diff --git "a/deduped/dedup_0657.jsonl" "b/deduped/dedup_0657.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0657.jsonl"
@@ -0,0 +1,64 @@
+{"text": "With billions of cells in the adult human body, all replicating and dividing in an environment laden with toxins, radiation, and free radicals, a certain amount of DNA damage is guaranteed to occur. Fortunately, all organisms have built-in checkpoints throughout the cell cycle that prevent such mistakes from propagating. At the G1 checkpoint during cell division, for example, molecules survey nuclear DNA for errors and breaks before the cell is deemed fit to undergo S phase, the DNA replication stage. If damage is found, enzymes either work to repair it or, in some cases, trigger programmed cell death, or apoptosis. But when checkpoints fail, and DNA damage is left unrepaired, disease such as cancer can result. A better understanding of these events, as provided, for example, by Vincenzo Costanzo and colleagues in this issue, will consequently lead to a better understanding of the mechanisms that give rise to cancer.A serious form of DNA damage, called a double strand break (DSB), cuts the helix clean through\u2014a far worse scenario than if just one strand slips free. In response to a DSB, the cell recruits a signaling protein called ATM and a three-protein complex called MRN, whose components selectively bind to broken DNA ends. A malfunction of this signal and repair pathway is dire. People who suffer from the genetic disease ataxia-telangiectasia (A-T) lack a functioning ATM molecule and therefore cannot properly handle DSBs or successfully navigate the G1 checkpoint. This condition leads to a host of problems, including abnormal chromosomes, deficient immune function, and a predisposition to cancer. A-T-like disease (ATLD), another rare genetic condition, has very similar symptoms. The only difference is that the protein missing is Mre11, a subunit of MRN. While recent work on the cellular level has indicated that MRN activates ATM, the biochemical relationship between these proteins has yet to be fully understood.Studying these two molecules using traditional biochemical assays is difficult because knocking out the activity of these proteins is lethal to many cells. Costanzo and colleagues used a novel test system of cell-free frog extracts and found that Mre11 is necessary for both ATM activation and for the formation of large protein\u2013DNA complexes apparently responsible for triggering the cascade of signaling molecules underlying the DNA damage response at the G1 checkpoint.The frog extract system allowed the team to manipulate the presence or absence of Mre11 and accurately measure the response triggered by the addition of fragmented bits of DNA . As predicted, without a functional Mre11 protein, ATM was not activated and there was no response. By simply adding the protein Mre11 back to the mixture, the damage response was restored. But when the researchers added a mutant form of Mre11, still capable of performing its essential tasks in another stage of the cell cycle\u2014DNA replication\u2014the G1 damage response remained suppressed. This mutant form of the Mre11 protein lacks the C-terminal, or DNA-binding, end.Costanzo and colleagues also found that this DNA-binding end is required for the assembly of DNA\u2013ATM\u2013MRN complexes in the presence of fragmented DNA and seems to direct the entire damage response. This work helps to explain the similarity between patients with A-T and those with ATLD, and hints at the formation of a large \u201csignaling\u201d complex that helps to orchestrate the crucial response to DBSs in DNA."}
+{"text": "In the early 1990's, a new cell signaling pathway was described. This new paradigm, now known as the JAK/STAT pathway, has been extensively investigated in immune-type cells in response to interferons and interleukins. However, recent evidence suggests that the JAK/STAT pathway also mediates diverse cellular responses to various forms of biological stress including hypoxia/reperfusion, endotoxin, ultraviolet light, and hyperosmolarity. The current literature describing the JAK/STAT pathway's role in cellular stress responses has been reviewed herein, but it is clear that our knowledge in this area is far from complete. In multicellular organisms, every cell comprising every tissue, organ, or organ system constantly strives to maintain homeostasis in the face of destabilizing influences. Whether it is external stimuli such as toxic chemical exposure or changes in oxygen tension, or natural alterations in pH or osmolarity due to normal cellular metabolism, each cell in the body is equipped with the molecular machinery required to sense these environmental changes and respond to them. Because these stressful stimuli can impinge on normal cellular functioning, discrete cellular sensing mechanisms have evolved to maintain homeostasis. For example, ATP depletion caused by hypoxia activates AMPK which phosphorylates multiple downstream targets to switch the cell from a mainly anabolic to catabolic state . SimilarOne interesting question is how do cells translate diverse stressful stimuli into activation of specific molecular pathways? Cellular signaling from membrane to nucleus is typically accomplished through ligand/receptor activation of intracellular second messengers. In many cases these second messengers are kinases which phosphorylate substrates leading to a cascade by which successive macromolecules are triggered. Ultimately, a terminal transcription factor is activated which then translocates to the nucleus to activate specific target genes. This type of cellular signaling has been well-characterized following receptor activation by polypeptide ligands, but some forms of cellular stress such as hypoxia cause activation of specific molecular pathways in the apparent absence of ligand to receptor stimulation. Therefore, there must be alternative routes for direct activation of target genes that circumvents the canonical ligand/receptor/second messenger cascade. One such pathway that may transmit signals to the nucleus by this alternative route is the Janus Activated Kinase/Signal Transducer and Activator of Transcription family of transcription factors (JAK/STAT).The JAK/STAT pathway includes seven functionally related, latent transcription factors (STAT) and four non-receptor tyrosine kinases (JAK) [reviewed in ]. In theWhile signaling through the canonical JAK/STAT pathway has been well-characterized in immune-type cells in response to interleukins and interferons, there is emerging evidence that STATs also mediate cellular responses to various forms of cellular stress. These findings, in addition to mounting evidence suggesting that some STATs are phosphorylated on serine by members of the MAPK family, imply that alternative mechanisms for STAT activation exist. Further, these alternative means of activation may lead to different outcomes with regards to STAT signaling. For example, STAT3 was recently shown to be serine phosphorylated by JNK during UV stress which had a predominately inhibitory role on STAT3 transcriptional activity . Could tin vitro. Thus, the MAPK and STAT pathways appear to converge during periods of cellular stress. In another study, UV light caused STAT1 tyrosine phosphorylation, nuclear accumulation, and DNA binding in keratinocytes [Some of the earliest studies implicating STATs in mediating cell stress responses were performed in cells exposed to UV light. In mouse embryonic fibroblasts (MEFs), UV light treatment resulted in phosphorylation of serine 727 in STAT1 via p38 MAPK ,6. FurthCellular stress can also occur in disease states such as diabetes, which is characterized by vascular dysfunction. For example, prolonged elevated glucose can act as a cell stressor through multiple pathways including hyperosmolarity , proteinDictyostelium, hyperosmotic stress leads to STAT1 phosphorylation without any known involvement of JAK or MAPK [Hyperosmotic stress can also activate STATs. For example, in the slime mold  or MAPK . But mam or MAPK . Interes or MAPK . In thisThe most well-investigated reports linking cellular stress with the JAK/STAT pathway are studies in cardiomyocytes undergoing hypoxia/reperfusion. Like UV light, hypoxia/reperfusion led to p38 MAPK phosphorylation followed by serine 727 phosphorylation of STAT1 which was associated with activation of pro-apoptotic FAS/FASL and caspase-1 . It was In vivo models of hypoxia/reperfusion also implicate STAT5 as a player in responses to cellular stress. But unlike STAT1, STAT5 is thought to be mainly protective by activating anti-apoptotic signals. For example, Yamaura et al. report that genetic deletion of STAT6 but not the STAT5A causes resistance to myocardial ischemia/reperfusion injury [n injury . This ren injury ,26. Studn injury ,28 but in injury .Although not as well studied as hypoxia/reperfusion or osmotic stress, reactive oxygen species have also been shown to activate the JAK/STAT pathway. Oxidative stress, such as might occur in diabetes and cardiovascular disease, was shown to activate HSP70 in smooth muscle cells in a JAK-dependent manner . This reTaken together, the studies reviewed herein support a role for the JAK/STAT pathway in various forms of cellular stress and relate perturbed JAK/STAT signaling to potential disease states. However, consistent with some of the current ideas about STAT biology, it is clear that cellular stress seems to activate STATs in ways that can be both detrimental to and supportive of cell survival. For example, STAT1 activation by hypoxia-reperfusion injury activates cell death pathways, while STAT5 activation by the same type of stressor seems to promote cell survival pathways. Thus, STATs may have evolved to fulfil both sides of a \"yin and yang\" type mechanism where either death or survival pathways can be activated depending on the strength or type of cellular stressor . This maThe most intriguing aspect of many cellular stress-activated pathways is the apparent absence of ligand-to-receptor stimulation. But the cell must somehow \"sense\" changes in the external milieu and transmit these signals to the nucleus. How does it do this? Two such examples of this type of cellular sensing are activation of a well-described transcription factor known as HIF-1\u03b1 (hypoxia-inducible factor), and another is the cellular thermostat called HSF (heat shock factor). In the case of HIF, enzymatic modification by an enzyme requiring oxygen as a cofactor is responsible for HIF activation and switching on of target genes when cells are stressed by low oxygen . For HSFIs it possible that STATs can also act as a cellular rheostat of various stressors? Recent suggestions that STATs can be post-translationally modified in ways other than phosphorylation  make this a possibility . For exain vivo may prove to be of therapeutic value.Finally, while our understanding of a stress-related p38/STAT1 (pSER) pathway seems to be taking shape, very few studies have investigated the role of serine phosphorylation of other STATs and what the upstream kinase (s) may be during cellular stress. Future studies might focus on identifying whether serine phosphorylation is common to other STATs during cellular stress and how this might relate to activation or inactivation of target genes. Other questions to be answered are what is the function of unphosphorylated STAT dimers found in the nucleus of unstimulated cells and how might other STAT post-translational modifications (other than phosphorylation) mediate STAT signaling beyond the canonical JAK/STAT pathways -41. Answ"}
+{"text": "To maintain the integrity of their genetic content, cells closely monitor the state of their chromosomal DNA. Any break or pairing anomaly in the double helix is perceived as damage that must be repaired. Mechanisms that sense DNA damage enlist the help of cell cycle checkpoint proteins, which stall cell division until the damage has been repaired. The exposed ends of linear chromosomes of eukaryotic cells (cells with nuclei) resemble the double-strand breaks of damaged DNA, which should make them vulnerable to unnecessary manipulations by repair enzymes. But chromosomes have special DNA sequences at their tips, called telomeres, that are coated with telomere-binding proteins that appear to protect ends from the unwanted attentions of repair enzymes. For instance, removing a telomere-specific DNA-binding protein, called TRF2, from telomeres leads to a rapid attack on chromosome tips, associated with the activation of the DNA damage pathway. The biochemical basis for TRF2's shielding effects remains obscure.PLoS Biology, Jan Karlseder et al. propose that TRF2 is a direct inhibitor of an early mediator of the DNA damage signal. Their observations offer new insights into how telomeres resist the inappropriate interventions of the DNA repair machinery.In this issue of Ataxia telangiectasia mutated (ATM) kinase is an enzyme that induces the activation of DNA repair enzymes as well as regulators of the cell cycle and apoptosis. Its enzymatic function is triggered by DNA damage sensors. Several observations suggest an antagonism between TRF2 and ATM: ATM is activated in aging cells with shortened telomeres and participates in ushering the cell into replicative senescence.  In contrast, TRF2 overexpression protects shortened telomeres from decay and delays cell entry into senescence.Here the authors examine the effect of TRF2 overexpression in cells subjected to radiation-induced DNA damage. This treatment is expected to lead to cell cycle arrest, an outcome mediated for the most part by ATM activation. Irradiated cells that overexpress TRF2, however, continue to enter cell division. Known targets of ATM's enzymatic activity are activated to a lesser degree in these cells, which harbor only about half the amount of active ATM detected in controls. This suggests that TRF2 may interfere with the DNA damage pathway early on, when ATM is activated.Do these findings reflect a direct interaction between ATM and TRF2? Karlseder et al. suggest they might. Though only a small fraction of TRF2 associates with ATM in normal cells, ATM and TRF2 proteins can form a complex in a test tube. The region of the ATM protein that interacts with TRF2 is the very region required for ATM's activation by DNA damage sensors. The authors propose that TRF2 binds to inactive ATM, and in so doing, prevents ATM's transition to an active state.The authors integrate their results in an elegant proposal that relates a cell's health to the length of its telomeres. They have previously shown that TRF2 binds another protein called Mre11, a DNA damage sensor known to activate ATM. Thus, by inhibiting ATM, TRF2 may nip in the bud any misguided attempts by Mre11 to \u201crepair\u201d DNA breaks in telomeres. But in aging cells, whose shortened telomeres no longer retain large amounts of TRF2, ATM activation, no longer muffled, eventually allows the onset of senescence. While TRF2 is abundant in normal cells, the authors note that its strict association with telomeres should locally limit its effect on ATM, leaving the DNA damage pathway intact at other chromosomal locations."}
+{"text": "Mre11 (which causes an ataxia-telangiectasia-like disease [ATLD]) and mutations in the ataxia-telangiectasia-mutated (ATM) gene lead to defects in handling damaged DNA and to similar clinical and cellular phenotypes. Using Xenopus egg extracts, we have designed a simple assay to define the biochemistry of Mre11. MRN is required for efficient activation of the DNA damage response induced by DSBs. We isolated a high molecular weight DNA damage signaling complex that includes MRN, damaged DNA molecules, and activated ATM. Complex formation is partially dependent upon Zn2+ and requires an intact Mre11 C-terminal domain that is deleted in some ATLD patients. The ATLD truncation can still perform the role of Mre11 during replication. Our work demonstrates the role of Mre11 in assembling DNA damage signaling centers that are reminiscent of irradiation-induced foci. It also provides a molecular explanation for the similarities between ataxia-telangiectasia (A-T) and ATLD.Mre11/Rad50/Nbs1 complex (MRN) is essential to suppress the generation of double-strand breaks (DSBs) during DNA replication. MRN also plays a role in the response to DSBs created by DNA damage. Hypomorphic mutations in  A defective cellular response to double-strand breaks in DNA is associated with several cancer-predisposition diseases. Specific defects affect the formation of a large protein complex that involves several key proteins Cellular response to DNA damage requires the coordinated activation of cell cycle checkpoints with DNA repair . FailurePhosphorylation of Nbs1 by ATM is critical for S-phase checkpoint . Nbs1 foATM function is defective in patients carrying the recessive genetic disorder ataxia-telangiectasia (A-T). A-T is characterized by cerebellar degeneration, immunodeficiency, radiation sensitivity, chromosomal instability, and cancer predisposition .Mre11 and Nbs1 give rise, respectively, to an A-T-like disease (ATLD) and Nijmegen breakage syndrome (NBS) (Hypomorphic mutations in me (NBS) . The clime (NBS) . All thrme (NBS) . These sMre11 binds DNA and is both a 3\u2032-to-5\u2032 exonuclease and an endonuclease that cleaves hairpin DNA structures . Rad50 bRad50 dimer binds to two Mre11 molecules to form a stable tetrameric complex with enhanced nuclease activities . hRad50/Mre11 or Nbs1 form IRIF inefficiently. In ATLD cells, which carry a defective Mre11, ATM activation is inhibited. Furthermore, ATM fails to localize to sites of DSBs in cells lacking functional MRN . IRIF are believed to originate by chromatin modification, such as H2AX phosphorylation, at the site of the DSB, followed by the recruitment of signaling and repair factors. MRN localizes to DSBs, independently of H2AX phosphorylation, and is critical for the formation of IRIF and the consequent response to DNA damage . Thus, conal MRN . Taken tXenopus eggs recapitulate signaling pathways triggered by DNA damage and have been instrumental in unraveling the functions of ATM and Mre11  as a reporter substrate to monitor the response to DSBs. This peptide contains two putative SQ phosphorylation sites for ATM or ATR: serines 134 and 139. To test the specificity of the kinase(s) activated by DSBs, we synthesized four peptides: wild-type and alanine substitutions at serine 134 (S134A), serine 139 (S139A), and serines 134 and 139 (S134A/S139A).Addition of fragmented DNA to  pathway . We prev pathway . We now  pathway . We usedIncubation of interphase extracts for 30 min with fragmented DNA dramatically enhanced phosphorylation of H2AX peptide A. PhosphWe next monitored phosphorylation of H2AX peptide in extracts in which specific DNA damage response signaling pathways were inhibited. X-ATM- and X-ATR-neutralizing antibodies were used to abrogate ATM- and ATR-dependent signaling, respectively. We previously demonstrated that these antibodies completely inhibit ATM- and ATR-dependent checkpoints in extracts , 2003. HNbs1 or Mre11 , H2AX peptide phosphorylation became partly independent of ATM and Mre11. This phosphorylation was sensitive to vanillin, a specific inhibitor of DNA-PK , and to In contrast to its inactivity in the DSB checkpoint reaction, MRN-ATLD1/2 can fulfill the essential function of MRN in preventing the accumulation of breaks during DNA replication. These results establish that MRN is required to activate the DSB signal pathway and that the C-terminal region of Mre11 plays a critical role in this activation.32P-labeled, 1 kb linear double-strand DNA molecules and applied to a BioGel A15m column. This large-pore gel filtration resin includes most proteins and small DNA fragments, but excludes protein\u2013DNA complexes larger than 1.5 \u00d7 107 kDa . When radio-labeled DNA at the concentration of 50 ng/\u03bcl  was applied to the column in the absence of extract . Fraction 10 from the excluded volume and fraction 25 from the included volume were precipitated with PEG, and biotinylated DNA molecules were affinity-purified using streptavidin-magnetic beads. The results of this assay show clearly that 32P-DNA was associated with biotinylated DNA in fraction 10, but not in fraction 25 . ATR activation might be triggered by processing of DSBs into single-strand DNA (ssDNA) . We prevates ATR . Since Mates ATR . AlternaWe propose that MRN interacts with linear DNA to form DNA\u2013protein complexes that induce the phosphorylation cascade responsible for the G1\u2013S checkpoint. MRN assembles with linear DNA molecules in vitro . We haveWe believe that the formation of these complexes is a critical step in the kinase cascade that leads to the G1\u2013S checkpoint. Several lines of evidence support this idea: (1) Mre11-depleted extracts do not form complexes and fail to activate ATM in response to DSBs. (2) Mre11 is concentrated 18-fold in the DNA\u2013protein complexes and is heavily phosphorylated. We previously established that phosphorylation of Mre11 correlates with increased nuclease activity . (3) ATMATM, and possibly ATR, participates in the assembly of the complexes. Pretreatment of extracts with caffeine, an inhibitor of ATM and ATR, significantly reduces the yield of complex.Some H2AX kinase activity is not associated with the DNA\u2013protein complex. This activity is principally accounted for by DNA-PK.Both MRN components Mre11 and Nbs1 are phosphorylated in response to DSBs. Nbs1 phosphorylation is ATM-dependent . Once re10 breaks/\u03bcl), the ATM-dependent checkpoint does not require Mre11 function  intact Mre11 protein and, presumably, binding of Mre11 to DNA, and (2) that IRIF form independently of , but areAs shown in 2.CSF-arrested extracts were freshly prepared according to To prepare DNA fragments containing DSBs, we used pBR322 plasmid digested with restriction endonucleases to yield different types of ends . These DNA fragments behaved equivalently in our assay (data not shown). For the experiments shown in 32P-labeled fragment was obtained by addition of \u03b1-32P-dATP (10 mCi/\u03bcl) to the PCR. The biotinylated 1 kb fragment was obtained by PCR on M13 ssDNA template using a 22 nt primer complementary to position 5,570 and a 22 nt primer complementary to position 6,584, biotinylated on three thymidine residues .The 1 kb DNA fragment used for size fractionation experiments was obtained by PCR on M13 ssDNA template using 22 nt primers complementary to positions 5,570 and 6,584 . The 32P2, 1 mM DTT, 1 mM NaF, 1 mM Na3VO4, and 10 mM MnCl2) supplemented with 0.5 mg/ml histone H2AX peptide (Sigma-Genosys), 50 \u03bcM ATP, and 1 \u03bcl of \u03b3-32P-ATP, 10 mCi/\u03bcl . Samples were incubated at 30\u00b0C for 20 min, and reactions were stopped by 20 \u03bcl of 50% acetic acid and spotted on p81 phosphocellulose filter paper . Filters were air-dried and washed three times in 10% acetic acid. Radioactivity was quantified in a scintillation counter.Interphase egg extracts were incubated with DNA fragments, DNA fragments and ATM-neutralizing Ab, ATR-neutralizing antibodies or 5 mM caffeine for 30 min at 22\u00b0C. Extract (2 \u03bcl) was mixed with 20 \u03bcl of EB kinase buffer  previously equilibrated with buffer A at 4\u00b0C. Extracts were mock-depleted, Mre11-depleted, or Mre11-depleted supplemented with 500 nM MRN or with 500 nM MRN-ATLD1/2. Control extracts were treated with 500 nM MRN and 100 \u03bcM TPEN or 5 mM caffeine or 1 mg/ml proteinase K at 37\u00b0C. After the samples were loaded, 15 ml of buffer A  were gently applied to the column. We collected 31 fractions of approximately 300 \u03bcl, and radioactivity was measured in a scintillation counter. For the elution profile of the circular plasmid in control extracts, a 1.8 kb plasmid derived form pUC19 with the SspI\u2013SapI region deleted  were incubated with or without 50 ng/\u03bcl of  deleted  was used32P-labeled 1 kb DNA fragments. Samples were applied to the BioGel A15m sizing column and fractions were collected. Void volume peak fraction 10 and included volume peak fraction 25 were incubated with 50 \u03bcl of specific polyclonal antibodies against Mre11 prebound to protein A\u2013Sepharose beads or beads alone overnight at 4\u00b0C . Beads were washed with buffer A, and radioactivity was counted in a scintillation counter.We incubated 200 \u03bcl of control, Mre11-depleted, or Mre11-depleted extract supplemented with Mre11 precipitated from the extract with 50 ng/\u03bcl of 32P-labeled 1 kb DNA fragments and 50 ng/\u03bcl biotinylated 1 kb fragments for 2 h at 22\u00b0C. Samples were applied to the BioGel A15m sizing column, and fractions were collected. Void volume peak fraction 10 and included volume peak fraction 25 were incubated with kilobase-BINDER dynabeads  or mock protein A dynabeads , and DNA fragments were isolated according to the kit protocol. Biotinylated DNA fragments bound to beads were washed with buffer A, and radioactivity was counted in a scintillation counter.We incubated 200 \u03bcl of control, Mre11-depleted, or Mre11-depleted extract supplemented with 500 nM MRN with 50 ng/\u03bcl Human MRN and MRN-ATLD1/2 were purified from baculovirus-infected cells according to published protocols . The recFor X-Mre11 complex depletion, 50 \u03bcl of interphase extract was incubated with 25 \u03bcl of protein A\u2013Sepharose beads coupled with 50 \u03bcl of preimmune serum or with 50 \u03bcl of X-Mre11 antiserum for 60 min at 4\u00b0C. For Ku70/80 depletion, 50 \u03bcl of interphase extract was incubated with 25 \u03bcl of protein A\u2013Sepharose beads coupled to 50 \u03bcl of Ku antiserum  for 60 min at 4\u00b0C.TUNEL assay was performed according to Xenopus ATM, Xenopus ATR, Xenopus Mre11, phosphoserine 1,981 of human ATM , and phosphorylated ATM/ATR SQ substrates .We incubated 2 \u03bcl samples of interphase egg extracts for 30 min at 22\u00b0C with 50 ng/\u03bcl DNA fragments, DNA fragments and 5 mM caffeine, or with 50 ng/\u03bcl circular plasmid, and 2 \u03bcl samples were recovered from the BioGel A15m column and precipitated with 9% PEG see A were di"}
+{"text": "The telomeric protein TRF2 is required to prevent mammalian telomeres from activating DNA damage checkpoints. Here we show that overexpression of TRF2 affects the response of the ATM kinase to DNA damage. Overexpression of TRF2 abrogated the cell cycle arrest after ionizing radiation and diminished several other readouts of the DNA damage response, including phosphorylation of Nbs1, induction of p53, and upregulation of p53 targets. TRF2 inhibited autophosphorylation of ATM on S1981, an early step in the activation of this kinase. A region of ATM containing S1981 was found to directly interact with TRF2 in vitro, and ATM immunoprecipitates contained TRF2. We propose that TRF2 has the ability to inhibit ATM activation at telomeres. Because TRF2 is abundant at chromosome ends but not elsewhere in the nucleus, this mechanism of checkpoint control could specifically block a DNA damage response at telomeres without affecting the surveillance of chromosome internal damage. The human telomere-associated protein TRF2 inhibits ATM kinase, suggesting a mechanism by which the telomeric protein complex prevents the activation of this DNA damage response transducer Telomeres prevent the recognition of natural chromosome ends as double-stranded breaks (DSBs). When telomeres become dysfunctional due to shortening or loss of protective factors, chromosome ends activate a DNA damage response mediated (in part) by the ATM kinase . A major\u0394B\u0394M, which removes the endogenous TRF2 complex from telomeres  repeats and recruits hRap1, ERCC1/XPF, WRN, and the Mre11/Rad50/Nbs1 complex to chromosome ends . TRF2 caelomeres . Upon exigase IV . The DNAigase IV . Primaryigase IV .An important transducer of the DNA damage signal is the ATM kinase , TRF2 overexpression partially abrogated this checkpoint response, increasing the percentage of cells entering mitosis from 0.3% to 8% . The inaWe then asked whether TRF2 overexpression inhibited other ATM-dependent readouts of the DNA damage response. ATM phosphorylates and stabilizes p53 in response to DNA damage  on the ATM kinase, we determined TRF2's effect on the activation of ATM itself. Phosphorylation of ATM on S1981, an early and essential step in the activation of this kinase, can be detected rapidly after IR, even when a low level of DNA damage is induced . To testIn order to understand the mechanism by which TRF2 inhibited ATM, we determined whether they interacted in vivo. IPs of the ATM kinase from primary human IMR90 fibroblasts resulted in recovery of a small fraction (approximately 1%) of endogenous TRF2 A. This aThe nature of the association of TRF2 with ATM was explored further using in vitro pulldown experiments. GST-tagged fragments of ATM were tested for their ability to bind purified TRF2 protein expressed in a baculovirus system. In parallel, we used baculovirus-derived TRF1, which was previously shown to interact with ATM by co-IP . TRF2 boBlunting of the DNA damage response was observed when TRF2 was overexpressed throughout the nucleus. Because TRF2 is chiefly present at telomeres, the simplest interpretation is that the observed activity reflected a telomeric function. However, we also considered the possibility that TRF2 may have a heretofore clandestine role in the general DNA damage response. If this were true, TRF2 might be expected to localize to IR-induced foci (IRIF), where it would be in a position to modulate ATM. Previous data had shown that the endogenous TRF2 does not relocate from telomeres to IRIF . SimilarNatural chromosome ends require mechanisms to prevent the activation of the DNA damage response. Inhibition of the ATM kinase at human telomeres is particularly important since the telomeric complex contains the Mre11 complex, one of the DNA damage sensors of the ATM pathway . The telWe feel that the interaction of TRF2 with ATM is likely to be relevant to the mechanism by which TRF2 blocks ATM signaling. TRF2 binds ATM in a region surrounding S1981, which is functionally linked to the oligomerization state of ATM. Phosphorylation on S1981 occurs concomitant with the dissociation of ATM dimers (or oligomers), forming the monomeric, active form of the kinase . TRF2 isIn this study we have expressed TRF2 at high levels throughout the nucleus, whereas endogenous TRF2 is localized primarily to telomeres . Our estPrevious studies have shown that overexpression of TRF2 can protect critically short telomeres generated by replicative aging . TRF2 reAs TRF2 can bind ATM, it has the inherent ability to recruit this protein to telomeres. ATM has not been observed at undamaged telomeres, but its abundance may be too low for detection. The idea that ATM could be recruited to telomeres by TRF2 is interesting considering that ATM-like kinases are necessary for telomere maintenance in Saccharomyces cerevisiae  and Schi5 cells were seeded in 5-cm culture dishes and exposed to a Ce137 source. Where indicated, the medium was replaced with medium containing 10 mM caffeine  and 1 \u03bcg/ml colcemide (Sigma). Indirect immunofluorescence was performed as described  and AG02496 and AG04405 primary A-T fibroblasts  were grown and infected with retroviruses as described elsewhere . For \u03b3-iescribed .6 293T cells were plated in 10-cm dishes. Cells were transfected with 1 \u03bcg of FLAG\u2013ATM DNA . The NaCl concentration was raised to 400 mM, and the lysate was incubated on ice for 5 min. The NaCl concentration was reduced to 200 mM, cell debris was removed by centrifugation, and an equal volume of Laemmli buffer was added to the lysate.One day prior to transfection, approximately 5 10\u2013ATM DNA  and 9 \u03bcg\u2013ATM DNA  or TRF1 6 IMR90 fibroblasts were run on 7.5% precast polyacrylamide Bio-Rad  Ready Gels. PVDF ImmobilonTM Transfer Membrane  was prepared for protein transfer according to the manufacturer's instructions and the gel was transferred for 2 h at 90 V. Membranes were preincubated in 10% milk, 0.1% Tween-20 in PBS for 30 min at room temperature and subsequently incubated with primary antibodies: polyclonal rabbit ATM S1981\u2013P (4 cells/\u03bcl. Lysates (10 \u03bcl) were separated on SDS-polyacrylamide gels  and transferred onto nitrocellulose membranes (Schleicher and Schuell) for 60 min at 90 V (Bio-Rad Mini-Protean II Cell). Membranes were preincubated in 10% nonfat dry milk, 0.1% Tween-20 in PBS for 30 min and subsequently incubated with primary antibodies: p53 D01 ; TRF2 serum 647 .For ATM immunoblots in the ATM S1981\u2013P suppression assays: 40 \u03bcl of 293T cell lysate or ATM immunoprecipitated from approximately 5 10 S1981\u2013P  and mouserum 647 ; pRB #55erum 647  in 5% dr7 cells/0.1 ml buffer) in 20 mM HEPES (pH 7.9), 0.42 M KCl, 25% glycerol, 0.1 mM EDTA, 5 mM MgCl2, 0.2% NP40, 1 mM DTT, 0.5 mM PMSF, 1 \u03bcg/ml leupeptine, 1 \u03bcg/ml aprotinin, 10 \u03bcg/ml pepstatin on ice for 30 min. Debris was removed by centrifugation . Protein concentration in the supernatant was determined using the Bradford assay and 400 \u03bcg of protein was diluted to 150 mM KCl and incubated for 20 min with 100 \u03bcl of protein G\u2013Sepharose beads (Amersham), blocked with 1% fetal bovine serum in PBS. The beads were collected at 14,000 rpm for 1 min and the supernatant was incubated with 5 \u03bcg of anti-ATM antibody  or anti-Cyclin D1 antibody  for 1 h at 4 \u00b0C on a nutator. Protein G\u2013Sepharose beads (30 \u03bcl) were added, and the mixture was incubated 1 h at 4 \u00b0C on a nutator. The beads were collected at 4,000 rpm at 4 \u00b0C, washed three times with wash buffer  by vortexing the suspension for 10 s. The beads were resuspended in Laemmli buffer and boiled 5 min, and proteins were separated by polyacrylamide gel electrophoresis. For IP of endogenous ATM from IMR90 fibroblasts for the phosphorylation assay, cells were resuspended in lysis buffer  and centrifuged at 13,000 rpm for 10 min. 400 \u03bcl of lysate was incubated with 30 \u03bcl of blocked protein G beads and 100 \u03bcl of D16.11 monoclonal supernatant  was added. After 3 h at 30 \u00b0C, cells were harvested, resuspended in 8 ml of lysis buffer  and sonicated three times for 30 s on ice. The lysate was cleared by centrifugation at 50,000 g at 4 \u00b0C and incubated with 600 \u03bcl of equilibrated glutathione beads for 2 h at 4 \u00b0C. The beads were washed three times for 10 min each  and a fourth time in wash 4 . Fusion proteins were eluted in 500 \u03bcl of wash 4 containing 15 mM glutathione (reduced form). Two subsequent elutions were collected. Five micrograms of GST fusion proteins or GST alone were incubated with 2 \u03bcg of baculoviral TRF1 or TRF2 in binding buffer  at 4 \u00b0C for 1 h. Glutathione beads (20 \u03bcl) were added and incubated for 1 h at 4 \u00b0C. Beads were collected by centrifugation at 5,000 rpm at 4 \u00b0C and washed three times for 10 min each with binding buffer, and bound protein was eluted by boiling the samples in Laemmli buffer. GST fusion proteins, TRF1, and TRF2 were detected by immunoblotting.GST\u2013ATM fusion plasmids  were traCells were seeded on microscope coverslips and irradiated with 4 Gy of \u03b3-irradiation as described above. Cells were incubated in growth medium containing 1 \u03bcg/ml colcemid for 16 h. Cells were fixed, and phosphorylated histone H3 was detected by indirect immunofluorescence using a phosphospecific antibody . Cells in mitosis were counted and expressed as a percentage of total cell number."}
+{"text": "Cyclin-dependent kinases (CDKs) regulate the progression of the cell cycle in eukaryotes. One of the major roles of CDK is to promote chromosomal DNA replication. However, how CDKs promote DNA replication has been a long-standing question, because all the essential CDK substrates in DNA replication have not been identified yet. Recently Sld2 and Sld3 were identified as essential substrates of CDKs in the initiation step of DNA replication in budding yeast. Moreover, bypass of their phosphorylations is sufficient to promote DNA replication. Phosphorylation of Sld2 and Sld3 by CDKs enhances the formation of complex(es) with a BRCT -containing replication protein, Dpb11. We further propose that multiple phosphorylation by CDKs controls this process in budding yeast. Even though Sld3 orthologues in multicellular eukaryotes have not been identified, similar complex formation and, therefore, a similar mechanism of initiation control might be employed in eukaryotes. It has been known for a long time that CDK activity is required for DNA replication in eukaryotes. This concept was established by the early 1990s. For example, CDK-containing fractions activated the replication of SV40 virus in cellular extracts ; and finChromosomal DNA replication in eukaryotes initiates from multiple replication origins. Activities of individual origins are regulated as follows: The six-subunit origin recognition complex (Orc) binds to replication origins throughout the cell cycle in yeast cells, and the putative replicative helicase Mcm (Mcm2-7 complex) is recruited onto Orc-bound origins with the aid of Cdc6 and Cdt1 to form the pre-replicative complex (pre-RC), from late M to G1 phase when CDK activity is low. Once both CDK and Dbf4-dependent protein kinase (DDK/Cdc7), another protein kinase essential for DNA replication, are activated, many replication proteins including replicative DNA polymerases, \u03b1, \u03b4 and \u03b5 are loaded onto the pre-RC formed origins. Then origin DNA is unwound and replication forks are formed to synthesize DNA . For sld2 mutation was originally isolated as one of sld  [We previously showed that budding-yeast Sld2 is an essential CDK target for DNA replication . The slddpb11-1) . The Slddpb11-1) . Dpb11 hdpb11-1) ,15. C-tedpb11-1) . Dpb11 adpb11-1) , our unpdpb11-1) . This stsld3 mutation was also isolated by the 'sld' screening [sld3-2A mutant cells. First, multicopy DPB11 suppresses lethality caused by sld3-2A [JET1-1 mutation -11D to initiate DNA replication) restores the growth defect [JET1-1 was isolated as a mutation, which induces untimely DNA replication when the phosphomimetic Sld2 (Sld2-11D) was expressed. The JET1-1 mutation occurred in the CDC45 gene, whose product binds to Sld3. However, Cdc45 itself is not a target of Cdk1 in the initiation, because disruption of all the CDK phosphorylation motifs in Cdc45 does not show any defect in DNA replication nor cell growth. Jet1-1 seems to enhance the interaction between Sld3 and Dpb11 through the interaction between Cdc45 and Sld3 [Actually, we and others found another essential CDK target, Sld3 ,6. The screening . Of 12 CJET1-1, multicopy DPB11 and the sld2-D mutation while Zegerman and Diffley combined the SD fusion and the sld2-D mutation [JET1-1 sld2-D mutant cells lacking CDK activity (DNA synthesis in SD fusion strain has not been characterized in detail). In any combinatory strains, DNA replication induced in G1 cells is not efficient as that in CDK-driven DNA replication. Nonetheless, these data strongly suggest that phosphorylation of Sld2 and Sld3 by Cdk1 are the minimal requirement for the initiation of DNA replication although we cannot rule out the formal possibility that the SD fusion and JET1 bypass not only Sld3 phosphorylation but also other phosphorylations.We combined mutation ,6. In anWhile phosphorylation-dependent interactions between Sld2, Sld3 and Dpb11 appear to be essential to initiate DNA replication, how these interactions facilitate initiation is still obscure. A novel complex, pre-Loading Complex (pre-LC) containing Pol\u03b5, GINS, Dpb11 and Sld2 was detected in the cells treated with a cross-linking reagent and this complex formation depends on CDK but not DDK nor pre-RC (our unpublished results). On the other hand, Sld3, together with Cdc45, associates with pre-RC-formed early-firing origins even in G1 phase . Thus, wThe phosphorylation-dependent interaction between Dpb11, Sld2 and Sld3 may be an essential mechanistic requirement to promote the initiation of DNA replication. It is also conceivable that these interactions monitor cellular CDK activity to couple DNA replication with other cell cycle events. We will discuss the interaction between Dpb11 and Sld2 from our viewpoint.84-Pro, to PIKK (PI3 kinase related kinase) phosphorylation motif, Thr84-Gln, results in phosphorylation of Thr84 by DNA-dependent protein kinase, one of PIKK, and this phosphorylation depends on pre-phosphorylation by CDK. We thus argue that phosphorylation renders Thr84 accessible to DNA-dependent kinase in the Thr-Gln construct and to Cdk1 in the original construct, probably by phosphorylation-dependent conformational change  composed of Orc at the replication origins. Active Cdk1 phosphorylates the pre-RC components and inhibits reassembly of pre-RC to prevent reinitiation (reviewed by ). The hiThe Sld3 protein has 12 CDK phosphorylation motifs. Two of them, Thr600 and Ser622, are responsible for CDK phosphorylation-dependent interaction between Dpb11 and Sld3 ,6. SimulBecause regulation of DNA replication as well as the cell cycle seems to be well conserved throughout eukaryotes, the molecular mechanisms of the initiation of DNA replication regulated by CDK might be conserved. Orthologues of Sld2, Sld3 and Dpb11 are found in yeast and fungi while in other organisms they seem to differ significantly  declare that they have no competing interests.All the authors wrote the manuscript and H.A. organized it."}
+{"text": "Unrepaired DNA double-strand breaks (DSBs) are a major cause for genomic instability. Therefore, upon detection of a DSB a rapid response must be assembled to coordinate the proper repair/signaling of the lesion or the elimination of cells with unsustainable amounts of DNA damage. Three members of the PIKK family of protein kinases -ATM, ATR and DNA-PKcs- take the lead and initiate the signaling cascade emanating from DSB sites. Whereas DNA-PKcs activity seems to be restricted to the phosphorylation of targets involved in DNA repair, ATM and ATR phosphorylate a broad spectrum of cell cycle regulators and DNA repair proteins. In the canonical model, ATM and ATR are activated by two different types of lesions and signal through two independent and alternate pathways. Specifically, ATR is activated by various forms of DNA damage, including DSBs, arising at stalled replication forks (\"replication stress\"), and ATM is responsible for the signaling of DSBs that are not associated with the replication machinery throughout the cell cycle. Recent evidence suggests that this model might be oversimplified and that coordinated crosstalk between ATM and ATR activation routes goes on at the core of the DNA damage response. Accumulation of DNA damage at the cellular level is linked to a number of phenotypes at the organism level including progeria, neurodegeneration and cancer. Therefore, understanding how cells respond to lesions in their DNA has become a central area of research in biomedical sciences. In particular, significant effort has been made in elucidating the components and mechanisms of the signaling pathways that alert about the existence of DSBs . Our curThe two types of DSBs can artificially be mimicked in the laboratory. Typically, chemicals such as hydroxyurea (HU) or aphidicolin are used to induce activation of ATR, and exposure to ionizing radiation (IR) for activation of the ATM pathway. In addition, the levels of phosphorylation of ATM and ATR targets serve as a quantitative readout of the kinase activities. For instance, Chk2 and Chk1 phosphorylation are regularly used as a measure of ATM and ATR activation status, respectively. However, a number of studies have previously reported that IR, which supposedly only activates ATM, also leads to noticeable phosphorylation of Chk1. One possible interpretation is that this phosphorylation is derived from \"accidental\" phosphorylation of Chk1 by ATM, particularly at the high doses of IR used in this type of experiment . Howeverin vitro activity of ATR whether is purified from damaged or intact cells Q motifs once they are activated? Is the specificity given just by the accessibility of the substrates at the sites of DSBs? In the light of these facts, delineating the specific in vivo functions of newly identified ATM/ATR-dependent phosphorylation events should be a critical avenue of future research.In contrast to the crosstalk between ATM and ATR that is activated in response to IR, the analysis of the response to \"replication stress\" published in these recent reports is still consistent with the canonical model and places ATM/Chk2 and ATR/Chk1 in two alternative and non-interacting pathways. Noteworthy, our data . On the technical level, we expect that the incorporation of flow cytometry protocols onto DNADSB: DNA double-strand break; PIKK: phosphatidyl-inositol 3 kinase like protein kinase; ATM: Ataxia Telangiectasia mutated; ATR: ATM and Rad3-related; DNA-PKcs: DNA-dependent protein kinase catalytic subunit, HU: hydroxyurea; IR: ionizing radiation; ssDNA: single stranded DNA; RPA: replication protein A; CDK: cyclin-dependent kinase.The author(s) declare that they have no competing interests.MC and BM contributed to the initial draft of the manuscript. OF wrote the manuscript. All authors read and approved the final manuscript."}
+{"text": "ATM is also modified by PARP-1 during DNA damage. We have also evaluated the impact of PARP-1 absence or inhibition on ATM-kinase activity and have found that while PARP-1 deficient cells display a defective ATM-kinase activity and reduced \u03b3-H2AX foci formation in response to \u03b3-irradiation, PARP inhibition on itself is able to activate ATM-kinase. PARP inhibition induced \u03b3 H2AX foci accumulation, in an ATM-dependent manner. Inhibition of PARP also induces DNA double strand breaks which were dependent on the presence of ATM. As consequence ATM deficient cells display an increased sensitivity to PARP inhibition. In summary our results show that while PARP-1 is needed in the response of ATM to gamma irradiation, the inhibition of PARP induces DNA double strand breaks (which are resolved in and ATM-dependent pathway) and activates ATM kinase.ATM and PARP-1 are two of the most important players in the cell's response to DNA damage. PARP-1 and ATM recognize and bound to both single and double strand DNA breaks in response to different triggers. Here we report that ATM and PARP-1 form a molecular complex  Functional inactivation of the ATM gene product and Atm-null mice, which were created by disrupting the Atm locus, recapitulate the human A-T phenotype and display growth retardation, mild neurological dysfunction, male and female infertility, extreme predisposition to thymic lymphomas, and acute sensitivity to ionizing radiation ATP. Kinase reactions were performed at 30\u00b0C during 20 minutes and terminated by the addition of 6\u00d7SDS loading buffer (1:1), and reaction products were resolved by SDS-PAGE. Incorporation of 32P into the PHAS-I substrate was evaluated by phosphorimaging. All kinase reactions were performed under linear reaction conditions. Equal loading in each lane was guaranteed by coomasie blue staining.ATM kinase assays were conducted using the protocol described by Sarkaria et al. . ATM wasATM, ataxia telanagiectasiaBER, base excision repairDAPI, 4',6'-diamidino-2-phenylindole dihydrochlorideDSB, double strand breakDTT, 1,4-dithiothreitolEGTA, ethylene glycol tetraacetic acidHEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)HR, homologous recombinationMNU, N-methyl-N-nitrosoureaPAR, poly(ADP-ribose)PARP, poly(ADP-ribose) polymeraseSDS-PAGE, sodium dodecyl sulphate-polyacrylamide gel electrophoresisRA-Q carried out poly(ADP-ribosylation) studies, immunofluorescence, ATM kinase, comet assay and apoptosis studies; JAMG contributed to apoptosis studies; DMO helped with ATM kinase assay; AP, MTV, RMR and RQP contributed to immunoprecipitation and comet assays studies. JMM, GdM, MRdA conceived and participated in design the study. FJO conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript."}
