has a high success rate."}
+{"text": "In Wolff-Parkinson-White Syndrome (WPW), presence of accessory pathways causes various tachyarrhythmias that lead to different symptoms and clinical conditions in patients. Atrial fibrillation is observed in about 20-30% of this group of patients. Life threatening malignant ventricular arrhythmias and sudden cardiac deaths are observed in patients having rapid conduction in accessory pathways and short antegrade refractory periods (<250 msn). We present a WPW syndrome case that presented to the emergency service with narrow QRS tachycardia and later developed malignant ventricular arrhythmia. A 32 years old male with no previous cardiac evaluation and clinical complaints presented to the emergency service with palpitation. Due to narrow QRS complex tachycardia, emergency service physicians  administWPW syndrome is a clinical entity characterized by presence of an electrical signaling accessory pathway between atrium and ventricular that may cause tachyarrhythmia's sometimes and sudden cardiac death. Studies have shown that SCD occurs at the rate of 0.15% per year in patients with WPW. These deaths are caused by atrial fibrillation with rapid ventricular response that leads to ventricular fibrillation (VF) .The most frequently encountered tachycardia in WPW syndrome is the reentrant tachycardia. The degeneration of reciprocating tachycardia to atrial fibrillation is not uncommon . It has Risks factors for sudden death in WPW are presence of more than one AP, development of AVRT along with AF and the shortest preexcitation RR interval less than 260 msn ,2,7. DevAs a result, Using AV node suppressive medicines in patients with WPW syndrome may cause atrial fibrillation followed by development of fatal cardiac arrhythmias. We believe that it is important to acquaint all the clinicians, especially the emergency service and ambulance physicians who are the first to face SVT patients in daily practice, with this issue."}
+{"text": "We describe a patient with an implanted pacemaker for impaired AV conduction who presented with  an incessant tachycardia. EP study showed that the tachycardia was atrioventricular nodal reentrant tachycardia (AVNRT) with repeated spontaneous initiation because of poor or absent antegrade fast pathway conduction. Slow pathway ablation was successful in terminating the tachycardia and making it non-inducible. During a follow-up visit in the pacemaker clinic, a 45-year-old male complained of persistent palpitations for the past 2 months. He had undergone implantation of a permanent single chamber pacemaker with a ventricular lead 18 years back for trifascicular block with intermittent complete heart block and had subsequently undergone pulse generator replacement twice. His heart rate in the clinic was 130 bpm. Echocardiogram showed normal LV function without any abnormalities. He was not on any drugs. Electrocardiogram showed a broad complex tachycardia with a right bundle branch block (RBBB) morphology, 1:1 ventriculo-atrial (VA) association and a short RP interval. An electrophysiology study was planned in view of the persistent tachycardia.In the electrophysiology lab, he had tachycardia at the beginning of the procedure. The tachycardia could be easily terminated with ventricular overdrive pacing, and on termination of the tachycardia he was found to have sinus rhythm with a PR interval of 380 ms and broad QRS of RBBB morphology. However, tachycardia would always reinitiate spontaneously after a few beats of sinus rhythm . During Intracardiac electrograms during tachycardia showed 1:1 VA association with VA interval of 95 ms and central atrial activation. RV overdrive pacing at a cycle length (CL) slightly shorter than the tachycardia CL showed a ventricle-atrium-ventricle (VAV) response on termination of pacing with post pacing interval 216 ms longer than the tachycardia cycle length and VA interval was 150 ms longer than stimulus-atrial (SA) interval, all consistent with typical slow-fast atrioventricular nodal reentrant tachycardia (AVNRT) .Due to the incessant nature of the tachycardia, mapping had to be performed in tachycardia in the region of the slow pathway guided by fluoroscopy and electrograms. Ablation near the os of the coronary sinus was accompained by junctional beats. Post ablation, patient remained in sinus rhythm. AH and HV intervals were 228 ms and 50 ms respectively. Atrial programmed stimulation showed no dual pathway physiology and tachycardia could not be induced with atrial premature stimuli or burst pacing.AVNRT usually presents as a paroxysmal form of tachycardia with each episode lasting for a short period of time. We could find only one report of incessant presentation of AVNRT . In pati"}
+{"text": "Major spontaneous variation in cycle length during supraventricular tachycardia is quite an uncommon phenomenon, which sometimes can mislead a correct diagnosis. We describe a patient who developed spontaneous variation in cycle length during electrophysiologic study in whom the coronary sinus cannulation was extremely difficult. In this situation, careful inspection of the mechanisms associated with this variation and classic pacing maneuvers are important to make a correct diagnosis of the supraventricular tachycardia. Major cycle length (CL) variations are unusual in supraventricular tachycardia. These variations can occur due to several mechanisms, which are not always obvious . In patiA 20-year-old man underwent EPS for evaluation of recurrent palpitations. Baseline 12-lead electrocardiogram was normal. Catheter positioning induced a sustained narrow QRS complex tachycardia with 1:1 ventriculo-atrial (VA) relationship. Coronary sinus (CS) cannulation was extremely difficult due to anatomical reasons and could not be performed in the beginning of the study. During the tachycardia, there was a spontaneous change in CL from 346 to 265 ms. A significant QRS voltage alternans was also observed . What arMinor CL variations are frequently seen during supraventricular tachycardia, but oscillations above 15 ms are unusual. These changes can occur by a variety of mechanisms, particularly due to autonomic influences. In a re-entrant mechanism, a shift in either the antegrade or the retrograde limb, or a change in the conduction time along these limbs can contribute to the CL change. In tachycardias due to enhanced automaticity, either a shift in the automatic focus or varying degrees of exit block from the focus can contribute to the change in CL -5.In the beginning of tachycardia CL 346 ms), the AH, HA and VA intervals are 198 ms, 175 ms and 107 ms respectively. When the tachycardia CL changes (265 ms), the intervals are 118 ms, 150 ms and 105 ms respectively. So, it is possible to conclude that the change in tachycardia CL is predominantly due to change in conduction along the antegrade limb, which is in this case the AV node. Additionally, retrograde atrial activation sequence remains the same during the CL change. These findings are highly suggestive of a change in the antegrade conduction through the AV node. Overdrive ventricular pacing was done to entrain the tachycardia and the response on stopping the entrainment was VAV: further evidence against AT. The post pacing interval minus tachycardia cycle length (PPI-TCL) was 126 ms and the difference  was 96 ms. Also there is evidence of progressive fusion during tachycardia entrainment by ventricular pacing. These findings are in favour of a pathway as the tachycardia mechanism.  . W ms, the The present case illustrates an ORT using a concealed left lateral bypass in a patient with dual AV node physiology, which has been previously reported .  The inThe challenging component of this case was the significant delay in CS cannulation, which can make the diagnosis difficult. The tachycardia was successfully terminated by accessory pathway ablation. Moreover, AV nodal slow pathway ablation strategy could be considered even in patients with no inducible AVNRT in special populations  in order to reduce the risks due to multiple EPS for recurrent arrhythmias .Although the exact mechanism associated with change in tachycardia CL is unknown, it is suggestive that antegrade conduction modification through the AV node was the causal factor. AV node accommodation is possible, but not the most probable explanation for the change in CL, since a gradual increase in heart rate would be expected . Thus, a"}
+{"text": "Atrial premature beats are frequently diagnosed during pregnancy (PR); supraventricular tachycardia (SVT)  is less frequently diagnosed. For acute therapy, electrical cardioversion with 50\u2013100 J is indicated in all unstable patients (pts). In stable SVT, the initial therapy includes vagal maneuvers to terminate tachycardias. For short-term management, when vagal maneuvers fail, intravenous adenosine is the first choice drug and may safely terminate the arrhythmia. Ventricular premature beats are also frequently present during PR and benign in most of the pts; however, malignant ventricular tachyarrhythmias  may occur. Electrical cardioversion is necessary in all pts who are in hemodynamically unstable situation with life-threatening ventricular tachyarrhythmias. In hemodynamically stable pts, initial therapy with ajmaline, procainamide or lidocaine is indicated. In pts with syncopal VT, VF, VFlut or aborted sudden death, an implantable cardioverter-defibrillator is indicated. In pts with symptomatic bradycardia, a pacemaker can be implanted using echocardiography at any stage of PR. The treatment of the pregnant patient with cardiac arrhythmias requires important modifications of the standard practice of arrhythmia management. The goal of therapy is to protect the patient and fetus through delivery, after which chronic or definitive therapy can be administered. Both supraventricular and ventricular tachyarrhythmias are not uncommon during pregnancy.2 However3911et al.[et al.[Supraventricular or ventricular tachyarrhythmias can become more frequent during pregnancy or they may develop for the first time. An incre1et al. reportedl.[et al. studied l.[et al. In womenl.[et al. Similar l.[et al.21et al.[P = ns) and sinus tachycardia (heart rate >100/min)  were relatively rare, whereas there was a high frequency of sinus arrhythmias in both groups . Isolated atrial premature beats (APB) were seen in 56% in G I and 58% in G II (P = ns), complex APBs  or SVT  were observed rarely. Isolated ventricular premature beats (PVC) were recorded in 49% G I and 40% G II patients (P = ns), whereas the incidence of multifocal PVCs was higher in G I (12%) than in G II (2%) (P < 0.05). Ventricular tachycardia (VT) or ventricular fibrillation (VF) were not recorded in any of the patients.[Shotan et al. assessedpatients.Before initiating therapy, it is important to correctly diagnose the type and mechanism of the underlying arrhythmia so that the proper therapeutic modalities can be implemented. The pregnant patient with arrhythmias usually seeks medical attention because of palpitations, light-headedness, shortness of breath or anxiety. Clues for correct diagnosis and treatment come from findings during physical examination and correct analysis of the electrocardiogram (ECG). Knowing the ECG features of the different types of narrow (QRS width <0.12 s) or wide (QRS width >0.12 s) tachycardias are of extreme importance to obtain ECG documentation of the arrhythmia so that the pregnant woman can receive the correct treatment.Intrauterine, all types of arrhythmias can occur. They are frequently intermittent and may disappear until delivery or the neonatal period.23 Fetal 2428et al. documented intrauterine arrhythmias with the use of fetal electrocardiography in 1968. Currently, fetal echocardiography is the best method and remains the cornerstone for in utero diagnosis of arrhythmias.[The description of intrauterine AFlut by Carr and McLure in 1931 is probably the first published report. Blumenthal hythmias. For diffsyst < 100 mmHg). Clinical studies of verapamil in pregnant women have not demonstrated adverse effects on either the patient or the fetus. However, intravenous administration of verapamil carries a risk of precipitating maternal hypotension and secondary hypoperfusion. In addition, verapamil is capable of causing fetal bradycardia, high-degree AV block and hypotension. Pregnancy is also related to an increased frequency of arrhythmias in previously asymptomatic patients with Wolff- Parkinson-White syndrome.[Narrow-QRS tachycardia is a cardiac rhythm with a rate faster than 100 beats/min and a QRS duration of <0.12 s. The pati33syndrome. Thereforsyndrome. There arsyndrome. In a versyndrome.Any arrhythmia can occur in the pregnant woman, and the frequency and symptomatic severity of arrhythmias may be increased during pregnancy. Although atrial fibrillation (AF) and atrial flutter (AFlut) are very frequent arrhythmias in adult non- pregnant patients, AF and AFlut are unusual in the absence of structural heart disease. ObviouslAtrial premature beats (APB) in pregnant woman with structurally normal hearts are benign. Atrial pOne of the most important problems in intensive care, emergency medicine and cardiac rhythmology are to take care of pregnant patients with recurrent VT, ventricular flutter or VF. Management of cardiac arrest due to life-threatening ventricular tachyarrhythmias is essential to prevent sudden cardiac death in the mother and the fetus. However, treatment of the underlying arrhythmia requires a correct diagnosis. This is possible in the majority of patients using a 12-lead surface electrocardiogram.Since a drug given for the treatment of SVT may be deleterious to a patient with VT, the differential diagnosis of a broad QRS tachycardia is critical. Wide-QRS complex tachycardias (QRS duration >0.12 s) often pose a difficult diagnostic and therapeutic problem. Errors aAlthough sustained (duration >30 s) VT is rare in pregnant women, there are some reports that VT (when occurring) originates in the patient with a normal heart mainly from the right ventricular outflow tract. Idiopath45Life-threatening ventricular fibrillation (VF) or ventricular flutter (VFlut) can occur in any stage of pregnancy and is associated with a high risk of sudden cardiac death. In patients with VF or VFlut, DC defibrillation is the method of choice (100-360 J). Prompt cardiopulmonary resuscitation and early defibrillation by either DC-countershock or an automated external defibrillator (AED) significantly improve the likelihood of successful resuscitation from VF. For longVentricular premature beats (VPB) in pregnant woman with structurally normal hearts are benign and therapy is usually not necessary. Patient P = ns). Intrauterine death was 8.0% in fetal AFlut and 8.9% in fetal SVT (P = ns).Management of fetal arrhythmias is very difficult and requires cooperation of different consultants . The problem with fetal tachyarrhythmias is the risk of hydrops fetalis and subsequent death. Supravenet al. reported a 25-year-old pregnant woman with persistent fetal tachycardia (rate 267 beats/min) and subsequent hydrops fetalis.[et al. described 3 cases with hydrops fetalis due to supraventricular tachyarrhythmias, successfully treated with amiodarone and digoxin or the combination of digoxin, procainamide and propranolol.[The treatment of fetal arrhythmias is possible by treating the mother or by treating the fetus directly. Antiarrhythmic agents that have been used to treat fetal arrhythmias include digoxin, \u03b2-blocking agents, verapamil, procainamide and quinidine. In addition, in cases of fetal ventricular tachyarrhythmias class I and III antiarrhythmic agents have been advocated.13 Recent fetalis. The womapranolol.et al. described 60 cases with fetal arrhythmias, of which 26 cases (43%) were with hydrops fetalis and 34 cases (57%) without. When tachyarrhythmias were refractory to transplacental treatment, fetal therapy was performed with direct umbilical drug administration.[maternal therapy fails to suppress or sufficiently decreases the rate of fetal tachyarrhythmias, direct drug administration to the fetus is mandatory. Direct fetal treatment regimes have been used that consists of intraperitoneal and/or umbilical intravenous administration of different drugs. In addition, umbilical drug administration allows not only direct treatment but also drug monitoring. Hansmann stration. Of thosestration.56 DespitDuring pregnancy, an increased incidence of maternal cardiac arrhythmias is observed, ranging from clinically irrelevant isolated atrial or ventricular premature beats to debilitating SVT and VT or VF. In all pregnant patients with tachyarrhythmias, evaluation of the underlying etiology and the degree of left ventricular function (dysfunction) is essential. Correct treatment of arrhythmias in the intensive care patient should be based on understanding the causal mechanism. In pregnant women with maternal and/or fetal arrhythmias, therapeutic strategies should be based on interdisciplinary cooperation . In general, acute therapy of arrhythmias during pregnancy is similar to that in the nonpregnant patient. However, special consideration should be given to potential teratogenic and hemodynamic adverse effects on the fetus. With this in mind, a successful pregnancy, for both mother and the fetus, can usually be the result."}
+{"text": "The occurrence of atrial tachycardias (AT) is a direct function of the volume of atrial tissue ablated in the patients with atrial fibrillation (AF). Thus, the incidence of AT is highest in persistent AF patients undergoing stepwise ablation using the strategic combination of pulmonary vein isolation, electrogram based ablation and left atrial linear ablation. Using deductive mapping strategy, AT can be divided into three clinical categories viz. the macroreentry, the focal and the newly described localized reentry all of which are amenable to catheter ablation with success rate of 95%. Perimitral, roof dependent and cavotricuspid isthmus dependent AT involve large reentrant circuits which can be successfully ablated at the left mitral isthmus, left atrial roof and tricuspid isthmus respectively. Complete bidirectional block across the sites of linear ablation is a necessary endpoint. Focal and localized reentrant AT commonly originate from but are not limited to the septum, posteroinferior left atrium, venous ostia, base of the left atrial appendage and left mitral isthmus and they respond quickly to focal ablation. AT not only represents ablation-induced proarrhythmia but also forms a bridge between AF and sinus rhythm in longstanding AF patients treated successfully with catheter ablation. Atrial fibrillation (AF) is no longer a formidable rhythm since ablationists challenged this notorious arrhythmia more than a decade ago in their unprecedented quest for sinus rhythm (SR) . AblatioBased on our observation and also that of others, the likelihood of occurrence of ATp is probably a function of the volume of tissue ablated for AF. Importantly, recent expansion of AF ablation has caused a surge in the incidence of ATp. Incidence of ATp after PV isolation has been variably reported from 2.9% to 10% . NotablyThe Working Group Report classified atrial flutter/tachycardia into macroreentrant and focal, the clinically relevant categories . It is oATp can occur intraprocedurally and/or postprocedurally (early or delayed). There is a mechanistic difference between the ATs occurring intraprocedurally and postprocedurally. It has been observed that the mechanism of ATp depends upon the clinical type of AF and the ablation strategy, to a great extent.Using a stepwise approach to ablation of longstanding AF, PV isolation is followed by electrogram-based atrial defragmentation. During this stage of ablation, usually, there is an increase in the AF cycle length (AFCL) compared to baseline AFCL. Often, at this very stage, AF converts into slower atrial tachycardia or flutter (CL \u2265 200\u2009ms approximately). Thus, AT is observed as a transitional rhythm from AF to SR before the third and final step of linear ablation is undertaken . Such inAfter performing AF ablation, usually, variable degree of inflammatory state exists in the atria. It takes about 6\u201312 weeks to form a fibrous scar at the site of ablative lesion. Post-AF ablation, this is usually observed as a blanking period marked by transient but recurrent nonclinical atrial arrhythmias. As inflammation heals, inhomogeneous areas of nonuniform scar interspersed with healthy and/or partially damaged atrial tissue emerge . Thus, aIn contradistinction to intraprocedural ATp which occur before linear ablation, most of the post procedural ATp develop after linear ablation of longstanding AF.It has been observed that the volume of tissue ablation probably dictates the incidence of ATp. The volume of tissue ablated is directly related to the clinical type of AF. In paroxysmal AF, PV isolation is enough to cure AF in majority of the patients. Since the lesions are limited around PV ostium in the antrum, the PV ostia are the likely sites of focal ATp. Moreover, circumferential lesions involve higher volume of tissue than segmental lesions explaining a substantial contribution of the former to the rising incidence of ATp.For longer lasting forms of AF, wherein circumferential PV isolation is combined with linear ablation in the roof, posterior left atrium or posterolateral mitral isthmus, macroreentry is established most likely around the mitral annulus or ipsilateral pulmonary venous antrum. Mitral annular and roof dependent flutters are the consequential ATp in the same order of frequency. Cavotricuspid isthmus (CTI) dependent ATp is another likely macroreentrant tachycardia although it is the least common variety.Localized circuits get established in small areas most commonly at the venous ostia , left septum, mouth of left atrial appendage (LAA), posterior left atrium and posterolateral mitral isthmus . Such localized small circuits give rise to focal ATp from these sites. Left atrium (LA) adjoining anterior mitral annulus is an uncommon site of focal ATp , 22. UnlClinically, the diagnostic and localizing value of surface ECG is debatable in atrial tachycardias arising after ablation. Since, the magnitude and direction of vector of atrial activation are tremendously influenced by the differential conduction velocity and low voltage areas of extensively ablated atria, surface P waves do not provide consistent information on the mechanism of ATp and the location of focal ATp. Therefore, regular ECG clues cannot be applied effectively to patients subjected to extensive ablation of the atria.In the electrophysiology laboratory, it is important to diagnose the mechanism underlying ATp to achieve successful termination. As a preliminary step, it is important to acquire the information on previously ablated sites and determine if clear end point  had been achieved. If patient is in SR during the repeat procedure, the evaluation for completeness of previously performed PV isolation should be the first step. If there is any evidence of PV reconnection, PV isolation should be completed before targeting other areas. If linear ablation involving CTI was performed previously, bidirectional block should be reconfirmed. Repeat ablation may be attempted to ascertain block.During ongoing tachycardia, we adopt and recommend a three-stepped approach  to diagnUsing the electrograms recorded from LAA and coronary sinus (CS) for one minute, the mean cycle length and the range of variation in cycle length over 1 minute is assessed. If the variation is >15% of the mean cycle length, focal mechanism is the most likely diagnosis. On the other hand, variation <15% does not rule out focal mechanism. In the latter situation, next step should be used to diagnose or rule out macroreentrant ATp.perimitral ATp is the most likely possibility  and the anterior and posterior walls activate low to high, counterclockwise (or clockwise) sibility . roof dependent ATp rotating counterclockwise (or clockwise) around the antrum of right PVs is the most likely possibility. If the left atrial activation pattern is lateral to septal both anteriorly and posteriorly and the anterior and posterior walls activate low to high and high to low (or vice versa), respectively, roof dependent ATp rotating counterclockwise (or clockwise) around the antrum of left PVs is the most likely possibility. From therapeutic standpoint, we do not need to categorize roof dependent circuit as right or left , respectively,  or left . CTI dependent flutter would be septal to lateral and low to high both on the anterior and posterior walls. In contrast, clockwise CTI dependent flutter would demonstrate high to low activation on the anterior and posterior walls of the left atrium. The left atrial activation pattern in typical counterclockwise Entrainment of ATp is a confirmatory step in the diagnosis of macroreentry. Importantly, if the ATp is entrained from three (at least two segments to avoid inadvertent termination or conversion to another tachycardia due to rapid pacing) distinct atrial segments  with postpacing interval (PPI) < 30\u2009ms at each of the sites, macroreentry is confirmed. If this is not the case, macroreentry is ruled out and focal tachycardia is the only possible diagnosis.Considering that macroreentrant ATp would usually represent one of the following three: (1) mitral isthmus dependent flutter , (2) roof dependent flutter, and (3) cavotricuspid isthmus dependent flutter, let us deductively infer each of these possibilities based on left atrial and CS activation patterns.The atrial activation pattern reflects the direction of centrifugal propagation of ATp from the focal source. In a single tachycardia cycle, the activation pattern of CS  and the left atrial activation pattern  which do not conform to macroreentrant mechanism provide a useful guide for mapping the focal source. Recording fragmented electrogram spanning over 50\u201375% of tachycardia cycle length is suggestive of site of localized small circuit . The entrainment response for focal ATp is characteristically distinct from macroreentry. Of note, in contrast to macroreentrant circuit which is spread over more than one atrial segment, small circuit can be localized to one atrial segment only. On entrainment, PPI continues to get shorter as pacing site gets closer to the focus. This phenomenon provides an important guide to segmental localization of focal ATp . PPI < 3In contrast to typical focal ATs arising in normal hearts, focal ATp demonstrating automatic mechanism of initiation and maintenance of tachycardia is less commonly encountered in post-AF ablation patients. High variability in AT cycle length is characteristically described for automatic tachycardias with spontaneous onset and offset with gradual warm up and decline, respectively. The centrifugal atrial activation pattern can be helpful in mapping the source of the focus. Instead of continuous low voltage fragmented local activity on electrograms, a sharp and high voltage presystolic potential with high negative dV/dT monophasic (QS shaped) unipolar electrogram will be obtained at the site of origin of AT. Entrainment of automatic ATs is not feasible. Overdrive pacing of automatic tachycardias will have a variable response from the same site of pacing. Postoverdrive pacing recovery time of automatic focus is highly variable. As against it, fixed postpacing interval can be obtained after entrainment of focal AT due to localized reentry.Three dimensional electroanatomical mapping systems are not indispensable for diagnosis and ablation of ATp. For those who are conversant with the fluoroscopic anatomy of atria and their venous inputs and perform electrogram guided ablation of ATp expeditiously, 3D systems do not offer any specific advantage in majority of the cases. Very often, more than one ATp sequentially occurs before restoration of SR. Conversion of target tachycardia to another tachycardia will entail reconstruction of activation maps every time it happens. Besides, after building the maps, entrainment maneuvers cannot be dispensed with for establishing and/or confirming the diagnosis. Moreover, critical areas of low amplitude signals may be ignored as noise. This can cause disparity between clinical tachycardia and reconstructed electroanatomical map especially for localized reentrant ATp. Though it is a matter of operator preference, 3D systems are not essential for ATp ablation. Instantaneous multielectrode epicardial mapping systems have the advantage of building atrial activation maps within 8\u201310 minutes noninvasively. Sustenance of tachycardia is not mandatory. Preprocedural diagnosis regarding the mechanism and source of ATp may be obtained noninvasively. However, clinical utility in this area will require validation.Usually, AF ablation is undertaken in patients who fail to respond to drug therapy. The response to drug therapy may improve postablation in patients with recurrent AF. However, ventricular rate gets faster during ATp than AF. Often, ATp is very stable and sustained. Patient tolerance is worse for ATp than AF for such reasons. Though there are no randomized trials involving drug therapy in ATp, it is observed that ATp do not effectively respond to the drugs. On the other hand, ablation offers cure for the arrhythmia. Consequentially, catheter ablation is preferred over medical management for ATp.The ablation of focal ATp is accomplished more easily than the diagnosis. The reverse holds true for macroreentrant ATp. Successful termination of target tachycardia is the common endpoint for both the types of ATp. Conversion of target tachycardia to another tachycardia with same/different cycle length and different atrial activation pattern is frequently encountered before eventual restoration of SR. Therefore, close monitoring of electrograms during tachycardia ablation is very important. Finer changes in activation pattern and cycle length may be the only subtle clues towards requirement of repeating diagnostic maneuvers including the entrainment response.Focal ATp are ablated at the site of origin. Using saline irrigated tip catheter and a target temperature upto 42\u00b0C, radiofrequency energy with power of upto 30\u2009W can be delivered for 30\u201360 seconds at each point with continuous monitoring of electrograms. Transient acceleration of tachycardia following the commencement of energy-delivery may occur when ablation is localized at the right spot. If tachycardia fails to terminate or convert to another tachycardia after at least 60\u2009s of energy delivery, further mapping is performed to localize a better site for ablation. Macroreentrant ATp are targeted by performing linear ablation. CTI ablation is performed conventionally for CTI dependent flutters. Linear ablation of the left atrial roof is performed by joining the ostia of two superior pulmonary veins at the most cranial aspect of LA. It terminates both the right and the left sided roof dependent flutter. Perimitral flutter is targeted by performing linear ablation at the posterolateral mitral isthmus. Ablation of mitral isthmus is performed by withdrawing the catheter from the ventricular side of the mitral isthmus  to the left inferior PV. Ablation within the CS on the epicardial side of the mitral isthmus is performed when bidirectional conduction block cannot be achieved across the isthmus after at least 20 minutes of endocardial energy application. Power of up to 35\u2009W endocardially and upto 25\u2009W epicardially is required to achieve transmural lesion in most resistant cases. The endpoint is creation of line of complete block. Confirmation of bidirectional block is undertaken following restoration of SR.Block across the mitral isthmus linear ablation is demonstrated by differential pacing from distal and proximal CS dipoles sequentially and recording the time of activation in LAA. If LAA activation is earlier with proximal CS pacing than more distal CS pacing, it is suggestive of unidirectional block. If subsequent pacing from LAA shows that the activation in CS proceeds from proximal dipole distally, it is conclusive of bidirectional block . EstimatUsing the algorithm mentioned above, 97% ATp were diagnosed in less than 11 minutes of mapping duration in a recently published report from our center. Incoherent mapping due to widespread areas of altered electrogram characteristics/scars and noninducibility after inadvertent termination of tachycardia caused difficulty in diagnosis. All the diagnosed cases were treated successfully. Complete line of block at mitral isthmus, left atrial roof and CTI was achieved in 95%, 97%, and 100% cases, respectively. At follow-up of 21 \u00b1 10 months, recurrence of sustained ATp was observed in 5%. After repeat ablation procedure, SR was maintained in 95% patients .It is proven beyond doubt that ATp is partly an iatrogenic proarrhythmia. Since the volume of ablation drives the probability of occurrence of ATp, limiting the ablation within the atrium can help reduce the incidence of certain forms of ATp. Judicious use of ablative energy can help minimize the incidence of reentrant and focal ATp. Macroreentrant ATp develop frequently in patients with incompletely blocked previous linear ablation. Ensuring that bidirectional block is achieved and documented after linear ablation can prevent recurrent macroreentry. An important lesson learnt from AF ablation procedures is that application of energy unscrupulously and indiscriminately is not helping cure AF. Therefore, limiting ablation to achieve isolation of PVs in paroxysmal AF and PV isolation plus necessary defragmentation and linear ablation in persistent and long lasting forms of AF can retard the epidemically growing pace of ATp.In the era of AF ablation, there is an increase in the incidence of both macroreentrant and focal ATs. Extensive substrate modification generates focal areas of slow conduction and low voltage capable of sustaining localized reentry, a novel mechanism of reentrant atrial arrhythmias post-AF ablation. ATp is also the final common pathway towards restoration of SR in catheter ablation of long lasting AF. Ascertaining bidirectional block after linear ablation and minimizing the volume of tissue ablation can help reduce the incidence of ATp. Using conventional tools and electrogram guidance for catheter ablation, deductive algorithm presented here can meticulously diagnose and cure ATp."}
+{"text": "Plasmodium chabaudi has proven of great value in the analysis of fundamental aspects of host-parasite-vector interactions implicated in disease pathology and parasite evolutionary ecology. However, the lack of gene modification technologies for this model has precluded more direct functional studies.The rodent malaria parasite in vitro culture methods to yield P. chabaudi schizonts for transfection and conditions for genetic modification of this rodent malaria model are reported.The development of P. chabaudi gene-integrant lines that constitutively express high levels of green fluorescent protein throughout their life cycle have been generated.Independent P. chabaudi is now possible. The production of genetically distinct reference lines offers substantial advances to our understanding of malaria parasite biology, especially interactions with the immune system during chronic infection.Genetic modification of  Plasmodium have led to substantial advances in malaria research [Plasmodium gallinaceum, followed by Plasmodium falciparum [Plasmodium berghei [Plasmodium yoelii [P. berghei has been the focus for the development of technical advances in transfection [The development of transfection technologies in research -3. The flciparum ,5. Howev berghei -9, and h berghei -13. Stabm yoelii  but P. bsfection .P. berghei causes a rapid and virulent infection leading to widespread tissue pathology and early death without effective host immune control making the investigation of host adaptive immune responses and chronic malaria infections challenging [P. berghei clones limits its use as a model for investigations of the evolution and ecology of host-parasite interactions [P. berghei through the mosquito vector occurs at lower temperatures (18\u201321\u00b0C) and is longer (21 days) than transmission of human or other rodent malaria parasites (> 24\u00b0C for 10\u201314 days) and P. falciparum. This may influence studies of parasite biology and development in the vector as parasite-vector interactions are sensitive to temperature .P. chabaudi could provide a more relevant model for investigating anti-malarial host immune responses because infections are usually controlled by host immunity .  chronic -26. Alsodynamics -30. In aa models .P. chabaudi will, therefore, provide opportunities for experimental and analytical advances in fields as diverse as immunology and evolutionary ecology. This paper presents the first report of the generation of fluorescent P. chabaudi lines that constitutively express high levels of Green Fluorescent Protein (GFP) throughout their life-cycle.The development of gene transformation technologies for i.p. with 1 \u00d7 107 P. chabaudi parasites from clone AJ4916. 500 \u03bcl of blood containing ring and early trophozoite-stage parasites were collected by cardiac puncture at 3 days post infection (5\u201310% parasitaemia). Parasites were cultured for 17\u201318 hours at a 1.5% dilution in complete culture medium  containing 25% heat inactivated foetal calf serum (Gibco), at pH 7.25) in the presence of 10% O2, 5% CO2, 85% N2, at 32\u00b0C in upright 200 ml flasks (Ikawa) in a horizontal shaking incubator at 30 rpm. Parasitized blood forming a layer at the bottom of the flask was gently removed and centrifuged at 1500 rpm for 30 sec. 5 \u03bcl of pelleted cells (1 \u00d7 106 schizonts) were used per transfection.To obtain parasites for transfection, male MF1 mice (10 weeks) were infected Gfp was introduced into the genome of P. chabaudi parasites, using the PbGFPCON plasmid previously described [2O was added to 100 \u03bcl of Amaxa nucleofectortm test solution 88A6 (Basic Parasite Nucleofectortm solution 2) in the manufacturers' cuvette (Amaxa Biosystems). 5 \u03bcl of schizont mix was added and electroporation was carried out in an Amaxa nucleofectortm using program U33. After electroporation, 50 \u03bcl of pre-warmed complete culture media was added and the transfection mix was immediately injected i.v. into an MF1 mouse. Recipient mice received 35 \u03bcg/ml pyrimethamine in their drinking water (pH 3.5\u20135) for seven days post infection; the minimum pyrimethamine dose required to clear P. chabaudi infections of clone AJ in 24 hours . Giemsa-stained smears were scanned every one to two days and parasites that produced patent infections (days 14\u201320) were immediately passaged to further mice for the production of stabilate stocks.escribed . 5 \u03bcg ofssu-rrna locus at the 5' region, amplification was carried out with primer Pc5'F (TTGTAAGAACGTGCTTGGTG) that is specific for P. chabaudi ssu-rrna sequence on P. chabaudi genome contig827, in the target region, and primer Pl5'R (TTCCCAGTCACGACGTTG) that anneals to P. berghei d-ssu rrna sequence in the PbGFPCON plasmid. To demonstrate integration into the contig827 ssu-rrna locus at the 3' region, amplification was carried out with primer Pc3'R (AGAGCCCAGCGATGAC) that is specific for P. chabaudi contig827 ssu-rrna sequence in the integration site, and primer Pl3'F (CAATGATTCATAAATAGTTGGAC) that anneals to P. berghei d-ssu rrna sequence in the PbGFPCON plasmid. To demonstrate the presence of tg-dhfr sequence, amplification was carried out with primers L190 (CGGGATCCATGCATAAACCGGTGTGTC) + L191; CGGGATCCAAGCTTCTGTATTTCCG. To amplify circular PbGFPCON plasmid, amplification was carried out with primers PlF2 (AATCATGACTTCTGTCACTGC) and Pl5'R. Primers Pc5'R and Pc3'R anneal specifically to sequences within P. chabaudi contig827 ssu-rrna and not to sequences within the PbCON vector. Probe template for the detection of tgdhfr by Southern blots was amplified using primers L190/L191. DNA was digested with HindIII and NheI, transferred to Hybond N+ membrane (Amersham) and hybridized according to the manufacturers methods. Wet preparations of live parasites expressing GFP were visualized using Openlab digital imaging (Improvision). The development and progression of parasitaemia in transformed parasites was compared to the wild type ancestor by following six mice infected with 106 parasitized red blood cells for each line. Infections were monitored daily to collect red blood cell density and parasitaemia data until day 14 post infection, when the acute phase parasites had been cleared. The infection dynamics of the two lines were analysed using linear mixed-effects models, which account for repeated measures across infections. One mouse from each line was euthanized (day 10 and 11) so these infections did not contribute data for the whole time course.For genetic analysis of the integration locus, DNA was isolated as previously described  and SoutPlasmodium is thought to be the free merozoites, released at schizogony, that are not surrounded by red blood cell cytoplasm and membranes.P. berghei may, therefore, be relatively amenable to genetic transformation because schizonts developing in reticulocytes do not rupture in in vitro culture conditions, so high numbers can be purified. These rupture, releasing merozoites, during electroporation. In contrast, P. chabaudi schizonts, developing in mature red blood cells, do not arrest in culture and cannot be purified in such large numbers. For this reason, the transformation efficiency of P. chabaudi is likely to be considerably lower that that of P. berghei. The major improvements in rodent malaria parasite transformation efficiency obtained with the Amaxa Nucleofectortm technology [P. chabaudi schizonts suggested to us that transformation of P. chabaudi may now be possible.The optimal stage for DNA uptake by chnology , howeverP. chabaudi schizonts, the in vitro culture protocol described by Mackinnon et al [P. chabaudi ring-stage parasites/young trophozoites develop over 17\u201318 hours into a population of parasites that contain > 10% mature schizonts  for selection of transgenic parasites  between the P. berghei d-ssu-rrna target region and P. chabaudi ssu-rrna sequences on genome contig827, indicating that these are orthologous loci. Linearized PbGFPCON DNA was introduced into the parasite genome by electroporation and recombinant parasites that express tghfr were selected by treatment with pyrimethamine.To obtain appropriate numbers of on et al  was adaps Figure . Schizonette pyrR for seleCON cassette into the P. chabaudi genome was confirmed by PCR analysis in four independent lines and line '2.3' was selected for further genetic and phenotypic analysis. In P. chabaudi line 2.3, PbGFPCON integrated into the genome of contig 827 rRNA subunit, orthologous to the P. berghei c or d-ssu-rrna that have previously been shown to be non-essential genes in rodent malaria parasites [Integration of the PbGFPin vivo asexual dynamics of line 2.3 was not significantly different to wild type P. chabaudi AJ4916 ancestral parasites that had undergone comparable numbers of passages = 0.02; P = 0.901). The patterns observed throughout infections were similar, though parasitaemia of line AJ4916 was significantly lower on days 8 and 9 post infection  = 4.96; P < 0.0001). The lines did not differ in the patterns or the average levels of anaemia they caused  = 0.001; P = 0.975). Although reversion to the wild-type genotype was observed at a low rate after multiple blood-stage passages, all Pc-GFPCON (line 2.3) parasites observed at day 8 of infection were GFP-positive.The Plasmodium chabaudi is reproducibly accessible for genetic transformation at an efficiency that is sufficient for genomic integration of introduced genes. The development of technologies that allow disruption or modification of gene expression in P. chabaudi, thus, opens the way for direct functional analysis of parasite proteins throughout both acute and chronic stages of an in vivo malaria infection, including those that have been implicated in modulation of the host immune response [P. chabaudi parasite lines also offers the opportunity for imaging of direct interactions between the parasite and host cells within a variety of host tissues.response . The genGFP: green fluorescent protein; Tgdhfr: Toxoplasma gondii Dihydrofolate reductase.The authors declare that they have no competing interests.Both authors conceived and designed the project and prepared the manuscript. SR prepared and characterized parasites and JT undertook the transfection and molecular analyses. All authors read and approved the final manuscript."}
+{"text": "The homeostatic control of the cellular proteome steady-state is dependent either on the 26S proteasome activity or on the lysosome function. The sex hormone 17\u03b2-estradiol (E2) controls a plethora of biological functions by binding to the estrogen receptor \u03b1 (ER\u03b1), which is both a nuclear ligand-activated transcription factor and also an extrinsic plasma membrane receptor. Regulation of E2-induced physiological functions  requires the synergistic activation of both transcription of estrogen responsive element (ERE)-containing genes and rapid extra-nuclear phosphorylation of many different signalling kinases . Although E2 controls ER\u03b1 intracellular content and activity via the 26S proteasome-mediated degradation, biochemical and microscopy-based evidence suggests a possible cross-talk among lysosomes and ER\u03b1 activities. Here, we studied the putative localization of endogenous ER\u03b1 to lysosomes and the role played by lysosomal function in ER\u03b1 signalling. By using confocal microscopy and biochemical assays, we report that ER\u03b1 localizes to lysosomes and to endosomes in an E2-dependent manner. Moreover, the inhibition of lysosomal function obtained by chloroquine demonstrates that, in addition to 26S proteasome-mediated receptor elimination, lysosome-based degradation also contributes to the E2-dependent ER\u03b1 breakdown. Remarkably, the lysosome function is further involved in those ER\u03b1 activities required for E2-dependent cell proliferation while it is dispensable for ER\u03b1-mediated ERE-containing gene transcription. Our discoveries reveal a novel lysosome-dependent degradation pathway for ER\u03b1 and show a novel biological mechanism by which E2 regulates ER\u03b1 cellular content and, as a consequence, cellular functions. While protein synthesis always requires gene transcription and mRNA translation, cells have evolved different physiological mechanisms to regulate proteolysis and thus protein turnover. Indeed, degradation of intracellular proteins occurs via targeted  26S proteasome activation and extra-cellular proteins are eliminated through a vesicular system that ultimately addresses them to the lysosomes. Remarkably, in recent years, this notion has been refined by the recognition that also intracellular soluble proteins can be shuttled to lysosomes for degradation via a non-vescicular system. Thus, beside the homeostatic control of protein turnover, the regulatory mechanisms of proteostasis networks could represent also master organizers of signal transduction circuits The functions of the cellular proteome are controlled by a homeostatic steady-state, which is granted by the balance between protein synthesis and degradation   e.g., ERK/MAPK; PI3K/AKT)  and the realization of the E2-induced cellular effects both in cell lines  e.g., cell migration) The estrogen receptor \u03b1 (ER\u03b1) is a ligand-activated transcription factor that belongs to the nuclear hormone receptor super-family. ER\u03b1, together with the other receptor subtype (ER\u03b2) mediates the pleiotropic effects of the sex hormone 17\u03b2-estradiol (E2) that include many physiological processes such as growth, development, and differentiation. In particular, the E2:ER\u03b1 complex molecular actions are a function of ER\u03b1 intracellular localization: in the nucleus, the activated ER\u03b1 drives transcription not only of those genes that contain the estrogen-response element (ERE) within their promoters but also of non-ERE-containing genes through the stimulation of the activity of specific transcription factors  also controls E2-induced ER\u03b1 degradation The existing paradigm defines that the E2-dependent control of ER\u03b1 intracellular concentration contributes to the regulation of the pleiotropic effects elicited by E2 in several target tissues. Regulation of ER\u03b1 stability depends on the activation of the 26S proteasome and is intrinsically connected with the ability of the E2-activated receptor to regulate gene transcription i.e., MCF-7 and T47D-1 mammary adenocarcinoma cells). Our results indicate that ER\u03b1 degradation requires lysosomal function in addition to the 26S proteasome activity and that lysosomes are implicated in the regulation of the E2-depedent signalling to cell proliferation.In addition to 26S proteasome, some relationships among lysosomes and ER\u03b1 have been reported in different cell lines In order to understand a potential interplay among lysosomes and ER\u03b1, we started by investigating the 26S proteasome-dependent ER\u03b1 degradation. To this purpose adenocarcinoma (MCF-7) cells were treated for 2 hrs with E2 in the presence or in the absence of the pre-treatment with different doses of Mg-132, an inhibitor of 26S proteasome activity . As expeThese data confirm that ER\u03b1 breakdown is regulated by the 26S proteasome but additionally suggest the presence of other degradation mechanisms in the control of ER\u03b1 intracellular levels.i.e., Sp-1 ER\u03b1) Because we observed that the 26S proteasome activity is only partially required for E2-induced ER\u03b1 degradation, we next studied the role of lysosomes in the control of ER\u03b1 intracellular level. To fulfil this task, we evaluated if ER\u03b1 could localize to lysosomes by employing an ER\u03b1 antibody, which highlights cytoplasmic ER\u03b1 in breast cancer cells , which recognizes an epitope located within the ER\u03b1 N-terminus. Confocal microscopy analysis demonstrated that the anti-ER\u03b1 Sp-1 antibody stains MCF-7 cells both in the nucleus and in the cytoplasm while anti-ER\u03b1 D12 antibody stains only the nucleus of MCF-7 cells . ER\u03b1 barely co-localizes with LAMP-2 and lysotraker in MCF-7 cells under basal conditions while E2 treatment determines a time-dependent increase in cytoplasmic co-localization of ER\u03b1 with either lysosomal markers that reached a maximum after 2 hrs of hormone treatment  with increased ER\u03b1 cytoplasmic localization  that barely affect MCF-7 cell viability , a drug that inhibits lysosomal enzymes by changing endosomes and lysosomes internal pH iability  induced iability  and timeiability  dependeniability \u2019 and 3E.iability .The change in endosomal pH caused by chloroquine has also the consequence to impede the fusion of endosomes to lysosomes Altogether, these data strongly indicate that cytoplasmic ER\u03b1 is addressed to the lysosomal compartment in an E2-dependent manner and that lysosomal function is implicated in the control of ER\u03b1 cellular content.Because ER\u03b1 degradation contributes to E2-induced ER\u03b1 gene transcription in vitro and in vivoIt is now accepted that the extra-nuclear plasma membrane localized ER\u03b1 directs the activation of the rapid E2 signalling e.g., cyclin D1) and in parallel up-regulate the level of the anti-apoptotic and pro-survival protein Bcl-2 Many groups including our own have clarified that the E2-induced ER\u03b1 extra-nuclear activity is required for E2-induced cell proliferation. In particular, the E2-dependent activation of ERK/MAPK and PI3K/AKT pathways control the transcription of specific cell cycle regulated genes  do not affect breast cancer cell viability and are the minimum sufficient amount that determines the time- and dose-dependent (Also in ER\u03b1-containing cells the exposure to 17\u03b2-estradiol (E2) results in a ligand-dependent reduction of the total receptor content. In this way, E2 determines the amount of ER\u03b1 intracellular levels by controlling receptor turnover and synchronizes ER\u03b1 activities with the cellular response. The mechanism underlying ER\u03b1 elimination requires the activation of the 26S proteasome. Indeed, both apoER\u03b1 and E2-activated receptor undergo proteasomal degradation ependent  accumulaependent , a membrependent . In turni.e., 10 \u00b5M)  was observed in lysososmes of HepG2 cells by electron microscopy Accordingly, we report here that lysosomes contribute to the E2-dependent control of ER\u03b1 intracellular content . Indeed,, 10 \u00b5M) , which a, 10 \u00b5M)  and [28], 10 \u00b5M)  and time, 10 \u00b5M)  E2-inducThe accumulation of ER\u03b1 observed in the presence of the lysosome-distrupting function drug chloroquine rapidly occurs after E2 administration (30 min) and remains significant up to 8 hrs of hormone treatment , possibli.e., anti-ER\u03b1 Sp-1 antibody) {i.e., H2_NES - Nessi) that is abundantly and artificially located in the cytoplasm {i.e., up to 2 hrs) also induces a progressive reduction in the co-localization of the ER\u03b1 with the EEA1  that originate from the plasma membrane feed in the endosomes e.g., lysosomes; nucleus). In this respect, published evidence suggests both an active mechanism for E2 internalization into cells and an endocytic shuttling for the membrane-localized ER\u03b1 Another finding presented here is the fact that the cytoplasmic ER\u03b1 localizes at the lysosomes . This stthe EEA1 . In parathe EEA1 , occurs.the EEA1  further In conclusion, the findings reported here reveal a novel role for lysosomes in E2-induced ER\u03b1 degradation as well as in those ER\u03b1 activities required for E2-dependent breast cancer cell proliferation. Remarkably, our data, together with the recognition that the activity and the cellular concentration of the receptor for glucocorticoids are at least in part under the control of lysosomes Human breast adenocarcinoma cells (MCF-7 and T47D-1) \u22128 M), Mg-132 (1 \u00b5M), chloroquine (Clo) (10 \u00b5M) or EGF (1 \u00b5g/ml). Cell number counts, protein extraction, biochemical assays were performed as previously described Cells were grown in 1% charcoal-stripped fetal calf serum medium for 24 h and then stimulated with E2 at the indicated time points; where indicated, inhibitors  were added 30 min before E2 administration. Unless otherwise indicated, cell were treated with E2 (10The pcDNA 3.1 flag-ER\u03b1 was previously described 5\u2032-CATCGACGTCCCTCCAGAAGAG-3\u2032 (forward) and 5\u2032-CTCTGGGACTAATCACCGTGCTG-3\u2032 (reverse), for human cyclin D1 5\u2032- AACTACCTGGACCGCTTCCT-3\u2032 (forward) and 5\u2032- CCACTTGAGCTTGTTCACCA-3\u2032 (reverse), for human cathepsin D 5\u2032-GTACATGATCCCCTGTGAGAAGGT-3\u2032 (forward) and 5\u2032-GGGACAGCTTGTAGCCTTTGC-3\u2032 (reverse), for human progesterone receptor (PR) 5\u2032-AAATCATTGCCAGGTTTTCG-3\u2032 (forward) and 5\u2032-TGCCACATGGTAAGGCATAA-3\u2032 (reverse), for human GAPDH 5\u2032-CGAGATCCCTCCAAAATCAA-3\u2032 (forward) and 5\u2032-TGTGGTCATGAGTCCTTCCA-3\u2032 (reverse). Total RNA was extracted from cells using TRIzol Reagent  according to the manufacturer\u2019s instructions. To determine gene expression levels, cDNA synthesis and qPCR were performed using the GoTaq 2-step RT-qPCR system  in a ABI Prism 7900 HT Sequence Detection System  according to the manufacturer\u2019s instructions. Each sample was tested in triplicate, the experiment repeated twice and the gene expression normalized for GAPDH mRNA levels.The sequences for gene-specific forward and reverse primers were designed using the OligoPerfect Designer software program . The following primers were used: for human pS2 MCF-7, T47D-1 and ER\u03b1-transfected HeLa cells were plated and stained as previously described i.e., vinculin or tubulin) intensity. In all analyses, p values <0.01 were considered significant, but for densitometric analyses where p was <0.05. Data are means of at least three independent experiments +/\u2212 SD.A statistical analysis was performed using the ANOVA test with the InStat version 3 software system . Densitometric analyses were performed using the freeware software Image J by quantifying the band intensity of the protein of interest respect to the relative loading control band  or lysotracker (B) both in the presence and in the absence of E2 (10 nM\u20132 hrs). Figures show one unique confocal plane. All co-staining procedures were described in details in the Material and Methods section. (C) Time course analysis of T47D-1 cells treated with E2 (10 nM) at the indicated time points both in the presence and in the absence of chloroquine (Clo\u201310 \u00b5M). Loading control was done by evaluating vinculin expression in the same filter. Figure shows representative blots of three independent experiments. (D) Western blot analysis of cyclin D1 (Cyc D1) and Bcl-2 expression levels in T47D-1 cells treated with E2 (10 nM\u201324 hours) both in the presence and in the absence of chloroquine (Clo\u201310 \u00b5M). Loading control was done by evaluating tubulin expression in the same filter. Figure shows representative blots of three independent experiments.(TIF)Click here for additional data file.Figure S2H2_NES ER\u03b1 characterization. (A) Schematic of the point mutations introduced in the hinge region of the ER\u03b1 (TIF)Click here for additional data file."}
+{"text": "Visceral leishmaniasis is a lethal parasitic disease transmitted by phlebotomine sand flies. The largest focus of VL in Ethiopia is located in the lowland region bordering Sudan, where the epidemiology is complicated by the presence of thousands of seasonal agricultural workers who live under precarious conditions.We conducted two parallel case-control studies to identify factors associated with VL risk in residents and migrants. The studies were conducted from 2009 to 2011 and included 151 resident cases and 157 migrant cases, with 2 matched controls per case. In multivariable conditional regression models, sleeping under an acacia tree at night (odds ratios (OR) 5.2 [95% confidence interval 1.7\u201316.4] for residents and 4.7 [1.9\u201312.0] for migrants), indicators of poverty and lower educational status were associated with increased risk in both populations. Strong protective effects were observed for bed net use . For residents, living in a house with thatch walls conferred 5-fold and sleeping on the ground 3-fold increased risk. Among migrants, the risk associated with HIV status was borderline significant and sleeping near dogs was associated with 7-fold increased risk.Preventive strategies should focus on ways to ensure net usage, especially among migrant workers without fixed shelters. More research is needed to understand migration patterns of seasonal labourers and vector bionomics. Visceral leishmaniasis is a lethal parasitic disease transmitted by sand flies. The largest focus of VL in Ethiopia is located in the lowland region bordering Sudan, where hundreds of thousands of agricultural workers migrate for work every year during the planting and harvest seasons. We conducted two parallel studies in residents and migrants to determine the living conditions and behaviors that put people at higher risk of VL risk. We found that sleeping under an acacia tree at night, indicators of poverty and lower educational status were associated with increased risk in both populations. Sleeping under a bed net was protective. For residents, living in a house with thatch walls and sleeping on the ground increased risk of VL. Among migrants, the risk associated with HIV status was borderline significant and sleeping near dogs was associated with increased risk. Preventive strategies should focus on ways to ensure net usage, especially among migrant workers without fixed shelters. More research is needed to understand migration patterns of seasonal labourers and vector behavior. Leishmania donovani has also been found in dogs and wild mammals in Sudan and Ethiopia Visceral leishmaniasis (VL) is a lethal parasitic disease transmitted by phlebotomine sand flies. The typical clinical picture is a chronic systemic illness with fever, weight loss, splenomegaly, hepatomegaly, and bone marrow suppression with pancytopenia. East Africa is second only to the Indian subcontinent in annual VL incidence Phlebotomus orientalis, found in association with cracked black cotton-clay soils and acacia-balanites forest In 2005, a new VL epidemic was reported in Libo Kemkem in the highlands of north-western Ethiopia, where only a handful of cases had been reported in the past The studies were conducted in Kafta-Humera district, Tigray regional state, bordered on the west by Sudan, and on the north by the Tekez\u00e9 River which separates Ethiopia from Eritrea . Kafta-HThe study protocols were approved by the ethical review committees of the Ethiopian Public Health Association (resident protocol) and the Tigray Regional State Health Bureau (migrant protocol). Each adult participant provided written informed consent. A parent or guardian provided consent on behalf of child participants. All research activities adhered to the principles expressed in the Declaration of Helsinki. Approval to record existing hospital data on HIV status was given only for the migrant protocol; these data are therefore missing for the resident protocol.Because the resident and migrant populations differed substantially in terms of practical options for valid control selection and some aspects of exposure history, we performed the two investigations independently. An effort was made to maintain key variables in both investigations, but the difference in living circumstances required some questions to be worded differently.M\u00e9decins Sans Fronti\u00e8res (MSF)-Holland until to June 2009. After June 2009, responsibility for VL treatment was assumed by regular hospital staff. This hospital is the main VL treatment facility for the area and treated 348 VL cases in 2009, 505 in 2010 and 405 in 2011. For both studies, VL case definitions followed the hospital diagnostic algorithm. A past VL case was a patient with at least 2 weeks of fever plus weight loss and/or splenomegaly, diagnosed by KAH based on positive DAT  or rK39 dipstick and treated with antileishmanial drug with clinical resolution of symptoms; or a patient with Leishmania amastigotes demonstrated in splenic aspirate. A current VL case was a patient diagnosed with illness characterized by at least 2 weeks of fever plus weight loss and/or splenomegaly, plus Leishmania amastigotes in the relevant aspirate and/or positive DAT or rK39 dipstick result. Both studies included 2 controls per case matched by sex and age group . A meta-analysis estimated rK39 and DAT sensitivities of 79% and 93% in East African studies, with specificities of 85% and 96% respectively Cases were ascertained for both studies at the Kashay Aberra Hospital (KAH) which contained a VL treatment center operated by We used a community-based strategy to recruit controls for the resident study. Because a community-based approach was impossible for the migrant study due to the transience of the migrants, we recruited controls for this study in the hospital on services other than the VL treatment service. The two studies were therefore conducted independently, although an effort was made to include key variables in both questionnaires. The target sample size was determined in PS  . Based the assumption of 30% exposure among controls, we estimated that 150 cases and 300 controls were required for each study to achieve 90% power, with 95% confidence, and 5% precision to detect a variable with an odds ratio of 1.9. Details specific to each study are included below.kebeles . Controls were selected from the two nearest neighboring houses to the case. Candidate control households were excluded and the next neighboring house selected if there was no household member meeting the age and sex matching criteria, or if there had been a case of VL in the household in the last 5 years. Candidate control individuals were screened with a focused medical history to rule out past or current VL. Those with past VL by history were excluded as controls. Persons with suspected untreated VL found in the course of fieldwork were referred to the hospital for diagnosis and treatment, and were eligible to be included as cases if confirmed.Resident case patients were recruited from May to June 2009. Resident cases were identified both retrospectively from hospital records and prospectively for patients diagnosed during the recruitment period. A line listing of VL patients treated over the previous 12 months was compiled with the collaboration of MSF-Holland and the study team sought patients in the five most affected Cases and controls for the migrant study were recruited prospectively in KAH from October 2009 to February 2011, with recruitment concentrated in the months with higher migrant influx. Migrants were defined as persons living in the area temporarily for economic purposes. Patients who met the VL case definition above and reported themselves to be migrants were eligible to participate. Controls were recruited among migrants presenting to KAH with any condition other than VL or malaria, and were recruited within a week of the corresponding case. Two age-group- and sex-matched controls were recruited for each case. Negative results by rK39 rapid test were required for inclusion. The most common diagnoses among potential controls were malaria, pneumonia, trauma and HIV-related conditions. Potential controls diagnosed with malaria  were excluded.Structured questionnaires were used to collect the data. For the resident study, trained field workers administered the questionnaire under the supervision of study team members. For the migrant study, trained hospital nurses familiar with VL diagnosis and treatment procedures administered the questionnaires. One hospital supervisor coordinated data collection in collaboration with the study team. Data were single-entered in databases designed using Epidata\u00ae software and managed by the study data manager. All questionnaires were reviewed in the field and the database and questionnaire compared by two independent observers. The data were analysed using univariable and backwards stepwise multivariable conditional regression with Wald 95% confidence limits, to account for the matched design in SAS 9.2 . The Kruskal-Wallis test was used for comparison of continuous variables. Variables with p<0.10 in the univariable analyses was tested in multivariable model. Interaction between variables tested using interaction terms.Each study recruited slightly more than 150 VL cases  with two matched controls per case . Among rIn univariate analyses. factors associated with elevated risk in both studies included sleeping outside, on the ground or under an acacia tree , 3 and 4Some significant risk factors were found only in one of the studies. In the resident study, having house walls constructed from grass thatch was associated with an odds ratio of 4.5 compared to walls made from earth or other materials . Data onIn multivariable conditional regression models, both datasets demonstrated elevated risk associated with sleeping under an acacia tree at night (odds ratio (OR) 5.22 [95% confidence interval 1.66\u201316.42] and 4.74 [1.88\u201311.99] for residents and migrants respectively), indicators of poverty  and lower educational status . Strong Although the northern lowland border with Sudan has long been known as the most important VL-endemic zone in Ethiopia, our data represent the first systematic evaluations of risk factors for disease in the area. Several overarching themes emerge from both the resident and migrant data. Poverty and low educational status are strong underlying factors in both studies. Environmental associations also emerged, including sleeping under acacia trees and in more exposed settings . A protective effect of bed net use was seen in both studies, and supports the policy of net use as a control strategy. The massive scale-up of insecticide-treated nets for malaria control launched by the Ministry of Health in 2005 may therefore have collateral benefits for VL control Humera is located near the Eritrean and Sudanese borders, acting as a node for cross-border trade and traffic. An estimated 250,000 migrant workers come to the area each farming season . Many migrants come from the highlands, where until recently there was no reported VL transmission. Return of newly infected migrant workers was hypothesized to have triggered the VL epidemic in Libo Kem Kem and Fogera in the mid-2000s P. orientalis has generally been considered exophilic and exophagic P. orientalis, with high sand fly densities found in association with acacia-balanites forest Risk associated with nocturnal outdoor exposure was also seen in our earlier study in Libo Kem Kem We found no association with animal ownership in our resident analysis, in contrast to findings in Libo where dog ownership was linked to increased risk and Sudan where both dogs and cattle appeared as risk factors for VL The two studies we performed used different recruitment methods for logistical reasons, and this difference may have affected characteristics of the control groups, in particular. The use of village controls, as in the resident study, is generally considered optimal in terms of comparability of case and control groups. We chose resident controls with no history of kala-azar in the household in the previous 5 years, because of the strong household clustering seen in VL, the fact that many of the factors evaluated are household-level variables, and the high likelihood that household members of kala-azar cases might have undetected subclinical VL infection Finally, in our studies as in many others, VL risk was strongly associated with poverty and factors linked to poverty Checklist S1STROBE checklist.(DOCX)Click here for additional data file."}
+{"text": "The endocannabinoid system is comprised of cannabinoid receptors (CB1 and CB2), a group of endogenous neuromodulatory lipids (endocannabinoids), and the machinery for their biosynthesis, metabolism, and transit that are involved in a variety of physiological processes including pain, appetite, memory, inflammatory and immune responses. In the brain, endocannabinoids are primarily involved in retrograde signaling, being synthesized and released from postsynaptic neurons to stimulate CB1 receptors located on the presynaptic neurons. Here, we provide an overview of the current research on the transport of endocannabinoids across plasma membranes and their intracellular trafficking with an emphasis on various potential targets for developing therapeutic drugs.The two most extensively studied endocannabinoids are anandamide (AEA or N-arachidonylethanolamine) and 2-arachidonylglycerol (2-AG). They are believed to be synthesized \u201con-demand\u201d in response to various physiological stimuli to modulate intracellular secondary messengers upon receptor activation. Imbalances in the endocannabinoid system, either in the central nervous system (CNS) or peripheral tissues, is associated with many types of pathologies. In particular, changes in tissue concentrations of anandamide and 2\u2013arachidonoylglycerol have been observed in pain, inflammation, obesity, neurological and immunological disorders.During neurotransmission, stringent regulation of the receptor mediated signaling is required along with rapid removal of the endocannabinoids from the synaptic cleft. A growing body of evidence has shown that endocannabinoids can rapidly cross the plasma membrane followed by carrier-mediated transport to their intracellular sites of sequestration or hydrolysis in different subcellular locations ,2. SeverFor many years it was understood that transport of lipid molecules such as long-chain fatty acids through the cell membrane occurred by passive diffusion. However, a fundamental shift in understanding has occurred and now it is generally accepted that fatty-acids cross the cell membrane by a protein-mediated mechanism involving either specific transporter(s) and/or carrier protein(s). Pharmacological studies  indicateThe structural similarity of endocannabinoids to fatty acids suggests that they may share similar transport mechanisms. Contemporary models based on the characterization of \u201cfatty-acid transporters\u201d are comprised of, but not limited to, plasma membrane-associated fatty-acid binding proteins (FABPs), the cytosolic and circulating FABPs as well as a family of fatty-acid transport proteins FATP 1\u20136). These intracellular carrier proteins can provide potential targets for the development of therapeutics that modulate lipid-signaling pathways. Currently, the functions of individual components of the fatty-acid transporter model are being elucidated, and intracellular carrier proteins that shuttle the endocannabinoid anandamide from the plasma membrane to its intracellular targets have been identified. These include fatty acid binding proteins, albumin, heat shock protein 70, and the fatty acid amide hydrolase-like anandamide transporter protein (FLAT) \u20136. It ha. These iA number of compounds that inhibit the cellular uptake of anandamide have been developed; however, in most cases the mechanism by which they inhibit cellular uptake has yet to be fully determined. Even so, it has been demonstrated that AM404, AM1172, VDM11 and UCM707 as well as OMDM1, OMDM2 and LY2183240, can significantly reduce the cellular uptake of anandamide. Moreover, one or more of these compounds have been found to decrease carcinoma cell proliferation and tumor growth, and are effective in animal models against indicators of inflammation, pain, multiple sclerosis, colitis and anxiety, diarrhea. In addition, both AM404 and VDM11 were found to inhibit the reinstatement of nicotine-seeking behavior in rats, and that AM404 also prevents the development of nicotine dependence in rats. Evidence has also been obtained, from murine models, that AM404 may be effective against obsessive-compulsive disorder. Though AM404 has off-target interactions that inhibit COX-1, COX-2 and prostaglandin synthesis, this compound has been found to reduce signs of visceral pain in mice in a manner that appears to be CB1 receptor-mediated and is a molecule with overall interesting therapeutic effects that make it a candidate for further studies. It has also been reported that SB-Fl-26, an inhibitor of the intracellular fatty acid binding proteins, displays antinociceptive activity in a mouse model of inflammatory pain. Continuing effort in the design and development of pharmacological agents that inhibit anandamide uptake can serve to control lipid-signaling pathways, inflammatory responses and metabolic dysfunction, offering a new class of multi-indication pharmacophore with high potential for future therapeutic applications in the prevention and treatment of metabolic associated disease."}
+{"text": "N-linked glycosylation in all domains of life. In Archaea, this enzyme termed AglB, is responsible for transferring lipid carrier-linked glycans to select asparagine residues in a variety of target proteins including archaellins, S-layer proteins and pilins. This study investigated the ability of a variety of AglBs to compensate for the oligosaccharyltransferase activity in Methanococcus maripaludis deleted for aglB, using archaellin FlaB2 as the reporter protein since all archaellins in Mc. maripaludis are modified at multiple sites by an N-linked tetrasaccharide and this modification is required for archaellation. In the Mc. maripaludis \u0394aglB strain FlaB2 runs as at a smaller apparent molecular weight in western blots and is nonarchaellated. We demonstrate that AglBs from Methanococcus voltae and Methanothermococcus thermolithotrophicus functionally replaced the oligosaccharyltransferase activity missing in the Mc. maripaludis \u0394aglB strain, both returning the apparent molecular weight of FlaB2 to wildtype size and restoring archaellation. This demonstrates that AglB from Mc. voltae has a relaxed specificity for the linking sugar of the transferred glycan since while the N-linked glycan present in Mc. voltae is similar to that of Mc. maripaludis, the Mc. voltae glycan uses N-acetylglucosamine as the linking sugar. In Mc. maripaludis that role is held by N-acetylgalactosamine. This study also identifies aglB from Mtc. thermolithotrophicus for the first time by its activity. Attempts to use AglB from Methanocaldococcus jannaschii, Haloferax volcanii or Sulfolobus acidocaldarius to functionally replace the oligosaccharyltransferase activity missing in the Mc. maripaludis \u0394aglB strain were unsuccessful.The oligosaccharyltransferase is the signature enzyme for  N-glycosylation refers to the covalent attachment of glycans to target proteins at asparagine residues located within a conserved sequon . The oligosaccharyltransferase (OST) is the signature enzyme of the N-glycosylation pathways in all three domains of life [ of life \u20133. In bo of life  and AglB of life , respect of life . Both Pg of life ,4.N-glycosylation pathway in Archaea has been best studied, in terms of both glycan structure and genetic analysis of the biosynthesis and assembly of the glycan, in three distinctive model organisms, namely the methanogen Methanococcus maripaludis, the extreme halophile Haloferax volcanii and the thermoacidophile Sulfolobus acidocaldarius [N-linked glycans in archaea are S-layer proteins [N-glycosylation pathway involves the sequential addition of sugar monomers onto a dolichol-type lipid carrier embedded in the cytoplasmic membrane, followed by a flipping of the lipid-linked glycan across the membrane. Finally, on the external face side of the cytoplasmic membrane, AglB transfers the glycan from the lipid carrier onto the acceptor protein en bloc [N-glycan has been shown to occur in a very limited number of archaeal species [The aldarius ,7,8. Glyaldarius ,9,11. Thproteins \u201314, archproteins \u201319 and pproteins \u201322. The  en bloc . Further species ,25.N-acetyl-glucosamine, N-acetyl-galactosamine or a simple hexose [Mc. maripaludis and Hfx. volcanii, aglB deletion mutants have been isolated [S. acidocaldarius [Among the three domains, it appears that glycan structures as well as the nature of the linking sugar and the lipid carrier are most variable in Archaea . In diffe hexose . The lipe hexose ,24,26\u201330isolated ,12,31 whaldarius .Archeoglobus fulgidus and Pyrococcus furiosus. In in vitro experiments, neither enzyme could process the lipid-linked glycan of the other organism [Haloarcula marismortui, Halobacterium salinarum and Haloferax mediterranei could all functionally replace the oligosaccharyltransferase activity in a Hfx. volcanii \u0394aglB strain. While all of these species are extreme halophiles, their respective AglBs, though structurally similar, all transfer lipid-linked glycans in their native cells that are distinct from that found in Hfx. volcanii. In addition, in at least some cases, the heterologous AglB had to accommodate a different linking sugar or dolichol length to be effective, demonstrating a relaxed specificity of the enzymes.The specificity of AglB for different sugar-donor substrates was first reported for enzymes from organism , indicatorganism . SpecifiaglB [aglB within a given organism indicated that, at least in some cases, distinct versions of the enzyme are present that possess, for example, variations in the catalytic motif WWDXG. Other studies have indicated that not all versions of AglB are constitutively expressed in organisms that have multiple copies [Hfx. volcanii, two distinct N-linked glycans have been reported, depending on the salt concentration of the medium [aglB mutant even though only a single aglB gene is detected in the sequenced genome [aglB with such low sequence similarity to known aglBs that it escaped detection or a novel mechanism/enzyme for the transfer of the low salinity glycan. The presence of multiple AglBs in a single organism, some not constitutively expressed, some with variations in conserved motifs, suggest that they may be involved in different transfer reactions with different substrates. Such is the case in Trypanosoma brucei, where there are three single subunit OSTases, all with distinct donor and acceptor specificities [The overwhelming majority of archaea (166/168 sequenced genomes examined) contain an identifiable aglB , includie copies ,24. In te medium . The trad genome  suggestificities .Mc. maripaludis, N-glycosylation of archaellins  also required for archaella assembly [fla operon, EarA [In rchaella ,39) is crchaella ,40,41. Irchaella . In mutarchaella . In vitrhe donor . While che donor . The latassembly . This ocon, EarA .Mc. maripaludis strain deleted for aglB. This information contributes to the substrate specificity/variability of AglB and may aid in studies designed to use Archaea for glyco-engineering purposes [In this contribution, we examine the ability of several heterologous AglBs to functionally compensate for the oligosaccharyltransferase activity in a purposes ,45.Methanococcus maripaludis S2 \u0394hpt (Mm900) [Methanococcus voltae PS, Methanothermococcus thermolithotrophicus DSM2095 were all grown in Balch Medium III [2/H2 (20:80). Methanocaldococcus jannaschii JAL-1 was grown in the minimal medium described by Ferrante et al. [Mc. maripaludis and Mc. voltae were incubated at 35\u00b0C, Mtc. thermolithotrophicus at 60\u00b0C and Mcc. jannaschii at 80\u00b0C. For complementation studies, Mc. maripaludis \u0394aglB harbouring the various complementation vectors were grown in nitrogen-free medium containing puromycin (2.5\u03bcg/ml) for plasmid selection and supplemented with either L-alanine (10mM) or NH4Cl (10mM) as sole nitrogen source [Escherichia coli Top10 cells , used for various cloning steps, were grown at 37\u00b0C in Luria-Bertani (LB) broth or agar with ampicillin added (100\u03bcg/ml) for plasmid selection when required. (Mm900) , Methanodium III  under a e et al. . Mc. marn source . EscheriaglB in Mc. maripaludis was re-created using pKJ574 and methodology previously reported [aglB-14-9.An in-frame deletion of reported . FollowiaglB, from Mc. voltae (GenBank accession ABD17750), was amplified by PCR  using primers listed in Mc. voltae cells as template. The forward and reverse primers had either NsiI or MluI restriction sites added, respectively. For Mtc. thermolithotrophicus, the aglB sequence has not been previously reported. A BLAST search using the AglB protein sequence from Mc. maripaludis as bait, retrieved WP_018154595 in GenPept as the only hit  in Mtc. thermolithotrophicus DSM 2095. The gene (GenBank accession NZ_AQXV01000054.1) was amplified by PCR  using the primers listed in M. thermolithotrophicus as template. The aglB gene from Mcc. jannaschii (MJ_RS08150) was amplified by PCR  using the primers listed in Mcc. jannaschii as template. The forward primer in this case included a single nucleotide change to remove an internal NsiI restriction site while leaving the amino acid sequence unchanged. The aglB gene from Hfx. volcanii (HVO_RS12050) was amplified by PCR  with the primers listed in Hfx. volcanii aglB and Sulfolobus acidocaldarius aglB (NC_007181.1) were also synthesized with a C-terminal FLAG-tag using Mc. maripaludis codon preferences while avoiding NsiI and MluI sites . Each of the aglB genes was digested with NsiI and MluI and cloned into pHW40 previously digested with the same restriction enzymes to generate the complementation plasmids used in this study  or alanine (nif promoter induced). At least three transfers in nitrogen-free medium supplemented with alanine were done prior to analysis.n method . The com\u0394aglB mutant cells carrying either pKJ1240  or pKJ1251  was extracted using a High Pure RNA Isolation Kit (Roche Life Science), followed with an additional DNase digest using an Ambion\u2122 TURBO DNA-free Kit (Invitrogen). The presence of the aglBsa or aglBhv transcript in the RNA extract was detected using a OneStep RT-PCR Kit (Qiagen) with 10 ng of the total RNA extract as template and the corresponding gene-specific primers listed in \u0394aglB mutant cells carrying either pKJ1240 or pKJ1251 as template and the corresponding gene-specific primer pair, but omitting the reverse transcription step were conducted to rule out the possibility of DNA contamination of the RNA template.Total RNA from \u0394aglB mutant cells carrying plasmid-borne aglBsa (pKJ1240) as template and the aglBhv primer pair and RNA extract from \u0394aglB mutant cells carrying plasmid-borne algBhv (pKJ1251) as template and the aglBsa primer pair to further exclude the possibility of non-specific amplification of the two primer pairs.PCR experiments using pKJ1240 or pKJ1251 as template and the corresponding gene-specific primer pairs were performed to confirm the amplicon size and primer specificity in the RT-PCR. In addition, RT-PCR experiments were also conducted using RNA extract from Mc. maripaludis Mm900, Mc. maripaludis \u0394aglB-14-9 and the various Mc. maripaludis \u0394aglB-14-9 strains carrying complementation plasmids were separated by SDS-PAGE (12.5% acrylamide gels) and transferred to Immobilon-P membrane  and examined by western blotting using anti-FlaB2 specific antibodies, as previously described [4Cl or alanine prior to the western blotting experiments. Detection of FLAG-tagged versions of Hfx. volcanii and S. acidocaldarius AglB in whole cell lysates of the appropriate complementation strains was attempted using anti-FLAG antibodies .Whole cell lysates of escribed . ComplemMc. maripaludis strains after staining with 2% (w/v) phosphotungstic acid, pH 7.0, as previously described [Transmission electron microscopy was performed on the various escribed .http://www.enzim.hu/hmmtop/) [The presence of transmembrane domains in AglB proteins selected for this study was predicted using HMMTOP (hmmtop/) .N-glycosylation pathway in Archaea, namely the transfer of a glycan from its lipid carrier to the target protein [aglB deletion strain in Mc. maripaludis, attempts were made to complement that strain with a wildtype copy of aglB expressed in trans. However, it was not possible to confirm that the expressed wildtype copy of aglB could rescue the deletion strain since the aglB mutant quickly stopped synthesis of FlaB2 upon repeated serial transfers [AglB is the oligosaccharyltransferase that performs the most conserved and critical terminal step in the  protein . Followiransfers . This turansfers .aglB deletion and immediately store aliquots of the mutant, designated \u0394aglB-14-9, at -80\u00b0C while it was still synthesizing FlaB2 that could be detected in western blots. Using pKJ677 expressing wildtype Mc. maripaludis aglB from a nif promoter, it was possible to show complementation of the deleted aglB in the \u0394aglB-14-9 mutant. This was initially demonstrated by western blotting where the faster migrating version of the reporter glycoprotein FlaB2 in \u0394aglB-14-9 was fully restored to wildtype size following growth of the complemented strain in nitrogen-free medium supplemented with alanine, where transcription from the nif promoter is induced  and from other more distantly related archaeal species in which the N-glycosylation system has been best studied, namely S. acidocaldarius and Hfx. volcanii. Successful complementation would also indicate, in cases where it was not yet known (Mtc. thermolithotrophicus and Mcc. jannaschii), that the putative aglB gene did encode an active oligosaccharyltransferase. The topology of AglB proteins include a typical 13 transmembrane helices in the N-termini with extracellular loops between transmembrane helixes, and a soluble C-terminal domain located in the extracellular side of the cytoplasmic membrane where the catalytic site is located [Mc. maripaludis AglB to the other AglBs used in this study is presented in Mc. voltae, the thermophilic Mtc. thermolithotrophicus  and the hyperthermophilic Mcc. jannaschii . These methanogens, as well as Mc. maripaludis, are all stringent anaerobes that grow optimally at neutral pH with 1\u20134% NaCl. Hfx. volcanii is an extreme halophile growing optimally in 1.5\u20132.5M NaCl, at pH 7 and 45\u00b0C. S. acidocaldarius, on the other hand, is a thermoacidophile, growing optimally at 70\u201375\u00b0C and pH 2\u20133. Since the catalytic site in AglB is predicted to be orientated extracellularly [Hfx. volcanii and S. acidocaldarius may have specific adaptations to function in high salt or low pH that would not be required for the methanogen AglBs.To study the promiscuous nature of archaeal AglBs, the  located \u201356. A pallularly , the enzMtc. thermolithotrophicus was most similar to AglB of Mc. maripaludis, being almost 60% identical (and 77.5% similar) and almost identical in length . AglBs from Mc. voltae and Mcc. jannaschii were larger by 65 and 81 amino acids, respectively and slightly less than 50% identical to the Mc. maripaludis enzyme. Most of the extra length in the Mcc. jannaschii enzyme is found in one large insertion of about 70 amino acids (between amino acids 227 and 299), when compared to the Mc. maripaludis AglB. This insertion is predicted to contain 2 additional transmembrane helices, resulting in a total of 15, compared to 13 for AglBs of Mc. maripaludis, Mc. voltae and Mtc. thermothithotrophicus. The AglBs from the two non-methanogens tested, Hfx. volcanii and S. acidocaldarius, were much less similar to the Mc. maripaludis AglB, being only 17.9 and 19.9% identical, respectively. In addition, these two oligosaccharyltransferases were much different in length compared to the Mc. maripaludis AglB. The Hfx. volcanii AglB was almost 200 amino acids larger than the Mc. maripaludis enzyme while that of S. acidocaldarius was almost 100 amino acids smaller.AglB of Hfx. volcanii it is GND and in S. acidocaldarius it is GFD. In all cases, this motif is found in the first extracellular loop in the N-terminus of the protein. The second motif, WWDXG, is necessary for catalysis and found in the extracellular C-terminal domain. In the four methanogens, this motif is identical, WWDNG, while in both Hfx. volcanii and S. acidocaldarius the sequence of this motif is WWDYG. Most variation is found in the third motif, the DK (DXXK or the relaxed version DXXMXXX(M/I)) or MI (MXXIXXX(I/V/W) motif [N-linked glycosylation sequon (N-X-S/T) and is found adjacent to the WWDXG motif in the tertiary structure of the enzymes. The DK motif is found in most AglB proteins (as well as in eukaryotic Stt3) although variations in the motif have been reported in terms of an insertion of 4\u201314 amino acids that interrupts the DK motif in some archaea (DXXMX(4\u201314)K), including in certain extreme halophiles. Hfx. volcanii AglB has a 5 amino acid insertion here. S. acidocaldarius AglB has the DK motif (DIAK) which is typical of Crenarchaeota. In lieu of the DK motif, some archaea  have an MI motif at the same position which is thought to perform the same function as the DK motif. This is the case for the four methanogens in this study. The three key amino acids are conserved in all four cases (MXXIXXXW) although there is some variation in the X positions  motif . This moositions . Since tMc. maripaludis \u0394aglB mutant, the initial screen to indicate successful complementation was by western blotting after growth of the complemented \u0394aglB-14-9 strain in nitrogen-free medium supplemented with alanine or NH4Cl. Only a limited number of archaeal N-linked glycan structures are known [Mc. voltae has an N-linked glycan structure been reported. It is a trisaccharide with significant similarity to the tetrasaccharide of Mc. maripaludis [N-acetylated. In the case of Mc. voltae, this position is held by an N-acetyl-glucosamine while in Mc. maripaludis the linking sugar in the glycan is N-acetyl-galactosamine. Transformation of the \u0394aglB-14-9 strain with pKJ1229 containing Mc. voltae aglB, followed by growth in alanine supplemented nitrogen-free medium indicated that the Mc. voltae enzyme was capable of restoring the lost oligosaccharyltransferase activity leading to the production of wildtype sized FlaB2s  from a whole genome shotgun sequence (GenBank accession No. NZ_AQXV01000019) with high sequence identity to aglB from Mc. maripaludis. Despite being a thermophile with optimal growth near 60\u00b0C, this gene from Mtc. thermolithotrophicus was able to very effectively restore wildtype size FlaB2  found in the Mcc. jannaschii AglB lacking in the remaining three methanogen AglBs. The lack of complementation may be due simply to the activity profile of the Mcc. jannaschii AglB in regards to temperature. Complementations of the aglB mutant of Mc. maripaludis were done at 35\u00b0C and 40\u00b0C while Mcc. jannaschii grows optimally above 80\u00b0C. Growth of Mc. maripaludis can occur to 45\u00b0C but above 42\u00b0C the reporter protein we use, FlaB2 archaellin, is not made [aglBs were cloned into the same site of the same vector and transcribed from the same nif promoter, we cannot rule out that the lack of activity demonstrated was due to degradation/instability of the expressed Mcc. jannaschii AglB. Furthermore, the lipid composition of the cytoplasmic membrane of Mcc. jannaschii is known to vary considerably depending on the growth temperature. At the low end of its growth range (45\u00b0C), the lipids are mostly typical diethers, but as the growth temperature is raised to 75\u00b0C the proportion of tetraether lipids and a novel macrocyclic diether lipid dramatically increase [Mcc. jannaschii aglB to complement in Mc. maripaludis may thus be due to faulty insertion of the AglB into the strictly diether lipids in the cytoplasmic membrane of Mc. maripaludis [Mc. voltae or Mtc. thermolithotrophicus since both these organisms have membrane lipids that are also diethers [Mtc. thermolithotrophicus, no N-linked glycan structures have been reported for Mcc. jannaschii and, likewise, there are no reports on the structures of dolichol phosphate carriers so it is possible that AglB in Mcc. jannaschii would naturally recognize a unique glycan structure possibly with a different linking sugar or a different lipid carrier and was not able to utilize the Mc. maripaludis versions.All attempts to show complementation of the \u0394ccessful . The fainot made . Howeverincrease . The inaipaludis . This wodiethers . As withaglBs from S. acidocaldarius and Hfx. volcanii , RT-PCR demonstrated that the mRNA for each aglB was present in the respective complementations .The other two failed complementations used the volcanii . These tand AglB . For thentations . Expressreported , Taguchin E.coli . Express degrees . The aglHfx. volcanii, the N-linked glycosylation system is very complicated. Completely different glycans are found depending on the salt content of the growth medium. At high salt (3.4M NaCl), a pentasaccharide  is made [aglB gene is reported for Hfx. volcanii but this AglB is only required for the transfer of the pentasaccharide but not the low salt tetrasaccharide [Hfx. volcanii AglB to that of Mc. maripaludis is much lower (17.9/ 31.0%) than that shown by the Mc. voltae and Mtc. thermolithotrophicus enzymes and the halophile enzyme is much longer. In addition, the DK/MI motif is completely different in halophiles and methanogens. The DK motif has been shown to be catalytically important both in yeast Stt3 [P. furiosus and A. fulgidus [Hfx. volcanii, the sequence is the modified DM version of the motif, DWQMASTDAK. Methanococci have the MI motif at the corresponding position in AglB believed to perform the same role as the DK/DM motif and in Mc. maripaludis the MI motif is MTSIASVW. In PglB of Campylobacter jejuni, the MI motif (MSLIFSTV) has been shown by mutational analysis to be important for catalytic activity with only chemically similar amino acids tolerated at the conserved positions [Hfx. volcanii and not properly folded in the 2% NaCl-containing medium used for Mc. maripaludis. It is also possible that the halophile AglB was misfolded and either degraded or did not insert properly into the cytoplasmic membrane, although the membrane lipids of Hfx. volcanii are diether types like that in Mc. maripaludis [Hfx. volcanii AglB complementation can also be envisioned. One is the difference in the linking sugar in the glycans of Hfx. volcanii and Mc. maripaludis. However, it is known that the Hfx. volcanii aglB can be replaced with aglB from different extreme halophiles that can transfer glycans with either a hexose or N-acetylhexuronic acid as a linking sugar so one would expect that the AglB from Hfx. volcanii would accommodate a GalNAc linking sugar. Another unlikely reason for the failure of the Hfx. volcanii AglB to complement could lie in the nature of the dolichol carrier, but the Hfx. volcanii carrier is C55-C60 dolichol phosphate with saturated isoprenes at the \u03b1 and \u03c9 positions [Mc. maripaludis it is a C55 dolichol phosphate that has two sites of saturation, presumed to be the \u03b1 and \u03c9 positions too [In  is made . The fir is made ,25. Here is made . Intriguccharide . The oliast Stt3  as well fulgidus ,56. In Hositions . Given tositions , it is pipaludis . Other lositions  and in MS. acidocaldarius AglB. In S. acidocaldarius, the N-linked glycan is a complex tri-branched hexasaccharide containing the unusual sulfated sugar, sulfoquinovose and with a linking sugar of N-acetylglucosamine [Mc. maripaludis. Even with an AglB from the much more closely related hyperthermophile Mcc. jannaschii, we were unable to show complementation. Furthermore, in its native environment AglB of S. acidocaldarius would be inserted into a cytoplasmic membrane comprised of tetraether lipids, including ones that could contain up to 4 cyclopentane rings [Hfx. volcanii AglB, the one from S. acidocaldarius shows low sequence identity and similarity to that of Mc. maripaludis (19.9%/34.1%). The S. acidocaldarius AglB has the DK motif (DIAK) rather than the MI motif of Mc. maripaludis AglB. Furthermore, there are potentially significant differences in the substrates encountered. The linking sugar in the glycan of S. acidocaldarius is GlcNAc and not GalNAc as in Mc. maripaludis. In addition, the dolichol carrier normally recognized by AglB in S. acidocaldarius was recently shown to be an unusual, short (C45) dolichol pyrophosphate [S. acidocaldarius AglB towards the Mc. maripaludis dolichol carrier, identified as C55 dolichol phosphate [The other failed complementation occurred with the cosamine . Many pone rings ,68. Cytone rings ,70. As whosphate  and not hosphate  and thishosphate .in vivo experiments with extreme halophiles [in vitro with the hyperthermophiles A. fulgidus and P. furiosus [Mc. voltae AglB to transfer glycans of similar but different composition, including glycans with either GlcNAC or GalNAc as the linking sugar. We have also identified for the first time the AglB from the thermophilic methanogen Mtc. thermolithotrophicus and demonstrate that it can functionally replace the oligosaccharyltransferase activity in the Mc. maripaludis \u0394aglB mutant. As there are currently no published data on the nature of N-linked glycans in Mtc. thermolithotrophicus, it is not possible to state how different the Mc. maripaludis glycan is from that naturally transferred by the Mtc. thermolithotrophicus AglB. We have begun studies to determine the N-glycan attached to archaellins in this thermophilic methanogen to address this issue. Attempts to complement using AglBs from more distantly related and more extremophilic archaea for which data on N-linked glycosylation systems is well known were unsuccessful, although the possible reasons for this are many. The accumulation of data on the relaxed nature of substrates accepted by various AglBs will aid in any efforts to develop archaea as platforms for glycoengineering [This study extends to methanogens the examination of AglB promiscuity previously reported in lophiles  and in vfuriosus . We haveineering .S1 Fig(DOCX)Click here for additional data file.S2 Fig(DOCX)Click here for additional data file.S3 Fig(DOCX)Click here for additional data file.S4 Fig(DOCX)Click here for additional data file.S5 Fig(DOCX)Click here for additional data file."}
+{"text": "Dengue fever is the most important arboviral infection that affects humans, particularly in tropical and subtropical regions. Here, we provide the first comprehensive overview of the severity of dengue epidemics in French Guiana.3 were associated with dengue severity.We monitored hospitalized cases between 2008 and 2013. Detailed clinical features and biological parameters were collected on a daily basis from all cases. Among the 1,356 cases, 216 (16%) were classified according to the WHO 2009 classification as dengue without warning signs (WS), 926 (68%) were classified as dengue with WS and 214 (16%) were classified as severe dengue. The severity rates were similar between the three major epidemics that occurred during the study period, whereas the hospitalization rate was highest in 2013. Fluid accumulation, aspartate aminotransferase (ASAT) counts>193 IU/L and platelet counts<75,000 cells/mmOur findings provide a recent epidemiological description of the severity of dengue epidemics in French Guiana. These results highlight the potential impacts and consequences of implementing the WHO 2009 classification on hospital activity. Future studies should include virological and immunological investigations of well-documented serum samples. Aedes mosquitoes. Recent estimates indicate that dengue fever is the most important arthropod-borne human disease, with infections primarily occurring in tropical and subtropical regions; there are 390 million dengue infections per year worldwide, of which 96 million are clinically apparent , [32\u201362] and [>62]. A quantitative variable \u201cdelta-hemat\u201d was calculated using the equation Between October 2008 and December 2013, 1,356 hospitalized cases were included in the study, of which 243 were hospitalized during the 2009 epidemic, 115 in 2010 and 694 in 2013 . As showAs shown in A comparison of the clinical category distributions revealed an increase in the hospitalization rate in 2013 (4.3% vs. 1.8% in 2009 and 1.3% in 2010) . By cont\u22123). The 2013 epidemic had the highest impact on hospital admissions during the study period, with 694 hospitalizations. However, the duration of hospitalization did not show any significant variation between epidemics , whereas the 2010 epidemic had a lower severity rate (0.3%) . Overallpidemics .3, transaminases level higher than 62 UI/L or a variation in hematocrit levels . The 2009 epidemic was caused predominantly by DENV-1 (67.6%) and DENV-4 (27.0%). DENV-2 was isolated throughout 2010, although the predominance of DENV-1 and DENV-4 were 48.8% and 43.9%, respectively. In 2013, a clear predominance of DENV-2 was observed, representing 96.7% of hospitalized cases. The distributions of the four serotypes were significantly different betweenclinical categories (P = 0.049). The DENV-2 serotype was more strongly associated with dengue severity  than was DENV-1 . DENV-1 was therefore over-represented among dengue cases without WS, whereas DENV-2 was under-represented in this category.Transaminase (ASAT and ALAT) levels progressively increased between days 1 and 5 days of the illness , with daThis study was the first of its kind conducted in French Guiana describing the clinical and biological features associated with hospitalized dengue cases. The five-year system of monitoring hospitalized cases allowed us to describe the dynamics, magnitude and severity of the three epidemics that occurred since 2008. The impacts of the outbreaks on hospital activity were considerable in 2013, moderate in 2009 and minimal in 2010. The hospitalization rate was the highest during the 2013 outbreak (4.2%), which was noteworthy in terms of duration and number of estimated cases.The retrospective implementation of the WHO 2009 classification for both epidemics among hospitalized cases enabled us to compare the severity of the epidemics. Although the number of admissions substantially increased in 2013, the severity rates were similar in 2009 and 2013. These results may be linked to increased awareness due to the WHO 2009 classification recommending that patients with any WS should be admitted for close observation ,24, and Health care policies recommend immediate admission for vulnerable patients  with dengue-like syndrome to avoid severe illness. Professional practices following these recommendations could have explained the small number of infants with severe forms of the disease (7%). In addition, many studies have noted that secondary infection with another serotype could be a risk hazard for SD \u201330. ThisAccording to the univariate analysis, we found that the presence of petechia, epistaxis, clinical fluid accumulation, hepatomegaly, low pulse rate and abdominal pains were associated with SD. At day 5 of the illness, low albuminuria, natremia and serum total protein levels as well as low platelet counts were associated with SD. Patients with SD had higher ASAT and ALAT levels and higher hematocrit variations at day 5 than patients classified with dengue without WS or with WS. We found that low platelet count and transaminases levels were significantly associated with SD. Recent studies regarding the 2009 WHO classification confirmed these results ,32. In aOne limitation of this study was that inclusion was restricted to hospitalized cases, which does not allow us to generalize our findings to all dengue cases. Indeed, our results regarding the factors associated with SD could be different if ambulatory cases were included in the study.One of the strengths of our study was that all hospitalized cases between November 2008 and December 2013 admitted at any of the three hospitals for the whole territory were enrolled ina large study population , giving our results good power and representation. Additionally, a single clinician classified all of the cases, leading to high quality data and avoiding biases related to variations in medical practices. In addition, the daily data collection from the time of admission until discharge allowed us to describe the clinical evolution and to study the clinical and biological features throughout the hospitalization period. We cannot rule out the possibility that clinical signs and symptoms used in the WHO 2009 system may not have been stringently collected prior to its implementation. Nevertheless, clinical features collected during the study period appeared consistent with the proper implementation of WHO 2009 classification.The pathophysiology of SD appears to be multifactorial, entailing complex interactions among viral factors, host genetics and the immunologic background of the host, the most important being prior to exposure to dengue virus. Hyperendemicity with different serotypes is believed to be one of the most significant factors influencing dengue severity . Future We presented a comprehensive epidemiological description of the severity of dengue epidemics in French Guiana. We also identified potential new clinical and biological predictive factors of dengue severity, although further work in identifying other virological and immunological markers is needed to improve our knowledge of the risk factors in French Guiana."}
+{"text": "Degenerative skeletal disorders including osteoarthritis (OA) and osteoporosis (OP) are the result of attenuation of tissue regeneration and lead to painful conditions with limited treatment options. Preventative measures to limit the onset of OA and OP remain a significant unmet clinical need. MicroRNAs (miRNAs) are known to be involved in the differentiation of stem cells, and in combination with stem cell therapy could induce skeletal regeneration and potentially prevent OA and OP onset.The combination of stem cells and miRNA has been successful at regenerating the bone and cartilage in vivo. MiRNAs, including miR-146b known to be involved in chondrogenic differentiation, could provide innovative targets for stem cell-based therapy, for the repair of articular cartilage defects forestalling the onset of OA or in the generation of a stem cell-based therapy for OP.This review discusses the combination of skeletal stem cells (SSCs) and candidate miRNAs for application in a cell-based therapy approach for skeletal regenerative medicine. Degenerative skeletal disorders are specific diseases associated with the ageing bone. These disorders can be divided into two main diseases: osteoarthritis (OA) and osteoporosis (OP). Given OA and OP are the result of the loss of the regenerative capacity of the skeletal tissues, skeletal stem cells (SSCs) have been investigated with the aim of harnessing their potential to improve the symptoms and treatment of these pathologies.OA is a prevalent chronic disease and can be described as a heterogeneous condition, which results in joint signs and symptoms associated with defective integrity of the articular cartilage and changes to the bone at joint margins . ArticulArticular cartilage deterioration and onset of OA could potentially be prevented by repair of the initial articular cartilage defect. A number of research groups have looked to identify the presence of chondroprogenitor cells within the articular cartilage and in tissues directly surrounding the articular cartilage, such as the synovium , the groThe human skeleton reaches peak bone mass at around 30\u00a0years of age and, thereafter, bone mass is gradually lost. OP is a degenerative skeletal disorder, characterised by low bone mass and generalised disorder of the bone microarchitecture. OP is observed in men and women  and is a common cause of loss of bone mass and subsequent fracture . It is eCurrently, OP is treated with drugs which aim to increase bone density or inhibit bone resorption. Strategies include the use of bisphosphonates , 19, selStem cells have been shown to be regulated in part by microRNAs (miRNAs), which regulate genes involved with differentiation post-transcriptionally. MiRNAs are processed from longer primary transcripts which undergo processing in the nucleus and the cytoplasm to form small non-coding RNA, which average 22 nucleotides in length . SequencA stem cell is characterised by its ability to self-renew by means of asymmetrical cell division and its potential to differentiate into specialised types of cells, thereby retaining a pool of stem cells and simultaneously producing transit amplifying cells . Adult sThe term skeletal stem cell (SSC), preferred by the authors and used in this review in reference to our own data defines, specifically, a self-renewing stem cell that resides in postnatal bone marrow and can differentiate into cartilage, the bone, haematopoiesis-supportive stroma and marrow adipocytes. It is the SSC of the bone marrow stroma that is responsible for the regenerative capacity inherent to the bone.The heterogeneous population of cultured plastic adherent cells isolated from the bone marrow should be referred to as bone marrow stromal cells (BMSCs). However, it is acknowledged, the term mesenchymal stem cell (MSC), originally in reference to a hypothetical common progenitor of a wide range of \u201cmesenchymal\u201d  tissues, is commonly used and in this review will be retained where cited/used by others in the field.Additional to their differentiation and proliferative properties, SSCs have been proposed to possess immuno-modulatory properties which can regulate tumour evasion, autoimmunity and regulation of transplantation tolerance . A combiLoss of chondrocytes and diminishment of the surrounding specialised ECM is as a result of the inability for cartilage to undergo spontaneous endogenous regeneration. The use of cell-based therapies to repair articular cartilage defects aims to produce a fully functional joint surface, capable of tolerating stress and strain.Several studies have investigated the potential of SSCs in regenerating cartilage in animal models. For example, Im et al. induced osteochondral defects in to the patella grooves of rabbits, and autologous bone marrow-derived MSCs were applied to the defect sites. Histological and molecular analysis concluded that implantation of cultured MSCs could enhance cartilage repair . In expeA popular choice amongst research groups for investigating articular cartilage regeneration has been transplantation of SSCs combined with a scaffold. Previously, osteochondral progenitor cells expanded in vitro and dispersed into a type-1 collagen gel were transplanted into a full-thickness surgically induced articular cartilage defect in rabbits. At 24\u00a0weeks, the post-implantation subchondral bone was completely repaired with overlying articular cartilage . FurtherPrevious clinical studies have reported the therapeutic effect of MSCs administration in patients \u201348. NejaGiven OP is the result of altered bone remodelling, improving the efficiency or restoration of appropriate balance of this process would appear a natural strategy for the treatment of OP. It is known that SSCs can be induced to form osteoblasts when cultured on tissue culture plastic . HoweverThe use of bone tissue, autograft (patient derived) and allograft (donor), together with bone stem cells and progenitors has been examined. Marcacci et al., in a study of four patients with large bone defects, examined the potential of autologous culture-expanded SSCs onto a ceramic scaffold . No majoIn vitro models of stem cell differentiation have allowed for the analysis of miRNAs involved with post-transcriptional regulation of chondrocyte and cartilage development, as well as osteocyte and bone development. Such miRNAs are responsible for gene activation or suppression during the process of differentiation. A selection of miRNAs and their mRNA targets studied to date, known to be involved in stem cell differentiation, are listed in Table Given that miRNAs display the potential to regulate chondrogenic and osteogenic differentiation of stem cells, harnessing miRNAs offers an appealing strategy for skeletal tissue repair of cartilage or enhancement of differentiation of SSCs towards an osteogenic lineage for bone formation. The potential of miRNAs to augment articular cartilage regeneration has been demonstrated in a study conducted by Lolli and colleagues \u2022\u2022. MiR-2The potential of miRNAs to augment bone formation has been demonstrated in a number of murine studies. With both miR-138 and miR34a, a hydroxyapatite/tricalcium phosphate (HA/TCP) scaffold was utilised in order to localise stem cells subcutaneously. Chen et al. used a similar approach to study the role of miR-34a, which is a negative regulator of bone formation \u2022\u2022. hMSCsLi et al. used a miRNA intravenous therapy approach, without the use of the scaffold, to investigate the role of the positive regulator of osteogenic differentiation, miR-2861, on bone formation in mice . When anALP and OCN expression in photoactivated hADSCs compared to non-UV treated cells. In addition, the specific use of nanoparticle conjugated miR-148b resulted in delivery of miR-148b to the intracellular compartments of hADSCs, without the need for additional, potentially damaging, chemical-based methods of transfecting stem cells.For successful use of miRNA in stem cell therapeutics, it will be important to localise and minimise any miRNA off target effects. Qureshi et al. developed a technique for photoactivation of nanoparticle conjugated miR-148b \u2022; miR-14The problems associated with degenerative skeletal disorders highlighted in this review indicate how miRNA could be used to treat these musculoskeletal conditions. The underlying aetiology of OA remains unknown which makes development of a treatment for this debilitating disease difficult. However, if initial chondral lesions can be targeted, the potential for a preventative approach in OA will become a clinical possibility. If the original chondral lesion can be repaired using stem cells enhanced to undergo chondrogenic differentiation efficiently with use of miRNAs modulation, inducing regeneration of the articular cartilage and reinstating integrity, then the degenerative changes, typical of OA could be reduced. Thus, an attractive approach, with knowledge of different miRNAs expression during chondrogenic differentiation, would be to administer specific miRNAs transfected stem cells to chondral defect sites to enhance articular cartilage regeneration capacity. The bone regeneration balance lost in osteoporosis can benefit from an SSC-based cell therapy which could potentially restore bone microarchitecture and composition to a healthy state. The approach of priming these SSCs with miRNA could lead to enhanced direction of SSCs towards osteogenic differentiation. MiRNAs have been shown to enhance bone formation in murine trials, and known mutations in miRNAs have been identified in human osteoporotic patients. This cell-based approach could be advantageous when applied at early stages of the disease in order to prevent further bone loss and minimise any potential fracture risk that can occur with disease progression. While consideration of miRNAs in skeletal disease therapy is still in its infancy, with considerable research still to be undertaken, the potential for the use of miRNA in a therapeutic context offers an exciting treatment option for a growing ageing population."}
+{"text": "Morbidity and mortality in China are increasingly associated with lifestyle behaviors, e.g., smoking, poor nutritional choices, and physical inactivity. Lifestyle-related non-communicable diseases  are at critical levels globally, in turn their socioeconomic burdens. Knowledge of lifestyle-related health behaviors and beliefs of mainland Chinese would help inform the design and targeting of cost-effective health education for individuals and campaigns in the interests of promoting and protecting health, and preventing disease. This study's objective was to describe the lifestyle behaviors and beliefs of a sample of urban mainland Chinese, and their congruence with evidence-based guidelines for maximal health.A cross-sectional interview questionnaire study was conducted in which 835 mainland Chinese  from four urban areas participated.About half (52%) reported smoking to some degree with 21% being habitual smokers; 33% being above average weight; 62.1% met physical activity guidelines for health benefits; 92% being sedentary for 5.8 \u00b1 3.40 h/d; 66% experiencing moderate/high stress; and sleeping 7.1 \u00b1 1.31 h nightly with 35% reporting sleeping poorly. When standard serving sizes were considered, daily consumption of grains, fruits, and vegetables was reported to be consistent with dietary recommendations for good health, however, added salt (3.7 \u00b1 7.42 tsp) and sugar (3.9 \u00b1 12.99 tsp) exceeded recommendations. Life stress was rated moderate by 59.6% of respondents, with personal and family health stresses ranking highest . Regarding beliefs about importance of lifestyle behaviors to health, respondents' understanding was not consistent with evidence-based recommendations. Only 64% of participants believed smoking abstinence is highly important to health; 56% regular exercise; and 37% consumption of whole grains, 62% fruit and vegetables; and 54% maintaining a healthy body weight.To be congruent with established guidelines for healthy living, health promotion and disease prevention education for individuals and public campaigns warrants targeting health knowledge and beliefs of urban Chinese as well as lifestyle-related health behaviors. The roles of gender, education and living rurally, on lifestyle behaviors and beliefs of the Chinese, warrant elucidation. Such knowledge may help to design, target, and implement health promotion and disease prevention education programs for individuals and the general public in China, with a view to protect health, and reduce the prevalence of lifestyle-related NCDs and their risk factors, and their associated social and economic burdens.2.2.1.A cross-sectional descriptive study was designed based on a structured face-to-face interview questionnaire. The study was reviewed and approved through the ethics review process of the participating institutions. The participants provided signed informed consent prior to their data being included. The target population included adult residents in four urban areas in the Chinese provinces of Hubei, Liaoning, Hebei, and Shanxi. The valid sample size was 835. Of the total of 846, 11 respondents failed to give their ages or volunteers were under 18 years of age. Interviewers (n = 80) were qualified health professionals . At the time of this study, these individuals were students in masters of physical therapy programs. As part of their professional training related to practice competencies, these students were trained to interview people about their lifestyle-related health behaviors and beliefs. Standardized interviewing technique as a clinical competency helped ensure a standardized procedure was instituted including how to address questions. We selected a purposive snowballing sampling method in that student interviewers were asked to recruit at least 10 individuals for interviewing (range 10 to 15). These individuals could be on or off campus, with an emphasis on those they did not know personally. Student interviewers were instructed to inform all respondents not only about the nature of the questionnaire, but also that no identifying information was required. Interviews were conducted within two weeks. Each interview was 30 minutes in duration.2.2.A structured questionnaire was developed based on previous work conducted in Canada The questionnaire was pre-tested on a convenience sample (n = 7) and modifications were made to enhance clarity of the items. More unambiguous mutually exclusive choices were added for items with multiple response options. In the interest of cultural relevancy, the unit of consumption in the dietary section was set to grams. Two proficiently bilingual individuals independently translated the questionnaire into Mandarin. The questionnaire was tested for clarity and comprehension on a sample of four bilingual individuals and revised accordingly.2.3.p values were two-sided and alpha was set at 0.05. The data were analyzed using Statistical Package for Social Sciences .All variables were summarized using standard descriptive statistics including means, standard deviations, and frequencies. Normality of distribution of continuous variables was assessed using the Kolmogorov-Smirnov test. Chi-square tests compared the frequency of those categories of interest. Kendall's Tau-b Tests were performed to determine the association between ordered variables. Mann-Whitney U tests assessed gender differences for physical activity variables. The Kruskal-Wallis test for independent samples assessed level of significance for variables with non-normal distributions. Where statistical significance was observed for the Kruskal-Wallis test, the Mann-Whitney U test with Bonferroni corrections was used for post-hoc analysis. All 2We selected cut-points for recommendations for maximal health status that are established, evidence-based, and commonly reported 3.3.1.2; 655 people (78.4%) were below a BMI of 25, 155 (18.6%) were between 25 and 30, with 22 (2.6%) over 30. In terms of education, 468 respondents (56.1%) held a college/university degree; 299 (35.8%) technical or trade school diploma; and only 62 (7.4%) had no formal education including elementary school education.3.2.3.2.1.p < 0.001), with 27% of men and 74% of women reporting being non-smokers, 40% of men and 22% of women reporting smoking almost never/seldom/sometimes, and 33% of men and 5% of women reporting smoking usually/always. The same pattern of gender difference was apparent when asked about smoking as a means of managing stress (p < 0.001), with 27% of men and 62% of women reporting never doing so, 60% of men and 36% of women reporting almost never/seldom/sometimes; 13% of men and 2% of women reporting usually/always, respectively. Within smokers, men were more frequent users of pipes and cigars than women (p < 0.001).Across respondents, 21% reported being frequent smokers , 48% repp = 0.089). Within smokers, the difference of educational levels was significant in the number of cigars/pipes a respondent smoked daily (p = 0.003), with college/university diploma and high school being in one subset and primary school/no education being in another subset. Also, the number of cigars/pipes smoked per day by respondents with primary/no education was significantly higher than those consumed by respondents with education equal or greater than high school.No association between smoking status and education level was observed (3.2.2.2 (n = 831 reporting) With respect to BMIs, 74% of men and 67% of women were within the healthy range for the Asian population, i.e., 18.5 to 24.9 kg m3.2.3.Analysis of self-reported data on physical activity, exercise, and sitting over the 7 days immediately prior to data collection showed that the participant number within the sample sub-sets is variable given participants' inability to accurately recall the details of their physical activity, exercise, and sitting patterns. Total minutes of physical activity per week (moderate and vigorous) were calculated using the product of minutes per day and days/wk of physical activity engagement reported. In terms of physical activity for health benefits, 734 participants responded to the query of physical activity participation. Of these n = 456 (62.1%) met or exceeded the threshold for health benefits of 150 minutes of moderately-intense physical activity weekly and/or 75 minutes of vigorously intense physical activity (the n = 456 includes n = 134 who met both moderate and vigorous PA thresholds) p < 0.001) and those with elementary or no education (p < 0.001).Mann-Whitney tests showed that males spent more time than females performing vigorous exercise. For those who met physical activity thresholds, the Kruskal-Wallis tests showed no significant differences for weekly minutes of moderate or vigorous physical activity across levels of education . However, in terms of time sitting, college/university educated spent significantly more time sitting compared to those with technical/high school education (p < 0.001).3.2.4.p = 0.045), women in general are more likely to be concerned about family members' sickness than men. Nearly 60% of respondents reported stress in their life was moderately intense, with 57% of men and 63% of women reporting overall stress to be moderate high.Respondents were asked to rate common life stressors on a three-point scale, ranging from little to none (scored as 1) to a great deal (scored as 3) . Of strep < 0.001), although the association is not strong. When the population is stratified into 4 age groups , stress was observed to be negatively associated with age group (p < 0.001), with the youngest group (18\u201334 y) reporting most stress , \u201ceating lots of fruit and vegetables\u201d (p = 0.027), \u201cnot smoking cigarettes\u201d (p = 0.002), and \u201cmaintaining a normal healthy body weight\u201d (p = 0.007). Women are more likely to report diet and weight to be very important compared with men, and more likely to practice smoking abstinence than men. This latter finding was consistent with smoking practices in men and women.With respect to gender differences, women more than men believed that the following were more important: \u201ceating a diet that is low in fat\u201d . Specifically, those respondents who believe that \u2018never smoking cigarettes\u2019 is important to health, generally don't smoke or smoke less than those who believe that not smoking cigarettes is of low importance to a person's overall health.We examined three primary relationships between lifestyle-related practices/behaviors and beliefs about these and maximal health, specifically, relationships between smoking practices and belief about smoking and health; between calculated BMI and belief about healthy BMI for health; and level of physical activity and belief about the importance of physical activity/exercise for health. We observed a positive association between smoking practice  and the belief that not smoking cigarettes is importance to health . However, we did observe a negative association between a respondent's weekly frequency of fast food consumption vs. that individual's belief about the importance of consuming a low fat diet for health .No association was observed between a respondent's calculated BMI and that individual's belief about the importance of maintaining a healthy body weight .Although alcohol consumption was generally low in this Chinese cohort, when respondents were categorized in terms of drinking risk , there was no association between level of drinking risk and respondents' beliefs about the importance of drinking in moderation or not drinking, for health benefit . Alternatively, the belief that exercising regularly is important to health is not necessarily associated with whether respondents met the physical activity or exercise guidelines for good health.Regarding, physical activity, no association was observed between those who participated in the recommended guidelines for physical activity (categorized as Yes/No) and belief about the relative importance of physical activity/exercise is for general health  Based on nutritional guidelines for the Chinese 2The healthy BMI range for the Asian population is 18.5 to 24.9 kg mChinese healing traditions have included herbs and supplements for centuries The traditional role of women being responsible for the diet of the family may partly explain gender differences related to nutrition 4.3.For optimal health, 150 minutes of moderately-intense physical activity weekly or 75 minutes of moderately intense activity are recommended 4.4.Western living coupled with traditional values in China is associated with moderate to high levels of stress 4.5.www.whpa.org), and their beliefs about lifestyle and health and NCDs, provides essential information in identifying what type of health education needs to be delivered and at what level, i.e., knowledge, practice or belief, or some combination.Health professionals may assume that if a person has accurate beliefs about the relationships of lifestyle practices such as smoking, healthy diet and weight, and healthy physical activity levels, that these would lead to healthy lifestyle practices. Our preliminary findings showed inconsistent relationships. They suggest that beliefs about the health consequences of various lifestyle practices can be distinct to what a person actually practices. Further study is needed to examine these relationships in greater detail in the cohort of interest in this study and in the general Chinese population. If valuable resources are to be invested into health promotion education campaigns, it is essential that programs are tailored and targeted to the needs of individuals and groups. For example, people's health and their knowledge about NCDs, their lifestyle practices which can be readily assessed clinically with tools such as the Health Improvement Card advocated by the World Health Professions Alliance , lifestyle-related knowledge and beliefs as well as practices need to be foci of health education and population-based health promotion campaigns if these are to be cost-effective. Future studies are needed to replicate and extend these observations to other cohorts of the mainland Chinese population including issues related to motivation, adherence and commitment to being physically active."}
+{"text": "Most behaviors such as making tea are not stereotypical but have an obvious structure. However, analytical methods to objectively extract structure from non-stereotyped behaviors are immature. In this study, we analyze the locomotion of fruit flies and show that this non-stereotyped behavior is well-described by a Hierarchical Hidden Markov Model (HHMM). HHMM shows that a fly's locomotion can be decomposed into a few locomotor features, and odors modulate locomotion by altering the time a fly spends performing different locomotor features. Importantly, although all flies in our dataset use the same set of locomotor features, individual flies vary considerably in how often they employ a given locomotor feature, and how this usage is modulated by odor. This variation is so large that the behavior of individual flies is best understood as being grouped into at least three to five distinct clusters, rather than variations around an average fly. Many behaviors that we perform everyday, including something as familiar as making a peanut-butter sandwich, consist of a sequence of recognizable acts. These acts may include, for example, holding a knife and opening a jar. Yet often neither the sequence nor the individual acts are always performed in the exact same way. For example, there are many ways to hold a knife and there are many ways to open a jar, meaning neither of these actions could be called \u201cstereotyped\u201d.A lack of stereotypy makes it difficult for a computer to automatically recognize the individual acts in a sequence. This same problem would apply to other common behaviors, such as walking around somewhere you have not visited before. While we easily recognize it when we see it, walking is not a stereotyped behavior. It consists of a series of movements that differ between individuals, and even in the same individual at different times. So how can someone automatically recognize the individual acts in a non-stereotyped behavior like walking?To begin to find out, Tao et al. developed a mathematical model that can recognize the walking behavior of a fruit fly. Existing recordings of fruit flies walking were analyzed using a type of mathematical model called a Hierarchical Hidden Markov Model (often shortened to HHMM). Such models assume that there are hidden states that influence the behaviors we can see. For example, someone\u2019s chances of going skiing (an observable behavior) depend on whether or not it is winter (a hidden state).The HHMM revealed that the seemingly random wanderings of a fly consist of ten types of movement. These include the \u201cmeander\u201d, the \u201cstop-and-walk\u201d, as well as right turns and left turns. Exposing the flies to a pleasant odor \u2013 in this case, apple cider vinegar \u2013 altered how the flies walked by changing the time they spent performing each of the different types of movement. All flies in the dataset used the same ten movements, but in different proportions. This means that each fly showed an individual pattern of movement. In fact, the differences between flies are so great that Tao et al. argue that there is no such thing as an average walk for a fruit fly.The model represents a complete description of how fruit flies walk. It thus provides clues to the processes that transform an animal\u2019s sensory experiences into behavior. But it also has potential clinical applications. Similar models for human behaviors could help reveal behaviors that are abnormal because of disease. Normal behaviors also show variability, and some diseases increase or decrease this variability. By making it easier to detect these changes, mathematical models could support earlier diagnosis of medical conditions. There are many approaches to the study of neural underpinnings of behavior: One large body of work is rooted in the psychophysical literature where an animal is forced to choose between a few discrete behaviors . This apUncovering the structure within non-stereotyped behaviors such as locomotion requires sophisticated analytical tools. These tools can be\u00a0applied\u00a0to two complementary representations of an animal\u2019s behavior which can be described in the shape/posture space or in the world coordinate system. Recently much progress has been made in employing analytical tools that describe behaviors as a sequence of transformations in the shape/posture space using both supervised , and unsMuch of the work in extracting structure from an organism\u2019s trajectory is derived from the \u2018run and tumble model\u2019 which was originally employed in the context of bacterial chemotaxis . In thisThe lack of a model for locomotion makes it difficult to quantify the effect of stimuli on locomotion and is a critical missing piece in understanding the underlying sensorimotor transformations. For example, in many studies of odor modulation of locomotion, odors are primarily described as attractive or repulsive; this description is based on the end result, and does not consider the navigational maneuvers that underlie these end-results. Ignoring the underlying navigational maneuvers has led to a fundamental misunderstanding of odor modulation of locomotion. In a recent detailed analysis of a fly\u2019s locomotion, we demonstrated that it's navigational maneuvers in response to similarly attractive odors are quite distinct ; the anaIn this study, we employ a hierarchical statistical model, Hierarchical Hidden Markov Model (HHMM) to describe the structure in the fly\u2019s locomotion . We showWe model the locomotion of wild-type flies exploring a circular arena  whose ceWe first\u00a0attempted to model the fly\u2019s locomotion using Hidden Markov Model (HMM) . HMMs crIn this study, we use observables that describe the change of position as a function of time, and hence our analysis will focus on behavioral states in the velocity space. Speed and angular speed are commonly used measures of velocity. But, because it is difficult to measure angular speed accurately at low speeds   to model the data . We reas2\u00a0+\u00a06*42\u00a0+\u00a06*4*5\u00a0=\u00a0252, and 82\u00a0+\u00a08*42\u00a0+\u00a08*4*5\u00a0=\u00a0352 parameters, and the HMM has 242\u00a0+\u00a024*5\u00a0=\u00a0696 and 322\u00a0+\u00a032*5\u00a0=\u00a01184 parameters respectively; therefore, HHMM has fewer parameters. When a simpler model better characterizes the data, we can conclude that the additional structure contained in that model provides a more accurate characterization of the structure within the data.Indeed, in a Bayesian model comparison , HHMMs outperformed HMMs with the same number of states. Since HMMs rarely used more than 35 states (even when models with higher number of states were fit), to perform model comparisons, we used models with less number of states than the particular HHMM we eventually employed. We compared a two-level HHMM with 6 HL states and 4 LL states to a single-level HMM with the same number of states (4\u00a0\u00d7\u00a06\u00a0=\u00a024 states). We labeled the non-hierarchical model as the null model, and were able to reject the null model using Bayesian model comparison at p\u00a0<\u00a00.0001, implying that a hierarchical model is necessary. Another model comparison \u2013 a two-level model with 8 HL and 4 LL states compared to a single-level model with 32 states \u2013 also yielded similar results. The objectively better performance of an HHMM compared to an HMM suggests that a model that includes a hierarchical structure is more consistent with a fly\u2019s locomotion. It is important to note that, HHMMs are actually simpler than HMMs with the same number of states. This simplicity comes from the fact that any HHMM \u2013 which puts very specific constraints on the transition probability matrix \u2013 can be represented by an HMM but not vice-versa. HHMMs with the same number of states has far fewer parameters. Thus, for the two comparisons above, the HHMM has 6The model we chose has 10 HL states  and 5 LLTo make the difference between HHMM and HMM clearer, we compare the HHMM above to a HMM. As expected the time a fly spends in a HMM state is shorter than that in a HHMM state . The lon example\u00a0 shows thThe duration of the LL states of a HHMM is shorter than the duration of the HL state state . MoreoveThe limitations of HMM in describing phenomenon which have hierarchical and shared structure because of the short duration of its states is well documented . TherefoBoth the organized transitions between HL states, and the narrow range of observables associated with each state shows that the fly\u2019s locomotion is structured: The transition probability matrix is sparse \u2013 a vast majority of transitions from each HL state were to 2-3 other HL states. When we reordered the states  from low-speed-high-turn-states to high-speed-low-turn states, we found that from any state the flies transitioned to the neighboring states with a high probability  suggestilocomotor feature which describes a fly\u2019s locomotion in HL state 10. To better visualize this feature, we translated each track such that it began at the origin\u00a0and rotated the tracks so that the initial velocity vector pointed along the y-axis  that the observed Euclidean distance represents variations around the same average fly. The same conclusion applied to the fly\u2019s behavior in the other three conditions . The odor-induced change in locomotion has a fine spatial scale \u2013 the fly\u2019s response to odor changes as it moves from the border of the odor-zone to its center, and as it moves away from the odor border.The HHMM framework also allowed us to show that flies used the same 10 locomotor features, but in different proportions. The variation is so large that the fly\u2019s behavior cannot be understood as variations around the same average fly. Instead, the flies employ a minimum of at least 3\u20134 different strategies.Below we discuss the limitation and implication of these findings.a\u00a0model of locomotion and not the model of locomotion. The choice of observables and model strongly influences the features of the structure that is discovered. Our particular model reveals the structure of locomotion in the velocity space.The model presented here is In choosing the observables, we employ a common method for describing locomotion, that\u00a0is we treat the fly as a point object and measure the instantaneous change in the position of this point object; therefore, much of the insights from the model relate to how the fly changes its position in time. Apart from ct brain , and becct brain .A fly\u2019s position can also be described using the actual position of the animal as observables rather than the change in the position, as employed in a recent study in rats  Using thModel architecture is also important. A hierarchical model performed better than a non-hierarchical model. The current model has state durations of\u00a0<3 s. It is clear to human observers that there is structure in the data that is\u00a0>3 s long. Flies sometime explore the outer border of the arena using characteristic paths that can last up to a minute. The short duration of states in our model cannot capture structure on these long-time scales. One possibility is choosing a deeper-layered architecture. Given the structured transitions between the HL states in our model, it is likely that if we used a deeper-layered architecture, we would likely uncover structure on a longer timescale.During both HL states\u00a01\u00a0and\u00a02, the fly\u2019s locomotion is quite slow, but in state 2 the fly stops and runs intermittently while in state 1, the fly is continuously in motion, albeit slowly. Similarly, in each of the HL states 4, 5 and 7,  seconds  \u2013 a time seconds . This tiits time .Another surprising result is that the same set of locomotor features describes the behavior of all the flies in the dataset. This result is particularly surprising given that our model explicitly allows each fly its own set of locomotor features. The fact that all flies can be reasonably modeled by the same model implies that within a given environment all flies construct their locomotion from the same building blocks, and differences in locomotion amongst flies or the effect of sensory stimulation can be quantified as changes in the frequency with which these building blocks are employed. An important avenue for future research is to assess whether these locomotor features are fixed or flexible.In nature, animals encounter odors in a cluttered and dynamic sensory environment . DiscrimWe find that this behavior near the odor source can be described by changes in the HL states. The clearest evidence that changes in HL states are a good description of the fly\u2019s behavior is the analysis in which we measured the spatial distribution of odor-evoked changes in HL states , and obsEven single-cell organisms and animals with simple nervous systems display substantial individuality . AnimalsThe diversity of odor responses observed here is consistent with work done on moths where  but in sWhen considered from the viewpoint of an individual animal, this variability is hard to understand: A hungry fly in search of food should respond with a singular, hardwired behavior which represents an optimal strategy for locating food. However, species evolve as large populations of individuals, and a successful species should be able to adapt to fluctuating environmental condition. Recent work has shown that - bet hedging - a process by which the same genotype shows considerable phenotypic variation is important for adaptation to fluctuating environments . Having Studying individual behavioral responses is also important to understand the mechanism underlying both the control of locomotion and how odors control locomotion. Analyzing behavior at the population level can provide important insights into an animal\u2019s response but does not provide the resolution necessary for understanding the neural mechanism underlying the moment-by-moment control of behavior at the level of individual flies. In this context, it is instructive to take a closer look at the average response to odors in the light of clusters of response to odors. The average response  was surphttps://github.com/elifesciences-publications/HHMM). The dataset can be found on Dryad (doi:10.5061/dryad.m930f2m).All the code required to fit the HHMM model, and perform all the analysis in this manuscript can be found on Github .The methods used to collect the behavioral data were reported in a previous study . BrieflyThe behavioral arena was normalized to a unit circle centered at the origin. The raw coordinates of the centroid of the fly were smoothed using wavelet denoising followed by a locally weighted (lowess) filter. Speed and curvature were defined exactly as in the previous study.t was defined as the component of the velocity at time To quantify the behavior of the 34 flies, we computed the speed of the fly along the original direction of movement , and the time independent probability of transitioning between these states. The model processes which produce the observations in an HMM are hidden to the researcher and thus, the goal of fitting an HMM is to uncover the highest likelihood probability model parameters that can generate the data. Baum and others developed the core theory of HMMs . Since tHMMs have been shown to be effective in modeling behavior because instantaneous measures of an observable are variable; therefore, behavioral states inferred by the application of simple thresholding to instantaneous measures of the observables are likely to be erroneous. HMM remedies this problem by inferring states based not only on the value of the observable at the current time point but also on the previous and following time points, and allows a more accurate determination of state  and 5 hidden states at the lower level (LL) . The empirical data to which the model is fit is a time series of the two observables - ij) that a fly in a given state detailed in the jth column will transition to a different high-level state detailed in the ith row. The high-level states are arranged in ascending order of mean speed/variance in curvature ratio. Because of this arrangement, the TP for the HL states appears well-structured. From any state, there is a strong tendency to transition to one of the neighboring state. This tendency implies that flies transition to states which have a similar speed/curvature ratio. LL states that belong to the same HL state often have more similar speed/curvature ratios. Thus, there is less of a tendency for LL states to transition to the LL state with the closest speed/curvature ratio. Nevertheless, the LL state transition probability matrices, too, are sparse; signifying a distinct pattern of transition between LL states  on the top level with each HL state being associated with five low-level states (LL states) on the bottom level . Each LLNow we will define our two layered HHMM as follows:q(Z) is obtained using the forward-backward algorithm which provides sufficient statistics needed to update the approximate posterior distributions over the parameters. In this setting, posterior probability