+{"text": "The acquired immunodeficiency syndrome (AIDS) is accompanied by a significant increase in the incidence of neoplasms. Several causative agents have been proposed for this phenomenon. These include immunodeficiency and oncogenic DNA viruses and the HIV-1 protein Tat. Cancer in general is closely linked to genomic instability and DNA repair mechanisms. The latter maintains genomic stability and serves as a cellular anti-cancer barrier. Defects in DNA repair pathway are associated with carcinogenesis.This review focuses on newly discovered connections of the HIV-1 protein Tat, as well as cellular co-factors of Tat, to double-strand break DNA repair. We propose that the Tat-induced DNA repair deficiencies may play a significant role in the development of AIDS-associated cancer. The development of neoplasms in AIDS is generally assumed to be due to a failure of immune surveillance and infections by oncogenic viruses. However, a growing body of evidence suggests that HIV-1 and its proteins may play a more direct role in tumor development.in vivo has been associated with the increase of KS-like lesions, although this role of Tat in KS development has been controversial [Several types of cancer have been strongly associated with the HIV-1 infection and AIDS. These are Kaposi sarcoma (KS), lymphoproliferative disorders and cervical cancer . KS is coversial . In summTwo other types of cancer have been associated with AIDS. HIV-1 infected patients develop lymphomas at relatively high frequency and in 3% of HIV-1 infected patients, non-Hodgkin lymphoma (NHL) is the initial manifestation of AIDS. As is the case of KS, NHL in HIV-1-infected patients was associated with a viral infection, in this case, Epstein-Barr virus infection (EBV) . FinallyFinally, there are reports of increase in incidence of colorectal cancers in long-term AIDS survivors -22. ColoCells have developed many mechanisms to protect the integrity of chromosomal DNA. These mechanisms are important for cell and organism survival. Surveillance protein complexes monitor the integrity of the genome. Detection of aberrant DNA and chromosome structures such as double-strand DNA breaks coordinately triggers checkpoint pathways and DNA repair systems . ActivatThe most hazardous form of DNA damage is a double-strand DNA break (DSB) -27. EvenCS), and the Ku80/Ku70 heterodimer [CS is recruited to the sites of DSBs by binding to the carboxy-terminal motif of the Ku80  protein, subsequently, DNA-PK is activated [The cellular DNA damage response to DSBs is controlled by three related serine/threonine kinases: ATM (ataxia telangiectasia mutated), ATR (ATM and Rad3 related) and DNA-PK (DNA-dependent protein kinase). These key players of the DNA damage response are recruited to DSB sites by other proteins, some of which appear to serve as sensors of DSBs Figure . The mecerodimer . DNA-PKCctivated . Unlike ctivated .DSB repair is mediated by two major repair systems in mammalian cells. Similar to yeast, mammalian cells can perform homologous recombination (HR) . In thisIn addition to their role in the activation of cell cycle checkpoints, the ATM and ATR kinases are directly involved in DSB repair. They phosphorylate the BRCA1 protein and the histone H2A variant termed H2AX -51. BRCAThe phosphorylated histone H2AX, termed \u03b3H2AX, appears very early at the sites of DNA damage in chromatin ,53. It iIn contrast to ATM and ATR, DNA-PK is a critical component of the NHEJ pathway. NHEJ is thought to be effective at any time during the cell cycle ,61, but,It has been known for a long time that patients carrying mutations in certain DNA repair genes also suffer from an increased incidence of cancer . One exaNature showed that clinical specimens from different stages of human tumors of the urinary tract, lung, colon and breast express activated markers of the ATM- and ATR-dependent DNA damage response [Only a small fraction of population carries ATM or BRCA1 mutations ,70. Thusresponse ,73. Thesresponse . MutatioIn contrast to ataxia telangiectasia, no such cancer-prone disease was associated with NHEJ. One likely reason is that a mutation in NHEJ has such debilitating effects that most carriers of this mutation die before they reach the stage when cancer could develop. However, NHEJ genes have been the subject of animal studies and transgenic knock out models were developed, Ku80 knock out and Xrcc4 knock out being examples discussed here.Mice lacking Ku80 are viable, but develop severe immunodeficiency, which seems to be the most pressing problem in these animals . Xrcc4-dTaken together, ATM-, ATR-, and NHEJ-dependent DNA damage response plays a central role in tumorigenesis and agents that disrupt this response may lead to the development of cancer.Tat is a cationic 86\u2013101 amino acid polypeptide encoded by HIV-1 . Tat funAlthough interactions of Tat with cellular proteins are widely studied, little is known about effects of Tat on cellular DNA repair. Tat was shown to induce the expression of the DNA polymerase beta gene, which encodes a key protein in the DNA base-excision repair pathway . ExpressIn addition to regulation of DNA polymerase beta gene, Tat was also implied to play a role in DSB DNA repair, since cellular extracts containing the Tat protein have a reduced ability to re-join linearized DNA . This fiAn additional piece of evidence for the Tat role in the suppression of double-strand DNA break repair came from Tat-expressing rhabdomyosarcoma cell lines . In thesThe cellular protein Tip60 (Tat interactive protein) was originally discovered as a protein interacting with HIV-1 Tat . HoweverTip60 is involved in multiple steps of the cellular DNA damage response. Similarly to p53, Tip60 is a target of the human Mdm2 protein, which catalyzes Tip60 ubiquitination and proteosomal degradation . Second,Tip60+/-) exhibit severely impaired oncogene-induced DNA damage response, which is ATM- and ATR-dependent [[Tip60+/- did not have a general deficit in DNA damage response to DSBs (ionizing radiation), which could be inferred based on the defect in oncogene-induced DNA damage response. These latter data thus seemingly contradict the above report indicating that Tip60 is required for ATM activation in response to DSBs. However, it has to be pointed out that the Tip60+/- mice still had one active Tip60 allele and it is thus possible that what is observed is a dose-dependent effect and an additional Tip60 inhibition is required to see its role in DNA damage response to DSBs. Unfortunately, homozygous embryos that lack Tip60 die before implantation, thus complicating the analysis. In summary, two lines of evidence suggest that Tip60 interacts with ATM and regulates the ATM-dependent DNA damage response, although some aspects of this interaction remain to be clarified.The second point of interaction of Tip60 with DSB repair is the ATM kinase Figure . ATM autpendent [ see abovet al. reported that Tip60 is required in Drosophila for selective histone exchange at DSB sites [Cellular DNA is packaged together with histones into chromatin, and the chromatin structure may affect sensing and repair of DSBs. Acetylation of histones is thought to \"open\" the chromatin structure DNA to DNA repair proteins. Tip60 was shown to acetylate histone H4 at the DSB sites . Lack ofSB sites . SpecifiAs noted above, Tip60 was originally identified as a Tat-intereacting protein . Tip60 dIn this article, we summarize several functions of Tat and its interacting proteins in cellular DNA repair. We suggest that Tat may, by regulating its cellular targets, affect cellular DSB repair, the consequences of which could be genomic instability, which may give rise to mutations and contribute to development of cancer. Experiments are underway in our laboratories to investigate Tat role(s) in DSB repair. It is hoped that this review will stimulate further study in this underexplored, yet potentially important field.GN and RD conceived of the idea and co-wrote the manuscript. JAS provided helpful comments, created the model for Tip60 role in DSB repair and participated in the preparation of the manuscript."}
+{"text": "The cytoskeletal adaptor protein vinculin plays a fundamental role in cell contact regulation and affects central aspects of cell motility, which are essential to both embryonal development and tissue homeostasis. Functional regulation of this evolutionarily conserved and ubiquitously expressed protein is dominated by a high-affinity, autoinhibitory head-to-tail interaction that spatially restricts ligand interactions to cell adhesion sites and, furthermore, limits the residency time of vinculin at these sites. To date, no mutants of the vinculin protein have been characterized in animal models.Here, we investigate vinculin-\u0394Ex20, a splice variant of the protein lacking the 68 amino acids encoded by exon 20 of the vinculin gene VCL. Vinculin-\u0394Ex20 was found to be expressed alongside with wild type protein in a knock-in mouse model with a deletion of introns 20 and 21  and shows defective head-to-tail interaction. Homozygous VCL-\u0394In20/21 embryos die around embryonal day E12.5 showing cranial neural tube defects and exencephaly. In mouse embryonic fibroblasts and upon ectopic expression, vinculin-\u0394Ex20 reveals characteristics of constitutive head binding activity. Interestingly, the impact of vinculin-\u0394Ex20 on cell contact induction and stabilization, a hallmark of the vinculin head domain, is only moderate, thus allowing invasion and motility of cells in three-dimensional collagen matrices. Lacking both F-actin interaction sites of the tail, the vinculin-\u0394Ex20 variant unveils vinculin's dynamic binding to cell adhesions independent of a cytoskeletal association, and thus differs from head-to-tail binding deficient mutants such as vinculin-T12, in which activated F-actin binding locks the protein variant to cell contact sites.Vinculin-\u0394Ex20 is an active variant supporting adhesion site stabilization without an enhanced mechanical coupling. Its presence in a transgenic animal reveals the potential of splice variants in the vinculin gene to alter vinculin function in vivo. Correct control of vinculin is necessary for embryonic development. The cytoskeletal adaptor protein vinculin emerged together with cell adhesion receptors during early metazoan evolution Caenorhabditis elegans and to embryonal lethality in mice Genetic inactivation (knock-out) of VCL leads to paralysis and defects in muscle architecture in d of 1nM 2) are blocked. It has been suggested that the combinatorial activity of several partners as found only in cell contacts, is required to unlock the head-to-tail interaction (HTI) Studies performed on vinculin null cells and animals indicate that the protein modulates adhesion and migration of cells and may define a critical point of regulation in the process of self-assembly and disassembly of adhesion sites. In fact, the protein's structure and biochemical properties suggest the importance of simultaneous regulation by several interaction partners to restrict high affinity interactions to adhesion sites In this work, we analyse a constitutively active vinculin variant, vinculin-\u0394Ex20, using the knock-in VCL-\u0394In20/21 mouse model. Apart from vinculin knock-outs, no other mouse model investigating vinculin function has been analysed to date. Alternative splicing of exon 20 removes 2.4 helices from the Vt five-helix bundle domain, deleting the actin interaction sites as well as essential parts of the head interaction sites and promotes constitutive ligand binding of the vinculin head. Homozygous VCL-\u0394In20/21 animals die between embryonal day E10.5 to E12.5 with embryos showing exencephaly and lack of midline fusion. Furthermore, they express vinculin-\u0394Ex20 in addition to reduced levels of wild type vinculin. The phenotype of cells expressing vinculin-\u0394Ex20 reflects vinculin interactions in adhesion sites independent of auto-inhibition and cytoskeletal coupling, and contributes to a better understanding of vinculin functional regulation in cells and tissues.To introduce selected mutations at the 3\u2032 end of the vinculin gene, we generated a targeting vector for homologous recombination, eliminating introns 20 and 21 . The knoAs described above, VCL-\u0394In20/21 (ki/ki) embryos could be identified until E12.5 but not at later stages. Furthermore, E12.5 embryos were usually already dead and showed early signs of resorption. At E10.5 VCL-\u0394In20/21 (ki/ki) embryos were still alive and showed the same size as wild type or heterozygous embryos isolated from the same pregnant mouse, indicating that embryonic death occurred between E10.5 to E12.5. Morphological inspection of VCL-\u0394In20/21 (ki/ki) embryos revealed a severe craniofacial defect. The cranial neural folds failed to fuse resulting in the formation of an exencephaly. Furthermore, other head structures also failed to fuse at the ventral cranial midline \u2032. HistolTo test whether expression of the vinculin-\u0394Ex20 variant affects cell survival during development, TUNEL-staining on histological sections from E10.5 embryos was performed. Indeed, whereas only a few TUNEL positive cells were present in sections from wild type embryos, a massive increase in TUNEL positive cells could be detected in VCL-\u0394In20/21 (ki/ki) embryos. Interestingly, massive cell death was found almost exclusively in mesenchymal tissue, ventral to the spinal cord and in the neuroepithelium, but was not observed in heart or liver \u2032.To evaluate the potential effects of the vinculin splice variant on embryonal development, we generated a vinculin-\u0394Ex20 expression plasmid equipped with an N-terminal EGFP for expression and detection in eukaryotic cells. In C2C12 myoblasts, the efficiencies of transfection and expression levels of the wild type and \u0394Ex20 forms of GFP-tagged vinculin as determined by FACS analysis were identical (data not shown). Immunoblots revealed ratios of 1\u22361.2\u20131.8 of endogenous to ectopically expressed protein and did not show any additional short fragments that would be indicative of enhanced degradation of the vinculin-\u0394Ex20 (data not shown). Analysis of protein targeting in transfected C2C12 cells revealed strong adhesion site localization concomitant with a reduced cytoplasmic occurrence of vinculin-\u0394Ex20 compared to vinculin wild type . Further2 (mean \u00b1 SEM) and 0.67\u00b10.03 \u00b5m2, respectively (3 to 2.5\u00b10.2\u00d7103 \u00b5m2 (mean \u00b1 SEM). Taken individually, neither characteristic showed statistically significant differences with p- values (t-test) of 0.32 and 0.09, respectively. However, analysis of adhesion relative to whole cell areas confirmed the initial (subjective) impression. The density of adhesion sites rose from 16\u00b11 to 20\u00b11 sites in 100 \u00b5m2  and the adhesion area reached 13.2\u00b10.7% of the total area of the cell , reflecting an increase of 40% in vinculin-\u0394Ex20 compared to vinculin wild type expressing cells  and (ki/ki) MEFs as compared to VCL (wt/wt) MEFs from littermates, confirming the impact of vinculin-\u0394Ex20 on the cellular control of adhesion site formation . ComparaHaving characterized vinculin-\u0394Ex20 as a constitutive variant that can enhance adhesion site occurrence, most likely as a consequence of a reduced head-to-tail interaction, we next addressed the impact of ligand binding to the vinculin-\u0394Ex20 tail domain. Humphries et al. suggested selective targeting of the vinculin tail (Vt) to a subset of actin filaments 1/2(I) corresponding to tethered protein and t1/2(II) reflecting the pool of actively bound protein 1/2(II) of 16\u00b11 s (mean \u00b1 S.D.) for wild type vinculin is relatively low in C2C12 cells as compared to other cells, but well within the range of values reported for vinculin in the literature 1/2(II) of 39\u00b12 s and 49\u00b13 s for vinculin head Vd1-Vd3 (amino acids 1\u2013716) and vinculin head Vd1-Vd4+ , respectively. Thus, the half life time t1/2(II) of 120\u00b17 s determined for vinculin-\u0394Ex20, which is 7 times longer than that of vinculin wild type, demonstrated strongly enhanced binding of this vinculin splice variant to adhesion sites. This behaviour differed from that of (pure) vinculin head interactions. Most notably, the vastly prolonged residency time was not accompanied by a decrease of vinculin-\u0394Ex20 protein in the mobile fraction (74%). In contrast, vinculin-T12, an established head-to-tail binding mutant with defective Vd4-Vt(Vd5) interaction yet intact F-actin binding 1/2(II) of 315\u00b132 s in C2C12 cells (A strong influence of the vinculin-\u0394Ex20 tail domain on the cellular function of vinculin became evident when we investigated residency times of different EGFP-tagged variants by fluorescence recovery after photobleaching (FRAP). C2C12 cells were used for the comparison of vinculin kinetics, since we have previously obtained highly reproducible values in these cells with a number of different proteins and domain constructs 12 cells . These dHere we report biochemical and functional consequences of the genetic removal of introns 20 and 21 from the vinculin gene VCL. Homozygous (ki/ki) embryos carrying the VCL-\u0394In20/21 allele, die between E10.5 to E12.5 and display severe craniofacial defects. Vinculin expression analysis in E10.5 embryos reveals reduced levels of the endogenous wild type protein and the appearance of an alternatively spliced vinculin variant lacking exon 20. Vinculin-\u0394Ex20 is a  109 kDa protein devoid of the actin interaction sites of the tail (Vd5) and of the inhibitory intramolecular head-to-tail interaction (HTI) (Vd4\u2013Vd5). Reduced HTI of vinculin-\u0394Ex20 leads to strongly enhanced residency times of the protein and stabilization of adhesion sites, affecting cellular control of adhesion and motility.The phenotype of the VCL-\u0394In20/21 mouse only partially resembles the phenotype of vinculin knock-out animals, although both mouse mutants die during midgestation after having completed gastrulation. Both mouse mutants exhibit a cranial neural tube closure defect resulting in an exencephaly. As suggested by Xu et al. Despite these similarities, the phenotype of the vinculin null embryos is more severe than that of the VCL-\u0394In20/21 embryos. Vinculin null embryos are already smaller at E8.5 and only some survive until E10.5 In contrast, VCL-\u0394In20/21 embryos show no growth retardation and are the same size as wild type embryos at E10.5. Consistently, histological analysis of hearts from VCL-\u0394In20/21 embryos revealed normal differentiation into epicardial, myocardial and endocardial structures. In addition, there was no obvious defect in the formation of the peripheral nervous system in these embryos. Thus, reduced levels (far below 50%) of wild type vinculin are probably sufficient to sustain normal organ development. Despite this absence of apparent phenotype, expression of vinculin-\u0394Ex20 protein and reduced expression of wild type vinculin cause apoptotic cell death in the neural epithelium and in mesenchymal cells ventral to the spinal cord. Whether or not this is a consequence of defective cell adhesion and migration remains unclear.Studies on mice carrying vinculin null (knock-out) alleles provide evidence that one functional vinculin allele is sufficient to allow regular embryonal development. Heterozygous mice are fertile and display no obvious pathology. Investigating cardiac function in adult heterozygous vinculin null mice, Ross and co-workers report stress-inducible cardiac complications Vinculin-\u0394Ex20 is detected as one protein without additional head fragments in immunoblots of primary MEF cells derived from VCL-\u0394In20/21 (ki/ki) mice and upon ectopic expression in different cell lines. In cells, this protein displays preferential adhesion site targeting together with a low cytoplasmic pool and induces a rise in adhesion site density. These characteristics indicate constitutive binding of vinculin-\u0394Ex20 to head ligands such as talin and alpha-actinin. Direct comparison of the \u0394Ex20-splice variant to vinculin head constructs or the head-to-tail binding mutant vinculin-T12 reveals informative differences. Ballestrem and co-workers report that a range of vinculin head constructs as well as vinculin-T12 can induce a 3\u20134 fold increase in total adhesion area covering more than 20% of the cell's spreading area. This drastic rise appears to result from a 2-fold increase in average adhesion size and a 2\u20133 fold rise in the number of adhesions Some studies indicate that half life times of vinculin (and vinculin head) in adhesions are directly linked to those of talin and integrins Consequences for the interaction of vinculin tail-\u0394Ex20 with acidic phospholipids are less obvious. This interaction is functionally important for vinculin's activity and residency time in adhesions and competes for actin filament binding Finally, the altered lipid binding site based on the basic collar and hydrophobic hairpin of vinculin tail may still be subject to regulation by protein phosphorylation. In the \u0394Ex20-tail, Y1065 may be phosphorylated via the FAK-src signalling axis, which is associated with enhanced adhesion turnover Vinculin is a phylogenetically conserved single-copy protein which, apart from providing unique functions during embryonal development, is essential in adult heart tissue, where it is required for long-term preservation of cardiac function in vitro and in mice in vivo. The mutant protein lacks sites involved in functionally important interactions with actin as well as with its own head domain turning the mutant insensitive to normal regulatory interactions. The constitutively active behavior of the protein is associated with severe malformations during embryonic development in mice providing in vivo evidence for the functional importance of a fine tuned regulation of vinculin function.In conclusion, we here present the detailed characterization of a new variant of the cell adhesion protein vinculin Mouse breeding and experiments were performed in the animal facilities of the Faculty of Medicine, University of Leipzig according to European (Council Directive 86/609/EEC) and German (Tierschutzgesetz) guidelines for the welfare of experimental animals and were approved by the local authorities (Landesdirection Leipzig). Mice were housed in a 12 h/12 h light dark cycle with access to food and water ad libitum.5\u2032AGTGAAGACGCCTGTATGG and 5\u2032AGCAGCCCTCTGGAAGGAC. PCR performed for 33 cycles with an annealing temperature of 60\u00b0C and 30 s of elongation time resulted in a 271 bp fragment for the wild type and a 324 bp fragment for the transgenic allele comprising the lox-P site.Heterozygous animals were mated and 12\u201316 hours later females were examined for the presence of a vaginal ejaculatory plug. The day of plug detection was determined as E0.5 of pregnancy. Embryos were isolated at indicated time points. DNA retrieved from the amnions was used for genotyping PCR with primers GGGAGTCTTTCTGACCCAG 3\u2032 (exon 22). PCR was performed with recombinant Taq-DNA polymerase (MBI Fermentas) using the forward primer 5\u2032 GATGAGCTGGCTCCTCCTAAG 3\u2032 (exon 18), and the reverse primer used for c-DNA synthesis. PCR performed for 39 cycles with an annealing temperature of 60\u00b0C and 60 s of elongation time, resulted in 620 bp and 420 bp fragments for wild type and \u0394Ex20 vinculin mRNA, respectively. The identity of the \u0394Ex20 mRNA was determined by direct sequencing.Embryos were lysed and RNA was isolated with the RNeasy mini kit (Qiagen) using on-column DNAse digestion. RT reaction was performed with the Revert Aid First strand c-DNA synthesis kit (MBI Fermentas) and the specific primer 5\u2032 Embryos were homogenized in lysis buffer  Triton-X-100, 1% (v/v) Protease inhibitor cocktail (Sigma)) and incubated for 30 min on ice. Debris was removed by centrifugation, 13000 rpm at 4\u00b0C. Protein concentration in supernatants was determined using the BCA assay (Pierce). Supernatants were diluted with 2x SDS-loading buffer (Sigma) and denatured for 3 min at 95\u00b0C. 10 \u00b5g total protein extract of each embryo were loaded onto 8% SDS-polyacrylamide gels and separated. After transfer onto nitrocellulose membrane, immunodetection was performed using the vinculin antibody hVin-1 (Sigma) as described below.Embryos were fixed using 4% PFA in phosphate buffer over night at 4\u00b0C. Thereafter, embryos were washed 3 times in PBS/20 mM glycine, stepwise dehydrated in ethanol and finally embedded in paraffin. 5 \u00b5m-sections were taken and mounted onto glass slides. Paraffin sections were stained with haematoxylin and eosin. TUNEL staining was performed according to the manufacturer's protocol (Roche) and counterstained with DAPI (Invitrogen).To isolate MEF cells from E10.5 embryos, brain and dark red organs were removed. Thereafter, embryos were washed in sterile PBS and cut into smaller pieces. Cells were separated by 0.05% trypsin treatment for 5 min at 37\u00b0C. The digest was stopped with FCS and dispersion of cells was enhanced by up and down pipetting through a 1 ml tip. MEFs were seeded onto cell culture dishes and cultured in DMEM (high glucose), 10% FCS, 2 mM L-glutamine and antibiotic/antimycotic mix (GIBCO). Cell preparations from each genotype (passages 2 or 3) were immortalized by retroviral transduction of SV40 LT antigen. Immortalized populations were tested for vinculin expression levels. Their migratory capacity was determined in three-dimensional collagen invasion.Vinculin expression constructs were based on the vinculin full-length clone in pEGFP-C2 (Invitrogen) and the vinculin tail construct (Vt 879\u20131066) as described earlier To assess stability of vinculin transcripts, MEFs were treated with 10 \u00b5M cycloheximide, which blocks protein synthesis http://rsb.info.nih.gov/ij, version 1.42). Graph plots and statistical analysis were carried out using Excel 2004 for Mac (Microsoft).Protein bands were visualized using ECL  according to manufacturer's protocol and Amersham Hyperfilm ECL . Films were scanned at 600 dpi/16bit greyscale (Epson 2480) and band intensities determined using background subtraction and gel analysis from ImageJ software  on the following day with vinculin expression constructs (0.5 \u00b5g DNA) using FugeneHD (Roche) according to manufacturer's protocol. After 24 h of transfection, cells were fixed in phosphate-buffered 4% paraformaldehyd for 10 min at 37\u00b0C. Coverslips were washed with PBS/20 mM glycine, permeabilized in PBS/0,01% Tween 20 for 5 min and blocked for 15 min in blocking solution . After 1 hour of incubation with the vinculin-specific antibody hVin-1 , cells were washed in PBS and incubated for 30 min with (i) goat-anti-mouse-alexa-488 conjugated secondary antibody , (ii) DAPI (1\u2236250) and (iii) alexa-568-conjugated phalloidin (1\u2236100) in blocking solution . Coverslips were washed in PBS (3\u00d7) and water (1\u00d7) and mounted using Mowiol (Hoechst). Fluorescence images were taken with a Zeiss Axiovert 200 microscope with HXP 120 illumination using AxioVision 4,7 software (Zeiss).C2C12 myoblasts Localization and quantification of adhesion parameters, such as \"whole cell area\", \"adhesion number\" and \"adhesion size\" was achieved by processing the fluorescence images of GFP-tagged vinculin variants with ImageJ software. 16bit TIF-images were treated with a cell edge-detection procedure to determine the whole cell area and to limit adhesion quantification to this area. The order of commands for the cell edge-detection was: enhance contrast, FJ edges, make binary, dilate, close, fill holes, and erode. In a second step, the (same) original image was used to select vinculin containing adhesions and to produce the adhesion pattern or footprint. The following commands were used: subtract background, enhance contrast, set threshold, convert to mask. By thresholding, images were reduced to vinculin-containing adhesion patters. \"Analyze particles\" provided number and size of adhesions from the binary footprint. Graph plots and statistical analysis, normality test and two-tailed unpaired t-test, were carried out using Sigma Plot 10 (Systat).Preparation of gels and cell invasion analysis were performed as described previously FRAP experiments were performed as described earlier Figure S1Genomic structure of the vinculin gene VCL. The knock-in approach for an inducible expression of vinculin-LD, a lipid binding-deficient mutant of vinculin tail  High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet 25: 139\u2013140.Establishment of the VCL-\u0394In20/21 knock-in mouse line. (A) (0.60 MB TIF)Click here for additional data file.Figure S2Sequence analysis of the alternative splice site. RT-PCR using primers in exons 18 and 22 was employed to obtain a cDNA fragment of vinculin-\u0394Ex20 from E10.5 total RNA. DNA sequencing revealed mRNA and derived amino acid sequences of the exon 18 to 21 boundary. (B) Pre mRNA of the VCL-\u0394In20/21 allele. Exon 20 contains consensus nucleotide sequences required for conventional intron splicing [41]. The proposed branch site \u2018CUPuAPy\u2019 (green) and the splice acceptor site \u2018CAG/G\u2019 (underlined) including pyrimidine-rich region (blue) are indicated. The splice donor site of exon 18 is maintained (not shown). . 41. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P (2002) Molecular biology of the cell (4th edition), Garland Science, New York. 319\u2013324p.Alternative splicing of the VCL-\u0394In20/21 allele. (A) (0.31 MB TIF)Click here for additional data file.Figure S3Representative immunoblots of vinculin and c-myc. VCL-\u0394In20/21 MEFs were treated with 10 \u00b5M cycloheximide (CHX) for the indicated periods of time \u22120.02 x , R2\u200a=\u200a0.90) provides an estimate of the vinculin-\u0394Ex20 half life time of 1.5 days (35 hours) in cells. Error bars: S.D.Protein stability of wild type and \u0394Ex20 vinculin in MEFs. (A) (1.05 MB TIF)Click here for additional data file."}
+{"text": "DNA double-strand breaks are among the most serious types of DNA damage and their signaling and repair is critical for all cells and organisms. The repair of both induced and programmed DNA breaks is fundamental as demonstrated by the many human syndromes, neurodegenerative diseases, immunodeficiency and cancer associated with defective repair of these DNA lesions. Homologous recombination and non-homologous end-joining pathways are the two major DNA repair pathways responsible for mediating the repair of DNA double-strand breaks. The signaling of DNA double-strand breaks is critical for cells to orchestrate the repair pathways and maintain genomic integrity. This signaling network is highly regulated and involves a growing number of proteins and elaborated posttranslational modifications including phosphorylation and ubiquitylation. Here, we highlight the recent progress in the signaling of DNA double-strand breaks, the major proteins and posttranslational modifications involved and the diseases and syndromes associated with impaired signaling of these breaks. Mammalian cells and organisms have evolved elegant ways to maintain their genomic integrity and respond to the various DNA lesions that they continuously face. DNA damage can result from exogenous stresses, such as ionizing radiation (IR), ultraviolet (UV) light and chemical compounds, or from endogenous insults such as reactive oxygen species (ROS) and DNA replication errors .DNA double-strand breaks (DSBs) are among the most serious and lethal types of DNA damage, as a single DSB is sufficient to kill a cell or disturb its genomic integrity . DSBs ar and section 2s) [DNA damage response (DDR) to various types of DNA insults is a well orchestrated process and is required to maintain genomic integrity Figure  9-12]. -12. 9-122tion 2s) . Two majtion 2s) . The HR tion 2s) . The chotion 2s) ,17.In the situation where cells are unable to repair their DSBs, DDR pathways are activated by kinases such as ATM and ATR, thus leading to the senescence or the death of damaged cells -21  including phosphorylation, ubiquitylation, SUMOylation, acetylation and methylation, that are critical for DSBs signaling. Mutations in a number of genes involved in the signaling of DSBs have been demonstrated to lead to various human pathologies including cancer and will be also discussed in this review.Mammalian cells have evolved a sophisticated network of proteins to sense and signal DSBs Figure . MembersThree members of the PIKK family are essential for the response to DSBs Figure . These kS. cerevisiae rad50 and is a member of the structural maintenance of chromosome (SMC) protein family [In mammalian cells, DSB ends are recognized by the MRE11/Rad50/NBS1 (MRN) and the KU70/KU80 complexes that function as sensors of DSBs but are also involved in processing the DNA break ends ,33. The n family . The thin family .in vivo functions [The MRN complex interacts with the N-terminal domain of ATM and recruits it to DSBs. The MRN complex is also required for ATM activation-41. In uunctions .Three serine/threonine protein phosphatase PP2A, PP5 and WIP1, have been implicated in the control of ATM activation -50. In uIn response to DNA damage, activated ATM, or alternatively DNA-PKcs or ATR, rapidly phosphorylates H2A.X, a histone H2A variant, on its serine 139 (\u03b3-H2A.X) . The larTyrosine 142 residue of H2A.X is constitutively phosphorylated and its subsequent dephosphorylation in response to DNA damage may enhance MDC1 and ATM recruitment to extend and maintain \u03b3-H2A.X phosphorylation . PhosphoThe elimination of \u03b3-H2A.X at DNA damage sites is required for appropriate DNA damage repair. In mammalian cells, dephosphorylation of serine 139 residue of H2A.X is regulated by the protein phosphatase PP2A and PP4 -57. WhilMDC1 recognizes \u03b3-H2A.X and binds to it via its tandem BRCA1 C-terminal (BRCT) domains . This reThese examples of phosphorylation/dephosphorylation events highlight the importance of these processes in the signaling of DSBs.Recent evidence have demonstrated major roles for ubiquitylation and Sumoylation in the signaling of DSBs -68. PostE3 ligases govern the specificity of ubiquitylated substrates and fall into four major groups; the HECT (Homologous to the E6-AP Carboxyl Terminus) type E3, the RING  type E3, the U-box type E3 and the A20-type C2/C2 zinc-finger . In the In the SUMOylation pathway, three mammalian SUMO isoforms can be used for covalent modifications of protein substrates. SUMO-1 conjugates only a single SUMO moiety to a protein substrate, while SUMO-2 and SUMO-3 which are similar, can form poly-SUMO chains. SUMO isoforms are initially cleaved by SUMO-specific proteases (SNEPs). Subsequently the cleaved SUMOs are activated by the E1 enzyme that consists of SUMO1 activating enzyme subunit (SAE) 1 and 2 also known as Uba2 and Aos1. SUMO is then transferred to the single E2 enzyme UBC9 and subsequently ligated to the target substrates by a few E3 ligases known as Protein Inhibitor of Activated STAT  ,85.Similar to other cellular processes, different ubiquitin E3 ligases including RNF8, RNF168 and BRCA1/BARD1 have been demonstrated to play central roles in the early signaling of DSBs  clusters of MDC1 are phosphorylated by ATM ,87-89. TRNF8 ubiquitylated H2A serves to recruit the E3 ligase RNF168 through its Motif Interacting with Ubiquitin 2 (MIU2) -100. RNFin vitro; however, it has been difficult to identify its in vivo ubiquitylation substrates. \u03b3-tubulin [in vivo ubiquitylation substrates for BRCA1.Interestingly, the heterodimer BRCA1/BARD1 was reported to form K6-linked ubiquitin chain during DNA replication or repair ,107. BRC-tubulin , RPB8 [1-tubulin , Topoiso-tubulin , and CtI-tubulin  are amonWhile the importance of SUMOylation in DNA repair and replication has been demonstrated earlier ,112-115,Thus, in addition to phosphorylation, increasing evidence indicates the requirement for other posttranslational modifications including ubiquitylation and SUMOylation for the signaling of DSBs.A number of hereditary human diseases/syndromes have been associated with mutations that target genes involved in the signaling of DSBs. Some of these genes and the human diseases and syndromes associated with their mutations are discussed here.Nbs1 or Mre11 exhibit increased radiosensitivity, defective cell cycle checkpoints, chromosome instability and immunodeficiency [Nbs1 or Mre11 hypomorphic mutant mice, Rad50 hypomorphic mutants show partial embryonic lethality and exhibit progressive hematopoietic stem cell failure without increased radiosensitivity or defective cell cycle checkpoints [The MRN complex is recruited to the DNA damage site and activates ATM. In contrast to Atm, knockout mouse models for Mre11, Rad50 and Nbs1 are embryonic lethal -119. Hypficiency -123. In ckpoints .NBS1 mutations have been associated with the Nijmegen breakage syndrome (MIM #251260) characterized by microcephaly, radiosensitivity, growth delay, ovarian dysgenesis, immunodeficiency and marked cancer predisposition [NBS1 mutations, most of them leading to truncated NBS1 proteins or amino-acid substitutions that might affect NBS1 protein-protein interactions, have been reported for patients with the Nijmegen breakage syndrome. These NBS1 mutants with truncations or amino-acid substitutions are likely to retain partial NBS1 activities, thus explaining the milder defects observed in these patients compared to Nbs1 null mutation in mice that leads to embryonic lethality [In human, position . Patientethality ,125.MRE11 gene result in ataxia telangiectagia like disorder  characterized by cerebellar atrophy and radiosensitivity without marked immunodeficiency, cancer predisposition or telangiectagia [ATM mutations. In contrast to NBS and A-T, patients with ATLD have almost normal immune responses. While the limited number of ATLD patients does not allow determination of whether this syndrome associates with increased cancer risk, ATLD1/ATLD1 Mremice exhibited impaired Atm functions but showed no increased cancer susceptibility [Hypomorphic mutations of human iectagia . ATLD hatibility .RAD50 deficiency (MIM #613078) was reported for a patient with NBS-like disorder characterized by microcephaly, growth retardation and radiosensitivity without marked immunodeficiency or cancer predisposition . Cells fATM plays important roles in the responses to induced DSBs as well as to programmed DSBs generated during V(D)J and meiotic recombinations. Atm deficiency in mice results in defective activation of cell cycle checkpoints, impaired rearrangement and expression of T-cell receptors, reduced class switch recombination of immunoglobulins, sterility and tumorigenesis ,128-133.ATM result in ataxia-telangiectagia  characterized by progressive cerebellar ataxia, oculocutaneous telangiectagia, immune defects and lymphoid tumors [In human, mutations of d tumors . In addid tumors ,135-137.ATM have been also associated with human cancers. Analysis of coding exons of 518 protein kinases in 210 different human cancers, indicated that ATM gene ranked third in terms of mutation frequency, behind Titin and BRAF (B-Raf proto-oncogene serine/threonine-protein kinase) [Somatic mutations of  kinase) .ATR mutation [RPA1) and replication factor C2 (RFC2) has been associated with the Miller-Dieker lissencephaly syndrome (MIM #247200) and the William-Beuren syndrome (MIM #194050), respectively. These syndromes are also characterized by microcephaly, growth retardation and facial abnormality [In humans, the autosomal recessive disorder known as Seckel syndrome (MIM #210600) is associated with mutation ,140. Feamutation . Thus, hormality ,143.Atm, null Atr mutation leads to early embryonic lethality in mice [ATR mutation (A2101G) associated with the Seckel syndrome in patients, recapitulated the symptoms of the human disease [In contrast to  in mice . Interes disease .DNA-PKcs-null mice are viable but exhibit radiosensitivity, immunodeficiency, and hyperplasia and dysplasia of the intestinal mucosa. However, these mutant mice are not growth retarded [retarded .DNA-PKcs mutations result in radiosensitive severe combined immunodeficiency (RS-SCID) characterized by radiosensitivity and immunodeficiency without microcephaly and mental retardation [DNA-PKcs mutations.In humans, ardation . The B-cardation ,149. No RNF168 mutations [The recently identified RIDDLE syndrome (MIM #611943) has been associated with homozygous utations ,150. ThiRnf8, an E3 ligase required for the recruitment of Rnf168 to sites of DNA damage, have been reported. While no human syndrome/disease have been reported yet to associate with RNF8 mutations, -/- Rnf8mice, similar to the RIDDLE syndrome patient, suffer from defective IgH Class Switch Recombination and are immunodeficient [-/- Rnf8males also exhibit impaired spermatogenesis and are infertile [-/- Rnf8mice are growth retarded and display increased cancer predisposition, demonstrating that Rnf8 is a novel tumor suppressor [Rnf168 mutations are required to determine whether they reproduce characteristics of the RIDDLE syndrome and whether, similar to Rnf8, Rnf168 plays a role in cancer.Mouse models carrying mutations of eficient ,152. Rnfnfertile -153. Remppressor . StudiesBRCA1 is important for a number of cellular functions including activation of cell cycle checkpoints and repair of DSBs through HR pathway . Other fBRCA1 alleles is inherited from one of the parents and loss of heterozygosity (LOH) of the Wild-type BRCA1 allele is required in order for tumors to develop. Women with inherited inactivating mutation of BRCA1 gene have about a 65-80% lifetime risk of developing breast cancer [BRCA1 gene are also predisposed for ovarian cancer with a lifetime risk about 37-62% compared to less than 2% for women that do not carry BRCA1 or BRCA2 mutations [Mutations of the tumor suppressor BRCA1 (MIM #113705) predispose women for breast and ovarian cancer ,162. Typt cancer . The famutations . BRCA1 fBRCA1 or BRCA2. Both genes play important roles in the HR repair pathway. Inactivation of either BRCA1 or BRCA2 has been shown to drastically decreases HR activities [A remarkable therapeutic opportunity has been discovered recently for cancer patients that carry mutations of the familial breast cancer genes tivities ,165. Inttivities -169. PARtivities . In the tivities ,167. Sevtivities . There iBrca1 mutation have been reported[Brca1 null mutations lead to early embryonic lethality [Brca1 mutations to mammary epithelial cells lead to mammary tumorigenesis [Several mouse models for  reported. While Bethality , targeteigenesis ,174. In Brca1 mutations (\u039411/\u039411Brca1) [BRCA1 associated breast cancers, the responses of these cancers to therapies and the mechanisms and significance of the reduced 53BP1 expression in breast tumors with BRCA1 or BRCA2 mutations.Interestingly, recent studies demonstrated that inactivation of 53bp1 rescued the proliferation defect and hypersensitivity to DNA damaging agents, and partially restored the HR defects of Brca1 deficient cells ,176. Ina\u039411/\u039411) . 53BP1 eRemarkable progress has been made over the past few years regarding the signaling and repair mechanisms of DNA double-strand breaks. Post-translational modifications have emerged as key factors that regulate these processes. Although more studies are required to identify missing players in these repair/signaling pathways and the mechanisms that control these processes, it is likely that the considerable amount of knowledge accumulated over the years will facilitate the development of better therapies for human diseases including cancer.The authors declare that they have no competing interests.TB, MB and RH wrote the manuscript. All authors read and approved the final manuscript."}
+{"text": "Normal human lymphocytes were exposed to OH. radicals produced indirectly by exposure to H2O2 or directly by gamma irradiation. Using a flow cytometry technique to measure changes in nucleoid size, it was found that generation of OH. in each system produced a characteristic relaxation in nuclear supercoiling. Exposure of cells to H2O2 produced a metal-dependent step-wise relaxation in extracted nucleoids, while gamma irradiation induced a gradual dose-dependent increase in nucleoid size. The site-specific metal-dependent changes produced in lymphocytes incubated in H2O2 should also occur in gamma irradiated cells, but the characteristic effects on nuclear supercoiling would not be detected within the background of random DNA damage. The importance of metals in maintaining the supercoiled loop configuration of DNA within the protein matrix suggests that free radical damage at metal locations may be particularly toxic for the cell."}
+{"text": "Their results suggest that if clinicians look for common psychiatric and medical conditions in those complaining of prolonged fatigue, the rate of detection will be higher than previously estimated. The most common co-morbid condition identified was depression, suggesting a simple mental state examination remains the most productive single investigation in any new person presenting with unexplained fatigue. Currently, most diagnostic criteria advice CFS should not be diagnosed when an active medical or psychiatric condition which may explain the fatigue is identified. We discuss a number of recent prospective studies that have provided valuable insights into the aetiology of chronic fatigue and describe a model for understanding chronic fatigue which may be equally relevant regardless of whether or not an apparent medical cause for fatigue can be identified.There are currently no investigative tools or physical signs that can confirm or refute the presence of chronic fatigue syndrome (CFS). As a result, clinicians must decide how long to keep looking for alternative explanations for fatigue before settling on a diagnosis of CFS. Too little investigation risks serious or easily treatable causes of fatigue being overlooked, whilst too many increases the risk of iatrogenic harm and reduces the opportunity for early focused treatment. A paper by Jones See the associated research paper by Jones et al:  The metaphor reinforces the idea that in medicine common things happen commonly and that clinicians should avoid spending too much time chasing rare or unlikely diagnoses. Fatigue is a very common clinical problem with many possible causes ,2. Some Medicine , as wellAt present, and despite much effort, there are no investigative tools or physical signs that can confirm the presence of CFS and it remains a diagnosis of exclusion . As a reStudies based in specialized clinics have suggested that yields from detailed investigations of those with prolonged fatigue are low, with only 5% of laboratory tests revealing an underlying cause . Howeveret al. [et al. did find some 'zebras' but, as expected, these were relatively rare. A simple mental state examination appears to remain the most productive single investigation in any new person presenting with unexplained fatigue [A clinician assessing a patient in the community with apparent CFS may well ask 'If I look, how likely am I to find a contributing medical or psychiatric cause for the fatigue, and what difference will this make?' A paper by Jones et al.  may helpet al. -19, incret al. . Based o fatigue .et al.'s findings also raise questions about the nature of chronic fatigue. Currently, most diagnostic criteria suggest CFS should not be diagnosed when an active medical or psychiatric condition is identified which may explain the fatigue [The identification of potentially treatable causes of fatigue has obvious clinical importance. However, Jones  fatigue . This im fatigue ,19,22-25 fatigue . Based o fatigue ,28. This fatigue . There i fatigue ,31. ThusCFS: chronic fatigue syndrome.The authors declare that they have no competing interests.The authors contributed equally to the writing of this articleTests that should usually be done:\u2022 urinalysis for protein, blood and glucose\u2022 full blood count\u2022 urea and electrolytes\u2022 liver function\u2022 thyroid function\u2022 erythrocyte sedimentation rate or plasma viscosity\u2022 C-reactive protein\u2022 random blood glucose\u2022 serum creatinine\u2022 screening blood tests for gluten sensitivity\u2022 serum calcium\u2022 creatine kinase\u2022 assessment of serum ferritin levels (children and young people only).Additional serology tests that should only be done if the history suggests the possibility of a recent infection:\u2022 chronic bacterial infections, such as borreliosis\u2022 chronic viral infections, such as HIV or hepatitis B or C\u2022 acute viral infections, such as infectious mononucleosis (use heterophile antibody tests)\u2022 latent infections, such as toxoplasmosis, Epstein-Barr virus or cytomegalovirus.The pre-publication history for this paper can be accessed here:"}
+{"text": "Lentivirus to integrate within active transcription units and is required for efficient viral replication. We now present a crystal structure containing the N-terminal and catalytic core domains (NTD and CCD) of HIV-2 IN in complex with the IN binding domain (IBD) of LEDGF. The structure extends the known IN\u2013LEDGF interface, elucidating primarily charge\u2013charge interactions between the NTD of IN and the IBD. A constellation of acidic residues on the NTD is characteristic of lentiviral INs, and mutations of the positively charged residues on the IBD severely affect interaction with all lentiviral INs tested. We show that the novel NTD\u2013IBD contacts are critical for stimulation of concerted lentiviral DNA integration by LEDGF in vitro and for its function during the early steps of HIV-1 replication. Furthermore, the new structural details enabled us to engineer a mutant of HIV-1 IN that primarily functions only when presented with a complementary LEDGF mutant. These findings provide structural basis for the high affinity lentiviral IN\u2013LEDGF interaction and pave the way for development of LEDGF-based targeting technologies for gene therapy.Lens epithelium derived growth factor (LEDGF), also known as PC4 and SFRS1 interacting protein 1 (PSIP1) and transcriptional co-activator p75, is the cellular binding partner of lentiviral integrase (IN) proteins. LEDGF accounts for the characteristic propensity of  Retroviruses crucially rely on insertion of their genomes into a host cell chromosome, and this process is carried out by the viral enzyme integrase. HIV and other lentiviruses also depend on LEDGF, a cellular chromatin-associated protein, which binds their integrase proteins and tethers them to a human chromosome. The interaction between integrase and LEDGF can potentially be exploited for directing integration of lentiviral vectors in gene therapy applications, as well as for development of antiretroviral drugs. Herein, we present a three-dimensional structure of a protein\u2013protein complex containing a fragment of HIV integrase and the integrase-binding domain of LEDGF. Our structure elucidates the hitherto unknown LEDGF\u2013integrase interface involving the amino terminal portion of the viral enzyme. Using a range of complementary approaches, we further show that these novel protein\u2013protein contacts are essential for the function of LEDGF in HIV integration. The novel structural details will be very useful for the development of HIV inhibitors that target the integrase\u2013LEDGF interaction. Furthermore, they enabled us to design a mutant of HIV integrase that depends on a reverse-engineered mutant of LEDGF, providing an inroad to the design of LEDGF-based lentiviral vector targeting strategies. Integration of reverse transcribed viral cDNA into the host cell genome is an essential step in the retroviral life cycle. This process is catalyzed by integrase (IN), a virus-derived enzyme, which carries out two separate reactions acting on both cDNA termini (reviewed in 35E motif) that coordinate a pair of Mg2+ cations during catalysis NTD+CCD) Retroviral INs share a conserved three domain organization, each containing a central catalytic core domain (CCD), flanked by N- and C-terminal domains (NTD and CTD) in vitroLentiviral DNA integration critically depends on lens epithelium-derived growth factor (LEDGF) . This size is consistent with a dimer of HIV-2 INNTD+CCD plus one or two LEDGFIBD molecules, closely matching the basic building unit observed in the crystal (2LEDGF substructure). The substructure assembles further into closed trimers with a three-fold NCS  as well as hydrophobic stacking interactions involving Lys-14 and Tyr-15 of the NTD and Trp-131, Trp-132, and Lys-186 of the CCD. An almost identical NTD-CCD interface was observed in the crystal structure of the uncomplexed HIV-1 INNTD+CCD tetramer 2LEDGF substructure . Consistent with earlier reports The domain\u2013domain interfaces observed in the crystal structure were targeted by mutagenesis to investigate their functional relevance. Three LEDGF mutants were designed to eliminate or reverse the positive charges facing the IN NTD: K401A/K402A/R405A (AAA), K401E/K402S/R405E (ESE), and K401E/K402E/R405E (EEE). The K360E mutation targeted a salt bridge from LEDGF residue Lys-360 to IN Asp-167 within the IBD-CCD interface 6-tag pull down experiments. To demonstrate that these observations were not due to off-site effects such as defective folding or reduced expression of the LEDGF mutants and to validate the novel NTD-IBD interface further, the complementary IN residues were mutated, producing a reversed charge D6K/E10K/E13K (KKK) HIV-1 mutant. Impressively, KKK IN robustly interacted with the complementary EEE LEDGF mutant, generating \u223c40% of WT-WT \u03b2-galatosidase activity and furthermore, it failed to interact with WT LEDGF . The relative efficiencies of concerted and half-site integration processes strongly depend on the in vitro reaction conditions, with parameters such as the length of the donor DNA, enzyme source and concentration, and presence of crowding agents greatly affecting the outcomes Whereas in vitro, although the fidelity of LEDGF-mediated strand transfer varies for the different INs LEDGF robustly promotes the strand transfer activities of divergent lentiviral INs in vitro to a similar extent In the presence of 10 nM 500-bp donor substrate, 2.9 kb supercoiled plasmid DNA (pGEM), and WT LEDGF, WT HIV-1 IN carries out robust, predominantly half-site strand transfer In agreement with earlier observations Significantly, both KK and KKK IN mutants gained concerted integration activity in the presence of EEE LEDGF. Furthermore, both IN mutants, and most dramatically KKK IN, favored the mutant LEDGF form . These rLedgf-null mouse embryo fibroblasts (MEFs) transfected with a human LEDGF expression vector or its mutant forms were infected with single-round, vesicular stomatitis virus glycoprotein G (VSV-G)-pseudotyped HIV-1 vectors expressing a luciferase reporter gene (HIV-Luc), and the levels of luciferase activity in cell extracts were measured 44 h post infection. The WT and mutant LEDGF proteins were well-expressed, and endogenous mouse LEDGF protein, as predicted, was not detected in cells transfected with the empty vector  of WT HIV-Luc infectivity in the presence of WT LEDGF. These results confirm that modifications of the charge-charge NTD-IBD interface allow creation of viable gain of function IN mutants able to functionally interact with an engineered version of LEDGF.Release and infectivity of HIV-1 mutants carrying substitutions at IN positions 6, 10, and 13 were impaired to various extents. The KKK variant was most affected, failing to support any appreciable infectivity under a variety of conditions. This result was not unexpected, as often subtler changes in IN grossly affect various HIV-1 replication steps E or EEE . SignifiE or EEE . In repeNTD+CCD:LEDGFIBD complex contained closed trimers of the IN2LEDGF substructure held together primarily by IN-IN contacts. Based on the three-fold symmetry of this assembly, we tentatively speculate that it could reflect packing arrangement of IN molecules within retroviral capsids, which too feature three-fold symmetry 2LEDGF substructure are biologically relevant. Such evidence could come, for example, by observing similar multimers in crystals of a divergent retroviral IN. Although we have not detected analogous large-sized complexes in solution, the calculated concentration of IN within retroviral capsids is very high In this work we extended the known lentiviral IN-LEDGF interface to include the interactions between the NTD of IN and the IBD of LEDGF. Since there is no evidence that the CTD of IN or LEDGF regions outside of the IBD are involved in the interaction, the contacts observed in our crystal structure may very well represent the entire IN-host factor interface. These novel structural details will invariably aid the development of inhibitors of the IN-LEDGF interaction. Intriguingly, both crystal forms of the HIV-2 INNTD+CCD fragment, Craigie and colleagues proposed a plausible model for the synaptic IN tetramer (dimer of dimers) NTD+CCD:LEDGFIBD complex were seen in the earlier structure, where the NTDs mediated contacts between IN dimers NTD+CCD structure, which lacked appreciable electron density for the NTD-CCD linkers in vitro conditions Mounting experimental evidence suggests that the active form of retroviral IN is a tetramer Lentivirus-host interaction. Compared to the lock-and-key CCD-IBD interface, the contacts involving the NTD are based on charge-charge interactions and therefore lend themselves to complementary reverse-charge engineering. Since LEDGF has been shown to target lentiviral integration to active transcription units in vitroUsing complementary approaches we demonstrated that the NTD-IBD interface is important for the functional NTD+CCD and pES-IBD-3C7 were used for co-expression of HIV-2 INNTD+CCD and LEDGFIBD in bacteria. To obtain the former, a fragment encoding residues 1\u2013209 of HIV-2 IN was inserted between NcoI and BamHI sites of pCDF-Duet1 (Novagen); the latter was made by TA-cloning of a PCR fragment encoding LEDGF residues 347\u2013471 with an internal human rhinovirus 14 (HRV14) 3 C protease cleavage site  into pET-SUMO (Invitrogen). pCPH6P-HIV1-IN, used for expression of full-length HIV-1 IN, was obtained by replacement of an XmaI/XhoI fragment encoding BIV IN in pCPH6P-BIV-IN HXB2 IN. Mutations were introduced into pCPH6P-HIV1-IN and pFT1-LEDGF env-deficient HIV-1 proviral clone pNLX.Luc(R-) encoding HIV-1 with a gene for firefly luciferase in place of Nef (HIV-Luc) and pIRES2-eGFP-LEDGF, as previously described Saccharomyces cerevisiae Ulp1 (residues 403\u2013621) Compatible plasmids pCDF-HIV2-INNTD+CCD:LEDGFIBD complex for crystallography, Escherichia coli PC2 cells NTD+CCD and pES-IBD-3C and grown in LB medium in the presence of 50 \u00b5g/ml kanamycin and 100 \u00b5g/ml spectinomycin to an A600 of \u223c1.0 were supplemented with 50 \u00b5M ZnCl2 and induced with 0.3 mM isopropyl-\u03b2-D-thiogalactopyranoside. Following 4 h induction at 22\u00b0C, cells were harvested and stored at \u221280\u00b0C. For purification, cells were lysed by sonication in 1 M NaCl, 20 mM imidazole, 0.2 mM PMSF, 50 mM Tris-HCl, pH 7.4, and the protein complex was captured on Ni-NTA agarose (Qiagen). Following extensive washing the protein was eluted in 1 M NaCl, 200 mM imidazole, 50 mM Tris-HCl, pH 7.4. The His6-SUMO tag was cleaved by overnight incubation with SUMO protease at 7\u00b0C in the presence of 2 mM DTT. The sample was diluted with four volumes of 1 M NaCl, and the released His6-SUMO was depleted by absorption onto a 5-ml HisTrap column . Residues C-terminal to the IBD were removed by overnight digestion with HRV14 3 C protease in the presence of 10 mM DTT at 7\u00b0C. The complex was then purified by chromatography over a Superdex-200 column  in 1 M NaCl, 50 mM Tris-HCl, pH 7.4, concentrated to 17 mg/ml, supplemented with 10 mM DTT and 10% glycerol, and flash-frozen in liquid nitrogen.To obtain HIV-2 IN6-tag was removed by digestion with HRV14 3 C protease. Non-tagged EIAV IN and C-terminally His6-tagged HIV-1, HIV-2, BIV, EIAV, and MVV IN proteins have been reported Non-tagged wild type and mutant HIV-1 IN proteins used in strand transfer assays were produced in PC2 cells transformed with pCPH6P-HIV1-IN or its mutant forms as previously described NTD+CCD:LEDGFIBD complex at a concentration of 4 mg/ml in 20 mM Tris-HCl, pH 7.4, 300 mM NaCl, and 2 mM dithiothreitol (DTT) with 1 \u00b5l reservoir solution containing either 2.6 M sodium acetate, 0.1 M KI and 0.1 M Bis-Tris propane-HCl, pH 7.0 (form I) or 2.5 M sodium acetate, 10 mM MgCl2, and 0.1 M Bis-Tris propane-HCl, pH 7.0 (form II). Crystals of form I appeared within 24 h and reached the maximum size of \u223c300\u00d7300\u00d7300 \u00b5m within 10\u201330 days, while those of form II appeared within a week and grew over several months to \u223c150\u00d7150\u00d7150 \u00b5m. Both types of crystals were cryoprotected in 25% glycerol, 2.6 M sodium acetate, 10 mM MgCl2, 0.1 M Bis-Tris propane-HCl, pH 7.0. Diffraction data were collected to a resolution of 3.0 \u00c5 (form I) and 3.2 \u00c5 (form II) at the European Synchrotron Radiation Facility (ESRF) beamline ID23-1 at 100 K. The data were processed using MOSFLMSCALACCP4 project Vapor diffusion crystallization experiments were set up at 18\u00b0C in hanging drops by mixing 1 \u00b5l HIV-2 INMOLREPREFMACPHENIXCOOTCrystal form I belonged to the space group P321 with unit cell parameters a\u200a=\u200ab\u200a=\u200a210.5 \u00c5, c\u200a=\u200a162.6 \u00c5, \u03b1\u200a=\u200a\u03b2\u200a=\u200a90\u00b0, and \u03b3\u200a=\u200a120\u00b0. The structure was solved by molecular replacement with 12121 with unit cell parameters a\u200a=\u200a201.4 \u00c5, b\u200a=\u200a202.5 \u00c5, c\u200a=\u200a280.5 \u00c5, and \u03b1\u200a=\u200a\u03b2\u200a=\u200a\u03b3\u200a=\u200a90\u00b0. A high degree of NCS was expected due to the large unit cell. Therefore, to reduce potential bias in Rfree estimation, the test reflection set was chosen in thin shells using SFTOOLS, part of the CCP4 program suite PHASERPHENIX and restrained refinement in REFMAC, imposing tight 12-fold NCS restraints. Positive Fo-Fc density was observed at the known binding sites for zinc and magnesium and the corresponding atom was added to the structure. Details on data collection and refinement statistics are shown in Form II crystals belonged to the space group P26-tag pull-down and yeast two-hybrid assays were performed as described previously S. cerevisiae strains Y187 and AH109 were from BD Biosciences. Untagged, recombinant INs were used in all strand transfer assays. HIV-1 and EIAV integration assays with the respective 500-bp and 225-bp RU5 donor DNA substrates were carried out as previously described 5\u2032-GGACTGAGGGGCCTGAAATGAGC/5\u2032-ACTGTTGGGTGTTCTTCACCGCCCC GCGAGCT and pU3U5 template; primers 5\u2032-TTAAGTTGGGTAACGCCAGG/5\u2032-ACT GTAGGATCTCGAACAGAC and pU3U5-EIAV template were used to make the EIAV donor His5\u2032-CCTTTTAGTCAGTGTGGAAAATCTCTAGCA or 5\u2032-CCTTTTAGTCAGTGTGGAAAATCTCTAGCAGT and 5\u2032-ACTGCTAGAGATTTT CCACACTGACTAAAAGG to create a 32 bp mimic of the pre-processed or non-processed HIV-1 U5 cDNA terminus, respectively. Two \u00b5l HIV-1 IN in 750 mM NaCl, 2 mM DTT, 20 mM Tris-HCl, pH 7.4 (DB) was added to 36 \u00b5l master mix containing 0.55 \u00b5M donor DNA and 0.30 \u00b5g supercoiled pGEM-9Zf(-) target DNA in 25.3 mM NaCl, 5.5 mM MgSO4, 11 mM DTT, 4.4 \u00b5M ZnCl2, 22 mM HEPES-NaOH, pH 7.4. Following a 3\u20135 min pre-incubation at room temperature, reactions were supplemented with 2 \u00b5l LEDGF in DB and allowed to proceed at 37\u00b0C for 30 min. The final concentrations of HIV-1 IN and LEDGF were both 0.6 \u00b5M. The reactions were stopped by addition of 25 mM EDTA and 0.5% SDS. The products deproteinized by digestion with 30 \u00b5g Proteinase K for 1 h at 37\u00b0C and ethanol precipitation were resolved by electrophoresis in 1.5% agarose gels and detected using ethidium bromide.For enhanced HIV-1 concerted integration assays, donor DNA was prepared by annealing DNA oligonucleotides O-phosphotransferase gene flanked by KpnI sites E. coli cells were transformed with the ligation mixture. Plasmids were isolated from individual kanamycin-resistant colonies, and those releasing fragments of expected sizes (\u223c3 and 1.2 kb) upon digestion with KpnI, were sequenced using primers annealing within the Tn5-derived fragment.For sequencing analysis, reaction products migrating as a band of \u223c3 kb were isolated from a 1.5% agarose gel and converted into fully double stranded forms by treatment with \u03a629 DNA polymerase (New England Biolabs) in the presence of 500 \u00b5M dNTPs. The DNA was then 5\u2032-phosphorylated and ligated to a blunt-ended 1.2-kb PCR fragment spanning the Tn5 aminoglycoside-3\u2032-32P-based reverse transcriptase (RT) assay. The Ledgf-null E2(\u2212/\u2212) mouse embryo fibroblasts (MEFs) transformed with simian virus 40 large T antigen were previously described Single cycle infectivity assays were done as described elsewhere Text S1Validation of LEDGF-Dependent Concerted HIV-1 IN Strand Transfer Activity(0.04 MB DOC)Click here for additional data file.Figure S1Examples of Electron Density for Different Regions of the Structure. (A) The CCD-IBD interface with crucial LEDGF residues Asp-366 and Ile-365 labeled. In all panels the 2fo-fc electron density contoured at 1.5 \u03c3 level is shown as chicken wire in blue, and protein residues are represented as sticks. Coloring of carbon atoms is related to their chain ; nitrogen, oxygen, and sulfur are blue, red, and yellow, respectively. (B) The HHCC motif, including a coordinated Zn atom (gray sphere). (C) The native side-chain and corresponding electron density of HIV-2 IN residue Phe-185.(6.93 MB TIF)Click here for additional data file.Figure S2Stereo Image Showing Details of the HIV-2 IN CCD-LEDGF IBD Interface. Interacting residues are shown as sticks and are labeled. Cartoon and carbon atoms are colored according to their chain . Hydrogen bonds between Asp-366 and the main chain amides of IN residues Asn-170 and Thr-171 are shown as black dashes.(1.28 MB TIF)Click here for additional data file.Figure S32LEDGF substructure is shown in green, cyan, and pink , crystallized as a tetramer (dimer of dimers). One dimer of IN (green and cyan) is shown with the CCDs in the same orientation as in panel A, with the tetramer completed by the dimer colored yellow and orange. The yellow NTD enclosed in an oval is in the same position and orientation as the green NTD in (A), while the orange NTD (circled) is in a similar position but a different orientation to the dark blue NTD in (A). (C) Schematic diagram of the proposed assembly and domain interactions within the active synaptic complex (IN CTDs are not shown). Coloring of the IN and IBD molecules is same as in (A) and (B); large circles represent the IN CCDs, small circles the NTDs, and parallelograms the IBDs. NTDs are connected to the same-chain CCDs by flexible hinges (black curves). Association of the two dimers during synaptic complex assembly involves a swap of an NTD from each dimer to interact with a CCD from the opposing dimer. When loaded, LEDGF would engage the CCDs from one dimer and an NTD from another, effectively stabilizing the complex. Further, it is also speculatively possible that the other NTD interacts with the IBD, as seen with the dark blue NTD in (A). (D) Alternative model for the assembly of the synaptic complex in which there is no NTD swap. In this case the IBD of LEDGF stabilizes the synaptic complex by locking the NTDs in the correct orientation for tetramerization.A Model for IN Tetramerization via Inter-Dimer NTD Swapping. (A) The INnk as in . The NTDd trimer . (B) The(0.81 MB JPG)Click here for additional data file.Figure S4Validation of LEDGF-Dependent Concerted HIV-1 IN Strand Transfer Activity. (A) Increasing input of donor DNA favors concerted integration. Lane 1 contains a mock sample, where IN and LEDGF were omitted; lane 2 shows activity in the absence of LEDGF; lane 3 contained both LEDGF and IN, but no donor DNA. Lanes 4\u20139: HIV-1 IN was incubated with 1 \u00b5M-4 nM (as indicated) blunt 32-bp donor DNA mimicking the U5 HIV-1 cDNA end and supercoiled target DNA in the presence of LEDGF. (B) HIV-1 IN strand transfer inhibitor MK0518  effectively blocks accumulation of full- and half-site reaction products. Lanes 4\u20139: HIV-1 IN was incubated with 0.5 \u00b5M pre-processed 32-bp donor DNA in the presence of LEDGF and MK0518 at final concentrations of 1,400 \u00b5M (lane 4), 140 \u00b5M (lane 5), 14 \u00b5M (lane 6), 1.4 \u00b5M (lane 7), 0.14 \u00b5M (lane 8), or 0.014 \u00b5M (lane 9). Almost complete suppression of half- and full-site integration is achieved at 1.4 \u00b5M MK0518, which is comparable to the concentration of IN (0.8 \u00b5M) used in this experiment. The inhibitor was not present in lane 3. Lane 1 contained a mock sample without IN and LEDGF; the cofactor was omitted from the reaction in lane 2. Migration positions of DNA size standards, DNA substrate, open circular (o.c.), and supercoiled (s.c.) target DNA forms, half- and concerted (full-site) products are indicated. (C) 2-D agarose gel analysis of reaction products formed under conditions of enhanced concerted integration. DNA species obtained from incubation of pre-processed 32-bp donor DNA and supercoiled pGEM target in the presence of HIV-1 IN and LEDGF (lane 1), IN alone (lane 2), or in the absence of both proteins (lane 3) were separated in 0.6% agarose along with 1-kb ladder DNA (lane L) (top gel). A lane with a sample identical to that in lane 1 was excised from the gel. In this gel slice, two wells were created for parallel separation of the 1-kb DNA ladder and another aliquot of sample 1. The DNA was then separated in the perpendicular direction in a 1.6% agarose gel and visualized with ethidium bromide. Projected migrations of the linear DNA standards are indicated with red crosses. Note migration of the full-site (FS) product along the arc defined by the linear DNA size standards, while circular DNA species  appear above the arc. Products of multiple full-site events are expected to result in a gamut of linear DNA species of variable lengths migrating as smears in agarose gels; akin to the full-site product, these species distribute along the arc.(2.33 MB TIF)Click here for additional data file."}
+{"text": "LMNA gene mutation while Restrictive Dermopathy (RD) individuals                            have a homozygous deficiency in the processing protease Zmpste24.  These                            mutations generate the mutant lamin A proteins progerin and FC-lamina A,                            respectively, which cause nuclear deformations and chromatin perturbations.                             Genome instability is observed even though genome maintenance and repair                            genes appear normal.  The unresolved question is what features of the DNA                            damage response pathways are deficient in HGPS and RD cells.  Here we                            review and discuss recent findings which resolve some mechanistic details                            of how the accumulation of progerin/FC-lamin A proteins may disrupt DNA                            damage response pathways in HGPS and RD cells.  As the mutant lamin                            proteins accumulate they sequester replication and repair factors, leading to                            stalled replication forks which collapse into DNA double-strand beaks                            (DSBs).  In a reaction unique to HGPS and RD cells these accessible DSB                            termini bind Xeroderma pigmentosum group A (XPA) protein which                            excludes normal binding by DNA DSB repair proteins.  The bound XPA also                            signals activation of ATM and ATR, arresting cell cycle progression,                            leading to arrested growth.  In addition, the effective sequestration of                            XPA at these DSB damage sites makes HGPS and RD cells more sensitive to                            ultraviolet light and other mutagens normally repaired by the nucleotide                            excision repair pathway of which XPA is a necessary and specific                            component.                                      Progeria syndromes have in                            common a premature aging phenotype and increased genome instability.  The                            susceptibility to DNA damage arises from a compromised repair system,                            either in the repair proteins themselves or in the DNA damage response                            pathways.  The most severe progerias stem from mutations affecting lamin A                            production, a filamentous protein of the nuclear lamina.                             Hutchinson-Gilford progeria syndrome (HGPS) patients are heterozygous for a                             The accumulated changes lead to deficiencies in                        enzymes involved in necessary metabolic and maintenance processes, over time                        causing an escalating loss of function with an inability to maintain                        replicative fidelity of the genome [The aging process represents progressive                        changes in a cell or an organism which culminate in death due to accumulated                        defects in function leading to system failure .  Thesee genome -4.  ThusIndividuals                        with a progeroid syndrome have a premature aging phenotype and, depending on                        the specific mutations involved, the effects on lifespan may range from                        moderate to severe.  Examples include Werner syndrome (WS), Bloom syndrome                        (BLM), Cockayne syndrome (CS), ataxia-telangiectasia (AT), Hutchinson-Gilford                        progeria syndrome (HGPS), and restrictive dermopathy (RD).  They arise from                        mutations in one or several genes involved in DNA metabolism or in its                        regulation.  Accelerated aging also may result from partial genome imbalances                        as seen in the chromosomal disorders of Down, Klinefelter and Turner syndromes.                                                          WRN or BLM genes which encode RecQ DNA helicase proteins [E                xcision R                epair C                ross-C                omplementing                        group 6                 or 8                 proteins  [ATM (a                taxia-t                elangiectasia m                utated) gene                        cause AT; ATM encodes a phosphatidylinositol-3-kinase involved in the                        cell cycle checkpoint signaling pathway for detection of DNA damage and its                        subsequent repair [WS or BLM arise from mutations in the proteins -7 while t repair ,10. Thust repair -16.    t repair ,15,17. t repair -20. Simit repair .  Thus, LMNA gene; exons 1-10 encode the N-terminal 566                            amino acids of lamins A and C; however, exons 11 and 12 are unique to lamin A                            mRNA and code for an additional 98-amino acid C-terminal region which contains                            functionally important post-translational modification sites.  Lamin B1 and B2                            (B-type) are encoded by LMNB1 and LMNB2 genes and are expressed                            throughout development and in adult cells.  In contrast, LMNA expression                            occurs in differentiated cell types. Lamins A and B differ from lamin C in that                            they are post-translationally modified in their C-terminal regions ;                            the farnesylated and carboxy-methylated prelamin A (FC-prelamin A) is                            toxic, especially with the absence of normal lamin A, causing perinatal death [LMNA gene                            itself.  The dominant mutation is a C\u00e0T base                            substitution at position 1824 within exon 11.  Although there is no amino acid                            change (G608G) a cryptic splice donor site is activated within exon 11.                             Sporadic use of this cryptic site in splicing of LMNA pre-mRNA removes                            an additional 150 base-pair sequence, causing a 50-amino acid deletion  forms and                            accumulates though at a much slower rate than for FC-prelamin A formed with the                            homozygous Zmpste24 mutation in RD.  While the farnesyl and carboxy-methyl                            moieties are necessary for lamin B functions their persistence in progerin and                            FC-lamin A causes multiple abnormalities in nuclear structure and function [1 chromatin and may lead to formation of bi-nucleate                            cells [The                            HGPS and RD laminopathies arise from deficiencies in these post-translational                            modifications of prelamin A.  All Zmpste24  enzymatic  activity is lost in individuals with RD                             are extremely                            sensitive to DSB inducers such as camptothecin (CPT) and etoposide [The laminopathy-based progeroid cells                            also were found to be sensitive to various DNA damaging agents. In particular,                            Zmpste24toposide , which itoposide .       toposide . These via ATM signaling [Ch                    romatin I                    mmuno-P                    recipitation (ChIP)                            procedure [HGPS                            and RD cells in culture exhibit limited growth potential relative to BJ normal                            human primary fibroblast cells.  Young HGPS and RD cells grow quite well but                            the cells senesce quickly relative to normal fibroblasts and growth stops, much                            sooner for RD than HGPS .  As theignaling ,40.  Thurocedure .  A    i.e., phosphorylation of p53) via the kinase activities of Chk1 and Chk2 [DNA damage in cells evokes a checkpoint response which                            moderates cell cycle progression for repair of the damage  Figure .  The fiand Chk2 ,43.    Culture-aged                            HGPS and RD cells contain accumulated DNA damage and compromised genome                            integrity.  Liu et al. examined these cells to determine if the damage                            checkpoint pathways were persistently activated .  They Liu                            et al. also determined biochemically whether ATM and ATR activities were                            responsible for the reduced replicative capacity of HGPS cells.  Caffeine                            inhibits both ATM and ATR, and caffeine-treated HGPS cells demonstrated a                            significant restoration of replicative activity.  Knockdown of ATM and ATR                            protein levels by siRNA silencing also restored significant replicative                            activity .  Thus, Are the activation and sub-nuclear clustering of ATM                            and ATR in progeroid cells directly related to the accumulated progerin                            protein?  This question was addressed by investigating the effects of progerin                            expression in normal cells and, alternatively, the inhibition of the prelamin A                            processing in progeroid cells .  It wasGenome                            instability can arise from multiple causes; one of the most obvious being an                            increased sensitivity to DNA damage due to genetic or epigenetic deficiencies                            in DNA repair.  The persistent activation of ATM/ATR checkpoint pathways in                            HGPS and RD reflects a delay in DNA repair efficiency in these cells .  The DSi.e., ATR, ATM, Chk1, Chk2 and                            p53) were activated [-/-mice and in HGPS cells treated with \u03b3-irradiation [It is expected that multiple DSB repair                            proteins would be recruited to the DNA damage sites for repair as part of the                            damage response.  Surprisingly, such was not the case.  Employing                            immunofluorescence tracking of \u03b3-H2AX foci and neutral single-cell                            electrophoretic (comet) assays to measure DNA DSBs Zou's group observed a                            significant parallel increase in nuclear \u03b3-H2AX foci and DSB frequency in                            HGPS cells relative to BJ fibroblasts.  Cellular progerin levels exhibited                            similar increases in the aged progeroid cells .  Althouctivated ,       ctivated .  This wctivated ,44-46 anctivated .  In   ctivated . Impaireadiation . These dXeroderma                                    pigmentosum group A (XPA) protein is                            a specific and essential factor for NER but is not involved in the repair of                            DSBs [per se in HGPS                            and RD cells is functional, and, also that the XPA behaves normally in not                            binding to genotoxin-induced DSBs.                                              DSBs .  The ro    DSBs ,48-51. N    DSBs .  XPC is    DSBs  but did     DSBs .       How                            does the binding of XPA to laminopathy-generated DSBs relate to the lack of                            Rad50 and Rad51 binding?  Is the XPA association with the DSBs sufficient to                            exclude these proteins?  Zou's group employed the ChIP assay and siRNA                            knockdown of XPA to resolve these questions.  XPA was found in the                            \u03b3-H2AX-associated chromatin fragments from HGPS cells but not from normal                            BJ cells, even when DSBs were induced in the latter by CPT .  Nuclea. observed that XPA depletion partially restored the                            recruitment of Rad50, Rad51 and Ku70 to \u03b3-H2AX chromatin containing DNA                            DSBs [If                            this XPA association with DSBs in progeroid chromatin is sufficient to exclude                            Rad50 and Rad51, this exclusion should be reversible with XPA depletion by                            knockdown with RNAi.  Lui et al    DSBs ,52.  ThiBomgarden et al. found that of the multiple NER                            factors XPA specifically was needed for ATR signaling of DNA damage during                            S-phase and that XPA knockdown compromised the normal response to UV damage .  This iLamin A and C proteins form nucleoplasmic                            foci which organize proteins for initiation of replication in early S-phase,                            including the colocalization of PCNA .       Why                            does XPA colocalize with the laminopathy-induced DSBs marked by \u03b3-H2AX in                            aging progeroid cells?  Stalled replication forks may result in S-phase arrest                            via persistent ATM/ATR activation ,53.  DSB-/- mice to block the                            prenylation reaction since it is believed that a major phenotype-inducing                            element of progerin and FC-prelamin A is the farnesyl moiety [Farnesyl transferase inhibitors (FTIs) have been                            applied to progeroid cells and to Zmpste24l moiety ,29.  FTIl moiety ,66.    l moiety ,19,52. l moiety ,68.  Thel moiety ,68.    Great                            interest in understanding HGPS has been promoted by recent findings that linked                            normal aging to the laminopathy disease. The connection is supported by several                            lines of evidence and observation. First, the same mechanism responsible for                            HGPS is also active in normal aging cells . Cells f-/-cells as well as normal aging cells which also express low levels of progerin.                        The endogenously induced DNA damage in these cells is unrepairable and                        concurrent with aberrant nuclear morphology. In HGPS and RD cells, however, the                        accumulated damage can not be reversed by treatment with FTIs though the                        treatment restores the normal nuclear morphology of the cells. In response to                        the accumulated DNA damage, ATM and ATR checkpoints are highly and persistently                        activated in these progeroid cells, leading to accelerated replicative arrest.                        Importantly, the fact that DNA damage is unrepairable is at least in part due                        to a \"murder-suicide\" action mediated by wild-type NER protein XPA which is                        unexpectedly trapped to DSB sites. The action not only blocks the access of                        DSBs to DSB repair factors but also abolishes NER to which XPA belongs. This                        mechanism also represents the first known case in which a protein from one DNA                        repair pathway disrupts another DNA repair pathway. Due to the common                        involvement of progerin in both HGPS and normal aging, it will be of great                        interest to see if the same mechanism is also true in normal aging. In addition,                        outstanding questions as to what is the cause for XPA mislocalization to the                        DSB sites and what is the epigenetic role of progerin in this process remain to                        be addressed in the future.                                Genome instability caused by cellular                        accumulation of DNA damage, particularly DNA double-strand breaks, is a common                        cause of systemic aging and premature aging -4. Howev"}
+{"text": "Retroviral replication proceeds through a stable proviral DNA intermediate, and numerous host cell factors have been implicated in its formation. In particular, recent results have highlighted an important role for the integrase-interactor lens epithelium-derived growth factor (LEDGF)/p75 in lentiviral integration. Cells engineered to over-express fragments of LEDGF/p75 containing its integrase-binding domain but lacking determinants essential for chromatin association are refractory to HIV-1 infection. Furthermore, both the levels of HIV-1 integration and the genomic distribution of the resultant proviruses are significantly perturbed in cells devoid of endogenous LEDGF/p75 protein. A strong bias towards integration along transcription units is a characteristic feature of lentiviruses. In the absence of LEDGF/p75, HIV-1 in large part loses that preference, displaying concomitant integration surges in the vicinities of CpG islands and gene promoter regions, elements naturally targeted by other types of retroviruses. Together, these findings highlight that LEDGF/p75 is an important albeit not strictly essential cofactor of lentiviral DNA integration, and solidify a role for chromatin-associated LEDGF/p75 as a receptor for lentiviral preintegration complexes. By now one of the best characterized virus\u2013host interactions, the integrase-LEDGF/p75 interface opens a range of opportunities for lentiviral vector targeting for gene therapy applications as well as for the development of novel classes of antiretroviral drugs. A key step in the retroviral lifecycle is the formation of the provirus, the integrated form of the viral cDNA that is produced during reverse transcription. Retroviral integration is promoted by the viral integrase (IN) enzyme, which enters the cell as a component of the virion particle. IN catalyzes two spatially and temporally distinct reactions within the context of the preintegration complex (PIC), a large structure derived from the virus core Retroviral IN enzymes purified from a variety of sources display 3\u2032 processing and DNA strand transfer activities in vitro LEDGF/p75, a member of the hepatoma-derived growth factor (HDGF) related protein (HRP) family, was initially implicated in lentiviral biology through its association with ectopically expressed HIV-1 IN in 293T cells PSIP1) HRPs are characterized by a conserved N-terminal PWWP domain, an \u223c90\u2013 to 135\u2013amino acid module found in a variety of nuclear proteins LEDGF/p75 is a ubiquitous nuclear protein, tightly associated with chromatin throughout the cell cycle The cellular functions of LEDGF/p75 and closely related HRP2 remain largely uncharacterized, although initial reports have indicated a role for LEDGF/p75 in transcriptional regulation HIV-1 and feline immunodeficiency virus (FIV) INs predominantly localize to nuclei upon ectopic expression in a variety of cell types Additional studies revealed that LEDGF/p75 binds to a variety of lentiviral IN proteins, but, significantly, fails to interact with IN proteins derived from five  of the six other tested retroviral genera Q168A behaved as a class II IN mutant virus Q168A replication defect.HIV-1 IN is composed of three functional domains: the N-terminal domain (NTD), the catalytic core domain (CCD), and the C-terminal domain (CTD) . InitialHuntingtin, elongation factor 3, the regulatory subunit of protein phosphatase 2A, and PI3-kinase TOR The 3-D structure of the LEDGF/p75 IBD solved by nuclear magnetic resonance spectroscopy revealed a compact \u03b1-helical domain possessing topological and structural similarities to HEAT repeat domains Initial RNAi-based studies were central to establish important links between endogenous LEDGF/p75 protein and lentiviral IN expression levels and subcellular localization, yet they failed to reveal an important role for the cell factor in HIV-1 replication. In some RNAi-based studies, despite achieving what appeared to be very efficient reductions in cellular protein HIV-1 infection was fully restored to LEDGF/p75-depleted cells by ectopic expression of the cell factor The isolated IBD competitively inhibited LEDGF/p75-dependent stimulation of IN activity in vitro A128T/E170G was partially defective,and its replication capacity was reduced further upon LEDGF/p75 knockdown, suggesting that the mutant IN still depended on LEDGF/p75 for integration d of the interaction between wild type HIV-1 IN and LEDGF/p75 is notably in the low nM range . Conceivably, by slightly detuning the LEDGF/p75-binding interface, the escape mutations afforded the dissociation of PIC-born IN from non-productive complex formation with the LEDGF/p75 fragment. Following multiple cycles of association/dissociation, the PIC would eventually engage a functional cofactor molecule.An HIV-1 mutant selected for its ability to replicate in MT-4 T cells engineered to express the C-terminal portion of the p75 isoform  of 150 \u00b5M bound the CCD at the IBD interaction site The significant reductions in HIV-1 infectivity observed in cells extensively depleted for LEDGF/p75 protein Psip1 sequences.After the acceptance of this Review, Marshall et al. Accession Numberswww.ncbi.nlm.nih.gov/) using the following accession numbers: HIV\u20101 IN (NP_705928), LEDGF/p75 (NP_150091), HDGF (NP_004485), HRP1 (NP_612641), HRP2 (NP_001001520), HRP3 (NP_057157), LEDGF/p52 (NP_066967), PSIP1 (GeneID 11168); JPO2 (Q96GN5), c\u2010MYC (NP_002458), and FIV IN (NP_040973). The Protein Data Bank (http://www.rcsb.org/pdb) accession number for the CCD\u2010IBD complex is 2B4J.Detailed information on the following genes and proteins can be accessed at the National Center for Biotechnology Information (http//:"}