distributions over rows of transition probability matrices are assumed to be Dirichlet, and the prior is chosen to favor self-transition parameters, We can henceforth refer to the set of model parameters as The emissions probability distributions associated with each state were assumed to be Normal inverse Wishart with a prior favoring zero mean and unit variance. For each computational run, the initial parameters of these posterior distributions were randomized.i-th HL state to i-th HL state) was six times higher than transitions across HL states ((i-th HL state to j-th HL state). The prior for all i-to-j transitions were same. The Dirichlet prior over state transitions which we used was very weak. Specifically, in strength, the prior we used corresponds to the equivalent of two observations relative to the\u00a0>10,000 observations that we used to fit the model for each fly.The priors used for fitting were such that within state transitions  instantiation. Under our factorized approximation, this objective function takes the formThe VBEM algorithm minimizes this objective function using coordinate ascent in the q(\u03b8) q(z) function space. That is we obtain iterative update rules by simply taking the functional derivative if the KL with respect to q(Z) for fixed q(\u03b8) and then solving for q(Z). This results in the so-called E step where we update the posterior distribution over latent variables by averaging the true joint distribution of observations, parameters, and latent variables over our current estimate of the posterior on parameters:In the so called M step, the roles are reversed:Here, the tilde indicates equality up to an additive constant. This two-step procedure is repeated until convergence. The simplicity of these equations belies the complexity of the actual calculation of the posterior distribution over latent state variables. This is accomplished using the well-known forward-backward algorithm. The particular implementation of the forward-backward algorithm used in VB differs from the traditional EM implementation in that the parameters of the transition probability matrix are obtained by exponentiation of the geometric mean of the transition probability matrices:Based on the current posterior over parameters instead of simply using a maximum likelihood or MAP estimate. Because we assumed the rows of the transition probability matrix to be sparse, this further encourages the model to leave un-needed states unused.Regardless, based on the assignments of observable tracks to HHMM models, we can iteratively update model parameters for each cluster to maximize the probability of observing the observables given the model parameters and the initial LL\u00a0state probability density using the forward-backward algorithm. This operation can be thought of as the maximization step where we are calculating the best set of model parameters . The flies are then clustered into two clusters using k-means clustering based on the expected distribution of lower level state usage. Individual HHMMs were fit to each of these new clusters. In the cluster reassignment step, we filled each unused cluster(s) with the fly(s) that had the worst fit to the current cluster assignment. After each step, we conducted 10 iterations of the EM algorithm. The sequence of perturbations was conducted for 10 iterations before a final fit using the EM algorithm was conducted until convergence.nz, to the nth fly. When n\u00a0=\u00a0kz, it indicates that the kth HHMM under consideration governs the fly\u2019s movement. Therefore, in addition to identifying the posterior distribution over high and low-level states, we also infer a probability distribution over cluster assignments. These probability distributions are then used to determine how much we should weight each fly\u2019s movement data when updating the parameters of the different HHMM\u2019s.To account for differing search strategies that may be utilized by different flies we also fit a mixture of HHMMs to our multi-fly data set. The goal of this model is to identify a small set of different HHMMs that can describe our entire data set by clustering flies according to the similarity in their locomotion. In this context, two flies are said to behave similarly if the same HHMM provides a good description of their behavior. To model this scenario, we added another layer to our Bayesian model of the fly movement dataset. In this topmost layer, we instantiate a Dirichlet process which probabilistically assigns a label, In this study, we experimented with models with a varying number of HL states (6-16), and low-level states (4-6). One limitation of our fitting procedure is that it is not possible to compare models with a different number of states objectively, and thus the choice of model depends on the investigator. We chose a model with 10 HL states for two reasons: The most compelling reason is that different model runs with 10 HL states produced results that were more similar to each other than did model runs with either lower or higher number of states. Another reason is that as the number of HL states in the model is increased, many HL states are sparsely used.We think that the range 6\u201312 is a fairly narrow range. One important point is that within this narrow range of states, the state duration in all the models we tried were very similar.One important limitation of our modeling approach  is that it is difficult to compare across models because everything changes slightly\u2013 LL states change, HL states change. We are currently revising the model to keep the LL states fixed so that the modeling approach would mostly focus on how the HL select the LL states. This process will make it much easier to compare across models.For a given HMM fit, we may obtain the transition probability matrix (A). To obtain higher level structure from the states fit to a HMM, we may cluster the states based on their likelihood to transition to each other. One method of sorting and clustering the transition matrix into a block diagonal structure involves the use of information bottleneck formalism . We usedd states  .Given an HMM and an HHMM model with equal number of total states and observables O, we wish to calculate the probability of the HHMM model given the observations (P(HHMM|O)). Using Bayes theorem, we can calculate this with:Utilizing a flat prior and Bayes factor:We now obtain:We utilized the evidence lower bound to approximate 2+10*52+50*5 = 600 parameters.To define an HMM, we need the transition probability at the start of the track. We considered the overall vector of the 10 frames (330 ms) before each track as the vector defining the fly\u2019s directional intent prior to starting a track. We defined the angle of rotation as the angle between this vector and the forward direction. These translated and rotated tracks allow us to visualize the distinct types of locomotion defined by the HL states , inside odor-zone following first entry (DI), outside odor-zone before first entry (BO), and outside odor-zone following first entry (DO). The standard deviation (SD) of the probability of HL states (P) in each scenario were calculated as follows:The nominal radius of the odor-zone defined by the radius of the odor tube was 1.25\u00a0cm\u00a0. HoweverFor each fly, we measured the probability distribution of HL states occupancy for each of our four scenarios. We repeated this process 10,000 times to generate a distribution of the test statistic that we would expect from the null hypothesis. We then calculated the empirical statistic using the same formulation as the test statistic: TS. Using the distribution of test statistic and our empirical statistic, we conducted a two-tailed test with alpha\u00a0=\u00a00.05 and 0.01. As our data included multiple statistical tests (one for each HL state), we corrected for multiple comparisons by applying the Holm-Bonferroni procedure. This process was repeated for outside the odor zone.X-means clustering is an extension of K-means clustering. K-means clustering is an iterative algorithm that assigns data points to one of K groups based on the distance between points and the cluster centers; in most versions of K-means clustering, the number of clusters is specified by the user. X-means extends the K-means algorithm by computing the Bayesian information criterion (BIC) scores associated with a given K-means model fit, and, therefore allows a better assessment of the appropriate number of clusters in the data . FollowiIn this case, the t statistic and the corresponding p values represent the likelihood that k-means with a given cluster size will do significantly better than one with smaller cluster size. We chose the maximum cluster K that fulfilled t\u00a0>\u00a03.86 (p\u00a0<\u00a00.05) and within 5% of the minimum BIC.I-BI was computed for each fly and was the input to the X-means. For outside the odor-zone, Do-Bo was computed for each fly and was the input to the X-means  models  \u2013 a geneFirst, we divide the data into 1 s time-bins. We also performed logistic regression on data subdivided into 0.33, 0.66, and 3 s bins  with varying amounts of time overlap and found no notable differences in model predictions. Because we want the chance prediction to be 50% in each analysis, bins were randomly removed from either the before or during case such that the total number of bins were the same for the before period and during period. Next, we performed principal component analysis (PCA) on the distribution to obtain a smaller number of uncorrelated variables. We considered the smallest number of principal components that cumulatively explained over 90% of the variance in our analysis.The resulting principal components were used as predictors in fitting to a logarithmic regression model. We used the MATLAB built-in function \u2018glmfit.m\u2019 to implement fitting to a generalized linear model. For fitting to logit model, we used a binomial distribution (having experienced the odor or not) and the \u2018logit\u2019 criterion. The resulting logistic function based on the population data was used to predict if a fly was experiencing odor in any given 1 s bin.1, M2), we considered the perpendicular distance  on the behavior of the flies, the GLM was fit using the speed and curvature as predictors instead of the distributions of HL states. To compare the relative probability of correct predictions on for each fly between two different types of GLM fits  time bin observation of HLS distribution. To better partition flies into clusters based on both the average difference across time and smaller snapshots of difference across the 1 s time frame, we took X-means as the first partitioning of flies. Then we took a total of 6 flies from the largest clusters (n\u00a0>\u00a010) that had the worst predictive power given GLM fits based on clusters. We then redistributed these flies into clusters in order to maximize the sum of the predictive power of individual flies across all clusters.I, BO, DI and DO) separately. To generate a synthetic track, an HL state was first chosen based on the occurrence probability distribution of HL states. At this point, a new HL state was assigned for the next time instance (HHMM synthetic flies were generated based on the transition probabilities for each of the four scenarios (Bscenario . 100 setscenario . The reso and Di) separately  in circular arena in the dark and where odor can be strictly limited to a central zone. They monitor fly movement as velocity  prior to and after odor is introduced to the arena center. They then analyze the data with a Hidden Markov Model (HMM) and a Hidden Hierarchal Markov Model (HHMM) and show decisively that the HHMM fits the data better and that the high level sates (HL) describe stereotypical locomotor components and that transitions between them vary in probability such that states with similar velocities have higher transition probability. They then show that introduction of odor affects the probability that a given HL state is occupied and varies inside and outside the odor zone with final spatial structure. A surprising finding is that the average probability distributions of the HL states cannot be used to determine the presence of the odor. Subdividing the flies according to their individual pre and during odor probability distributions and clustering reveal 3-4 categories of responses and there are different cluster of the 34 flies tested for each of the four conditions . The most interesting conclusions of the paper are: 1) the observation that the HHMM model fits better than the HMM model, implies that there is structure at multiple time scales in the data 2) under the specific conditions imposed that although all flies in dataset use the same set of locomotor features, individual flies vary considerably in how often they employ a given locomotor feature (HL state), and how this usage is modulated by odor. The paper should arouse general interest in the behavioral neuroscience community.Essential revisions:1) There are concerns about how well the data constrains particular HHMM put forward that can be allayed by putting confidence intervals on the probability distributions of Figure 5 and Figure 6.2) Several of the reviewer concerns focus on dwell times in each HL state. These dwell time should be analyzed and distributions presented and interpreted.3) The observation that the HHMM model fits better than the HMM model, implies that there is structure at multiple time scales in the data. For example, HL states may be prolonged because the systems transitions among nearby LL states within the HL state; is this supported by the dwell time of LL states within a prolonged HL state? The authors also note in the Discussion that there is structure on longer time scales. Can they think of some analysis that would pull this out?4) The findings about individuality and the fact that the presence of odor can be predicted from a model that takes individuality into account but not from a model that does not are interesting. Here however, some additional analyses or data would help support the claim. For example, can the authors compare the distribution of states early versus late in the trial and show that each individual still occupies a characteristic set of states? How do HL state dwell times vary among individual or early vs. late in a trial? Would more flies analyzed and/or for longer period of time help resolve the individuality issues?5) The detailed reviewer comments are appended and that should be addressed in light of the consensus concerns above.Reviewer #1:Concerns1) Subsection \u201cA small number of strategies can explain the variability in flies\u2019 response to odor\u201d third paragraph: be explicitly clear as to how many clusters were found for each case illustrated in Figure 9. In Figure 9A, I assume there were at least 5 clusters but that cluster 4 had less than 4 flies; were there other clusters? Be very clear as to the number of clusters for Figure 9A and 9B.2) Results section: you state in results that flies \"\u2026spend 60% of time performing a locomotor feature for >300 milliseconds, and >10% of their time performing a single locomotor feature for >3s \u201d. The first statement appears compatible with the cumulative distribution in the figure, but I don't see the second at all. Am I missing something or is the maximum duration illustrated 1.5 s and less that 5% of states are of this duration or longer? Please plot in a supplemental figure the real distribution of time duration of states in the data. These data are essential if you are to make claims like \"These locomotor characteristics can persist over 3 seconds \u2013 a time period during which a fly takes 30 steps on average (given a step frequency of 10 Hz). This tight control over \ud835\udc63\u0302|| over tens of steps strongly suggests that locomotion unfolds, not on a step-by-step basis, but in blocks of tens of steps.\" Or like \"A fly moves at a relatively constant \ud835\udc63\u0302|| and \ud835\udc63\u0302\u2ae0 for tens of step.\" It seems for example, that for states that last 300 ms that only 3 steps are possible and there are many states that last shorter periods. Are moving states distributed in duration longer/shorter that stopping states?3) Subsection \u201cOdors affect behavior on a fine spatial scale.\u201d, paragraph two: Here you are creating a sequence of behavior based on averages and YET you claim that average data does not describe a fly's behavior but there are distinct strategies. Please clarify.Reviewer #2:1) The model assumes that behavior is best modeled as set of discrete states . The alternative possibility, alluded to briefly in subsection \u201cFlies show considerable variability in locomotion despite employing the same locomotor features.\u201d, is that some parts of the behavior could be better represented (or controlled) as continua. Since velocity is a continuous 1D variable, and since the fly must pass through intermediate velocities to transition from low to high velocity and vice-versa, I think this alternative should be considered. I am not suggesting the authors entirely revamp their model but I think this point could be discussed or considered a bit more prominently.2) In the analysis of spatial structure , the role of time history should be considered/discussed. For example, behavior near the odor border might be different because the fly is more likely to have experienced no odor shortly before odor (or vice versa) than in the center of the arena. The responses of olfactory neurons are well known to show responses that depend on history over multiple time scales, so this point should be considered/discussed. Whether behavior could also be influenced by airflow at different parts of the chamber should be noted (without assuming the reader knows the details of the earlier paper). For example, could the airflow from the vacuum be causing the flies to slow down inside the odorized area, as in Yorozu et al., 2009?3) The findings about individuality are quite interesting. As mentioned above, the analysis in which the presence of odor can be predicted based on individual flies or clusters of flies, but not the whole dataset is quite interesting. However, as the authors note in the response to Reviewer 3, individuality in responses has also been investigated elsewhere. A typical analysis in these studies  is to compare behavior of the same individual at different time points and to show that they are more similar to themselves than to each other. The authors might consider splitting their data in time and repeating the analysis, although the time interval of the data here is relatively short (6 min). In addition, it would be nice to know if they could correlate their clusters with anything else about the flies. In the response to reviewers the authors allude to different behaviors produced by different genotypes. I think it would add to the interest of the study if these data were included.4) The comparison of HMM and HHMM models is nicely rigorous but seems highly technical for this journal. The authors should consider focusing the text on the conceptual conclusions that can be drawn from this comparison.Reviewer #3:Before publication some work is needed to address questions about: 1) how to interpret HL behaviors ; 2) error bars.Main comments:Error bars.I could not get a clear sense of how well the data is constraining the HHMM model. For example in Figure 5, what is the uncertainty of these distributions? Can the authors bootstrap the data? Likewise in Figure 6 how many data points go in each colored dot? What is the uncertainty of the probability plots as a function of radial distance? There are no error bars on these plots.Time spent in HLs.One of the reasons HHMM seems to work better than HMM is that behaviors have extended durations and since the trajectory can jump around the LL states within a single HL state, that HL state can last long. Even though this is a key aspect of the model, there is no analysis or plot of the waiting time distribution in each HL state that would give an idea of the \"duration\" of such states during behavior and how that duration depends on the number of HL and LL states used in the HHMM model. The only thing I could find was Figure 2\u2014figure supplement 1  and the statement made: \"A fly moves at a relatively constant \ud835\udc63\u0302|| and \ud835\udc63\u0302\u2ae0 for tens of step. This tendency means that a fly's locomotion can be decomposed into a small number of locomotor features \u2013 10 features in the case of the model we present.\". However, this main conclusion is provided without plots about it. Supporting this point with quantitative data analysis is important because the authors use it to interpret various aspect of the results. It is also important to know if some HLs state last much longer than other in order to interpret the data. This may also clarify why 10HLs each with 5LLs are used in the HHMM. See below.Subsection \" HHMM reveals that a fly\u2019s locomotion is surprisingly structured in the velocity space\u2026\".An interesting outcome underlined by the authors (last paragraph) is that the resulting HHMM accounts for 80% of all the data  using 10 locomotor features (10 HLs). Some of the HL states correspond to clearly distinct behavior, such as 1=meander, 2=stop-to-walk or 9=fast right turn, 10=fast left turn. However, other HLs seem to be part of a continuum, such as 4,5,7= medium speed walking, and it is not entirely clear why 3 distinct HLs are needed to describe medium speed walking. Some HLs seem to fit less well the data, e.g. HL 6. I could not find a clear explanation of why 10HLs each with 5LLs were chosen and whether fewer HLs would have worked as well. What would happen if the HHMM had less HL nodes but more LL nodes in each HL? A discussion of survival times in each HLs might help sort this out and provide a way to interpret states 4,5,7. Are these different behaviors or one behavior distributed over 3 HL?Subsection \u201cLocomotor features and implications for neural control of behavior\u201d.In the discussion the authors say that v_parallel lies within a narrow range that is distinct for each three state and that 3 states reflect a tight control on locomotion by the brain. They mention these locomotor state can persist up to 3 second/30 steps and suggest that this indicates that the brain controls locomotion in blocks of 10 steps. I find this conclusion drawn from the finding of these 3 clusters too speculative given the data: In Figure 3\u2014figure supplement 1 and Figure 4 the distributions of v_par overlap significantly between HL 4,5 and 7. This is again related to the two points above. Finally, if HL 4 5 7 are really distinct behaviors then another possibility could be that they are needed to account for fly-to-fly variability in the data, and that for a single fly only one state is sufficient to describe medium speed walk.eLife. Your revised article has been favorably evaluated by K VijayRaghavan (Senior Editor), a Reviewing Editor, and two reviewers.Thank you for resubmitting your work entitled \"Statistical structure of locomotion and its modulation by odors\" for further consideration at The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:Significant additional revisions are still required. The comments of the expert reviewers, below, are detailed and require full responses.Reviewer #2:This manuscript compares HMM and HHMM approaches to clustering behavioral data from flies in an olfactory paradigm. Based on a rigorous comparison of models, the authors conclude that the HHMM model performs better than the HMM model, implying the presence of hierarchical long-time scale structure in the data. They further analyze the behavior of individual flies and show that responses to odor cannot be understood in terms of variation around an \"average fly\" but rather are better understood as belonging to 3-4 response types. Response types of individuals are stable over the duration of the experiment. Overall the methods introduced for analyzing complex behavioral data appear to be sound and are likely to be of broad interest to scientists studying natural behavior and its neural correlates.Two points need to be addressed before acceptance:1) How do the priors used in fitting constrain the structure of the transition matrices found for the models? In the Results section, the authors state that \"the assumption of Markov dynamics with a sparse prior on state transitions penalizes the consideration of unlikely state transitions base upon recent history and future destinations.\" This suggests that a sparse prior was applied in fitting. However, later in the paper the authors state: \"The transition probability matrix for the HMM was sparse, suggesting that from each state there are transitions to only a handful of other states.\" If a sparse prior was applied during fitting than the fact that the resulting transition matrix is sparse is not really a finding about the data.Similarly, the authors need to clarify what fitting priors or constraints were placed in the HHMM model. The Results state \"This is because any HHMM- which puts very specific constraints on the transitions probability matrix- can be represented by an HMM but not vice-versa.\" What are the constraints on the transition probability matrix for the HHMM? The text says \"The transition probability matrix is sparse- a vast majority of transitions from each HL state were to 2-3 other HL states.\" Was this imposed by fitting priors?2) Parts of the manuscript are somewhat long and repetitive. I think the manuscript could be productively shortened to have greater impact on its readers.For example, in the section titled \"HHMM reveals that a fly's locomotion is surprisingly structured in the velocity space\" the last paragraph is devoted to restating the major conclusion of the first section: HHMM performs better than HMM. I think this could be reduced or folded into section one, which focusses on this comparison, and the section focused more exclusively on describing the HL states uncovered by the model.In the Discussion subsection \u201cFlies show considerable variability in locomotion despite employing the same locomotor features\u201d paragraphs two and three are highly descriptive of the individual fly data and somewhat repetitive with parts of the Results subsection \u201cBoth locomotion and an odor\u2019s effect on locomotion is fly dependent\u201d . I think these sections could be condensed to make the major points about individual variability in the Results, and use the Discussion mostly to compare these findings with the results of other studies.Reviewer #3:The authors have addressed most of my concerns expect the important one regarding the confidence interval on the distributions in Figure 5. What I am asking is for the authors to use bootstrapping to extract many sample distributions from subsets of the data in order to get a confidence interval on how these bins are populated by the data and how significant the changes are between before and during odor exposure. Essential revisions:1) There are concerns about how well the data constrains particular HHMM put forward that can be allayed by putting confidence intervals on the probability distributions of Figure 5 and Figure 6.There are two sources of variability. The first corresponds to how well the data constrains the model. This source of variability can be quantified as follows: The standard deviation (SD) of the probability of HL states (P) in each scenario can be calculated as follows:SDj=Pj1-PjN-1\u2200j\u22081,2,3,\u202610HLstateWhere N is the total number of data points in each scenario. This standard deviation is extremely small and is shown in Figure 5.The second source of variability is how different is the behavior of different flies in a given scenario. Getting to the bottom of this variability is the main question that drives the manuscript from Figure 7-9.2) Several of the reviewer concerns focus on dwell times in each HL state. These dwell time should be analyzed and distributions presented and interpreted.We have analyzed the dwell times of each HL state . Specifically, we plot the cumulative distributions of the HL states. We also plot the percentage of time a fly spends in a state of a given duration. These plots show the differences in dwell time in different HL state.3) The observation that the HHMM model fits better than the HMM model, implies that there is structure at multiple time scales in the data. For example, HL states may be prolonged because the systems transitions among nearby LL states within the HL state; is this supported by the dwell time of LL states within a prolonged HL state? The authors also note in the Discussion that there is structure on longer time scales. Can they think of some analysis that would pull this out?The plot on dwell time \u2013 Figure 2\u2014figure supplement 2 \u2013 also plots the average dwell time of the low-level states and the number of LL state transitions/transition into HL state as a function of the duration of the HL state. These data support the idea stated above: The number of transitions increase when the duration of HL states become longer. Thus, this analysis works exactly as the reviewers envision above, and as one would expect if the data has structure on multiple time scales.With regards to pulling out structure on an even longer time scale: we don\u2019t think that there is any simple analysis that would work. We think that pulling out longer timescale likely requires a different model with more hierarchical layers, and likely a different set of observables.4) The findings about individuality and the fact that the presence of odor can be predicted from a model that takes individuality into account but not from a model that does not are interesting. Here however, some additional analyses or data would help support the claim. For example, can the authors compare the distribution of states early versus late in the trial and show that each individual still occupies a characteristic set of states? How do HL state dwell times vary among individual or early vs. late in a trial? Would more flies analyzed and/or for longer period of time help resolve the individuality issues?We performed the analysis suggested here . We find that even if you take a 1-second chunk of data, it assigns flies to the correct cluster at a level greater than chance. A 30-second chunk of data classifies >80% of the flies accurately. The correctly assigned fraction is about the same whether we use the first 30 seconds of data or the last 30 seconds of data.It is important to note that what we are claiming is that these 34 six-minute trajectories do not belong to the same cluster. To establish individuality, one needs trajectories from the same fly over multiple days. It is also important to control the environmental conditions within a very tight bound. We were anal about the environment conditions. But, because the experiments were not specifically designed to get at the question of individuality, therefore the bounds on many conditions \u2013 age of the fly (3-5 days old), culture conditions (50-200 eggs) should be controlled even more tightly. Moreover, we did not control humidity at the time of the experiment. In essence, collecting longitudinal data under even more controlled conditions from a large population of flies is necessary to settle questions regarding individuality, and is well beyond the scope of this study.5) The detailed reviewer comments are appended and that should be addressed in light of the consensus concerns above.We agree with most of the reviewer critiques and have addressed them in the manuscript.Reviewer #1:Concerns1) Subsection \u201cA small number of strategies can explain the variability in flies\u2019 response to odor\u201d third paragraph: be explicitly clear as to how many clusters were found for each case illustrated in Figure 9. In Figure 9A, I assume there were at least 5 clusters but that cluster 4 had less than 4 flies; were there other clusters? Be very clear as to the number of clusters for Figure 9A and 9B.Thank you. We have specified the number of clusters in the figure in subsection \u201cA small number of strategies can explain the variability in flies\u2019 response to odor\u201d.2) Results section: you state in results that flies \"\u2026spend 60% of time performing a locomotor feature for >300 milliseconds, and >10% of their time performing a single locomotor feature for >3s \u201d. The first statement appears compatible with the cumulative distribution in the figure, but I don't see the second at all. Am I missing something or is the maximum duration illustrated 1.5 s and less that 5% of states are of this duration or longer? Please plot in a supplemental figure the real distribution of time duration of states in the data. These data are essential if you are to make claims like \"These locomotor characteristics can persist over 3 seconds \u2013 a time period during which a fly takes 30 steps on average (given a step frequency of 10 Hz). This tight control over \ud835\udc63\u0302|| over tens of steps strongly suggests that locomotion unfolds, not on a step-by-step basis, but in blocks of tens of steps.\" Or like \"A fly moves at a relatively constant \ud835\udc63\u0302|| and \ud835\udc63\u0302\u2ae0 for tens of step.\" It seems for example, that for states that last 300 ms that only 3 steps are possible and there are many states that last shorter periods. Are moving states distributed in duration longer/shorter that stopping states?The referee raises three important points here: 1) one concerning statements that we made regarding state duration, 2) general issues related to state duration, 3) conclusions we draw based on the state durations.With regards to the specific statements that >10% of the time is spent performing locomotor features >3 s: Figure 2\u2014figure supplement 1 plots the fraction of transitions above a certain duration. To estimate how much time a fly spends in a state that is >a certain duration (t), we have to multiply N(t)*t, where N is the number of transitions of exactly duration t, and calculate P(>t) from the resulting quantity. We have now shown this calculation in Figure 2\u2014figure supplement 2B. The number 10% comes from the mean curve (black line). When we examined the same distribution by state, we found (as implied by the reviewer above) that the stop state (State 2) dominates the long duration states. Interestingly, the fast states \u2013 states 9 and 10 and state 1 (meander) also has many long duration transitions. The medium speed states \u2013 states 4-7 rarely have long duration transitions. Therefore, the conclusion that \u201cA fly moves at a relatively constant \ud835\udc63\u0302|| and \ud835\udc63\u0302\u2ae0 for tens of step\u201d is weaker than we originally thought. The general idea that flies can reside within the same state for many steps is true, and we have clarified the discussion in subsection \u201cOdors affect behavior on a fine spatial scale\u201d to reflect the same.With regards to the general issue related to state durations \u2013 we present a new analysis which quantifies \u2013 1) duration of HL states, 2) duration of low-level states, 3) No. of low-level state transition/transition into HL states. These analyses are detailed in Figure 2\u2014figure supplement 2.Finally we have clarified the conclusions we draw from state durations. We state clearly that the states of the HHMM are not necessarily the states employed by the system. In fact, as pointed out by another reviewer, there is no guarantee that there are discrete states at all. We completely agree with that sentiment and described explicitly in the discussion subsection \u201cLimitations of the model\u201d.3) Subsection \u201cOdors affect behavior on a fine spatial scale.\u201d, paragraph two: Here you are creating a sequence of behavior based on averages and YET you claim that average data does not describe a fly's behavior but there are distinct strategies. Please clarify.This is an excellent point. We have deleted the entire discussion.Reviewer #2:1) The model assumes that behavior is best modeled as set of discrete states . The alternative possibility, alluded to briefly in subsection \u201cFlies show considerable variability in locomotion despite employing the same locomotor features.\u201d, is that some parts of the behavior could be better represented (or controlled) as continua. Since velocity is a continuous 1D variable, and since the fly must pass through intermediate velocities to transition from low to high velocity and vice-versa, I think this alternative should be considered. I am not suggesting the authors entirely revamp their model but I think this point could be discussed or considered a bit more prominently.The most parsimonious way to think about the discrete vs. continuous is to think about the time-series of velocity and curvature as outputs of a dynamical system. In this framework, the HL states would represent the system being in a vicinity of a fixed point for the vast majority of time. We have included this idea in the discussion in subsection \u201cExtracting observables from the trajectory\u201d.2) In the analysis of spatial structure , the role of time history should be considered/discussed. For example, behavior near the odor border might be different because the fly is more likely to have experienced no odor shortly before odor (or vice versa) than in the center of the arena. The responses of olfactory neurons are well known to show responses that depend on history over multiple time scales, so this point should be considered/discussed. Whether behavior could also be influenced by airflow at different parts of the chamber should be noted (without assuming the reader knows the details of the earlier paper). For example, could the airflow from the vacuum be causing the flies to slow down inside the odorized area, as in Yorozu et al., 2009?The reviewer raises two issues here:The first issue is that the behavior is not just spatially structured, but spatio-temporally structured. We agree with the reviewer. The spatial structure we present in Figure 6 is actually spatio-temporal structure. We have discussed this issue and added a figure  which shows that the behavior evolves as a function of time. However, this evolution is complete within the first 10 seconds or so. Unfortunately, because of 1) individuality among flies, 2) because we did not quantify the concentration of odor as a function of time (after the first minute), we cannot make a definitive analysis of the nature of the spatio-temporal structure in the data. The main point we are making in Figure 6 is that the HL states provide an important analytical tool for analyzing this structure.The second issue relates to the airflow. We are quite confident that behavior in the arena is minimally impacted by airflow because the airflow we use is much smaller than almost any other study on fly olfaction, and is well-below the reported thresholds for anemotactic responses. More importantly, in the original study , we had performed controls in which we compared the effect of turning on the air, then the air and vacuum on the fly\u2019s locomotion. We found that there was no observed effect of either the air or the air/vacuum. This issue is discussed in subsection \u201cHHMM modeling\u201d.3) The findings about individuality are quite interesting. As mentioned above, the analysis in which the presence of odor can be predicted based on individual flies or clusters of flies, but not the whole dataset is quite interesting. However, as the authors note in the response to Reviewer 3, individuality in responses has also been investigated elsewhere. A typical analysis in these studies  is to compare behavior of the same individual at different time points and to show that they are more similar to themselves than to each other. The authors might consider splitting their data in time and repeating the analysis, although the time interval of the data here is relatively short (6 min). In addition, it would be nice to know if they could correlate their clusters with anything else about the flies. In the response to reviewers the authors allude to different behaviors produced by different genotypes. I think it would add to the interest of the study if these data were included.There are two important points here. First, given our limited dataset, can we still assess whether the clusters are stable? This analysis is presented in Figure 7\u2014figure supplement 4. The stability of the cluster depends on \u2013 1) How different are the clusters from each other? If the clusters are very different, then only a small temporal sample is enough to assign flies to clusters. To assess how different the clusters are from each other, we assembled tracks of a given length from each fly by sampling data points at random. We found that there is a high probability that tracks >10 second in length were assigned to the original cluster. This analysis implies that the cluster means are sufficiently different that small chunks are representative.2) How long of a time-sample does one need to describe the average behavior? We analyzed whether chunks of contiguous data points of a given length are representative of the original cluster. We performed two analyses: a) we asked whether chunks of a given length belong to the original cluster. We found that we could assign the flies to their original cluster at greater than chance level. b) We chose chunks either at the beginning or at the end of the track. Once again, we find that small chunks are predicted to be in their respective cluster at levels much greater than chance.Second, we examined whether the clusters correlated with 1) time of recording, 2) starvation time, 3) age of the fly. We found no trends.4) The comparison of HMM and HHMM models is nicely rigorous but seems highly technical for this journal. The authors should consider focusing the text on the conceptual conclusions that can be drawn from this comparison.We agree with the reviewer. But, based on the previous set of reviews, we would like to keep that description. A large section of the audience has grave misunderstandings about HHMM vs. HMM. It is best to clarify these misconceptions at the outset.Reviewer #3:Before publication some work is needed to address questions about: 1) how to interpret HL behaviors ; 2) error bars.Main comments:Error bars.I could not get a clear sense of how well the data is constraining the HHMM model. For example in Figure 5, what is the uncertainty of these distributions? Can the authors bootstrap the data? Likewise in Figure 6 how many data points go in each colored dot? What is the uncertainty of the probability plots as a function of radial distance? There are no error bars on these plots.There are two sources of variability. The first corresponds to how well a model constrains the data. This source of variability can be quantified as follows: The standard deviation (SD) of the probability of HL states (P) in each scenario were calculated as follows:SDj=Pj1-PjN-1\u2200\u2200j\u22081,2,3,\u202610HLstateWhere N is the total number of data points in each scenario. This standard deviation is extremely small and is shown in Figure 5.The second source of variability is how different is the behavior of different flies in a given scenario. Getting to the bottom of this variability is one of the questions which drives the manuscript after Figure 6.Time spent in HLs.One of the reasons HHMM seems to work better than HMM is that behaviors have extended durations and since the trajectory can jump around the LL states within a single HL state, that HL state can last long. Even though this is a key aspect of the model, there is no analysis or plot of the waiting time distribution in each HL state that would give an idea of the \"duration\" of such states during behavior and how that duration depends on the number of HL and LL states used in the HHMM model. The only thing I could find was Figure 2\u2014figure supplement 1  and the statement made: \"A fly moves at a relatively constant \ud835\udc63\u0302|| and \ud835\udc63\u0302\u2ae0 for tens of step. This tendency means that a fly's locomotion can be decomposed into a small number of locomotor features \u2013 10 features in the case of the model we present.\". However, this main conclusion is provided without plots about it. Supporting this point with quantitative data analysis is important because the authors use it to interpret various aspect of the results. It is also important to know if some HLs state last much longer than other in order to interpret the data. This may also clarify why 10HLs each with 5LLs are used in the HHMM. See below.This is an important point. We have now analyzed the duration distributions for both the HL and LL states . A short description of our findings is presented in the essential revisions and repeated below. We have analyzed the dwell times of each HL state . Specifically, we plot the cumulative distributions of the HL states. We also plot the percentage of time a fly spends in a state of a given duration. These plots show the differences in dwell time in different HL state.The plot on dwell time \u2013 Figure 2\u2014figure supplement 2 \u2013 also plots the average dwell time of the low-level states and the number of LL state transitions/transition into HL state as a function of the duration of the HL state. These data support the idea stated above: The number of transitions increase when the duration of HL states become longer. Thus, this analysis works exactly as the reviewers envision above, and as one would expect if the data has structure on multiple time scales.Subsection \" HHMM reveals that a fly\u2019s locomotion is surprisingly structured in the velocity space\".An interesting outcome underlined by the authors (last paragraph) is that the resulting HHMM accounts for 80% of all the data  using 10 locomotor features (10 HLs). Some of the HL states correspond to clearly distinct behavior, such as 1=meander, 2=stop-to-walk or 9=fast right turn, 10=fast left turn. However, other HLs seem to be part of a continuum, such as 4,5,7= medium speed walking, and it is not entirely clear why 3 distinct HLs are needed to describe medium speed walking. Some HLs seem to fit less well the data, e.g. HL 6. I could not find a clear explanation of why 10HLs each with 5LLs were chosen and whether fewer HLs would have worked as well. What would happen if the HHMM had less HL nodes but more LL nodes in each HL? A discussion of survival times in each HLs might help sort this out and provide a way to interpret states 4,5,7. Are these different behaviors or one behavior distributed over 3 HL?repeatability.The explanation of why we chose the model was in subsection \u201cModel selection\u201d of the Materials and methods. We have expanded this section to address the reviewer\u2019s comments. To address the reviewer\u2019s specific questions: The main reason for the choice of 10 HL and 5 LL states was We tried different combination of HL and LL states from 6-16 for HL states and 4-6 for LL states. There were some models with as few as 6 HL states that worked well. Models with 16 HL states rarely used more than 12 HL states. So, models with 6-12 HL states could work. However, multiple runs with 6 or 8 states gave widely different results, therefore we decided to use 10 states. With respect to the LL states, 4-6 states yielded similar results. If more than 6 LL states were chosen, many LL states remained unused.We think that the range 6-12 is a fairly narrow range. One important point is that within this narrow range of states, the state duration in all the models we tried were very similar. The insensitivity of state duration made us confident that the structure we discovered is real.A detailed analysis of the duration of the HL state seems consistent with the reviewer\u2019s intuition that it would make more sense to combine those states 4-7 into a single state because these states have a shorter duration. Does reducing the number of HL state combine the three medium speed HL states into one state? The answer is largely a no see . AlthougOne important limitation of our modelling approach  is that it is difficult to compare across models because everything changes slightly\u2013 LL states change, HL states change. We are currently revising the model to keep the LL states fixed so that the modeling approach would mostly focus on how the HL select the LL states. This process will make it much easier to compare across models. Unfortunately, this change is non-trivial and beyond the scope of this manuscript.Subsection \u201cLocomotor features and implications for neural control of behavior\u201d.In the discussion the authors say that v_parallel lies within a narrow range that is distinct for each three state and that 3 states reflect a tight control on locomotion by the brain. They mention these locomotor state can persist up to 3 second/30 steps and suggest that this indicates that the brain controls locomotion in blocks of 10 steps. I find this conclusion drawn from the finding of these 3 clusters too speculative given the data: In Figure 3\u2014figure supplement 1 and Figure 4 the distributions of v_par overlap significantly between HL 4,5 and 7. This is again related to the two points above. Finally, if HL 4 5 7 are really distinct behaviors then another possibility could be that they are needed to account for fly-to-fly variability in the data, and that for a single fly only one state is sufficient to describe medium speed walk.Yes, we have changed the discussion around this claim.Significant additional revisions are still required. The comments of the expert reviewers, below, are detailed and require full responses.Reviewer #2:[\u2026] Two points need to be addressed before acceptance:1) How do the priors used in fitting constrain the structure of the transition matrices found for the models? In the Results section, the authors state that \"the assumption of Markov dynamics with a sparse prior on state transitions penalizes the consideration of unlikely state transitions base upon recent history and future destinations.\" This suggests that a sparse prior was applied in fitting. However, later in the paper the authors state: \"The transition probability matrix for the HMM was sparse, suggesting that from each state there are transitions to only a handful of other states.\" If a sparse prior was applied during fitting than the fact that the resulting transition matrix is sparse is not really a finding about the data.Similarly, the authors need to clarify what fitting priors or constraints were placed in the HHMM model. The Results state \"This is because any HHMM- which puts very specific constraints on the transitions probability matrix- can be represented by an HMM but not vice-versa.\" What are the constraints on the transition probability matrix for the HHMM? The text says \"The transition probability matrix is sparse- a vast majority of transitions from each HL state were to 2-3 other HL states.\" Was this imposed by fitting priors?th \u2013 jth state were the same.We have made the priors that we use more explicit . The description in subsection \u201cRationale for the choice of HHMM as the model and the model architecture\u201d only refers to the fact that self-transitions are favored over transition to another state. The priors for all transitions from iWith respect to HHMM versus HMM, this is already well-described in the manuscript. . Essentially, an HMM with 50 states allows transitions between each of the 50 states. HHMM with 10 HL states and 5 LL states only allows a fraction of these transitions because only LL states within each HL state can transition amongst each other. This property also means that HHMM can always be represented by HMM and not vice-versa.2) Parts of the manuscript are somewhat long and repetitive. I think the manuscript could be productively shortened to have greater impact on its readers.For example, in the section titled \"HHMM reveals that a fly's locomotion is surprisingly structured in the velocity space\" the last paragraph is devoted to restating the major conclusion of the first section: HHMM performs better than HMM. I think this could be reduced or folded into section one, which focusses on this comparison, and the section focused more exclusively on describing the HL states uncovered by the model.In the Discussion subsection \u201cFlies show considerable variability in locomotion despite employing the same locomotor features\u201d paragraphs two and three are highly descriptive of the individual fly data and somewhat repetitive with parts of the Results subsection \u201cBoth locomotion and an odor\u2019s effect on locomotion is fly dependent\u201d . I think these sections could be condensed to make the major points about individual variability in the Results, and use the Discussion mostly to compare these findings with the results of other studies.We agree with the reviewer. We have not only made the two specific changes suggested above. We have also taken a careful look at the manuscript, and by cutting repeated segments and tightening the writing, we have reduced the word count  by ~2000 words.Reviewer #3:The authors have addressed most of my concerns expect the important one regarding the confidence interval on the distributions in Figure 5. What I am asking is for the authors to use bootstrapping to extract many sample distributions from subsets of the data in order to get a confidence interval on how these bins are populated by the data and how significant the changes are between before and during odor exposure.Apologies for not fully understanding your query. We have performed the bootstrapping. Confidence intervals and significance are noted in Figure 5."}
+{"text": "Candida species, especially Candida albicans. Invasive candidiasis includes candidaemia, disseminated candidiasis with deep organ involvement and chronic disseminated candidiasis. During the last decades rare pathogenic fungi, such as Aspergillus species, Zygomycetes, Fusarium speciesand Scedosporium have also emerged. Timely diagnosis and proper treatment are of paramount importance for a favorable outcome. Besides blood cultures, several laboratory tests have been developed in the hope of facilitating an earlier detection of infection. The antifungal armamentarium has also been expanded allowing a treatment choice tailored to individual patients\u2019 needs. The physician can choose among the old class of polyenes, the older and newer azoles and the echinocandins. Factors related to patient\u2019s clinical situation and present co-morbidities, local epidemiology data and purpose of treatment  should be taken into account for the appropriate choice of antifungal agent.Invasive fungal infections are a growing problem in critically ill patients and are associated with increased morbidity and mortality. Most of them are due to  Candida species (spp) were predominantly isolated (17%) followed by Aspergillus species. Candidaemia is associated with a high mortality and increased length of hospital stay and cost [.High attributable mortality may be due to delayed diagnosis and treatment, development of resistance or severity of illness. The purpose of the present review is to provide a practical approach to diagnosis and treatment of invasive fungal infections in the critically ill.Great advances in contemporary medicine and especially in critical care achieved during the last decades have contributed not only to longer survival of patients, but also to the increasing incidence of opportunistic infections caused by fungi. Complex medical and surgical problems, disruption of natural barriers, multiple invasive procedures and prolonged antibiotic treatment are some of the factors contributing to the alarming increase of fungal infections in the Intensive Care Unit (ICU) setting ,2. The land cost ,5..High Candida species are ubiquitous and constitute part of the normal human flora. Only a small percentage of the identified species cause disease in humans. Candida spp. is responsible for an extremely large spectrum of diseases [Candida infections include candidaemia with or without endopthalmitis; disseminated haematogeneous infections; involvement of a single deep organ site  and chronic hepatosplenic candidiasis mostly in haematological patients [Candida infection can be endogenous  and exogenous  even leading to local outbreaks [diseases ,7. Invaspatients . Source utbreaks . Existinutbreaks .Candida bloodstream infections (BSIs) constitute the vast majority of nosocomial fungal infections. In a large nationwide surveillance study in United States (SCOPE) Candida spp were ranked fourth among the hospital-acquired BSIs (9%) [Candida infections (ICI) in the critically ill are available. In an Australian study of ICU-acquired BSIs, Candida species were ranked fourth (15.5%) while according to Meyer et al. the incidence of primary nosocomial candidaemia in 682 German ICUs remained stable in a 5-year period [Candida species [SIs (9%) . The majSIs (9%) . AlmiranSIs (9%) ,13. In aSIs (9%) . Limitedd fourth .5% whiler period . In a rer period . In a lar period . Finallyr period . In a to species . The dis species ,21.Candida BSIs are a well-recognized cause of morbidity and mortality among the critically ill. Though the crude mortality varies between studies, most authors report high percentages (39%\u201360%) and excess financial burden [et al. included seven studies with attributable mortality ranging between 5 and 71%. For six of them a considerable difference in mortality between cases and controls was observed. Moreover the length of stay and hospitalization cost was significantly higher than that of controls [l burden ,22. Attrcontrols . If candcontrols . Candida species which are pathogenic for humans, Candida albicans is the most frequently recognized followed by C. parapsilosis, C. glabrata and C. tropicalis [C. krusei, C. dublinensis, C. guillermondi, C. kefir, C. lusitaniae, and C. rugosa. Nevertheless the list of species formerly considered as \u201cnon-pathogenic\u201d is expanding with the increase in the number of vulnerable population and the ability of the laboratory to isolate new species.During the last decades a shift to non-albicans species has been noted [Candida species in a 6-year period has changed with C. albicans decreasing by 10% though still remaining the most common isolated species [albicans species has been also observed in critically ill patients with considerable differences in the percentage of albicans vs non-albicans spp [C. albicans, followed by C.parapsilosis (23%), C. glabrata (15%), C. tropicalis (9%) and other species (13%) [C. albicans accounted for 57% of blood isolates followed by C. glabrata (16.7%), C. parapsilosis (7.5%), C. krusei (5.2%) and C. tropicalis (4.9%) [albicans species (NAS). In a case-comparator study Chow et al. showed that fluconazole exposure, presence of a central venous catheter and mean number of antibiotics per day were associated with an increased risk of BSIs due to NAS compared to C. albicans while in another study use of medical devices, steroids receipt and pre-existing candiduria were the risk factors associated with the presence of NAS [Candida species has its separate characteristics [Candida spp. is important because some of these species are resistant to fluconazole or other antifungal agents. Awareness of risk factors for the presence of NAS, rapid species identification and antifungal susceptibility testing are required for the proper and timely treatment of these infections.Among opicalis . Speciesen noted . Accordi species . This ch species . The inccans spp . In an Ies (13%) . In a prs (4.9%) . Severale of NAS ,32. Moreeristics ,34,35  is not an easy task because signs and symptoms vary from minimal to dramatic while existing diagnostic procedures present several drawbacks. Blood cultures (BCs) remain the cornerstone of diagnosis but they have suboptimal sensitivity (30%\u201350%) and need long incubation time . Moreovenfection .d-glucan tests whereas antibodies against the mannan antigen (anti-mannan) have also been developed [Candida; Biorad, Biorad laboratories GmBH); and an enzyme\u2013linked immunosorbent assay (ELISA). Both methods have equal specificity (90%\u2013100%) in diagnosing candidaemia [Candida species under consideration, being higher for C. albicans [d-glucan (BG) , which is a pan-fungal marker , demonstrates variable sensitivity depending on the cut-off diagnostic value and the Candida species under consideration [Candida infection and it must be interpreted with caution due to false positive results from albumin and/or immunoglobulin administration, haemodialysis or Gram-positive bacteraemia [et al. the BG test exhibited excellent positive  and negative  predictive values in critically ill patients [C. albicans  showing 77%\u201389% sensitivity and 91%\u2013100% specificity [Candida species and it has not been validated in the critical care setting.In order to make timely diagnosis more feasible, several serological markers have been developed. These tests consist of the detection of various agents, components of the fungal cell wall such as the mannan and 1,3-\u03b2-eveloped ,39,40,41didaemia ,42 but Ealbicans ,44. In halbicans ,38. Combteraemia . A negatpatients . An indicificity ,47. ThouCandida infection [et al., both real\u2013time PCR and BCs have comparable sensitivities in diagnosing candidaemia (60%) but PCR is invaluable in diagnosing deep\u2013seated candidiasis with negative BCs (sensitivity 88% for PCR vs 17% for BCs) [et al. tested three real\u2013time PCR assays for the detection of Candida spp in non-neutropenic critically ill patients with candidaemia, showing excellent sensitivity (90.9%) and specificity (100%) [Additionally nucleic acid-based detection methods  have been developed for the detection of nfection ,48,49. Afor BCs) . Moreovefor BCs) . Data coin situ hybridization (PNA FISH). This method is a rapid way to differentiate among the usually isolated Candida species in blood provided that blood cultures have developed Candida spp [Finally several recently introduced diagnostic tools include: (a) matrix- assisted laser desorption ionization\u2014time of flight mass spectrometry (MALDI\u2013TOF MS). The test seems a rapid and reliable tool for the identification of yeasts and yeast-like fungi ; (b) a cdida spp . In a redida spp . Candida infection leads to increased mortality in case of treatment delay. The lack of methods with a high sensitivity and specificity for the timely diagnosis of IC created the need for the identification of risk factors and evaluation methods in order to ensure timely treatment even in the absence of laboratory evidence of infection. These risk factors have been described in many studies [Invasive  studies ,54,55,56Candida colonisation patterns in combination with the established risk factors of Candida Prediction Rules have been established in many studies [Fungal colonisation has been associated with the development of IC, yet according to recent data, a small proportion (3%\u201325%) of colonised patients subsequently develop invasive disease ,58. Due  studies ,62,63,64Aspergillus spp are moulds which are able to cause life-threatening invasive disease in immunocompromised individuals and local disease in immunocompetent persons. The latter can present with a spectra ranging from localised infection of the lungs and sinuses to allergic reactions due to spore inhalation. The species present a worldwide distribution and are found in the environment, plants and decomposing organic matter. Among the hundreds of Aspergillus species few are able to cause disease to humans. The most commonly encountered include A. fumigatus followed by A. flavus and A. terreus. The epidemiology of aspergillosis in the ICU is difficult to establish due to the inhomogeneity of hospitalised patients, the diagnostic difficulties necessitating a biopsy and the difficulty in discriminating between colonisation and disease [Aspergillus in the ICU include improperly cleaned ventilation systems, water systems, or even computer consoles [ disease . Sometim disease  while a  disease . Possiblconsoles . ICU patconsoles . Anastomconsoles  while raconsoles ,71.The diagnostic approach includes evaluation of possible risk factors, clinical and radiological signs and the implementation of specific laboratory and \u201chigh technology\u201d methods.etc. [Aspergillus to the brain can cause seizures, brain infarctions, intracranial haemorrhage and meningitis.Persons at greatest risk include patients with haematological malignancies, solid organ transplant recipients, haematopoietic stem cell transplant recipients (HSCT) but also prolonged steroid treatment before ICU admission, chronic obstructive pulmonary disease, severe burns, previous cardiac surgery etc. . Clinicaet al. recorded nonspecific infiltrates and consolidation as the commonest radiological findings in critically ill patients with Invasive Aspergillosis (IA) [Radiologic chest radiograph might be negative at the beginning of the disease, or might show nonspecific changes even during the late stages  and theysis (IA) .Aspergillus in invasive tissue sampling [Aspergillus from cultures of bronchial secretions, broncho alveolar lavage (BAL) or other body fluids or tissues, might represent colonisation rather than infection [Aspergillus in respiratory samples lies between 10%\u201380%, according to different studies [The gold standard of diagnosis of IA is the histopathological identification of sampling . Howevernfection . Howevernfection . Focusin studies ,79.d-glucan, two fungal cell wall components in blood or other body fluids. The first is released in body fluids during Aspergillus growth [d-glucan, false positive results might be associated to the use of immunoglobulin contaminated with fungal products, the presence of bacterial infections, the administration of several antibiotics and the use of cellulose filters of haemodialysis [Two non-culture-based diagnostic techniques are available: the detection of galactomannan (GM) and \u03b2-s growth . It can s growth . This mes growth . In non-s growth . Variabls growth . As for dialysis .et al., a whole blood quantitative real time PCR (qPCR) targeting to a special gene sequence of the fungus could prove as a clinically reliable technique for diagnosis of IA [An additional method for IA diagnosis is PCR . The senis of IA . Additiois of IA .proven, probable, and possible [proven diagnosis. Probable IPA is confirmed by a combination of clinical and host factors and positive mycological criteria, including cultures or detection of cell wall components. Possible IPA diagnosis is based on the presence of clinical and host features but without positive mycology. However, the aforementioned criteria have been validated in immunosuppressed patients, while in critically ill without classic risk factors this classification has been questioned [probable (\u201cputative\u201d) if there are compatible signs, abnormal medical images and either host risk factors or BAL culture positive for Aspergillus. This simple clinical algorithm has been validated in critically ill patients with histopathologically proven aspergillosis, showing specificity 61% and sensitivity 92%, and might prove to be useful in the IA diagnostics in critically ill patients.The European Organization for Research and Treatment of Cancer/Mycosis Study Group (EORTC/MSG) has incorporated the risk factors, clinical signs and laboratory tests in an attempt to stratify the diagnosis of invasive pulmonary aspergillosis (IPA) into possible . Histopaestioned . Therefoestioned . AccordiEntomophtorales and Mucorales. Entomophtorales are rarely implicated in a life-threatening angioinvasive human disease, whereas Mucorales are responsible for mucormycosis, the third commonest invasive fungal infection [Mucorales are traditionally divided in six families: Mucoraceae, Cunninghamellaceae, Saksenacea, Thamnidaceae, Syncephalastraceae and Mortierellaceae. Recently a seventh family, called Absidiaceae, was added. Rhizopus, Mucor, Rhizomucor, Absidia, Apophysomyces, members of the genera of the two families of Mucoraceae-Absidiaceae, are pathogens most commonly implicated in human disease [The class of Zygomycetes is divided in two orders, nfection . Mucoral disease .These organisms are ubiquitous saprophytes in nature rarely infecting organisms with intact immune system. Based on anatomic localization, mucormycosis can be classified in six forms: rhino- cerebral, pulmonary, cutaneous, gastrointestinal, disseminated and uncommon presentations . ClinicaRhizopus species [Sporadic mucormycosis is a life - threatening condition, always associated with certain risk factors, mainly neutropenia and prolonged acidosis of either diabetic or renal origin. Mucormycosis in the ICU setting is related more commonly to massive injuries e.g. from motor vehicle accidents, natural disasters ,96 or co species . Mucorales species has been recently described, but it cannot be routinely used [Aspergillus and Mucorales spp.The diagnosis is based on the examination of tissue samples. Stains of fixed tissues with hematoxylin-eosin, Grocott-methanamine-silver (GMS) or periodic acid-Schiff (PAS) are pathognomonic, showing broad nonseptated hyphae, irregularly branched at angles varying from 45\u201390\u00b0 .Vascularely used ,101. TabRecent decades have seen an impressive progress in the development of our therapeutic antifungal armamentarium. Four classes of antifungal drugs are currently available for the treatment of invasive fungal diseases in critically ill patients. They include: (1) polyenes, (2) azoles, (3) echinocandins and (4) pyrimidine analogues.Candida species- with the exception of C lusitaniae and C guillermondii but also Cryptococcus neoformans and the Mucorales.The antifungal spectrum of the drug also includes filamentous fungi especially Aspergillus spp (with the exception of A. terreus) dimorphic fungi such as Histoplasma, Blastomyces, Coccidioidomyces, Paracoccidiodomyces, and emerging yeasts such as Trichosporon spp and Geotrichum spp although Trichosporon strains with high MICs to amphotericin B were detected in some studies [C. glabrata and C. krusei isolates presenting higher minimum inhibitory concentrations (MICs) [A. fumigatus, the species exhibiting usually susceptibility to amphotericin B, has shown an increase in resistance [alternative agents for the treatment of candidaemia [For several decades, amphotericin B deoxycholate (AmB) has been the mainstay of treatment for invasive fungal infections. It possesses a broad spectrum of activity against not only most of  studies . Its eff studies ,104. Dess (MICs) . On the s (MICs) . A. fumisistance . The usesistance  The risksistance ,110 and sistance  but havesistance . Moreovesistance . Infusiosistance . In contdidaemia  due to tdidaemia . This redidaemia . Dreyfusdidaemia .Four azole compounds are available for the treatment of invasive fungal diseases: itraconazole, fluconazole, voriconazole and posaconazole.Aspergillus spp. Once available as oral agent, it is now available in parenteral form as well. The role of itraconazole in critically ill patients with invasive fungal infections (IFI) has not been determined.The older agent of azoles, with a good activity against Candida with the exception of C. glabrata and C. krusei but not against Aspergillus or Zygomycetes. Fluconazole acts by inhibiting an enzyme necessary for the biosynthesis of cell membrane sterol ergosterol [et al have shown that levels of fentanyl and midazolam are increased with the co-administration of fluconazole or voriconazole [Fluconazole is active against most species of gosterol  and althgosterol ,120 it hgosterol . Especiagosterol  Skrobik conazole . ElevatiCandida species including the ones resistant to fluconazole, Cryptococous neoformans, Aspergillus and Fusarium species. Zygomycetes are not susceptible to voriconazole. It is the drug of choice for invasive forms of aspergillosis [A. fumigatus have also been ascribed to voriconazole [Voriconazole is a second-generation member of azole family. It possesses a broad spectrum of activity covering gillosis . It actsgillosis ,127,128.conazole . Adverseconazole ,130 but conazole  though tconazole . A wide conazole ,134. Facconazole ,123. Vorconazole .Candida spp, Aspergillus spp, Cryptococcus and Mucorales. It is available only in oral suspension form  therefore its use in the critically ill is very limited. Posaconazole is given to prevent the fungal infections in neutropenic patients with leukaemia [The newest compound of azoles is active against eukaemia . The comeukaemia .Candida and Aspergillus species. Their mode of action is the inhibition of the synthesis of 1,3-\u03b2-glucan, a polysaccharide which maintains the integrity of the cell wall and they are fungicidal in vitro against Candida but fungistatic for Aspergillus [.This is the newest class of antifungal agents developed and they include caspofungin, micafungin and anidulafungin. They possess a limited spectrum of activity covering only ergillus .C. parapsilosis is associated with higher MICs and therefore echinocandins are not recommended for candidaemia caused by these species. Their major advantages are the few or negligible interactions with other drugs, especially for micafungin and anidulafungin and their minor adverse effects  [They are given only intravenously in a slow infusion rate in order to avoid the rare infusion - related reactions. Since the active drug is not excreted into the urine their use in candiduria is not suggested. Moreover, the level of echinocandins in special compartments such as cerebrospinal fluid and intraocular compartment remains low. actions) . Differeactions) ,141,142 A significant advantage of echinocandins is that being fungicidal they offer much more rapid resolution of symptoms with fewer complications when compared to fluconazole . Due to  or other severe mycosis such as cryptococcosis, aspergillosis and chromoblastomycosis [Flucytosine is the main representative of the class. It is available only as oral formulation in USA but also in intravenous form in other countries and it is mostly used in combination with AmB for special forms of invasive candidiasis omycosis . Newer drugs under investigation include isavuconazole, ravuconazole and albaconazole while a human recombinant monoclonal antibody  has been used in combination with AmB showing favorable results ,145.Candida species and susceptibility tests [albicans species; prior treatment with fluconazole; site of infection; spectrum of activity; known adverse effects; pharmacodynamics /pharmacokinetics; cost of treatment; but the most important factor is the presence of haemodynamic instability [C. glabrata, echinocandins are preferred to fluconazole. Amphotericin B is characterized as an alternative choice in case of intolerance to the other two, refractory infection, resistant organism or suspicion of infection due to pathogens other than Candida (e.g. cryptococcus). This is a basic difference from the guidelines of 2004 where AmB was a first choice. A step-down from echinocandin to fluconazole is suggested provided there is a clinical improvement and sterilisation of blood cultures. The recent guidelines of the European Society of Clinical Microbiology and Infectious Diseases (ESCMID 2011) [Candida sepsis are suggested also by Kullberg et al. [C. parapsilosis) an echinocandin is preferred. Finally the German speaking Mycological Society and the Paul \u2013 Ehrlich \u2013 Society for Chemotherapy suggest the use of echinocandins or liposomal amphotericin B in critically ill septic patients instead of fluconazole [The time of treatment initiation is a key factor for the favorable outcome of invasive candidiasis. Several studies have shown that delay of initiation of appropriate antimicrobial therapy over 24 or 48 h has a negative impact on mortality ,147,148.ty tests . Importatability ,150. Acctability . NeverthID 2011)  endorse g et al.  while thg et al. . Moreoveconazole .Candida is common or at least not negligible, empirical treatment with azoles cannot be recommended. Local and general resistance patterns are often published [An important parameter is that every institution should be aware of its resistance rates since in case that resistant ublished ,156 helpCandida spp supports this view. In case of catheter-related bloodstream infection, an antifungal drug with biofilm action is preferred (AmB or echinocandin). Finally, a fundoscopic examination is of pivotal importance in order to exclude disseminated endocular infection. If a form of localised candidiasis has to be treated, a longer treatment is suggested and the recommended agents are shown in Further important considerations for the practitioner include: (a) the length of therapy (b) the removal of central catheters (c) the fundoscopic examination. Serial blood cultures should be drawn after the start of treatment in order to ascertain blood sterilization. Duration of treatment is defined to 14 days after the last positive blood culture ,150,154.Combination of amphotericin B with flucytosine is recommended in cases of localised infection such as meningitis, osteomyelitis and intra-abdominal infections .Because the mortality associated with invasive candidiasis is high while the sensitivity of blood cultures is low other management options exist, including prophylactic, pre\u2013emptive and empirical therapy.albicans species. A more judicious approach should include the careful validation of patients at risk taking into consideration local data on rates of different Candida species.Prophylaxis is defined as the administration of antifungal agents to high-risk patients without signs or symptoms of infection in order to prevent the development of invasive fungal infection. The agent given systematically for that purpose is mainly fluconazole while recently the use of echinocandins has been successfully tested . AlthougCandida colonisation, presence of gastrointestinal surgery or use of total parenteral nutrition are among the risk factors suggested for use in such cases [d-glucan was used for identifying ICU patients at highest risk to develop an IFI and for monitoring treatment response [Initiation of antifungal agents in the presence of multiple risk factors constitutes pre-emptive treatment. Prolonged ICU stay, use of broad-spectrum antimicrobials, multi-focal ch cases ,172. Thech cases . In a reresponse . NeverthCandida infection is due to NAS and increasing costs [If antifungal treatment is given to a patient with clinical signs of infection  and several risk factors for candidaemia without proof of invasive candidiasis, the term \u201cempirical\u201d may be used. Moreover this term can be applied if antifungal treatment is given to a patient with candidiasis proven by blood culture pending the results of susceptibility tests. In the first case the criteria for therapy initiation are vague in contrast to neutropenic patients and the benefits are not well established. The largest conducted study is the one by Shuster conducted in a SICU. No clear benefit of fluconazole use was proved in that study . IDSA gung costs . Canadiang costs . Fluconang costs . Figure Aspergillus spp and the drug\u2019s side effects have limited its use for the treatment of IPA [Even a clinical suspicion of IPA should lead to the consideration of initiation of antifungal treatment, since the mortality of the disease remains high. AmB was the antifungal of choice for many years. However, the reported development of resistance among t of IPA . Lipid-bt of IPA .The treatment of choice for IA is voriconazole . The recAspergillus spp [. Combination of azoles and echinocandins might be used in refractory cases of IA [Other alternative drugs for the refractory cases of IPA are the echinocandins. Caspofungin has shown favorable results in patients with IA refractory to first line antifungals . Micafunllus spp . Combinaes of IA . The comes of IA ,181. Addes of IA .A.terreus shows primary resistance to AmB while similar susceptibility results have been demonstrated for several species of the Fumigati group [A. fumigatus possibly due to genotypically determined resistance mechanism. Cross-resistance to triazole has also been reported. According to IDSA guidelines, itraconazole should not be used for treatment of IPA refractory to voriconazole because of the possibility of cross-resistance and the subsequent toxicity [The duration of IPA treatment might last from several months to more than one year and should be tailored to patients\u2019 response ,182. Cliti group ,180. Multoxicity . A reduction of the degree of immunosuppression by immunomodulatory therapy is a possible adjunctive factor to successful therapy of IPA. According to IDSA guidelines neutropenic patients with IPA might benefit from the administration of granulocyte colony-stimulating factor (G-CSF) or granulocyte-macrophage colony-stimulating factor (GM-CSF) . There aAdditional measures for prevention of IPA are the use of high \u2013 efficiency particulate air filtration (HEPA) and the avoidance of hospitalisation in areas with construction procedures . RegardiMucorales spp. requires several simultaneous approaches: aggressive (sometimes disfiguring) surgical intervention, antifungal drug therapy and management of all underlying medical conditions that might predispose the patient to the disease. On diagnosis LipAmB should be started at a dose 5\u201310 mg/kg once daily. The maximal dose is indicated for mucormycosis with intracerebral extension. Posaconazole, a new triazole antifungal agent, is currently considered as a second-line drug for the treatment of mucormycosis at a dose of 400 mg twice daily. Its use is recommended in combination with LipAmB or as sequential long-term therapy. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and hyperbaric oxygen have been used adjunctively in neutropenic patients offering doubtful results [The treatment of  results .Invasive fungal infections in the critical care setting often constitute a challenging diagnostic and therapeutic problem. Clinical awareness, knowledge of local epidemiology and pharmaceutical considerations are factors of paramount importance for an early diagnosis and treatment of these potentially lethal infectious diseases."}