+{"text": "Finally, we show that CK sites in CREB are phosphorylated during cellular growth and that phosphorylation of these residues reduces the threshold of DNA damage required for ATM-dependent phosphorylation of the inhibitory Ser-121 residue. These studies define overlapping and distinct modes of CREB and ATF1 regulation by phosphorylation that may ensure concerted changes in gene expression mediated by these factors.Activating transcription factor 1 (ATF1) and the closely related proteins CREB (cyclic AMP resonse element binding protein) and CREM (cyclic AMP response element modulator) constitute a subfamily of bZIP transcription factors that play critical roles in the regulation of cellular growth, metabolism, and survival. Previous studies demonstrated that CREB is phosphorylated on a cluster of conserved Ser residues, including Ser-111 and Ser-121, in response to DNA damage through the coordinated actions of the ataxia-telangiectasia-mutated (ATM) protein kinase and casein kinases 1 and 2 (CK1/2). Here, we show that DNA damage-induced phosphorylation by ATM is a general feature of CREB and ATF1. ATF1 harbors a conserved ATM/CK cluster that is constitutively and stoichiometrically phosphorylated by CK1 and CK2 in asynchronously growing cells. Exposure to DNA damage further induced ATF1 phosphorylation on Ser-51 by ATM in a manner that required prior phosphorylation of the upstream CK residues. Hyperphosphorylated ATF1 showed a 4-fold reduced affinity for CREB-binding protein. We further show that PP2A, in conjunction with its targeting subunit B56\u03b3, antagonized ATM and CK1/2-dependent phosphorylation of CREB and ATF1  Members of the CREB/ATF subfamily of bZIP transcription factors, including CREB, CREM, and ATF1 were among the first stimulus-induced transcription factors to be identified. The seminal member of this family, CREB, was identified some twenty years ago as the major nuclear binding protein of the somatostatin cyclic AMP response element (CRE), an octanucleotide palindrome (TGACGTCA) that has been identified and functionally validated in several thousand mammalian genes Activation of CREB occurs through phosphorylation of Ser-133 within the kinase-inducible domain (KID)  within the amino-terminal region of the CREB KID. Although the functional consequences of CREB phosphorylation are not well understood, evidence suggested that ATM/CK cluster phosphorylation antagonized CREB-CBP interaction ct cells . Based oCREB undergoes a rapid ATM dependent and phosphatase-sensitive electrophoretic mobility shift on SDS-PAGE gels following cellular exposure to IR S36/41A mutant totally abolished the ATF1 electrophoretic mobility shift , Ser-36 and Ser-41 caused a change in ATF1 electrophoretic mobility; a fraction of each mutant migrated faster than the wild-type protein . Combinety shift . This fiin vivo, we attempted and failed to generate a phospho-specific antibody that would recognize ATF1 phosphorylated on Ser-36, Ser-38, and Ser-41. As an alternative approach, we exploited the strong conservation between CREB and ATF1 in the KID region and constructed an ATF1D39E,E41D mutant that rendered the ATF1 ATM/CK cluster identical to its CREB counterpart, which was readily detected using an \u03b1-pCREB-108/111/114 CREB antibody  can be used to distinguish toxin-sensitive  from toxin-insensitive  phosphatases The PP2A catalytic subunit is targeted to diverse substrates via interaction with specificity-determining (B) subunits A major distinction between CREB and ATF1 ATM/CK cluster regulation pertains to the level of constitutive phosphorylation. While ATF1 is stoichiometrically phosphorylated on CK sites in the absence of DNA damage, only a fraction of CREB is phosphorylated on CK sites in undamaged cells see . This inWe used pharmacologic inhibitors to begin probing mechanisms DNA damage-independent CREB phosphorylation Neither PI3 kinase nor MEK inhibitors had any effect on CM-induced CREB phosphorylation in HEK 293T cells (data not shown), suggesting that these mitogenic pathways are not involved. On the other hand, preincubation of HEK 293T cells with the proteasome inhibitor MG-132 abolished CM induced CREB phosphorylation on Ser-108/111/114, suggesting a critical role for proteasome-mediated protein degradation . This fiOur previous studies showed that phosphorylation of CREB on Ser-108/111/114 was required for DNA damage-induced phosphorylation of CREB on Ser-121 The ATM promoter contains positionally conserved CRE elements suggesting the interesting possibility that ATM is regulated by its own substrates . ATM proIn this study, we compared the DNA damage-dependent and DNA damage-independent phosphorylation of CREB and ATF1 on an evolutionarily conserved ATM/CK phosphorylation cluster within their respective KIDs. The principle findings of the study include: (i) ATF1 is phosphorylated by ATM on Ser-51 in response to DNA damage in a manner that requires phosphorylation of upstream residues by CK1/CK2; (ii) ATF1 hyperphosphorylation on CK residues inhibits CBP binding; (iii) B56\u03b3/PP2A antagonizes CREB and ATF1 phosphorylation on CK/ATM sites; and (iv) priming phosphorylation of CREB on CK sites during cell growth reduces the DNA damage threshold required for ATM-dependent phosphorylation of Ser-121. These findings illustrate conserved similarities as well as differences in the phosphoregulation of CREB and ATF1 and point toward the existence of a novel pathway regulating CREB phosphorylation status during cell growth.CK-dependent phosphorylation of ATF1 within its KID, including Ser-36 and Ser-41, was reported by Masson et al, but the functions of these sites has been elusive Although the functional impact of CK-mediated ATF1 phosphorylation is still unclear, we found that mutation of Ser-36 and Ser-41 increased CBP KIX domain binding by up to four fold . This reThis study implicates B56\u03b3-PP2A as a negative regulator of ATM/CK cluster phosphorylation. Specifically, the IR-induced phosphorylation of CREB on both Ser-108/111/114 and Ser-121 was upregulated in PP2A- or B56\u03b3-deficient cells, indicating that B56\u03b3-PP2A extinguishes DNA damage-dependent phosphorylation of CREB . CREB isCREB differs from ATF1 with respect to the level of constitutive, DNA damage-independent, phosphorylation on the CK sites. Here, we show that the phosphorylation status of CREB CK residues is influenced by cell growth status and that CM from confluent cells induces Ser-108/111/114 phosphorylation in freshly plated cells . FurtherThe impact of DNA damage-dependent phosphorylation on CREB and ATF1 transcriptional activity is yet to be elucidated. The ATM gene harbors consensus CRE elements within its promoter that were required for optimal activity in reporter assays S36A (5\u2032-CAACAGGTATCATCTTT AGCAGAAAGTGAGGAGTCC CAG-3\u2032 and its reverse complement), ATF1S38A (5\u2032-GGTATCATCTTTATCAGAAGCTGAGGAGTC CAGGA-3\u2032 and its reverse complement), ATF1S41A (5\u2032-GTCGGATGAGTCCTGGGCCTCCTCACT TTCTG-3\u2032 and its reverse complement), ATF1S36/41A (5\u2032-CAGGTATCATCTTTAGCA GAAAGTGAGGAGGCCCAGGACTCATCC-3\u2032 and its reverse complement), ATF1S50A (5\u2032-CTGACAGCATAGGCGCCTCACAGAAAGCTCAC-3\u2032 and its reverse complement) and ATF1S51A (5\u2032-GACAGCATAGGCTCCGCACAGAAAGCT CACGGG -3\u2032 and its reverse complement). The ATF1 shRNA construct was constructed by cloning the following oligonucleotide into the pSuperior plasmid: 5\u2032-GATCCGAACTACACCTTCA-3\u2032. The PP2Ac and B56\u03b3 shRNA constructs were constructed by cloning the following oligonucleotides into the pSuperior plasmid: PP2Ac: 5\u2032-TGGAACTTGACGATACTC T-3\u2032 and B56\u03b3 5\u2032-TCAGTGACAACGCAGCGAA-3\u2032. siRNA SMARTpools against CREB, ATF1 and B56\u03b3 were obtained from Dharmacon Inc.pCMV-Myc-hATF1 was constructed by cloning the BC029619 clone from Open Biosystems into the pCMV-Myc vector (Clontech). Site-directed mutagenesis was performed using the QuickChange method (Stratagene) and the indicated primers: ATF1HEK 293T, MeWo, and HeLa cells were purchased through ATCC and maintained in Dulbecco's Modified Eagle's medium (DMEM) containing 5% FBS. The pATF1-47/50/51 antibody was generated by immunizing rabbits with a triply phosphorylated ATF1 peptide (NH2-CD[pS]IG[pS][pS]QKAH-COOH) . Peptide synthesis and purification of antisera was performed as described before for the pCREB-108/111/114 antibodyTransfections were performed using the calcium phosphate DNA precipitation procedure as described. Cells were harvested 48 h later and extracts prepared as described previously 5\u2032-CAAACGAACCTGGAGAGAGC-3\u2032 and 5\u2032- GGTGGAGGGATTTGGTAGG T -3\u2032.Real-time PCR analysis of ATM mRNA was performed using standard procedures. Briefly RNA extraction was performed by the Qiagen RNA extraction kit followed by real-time PCR analysis using a Bio-Rad MyIQ single color real-time PCR detection system with SyBr green. The following ATM primers were used: Figure S1(A) ATF1 is hyperphosphorylated in mouse tissues. Thymus or spleen extracts were treated with vehicle or lambda phosphatase prior to analysis by immunoblotting with \u03b1-ATF1 and \u03b1-CREB antibodies. (B) ATF1E40D,D43E is detected by \u03b1-pCREB108/111/114 antibodies. HEK 293T cells were transfected with wild-type FLAG-ATF1 or FLAG-ATF1E40D,D43E expression plasmids. Overexpressed and endogenous ATF1 proteins were detected with \u03b1-ATF1 and \u03b1-pCREB108/111/114 antibodies. The detection of FLAG-ATF1E40D,D43E with \u03b1-pCREB108/111/114 provides evidence that the conserved ATM/CK cluster is phosphorylated in intact cells.(1.82 MB EPS)Click here for additional data file."}
+{"text": "In recent years data from both mouse models and human tumors suggest that loss of one allele of genes involved in DNA repair pathways may play a central role in genomic instability and carcinogenesis. Additionally several examples in mouse models confirmed that loss of one allele of two functionally related genes may have an additive effect on tumor development. To understand some of the mechanisms involved, we examined the role of monoallelic loss or Atm and Brca1 on cell transformation and apoptosis induced by radiation.Cell transformation and apoptosis were measured in mouse embryo fibroblasts (MEF) and thymocytes respectively. Combinations of wild type and hemizygous genotypes for ATM and BRCA1 were tested in various comparisons.Haploinsufficiency of either ATM or BRCA1 resulted in an increase in the incidence of radiation-induced transformation of MEF and a corresponding decrease in the proportion of thymocytes dying an apoptotic death, compared with cells from wild-type animals. Combined haploinsufficiency for both genes resulted in an even larger effect on apoptosis.Under stress, the efficiency and capacity for DNA repair mediated by the ATM/BRCA1 cell signalling network depends on the expression levels of both proteins. Xpc and p53, Atm and p53, and Fen1 and Apc genes predispose humans to UV radiation-induced skin cancer, mammary carcinoma or adenocarcinomas, respectively [Brca1 and Atm. Earlier reports suggested a link between Atm heterozygosity and breast cancer. The reported estimated relative risk varied in the range of 1.5 to 12 fold [ATM heterozygosity contributes to breast cancer pathobiology were proposed, most of which were associated with the expression of dominant negative ATM protein [ATM mutations in familial breast cancer cases are actually result in truncated gene products resulting in no expression of ATM protein from the mutant allele [ATM heterozygotes with null mutation for one of the alleles could be as high as 1-3% of the US population [Atm and Brca1 heterozygous parental strains of mice. In both parental strains, one of the alleles of the Atm or Brca1 genes was truncated, resulting in loss of expression of the corresponding protein from the truncated allele. The biological function and roles of ATM and BRCA1 are relatively well established. Both proteins are involved in DNA repair and function as sensor/transducers. ATM is involved in the earliest events in DNA double strand break detection and initiates the activation of several pathways linked to cell cycle checkpoint controls [In recent years data from both mouse models and human tumors, suggest that loss of one allele of genes involved in DNA repair pathways may play an important role in carcinogenesis. Haploinsufficiency as a result of loss of allele for APC, ARF, ATM, BRCA1, BRCA2, LKB1, CDKN1B, P53, RB and other proteins has been shown to contribute to tumorigenesis . Additioectively -9. Imporectively . Further 12 fold -13. Diff protein ,15. Howet allele ,17. Impopulation ,19. Takecontrols . ATM alscontrols . The phocontrols . BRCA1 lcontrols ,24. Mutacontrols . We hypoAtm and Brca1 heterozygous (+/-) animals have been described previously [Atm or Brca1 alleles have been disrupted by targeted mutagenesis. This mutagenesis prevented any protein synthesis from the targeted alleles. As a result, Atm or BRCA1 proteins were coded only from the wild type alleles. Atm and Brca1 hemizygous mice were mated and only F1 littermates were used. Genotypes were determined by PCR. The p53 status was \"wild type\" for both genotypes as shown earlier [eviously ,27. In b earlier Atmwt/Brca1wt), single hemizygous (hz) for Atm (Atmhz/Brca1wt) single hemizygous for Brca1 (Atmwt/Brca1hz) and double hemizygous (Atmhz/Brca1hz).Pregnant mice were sacrificed on day 14 of the gestation. Mouse embryo fibroblasts (MEF) from each embryo were cultured separately with DMEM high glucose (Invitrogen) supplemented with 15% FBS (ATCC) and then genotyped. Four genotypes of MEF cells from the same litter were used for each experiment: wild-type,  was added to each well. 24 hours later, the cells were fixed with acetic acid and methanol (v/v = 3:1), and stained with 3 \u03bcg/ml of acridine orange (Sigma) for 1 min. Micronuclei in binucleated cells (BN) were counted under fluorescent microscope. More than 500 BN cells were scored for each sample.6 cells from each genotype were labeled with CD4+ and CD8+ specific antibodies (Pharmingen) and two color flow cytometry analysis was used to estimate the survival of each thymocyte subtype. Total of 20,000 cells for each genotype were examined and the percent of double positive CD4+/CD8+ cells was estimated based on that number.Mice were irradiated with 5 Gy of \u03b3-rays. 24 hours later, thymuses from the irradiated and sham-irradiated control mice were isolated, weighed and homogenized gently for single cell suspension preparation. After estimation of the total cell number, 1\u00d7 106 cells/ml. An aliquot of 100 \u03bcl cell suspension was mixed with 300 \u03bcl 0.5% low melting-point agarose (Amresco) in DMEM containing 10% FBS. 100 \u03bcl of the mixture was layered on glass slide pre-coated with 0.5% LE agarose and covered with another glass slide. After brief incubation on ice for agarose solidification, the cover slides were carefully removed and the samples were gently immersed into freshly prepared lysis solution  for 1.5 hrs followed by incubation for 20 min in electrophoresis buffer . The electrophoresis was performed in the same buffer . The samples were neutralized with 0.4 M Tris-HCl buffer (pH 7.5) and air-dried after a brief fixation with 70% ethanol.DNA damage and repair were evaluated with alkaline comet assay according to the report by Olive et al  with somIndividual cells were visualized with BrdU staining and photographed under fluorescence microscope. 100 comets of each sample were analyzed with a free software called Casp .Atmwt/Brca1wt, Atmwt/Brca1hz, Atmhz/Brca1 wt and Atmhz/Brca1hz. Yields of transformed clones were measured both for unexposed controls and after a dose of 2 Gy. The results shown in Tables Brca1 hemizygotes show a similar transformation frequency as the Atm hz, however, the interesting point to note is that the double hemizygotes Atm/Brca1, show little or no increase over Brca1hz or Atm hz alone. There were small statistically not significant differences in the clonogenic survival for all populations after irradiation (results not shown).Radiation-induced transformation of MEF was examined as a surrogate for carcinogenesis in vivo. A total of 19 embryos from five litters were used and included the following genotypes: Atm and Brca1 have more background DNA damage than wild type cells. This elevated background of DNA damage may point to the higher vulnerability of these cells to DNA damage and cell transformation if additional damage is induced.In these experiments we accessed the background DNA damage in all four genotypes by alkaline comet assay Figure . NotablyAtm and Brca1 at the highest dose, but for lower doses no such differences were found. These results suggests that the DNA damage induced by radiation is less efficiently repaired in double hemizygous cells and may point to an increased mutation accumulation in these cells after DNA damage is induced.Figure +/CD8+ thymocytes, after in vivo \u03b3-irradiation , CD4n Figure . As expeThis study demonstrates that cells hemizygous for either Atm or Brca1 are more sensitive to transformation by radiation and exhibit defective induction of apoptosis under stress. Remarkably, combined hemizygosity for both genes show additive negative effect on apoptosis induction and increased genomic instability reflected by micronuclei formation.In recent years, epidemiological data as well as studies in mouse models confirmed that heterozygosity may play a significant role in tumor initiation and development. The most striking conclusion from these experiments is that heterozygosity for a single gene may contribute to tumor formation. To what degree this may reflect in increased cancer risk heterozygous carriers is a very important issue which can be resolved only after understanding the mechanisms underlying the role of heterozygosity in tumor formation. The role of heterozygosity is more obvious in cases where the product of the mutant allele is a truncated protein having dominant negative effect. Truncated versions of P53, Rb, Ras, NF1, ATM, BRCA1 and 2, INK4 family of proteins, CREB binding protein (CBP) and others have been identified in different tumors ,32. MuchAtm and Rad9 genes were haploinsufficient [Atm and Brca1. As was the case in our prior study, the background transformation frequency of MEF was the same for all studied genotypes. Remarkably, the transformation frequency after induced DNA damage was dependant on the genetic background. Both hemizygous genotypes show statistically significant increases in cell transformation in comparison with the wild type cells. Interestingly, the transformation frequency of MEF on a doubly hemizygous background was in the same range as the singly hemizygous MEF which indicated that there is no additive effect of hemizygosity for Atm and Brca1 genes for this endpoint. Nevertheless, these results confirm that stress related pathways may depend on proper expression levels of these key proteins.We hypothesize that haploinsufficiency is a factor mostly in acute cell conditions, where different factors trigger stress response pathways. Due to the networked nature of this response, the insufficient expression level(s) of some proteins may lead to reduced overall network response. As a consequence, stress related processes, apoptosis for example, may be less effective. Previously, we substantiated this idea using a system where both fficient . In the Atm and Brca1 genes results in elevated levels of MN. This observation supports the conclusion from the transformation experiments and indicated strongly that processes active under stress depend on the expression levels of both Atm and Brca1 proteins.The induction of genomic instability was monitored by measuring micronuclei (MN) formation. In one set of experiments, we determined the induction of MN in different genotypes. Our results show that combined hemizygosity for in vivo after radiation induced DNA damage. Under the conditions we used, cell survival depended largely on the genetic background. We registered the highest level of cell survival in the doubly hemizygous cells, where the rates were two fold greater in wild type cells and 1.5 fold greater than singly hemizygous cells. Since statistically, the number of damaged sites per cells should be the same for all genotypes, the differences in cell survival suggests that damage detection was less efficient in the double heterozygous cells and that more cells with DNA damage may accumulate in the thymuses of double heterozygous animals. Many if these cells will undergo apoptosis in subsequent division attempts but a very small fraction may survive increasing the probability of subsequent transformation.The induction of cell transformation is thought to depend on the efficiency of apoptosis induction. In order to estimate the role of genetic background in apoptosis induction, and since ATM plays very important role in thymocyte apoptosis after irradiation , we measThe results from the estimation of the background DNA damage done by alkaline comet assay were somewhat unexpected for us. They clearly show that the background DNA damage is higher in the hemizygous genotypes. Since we didn't find difference in the background transformation frequency  between the heterozygous and wild type genotypes, we may conclude that the DNA damage detected by this method is not relevant to the background transformation frequency. It could be related though to the highest transformation levels in the heterozygous genotypes after irradiation where the combination of this damage and the one induced by radiation may result in higher degree genetic instability.Considering the network of physical interactions between active factors in living cells may help to explain how it is that reduced levels of expression of a single protein may have such a large effect in the system of events which comprise the biology of the cell. Biological networks are capable of self assembly and disassembly. For example, many local networks may be assembled only when they are needed - for instance after DNA double-strand breaks are induced. The requirement for assembly in response to an event at an unknown point in a relatively large  area, introduces spatial and quantitative limitations on the process. DNA double-strand breaks are a local event that may appear at any place in the nucleus. A local network has to be assembled at the points of DNA double-strand breaks in order to signal and initiate the repair. Proteins, potential members of the local networks, have to be in close proximity to the break or to be able to translocate quickly to the site. Several experiments confirmed that this is the case. Immunofluorescence analysis of cells after radiation induced DNA double-strand breaks show that many DNA repair proteins, like ATM, P53BP1, MRE11, Rad50 and NBS1, ATR, colocalize and form discrete foci on the sites of DNA damage ,37. In aIn summary, we have shown that hemizygosity and combined hemizygosity for Atm and BRCA1 both constitute a prominent contribution to radiation induced cell transformation and apoptosis. While it has long been hypothesized that radiosensitivity in some individuals may well be the result of haploinsufficiency for low penetrance genes, little progress has been made in elucidating specific examples. We have now identified three genes with high penetrance and a low frequency of mutation that confer sensitivity to radiation induced effects, such as cancer. This is relevant given that the frequency of mutation of any individual sensitizing gene inducing heterozygosity among individuals in the general human population may be low and largely undetected. Compound heritable mutations inducing heterozygosity in more than one radio sensitizing gene could render a sub-population particularly radiosensitive. Since such heritable mutations can become concentrated in certain ethnic groups, elements of the human population may be especially vulnerable to radiation induced biological effects.The authors declare that they have no competing interests.LBS and TL provided the mice, mating, genotyping, embryo cells isolation and culture. FS and LZ and GZ carried out the comet assay, transformation assays, apoptosis and micronuclei assay. EJH conceived the study and participated in its design and coordination. LBS and EJH drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "Fatigue is a common symptom of advanced cancer limiting one's activity and affecting the quality of life. It is a multidimensional symptom complex with subjective and objective components. Hence, its definition and assessment seems arbitrary, incomplete, and elusive. Components of fatigue often merge with other \u2018disease states\u2019 as anemia, depression and so on, compounding difficulty to assess it separately. Fatigue has a high prevalence rate, and lasts longer in chronic diseases like cancer. Its association with treatment modalities like chemotherapy, radiotherapy alongside the primary disease process makes it seemingly ubiquitous in many cases. Systemic manifestation of cancer causes excess demand on body resources on cell repair, uncontrolled growth with metabolite accumulation causing fatigue. Co-morbid conditions of organic and psychological nature causes fatigue. There are many assessment tools for fatigue with different uses and objectives, simple and reproducible tools like Brief Fatigue Inventory, Edmonton Symptom assessment scale seem feasible in everyday practice. Management of fatigue is not straightforward and rewarding. Although treatment of cause appears to be an attractive option, it is not possible in all cases. Therapeutic agents targeting cytokine load is in early stages of study and available results are not favorable. Specific measures aimed at pain relief, prevention/treatment of sepsis, management of depression, avoidance of drugs causing fatigue, restoring the metabolic profile are important. Methyl phenidate, megestrol, and modafinil are some drugs with promising effect to treat fatigue, though confirmatory studies are yet to be established. Non-pharmacological methods are also helpful. Forewarning patients on upcoming fatigue, active regular exercise, and stress management are some of them. Fatigue being a multidimensional entity, single mode of therapy is insufficient. Combined modality tailored to individual patient need and understanding may be the right way to battle this ill-understood symptom. This review article examines the etiopathogenesis and management strategies of fatigue in cancer. Fatigue is recognized as a common state in palliative care and patients with advanced cancer experience it as the most distressing symptom affecting their quality of life.23 Patien2A significant proportion of disease free survivors report disruptive fatigue levels years after their treatment. Fatigue Somehow, cancer-related fatigue was downplayed or overlooked for years. Less than 50% of cancer patients discussed the options of treatment of the fatigue symptoms with their oncologist, and only 27% recommended any form of treatment.7 It is poThe elusiveness of the condition is evident in its description itself. Fatigue has been presented as a concept, a construct, and as a definition.www.nccn.org/physician_gls/PDF/fatigue.pdf, access date 26 April 2009)A formally accepted definition of fatigue is not established due to complexity of this condition. Most definitions are but useful description or guidelines. National Comprehensive Cancer Network defines cancer-related fatigue as a \u2018distressing persistent subjective sense of tiredness or exhaustion related to cancer or cancer treatment that is not proportional to recent activity and interferes with usual functioning.\u2019 .The definition according to Oncologic Nursing society is more descriptive. \u201cFatigue is a feeling of debilitating tiredness or total lack of energy that can last for days, weeks or months; commonly caused by anaemia, fatigue is the side effect of chemotherapy that affects patients the most \u2013more than nausea, pain or depression; symptoms include feeling weak or worn out, having difficulties in climbing stairs, walking short distances and performing simple daily tasks; proper nutrition, light exercise, short naps and medications may help alleviate the fatigue  Research steering committee recently put forward a working definition for fatigue as \u2018Fatigue is a subjective feeling of tiredness weakness or lack of energy.\u2019The prevalence of fatigue in palliative care setting is in the range of 48-78%. ConsisteLittle is known about the pathophysiology of fatigue in advanced cancer. Patients experience fatigue due to a variety of reasons throughout their cancer journey. The EAPC expert group suggested a differentiation between primary and secondary fatigue. The former is probably related to high cytokine load and the latter is from cancer treatment or concurrent diseases or syndromes. High cyt30It is found that the diurnal rhythm of cortisol secretion is upset in a subtle manner in breast cancer patients. Evening levels of cortisol was found to be comparatively low in these patients than normal population. HypothalAnother theory is that the systemic effects of cancer treatment causing accumulation of metabolites as a result of normal tissue damage give rise to fatigue. A wide rFatigue is closely associated with anemia in cancer patients. Erythropoietin secretion is inhibited because of high levels of cytokines. Decrease in levels of fatigue was observed in patients treated with erythropoietin. However,The psychosocial factors associated with fatigue are well documented.40 The coSeveral factors play in the occurrence of fatigue; however, no specific predictive factors have been identified in the literature. Age is considered a predictive factor though the evidence is conflicting. Younger patients, less than 34 years do better than older patients. SimilarlAmong women with breast cancer, younger age group was more vulnerable to fatigue, probably due to the aggressiveness of their treatment.A pre-treatment fatigue level is an important factor. There is evidence that the patients experience fatigue even before their cancer diagnosis.\u2018fatigue\u2019 is inherent only in French and English languages, and not in other European languages.[Fundamental to the management of fatigue is its comprehensive assessment. Recent years witnessed a quantum leap in fatigue research. Definition and validation of tools pose questions as they are from different patient populations. Assessmeanguages.Moreover, since fatigue is clearly a multidimensional symptom that is influenced by a number of factors, a wider assessment of other symptoms like pain and psychological morbidity is also necessary while planning an intervention strategy. Several tools are available for clinical assessment of fatigue. In fatigue research, since the aims of study are varied, a detailed and lengthy assessment is mandatory. Fatigue assessment questionnaire, multidim52Cancer related fatigue is one of the poorly attended symptoms. Inadequate skills and lack of awareness on the symptoms among the physicians can be suggested as reason, apart from under reporting.Pharmacological agent s that are targeting excessive cytokines have been an area of interest and a variety of such agents like Thalidomide, Pentoxyfyllin, and Rolipram are currently under investigation. However, early reports are not favorable.55 TreatmThe opioid dose should be individually tailored and dose modifications should be made for an optimum pain reduction. WHO analgesic ladder is the guideline. SpecificMetabolic disorders should be corrected. Electrolyte, hormonal imbalances are to be managed and endocrine problems should be addressed. Adequate hydration and treatment of sepsis is to be attempted. Nutritional supplementation may be tried. Megestrol acetate in the dose range of 160-480 mg per day was shown to improve appetite in many trials.60 But it60Methyl phenidate is an amphetamine derivative acting on synaptic monoamine receptors and facilitates the release of catecholamine release. The onset of action is fast and it has a half life of ~2 hrs. It is metabolized in liver and excreted through kidneys. It is particularly useful in depression in palliative care settings.65 Its va66Megestrol acetate, in the dose range of 480-800 mg has been FDA approved for cachexia related to HIV/AIDS and cancer related-fatigue. The drug improves appetite, increases activity, and contributes to overall well being in advanced cancer patients, though tThe centrally acting acetyl cholinesterase inhibitor drug Donepezil was found to be effective in opioid induced sedation. However,Corticosteroids such as methyl prednisolone or dexamethasone are recommended for relieving fatigue in short periods.71 InfectModafinil, a GABA inhibitor has been shown to be effective in relieving fatigue in many chronic conditions like HIV/AIDS, multiple sclerosis, Parkinson's disease.\u201374 Its uForewarning patients about the symptoms of fatigue and providing information on strategies to alleviate it can provide some relief and reduces the anxiety of unexpected symptoms. If the patients are asked to discuss about their fatigue, that in turn helps them to make the symptom more tangible and may reduce the uncertainty of its occurrence and associated distress. ExerciseSignificant improvement in affective state and alleviation of pain was observed in patients who underwent a group exercise therapy twice a week, each session lasting for 50 minutes, for six weeks.Stress management techniques help to reduce the anxiety associated with fatigue symptoms. Difficulty in thinking and concentration was found to be improved if the patient focuses on the recreational activities for 20-30 minutes three times a week. Brief psThe complexity of fatigue warrants a transdisciplinary approach for an effective management. It includes pharmacological interventions, psycho education, individual exercises, couns eling, and information. Treatment interventions have to be individualized and each patient should have his or her own plans to combat fatigue. This needs sustained effort. Prompt symptom assessment and early intervention is the key to a successful management plan. Fatigue experienced by a patient at the close of life is a normal phenomenon, and a vigorous attempt for reversal in the final hours may not be appropriate as it may cause a re-entry into the world of suffering. Hence, a judicious approach is most necessary in dealing with cancer-related fatigue."}
+{"text": "This study aimed to examine the usability of a newly designed virtual reality (VR) environment simulating the operation of an automated teller machine (ATM) for assessment and training.Part I involved evaluation of the sensitivity and specificity of a non-immersive VR program simulating an ATM (VR-ATM). Part II consisted of a clinical trial providing baseline and post-intervention outcome assessments.A rehabilitation hospital and university-based teaching facilities were used as the setting.A total of 24 persons in the community with acquired brain injury (ABI) - 14 in Part I and 10 in Part II - made up the participants in the study.In Part I, participants were randomized to receive instruction in either an \"early\" or a \"late\" VR-ATM program and were assessed using both the VR program and a real ATM. In Part II, participants were assigned in matched pairs to either VR training or computer-assisted instruction (CAI) teaching programs for six 1-hour sessions over a three-week period.Two behavioral checklists based on activity analysis of cash withdrawals and money transfers using a real ATM were used to measure average reaction time, percentage of incorrect responses, level of cues required, and time spent as generated by the VR system; also used was the Neurobehavioral Cognitive Status Examination.The sensitivity of the VR-ATM was 100% for cash withdrawals and 83.3% for money transfers, and the specificity was 83% and 75%, respectively. For cash withdrawals, the average reaction time of the VR group was significantly shorter than that of the CAI group (p = 0.021). We found no significant differences in average reaction time or accuracy between groups for money transfers, although we did note positive improvement for the VR-ATM group.We found the VR-ATM to be usable as a valid assessment and training tool for relearning the use of ATMs prior to real-life practice in persons with ABI. Operating an automated teller machine (ATM) is one of the most common tasks involving community-living skills that a person might undertake. ATMs are computerized telecommunication devices that provide the customers of financial institutions access to making financial transactions in a public space without the need for a human clerk or bank teller. Using an ATM, customers can access their bank accounts to make cash withdrawals, transfer money, and check the balance of their accounts, as well as pay electronic bills. But although ATMs are widely used and very convenient, it has been shown that older persons and users with disabilities face difficulties with their operation ,2. A stuIn addition, persons with acquired brain injuries (ABI) have different levels of cognitive function that can affect their ability to perform basic self-care and participate in the community . They maVirtual reality (VR) is a technology that allows people to view, navigate, or interact with a simulated three-dimensional world in real time. It is a computer-generated environment that creates an opportunity for individuals to engage in activities similar to the reality -6. TheseIn this study, we sought to answer two questions: 1) What would be the value of using a newly designed virtual reality ATM program (VR-ATM) in predicting the success or failure of persons with ABI when using real ATMs? and 2) would the VR-ATM be an effective training media compared with the conventional training approach using computer-assisted instruction (CAI) for improving the performance of persons with ABI in cash withdrawals and money transfers at ATMs? The study was divided into two parts: the first investigated the predictive validity of using the VR-ATM as a tool to assess performance on real ATMs in persons with ABI, while the second compared the effects of using the VR-ATM program with those of using CAI when training persons with ABI to operate ATMs for cash withdrawals and money transfers. We believed that task-specific training through the use of VR could enhance representative functioning in problem-solving in clients with ABI, which might then be incorporated into the various stages of problem-solving skills training and then transferred to problem-solving performance in real life .A total of 24 participants with ABI volunteered to participate in the study. To be included, participants had to 1) be aged between 18 and 65, 2) have the ability to use at least one hand to operate the touch monitor, 3) attain a score of 22 or above on the Chinese Mini-Mental State Examination (MMSE) , 4) be cFigure The first part of the study involved a one-time instruction session in use of both the VR-ATM and the real ATM by an occupational therapist. Participants were first randomly allocated by sealed envelopes to either an \"early\" or a \"late\" VR-ATM program. The early group received instruction in the VR-ATM program, immediately followed by practice with the real ATM. Participants in the late group were exposed to the real ATM first, immediately followed by the VR-ATM. All participants performed the same tasks - cash withdrawals and money transfers - with the VR-ATM or the real ATM in a rehabilitation hospital. For the real ATM practice, the therapist issued the participant an ATM card, a password, and the account number of the target account for the money transfers. The assessment criteria were based simply on a dichotomous scale - success or failure on a behavioral checklist in using the ATM  with feedback and verbal reinforcement. The only difference was that the participants in the CAI group received tutorial sessions, demonstrations, and verbal feedback from the trainer with the use of PowerPoint rather than from a virtual environment.In Part I, the success or failure of participants in using either the VR-ATM or the real ATM was recorded and compared for each step. Two behavioral checklists were developed based on activity analysis, a 14-item one for cash withdrawals and a 17-item one for money transfers, to assess the participants' performance in using ATMs  with the level of cues ranging from 1 to 2 with the VR-ATM. For those who failed with the real ATM, average reaction time was 26.5 seconds (range was 23 to 30 seconds) with the level of cues ranging from 2 to 3 with the VR-ATM.The sensitivity of the VR-ATM was 100% for cash withdrawals and 83.3% for money transfers. This meant that if the participant lacked sufficient ability to operate the real ATM, the VR-ATM would accurately reflect the deficits. This result reflects a high probability that the VR-ATM would detect problems in users who would fail at using a real ATM. The specificity of the VR-ATM was 83% and 75% for cash withdrawals and money transfers, respectively. This result reflects satisfactory specific values but some probability that the VR-ATM would detect problems in clients who would actually succeed in using a real ATM. The VR-ATM had an acceptable positive predictive value of 50%, meaning that it estimated that half the users who had problems operating the VR-ATM would fail when using a real ATM. The VR-ATM, however, had a high negative predictive value of 100%; in other words, every participant who succeeded in operating the VR-ATM would have no difficulty using a real ATM.The results of the Mann-Whitney test indicated no significant differences in cognitive performance between participants in the VR-ATM and CAI groups as assessed by the Cognistat (p = 0.288 - 0.911), and in baselines as assessed by the VR-ATM p = 0.753 - 0.834) ; that is, participants who had no difficulty with a real ATM could still fail when operating the VR-ATM, possibly owing to the complexity of or unfamiliarity with the system, as also reflected in reliability studies of virtual environments 5%; that . AlthougSuccess in real ATM practice can thus be predicted by the average reaction time and level of cues used in the VR-ATM program. In reality, participants with an average reaction time exceeding 30 seconds in any step would fail when using a real ATM. Participants who failed in operating the VR-ATM usually needed an average of 26.5 seconds (ranging from 23 to 30 seconds) in average reaction time with more than two levels of cues. Those who passed the real ATM test showed a mean of 15.5 seconds (ranging from 12 to 19 seconds) and a range between one and two cue levels in the VR-ATM. It is likely that people with ABI fail at real ATM operations because of their slow response time, which cannot be traded off since a real ATM is programmed to allow every person a maximum of 30 seconds to respond at every step and only three chances to make an error in password key-in.In Part II, our baselines showed no significant differences between the two groups, implying that the method of assigning participants to either group by matched pairs was successful in equalizing both. Thus, the results of the study support use of the VR-ATM to train people with ABI as a better approach than using conventional CAI in improving speed and accuracy in making cash withdrawals. In the performance of money transfers, the difference between groups was close to significant, but this advantage was lost in the post-training results. Failure to achieve a statistically significant difference in this finding may be related to the complex steps involved in making a money transfer, since the cash withdrawal task was simple and had fewer steps compared with the money transfer task.VR technology can serve as a program for repetitive practice in a simulated and modifiable environment that poses no threat to participants and places no physical limitations upon them. Repetitive practice is essential to effective therapy, and the VR approach provides an objective, accurate measurement of patient responses in a series of repetitive tasks and a more economical training program requiring less than one-on-one contact with a therapist . Once clThis study does have several limitations. The sample size in both parts of the study was small. During the real ATM practice in Part I, the money amount used for money transfers was only HK$10, which was too small a value to induce anxiety comparable to a real-life situation. A follow-up measurement in Part II of the study would also be necessary to determine whether the skills gained from using the VR-ATM are maintained over time. Furthermore, the long-term benefits of the VR-ATM for learning to reuse ATMs prior to real-life practice in clients with ABI remain unproven. Although the VR-ATM can be used as a reference point, it cannot replace real ATM assessment if the real-life performance of the client needs to be known. In terms of implications for future research, sufficient compelling evidence exists to encourage further randomized controlled trials. It might be useful if future studies of virtual reality training could be repeated with larger sample sizes, and if the treatment effect over time could be measured through follow-up studies.We found the VR-ATM to be a valid assessment and training tool for relearning the use of ATMs in clients with ABI. The VR-ATM, which can be openly accessed anywhere through the internet, provides information about the time and levels of cues needed in virtual practice, which is important for training skills in a protective environment, increasing the confidence of clients, and providing training opportunities prior to real-life practice in the community.The authors declare that they have no competing interests.KNKF designed the VR-ATM. CKKY formulated concepts and ideas in Part I of the study. WAKY and YEWH collected and analyzed data for Part I. KNKF formulated concepts in Part II of the study. CBCH, LKCK, LJCK, and LTHY collected and analyzed data for Part II. KNKF, CKKY and WAKY drafted the manuscript. All authors read and approved the final manuscript.Behavioral Checklist in ATM operation.Click here for file"}
+{"text": "The transcription factor, milk protein binding factor (MPBF/Stat5), is a member of the STAT family of signalling molecules which mediates prolactin signal transduction in lactating mammary gland by binding to GAS (gamma-interferon activation site) DNA elements. We have determined the levels of STAT factors in nuclear extracts from a variety of human breast tissues including carcinoma and normal 'resting' breast by electrophoretic mobility-shift assay. The results show that the level of STAT binding activity is low in normal 'resting' breast and benign lesions while carcinoma samples have significantly higher (P < 0.01) amounts of STAT binding activity. Supershift analysis suggests that Stat1 and possibly other members of the STAT family of signalling factors, including Stat3, are activated in breast cancer tissues."}