+{"text": "The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.In immunocompromised patients, reactivation of latent BK polyomavirus (BKPyV) can cause disease with lytic infections of the kidneys and the lower urinary tract. Emerging evidence also links BKPyV to oncogenesis and high\u2010grade intrarenal and transitional cell carcinomas. These neoplasms strongly express polyomavirus large\u2010T antigen as a defining feature; that is, they are \u2018large\u2010T\u2010positive carcinomas\u2019. Such neoplasms arise in immunocompromised patients, typically in renal allograft recipients, and preferentially in tissues harbouring latent BKPyV. In recent articles in this journal, it was shown that tumour cells harbour replication\u2010incompetent clonal BKPyV. The virus can be truncated and randomly integrated into the genome, and/or it can be mutated in an episomal state. Truncation and/or deletions in the BKPyV non\u2010coding control region can hamper late viral gene expression, replication, and cell lysis, while facilitating overexpression of early genes, including that encoding large\u2010T. Biologically active fusion proteins or alterations in human tumour suppressor or promoter function have not been described so far, making uncontrolled large\u2010T gene expression in non\u2010lytically infected cells a prime suspect for neoplastic transformation. Current concepts of BKPyV\u2010induced disease, including recent reports from this journal, are discussed, and evolving paradigms of BKPyV\u2010associated oncogenesis are highlighted. \u00a9 2018 The Authors.  Lancet suggested that BKPyV was in search of a disease Polyomaviruses, including the BK polyomavirus (BKPyV) strain, are ubiquitous, and 40 years ago an editorial in the Well studied are BKPyV infections that start as clinically insignificant primary events in young individuals. After primary infection, the virus is usually not completely cleared from the body, but rather establishes latency, mainly in the urogenital tract , but also in other tissues and cells, such as tonsils, lymphocytes, blood mononuclear cells, and the brain. Latent BKPyV is usually in an episomal state and escapes standard morphological detection, necessitating the use of molecular techniques. Beyond infancy, latent infections can be found at any age, possibly driven by low\u2010level subclinical sporadic replication. By using polymerase chain reaction testing, we found latent BKPyV in the renal parenchyma (34%) and urothelium (42%) of asymptomatic adult patients .Under immune modulation, latent BKPyV can be reactivated and enter into a replicative cycle in permissive tissue. During the replicative cycle, early viral genes, including the large\u2010T gene, are expressed initially  in two neoplasms (each strain restricted to one tumour). Chapel Hill BKPyV 1 and 2 were linearised, truncated at viral capsid protein\u2010encoding sites, and randomly integrated into the tumour genome at a single locus. No BKPyV was found in adjacent non\u2010neoplastic parenchyma. Viral truncation with deletions in late gene sequences not only rendered Chapel Hill BKPyV 1 and 2 replication incompetent, but presumably also disrupted negative large\u2010T\u2010controlling feedback loops, resulting in unregulated and persistent expression of early viral genes. Overexpression of large\u2010T was presumably further promoted by deletions in the NCCR domain of Chapel Hill BKPyV 1 and resulting alterations in NCCR regulatory functions . No role in oncogenesis could be attributed to host gene integration or novel bioactive fusion proteins. M\u00fcller et al also described a linearised and truncated BKPyV randomly integrated at a single locus into the tumour genome of a micropapillary metastatic large\u2010T antigen expressing urothelial carcinoma of donor origin. Similarly to the observations of Kenan et al, truncation was noted in late viral gene sequences, rendering the integrated virus replication incompetent. What is especially intriguing is that M\u00fcller et al additionally detected episomal full\u2010length BKPyV that was not replicating because of a short, specific 17\u2010bp deletion in the NCCR P\u2010block impairing late but not early viral gene expression. As the same NCCR deletion was noted in the integrated viral gene sequence, the authors speculated that, during neoplastic transformation, mutation of the episomal BKPyV had occurred first, followed by truncation and chromosomal integration. Sole episomal mutated BKPyV without integration into the tumour genome was seen in one of our recently diagnosed high\u2010grade large\u2010T\u2010positive renal cell carcinomas. This tumour\u2010associated full\u2010length BKPyV showed deletions in the R\u2010block and S\u2010block and duplications of the O\u2010block, P\u2010block and Q\u2010block of the NCCR, promoting early and hampering late viral gene expression. In contrast to the report of M\u00fcller et al, however, no deletions were found in the NCCR P\u2010block . These modern\u2010era data are in line with those from older studies using electrophoresis and Southern blot techniques Three seminal publications by Kenan All studies combined show a common scheme in BKPyV\u2010associated cancer Figure ; Table 1et alCurrent observations, based on experience with simian virus 40 (SV40) and Merkel cell polyomaviruses, have culminated in the following hypothetical model(s) of BKPyV\u2010associated carcinogenesis Figure . In permet alet alRecently collected evidence on the role of BKPyV as a neoplastic driver is compelling. Seminal observations made by M\u00fcller All authors contributed to writing the manuscript."}
+{"text": "Streptococcus suis is a major pathogen of swine, responsible for a number of chronic and acute infections, and is also emerging as a major zoonotic pathogen, particularly in South-East Asia. Our study of a diverse population of S. suis shows that this organism contains both Type I and Type III phase-variable methyltransferases. In all previous examples, phase-variation of methyltransferases results in genome wide methylation differences, and results in differential regulation of multiple genes, a system known as the phasevarion (phase-variable regulon). We hypothesized that each variant in the Type I and Type III systems encoded a methyltransferase with a unique specificity, and could therefore control a distinct phasevarion, either by recombination-driven shuffling between different specificities (Type I) or by biphasic on-off switching via simple sequence repeats (Type III). Here, we present the identification of the target specificities for each Type III allelic variant from S. suis using single-molecule, real-time methylome analysis. We demonstrate phase-variation is occurring in both Type I and Type III methyltransferases, and show a distinct association between methyltransferase type and presence, and population clades. In addition, we show that the phase-variable Type I methyltransferase was likely acquired at the origin of a highly virulent zoonotic sub-population. Streptococcus suis is a major veterinary pathogen, causing a range of chronic and severe diseases in pigs such as arthritis and septicaemia   within a gene or promoter, or by the shuffling of sequences by homologous recombination between expressed and silent loci via inverted repeats (IRs) present in these loci . Phase vregulon) . These sfluenzae , Moraxelarrhalis , pathogearrhalis  and Streeumoniae . All thensferase . In contnsferase . All phansferase . This haStreptococcus suis isolates were grown on Brain-Heart Infusion (BHI) agar or Sheep-blood agar (Oxoid), with liquid cultures grown in Todd-Hewitt broth containing 0.2% yeast extract (Oxoid) at 37\u00b0C. Escherichia coli DH5\u03b1 and BL21 were grown in Luria\u2013Bertani media supplemented with 100\u00a0\u03bcg/ml ampicillin where appropriate, at 37\u00b0C with 200\u00a0rpm shaking. Prototype S. suis strains used in this study are detailed in Table Standard molecular biology techniques were used throughout . GenomichsdS in S. suis strain S735 were quantified utilising FAM labelled PCR coupled to a restriction digest in a method similar to that used previously for S. pneumoniae (hsdS locus was PCR amplified (3.02 kb) from extracted genomic DNA prepared from an entire plate of S. suis strain S735 grown overnight on BHI agar. PCR was carried out using GoTaq DNA polymerase (Promega) according to the manufacturer\u2019s instructions, and utilising primers that bind outside the area of recombination (Ssu-T1-For-FAM and Ssu-T1-Rev). The PCR products were then digested in a double-digest with DraI and NciI (New England Biolabs). This digestion was predicted to yield different sized FAM-labelled fragments for each of the variant forms. The pool of restriction fragments was run on an ABI prism Gene Analyser (Life Technologies). The area of the peak given by each labelled fragment, each corresponding to the prevalence of one of the variant forms, was quantified using Peak Scanner v1.0.The variant alleles of eumoniae . The whoS. suis strain grown over-night on BHI agar.Fragment length analysis of the phase-variable Type III methyltransferase repeat tract was conducted using the fluorescently labelled forward primer SsuT3-F-FAM and the reverse primer SsuT3-R, and fragments were analysed by the Australian Genome Research Facility . PCR was carried out using cell suspensions using the relevant S. suis strain S735 using cells grown overnight on BHI plates, so as to replicate the growth conditions used for the Type I allele quantification assay , SS1028 (modS2) and YS77 (modS3). A vector containing an non-methyltransferase, siaB, used previously  to a final concentration of 0.5\u00a0mM overnight at 37\u00b0C with shaking at 200\u00a0rpm.PCR products for cloning into the NcoI/BamHI site of pET15b cloning vector (Merck) were prepared using KOD Hot-start DNA polymerase (Merck) according to manufacturer's instructions. Primers specific for the Type III system were designed to clone the gene containing only one GAGCA repeat so as to lock-on the methyltransferase (SsuT3-oE-F and SsuT3-oE-R). We cloned the three unique eviously  served aE. coli cells expressing each methyltransferase and a negative control expressing an the non-methyltransferase siaB, described previously (S. suis strain LSS66 was prepared from an overnight culture in Todd Hewitt broth (Oxoid) +0.2% Yeast Extract (Fisher Scientific) and cells lysed according to the Genomic DNA Handbook (Qiagen) using 100 mg/ml Lysozyme (Sigma) supplemented with 250 units/ml Mutanolysin (Sigma). High-molecular-weight genomic DNA was isolated using Genomic-tip 100/G columns (Qiagen) according to the manufacturer's instructions and DNA resuspended in 10 mM Tris\u2013Cl, pH 8.5 (Qiagen) overnight at 4\u00b0C. A phenol:chloroform:isoamylalcohol (Sigma) clean-up was then performed before finally resuspending DNA in 10\u00a0mM Tris\u2013Cl, pH 8.5 (Qiagen) overnight at 4\u00b0C. SMRT sequencing and methylome analysis was carried out as previously  containing 5% (v/v) sheep blood  as described previously (hsd region from S. suis P1/7 (Genbank locus tags SSU1271-SSU1274) and the mod locus from S. suis T15 (T15_1305) and used blastn against a custom blast database containing the collection and published complete genomes (S. suis strain P1/7 and using these as a tblastn query against a custom blast database containing the collection and published complete genomes (S. suis P1/7 (Genbank ID: AM946016) and which were present in every isolate were included in the core genome. A neighbour-joining tree of S. suis was made from this core genome using a pairwise distance matrix created with the \u2018K80\u2019 model  . This analysis examined the presence of both phase-variable Type I and Type III methyltransferases within S. suis genomes. Of these 393 S. suis strains, 262 strains contained a phase-variable Type I system, characterized by duplicate, variable hsdS loci containing IRs  . We alsoS. pneumoniae  of Type I alleles present in the expressed hsdS locus of the Type I system consist of 5\u2032-TRD-1 and 3\u2032-TRD-2, which we have designated allele B. Only two strains contain allele A, consisting of 5\u2032-TRD-1 and 3\u2032-TRD-1. No strains contained allele C (5\u2032-TRD-2 and 3\u2032-TRD-2) or allele D (5\u2032-TRD-2 and 3\u2032-TRD-1) in the expressed hsdS locus immediately downstream of the hsdM gene. However, this apparent lack of either allele C or allele D in the expressed hsdS locus of S. suis genomes could be a result of the genome annotation process \u2013 minority alleles do exist in a population but this locus will only be annotated as the majority allele in the final sequence annotation. In order to investigate if these duplicate, \u2018tail-to-tail\u2019 hsdS genes could undergo homologous recombination to produce variable hsdS sequences in the expressed locus immediately downstream of the hsdM gene, even in the absence of a locus-associated recombinase, we designed a fluorescent PCR reaction coupled to a restriction digest in order to type and quantify the alleles present within a population of S. suis  in the expressed hsdS locus , 5.14% of the population hsdS allele C (5\u2032-TRD-2 and 3\u2032-TRD-2)  , methyltransferase (HsdM)\u00a0and specificity (HsdS) components Figure , with theumoniae , we demoi Figure , and tha\u2032 Figure . Analysis Figure \u2013E. Usings Figure  and\u00a0E, c) Figure  and\u00a0E, a) Figure  and\u00a0E. Tallele B , and thaallele B . This deS. suis also demonstrated the presence of two additional Type I R-M loci (YYK_03085-YYK_03100 and YYK_07615-YYK_07625 in strain S735). Previous in depth analysis of Type I R-M systems in S. suis has shown that homologues of these loci are distributed across the majority of S. suis strains , with high diversity observed in the central TRD\u00a0(<25% nucleotide identity), which dictates the DNA sequence to be methylated (mod gene with 5\u2032-GAGCA(n) repeats, 29 contain an identical gene to the one we identified in a single strain of S. suis, strain T15, in our systematic study of all SSR-containing Type III mod genes in REBASE  repeat tract occurs in these genes, leading to variable expression of the mod gene, we performed FAM-labelled PCR coupled to fragment length analysis, over the repeat tract of the alleles identified in strains LSS89 and SS1028, as we have used previously to characterize and quantify expression of phase-variable genes  repeat tract length between each of the 41 Type III mod genes in our S. suis strain collection; this is also an excellent indication that phase-variable expression of this gene is occurring  sequencing and methylome analysis using plasmid DNA isolated from E. coli BL21 over-expressing each allelic variant demonstrated that these three alleles all methylate different DNA target sequences ATD-3\u2032  methylates the sequence 5\u2032-VTC(m6)ATC-3\u2032 ANNNB-3\u2032 ATC-3\u2032) occurs in all three vectors, as would be expected in DNA isolated from E. coli , modS2 (SS1028)\u00a0and modS3 (YS77) . This low number of repeats is highly stable, with low rates of phase-variation predicted based on previous analyses of SSR length and phase-variation rate ATC-3\u2032  , with sy3 (YS77)  of S.SsuodS1 LSS8, modS2  immediately upstream of a putative Type III mod gene. However, closer examination of this region showed that a functional Type III mod gene containing SSR\u2019s only occurred if a unique 119\u00a0bp sequence was present between the SSRs and the putative mod gene  repeats were present, sometimes in very high numbers  based on a Bayesian clustering method . Only strains T15 (Netherlands) and R61 (China) were not isolated in the UK. Interestingly, all strains from BAPS group 2 contained neither phase-variable methyltransferase, with a large proportion of BAPS group 4  also containing neither system , but that the phase-variable Type III methyltransferase has either been independently acquired at least three times in different populations, or alternatively been lost multiple times from isolates of S. suis.Our previous studies with g method  as well g et\u00a0al.\u00a0). Upon eg et\u00a0al.\u00a0 and the g et\u00a0al.\u00a0. The phag et\u00a0al.\u00a0, and serm humans . All memm Figure . In summin silico analysis due to the genetic features associated with them , and thus exclude them as stably expressed antigens, the identification of members of a phasevarion can only be accomplished by studying the strains that contain phase-variable methyltransferases , the three minor variants  could all be detected using our bespoke FAM-labelled PCR assay  and modS2 (strain SS1028)  Figure . Phase-v) Figure , althoug) Figure ,15,46\u201348modS allelic variants present in S. suis  repeats in the genomes of our S. suis strain collection, but these are not always linked to the downstream mod gene due to the apparent requirement of the observed 119 bp \u2018linker\u2019 sequence we observed in the 41 strains containing a phase-variable Type III mod gene, it may be that acquisition of a phase-variable Type I locus leads to subsequent inactivation of the Type III mod gene by loss of the 119\u00a0bp \u2018linker\u2019 required for phase-variation of the Type III locus, but this would require subsequent investigation to confirm.Our demonstration of a distinct lineage-specific segregation of phase-variable methyltransferases in vergence . In the and modD , and strod genes ,39. The t et\u00a0al.\u00a0 but agaiS. suis leads to the possibility of multiple phasevarions in this species. The presence of phasevarions complicates the development of vaccines and therapeutics, as the stably expressed protein profile of S. suis can only be defined by dissecting which genes are controlled by phasevarions in this species.Our demonstration of the presence of several unique phase-variable methyltransferases in Supplementary DataClick here for additional data file."}
+{"text": "Cation [3]4+ features four pairs of olefins from the two tetrakis\u2010NHC ligands perfectly arranged for a subsequent [2+2] cycloaddition. Irradiation of [3](BF4)4 with a high pressure Hg lamp connects the two tetra\u2010NHC ligands through four cyclobutane linkers to give compound [4](BF4)4. Removal of the template metals yields the novel oktakisimidazolium salt H8\u20105(BF4)8. The tetrakisimidazolium salt H4\u20102(BF4)4 and the oktakisimidazolium salt H8\u20105(BF4)8 have been used as multivalent anion receptors and their anion binding properties towards six different anions have been compared.The tetrakisimidazolium salt H Polyimidazolium cations: The octakisimidazolium salt H8\u20105(BF4)8 has been obtained from two equivalents of tetrakisimidazolium salt H4\u20102(BF4)4 in a template synthesis via the tetranuclear octakis\u2010NHC complex [Ag4(2)2] followed by postsynthetic irradiation and formation of four cyclobutane linkers between the two tetra\u2010NHC ligands and demetallation. The binding of selected anions by H8\u20105(BF4)4 has been studied. N\u2010heterocyclic carbene (NHC) donors have appeared as promising ligands for the design of metallosupramolecular assemblies that can be utilized for PAM processes. Due to the stability of the M\u2212CNHC bond, poly\u2010NHC\u2010derived metallosupramolecular architectures can be as stable or even more stable than supramolecular architectures derived from Werner\u2010type ligands.N\u2010olefin\u2010substituted poly\u2010NHCs have recently been developed as an effective PAM strategy for the connection of poly\u2010NHC ligands.C3\u2010symmetric polyimidazolium precursors, respectively. The preparation of these cage\u2010type polyimidazolium salts is of particular interest, given that imidazolium salts are considered privileged anion receptors due to their strong affinity to anions through (C\u2212H)+\u22c5\u22c5\u22c5X\u2212 interactions, which combine hydrogen bonding with favourable electrostatic interactions.Coordination\u2010driven self\u2010assembly is currently one of the most effective strategies for the rational construction of discrete supramolecular coordination complexes (SSCs).Multivalent binding interactions between a host/receptor and a guest requires that the receptor possesses more than one binding site connected through suitable spacers.4\u20102(BF4)4, 1,2,4,5\u2010tetrakis(diethoxyphosphinylmethyl)benzene1 featuring four internal olefin groups. In a subsequent reaction, compound\u20051 was alkylated at the imidazole nitrogen atoms using 1\u2010bromobutane to give H4\u20102(Br)4. Anion exchange yielded finally the tetrakisimidazolium salt H4\u20102(BF4)4 (Scheme\u20054\u20102(X)4  were fully characterized by NMR spectroscopy, mass spectrometry and (for H4\u20102(Br)4) by elemental analysis (see the Supporting Information).For the preparation of tetrakisimidazolium salt H4\u20102(Br)4 with a slight excess of Ag2O followed by addition of AgBF4 yielded the sandwich\u2010type assembly [3](BF4)4 in good yield of 86\u2009% (Scheme\u20053](BF4)4 was confirmed by 1H and 13C{1H} NMR spectroscopy. The resonances for the olefin protons were detected at \u03b4=7.54 and 7.31\u2005ppm  in the 1H\u2005NMR spectrum, only slightly shifted upfield compared to the equivalent resonances in H4\u20102(BF4)4 . A characteristic doublet resonance for the CNHC carbon atoms at \u03b4=178.1\u2005ppm (1JAgC=149\u2005Hz) was found in the 13C{1H} NMR spectrum. The strongest peak in the electrospray ionization mass spectrum  also confirmed the formation of the cationic assembly [3]4+ (see the Supporting Information). Transmetallation of the tetrakis\u2010NHC ligand from [3](BF4)4 to gold(I) in [6](BF4)4 was achieved by reaction of [3](BF4)4 with [AuCl(tht)] 4 suitable for an X\u2010ray diffraction study could not be obtained in spite of multiple attempts. However, stirring of an acetonitrile solution of [3](BF4)4 with four equiv of NaBPh4 in acetonitrile led to the isolation of the mixed anion salt [3](BF4)2(BPh4)2. Single crystals of [3](BF4)2(BPh4)2\u22c54CH3CN were grown by slow diffusion of diethyl ether into a saturated solution of [3](BF4)2(BPh4)2 in acetonitrile. An X\u2010ray diffraction analysis with crystals [3](BF4)2(BPh4)2\u22c54\u2009CH3CN confirmed the formation of the sandwich\u2010type complex cation [3]4+ , Ag1\u22c5\u22c5\u22c5Ag1* 15.025(1) and Ag2\u22c5\u22c5\u22c5Ag2* 16.626(1) \u00c5. The average Ag\u2212CNHC bond length of 2.048\u2005\u00c5 and the average N\u2010CNHC\u2010N angle of 102.0\u00b0 fall in the typical range for Ag\u2010NHC complexes.centroid\u22c5\u22c5\u22c5Ccentroid measures 3.519\u2005\u00c5. The olefin units of the two tetrakis\u2010NHC ligands are arranged in pairs with the double bonds aligned in an almost parallel fashion. The average distance of the midpoints of the C=C bonds in each pair measures 3.6\u2005\u00c5 which is a perfect separation for a subsequent [2+2] cycloaddition reaction.Crystals of [+ Figure\u2005. The tet3]4+, a post\u2010synthetic modification on the cation via a photochemically induced [2+2] cycloaddition reaction was investigated next. To this end, a sample of compound [3](BF4)4 was dissolved in acetonitrile. This solution was irradiated with a high pressure mercury lamp leading to conversion of [3](BF4)4 into complex [4](BF4)4 featuring four cyclobutane units as linkers between the two tetrakis\u2010NHC ligands (Scheme\u20054](BF4)4 was quantitative and stereospecific as confirmed by 1H and 13C{1H} NMR spectroscopy 4 features no resonances for the olefin protons anymore, but two new resonances at \u03b4=5.32 and 5.18\u2005ppm for the protons of the newly formed cyclobutane rings.Given the favourable orientation of the olefin groups in cation [ induced +2 cycloa3](BF4)4, crystals for an X\u2010ray diffraction study of [4](BF4)4 could not be obtained. However, stirring of an acetonitrile solution of [4](BF4)4 with 4\u2005equiv of NaBPh4 lead, after addition of THF and cooling, to the precipitation of crystals of composition [4](BPh4)4 which were suitable for an X\u2010ray diffraction analysis.As was observed with salt [4](BPh4)4  and 15.119(2) \u00c5. The average Ag\u2212CNHC bond lengths and the average N\u2010CNHC\u2010N angle do not differ significantly from the equivalent parameters in [3]4+. The formation of the four cyclobutane rings in [4]4+ leads to a shortening of the distance between the midpoints of the two central benzene rings from 3.519\u2005\u00c5 in [3]4+ to 2.837\u2005\u00c5 in [4]4+. In addition, the central benzene rings are bent in a convex manner relative to the cyclobutane linkers 4 generated a precipitate of AgCl and the octakisimidazolium salt H8\u20105(Cl)8. Anion exchange with NH4BF4 yielded H8\u20105(BF4)8 in an overall yield of 76\u2009% (Scheme\u20058\u20105(BF4)8 was characterized by 1H and 13C{1H} NMR spectroscopy and by mass spectrometry (see the Supporting Information). The resonances at \u03b4=9.70 and at \u03b4=134.7\u2005ppm in the 1H and 13C{1H} NMR spectra, respectively, confirmed the demetallation and formation of the octakisimidazolium salt. The resonances for the imidazolium H2 and C2 atoms fall, as expected, in the range previously recorded for the related resonances in the tetrakisimidazolium salt H4\u20102(BF4)4. The resonances for the cyclobutane protons in cation H8\u201058+ were detected as two singlets at \u03b4=5.10 and 5.19\u2005ppm, only slightly shifted upfield from the equivalent resonances in [4](BF4)4 (\u03b4=5.32 and 5.18\u2005ppm). The ESI mass spectrum shows strong peaks for various ions [H8\u20105+nBF4](8\u2212n)+ with the strongest peak (100\u2009%) recorded at m/z=355.3715 .Addition of NH% Scheme\u2005. Salt H83](BF4)4 undergoes a transmetallation reaction with [AuCl(tht)] to give the tetranuclear gold(I) complex [6](BF4)4 in 70\u2009% yield (Scheme\u20056](BF4)4 was confirmed by 1H and 13C{1H} NMR spectroscopy (\u03b4(CNHC)=180.3\u2005ppm, see the Supporting Information). The ESI mass spectrum shows the strongest peak (100\u2009%) at m/z=684.5022 . Gold complex [6](BF4)4 also reacts quantitatively upon irradiation (high pressure mercury lamp) in a [2+2] cycloaddition reaction to give compound [7](BF4)4 featuring four cyclobutane linkers between the two tetra\u2010NHC ligands. Alternatively, compound [7](BF4)4 can be generated via a transmetallation reaction from silver complex [4](BF4)4 and [AuCl(tht)] in 59\u2009% yield. Gold compound [7](BF4)4 was fully characterized by 1H and 13C{1H} NMR spectroscopy (\u03b4(CNHC)=184.1\u2005ppm) and by ESI mass spectrometry (see the Supporting Information). While gold complex [7](BF4)4 is easily accessible, it is a less suitable precursor for the liberation of the tetrakisimidazolium salt H8\u20105(BF4)8 since the Au\u2212CNHC bonds are less labile compared to the Ag\u2212CNHC bonds. This causes problems in the liberation of the H8\u20105(BF4)8 from [7](BF4)4.The tetranuclear silver(I) complex [d Scheme\u2005 similar 4\u20102(BF4)4 and H8\u20105(BF4)8 offers a good opportunity to compare their capabilities as multivalent anion receptors. The recognition and binding properties of the anions in the two salts were studied by 1H\u2005NMR titration experiments monitoring selected proton signals of the receptors upon addition of the tetrabutylammonium salts of the investigated anions. All titrations studies were carried out in [D6]DMSO. For the study we selected six anions of different geometry and charge density, namely chloride, bromide, nitrate, benzoate, adenosine triphosphate (ATP\u2212) and 2\u2010(4\u2010isobutylphenyl)propionate (IBF\u2212). The last two anions were selected in an effort to demonstrate the relevance of the two polyazolium salts as receptors of anions with biological and medical interest (2\u2010(4\u2010isobutylphenyl)propionic acid is ibuprofen, H\u2010IBF). Generally, addition of solutions containing the anions induced significant perturbations in the 1H\u2005NMR spectra of the polyimidazolium hosts.The preparation of the polyimidazolium salts H1H\u2005NMR spectra of H8\u20105(BF4)8 upon titration with [NBu4+](IBF\u2212). The spectra illustrate how the resonance for the eight equivalent acidic imidazolium protons (H2) is shifted progressively downfield upon addition of increasing amounts of IBF\u2212. Together with this, one of the resonances due to the remaining protons of the imidazolium ring (H5) is slightly downfield shifted, while the resonance for the other one (H4) moves slightly upfield 4 as the host, the stoichiometry of the host:guest complexes formed was best fitted to a 1:2 stoichiometry (two anions bound to the tetrakisimidazolium receptor). This assumption was based on the analysis of the binding isotherms resulting from the titrations of host H4\u20102(BF4)4 with all six anions. In all cases, the 1:2 stoichiometry gave the best distribution of residuals, compared to a 1:1 stoichiometry.The determination of the binding constants between the anions and H8\u20105(BF4)8, the Job plot analyses suggested a stoichiometry that could vary between 1:3 or 1:4 . We are perfectly aware that the Job plot analysis has serious limitations, particularly when referred to models of high stoichiometry,4\u20102(BF4)4, the 1:4 stoichiometry in which two arms of the receptor are bound to each anion seems to be the most plausible one.For the experiments performed with H8\u20105(BF4)8 due to the limitations of the regression analysis used to process the data obtained from 1H\u2005NMR titrations. For the determination of the constants we also considered two different variants of the 1:2 binding model, depending on whether the two stepwise binding constants are linked , or not .For the determination of the binding constants, a 1:2 stoichiometry model was used for both the tetrakisimidazolium and the octakisimidazolium salts. The 1:4 (or 1:3) models were not used for evaluating the titrations with H4\u20102(BF4)4, did not differ much regardless of whether we used a cooperative or non\u2010cooperative binding model (entries\u20051\u20136). This allows us to assume that the binding of the anions followed a non\u2010cooperative binding model, and this was the model that we used for the determination of the association constants when the octakisimidazolium salt H8\u20105(BF4)8 was used (entries\u20057\u201312). The data reflect that the affinities shown for chloride are higher than that shown for bromide, in agreement with the larger basicity of the former one. Both receptors show larger affinities for carboxylates and ATP\u2212. The two carboxylate anions (benzoate and IBF\u2212) exhibited a rather similar affinity and the binding constant shown for ATP\u2212 was the largest found for both receptors, therefore showing large selectivity for this anion. The larger affinities observed for phosphate anions when polyazolium receptors are used have been observed before.8\u20105(BF4)8 were between 3\u20138 times larger than those obtained when H4\u20102(BF4)4 was used.As can be seen from the data in Table\u20058\u20105(BF4)8 from two tetrakisimidazolium building blocks H4\u20102(BF4)4. The intermediate octakis\u2010NHC complex [4](BF4)4 with four cyclobutane linkers features two non\u2010planar central benzene groups. The tetrakis\u2010 and the octakisimidazolium salts were tested as multivalent receptors of six different anions, including two with relevant biological and medical significance (ATP\u2212 and IBF\u2212). From our study, we concluded that the octakisimidazolium salt exhibited a larger binding affinity for all six anions tested. Given that we did not find reasons to conclude that the stepwise binding of the anions followed a cooperative model, we believe that the enhancement of the binding affinity should be ascribed to the larger electrostatic attraction produced between the anionic guests and the octacationic octakisimidazolium receptor compared to the tetracationic tetrakisimidazolium one. With our work we proved that the template\u2010controlled preparation of polyimidazolium salts offers a unique opportunity to generate multivalent receptors with enhanced recognition abilities.In summary, we have demonstrated the template synthesis of the novel octakisimidazolium salt HFull details of synthesis and characterisation can be found in the Supporting Information.3](BF4)2(BPh4)2\u22c54\u2009MeCN), and 1972487 ([4](BPh4)4) Deposition Numbers 1972486  should be addressed to the authors.SupplementaryClick here for additional data file."}
+{"text": "Cryptosporidium spp., Giardia duodenalis, and Blastocystis sp. are common intestinal protozoans that infect humans and animals worldwide. A survey that assessed the prevalence, molecular characteristics, and zoonotic potential of these pathogens was conducted on a variety of dogs in Guangzhou, southern China. A total of 651 canine stool samples from household (n\u2009=\u2009199), shelter (n\u2009=\u2009149), breeding (n\u2009=\u2009237), and pet market dogs (n\u2009=\u200966) were collected from eight districts in Guangzhou. Cryptosporidium spp., Giardia duodenalis, and Blastocystis sp. were detected by PCR amplification of the SSU rRNA gene. Giardia duodenalis-positive specimens were further assigned into assemblages using the glutamate dehydrogenase gene. Cryptosporidium spp., G. duodenalis, and Blastocystis sp. were found in 21 (3.2%), 20 (3.1%), and 35 (5.4%) samples, respectively. The overall prevalence of shelter dogs  was significantly higher than that of household , breeding , and pet market dogs  . Deworming in the past 12\u00a0months had a strong protective effect on the risk of contracting parasite infections (P\u2009<\u20090.001). No significant differences were detected between age or sex groups (P\u2009>\u20090.05). Dog-specific C. canis (n\u2009=\u200919) and zoonotic C. parvum (n\u2009=\u20092) were the only two Cryptosporidium species. Sequence analysis revealed the presence of three G. duodenalis assemblages: dog-specific assemblages D (n\u2009=\u200914) and C (n\u2009=\u20095), and cat-specific F (n\u2009=\u20091). Zoonotic Blastocystis ST3 (n\u2009=\u200928) was the dominant subtype, followed by ST1 (n\u2009=\u20096) and ST10 (n\u2009=\u20091). To our knowledge, this is the first large-scale investigation on the occurrence and molecular characteristics of Blastocystis sp. in dogs in China. Our results indicated that the dogs seemed to play a negligible role as reservoirs for Cryptosporidium spp. and G. duodenalis transmission to humans, but they are potential novel suitable hosts of Blastocystis sp. A strict sentinel surveillance system of dogs should be established to minimise the zoonotic risk of spreading blastocystosis among humans and dogs. Cryptosporidium spp., Giardia duodenalis, and Blastocystis sp. are cosmopolitan enteric protists with a wide range of hosts, including humans, non-human primates, companion animals, ruminants, birds, and wild mammals3. Although the pathogenicity of Blastocystis sp. is under strong debate, it may also be associated with gastrointestinal disease-causing agents like Cryptosporidium spp. and G. duodenalis, which cause issues such as self-limiting diarrhoea, abdominal pain, irritable bowel syndrome, and flatulence5. In particular, people with compromised immune systems (e.g. AIDS patients and organ transplant recipients) are susceptible to these infections7. Infections occur mainly by faecal\u2013oral transmission after ingestion of infective forms (oocysts or cysts), usually via water, food, or direct contact8. Cryptosporidium parvum, C. hominis, C. meleagridis, C. canis, and C. muris are the five most common human pathogenic species of Cryptosporidium, of which C. canis is the most prevalent species in dogs11. G. duodenalis consists of eight distinct assemblages or genotypes (A\u2013H). Assemblages A and B have a wide host range and are responsible for the majority of known human disease cases, whereas assemblages C\u2013H seem to be host-specific for non-human species1. Dogs are predominantly infected by assemblages C and D14. Additionally, at least 17 distinct Blastocystis subtypes were identified. ST1\u20139 and ST12 are the common zoonotic subtypes, and ST10\u201311 and ST13\u201317 only infect non-human species15.Cryptosporidium spp., G. duodenalis, and Blastocystis sp. in dogs have been conducted worldwide, and numerous species/assemblages/subtypes have been detected, such as C. canis, C. parvum, C. muris, C. meleagridis, C. hominis, G. duodenalis assemblages A\u2013F, and Blastocystis ST1\u2013ST6 and ST1014  and companion animals (i.e. >\u200910.62 million pets in the city in 2015) . To date, one study of Cryptosporidium spp. and three molecular epidemiological studies of G. duodenalis have been published on dogs in the region36; however, nothing is known about the occurrence and molecular characterisation of Blastocystis sp.. The purpose of our study was to estimate the overall occurrence of Cryptosporidium spp., G. duodenalis, and Blastocystis sp. in dogs living in areas of Guangzhou and assess the zoonotic potential between humans and dogs.As intimate companions, dogs have close contact with humans. However, dogs often harbour intestinal protozoa, which can cause mild to severe disease in dogs and lead to zoonotic infections in humans. Among these protozoa, 2 and has a population of about 140 million. The annual average temperature is 20\u201322\u00a0\u00b0C and the average relative humidity is 77% . A total of 651 fresh faecal samples were randomly collected from 199 household dogs , 149 shelter dogs (from two shelters located in suburban Luogang and Huangpu Districts), 237 breeding dogs (from two breeding centres located in suburban Conghua and Nansha Districts), and 66 pet market dogs (from one pet market in urban Tianhe District), with or without a history of illness, on a single occasion between January and December 2018 ; it covers an area of 7434\u00a0mg for 5\u00a0min and precipitates were used for DNA extraction. Genomic DNA was extracted from 200\u00a0mg of each precipitate using an E.Z.N.A. Stool DNA Kit  according to the manufacturer\u2019s instructions. To improve the quality of recovered DNA, the mixtures of stool samples and SLX-Mlus buffers were vibrated at maximum speed for 15\u00a0min until the stool samples were thoroughly homogenised. Extracted DNA was stored at \u2212\u200920\u00a0\u00b0C.A 10-g aliquot of each sample was individually mixed with 30\u00a0ml of distilled water and passed through a ~\u2009250-\u03bcm-wide wire mesh sieve. Suspensions were centrifuged at 3000\u2009\u00d7\u2009Cryptosporidium spp. was detected by nested PCR amplification of an approximately 830-bp fragment of the 18S rRNA gene as previously described37. G. duodenalis was detected by nested PCR amplifications of a 290-bp product of the 18S rRNA gene and a 520-bp polymorphic fragment of the glutamate dehydrogenase (GDH) gene as described39. To detect Blastocystis sp., an approximately 600-bp fragment of the 18S rRNA gene was amplified by single primer PCR as previously described , 2\u00a0mM MgCl2, 0.2\u00a0mM dNTP mixture, 0.625 U of TaKaRa Taq , and 1\u00a0\u03bcl of genomic DNA. Each specimen was analysed in duplicate using positive (cattle-derived DNA) and negative (sterile water) controls.https://www.ncbi.nlm.nih.gov/) database using Clustal X 2.1 . Phylogenetic analysis was performed by a neighbour-joining (NJ) analysis in MEGA 7.01 (https://www.megasoftware.net/) based on the Kimura 2-parameter model using 1000 bootstrap replicates. The p-distance model was selected as the most suitable model.The positive secondary PCR products were directly sequenced by GENEWIZ . Sequence accuracy was confirmed with two-directional sequencing. All raw sequencing data were viewed and aligned by eye in Chromas Pro 1.33 . The identity of species/assemblages/subtypes was established by comparing the obtained sequences with reference sequences from the National Center for Biotechnology Information  with 95% confidence intervals. Differences at P\u2009<\u20090.01 were considered significant.Differences between prevalence and the dog\u2019s origin , age (\u2264\u20096\u00a0months vs. >\u20096\u00a0months), sex, and deworming conditions (dewormed vs. non-dewormed in the past 12\u00a0months) were compared using a \u03c7Prior to fecal specimen collection, we showed an informed consent to the dogs owner. This informed consent provides some information, including the purpose of the study, research approval number, the benefits and risks that may bring to their animals participating in the study. The informed consent was obtained from the dog owners. Appropriate permission in written form was obtained from the animal owners. During specimen collection, all animal workstrictly followed the guidelines relating to the recommendations from the Guide for the Care and Use of LaboratoryAnimals of the Ministry of Health, China. Our protocol in written form was authorized by the Animal Ethics Procedures and Guidelines of the People's Republic of China and the approval of China Guangdong Province Science and Technology Department (Permit Number: SYXK (Yue) 2011\u20132018).Cryptosporidium spp., G. duodenalis, and Blastocystis sp. The prevalence and 95% confidence intervals are summarised in Table Cryptosporidium spp., G. duodenalis, and Blastocystis sp. were detected in 21 (3.2%), 20 (3.1%), and 35 (5.4%) of the examined samples, respectively. Co-infection rates significantly differed based on the dogs\u2019 origins. The overall prevalence of shelter dogs  was significantly higher than that of household , breeding , and pet market dogs  . Moreover, deworming in the past 12\u00a0months had a strong protective effect on the risk of contracting pathogens, with non-dewormed dogs having 15-times higher risk of overall positive infection rates than dewormed animals . No significant difference was observed between age categories  in the prevalence of Cryptosporidium spp. , G. duodenalis , or Blastocystis sp. . There were also no significant differences in overall  and pathogen-specific prevalence rates between the two sex groups of dogs .Faecal samples from 651 dogs were tested by PCR for the presence of SSU rRNA Cryptosporidium-positive canine samples revealed the presence of C. canis (n\u2009=\u200919) and C. parvum (n\u2009=\u20092)  Table . NucleotG. duodenalis assemblages: D (n\u2009=\u200914), C (n\u2009=\u20095), and F (n\u2009=\u20091). Three SSU rRNA nucleotide sequences of G. duodenalis assemblages D, C, and F were 100% identical to the GenBank reference sequences DQ385549, DQ385548, and JX275387, respectively. The genotypes identified by the GDH gene were fully consistent with those identified by the SSU rRNA gene and there were no overlapping nucleotides at any position, as shown by the chromatograms. No mixed assemblage infections were identified , and the remaining three sequences had minor differences from EF507636, including two single nucleotide polymorphism (SNPs) in four specimens (C to T substitution at position 162 and T to G substitution at position 324), three SNPs in two specimens , and three SNPs in three specimens . All GDH sub-assemblage C sequences were identical to each other and showed 99% sequence similarity to the EF507621 reference sequence, with one SNP difference at position 12 (T\u2009\u2192\u2009C). The assemblage F nucleotide sequence was identical to the corresponding KF993737 sequence of from a cat in China , ST1 (n\u2009=\u20096), ST10 (n\u2009=\u20091), and unknown ST (n\u2009=\u20091). Twenty-seven nucleotide sequences identified as ST3 were identical to each other and had 100% similarity to the MK782518 reference sequence from urticaria patients in Brazil. Six ST1 nucleotide sequences included two different nucleotide sequences with 100% similarity to the GenBank reference sequences MK782501 in four specimens and MK782521 in two specimens. The ST10 nucleotide sequence had 100% similarity to a cattle-derived sequence from Malaysia in GenBank (MK240480). The remaining nucleotide sequence was not assigned a subtype by the sequence typing database, and was 100% homologous with the published sequence MK511788 from Malaysia.DNA sequencing of the Blastocystis subtypes obtained in the present study into three subtypes , and the unknown subtype was grouped into subtype ST1  in the surveyed canine populations. This finding is comparable to the prevalences in Poland 41, India 42, the United States (2.0% and 3.8% for Cryptosporidium)44, China (3.8% and 4.9% for Cryptosporidium)14, Italy (3.3% for Cryptosporidium)9, Australia (2.5% for Blastocystis)29, Brazil (2.6% for Blastocystis)31, and France (3.4% for Blastocystis)20. However, higher prevalences of 21% of Cryptosporidium from Japan, 36.5% of G. duodenalis from Spain, and 37.5% of Blastocystis from Colombia were also previously found in dogs33. Aside from geographical considerations, many factors can contribute to this difference in the prevalence, including a dog\u2019s age, origin, health status, and examination methods used. Importantly, the true prevalences may be underestimated because of the intermittent shedding of oocysts/cysts, low parasitic burdens, and invalid amplification23. Therefore, it is important to perform a well-designed longitudinal study that includes appropriate sampling methods and a combination of diagnostic tests  to estimate the real prevalence.In this study, 23. Additionally, these shelter dogs originally roamed free in the nearby streets before they were found by local citizens and sent to the shelters, which increased their exposure to a variety of pathogens. No significant age- and sex-associated differences were detected in the prevalence of these three pathogens, which is consistent with observations of previous studies in China, Japan, Colorado, France44 , and Australia45. As expected, deworming had a significant negative effect on the risk of overall and single pathogen infections. This could be related to the fact that the anthelminthic ingredients used for dogs in China mainly include ivermectin, pyrantel, praziquantel, pyrantel pamoate, febantel, nitazoxanide, metronidazole, and fenbendazole, most of which are also effective against protozoan infections, such as Giardia spp., Cryptosporidium spp., and Blastocystis sp.48. Thus, pet hygiene management is suggested to be a major risk factor for contracting these pathogens in dogs.In risk factor analysis, the overall and pathogen-specific prevalences of shelter dogs were significantly higher than those of household, breeding, and pet market dogs. Poor care conditions may be a significant factor that contributed to the high prevalence in shelter dogsC. canis. Another interesting outcome was the identification of C. parvum in two of the canine isolates genotyped. Cryptosporidium parvum is the most frequent species known in cryptosporidium infections of humans and has resulted in several zoonotic outbreaks49. However, because of the omnivorous nature of dogs, C. parvum detected from dogs in this study may have been present because of accidental acquisition or mechanical carriage of C. parvum oocysts of anthroponotic origin via environmental contamination. Although the host-specific species C. canis also colonised individuals in hospitals, including children, HIV patients, and even immunocompetent individuals52, the infections in humans were likely transient53. Based on our data and that of other studies, we conclude that dogs do not seem to be suitable reservoirs for Cryptosporidium spp. transmission to humans, therefore, posed a limited risk to humans. This is consistent with the findings reported in dog populations in eastern Spain, where most of the genotypes identified seemed to be primarily transmitted within canine cycles24.The sequencing data revealed that dogs were predominantly infected by the expected host-specific species G. duodenalis, dogs were infected by assemblages D and C. Surprisingly, the supposedly cat-specific assemblage F was also found in one household dog, which was consistent with a previous report in Beijing, China14. Considering there was little possibility of the specimen being contaminated with cat faeces, as individual faecal samples were freshly collected by pet dog owners who kept only a single companion animal, it is more likely that the dog was transiently infected by ingesting parasite cysts of cat origin. Assemblages D and C have strong host specificities and have been mainly detected in canines. Both are considered of limited zoonotic relevance, although sporadic cases of human infections have been frequently detected in travellers, children, and diarrhoeal outpatients55. The dominant appearances of G. duodenalis assemblages D and C in dogs in our study suggested that zoonotic transmission of giardiasis rarely occurs between humans and dogs.Regarding Blastocystis subtypes has been identified in dogs worldwide and the subtype constitution was observed to differ among geographical regions, such as ST1 and ST4 in China; ST1, ST4, ST5, and ST6 in India; ST1 and ST10 in the USA; ST1, ST3, and ST4 in Australia; and ST1 and ST2 in Thailand57. This is the first large-scale survey on the prevalence and genetic characteristics of Blastocystis sp. in dogs of various origins in China, and we detected the presence of subtypes ST3, ST1, and ST10. Among the subtypes in this study, ST3 and ST1 are the two predominant subtypes. The subtype distribution of Blastocystis in dogs in our study consistent with most populations in humans around the world58. In China, in a cross-sectional survey in humans from four epidemiological settings, ST3 was the predominant type, accounting for 60.4% (n\u2009=\u2009116) of 192 positive specimens, followed by subtype ST1, accounting for 24.5% (n\u2009=\u200947)58. A report from Argentina also showed that Blastocystis ST3 was the most prevalent subtype (48 cases) among 76 patients infected with Blastocystis, and other subtypes identified were ST1 (14.9%), ST6 (7.5%), and ST2 (5.9%)57. Moreover, ST3 and ST1 were found in dogs and their owners in Australia, the Philippines, and Turkey59. All of these studies suggested that ST3 and ST1 might be the important sources of human-to-human or animal-to-human transmission of Blastocystis, although more environmental factors and or other animal sources should be included. Blastocystis ST10 was found in one dog sample; this subtype is frequently identified in common livestock, including cattle, sheep, goats, and deer60, and occasionally found in wild animals, pigs, dogs, and cats27. Taken together, our results revealed that canines are a novel reservoir for Blastocystis.A high diversity of 62. However, our epidemiological study still generated baseline information and determined the genetic diversity of these pathogens in the investigated region.We conducted partial assessment of the zoonotic potential of our canine isolates using only molecular epidemiological data, because assessing the risk for zoonotic transmission of these pathogens from dogs to/from humans is difficult. The only way to properly determine zoonotic transmission is by conducting case\u2013control studies that assess the genotypes/subtypes of these pathogens by using appropriate molecular typing tools in human and canine populations that maintain permanent close contact in the same spatial and temporal settingCryptosporidium spp., G. duodenalis, and Blastocystis sp. were determined in dogs in Guangzhou. Our risk factor analysis showed that management of pet hygiene may be a major risk factor for contracting these pathogens in dogs. Our results suggest that dogs do not seem to be suitable reservoirs of human giardiasis or cryptosporidiosis in the investigated region, but may act as novel suitable hosts of human blastocystosis. Strict sentinel surveillance of dogs, especially stray dogs, should be established to minimise the risk of spreading blastocystosis among humans and dogs.The prevalence and molecular characteristics of Supplementary Table S1.Supplementary Table S2."}
+{"text": "A previous study showed early statin administration in patients with acute ischemic stroke (AIS) was associated with a lower risk of early-onset seizure (ES), which is a high risk of epilepsy, but this retrospective study design may not have eliminated confounding factor effects. We aimed to verify the determinants and prognostic significance of ES and clarify the effects of statin administration. Consecutive AIS patients without a history of epilepsy were enrolled. The relationship between ES (within 7 days of index-stroke) and statin treatment was assessed using multivariate and propensity scores (PS). Of 2,969 patients with AIS, 1,623 (54.6%) were treated with statin, and 66 (2.2%) developed ES. In logistic regression models, cortical stroke lesion [odds ratio (OR), 2.82; 95% confidence interval (CI), 1.29\u20137.28) and pre-morbid modified Rankin Scale (per 1 point)  were higher risks for ES, while statin significantly reduced the risk of ES . In accordance with PS-matching, statin treatment produced consistent results for ES after adjusting by inverse probability of treatment-weighting PS . In conclusion, as previously, statin treatment was independently associated with a lower risk of ES in AIS. Stroke is the most common comorbidity in epilepsy in elderly people2. Recent reviews have reported acute symptomatic seizure in acute ischemic stroke (AIS), so called \u201cearly-onset seizure\u201d (ES), was a risk of post-stroke epilepsy (PSE)5. Estimates of the rate of ES in patients with an AIS in the last decade range from 2% to 6.5%6. Recently, the predicting score of PSE with AIS was published, with ES the most significant risk factor7.Over the last decade, there have been notable improvements in the treatment of acute stroke. While the number of patients surviving stroke is expected to increase, optimal management of post-stroke patients remains problematic9. Statin is an inhibitor of 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-CoA) reductase and a key drug in the management of acute phase or for the prevention of atherosclerotic diseases, including stroke and coronary artery disease, and is thought to possess neuroprotective properties10. Statin administration can lead to the modification of epileptogenic processes, presumably from its AED effects16. Early use of statins reduced the risk of ES in the management of AIS, and was associated with a lower risk of progression of ES into PSE11; however, the retrospective design and small number of participants in the study meant confounding factors may not have been eliminated. For example, cardioembolic strokes occur in cortical areas more frequently and are treated with statin less frequently in the acute phase. Stroke subtypes should therefore be acknowledged in any retrospective analysis.The lack of robust evidence in previous studies has meant prophylactic use of anti-epileptic drugs (AED) for ES or PSE remains controversial; indeed, current stroke guidelines do not recommend use of AED for such purposesThere is a paucity of clinical evidence on the association between statin and seizure. We therefore aimed to verify the predisposing factors in ES in patients with AIS from our observational data, as well as clarify the association between statin administration and ES using propensity score (PS) methods.All patients admitted to the Department of Stroke and Cerebrovascular Diseases of the National Cerebral and Cardiovascular Center were registered in a database . We identified consecutive patients with AIS admitted within 3 days of onset between August 2012 and July 2016. AIS was defined as the acute onset of focal neurological symptoms lasting 24\u2009h or longer and confirmed by MRI. The following patients were excluded: (i) those diagnosed with epilepsy before index-stroke; (ii) those with stroke due to a trauma, intracerebral hemorrhage, or subarachnoid hemorrhage; (iii) those diagnosed with transient ischemic attack after admission; and (iv) those who did not undergo MRI.The present study was approved by the Institutional Ethical Committee of the National Cerebral and Cardiovascular Center and conducted in accordance with relevant institutional guidelines. The ethics committee granted a waiver to conduct this study without written informed consent.The collected data included information regarding patient clinical history and presentation, laboratory, imaging, electroencephalographic, treatment, and outcomes [modified Rankin Scale (mRS) score and mortality] at discharge. The data collectors were unaware of the current study.17. We classified stroke subtypes according to the Trial of Org 10172 in Acute Stroke Treatment (TOAST) classification18. We estimated vascular territory according to a published atlas19, and the AIS lesions according to the Alberata Stroke Program Early CT Stroke score for MRI (DWI-ASPECT)20.Stroke severity was measured using the National Institutes of Health Stroke Scale (NIHSS) score on hospital admission, and trichotomized into three levels 21. We assessed seizure semiology before treatment, the deterioration of consciousness, and any subtle neurological manifestations in the stroke care unit or stroke ward. An imaging study was performed to exclude recurrence of stroke. Electroencephalography (EEG) was also performed if patients previously had, or were deemed likely to have, seizure. The EEG findings were obtained by two trained neurologists in neurophysiology .In the current study, patients were recruited if any occurrence of seizure had occurred, after careful evaluation by a trained neurologist(s). ES was defined as a seizure within 7 days of stroke8. Statins were used in patients whose stroke was presumed to be of atherosclerotic origin, including small-vessel occlusion and large-artery atherosclerosis, with or without consideration of the low-density lipoprotein cholesterol level, and not for the prevention of seizure8. Statin use was classified into two phases: before stroke or in the acute phase. Statin treatment in acute phase was defined as starting within 3 days of index-stroke onset. Types of statin included pitavastatin, atorvastatin, simvastatin, rosuvastatin and pravastatin. AEDs were administered according to the current guidelines on seizures22 if patients needed treatment, regardless of EEG findings.All patients were undergoing treatment for strokes, including antiplatelet agents, anticoagulants, and edaravone as a neuroprotectant, with some having endovascular treatment or decompressive craniectomy, in line with current guidelinesWe examined the differences between the groups using Pearson\u2019s chi-square test and Fisher\u2019s exact test for categorical data, and Welch\u2019s t test and Wilcoxon\u2019s rank sum test for continuous variables. All P-values were 2-sided, with P-values of <0.05 considered statistically significant.Firstly, logistic regression was used for multivariate analysis of clinical characteristics pertaining to ES, and the associations between ES and clinical outcomes. Pre-specified variables determined to be clinically important were also included in the model.23. ES and outcome at discharge were analyzed as dependent variables. In PS-matching methods, rigorous adjustment was performed with PS matching using the following algorithm: 1:1 optimal match with caliper width 1/5 logit of the SD and no replacement24. In the IPTW method, patients were weighted by the inverse probability of receiving statin, the average treatment effect (ATE) and average treatment effect on the untreated (ATT) were estimated by computing the difference between the observed and potential outcomes resulting from the presence and absence of statin treatment for each subject.Secondly, PS were estimated using a logistic regression model. Possible confounders were chosen for their potential association with statin on clinical knowledge. The predicted probability of preprocedural statins was calculated by fitting a logistic regression model, using all clinically relevant variables. PS was used with PS-matching and inverse-probability-of-treatment weighted (IPTW) methodshttps://www.R-project.org/.).Two-hundred sixteen subjects with missing values were excluded from the multivariate and PS analysis. Statistical analysis was performed using R version 3.5.0 (R Core Team (2018). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL We identified 4595 patients with acute stroke, including intracranial hemorrhage, transient ischemic attack, and 2969 patients with AIS. Of the patients with AIS , 1623 (54.6%) were treated with statin (93 only before index-stroke and 1530 in acute phase after admission), and 66 (2.2%) developed ES during the hospitalization. Comparison of the baseline characteristics between the patients with ES (ES group) and those without ES (non-ES group) are shown in Table\u00a0Among the 66 patients with ES, 28 (42.4%) had a focal aware seizure, 21 (31.8%) a focal impaired awareness seizure, and 27 (40.9%) a secondary generalized convulsion. Of those with ES, 22 (33.3%) developed status epilepticus. The majority  of all ES occurred during the first 24\u2009hours, 12 (18.2%) occurred during 24 to 48\u2009hours, and 6 (9.1%) occurred 3\u20137 days after index-stroke. Of 66 patients with ES, 57 (86.3%) had EEG and 20 (30.3%) showed epileptiform discharges. Nine patients with ES did not undergo EEG examination due to the following reasons: the seizure episode taking place out-of-hours for EEG examination in four, too critical medical condition to be eligible for EEG examination in three, and unknown reasons in two.Comparison of treatment and outcomes at discharge between the ES and non-ES groups are shown in Table\u00a0In logistic regression models adjusted by age, sex, body mass index (BMI), pre-morbid mRS, initial NIHSS, LDL-cholesterol level, subtypes of stroke (TOAST classification), cortical stroke lesion, and statin treatment, cortical stroke lesion [odds ratio (OR), 2.83; 95% confidence interval (CI), 1.29\u20137.28; P\u2009=\u20090.008), pre-morbid mRS (per 1 point) , and initial NIHSS (per 10 point)  were higher risks of ES, while statin treatment significantly reduced the risk of ES   or mortality  at discharge.Propensity score (PS) precision was evaluated using a receiver operating characteristic curve, with the area under the curve showing good precision equaling 0.730 . Of patients who received statin, 54.6% (n\u2009=\u2009886) were matched to similar patients who did not. The covariate balance in the PS-matched patients was enormously improved Table\u00a0. RegardiThe major findings of this study were as follows: (i) cortical stroke lesion, pre-morbid mRS, and initial NIHSS were higher risks for ES, while statin treatment was significantly associated with a lower risk for ES in patients with AIS, and (ii) statin treatment still had a consistent result after adjusting by PS methods.26. We found that cortical stroke lesion, higher NIHSS and higher degree of disability, represented by pre-morbid mRS, were independently associated with ES in the study subjects. Our study confirmed these factors also promote ES after AIS.Several previous studies have reported AIS patients with cortical stroke lesion, higher stroke severity or other comorbidities had acute symptomatic seizures more frequently than those without11 and PSE16 after stroke. Statin was also associated with a lower risk of epilepsy in the absence of stroke14. Our study demonstrates early use of statin reduced ES in two PS analyses, adjusted by baseline characteristics, stroke severity, stroke subtypes, and lipid profile. These findings suggest statin is independently associated with lower incidence of ES than other factors. Using these two methods, confounding factors could be reduced or eliminated by measured covariates23. The effect size of statin was almost equivalent to that found in previous studies16. The current study, however, differs from previous analyses by reducing selection biases through the addition of PS analyses, adding robustness regarding the inhibitory effect of statin for ES. Although the rate of ES was relatively low compared to the other ES study11, it is intriguing that the effect of statin, represented by ATT or ATE, was estimated at 1.9% and 1.7%, respectively.Recent studies have shown that statin was associated with reduced risk of ES5. ES was indicated to be a significant risk factor for PSE in a meta-analysis3. Experimental studies have provided convincing evidence that statins have a neuroprotective, and anti-seizure, effect. It has been reported that lipophilic statins, such as atorvastatin, pitavastatin and simvastatin, but also hydrophilic statins, including simvastatin, have a suppressive effect on seizure development in an experimental animal model30. The possible anti-seizure mechanism of statins may be related to the reduction in neuroinflammation mediated by a decrease in glutamate, pro-inflammatory cytokines  and action in the nitrergic system30. In accordance with our findings and a previous study11, early use of statin was independently associated with a lower incidence of ES, which may be related to one or more of the mechanisms described above.ES is considered a transient metabolic and biochemical phenomenon, incorporating hypoxia, metabolic dysfunction, global hypoperfusion, hyperperfusion, glutamate excitotoxicity, ion channel dysfunction, and blood-brain barrier disruption in acute phase32. A post-hoc analysis of randomized clinical trials showed patients with ischemic stroke of small-vessel subtypes and treated by high dose of atorvastatin had a higher incidence of hemorrhagic stroke, though hemorrhage risk was not increased in patients with stroke of a large-artery atherosclerosis or cardioembolic origin31. In addition, active statin therapy was not associated with significant increase in ICH, and had a significant reduction in all stroke and all-cause mortality in a meta-analysis of 31 randomized controlled trials of statin therapy32. Therefore, future prospective studies testing the effect of statins on early seizure after stroke should be considered with such factors in mind.Regardless of stroke subtype or cholesterol levels, our study suggested that statin imparted a protective effect against ES; however, the risk of statin-induced hemorrhage must also be consideredWe acknowledge some limitations in this study. Firstly, the study was performed in a single-center, with retrospective design, and its observation period was short . Although the 165 patients were initiated statin after acute phase, the reasons behind why they were not initiated within 3 days could not be found. We also excluded subjects with missing data from the analysis and could not include all potential factors not to start statin, i.e. dysphasia, drug hypersensitivity, progression or recurrence of stroke, infection, etc. Such factors may have caused selection bias and limited generalizability. Secondly, acute statin treatment for stroke is not well-established, and our management of AIS could not be sufficiently aligned to other stroke guidelines, further limiting generalizability. Thirdly, there was potential for misdiagnosis regarding limb-shaking TIA for patients with severe carotid stenosis or occlusion; however, this is a rare phenomenon in carotid disease, and with MRI and EEG assessment by a professional neurologist, the risk of misdiagnosis should be minimized. Fourthly, we could not assess doses or types of statins because of the difficulty in acquiring subjects in each group. The neuroprotective effects of statins likely changed according to different doses and type of drug, for example. The study, however, did demonstrate early use of statins was significantly beneficial, including in low doses of commonly-prescribed types. We hope future prospective studies will be performed to address some of the limitations of the current study.In conclusion, using PS analysis, this study showed robustly that statin treatment can be associated with a lower risk of ES in AIS.Online Supplemental Material."}