+{"text": "In the last fifteen years, rapid progress has been made in delineating the cellular response to DNA damage. The DNA damage response network is composed of a large number of proteins with different functions that detect and signal the presence of DNA damage in order to coordinate DNA repair with a variety of cellular processes, notably cell cycle progression. This signal, which radiates from the chromatin template, is driven primarily by phosphorylation events, mainly on serine and threonine residues. While we have accumulated detailed information about kinases and their substrates our understanding of the role of phosphatases in the DNA damage response is still preliminary. Identifying the phosphatases and their regulation will be instrumental to obtain a complete picture of the dynamics of the DNA damage response. Here we give an overview of the DNA damage response in mammalian cells and then review the data on the role of different phosphatases and discuss their biological relevance. Maintenance of genomic integrity is an essential part of cellular physiology. Genotoxic insults that induce DNA breaks must be repaired in order to prevent the propagation of mutations that can contribute to malignant transformation. DNA damage occurs following a variety of stimuli including ionizing radiation (IR), ultraviolet radiation (UV), replication stress, chemicals from the environment, and reactive oxygen species that are produced as a byproduct of cellular metabolism.The processes by which cells repair damage to DNA and coordinate repair with cell cycle progression are collectively known as the DNA damage response (DDR). In cases in which the damage cannot be repaired, prolonged cell cycle arrest can lead to senescence or the induction of apoptotic signals -3. SignaAnalogous to growth factor receptor signaling, DNA damage signaling is also driven primarily by changes in protein localization and post-translational modifications. Among post-translational modifications, serine and threonine phosphorylations occupy central stage  and the Rad9-Rad1-Hus1 (9-1-1) complexes that localize to double stranded breaks (DSBs) or regions of replication stress and single stranded breaks, respectively ,7, which sustain and amplify the DDR signal . ImportaChk2-deficient mice are viable and do not have an increased risk for cancer, Chk1-deficient mice are embryonic lethal [The relative contributions of the effector kinases in development have been highlighted using mouse models. While c lethal -33. Althc lethal .Several mediator proteins such as H2AX, BRCA1, MDC1, Claspin, and 53BP1 work to coordinate the localization of various factors in the DDR, promote their activation, and regulate substrate accessibility . The hisBRCA1 is a target of multiple phosphorylations although for many of them the biological significance is largely unclear (reviewed in ) ,56. RecrThe effector proteins Cdc25, p53, and E2F1 function to activate cell cycle checkpoints and regulate the transcription of genes whose products are important in the end result of the DDR, whether it be DNA repair, apoptosis, or senescence.The Cdc25 phosphatases regulate cell cycle progression by removing inhibitory Y15 phosphorylations from the cyclin-dependent kinases Cdk1 and Cdk2 . The negP53 is stabilized after DNA damage which allows it to activate the transcription of genes whose products participate in cell cycle arrest, DNA repair, senescence, or apoptosis, depending upon the stimulus . Mdm2 neThe transcription factor E2F1 is also activated by phosphorylation in response to DNA damage. ATM and CHK2 phosphorylate E2F1 on S31 and S364, respectively, which leads to E2F stabilization ,85. AccuA simplistic reading of the scenarios described above suggests a unidirectional wave of phosphorylation events radiating from the site of damage that is progressively amplified to relay the signal to a large number of substrates in the cell Fig. . UnfortuSince much of the signaling of the DDR is relayed by serine and threonine phosphorylation, it is intuitive that protein serine/threonine phosphatases would negatively regulate these phosphorylation events. Indeed, there are many proteins in the DDR that are negatively regulated in this manner, although there are also specific cases in which certain phosphatases enhance the activity of proteins in the pathway , PP4, PP5, PP6, and PP7. The metal-dependent protein phosphatases, which require Mgiewed in ,89).Multiple phosphatases have been implicated in negatively regulating \u03b3-H2AX. In yeast, deletion of any gene of the PP4-like complex HTP-C  increased the amount of cellular \u03b3-H2AX. Although Pph3 deficient cells had similar rates of DSB repair and loss of \u03b3-H2AX foci as wild-type cells, Rad9 and Rad53  remained active longer and this correlated with maintenance of the G2/M checkpoint .Pharmacologic inhibition of PP2A or knockdown with siRNA increased the amount of total \u03b3-H2AX, the number of \u03b3-H2AX foci-positive cells, the intensity of the foci, and the amount of time the foci were maintained following treatment with the topoisomerase I inhibitor camptothecin . Indeed,In cells with both PP4C and PP2A C knocked-down, \u03b3-H2AX levels were higher and sustained longer after camptothecin treatment as compared to control cells . PP2A C PP6 can also negatively regulate \u03b3-H2AX through binding to DNA-PK. The DNA-PK/PP6 catalytic subunit complex was disrupted by DNA-PK autophosphorylation and phosphorylation of PP6 . DepletiWip1-/- mice had higher basal levels of \u03b3-H2AX than Wip1+/+ mice in the absence of DNA damage as well as higher levels of \u03b3-H2AX after IR [Finally, Wip1  was found to bind to H2AX, associate with the chromatin throughout the cell cycle, and co-localize with \u03b3-H2AX in IR-induced foci . Overexpafter IR . Interesafter IR ,97. SileThus, several phosphatases  participate directly or indirectly in the dephosphorylation of \u03b3-H2AX. It is still not clear what the exact contribution of each phosphatase is but the emerging data suggest some level of redundancy as well as some context-dependent specificity. In addition, although it seems clear that serine/threonine phosphatases predominate in DDR signaling, tyrosine phosphorylation also plays a part. Recent data has shown that Eyes Absent tyrosine phosphatases are involved in the dephosphorylation of the H2AX Y142 residue which is involved in the formation of \u03b3-H2AX foci .PP2A is also involved in the regulation of Replication Protein A (RPA) which coats single stranded DNA . The RPAThe first evidence that PP2A might play a role in the ATM-dependent DDR came from the finding that the PP2A B subunit dissociates from the PP2A heterotrimer in the nucleus in an ATM-dependent manner after IR . It was Wip1 mouse models have revealed a role for Wip1 in negatively regulating Atm [Wip1-null mouse embryo fibroblasts (MEFs) have an increase in Atm phosphorylation at S1987 (corresponding to human ATM S1981) and an increase in Atm activity under normal conditions as well as after IR. Phosphorylation of p53 S18 (human S15), the Atm phosphorylation site, was increased slightly as well [Wip1+/- and Wip1-/- mice in an E\u03bc-myc background displayed an increase in Atm phosphorylation and p53 S18 phosphorylation [Wip1+/- and Wip1-/- mice were more resistant to tumor formation and this was dependent on Atm and p53 [Two different ting Atm ,105. E1A as well . Indeed, as well ,105. SplWip1 and showed that the expression of Wip1 after IR did not have an effect on ATM S1981 phosphorylation [In human cells, the overexpression of Wip1 decreased ATM autophosphorylation and ATM-dependent CHK2 phosphorylation after IR. The induction of Wip1 protein levels in control cells correlated with the decrease in phosphorylated ATM after IR. ATM phosphorylation also remained longer after IR in cells with lower levels of Wip1 . Anotherrylation . This diIn contrast to PP2A and Wip1 which suppress ATM activation, PP5 plays an important role in the activation of the DDR through ATM. Cells with decreased PP5 protein or activity exhibited a decrease in ATM autophosphorylation at S1981, a decrease in ATM kinase activity, and a phenotype of radio-resistant DNA synthesis after DNA damage, which is consistent with the phenotype of cells lacking ATM . PP5-defIn addition to its role in activating ATM, PP5 was also shown to be important for the activation of ATR. PP5 can bind to ATR after treatment with neocarzinostatin, UV, and hydroxyurea (which mimics replication stress). PP5 was necessary for the phosphorylation of CHK1 at S345, and the knockdown of PP5 inhibited the replication checkpoint after UV, inhibited the S-phase checkpoint after hydroxyurea, and decreased RPA phosphorylation and foci formation .PP1, PP2A, and PP6 have all been shown to positively influence DNA-PK activity. When PP1 was added to DNA-PK complexes that were induced to autophosphorylate, the reduction in activity and disruption of the DNA-PK-DNA binding due to the autophosphorylation were reversed . PP2A dePP6 and DNA-PK form a complex in cells and binding increased after IR . IR causSchizosaccharomyces pombe, the PP1 homologue Dis2 negatively regulates CHK1 [CHK1 has been shown to be negatively regulated by multiple protein serine/threonine phosphatases. In tes CHK1 . Cells ltes CHK1 . The ovetes CHK1 . Indeed,tes CHK1 ,115. Howtes CHK1 ,117.X. laevis egg extracts, the addition of PP2A C reversed CHK1 phosphorylation at S344 (human S345) after activation by DSB [In human cells, the inhibition of PP2A induced CHK1 phosphorylation in the absence of DNA damage and also prevented CHK1 dephosphorylation after hydroxyurea removal . The knon by DSB . The inhn by DSB .Wip1-/- MEFs in a 129/sv-C57BL6 background showed a greater increase in phosphorylation at S345 in CHK1 after IR than wild-type MEFs, whereas +/+ Wip1and Wip1-/- splenocytes expressing E\u03bc-myc did not show any difference in Chk1 S345 phosphorylation, possibly indicating a cell type specific or DNA damage specific regulation of CHK1 via Wip1 [Human CHK1 is also regulated by Wip1. Wip1 could dephosphorylate CHK1 primarily at S345 and slightly at S317 in vitro. In vivo, the overexpression of Wip1 resulted in the elimination of CHK1 phosphorylation at S345 and S317, a decrease of Cdc25C phosphorylation at S216, a decrease in Cdk1 phosphorylation at Y15, and a decrease in the S-phase and G2/M checkpoints, whereas the knockdown of Wip1 via siRNA caused the reverse effects . Breast via Wip1 ,106. In Saccharomyces cerevisiae CHK2 homologue Rad53. The PP2C phosphatases Ptc2 and Ptc3 as well as the type 2A phosphatase Pph3 have all been shown to negatively regulate Rad53 under different circumstances. To study DSB in yeast, a system that induces the HO endonuclease to create a single DSB at a specific locus that cannot be repaired by homologous recombination was utilized. A single break will cause a G2/M arrest and then adaptation to the checkpoint. Cells lacking Ptc2 and/or Ptc3 were defective in adaptation to an HO-induced G2/M arrest. Ptc2 and Ptc3 were required for recovery from the checkpoint as measured by Rad53 dephosphorylation and release from the G2/M checkpoint [Much of the work examining the negative regulation of CHK2 has been done using the eckpoint ,121. Ptceckpoint ,121. MutS. cerevisiae, deletion of the PP2A-like phosphatase Pph3 caused hypersensitivity to methylmethane sulfonate [Also in ulfonate . Pph3-Psulfonate .One study attempted to differentiate the roles of Pph3, Ptc2, and Ptc3 in negatively regulating Rad53. Cells lacking Pph3 again showed hyperphosphorylation of Rad53, but Rad53 was still deactivated after methylmethane sulfonate treatment and removal . Cells lIn humans, CHK2 was found to be regulated by PP2A and Wip1. Inhibition of PP2A using okadaic acid increased the phosphorylation of CHK2. Although PP2A was also found to negatively regulate ATM, the effect on CHK2 phosphorylation was ATM-independent . UtiliziRecent work from our laboratory has identified the B'\u03b1 subunit of PP2A as a CHK2 binding partner . B'\u03b1 wasWip1 and CHK2 were found to bind in the nucleus and binding was dependent upon the CHK2 SQ/TQ domain, kinase activity, and nuclear localization signal and the Wip1 N-terminal domain ,129. EndPP1 could dephosphorylate BRCA1 at the CHK2 target site S988, the ATM target site S1524, and the ATR site S1423 ,134. TheIn addition to being regulated by MDM2, p53 is also negatively regulated through direct dephosphorylation by PP1 and PP2A. PP2A bound to p53 following IR and dephosphorylated S37 , whose pInhibition of PP1, but not PP2A, with okadaic acid induced the p53 target Bax and, consequently, apoptosis in rabbit lens epithelial cells . InhibitWip1-/- MEFs exhibited a slight increase in p53 phosphorylation at S15 and an increase in the levels of p53 target p21 [Wip1-/- MEFs had an increase in protein levels and S15 phosphorylation whereas knockdown of Wip1 with siRNA resulted in increased p53 protein levels and S15 phosphorylation. In this system, Wip1 did not have an effect on ATM or ATR after IR or UV, respectively, therefore the effect on p53 seems to be direct [Importantly, Wip1 was induced in response to IR in a p53-dependent manner as a part of a negative feedback mechanism ,141. Wiprget p21 . In an irget p21 . After Ie direct .Wip1-/- mice displayed a defect in T cell maturation due to sustained p53 activation [Wip1-/- MEFs had a more robust G1 arrest following IR, which may be due to increased activity of p53 [tivation . Wip1-/-y of p53 . Wip1 way of p53 . Overexpy of p53 . Interesy of p53 . These dNot only is p53 regulated by multiple protein serine/threonine phosphatases directly, but it is also regulated indirectly through the regulation of Mdm2. Mdm2 has been predicted to be a Wip1 substrate . Indeed,The multiple modes of regulation of p53 and its activation via negative feedback loops signifies the importance of keeping p53 tightly regulated after DNA damage. Protein serine/threonine phosphatases play a role in regulating p53 through direct dephosphorylation via PP1, Wip1, and PP2A as well as enhancement of Mdm2 negative regulation of p53 through Wip1.In summary, recent literature has demonstrated that protein serine/threonine phosphatases have important functions both in the activation of the DDR and in its negative regulation. At least, negative regulation operates at two levels: keeping proteins in an inactive state and inactivating them following the repair of the damaged DNA. This regulation Fig.  allows fThe data discussed here seems to reveal a scenario where multiple phosphatases target the same phosphorylation events. While this could be construed as excessive promiscuity of phosphatases we believe that a more nuanced reading of the data should be performed. First, the inherent limitations of different experimental approaches should be kept in mind. For example, genetic data (deletion or RNAi-mediated silencing) may result in changes in phosphorylation of the target protein but the effects might be indirect; pharmacologic inhibitors might have off target effects and suffer from low specificity; in vitro assays might reveal that a certain phosphatase can dephosphorylate a target but they may never co-localize in the cell. Second, although multiple phosphatases may target the same protein or phosphorylated residue they might have very specific functions depending on the type of damage, tissue type, and cell cycle compartment. Thus, although the general themes of these regulatory steps have been recently uncovered, working out the details and the dynamic behavior of the system is going to keep investigators busy for many years to come.9-1-1 COMPLEX: Rad9-Rad1-Hus1; ATM: ataxia telangiectasia-mutated; ATR: ataxia telangiectasia and Rad3-related; ATRIP: ATR-interacting protein; DDR: DNA damage response; DNA-PK: DNA-dependent protein kinase; DSB: double stranded break; IR: ionizing radiation; MEFS: mouse embryo fibroblasts; MRN: Mre11-Rad50-Nbs1 complex; PCNA: proliferating cell nuclear antigen; RFC: replication factor C; RPA: replication protein A; UV: ultraviolet radiation.The authors declare that they have no competing interests.AF and AM contributed to the preparation of the manuscript and approval of its final version.Table 1. Positive and negative regulators of specific phosphorylation sites of proteins in the DNA Damage ResponseClick here for file"}
+{"text": "Human papillomaviruses (HPV) are the causative agents of cervical cancers. The infectious HPV life cycle is closely linked to the differentiation state of the host epithelia, with viral genome amplification, late gene expression and virion production restricted to suprabasal cells. The E6 and E7 proteins provide an environment conducive to DNA synthesis upon differentiation, but little is known concerning the mechanisms that regulate productive viral genome amplification. Using keratinocytes that stably maintain HPV-31 episomes, and chemical inhibitors, we demonstrate that viral proteins activate the ATM DNA damage response in differentiating cells, as indicated by phosphorylation of CHK2, BRCA1 and NBS1. This activation is necessary for viral genome amplification, as well as for formation of viral replication foci. In contrast, inhibition of ATM kinase activity in undifferentiated keratinocytes had no effect on the stable maintenance of viral genomes. Previous studies have shown that HPVs induce low levels of caspase 3/7 activation upon differentiation and that this is important for cleavage of the E1 replication protein and genome amplification. Our studies demonstrate that caspase cleavage is induced upon differentiation of HPV positive cells through the action of the DNA damage protein kinase CHK2, which may be activated as a result of E7 binding to the ATM kinase. These findings identify a major regulatory mechanism responsible for productive HPV replication in differentiating cells. Our results have potential implications for the development of anti-viral therapies to treat HPV infections. Over 100 types of human papillomavirus (HPV) have been identified, and approximately one-third of these infect epithelial cells of the genital mucosa. A subset of these HPV types are the causative agents of cervical and other anogenital cancers. The infectious life cycle of HPV is dependent on differentiation of the host epithelial cell, with viral genome amplification and virion production restricted to differentiated suprabasal cells. While normal keratinocytes exit the cell cycle upon differentiation, HPV positive suprabasal cells are able to re-enter S-phase to mediate productive replication. The mechanisms regulating the activation of differentiation-dependent viral replication are largely unknown. In this study, we demonstrate that HPV induces an ATM-dependent DNA damage response that is essential for viral genome amplification in differentiating cells. In addition, we have found that ATM signaling to its downstream target CHK2 is critical for providing an environment that is conducive to HPV productive replication. Our findings identify an important regulatory mechanism by which HPV controls replication during the productive phase of the life cycle and may identify new targets for the development of therapeutics to treat HPV-induced infections. Human papillomaviruses (HPV) are the etiological agents of most anogenital cancers and their productive life cycle is dependent upon epithelial differentiation The fidelity of cellular replication is controlled by signaling pathways that block the propagation of damaged DNA ATM activates a number of downstream targets that are involved in cell cycle control, apoptotic responses and DNA repair Given the importance of this pathway in controlling replication, we investigated if ATM signaling was necessary for stable HPV replication in undifferentiated cells, as well as productive replication in differentiated cells. Our studies indicate that HPV proteins induce an ATM response in both undifferentiated and differentiated cells. Importantly, we found that ATM kinase activity is necessary for viral genome amplification in differentiating cells, but not for stable maintenance in undifferentiated cells. These studies implicate HPV activation of DNA damage signaling in controlling productive viral replication upon differentiation.To determine if HPV induces a DNA damage response in infected cells we first examined the expression level, as well as activation status, of ATM by Western blot analysis . For theTo determine if phosphorylation of ATM correlated with activation of downstream targets, we examined the phosphorylation status of three of its substrates: CHK2, NBS1 and BRCA1. CHK2 is an important transducer of the ATM signaling pathway, and its activation is initiated by ATM phosphorylation on threonine 68 (pCHK2) We next wanted to confirm that ATM activity was responsible for CHK2 phosphorylation in HPV positive cells, as CHK2 can also be phosphorylated and activated by the ATR kinase In response to DNA damage, ATM is recruited to distinct nuclear foci by the MRN complex, which consists of NBS1, MRE11 and RAD50 The detection of phosphorylated CHK2, NBS1 and BRCA1 in HPV positive cells suggested that ATM may be localized to nuclear foci, as is observed in cells undergoing a DNA damage response We next examined the localization of phosphorylated CHK2 Thr68 in undifferentiated and differentiated cells. In undifferentiated HPV-31 positive cells, a number of foci containing both pCHK2 Thr68 and \u03b3-H2AX were detected, although every cell did not stain positive for these foci . Upon diIt was next important to confirm that pCHK2 Thr68 localization to nuclear foci was not specific to calcium-induced differentiation. For these studies, HPV-31 positive keratinocytes, as well as normal keratinocytes, were induced to differentiate by growth in organotypic raft cultures, and immunohistochemistry was performed on cross sections of the rafts. As shown in We next investigated if activation of the ATM pathway is necessary for stable replication of HPV genomes in undifferentiated cells, or viral genome amplification in differentiated cells. Since our studies identified activated CHK2 and BRCA1 in undifferentiated HPV-positive cells, we first examined the effect of inhibiting ATM kinase activity on episomal maintenance . HPV-31 To determine if ATM kinase activity is necessary for differentiation-dependent viral genome amplification, HPV-31 positive CIN612 cells were induced to differentiate in high calcium medium in the presence of DMSO or KU-55933. DNA was harvested from monolayer cells (0 hour), as well as 48 and 96 hours post-differentiation. As shown in Since we observed the formation of nuclear foci containing pATM Ser1981 in HPV-31 positive cells and found that ATM kinase activity is necessary for viral genome amplification, we investigated whether ATM activity is required for the formation of HPV replication foci in differentiating cells. For these studies, tyramide-enhanced fluorescence in situ hybridization (FISH) was used to detect viral genomes in cells that were treated with DMSO, or 10 uM of the ATM inhibitor. In monolayer cells, only single foci of viral genomes were detected in a small number of cells (9.6\u00b12.3%) , which iWe previously showed that HPVs induce low-levels of caspase 3/7 activation upon differentiation and that this is important for cleavage of the E1 replication protein and genome amplification To determine which viral proteins could be responsible for ATM activation, we first examined a possible role of E7 in this process, since it has been shown to de-regulate cell cycle control upon differentiation In this study, we show that human papillomaviruses activate the ATM DNA damage response and that this is necessary for productive viral replication upon differentiation. These findings identify a primary regulatory mechanism responsible for HPV genome amplification. Our studies indicate that papillomaviruses induce phosphorylation of ATM, as well as its substrates CHK2 and BRCA1, in undifferentiated cells, but this activation has minimal effect on the long-term maintenance of HPV episomes. In differentiating cells, the phosphorylation of NBS1, well as CHK2 and BRCA1, was observed and inhibition of the ATM pathway completely blocked amplification of viral genomes. In addition, we found CHK2 activity to be required for HPV-mediated caspase activation, as well as viral genome amplification. It is possible that activation of the ATM response in differentiating cells induces an S or G2/M arrest that provides an environment conducive to productive viral replication. HPV genomes replicate bi-directionally via theta structures in basal cells, but may switch to replication by a rolling circle mechanism during amplification HSV-1 and SV40 have been shown to recruit members of the ATM DNA damage pathway to specific sites of replication in the nucleus Our studies further demonstrate that the addition of a specific inhibitor to CHK2 blocks viral genome amplification. Upon activation, CHK2 phosphorylates the Cdc25a and Cdc25c phosphatases to initiate cell cycle arrest in G1/S or G2/M through their degradation or cytoplasmic sequestration, respectively The MRN complex appears to be important for HPV amplification, as the phosphorylated forms of CHK2, NBS1 and BRCA1 were detected in differentiated HPV positive cells. For some viruses, the DNA damage response represents an obstacle that must be overcome for efficient replication. For example, the adenovirus E1b55K/E4orf6 proteins induce degradation of the MRN complex, blocking NBS1 phosphorylation and preventing concatemerization of viral genomes Caspase activation has been shown to be an important and novel means by which HPV proteins regulate amplification Our studies indicate that in stable cell lines E7 activates CHK2, and that it forms a complex with the phosphorylated form of ATM. Deletion of the LXCXE Rb binding domain in E7 abrogated ATM binding, however binding could occur directly or indirectly through another protein. Preliminary results using Rb-deficient Saos-2 cells indicate that E7 binding to ATM does not require Rb . Previous studies have shown that deletion of the LXCXE binding domain in E7 blocks HPV genome amplification In addition to E7, the HPV replication protein E1 may also contribute to the ATM response. Upon differentiation, the expression of E1 increases, contributing to enhanced viral replication In summary, our studies demonstrate that HPV proteins activate the ATM DNA damage response and that this is necessary for amplification of viral genomes upon differentiation. The formation of HPV replication foci in differentiating cells is dependent upon ATM activity and suggests that DNA repair proteins may participate directly in viral replication. Importantly, we have established a link between caspase activation and the DNA damage response. Caspase 3/7 consensus cleavage motifs are found at conserved locations in E1 proteins of almost all papillomavirus types, and we suspect caspase activation may be necessary for their productive replication. We believe that activation of the ATM pathway will prove to be a common mechanism utilized by HPVs to promote viral replication in differentiating cells. These observations suggest that the ATM pathway may be an effective therapeutic target to block the spread of HPV infections.Human foreskin keratinocytes (HFKs) were derived from neonatal human foreskin epithelia and maintained in E medium containing mouse epidermal growth factor (EGF) and mitomycin-treated J2 fibroblasts as previously described The pBR322min-HPV31 plasmid has been described Transfection of HFKs and selection for cells stably maintaining HPV-31 genomes were performed as described previously Differentiation in high calcium was performed as described previously Whole cell extracts were harvested in RIPA lysis buffer and quantified using the Bio-Rad protein assay. Western blot analysis was performed as described U20S cells were transfected at 30% confluency with one microgram of wild-type or mutant HA-tagged HPV-31 E7 proteins using FuGene6, according to the manufacturer's instructions (Roche). After 48 hours, lysates were harvested as previously described HPV positive cells and normal HFKs were grown on coverslips and induced to differentiate in high calcium in the presence of DMSO or 10 uM KU-55933. At time 0 (undifferentiated) and 48 hr post-calcium induced differentiation, the cells were washed three times in cold phosphate buffered saline (PBS), fixed in 4% paraformaldehyde in PBS for 15 minutes, then permeabilized in 1%Triton X-100-PBS for 10 minutes. Cells were blocked with PBS containing 10% bovine serum albumin (BSA) for one hour at room temperature. Primary antibodies were diluted in PBS containing 10% BSA and incubated on coverslips overnight at 4\u00b0C. The samples were then washed in PBS and stained with fluoroscein isothiocyanate (FITC)-conjugated anti-rabbit antibody (1\u223650 dilution) (Zymed) or AlexaFluor 568 anti-mouse antibody (Invitrogen) (1\u2236400 dilution) for one hour at room temperature. Primary antibody dilutions for mouse anti-phospho-ATM Ser1981 (Rockland), anti phospho-H2AX Ser139 (\u03b3-H2AX) (Upstate) were 1\u2236400 and 1\u2236500, respectively. Rabbit anti-phospho-CHK2 Thr68  and anti-phospho-H2AX Ser139 (\u03b3-H2AX)  were diluted 1\u223650. Mouse anti-MRE11 and mouse anti-Rad50 were diluted 1\u2236200. Mouse anti-keratin 10 (K10) (Santa Cruz) was diluted 1\u2236100. Sections from normal keratinocyte raft cultures or HPV-31 transfected keratinocyte raft cultures were examined by immunofluorescence as described previously 6 undifferentiated HFK-31 cells, or HFK-31 cells differentiated in high calcium for 48 hr were spread on Superfrost Plus slides (Fisher) and allowed to air-dry. Cells were fixed with 4% paraformaldehyde at room temperature followed by permeabilization in 1\u00d7 PBS, 0.5% Triton X-100 for 10 min. The slides were treated with 100 ug/ml RNase A in 2\u00d7 SSC for 1 hour at 37\u00b0C. Subsequently, the slides were washed three times with 2\u00d7 SSC, then dehydrated for 2 min each in 70% EtOH, 85% EtOH and 100% EtOH at room temperature. Slides were then denatured in 70% formamide-2\u00d7 SSC at 74\u00b0C for 2 minutes, followed by dehydration for 2 min each in 70% EtOH (\u221220\u00b0C), 85% EtOH and 100% EtOH at room temperature. The probe was denatured at 74\u00b0C for 10 minutes, and then 10 ul of probe was hybridized overnight to the denatured slide at 37\u00b0C. After overnight incubation, the slides were washed multiple times, and tyramide-enhanced fluorescence was carried out according to the manufacturer's instructions (Perkinelmer). The cellular DNA was counterstained with DAPI, and the slides were mounted in Vectashield. Images were collected using a UV LSM 510 confocal laser-scanning microscope (Zeiss).HPV-31 genomic DNA probes for FISH were prepared by nick translation of plasmid genomic DNAs using the BioNick labeling system according to the manufacturer's instructions (Invitrogen). Viral DNA was detected by tyramide fluorescent in situ hybridization as previously described Figure S1MRN components are localized to nuclear foci in HPV positive cells. HFK-31 cells, as well as normal HFKs were harvested, fixed and permeabilized at either time 0 (undifferentiated cells) or after 48 hr of calcium-induced differentiation. Samples were stained with antibodies to either MRE11 or RAD50 and analyzed by confocal fluorescence microscopy. Cellular DNA was counterstained with DAPI and is shown as merged with the indicated antibodies.(5.56 MB PDF)Click here for additional data file.Figure S2DNA repair proteins exhibit a nuclear staining pattern in raft cultures of HPV positive cells. Immunohistochemistry was performed on cross sections of organotypic raft cultures generated from HFK-31 cells, as well as normal HFKs using antibodies to (A) pATM Ser1981, (B) \u03b3-H2AX, (C) MRE11, or (D) K10. Cellular DNA was counterstained with DAPI. Images were captured using confocal fluorescence microscopy. pATM is found in the basal and suprabasal cells in HFK-31 cells but only background staining is observed in HFKs. MRE11 is distributed throughout all epithelial layers for rafts generated from HFK-31 cells, as well as normal HFKs. \u03b3-H2AX is found at high levels in all layers of HFK-31 rafts, and at reduced levels in normal HFK rafts.(2.77 MB PDF)Click here for additional data file.Figure S3Southern analysis of HPV-31 cells treated with inhibitors of ATM and CHK2. DNA was harvested from undifferentiated CIN612 cells, as well as from cells induced to differentiate for 48 and 96 hr in high calcium in the presence of DMSO, 10 uM KU-55933 or 5 uM of the CHK2 inhibitor (CHK2i). Total DNA was digested with either Xho1, which does not cut the HPV genome (uncut), or with HindIII, which linearizes the genome (cut). Southern blot analysis was performed to analyze viral genome amplification. The four forms of HVP-31 DNA found in this analysis are labeled. Standards of HPV genome copies per cell are indicated to the left of the gel. Ca\u200a=\u200acalcium.(0.80 MB PDF)Click here for additional data file.Figure S4Analysis of the efficacy and specificity of the CHK2 inhibitor. Lysates were harvested from undifferentiated CIN612 cells, as well as after differentiation in high calcium for 48 and 96 hr in the presence of DMSO or 5 uM CHK2i. Western blot analysis was performed using an antibody to the CHK2 substrate pCdc25c Ser216, or to pCHK2 Thr68 or total CHK2. GAPDH served as a loading control. Ca\u200a=\u200acalcium.(3.75 MB PDF)Click here for additional data file."}
+{"text": "High levels of metabolism and oxygen consumption in most adult murine ocular compartments, combined with exposure to light and ultraviolet (UV) radiation, are major sources of oxidative stress, causing DNA damage in ocular cells. Of all mammalian body cells, photoreceptor cells consume the largest amount of oxygen and generate the highest levels of oxidative damage. The accumulation of such damage throughout life is a major factor of aging tissues. Several multiprotein complexes have recently been identified as the major sensors and mediators involved in the maintenance of DNA integrity. The activity of these complexes initially seemed to be restricted to dividing cells, given their ultimate role in major cell cycle checkpoints. However, it was later established that they are also active in post-mitotic cells. Recent findings demonstrate that the DNA damage response (DDR) is essential for the development, maintenance, and normal functioning of the adult central nervous system. One major molecular factor in the DDR is the protein, ataxia telangiectasia mutated (ATM). It is required for the rapid induction of cellular responses to DNA double-strand breaks. These cytotoxic DNA lesions may be caused by oxidative damage. To understand how ATM prevents oxidative stress and participates in the maintenance of genomic integrity and cell viability of the adult retina, we determined the ATM expression patterns and studied its localization in the adult mouse eye.Atm gene expression was analyzed by RT\u2013PCR experiments and its localization by in situ hybridization on adult mouse ocular and cerebellar tissue sections. ATM protein expression was determined by western blot analysis of proteins homogenates extracted from several mouse tissues and its localization by immunohistochemistry experiments performed on adult mouse ocular and cerebellar tissue sections. In addition, subcellular localization was realized by confocal microscopy imaging of ocular tissue sections, with a special focus on retinal cells.Atm cDNA sequence. Atm mRNA was detected in most cell bodies of the adult mouse eye by in situ hybridization of ocular tissue sections with specific digoxigenin-labeled PCR-amplified cDNA probes. Western blotting with different specific antibodies revealed bands corresponding to the expected sizes of ATM and its active forms (ATMp). These bands were not observed in the analysis of protein homogenates from Atm-deficient mouse tissues. ATM immunoreactivity was detected in the nucleus of all adult mice retinal cells and in most non-neuronal ocular cell types. The active phosphorylated form of ATM was also present in the retina as well as in non-neuronal cells of the adult mouse eye. However, its subcellular localization differed as a function of the cell type examined. A major finding of this study was that ATMp immunostaining in photoreceptor cells was exclusively in the cytoplasm, whereas ATM immunostaining was only in the nucleus of these cells. Furthermore, the specific and distinct ATM and ATMp immunolabeling patterns in photoreceptor cells were identical to those observed in the adult mouse cerebellar granule cells.Using RT\u2013PCR, we detected a band of the expected size, with its sequence matching the amplified Atm gene and protein in the adult mouse eye. In particular, we observed a difference between the localization patterns of the active and inactive forms of ATM in photoreceptor cells. These localization patterns suggest that ATM and its phosphorylated activated form may be involved in both the protection of cells from oxidative damage and the maintenance of ocular cell structure and function. The protection mechanisms mediated by the two forms of ATM appear to be particularly important in maintaining photoreceptor integrity.We report the expression profile of  The retina is a part of the central nervous system (CNS). It forms from the prosencephalon early in embryogenesis and from the telencephalon at later stages of development ,2. Like Paradoxically, while light and oxygen are essential for vision, high levels of oxygen consumption create a stressful environment for neurons. Indeed, metabolic byproducts, primarily reactive oxygen species (ROS), constantly attack neuroretinal genomic and mitochondrial DNA ,7. ROS a-terminus is required to recruit ATM to sites of DNA damage [Oxidative stress causes many types of DNA damage, such as oxidative DNA damage, single-strand breaks, or double-strand breaks (DSBs) . DNA DSBA damage -24. ATM A damage . ATM phoA damage ,26-29. AA damage . After iA damage .ATM gene lead to ataxia telangiectasia (A-T), an autosomal recessive disorder characterized by progressive ataxia, conjunctival telangiectasias, and other defects including immunodeficiency, cancer susceptibility, chromosomal instability and sensitivity to ionizing radiation (IR) [Loss of ATM function in human and mouse cells causes defects in molecular pathways that are normally activated by DNA DSBs . Mutatioion (IR) ,34. ATM ion (IR) -37. It iion (IR) ,39.Atm-deficient mice spontaneously develop increased levels of oxidative damage and display mutation profiles suggestive of oxidative stress [Atm-deficient mice are particularly marked in Purkinje cells [ATM is activated in response to increased levels of endogenous as well as induced oxidative DNA damage that includes, but is not necessarily limited to DSBs ,40. Atm-e stress ,42. Elevje cells . Oxidatije cells ,44, and je cells .Atm-deficient mice to ROS-induced DNA damage, retinal neurodegeneration has not been reported in patients affected by A-T. Most studies aimed at elucidating the DSB response have been performed in proliferating cell lines. Nevertheless, it was recently shown that an intact DNA damage response is essential for normal development, organization, and maintenance of the nervous system [Although ocular tissues, especially the retina, are exposed to extremely high levels of ROS, and despite the increased sensitivity of s system . The pros system ,47. The s system ,49. Indepinball eye (piy), in which almost all retinal neurons undergo apoptosis during differentiation, has been recently isolated. A missense mutation in a small subunit of DNA primase (Prim1) underlies this mutant phenotype. This mutation does not affect cell proliferation but specifically induces extensive retinal neuronal apoptosis by activation of the ATM-Chk2-p53 pathway [Drosophila eyes causes progressive degeneration of photoreceptors in the absence of exogenously induced DNA damage [Recent studies have reported that the role of ATM in the DNA damage response in the CNS\u2014including the retina\u2014is conserved between several species. In the zebrafish, surveillance of genome integrity is ATM-dependent. Indeed, a zebrafish mutant,  pathway . SimilarA damage . In thisNbs1 gene encoding the Nibrin protein-share a variety of phenotypic abnormalities, such as spino-cerebellar ataxia, chromosomal instability, radiation sensitivity, and defects in cell-cycle checkpoints in response to IR. The similarity between A-T and NBS may be a result of biochemical links between ATM and NBS1 in the DNA damage response and cell cycle regulatory pathways [Nbs1 gene in the CNS shows a neurologic phenotype in these animals, characterized by the arrested proliferation of granule cell progenitors and apoptosis of post-mitotic neurons in the cerebellum; this leads to severe ataxia and microcephaly, typical clinical features of NBS in humans [Nbs1 disruption also leads to a dramatic impairment in the development of the eye and optic nerve, with severe dysfunction of the photoreceptors [Atm-deficient mice do not exhibit this neurologic phenotype. A simple explanation for the phenotypic differences between Atm-deficient mice and A-T patients could be that generation of the A-T cerebellar phenotype in the mouse requires a greater suppression of the DNA damage response than that achieved by deletion of the Atm gene [The rare diseases A-T and Nijmegen breakage syndrome (NBS)-with mutations in the pathways -55. Inden humans . These mn humans . Nbs1 dieceptors . This anAtm gene .ATM missense variants [A recent study suggested that the formation of retinal and choroidal vascular abnormalities  observed in patients of European-American descent is associated with variants , consistvariants . These fAtm mRNA and protein in the adult murine eye. Thus, we performed such a study to better understand both the physiologic role of ATM in the adult murine eye and the pathological features of A-T, which seem to have a broader spectrum of ocular manifestations than previously thought.These studies demonstrate a fundamental role for ATM both in the development and maintenance of the eye. However, no previous systematic study has yet determined the precise localization of both Atm mRNA and the localization of ATM protein in the adult mouse eye. We showed that ATM protein was essentially localized in the nucleus of retinal cells and non-neuronal cells of the mouse adult eye. High levels of the activated phosphorylated form of ATM (ATMp) were detected in the nucleus and the cytoplasm of most ocular cell types. Additionally, immunoreactivity was detected in the same cells for both ATM and ATMp; however, ATMp cellular localization in photoreceptor cells differed from that detected in other retinal cells. In mouse photoreceptors, ATM immunostaining seemed to be exclusively in the nuclei, whereas ATMp immunostaining was confined to the cytoplasmic compartment. The specific patterns of ATM and ATMp immunoreactivities appeared to be the same in the mouse cerebellar granule cells as those observed in mouse photoreceptor cells. This may be indicative of a particular susceptibility of these cells to oxidative damage. Our findings suggest that ATM and its phosphorylated form have common and redundant functions as well as distinct and specific functions in the maintenance of the integrity of ocular cells.In this study, we determined the distribution pattern of All animals were handled in strict accordance with the ARVO Statement for Use of Animals in Ophthalmic and Vision Research. C57BL/6J mice  were maintained on a 12 h:12 h light-dark cycle at a room temperature of 21\u00a0\u00b0C.Atm mRNA in the cerebellum, neuroretina, RPE, ciliary body, and lens from 2-month-old adult mice were examined by RT\u2013PCR. Total RNA was extracted from each sample of each mouse ocular compartment and from each mouse cerebellum by TRIzol method, according to the manufacturer\u2019s recommendations . Next, 1\u00a0\u03bcg aliquots of total RNA were reverse transcribed with reverse transcriptase  and oligo dT primer, according to the manufacturer\u2019s instructions.2 concentrations, annealing temperatures and number of cycles were optimized for Atm and cyclophilin A genes to perform PCR in the linear part of amplification [Atm) and the control, in this case cyclophilin A, to be measured by the comparison of the respective intensities of their distinct PCR amplified products on the same gel.PCR conditions such as MgClfication . We deteAtm primer, and 0.04\u00a0\u00b5M of each cyclophilin A primer, 0.2\u00a0mM dNTP, 1.5\u00a0mM MgCl2, 2.5\u00a0\u00b5l 10X PCR buffer, and 0.05 U Taq DNA polymerase (Invitrogen). Semiquantitative PCR was performed with a denaturing step of 94\u00a0\u00b0C for 4 min, followed by 30 cycles  of 94\u00a0\u00b0C for 30 s, 55\u00a0\u00b0C for 30 s, 72\u00a0\u00b0C for 1 min, then a final extension of 7 min at 72\u00a0\u00b0C. Atm primers (forward 5\u2032- ATC CCT TGT GTG TTC TCT G \u22123\u2032 and reverse 5\u2032- CGC CTC TGC TGT CGT GTA T \u22123\u2032) and cyclophilin A primers (forward 5\u2032-TGG TCA ACC CCA CCG TGT TCT TCG-3\u2032 and reverse 5\u2032-TCC AGC ATT TGC CAT GGA CAA GA-3\u2032) amplified 472 bp and 311 bp products, respectively.PCR reactions were performed in 25\u00a0\u00b5l of reaction mixture containing 2\u00a0\u00b5l cDNA, 0.2\u00a0\u00b5M of each PCR products were separated on 1% agarose gels and visualized by ethidium bromide staining under UV light. Each RT\u2013PCR reaction was done in triplicate with three different samples for each microdissected tissue extract. The image of the ethidium bromide-stained gel was digitalized, using a digital video image analyzer ImagerTM , and analyzed using ImageJ 1.40\u00a0g software.We systematically verified that all the PCR reactions were performed during their exponential phase, also called the linear phase, and, thus, that we had not yet reached the plateau phase.cyclophilin A gene expression, which reflects the initial amount of RNA, by making the ratio between the signal obtained for this Atm gene and that obtained on the control standard curve for the same quantity of cyclophilin A. Optical densities of the PCR bands were measured using ImageJ 1.40\u00a0g software. Statistical analysis was performed using ANOVA  to detect significant intergroup differences. Values are expressed as mean\u00b1SEM, and a p<0.001 was considered statistically significant. Comparisons were made between retina and other ocular tissues using a Student\u2013Newman\u2013Keuls test.PCR signals were normalized as a function of the Atm PCR product was inserted into the pCRII-TOPO TA Cloning vector (Invitrogen). Products were checked by sequence analysis. Digoxigenin (DIG)-labeled riboprobes were synthesized by in vitro transcription using the standard DIG-labeling reaction protocol from Promega . T7 and SP6 RNA polymerase were used for the sense and antisense riboprobes, respectively.Eyes from adult C57BL/6J mice were fixed by incubation in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) at 4\u00a0\u00b0C, embedded in paraffin, and cut into 5\u00a0\u03bcm sections. The Atm mRNA hybridization signals were developed with the BCIP/NBT Substrate System .Tissues were deparaffinized by incubation in xylene and rehydrated through a graded series of alcohol solutions. Next, 150 ng RNA probes were diluted in mRNA HIS Solution  and incubated with sections at 60\u00a0\u00b0C overnight in a humidified chamber. After washing in Stringent Wash Concentrate 50X (Dako), labeling was detected by incubation with 1:500 alkaline phosphatase-coupled anti-DIG antibody in antibody diluent (Dako) for 1 h at room temperature. Rabbit polyclonal anti-ATM (H-300), used at a dilution of 1:300, and goat polyclonal anti-recoverin (C-15), used at a 1:200 dilution, antibodies were purchased from Santa Cruz Biotechnology . We used three antibodies against phosphorylated ATM (pS1987 in mice that correspond to pS1981 in human) that display the same immunolabeling: rabbit polyclonal antibody pS1987 (ab2888), used at 1:50 dilution, was purchased from Abcam , mouse monoclonal antibody pS1987 (200\u2013301\u2013500), used at a 1:200 dilution, was purchased from Rockland  and rabbit polyclonal antibody pS1987 (11122), used at a 1:200 dilution was purchased from Signalway antibody . Mouse monoclonal anti-\u03b3H2AX antibody , used at a 1:500 dilution and mouse monoclonal anti-8-oxoguanine antibody (N45.1), used at a 1:40 dilution, were purchased from Upstate  and Gentaur  respectively.2HPO4; 1.47\u00a0mM KH2PO4; pH 7.4) between each step. After DAB staining, sections were counterstained with methyl green solution and mounted with Eukitt . For immunohistochemical staining of 8-oxoguanine (8-oxo-dG) in DNA, ribonucleic acids were removed from sections with 20\u00a0\u00b5g/ml Rnase solution (Invitrogen) and tissue DNA was denatured in 2N HCl for 5 min before incubation with primary antibody. The specificity of the antibody raised against the 8-oxo-dG was tested. Experiments were performed not only in normal adult retina but also in normal and Ogg1 knockout mice livers (data not shown). This modified base is known to be accumulated in the liver of \u2212/\u2212Ogg1 mice as compared to the normal liver of control mice [Paraffin sections were deparaffinized in Xylene and boiled in a microwave oven for two periods of 10 min in a citrate buffer composed of 0.01 M citric acid monohydrate, pH 6.0. Sections were incubated with primary antibody in antibody diluent (Dako) in a humidified chamber overnight at 4\u00a0\u00b0C. The ChemMate peroxidase/DAB Rabbit/Mouse detection kit (Dako) was used to detect bound antibodies, using the reaction protocol. Sections were washed in 1X PBS  in a humidified chamber overnight at 4\u00a0\u00b0C. Sections were washed and incubated with a 1:200 dilution of secondary Alexa Fluor 488 donkey anti-rabbit (A21206), Alexa Fluor 546 donkey anti-goat (A11056), or Alexa Fluor 488 goat anti-mouse (A11017) antibodies  in antibody diluent (Dako) in a humidified chamber for 2 h at room temperature in the dark. Washed sections were mounted in Fluorescent Mounting Medium (Dako). Sections were counterstained with 1:1,000 propidium iodide  or 1:1,000 TO-PRO-3 (Invitrogen).Optically sectioned images were acquired by confocal laser scanning microscopy using a Leica SP5 confocal microscope and analyzed using Leica Microsystems LAS AF software (1.8.2). Two labels colocalized if they were too close in the tissue to be resolved optically. The extent of colocalization of two labels was measured using the \u201cColocalization\u201d module of Imaris software , described previously . Briefly\u2212/\u2212Atm mouse tissues were used as controls for nonspecific binding.Total protein lysates were prepared in a Potter-homogenizer with cold buffer composed of 150\u00a0mM Nacl, 10\u00a0mM Tris HCL, 1\u00a0mM EDTA, 1\u00a0mM EGTA, 2\u00a0mM NaOV, 190\u00a0mM NaF, 2\u00a0mM PMSF, 1% Triton X100, 0.5% NP-40, and protease inhibitor cocktail (Sigma-Aldrich). Protein concentration was determined using a Lowry protein assay kit . Proteins were separated on 7% polyacrylamide gels. Each lane was loaded with 100\u00a0\u00b5g of protein extract. Separated proteins were transferred onto a nitrocellulose membrane and blocked with 5% skim milk for 1 h. Blots were incubated with either the monoclonal antibody against Mat-3  diluted 1:500 with 1% BSA in PBS-Tween for 3 h at room temperature or with the monoclonal antibody against ATMp (200\u2013301\u2013500) purchased from Rockland  and diluted 1:500 with 1% BSA in PBS-Tween overnight. In parallel, membranes were incubated with 1:1,000 goat anti-\u03b2-Actin antibody (Tebu) for 2 h at room temperature. Proteins were detected by chemiluminescence  on light-sensitive film . High amounts of 8-oxo-dG (a major oxidized form of guanine) are produced, both in genomic and mitochondrial DNA, by ROS in the retina, exposed to normal conditions of illumination and functioning in basal physiologic conditions. To evaluate the extent of oxidative damage of cellular DNA under basal conditions, we examined immunohistochemically the retinal and cerebellar distribution of 8-oxo-dG in the C57BL/6J mouse strain, using an anti-8-oxo-dG monoclonal antibody.