+{"text": "Brechemia lineata is a well-known medicinal plant in the Rhamnaceae family and widely used in traditional Chinese medicine. Here, we sequenced the complete chloroplast genome using Illumina pair-end sequencing data. The chloroplast genome was 154,962\u2009bp in length, consisting of a large single-copy (LSC) region of 82,928\u2009bp, a small single-copy (SSC) region of 17,376\u2009bp, and a pair of inverted repeat (IR) regions of 27,329\u2009bp. The chloroplast genome consists of 112 unique genes, including 78 protein-coding genes, 30 transfer RNA, and 4 ribosomal RNA genes. The overall GC content of the chloroplast genome was 37.0%. The phylogenetic analysis suggests close relationship of B. lineata with other Berchemia species. These genomic resources will be valuable resource for systematic and phylogenetic studies of Berchemia genus. Berchemia is a genus of Rhamnaceae family, comprises of about 32 species and mainly distributed in temperate and tropical areas of East to Southeast Asia (Chen and Carsten Berchemia lineata (L.) DC. is a traditional Chinese medicinal species distributed in China , Japan and Vietnam. Berchemia lineata roots and leaves are used medicinally for relieving coughs and reducing sputum and for treating injuries, trauma, and snakebites  and voucher specimen (Zhou2019-18) was deposited in the Herbarium of Sun Yat-sen University (SYS). Genomic DNA was isolated using Tiangen plant genomic DNA kits  and sequenced on the Illumina Hi-Seq 2500 platform. GetOrganelle pipeline were used for de novo chloroplast genome assembly  region of 82,928\u2009bp, a small single-copy (SSC) region of 17,376\u2009bp, and a pair of inverted repeat (IR) regions of 27,329\u2009bp. The chloroplast genome contained 112 unique genes, including 78 protein-coding genes, 30 transfer RNA genes, and 4 ribosomal RNA genes. The overall GC content of the chloroplast genome was 37.0% and the corresponding values of LSC, SSC, and IR regions were 34.7%, 31.2%, and 42.4%, respectively.B. lineata within the Rhamnaceae family was inferred using the previously published eight chloroplast genome from the Rhamnaceae family and Hippophae rhamnoides and Elaeagnus macrophylla (Elaeagnaceae) as out group. The chloroplast genome of these species were aligned using MAFFT v7.3  (Cheon et\u00a0al. B. lineata will provide a fundamental resource for studying the systematic position and conservation of this important medicinal species.Phylogenetic relationship of te clade  might be"}
+{"text": "Metabriggsia ovalifolia W. T. Wang is one of the first-class national protected plants endemic to Karst areas in China. In this study, the complete chloroplast genome was sequenced using Illumina pair-end sequencing data. The chloroplast genome was 153,333\u2009bp in length, consisting of a pair of inverted repeats , separated by a large single copy region  and a small single copy region . The chloroplast genome encodes 131 genes, including 87 protein-coding genes, 36 transfer RNA, and eight ribosomal RNA genes. The overall GC content of the chloroplast genome was 37.55%. M. ovalifolia phylogenetic analysis indicated close relationship with Oreocharis mileensis of Gesneriaceae family. These genomic resources will be helpful for conservation of this endemic plant species. Metabriggsia W. T. Wang is an endemic genus of China belongs to subfamily Didymocarpoideae and Trichosporeae tribe of Gesneriaceae, consists of only two species. Metabriggsia ovalifolia W. T. Wang is a perennial herb, endemic to Guangxi and Yunnan provinces of China , an emergency rescue plan for threatened species in China  as a reference genome following Geseq and further manually verified and visualized in Geneious Prime v.2019.1.3 , Chinese Academy of Sciences, Guilin, Guangxi, China and voucher specimen (MYP2020010) was deposited in the Herbarium of Guangxi Institute of Botany (IBK). These plants were introduced from Libo County, South of Guizhou province, China. Genomic DNA was isolated using Tiangen plant genomic DNA kits  and sequenced on the Illumina Hi-Seq 2500 platform. A total of 6\u2009Gb of 150\u2009bp pair end raw reads were obtained and used for assembling the chloroplast genome using GetOrganelle pipeline  region of 84,381\u2009bp and a small single copy (SSC) region of 18,056\u2009bp, with a pair of inverted repeat (IR) regions of 25,448\u2009bp each. The overall GC content of the chloroplast genome was 37.55%. In total, the chloroplast genome contained 131 genes, consists of 87 protein-coding genes, 36 transfer RNA genes, and eight ribosomal RNA genes.M. ovalifolia and previously published 11 chloroplast genomes from the Gesneriaceae family were used to investigate the phylogenetic relationships using Streptocarpus ionanthus as outgroup. A maximum-likelihood tree with 1000 bootstrap replicates was inferred by RAxML-HPC2 Workflow on XSEDE (v.8.2.12) using the CIPRES online portal (Miller et\u00a0al. M. ovalifolia grouped with Oreocharis mileensis. Our results provide fundamental genetic resources for conservation and future evolutionary studies of this endemic species of China.The complete chloroplast genome sequence of"}
+{"text": "The acute phase reaction is a systemic response to acute or chronic inflammation. The serum level of C-reactive protein (CRP) is the only acute phase biomarker widely used in routine clinical practice, including its uses for prognostics and therapy monitoring in cancer patients. Although Interleukin 6 (IL6) is a main trigger of the acute phase reactions, a series of acute phase reactants can contribute . However, the experience from patients receiving intensive chemotherapy for hematological malignancies has shown that, besides CRP, other biomarkers  also have altered systemic levels as a part of the acute phase reaction in these immunocompromised patients. Furthermore, CRP and white blood cell counts can serve as a dual prognostic predictor in solid tumors and hematological malignancies. Recent studies also suggest that biomarker profiles as well as alternative inflammatory mediators should be further developed to optimize the predictive utility in cancer patients. Finally, the experience from allogeneic stem cell transplantation suggests that selected acute phase reactants together with specific markers of organ damages are useful for predicting or diagnosing graft versus host disease. Acute phase proteins may also be useful to identify patients (at risk of) developing severe immune-mediated toxicity after anticancer immunotherapy. To conclude, future studies of acute phase predictors in human malignancies should not only investigate the conventional inflammatory mediators  but also combinations of novel inflammatory parameters with specific markers of organ damages. Serum levels of C-reactive protein (CRP) have been used for several decades as a marker of the acute phase reaction that can be induced both by acute and chronic states as a systemic reaction to inflammation, injury, or infections ,2. HowevThe acute phase reaction is characterized by increased levels  of several proteins in response to inflammation, infection, or tissue injury, but the name is misleading because the reaction can also be seen in chronic diseases with fluctuating conditions , or be a chronic or long-lasting response that is maintained during the chronic disease ,6. The rThe acute phase reaction was initially described as a reaction involving various serum proteins, including increased levels of several complement factors, coagulation factors, antiproteases, transport proteins, CRP, serum amyloid A, ferritin, as well as proinflammatory cytokines ,3. HowevAccording to the definition of acute phase proteins many cytokines, soluble cytokine receptors, and soluble adhesion molecules can be classified as acute phase proteins. The final acute phase reaction  reflects both the initial step/mechanisms for induction of the reaction (see above) and altered serum levels of associated proteins responding to the inducers. However, the induction and the reaction proteins are overlapping, as can be illustrated by the CRP example. Serum CRP production and release can be induced by IL6, IL8, and TNF\u03b1 , but at The complexity of the acute phase reaction is illustrated by the observations from patients with febrile chemotherapy-induced neutropenia . Even thA similar complexity of the acute phase reaction is also observed for immunocompetent individuals. This is illustrated by a recent study investigating patients with sepsis . The autThe molecular structure and the biological functions of CRP have been described in several recent reviews ,28,29,30v\u03b23 integrins, respectively. Monomeric CRP effects can also be mediated via lipid rafts, and integrins than \u03b1v\u03b23 can also bind monomeric CRP. Furthermore, recent studies suggest that CRP can also exist as fibril-like structures . Th. Th43]. Inflammatory biomarkers have a prognostic impact on several malignancies; mainly solid tumors see . HoweverAllogeneic stem cell transplantation is used in the treatment of aggressive hematological malignancies, and antileukemic effects can then be mediated both as a leukemia-specific graft versus leukemia reactivity and as a consequence of the general GVHD reaction directed towards antigens that are expressed both by normal and malignant recipient cells ,133. ThuWill CRP have a role in future cancer treatment? In our opinion, the answer is yes. CRP is already a useful biomarker especially for prognostication and diagnosis of complications to anticancer treatment. However, we believe that CRP may become even a more useful diagnostic or prognostic biomarker if it can be used in combination with other acute phase markers as a part of an acute phase profile. The biological functions of CRP are now being explored, and some studies suggest that CRP may even become a therapeutic target for anti-inflammatory treatment .Recent reviews of epidemiological studies suggest that inflammation can predispose to cancer, and targeting of inflammation and the molecular mechanisms involved in the inflammatory processes may therefore represent a possible strategy for cancer prevention ,135. ThiWhat can we then learn from the hematological experience with regard to the acute phase reaction in clinical oncology? First, broad acute phase (cytokine) responses can be detected even in severely immunocompromised patients receiving the most intensive anticancer therapy. Second, hematological biomarkers of inflammation  can be used together with molecular acute phase biomarkers for prognostication and therapy monitoring in cancer patients. Alternative markers should be further investigated as markers of the acute phase reaction, including systemic levels of alternative single molecules, biomarker profiles, and monocyte subsets. The optimal biomarker or biomarker combination to use for prognostication or therapy monitoring will probably differ between various malignancies and possibly also between patient subset with the same malignant disease. Third, the GVHD experience shows that based on an initial screening of several inflammatory biomarker it is possible to identify a few optimal biomarkers and an optimal time point for prognostic evaluation of patients. A similar strategy should be tried to identify relevant biomarkers to use in patients receiving anticancer immunotherapy. A major goal would then be to try to identify proinflammatory biomarkers that can distinguish between the likelihood of an anticancer effect versus the risk of severe immune-mediated complications. The possibility of combining inflammatory biomarkers and organ-specific markers should also be considered in anticancer immunotherapy."}
+{"text": "Intestinal stem cells are non-quiescent, dividing epithelial cells that rapidly differentiate into progenitor cells of the absorptive and secretory cell lineages. The kinetics of this process is rapid such that the epithelium is replaced weekly. To determine how the transcriptome and proteome keep pace with rapid differentiation, we developed a new cell sorting method to purify mouse colon epithelial cells. Here we show that alternative mRNA splicing and polyadenylation dominate changes in the transcriptome as stem cells differentiate into progenitors. In contrast, as progenitors differentiate into mature cell types, changes in mRNA levels dominate the transcriptome. RNA processing targets regulators of cell cycle, RNA, cell adhesion, SUMOylation, and Wnt and Notch signaling. Additionally, global proteome profiling detected >2,800 proteins and revealed RNA:protein patterns of abundance and correlation. Paired together, these data highlight new potentials for autocrine and feedback regulation and provide new insights into cell state transitions in the crypt. Habowski et al. develop a sorting protocol for purification and comparative analysis of mouse colon stem cells and their progeny. By proteomic and transcriptomic analysis, they determine that lineage commitment is accompanied by a greater change in mRNA splicing and polyadenylation than in gene expression and they characterise signalling pathways involved in differentiation. Constant replacement maintains homeostasis and proper absorption of water and nutrients, but the fast timescale of birth-to-death places great demand on both stem and daughter cells. Stem cells are by necessity non-quiescent and rapidly dividing, and progenitor cells exhibit rapid loss of stemness and commitment to differentiation. Multiple studies have shown how absorptive and secretory cell types can respond to wounding by de-differentiation and repopulation of the stem cell compartment5. Although this de-differentiation process occurs promptly, it is unknown if these reverse changes in cell state and gain of stemness occur on a similar rapid timescale as loss of stemness.The intestinal crypt is a good model for studying how stem cells support a rapidly renewing tissue. Crypts are invaginating structures of single-layer epithelium in which stem cells reside in a supportive niche at the base where they produce daughter cells (progenitors). Progenitors move up the crypt to differentiate and replace mature cells that are dying at the mucosal surface\u2014a process with an average lifespan of only 4\u20135 days6. The progenitor\u2019s first round of cell division and commitment to either an absorptive (AbsPro) or secretory (SecPro) lineage happens nearly simultaneously with entrance into this zone. These changes occur within minutes-to-hours of each other, suggesting that loss of stemness and choice of cell lineage are connected and\u00a0directed by processes that occur on this timescale.Quantitative imaging and lineage-tracing tools have shown that newly produced progenitor cells lose stemness as they move from the stem cell niche into a compartment called the transit amplifying zone (TAZ)7. In addition, Notch signaling balances commitment to either the absorptive or secretory lineage through lateral inhibition signaling4. There has been a longstanding expectation that stem cells are defined by a unique transcriptome and that loss of stemness and lineage commitment are similarly defined by unique signatures. However, although signaling systems are capable of altering transcription, it is not known how much of the rapid changes in cell state are due to the turning ON/OFF of signal-targeted gene programs versus more immediate processes of co- and post-transcriptional processing, such as alternative mRNA splicing and alternative polyadenylation (APA)10. Each of these processes can quickly modify the nascent transcriptome and its attendant proteome by altering the coding sequences of mRNAs, the localization or interactions of mRNA and proteins, or by changing protein abundance through alterations in mRNA stability and/or protein translation rates14.Several signal transduction systems are important for the early changes in cell state. A decrease in Wnt signaling and activation of the unfolded protein response (UPR) correlates with loss of stemness16. For example, the transgenic stem cell lineage marker Lgr5-EGFP enables purification of GFP-bright stem cells, but a mosaic expression pattern of the transgene in the intestine has made it difficult to confidently separate daughter cells from GFP-negative stem cells and differentiated cells18. Single-cell RNA-sequencing captures the diversity when analyzing mixed cell populations and has been useful for defining intestinal lineage trajectories and diversity of mature cells 23. However, its low sequencing depth misses moderate-to-lowly expressed transcripts and mRNA splicing and polyadenylation analyses are not yet reliable. Therefore, the transcriptome and proteome basis for loss of stemness and early commitment is unknown.To study how transcription and post-transcription processes contribute to stemness and differentiation, it is necessary to separate stem cells, daughter cells, and their differentiated progeny. Multiple cell sorting protocols have been optimized to isolate stem cells, but each lack resolution of these three cell typesHere, we developed a new cell sorting protocol for purification and comparative analysis of colon stem cells, their immediate daughters , and their differentiated cell types, including tuft cells, EEC, and enterocytes (Ent). The protocol can be used with non-transgenic mice of any strain and importantly, when coupled to bulk RNA sequencing and mass spectrometry-based global proteome profiling, can provide a deeper analysis of cellular transcriptomes and proteomes. Using this protocol, we found that while the transcriptome and proteome of each cell type are generally correlated, deeper analyses of the bulk RNA-seq data reveal that loss of stemness and lineage commitment are accompanied by a greater change in mRNA splicing and polyadenylation than in gene expression, a pattern that largely resolves as progenitor cells mature. Sequencing analysis also enabled higher resolution of signal transduction systems , environmental sensing pathways, and patterns of lineage distinction, including prostaglandins and Fgf signaling pathways. These patterns were seen at both the RNA and protein level and\u00a0are likely key to understanding the processes of homeostasis, namely: (i) loss of stemness, (ii) lineage commitment, and (iii) signaling connections between mature cell types. We relate how these findings are relevant to the earliest events that happen during loss of stemness and we highlight\u00a0ways in which mature cells might de-differentiate to re-acquire the state of stemness.16  and from mature enterocytes . Secretory progenitors were identified as SecPDG as this population contains mostly secretory progenitors and deep crypt secretory cells, with a possible minor contribution of goblet cells, a cell type that is largely missing from our isolated cells . For each of the isolated cell types we identified strongly associated biomarkers, including novel highly expressed proteins confirmed via proteomic analysis and immunohistochemistry  protocol with new methods for global proteome analysis of small numbers of cells <200 cells) enabled us to compare the transcriptome and proteome for all six cell populations00 cells Lgr5, Smoc2, Cd44, Cdca7, Notch1, and Rnf43, which show elevated expression in stem cells, but are well expressed in the other cell populations  to the final steps of differentiation  and Wnt signaling targets , but newly identified markers are connected to epigenetics processes , regulation of the cell cycle  are highest in stem cells, but interestingly, their protein products are readily detectable in differentiated cells, thus highlighting inconsistencies between mRNA and protein biomarkers of proliferation , are shown in Fig.\u00a0Although these data suggest that colon crypt stem cells have few specific markers, our analysis identified a set of 16 highly enriched mRNAs that distinguish stem cells from all other cell populations  events  has known functions in adhesion as well as Wnt and Notch signaling , Wdhd1 (DNA replication), and Cby1 ) show significant increases in distal polyA choice and lengthening of the 3\u2032-UTR  has four RRM RNA-binding domains and functions in splicing and transcription regulation, including suppression of Notch and activation of Wnt signalingRNA Fig.\u00a0. Delta-cing Fig.\u00a0. A C-terUTR Fig.\u00a0. InteresUTR Fig.\u00a0.47. Consistent with this, our analysis revealed that exon 25 has the highest inclusion in stem cells, and the lowest in SecPDG and Ent  are present in the crypt with Itga6 isoform A (inclusion of exon 25) being more abundant in the base of the crypt, and isoform B (skipping of exon 25) being more abundant near the top of the crypt  that activate expression of lineage-specific genes. Significantly, in addition to common splicing and APA changes in both lineages, our analysis detected 469 and 207 lineage-specific changes in alternative mRNA splicing , whereas nearly half of the Eif4a2 mRNA in the stem, AbsPro, and Ent populations encodes a truncated protein isoform  is largely missing in AbsPro mRNA (34% inclusion) but mostly present in SecPDG mRNA (71% inclusion) , whereas polyadenylation of Ihh mRNA is shifted to a more distal site in SecPDG (Wnt enhanced). Alternate processing of these genes could potentially contribute to the skewing of Wnt and Notch signaling\u00a0activities in cells55.Although the functional consequences of many distal polyA choices are not known, two striking examples of changes in polyA choice in absorptive versus secretory lineage are shown in Fig.\u00a0Dll1 and Dll4, as well as a third ligand Nov  and lineage commitment steps , but also identified expression patterns suggesting additional autocrine/paracrine signaling that could impact lineage choice. For example, Notch signaling is known to direct lineage choice via lateral inhibition signaling in small intestinal crypts. Our RNA-seq data indicate that secretory lineage  cells express high mRNA levels for Notch ligands Nov Fig.\u00a0. Stem an7. Although our analysis indicates activation of UPR in colon crypt progenitors, we observe that UPR signaling is lineage-skewed and most active in secretory populations  were detected in the secretory lineage, the downstream target genes for two of them\u2014Atf6, Ern1 (Hspa5 and Hsp90b1) displayed the highest expression in this lineage. These targets promote ER expansion and survival from stress. Taken together, the increased expression of sensors and downstream targets in the secretory lineage suggests a sensitization to UPR stress that might play a role in lineage choice and/or stabilization. Interestingly, ER stress can slow migration, consistent with recent observations that secretory progenitors migrate up the crypt at a slower rate than absorptive cells58.UPR directs cellular responses to ER stress such as growth arrest, apoptosis and/or survival, and can trigger loss of stemness as intestinal stem cells exit their nicheons Fig.\u00a0. Active lls Fig.\u00a057. Furth60. Our transcriptional profiling indicated that only a few Fgf ligands are expressed by the epithelia , and predominantly by EECs. Fgf receptors, in contrast, are broadly expressed across the different cell types with Fgfr3 detected at the highest level in the secretory lineages of SecPDG and tuft , which converts arachidonic acid into prostaglandin H2  and the prostaglandin transporter Abcc4 are expressed in all cell types  for prostaglandins and an enzyme that degrades these molecules (Hpgd), suggesting that enterocytes might act as sinks for prostaglandin-mediated signals.Gene expression analysis also uncovered potential for lineage-specific autocrine/paracrine activities in prostaglandin signaling Fig.\u00a0. ConsistPDG Fig.\u00a0. EnterocTcf7 and Tcf7l2 are the predominant family members in stem cells, but Tcf7l1 and Tcf7l2 are even more highly expressed in progenitor and mature populations along with negative regulators, such as the Tle repressors  are broadly expressed, whereas the direct negative regulator Insm1 is elevated in EECs  have a well-established role in maintaining the intestinal stem cell niche and allowing for differentiation of progenitor cells upon exit from that niche. Wnt transcription factors ors Fig.\u00a0a\u2013d, 27a.ECs Fig.\u00a062. InterEnt Fig.\u00a0. BindingEnt Fig.\u00a0. Express66, yet their expression patterns suggest that there is potential for additional cross-talk signaling with the rare tuft and EEC cell types. Previous work has suggested that Kit , the receptor for kit ligand  that directs cell survival pathways in stem cell niches, is specific for Paneth cells in the small intestine and DCS/goblet cells in the colon65. Although we observed highly expressed Kit mRNA in SecPDG and tuft populations  and secretory (Kit receptor) cell populations suggest that Kit could be an intra-cryptal signal from the absorptive lineage to tuft cells. This is mainly a soluble signal since the dominant spliced isoform of Kitl (inclusion of exon 6) is the \u00a0secretable\u00a0isoform , and its negative regulators . Other Egf receptor family members, Erbb2, and Erbb3, are highly expressed in all cell types including stem cells  are robustly expressed in all colon crypt populations. These expression patterns show that subsets of known stemness regulators are a broadly shared feature of all intestinal crypt cell types.Finally, the intestinal crypt is known for its impressive plasticity to rapidly regenerate stem cells at the base of wounded crypts. Multiple studies have shown that the epithelial cell populations, including Ent, tuft, EEC, and progenitor cells have the capacity to de-differentiate into stem cells and restore the nicheors Fig.\u00a0, includiors Fig.\u00a0. ImportaThis study presents a high-resolution cell sorting protocol for mouse colon crypt epithelia, an advance that permitted deep RNA-seq and proteomics analyses of multiple cell types including progenitor cells for absorptive and secretory lineages Fig.\u00a0. A key fGlobal analysis of gene expression in all six sorted cell populations enabled a more precise identification of stem cell markers Fig.\u00a0, reveali6. The shared changes in RNA processing in the AbsPro and SecPDG populations might therefore represent events that occur during these earliest steps of transition. Indeed, changes in splicing and polyadenylation were detected in regulators of Wnt, Notch, and other known regulators of intestinal stem cells. For example, alternative RNA splicing of delta-catenin mRNA removes an exon that encodes a Numb binding domain in progenitor populations, and it removes an exon for RNA binding domain in Split ends (Spen) mRNA in stem cells  cell leaves the stem cell niche and enters the TAZlls Fig.\u00a0. Numb isSUMOylation is the most significant ontology category associated with commonly processed mRNA targets Fig.\u00a0. SUMO prPtger4  are most highly expressed in the absorptive lineage, implying that prostaglandins have different roles in the two lineages (Supplement 25d)72. The overall expression pattern of prostaglandin genes suggests that tuft cells could provide prostaglandin precursors to all cryptal cell types for conversion and whole-cryptal production of PGE2 , a potential form of \u201ccrowd-sourcing\u201d of a signal known to be important for responding to wounding Cle/J, Stock Number 008875)24, agouti mice , and NSG mice , which were purchased from The Jackson Laboratory. FVB/NCrl mice (Strain Code 207) and BALB/cAnNCrl mice (Strain Code 028) were purchased from Charles River. A detailed step-by-step procedure is available through Nature Protocol Exchange77. In brief, mouse colons (cecum to rectum) were removed, flushed, and linearized. Tissue was dissociated at a slow rotation at 4\u2009\u00b0C for 1\u2009hr in a solution of 2\u2009mM EDTA and 10\u2009\u00b5M Rock inhibitor. Aggressive shaking of the tissue solution, filtering (using 100\u2009\u00b5m followed by 40\u2009\u00b5m filters), and centrifugation (500\u20131000\u2009\u00d7\u2009g for 5\u201310\u2009min at 4\u2009\u00b0C depending on the step) were performed to isolate single cells. Data in the Supplementary Fig.\u00a0All mouse work was performed in accordance with NIH guidelines and was approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, Irvine, approval numbers AUP- 17-053. Male C57BL/6\u2009N(NJ), obtained from the KOMP repository, mice aged 5\u20137 weeks were used unless otherwise noted . Following a wash step, cells were incubated for 30\u2009min in FACS buffer ) with the following pre-conjugated validated flow antibodies: CD45-BV510 , CD31-BV510 , CD326-eFluor450 , CD44-PerCP-Cy5.5 , CD24-PECy7 , and CD117-APC-Cy7 . Following wash steps, cells were resuspended in FACS buffer and Live/Dead Aqua (Thermo Fisher # L34957). An alternative CD45-APC  antibody was used in the Supplementary Fig.\u00a0Cells were bulk sorted on a BD FACS Aria Fusion using a 100\u2009\u00b5m nozzle (20 PSI) at a flow rate of 2.0 with a maximum threshold of 5,000 events/sec. The sample chamber and collection tubes were kept at 4\u2009\u00b0C. Following exclusion of debris and singlet/doublet discrimination, cells were gated as demonstrated in Supplementary Fig.\u00a0RNA was extracted from TRIzol samples using a Direct-zol RNA Micro-Prep kit (Zymo #11-330\u2009M) and associated guidelines. Sorted samples of each cell type were pooled as needed at the start of RNA preparations to ensure a minimum of 2,500 cells per sample. RNA sample quality and concentration was evaluated using an Agilent Bioanalyzer on an RNA high sensitivity pico chip. RNA samples were then pooled as needed to allow 1\u2009ng library preps with Clontech Low Input Pico Kit (Takara #634940). Following confirmation of library quality by Agilent Bioanalyzer DNA high sensitivity chip, a total of 22 samples were sequenced . Samples were multiplexed and sequencing was performed with 100\u2009bp paired-end run on Illumina HiSeq 4000.78. Gene expression significance was determined by DESeq2 Wald P value test with a padj <\u20090.01 with a minimum mean of 50 normalized counts. Heatmaps and PCA plot were generated in RStudio (version 1.0.153) with R (version 3.6.1) using pheatmap  and plotPCA, respectively, of r-log-transformed (regularized log) DESeq2 data. r-log-transformation is a robust way to transform the count data, used in differential gene expression analysis, to a log2 scale in a way which minimizes differences between samples and normalizes with respect to library size, it is also a standard function for downstream analysis such as clustering or linear discriminant analysis. Bar graphs of gene expression data were generated in GraphPad Prism (version 6.01) with normalized read counts (output of DESeq2) and error bars defining standard deviation. Supplementary Data #Paired-end sequencing reads were trimmed of adapter sequences and analyzed for quality using Fastqc (version 0.11.7). Data were aligned to the mouse genome (UCSC mm10 from Illumina iGenome) using STAR (version 2.5.2a), converted to bam files and merged (samtools 1.3) and read counts were generated using HTSeq . Differential gene expression analysis was done in RStudio (version 1.0.153) with R (version 3.6.1) using default setting of the DESeq2 pipeline for statistical analysis Merged bam files were sorted and indexed (samtools 1.3) for downstream analysis. Alternative splicing was investigated using rMATS Turbo (rMATS.4.0.1) with STAR 2.5.2a, Samtool 1.3, and enthought_python 7.3.2 comparing two cell types at a time using UCSC mm10 gtf. MAJIQ (v1.1) was also run for alternative splicing with anaconda 3\u20132.0.1 and recommended mm10 ensembl gff3 reference with type\u2009=\u2009strand-specific followed by VIOLA for visualization. DaPars (v0.9.1) was used for alternative polyadenylation analysis with recommended mm10 UCSC reference files and python 2.7.15, bedtools 2.25.0, R 3.4.1, and the following settings . rMATS significance was defined in three different levels of significance: FDR\u2009<\u20090.05, FDR\u2009<\u20090.01, FDR\u2009<\u20090.01 with \u00b125% dpsi. Similarly, DaPars significance was defined in three different levels of significance: FDR <\u20090.05, FDR <\u20090.01, FDR <\u20090.01 with \u00b125% PDUI. Alternative processing gene lists are provided in Supplementary Data #79 (http://pantherdb.org/) and Enrichr81 (https://amp.pharm.mssm.edu/Enrichr/).Gene ontology and gene enrichment analysis of mRNA-seq data were performed on specified gene lists using Pantherg for 10\u2009min at 4\u2009\u00b0C to keep the cells at the bottom of the tube to avoid potential cell loss. In all, 2\u2009\u00b5L of 0.1% n-Dodecyl \u03b2-D-maltoside in 25\u2009mM ammonium bicarbonate was added to each PCR tube with gentle shaking. Intact cells were lysed using sonication five times at 1-min intervals over ice and then centrifuged for 3\u2009min at 3000\u2009\u00d7\u2009g. Samples were then incubated on a thermocycler for denaturation at 75\u2009\u00b0C for 1\u2009h. In all, 1\u2009\u00b5L and 2\u2009\u00b5L of 10\u2009ng/\u00b5L trypsin (Promega) in 25\u2009mM ammonium bicarbonate was added to the PCR tubes at a total amount of 10\u2009ng for <1000 cells and 20\u2009ng for >1000 cells. Samples were digested for overnight (~16\u2009h) at 37\u2009\u00b0C with gentle sharking at ~500\u2009\u00d7\u2009g. After digestion, 2\u2009\u00b5L of 5% formic acid was added to the tube to stop enzyme reaction. The final sample volume was reduced down to ~20\u2009\u03bcL using SpeedVac and the sample PCR tube was inserted into the Liquid chromatography vial for direct liquid chromatography\u2013mass spectrometry (LC-MS) analysis. The processed samples were either analyzed directly or stored at \u221220\u2009\u00b0C for later LC-MS analysis.Prior to sample processing PCR tubes were centrifugated at 1000\u2009\u00d7\u20096, a maximum ion trap time of 100\u2009ms. Top-10 precursors were isolated with an isolation window of 2, an AGC target of 2\u2009\u00d7\u2009105, a maximum ion injection time of 250\u2009ms , and then fragmented by high energy collision with an energy level of 32%. A dynamic exclusion of 30\u2009s was used to minimize repeated sequencing. MS/MS spectra were scanned at a resolution of 17,500.The cell subpopulation digests were analyzed using a commonly available Q Exactive Plus Orbitrap MS . The standard LC system consisted of a PAL autosampler , two Cheminert six-port injection valves , a binary nanoUPLC pump , and an HPLC sample loading pump . Both SPE precolumn  and LC column  were slurry-packed with 3\u2009\u00b5m C18 packing material (300-\u00c5 pore size) . Sample was fully injected into a 20\u2009\u00b5L loop and loaded onto the SPE column using buffer A (0.1% formic acid in water) at a flow rate of 5\u2009\u00b5L/min for 20\u2009min. The concentrated sample was then separated at a flow rate of 150 nL/min and a 75\u2009min gradient of 8\u201335% buffer B (0.1% formic acid in acetonitrile). The LC column was washed using 80% buffer B for 10\u2009min and equilibrated using 2% buffer B for 20\u2009min. Q Exactive Plus Orbitrap MS (Thermo Scientific) was used to analyze the separated peptides. A 2.2\u2009kV high voltage was applied at the ionization source to generate electrospray and ionize peptides. The ion transfer capillary was heated to 250\u2009\u00b0C to desolvate droplets. The data-dependent acquisition mode was employed to automatically trigger the precursor scan and the MS/MS scans. Precursors were scanned at a resolution of 35,000, an AGC target of 3\u2009\u00d7\u20091083 and MS/MS spectra were searched by Andromeda search engine against the against mouse UniProt database (fasta file dated 12 April 2017) . Search results were processed with MaxQuant and filtered with a false discovery rate \u22641% at both protein and peptide levels. For label-free quantification, the match between runs (MBR) function was activated with a matching window of 0.4\u2009min and the alignment window of 20\u2009min. The quantitation results were extracted from MaxQuant outputs based on at least two valid values in one sample type by using Peruses (Version 1.5.8.3)84. Supplementary Data #The freely available open-source MaxQuant software was used for protein identification and quantification. The MS raw files were processed with MaxQuant (Version 1.5.1.11)http://www.proteinatlas.org. Tissue in these images are from the intestine and labeled with the specific location including duodenum, small intestine, colon, or rectum86.All protein staining images are from the Human Protein Atlas and readily available at More than 200 mice were used to optimize and validate the flow sorting procedure and perform mRNA sequencing and proteomics. For proteomics three biological replicate were collected for each cell type, each biological replicate is treated as one sample during data analysis. These biological replicates are from independent mice and independent flow sorts. For mRNA-sequencing additional mice had to be used and pooled in order to isolate enough cells for sequencing, particularly for rarer cell types. In total we sequenced the following number of biological replicates (aka samples) per cell type stem\u2009=\u20093, AbsPro\u2009=\u20093, SecPDG\u2009=\u20094, tuft\u2009=\u20095, Ent\u2009=\u20095, EEC\u2009=\u20092. These biological replicates are from independent mice (sometimes sets of pooled mice) and independent flow sorts. Pooling of independent sorts was done as needed to ensure >2,500 cells for RNA preparation as described in the \u201cRNA Preparation and RNA-seq\u201d method section. The number of independent mice for each of the biological replicates per cell type is as follows: stem\u2009=\u20091,1,1; AbsPro\u2009=\u20091,1,1; SecPDG\u2009=\u20092,2,4,4; tuft\u2009=\u20094,4,4,4,4; Ent\u2009=\u20095,5,6,5,5; EEC\u2009=\u20098,10.t test); standard deviation quantitation for mRNA expression graphs  were used for statistical analysis as specified in the appropriate methods section. GraphPad Prism version 6.01) was used for additional analysis including: Fig.\u00a0.01 was uFurther information on research design is available in the\u00a0Supplementary InformationSupplementary Data 1Supplementary Data 2Supplementary Data 3Supplementary Data 4Description of Additional Supplementary FilesReporting SummaryPeer Review File"}
+{"text": "Childhood obesity has become a global public health issue. Today, there are opportunities to promote health through technological devices such as serious games. Despite the major advancement of this field of research, the use of serious games as a validated intervention in clinical practice requires further clarifications on some methodological aspects. In this perspective article, we report the pros and cons of existing serious games. Besides, we attempt to propose a new methodology of design of a serious game that could help to cope with childhood obesity. The proposed idea consists of a serious game in virtual reality based on enjoyment, movement, education, and executive functioning (EF) training. Longitudinal studies and solid research protocol would certainly ensure consistency and aid interpretation. The prevalence of obesity among children is freighting, and is constantly raising in both developed , while in a sitting or reclining posture\u201d  posture\u201d . Notablyposture\u201d . With reposture\u201d .While the multidisciplinary approach had a clinically significant impact on body weight, physical fitness, and psychosocial wellbeing, its long-term success was modest and not sustained . This siIn the context of obesity, there are four types of serious games: The first type aimed to decrease energy intake by improving knowledge concerning healthy nutrition and changing children\u2019s attitudes about food . The second type aimed to reinforce the weight control process and apply nutrition knowledge in daily life (serious games based on EF training). The third type aimed to increase the energy expenditure . The last type aimed to provide knowledge, enhance motivation, and encourage behavior change related to healthy eating, PA, and stress coping . Current studies showed that playing serious games might contribute to tackling childhood obesity . DespiteSerious games based on nutrition knowledge and/or dietary change were designed primarily to reduce energy intake by (i) improving knowledge concerning healthy nutrition, and (ii) changing children\u2019s attitudes about food. Despite the relevance of these findings, there is a need to standardize how serious games were assessed. Another critical point is that the \u201csource\u201d of eating habits in the majority of studies is not the children but rather the parents . Hence, Executive functioning regroups higher cognitive processes allowing flexible behavior to environmental circumstances in essentially all facets of daily living . EF is rTaking into account all the above, a burgeoning field of research suggests that training EF may be a promising strategy to aid in obesity treatment . DespiteExergaming is an emerging technology that allows the players to interact physically with onscreen avatars through a variety of gross motor movements such as jumping, kicking, punching, and ducking . Today, Systematic reviews and meta-analyses comparing the effects of playing exergames to engaging in another form of sedentary screen time on obesity-related outcomes reported inconsistencies in the literature . Some laRecently, the Youth Compendium of Physical Activities reported PA intensities from exergames play based on the specific type of exergames, age, and gender . AccordiIt is worth mentioning that only a few studies examined the possible effects of exergames on snacking behavior during activity. The study by To date, four research groups took the initiative to develop multidisciplinary serious games including different game modules that can be used to promote healthy behaviors in children with obesity. Three of them were recently published , while oCritically, the available multidisciplinary serious games focused more on nutrition knowledge and dietary change and much less on PA, which was lightly involved in the game design. The latter also clearly lacked elements of EF training.Serious gaming could be a promising new way to tackle childhood obesity. In this perspective article, we discuss relevant trials on serious games for four main purposes: (1) decrease energy intake, (2) increase energy expenditure, (3) reinforce the weight control process, and (4) encourage behavior change related to healthy eating, PA, and stress coping. Still, none of the published serious games combined all these purposes into the same game design, whereas all of them are essential for successful weight control . From ouApplying our new model would be possible by incorporating both healthy and unhealthy eating messages (nutrition education), into the exergames instead of a film game. Moreover, as EF plays an essential role in both learning processes and children\u2019s attitudes about food , we suggIn respect to the movement dimension, the active gaming mode must contain a properly planned program of PA instead of non-controlled movements to ensure the reliability of the program as well as a child\u2019s safety . It is important to highlight that the intensity of serious game must range from moderate to vigorous activity. This will help to both prevent and treat childhood obesity .To ensure the enjoyment dimension and reduce stress induced by PA, the use of Virtual Reality appears to offer a good solution due to its fun character . EnjoymeTechnically, to ensure that each dimension of our model is properly designed, guidelines in the literature must be followed . In addiTo summarize, creating a serious game in virtual reality based on enjoyment, movement, education, and EF training may have the potential to help treat childhood obesity in clinical practice. Longitudinal studies and standardized protocols would certainly ensure consistency and aid interpretation.The original contributions presented in the study are included in the article/supplementary material; further inquiries can be directed to the corresponding author.MB wrote the manuscript. AA-Z and YS revised it. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Choniomyzon copepod obtained from a longlegged spiny lobster Panulirus longipes longipes , collected from Hualien Port, Eastern Taiwan. We illustrated morphological features of the specimen to determine its taxonomic identification. The new species reported here is the first record of Choniomyzon species from spiny lobster in Taiwanese waters.This study reports an undescribed species of the Choniomyzon taiwanensis n. sp. is described based on specimens collected from examining external egg masses of spiny lobster Panulirus longipes longipes , obtained from Hualien, Taiwan. The new species differs from its congeners in possessing the following characteristics: (1) small prosome (about 0.84 mm); (2) armature of antennule being 1, 1, 2, 2, 1, 1, 1, 2, 1, 1+1 (aesthetasc), 4, 6+1 (aesthetasc); (3) five-segmented antenna; (4) second segment of antenna bearing 1 inner seta; (5) two-segmented maxilla. Based on the evidence of distinctive morphological features and host preference, Choniomyzon taiwanensis n. sp. is a new species. Until now, four species of Choniomyzon have been known living on decapods, and the new species reported here is the first record of Choniomyzon species from spiny lobster in Taiwanese waters. Choniomyzon inflatus Wakabayashi, Otake, Tanaka & Nagasawa, 2013, simulates the external eggs of its host in its prosome shape and size, and its caudal rami are similar to its host\u2019s egg attachment filaments [Nicothoid copepods are small, highly specialized parasites that live on other crustaceans ,2. So failaments .Choniomyzon Pillai, 1962, is a small genus of siphonostomatoid copepod in the family Nicothoidae Dana, 1849, and only three species have been recognized [Choniomyzon panuliri Pillai, 1962, parasitic on the abdomen of spiny lobsters, Panulirus homarus Linnaeus, 1758, and Panulirus versicolor Latreille, 1804; Choniomyzon libiniae Santos & Bj\u00f6rnberg, 2004, on the external eggs of an epialtid crab, Libinia spinosa Gu\u00e9rin, 1832; and C. inflatus on the external egg masses of the smooth fan lobster, Ibacus novemdentatus Gibbes, 1850  of the lobster were measured. The external egg mass of the lobster was examined for the presence of parasitic copepods, and the copepod specimens were picked up by using insect forceps. A total of 37 female copepods were collected from the lobster. One live non-ovigerous female and one live ovigerous female copepod were photographed on a Motic BA210 compound microscope . Subsequently, all the copepod specimens were preserved in 70% ethanol.An egg-bearing female longlegged spiny lobster Morphological observations of parasitic copepods were performed as described by Humes and Gooding in 1964  for the Four copepod specimens were transferred to 4% buffered glutaraldehyde for further analysis in scanning electron microscope (SEM). The specimens were dehydrated by an ethanol gradient (70% \u2192 85% \u2192 95% \u2192 100%) and transferred on aluminum stubs with a drop of hexamethyldisilazane (HMDS) for critical point drying. The stubs were sputter-coated with gold  and then observed using a Hitachi TM4800 SEM .Order Siphonostomatoida Burmeister, 1835Family Nicothoidae Dana, 1849Choniomyzon Pillai, 1962Genus Choniomyzon taiwanensis n. sp.Figure 4 and Figure 5Materials examinedHolotype: one ovigerous female (NTUM-Inv-10017). Paratype: one ovigerous female (NTUM-Ivn-10018). Types were deposited in the National Taiwan University Museum (NTUM). Other materials: 30 females, deposited in the Department of Fisheries Production and Management, National Kaohsiung University of Science and Technology, Kaohsiung, Taiwan.Type host:P. longipes longipes . Morphometric measurement: total body length: 193.84 mm, abdomen length: 108.13 mm, cephalothorax length: 85.71 mm, cephalothorax width: 50.46 mm, and abdomen width: 40.52 mm  share the greater number of common characteristics compared with the other two species   are phylogenetically close to each other. Several characteristics  found in the former two species are also present in C. inflatus (I. novemdentatus) belongs to the same infraorder (Achelata) as Panulirus. On the other hand, C. libiniae  shows some unique characteristics  , and theinflatus , and itsC. taiwanensis n. sp. is confirmed a new species and the first record of Choniomyzon species from spiny lobster in Taiwanese waters.Based on the evidence of distinctively morphological features and host preference,"}
+{"text": "The tumor immune microenvironment (TIME) has been recognized to be an imperative factor facilitating the acquisition of many cancer-related hallmarks and is a critical target for targeted biological therapy. This research intended to construct a risk score model premised on TIME-associated genes for prediction of survival and identification of potential drugs for ovarian cancer (OC) patients.The stromal and immune scores were computed utilizing the ESTIMATE algorithm in OC patient samples from The Cancer Genome Atlas (TCGA) database. Weighted gene co-expression network and differentially expressed genes analyses were utilized to detect stromal-and immune-related genes. The Least Absolute Shrinkage and Selection Operator (LASSO)-Cox regression was utilized for additional gene selection. The genes that were selected were utilized as the input for a stepwise regression to construct a TIME-related risk score (TIMErisk), which was then validated in Gene Expression Omnibus (GEO) database. For the evaluation of the protein expression levels of TIME regulators, the Human Protein Atlas (HPA) dataset was utilized, and for their biological functions, the TIMER and CIBERSORT algorithm, immunoreactivity, and Immune Cell Abundance Identifier (ImmuCellAI) were used. Possible OC medications were forecasted utilizing the Genomics of Drug Sensitivity in Cancer (GDSC) database and connectivity map (CMap). TIMErisk was developed based on ALPK2, CPA3, PTGER3, CTHRC1, PLA2G2D, CXCL11, and ZNF683. High TIMErisk was recognized as a poor factor for survival in the GEO and TCGA databases; subgroup analysis with FIGO stage, grade, lymphatic and venous invasion, debulking, and tumor site also indicated similar results. Functional immune cells corresponded to more incisive immune reactions, including secretion of chemokines and interleukins, natural killer cell cytotoxicity, TNF signaling pathway, and infiltration of activated NK cells, eosinophils, and neutrophils in patients with low TIMErisk. Several small molecular medications which may enhance the prognosis of patients in the TIMErisk subgroup were identified. Lastly, an enhanced predictive performance nomogram was constructed by compounding TIMErisk with the FIGO stage and debulking.These findings may offer a valuable indicator for clinical stratification management and personalized therapeutic options for OC patients and may be a foundation for future mechanistic research of their association. Globally, human ovarian cancer (OC) is associated with the highest lethality among the gynecological malignancies; the mortality accounts for approximately 5% of all female cancer-related deaths . Patient+\u00a0and CD8+ T cells into the tumor has been associated with improved overall and progression-free survival in OC patients (The tumor immune microenvironment (TIME) has been known to be an important factor facilitating the acquisition of many cancer-related hallmarks. Successful peritoneal metastasis which entails the co-evolution of stromal and cancer cells has been recognized as the key cause for high risk of recurrence and mortality \u20137. In OCpatients .The TIMEpatients , a perfehttps://www.gtexportal.org/) and TCGA databases . TCGA database was utilized to examine the possible TIME- and prognosis-related genes and premised on it the TIMErisk was then evaluated. An aggregate of 375 OC patients from TCGA, median age was 59 years (30 to 87), were randomly categorized into two cohorts in the ratio of 7:3 utilizing the \u201ccaret\u201d package in R software; these were considered to be the training and testing cohorts, in that order. The training cohort consisting of 263 samples was utilized to detect the TIME regulators and build a prognostic model. The testing set with 112 samples was utilized to evaluate the model\u2019s performance. GSE53963 and GSE140082 cohorts were accessed from the GEO dataset (https://www.ncbi.nlm.nih.gov/geo/) and utilized for independent external validation of the model. Stromal and immune scores were computed utilizing the \u201cestimate\u201d package in R software premised on the ESTIMATE algorithm  value  <0.05 and | Log2 [Fold Change (FC)] | >2 were considered to be DEGs. WGCNA was utilized to detect the co-expressed gene modules strongly related to the stromal and immune scores. The gene modules of maximal |correlation coefficient were regarded as strong stromal and immune\u00a0correlated modules. The intersection of stromal and immune correlated DEGs and strong stromal and immune-correlated gene modules was utilized as the input in the Least Absolute Shrinkage and Selection Operator (LASSO) regression analysis.LASSO is a descending dimension technique for regularization which could be utilized for examining biomarkers for survival analysis in combination with the Cox model . The strhttp://www.immport.org). The possible enriched biological functions associated with TIMErisk were detected utilizing the gene set enrichment analysis (GSEA) technique and annotated via Kyoto encyclopedia of genes and genomes (KEGG) and gene ontology (GO) datasets. In GSEA, the FDR value < 0.05 was judged to be a statistically significant enrichment.The levels of infiltrating stromal and immune cells were computed utilizing the CIBERSORT algorithm . Single-To assess the independent prognostic significance, multivariate and univariate Cox regression analyses for TIMErisk and clinical variables were performed. Based on the independent prognostic significance a nomogram was built for the training set to forecast the survival of EOC patients. In the nomogram score system, each of the variables was allotted a point; total points were calculated by summation of points for each sample to predict survival. Using calibration plot, and decision curve analysis (DCA) the discriminating ability, and predictive performance of the nomogram score system were assessed. The nomogram was also employed in the testing set and the whole set to validate the results.https://www.cancerrxgene.org). Estimation of the drug response was done by computing the half-maximum inhibitory concentration (IC50). Possible small molecule drugs for UCEC were forecasted utilizing the Connectivity map  comprising of genome-wide transcriptional expression data from small molecule drugs; premised on the links between genes, drugs, and diseases via the variation in gene-expression profiles potential candidates were predicted. This was premised on DEGs between low- and high-risk cohorts with | log2fold change (FC) | > 2 and FDR < 0.05.The chemotherapeutic response in OC patients was evaluated utilizing a public dataset, Genomics of Drug Sensitivity in Cancer  and validation cohort (112 participants) in a ratio of 7:3 ratio. The basic features for the TCGA training and validation cohorts, such as FIGO stage, age, grade, lymphatic and venous invasion, days to the new tumor, and debulking, were not significantly different . Through multivariate Cox regression analysis, Immunescore, FIGO stage, and debulking were identified as the prognostic significances  using \u201crms\u201d and \u201csurvival\u201d packages in R  receptor, PTGER3, exerts multiple effects including invasion, epithelial cell growth, and immune regulation . Our fincetylase . CTHRC1 cetylase . Aberrancetylase , 41. In Interestingly, resting or na\u00efve immune cells such as CD4 naive T cells, resting dendritic cells and resting NK cells were elevated in the patients with higher TIMErisk, whereas a large number of functional immune cells, including activated NK cells, eosinophils, and neutrophils, corresponding to more incisive immune reactions, including antigen processing and presentation, chemokines, interleukins, natural killer cell cytotoxicity, and BCR and TNF signaling pathways showed higher infiltration in the low TIMErisk patients. The findings were consistent with the conclusion that immunosuppression was the primary cause for the greater risk of malignant progression and death. Based on the above results, we speculated that the predictive model based on TIMErisk may be a reliable biomarker for cancer therapy.Fortunately, we identified 21 compounds with 20 MoAs, including adrenergic receptor antagonists, a cyclooxygenase inhibitor, and a serotonin receptor antagonist. The PPAR receptor agonist (clofibrate) and chloride channel blocker (benzbromarone), in particular, could offer possible advantages for high-risk cohort patients. Cyclooxygenase inhibitor (Sc-560) and leukotriene receptor antagonist (tomelukast) showed greater sensitivity for patients with low TIMErisk. Clofibrate is widely used in the treatment of tumors including pancreatic cancer , colon cCurrently, FIGO staging is the most extensively utilized technique to examine the malignancy potential as well as the disease progression in OC. However, this technique has its drawbacks since it is mainly contingent on the distant metastasis, lymph node invasion, size, and location of the tumor. It does not consider the heterogeneity of tumor, age, and other clinical characteristics. Therefore, it is costly to construct an integrated prognostic model consisting of clinical properties and high-risk gene signatures. Our results showed that FIGO stage, debulking, and TIMErisk of the analyzed EOC samples in the TCGA training cluster were independent high-risk factors associated with poor survival. In addition, the nomogram based on the prognostic signature showed a higher net benefit and better predictive accuracy than the FIGO stage system and FIGO stage & debulking system. These results may guide the individualized treatment for OC patients.While our model was valuable in examining prognosis and carrying out therapies for OC patients, it ought to be prospectively confirmed by large-sample clinical studies. The context of TIME, such as remodeling stroma, the status of immune cells infiltration, immunoreaction, and the molecular mechanisms mediated by TIMErisk was explored through bioinformatic analysis only. Thus, additional experimental validations are required to corroborate these findings. Additionally, we have identified several potential drug compounds for TIMErisk subgroups. Unfortunately, there is a lack of available research to confirm their efficacy in ovarian cancer. Further investigations are needed to contrast the TIMErisk scores with present biomarkers and examine the relationship between TIMErisk and the potential drugs in OC patients.To summarize, our research detected a risk prognostic signature encompassing 7 genes related to TIME. The TIMErisk can forecast the OS of OC patients and indicated the situation of stroma remodeling and immune response. Candidate drugs for TIMErisk subgroups were identified. Lastly, an enhanced predictive performance nomogram by compounding TIMErisk with the FIGO stage and debulking was constructed. Ultimately, these findings could offer a valuable indicator for clinical stratification management and personalized therapeutic options for OC patients and may be a foundation for forthcoming mechanistic research projects of their association.The original contributions presented in the study are included in the article/JY, SH, and LH were responsible for the design, analysis, and draft of the research. JL, YW, and XZ plotted all figures in this manuscript. ZW and LG helped in data analysis. All authors approved the final version of this manuscript and agreed to be accountable for all aspects of the work.This research is sponsored by Hubei Province\u2019s Outstanding Medical Academic Leader Programme and the Fundamental Research Funds for the Central Universities (No. 2042021kf0125).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Vitamin K2 activates vitamin K-dependent proteins that support many biological functions, such as bone mineralization, the inhibition of vascular stiffness, the improvement of endothelial function, the maintenance of strong teeth, brain development, joint health, and optimal body weight. Due to the transformation of food habits in developed countries over the last five decades, vitamin K and, specifically, vitamin K2 intakes among parents and their offspring have decreased significantly, resulting in serious health implications. The therapeutics used in pediatric practice (antibiotics and glucocorticoids) are also to blame for this situation. Low vitamin K status is much more frequent in newborns, due to both endogenous and exogenous insufficiencies. Just after birth vitamin K stores are low, and since human milk is relatively poor in this nutrient, breast-fed infants are at particular risk of a bleeding disorder called vitamin K deficiency bleeding. A pilot study showed that better vitamin K status is associated with lower rate of low-energy fracture incidence. An ongoing clinical trial is intended to address whether vitamin K2 and D3 supplementation might positively impact the biological process of bone healing. Vitamin K2 as menaquinone-7 (MK-7) has a documented history of safe and effective use. The lack of adverse effects of MK-7 makes it the ideal choice for supplementation by pregnant and nursing women and children, both healthy and suffering from various malabsorptions and health disorders, such as dyslipidemia, diabetes, thalassemia major (TM), cystic fibrosis (CF), inflammatory bowel diseases (IBD), and chronic liver diseases. Additionally, worthy of consideration is the use of vitamin K2 in obesity-related health outcomes. Vitamin K1 and K2 are fat-soluble vitamins. Vitamin K1 is found mainly in leafy green vegetables. Vitamin K2 (menaquinones) contains an unsaturated aliphatic side chain with a variable number of prenyl units. The number of prenyl units indicates the respective type of menaquinone. For example, MK-4 contains four prenyl units and MK-7 contains seven prenyl units. Vitamin K2 is mostly produced by bacteria, except for MK-4, which can be developed by tissue-specific conversion from vitamin K1 in animals. A traditional Japanese dish called \u201cnatto,\u201d consisting of fermented soybeans, holds the highest content of K2, particularly MK-7.gamma-glutamylcarboxylase (GGCX) and in the carboxylation process of vitamin K-dependent proteins (VKDPs) [Both vitamins K1 and K2 act as essential cofactors for the enzyme  (VKDPs) . VitaminIn addition to participating in the activation of VKDPs, vitamin K has been reported to operate as an anti-inflammatory and antioxidant agent independent of its GGCX cofactor activity ,5. A recVitamin K2 is also a transcriptional regulator of bone-specific genes that functions through the steroid and xenobiotic receptor (SXR) to facilitate the expression of osteoblastic markers . MoreoveThe role of VKDPs in processes beyond coagulation has been discovered and well demonstrated in the past few decades. The evidence from numerous clinical trials clearly supports the benefit of high vitamin K2 consumption for human health. Vitamin K2 meets all criteria for a bioactive substance to be considered for a recommended daily intake (RDI). Many countries have an RDI for vitamin K1 based on earlier research. As vitamin K2 is very important for extrahepatic tissues, the recommendations should combine vitamin K1 and K2 intakes. The procedures by which vitamin K2 levels can be assessed call for standardization, and an RDI for vitamin K2 based on current research needs to be established and accepted worldwide.The objective of this paper was to perform a systematic review of research papers. We also evaluated clinical trials that examined the role of vitamin K2 for children\u2019s health and whether vitamin K2 supplementation influences markers of bone disease such as bone mineral density.Vitamin K2 activates proteins performing crucial biological functions that range from bone mineralization and healthy teeth, through promoting cardiovascular health, to maintaining brain development, joint health, and optimal body weight .Osteocalcin is a VKDP synthesized by osteoblasts and is thought to be related to bone mineralization. Vitamin K is necessary for the activation of osteocalcin. Moreover, vitamin K2 has been shown to inhibit resorption of the bone by suppression of the prostaglandin E2 synthesis in osteoclasts . ChildreAccording to the traditional view, dental caries are considered a tooth de-mineralizing process that takes place solely in the oral cavity. Attributed to a new perception of oral/systemic links is the view that dental caries are an uncontrolled inflammatory response regulated by the brain and mitigated through the hypothalamus/parotid axis of the endocrine system. Tooth vulnerability or resistance is determined by a signaling factor constituted by the role of free radicals in the hypothalamus. This systemic caries paradigm puts nutrition at the forefront of prophylaxis as it concentrates on the root of the disease rather than traditional symptom-focused prevention efforts .Vitamin K2 works in concert with calcium and vitamin D and appears to have a significant antioxidant role. Therefore, vitamin K2 can help to considerably reduce tooth decay while also appearing to play a prospective saliva-buffering role in the exocrine parotid and other salivary glands .While cardiovascular incidents are rare in children, clinical observations show that arterial calcification and atherosclerosis is a progressive process that accumulates over decades ,16. ReseSolid evidence exists that vitamin K2 plays important roles in the nervous system. Vitamin K2 is necessary to activate VKDPs in the brain, such as growth arrest-specific gene 6 protein (Gas6) and protein S, which are connected to cognitive processes. Gas6 and protein S influence different procedures in the brain, such as apoptosis, cell growth, and myelination . MoreoveIn the brain, vitamin K2 occurs mainly as MK-4. The highest concentrations of MK-4 were found in midbrain and pons medulla, and the lowest concentrations were observed in the cerebellum, olfactory bulb, thalamus, hippocampus, and striatum. Although MK-4 is the primary form in the brain, it was found that the supplementation of MK-7 increases the level of MK-4 in brain tissue .Vitamin K is also involved in the synthesis of sphingolipids, crucial for the development of the functional integrity of the nervous system. Animal studies speak in favor of vitamin K2\u2032s role in the biosynthesis of sphingolipids. Initially recognized for their role as building blocks of cell membranes, sphingolipids are now known to be involved in cell signaling, division, differentiation, and apoptosis. There are some studies, which showed the connection between alterations in sphingolipid metabolism and cognitive decline as well as neurodegenerative disorders such as Alzheimer\u2019s and Parkinson\u2019s diseases .Moreover, animal and human studies suggest that optimal vitamin K status is important for psychomotor behavior and cognition. Additionally, in one report, vitamin K deficiency, due to administration of warfarin treatment during pregnancy, was associated with warfarin embryopathy. Some infants exhibited optic atrophy, developmental delay, and seizures after treating pregnant mothers with warfarin .Vitamins K1 and K2 both activate VKDPs in the liver . The defWarfarin during pregnancy might impact newborn health. The resulting abnormalities include the cartilage and joints , which iTherefore, the optimal level of vitamin K is important for joint development. Moreover, it has been shown that VKDPs, inclusive of the mineralization inhibitor MGP, are detected in joint tissues, including cartilage and bone. It has been previously indicated that low vitamin K status is correlated with higher risk of osteoarthritis (OA) .In human OA cartilage, MGP was found to be mainly inactive. Conversely, MGP is primarily carboxylated in healthy articular cartilage, suggesting the carboxylation of MGP is associated with OA .Respiratory tract infections (RTIs) are common in children, and vitamin D deficiency was shown to be associated with increased risk of RTI. Thus, vitamin D3 supplementation was accepted by medical community as an important nutrient, which reduces the risk of respiratory problems in children. It is, however, important to remember that vitamin D3 should be supplemented with vitamin K2 .Currently, highest international interest is concentrated on the COVID-19 pandemic and potential ways of reducing its mortality rate. Researchers have recently shown that optimizing blood vitamin D and K levels could offer a solution for the reduction of mortality rate. Researchers proved the synergistic interplay between vitamins D and K on bone and cardiovascular health. Moreover, some scientists suggest that supplementation with vitamin D3 can be considered safe when it is combined with vitamin K2. New randomized controlled trials are needed to prove the discussed evidence .During adolescence, the incidence of forearm fractures in children reaches its highest point as exercise increases. At the same time, cortical bone mass decreases due to increased calcium requirements in skeletal growth.Physical activity and adequate nutrient intake have favorable influence on the bone quality. Hungarian researchers demonstrated that changes in bone mineral status among 10\u201312-year-old children, assessed by ultrasound method, are correlated with the amount of intense physical activity as well as with optimal vitamin K intake .Vitamin K, as the \u03b3-carboxylase cofactor, takes part in bone metabolism. Childrens\u2019 requirements for this vitamin are among the greatest; its deficiency may have an impact on the peak bone mass formation, as well as on osteoporosis risk in adulthood.The beneficial role of vitamin K, especially vitamin K2, in bone health is well established scientifically, based on epidemiological as well as on interventional studies published over the past decade. Of particular significance is the comprehensive attitude to bone health in children of all ages that includes optimal intake of calcium, vitamins D and K, balanced diet, and exercise. It has been shown that subclinical vitamin K and D deficiency is present in healthy pediatric population with low-energy bone fractures .Further, a pilot study, which enrolled 20 children with radiologically confirmed low-energy fractures and 19 healthy children as a control group, showed that low vitamin K status, represented by the percentage of the active form of osteocalcin (UCR), correlates statistically with the low-energy fracture risk .Based on a previous study, researchers assessed the impact of vitamin K2 on fracture repair. This clinical trial was accepted by the ethical committee and is ongoing. What has been learned so far is that low vitamin K status increases the fracture risk in kids. At this stage the positive effect of vitamin K2 on bone healing is only a hypothesis, but researchers are looking forward to the future results that will give us the answer whether vitamin K2 and D3 supplementation might positively impact this biological process .Several authors have linked vitamin K status to fat and glucose metabolism. What lies behind obesity in childhood and adolescence is the development of insulin resistance that causes metabolic, structural, and functional changes, which may lead to increased risk of cardiovascular diseases and type 2 diabetes. Adolescence is also a crucial period when the so-called \u2018adiposity rebound\u2019 may occur, which means that adiposity increases after its lowest point in childhood. Children with a higher childhood BMI tend towards having a higher BMI, waist, and hip circumference in adulthood .The results of a three-month animal study demonstrated that mice supplemented with vitamin K2 on the top of a high-fat diet gained less weight, less body fat, and showed decreased serum glucose and leptin in comparison with the control group on a high-fat diet only . In humaSo far, few studies have investigated the relationship between body weight and vitamin K intake. Nonetheless, it is acknowledged that suitable micronutrient intake is crucial to maintain different metabolic functions of the body, while inadequate intake is one of the top 10 risk components for the overall sickness burden globally . These oThalassemia major (TM) is also called Cooley\u2019s anemia. People suffering from this most dangerous form of beta thalassemia have severe symptoms and life-threatening anemia. Their hemoglobin does not produce enough beta protein; therefore, they need regular blood transfusions and other medical treatment. Thalassemic osteopathy (TOSP) represents a salient factor determining risk for morbidity in patients with Cooley\u2019s anemia and manifests as osteopenia/osteoporosis. A pilot study conducted among children with TM clearly showed that vitamin K2 and calcitriol combination positively affects bone mineral density (BMD). The authors suggested that patients with TOSP might benefit from K2 supplementation, although more clinical trials are needed to study the effects of treatment .People with cystic fibrosis (CF) may develop fat malabsorption due to pancreatic insufficiency, and this may also be linked to deficiencies of fat-soluble vitamins like vitamin K. Studies show that vitamin K deficiency is common in CF infants and toddlers and can even be detected in children receiving recommended supplementation. Moreover, a strong association between vitamin K status and clinical outcome in CF patients was found. Vitamin K intake was found to be an independent predictor of osteoblastic activity markers like: Glu-OC, Gla-OC, PICP , and PINP . Supplementation with vitamin K2 appears to be a good solution to improve the level of vitamin K in children with CF, but agreement needs to be reached on the appropriate dose and frequency of use of this nutrient ,43,44.Vitamin K deficiency was frequent in pediatric IBD patients, and more common in Crohn\u2019s Disease (CD) than ulcerative colitis (UC) in pediatric patients . There iThe reason for low vitamin K status in IBD remains unknown. It has been suggested that vitamin K deficiency is an effect of malabsorption caused by IBD, as well as by current treatment.This is confirmed by the fact of the simultaneous deficiency of vitamin E in IBD and vitamin K metabolism disorders caused by antibiotics ,52,53. IIn addition to the disease mechanism itself, the diet plays a key role in the development of vitamin K deficiency. Patients suffering from IBDs frequently consume inadequate amounts of the minerals and vitamins, resulting in nutritional deficiencies ,56. GoodPediatric IBD patients seem to be prone to vitamin K deficiency due to ongoing inflammation. Consistent with the effects of vitamin K on bone metabolism, numerous clinical studies in adults showed that low vitamin K status contributes to low BMD in CD patients ,59. ClinDue to malabsorption of fats and an inadequate diet, children with chronic liver disease are exposed to ongoing vitamin K deficiency, which increases the risk of hemorrhages and fractures and is related to degree of cholestasis and severity of liver disease. Low vitamin K status was shown to be common in children with mild to moderate chronic cholestatic liver disease, even despite vitamin K supplementation ,63. AdeqThe researchers in Japan found that severely disabled children suffer from deficiencies of various nutritional compounds. There are many factors that contribute to low vitamin K status such as malnutrition, malabsorption, changes in microbiota, and also hepatic dysfunction.The researchers showed that more than 40% of severely disabled children have vitamin K deficiency. In the group with vitamin deficiency, the majority of children demonstrated a bleeding tendency, more than 60% developed vitamin K deficiency in association with infection, and over 40% of them were treated with antibiotics. The good news is that all showed a good response to vitamin K2 supplementation, which seems to be especially important for disabled children in case of long-term antibiotic treatment .A significant number of pediatric patient visits each year end with the prescription of antibacterial drugs. Antibiotic therapy affects vitamin K levels in children. It has been shown that there are changes in gut microbiota due to antibiotics that alter intestinal vitamin K production. The level of K2 in the liver is lowered in people on antibiotics, especially on the cephalosporins, due to impairment the recycling of vitamin K.Vitamin K deficiency is known to cause coagulopathy and bleeding in children on prolonged antibiotic treatment, therefore, in seriously ill patients on extended periods of antimicrobial drugs and inadequate diet, vitamin K2 prophylaxis is suggested to prevent morbidity and mortality ,65,66.For children who suffer from chronic diseases, the immunosuppressive and anti-inflammatory properties of oral corticosteroids constitute an inevitable treatment option. Their prolonged use may lead to various adverse drug reactions (ADRs), such as significant reductions in bone formation through the inhibition of osteoblasts. Moreover, corticosteroid use increases calcium excretion in the urine. Therefore, osteoporosis is considered a particular complication of chronic childhood illnesses cured with glucocorticoids (GCs) ,68.The adverse effects of GCs on bone formation are more pronounced in the growing skeleton, where trabecular and cortical bone growth is negatively affected. Decreased bone quality has been found in different disorders that require GCs, and a clinical study reported increased fracture risk in children who require more than four courses of GCs .Japanese researchers found that vitamin K2 drugs might be effective to prevent bone fracture in glucocorticoid-induced osteoporosis (GIOP), because they increase bone strength independently of BMD .Th authors of a systematic review, who critically evaluated the treatment options used in the management of bone loss associated with GC use among children, established that vitamin K2 (menatetrenone) combined with alfacalcidol has a beneficial effect on BMD in children who were treated with GCs for a longer time .It was also reported by a team of Japanese researchers that treatment with alfacalcidol and vitamin K2 (as MK4) is beneficial for supporting bone health in children with skeletal unloading. The results of this pilot study showed that vitamin K2 as MK4 effectively and safely improves lumbar BMD in long-term prednisolone-treated children .Vitamin K2 treatment has been shown to decrease the osteoporotic bone loss including GIOP . It is aIn recent decades, vitamin K2 (menaquinone) has been specifically highlighted as a crucial cardiovascular and bone health nutrient .Since the 1950s, many children and adults get less of this important nutrient than they should, and substantially lower vitamin K intakes may have serious health implications. Two cohorts of 4-year-old children were compared. A cohort born in the 1950s was compared in terms of dietary intake and sources of vitamin K with children born in the 1990s and showed that dietary vitamin K intake was significantly higher in the 1950s (39 mcg/day) than in the 1990s (24 mcg/day). Between the 1950s and the 1990s, people started to consume less vegetables and more fats and oils, therefore, sources of vitamin K intake have changed remarkably. Due to general changes in food habits , vitamin K intakes of children on Western diets have been on a significant decline since 1950s .During the sharp increase in pubescence children seem to be extremely exposed to forearm fractures. Factors responsible for this regularity are closely related to each other and include skeletal growth, elevated need for calcium, increased physical activity, and decreased cortical bone mass. In recent years researchers aimed to check whether and how this regularity has changed. The outcome of a population-based study that was conducted in Minnesota over four time periods, 1969\u20131971, 1979\u20131981, 1989\u20131991, and 1999\u20132001, demonstrated that yearly incidence rates of forearm fractures per 100,000 escalated from 263.3 in 1969\u20131971 to 322.3 in 1979\u20131981, and to 399.8 in 1989\u20131991 before stabilizing at 372.9 in 1999\u20132001. Age-adjusted incidence rates per 100,000 were 32% higher among males in 1999\u20132001 compared with 1969\u20131971, and 56% greater among females in the same time periods .Considerable noteworthy and correlatory evidence emerges from the comparison of the two sets of data\u2014the decreased intake of vitamin K over a 40-year period (from the 1950s to the 1990s) and the data from Minnesota inquiry presenting an increase in broken forearms over a similar 30-year period\u2014as vitamin K intake lessened in the youth population, the potential forearm fractures in children heightened .The research also showed that children have the highest tissue-specific vitamin deficiency. Vitamin K status was most frequently evaluated by the percentage of active osteocalcin (cOC), vitamin K-dependent protein, important for bone.When the vitamin K status of bone in healthy children was contrasted with that of adults for the needs of a cross-sectional study, a noticeable elevation of the ratio of uncaroboxylated (inactive) osteocalcin (ucOC) into carboxylated (active) osteocalcin was observed in children, thus indicating a poor vitamin K status. Moreover, in the children\u2019s group the researchers also found a considerable correlation between bone markers for bone metabolism and ucOC and cOC. These deductions imply markedly low levels of vitamin K in the bone during growth .A separate study found that the largest tissue-specific vitamin deficiency is common among children and adults above 40 years, and thus menaquinone-7 (MK-7) supplementation may have a beneficial influence on improving the extra-hepatic vitamin K status .Much research demonstrates that children need more vitamin K than adults due to various health disorders and therapeutics used in pediatric practice. For instance, vitamin K deficiency often goes hand in hand with disorders of fat malabsorption. Shortage of vitamin K manifests itself with easy bruising and bleeding, and children suffering from malabsorption also have tendencies to poor bone health and osteoporosis ,80. SuppLow vitamin K status is much more common in neonates than adults, due to both endogenous and exogenous deficiency. The endogenous case has been associated with poor intestinal colonization by bacteria  and a deThe reasons for the exogenous insufficiency arise from limited vitamin K transport across the placental barrier and its low accumulation in breast milk.The main exogenous source of vitamin K in newborns, which is almost exclusively milk, is not able to suitably equalize the insufficient endogenous production, because mother\u2019s milk contains 1 to 4 mcg/L of vitamin K1 (and a much lower concentration of vitamin K2). Throughout the first 6 months of life the median amount of vitamin K that entirely breast-fed infants receive has been described to be below 1 mcg/day. Surprisingly, this amount in infants, who, as their meal get a typical supplemented formula, is approximately 100-fold higher. This argument should encourage breast-feeding mothers to seriously consider supplementation with vitamin K2 ,84,85,86The content of vitamin K in breast milk depends on the geographical region . ResearcThe second endogenous culprit of the neonates\u2019 deficiency of vitamin K at birth is the poor transport of this nutrient across the placenta from mother to infant. Particularly in preterm pregnancies, little vitamin K actually crosses the placenta from mother to infant . HoweverHealthy newborn infants have a very fragile vitamin K coagulation status . In the Based on epidemiological studies of the prevalence of late VKDB, researchers have demonstrated that China, Japan, countries within Southeast Asia, such as Thailand and Vietnam, and also Australia have greater rates of VKDB than in the remaining parts of the world.Vitamin K insufficiency in Thai mothers (represented by detectable PIVKA-II levels) was due to reduced dietary K intakes during gestation period .The Japanese nationwide surveys found that the 87.7% of VKDB cases reported involved exclusive breastfeeding. Guidelines for expectant mothers in Japan who use drugs that could impair the absorption of vitamin K (excluding warfarin) say that they should be provided regular doses of 15\u201330 mg vitamin K daily 2 to 4 weeks before delivery or their newborn should receive 0.5\u20131 mg IM vitamin K2 administration ,103,104.The infant\u2019s intake of vitamin K is a subject to regional variations, and it also depends on the fact whether the mother is supplemented with any form of vitamin K (K1 or K2).In the USA and Canada, the adequate intakes (AIs) for babies are based on the calculated average vitamin K1 intake of healthy breastfed infants and the expectation that newborns receive prophylactic vitamin K1 at delivery, as recommended by American and Canadian pediatric societies . In US, The European Society for Paediatric Gastroenterology Hepatology and Nutrition (ESPGHAN) recommends as follows: healthy new-born infants should either receive 1 mg of vitamin K1 by intramuscular injection at birth; or 3 \u00d7 2 mg vitamin K1 orally at birth, at 4 to 6 days and at 4 to 6 weeks; or 2 mg vitamin K1 orally at birth, and a weekly dose of 1 mg orally for 3 months .In Japan an AI of 4 mg/day for infants aged 0\u20135 months was determined by multiplying the average milk intake and the average vitamin K content of milk, and assuming the presence of the oral administration of vitamin K just after birth in clinical settings . HoweverVitamin K2, as MK-7, has a documented history of safe and effective use in children, as well as in adults. When reading product labels, one can notice that MK-7 is already mentioned as a form of vitamin K. The absent side effects of MK-7 also precluded many authorities, such as The Food and Nutrition Board of the Institutes of Medicine (IOM), the European Commission, the Expert Group on Vitamins and Minerals in UK (UK EVM), and the World Health Organization (WHO)/Food and Agriculture Organization (FAO), from establishing a tolerable upper intake level for any form of vitamin K. This is because exceeding the adequate intake is safe, even when someone additionally ingests MK-7 from foods and supplements. The only possible contradiction is the use of anticoagulant drugs, such as coumarins, which may interfere with vitamin K cycle.Vitamin K2, especially as MK-7, which lasts longer in the body than MK-4, has important roles to play in the health of children, including the performance of various physiological functions such as coagulation, promoting bone mineralization, and a healthy cardiovascular system. Furthermore, vitamin K-dependent matrix-gla protein (MGP) helps inhibit arterial calcification (which may begin in childhood), so early supplementation with vitamin K2 may contribute to good cardiovascular health in infancy, puberty, and beyond. The current adequate intake level of vitamin K for pregnant and nursing women is 90 mcg. Likewise, research suggests that 45\u201350 mcg/day MK-7 is an appropriate intake range for children ,108,109.The good news shared by such trustworthy bodies as the European Food Safety Authority (EFSA), the UK EVM, the IOM, and WHO, which was also supported by clinical and nonclinical data, clearly states that using MK-7 as a dietary supplement according to the recommended dosages is safe ,111,112."}
+{"text": "Archaea, Prokarya, and Eukarya). The replicase (Rep) from these viruses is responsible for initiating rolling circle replication (RCR) of their genomes. Rep is a multifunctional enzyme responsible for nicking and ligating ssDNA and unwinding double-stranded DNA (dsDNA). We report the structure of porcine circovirus 2 (PCV2) Rep bound to ADP and single-stranded DNA (ssDNA), and Rep bound to ADP and double-stranded DNA (dsDNA). The structures demonstrate Rep to be a member of the superfamily 3 (SF3) of ATPases Associated with diverse cellular Activities (AAA+) superfamily clade 4. At the Rep N terminus is an endonuclease domain (ED) that is responsible for ssDNA nicking and ligation, in the center of Rep is an oligomerization domain (OD) responsible for hexamerization, and at the C terminus is an ATPase domain (AD) responsible for ssDNA/dsDNA interaction and translocation. The Rep AD binds to DNA such that the ED faces the replication fork. The six AD spiral around the DNA to interact with the backbone phosphates from four consecutive nucleotides. Three of the six AD are able to sense the backbone phosphates from the second strand of dsDNA. Heterogeneous classification of the data demonstrates the ED and AD to be mobile. Furthermore, we demonstrate that Rep exhibits basal nucleoside triphosphatase (NTPase) activity.Circular Rep-encoding single-stranded DNA (CRESS-DNA) viruses infect members from all three domains of life ( Archaea, Eubacteria, and Eukarya domains of life (\u20139\u2013ori) to unwind the genome and generate a cruciform structure\u2014a process that is possibly accompanied with ATP hydrolysis by Rep. Rep nicks the (+) strand of the cruciform at a sequence-specific site to generate a free 3\u2032-OH end for leading-strand DNA synthesis, and itself becomes covalently attached to the 5\u2032-PO4 of the (+) strand. Replication continues to generate a complete (+) strand with several nucleotides beyond the start site. A second round of cleavage by Rep liberates the 3\u2032-OH of the same strand. Rep then ligates the ssDNA 5\u2032-PO4 attached to itself to the recently generated 3\u2032-OH of the same strand to generate a circular ssDNA (Circular replicase (Rep)-encoding single-stranded DNA (CRESS-DNA) viruses are a diverse and widely prevalent group of viruses that infect  of life \u20136. CRESSof life \u2013, 8. Rep of life \u2013. RCR is of life \u2013, 9\u201317. W life \u20139\u2013. CRESS-DED) , and ED from transposases suggests that these domains are evolutionarily related  superfamily (clade 4). The structures further demonstrate the ED to be mobile, Rep to form a hexamer with ss/dsDNA bound to its central channel, Rep to use an oligomerization domain (OD) for hexamerization, and the Rep\u2019s ATPase domains (AD) to adopt a spiral staircase arrangement around ssDNA/dsDNA and demonstrate a sequential mode of ATP hydrolysis and direction of ssDNA translocation. We further demonstrate that Rep exhibits basal nucleoside triphosphatase (NTPase) activity.The nuclear magnetic resonance (NMR) and crystal structure of an N-terminal fragment of Rep identify this domain to be an HUH (His-hydrophobic-His motif) endonuclease domain (ED) , 19. ED  related , 20\u201322. s genera . Geneticentified . Members animals , 25. Porindustry \u201328. To uCryo-EM two-dimensional (2D) class averages identify top, tilted, and side views of Rep in ice . Top andAD may adopt distinct positions with respect to the OD . We. WeAD mao the OD  30). Th. ThAD mareported , 19. 3D reported . The amireported  to C. Th10.1128/mBio.00763-21.1FIG\u00a0S1FIG\u00a0S1, TIF file, 2.7 MB.Cryo-EM studies of PCV2 Rep. (A) Representative micrograph of collected data identifying different orientations of Rep. The image has been low pass filtered to 15-\u00c5 resolution to enhance the contrast. Scale bar at bottom left is 20 nm. (B) Fourier shell correlation curves reported by cryoSPARC. (C) Resolution heat maps of PCV2 Rep bound to ssDNA (top) and dsDNA (bottom). Multiple slices of the side view demonstrate the local resolution of the maps. Note that both the ssDNA and dsDNA have lower resolution than the protein. Scale bar on left identifies the resolution corresponding to the heat map. Download Copyright \u00a9 2021 Tarasova et al.2021Tarasova et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.00763-21.2FIG\u00a0S2ED (pastel yellow), OD (pastel red), and AD (pastel cyan). The secondary structures of the ED crystal structure (PDB entry 5XOR), OD, and AD (this report) are shown inside the domain boxes. Absolutely conserved amino acids are white font in a red box with blue outline. Highly conserved amino acids are red font in a white box with blue outline. Amino acids absent in a sequence are indicated by periods. The black circles identify amino acids with large side chains  that were used for eliminating possible register errors due to the moderate resolution of the map. Download FIG\u00a0S2, TIF file, 1.4 MB.Sequence alignment of circovirus Reps. Sequence alignment generated by Clustal Omega. Image generated using ESPript 3.0 with the % equivalent and normal coloring scheme. Boxes at the top identify Copyright \u00a9 2021 Tarasova et al.2021Tarasova et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.00763-21.3FIG\u00a0S3ED. The ED, OD, and AD are colored as according to ED in the data. The low number of particles in each class did not allow for a high-resolution map to be determined. Download FIG\u00a0S3, TIF file, 0.8 MB.3D variability analysis of the Copyright \u00a9 2021 Tarasova et al.2021Tarasova et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the OD (amino acids 119 to 157) and an AD (amino acids 158 to 301). The OD is a four-helix bundle with three of the helices nearly parallel to one another and the fourth perpendicular to them. Six OD oligomerize to generate a torus with a pore diameter of 12\u2009\u00c5. The pore is defined by the side chains of Arg145, Asn146, Tyr147, and Arg148. Segmentation of density pertaining to the OD hexamer followed by 60, 120, 180, 240, and 300\u00b0 rotations through the center of the pore overlays onto the original density with correlation coefficient values between 0.95 and 1.0, suggesting that the OD hexamer follows C6 symmetry. Sequence comparison suggests that all circovirus Reps share a minimum of 30% sequence identity in this region; thus, it is likely that all circovirus Reps utilize a comparable OD for forming hexamers , the simian virus 40 (SV40) large T antigen , adeno-associated virus 2 (AAV2) Rep40 (PDB entry 1S9H), and bovine papillomavirus (BPV) E1 (PDB entry 2GXA), all members of SF3 from the AAA+ superfamily , 33OD isAD overlay with root mean square deviation (RMSD) values in the range of 0.7 to 1.1\u2009\u00c5. The arrangement of AD can be described by six rotation axes about which a rotation followed by a translation, parallel to the axis, will overlay two neighboring ADs (AD-AD interfaces. Between each of five neighboring AD (subunits A to E), there is 760 \u00c52 of buried surface area (BSA). An extensive seam between the subunits F and A diminishes their AD interaction to 80 \u00c52 of BSA , and sensor 3. Density not described by the Rep coordinates can be observed within four of the putative ATP binding sites (2+ for two reasons: (i) ATP-Mg2+ was added during purification, and (ii) Rep is an ATPase (see below) and likely to have hydrolyzed the ATP present in the buffer. Into each of the four densities could be modeled a Mg2+, two phosphates, and the ribose sugar of ADP  and the ADP \u03b2-phosphate, an H-bond between the Lys180 (WA) amine and ADP \u03b2-phosphate, electrostatic interaction between the Asp216 carboxylate (WB) and Mg2+, and electrostatic interaction between Mg2+ and the ADP phosphates. Also, the Asn256 (mC) amide is in proximity to position a water for nucleophilic attack on the ATP \u03b3-phosphate  H-hosphate , and (iihosphate . In tota10.1128/mBio.00763-21.4FIG\u00a0S4cis-subunit in yellow and trans-subunit in red. (Bottom) LigPlot+ images of Rep-ADP interaction. Residues involve in hydrophobic contacts are depicted as arcs with emanating lines, and hydrogen bonds are depicted as dashed lines. (A) Subunit interface AB; (B) subunit interface BC; (C) subunit interface CD; (D) subunit interface DE; (E) ATP state of SV40 LTag; (F) ADP state of SV40 LTag; (G) ATP-like state of BPV E1; (H) ADP state of BPV E1. The Mg2+ are shown as magenta spheres, and the Cl\u22121 of BPV E1 is shown as a larger pink sphere. Download FIG\u00a0S4, TIF file, 1.2 MB.Nucleotide binding states of Rep. (A to D) (Top) Licorice models with the Copyright \u00a9 2021 Tarasova et al.2021Tarasova et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the cis-components (1SVM) and ADP-bound E1 (PDB entry 2GXA) structures. The Arg498 of LTag coordinates a water molecule to the ATP \u03b3-phosphate and is proposed to act as a switch in sensing ATP binding and coordinating its hydrolysis to the neighboring subunit  and BPV E1 by overlaying subunits providing the mponents . LTag anmponents , 34. The EV71 2C .10.1128/mBio.00763-21.5FIG\u00a0S51SVM); (B) EV71 2C bound to ATP-\u03b3-S (5GRB); (C) AAV2 Rep40 bound to ADP (1U0J); (D) BPV E1 bound to ADP (2GXA); (E) PCV2 Rep bound to ADP (this report). The N and C termini are indicated by blue and red circles. Download FIG\u00a0S5, TIF file, 1.1 MB.The lid-like domains of SF3 helicases. Cartoon ribbon model of the ATPase domains in red, C-terminal extension (lid-like domain) in yellow, and nucleotide in CPK. (A) SV40 LTag bound to ADP . Th. Th2+, t weak  is a generalized interpretation of the multiple ssDNA sequences bound to Rep.Density can be seen in the center of the Rep hexamer spiraling away from the OD . BiochemOD . We hypoOD . Indeed,OD , suggestOD  and manuOD . The docOD , 40. TheOD . The mod\u22121). Density for the ssDNA extends toward the center of the OD ring and terminates near the guanidium group of Arg148, suggesting that ssDNA is translocated through the pore. Rigid body fitting of a purine nucleotide into the pore suggests that its translocation requires either the dehydration of the nucleotide, rotation of the base, or expansion of the pore. The phosphates from ssDNA interact with amino acids located in two loops: pore loop 1 located between \u03b22 and \u03b12 (Trp202) and pore loop 2  located between \u03b13 and \u03b24 (Lys240 and Gly241) (The backbone phosphates from four consecutive nucleotides interact with the six subunits of Rep (1\u2009nt subunit Gly241) . The ssDOD pore. The 5\u2032 overhang agrees with the 3\u2032-to-5\u2032 directionality of Rep. In addition to the described interactions between Rep and the ssDNA, the guanidinium groups of Arg199 (pore loop 1) from subunits A to C are less than 7.5\u2009\u00c5 from the first four nucleotide phosphates of the second strand of nucleic acid  Cryo-EM map with modeled regions colored in dark gray. (Center) Map shown as a chicken wire mesh with model as stick representation. (Right) Ninety-degree rotation of center orientation; arrow identifies direction of rotation. The dsDNA map (second from top) is low pass filtered to demonstrate the fit of the double helix. This region has a much lower resolution than the protein; see Copyright \u00a9 2021 Tarasova et al.2021Tarasova et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the ED in complex with a 10-mer ssDNA derived from the viral ori provides the first image of how ED binds to the loop of the predicted ori stem-loop hairpin for the nicking activity described above  an OD in the middle of the sequence, and (iii) an SF3 AD at the C terminus , and Rep with no DNA affects this property. Six ODs assemble to form a torus with a pore defined by a 12-\u00c5 diameter. The AD structure is homologous to the ATPase domains of SV40 LTag, the BPV E1, the AAV2 Rep40, and the EV71 2C helicase proteins.CRESS-DNA viruses are widely distributed in nature and utilize RCR for genome replication , 6. Whiled above . To proved above . The strterminus . The denin vivo conditions. Rep binds ssDNA in a 3\u2032-to-5\u2032 direction, such that the Rep N terminus is positioned near the dsDNA fork and ssDNA is pulled through the OD pore . ATP anabolism is the reverse of this process. The sequential model was adopted to describe the translocation of nucleic acid by the homohexameric T7 gp4 and Rho  the nucleotide states for the six ADs from the top to bottom of the staircase are ATP, ATP, ATP/ADP, ATP/ADP, ADP/empty, empty; (iii) only the central four ADs engage the substrate; (iv) the AD at the bottom of the staircase translocates to the top of the staircase upon binding ATP; (v) hydrolysis of ATP for the AD closest to the bottom of the staircase drives the remaining ADs to translocate toward the bottom of the staircase and pull the substrate; and (vi) ADP is released from the AD that is nearest to the bottom of the staircase. Consequently, each ATP binding and hydrolysis translocate the substrate one unit through the central channel of the translocase (Plasmodium translocon of exported proteins (PTEX), a 1.6-MDa complex that transports Plasmodium proteins into the host erythrocytes across the Plasmodium membrane  was codon optimized by GenScript (New Jersey) and cloned into a modified pET28a vector containing a small ubiquitin modifier (SUMO) following the start codon for expression in Escherichia coli BL21(DE3) cells. Cells were grown in terrific broth in the presence of 50\u2009\u03bcg ml\u22121 kanamycin until mid-log phase and cooled to 20\u00b0C, protein expression was induced with 200\u2009\u03bcM isopropyl-\u03b2-d-1-thigalactopyranoside (IPTG), and protein was expressed for less than 16\u2009h at 20\u00b0C. Cells were centrifuged at 4,000\u2009\u00d7\u2009g for 30 min. Cell pellet was resuspended in 35\u2009ml of 20\u2009mM HEPES (pH 8.2), 450\u2009mM sodium chloride (NaCl), 25\u2009mM imidazole (pH 8.2), 10\u2009mM magnesium chloride (MgCl2), 0.5\u2009mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 100\u2009mM phenylmethylsulfonyl fluoride (PMSF), 0.5\u2009\u03bcl salt-activated nuclease (Millipore Sigma), 1\u2009mM ATP (Millipore Sigma) and lysed using a sonicator. The lysate was centrifuged at 32,000\u2009\u00d7\u2009g for 40 min at 4\u00b0C. The supernatant was applied to 5\u2009ml of Ni-NTA (nitrilotriacetic acid) chromatography resin (Gold Biotechnology), washed with 5 column volumes (CV) using the same buffer, eluted, and fractionated with 5 CV of the same buffer supplemented with 600\u2009mM NaCl and 750\u2009mM imidazole (pH 8.2). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis  was used to visualize the protein content of the fraction. Fractions with the greatest Rep content were pooled and digested with 100\u2009\u03bcg of Ulp1 protease for 1\u2009h at 4\u00b0C to hydrolyze the SUMO fusion at the N terminus, diluted to 300\u2009mM NaCl using the same buffer, and processed using a 1-ml heparin-conjugated chromatography resin  connected to an \u00c4kta Pure . Sample was washed with 3 CV of the same buffer and eluted using a salt gradient (0 to 2 M NaCl) in the same buffer. Fractions possessing Rep were concentrated using ultrafiltration and processed using size exclusion chromatography (Superose 6 10/300) connected to an \u00c4kta Pure equilibrated in 20\u2009mM HEPES (pH 8.2), 500\u2009mM NaCl, 0.2\u2009mM TCEP, 10\u2009mM MgCl2 . Fractions possessing Rep were pooled, concentrated, flash frozen using N2(l), and stored at \u221280\u00b0C. Ulp1 was purified as previously described  was determined by comparing its band intensity to that of carbonic anhydrase  with known concentration.\u22121 (AU time\u22121) rate of NADH conversion to NAD+. AU was converted to concentration using a calibration curve of NADH concentration (known) versus absorbance (measured). Kinetic parameters (kcat and S0.5) were extracted using nonlinear fitting with the program Origin 2016 (OriginLab).The ATP/NADH-coupled spectrophotometric assay was performed using 66 nM Rep per reaction . Measure\u22121 (4\u2009\u03bcl) were applied to the grids for 3\u2009s; blotted using a blot force of 2, a blot time of 4\u2009s, a drain time of 0\u2009s, a relative humidity of 100%, and a temperature of 4\u00b0C; and plunge frozen into a bath of liquid ethane using an FEI Mark IV Vitrobot. Data were collected on a Thermo Fisher Scientific FEI Titan Krios operating at an acceleration voltage of 300\u2009kV and a Cs  of 2.7\u2009nm. Images were recorded with a Gatan Summit K2 direct electron detector operating in counting mode (Grids for cryo-EM were prepared by plasma cleaning UltrAuFoil Holey Gold films (Electron Microscopy Sciences) for 30\u2009s using a Fischione Instruments model 1070 NanoClean. Samples at 0.4\u2009mg mling mode . The micing mode .Ab initio structure determination, heterogeneous classification, 3D variability, nonuniform refinement, and 3D Fourier shell correlation (3DFSC) were performed with cryoSPARC to generate Rep bound to ssDNA and dsDNA , B-DNA , C-DNA , and RNA  were generated by the x3DNA server . These mMap segmentation was performed using UCSF Chimera with a 2.5-\u00c5-radius color zone. Correlation coefficient values between maps were also calculated using UCSF Chimera .2, 1\u2009mM CaCl2, and 50\u2009mM EDTA for 2 h. A 1% agarose gel (40\u2009ml) was cast in the presence of 1\u2009\u03bcl of SYBR-Gold nucleic acid stain . For controls, a 1 \u03bcM concentration of a 12- and a 44-nt oligonucleotide (10\u2009\u03bcl each) was also processed with the agarose gel. Gels were visualized using a UV-transilluminator at 302\u2009nm.To determine the identity of nucleic acid bound to Rep, we independently treated the purified sample with DNase I or RNase I (Thermo Fisher) according to the manufacturer\u2019s protocol. For each reaction, a total of 40 \u03bcM purified Rep (10\u2009\u03bcl) was first denatured at 90\u00b0C for 15\u2009min. The sample was cooled to room temperature and then digested with 10 U of RNase I in 20\u2009mM Tris-acetate (pH 8.0), 100\u2009mM NaCl, and 0.1\u2009mM EDTA or with 1 U of DNase I in 100\u2009mM Tris-HCl (pH 7.5), 25\u2009mM MgCl7LAR, and Rep with dsDNA, 23250/7LAS, respectively.The cryo-EM map and atomic coordinates have been deposited into the EMDB and PDB, respectively. Accession codes (EMDB/PDB) are as follows: Rep with ssDNA, 23249/"}
+{"text": "Composite cylinders were cemented on the zirconia sample with Duo-Link Universal (Bisco). Eight specimens per group were subjected to 10,000 thermocycles and subsequently bond strength was tested with shear-bond strength test. ANOVA test showed that artificial aging significantly affected the bond strength to zirconia. Bonferroni test highlighted a significant influence of adhesive treatment (Signum) on bond strength after thermocycling. It was concluded that 10-MDP-based bonding systems showed no improvement in initial bond strength compared with tribochemical treatment. All chemical bonding techniques tested in this study were influenced by thermocycling.This study evaluated the effectiveness of chemical-based adhesive techniques on promoting immediate and aged bond strength between zirconia and luting cement. A total of 128 discs of zirconia were divided into 4 groups ( Continued development of dental ceramics has allowed the coupling of excellent esthetic qualities with improved mechanical properties, and these ceramics are now widely used to realize indirect metal-free restorations. Their major properties are hardness, a high coefficient of elasticity, resistance to heat and chemical attack, and high fragility ,2,3. Sev2), which include feldspathic, leucite-based, and lithium-disilicate materials, have well-established adhesive protocols due to the presence of silica. In contrast, alumina and zirconia, also called crystalline ceramics, do not contain silica or glass components. Their atoms are arranged in a regular pattern, which makes them denser and more resistant to fracture [Dental ceramics could be classified according to the silica content. The silica-based ceramics  monomer. The 10-MDP monomer has two functional groups, an acid group that bonds to hydroxyl groups on the zirconia surface and a methacrylate (carboxylic acid group) that can be light-cured with the composite monomers. The 10-MDP monomer is contained in specific primers designed for zirconia , but recn = 16 each), where the specimens were randomly allocated  considering:This study was designed in 8 study groups : tribochemical treatment, Signum Zirconia Bond ; Z-Prime Plus ; All-Bond Universal .\u201cArtificial aging\u201d in 2 levels: half of the specimens treated with an adhesive approach were thermocycled before shear-bond stress.A schematic representation of the study design is displayed in For this in vitro study, 128 square-shaped specimens 2 mm thick were prepared by sectioning CAD-CAM blocks of cubic zirconia with a diamond saw . After sectioning, all specimens were sintered and glazed according to the manufacturer instructions. The obtained slices were polished with #600, #1000 and #1200 paper grit to standardize zirconia surface.n = 32 per group) according to the adhesive treatment performed. Before adhesive application, all the ceramic surfaces were cleaned and dried.The so-obtained specimens were embedded in an acrylic resin base , repolished with paper grit to remove any residual resin that might have covered the zirconia surface. Specimens were the washed under copious deionized water and divided into 4 groups  at 3 bar pressure for 15 s at 10 mm distance using an intraoral microblasting unit (Kavo). After washing the specimen surface for 30 s with water, one coat of Silane Primer (3M ESPE) was applied and air-dried for 10 s before brushing the bonding resin  over the entire surface and light-cured for 20 s with a LED curing unit at 1400 mW/cmGroup 2: Signum Zirconia Bond I  was dispensed and applied with a microbrush to the entire surface for 20 s and air-dried for five seconds; Signum Zirconia Bond II was then applied, and light-cured as described in group 1.Group 3: The ceramic surface was coated with a single layer of Z-Prime Plus , which was applied through a microbrush for 1 min and gently air-dried.Group 4: A universal adhesive system  was brushed over the zirconia surface in two consecutive layers, 15 s each. After gentle air-drying, specimens were light-cured as described in group 1.A summary of the adhesives procedures in the different groups is displayed in 2 for 120 s. Then, the polyethylene mold was removed, and the cylinders were transferred to distilled water and stored in a dark box for 7 days at 37 \u00b0C. Then, after the various adhesive procedures were performed on the zirconia surfaces, the cylinders were cemented with a constant pressure on the center of the zirconia sample surface with Duo-Link Universal (Bisco), and light-cured after one minute on four sides for 20 s per side.Preformed polyethylene molds with a hole in the center were then used to produce composite cylinders . The nanohybrid composite resin  was placed into the mold and incrementally condensed to fill it; each cylinder was cured with a multi-LED lamp  at 1400 mW/cm2, which is calculated using the formula \u03c3 = L/A, where L is the force (expressed in N) at which there was the detachment of the cylinder, A = \u03c0 \u00d7 r2 (in mm2) was the bonding surface, and r is the radius of the cylinder.Next, the specimens were stored in deionized water for 24 h at 37 \u00b0C. After storage 16 specimens from each group were immediately subjected to the shear-bond strength test, while the remaining 16 specimens of each group were subjected to 10,000 thermal cycles in alternating water baths at 5 \u00b0C and 55 \u00b0C for 60 s each (5 s dwell time). The shear-bond test was performed fixing the resin base on a universal machine  with a notched blade that applied a force on the composite cylinder at a speed of 1 mm/min. This test provides bond strength expressed in MPa/mmFractured specimens were observed under optical microscopy  at 40\u00d7 magnification to establish failure modes, which were classified as: ACO (adhesive detachment between composite and resin cement); ACE (adhesive detachment between ceramic and resin cement); AM (mixed adhesive detachment); CC (cohesive detachment within composite) and CM (cohesive detachment within ceramic).post hoc tests were performed to evaluate the effect of different adhesion technique (AT) and artificial aging (AA), and their interaction, on bond strength. Fracture modality was analyzed using the \u03c72 test. Differences were considered statistically significant at p < 0.05.Two-way ANOVA and Tukey Mean bond strengths (with standard deviations) and type of fracture (expressed as percentage) in each group before and after thermocycling are shown in p < 0.00001) and the artificial aging (p < 0.0001) significantly affected the bond strength on zirconia. The Tukey analysis highlighted a significant influence of adhesive treatment on bond strength after thermocycling. In particular, the bond strength obtained in group 2 was significantly higher than that for other adhesive procedures (p < 0.0001). In regard of the fracture mode, ACO was the mainly detected fracture in all groups, before and after thermocycling. The \u03c72 test revealed that AT and AA did not statistically influence the type of fracture between zirconia and dual-curing cement.The ANOVA test showed that adhesive treatment  with the hydroxyl groups on the zirconia surface. A recent in vitro study  confirmeRegarding the effectiveness of chemical bonding techniques, the results of the present study are consistent with those reported by Seabra et al. , who con2O3 particles, followed by silane application. The tribochemical treatment allows combining micro-mechanical retention created by sandblasting with the chemical retention achieved by silanization. In the present study, the tribochemical treatment did not increase the immediate bond strength of the resin cement to zirconia compared with ceramic primers and universal adhesives, and it was more susceptible to damage by thermocycling then some chemical bonding treatments. Several previous studies investigated the bond strength obtained between a silanized zirconia surface and resin-based cement, but there is still no consensus in the literature. Passos et al. [The tribochemical treatment consists of surface roughening with 30-\u00b5m silica modified with Als et al.  evaluates et al.  claimed s et al. ,39, surfs et al. . Thus, tTo better assess the long-term effectiveness of the adhesive treatments, samples were subjected to a thermocycling procedure entailing alternating baths of distilled water at 5 \u00b0C and 55 \u00b0C for 60 s each. In the present study, 10,000 thermal cycles were performed, after which some samples showed spontaneous debonding of the cylinders and they were consequently excluded from the study. Six cylinders had broken away: one from group 1, three from group 2, and two from group 4. Thermocycling is generally used to cause rapid aging of a composite; switching between high- and low-temperature baths produces expansion and contraction of the composite, which places stress on the adhesive interface, simulating the aging conditions of the mouth. Thus, thermocycling induces the hydrolytic degradation of the bonding because of the water diffusion into the interfacial layer of the resin composite and zirconia, decreasing the bond strength of resin luting agents to zirconia ,41,42. RThe results of the present study caused us to reject the second null hypothesis because thermocycling significantly influenced the bond strength for all adhesive techniques tested in this in vitro study. These results were partially supported by a previous study by Kim et al. , which eIn the present study the samples treated with specific primers for zirconia (Z-Prime Plus and Signum Zirconia Bond) showed similar bond strengths to other techniques. However, after thermocycling, Signum Zirconia Bond maintained significantly higher bond strength than other treatments. This outcome may be related to the primer composition. Signum Zirconia contained a mixture of organophosphate monomers that bind chemically to the zirconia on one side and to the composite resin on the other side. In particular, organophosphates monomers have an organofunctional component, often a methacrylate group, which can be co-polymerized with the monomers of the resin composite, and a phosphoric acid that binds with the metal oxides of zirconia. The other monomers cooperate in the development of the bond between the zirconia and resin cement. Moreover, the presence of acetone in Signum Zirconia Bond could increase the surface wettability of zirconia and thus promote bonding with methyl\u2013methacrylate. Acetone can also remove impurities from the zirconia surface , thus inThe results obtained confirmed that there are currently adhesive strategies to be applied in the cementation of cubic zirconia. However, there is still a problem of stability of the adhesion values obtained, which prove to be susceptible to stresses such as thermocycling. Furthermore, the effect of the mechanical stresses on adhesion on zirconia should be evaluated in addition to thermal stress.Within the limitations of this in vitro study, it could be affirmed that all adhesive treatments tested showed significant reduction in the bond strength after thermocycling. Moreover, the use of specific zirconia primers such as Signum Zirconia Bond showed a significantly higher bond strength than that of other adhesive procedures after thermocycling. All-Bond Universal did not achieve any improvement in bond strength compared with tribochemical treatment or other specific primers."}
+{"text": "Chitosan (CS)/poly(ethylene oxide) (PEO)-based nanofiber mats have attracted particular attention as advanced materials for medical and pharmaceutical applications. In the scope of present studies, solution blow spinning was applied to produce nanofibers from PEO and CS and physicochemical and biopharmaceutical studies were carried out to investigate their potential as wound nanomaterial for skin healing and regeneration. Additional coating with hydrophobic poly(dimethylsiloxane) was applied to favor removal of nanofibers from the wound surface. Unmodified nanofibers displayed highly porous structure with the presence of uniform, randomly aligned nanofibers, in contrast to coated materials in which almost all the free spaces were filled in with poly(dimethylsiloxane). Infrared spectroscopy indicated that solution blow technique did not influence the molecular nature of native polymers. Obtained nanofibers exhibited sufficient wound exudate absorbency, which appears beneficial to moisturize the wound bed during the healing process. Formulations displayed greater tensile strength as compared to commercial hydrofiber-like dressing materials comprised of carboxymethylcellulose sodium or calcium alginate, which points toward their protective function against mechanical stress. Coating with hydrophobic poly(dimethylsiloxane)  impacted porosity and decreased both mechanical properties and adherence to excised human skin, though the obtained values were comparable to those attained for commercial hydrofiber-like materials. In vitro cytotoxicity and irritancy studies showed biocompatibility and no skin irritant response of nanofibers in contact with a reconstituted three-dimensional human skin model, while scratch assay using human fibroblast cell line HDFa revealed the valuable potential of CS/PEO nanofibers to promote cell migration at an early stage of injury. Nanotechnology is a dynamically growing discipline with a large potential in the medical and pharmaceutical fields. Among a wide range of nanomaterials, including nanotubes, nanoparticles, and nanoflakes ,2, nanofElectrospinning has been the most widely explored method of polymer-based nanofibers preparation thus far . The proBasically, in SBS, a polymer solution is flown through the inner nozzle and stretched into fibers by a pressurized airflow, enabling their deposition on a collector in the direction of gas flow. It is a robust process with a relatively high production rate and low energy consumption which, in contrast to the electrospinning method, does not need the use of harsh organic solvents or high voltage .Among biopolymers used in spinning technologies, chitosan (CS) is a biocompatible polysaccharide composed of randomly ordered glucosamine and N-acetylglucosamine units linked with \u03b2 (1 \u2192 4) glycosidic bonds, and has attracted a particular attention . CS is cIt should be stated that CS is a relatively inhomogeneous material (particularly due to its origin and manufacturing process) and a wide range of CS types differing, e.g., in purity level, deacetylation degree, or molecular mass, are thus commercially available. These internal properties influence not only the final product characteristic or its applicability, but also may determine the suitability of a particular type of CS in a technological process. For instance, CS with higher molecular weight above 200\u2013250 kDa) can be considered as a viscous agent for semi-solid preparations (including hydrogels or emulgels) 0\u2013250 kDa, or micrPoly(ethylene oxide) (PEO) is a class of nonionic synthetic polymers also applied in spinning techniques solely or as additives to other polymers . PEO is To our best knowledge, there are only a limited number of studies focused on the use of CS in solution blow spinning ,30 and nw/w) polymer solutions (formulation CS/PEO 10%). Morphological properties of CS/PEO nanofibers were investigated by using scanning electron microscopy. Basically, SEM imaging  or 10%  compatibility, and the plausible effect of SBS process on the interaction between PEO and CS. ATR-FTIR spectra of unmodified CS/PEO nanofibers and poly(dimethylsiloxane) modified nanofibers CS/PEO-S with respect to pure PEO and CS are shown in \u22121 assigned to asymmetric stretching vibrations of -CH group and a prominent complex absorption intensity at around at 1050 and 1020 cm\u22121 attributed to C\u2013O\u2013C stretching mode  was purchased from Sigma and JC-1 MitoScreen kit was obtained from BD Biosciences . EpiDerm tissue (lot number 28690) was from MatTek In Vitro Life Science Laboratories . Simulant wound exudate fluid  for in vitro absorption capacity measurements and bioadhesive studies was prepared according to [Highly purified medical grade chitosan (Chitosciencerding to . Polyethrding to  with thew/w) CS and 6.4 and 8% (w/w) polyethylene oxide (PEO) were dissolved in 0.5% (v/v) acetic acid aqueous solution and left for continuous stirring for 24 h in room temperature. Overall concentration of polymers in the solution was 8 and 10% (w/w). Concentration below 8% had too low viscosity whereas concentration above 10% was found to clog nozzle during SBS process. According to [Suitable concentration and ratio of PEO and CS for the fiber formation process were selected upon preliminary studies. Solutions with blend of polymers containing 1.6 and 2% ) to 1.0 mL/h (10% (w/w)). At the same time, the airstream was supplied through the outer nozzle of the SBS nozzles system with a constant pressure of 0.08 MPa. Fibers were produced by shear-drag elongation of the polymers blend solution by the stream of air at the distance of 50 cm between the nozzle system and the surface of the collector. As a collector, the rotating cylinder with reciprocating motion was used . The process continued until the formation of a nanofibrous mat with a thickness of approximately 100\u2013200 \u03bcm and was carried out three times for each nanofibrous material\u2019s composition.Nanofibers were produced in SBS process, described in detail previously by our group . During For mechanical and bioadhesive measurements, nanofibrous materials were additionally coated with liquid poly(dimethylsiloxane) (S-coating) which was sprayed uniformly through a nozzle (diameter 0.8 mm) on their surface in a mass ratio 1:1. The distance between the nozzle and the nanofibers was 10 cm. The morphology and fiber size were investigated using scanning electron microscopy . Samples were prepared by cutting a mat into a 5 mm \u00d7 5 mm square sample and putting it on the surface of the SEM stub using carbon/aluminum conducting tape. Before imaging, samples were coated  with about 10 nm layer of Au:Pd (80:20 atomic ratio). For each sample at least 100 fibers were measured in three different areas of observation.s\u2014sample density, dp\u2014polymer density. Square samples with dimensions about 10 mm \u00d7 10 mm were weighed, and sample density was calculated: ds = m/(\u03b4\u2219A), where m\u2014sample mass (g), \u03b4\u2014sample thickness (cm), A\u2013sample area (cm2) [The porosity of the nanofibrous materials was determined using a gravimetric method based on the following relation: ea (cm2) . The sam2) at ambient conditions, and the water contact angle was measured over 1 s with 10 frames per second. The water contact angle for each material was measured three times, and values are presented as mean \u00b1 standard deviation.Hydrophilic properties of CS/PEO nanofibers were studied using the sessile drop method . Droplets of 5 \u03bcL distilled water were dispensed onto the surface of the material . Spectra were detected three times in ATR mode and analyzed with the OMNIC 8.3 software, and representative spectrum for each sample is presented as a result.Rectangular samples of CS/PEO nanofibrous materials underwent a uniaxial stretching test according to previously described protocol . For thiThe test was conducted using Instron 3345 model  with crosshead speed 10 mm/min at ambient conditions which measured the maximum load and strain at rupture. Each experiment was carried out five times.SEM imaging and porosity measurements displayed that fibers occupy only a fraction of the volume of the material sample. One can determine this fraction from the 1-P relationship, which also applies to the cross-sectional area of the sample. Since only a fraction of fibers occupies the cross-sectional area of the sample, only this fraction of the material thickness transfers the applied load during tensile testing. This effect was accounted for in the data processing for tensile properties calculation. Due to poor mechanical properties of Control-2, fixed distance at which the probe was raised (about 2 mm) was applied to estimate its tensile strength and Young modulus. Absorption capability was measured using simulate wound exudate (SWE) fluid on a self-constructed thermostated inclined steal plate at 32 \u00b1 1 \u00b0C according to ,61. EachThe protocol of bioadhesion study was approved by the Local Bioethical Committee, Bialystok, Poland (permission number R-I-002/305/2019). Freshly excised human skin was obtained from the clinic of surgery and aesthetic medicine in Bialystok from women undergoing face lift. Tissue specimens were preserved in the isotonic saline solution, frozen at \u221220 \u00b0C directly after the surgery and kept no longer than 60 days. In prior experiments, skin was thawed at ambient conditions, cut into pieces, and microscopically checked for tissue integrity.Bioadhesive properties of nanofibers in contact with excised human skin were carried out with texture analyzer TA.XT. Plus  . Uncoate2. The cells were seeded into six-well plates (with density of 5 \u00d7 105 cells per well) and cultured for 48 h in optimal growth conditions . Extraction of CS/PEO 10% nanofibrous material in serum-free medium at concentrations 10, 20, 40 mg/mL took place at 37 \u00b0C for 72 h according to ISO EN 10993-5:2009 [Human dermal fibroblasts cell line HDFa from American Type Culture Collection  were propagated according to the enclosed procedure protocol in Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) supplemented with 10% fetal bovine serum, 50 U/mL penicillin and 50 \u03bcg/mL streptomycin at 37 \u00b0C in an atmosphere with 5% CO3-5:2009 . After f3-5:2009 .2 humidified atmosphere. Then the culture medium was discarded, cells were rinsed three times with Phosphate Buffered Saline (PBS) and incubated for 4 h in MTT solution at 37 \u00b0C. Afterwards, medium was removed from the wells and the cells were lyzed with DMSO and Sorensen\u2019s buffer. The absorbance of purple formazan derivative in living cells was measured spectrophotometrically at 570 nm . Cell viability cultured in the presence of nanofibers extracts was calculated as a percent of control cells not exposed to CS/PEO material. Additional control, pure PEO and pure CS were dispersed in medium at concentrations 32 mg/mL and 8 mg/mL, respectively-referring to those occurred in the highest tested concentration of nanofiber extract. Experiments were performed for at least three independent replicates.According to Carmicheal et al. , the viaDisruption of the mitochondrial membrane potential (MMP) was analyzed using the lipophilic cationic fluorochrome (JC-1 MitoScreen kit) as previously described . Subsequ2, 95% relative humidity), tissues were thoroughly rinsed with PBS, blotted to remove the tested material, and transferred to fresh medium. After 42 h-incubation period, the MTT assay was carried out by transferring the tissues to 24-well plates containing MTT medium at a concentration of 1 mg/mL. After 3 h incubation, the blue formazan salt formed by cellular mitochondria was extracted with 2.0 mL/tissue of isopropanol and the optical density of the extracted formazan was determined spectrophotometrically at 570 nm. Sterile PBS was used as negative control whereas 5% (w/w) SDS solution was used as positive control and examined concurrently with nanofibers. Test was performed in triplicate.The test consists of a topical exposure of nanofibrous material to a reconstructed human epidermis model EpiDerm\u2122 followed by a cell viability assay which was measured by dehydrogenase conversion of MTT. Test was performed according to the enclosed procedure described in Section 7.4. of EPI-200-SIT Protocol ,66. Brie2. Images were taken after 4 h, 24 h and 48 h incubation using a phase contrast microscope  at a 100\u00d7 magnification. The wound closure expressed as a change in pixels intensity between cell monolayer and scratch area over time was assessed by ImageJ software  and calculated as a percentage of the initial scratch area at 0 h.The scratch test was used to evaluate the migration ability of fibroblast HDFa cells in the presence of CS/PEO 10% nanofibers extract and pure CS or PEO controls. Cells were cultured in six-well plates until approximately 100% confluence. Thereafter, vertical scratches were produced using 20 \u03bcL pipette tips . After wp < 0.05). The difference among the mean fiber sizes, mean water contact angle values and bioadhesive behavior of analyzed materials were tested using the Kruskal-Wallis test with post hoc nonparametric Dunn\u2019s test for multiple comparisons. The difference among the mean porosity and mean values of the mechanical properties of analyzed materials was tested in one-way ANOVA with post hoc Tukey\u2019s test for multiple comparisons.The normality of fiber size distributions, porosity, water contact angle and results from mechanical and bioadhesive properties was tested using the Shapiro-Wilk test . The presence of a hydrophobic layer impacted mechanical properties of nanofibers, though the obtained values were comparable to those attained for commercial hydrofiber-like materials comprised of carboxymethylcellulose sodium or calcium alginate. CS/PEO 10% nanofibers exhibited cytocompatibility at concentration 10\u201320 mg/ml and fibroblast viability comparable to the control group at all tested time points. Solution blow-spun material did not induce irritancy in contact with EpiDerm\u2122 tissue, which confirmed its compatibility with a skin model. Additionally, an in vitro scratch assay demonstrated its ability to promote fibroblast migration even at early time points. Overall, obtained results show that CS-enriched, solution blow-spun PEO nanofibers with a poly(dimethylsiloxane) outer layer may serve as valuable material per se for skin healing and regeneration."}
+{"text": "Canarium ovatum Engl.), an indigenous tree found in the Philippines, is highly regarded for its fruit due to its high economic value. During processing, the pulp is often discarded as waste but contains considerable amounts of oil and bioactive minor lipid components. The present study explored the antioxidant and antibacterial properties of saponified diethyl ether extract of pili pulp oil and related this activity to the nature of compounds present in the extract through GCMS. The extract indicated the elution of 18 major compounds which are mostly cyclic triterpenic  and phytosterol  class of compounds. Characterization of the bioactivity of the extract showed high antioxidant activities measured by DPPH radical scavenging (EC50: 74.45\u2009\u00b1\u20091.29\u2009\u03bcg/mL) and lipid peroxidation inhibition (EC50: 3.02\u2009\u00b1\u20090.06\u2009\u03bcg/mL) activities that were comparable with that of \u03b1-tocopherol. Moreover, an observed bactericidal activity was demonstrated by the extract against E. coli and S. typhi with MIC values of 40 and 35\u2009\u03bcg/mL, respectively. The observed bioactivity of the pili pulp oil extract can be attributed to these compounds which may provide desirable health benefits.Pili ( Canarium ovatum Engl., locally known as pili, is an indigenous tree commonly found in the Philippines which is cultivated for its edible fruit [le fruit . Pili nule fruit . In pilile fruit , 4. ThesS. aureus, E. faecalis, and P. aeruginosa are studied by Amoussa et al. [Antioxidants and antimicrobial agents play a significant role in the food sector primarily because bacterial growth and lipid oxidation are the main factors that determine food quality loss and shelf-life reduction. Oftentimes, synthetic additives such as BHA/BHT are commonly added to food products to inhibit the process of lipid oxidation and microbial growth and to extend their shelf-life. However, a shift to naturally derived compounds is seen and increasingly being sought by many companies due to possible adverse effects associated with long-term intake of synthetic compounds , 6. Phyta et al.  and Nzoga et al. . Phenolia et al. .Hence, the present study explored the potential of minor lipid components in pili pulp oil as a source of phytosterols and cyclic triterpenoids with antioxidant and antibacterial properties. The interest in these naturally derived compounds is not only due to their biological activity but also to maximize the economic potential of pili pulp oil.Canarium ovatum Engl.) fruits were obtained from a local market at Goa, Camarines Sur, Philippines. Microbial strains  used for the antibacterial activity assay were obtained from the Philippine National Collection of Microorganisms (PNCM), BIOTECH, UPLB, College, Los Ba\u00f1os, Laguna, Philippines. All other chemicals and standards were purchased commercially.Pili (n-hexane at 1\u2009:\u20094 ratio of dried pulp weight (g) to solvent volume (mL). After 12\u2009h of extraction at room temperature with constant agitation, the oil was recovered by solvent evaporation by using a rotary evaporator.Pili fruits were manually depulped by blanching in lukewarm water for about 15\u201320\u2009min. The pulps were then collected and dried in a convection-type oven at 70\u00b0C overnight or until moisture content reached about less than 3%. Extraction of oil was carried out by using The unsaponifiable fraction of oil was obtained by saponification following the method of Almeida et al.  with som\u03bcm film thickness . The initial oven temperature was held at 190\u00b0C for 1\u2009min then raised to 300\u00b0C at 15\u00b0C/min and kept constant for 10\u2009min. Helium was used as the carrier gas with a constant flow rate of 1\u2009mL/min. The injector, MS ion source, and MS interface temperatures were set at 310, 230, and 280\u00b0C, respectively. A sample injection of 1\u2009\u03bcL was performed in a split mode of 10\u2009:\u20091 and peaks were detected in full scan acquisition mode from m/z 50 to 500. Identification of the individual components was performed by NIST mass spectral library on the basis of the mass fragment and e/z values of each component. The relative concentration of each peak was computed based on the total ion count.Profiling of SDEE was performed on a Shimadzu GCMS-QP2020 equipped with a Shimadzu AOC-20i Plus auto-injector  under electron impact ionization at 70\u2009eV. Separation of components was carried out in SH-Rxi-5Sil MS capillary column with dimensions of 30\u2009m\u2009\u00d7\u20090.25\u2009mm ID\u2009\u00d7\u20090.25\u2009\u03b1-tocopherol were used as a blank and positive control, respectively. The absorbance of the resulting mixture was measured at 516\u2009nm and the percent radical scavenging activity was calculated based on the following equation:The scavenging activity of SDEE against DPPH radical was evaluated by using the method of  with som50 value is defined as the concentration of sample required to scavenge 50% of DPPH radical under the assayed conditions.The EC\u03bcg/mL of SDEE (in chloroform) and 0.5\u2009mL of 10% egg yolk homogenate (w/v in distilled water) was mixed in a screwcapped tube and the volume was made up to 1.0\u2009mL by adding distilled water. Then, 0.05\u2009mL 0.07 M FeSO4 (in distilled water) was added, and the mixture was incubated at 37\u00b0C for 30\u2009min to induce lipid peroxidation. A 0.05\u2009mL of 20% (w/v) trichloroacetic acid solution (TCA) in distilled water and 1.0\u2009mL 0.1% (w/v) thiobarbituric acid solution (TBA) in distilled water was added to the mixture, vortexed, and heated in a water bath at 80\u00b0C for 30\u2009min. After cooling, 3\u2009mL of butanol was added, and the mixture was centrifuged at 3000\u2009rpm for 5\u2009min. The absorbance of the upper layer was measured against 3\u2009mL butanol at 512\u2009nm. Chloroform and \u03b1-tocopherol were used as blank and positive controls, respectively. The lipid peroxidation inhibition activity was calculated by using the following equation:A mixture of 0.1\u2009mL of 0.1\u201310\u200950 value is defined as the concentration of sample required to inhibit 50% of lipid peroxidation under the assayed conditions.The ECS. aureus, B. cereus, E. coli, S. typhi, and P. aeruginosa was carried out by disk diffusion method [8\u2009CFU/mL was uniformly spread onto individual solid media plates of Muller\u2013Hinton agar by using a sterile cotton swab. Disks of 6\u2009mm in diameter were impregnated, until saturation, with 0.1\u2009mg/mL of the extract. The disks were then allowed to dry placing in the inoculated agar. Chloramphenicol and chloroform served as positive and negative controls, respectively. The inoculated plates were incubated at 37\u00b0C for 18\u201324\u2009h. Antimicrobial activity was evaluated by measuring the zone of inhibition against the test organisms.Qualitative antimicrobial activity of SDEE against n method . Briefly\u03bcg/mL. Then, 295\u2009\u03bcL of each dilution was transferred into a 96-well microplate. A 5\u2009\u03bcL of test bacterial suspension (1.0\u2009\u00d7\u2009106\u2009CFU/mL) was inoculated to obtain a final concentration of 1.67\u2009\u00d7\u2009104\u2009CFU/mL and a final volume of 300\u2009\u03bcL per well. The inoculum (positive control) and culture medium (negative control) were put into the first column of the microplate, and the chloramphenicol antibiotic control ranging from 0.5 to 75\u2009\u03bcg/mL was in the final column. Each plate was wrapped loosely with cling film to prevent dehydration during incubation for 18\u201324\u2009h at 37\u2009\u00b0C. Subsequently, 10\u2009\u03bcL of bacterial growth indicator, resazurin at 6.75\u2009mg/mL, was added to wells, which were then incubated for 30\u2009min at 37\u2009\u00b0C. The lowest concentration of the extract that visually showed no growth was determined as MIC.The MIC of the extract exhibiting sensitivity to the tested microorganism based on the disk diffusion assay was determined following the methods outlined by Eloff  with somP < 0.05.All experiments and measurements were carried out in triplicate. The data were presented as mean\u2009\u00b1\u2009SEM and were analyzed by using one-way ANOVA. Means were compared using Tukey's post hoc comparison test by using R software . Significant differences between means were determined at Extraction of oil revealed 23.92\u2009\u00b1\u20090.21% yield, expressed in dry weight basis of pulp. The unsaponifiable fraction of oil obtained from diethyl ether extraction showed 1.0294\u2009\u00b1\u20090.0501%. These values were slightly lower than our previous findings [\u03b2-Amyrin showed the highest abundance of around 34.75%, followed by \u03b1-amyrin and \u03b2-sitosterol with 20.92 and 15.78%, respectively. Other phytosterols identified in SDEE include brassicasterol, stigmasterol, campesterol, and fucosterol , costerol . These wcosterol .\u03b1-and \u03b2-isomers, are generally found in different plant part extracts such as in C. tramdenum bark which contains 0.03\u2009mg/g \u03b2-amyrin [M. barteri and S. longifolia also contain high amounts of \u03b1-amyrin as reported by Ce et al. [Amyrin, both \u03b2-amyrin . Areal pe et al.  and Saeie et al. . Other te et al. , 23.50 values of 3.02\u2009\u03bcg/mL with that of \u03b1-tocopherol (2.92\u2009\u03bcg/mL), a known antioxidant compound, though a moderate activity was observed in terms of its DPPH radical scavenging activity with a slightly higher EC50 value of 74.45\u2009\u03bcg/mL in SDEE as compared to 65.91\u2009\u03bcg/mL in control.The antioxidant activity of the SDEE was analyzed in terms of scavenging activity against DPPH radical and the ability to inhibit lipid peroxidation in the egg yolk system. As shown in \u03b2-sitosterol, and stigmasterol have been shown to exhibit scavenging activities against DPPH radical and provide hepato- and neuro-protection of hydrogen peroxide-induced oxidative stress levels [Myrcianthes pungens leaves revealed high antioxidant activity with antioxidant protection equivalent to the Trolox of 137 and 129% for \u03b1-and \u03b2-amyrin, respectively, at 500\u2009\u03bcg/mL [Terpenoids and sterols, in general, have been shown to exert antioxidant properties owing to their hydroxyl group that participates via hydrogen atom transfer or single electron transfer mechanism in quenching reactive oxygen species , 25. It s levels . Isomers00\u2009\u03bcg/mL .E. coli and S. typhi with 10.3 and 11.7\u2009mm zone of inhibition, respectively, at 0.1\u2009mg/mL. The MIC showed that 40 and 35\u2009\u03bcg/mL of the extract were able to inhibit the growth of E. coli and S. typhi, respectively. The extract was not active or did not show antibacterial activity in S. aureus, B. cereus, and P. aeruginosa at 0.1\u2009mg/mL.The antibacterial potential of SDEE against 5 common food pathogens is shown in \u03b2-amyrin exerting antibacterial activities against the 5 pathogens tested in this study. In a separate study, hexane extract of Manilkara subsericea fruit which is mostly \u03b1-and\u03b2-amyrin acetate showed a MIC value of 250\u2009\u03bcg/mL against S. aureus [\u03b2-sitosterol that were isolated from Icacina trichantha, showed high antimicrobial properties against B. subtilis, E. coli, and C. albicans.The antibacterial activity of SDEE can be attributed to the high amyrin content which was also observed by Abdel-Raouf et al.  in sever. aureus . Aside f. aureus  reportedE. coli as demonstrated by Broniatowski et al. [The regulatory activity of amyrin including other triterpenoids in disrupting pathways responsible for cell division and protein synthesis, as well as destabilization of bacterial cell membrane and inhibition of cell growth are some of the plausible mechanisms of action of these compounds . Furtheri et al. .\u03b1-tocopherol, a known antioxidant compound. The extract also exerts antibacterial activities against E. coli and S. typhi which are bacterial pathogens of concern, especially in food preparation. GCMS profiling revealed 18 compounds majority of which are cyclic triterpenes and phytosterols such as \u03b1- and \u03b2-amyrin, lupenone, \u03b2-sitosterol, brassicasterol, and stigmasterol. Our results suggest that these bioactive compounds are responsible for the observed bioactivities which may provide desirable health benefits.Extraction, saponification, and diethyl ether fractionation of the unsaponifiable matter of pili pulp oil showed strong antioxidant properties as measured by its scavenging activity against DPPH radical and lipid peroxidation inhibition activities and are found to be comparable to"}