+/+Atm) mouse strain and the Atm-deficient mice (\u2212/\u2212Atm). These strains have an sv129 genetic background. Both C57Bl/6J and sv129 mouse strains displayed the same 8-oxo-dG retinal immunostaining pattern , in the Atm knockout mice retina  varied less than 5% between each lane of electrophoresis migration in all our experiments and was used to normalize variations in Atm expression. Atm mRNA was detected in each mouse ocular tissue sample examined; bands of the same size were observed in both ocular and cerebellar tissues. Atm mRNA levels were significantly higher in the neuroretina than in any other ocular tissues  by nonradioactive in situ hybridization using DIG-labeled sense and antisense riboprobes [Atm sense probe , inner and outer nuclear layer (INL and ONL) and in PIS  as well as the inner and outer plexiform layers (IPL and OPL). Expression of Atm mRNA seemed higher in the PIS, INL, and GCL than in the ONL. Atm mRNA was also expressed in the RPE cell layer, which is adjacent to the neural retina and is also derived from the CNS , corneal stromal keratocytes (CS) and corneal endothelial cells (CEn) (Atm mRNA was readily detected in the lens epithelium (Le), the transitional zone (Tz), and in elongating fiber cells (Lf), in which the nucleus was still visible  and scleral (Sc) cells, also produced nscripts . We detels (CEn) . In the  visible . Iridal  signals . The pig signals .Atm expression in normal mouse cerebellum tissue sections. This served as a positive control for our experiments on adult mouse ocular tissues. As expected, no specific labeling was detected in any cerebellar tissue sections hybridized with the Atm sense probe  in adult ocular tissues using immunohistochemistry and western blot analysis. For immunohistochemistry experiments, we used three antibodies specific for mouse phosphorylated ATM at serine 1987 . The same pattern was observed with these antibodies. We used one of these pS1987 antibodies (Rockland) for western blotting. We detected a specific band in each lane of DNA electrophoresis migration, which corresponded to the size of ATMp. This band was not observed in ent mice . We deteent mice . ATMp iment mice . ATMp seent mice . We alsoent mice . No immuent mice .These highly reproducible observations shown in Among the non-neuronal cells of ocular tissue sections, we observed strong ATMp immunostaining in the nucleus and cytoplasm of CEp, CS, and CEn cells . WhereasWe observed strong nuclear ATMp immunolabeling in the PL , but weaOur findings revealed ATM immunolabeling in the nuclei of all retinal cell layers, but a different pattern of localization was observed for ATMp. We detected ATMp immunostaining, mostly in the cytoplasm of photoreceptor cells, but mainly in the nuclei of other retinal cells. We also observed the same distinct and specific patterns of ATM and ATMp localization in the cerebellar GL. ATM protein was detected mostly in nuclei, whereas ATMp seemed to be localized in the cytoplasm of granule cells. To confirm this, we determined ATM and ATMp distribution and their subcellular localization using high-resolution confocal imaging of adult mouse retinal and cerebellar tissue sections.Confocal imaging showed ATM immunolabeling to be present in the nuclei of the ONL. Colocalization of ATM and nuclear DNA staining (TO-PRO-3) was particularly marked at the peripheral nucleoplasmic euchromatin, which surrounds the central densely stained heterochromatin  Figure . We usedIn cerebellar tissue sections, ATM immunostaining in PL appeared to be predominantly nuclear, with faint but detectable labeling in the cytoplasm . ATM immWe can summarize our findings as follows: ATM and ATMp were distributed in the same cells in all ocular compartments, with the exception of the ONL. In most, if not all, ocular compartments, ATM cellular immunoreactivity was detected primarily in the nucleus. ATMp cellular immunoreactivity was also detected primarily in the nucleus in most ocular cells, but was also detected in the cytoplasm. Indeed, we observed ATMp immunoreactivity mostly, if not exclusively, in the cytoplasm of all photoreceptors, in the PIS layer, as well as in the OPL and in the IPL. ATM appeared to be localized exclusively in the nucleus of these cells. These contrasting distribution patterns for ATM and ATMp were also observed in the granule cells of the cerebellum.Atm knockout and age-matched wild-type control mice. The technical approach used is not sensitive enough for detecting differences between Atm knockout and control mice. There might be compensatory systems that could make this detection extremely difficult whatever the method used. It seems plausible that ATR and DNA-PKcs serve to repair the DSBs potentially triggered by physiologic oxidative stress naturally existing in the retinal neurons in general and in the photoreceptor cells in particular. Furthermore, more detailed studies of retinal and cerebellar \u03b3H2AX phosphorylation throughout C57Bl/6J mouse lifespan are required for evaluating accurately the time course of spontaneous occurrences of DSBs and their extent both in nuclear and mitochondrial genomes. Similar studies should also be performed, both in retina and cerebellum, of \u2212/\u2212Atm and control mice at different stages of their lifespan, independently of any gamma irradiation.The damaging effects of visible and UV radiation on the mammalian retina can be detected as functional, morphological, or biochemical changes in the photoreceptor cells  and RPE Atm-deficient mice have both high levels of oxidative stress in cerebellum [The ATM protein acts to protect the nervous system from oxidative damage . Indeed,rebellum ,73,74 anrebellum , the cerrebellum ,75. Addirebellum , and a crebellum . The A-Trebellum ,31. HighSeveral studies suggest that ATM protein is localized in the cytoplasm of human and murine cerebellar neurons, contrasting with its nuclear localization and functions in proliferating cells ,39,76. HWe investigated the presence and distribution of ATM mRNA and protein. ATM is present in cells as two different forms: ATM and ATMp. We thus performed a comparative study of their cellular distribution in the normal adult mouse eye and cerebellum.Atm gene expression is upregulated in response to a mitogenic stimulus, resulting in an increase in ATM protein levels [Atm gene are more sensitive than wild-type animals to the cataractogenic effects of IR [Nbs1 in the lens altering the nuclear localization of the MRN (Mre11/Rad50/Nbs1) complex contributes to the early stages of cataract development due to impaired lens fiber cell differentiation [The cornea and lens are the first tissues to receive and absorb the light directly. ATM immunoreactivity was mostly detected in the nucleus, with a fraction observed in the cytoplasm of all corneal epithelial cells. ATMp showed strong staining both in the nucleus and cytoplasm of all epithelial corneal cells. It has been demonstrated that n levels . Moreoven levels . As miton levels , it is nts of IR ,83. IR-intiation . The MRNntiation . Additiontiation . Indeed,Light as well as UV radiation cross the cornea and aqueous humor of the anterior chamber to meet iridal and ciliary body cells. As may be expected, ATMp shows strong immunostaining in these cells. Indeed, the iris is a potential site of free radical damage as it is rich in polyunsaturated fatty acids, which are particularly susceptible to peroxidation . FurtherPhotoreceptor cells continuously produce high levels of ROS as a byproduct of their various functions throughout their lifespan. Thus, as may be expected, we detected ATM and ATMp immunoreactivities in these cells. The POS may be highly susceptible to lipid peroxidation by ROS due to their high concentration of docosahexaenoic fatty acyl chains and to the proximity of the likely sources of ROS production: peroxisomes and mitochondria in the adjacent PIS and RPE cells during POS phagocytosis. In this study, we detected significant levels of ATMp in PIS and in the IPL and OPL. However, the subcellular localization of ATM and ATMp in photoreceptors differed substantially from that observed in other retinal cells. Indeed, ATM immunoreactivity in the ONL was mostly, if not exclusively, confined to photoreceptor nuclei and did not colocalize with recoverin immunoreactivity. In stark contrast with ATM staining in photoreceptor cell bodies, ATMp had a predominantly cytoplasmic localization.Atm deficiency leads to abnormalities of cytoplasmic organelles [The function of ATM in the cytoplasm is not clear, but previous findings in mice have demonstrated that ganelles . The difganelles . It is wIn the neuroretina, the activated form of ATM is present in the cytoplasm, where it may protect against oxidative damage resulting from the high levels of ROS production by peroxisomes and mitochondria-major sites of oxidative metabolism. A pioneering study suggested that some ATM protein was localized outside the nucleus in cytoplasmic vesicular structures, more precisely in the microsomal fraction . AdditioThe reason for cerebellar degeneration in A-T is not clear. It has been attributed, by several investigators, to cytoplasmic functions of ATM that are not necessarily linked to the DNA damage response. PIS are highly enriched for peroxisomes and mitochondria. These organelles are sources of ROS but contain specialized antioxidant systems responsible for detoxifying reactive oxygen intermediates. However, when faced with excessively high oxidative stress and DNA damage, these systems cannot carry out their normal detoxification functions. ATM signaling is required to sense and initiate DNA DSBs repair. Therefore, nuclear genomic instability resulting from loss of this function has so far been considered as the major mechanism underlying the pathology of A-T. However, this disease presents a wide variety of symptoms, not all of which are readily explained by nuclear genomic instability. The study of cells and animal models of A-T has led to much speculation about additional pathogenic mechanisms.Moreover, recent studies have demonstrated that ATM is involved in other important functions. Two novel intertwined roles have been proposed for ATM: the regulation of ribonucleotide reductase, the rate-limiting enzyme in the de novo synthesis of deoxyribonucleoside triphosphate, and the control of mitochondrial homeostasis ,94. ATM trans retinal to the photosensitive 11 cis retinal, which is a key molecule of the visual cycle and phototransduction cascade. It also constitutes the outer hemato-ocular barrier of the eye. In addition to its light absorption properties, which generate free radicals, RPE is exposed to high oxygen concentrations, which may promote the generation of ROS, inducing oxidative damage in the event of impaired antioxidant defense mechanisms [Although the highest oxygen concentrations are detected in the neural retina, one should not underestimate the importance of oxygen consumption and ATP production and thus the high amounts of ROS physiologically produced in RPE cells ,98. ATM chanisms . Indeed,chanisms . The evechanisms . The sigAtm-deficient mice and A-T patients. So far, no such abnormalities have been reported. It remains to be determined why distinct ATM and ATMp immunostaining patterns are observed in granule cells and photoreceptors but not in other neuronal cells.The cytoplasmic localization of ATMp in photoreceptors is intriguing, as some form of retinal degeneration or dysfunction would be expected to occur in RetNet). This highlights a specific susceptibility of these cells to oxidative stress and DNA damage. The molecular basis of this cell type-specific susceptibility remains to be elucidated. The Harlequin mutant mouse strain (Hq) is an important mouse model, combining both cerebellar granule and photoreceptor cell degeneration [One possible explanation for this discrepancy may be related to the specific neuronal cell types targeted in various neurodegenerative diseases involving either the cerebellum or retina, or both. Indeed, studies performed on postmortem cerebellum samples from A-T patients unequivocally demonstrate that cerebellar granule cells are major targets of the A-T neurodegenerative process . Whateveneration . This mopcd) [Pcd mutant mice undergo selective degeneration of specific neuronal populations: cerebellar Purkinje cells, photoreceptor cells, and olfactory mitral cells. A recent study has identified predegenerative changes, including DNA damage/repair foci in target neurons with a well preserved general cytology, in the early stages of the neurodegenerative process in these mice [pcd mice contrasts with the apparent resistance of the same cells in Atm-deficient mice. Indeed, no retinal degeneration or dysfunction has been reported so far both in A-T patients and in Atm-deficient mice [Atm-deficient mice ophthalmic phenotypes must nowadays be reassessed by emerging noninvasive techniques increasingly available for exploring both human and mouse retinal structure and functions. This is mandatory for eliminating the possibility that A-T patients and Atm-deficient mice photoreceptors might actually display some subtle or manifest retinal dysfunctions corresponding to predegenerative alterations possibly reversible, such as those detected at the earliest stages of the neurodegenerative process occurring in the olfactory mitral cells of pcd mutant mice. Most A-T patients are affected by oculo-motor abnomalities. These abnormalities prevent in most cases the stable fixation of any visual stimulus. The absence of fixation often does not allow the ophthalmologists to perform complete and accurate visual examinations. Many A-T patients display a characteristic oculomotor apraxia (difficulty in the initiation of voluntary eye movements) frequently preceding the development of telangiectases [Another alternative, but not exclusive, explanation of these distinct patterns of ATM and ATMp localization and their possible link to the apparent sparing of photoreceptor cells in A-T patients might be provided by findings obtained in the mutant Purkinje cell degeneration mouse model (pcd) . Pcd mutese mice . The subent mice -108. Howiectases . Moreoveiectases . It is iAtm-deficient cells have severe cell-cycle checkpoint defects in response to IR exposure. The overlapping and redundant functions of ATM and ATR, as well as their specific distinct functions, may vary according to neuronal cell type. Further experiments based on conditional knockout mice for ATR as well as ATM are needed to test this hypothesis.Another possible explanation for the discrepancy observed between ATM and ATMp cellular immunostaining patterns may involve the second master regulators of the DNA damage response: ATR protein kinase . Most ATThe importance of maintaining genomic stability in neurons cannot be overemphasized. Their finite number, long life, high metabolic rate, and continuous exposure to oxidative stress, together with high levels of gene transcription, require stringent control of genomic integrity. Our findings show that ATM is present in the adult mouse whole cerebellum and retina. ATM and its activated form seem to be required for preventing the accumulation of oxidative damage in the eye, especially in the photoreceptors of the retina. The ATM/ATMp system is involved in the protection from abnormal ROS production and irreparable lethal DSBs and DNA deletions. Retinal antioxidants and DNA repair systems seem to be particularly efficient in the adult retina; indeed, retinal malignancy is rare in adult patient retinas despite daily exposure to UV and visible light radiations and metabolism-induced damage. Our study provides further insight into the molecular building blocks and pathways underlying the highly efficient retinal systems protecting against oxidative stress, DNA damage, retinal degeneration, and malignancies."}
+{"text": "The influence of surgical stress on resistance to i.v. challenge with Walker 256 tumour cells was investigated in rats, with respect to the functional state of the reticuloendothelial system (RES). Phagocytic activity of the RES was evaluated by colloid (gelatinized [131I] \"RE test lipid emulsion\") clearance, and opsonin levels were determined by bioassay. Reticuloendothelial clearance capacity was significantly (P less than 0-05) depressed 60 min following surgery  as quantified by both humoral and cellular parameters of RE function. Phagocytic depression was primarily due to impaired hepatic Kupffer cell function and related to a deficiency in the phagocytic supporting capacity of plasma, also referred to as opsonic or recognition factor (RF) capacity. During the postoperative period of RES colloid clearance depression, pulmonary localization of the blood-borne test particulate matter increased. Rats challenged with 51Cr-labelled viable tumour cells at a dose of 1-0 X 106 i.v., either prior to or during the postoperative period of RE depression, manifested a significant (P less than 0-05) increment in pulmonary localization of the viable tumour cells, and a decrease (P less than 0-05) in hepatic clearance. Evaluation of survival patterns demonstrated a significant (P less than 0-01) decrease in host resistance to i.v. tumour cell challenge (2 X 103 cells) during the postoperative period of RE depression and hypo-opsonaemia. Sham-anaesthetized control animals survived 17-9 +/- 0-8 days, while animals challenged during the period of RE depression survived 7-9 +/- 0-4 days. An increased incidence of respiratory distress and nasal discharge was observed in the animals with impaired survival. Thus, surgical manipulation may transiently compromise RES systemic host defence and may be reflected in an increment in the pulmonary localization of blood-borne tumour cells. The relationship of this altered pattern of tumour cell distribution to the impaired survival remains to be determined, and warrants investigations."}
+{"text": "Purpose. Totally endoscopic management  of patients with a duplicated renal system (DS) associated with severe vesicoureteral reflux (VUR) or obstructive ureterocele (UC) is an attractive alternative to traditional open procedures. The authors discuss feasibility and results of an all-endo approach on a consecutive series of patients. Methods. From 1999 to 2009, all patients with a complete DS associated with UC and/or VUR were proposed for primary all-endo approach. UC puncture was performed using a 3\u2009Fr Bugbee electrode. Deflux  injection was administered for VUR. The need for secondary surgery was evaluated on followup. Results. Of the 62 patients recruited, 46 were treated using a primary all-endo approach and 16 patients received no treatment. Of the 46 treated patients with 56 affected renal units, 32 (97%) UCs collapsed following puncture and 29 (63%) VURs were resolved or downgraded. Secondary VUR occurred in 13 (39%) renal units. Secondary surgery was performed on 23 (41%) renal units. Conclusion. The all-endo approach for VUR in DS is an effective therapeutic option. UC collapse was achieved by puncture in most of the patients; secondary VUR was the main complication in a small group of extravesical UC. There is wide debate on the management of patients with a complete duplicated pyeloureteral system (DS) associated with ureterocele (UC) and/or major vesicoureteral reflux (VUR), and consensus on this matter has not yet been reached \u20135. This From 1999 to 2009, patients with unilateral or bilateral complete DS associated with UC and/or VUR were recruited. Informed consent was acquired for each patient. Preliminary examinations included ultrasonography and voiding cystourethrogram (VCUG). The grade and side of VUR were recorded. Dilated duplicated system, position , and size of UC were established. A 99mTc-mercaptoacetyltriglycine (MAG3) diuretic renal scan was used in all UCs with a dilated upper system. A 99mTc-dimercaptosuccinic acid (DMSA) renal scan was performed in all VUR to evaluate scar formation. Urinary magnetic resonance imaging was undertaken in patients with unclear anatomy and poor renal function. After initial conservative management, a primary all-endo treatment approach was elected for selected patients. Common indications to perform UC puncture were a dilated upper system and recurrent urinary infections or an obstructive renographic pattern in a still functional renal moiety. Endoscopic treatment was indicated for patients with persistent grade \u2265III VUR and recurrent urinary tract infections following antibiotic prophylaxis. Three treatment options were available: puncture alone, puncture and Deflux  injection, and Deflux injection only. UC puncture was performed on the lower portion using a 3\u2009Fr Bugbee electrode. Deflux injection in the refluxing ureter was the preferred endoscopic procedure.UC size and upper tract dilatation were monitored twice a month after endoscopic puncture using ultrasonography; possible occurrence of secondary VUR was monitored by VCUG at one month. The MAG3 diuretic scan was repeated after 3 months. Results of VUR treatment were monitored by VCUG 3\u20136 months after Deflux injection. Patients underwent a repeat DMSA scan 6 months after conservative treatment and 12 months after successful endoscopic management. Secondary open surgery was considered if the endoscopic approach was unsuccessful. Whenever a simultaneous all-endo treatment of UC and VUR was performed, a control MAG3 scan was only used to check postoperative split function.The outcome of a primary all-endo approach was correlated with DS variants . Data were analyzed with GraphPad InStat software (version 3.10) . The chi-square test used for univariate comparisons. Fisher's exact test was used comparisons of categorical variables.P < 0.05 was considered significant.Multiple regression tests were used for factors influencing outcome. n = 17, 27%) were enrolled because of a history of febrile urinary tract infections. Among the 62 patients with documented DS, 40 patients had a UC of the upper moiety. Twenty-three UCs were on the right side , and 17 were on the left side . No bilateral cases were observed. VUR was associated with DS in 44 patients, occurring on the right side in 26 patients  and on the left side in 18 patients . In one patient, VUR affected both renal districts of the left DS. No treatment was required in 16 patients. Among these patients there were six nonobstructive small intravesical UCs and one extravesical UC corresponding to a multicystic upper moiety. Asymptomatic grade I\u2013III VUR affecting 12 lower renal moieties reduced spontaneously within 6 months after diagnosis.A total of 62 patients, with male\u2009:\u2009female ratio of 43\u2009:\u200919 and a mean age at referral of 18 months, (range 1\u201396 months), were recruited. Detection of hydronephrosis by antenatal ultrasonography led to the enrollment of 45 patients (73%); all other patients . Of these patients, 30 (65%) were enrolled following antenatal ultrasonography diagnosis of DS and/or UC at birth. Mean age at first treatment was 39 months (range 1\u201395 months). Among these patients, 9 had complete bilateral DS and 37 had complete unilateral DS. Forty-three unilateral UCs were observed. Twenty extravesical UCs were punctured; 12 of these UCs were associated with grade \u2265III VUR in the lower pole and these patients underwent simultaneous endoscopic VUR correction. Thirteen intravesical UCs were punctured, 11 of which were associated with grade \u2265III VURs in the lower moiety, which were treated endoscopically during the procedure. VUR not associated with UC was recorded in 23 renal moieties in 22 patients with DS. The lower renal moiety was involved in 21 of these patients, and both renal moieties were involved in the remaining patient. Deflux injections were administered to each affected renal unit. The procedure was repeated 4 months after the initial injection in 6 patients for a persisting grade \u2265III VUR or for a lower grade associated with UTI. The outcome of the all-endo primary treatment approach to 56 renal units affected by UC and/or grade \u2265III VUR is shown in In the 46 patients with DS associated with UC and/or VUR, the primary all-endo treatment was successful and resolutive in 23 (50%). For a further 17 (37%) patients this treatment strategy resolved breakthrough urinary tract infection and urinary obstruction and delayed the need for open reconstructive surgery. Only 6 patients (13%) with persistent severe VUR required secondary total or partial demolitive surgery for severe renal dysplastic changes. Factors affecting the outcome of the all-endo management approach and the rate of secondary surgery are shown in n = 29). The outcome of all-endo management was significantly influenced by the grade of VUR (P = 0.0261). UC collapse after puncture occurred in 32/33 renal units (97%), but secondary VUR occurred in only 13 of these patients (39%). The occurrence of this complication was significantly correlated with UC position and anatomy . UC position and anatomy also significantly influenced the need for secondary open surgical procedures in 23/56 renal units . In 14 of them there was an extravesical UC, in 12 an initial high-grade (\u2265IV) VUR in the lower pole. Twenty-five secondary surgical procedures were required (Endoscopic treatment of VUR by Deflux injection and puncture or Deflux injection alone was successful in 63% of renal units treated (required  mainly dRecent thinking on an endoscopic approach to DS associated with UC and/or VUR continues to be controversial. Surgery at the bladder level has been advocated for large extravesical UC of the upper pole associated with high-grade VUR in the lower pole \u201311. Afte"}
+{"text": "Alcohol problems are a major UK and international public health issue. The prevalence of alcohol problems is markedly higher among prisoners than the general population. However, studies suggest alcohol problems among prisoners are under-detected, under-recorded and under-treated. Identifying offenders with alcohol problems is fundamental to providing high quality healthcare. This paper reports use of the AUDIT screening tool to assess alcohol problems among prisoners.Universal screening was undertaken over ten weeks with all entrants to one male Scottish prison using the AUDIT standardised screening tool and supplementary contextual questions. The questionnaire was administered by trained prison officers during routine admission procedures. Overall 259 anonymised completed questionnaires were analysed.AUDIT scores showed a high prevalence of alcohol problems with 73% of prisoner scores indicating an alcohol use disorder (8+), including 36% having scores indicating 'possible dependence' (20-40).AUDIT scores indicating 'possible dependence' were most apparent among 18-24 and 40-64 year-olds (40% and 56% respectively). However, individual questions showed important differences, with younger drinkers less likely to demonstrate habitual and addictive behaviours than the older age group. Disparity between high levels of harmful/hazardous/dependent drinking and low levels of 'treatment' emerged (only 27% of prisoners with scores indicating 'possible dependence' reported being 'in treatment').Self-reported associations between drinking alcohol and the index crime were identified among two-fifths of respondents, rising to half of those reporting violent crimes.To our knowledge, this is the first study to identify differing behaviours and needs among prisoners with high AUDIT score ranges, through additional analysis of individual questions. The study has identified high prevalence of alcohol use, varied problem behaviours, and links across drinking, crime and recidivism, supporting the argument for more extensive provision of alcohol-focused interventions in prisons. These should be carefully targeted based on initial screening and assessment, responsive, and include care pathways linking prisoners to community services. Finally, findings confirm the value and feasibility of routine use of the AUDIT screening tool in prison settings, to considerably enhance practice in the detection and understanding of alcohol problems, improving on current more limited questioning (e.g. 'yes or no' questions). Alcohol problems are a major public health issue in the UK. The consequences affect individuals, their families, the health and emergency services and wider society. The strong association between alcohol consumption and an individual's risk of being either a perpetrator or victim of violent crime has been identified internationally . The extIn Scotland, alcohol is known to be closely associated with domestic abuse  and is aThe prevalence of alcohol problems is markedly higher in the Scottish prison population compared to the general population, at all ages and for both women and men, as shown in comparative analysis conducted as a separate part of this study . Among mIt is important to put alcohol-related offending into a broader social and economic context. Prisoners in Scotland are predominantly young men from disadvantaged backgrounds, many of whom have substance misuse problems . The ScoIdentifying individuals with alcohol problems is fundamental to providing high quality interventions tailored to individual needs in prison settings. It is also a necessary step to address the links between alcohol and offending described above by aiming to intervene in the often cyclical process of prison admissions where alcohol plays a major part. Effective identification is needed to signpost individuals to appropriate intervention, treatment and support options.Currently, there are prescribed screening points on admission to all Scottish prisons at which alcohol problems could be identified: reception screening (nurse), medical check  and Core Screen (prison officers). Additionally, prisoners can be referred or self-refer to medical and addiction services at any point during their incarceration. However, questioning on entry for alcohol does not extend much beyond a 'yes/no' response to the question 'Do you have an alcohol problem?' This was recalled by prisoners themselves as an \"aye or no\" question in the course of qualitative interviews conducted as a separate part of this study . Any furEffective assessment of prisoners is also essential to establish the range of needs relating to alcohol problems, in order to provide adequate, high quality health and social supports to address these needs. Research in England has suggested that only a limited proportion of those with alcohol problems are identified on entry to the prison system . In the In a rapid review conducted as part of this study, 13 studies which evaluated the reliability and/or validity of a range of alcohol screening tools with prison populations were identified ). In EngThis paper reports on data collected using the AUDIT screening tool with entrants to a Scottish prison. It assesses the extent of alcohol problems in this particular setting and provides additional analysis by key socio-demographic and crime-related factors. The paper also assesses the value and feasibility of using the AUDIT screening tool in prison settings. This work formed part of a larger national study  designedA screening questionnaire was developed which incorporated the World Health Organization's AUDIT standardised screening tool  and suppScores from the ten individual AUDIT questions \u2022 Zone III 16-19 represents a high level of alcohol problem: ('harmful' drinking)\u2022 Zone IV 20-40 clearly warrants further diagnostic evaluation for alcohol dependence: ('possibly dependent')Eight supplementary questions were added in order to provide additional contextual data for the screening results. These questions enquired into: sentence status, impact of alcohol and substances on the crime, treatment experience, employment, education, marital/family status and age. Showcards facilitated response choices where these were too detailed for the administered questionnaire . The prison intake incorporated short term and longer term sentenced prisoners as well as remand, and included young offenders as well as adults. The screening questionnaire was administered at the same time as the Scottish Prison Service (SPS) Core Screen/Induction interview by the four prison officers who routinely undertook this procedure . A preparatory two hour training session was held with these officers, together with relevant management and administrative staff.'What's in a Drink?' , whThe proportion of non-drinkers in the offender sample (15% over the previous year) is higher than in the general population, particularly in 'middle' age group (28% of 30-39 year-old prisoners). For example, the 2009 SHeS, showed 10% of males reporting not drinking, with the highest proportions of non-drinkers among 65 and over age groups, not represented in our prison sample . HoweverThe findings also highlight the high proportion of prisoners on remand or on very short sentences which presents further challenges to service provision, requiring a rapid response when in prison and greater attention to care pathways facilitating access to community-based interventions.Drinking alcohol was self-reported as associated with the index crime among two-fifths of respondents. This was most notable among older and younger prisoners, and was also higher among the sub-sample reporting violent offences . This is similar to responses to the SPS 2009 survey  where haWhilst it would be simplistic to identify alcohol as the only factor in these crimes, the findings add to the argument for addressing alcohol issues as a priority in the criminal justice setting, and their potential impact on reducing recidivism. The combined influence of drugs is also likely to be a factor but it is important that alcohol is addressed independently as needed.The data provide indications of disparity between the high levels of harmful/hazardous/dependent drinking identified and low levels of engagement with 'treatment' in this study population. Only around a quarter of those with AUDIT scores indicating possible dependency reported being 'in treatment for their drinking', incorporating even fewer having been engaged in ongoing community based work with alcohol issues. Whilst the data need to be viewed with caution as respondents' interpretation of the question appears variable and there is also scope for referral to services during the prison admission, nevertheless the proportion reporting existing engagement with services is low, considering the AUDIT scores relate to behaviour prior to admission.had received help/treatment. More positively, over one third of prisoners said they would take help for alcohol problems in prison (39%) and outside prison (36%), if offered.The challenging gap between prevalence of high consumption and problematic behaviours, and the current levels of service provision and access to alcohol interventions within prisons is reflected across the prison estate. The annual SPS survey data , show thThese findings confirm the potential of the AUDIT screening tool in terms of its value and feasibility in criminal justice settings. However, this analysis has also revealed important variations based on individual questions, particularly in revealing variations in drinking behaviour patterns and dependency levels among those with high levels of consumption, and also the presence of non-drinkers. Thus, in identifying individual and service needs, attention to individual question responses is required which in turn could enhance the value of using AUDIT.Using a validated screening tool on entry to prison is of key importance in identifying individual needs and appropriate routes linked to care pathways, as well as a clearer understanding of service requirements. Limited 'aye or no' questioning on admission such as 'Do you have an alcohol problem?' is likely to meet with the answer 'no', as shown from qualitative enquiry with prisoners and staff as a separate part of this study . A 'no' Finally, the administration of the AUDIT screening tool by trained prison officers as part of routine procedures was successful, including collection of the additional demographic data.The screening highlighted indicators of disadvantage and social exclusion among prisoners, with a high proportion of men without employment, with limited educational achievements and living alone. These findings contribute to a picture of men tending to live outside a range of social support mechanisms such as living with partners and parenting. Lack of social support has major implications for successful resettlement and desistence from offending , althougThere are some limitations to applying the study findings more widely; for example women prisoners  were not included as this was a single prison study. In addition, compared to the general Scottish prison population over a similar period, the sample is somewhat younger with shorter sentences ; for exaThe screening timing on entry may have resulted in underestimates of prevalence. Maggia et al  identifiAs far as the authors are aware, this is the first study in offender populations to detect differences in drinking patterns between younger and older 'possibly dependent' drinkers (score 20-40), reflecting AUDIT scores and analysis of individual question responses. The screening tool highlights varying needs among those with high scores and also enables identification of those who might not acknowledge that they have an alcohol problem in response to a limited 'aye or no' screening question, for example younger binge drinkers with few indications of dependency. This in turn creates greater opportunities to encourage engagement with interventions. In addition, the findings confirm the value and feasibility of routine use of the AUDIT screening tool in prison settings to considerably enhance practice in the detection and understanding of alcohol problems, improving on current more limited questioning ('aye or no' questions).The high prevalence of problematic drinking identified in the study, and the varied patterns of heavy drinking behaviours, together with links between drinking and crime and recidivism, support the argument for more extensive provision of alcohol-focused interventions in prison and related criminal justice settings. There is a need for a tiered approach, varied in intensity, and carefully targeted based on effective initial screening and assessment. The need for a rapid response and pathways providing links with community-based services is highlighted by the high proportion of those on remand or sentenced for very short periods and the high proportion of repeat offenders. Throughcare, outreach and inreach are essential concurrent developments that would help develop more streamlined and consistent care pathways. Potential interactions between drinking and drug use also need to be taken into account, in addition to other complex needs such as mental health, but the need for more alcohol specific interventions should also be prioritised. Finally, the high prevalence of socio-demographic indicators of disadvantage has implications for both successful desistance and rehabilitation, and holistic interventions which address such broader social and contextual issues are urgently required, which in turn may address prevalence of alcohol problems.AARS: Alcohol Arrest Referral Schemes; ABI: alcohol brief intervention; ANOVA: analysis of variance; AUDIT: Alcohol Use Disorders Identification Test; AUD: alcohol use disorder; CAGE: 'cut down, annoyed, guilty, eye-opener'; CJS: Criminal Justice System; NHS: National Health Service; NOMS: National Offender Management System; NRES: National Research Ethics Service; NVQ: National Vocational Qualification; OASys: Offender Assessment System; OHT: Offender Health Trainers; p/P: probability; PASW: Predictive Analytics Software; Q: question; sd/SD: standard deviation; SHeS: Scottish Health Survey; SPS: Scottish Prison Service; SPSS: Statistical Package for the Social Sciences; UK: United Kingdom; WHO: World Health Organization.The authors declare that they have no competing interests.SM and TP developed the detailed design of this study, and the final research instruments. LG and AM devised the overall research programme, including the original design for this study, and actively commented on design details, the report and this paper. With TP leading the overall study, SM led the section reported here, including data collection, overseeing training of officers and reporting of the analysis. OB oversaw data input and contributed to the analysis and reporting. AB undertook the statistical analyses and contributed to reporting. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/11/865/prepubAUDIT screening questionnaire and supplementary questions. This file contains the screening tool used in the study; comprising the AUDIT screening questionnaire1 and eight supplementary questions designed to provide additional contextual data for the screening results. 1Babor TF, Higgins-Biddle JC, Saunders JB, Monteiro MG: nd edition)AUDIT: The Alcohol Use Disorders Identification Test - Guidelines for Use in Primary Care (2. Geneva: World Health Organization; 2001.Click here for file"}
+{"text": "Gordonia terrae 3612. Both have siphoviral morphologies with isometric heads and long tails (500\u00a0nm). The genomes are 75,380\u00a0bp long and closely related, and the tape measure genes (9 kbp) are among the largest to be identified.Bacteriophages Katyusha and Benczkowski14 are newly isolated phages that infect  Gordonia spp. are common soil bacteria and are also associated with wastewater treatment plants , consistent with the length of the virion tails (approximately 500\u00a0nm). These are among the longest phage genes identified, and only slightly shorter than the tape measure protein gene of 9,141\u00a0bp ). AlthouBenczkowski14, Katyusha, and GMA7 each have two genes located downstream of the virion structural gene operon coding for lysis functions, with one coding for a muramidase and a second coding for a peptidase. All three genomes also have two or more closely linked genes encoding putative protein products, at least one of which is anticipated to provide the holin function. We did not identify either integrase or putative repressor genes, which is consistent with a strictly lytic lifestyle.KU963262 and KU963258, respectively.The genomes of Benczkowski14 and Katyusha are available from GenBank under the accession numbers"}