+{"text": "Oocyte (OC), embryo (EC), and ovarian tissue cryopreservation (OTC) are options for fertility preservation (FP) before going through gonadotoxic cancer treatment, or anticipated fertility decline in benign ovarian diseases, or for planned OC. The aim of this study is to report outcomes of FP in a single tertiary hospital in Korea.This is a retrospective study of OC, EC, and OTC cycles. All patients who visited or were referred to the infertility clinic at the Department of Obstetrics and Gynecology for the purpose of FP between 2010 and October 2021 were included.A total of 564 controlled ovarian stimulation cycles were conducted in 416 women. Three hundred fifty-seven women underwent 494 OC cycles. Most patients were diagnosed with breast cancer (22.4%), followed by endometriomas (21.9%), and then by planned OC (20.7%). Cases of OC have increased over the years, peaking at 109 cycles in 2019 compared to one in 2010. Fifty-nine women underwent 70 EC cycles, and breast cancer (50.8%) was the most common indication. Repetitive OC and EC cycles were undergone in 92 and 9 women, respectively , yielding a maximum number of 33 oocytes or 23 embryos being cryopreserved per patient. The utilization rate was 3.1% (11/357) in OC and 16.9% (10/59) in EC. Twenty-six women underwent OTC, and gynecologic cancer was the most common indication . One woman had the cryopreserved ovarian tissue retransplanted and successfully generated embryos.OC, EC, and OTC are possible options for preserving fertility, and these opportunities should be provided for women at risk of fertility decline or those who are eager to protect their future fertility. This is the first report on long-term FP outcomes in a single tertiary center in Korea. We expect that there will be more cases over the years and more women returning to use their gametes or embryos for pregnancy. Fertility preservation (FP) is becoming an increasingly important field in women\u2019s reproductive lives, and its demands are increasing rapidly. FP is considered in women before going through gonadotoxic cancer treatment or before anticipated fertility decline in the treatment of benign ovarian diseases.Advancements in cancer treatment have resulted in decreased overall cancer mortality rates and increased long-term survival rate. The increased survival rate in reproductive-age women with cancer has, in turn, led to more women to have a chance to focus on long-term quality of life issues, such as motherhood. However, such cancer treatments, including chemotherapy and radiotherapy, inevitably risk compromising future fertility  due to iPlanned oocyte cryopreservation (OC) or embryo cryopreservation (EC) is another indication of FP for women who are not married yet or want to postpone childbearing. In South Korea, the mean age at first live birth was delayed from 27.6 years in 1993 , which iThe third, and the most overlooked, indication of FP is women who require surgical treatment of benign ovarian diseases, which anticipate the decrease of ovarian reserve. In particular, endometriosis of the ovary is the biggest threat to women\u2019s fertility, since endometriosis itself can reduce the ovarian reserve by inflicting damage to the surrounding ovarian tissue  and ovarThere are three main strategies of FP, which the present study focuses on: OC, EC, and ovarian tissue cryopreservation (OTC). Other strategies include ovarian suppression with gonadotropin-releasing hormone (GnRH) agonists and ovarian transposition. However, using GnRH agonists for ovarian protection is controversial  and not The aim of this study is to report outcomes of FP of over 10 years in a single tertiary hospital in Korea and to see its improvements. This study focuses not only on FP in cancer patients, and planned cryopreservation, but also on FP in patients prior to anticipated fertility decline in the treatment of benign ovarian diseases. This study hopes to improve clinicians\u2019 awareness toward the various strategies of FP in any woman of reproductive age who needs or wants to preserve fertility.This single-center study retrospectively analyzed the FP outcomes of patients who were referred to or who visited the Fertility Center of Seoul National University Bundang Hospital between 2010 and October 2021. The indication for FP was one of the following: anticipated chemo- or radiation therapy, before scheduled ovarian surgery, or planned FP. Patients\u2019 characteristics including age, body mass index (BMI), diagnosis of the disease, anti-M\u00fcllerian hormone (AMH) level, and indication of FP were included as study parameters. The mean number of oocytes retrieved and the number of cryopreserved oocytes or embryos from all the controlled ovarian stimulation (COS) cycles for each patient were recorded. The follow-up data of all the patients included were extracted from medical records.The study received institutional review board approval (B-2110-714-104), and the informed consent was waived for a large number of patients with guaranteed anonymity.All patients who had COS cycles for oocyte retrieval carried out for FP were enrolled without any age limitations. Cases with cycle cancelations due to any reason were excluded, for example, follicular growth failure.All cycles (n = 564) were conducted with gonadotropin-releasing hormone (GnRH) antagonist protocols. Cycles were initiated in the early follicular phase of the menstrual cycle in patients with benign diseases or those undergoing planned OC. For cancer patients, since it was important not to delay their planned cancer therapy, random start cycles were applied in most patients regardless of the early follicular phase timing. All patients underwent COS cycles with either recombinant follicle-stimulating hormone  or FSH combined with luteinizing hormone (LH) [human menopausal gonadotropin (hMG), Menopur; Ferring, Malmo, Sweden). The starting dose of gonadotropin was determined according to the age and ovarian reserve of the patients. When the leading follicle reached the size of 13\u201314 mm, a GnRH antagonist  was used to prevent premature LH surge. Final oocyte maturation was triggered by the injection of a recombinant human chorionic gonadotrophin (rhCG)  or 0.2 mg triptorelin , or a combination of the two (250 \u03bcg of rhCG plus 0.2 mg of triptorelin), when two or more leading follicles measured 18 mm in diameter. In patients with hormone-dependent cancers , an aromatase inhibitor  was coadministered with gonadotropin daily starting from the COS cycles to at least 7 days after oocyte retrieval. Transvaginal ultrasound-guided oocyte retrieval was carried out under sedation 36 h after triggering. Metaphase II (MII) oocytes were selected for OC. For EC, the additional process of intracytoplasmic sperm injection (ICSI) using sperm from the husband was carried out and cultured until cleavage stage. One patient had her embryos cultured until blastocyst stage. The embryos were classified as \u201cgood quality\u201d for cleavage-stage embryos with grade 6B or more as assessed by the Steer method  and for The oocytes and embryos were vitrified using the Kitazato Vitrification Cryotop kit  according to the manufacturer\u2019s protocol , 19. WheOTC was carried out in the following patients: (1) those who could not delay their cancer treatment, (2) prepubertal females, (3) those with primary ovarian insufficiency (POI) or impending POI . Ovarian tissue retrieval was performed mainly by minimally invasive laparoscopic surgery. In all cases, the entire unilateral ovary was removed.The OTC protocol has been previously described , 21. As The primary outcomes were cryopreserved oocytes or embryos and cumulative numbers of these parameters. Secondary outcomes were the total number of retrieved oocytes and the number of mature oocytes. Other parameters such as distribution by diagnosis, changes in annual treatment pattern, and usage rate of cryopreserved oocytes or embryos were also analyzed.All statistical analyses were performed using the Statistical Package for the Social Sciences version 25.0 . Continuous variables were demonstrated as median  values as indicated and categorical variables were demonstrated as \u201cn (%)\u201d in the tables.A total of 564 COS cycles of OC or EC in 416 women were performed. Of this, 357 women underwent 494 OC cycles. The median age at the time of OC in all patients was younger than 35 years , and the median AMH level was 2.17 ng/ml (range 0.01\u201325.00 ng/ml). The most common indication for OC was breast cancer , followed by ovarian endometrioma , and then by planned OC . The characteristics of the patients who underwent OC are shown in via fresh in vitro fertilization (IVF). The utilization rate of the cryopreserved oocytes was 3.1% (11 out of 357 women), and one woman resulted in a successful pregnancy and a live birth. The main reasons for not attempting to become pregnant were due to their unmarried status (205 women), and 51 women were still receiving cancer treatment. Eight women who underwent OC died due to their original malignancy (Only 41 women out of the 357 who underwent OC (11.5%) were attempting to conceive, and the other 316 women were not currently attempting (88.5%). Out of the 41 women attempting, 13 women succeeded to conceive naturally, and 2 women succeeded lignancy Table\u00a02.via fresh IVF. Ten women attempted embryo transfer (ET) using cryopreserved embryos and 6 women succeeded in pregnancy, leading to a pregnancy rate of 60% (6 out of 10 women). Out of these 6 women, 5 of them had benign ovarian cysts and one had thyroid cancer. The most common reason for not attempting to become pregnant in women who underwent EC was since they were still receiving cancer treatment (23 women). Two women who underwent EC died due to their original malignancy , followed by hematologic cancer  Table\u00a05.The present study showed the experience of FP in a single tertiary center during a relatively long period. For women facing imminent fertility decline or those who desired to postpone their childbearing plan, physicians must provide the patients appropriate counseling and FP opportunities. Furthermore, there were cumulative effects on the number of cryopreserved oocytes or embryos through repetitive COS. Hence, the repeat of COS, as long as it does not affect the treatment of the cancer or benign diseases, can lead to the optimal number of oocytes or embryos being cryopreserved.The past 11 years of FP experience of this study showed an annual increasing trend of both OC and EC being performed. Other reports have shown a similar trend of increase in FP being performed in patients with cancer and planned OC. This is likely due to the increasing attention by physicians to the women\u2019s desire of future pregnancy, after a stronger collaboration between their cancer center and fertility center , and alsNevertheless, FP in women before undergoing surgery for benign ovarian cyst has been overlooked. Even when taking care to preserve as much normal ovarian tissue as possible when performing ovarian cystectomy, it cannot be done perfectly and ovarian function decline is bound to be present after surgery and situations are worse with low basal AMH or bilateral cases . This isThe current report does not provide data regarding the rate of women who were offered FP in the first place. A report by Chung et\u00a0al.  found thOur results showed an ongoing pregnancy rate of 9.1% per embryo transfer (1 out of 11) in OC cycles and a much higher ongoing pregnancy rate of 60% per embryo transfer (6 out of 10) in EC cycles. The ongoing pregnancy rate using cryopreserved oocytes in OC cycles was relatively low in our center. An explanation for such low pregnancy rate is due to the low number of women attempting pregnancy and an even lower utilization rate (only 41 women who underwent OC and 17 women who underwent EC were attempting to conceive). As we already mentioned, the utilization rate of cryopreserved oocytes was 3.1% (11 out of 357 women) with a similar value of 4.5% in another literature , and theRegarding OTC, the total number of cases was much lower compared to EC and OC cycles, even though ASRM stated that OTC is no longer considered experimental . Only onThe limitation of the present study is the retrospective nature and that the results of this single center cannot represent the whole of South Korea. In addition, the absolute number of OTC being performed is relatively low in South Korea, and live birth after its transplantation has not yet been achieved. On the other hand, a strong advantage of this report is that it is the first to provide data regarding three FP techniques of OC, EC, and OTC. Also, studies focusing on OC prior to anticipated ovarian function decline in benign ovarian diseases are rare, which should not be overlooked, especially in patients with endometriosis when infertility is of high concern.In conclusion, centers performing FP must widen indications for OC, EC, and OTC, so that women are not deprived of a chance of pregnancy using their own gametes or embryos. We hope sharing data regarding outcomes of FP will improve awareness of both clinicians and women at risk of fertility potential decline and help identify the limits of the procedure for its further improvement in the future.Supplementary Material. Further inquiries can be directed to the corresponding author.The original contributions presented in the study are included in the article/JRL, SKK, and CSS designed and conducted the research. YJC and SBK analyzed the data. YJC and YHH wrote the article. YHH and JRL reviewed the article. All authors read and approved the final article.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "This study aims to improve the quality of English teaching in contemporary colleges and universities, so as to cultivate more English translation talents. Taking corpus, English translation, and teaching practice as the main research horizons, this study analyzes the application of master of translation and interpreting (MTI) course design, English translation, and task migration by combining the task migration algorithm under Internet of Things (IoT) with the self-built corpus, so as to realize the cultivation of translation talents and design of teaching practice. A translation corpus is constructed, a two-way interactive online course is designed, and the experimental results of the complete local migration algorithm , random migration algorithm , and greedy heuristic migration algorithm  used in English teaching practice courses are analyzed and compared. The experimental simulation results reveal that the GHM algorithm proposed in this study shows good system stability, its duration is 60% better than that of the CLM algorithm, and its system throughput is increased by 50% compared with the CLM algorithm. In addition, the maximum delay time has little effect on the system throughput. When the system time slot length is fixed at 20\u2009ms, the user migration rate of the genetic algorithm is the highest under the different total numbers of users. In addition, in view of the wide application of neural network in English translation teaching, this study establishes an English translation evaluation model based on the combination of particle swarm optimization (PSO) algorithm and neural network and compares it with the traditional neural network model in simulation experiments. The results show that the addition of PSO algorithm can effectively improve the convergence speed of artificial neural network (ANN), reduce the training time of the model, and improve the accuracy of the ANN network. Using the PSO algorithm to train the neural network, the optimal solutions of different particle swarms can be obtained, and the error is small. The PSO-ANNs model can promote the quality of English translation teaching and improve the English translation ability of the students. Therefore, applying the task transfer algorithm and PSO algorithm to the practice of English translation teaching has greatly improved the efficiency of the English classroom. To sum up, this study provides new ideas for the curriculum design of contemporary college English teaching and has reference value for the cultivation of college English translation talents. With the development of today's economic globalization, the professionalization of the ancient profession of translation is getting higher and higher. Translation services belonging to the language service industry, such as professional document translation, interpretation and conference translation, editing and typesetting, multimedia translation and production, website and software localization, and language service outsourcing, have gradually entered the business scope of translation companies. The standardization and institutionalization of translation project management, translation customer service, and translation quality monitoring are also getting higher and higher, with obvious service industry characteristics and increasingly clear professional requirements. This requires employees in this industry to have special professional qualities, abide by professional ethics, understand professional characteristics, and possess professional abilities and qualifications. Of course, they also need industry associations and other organizations to formulate industry standards and practice rules, establish access mechanisms, and carry out training. The most important teaching goal for English teaching in contemporary colleges and universities is improving the translation ability and translation cognitive ability of students . TranslaThe choice of translation theory teaching content is based on the teaching objectives of English translation theory. Only clear teaching objectives can be integrated into the classroom in actual teaching work . The maiIt is known from the current research that most of the studies of English corpus development and the master of translation and interpretation (MTI) discipline focus on one aspect rather than combining them. Therefore, the work of this study is mainly divided into two parts. The first part is the combination of task transfer algorithm under the IoT and self-built corpus. The application of curriculum design, English translation, and task transfer for the master of translation and interpretation (MTI) is analyzed, so as to realize the cultivation of translation talents and the design of teaching practice. Then, a translation corpus is constructed, and a two-way interactive online course is designed. In the second part, the PSO algorithm is combined with ANNs to establish an English translation evaluation model based on PSO-ANNs.The contribution of this study is reflected in the research of English translation teaching practice, corpus construction method, and task transfer algorithm technology. It constructs an English-Chinese/Chinese-English bilingual translation corpus and designs a two-way interactive online English translation course combined with the systematic task transfer algorithm in the MEC scenario. Compared with the completely local transfer algorithm and the random transfer algorithm, the greedy heuristic transfer algorithm proposed in this study has higher performance in English teaching practice courses. The innovation of this study can be summarized as two points. The first point is to use the IoT task migration algorithm under edge computing to study English translation theory and design teaching practice courses. The second point is to establish an English translation evaluation model based on the PSO algorithm and neural network.In recent years, the increasing frequency of international exchanges and the continuous improvement of tourism policies have promoted the sustainable and rapid development of China's tourism industry. The application of technologies such as big data, cloud computing, and the IoT has also spawned smart tourism. With the rapid progression of international tourism, the translation and translation talents have gradually become imperative . The infAs an analog corpus, the monolingual corpus is often ignored in the parallel text research . The conThe edge computing unit describes the functions and characteristics of the terminal node in the MEC system after resources encapsulation , which iEdge computing allows end devices to migrate storage and computing tasks to network edge nodes, such as base stations, wireless access points, and edge servers. While meeting the computing capability expansion requirement of the terminal device, it can effectively save the transmission link resources of the computing task between the cloud server and the terminal device. Edge computing is mainly composed of four layers of functional structure: core infrastructure, edge computing center, edge network, and edge devices.The edge server carries most of the functions of the cloud computing center in the cloud computing mode and can provide services and computing support to each edge terminal, which can lay a solid foundation for the progress of mobile computing . HoweverIn the scenario of multiuser collaboration, the edge computing task offloading network connection model is shown in The characteristics of the link system are summarized as follows. \u2460 The connection between the incoming line and the outgoing line must go through one or several interlevel connections, and this connection or connecting device is a link. \u2461 The link and the selected outgoing line are occupied at the same time. \u2462 When the lines are selected, only the links that can be connected to idle outgoing lines should be selected. This method of line selection is called conditional selection.A system link model is constructed to improve the overall throughput of the system to reduce the network load of core gateways such as cloud servers in the future big data environment. The working principle of this model is sinking the server to the edge of the network, which greatly shortens the transmission distance compared with gathering all tasks in the cloud center for processing . The nodTpt and transmission cost Tts for node ni to migrate to node nj and the credibility tfj of node nj is calculated in the following equation, which is called the matching degree Dij between the node task and service node:The weighted Euclidean distance of the calculation cost W1, W2, and W3 are the corresponding matching weights of the calculation cost Tpt, transmission cost Tts, and credibility tfj of node nj in the actual environment, respectively. According to the actual environment of the system, different values can be assigned , where vmax is the maximum speed allowed by the particle. pij represents the position of particle i on j dimension, pij \u2208\u2009, where pmax is the maximum space position that the particle is allowed to move. \u03bb is the inertia weight, used to balance global search and local search. bij represents the individual extreme value of particle i on j dimension. gij represents the global extreme value of particle i on j dimension. c1 and c2 are acceleration factors that characterize the ability of particles to self-summarize and learn from high-quality particles in the group. r1 and r2 represent random numbers between . \u03b2 is the constraint factor, which is used to control the weight of speed.In the above equation, The data collected in this study is used for research, and the translation quality in the parallel corpus must be guaranteed, so the data collector must have a certain degree of bilingual language ability in Chinese and English . The datDuring the construction of corpus, the input of a large number of corpora will inevitably lead to phenomena such as misplacement, garbled characters, and symbol errors . At thatCorpus labeling refers to the division of corpus components for further retrieval and research, which is called part-of-speech labeling. Since the corpus contains bilingual languages, there are differences in labeling methods for different languages. When the English corpus is labelled, the corpus part of speech is divided and abbreviated, and the text is annotated with a tokenizer. However, the machine labeling cannot reach 100% accuracy, so manual verification is required .When the Chinese texts in the corpus are labelled, the parts of speech should be labeled on the ICTCLAS platform firstly. Then, the corresponding rhetorical means are labelled on the corpus according to a prominent rhetorical feature in the tourism discourse. Because there is no ready-made software to complete such marking, it needs to be done manually. During manual review, the rhetorical features contained in the sentence are obtained through the study of the phonetic, vocabulary, and grammatical features of the text. Different rhetorical devices are specifically labelled with sentences as a unit. The corpus mainly adopts autonomous coding methods, such as expressing similes, expressing puns, and expressing parallelism. Although manual coding is a huge project, once these annotations are completed, they will provide evidence for us to reveal the differences in the rhetorical usage of the English and Chinese tourism texts and the differences in the aesthetic concepts behind the texts. This is of great help to comparative rhetoric and comparative aesthetics .Corpus alignment is mainly for parallel corpora of Chinese and English texts, and the main steps are sentence division and sentence coding. The Chinese in the bilingual translation corpus is divided into five wildcards in words, which are ^p, ?\u2009^p, !\u2009^p, \u201c\u2009^p\u201d, and :\u2009^p. Replacing the five wildcards with the corresponding five punctuation marks can achieve a better sentence effect. The sentence division of the English corpus only requires four wildcards . The above steps are repeated again. Finally, the text is imported into Word Smith Tool 6.0. It can view the text that has been divided by clicking the \u201cright button\u201d next to the corpus and then clicking \u201cview.\u201d The text can be saved and exported by clicking \u201cSave.\u201dMultiuser collaborative service is only one of many application scenarios of edge computing. The task migration model of migrating multiuser tasks to the same edge cloud base station is analyzed in this study. Smart classrooms, smart phones, smart glasses, smart bracelets, and other smart IoT terminals have to perform complex and quantitative computing tasks in the development of future application-oriented businesses such as smart classrooms, smart transportation, smart cities, smart homes, and smart tourism. However, the battery energy of these smart IoT devices is often very limited, which cannot meet the life and work needs of human beings well. Edge computing well embodies the characteristics of distributed computing. The calculation is performed in the local area network (LAN) without transmitting the computing data or raw data to the cloud for processing through the network. It can reduce the computing load of the terminal device and can respond to the user request quickly.T is divided into disjoint time frames firstly, and then each different frame is divided into different channels. The end users correspond to different channels, and the edge server uses the different channels to distinguish the end users, so as to realize the network link of multiple terminals and a single edge server. The MECO migration system with K as the number of end users is shown in The system model for calculating migration in this study is the time division multiple access MECO system in long-term evolution (LTE). The total migration time slot The operation process of the system in Computing migration includes five modules of application perception, perception collection, task splitting, overall scheduling, and terminal execution. The computing migration decision process involves the number of end users, edge servers, channels, and bandwidth. Moreover, it may move with the end user's location. Therefore, the bandwidth, channel gain, communication noise, and terminal transmission power of the system are considered jointly in this study to establish a migration model for edge computing in the case of multiple terminals and multiple edge service servers. The migration steps of the MEC system are shown in A mobile device is composed of a migration decision unit, a local processing unit, and a transmission unit. The mobile device migrates some computing-intensive computing tasks to the MEC server for execution through the transmission unit, so as to solve the limited computing power of the mobile terminal. The MEC server is a virtual machine device deployed at a wireless access point and installed in a small data center, which can provide powerful IT services for mobile devices.The energy consumption optimizations in multiterminal single edge service computing migration of CLM algorithm, RM algorithm, and generative algorithm are simulated to analyze the energy consumption performance of the three migration algorithms. Massively controlled experiments are performed. The simulation experiment parameters for MEC calculation migration are shown in K refers to the total number of IoT terminal users in system. T is the total migration time slot. Ck is the calculation consumption of the terminal calculation k. \u03c3 represents the variance of Gaussian white noise. B refers to the channel bandwidth. Pk refers to the transmission power of the IoT terminal. Sk is the computing power of the terminal calculation k, and ek is the energy consumption of each cycle for local calculation of terminal k.In The two-way interactive online education model is based on the first generation of online education, which increases the interactive feedback link, considers the learner's learning experience and learning effect, and emphasizes the interactive nature of learning and the use of technology to deliver education and teaching content. It also contains feedback from learners and organizes students to communicate and discuss. This education model mainly focuses on three-screen courses, massive open online courses (MOOCs), and video open courses.In addition to the test questions, assignments, and learning works contained in the traditional two-way interactive education model, the translation course design is supplemented with a new real-time barrage function. According to general functions, MTI students use the tools of the corpus, such as retrieval, clustering, collocation, vocabulary, and keyword list to analyze and translate the original text in the parallel translation corpus. Many comments may suddenly appear on the screen within a certain second and float on the screen like a horizontal version. This kind of online comment method is called \u201cbarrage\u201d by netizens. At present, barrage videos are mostly used in media fields such as movies, television, and live broadcast platforms. However, the potential value of barrage videos such as distance education and online learning has received little attention and exploration by domestic and foreign researchers. One of the major disadvantages of traditional two-way interactive online education is the inability to get real-time feedback and interaction from students. The addition of the real-time barrage function can reflect and solve problems in the learning process in a timely manner, greatly improving the learning efficiency and enhancing the participation of MTI students. Compared with other majors, MTI focuses on the active participation of students. Therefore, online teaching based on real-time barrage is very suitable for actual teaching of MTI. The teaching content is detailed and practical, which further promotes the innovation of MTI teaching. The design of the translation course is shown in The two-way interactive teaching mode in the network environment shown in A translation workshop platform suitable for students and teachers is constructed based on three self-built tourism corpora. The users of the platform are classified into teachers, students, and managers. To ensure the security of the platform, teachers and students have to log in with the teacher ID number and student ID number, and administrators have to register and authenticate according to their ID cards. At present, the functions of the platform are divided into corpus experience area, practice area, information mutual assistance area, and acceptance area. The corpus experience area is the area where platform personnel perform functions such as denoising, labeling, indexing, term extraction, and alignment and realize the real meaning of corpus-assisted translation. The practice area focuses on practical operations and is mainly divided into the role playing of project managers, translation managers, translators, project managers, proofreaders, typesetting personnel, and corpus administrators. Platform personnel can conduct actual drills according to their own needs and improve themselves during the drills. The information mutual assistance zone is relatively simple, and platform staff can share operation and translation experience as well as learning materials such as translation tools and corpus links. The acceptance area is the area where the management personnel are located. This area collects suggestions and opinions from platform personnel. In this way, the platform is continuously optimized, and the errors are corrected to further improve the operational level of translation workshops. The plan of the translation corpus is shown in The corpus stores the language materials that have actually appeared in the actual use of the language, so the example sentence database should not usually be regarded as a corpus.Corpus is the basic resource carrying language knowledge, but it is not equal to language knowledge.Real corpus needs to be processed  before it can become a useful resource.The corpus has three characteristics:Artificial neural network is usually composed of multiple neurons and multiple nodes according to the algorithm principles of PSO algorithm and neural network. Multilayer feedforward neural network model is the most widely used neural network model, which mainly includes input layer, output layer, and hidden layer. The input layer obtains the required information from the outside and then inputs the obtained information into the neural network for subsequent processing. The hidden layer implements processing, and the output layer can output the processed results to the desired location. The neural network learning ability analysis model shown in In this study, the PSO algorithm is firstly improved. The random distribution method is used to obtain inertia weights to maintain the diversity of the population and improve the search ability. At the same time, the asynchronous change strategy is used to change the value of the learning factor to strengthen the learning ability of the particles and accelerate the convergence to global optimal solution. Secondly, the improved PSO is combined with feedforward neural network algorithm. Finally, for the complex and multidimensional factors, a variety of dimensionality reduction processing methods are used to obtain the factors of the main relevant information.Then, the following equation is used to determine the number of hidden layer nodes of the neural network model:J is the number of hidden layer nodes, M is the number of output layer nodes, and N is the number of input layer nodes. According to the above equation, the relationship between the number of network training times and the number of hidden layer nodes is obtained. The optimization principle of PSO algorithm is introduced into the neural network, which enhances the global optimization capability of the algorithm. The composite algorithm uses the movement and update of particles to find the optimal solution of the neural network at the initial stage. The algorithm flow is shown below.In the above equation, (i)Data preprocessing is implemented via the normalization method, and the purpose is reducing the noise of the original data.(ii)The output value is denormalized.xi is the normalized value, zi is the denormalized value, \u03bb1 is the lower limit, \u03bb2 is the upper limit, zimax is the maximum value in the original data, and zimin is the minimum value in the original data.Determine the number of hidden nodes.Determine the hidden layers.Determine the activation function by selecting the Sigmoid function as the activation function.The second step is setting the neural network related parameters.The third step is PSO initial position and speed setting.The initial position isThe initial speed isOptimal location record is(i)Hidden output layer th) is the weighted sum of the input of the h layer. aih is the connection parameter between the i layer and the h layer. xi is the activation value of the i layer. \u03b8h is the offset of the h layer.((ii)Output layer istj) is the weighted sum of the input of the j-th layer. Yj is the output of the j-th layer.((iii)Calculate reverse difference:(iv)w and bias vector \u0394\u03b8 are calculated and updated:The weight matrix \u0394The fourth step is the network output:whj and \u03b8j represent the new weight matrix and bias vector, respectively. whj\u2032 and \u03b8j\u2032 are the original weight matrix and bias vector, respectively.In the above equation, Calculate particle fitness.Update particle position and velocity.PSO-ANNs model.The fifth step is as follows:The mobile edge computing system designed in this study is divided into three parts. The first part is the mobile device, the second part is the edge server, and the third part is the cloud server. In this work, the mobile client is used to collect data through mobile phone software and upload it to the edge server. The edge server extracts the discriminant information through the projection matrix trained by the cloud server and compares it with the relevant information to obtain the relevant results and returns it to the mobile terminal. Its related feature information will be sent to the cloud server as a new training sample. The cloud server uses the projection matrix and feature information in the training database to send it to the edge server. In this study, Alibaba Cloud is selected as the cloud server, the hierarchical discriminant analysis algorithm proposed in this study is adopted to train the projection matrix obtained in the database, and the projection matrix was applied to extract the feature information of the data in the database and send it to the edge server for identification. A large amount of identifiable data is stored in the cloud server and trained using a hierarchical discriminant analysis feature extraction algorithm, and the projection matrix and feature information of all images are obtained, which is sent to the edge server as the basis for translation recognition.Model parameter setting is to set the two input objects. Input1 is undertaken as an example. Input2 and input1 perform the same operation, and the input form of the defined data is input1\u2009=\u2009keras.layers.Input,name\u2009=\u2009'input1\u2032), which represents a 16 \u2009\u00d7\u2009 4 matrix. Then the data goes into the convolutional layer, where input1 is renamed, input1 is named Convolution1, and input2 is named Convolution2. After the operation of the convolution layer, the data will be subjected to a secondary operation in the pooling layer. After the operation of the pooling layer is completed, the data processing of the CNN part is basically completed, and then the data processed by the CNN is used as the input of the particle swarm algorithm. The ReLU function is used as the activation function.Construction of the dataset: It can be seen from the previous data acquisition and preprocessing that, to fully train the model to achieve the true prediction of the problem, the data needs to be divided into training set and test set. The training set is used for model training and model parameter determination, and the test set is used to finally test the performance of the model. In this work, the training set and test set were divided according to the ratio of 9\u2009:\u20091.This research experiment is completed under the Ubuntu 16.04 operating system. The model programming language uses Python 3.6, and the compilation environment uses software Anaconda. The training in this study is implemented based on the Keras framework. Keras is a Python-based deep learning framework built on TensorFlow 2.0, which can easily define and train almost all types of deep learning models.The experiment simulation results of the edge collaboration are illustrated in Further simplification of the data in In Figures Figures Figures 8, 2.8\u2009\u00d7\u2009108, and 6.5\u2009\u00d7\u2009108, respectively. The data shows that the third algorithm is the most degraded, followed by the first two. Figures Figures The simulation results on the relationship between the total number of migrated users and the migration rate are shown in In The comparison on performances of different migration algorithms is shown in The PSO-ANNs model is used to verify the teaching effect of English translation. First, the sample collection of students' English translation learning characteristics is completed, and then it is proceeded in two steps. The first step uses PSO algorithm to train the neural network. The second step is evaluating and testing the validity of the model. The algorithm dataset is from Tianchi Datasets of Alibaba, and 2,000 students' English translation data are taken as the dataset of the algorithm in this research. However, due to space issues, the datasets are not provided in this article. The established model evaluates the quality of English translation teaching and compares it with ANNs model. The results are shown in The training results of the algorithm are shown in In the context of the IoT based on edge computing, this study analyzes the English translation teaching practice, corpus construction methods, and task transfer algorithm technology. Combined with the system task transfer algorithm of the MEC scenario, an English-Chinese/Chinese-English bilingual translation corpus was constructed, and a two-way interactive online English translation course is designed. GHM algorithm shows better performance than CLM algorithm and RM algorithm in actual English teaching. In addition, the addition of PSO algorithm can effectively improve the convergence speed of the neural network, reduce the model training time, and improve the accuracy of the neural network. The neural network is trained by the PSO algorithm, and the optimal solutions of different particle populations are obtained. Under the same experimental conditions, the model error is 0.23 when the number of particles is 5; the model error is 0.32 when the number of particles is 10; and the error of the model is 0.05 when the number of particles is 15. The model performs best at this point. However, this study also has some shortcomings. Firstly, it only focuses on two-way interactive online English translation courses and does not discuss preclass preview and after-class maintenance. Secondly, due to the limited resources and less test data of the system, further exploration is needed in the future to supplement and improve the application of the proposed task transfer algorithm in English practice classroom research.In future research, it will discuss the application of edge computing technology in \u201cinteractive\u201d translation teaching mode. It is believed that the combination of edge computing technology and \u201cinteractive\u201d translation teaching mode can make up for some deficiencies in traditional translation teaching, which contributes to the realization of translation teaching goals."}
+{"text": "The study was conducted to evaluate the toxicological effects, functional observation battery tests, and sexual maturity of semicarbazide oral gavage administration to juvenile Sprague-Dawley rats for 70 days at 0, 15, 30, and 60\u2009mg/kg/day weaning to sexual maturity. At 60\u2009mg/kg/day, there was a delay in mean age at acquisition of balano-preputial and vaginal patency and a decrease in body weight and food consumption in males. Treatment increased reticulocyte count, aspartate aminotransferase, and alanine aminotransferase levels in both sexes and decreased hematocrit and protein in males. Increased absolute and relative liver and spleen weight in both sexes were observed. Male rats had lower thymus and testes weights, whereas female rats had lower uterine weights. Semicarbazide caused significant changes in sperm motility, sperm count, and sperm abnormality. Histopathologically, semicarbazide caused cortical hypertrophy in adrenals and increased extramedullary hematopoiesis in the spleen; hepatocellular hypertrophy, follicular epithelial hypertrophy in the thyroid, and degeneration of seminiferous tubules in the testis were observed at 60\u2009mg/kg/day when compared to control. Results suggest that 60\u2009mg/kg/day of semicarbazide can exert systemic toxicity in juvenile rats. The no observed adverse effect level (NOAEL) of semicarbazide for juvenile Sprague-Dawley rats was estimated to be 30\u2009mg/kg/day. The semicarbazide (SEM) is the raw material of semicarbazone and has been shown to possess antifungal and antibacterial activities , 2 and rIn vitro, SEM has been shown to have poor mutagenic activity, but in vivo experimental evidence is still insufficient to make a conclusion [SEM showed toxicity in the bone, cartilage, and the aorta in Wistar Hannover GALAS rats . In vitrnclusion . In suscnclusion . SEM is nclusion . Recent nclusion . Ramos enclusion  showed Snclusion .\u00b5g/kg (=25\u2009ppb) but found in higher concentrations in baby foods, possibly because of the higher ratio of the gasket area of food mass for these small pack sizes [\u00b5g/kg and 53.9\u2009\u00b1\u20093.1\u2009\u00b5g/kg, depending on the type of food within the glass jars [Semicarbazide (SEM) is a by-product of azodicarbonamide (ADC), which is found in foods sold in glass jars and bottles with metal lids sealed with plastic gaskets, according to the European Food Safety Authority . SEM is ck sizes . Differeass jars . The hazass jars . Howeverass jars . AccordiTaking into account that children can represent a subpopulation with particularly high exposure to SEM, the present study is aimed to evaluate the detailed toxicological effects, Functional Observation Battery (FOB) tests, estrous cyclicity, and sexual maturity of SEM upon oral gavage administration during the most appropriate window of exposure\u2014the juvenile period\u2014namely, from weaning to sexual maturity, in male and female SD rats. Potential target organs and/or tissues have been selected on the basis of the juvenile test on rodents and the literature data on SEM toxicity , 22, 23.SEM was purchased from Sigma\u2013Aldrich .In-house breed offspring along with dams were acclimatized on PND 18\u201321 for 5 days before the start of the treatment. The offspring were weaned on PND 21 from dams. A total of 40 male and 40 female juvenile Sprague-Dawley (SD) rats weighing 40\u201355\u2009g males and 36\u201353\u2009g females (23\u201326 days old) were divided into four groups (10 rats in each group) by body weight stratification. Twelve dams were used to get 40 male and 40 female juvenile rats. The weight variation did not exceed \u00b120% of the mean weight for each sex. The animal experiment was performed in accordance with the guideline for the care and use of laboratory animals . The Insad libitum.Two juvenile rats of the same sex per cage were housed in sterilized Polysulfone rat cages with paddy husk as bedding material. Rats were housed in a controlled environment room . Pelleted rodent feed  and purified water in polycarbonate bottles were provided SEM is a crystalline white powder stored under ambient conditions. Daily fresh SEM formulation is prepared by dissolving in Milli-Q water for dose administration.The treatment started from between PND 23 and 26 years, which covers an equivalent human age of approximately 2 years of age . SEM forThe selected male and female juvenile rats were assigned to control and treatment groups as given in Three dose levels of 15, 30, and 60\u2009mg/kg/day were selected based on the results of the in-house 14-day oral dose range finding toxicity study with SEM in juvenile SD rats and available literature , 27. In All rats were observed for clinical signs and mortalities twice a day. Detailed clinical examination was done prior to the test item administration on Day 1 for all animals and at weekly intervals. During the comprehensive clinical examination, all rats were observed for changes in the skin, fur, eyes, mucous membranes, the occurrence of secretions and excretions and autonomic activity , posture, changes in gait and response to handling, the presence of clonic or tonic movements, and stereotypies ).Ophthalmological examination was performed with an ophthalmoscope once before the start of the treatment period and at the end of treatment. Mydriasis was induced before examination using a solution of 1% Tropicamide solution.The following neurological examination was conducted during the last week (10th week) of the treatment period for all rats.All animals were observed in the home cage for posture and for the presence or absence of unusual vocalizations and convulsions.Rats were subjected to an open-field test. The rats were placed in an open-field arena with a clean absorbent paper and observed for 2\u2009min. The following behavioral parameters were scored: gait, posture, mobility score, arousal level, clonic or tonic movements, stereotypic behaviors, bizarre behavior, urination, defecation, rearing, and vocalizations .During sensory reactivity measurements, rats were observed and recorded for the following observations: approach response, touch response, click response, tail-pinch response, pupil response, and aerial righting reflex \u201331.An electronic animal activity measuring device (Columbus Instruments) was used to monitor the motor activity of rats. Each rat was placed individually within the activity cages of the instrument. The rats were monitored for 60\u2009min. During this motor activity following parameters were measured: the stereotypic time  in seconds, the ambulatory time (large ambulatory movement) in seconds, horizontal counts, and ambulatory counts .The landing foot splay was assessed using a similar procedure as published by Edwards and Parker . The heeThe grip performance of the hind and forelimbs was tested using a computerized dual gripping force measuring device (make: Orchid Scientific). Three trials were performed for each rat, i.e., three trials each for forelimbs and hindlimbs. The average of three trials for both forelimbs and hindlimbs was calculated .Individual body weights were recorded on Day 1 of treatment (prior to treatment) and approximately weekly thereafter . The food consumption was measured at weekly intervals, and the individual food consumption was calculated by using the food consumed at each measuring interval and the number of days in the intervening period to determine the food intake/day.The estrous cycle length and pattern were evaluated by vaginal smears, and the stage of the estrous cycle was recorded daily for two weeks prior to necropsy. The length of the estrous cycle was computed for all females as the period between two successive diestrus stages.The age and body weight at the vaginal opening and preputial separation was recorded .Clinical pathology was performed on all animals (Groups 1\u20134) for blood chemistry and hematology (Day 71). The animals were fasting the entire night before the blood sample. Blood samples were collected by retro-orbital sinus puncture under isoflurane anesthesia prior to terminal sacrifice. Blood was collected into K2EDTA and heparinized tubes for analysis of hematology and clinical chemistry parameters, respectively. The following hematological parameters were determined using ADVIA 2120 hematology system: Hb, RBC, WBC, Plat, Hct, MCV, MCH, MCHC, DLC, Retic, and MPV. The following clinical parameters were determined using Dimension RxL MaX Clinical Chemistry System: ALT, Alb, ALP, AST, BUN, Creat, GGT, Glu, Pi, K, Na, LDH, T. Chol, T. Pro, T. Bil, Trig, Glob, A/G, Ca, Cl.TSH and T4 were estimated by the Enzyme-Linked Immunosorbent Assay (ELISA) method  for the samples.At necropsy, the right epididymis was collected and frozen for sperm count and the right vas deferens was collected for evaluation of sperm motility and sperm morphology. Sperm motility was evaluated using SCA\u00ae  CASA  system .At terminal sacrifice, all animals (Groups 1\u20134) were euthanized by exsanguination under isoflurane anesthesia after blood collection for clinical pathology. The brain, coagulating glands with seminal vesicles, epididymides, heart, kidneys, liver, ovaries, pituitary gland, prostate, spleen, testes, thymus, thyroid and parathyroid, and uterus with the cervix were weighed. The following organs and tissues from all animals were preserved in 10% neutral buffered formalin for histopathological examination: adrenals, bone marrow smear (from femur), brain , bulbourethral gland, cecum, coagulating glands with seminal vesicles, colon, diaphragm, duodenum, femur with joint, heart, harderian glands, ileum (with Peyer's patches), jejunum, kidneys, liver, lungs, mammary glands, mandibular lymph nodes, mesenteric lymph nodes, ovaries, pancreas, pituitary gland, preputial gland, prostate, rectum, salivary glands , sciatic nerves, spleen, spinal cord , sternum with marrow, stomach, thymus, trachea, thyroid and parathyroid, uterus with the cervix, and urinary bladder. The testes and epididymides were collected in modified Davidson's fluid. The eyes were collected in Davidson's fluid.The tissues were processed for routine paraffin embedding and 4-5 micron sections using a Leica\u00ae microtome and mounted on slides, which were subsequently stained with Mayer's Hematoxylin and Eosin.p < 0.05. All results were expressed as the mean\u2009\u00b1\u2009standard deviation of the mean.Differences between groups were determined by one-way analysis of variance (ANOVA) using Statistical Package for Social Sciences  software for windows and post hoc test for intergroup using the least significant difference, followed by Dunnett's test. Significance was considered at No SEM-related clinical signs and mortality were observed in the animals throughout the experiment. However, a clinical sign of sparse hair loss at the right and left flank was observed in a female of the control group and one male rat of the high dose group was considered a spontaneous finding and not related to treatment. However, incidental slight alopecia of the head and trunk in 2/10 in 60\u2009mg/kg/day males and slight to moderate alopecia of the head and hindlimb in 1/10 in 30\u2009mg/kg/day females were considered spontaneous finding and not related to treatment.An ophthalmological examination did not reveal any eye abnormalities.No treatment-related abnormalities were observed in the home cage and open-field observations at all the treated dose levels in either sex .Automated motor activity  assessmeThere were no treatment-related significant variations observed in hindlimb foot splay and grip performance in either sex when compared to concurrent controls .A statistically significant decreased body weight was observed in male rats at 60\u2009mg/kg during treatment days 50\u201370 . HoweverFood consumption was significantly decreased  in malesThe calculated mean estrous cycle length was 4.76, 4.43, 4.58, and 4.32 days in vehicle control, 15, 30, and 60\u2009mg/kg/day doses, respectively. The mean estrous cycle length in the treated groups was not significantly different from the vehicle control group .When soft pressure is applied to the animal's prepuce, the prepuce fully retracts from the penis. The average age at acquisition of balano-preputial separation in the control, 15, 30, and 60\u2009mg/kg/day exposure groups were 45.98\u2009\u00b1\u20091.07, 46.88\u2009\u00b1\u20092.11, 47.63\u2009\u00b1\u20091.63, and 48.28\u2009\u00b1\u20091.94 days, respectively. The mean age at acquisition of balano-preputial was statistically higher in the 30 and 60\u2009mg/kg/day dose group .The noticeable split in the membranous sheath covering the vaginal orifice that causes the vaginal edges to separate is referred to as a vaginal opening. The average duration post weaning of vaginal opening (patency) in the control, 15, 30, and 60\u2009mg/kg/day exposure groups were 36.21\u2009\u00b1\u20091.26, 36.89\u2009\u00b1\u20091.13, 37.27\u2009\u00b1\u20091.2, and 39.11\u2009\u00b1\u20091.13 days, respectively. The mean age at acquisition of vaginal patency was significantly delayed by 3 days at 60\u2009mg/kg/day when compared to the vehicle control group .Body weights at the age of preputial separation and vaginal opening are shown in An increase in reticulocyte count was observed in both sexes at 60\u2009mg/kg/day.This finding was associated with increased hematopoiesis and the presence of megakaryocytes in spleen, microscopically and was not accompanied by any change in other RBC-related parameters.In males, Hct decreased at 60\u2009mg/kg/day group compared with the vehicle control group. No significant differences in other hematological parameters of the 15, 30, and 60\u2009mg/kg/day treated rats as compared with those of rats in the normal control group .Total protein level decreased in males in the 60\u2009mg/kg/day groups compared with in the control groups. AST and ALT levels were significantly increased in both the sexes at the 60\u2009mg/kg/day group .There were no test item-related changes observed in thyroid stimulating hormone (TSH) and thyroxin hormone (T4) levels in adult males and females at termination .The majority of the tissues examined showed no changes in their absolute and relative weights against body weight when compared to concurrent controls. The absolute and relative weights of the liver and spleen were significantly increased in both the sexes at the 60\u2009mg/kg/day group. However, the absolute and relative weight of the testes and thymus were significantly decreased in males, and a marginal decrease in the absolute and relative weight of uterus with cervix was decreased in females at 60\u2009mg/kg/day group Tables  and 10.Significant decreases in the values for percent progressive motile sperms and percent motile sperms were recorded in the 60\u2009mg/kg/day group. Significant decrease in the percent of normal sperms and an increased percentage of abnormal sperms such as giant heads, round heads, tailless heads, and headless tails were recorded at 60\u2009mg/kg/day dose group, compared to the vehicle control. The commonly observed abnormalities across groups were headless or tailless sperms. The values for cauda epididymis weight, number of sperms per cauda epididymis, and number of sperms per gram of cauda epididymis did not differ significantly among the control and high dose group rats .The histopathological evaluations of the selected organs did not reveal any morphological abnormalities that could be attributed to the administration of SEM to the rats. However, following microscopic changes were observed in 60\u2009mg/kg/day group animals.Increased extramedullary hematopoiesis in the spleen, cortical hypertrophy in adrenals involving zona fasciculata of adrenals in males, and both zona fasciculata and zona glomerulosa in females were observed. The lymphoid depletion in the thymus was observed. A minimal degree of centrilobular hepatocyte hypertrophy in both males and females was observed .The main objective of the present study was to comprehensively evaluate the toxicity of SEM in juvenile Sprague-Dawley rats exposed orally for 70 days from weaning to sexual maturation. Few reports have been published on the subchronic oral toxicity of SEM. However, in the present study, mild hepatotoxicity and sperm parameters were affected, which was not reported previously. The rate of mortality, general behavioral changes, and body weight are preliminary indicators of early signs of toxicity caused by various chemicals and drugs , 37. DurIn humans and animals, the hematopoietic pathway is one of the most critical targets for toxic substances and a significant indicator of physiological and pathological states . An incrSince both the liver and the kidney are needed for an organism's survival, biochemical parameters are considered an appropriate predictor for toxicity evaluation . In addiIn the developing male reproductive tract, SEM seems to exert subtle adverse effects by altering the percentage of testicular tissue programmed for spermatogenesis without affecting spermatogenesis itself . In the Increased extramedullary hematopoiesis in the spleen was correlated with increased reticulocytes count, cortical hypertrophy in adrenals this involves zona fasciculata of adrenals in males and both zona fasciculata and zona glomerulosa in females was observed. Hepatocellular hypertrophy in both sexes was observed.After neonatal age, the thymus is required for proper ovarian growth and function, and abnormal thymus function may result in delayed puberty and altered uterus weight , 45. TheTherefore, overall the results of the present study indicate that the NOAEL in juvenile rats is 30\u2009mg/kg/day for SEM oral gavage administration."}
+{"text": "Bisphenol F is a substitute material for bisphenol A and is widely used in household products as a raw material for polycarbonate resin, epoxy resin, and plastic reinforcement. It is known to be mainly used in food containers, thermal paper for receipts, and coatings for water pipes. In some countries, bisphenol F has been detected in drinking water and human urine samples. However, due to the lack of safety evaluation data on bisphenol F, it is difficult to establish appropriate guidelines for the proper use of the substance, and social anxiety is increasing accordingly. This study investigated the use, exposure route, and distribution flow of bisphenol F, a household chemical. To determine the no-observed-adverse-effect level (NOAEL) and target organ of bisphenol F after exposure, a single-dose oral toxicity, dose-range finding , repeated dose toxicity , and genotoxicity  tests were performed. The pharmacokinetic profile was also obtained. The test results are as follows: in the pharmacokinetic study, it was confirmed that single oral exposure to BPF resulted in systemic exposure; in single oral dose toxicity test, the approximate lethal dose was found to be 4000\u00a0mg/kg and confusion and convulsion was shown in the test animals; NOAEL was determined to be 2\u00a0mg/kg/day for male and 5\u00a0mg/kg/day for female, and the no-observed-effect level (NOEL) was determined to be 2\u00a0mg/kg/day for males and 1\u00a0mg/kg/day for females, and the target organ was the small intestine; genotoxicity tests confirmed that BPF does not induce genotoxicity. Bisphenol A (BPA) is a chemical substance with high strength, heat resistance, and transparency  is mainly used as an epoxy resin, and is used for food packaging, water pipes, inner coatings of cans, thermal paper receipts, inter alia, and is mainly used as a coating for water supply pipes. In Korea, BPF was detected in higher concentrations than bisphenol A in the water intake of the Han River. In Seoul, the replacement of water pipes using BPF coatings was promoted. Since then, higher BPF levels were detected in the Han River samples than in the Yeongsan River and Nakdong River samples . Therefore, our research team conducted a long-term toxicity study (90-day repeated administration toxicity test), genotoxicity, and pharmacokinetic studies on BPF to resolve concerns and avoidance of chemical products that are prevalent in society.The BPF (Lot no.: ZS20190510) was purchased from Orient Chemical Enterprise, China. The test substance displayed properties of crystal foam, with low solubility and dispersibility in polar solvents. After grinding the test material, it was sieved through a 100-mesh screen and processed into powder form. BPF in powder form is uniformly dispersed in corn oil at a 20% concentration; this was therefore, selected as the form and vehicle for the test substance. The test solution showed a change in concentration within \u00b120%, which is the acceptable range for stability when refrigerated for 7\u00a0days, and the coefficient of variation between the upper, middle, and lower layers of the low and high doses was confirmed to be within the homogeneity acceptance range of 5%.\u00ae, version 6.3, Pharsight Corporation Mountain View, CA, USA).The test was carried out after approval  of the Institutional Animal Care and Use Committee (IACUC) of Korean Conformity Laboratories (KCL). BPF was orally administered at a dose of 200\u00a0mg/kg body weight (BW), to Sprague\u2013Dawley (SD) rats. To measure the concentration of BPF in the blood, blood was collected at a certain time  after administration, and the concentration of BPF was analyzed using liquid chromatography with tandem mass spectrometry (LC/MS/MS) . Based on the analysis, changes in blood BPF concentration and pharmacokinetic parameters were calculated via noncompartmental analysis (NCA)  of the IACUC of KCL under good laboratory practice (GLP) regulation. BPF was orally administered to SD rats to investigate the toxicity symptoms and the approximate lethal dose. Test solutions were administered once each to male and female rats at doses of 640, 1600, and 4000\u00a0mg/kg, and compared with the control group treated with a vehicle control of distilled water. During the experiment, the occurrence of dead animals, general symptoms, and changes in body weight were noted; gross findings of surviving animals were observed at the end of the experiment.The test was carried out after approval  of the IACUC of KCL and following internationally recognized test guidelines  and GLP regulation. To determine the dose of the 90-day repeated oral administration, a toxicity study was performed by repeated oral administration of BPF for 4 weeks. The test group comprised SD male and female rats administered doses of 25.6, 64, 160, 400, and 1000\u00a0mg/kg/day, and their results were compared with those of the control group. Body weight changes, feed intake, eye test, urinalysis, clinical pathology , organ weight measurement, and macroscopic findings were observed at the time of postmortem.The test was carried out after approval  of the IACUC of KCL. In accordance with the OECD testing guidelines  and GLP regulation, sub-chronic oral dose toxicity of BPF was studied in male and female SD rats at doses of 2, 10, 50, and 100\u00a0mg/kg/day in male and 1, 5, 15, and 30\u00a0mg/kg/day in female rats, followed by a 28-day recovery period. All dosing groups were compared with the control group. During the study, the animals were observed for clinical signs , functional observations , weekly body weights, food/water consumption, and then subjected to an ophthalmological examination. At the end of treatment period, the blood and urine were collected for urinalysis, urine sediment analysis, hematology, blood coagulation tests, serum biochemistry, and hormone analysis. Subsequently, the animals were killed and subjected to gross pathological examination, uterus cycle analysis , and organ weight measurement. The organs were preserved for histopathological examination.Salmonella typhimurium and WP2uvrA, a tryptophan-requiring strain of Escherichia coli, were used. The test substance of the highest concentration was prepared by dissolving the test substance in dimethyl sulfoxide (DMSO), and the test substance of a low concentration was prepared by diluting it step by step in DMSO. Both the direct method and the metabolic activity method were used.To obtain basic data for confirming whether the test substance (BPF) causes carcinogenicity, a microbial reverse mutation test was conducted following internationally recognized test guidelines  and GLP regulation. In the test, the histidine-requiring strains  of To determine the concentration in the main test, a concentration determination test was conducted in a concentration group of five steps with a mixture of three with 5000\u00a0\u00b5g/plate as the highest concentration. As a result, growth inhibition was observed in all the strains using the direct method and the metabolic activation method. Compared to the negative control group, no increase in the number of reverse mutated colonies that could be judged as positive was observed. Based on the concentration determination test, the main test was conducted at the following concentrations: TA98 strain of S9 mix (\u2212)/TA1537 of S9 mix (+): 0, 7, 21, 62, 185, and 556\u00a0\u00b5g/plate.The OECD guidelines 473  informed this test. To evaluate the genotoxicity of BPF, ovarian embryonic cells (CHO-k1 cells) derived from Chinese hamsters were used. The metabolic activation method (+S9 mix) with metabolic activating enzyme system (S9) and the direct method without application (\u2212 S9 mix) was used to conduct the chromosomal abnormality test under GLP regulation.The test substance was dissolved in DMSO to prepare the test substance at the highest concentration and subsequently diluted sequentially for lower concentrations of the test substance. To determine the treatment concentration of the test substance in the main test, a cell proliferation inhibition test at concentrations of 2.29, 6.86, 20.58, 61.73, 185.19, 555.56, 1666.67, and 5000\u00a0\u00b5g/ml was performed. Three mixtures and concentrations were chosen. The concentrations in the main test were as follows: direct method : 2.29, 6.86, and 20.58\u00a0\u00b5g/ml; direct method : 20.58, 61.73, and 185.19\u00a0\u00b5g/ml; metabolism activity method : 20.58, 61.73, and 185.19\u00a0\u00b5g/ml.To evaluate the genotoxicity of BPF, a micronucleus test was performed using bone marrow cells from Institute of Cancer Research mice following internationally recognized test guidelines  and GLP regulation. The test was carried out after approval  of the IACUC of KCL. The concentration of the test solution was as follows: preliminary test: 2000\u00a0mg/kg BW/day, 1000\u00a0mg/kg BW/day, 500\u00a0mg/kg BW/day, main test: 2000\u00a0mg/kg BW/day, 1000\u00a0mg/kg BW/day, and 500\u00a0mg/kg BW/day. In the preliminary test, three males and three females per group were used. As a result of the preliminary test, symptoms such as abnormal walking were observed in the group of females and males administered the highest concentration of test substance (2000\u00a0mg/kg BW/day), but no dead animals were observed. Based on the results of the preliminary test, the main test was conducted with the highest dose concentration of 2000\u00a0mg/kg BW/day. In this test, males were used because it was determined that there was no difference in sensitivity to toxicity between males and females.p\u2009<\u20090.05. SPSS for Windows version 12.0 software  was used for analysis. Asterisks (*) indicate statistically significant differences compared with the control groups. (1) Analysis of continuous data : the statistical treatment was conducted assuming normality. The differences among the groups were examined and assumed equal variance using a standard one-way analysis of variance (ANOVA). If the test showed statistical significance, the data were analyzed by parametric multiple comparisons to compare the control group with the experimental groups. If equal variance was obtained, Duncan\u2019s test was used, and if the equal variance was not obtained, Dunnett\u2019s t-test was applied. (2) Analysis of non-continuous data : the data were converted by scale conversion and then analyzed using Chi-squared analysis.The differences among the control group and all the dosing groups were analyzed through parametric or non-parametric multiple comparison procedures, as appropriate. Differences were determined to be statistically significant at The concentration of the BPF increased rapidly 0.25\u00a0h after administration, and then decreased rapidly for 3\u00a0h thereafter. In males, BPF in blood serum vanished after 72\u00a0h, and in females, the drug remained even after 72\u00a0h. The concentration of BPF in blood over time is shown in Fig.\u00a00-72\u00a0h, Cmax, and Vd value of females were\u2009~\u20091.5, 1.3, 1.1 times higher than those of males, respectively. Cl of males was\u2009~\u20091.5 times higher than that of females. The elimination half-life was increased in females because females have a higher absorption and lower clearance rate. However, there was no difference in the volume of distribution between both sexes. Unlike other chemicals, BPF has a high vanishing half-life, which is believed to be delayed in excretion from the body. In addition, it is judged that drug loss in females is delayed compared to males because females have a higher absorption rate and a lower excretion rate due to increased elimination half-life. As a result of analyzing the difference between males and females, AUCTwo males in the 4000\u00a0mg/kg group died on the first day of administration. After treatment, symptoms such as salivation and inanimation were observed in the male and female 640\u00a0mg/kg group; salivation, inanimation, stupor , and convulsions  were observed in the male and female 640\u00a0mg/kg group; and salivation, inanimation, confusion, and convulsions were observed in the male and female 4000\u00a0mg/kg group. On the first day of treatment, contamination around the anus was observed in the male 640, 1600, and 4000\u00a0mg/kg groups and the female 4000\u00a0mg/kg group, and no specific general symptoms were observed thereafter.p\u2009<\u20090.01) on the 1st day after treatment and on the 7th day in the 4000\u00a0mg/kg group (p\u2009<\u20090.05). There was no difference in body weight on the third day after treatment, but a tendency to lose weight was observed. All animals had recovered to their normal weight by the 14th day. In females, on the 1st and 3rd days after treatment, the body weight of the 1600 and 4000\u00a0mg/kg groups decreased (p\u2009<\u20090.01), and then recovered normally  to confirm the recovery of the substance.No dead animals were observed during the test. During the administration period, salivation was observed immediately after administration of the test substance in the males dosed\u2009>\u200910\u00a0mg/kg/day and females dosed\u2009>\u200915\u00a0mg/kg/day. Considering the duration, frequency, and pattern of salivation, it tended to be a dose-dependent effect of the test substance, but it only appeared immediately after administration and not during the recovery period. This is believed to have no toxicological significance as it appears to be due to the temporary promotion of salivation.No significant differences were noted across different groups in both sexes in the main group and the recovery group.During the administration period, significant weight loss  was observed in the males receiving\u2009>\u2009200\u00a0mg/kg/day and in the females receiving\u2009>\u200930\u00a0mg/kg/day. During the recovery period, the degree of weight loss in the male 200\u00a0mg/kg/day and female 60\u00a0mg/kg/day groups slowed . Although there was some recovery of weight lost, it is considered a toxicological effect because the weight loss was\u2009>\u200910% of the control group, and a dose correlation was observed  level of the male 200\u00a0mg/kg/day and the females dosed\u2009>\u200915\u00a0mg/kg/day was higher than that of the control group. The response showed a dose dependency and, in particular, both sexes showed the same tendency in the highest dose group. The increase in PT values at the highest dosages exceeded the range of biological fluctuations  at this laboratory. The changes in PT were considered to be an effect of the test substance for two reasons: (1) fat-soluble vitamins are required for the production of coagulation factors related to PT levels. Among the histopathological findings of this study, lymphatic dilatation seems to have inhibited the absorption of fat-soluble nutrients, and (2) the PT level recovered to some extent during the recovery period without administration of the substance. The increase in APTT levels in the recovery group of females receiving 60\u00a0mg/kg/day group was not observed in the main group, so it seems that this is of no toxicological significance , high-density lipoproteins (HDL), and low-density lipoproteins levels (LDL) in the males dosed\u2009>\u200950\u00a0mg/kg/day and the CHO level in the females dosed\u2009>\u20095\u00a0mg/kg/day groups decreased. In the case of HDL, a decreasing trend was observed. It was judged a secondary effect of absorption inhibition of the test substance .The cholinesterase (ChE) levels decreased in the male 200 mg/kg/day group in the main group and the recovery group, and there was no statistical difference, but a decreasing trend was observed even at high dosages in the female group, which is considered to be a change by the test substance. However, both male and female levels were within the biological rage of the test animals , therefore, its toxicological significance is unclear  level increased, therefore, an effect of the test substance cannot be excluded. The relative weight of the right thyroid gland of the male 200\u00a0mg/kg/day group and the left thyroid gland of the female 30\u00a0mg/kg/day group was increased compared to that of the control. The incidence was unilateral, there was no difference in absolute weight, and the dose dependency was not clear, so it was considered to be a relative change due to weight loss of the test animal (about 8\u201317% decrease in fasting weight before postmortem compared to the control group). In the case of histopathological examination, no functional or morphological abnormalities of the thyroid gland were identified and recovery was demonstrated during the recovery period. Therefore, the change in the T4 level was not found to have any supporting results, therefore, it was judged that there was no toxicological significance in the hormone analysis . In the recovery group, a minimal level of lymphatic dilatation was observed in the male 200\u00a0mg/kg/day and female 60\u00a0mg/kg/day groups, and symptoms recovered Fig.\u00a0.Fig. 5LaUnder the test conditions, weight loss was observed in the males dosed\u2009>\u2009200\u00a0mg/kg/day and females dosed\u2009>\u200930\u00a0mg/kg/day. Lacteal dilatation in the small intestine was observed in the males dosed\u2009>\u200910\u00a0mg/kg/day and females dosed\u2009>\u200915\u00a0mg/kg/day. Secondary to lacteal dilatation, the CHO level decreased in the males dosed\u2009>\u200950\u00a0mg/kg/day and the females dosed over\u2009>\u20095\u00a0mg/kg/day. The PT value was prolonged in the male 200\u00a0mg/kg/day and female\u2009>\u200915\u00a0mg/kg/day groups. All the findings mentioned above showed reversibility during the recovery period in the absence of BPF Fig.\u00a0. ConsideTherefore, the NOAEL of BPF was determined as 2\u00a0mg/kg/day in males and 1\u00a0mg/kg/day in females, and the target organ was identified as the small intestine.As a result of the main test, growth inhibition of bacteria was observed in all strains in the direct and metabolic activity methods. Compared to the negative control group, no increase in the number of reverse mutated colonies (which could be judged as a positive result) was observed. As a result of the sterility confirmation test of the test substance and S9 mix, no contamination by microorganisms was observed in the positive and negative controls. The number of colonies induced was within the expected range, indicating that each test was performed properly. From these results, it was determined that BPF did not induce a reverse mutation under these test conditions.In the case of the 24-h continuous treatment group and the 18-h recovery after 6-h treatment group without metabolic activity, the frequency of abnormal intermediate phases increased significantly compared to the control group at all dosages. In the case of the metabolic activity method (6-h treatment and 18-h recovery), no statistically significant increase was observed in the frequency of abnormal metaphase in all treatment groups compared to the negative control group. In the direct method and the metabolic activity method, the frequency of ploidy and intranuclear embedding also failed to increase compared to the negative control. Consequently, BPF did not induce chromosomal abnormalities in CHO-k1 cells under these test conditions.p\u2009<\u20090.01). After administration of the test substance, no statistically significant body weight change was observed in all administration groups compared to the control. The micronucleus incidence in the control and the positive control and the proportion of polyinflammatory red blood cells among the total red blood cells were within the range of historical control data. From the above results, it is believed that BPF does not induce micronuclei in the bone marrow cells of mice under the conditions of this test.As a result of the main test, no dead animals occurred in the test substance administration groups, and abnormal walking was seen in animals receiving 2000\u00a0mg/kg/day group. The number of polyinflammatory red blood cells among the total red blood cells did not show a distinct difference, and no inhibition of the proliferation of myeloid cells was observed compared to the control group. The micronucleus induction frequency observed in 4000 polyinflammatory red blood cells per animal did not show statistically significant results compared to the control at all dosages. Meanwhile, a difference was observed in the micronucleus induction frequency of the positive control group compared to the excipient control group  were performed, BPF did not induce reversion mutation or chromosomal aberration. In the in vivo micronucleus test, it was confirmed that BPF did not induce micronuclei in the bone marrow cells of mice. The above three genotoxicity tests confirmed that BPF does not induce genotoxicity.As a result of the single oral dose toxicity test for BPF, symptoms such as confusion and convulsions were observed when administered orally in a single-dose toxicity test in rodents, and the approximate lethal dose was found to be 4000\u00a0mg/kg. As a result of a repeated oral administration toxicity test over 90-day, weight loss in the male 200\u00a0mg/kg/day and female\u2009>\u200930\u00a0mg/kg/day groups, lacteal dilatation in small intestine in the male\u2009>\u200910\u00a0mg/kg/day and female\u2009>\u200915\u00a0mg/kg/day groups, reduction of total cholesterol in males\u2009>\u200950\u00a0mg/kg/day and females\u2009>\u20095\u00a0mg/kg/day, and prolonged prothrombin time in males 200\u00a0mg/kg/day and females\u2009>\u200915\u00a0mg/kg/day were observed. All the findings mentioned above showed reversibility during the recovery period in the absence of BPF. Through the above test results, the NOAEL of BPF was determined as 2\u00a0mg/kg/day in males and 5\u00a0mg/kg/day in females, and the NOEL of BPF was determined as 2\u00a0mg/kg/day in males and 1\u00a0mg/kg/day in females. The target organ was identified as the small intestine.Lacteal dilatation in the small intestine may be associated with intestinal lymphangiectasia in humans. Intestinal lymphangiectasis is classified into idiopathic intestinal lymphangiectasia due to congenital malformation and secondary intestinal lymphangiectasia caused by lymphatic obstruction or an underlying disease that increases intra-lymphatic pressure (Vignes and Bellanger Several studies have reported estimated daily intakes through exposure scenarios of BPA including its analogs (Liao and Kannan In the recent research, BPF was detected in several mustard products containing S. alba seeds and in various plants of the orchid family (Zoller et al. Currently, BPF is being used without a suitable substitute, but a risk issue has been raised which mandates national policy intervention for its use (Eladak et al."}
+{"text": "In this talk I will describe a series of studies conducted at the Centre for the Developing Brain, King\u2019s College London, that seek to increase our understanding of why infants who are born very early (before 32 weeks\u2019 gestation) are more likely to develop socio-emotional problems when they grow up compared to infants who are born at term. As part of the Evaluation of Preterm Imaging study we carried out multimodal MRI at term in over 200 newborns and studied whether we could identify specific patterns of brain development in those infants who might develop problems with emotion regulation and general mental health as they grow-up. At the behavioural level, we found that very preterm children compared to term-born controls had more mental health problems, including anxiety and autism-spectrum behaviours. Preterm children had lower IQ, were less able to regulate their emotions and inhibit unwanted behaviours. Children\u2019s tendency to attribute negative emotions to daily events, which could lead to increased anxiety, was associated with two main neonatal brain features. These were: 1) weaker structural connectivity in a long-range white matter projection tract called the uncinate fasciculus which connects the frontal lobe with the anterior temporal lobe and 2) altered fronto-limbic functional connectivity, both of which play a critical role in several aspects of social and emotional development. These findings show that early brain changes can be used to predict children\u2019s social and emotional outcomes, hence could be used to inform preventative interventions aimed at averting and targeting emerging emotional disorders.No significant relationships."}
+{"text": "Sanghuangporus\u00a0baumii is a traditional medicinal fungus that produces pharmacological terpenoids, but natural resources are insufficient for applications, and its growth and development mechanisms are poorly understood. Combining metabolomic and transcriptomic analyses, we found four terpenoid hormones and a central gene, isopentenyl diphosphate isomerase (IDI), involved in growth and development. Additionally, an exogenous hormone test was used to further confirm the importance of the four terpenoid hormones. Finally, hormone content determination and qRT\u2212PCR were performed to explore the growth and development mechanism; we found thatcis-zeatin (CZ) plays a major role in the mycelia stage, trans-zeatin (TZ) and gibberellin A4 (GA4) are important in the primordia stage, GA4 is crucial for the fruiting bodies stage, and abscisic acid (ABA) may be a marker of maturity. The IDI gene was also found to affectterpenoid hormone content by regulating the relative gene transcript levels, thereby controlling morphological changes in S. baumii. Our results revealthe growth and development mechanisms of S. baumii and may promote the breeding and utilisation of high-quality varieties. Sanghuangporus baumii (Pil\u00e1t) L.W. Zhou & Y.C. Dai is a precious fungus with medicinal effects, including improving immunity, a hypoglycemic effect and anticancer and antitumour activities . Th. ThCYP53IDI gene expression level were observed in Myc, followed by Pri and Fru. Furthermore, we revealed a correlation and linkage between TZ and CYP5340A71 and CYP5340A72 gene expression levels in different developmental stages. Similarly, the highest ABA product abundance and the highest ABA4 gene expression levels were observed in Fru, followed by Priand Myc. Our results are in agreement with those of previous studies [Metabolome and transcriptome analyses have become common technical means to explore the underlying molecular mechanisms of fungal metabolic biosynthesis ,30, and  studies ,30, showS. baumii. We compared the differences in terpenoid hormone contents and related gene transcript levels between IT and WT S. baumii and found that overexpression ofthe IDI gene does not increase the contents of all terpenoid hormones, mainly due to competition among hormones and tissue-specific expression [S. baumii CZ, TZ and GA4 levels and transcription of related genes were decreased in Myc and Pri stages, presumably due to increased triterpenoids accumulation caused by high-level expression of triterpenoid biosynthetic genes (Analysis of the underlying mechanism revealed the regulation of growth and development of pression ,35. IT Sic genes . When thic genes . This alic genes B. This pS. baumii are affected by terpenoid hormones, althoughit is unknown whether expressing all terpenoid hormone synthesis genes at the same time can accelerate the whole growth and development stage. Therefore, in future studies, we plan to use the gene coexpression method to study the growth and development of S. baumii [S. baumii.Studies have shown that the growth and development of . baumii  in an at. baumii ,35. The IDI. Subsequently, we measured the transcript levels of terpenoid genes and the content of terpenoid hormones. Analysis of the underlying mechanism revealed that the IDI gene repressed the transcription of TRIT1, CYP5340A71, CYP5340A72 and GGPS genes by increasing the transcript levels of SQS and LS genes, and this consequently decreased the accumulation of CZ, TZ and GA4, which slowed growth in the Myc and Pri stages. The IDI gene increased transcription of the GGPS gene by attenuating the transcriptional activity of SQS and LS genes, resulting in increased GA4 content and accelerated growth in the Fru stage. Specifically, CZ played a major role in the Myc stage, TZ and GA4 functioned in the Pri stage and GA4 influenced the Fru stage. ABA may be a marker of maturity in S. baumii. These findings provide important guidance for molecular breeding of S. baumii.Metabolomics and transcriptomics approaches were applied to identify four terpenoid hormones and the associated key biosynthesis gene,"}
+{"text": "The RMS roughness is about 0.5 nm. The FWHM of (002) XRD rocking curve is 230 arcsec and the FWHM of (102) XRD rocking curve is 260 arcsec. As result, a hole concentration of 5 \u00d7 1018 cm\u22123 and a resistivity of 1.5 \u2126\u00b7cm have been obtained. The hole concentration increases due to the incorporation of surface accumulated Mg dopants into suitable Ga substitutional sites with minimal formation of compensatory defects.Metal modulation epitaxy (MME) is a technique in which metal beams  are switched on and off in short periods in an RF MBE system while a continuous nitrogen plasma beam is kept on. We systematically studied the effect of periodic duty cycling on the morphology, crystalline quality, Mg doping concentration, and electrical properties of GaN:Mg films grown by MME. When the metal shutter duty cycling is 20 s open/10 s close, the sample has smooth surface with clear steps even with Mg doping concentration higher than 1 \u00d7 10 In fi20 cm\u22123 ,10. As a20 cm\u22123 , co-dopi20 cm\u22123 , superla20 cm\u22123  and dopi20 cm\u22123 . HoweverMetal-modulated epitaxy (MME) technology has been reported to greatly increase hole concentration in GaN. MME is a technique in which metal beams  are switched on and off in short periods in an RF MBE system, while a continuous nitrogen plasma beam is kept on . We firsIn metal modulation epitaxy, there are three parameters that can be changed to affect the crystal quality of the sample, namely, the fluxes of the metal source, the opening time of the metal source shutter and the closing time of the metal source shutter. According to my literature survey, the previous studies changed one or two of these parameters. In this article, I have studied the influence of three parameters on GaN:Mg films. The effect of periodic duty cyclings on GaN:Mg films  is systematically investigated in this work, and GaN:Mg films with smooth morphology, high crystalline quality and high hole concentration are obtained.\u221210 Torr. The templates were cleaned using a dilute hydrochloric acid solution in a ratio of 1:3, and then using ultrasonically cleaned with acetone, isopropanol, deionized water in sequence for 10 min each time, and dried with nitrogen before being loaded into a preconditioning chamber. Templates were first degassed in the preconditioning chamber at 200 \u00b0C for 60 min, followed by degassing in the growth chamber at 650 \u00b0C for 30 min. For all films, nitrogen was supplied by a RF plasma source with the power of 330 W and N2 flow of 1.5 sccm. Ga was supplied by a standard effusion cell, and Mg was supplied by the Veeco corrosive valve cracker. During growth, the BEP of Ga was 6.8 \u00d7 10\u22128 Torr. An 80 nm thick GaN buffer layer was first grown on templates by regular growth. Then GaN:Mg films were grown at 760 \u2103 with the same Ga and Mg flux, but the periodic duty cyclings (open/close) was varied. The total opening time of metal source shutter was 7200 s.All GaN:Mg films were grown by MME in a GEN 20A MBE system on n-type MOCVD-grown GaN templates, with a chamber pressure of approximately 1 \u00d7 10A Veeco Dimension 3100 Atomic Force Microscope (AFM) was used to observe the surface morphology of GaN: Mg samples in tapping mode. The electrical characteristics of the films at room temperature, such as hole concentration and mobility, were determined by a Hall effect measurement device. The samples were cut into small pieces of 1 cm\u00d71 cm, using indium dots as contact electrodes, and the current-voltage curve of each sample was linear to ensure that the contact was ohmic. Mg concentration was detected by secondary ion mass spectrometry (SIMS) measurements. With a high-resolution XRD instrument, the crystalline quality of the films was evaluated by the full width at half maximum (FWHM) of the symmetric (002) and asymmetric (102) diffraction patterns of the rocking curves.5 cm\u22122, which is determined by optical microscopy. Longer metal source shutter opening times means higher III/V ratio on average over one cycle, resulting in smoother surfaces, which is consistent with the theoretical considerations reported by Zywietz et al. [The metal source shutter closing time was kept constant of 5 s, and the metal source shutter opening time was 5 s, 10 s, 15 s and 20 s, respectively, which are recorded as A1, A2, A3 and A4. z et al. . The incThe metal source shutter opening time was kept constant of 10 s, the metal source shutter closing time was 2.5 s, 5 s, 10 s and 20 s, and the samples are marked as B1, B2, B3 and B4, respectively. As can be seen in We chose four different shutter duty cycles, with duty cycling (open/close) of 6s/3 s, 10 s/5 s, 20 s/10 s, 40 s/20 s, but the total metal source shutter opening time was kept at 7200 s. The samples were denoted as C1, C2, C3, and C4 respectively. As shown in 20 cm\u22123, 1 \u00d7 1020 cm\u22123, 6 \u00d7 1019 cm\u22123, and 1 \u00d7 1018 cm\u22123, respectively, which can be seen from 18 cm\u22123 and 1.4 \u00d7 1018 cm\u22123, respectively. As there are too many compensation defects in A1, although the Mg doping concentration of sample A1 is the highest, it appears as n-type probably due to the compensatory defects. Due to the excessive metal droplets on the A4 surface, the incorporation of Mg into the lattice is inhibited under too Ga-rich conditions. The doping concentration of Mg on the surface is only 1 \u00d7 1018 cm\u22123, and the generated holes are too few to offset the influence of intrinsic defects, so it appears n-type in the Hall test.According to the SIMS measurement, the Mg doping concentrations of the four samples A1, A2, A3, and A4 are 2.5 \u00d7 1017 cm\u22123, 1 \u00d7 1020 cm\u22123, 2 \u00d7 1020 cm\u22123, and 1.8 \u00d7 1020 cm\u22123, respectively. However, only sample B2 appears as p-type, and the hole concentration is 2 \u00d7 1018 cm\u22123. The other three samples appear as n-type GaN. As the metal source shutter closing time becomes longer, the overall average III/V ratio in the period decreases, and the Mg doping concentration generally increases. The excessively long shutter closing time for sample B4 results into slightly reduced Mg concentration compared to sample B3 probably due to aggravated Mg desorption. Thus, B1 appears as n-type mainly because Mg concentration is too low, and B3 and B4 are attributed to high density compensatory defects.According to the SIMS measurement, as shown in 19 cm\u22123, 1 \u00d7 1020 cm\u22123, 1.2 \u00d7 1020 cm\u22123, and 1.2 \u00d7 1020 cm\u22123, respectively. Except for C1, the Mg doping concentration is about the same. This is because the III/V ratios of the latter three samples remain the same. C1 may be due to the fact that the metal source shutter closing time is too short. Therefore, Ga and Mg atoms do not have enough time to diffuse and migrate on the growth surface, and find a suitable lattice position for incorporation, so the Mg doping concentrations is reduced.The results of SIMS measurements shown in 18 cm\u22123 is obtained; for comparison, the highest hole concentration of typical p-GaN in the world is 1\u20132 \u00d7 1018 cm\u22123, which is a great progress. However, hole mobility is relatively low, about 2 cm2/V\u00b7S. This is probably due to the high doping concentration of Mg, which forms a lot of point defects and extended defects, causing serious ionized impurity scattering. A low resistivity of 1.5 \u2126\u00b7cm is obtained by optimizing the metal source shutter opening time. Since Mg doping concentrations are almost the same for the other three samples, the increase in hole concentration is mainly due to the incorporation of surface accumulated Mg dopants into suitable Ga substitutional sites, while the formation of compensatory defects (N vacancies and extended defects) is minimal.8 cm\u22122 and 3.86 \u00d7 108 cm\u22122, respectively. The sample C3 shows the lowest edge defect density and the least defect compensation, which is consistent with the highest hole concentration obtained by the Hall test.We measured the X-ray diffraction rocking curve of these three groups of samples and obtained full width at half maximum (FWHM) of (002) plane and (102) plane, as shown in \u22128 Torr, nitrogen was supplied by a RF plasma source with the power of 330 W and N2 flow of 1.5 sccm, the substrate temperature is 760 \u2103, the metal shutter duty cycling is 20 s open/10 s close, and the sample has a high Mg doping concentration of over than 1 \u00d7 1020 cm\u22123 with a smooth surface. The RMS roughness is about 0.5 nm. The FWHM of (002) XRD rocking curve is 230 arcsec and the FWHM of (102) XRD rocking curve is 260 arcsec. As a result, a hole concentration of 5 \u00d7 1018 cm\u22123, corresponding Mg activation rate of 4.2%, and a resistivity of 1.5 \u2126\u00b7cm have been obtained, which is important to develop optoelectronic device such as laser. The hole concentration increases due to the incorporation of surface accumulated Mg dopants into suitable Ga substitutional sites with minimal formation of compensatory defects.In summary, we systematically studied the effect of the periodic duty cycling on the surface morphology, crystal quality, Mg doping concentration, and electrical properties of Mg-doped GaN films grown by MME technique. It was found that when the BEP of Ga was 6.8 \u00d7 10"}
+{"text": "The literature was searched on the PubMed and Web of Science databases. The search terms used were \u201cOTOPLAN\u201d, \u201ccochlear planning software\u201d \u201cthree-dimensional imaging\u201d, \u201c3D segmentation\u201d, and \u201ccochlear implant\u201d combined into different queries. This strategy yielded 52 publications, and a total of 31 studies were included. The review of the literature revealed that OTOPLAN is a useful tool for otologists and audiologists as it improves preoperative surgical planning both in adults and in children, guides the intraoperative procedure and allows postoperative evaluation of the CI.The cochlear implant (CI) is a widely accepted option in patients with severe to profound hearing loss receiving limited benefit from traditional hearing aids. CI surgery uses a default setting for frequency allocation aiming to reproduce tonotopicity, thus mimicking the normal cochlea. One emerging instrument that may substantially help the surgeon before, during, and after the surgery is a surgical planning software product developed in collaboration by CASCINATION AG  and MED-EL (Innsbruck Austria). The aim of this narrative review is to present an overview of the main features of this otological planning software, called OTOPLAN Conventional acoustic hearing aids become less effective for individuals affected by severe to profound sensorineural hearing loss. For a subset of this population, the emergence of cochlear implants (CIs) has offered an alternative therapeutic option .A CI translates acoustic signals into electrical impulses that are then conveyed to the organ of Corti in the cochlea. The regular cochlea has a tonotopic map that conducts characteristic frequencies (CFs) to precise locations along the basilar membrane (BM).CFs correspond to the frequency at which the cochlear BM expresses the highest sensitivity with the lowest sensation sound level .The arrangement of frequencies across space is known as cochlear tonotopy. Nerve fibers extend from the BM to the spiral ganglion, which is situated nearer to the central axis of the cochlear spiral and houses the cell bodies of neurons .To achieve the optimal functional outcome for CI patients, it is expected that tonotopic stimulation should be as precise as possible, meaning that the CI electrodes stimulate in accordance with their postoperative tonotopic positions .The variation in post-surgical speech perception can be affected by the patient\u2019s own physiologic features such as severity of deafness, age at CI surgery, etiology of hearing loss, degree of residual hearing, and several other preimplantation cognitive factors ,6. WhileCurrently, standard CI surgery uses a default setting for frequency allocation that aims to replicate tonotopicity, thus mimicking the normal cochlea. In the CI, electrode arrays are surgically placed within the cochlea to directly activate nerve fibers through electrical signals, circumventing the impaired sensory cells and mechanoelectrical transduction process . This prThe frequency-to-place matching of the CI electrode connection is usually based on the Greenwood function . This teElectrode arrays come in several different designs that influence the allocation of the CI electrodes within the cochlea ; when usWhen pre-set frequency programming is applied, differences in the type of implant, CDL, and degree of insertion may cause discrepancies between the CF of the cochlea and the frequency that the electrode presents to that part of the cochlea, leading to an allocation mismatch.  To solveAt this stage, it became necessary to implement a system that could facilitate a personalized examination of the patient\u2019s anatomy before the scheduled surgery, rather than relying on a standard approach to guide the surgical preparations for CI.\u00ae, allows three-dimensional handling that can be used preoperatively by the otologist to study the cochlear anatomy and visualize the electrode insertion depth prior to surgery, and to choose the best electrode array for that patient; postoperatively, it can be applied to check frequency allocation, and the proper CI position.One emerging instrument that may help the surgeon before, during, and after the surgery is an otological planning software product created in cooperation by CASCINATION AG  and MED-EL (Innsbruck Austria) . This sy\u00ae otological planning software and its different uses and to discuss the advantages and disadvantages of its use in CI surgery.The aim of this narrative review is to describe the main features of the OTOPLANThe literature was searched on the PubMed and Web of Science databases in May 2023. No time limitations were applied. The search terms were \u201cOTOPLAN\u201d, \u201ccochlear planning software\u201d \u201cthree-dimensional imaging\u201d, \u201c3D segmentation\u201d, and \u201ccochlear implant\u201d combined into the following query: \u2018cochlear planning software\u2019 * AND [(\u2018cochlear implant*\u2019 OR \u2018cochlear implant surgery*\u2019 OR \u2018otosurgery\u2019) AND ]. Papers published until the date of the review that contained this query in the title or the abstract were selected. We limited our search to publications indexed as articles, proceedings or reviews available in the English language.\u00ae system but used alternative software; and 8 articles that focused on robotic surgery for CI with or without OTOPLAN\u00ae. Finally, a total of 31 studies were included, among which 15 focused on adults only and 13 focused on children or mixed populations of adults and children, whereas 3 did not provide information on the age of the patients. This strategy yielded 52 publications. We excluded 4 articles that were focused not on CI but on other types of middle ear implants or bone-conduction implants; 5 articles that did not use the OTOPLAN\u00ae as a tool for preoperative surgical planning and postoperative electrode placement analysis and anatomy-based fitting in CI surgery.This review included several studies addressing the use of OTOPLANOTOPLAN, a standalone software tool, enables the generation of 3D reconstructions from digital imaging and communications in medicine (DICOM) images, offering a multifaceted approach to cochlear parameter calculation and visualization. This software not only facilitates the visualization of postoperative electrode positions but also ensures individualized matching and provides a comprehensive patient report, alongside a detailed postoperative analysis .When exploring cochlear metrics with OTOPLAN, several values are assessed, each providing unique insights into cochlear dimensions. The A-value represents the diameter, defined as the maximum distance from the round window to the lateral wall of the basal turn, passing through the modiolus. Meanwhile, the B-value illustrates the width of the cochlea, measured perpendicularly to the A-value line at the modiolus. Additionally, the H-value indicates the height of the cochlea, quantifying the space between the center of the basal turn and the apex point. These metrics are visually represented in OTOPLAN adeptly localizes the modiolus, round window, and cochlear boundaries to calculate the CDL at the organ of Corti level, utilizing the elliptic\u2013circular approximation (ECA) method . HistoriGiven that cochlear dimensions can fluctuate significantly, ranging from 19.71 to 45.6 mm and potentially varying by 30% to 40% ,28, it iThe capability of OTOPLAN in determining both the angular insertion depth (AID) of the CI  and the Accurate cochlear dimension estimates assist surgeons in selecting the most apt electrode array, ensuring an optimal length for each specific patient. This precision proves particularly insightful in instances of inner ear malformations and during the postoperative activation phase, where the frequency map can be utilized to enhance frequency reallocation.Designed to be compatible with both CT and MRI scans, OTOPLAN has demonstrated a minimal impact of CT slice thickness on CDL measurement . FurtherThe dimensions and form of the cochlea influence CI electrode placement and cochlear coverage, affecting final pitch discrimination ,24. The Utilizing CT imaging and 3D reconstruction, OTOPLAN has been applied in various research contexts to explore ear anatomy . The sofThe research indicates no difference in the A-value measured via DICOM and OTOPLAN, affirming its applicability for pediatric patients. Furthermore, a notable correlation exists between cochlear parameters  and the CDL, with a combination of the A-value and B-value providing a precise CDL estimation. Additionally, men generally present higher cochlear parameters than women, with CDL measurements being comparable to those obtained through the use of alternative techniques ,31,38.While OTOPLAN\u2019s reliability in estimating cochlear parameters has been acknowledged, concerns about its accuracy in malformed ears have been raised . The sofOTOPLAN\u2019s measurements of cochlear parameters in children were used in 3D segmentation software to measure the vestibular aqueduct (VAD) volume. A strong correlation was found between OTOPLAN measurements and VAD volumes, enabling the development of a system to calculate both CT inner ear volume and VAD volumes, particularly in subjects with an enlarged vestibular aqueduct requiring CI surgery. Gender-based differences in inner ear anatomy were also confirmed, and gender and VAD width at the midpoint were identified as significant predictors of the risk of gushing .Measuring the height of the scala tympani is challenging due to the limited resolution of clinical CT scans. OTOPLAN facilitates the generation of personalized, oblique cochlear views using available CT images .Research using OTOPLAN to explore the relationship between mastoid thickness and growth from 6 months to 20 years revealed a logarithmic growth in mastoid thickness that plateaus at 20 years. This information can assist otosurgeons in determining the required drilling depth in the mastoid and potentially inform improvements in CI design to minimize excess electrode lead length .\u00ae software. The evaluation noted excellent inter-rater reliability, a high agreement of outcomes, and a reduction in execution time using the automatic method [A retrospective evaluation compared cochlear parameters measured manually by two expert otosurgeons with those automatically obtained using a development version of the OTOPLANc method .The pivotal role of OTOPLAN in CI surgery is illuminated through its utility in assisting surgeons in devising a strategic surgical approach, foreseeing potential intraoperative complications, and choosing an electrode array that harmonizes with the specific cochlear anatomy. A variety of research has explored these aspects, investigating diverse methodologies for segmenting temporal bone surgical anatomy for patient-specific virtual reality simulation. Automated segmentation algorithms have emerged as a flexible and viable approach, particularly useful in managing cases with abnormal anatomy .A notable concern in CI surgery is intraoperative complications, which can lead to endoluminal fibrosis and round window ossification. Ensuring complete array insertion is crucial, not only to secure an optimal tonotopic match but also to stimulate the apex of the cochlea, which is vital for speech understanding and music perception, and where mismatch is notably pronounced .Moreover, OTOPLAN has proven effective in instances of severely advanced otosclerosis, including those with cochlear ossification and anatomical abnormalities, as well as in cases with a normally shaped cochlea, where conventional DICOM viewers were insufficient in providing necessary information. Particularly, OTOPLAN has demonstrated its worth in challenging cases of severely advanced otosclerosis, with comparative studies revealing that patients who underwent CI surgery with OTOPLAN evaluation exhibited slightly better outcomes and encountered no instances of incomplete array insertion, as opposed to a historical group where surgical planning was conducted using CT images ,46,47.Effective surgical planning, which enables the surgeon to sidestep critical issues during CI surgery, should be accomplished using the least invasive approach. Utilizing OTOPLAN-reconstructed imaging provides insightful analysis of the optimal surgical trajectory line through the retro-facial recess towards the round window and also enables the measurement and classification of the size of the facial recess, comparing the retro-facial approach to the standard facial recess approach .Accuracy in estimating the CDL is augmented by three-dimensional reconstructions, which scrutinize the entire 3D structure of the cochlea and are not subject to viewing angle effects, thereby representing the most precise technique for CDL estimation .Choosing the correct electrode array length is another crucial aspect in CI surgery, given the array of electrodes available, which vary in length and structure. OTOPLAN has been utilized to measure the CDL and estimate the frequency allocation map, assisting in selecting the most fitting electrode array . In pediOTOPLAN has also been validated in determining the postoperative AID, CDL, and cochlear place frequency with a lateral-wall array ,52. AID Furthermore, it has been suggested that the customized placement of slim modiolar electrodes, based on CDL measurements using OTOPLAN, can result in improved modiolar proximity . A shortEnsuring a complication-free cochlear implant procedure involves a meticulous preoperative assessment, which aims to facilitate atraumatic insertion and address individual anatomical variations. Nonetheless, achieving optimal audiological outcomes can be intricate due to patient-specific factors, unpredictable comorbidities, and potential surgical complications .The complexity of cochlear differences is well-established. Even when the cochlear morphology seems normal on CT scans, surgical challenges, such as partial insertion due to a smaller cochlea or injury to the lamina spiralis, can arise because traditional CT scans may not be sufficiently sensitive to identify certain issues .In the postoperative phase, the use of OTOPLAN allows surgeons to visualize the electrode insertion status from postoperative CT scans, enabling the application of an anatomy-based fitting map. This map, utilizing patient-specific data, aims to provide a fitting that closely aligns with natural tonotopic perception, considering critical parameters like the calculated tonotopic frequency of each electrode contact, determined by its angular location .In a comparative analysis of two insertion techniques using OTOPLAN, no differences were found in electrode array position or position in the scala tympani, regardless of whether insertion was through the round window or through anteroinferior cochleostomy in the transcanal Veria technique . AnotherInvestigations into the impact of existing frequency-to-place mismatch on speech perception in noise have indicated that a smaller mismatch correlates with improved speech perception in noise after 6 months. However, it has been acknowledged that additional research is needed to explore tonotopic fitting strategies based on postoperative CT images, revealing precise electrode contact positions ,61.Analyzing a postoperative CT using otological planning software allows for creating an anatomy-based frequency map, aiming to reallocate electrode array frequency and minimize mismatch. A comparison between anatomy-based and default frequency allocations revealed significant differences, seemingly related to cochlear coverage .A recent study investigated the impact of frequency reallocation based on an anatomical frequency map on speech perception and observed an improvement in speech perception, particularly in the parameters of Speech Recognition Threshold and Speech Awareness Threshold, following the reallocation .OTOPLAN software serves as a preoperative tool for surgeons, assisting in the selection of a more specific electrode array to optimize speech perception and facilitate postoperative anatomy-based fitting. A consensus regarding its utility in automatic cochlear measurements (CDL and frequency mapping) of A-, B-, and H-values has been noted, enabling a more personalized approach to cochlear implant (CI) surgery ,38.Leveraging automated tools and 3D visualization, the system enables quicker and more precise measurements compared to manual methods using the conventional DICOM viewer. This enhancement in measuring cochlear parameters and automatically calculating the CDL could potentially streamline clinical workflows and provide otosurgeons with greater autonomy. The precision of software-based cochlear reconstructions, even for malformed inner ears, has been substantiated, with no device-related complications reported in the existing literature .However, a few aspects of OTOPLAN deserve comment. Firstly, it necessitates that surgeons, audiologists, and radiologists become acquainted with the procedure, implicating a learning curve and potential variability in measurements due to differing training experiences . The latThe latest OTOPLAN version also introduces the capability to merge CT and MRI images, enhancing preoperative evaluation. Furthermore, integrating OTOPLAN with intraoperative electrophysiologic testing could potentially mitigate misplacement and establish correlations with postoperative acoustic hearing, presenting an additional benefit.A review of the existing literature underscores the utility of OTOPLAN for otologists and audiologists, enhancing preoperative surgical planning for both adults and children by providing detailed anatomical information, guiding intraoperative procedures, and facilitating postoperative evaluation of cochlear implantation. Notably, the system enables automatic CDL calculation, frequency mapping using A and B diameter measurements, and assistance in electrode selection. In postoperative stages, OTOPLAN provides a visualization of the electrode insertion status through postoperative CT scans, allowing audiologists to utilize an anatomy-based fitting map. This map uses patient-specific data to closely approximate natural tonotopic perception. However, additional research is warranted to refine the accuracy of CDL estimation, which is crucial for a thorough evaluation of pitch match and cochlear coverage in residual hearing."}
+{"text": "Evidence for use of second-line immunosuppressants for immune-related adverse events (irAEs) is inadequate. Therefore, a multicenter analysis should assess the efficacy of second-line immunosuppressants for severe irAEs associated with different malignant diseases.This descriptive study aims to investigate the effects of second-line immunosuppressants on corticosteroid-refractory irAEs in patients with lung cancer. We analyzed the effects of second-line immunosuppressants on underlying lung cancer and associated adverse effects.p\u2009<\u20090.005). The median progression-free survival and duration of response of underlying lung cancer from second-line immunosuppressant administration were 2.1 and 3.0\u00a0months, respectively. Of the patients with irAE, 27.4% developed infections and 5.5% might die due to infection.Our study included 4589 patients who had received immune checkpoint inhibitor treatment, with 73 patients (1.6%) developing irAEs requiring second-line immunosuppressants. The most commonly observed irAE was pneumonitis (26 patients), followed by hepatobiliary disorders (15 patients) and enteritis (14 patients). We found a confirmed response rate of 42.3% for pneumonitis, which was lower than the response rates of 86.7% for hepatobiliary disorders and 92.9% for enteritis. The time from the start of corticosteroid therapy to the addition of a second-line immunosuppressant correlated significantly with the resolution of irAE to Grade 1 (correlation coefficients of r\u2009=\u20090.701, Second-line immunosuppressant response was confirmed in 72.2% of irAEs in patients with lung cancer, with lower response rates observed in irAE pneumonitis compared to other irAEs.The online version contains supplementary material available at 10.1007/s00262-023-03528-x. Immune checkpoint inhibitors (ICIs), including anti-PD-1/PD-L1 and anti-CTLA-4 antibodies, have become the standard of care for lung cancer. ICIs are used for systemic therapy in advanced disease , consoliFor moderate to severe irAEs, corticosteroids are typically used as a first-line treatment. In cases of severe irAEs not controlled by corticosteroids alone, the addition of second-line immunosuppressants, such as infliximab or mycophenolate mofetil, may be considered. These second-line immunosuppressants are expected to increase immunosuppression and resolve severe irAEs. However, evidence supporting the use of second-line immunosuppressants for irAE management has been insufficient despite clinical guideline recommendations , 9. MostIn this study, we conducted a multicenter retrospective analysis of second-line immunosuppressants for irAEs in patients with lung cancer. We analyzed the effect of second-line immunosuppressants and their adverse effect on the underlying disease.We conducted a multicenter retrospective analysis in the TOPGAN group, a Japanese lung cancer research group (TOPGAN 2022-01), with the primary objective of clarifying the effect of second-line immunosuppressants for corticosteroid-refractory irAEs. We defined steroid refractoriness as irAEs that were not controlled by steroids alone. In such cases, second-line immunosuppressants were also administered. Second-line immunosuppressants were also used to taper steroid after irAEs were under control. We collected data on patients with lung cancer who had received ICI treatment until July 2022 and had developed irAEs and received second-line immunosuppressants in addition to corticosteroids. Patient data collected included patient characteristics , type of irAE, effect of second-line immunosuppressants, and clinical course after second-line immunosuppressant administration. Second-line immunosuppressants analyzed in this study were azathioprine, cyclophosphamide, cyclosporine, infliximab, intravenous immunoglobulin, mycophenolate mofetil, tacrolimus, and tocilizumab. This study was approved by the institutional review board of the Cancer Institute Hospital of the Japanese Foundation for Cancer Research (IRB no. 2022-GB-065), and informed consent was waived because of the retrospective nature of the study, with an opt-out option included.Two outcomes were evaluated in this study: (1) Responses to second-line immunosuppressants determined by each investigator using patient medical records and (2) The resolution of irAEs to CTCAE grade 1 (G1) within 90\u00a0days of second-line immunosuppressant initiation. The clinical course of the underlying lung cancer was evaluated by measuring progression-free survival (PFS) and duration of response (DOR) from the initiation of second-line immunosuppressant administration. Tumor response was evaluated based on the RECIST v1.1 criteria. Incidence of infections following second-line immunosuppressant administration was also analyzed.p\u2009<\u20090.05. Data analysis was performed using R and SPSS Statistics for Windows version 24.Categorical variables were compared using Fisher\u2019s exact test, and continuous data were compared using the Mann\u2013Whitney U test. The strength of the relationship between two sets of data was determined using Spearman\u2019s rank correlation coefficient. The Kaplan\u2013Meier method was used to estimate the median survival time. Statistical significance was set at Overall, 73 of 4589 patients who received ICI treatment 1.6%) developed irAEs requiring second-line immunosuppressant administration. Of the 358 patients who received combination immunotherapy with nivolumab and ipilimumab, 17 (4.7%) developed irAEs requiring second-line immunosuppressants. The frequency of patients requiring second-line immunosuppressants varied by institution, ranging from 0 to 3.2% . The most common irAE was pneumonitis (n\u2009=\u200926), followed by hepatobiliary disorders (n\u2009=\u200915) and enteritis (n\u2009=\u200914). Infliximab was the most frequently used immunosuppressant (n\u2009=\u200919), followed by cyclophosphamide (n\u2009=\u200915) and mycophenolate mofetil (n\u2009=\u200914). Of the 72 cases evaluated, 52 patients (72.2%) responded to the second-line immunosuppressants. Response rates of second-line immunosuppressants in each irAE are shown in Fig.\u00a0Among the patients with pneumonitis, 34.6% (9/26) had a history of thoracic irradiation . The median time between radiation completion and pneumonitis onset was 95 \u00a0days. Responsiveness to second-line immunosuppressants was confirmed in 44.4% (4/9) of cases. This was not substantially different from the 41.2% (7/17) response rate seen in those who had not undergone irradiation. The types of pneumonitis and number of cases among our patients were organizing pneumonia (OP) in 11 cases, nonspecific interstitial pneumonia (NSIP) in five cases, hypersensitivity pneumonia (HP) in one case, diffuse alveolar damage (DAD) in eight cases, and OP plus DAD in one case. The response rates to second-line immunosuppressants for each type were OP, 63.6% (7/11); NSIP, 60.0% (3/5); HP, 100% (1/1); DAD, 0% (0/8); and OP\u2009+\u2009DAD, 0% (0/1).p\u2009=\u20090.148). In the 34 patients whose irAE resolved to G1 after second-line immunosuppressant addition, there was a significant correlation between the time from the start of corticosteroid administration to immunosuppressant addition and irAE resolution to G1 .  of second-line immunosuppressants in irAE pneumonitis in patients with lung cancer . Other rGuidelines for managing irAEs recommend considering the addition of a second-line immunosuppressant 3\u20134\u00a0days after starting corticosteroid therapy . A retroThe previous clinical trials have reported that patients with lung cancer who discontinued treatment due to severe irAEs tend to have a longer DOR than others . HoweverThe evidence supporting the recommendation of second-line immunosuppressants has been relatively insufficient, relying mainly on retrospective studies from single centers and expert opinions. As shown in this multicenter study, irAE management with second-line immunosuppressants is not always sufficient to resolve all irAEs, particularly pneumonitis, and adverse effects on underlying lung cancer are a concern. Therefore, it is crucial to accumulate further evidence on the use of second-line immunosuppressants in each malignant disease, including this study.There are some limitations to this study. First, as this is a case series, we were unable to compare second-line immunosuppressants with other treatments. Second, due to the retrospective nature of this study, some biases in treatment selection and effects could not be avoided despite conducting multicenter trials to minimize these biases.The response rate of second-line immunosuppressants was confirmed in 72.2% of irAEs in patients with lung cancer. However, the response rate was lower in irAE pneumonitis compared to other irAEs.Supplementary file1 (DOCX 62 KB)Below is the link to the electronic supplementary material."}
+{"text": "TM; (i) the Modified Bouchard Activity Record; (j) the Rett Syndrome Behavioral Questionnaire; and (k) the Rett Syndrome Fear of Movement Scale. The authors recommend that service providers consider evaluation tools validated for RTT for evaluation and monitoring to guide their clinical recommendations and management. In this article, the authors suggest factors that should be considered when using these evaluation tools to assist in interpreting scores.Rett syndrome (RTT) is a complex neurodevelopmental X-linked disorder associated with severe functional impairments and multiple comorbidities. There is wide variation in the clinical presentation, and because of its unique characteristics, several evaluation tools of clinical severity, behavior, and functional motor abilities have been proposed specifically for it. This opinion paper aims to present up-to date evaluation tools which have specifically been adapted for individuals with RTT often used by the authors in their clinical and research practice and to provide the reader with essential considerations and suggestions regarding their use. Due to the rarity of Rett syndrome, we found it important to present these scales in order to improve and professionalize their clinical work. The current article will review the following evaluation tools: (a) the Rett Assessment Rating Scale; (b) the Rett Syndrome Gross Motor Scale; (c) the Rett Syndrome Functional Scale; (d) the Functional Mobility Scale\u2014Rett Syndrome; (e) the Two-Minute Walking Test modified for Rett syndrome; (f) the Rett Syndrome Hand Function Scale; (g) the StepWatch Activity Monitor; (h) the activPAL MECP2 coding for methyl CpG-binding protein 2 [Rett syndrome (RTT) is a neurodevelopmental disorder occurring in one of every 10,000 live female births in the US [rotein 2 .Many aspects of the clinical condition are linked to a specific genetic alteration. For instance, mutations such as p.Arg270*, p.Arg255*, and p.Arg168* tend to be associated with more severe symptoms, while mutations such as p.Arg133Cys, p.Arg294*, and C-terminal deletions tend to be associated with milder symptoms [It is a necessity that formal and informal assessments are conducted regularly by caregivers, parents, teachers, and healthcare professionals to suggest and assess clinical care and day-to-day management. Both assessment types inform the design of intervention strategies that are most suited to the goals set for each individual. Approaches that are suitable for RTT need to be considered. For example, the movement skills of many individuals with RTT are affected by apraxia. Despite the existence of many evaluation tools for apraxia conditions , the uniIdentify the evaluation goal\u2014The assessor should have a clear idea regarding the objective of the evaluation and should choose the most appropriate and related evaluation tool. For instance, an evaluation tool that provides a picture of the individual\u2019s skills at a specific time could be adequate for monitoring a person\u2019s improvement (or worsening) but could be insufficient for identifying emergent skills. When the goal of the evaluation is to recognize the impact of an intervention, the assessor should decide which tool to use after identifying the intervention program and goals.Familiar vs. unfamiliar situations\u2014Individuals with RTT may not respond well to new situations and new people . TherefoTiming of assessment\u2014Individuals with RTT have times during the day when they function better ,11. If pEvaluation organization\u2014When the evaluation begins, it should proceed from the tasks that are easier for the girl to those more challenging that require more active effort. In this way, the girl will experience success and will then be more able to tackle complex tasks.Communication\u2014The assessor should remember to talk to the girl throughout the evaluation meeting, modulating their voice to strengthen the relationship, observing carefully, and providing instructions and feedback. Communication should be supported by sufficient non-verbal elements  and augmentative communication tools usually used by the girl, is so far as possible, and caregivers.Ambiance\u2014The assessor should make sure that there is a generally relaxed atmosphere before and during the assessment.Use natural situations\u2014The person may show better abilities in certain natural situations compared to their abilities during an official examination. Therefore, whenever possible, the assessor should observe the person performing a task in situations in which they are used to doing it .Adjust the assessment according to the person\u2019s need\u2014Individuals with RTT may have variable functioning at different times of the day or on different days . TherefoAssess the musculoskeletal condition\u2014The degree of muscular shortening, articular contractures, and muscular tone abnormalities may negatively affect the individual\u2019s functional ability .Before evaluating a person with RTT, it is crucial to consider the following points:Clinical severity assessment: the Rett Assessment Rating Scale (RARS);Assessment of gross motor abilities: the Rett Syndrome Gross Motor Scale (RSGMS), the Rett Syndrome Functional Scale (ReFuS), the Functional Mobility Scale\u2014Rett Syndrome (FMS-RS), and the Two-Minute Walking Test (2MWT) modified for RTT;Manual function assessment: the Rett Syndrome Hand Function Scale (RSHFS);Assessment of physical activity level: the Stepwatch Activity Monitor\u2122 (SAM), the activPAL\u2122, and the Modified Bouchard Activity Record (M-BAR);Behavioral assessment: Rett Syndrome Behavioral Questionnaire (RSBQ);Fear of movement assessment: the Rett Syndrome Fear of Movement Scale (RSFMS).With these considerations in mind, the current opinion paper presents the evaluation tools mostly used by the authors in their clinical and research practice with individuals with RTT and provides essential considerations and suggestions regarding their best use. The current paper\u2019s authors believe that the information provided here could help to construct an evidence-informed short- and long-term evaluation and intervention plan when working with this population. All presented scales were developed or validated to be used with people with RTT and include tools for:Information related to each evaluation tool\u2019s structure, function, and certain psychometric properties are reported in This questionnaire was developed to assess the severity of the disorder in individuals with RTT by parents or caregivers. The tool has been used in previous studies ,35,36,37The tool was adapted from the Gross Motor Function Measure ,48 to beThis scale was developed to detect the functional ability of girls with RTT before, during, or after an intensive motor intervention. The tool is based on independent performance only. The scale is extremely sensitive to small changes, so it is suitable when the intervention period is short. In carrying out an evaluation with this tool, the task execution times without any assistance are measured. Verbal encouragement is possible, and the presentation of favorable individuals (parents/care providers) and motivational factors are recommended (it is important to list and maintain the same conditions in each test) but avoiding physical contact is required. Each item\u2019s score ranges from 0\u201312 points, so the score in the tool can range from 0 to 372 points. A higher score corresponds to better functional ability. Typical scores of young individuals with RTT who can walk ranged from 130\u2013220 (before intensive intervention) and 200\u2013320 (after intensive intervention) were found . The firThe Functional Mobility Scale (FMS) assesses the functional mobility of children with cerebral palsy and movement disorders ,53. It eThe 2MWT is a functional walking test developed as an alternative to the Six-Minute Walk Test. This test has traditionally been used for individuals who have experienced a stroke or have motor and neurological impairments ,56,57. RThe loss of manual function is typical for individuals with RTT during the initial period of the disorder, and the RSHFS is a valuable tool to score the person\u2019s level of hand functioning. The RSHFS protocol was developed based on the Hand Apraxia Scale, a 10-item measure of manual functioning . The hanStep counters and pedometers are objective, inexpensive, valid, reliable, and relatively easy-to-use measures of physical activity commonly used within the normative population . MoreoveThe activPAL\u2122 device uses a uniaxial accelerometer and inclinometer to determine step count and the time spent in lying down/sitting as well as standing and walking (uptime) positions. The device is attached to the person\u2019s thigh using adhesive pads and provides data measuring the thigh inclination and acceleration . In a rep < 0.001) and less time standing (1 h vs. 2 h 15 min\u2014p = 0.04) than those who walked independently. The M-BAR was validated with 43 individuals with RTT  to evaluate the \u201cuptime\u201d in this population [The BAR is a whole-day diary card in which every 15 min of the day a number can be assigned between one and nine to represent either sedentary behavior or a particular level of physical activity intensity . When vapulation . Moreovepulation  demonstrpulation .Some behavioral features have been associated with RTT ,76. AlthOne of the behavioral characteristics reported in girls with RTT is fear of movement (FOM) . The conThe current opinion paper is focused on evaluation tools dedicated to motor function due to the authors\u2019 experience in this field. Although the existing evaluation tools allow for the assessment of several aspects of RTT, a few of these remain unexplored to their full extent. For instance, objectively scoring this population\u2019s reaching ability is needed. As discussed above, every evaluation tool presents advantages and disadvantages and could be adequate for one specific aim but not another. Therefore, future research projects should focus on completing validation processes for each scale mentioned above. Furthermore, there are physiological measures that have been used in the general population, such as heart rate and respiration measurements, using technological gadgets. The possibility of using such devices for individuals with RTT has been questioned in previous research projects . The valAs individuals with RTT present functional diversity in different areas, validated tools are recommended to assess their abilities as a group as well as before, during, and after treatments. The current article has presented evaluation tools built, modified, and validated specifically for individuals with RTT. These evaluation tools stand alone or can be used together to enable a comprehensive and appropriate assessment of an individual\u2019s function according to a specific research protocol or an intervention program. The proposed evaluation tools cover the evaluation of RTT severity level (RARS), level of gross motor skills (RSGMS), independently performable motor skills (ReFuS), global mobility (FMS and 2MWT), purposeful manual functioning (RSHFS), physical activity , and fear of movement (RSFMS). The authors hope that by presenting the evaluation tools described above, better therapeutic assessments will be implemented by clinicians working with individuals with RTT, enabling finer therapeutic goal setting and better outcome evaluation during clinical interventions and research procedures. Moreover, the authors suggested options for the future development of evaluation tools for RTT and some futuristic research directions."}
+{"text": "Septic pulmonary embolism is a rare disease in children. We aimed to assess the clinical, microbiological, and radiological characteristics and outcomes of pediatric septic pulmonary embolism (SPE) and to identify any predictive factors for in-hospital mortality in patients with this unusual disease to enhance prognosis and treatment.A retrospective study to search the electronic medical records of children admitted to the pediatric pulmonology unit, Tanta University hospital with the diagnosis of SPE between January 2015 and June 2022.Seventeen pediatric patients were identified; ten males and seven females with a mean age of 9.4\u2009\u00b1\u20095.2 years. The most common presenting complaints were fever and shortness of breath (n\u2009=\u200917) followed by chest pain (n\u2009=\u20099), pallor (n\u2009=\u20095), limb swelling (n\u2009=\u20094), and back pain (n\u2009=\u20091). Methicillin-resistant Staphylococcus aureus (MRSA) was the most common causative pathogen in nine patients. The most common extra-pulmonary septic foci were septic arthritis in five patients (29.4%), septic thrombophlebitis in four patients (23.5%), and infective endocarditis in two patients (11.8%). All patients exhibited wedge-shaped peripheral lesions and feeding vessel sign in CT chest, whereas bilateral diffuse lesions, nodular lesions, and cavitation were present in 94.1% of patients, pleural effusion was identified in 58.8% of patients, and pneumothorax was detected in 41.2% of patients. Fifteen patients improved and survived (88.2%), while two patients died (11.8%).Early diagnosis of SPE with vigorous early therapy is critical for a better outcome, including appropriate antibiotics and timely surgical interference to eradicate extra-pulmonary septic foci. Septic pulmonary embolism (SPE) is a rare life-threatening disease in children, in which infected emboli from an extra-pulmonary septic focus reach the lung through the vascular system . SPE preThe most common microbiological organisms isolated in SPE are gram-positive cocci, including methicillin-susceptible Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, and Klebsiella. However, few case reports have been published showing that SPE is caused by Fusobacterium, Pseudomonas aeruginosa, Acinetobacter, and fungal infections .The diagnosis of SPE requires a high index of clinical suspicion and the documentation of specific radiological signs..The chesRecently, with the era of the COVID-19 pandemic, the incidence of pulmonary embolism has increased. Autopsy studies in adults have identified large-vessel pulmonary artery thrombosis and/or embolism, small vessel pulmonary artery thrombosis, and deep vein thrombosis in the lower extremities and other sites .Early diagnosis and management are crucial to improving the outcome of the patients. However, diagnosis of SPE remains difficult for clinicians because of its vague clinical manifestations and non-specific radiological findings. This work aimed to assess the clinical, microbiological, and radiological characteristics, and outcomes of SPE in children to facilitate early recognition, diagnosis, and treatment of this serious condition as well as to identify any predictive factors for in-hospital mortality in patients with this unusual disease to enhance prognosis and treatment.In this retrospective study, we searched medical records of children admitted to the pediatric pulmonology unit, Tanta University Hospital between the electronic January 2015 and June 2022 to identify cases of SPE. We could not obtain written informed consent from the patients\u2019 guardians due to the retrospective nature of the study. The study was approved by the ethics committee of the Faculty of Medicine, Tanta University.Inclusion criteria were age\u2009<\u200918 years and diagnosis of SPE. SPE was diagnosed according to Cook et al. criteria which include the following: CT chest scans showing diffuse nodular opacities or multifocal lung infiltrates compatible with septic embolism to the lung; the presence of a primary source of infection as a potential embolic source, exclusion of other causes of lung infiltrates, clinical and radiographic improvement after antibiotic therapy .Exclusion criteria were malignancy, tuberculosis, non-septic pulmonary embolism, and interstitial lung diseases.Using computer-based research, we identified thirteen children with SPE between January 2015 and June 2022 at the pediatric pulmonology unit, of Tanta University Hospital. We searched the medical records of the patients and the following data were extracted: age, sex, presenting symptoms, physical signs, the primary septic focus, duration of hospital stay, laboratory results, microbiological culture, radiological and echocardiographic findings, treatment received, and the outcome.CT pulmonary angiography scans were evaluated for the presence of unilateral or bilateral lesions, peripheral pulmonary nodules, wedge-shaped lesions, feeding vessel signs, pulmonary consolidations, cavitations, pleural effusion, pneumothorax, and mediastinal lymphadenopathy. The outcome of the patients was based on survival or death.Data were collected, revised, and edited into a master table using Microsoft Excel 2013. Data were then revised, coded, and entered into the statistical package for social science (SPSS) version 23. Categorical data were presented as numbers and percentages, while quantitative data with normal distribution were presented as mean and standard deviation. To identify predictors of in-hospital mortality, logistic regression was used. The Hosmer Lemeshow test was used as a goodness-of-fit test to assess the fit of logistic regression models. P\u2009<\u20090.05 was considered statistically significant.Seventeen pediatric patients were identified, ten male and seven female patients with a mean age of 9.4\u2009\u00b1\u20095.2 years range 1\u201316 years). Table\u00a0(\u201316 yearsMethicillin-resistant Staphylococcus aureus (MRSA) was the most common causative pathogen 52.9%), followed by Methicillin-sensitive Staphylococcus aureus infection (MSSA) (29.4%), Klebsiella pneumoniae (5.9%), and no growth was detected in two patients (11.8%). Cultures of blood, sputum, pleural fluid, pericardial fluid, soft tissue, and bronchoalveolar lavage were performed for the patients as described in Table\u00a0 was observed in (41.2%) of patients, right side cardiac vegetations were found in 3 patients , and five patients had dilatation of the right side of the heart , and the other six patients had a normal duplex scan.Abdominal ultrasound was performed on 15 patients. Abnormalities were identified in ten patients; four patients had hepatomegaly (23.5%), three patients had hepatosplenomegaly (17.6%), and three patients had bilateral nephropathy (17.6%).Six patients (35.3%) required joint ultrasound; three patients had left hip joint effusion, two patients had left knee effusion and one patient had left elbow effusion with surrounding edematous subcutaneous tissue.Table\u00a0 summarizLaboratory findings of the 17 patients with SPE were summarized in Table\u00a0. PolymerSince the oxygen saturation in ambient air ranged from 50 to 97%, all seventeen patients got antibiotic medication along with oxygen delivered either through nasal prongs or facemasks, while seven patients required intercostal chest tube insertion either for pleural effusion or pneumothorax. Patients 2 and 6 required repeated chest tube insertion due to recurrent pneumothorax caused by repeated ruptured pneumatoceles. Patients 16 and 17 required lung decortication surgery.Patient 2 required local drainage of hip joint arthritis twice due to recollection of pus in the hip joint, while patient 3 needed local drainage of the hip joint with pericardiocentesis and pericardial tube insertion for 24\u00a0h. Patient 7 was arranged for cardiac surgery but unfortunately passed away suddenly from cardiac arrest mostly due to a flail pulmonary valve from large mobile vegetation. Patient 8 required frequent hemodialysis due to underlying end-stage renal disease. Patients 9, 15, and 16 needed local drainage of the affected joint while patient 10 required surgical removal of vegetations on the tricuspid valve with valve replacement. Patients 11 and 12 needed intravenous steroids with immunosuppressive therapy for underlying Systemic Lupus Erythematosus. Patient 17 required surgical drainage of a soft tissue abscess.Twelve patients out of the 17 patients required pediatric intensive care unit (PICU) admission but none of them needed mechanical ventilation support. Anticoagulant therapy is controversial in the treatment of septic pulmonary embolism because of the theoretical risk of bleeding in the area of infected embolus and the lack of benefits. Twelve of our patients received anticoagulants in the form of low molecular-weight heparin (Enoxaparin). Regarding the outcome, fifteen patients survived without significant complications, while two patients died; one mostly due to large mobile pulmonary vegetation and the other one due to Covid-19 infection.The rate of in-hospital mortality in our study was 11.8%. To determine the predictor factors, logistic regression and univariate analysis of laboratory parameters were done as shown in Table\u00a0.SPE is a rare, serious complication of an infection in children that is difficult to diagnose partly due to non-specific presenting symptoms and partly due to the difficulty of identifying the primary source of infection. The process of septic pulmonary emboli starts with an extrapulmonary source of infection which leads to the extravasation of the pathogens, mostly bacteria into the systemic blood circulation. Once the organism reaches the bloodstream, it produces toxins and inflammatory mediators which results in thrombosis. The presence of a thrombus serves as a nidus for the proliferation and metastatic spread of the organism to the pulmonary circulation , 11.In the present study, the most common presenting symptoms are fever, shortness of breath, chest pain, pallor, and limb swelling. Moreover, the most common pathogens were MRSA and other Staphylococcus aureus and these results agree with the results described before in previous literature , 13.In a large cohort study done in China by Jiang J et al. on adult patients with SPE, they reported that skin and soft tissue infection (30.6%) was the most common foci of primary infection, followed by infective endocarditis 20.4%). This appears to be consistent with the causes of SPE in children. Wong et al. described in their study on pediatric patients that the commonest causes of septic PE were soft tissue and bone infections and they recommended that if the source is not clinically evident, a bone scan may identify a focus. In the present study, we emphasize the importance of septic arthritis and septic thrombophlebitis as the most common septic foci of infection 0.4%. Thi.Interestingly, none of our patients seem to have Lemierre syndrome despite its known association with septic pulmonary embolism either as an explicit diagnosis or as suggested by jugular vein thrombosis of Fusobacterium that is contradictory to the results of other studies performed on adults , 15, 16.Additionally, Lemierre syndrome may be underestimated in the literature due to the fact that the diagnosis is often not posed without the evidence of Fusobacterium . SimilarLastly, we cannot exclude that our sample did not include patients with primary signs of neck or pharyngeal infection but no initial suspicion of lung involvement, possibly causing cases of Lemierre syndrome to be underrepresented in our case series.Typical radiographic features of SPE in CT chest include peripheral wedge-shaped densities of varying sizes that end with a feeding vessel sign. Other pulmonary findings include nodular lesions, cavitation, pleural effusion, pneumothorax, and sometimes reactive mediastinal lymphadenopathy. All these findings were present in our study. Lee et al. reported that peripheral nodules were the most common lesions (89.0%), while cavitation and feeding vessel sign was identified only in 10.4% and 6% of all the lesions respectively .The most frequently prescribed antibiotics in our patients were vancomycin 82.4%), followed by linezolid and meropenem (41.2%). These results are in agreement with the results by Lin et al. and Wong et al. who found that vancomycin was the most effective antibiotic in their patients. In previous literature, some case reports used linezolid in the treatment of SPE in children with good results .4%, foll\u201322.The mortality rate for SPE in the present study was 11.8% (2 patients), while the survival rate was 88.2% (15 patients). The probable causes for mortality include large mobile pulmonary vegetation with a flail valve and the other one who died from severe Covid-19 infection. In Wong et al. study on 10 pediatric patients, there was no death and this may be attributed to their septic foci were non-cardiac lesions including soft tissue infections, bone infections, suppurative otitis media, and one patient with a catheter-related infection.In a previous study done by Yusuf et al., the prognostic factors associated with an SPE high mortality rate in adult patients included low-level oxygen saturation and altered mental status. Oh et al. described the risk factors for mortality in adult patients with SPE were tachypnea and segmental or lobar consolidation on computed tomography. In the current study, the risk factor for mortality was Covid-19 infection which was incompatible with the previous studies that assessed the in-hospital mortality for SPE patients , 24.Our study had several limitations. First, it is a retrospective single-center study which reduced the ability to find significant associations between variables. Second, we were unable to identify significant predictors of mortality due to the small sample size which is attributed to the rarity of the disease in children. Despite these limitations, our study provides valuable data to identify the clinical, radiological, and microbiologic characteristics of children with SPE.The present study confirms the findings of previous studies as regards the clinical presentation of SPE in children , the clinical applicability of the typical radiologic features , and the potentially unfavorable prognosis. The primary sources of septic pulmonary emboli in children and the causative organisms may vary depending on the selected population and the ward of hospitalization. Appropriate antibiotic therapy, respiratory support, and early surgical intervention are essential for the treatment of patients with SPE."
\ No newline at end of file