+{"text": "ICB) antibodies, which antagonize inhibitory receptors on T cells and their ligands and thus unleash the cellular immune system against the tumor. ICB showed tremendous effects in several types of cancer. However, only a proportion of the patients suffering from tumors, which are in principle sensitive, benefit from this treatment and other kinds of neoplasia are completely resistant. Great effort is currently being undertaken to distinguish responders from non\u2010responders, and concepts to turn the latter into the former are urgently required. One approach is to combine ICB with already well\u2010established treatment strategies, that is, the other mainstays of cancer therapy such as surgery, radiation therapy (RT), and chemotherapy. Depending on the circumstances, both chemotherapy and RT may act either immune suppressively or immune stimulatingly. In this issue of EMBO Molecular Medicine, Azad et\u00a0al (ICB monotherapy, becomes responsive to this treatment by simultaneous RT or chemotherapy.Immunotherapy has evolved as a new pillar of cancer treatment during the last decade. The main breakthrough was the development of immune checkpoint blocking (ad et\u00a0al  show tha Tumors hijack these mechanisms to evade immune response, and blocking these so\u2010called immune checkpoints  with therapeutic antibodies generated impressive results in a variety of tumors. These include malignant melanoma, Hodgkin lymphoma, Merkel cell carcinoma, and head and neck, breast, lung, gastric, hepatocellular, renal cell, ovarian, and colorectal cancer . The outcome of this trial will put the findings of Azad et\u00a0al (Clinical research on combined treatments is rapidly progressing, and although few results have been published, about 40 clinical trials are already listed on ad et\u00a0al  to the tClearly, the take\u2010home message, which was already well received in the field, is to hit the tumor simultaneously with as many different weapons as possible. The older strategy was overcome, to treat sequentially with first\u2010, second\u2010, and third\u2010line treatment while waiting each time until resistance occurred, and only after that try immunotherapy or other experimental treatments. The combination radiation and ICB treatment brings new hope, especially for those malignancies for which the current standard of care is not significantly efficacious."}
+{"text": "The exercise interventions were matched with regards to walking speed, and VO2 and heart rate was assessed throughout all interventions. A 4-hour liquid mixed meal tolerance test commenced 30 min after each intervention, with blood samples taken regularly. IW3 and IW1 resulted in comparable mean VO2 and heart rates. Overall mean postprandial blood glucose levels were lower after IW3 compared to CON , with no significant differences between IW1 (10.5\u00b12.8 mmol/L) and CON or IW3 and IW1 (P > 0.05 for both). Conversely blood glucose levels at specific time points during the MMTT differed significantly following both IW3 and IW1 as compared to CON. Our findings support the previously found blood glucose lowering effect of IW3 and suggest that reducing the interval length, while keeping the walking speed and time spend on fast and slow walking constant, does not result in additional improvements.Interval-type exercise is effective for improving glycemic control, but the optimal approach is unknown. The purpose of this study was to determine the importance of the interval length on changes in postprandial glycemic control following a single exercise bout. Twelve subjects with type 2 diabetes completed a cross-over study with three 1-hour interventions performed in a non-randomized but counter-balanced order: 1) Interval walking consisting of repeated cycles of 3 min slow (aiming for 54% of Peak oxygen consumption rate [VONCT02257190ClinicalTrials.gov  Physical activity is part of the first line treatment in type 2 diabetes and the effect of physical activity on glycemic control is extensively investigated with well-documented beneficial effects ,2. The oSubjects with type 2 diabetes are recommended to do moderate-intensity aerobic exercise at least three days per week with no more than two consecutive days without exercise . This meWe have tested aerobic interval walking (IW) as a novel type of exercise and found that both a long-term exercise intervention ,5 and a The reason why IW is superior to CW upon improving glycemic control is unclear. In that context, at least two factors separate IW from CW: Peak exercise intensity and the alternating intensity pattern (the shift from low to high intensity and vice versa). Since some studies have found that continuous exercise with higher intensity results in greater improvements in metabolic variables compared to continuous exercise with lower intensity \u201312, the In that context, one study including overweight/obese men compared two high intensity interval training programs consisting of cycles of 1 min and 2 min duration, respectively . Both prTherefore, the aim of this study was to investigate whether the benefit from an acute interval exercise session on postprandial glycemic control can be increased if more intervals are performed. For this purpose we compared IW3 to an interval session consisting of repeated cycles of 1 min of slow and 1 min of fast walking (IW1) in subjects with type 2 diabetes. The two exercise sessions were matched with regards to walking speed and time spend on fast and slow walking. We hypothesized that both exercise sessions were superior to no walking upon improving glycemic control, and furthermore that IW1 might improve glycemic control more than IW3.2, were recruited to the study via advertisements. Exclusion criteria were the use of exogenous insulin, pregnancy, smoking, evidence of liver, renal, cardiopulmonary or thyroid disease, pre-menopausal status (for women) and contraindications to increased levels of physical activity [Subjects with type 2 diabetes , age > 3activity .2peak-test with a portable indirect calorimetry system . Furthermore, subjects completed a physical activity questionnaire [All subjects underwent a medical screening including a medical examination, a blood chemistry screen, an oral glucose tolerance test (OGTT), a Dual x-ray absorptiometry (DXA) scan  and a graded walking VOionnaire .2peak test consisted of three successive 3-min stages where subjects walked on flat ground with subjective velocities: slow, moderate and as fast as possible. Subjects were paced by an instructor to ensure that they walked as fast as possible during the last stage. The VO2peak was calculated as the mean oxygen consumption during the last min of the last stage [The VOst stage ,21.www.ClinicalTrials.gov (NCT02257190).Oral and written informed consent was obtained from all subjects. The study was approved by the ethical committee of the Capital Region of Denmark (H-1-2014-060) and prospectively registered at The sample size was based on our previous study evaluating differences in postprandial glycemic control after IW3 vs. CON . In thatAll subjects performed three trials in a non-randomized but counterbalanced order. Trials were identical except for the following interventions: 1) One hour of interval walking consisting of repeated cycles of 3 min slow and 3 min fast walking (IW3); 2) One hour of interval walking consisting of repeated cycles of 1 min slow and 1 min fast walking (IW1); and 3) No walking (CON). Neither the subjects, nor the study investigators were blinded. Trials were separated by at least one week. Subjects were asked to withhold anti-diabetic medication and to abstain from vigorous activity from two days before until the end of each trial day. Moreover, subjects were instructed to eat the same food and to refrain from caffeine and alcohol for 24 hours prior to each trial day. As such, all consumed food and beverages was measured and registered by the subjects in a 24 h diet record in order for them to replicate it exactly. In the beginning of each intervention day, the diet records were checked by the investigators and the subjects confirmed that no vigorous physical activity had been performed for the preceding 48 hours.Following an overnight fast (\u22658 hours), subjects arrived at the laboratory, body weight was measured and an antecubital venous catheter for blood sampling was placed. Baseline blood samples were taken, and the intervention was initiated. During the IW1 and IW3 interventions, subjects walked on a treadmill with 1% incline, and during the control intervention subjects sat on a chair for one hour instead of walking. Breath-by-breath indirect calorimetry  and heart rate monitoring  was carried out continuously during the interventions. The two exercise interventions were matched regarding time duration and walking speed.In the end of both slow (t = 27 and 57 min) and fast (t = 30 and 60 min) intervals, subjects were asked to assess the current rate of perceived exertion (RPE) using a Borg scale . FollowiAfter the intervention, subjects rested in a bed, and 30 min after termination of the intervention, a 4-hour standardized liquid mixed meal tolerance test (MMTT) was initiated .th minute throughout the MMTT. Glucose and lactate levels were analyzed immediately in heparinized blood . Blood samples for subsequent analyses of insulin (Lithium Heparin tubes) were immediately placed on ice, centrifuged , and plasma was extracted and stored at \u201380\u00b0C until analysis. Insulin levels were measured by electrochemiluminescense immunoassay .Blood samples were collected at baseline (t = 0), during both slow (t = 27 and 57 min) and fast (t = 30 and 60 min) intervals of the intervention and every 152peak during the last minute of IW3 for slow and fast intervals, respectively. These intensities have previously shown efficient for improving postprandial glycemic control after an acute bout of IW3 in subjects with type 2 diabetes [2peak during fast and slow IW1 intervals in these 3 subjects were subsequently used to determine oxygen consumption rates during fast and slow IW1 intervals, for upcoming IW1 exercise bouts in subjects where IW1 was performed before IW3. The remaining 10 subjects were allocated to trials in a way by which the entire study was counterbalanced .Insulin sensitivity was estimated using different insulin sensitivity indices before/during the MMTT \u201326.Variables primarily relevant to the exercise trials  were compared using Student\u2019s paired t-test.Variables relevant to all trials were compared using one-way  repeated-measures analysis of variance (RM-ANOVA), with Bonferroni-corrected post hoc tests applied to identify significant differences between interventions.All statistical analyses were performed using Prism v6 .Results are reported as mean\u00b1SD. A P-value < 0.05 (two-tailed) was considered significant.st, 2014, and last intervention day was May 31st, 2015. Thirteen subjects were recruited to the study. One subject dropped out due to personal reasons. The remaining twelve subjects completed all three trial days as planned. For one subject, the estradiol levels fluctuated substantially between intervention days which raised doubt about her menopausal status. Since the female menstrual cycle may influence glycemic control [Recruitment started at October 1 control ,28, thisNone of the subjects had changes in their medication throughout the study, and no adverse events were seen during the study.Exercise characteristics are shown in 2 during exercise was not different between IW1 and IW3, whereas VO2 was lower and higher during slow and fast intervals respectively, when comparing IW3 to IW1 , was compared to the corresponding minutes of IW1 .Mean VO3 to IW1 . This waThere was no significant difference in body weight between trials prior to the interventions .2 was at all times higher than during the control intervention (data not shown).During the exercise interventions, VOMean HR during exercise was not significantly different between IW1 and IW3 (P > 0.05).IW3 resulted in higher HR during the fast intervals as compared to IW1 (P < 0.01), whereas IW3 tended to be lower compared to IW1 during the slow intervals (P < 0.1). When comparing the last minute of the IW3 intervals to the corresponding minutes of IW1 there was a significant difference for both the slow (P < 0.01) and for the fast (P < 0.001) intervals.Throughout the exercise interventions, HR was at all times higher than during the control intervention .Blood lactate levels during the exercise intervention were at all times higher in IW3 compared to IW1, and for both IW3 and IW1 at all times higher compared to control .There were no significant differences in baseline blood glucose levels between trial days before the interventions  .For statistical analyses of the mean glucose levels during the intervention/MMTT, please refer to There were no significant differences in mean blood glucose levels during any of the interventions, even though IW3 was borderline significantly lower compared to CON . Nor werMean blood glucose levels during the MMTT  were lowNo significant differences in maximal glucose levels during the MMTT were seen between any of the interventions . Nor werNo differences in baseline plasma insulin levels were seen between intervention days  . ImmediaData of RPE are shown in Eight of the eleven subjects preferred the IW3 intervention, whereas three preferred the IW1 intervention. Furthermore, eight subjects found the IW3 intervention to be the hardest one, while two subjects found the IW1 intervention to be the hardest one. One subject found the two exercise interventions equally hard. Five of the eight subjects that preferred IW3 also found this to be the harder intervention, whereas the three subjects that preferred IW1 all found IW3 hardest.per se is not responsible for the beneficial effects of interval walking.In this study we examined the effects of acute bouts of interval walking on postprandial glycemic control in type 2 diabetic patients. We found that one interval walking bout consisting of 3 min intervals improved postprandial blood glucose levels on a standardized meal initiated 30 min after completion of the exercise bout in subjects with type 2 diabetes as compared to no walking, which is consistent with our previous findings . WhereasThe two exercise sessions, IW1 and IW3, were matched regarding walking speed during slow and fast intervals, respectively, and total time spent on fast and slow walking. We observed that the mean oxygen consumption rate during exercise was the same in IW1 and IW3, suggesting that the walking economy did not depend on the length of the intervals and was apparently not affected by the number of accelerations and decelerations. These results made it possible to compare the two interval programs not only with regards to time and walking speed, but also with regards to energy expenditure and mean intensity.Despite the fact that no difference in mean oxygen consumption between trials was seen, IW3 resulted in higher peak oxygen consumption values and lower nadirs during fast and slow intervals, respectively. Also, HR reached higher values during fast intervals and tended to reach lower values during slow intervals, when comparing IW3 to IW1, whereas lactate levels during exercise at all times were higher during IW3 compared to IW1. In this way, the physiological stress of exercise was probably higher during IW3 compared to IW1, something which has previously been found . HoweverAlthough far from significant, one might speculate that IW3 might improve postprandial glycemic control more than IW1, at least towards the end of the MMTT . Also poHowever, since IW1 and IW3 differed both with regards to the peak intensity and with regards to the number of cycles, we cannot completely rule out that the more intervals and thereby the more accelerations and decelerations results in greater beneficial effect on blood glucose levels. If assuming that the peak exercise intensity also contributes to the beneficial effects seen, the effects of more cycles might be masked. Consequently, the question of whether peak exercise intensity is the more important factor for postprandial glycemic control in interval type exercise needs to be further investigated in future studies.Although the insulin sensitivity indices we used in this study are not the golden standard for evaluating insulin sensitivity, there were no indications of any differences in insulin sensitivity between the trials. Even though the calculations were based on an MMTT instead of an OGTT as originally described and validated, which therefore limits the comparability to previous studies, our results indicate that the differences found in glycemic control between IW3 and CON, should be sought in insulin sensitivity-independent mechanisms.For an exercise intervention to be successfully implemented in free-living settings, motivation and perceived exertion are both very important factors. The fact that eight out of eleven subjects preferred the IW3 program, despite that eight of the eleven found this program the hardest one, was paradoxical and surprising. Individual preferences and motivation should be considered when recommending an exercise program in order to enhance compliance. Moreover, while free-living adherence to our two types of interval exercise sessions is unknown, it is very important to assess since it has been suggested that the adherence to interval training regimes may be reduced when training is performed in a free-living setting .The lack of difference in mean incremental glucose levels and maximal glucose levels between IW3 and CON during the MMTT is contrary to our previous findings, despite fairly similar subject characteristics in the two studies . This maet al. found that postprandial glucose levels in subject with type 2 diabetes were lower for the subsequent 24 hours following a single interval-type exercise session compared to the control situation [Some studies suggest that the effects of an acute bout of exercise on postprandial glycemic control in subjects with type 2 diabetes is more pronounced after the second meal ,31. Thesituation  and the ituation  describeIn conclusion, the current study showed that an acute bout of IW3 improved postprandial glycemic control on a standardized meal initiated 30 min after completion of the intervention compared to no walking. IW1 did not result in significant improvements in overall mean postprandial glucose levels compared to CON, but blood glucose levels at specific time points during the MMTT were lower in IW1 compared to CON. No differences in postprandial glycemic control were seen between IW1 and IW3. Thus, interval training with three minute intervals can be recommended for improving postprandial glycemic control in subjects with type 2 diabetes, whereas the importance of interval length needs to be further addressed in future studies.S1 Protocol(DOC)Click here for additional data file.S1 TREND Checklist(PDF)Click here for additional data file."}
+{"text": "Scientific Reports6: Article number: 3249810.1038/srep32498; published online: 09012016; updated: 10242015The original version of this Article contained a typographical error in the spelling of the author Maryam Alaayedi, which was incorrectly given as Maryam Alayedi. This error has now been corrected in the PDF and HTML versions of the Article."}
+{"text": "The five-point FOIS for infants, which reflected the expansion of their oral diet with growth, had adequate reliability and validity. The caloric contribution as well as consistency of oral feeding could be used to distinguish FOIS levels 2 and 3, which correspond to the POF status in infants.This study aimed to investigate the reliability and validity of the Functional Oral Intake Scale (FOIS) for infants. Infants  who underwent a videofluoroscopic swallowing study (VFSS) were included in this retrospective study. Their nutrition records at the time of the VFSS were separately evaluated by two raters using the five-point FOIS for infants. Categorical swallowing and aspiration impairment scale data were also obtained from the VFSS. The inter-rater reliability of the FOIS for infants was high (95.5% absolute agreement) among the 201 evaluated infants, and this scale was significantly correlated with aspiration severity in the VFSS. We also investigated whether infants with partial oral feeding (POF) at the FOIS evaluation had achieved full oral feeding within 1 year of the evaluation and used this information to estimate whether the caloric contribution, as well as consistency of oral feeding, affected the feeding outcomes. This analysis included 33 infants who were receiving both oral and tube feeding . Among them, 26 infants achieved full oral feeding (FOF) without tube feeding after 1 year. Their initial contribution from oral feeding was higher than that in infants who still maintained POF after 1 year (28.46 \u00b1 22.79 vs. 6.00 \u00b1 5.45%,  Interventions for infants with dysphagia, such as environmental modifications , oral-moThe Functional Oral Intake Scale FOIS,  was initThe direct application of the FOIS to infants is challenging, as they are developing rapidly and will experience an expansion of the oral diet with age \u201313. AddiAll study-related procedures were performed in accordance with the ethical standards of the institutional and/or national research committee and the 1964 Declaration of Helsinki. Ethical approval for the study was obtained from the Seoul National University Hospital Institutional Review Board (IRB) (No. 1807-189-963), which waived the requirement for informed consent due to the retrospective nature of the study. The following inclusion criteria were applied to potential subjects: (1) participation in the VFSS to evaluate a swallowing disorder at \u22641 year of age between 2011 and 2017 and (2) recording of the dietary status at the time of the VFSS by a nutritionist.A seven-point ordinal FOIS has been validated in adults  7). As . As 7). The infants' caregivers were interviewed by a nutritionist, who recorded the type, amount, and consistency of food and liquid intakes, tube dependency, and total nutrient intake. Two occupational therapists with >2 years of experience in swallowing therapy retrospectively reviewed the nutritionist's medical records and assigned FOIS levels.Cross-validity was determined by comparing the infantile FOIS scores with the categorical ratings of swallowing impairment/aspiration severity and on the basis of the presence of swallowing impairment/aspiration determined by the VFSS . These thttp://www.kns.or.kr/English/index.asp, The Korean Science and Technology Center, Gangnam-gu, Seoul, Korea), which was developed by the Korean Nutrition Society for the nutritional evaluation of individuals or groups. If any food was not registered in the program, calories were calculated from the information printed on the product container. We also investigated whether infants with POF at the FOIS evaluation had achieved FOF within 1 year of the evaluation and used this information to estimate whether the caloric contribution, as well as consistency of oral feeding, affected the feeding outcomes.For infants with partial oral feeding (POF), the calorie contribution of oral feeding to the total caloric intake was estimated based on the same records used for the FOIS evaluation. Calories were calculated using the web version of CAN-Pro 5.0 software  to determine the association between the FOIS for infants and the presence or absence of swallowing impairment and aspiration.t-test. P < 0.05 was considered statistically significant. Analyses were performed using SPSS ver. 23.0 .Infants with POF were stratified according to whether they achieved FOF or not at 1 year after the evaluation, as determined by the caloric contribution of the oral intake at the time of the initial FOIS evaluation. Differences between these two groups were analyzed using an independent Data were obtained from 201 infants  who underwent a VFSS between 2011 and 2017. The baseline characteristics and main diagnoses of the subjects are presented in n = 3) and levels 4 and 5 (n = 5).The two occupational therapists achieved a high level of absolute agreement (95.5%) when applying the FOIS for infants , as showp = 0.014, V = 0.249) and severity  of aspiration during the VFSS. The infantile FOIS ratings correlated significantly with the severity , but not the presence of dysphagia .This study identified significant associations between the subject's level on the FOIS for infants and the presence  7), and McMicken et al. reported ICC values of 0.975 and 0.964 at the time of admission and discharge, respectively  (No. 1807-189-963), which waived the requirement for informed consent due to the retrospective nature of the study.YY: acquisition of data, analysis and interpretation of data, writing and critical revision of manuscript. H-IS: study concept and design, acquisition of data, analysis and interpretation of data, study supervision, and critical revision of manuscript for intellectual content.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "A high concentration of nerve branches was observed in the first quadrant (Q1) of the abductor hallucis muscle, which is the same area in which the MTrPs are described. The topography of the entry points of the branches of the medial plantar nerve to the abductor hallucis muscle correlates with the topography of the muscular trigger points. The anatomical structure of the MTrPs may be useful for a better understanding of the pathophysiology of myofascial disorders and provide a basis for surgical and clinical treatments.Myofascial pain syndrome is characterized by pain and a limited range of joint motion caused by muscle contracture related to motor-end-plate dysfunction and the presence of myofascial trigger points (MTrPs). It is the most frequent cause of musculoskeletal pain, with a worldwide prevalence varying between 13.7% and 47%. Of the patients with myofascial pain syndrome, approximately 17% have pain in the medial hindfoot area. The abductor hallucis muscle is located in the medial, posterior region of the foot and is related to painful plantar syndromes. The objective of this study was to describe the distribution of the medial plantar nerve and their anatomical relationship with MTrPs found in the literature. Thirty abductor hallucis muscles were dissected from 15 human cadavers . The muscles were measured, and the distribution data of the medial plantar nerve branches in each quadrant were recorded. For statistical analysis, we used generalized estimation equations with a Poisson distribution and a log logarithm function followed by Bonferroni multiple comparisons of the means. The data are expressed as the mean\u2009\u00b1\u2009standard deviation. The level of significance was adjusted to 5% ( Chronic myofascial pain is the most frequent cause of skeletal muscle pain with prevalence in the world population varying between 13.7% and 47% . Pain isThe abductor hallucis muscle has been gaining prominence in the most recent publications on plantar pain , 11. It According to Simons et al. , there aThe authors have sought anatomical approaches to support the theory of myofascial pain syndromes (MPSs) citing the presence of muscle trigger points and providing a pathophysiological explanation , 18. HowAnother important finding described in a recent study demonstrated that there may be a relationship between the entry points of the nerves to the muscle belly and the myofascial trigger points , 26. A dTo better understand MTrPs pathophysiology and to provide more anatomical data for the treatment application based on the hypothesis that trigger points can be related to the muscle innervation, the objective of this study was to observe the anatomical correlation between the clinically described MTrPs and the entry point of the branches of the medial plantar nerve into the abductor hallucis.2 and 25\u2009kg/m2; absence of signs of previous surgeries in the regions of interest; and absence of severe pathologies, anatomical deformities, and processes of necroses, hemorrhages, and fibroses that make adequate study of the tissues of the lower limbs impossible  prepared with 4% phenolic acid and 0.5% formaldehyde were dissected. The cadavers were obtained from a body donation program managed by the Discipline of Human Structural Topography of the Department of Surgery of the University, Medical School. The criteria of the 15 cadavers and 30 feet dissected are as follows: preserved anatomical structures; absence of dissection or previous surgical incision in the feet; age between 40 and 80\u2009years; BMI between 20\u2009kg/mpossible .X axis (anteroposterior) began at the origin  and ended at the insertion , and the Y axis  originated from the midpoint of the X axis, close to the navicular bone . The sample size calculation was based on the results of the first 10 feet evaluated by the pilot project; with this sample, the difference between quadrants 1 and 2  was 1.26 points on average with a variability of 1.5 points. The sample used results in a power of 85% and an alpha value of 5%, suggesting a sample size of 26 feet total.p < 0.05) for all tests.For the quadrant analysis, generalized estimation equations with the Poisson distribution and log logarithm function followed by Bonferroni multiple comparisons were used to evaluate the number of entry points of the medial plantar nerve into the hallucis abductor muscle in the muscle's respective quadrants. Data are presented as the mean\u2009\u00b1\u2009standard deviation, and the level of significance was adjusted to 5% (n\u2009=\u20091) was excluded from the study because of an orthopedic surgery with intense tissue fibrosis in the ankle that prevented adequate anatomical evaluation; therefore, 29 feet were used for the analysis. The anatomical analysis showed that all of the entries of the branches of the medial plantar nerve were concentrated in the posterior foot area near the calcaneus bone and that both the third and fourth quadrants  did not contain any entry points of the branches of the medial plantar nerve into the muscle belly. In contrast, the first quadrant  presented a statistically significant higher number of entry points of the branches of the medial plantar nerve relative to the second quadrant  (2.37\u2009\u00b1\u20091.84 points versus 1.11\u2009\u00b1\u20091.16 points) (p < 0.05) (Only one foot ( < 0.05) . After d < 0.05) .The relationship between the entry points of nerves into the muscle belly and the myofascial trigger points has already been reported by Akamatsu et al. , 26. NerThe anatomical entry points of the medial plantar nerve into the abductor hallucis muscle corresponded to the described areas of the myofascial trigger points (MTrPs).In addition, this region of the medial hindfoot is the same as described by Simon et al.  and SaggSeveral studies have examined the pathway of the medial plantar nerve but only up to the margin of the abductor hallucis muscle , 36. TheThe present study was the first to relate the entry points of the medial plantar nerve into the belly of the abductor hallucis muscle with the myofascial trigger points and to evaluate the standard location of the nerves using the quadrant approach. The location of the trigger points in relation to the entry points of the medial plantar nerve branches into the abductor muscle of the hallux is a logical explanation for understanding the dysfunction of the neurological activity of the MTrPs.The branches of the medial plantar nerve penetrate mostly into the first muscle quadrant  of the abductor muscle of the hallux and represent a strong relationship between nerve anatomy and the location of the myofascial trigger points."}
+{"text": "The Federation of European Biochemical Societies (FEBS) was the first regional organisation of biochemists, holding its first congress in London in 1964. There followed the creation of the Pan American Association of Biochemical Societies (PAABS) and then the Federation of Asian and Oceanian Biochemists (FAOB). An obvious development was the formation of a similar organisation to take care of Africa, but this proved impossible so long as apartheid survived in South Africa. With the removal of the latter, the way was clear for the foundation of the Federation of African Societies of Biochemistry and Molecular Biology (FASBMB). The first congress of the new federation was held in Nairobi in September 1996 under the Presidency of Prof. Dominic Makawiti of Nairobi University. Among the 300 participants were representatives from 19 countries in Africa. The second congress was held at Potchefstroom in South Africa in 1998 and the third was just held in Cairo."}
+{"text": "The heterostructure was synthesized by metal-organic chemical vapor deposition of single crystalline GaN onto a c-plane sapphire substrate, followed by the deposition of a visible light responding MoS2 monolayer (Eg\u2009=\u20091.9\u2009eV) formed by a Mo-sulfurization technique. Our experimental results reveal that MoS2/GaN photoanode achieved efficient light harvesting with photocurrent density of 5.2\u2009mA\u2009cm\u22122 at 0\u2009V vs Ag/AgCl, which is 2.6 times higher than pristine GaN. Interestingly, MoS2/GaN exhibited a significantly enhanced applied-bias-photon-to-current conversion efficiency of 0.91%, whereas reference GaN yielded an efficiency of 0.32%. The superior PEC performance of the MoS2/GaN photoelectrode is mainly related to the enhanced light absorption due to excellent photocatalytic behavior of MoS2, which reduces charge transfer resistance between the semiconductor and electrolyte interface, and the improvement of charge separation and transport. This result gives a new perspective on the importance of MoS2 as a cocatalyst coated onto GaN to synthesize photoelectrodes for efficient solar energy conversion devices.Solar-driven photoelectrochemical water splitting (PEC-WS) using semiconductor photoelectrodes is considered a promising solution for sustainable, renewable, clean, safe and alternative energy sources such as hydrogen. Here, we report the synthesis and characterization of a novel heterostructure MoS H2, in particular, is one of the most promising energy carriers and fuel sources due to its high energy-per-mass content, wide range of available storage and transport approaches, and reduced harmful emissions4. Indeed, the energy stored into its chemical bond can be used in fuel cells to produce clean electricity. One of the most promising solutions is represented by the use of photoelectrochemical cells (PECs) for light-driven water splitting. PEC water splitting using solar energy has attracted considerable attention in both scientific and industrial communities5. Because the fabrication process is simple and environmentally friendly, it has been considered one of the most attractive ways to produce H26. After it was firstly demonstrated by Fujishima and Honda in 1972 using TiO2 to split water into H2 and O2, researchers have been studying candidates of high performance photoelectrode for PEC water splitting9. To achieve high energy conversion efficiency, photoanodes should effectively harvest the sunlight and facilitate charge transfer while they should exhibit long-term stability10. The conversion efficiency of solar energy to chemical energy in hydrogen molecule and the stability during PEC process are crucial features of PEC cells, which are mainly determined by the semiconducting material properties of the photoelectrodes12. Therefore, many semiconductor materials including transition metal oxides have been explored primarily for PEC cells, such as TiO213, ZnO14, BiVO415, \u03b1-Fe2O316 and WO317 due to the chemical stability, low cost, and easy fabrication18. However, they generally have wide band gaps and absorb a limited portion of the solar spectrum, resulting in poor conversion efficiencies19. In pursuit of high-efficiency photoelectrodes for solar energy conversion applications, several crucial requirements should be satisfied, such as a suitable band gap value and appropriate band alignment of the working electrode with the water redox levels20. In recent decades, tremendous efforts have been devoted toward exploring novel and efficient photoelectrode materials to improve the solar energy photoconversion efficiency. In order to gain desired solar-to-hydrogen conversion efficiency, heterojunction structures are desirable and considered as an important strategy because they allow for the combination of properties from each element, leading to an improved overall efficiency21. The fabricated heterojunction not only can expand the spectral range for light-absorption, but also can promote photoexcited electron\u2013hole separation, which can minimize electron\u2013hole recombination, thus significantly enhancing the energy efficiency22.With the concern of a global energy crisis and subsequent desire for alternative fuel sources, hydrogen  is especially attractive because of its tunable optical band gap, high chemical stability, earth abundance, nontoxicity, and low cost in comparison with noble metals34. In-plane closely packed hexagonal arrangements of S\u2013Mo\u2013S atoms with covalent bonds compose two dimensional MoS2 structure35. These layers are held together by relatively weak van der Waals forces, which provide an advantage for exfoliating MoS2 film into monolayers36. Intrinsic MoS2 offers n-type semiconducting properties, with a tunable band gap (Eg\u2009=\u20091.2\u20131.9\u2009eV) that is classified by the number of layers37. Bulk MoS2 has an indirect band gap of Eg\u2009=\u20091.2\u2009eV, while monolayer MoS2 (ML-MoS2) has a direct band gap of Eg\u2009=\u20091.9 eV38, which suggests promise for application in PEC hydrogen generation39. Very recently, ML-MoS2 was considered as an important catalyst for both photocatalytic and electrocatalytic H2 evolution reactions due to the existence of abundant exposed edges, with active sites stemming from the sulfur edges of the MoS2 crystal layers41. Moreover, MoS2 thin films or nanosheets have been deposited onto ZnO NWs as cocatalysts, which suppressed the photocorrosion and increased the photocurrent densities42. Yong-Jun et al. reported that the intimate and large contact interface between MoS2 and TiO2 can efficiently promote photoinduced charge carrier separation, which leads to an extension of the charge carrier lifetime against recombination43.Recently, two-dimensional (2D) transition-metal-dichalcogenides (TMDCs) have intrigued physicists and material scientists due to their distinctive optical and electrical properties, which can be beneficial for numerous devices and applications2 on GaN by a Mo-sulfurization technique. We also demonstrated application of the MoS2/GaN heterostructure as a photoanode for PEC water splitting and proposed a mechanism for the process. The PEC characteristics are investigated in detail to evaluate the water splitting behavior of the heterostructure. In addition, improved PEC water splitting performance of the transferred ML-MoS2 onto GaN photoanode enabled by the photocatalytic behavior of ML-MoS2 is studied. The outcome of the study is that the MoS2/GaN photoanode shows a better enhanced PEC performance than pristine GaN. Therefore, the present study can be useful for the development of heterostructure based photoanodes in PEC applications.Herein, we report the synthesis and characterization of patterned highly crystalline ML-MoS2 synthesis procedure and the fabrication of MoS2/GaN heterostructure photoanode is displayed in Fig.\u00a02 in a furnace, then the MoS2 film was transferred to GaN on sapphire. Figure\u00a02 (ML-MoS2) before and after the transfer process placed onto the sapphire and GaN substrates, respectively. It can be seen that the ML-MoS2 maintains the same morphology after transfer. It is observed that this transfer technique does not introduce any cracks in the sample which suggests a clean surface and high-quality for the as-transferred samples. Patterned substrates with a uniform distribution of rectangular ML-MoS2 (approximately 190\u2009\u00d7\u2009110 \u00b5m2 in size and 50\u2009\u00b5m apart) were obtained. Further systematic characterizations of the synthesized ML-MoS2 were conducted with Raman spectroscopy and photoluminescence (PL) measurements. Raman spectroscopy is a common tool for determining the precise number of layers in MoS2 films such as tri, bi, and ML-MoS2. The Raman spectra for these MoS2 films contain peaks due to the 2, \u22121 and \u22121\u200945. The former corresponds to the opposite vibration of two sulfur atoms in regard to the molybdenum (Mo) atom in the basal plane (in-plane vibration mode), while the latter results from the vertical vibration of only sulfur (S) atoms in opposite directions (out-of-plane vibration mode), as illustrated in the insets of Fig.\u00a02(c)46. As is known, the frequency difference  centered at 660\u2009nm without a shoulder peak at \u223c610 \u2009nm  was observed. In ML-MoS2, the excited electrons and holes recombine through direct band-to-band transition at the K-point in the Brillouin zone37, leading to strong PL near 1.88\u2009eV. The superior optical properties and the observation of a single peak (A excitonic emission) again represent strong evidence that the ML-MoS2 synthesized here is undoubtedly of high quality. Moreover, X-ray diffraction were employed to confirm the high quality of the as-synthesized ML-MoS2 . Figure\u00a02 are uniformly continuous cross an area of micrometers. Figure\u00a02 that confirms uniformity with no defects such as cracks, which suggests a clean surface and high-quality for the produced ML-MoS2, in support of the Raman and PL results. The HRTEM image displayed in Fig.\u00a02 is a single crystal with a hexagonal lattice structure. A periodic honeycomb arrangement of the atoms with an inter-planar spacing of \u223c0.32\u2009nm is observed in Fig.\u00a0The synthesized MoSnts Fig.\u00a0. To furt2/GaN photoanode, a three-electrode home-made PEC cell was designed, as shown in Fig.\u00a02/GaN served as the working photoelectrode to absorb illuminated light energy and to convert it into electron-hole pairs, which then started the respective water splitting half reactions. Due to the conventional band bending of the semiconductors, the photogenerated electron-hole pairs will be separated, where the holes will drift to the surface of the MoS2/GaN to strip oxygen from the water (water oxidation) and the liberated electrons will migrate to the counter electrode (Pt wire) to convert hydrogen ions into molecular hydrogen gas (hydrogen reduction), as illustrated in Fig.\u00a0To investigate the PEC properties of the ML-MoS2/GaN photoanodes using electrochemical impedance spectroscopy (EIS) under dark conditions. The EIS measurements were performed with the voltage amplitude of 20\u2009mV for various frequencies (1.0\u2009Hz\u2013100\u2009kHz). Figure\u00a02/GaN photoanodes, respectively. Semicircles can be clearly distinguished in the Nyquist plots for each sample, which were used to understand the charge transfer process at the electrode/electrolyte interface, with the semicircle diameter being equivalent to the charge transfer resistance51. The smaller diameter of the semicircle for the MoS2/GaN electrode confirmed faster charge transfer process as well as more effective electron\u2013hole pairs separation. Based on the results shown by Nyquist plots, we can conclude that the MoS2 plays a significant role in increasing the light absorption, accelerating the charge separation and transfer at the interface, which enhances the PEC performance. As a result, the MoS2/GaN heterostructure could be a potential photoanode for high-efficiency solar hydrogen generation because of fast charge separation and transport. To ensure that the MoS2/GaN photoanode hasn\u2019t been degraded during the EIS measurement, a cyclic voltammetry (CV) scan is conducted before and after EIS measurement  plots, were analyzed according to the MS equation shown in Eq. . The positive slopes of the tangent lines in the MS plot display the n-type property for both photoanodes, for which the lowest potential of the conduction band can be extremely close to its flat-band potential, as illustrated in Fig.\u00a02/GaN photoanodes were calculated to be \u22120.88\u2009V and \u22120.21\u2009V vs Ag/AgCl, respectively.To gain further insights into the enhanced PEC performance of the MoS2/GaN photoanode features light-driven water splitting process to investigate its potential as high-performance photoelectrodes. Linear sweeps voltammetry (LSV) were measured for pristine GaN and the MoS2/GaN photoanodes at a sweep rate of 20\u2009mV/s, as depicted in Fig.\u00a02/GaN) and the reference electrode, both in the dark and under illuminated conditions using 1\u2009M NaOH as an electrolyte. Negligible dark currents were observed for all samples, revealing that the obtained photocurrent densities for all the prepared photoanodes are almost entirely generated through light irradiation. Compared to the pristine GaN, the MoS2/GaN photoanode showed increased photocurrent in the anodic bias condition. At zero bias vs Ag/AgCl, the MoS2/GaN photoanode exhibited a photocurrent density of 5.2\u2009mA\u2009cm\u22122, about 2.6 times higher than that of the reference GaN. The observed photocurrent density is mainly subjected to the improved carrier extraction/collection efficiency and the faster charge carrier transport to the desired water redox interfaces. CV measurements for pristine GaN and MoS2/GaN photoanode including the Tafel plots obtained from CV curves have been conducted for further confirmation for the improved PEC properties  that possesses the ability to absorb a significant portion of the entire solar spectrum, resulting in the generation of an increased number of electron-hole pairs38. In contrast, GaN with its large band gap energy will limit the solar absorption to photon energies in the UV region, which represents a small portion of the solar spectrum, thereby resulting in a small photocurrent density when exposed to the simulated sunlight54. The data in Fig.\u00a02/GaN photoanode with respect to the applied potential. The ABPE is given according to Eq. , and 2/GaN photoanode achieved an ABPE of 0.91% at about 0.21\u2009V vs. RHE. This result is a significant enhancement compared to only 0.32% at 0\u2009V vs. RHE for the reference GaN. Thus, the efficiency of the power conversion was increased by almost 3 times by using MoS2 as a cocatalyst coated onto GaN for the solar energy conversion device. To further investigate the photoresponse, long-term stability measurements were carried out using the chronoamperometry (CA) technique in 1\u2009M NaOH under 500 mWcm\u22122 irradiation, with an applied bias of 0\u2009V vs. Ag/AgCl. Figure\u00a02/GaN photoanode exhibited a highly stable photocurrent density, approximately 5.2\u2009mA\u2009cm\u22122 at zero bias vs Ag/AgCl, which represents a 2.6-fold enhancement compared to that of reference GaN. Measurements under successive illumination for 45\u2009min reveals no obvious decay in the photocurrent, which is substantially improved compared to the previous research focusing on GaN-based photoanodes. In addition, SEM was carried out for MoS2/GaN after PEC stability measurements and showed that there is no degradation in the morphology (no corrosion) of the patterned ML MoS2 . Trimethylgallium (TMGa) and NH2) by photolithography. Next, patterned Mo thin films deposited on sapphire substrates were placed in a quartz boat, which was in turn placed in the center of a chemical vapor deposition (CVD) tube furnace. A ceramic boat containing pure sulfur  was placed in the upwind low-temperature zone in the quartz tube. During the reaction, the temperature in the low temperature zone was controlled to be just above the melting point of sulfur (113\u2009\u00b0C). The quartz tube was first held under Ar at a flow rate of 100 sccm. The temperature was raised from room temperature to 750\u2009\u00b0C at a ramp up rate of 75\u2009\u00b0C min\u22121, and then held constant for 5\u2009min before being naturally cooled down to room temperature in 60\u2009min. To study solar-driven water splitting, CVD-grown single domains of MoS2 were transferred (using PMMA as a support film and 5\u2009M NaOH/NaF solution) onto a GaN epilayer grown onto a sapphire substrate by MOCVD. The PMMA film was dissolved in acetone and the residue removed by annealing in Ar at 150\u2009\u00b0C for 30\u2009min.After lithographic patterning of the photoresist layer, a 1-nm-thick thin film of Mo was deposited onto a sapphire substrate by e-beam evaporation. The process began with the patterning of a Mo film array with rectangular windows  were used as the working, counter, and reference electrodes, respectively. 1\u2009M NaOH aqueous solution was used as the electrolyte. The MoS2/GaN photoanode was mounted onto the Teflon chamber, where the sample surface was directly in contact with the electrolyte through a hole with a diameter of approximately 0.5\u2009cm. Then a conductive Cu wire was bonded to the MoS2/GaN photoanode surface using indium contact and wired to the counter electrode for hole transport. The sample was irradiated through a transparent quartz window using simulated sunlight provided by a 300\u2009W Xe lamp (Newport 66902). The light irradiance was kept constant at 500\u2009mW\u2009cm\u22122 during the measurements and illuminated surface area was about 0.5026\u2009cm2. The chronoamperometry and linear scan voltammetry (LSV) (scan rate of 20\u2009mV/s) experiments were performed using the single channel potentiostat. The performance of the MoS2/GaN photoanode was assessed based on the photocurrent density\u2013voltage (J\u2013V) curves evaluated both in the dark and under illumination.PEC experiments were performed in a three-electrode home-made cell wired to a typical potentiostat/galvanostat , operated by VersaStudio software. The as-synthesized samples were mounted onto a Teflon chamber cell having a size of Supplementary information."}
+{"text": "Surface potential mapping at the MoS2/GaN heterojunction is done using Kelvin Probe Force Microscopy to measure the conduction band offset. Current-voltage measurements show a diode like behavior of the heterojunction. The origin of diode like behavior is attributed to unique type II band alignment of the heterojunction. The photocurrent, photoresponsivity and detectivity of the heterojunction are found to be dependent on power density of the light. Photoresponse investigations reveal that the heterojunction is highly sensitive to 405\u2009nm laser with very high responsivity up to 105\u2009A/W. The heterojunction also shows very high detectivity of the order of 1014 Jones. Moreover, the device shows photoresponse in UV region also. These observations suggest that MoS2/GaN heterojunction can have great potential for photodetection applications.Fabrication of heterojunction between 2D molybdenum disulfide (MoS Weak interlayer van der Waals interaction present in TMDCs facilitates the exfoliation of bulk crystal in few layers offering layer dependent unique properties5. Since most of the 2D materials have relatively smaller bandgap, optoelectronic and photovoltaic devices based on these semiconductors can be realized due to their excellent light absorption properties8. Molybdenum disulfide (MoS2) is a typical layered transition metal dichalcogenide having indirect bandgap of 1.2\u2009eV in bulk form and direct bandgap of 1.8\u2009eV when it is in monolayer form9. Due to its unique layer dependent appealing properties such as high mobility and excellent light absorption covering broad range of spectral response, it has been extensively studied by scientists for various applications such as field effect transistors11, gas sensors13, photodetectors16 and flexible devices17. Moreover, researchers have shown their keen interest in observing photoresponse in MoS2 based photovoltaic and optoelectronic devices20. The first optoelectronic device based on monolayer MoS2 was a phototransistor with photoresponsivity of 7.5\u2009mA/W fabricated by Yin et al.19. High photoresponsivity of 880\u2009A/W much higher than first graphene photodetector21 (0.5\u2009mA/W) was achieved on mechanically exfoliated monolayer MoS2 based photodetector14. Multilayer MoS2 has also been considered in optically active devices for example, Kim et al. explored the optoelectronic properties of TFTs based on multilayer MoS2 and showed that it can be used in high detectivity phototransistors22.Two dimensional transition metal dichalcogenides (TMDCs) have garnered a great research interest due to their unique electrical, mechanical, optical and chemical properties making them preferable for potential applications in electronic and optoelectronic devices31. Heterogeneous integration of MoS2 with bulk materials such as Si, GaN32, SiC33 and SnO34 has been studied in recent past demonstrating the promising application of 2D/3D heterostructure based devices.Absence of dangling bonds in 2D layered materials facilitates their integration with three dimensional semiconductors to form van der Waals heterostructures. To further explore the properties of 2D layered materials for applications in nanoscale electronic and photovoltaic devices, their integration with bulk semiconductors has been explored in recent years utilizing the advantages of both 2D and 3D materials2/GaN heterojunction, GaN being a wide bandgap semiconductor faces challenges in p-type doping. Integration of narrow bandgap semiconductors with GaN can lead to high performance devices but their performance gets limited due to lattice mismatch issue. This constraint can be solved by use of TMDCs such as MoS2. In addition to it, heterojunction of MoS2 and GaN can be a potential candidate in heterojunction bipolar transistor device. One of the important consequence of MoS2/GaN heterojunction is the enhancement in the photoresponse. Wide bandgap materials such as GaN are used in UV photodetection whereas MoS2 can show response varying from visible to near infrared region since its bandgap lies in the range 1\u20132\u2009eV. Thus, broadband photodetection can be achieved by integrating GaN with MoS2.Considering MoS2/GaN heterojunction as a promising platform for electronic devices37. Duan et al. reported strong enhancement of electroluminescence in vertically stacked MoS2/GaN heterostructure which is difficult to achieve in other traditional indirect bandgap semiconductors36. Semiconductor-insulator-semiconductor diode consisting of MoS2, h-BN and GaN has been demonstrated by Jeong et al. exhibiting diode like characteristics and photoresponsivity of 1.2\u2009mA/W37. These investigations demonstrated that MoS2/GaN heterojunctions have great potential in high performance electronic devices.In the recent years, a few reports have investigated MoS2/GaN heterojunction and its characterization using KPFM and current-voltage (I-V) measurements have been reported. Determination of parameters such as work function difference and conduction band offset play important role to understand the charge transport in 2D/3D heterojunction. We focus on understanding of type II band alignment at the interface of MoS2/GaN heterojunction. Further, we emphasize on understanding photoresponse behavior of the heterojunction and show that heterojunction of multilayer MoS2 with GaN can be used in optoelectronic applications. Detailed investigation of band offset and high photoresponsivity of MoS2/GaN heterojunction can open a pathway for the integration of dissimilar semiconductors. This may lead to high performance, energy efficient optoelectronic devices, also their incorporation can enhance the functionality of both wide band gap semiconductors and 2D layered semiconductors.In the present work, fabrication of exfoliated MoS2 in the fabrication of 2D/3D heterostructures is the chemical method whereas mechanically exfoliated MoS2 is reported to have excellent crystalline nature with less defects and can offer excellent device properties as compared to chemically synthesized MoS2. The presence of MoS2 flakes exfoliated from bulk crystal onto GaN substrate was confirmed using Raman spectroscopy and thickness was measured using AFM 41, h and k are Planck\u2019s constant and Boltzmann constant, respectively. \u03d5 is the barrier height and \u03b7 is the ideality factor.MoSBarrier height and ideality factor can be further calculated using following equations:2/GaN heterojunction as measured by CAFM35. The unusual large value of ideality factor is due to the interface states. Since the heterojunction diode is fabricated using scotch tape method, interface between MoS2 and GaN is not devoid of these interface states. Therefore, the current transport mechanism will deviate significantly from thermionic emission and other transport processes such as tunneling and recombination become dominantly, thus increasing the value of ideality factor.Based on the above equations, barrier height and ideality factor are estimated to be 0.50\u2009eV and 11, respectively. Very large ideality factor (~38) is reported earlier in case of MoS2 bandgap and lower than the bandgap of GaN). To explore the photoexcitation at the heterojunction, the photoresponse of the device was investigated with varying laser intensity ranging from 0.02\u2009mW/cm2 to 16.6\u2009mW/cm2 as illustrated in Fig.\u00a0\u22127\u2009A to 4.53\u2009\u00d7\u200910\u22125\u2009A at illumination intensity of 12\u2009mW/cm2 giving on/off ratio of about 186.Photoresponse properties of heterojunction are investigated by irradiating the device with 405\u2009nm laser  and e is the electronic charge. The corresponding change in photoresponsivity and detectivity with illuminated power is illustrated in Fig.\u00a031. Maximum responsivity and detectivity are found to be 2\u2009\u00d7\u2009105\u2009A/W and 6\u2009\u00d7\u20091014 jones (1 Jone\u2009=\u2009cm-Hz1/2/W) at power density of 0.02\u2009mW/cm2 at the bias voltage of 5\u2009V. Ultra high photoresponsivity and detectivity were observed at low intensity indicating that as fabricated device is highly sensitive to low incident optical power. Significant enhancement in detectivity is observed for the MoS2/GaN heterojunction; of the order of 1014 Jones at 0.02\u2009mW/cm2 and it is higher than the value of detectivity observed in other photodetectors based on MoS2/3D heterojunctions. The comparative study of photodetection parameters of our fabricated device with the literature is summarized in Table\u00a02/GaN heterojunction, it comes out to be 2.79\u2009\u00d7\u200910\u221213 AHz\u22121/2. Moreover, the photoresponse characteristics of the heterojunction were measured with different wavelengths (650\u2009nm and 365\u2009nm)  Fig.\u00a0. The het2. Photocurrent increased when laser was turned on and it decayed on turning off the laser source  and depletion width are calculated and therefore energy band diagram can be drawn to evolve the carrier transport.On the basis of these values, built in potential  and GaN (4.6\u2009\u00d7\u20091017\u2009cm\u22123), respectively. Using above values, depletion width in MoS2 and GaN is calculated to be 104\u2009nm and 2.26\u2009nm, respectively.Depletion width is given by2 and GaN region are calculated to be 97\u2009mV and 2.23\u2009mV, respectively. The calculated values of depletion width and built-in potential barrier in both the regions help in evolving the band diagram and the charge transport.Furthermore, built in potential barrier in both the regions can be calculated using following equation:2 is in contact with GaN, band bending occurs in order to align the Fermi level. Since Fermi level of MoS2 is at higher energy level than that of GaN, electrons in MoS2 side will tend to move to GaN forming a built in potential at the interface. MoS2 acquires a depletion region whereas GaN acquires an accumulation region near the interface. Depletion width and built in potential in MoS2 region is larger than that of GaN region as calculated above. When MoS2 is given negative voltage with respect to GaN, higher current is observed compared to reverse bias case. Schematic of energy band structure on biasing is illustrated in Fig.\u00a02 is forward biased with respect to GaN, band edge of MoS2 raises and that of GaN lowers down. Electrons from MoS2 region can transport to GaN region due to decrease of effective barrier for flow of electrons from left side to right side giving high value of current. However, when MoS2 is reverse biased with respect to GaN, there is less probability for electrons in MoS2 region to move to GaN region because of relatively higher barrier. Hole current is not considered due to essential lack of holes.In order to understand the carrier transport and photoresponse of the device, a possible mechanism is proposed based on type II band alignment as illustrated in Fig.\u00a02, electron hole pairs are generated preferentially in MoS2 due to lower incident excitation energy than bandgap of GaN as shown in Fig.\u00a02, photocurrent is enhanced due to transport of photogenerated electrons from MoS2 region to GaN region. The observed lesser current in reverse biased case is due to higher barrier formation for photogenerated carriers to flow from MoS2 to GaN. However, when the device is illuminated with 365\u2009nm laser, large photocurrent is observed. Electrodes on MoS2 and GaN are separated by a distance of nearly 60 \u03bcm whereas spot size of the incident laser is 2\u2009mm. The incident light is illuminating both GaN and MoS2. Since 365\u2009nm wavelength is corresponding to bandgap of GaN, electron-hole pairs are generated in GaN also leading to significant enhancement in current. Both MoS2 and GaN are contributing to the total current leading to large enhancement in the photocurrent.Under illumination with light energy (405\u2009nm) higher than bandgap of MoS2/GaN diode which is a type-II heterojunction has been fabricated. The type II band alignment of 2D MoS2/GaN heterojunction has been investigated by measuring change in surface potential and corresponding change in work functions of MoS2 and GaN. The conduction band offset of 0.23\u2009eV was extracted using KPFM. From the current-voltage measurements, the heterojunction exhibited diode like behavior with barrier height of 0.50\u2009eV in dark. In addition, the photoresponse behavior of the device was explored and the device was highly sensitive to 405\u2009nm laser. The as fabricated heterojunction exhibited excellent optoelectronic performance such as ultrahigh photoresponsivity as 105\u2009A/W, gain as 105 and detectivity of the order of 1014 Jones. These results show that 2D MoS2/GaN can be used in efficient photodetection applications. Our results can pave the way in designing the optoelectronic devices based on integration of low dimensional materials with conventional 3D semiconductors.MoS2/GaN heterojunction. The GaN layer exhibits n-type behavior, sheet resistance of about 285 \u03a9/square, carrier concentration of 4.6\u2009\u00d7\u20091017\u2009cm\u22123 and Hall electron mobility of about 160\u2009cm2/Vs at room temperature, as measured by Ecopia Hall measurement set up (HMS 5000). The samples were ultrasonically cleaned in acetone followed by iso-propanol and De-ionized water (DI-Water) for 5\u2009minutes each, to remove the organic contaminants. In order to etch the native oxide layer from the surface, samples were dipped in the solution of HCl: H2O in the ratio of 1:2 for 30\u2009s. Samples were again rinsed with DI water and thereafter dried with nitrogen gun.The MOVPE grown Gallium Nitride (GaN) epitaxial film on c-plane sapphire substrate with 3\u2009\u03bcm thickness has been used for MoS2 crystal was purchased from SPI supplies. For the fabrication of MoS2-GaN heterojunction, 2D MoS2 flakes were transferred on GaN/sapphire from MoS2 crystal using mechanical exfoliation method  with laser excitation wavelength of 514\u2009nm. KPFM measurements were performed using Bruker multi mode Atomic Force Microscope in tapping mode. Pt coated Si tip was used to scan the samples and samples were grounded during the measurements.MoShod Fig.\u00a0. Raman m2 on GaN, SiO2 of thickness 100\u2009nm was deposited on MoS2/GaN sample using sputtering as an insulating layer  and GaN (40\u2009\u03bcm\u2009\u00d7\u200940\u2009\u03bcm) using Electron beam lithography (Model No: eLine plus from Raith GmbH). SiO2 was etched away within the opened window by dipping the sample in 10% HF for 10\u2009seconds  was chosen as top electrode on MoS2 as well as bottom electrode on GaN (Fig.\u00a0After transfer of MoSyer Fig.\u00a0. PMMA rends Fig.\u00a0. After rGaN Fig.\u00a0. CurrentSupplementary Information"}
+{"text": "Plasmodium falciparum gametocytes and female gametes. The potential of Pfs47 as a vaccine target was evaluated. Soluble full-length recombinant protein, consisting of three domains, was expressed in E. coli as a thioredoxin fusion (T-Pfs47). The protein was immunogenic, and polyclonal and monoclonal antibodies (mAb) were obtained, but they did not confer transmission blocking activity (TBA). All fourteen mAb targeted either domains 1 or 3, but not domain 2 (D2), and immune reactivity to D2 was also very low in polyclonal mouse IgG after T-Pfs47 immunization. Disruption of the predicted disulfide bond in D2, by replacing cysteines for alanines (C230A and C260A), allowed expression of recombinant D2 protein in E. coli. A combination of mAbs targeting D2, and deletion proteins from this domain, allowed us to map a central 52 amino acid (aa) region where antibody binding confers strong TBA (78-99%). This 52 aa antigen is immunogenic and well conserved, with only seven haplotypes world-wide that share 96\u201398% identity. Neither human complement nor the mosquito complement-like system are required for the observed TBA. A dramatic reduction in ookinete numbers and ookinete-specific transcripts was observed, suggesting that the antibodies are interacting with female gametocytes and preventing fertilization.Transmission-blocking vaccines are based on eliciting antibody responses in the vertebrate host that disrupt parasite development in the mosquito vector and prevent malaria transmission. The surface protein Pfs47 is present in  Plasmodium falciparum gametocytes. Full-length Pfs47 elicits no TBA; however, an antigen based on a modified version of the central region of Pfs47\u2019s domain 2 generates antibodies with potent TBA in mice. This TBA is independent of human complement or a mosquito complement-like system. Instead, such TBA antibodies likely function by interfering with female gametocytes and preventing fertilization. The Pfs47 region eliciting potent TBA is highly conserved in P. falciparum, suggesting the possibility of a broadly-effective vaccine or synergy with other vaccine target antigens.Transmission blocking activity (TBA) of malaria vaccines can potentially target parasite stages either within the human host or the mosquito vector. A team led by Carolina Barillas-Mury at the National Institutes of Health, USA, engineered a vaccine targeting the protein Pfs47 which is present mainly on the surface of  Plasmodium parasites, is transmitted by anopheline mosquitoes. Although the global malaria mortality rate decreased by 48% between 2000\u20132015, with an estimated 4.2 million lives saved as a result of scale-up of malaria control interventions, there were still 212 million new cases and an estimated 429,000 malaria-related deaths in 2015.1 These gains are threatened as Plasmodium parasites around the world exhibit growing resistance to anti-malarial drugs and as mosquitoes become resistant to insecticides.1 Effective anti-malarial vaccines are not currently available, and reducing the rate of disease transmission is one of the key steps to control and, eventually, to eradicate malaria.1Malaria, a life-threatening disease caused by Plasmodium gametocytes as they feed on blood from a malaria-infected host. Both male and female gametes emerge from infected red blood cells in the lumen of the mosquito midgut. Male gametocytes undergo exflagellation and release eight highly motile flagellated microgametes, while female gametocytes mature into macrogametes. Fertilization occurs in the midgut lumen, giving rise to zygotes that mature into motile ookinetes that traverse the mosquito midgut. Those ookinetes that reach the midgut basal lamina transform into oocysts and multiply repeatedly, giving rise to thousands of sporozoites. When the oocyst ruptures, sporozoites are released into the hemocele, migrate to the salivary gland of the mosquito, and are injected into a new vertebrate host when the mosquito ingests the next blood meal.2Mosquitoes become infected when they ingest Plasmodium in the mosquito midgut are vulnerable targets to block malaria transmission, because as parasites emerge from erythrocytes, they become accessible to intervening agents, such as antibodies or human complement, present in the ingested blood. Furthermore, Plasmodium development in the mosquito results in population bottlenecks, because parasites suffer great losses in each of the transitions from gametocytes to gametes, zygotes, ookinetes, and finally to oocysts.3Sexual stages of Plasmodium gametocytes. These antibodies interact with proteins present on the surface of sexual and sporogonic stages of Plasmodium or on the surface of the mosquito midgut, and disrupt molecular interactions, such as fertilization, critical for malaria transmission.3 Pre-clinical studies led to the development of several P. falciparum transmission-blocking vaccine candidates, of which Pfs230, Pfs25, and Pfs48/45 are the best characterized antigens.4 Pfs25 protein, expressed on the surface of female gametes in the mosquito midgut, persists throughout the zygote, ookinete, and early oocyst stages.5 Pfs230 and Pfs48/45, members of the 6-cysteine family of proteins, are expressed on the surface of both male and female gametocytes in the human host, persist in gametes, and mediate interactions critical for fertilization.6Malaria transmission-blocking vaccines rely on functional antibodies present in the serum of the vertebrate host that are ingested by mosquitoes together with Plasmodium infection. Ookinete midgut invasion causes irreversible damage to epithelial cells and activates a two-step nitration response regulated by the c-Jun N-terminal Kinases (JNK) pathway. This epithelial nitration triggers the local release of hemocyte-derived microvesicles which promotes mosquito complement activation.7 The thioester-containing protein 1 (TEP1), a key mediator of the mosquito complement-like system, binds to the ookinete surface and forms a complex that ultimately kills the parasite. Using linkage mapping and functional genetics, we identified Pfs47 as a P. falciparum gene that allows parasites to evade the mosquito immune system.8 Pfs47 is also a member of the 6-cysteine family of proteins and is expressed on the surface of female gametocytes, gametes, zygotes, and ookinetes.9Activation of mosquito immune responses greatly limits 10 The fact that P. falciparum has evolved the capacity to evade mosquito immunity suggests that these responses are an important barrier to malaria transmission. Although there are clear Pfs47 orthologs in other Plasmodium species, the sequence homology is low. P47 is critical for mosquito immune evasion and for optimal fertilization in P. berghei , but there is no clear evidence of involvement in P. falciparum fertilization.9Parasites expressing a Pfs47 haplotype compatible with a given mosquito vector disrupt JNK signaling in the invaded midgut cells, which prevents an effective nitration response and allows the ookinete to evade TEP1-mediated killing.P. falciparum infection in A. stephensi mosquitoes.11 However, studies with two other transmission-blocking vaccine targets (Pfs230 and A. gambiae aminopeptidase N) found that the region of the protein where antibodies bind is critical to block transmission.13 Polyclonal antibodies obtained after DNA vaccination of mice with a P. vivax P47 (Pvs47) coding plasmid significantly reduced Plasmodium vivax infection of Anopheles dirus.14 In this work, we explored the potential of Pfs47 as vaccine target, and used a combination of polyclonal and mAbs and protein deletions to search for targets to block P. falciparum infection in A. gambiae mosquitoes. A 52 amino acid (aa) region of Pfs47 where antibody binding confers strong (78\u201399%) TBA was identified, and the mechanism by which this interaction prevents mosquito infection was explored.Previous studies showed that three monoclonal antibodies (mAbs) against Pfs47 had no effect on P. falciparum Pfs47 is a surface protein with three s48/45 domains.9 Two of them (D1 and D3) each have six cysteines predicted to confer the canonical s48/45 structural fold of this protein family; while domain 2 (D2) is a degenerate domain with only two cysteine residues  was unsuccessful  in inclusion bodies. An in-column HPLC nickel affinity purification/refolding protocol was developed and pure soluble fusion protein was obtained , but the protein yield was very low (about 100\u2009\u00b5g of recombinant protein/L of harvested supernatant) Fig. . Finallyned Fig. .P. falciparum gametocytes  were readily obtained in oli Fig. . The Dom D3 Fig. , indicat D3 Fig. , Fig. S9E. coli was investigated by replacing the cysteine residues with alanines . ELISA assays with sera from four mice immunized with T-Pfs47 confirmed that the D1 and D3 domains elicit much stronger antibody responses than mD2 , reducing transmission by 77%, while antibodies after immunization with T-Pfs47 had no significant effect, even after three immunization boosts  was used to immunize mice. Purified mouse IgG obtained after one immunization boost with Pfs47-mD2 significantly reduced the median number of oocysts present, relative to the IgG control in sts Fig. .Mice immunized with Pfs47-mD2 were also used for two independent hybridoma fusions, and eight independent mAbs that recognize soluble Pfs47-mD2 were obtained. Based on ELISA and Western blot analysis, some mAbs recognize linear epitopes, while others target conformational ones Table . Interes15  revealed that JH11 binds the N-terminal epitope region , while IB2 and BM2 bind in the central regions  upstream of the modified cysteine loop  reduction in the number of ookinetes present in the midgut lumen 24\u2009h post-feeding    or absence (-H. Comp) of human complement in both oes Fig. . Disruptved Fig. . In P. bey) Fig. , as wellVA) Fig. .Fig. 5EfPlasmodium antigens have been identified over the past decades, including the pre-fertilization proteins Pfs48/45 and Pfs230, members of the six-cysteine family present on the surface of gametes, and the post-fertilization antigen Pfs25.21 Previous studies have shown that protective epitopes in these antigens are conformation-dependent.22 Producing large amounts of recombinant proteins with the proper folding has been a major challenge, especially for members of the six-cysteine family, because of the multiple disulfide bonds that must be properly formed.21 For Pfs47, the use of a thioredoxin carrier and expression in the E.coli Shuffle\u00ae T7 facilitated disulfide bond formation. Although the recombinant full-length protein accumulated in inclusion bodies, an in-column refolding protocol made it possible to recover pure soluble and stable protein for immunization. Furthermore, the 14 mAbs that were obtained after immunization with the refolded protein expressed in E. coli also recognized the recombinant BV-Pfs47, indicating that these two recombinant proteins shared several immunogenic epitopes.Several transmission-blocking 21 Although the D2 domain comprises roughly one third of the Pfs47 protein, none of the mAbs raised against full length T-Pfs47 targeted this domain, and even the reactivity of polyclonal mouse IgG to the D2 domain was much lower than to domains D1 or D3. However, the mD2 domain without cysteines is immunogenic, suggesting that the lack of antibody response to this region after immunization with the full-length protein may be due to immunodominant epitopes present in the D1 and D3 domains, and/or to the lack of exposure of the D2 domain due to masking by the other two domains.We were disappointed that none of the 14 mAb, nor the purified mouse polyclonal IgG after immunization with the full-length protein, had significant TBA. This is consistent with previous reports that immunization with full-length Pfs47 does not confer TBA.Plasmodium infection. Although the precise domain boundaries of Pfs47 are not known, the N-terminal of D2 could serve as a linker between domains 1 and 2. Antibody binding to this region may stabilize a conformation that facilitates the interaction of Pfs47 with a partner in the parasite that is involved in fertilization, or with a mosquito receptor that mediates immune evasion. Interestingly, the N-terminal epitope in mD2 is immunodominant and took over the IgG response after three immunization boosts, resulting in polyclonal mouse IgG with no significant TBA. A new recombinant protein in which this deleterious N-terminal region was removed (mD2-Del1) solved this problem and generated mouse IgG with strong TBA. Furthermore, immunization with a recombinant protein that includes only the central 52 aa region before the cysteine loop region elicited strong TBA. All recombinant proteins in this study were made based on the GB4 Pfs47 haplotype , the most frequent one in West Africa, and all the TBA were done with NF54 parasites that express Hp2  that differs from Hp1 by a single amino acid, and cross-protection was observed. The low variability in this 52 aa region, with only seven different haplotypes present world-wide that share 96\u201398% aa identity, makes it very likely that antibodies to one haplotype will cross-react with others. The cross-reactivity and cross-protection of anti-Pfs47-Hp1 antibodies with other haplotypes is currently under investigation. Due to its small size (52aa), conjugation of this antigen with a protein carrier is likely to enhance immunogenicity.mAbs that bind to the central region of mD2, immediately before the cysteine loop region, have strong TBA, while a mAb that binds to the N-terminal region enhances Pfs47 would hamper the ability of P. falciparum to evade mosquito immunity could not be tested, because parasite development was blocked at a very early stage. Most likely, anti-Pfs47 antibody binding to the surface of female gametes disrupted fertilization. The proposed anti-Pfs47 vaccine appears to block P. falciparum infection through a mechanism different from other leading targets, because Pfs47 is expressed on the surface of female gametes, while the anti-Pfs48/45 vaccine targets male gametes; and unlike Pfs230 , the Pfs47 TBA is independent of human complement. Moreover, Pfs25 protein is expressed in zygotes and ookinetes, while the observed TBA in Pfs47 appears to be acting at an earlier stage by preventing fertilization. This opens the possibility that the Pfs47 antigen may synergize with other transmission blocking vaccine targets. This 52 aa Pfs47 antigen is a promising vaccine candidate that lacks cysteine residues. Elicitation of protective antibodies does not seem to be conformation-dependent, it can be expressed at high yields in E.coli, and is immunogenic and protective.All immunizations in these studies were done using the Magic Mouse\u00ae adjuvant that contains immune-stimulatory short CpG DNA-oligodeoxynucleotides with unmethylated cytosine-guanine dinucleotides. Optimization of adjuvants, expression systems, and delivery strategies would be necessary to move this vaccine forward into clinical trials. The initial hypothesis that antibodies to Plasmodium falciparum Pfs47 coding sequence extending from the predicted signal peptide cleavage site to the GPI anchor site  was codon optimized for insect cell expression and synthesized by GenScript (Piscataway NJ). Two forms of Pfs47 were cloned from the mature full length Pfs47. The BV-Pfs47 construct was built by PCR amplification of the Pfs47 coding sequence from Thr32 to Tyr420, that was sub-cloned into a modified pAcSecG2T vector (Pharmingen), containing a TEV protease cleavable N-terminal hexahistidine/maltose binding protein (MBP) tag. The Pfs47 Domain 1 and Domain 3 fusion protein (Pfs47-D1-D3) construct, which lacks a predicted Domain 2 (D2), was cloned by overlap extension PCR to replace the predicted D2 (Ser155 to Gln267) with a GSGGSG tether linker. This Pfs47 D1-D3 construct (Thr32-Asn154 GSGGSG Asn268-Ala414) was subcloned into a modified pAcGP67b vector (BD Biosciences) with a hexahistidine tag preceded by a TEV cleavage site at the C terminus of the protein. Recombinant Pfs47 constructs were produced in insect cells using established protocols.23 In brief, high titer expression viruses were generated in Spodoptera frugiperda 9 (Sf9) cells and used to infect Trichoplusia ni (Hi5) cells. Secreted proteins were harvested from the Hi5 cell culture supernatant after 65 hs of infection and purified by nickel affinity chromatography. Using TEV protease, the hexahistidine/MBP tag was cleaved; and the tag was removed by ion exchange chromatography. Proteins were purified to homogeneity by size exclusion chromatography in HEPES-buffered saline  containing 2% glycerol.The mature full-length Escherichia coli expression (provided by Dr. George Christophides), cloned by PCR and subcloned into pET32 plasmid, containing a Thioredoxin N-terminal fusion and a C-terminal hexahistidine tag. T-Pfs47 was expressed in SHuffle\u00ae T7 Competent Escherichia coli. 8\u2009M urea solution containing inclusion bodies of cultures induced for 3\u2009h at 37 \u00b0C with 1\u2009mM isopropyl \u03b2-D-thiogalactopyranoside (Sigma) were purified by an in-column HPLC nickel affinity purification/refolding chromatography (Thermofischer) and dialyzed against PBS. Similarly, Pfs47 Domain 1 (Thr32 to Asn 154) and Pfs47 Domain 3 (Asn268 to Ala414) were produced using the same method mentioned above to obtain Thioredoxin-Pfs47 Domain 1 (T-Pfs47-D1) and Thioredoxin-Pfs47 Domain 3 (T-Pfs47-D3).Alternatively, the Thioredoxin-Pfs47 (T-Pfs47) construct (Thr32 to Tyr420) was codon optimized for E. coli was attempted multiple times, but no bacterial colonies could be obtained after transformation, suggesting that the protein product was toxic to E. coli. To overcome this problem, Pfs47 Domain 2 (Ser155 to Gln267) was synthetized in which the two cysteines were replaced by alanines (C230A and C260A). A hexahistidine tag was added at the C-terminal and subcloned into pET17b to obtain Pfs47 modified Domain 2 (Pfs47-mD2). The latter construct was used as template to generate several Pfs47-mD2 deletions: Pfs47-mD2-Del1 (Ile178 to Gln267), Pfs47-mD2-Del2 (Ile178 to Asn229) and Pfs47-mD2-Del3 (Ser155 to Asn181) by PCR amplification of different regions that were subcloned into the pET17b vector. All constructs derived from Pfs47-mD2 were isolated from inclusion bodies, purified by nickel affinity chromatography and dialyzed in HEPES-buffered saline . All gel images derive from the same experiment and were processed in parallel.Expression of recombinant Pfs47 Domain 2 (Ser155 to Gln267) protein alone, or as a thioredoxin fusion in Anopheles gambiae G3 and Anopheles stephensi Nijmegen strains were used. Mosquitoes were reared at 27\u2009\u00b0C and 80% humidity on a 12-h light-dark cycle under standard laboratory conditions. The Plasmodium falciparum strains NF54 was maintained in O\u2009+\u2009human erythrocytes using RPMI 1640 medium supplemented with 25\u2009mM HEPES, 50\u2009mg/l hypoxanthine, 25\u2009mM NaHCO3, and 10% (v/v) heat-inactivated type O\u2009+\u2009human serum  at 37\u2009\u00b0C and with a gas mixture of 5% O2, 5% CO2, and balance N2.10P. falciparum gametocyte cultures. Gametocytogenesis was induced as previously described.10 Briefly, the RBCs of a 14\u201317-day old mature gametocyte cultures (stages IV and V) of the P. falciparum NF54 line were separated by centrifugation . The infected RBCs were resuspended in one volume of human serum at 37\u2009\u00b0C and then diluted to 0.15%-0.2% stage V gametocytemia with O\u2009+\u2009human RBC at 42% in human serum at 37\u2009\u00b0C. All manipulations were done maintaining the tubes in water at 37\u2009\u00b0C. A 244 ul sample of diluted gametocytes was mixed into an Eppendorf tube containing 16\u2009\u03bcl of Ab test sample at 37\u2009\u00b0C and delivered to a prewarmed (37\u2009\u00b0C) glass feeder with parafilm as membrane. The test sample contained protein G purified IgG monoclonal antibodies (mAb), protein G purified mouse polyclonal antibodies, or protein G purified IgGs from control mouse diluted in non- heat inactivated AB\u2009+\u2009human sera at the mentioned concentrations. Mosquitoes were fed using membrane feeders with a water jacket at 37\u2009\u00b0C for 30\u2009min. Midguts were dissected 8\u201310 d after feeding, and oocysts were stained with 0.05% (wt/vol) mercurochrome in water and counted by light microscopy. The distribution of parasite numbers in individual mosquitoes between control and experimental groups was compared using the nonparametric Mann\u2013Whitney test . The percent reduction in transmission (TBA) was calculated as follows: 100\u2009\u00d7\u2009{1\u2212[(mean number of oocysts in the test)/(mean number of oocysts in the control)]}. All standard membrane feeding assays were confirmed in two to three independent experiments. Multiple naive mouse sera was purchased from Sigma-Aldrich  and human sera from Interstate Blood Bank .Mosquito females were infected artificially by membrane feeding with A. gambiae mosquitoes were injected 1\u20132 d postemergence as previously described.10 Briefly, mosquitoes were injected with 69\u2009nL 3\u2009\u03bcg/\u03bcL dsRNA solution 3\u20134 d before receiving a Plasmodium-infected blood meal. dsRNA A. gambiae TEP1 were produced using the MEGAscript\u00a9 RNAi Kit  using DNA templates obtained by PCR using A. gambiae cDNA and the primers previously described10 with T7 polymerase promoter sites added in the 5'-end. A. gambiae TEP1 gene silencing was assessed in whole sugar-fed mosquitoes by quantitative real-time PCR using primers TEP1- qF, TEP1-qR, respectively and were found to be 67% lower by qRT-PCR in dsRNA immune genes injected mosquitoes compared with a dsLacZ-injected control.Individual female A. gambiae mosquito midguts 24\u2009h after feeding using TRIzol (Invitrogen) and a modified RNeasy Mini Kit (Qiagen). cDNA was synthesized from 1\u2009\u03bcg total RNA using the QuantiTect Reverse Transcription Kit (Qiagen). Gene expression was analyzed by SYBR green qRT-PCR  in a CFX96 system using two technical replicates and three biological replicates . The P. falciparum gene Pf10_0203, an ADP ribosylation factor,10 was used as an internal reference to normalize each sample.Total RNA was isolated from 15 P. falciparum ookinetes, we measured the expression of four conserved ookinete-specific genes that have been previously described. These included two secreted adhesive proteins important in mosquito midgut attachment, secreted ookinete adhesive protein (SOAP) and von Willebrand Factor A domain-related protein (WARP), a chitinase (CHT1), and a subtilisin protease-like protein critical for midgut invasion (PIMMS2).20 The sequences of the primers used are provided below. We calculated fold-change differences in gene expression between A. gambiae treated with Pfs47 mD2 antibodies or control IgG antibody using the 2\u2212\u0394\u0394Ct method. Gene expression in NF54 gametocytes was measured as a negative control.To determine whether the Pfs47 mD2 antibody prevents the formation of qRT-PCR primer sequences used in this study; SOAP_Pf_qPCR_F CAAAGACATCTTCTCGTTCC; SOAP_Pf_qPCR_R TCGGTTTCTTGTTCTGATTT; WARP_Pf_qPCR_F GGTTGGGGAAGAAGGTAAGG; WARP_Pf_qPCR_R CACAAAAATCCCCATCATCA; CHT1_Pf_qPCR_F TCAACCCCTTTTAATCCGAA; CHT1_Pf_qPCR_R ACCCGTCTGCTCTTTTATTT; PIMMS2_Pf_qPCR_F GGGAGAAGGAAAAGGATCTA; PIMMS2_Pf_qPCR_R CTCGGATAATTCTTGTACCG; Pf10_0203_qPCR_F TTGGTGAAGTTGTTACGACTPf10_0203_qPCR_R CTCCTACATCCCATACGGTAAll animal procedures were performed according to protocols approved by the NIAID and NIH Animal Care and Use Committee. Five to eight weeks old naive, female Balb/c mice were purchased from Charles River  and maintained at a facility at the NIH. All procedures were performed in accordance with an animal study protocol approved by the NIAID Animal Care and Use Committee.n\u2009=\u20095) of female BALB/c mice were immunized with a volume of 20\u2009\u00b5L containing 5\u2009\u00b5g of protein emulsified in magic mouse adjuvant (Creative Diagnostics # CDN-A001) subcutaneously in the ear. The immunized mice were boosted at 2 week intervals three times with the same quantity of protein. Groups of control mice were immunized with adjuvant formulations only. Blood was collected on day 0 (Pre-immune sera) and 2 weeks after each subsequent immunization for analysis of antibodies titer. Hybridoma production was carried out at Antibody and Immunoassay Consultants, Rockville. IgG from mouse serum and hybridoma supernatant was purified as previously described.21Groups  overnight at 4\u2009\u00b0C. The plates were washed three times with TBS\u20130.1% Tween 20 (TBST) and blocked with general block ELISA blocking buffer (ImmunoChemistry cat # 640) for two hours at 37\u2009\u00b0C. Polyclonal and monoclonal purified IgG were used at 0.1\u2009\u00b5g/ml; animal sera were used at a 1;100 ratio diluted in buffer containing blocking buffer and TBST, added to the antigen-coated wells and incubated for two hours at 37\u2009\u00b0C. The plates were then washed three times with TBST and incubated with goat anti-mouse or anti-rabbit immunoglobulin G conjugated to alkaline phosphatase (Seracare cat # 5220-0303) secondary antibodies (0.2\u2009\u00b5g/ml) for two hours at 37\u2009\u00b0C. The plates were washed again and detection was performed using 100\u2009\u00b5L/well of p-nitrophenyl disodium phosphate solution . After a 20-min incubation, absorbance was read at 405\u2009nm with VersaMax ELISA plate reader.Flat-bottom 96-well ELISA plates  were coated with 1\u2009\u00b5g/ml of recombinant protein diluted in coating buffer . The proteins were detected using 6\u00d7-His epitope tag primary antibodies (ThermoFisher cat # MA1-21315) or animal sera at 1:1000 dilutions. The membranes were then washed three times with TBST and incubated with goat anti-mouse or anti-rabbit secondary antibodies conjugated to alkaline phosphatase at 1:5000 dilution. The proteins were then detected using Western Blue Stabilized Substrate for alkaline phosphatase (Promega cat # S3841) after 5\u2009min incubation.E. coli acetone powder. Secondary Alexa Fluor 488 goat anti-mouse (Abcam ab150105) and 594 goat anti-rabbit (Abcam ab150080) antibodies were used at 1:500 dilution and counter-stained with DAPI at 1:1000. Ookinetes were obtained from dissected midguts 24\u2009h post-infection, treated as mentioned above but stained with monoclonal anti-Pfs25 (4B7) (1\u2009mg/mL diluted 1:1000) as primary antibody. Slides as well as ookinete counting were examined using a confocal microscope at 63\u00d7 magnification.Gametocytes, gametes (activated at room temperature for 30\u2009min) were smeared on poly-L-lysine slides and allowed the slides to dry overnight at 4\u2009\u00b0C. The slides were then fixed in 4% para-formaldehyde  for 20\u2009min, washed three times (PBS) for 5\u2009min per wash, and blocked and permeabilized in 5% BSA, 0.1% triton (in PBS) prior to antibody staining. We incubated slides overnight at 4\u2009\u00b0C with the following primary antibodies: monoclonal mouse anti-Pfs47-mD2 , polyclonal rabbit anti-Pfs230 (1\u2009mg/mL diluted 1:1000), polyclonal mouse anti-T-Pfs47 (1.5\u2009mg/mL diluted 1:100), polyclonal mouse anti-Pfs47-mD2 Del1 (1.5\u2009mg/mL diluted 1:100), and polyclonal mouse anti-Pfs47-mD2 Del2 (1.5\u2009mg/mL diluted 1:100). Polyclonal antibodies were preabsorbed with 1% This research was conducted in accordance with all relevant guidelines and procedures, and has been approved by the National Institutes of Health Intramural Program.Data that support the findings of this study are available from the corresponding author upon reasonable request.Supplementary Material"}
+{"text": "Modification of the gap at the Dirac point (DP) in axion antiferromagnetic topological insulator  These effects, discovered in magnetic topological insulators (TIs), are very important for both fundamental science and future technological applications, like dissipation-less topological electronics and topological quantum computation. They are accompanied by a predicted opening of a gap at the Dirac point (DP) arising as a result of the time reversal symmetry (TRS) breaking due to the induced magnetic ordering. In turn, this magnetic gap and its magnitude can be good indicators of the developed effects and their modification under different conditions. Intrinsic magnetic TIs  are currently viewed as the best candidates for implementing the aforementioned effects. Thus, these compounds can be considered as a very promising platform for realizing other interesting and exotic effects, such as magnetic monopole and axion field and their possible manipulation22.Interplay between topology and magnetism plays a significant role in generation of a number of exotic topological quantum effects such as Quantum Anomalous Hall Effect (QAHE)13. This compound has layered crystal structure consisting of septuple layers (SLs) with van der Waals (vdW) bonding between them. Each SL contains Mn layer in the central plain with ferromagnetic coupling between Mn magnetic moments. An overall AFM ordering in the compound is formed by the nearest neighboring Mn FM layers coupled antiferromagnetically with each other. As a result, all magnetic moments are ordered and aligned with the c-axis, i.e. perpendicular to the surface (in the out-of-plane direction). The topological surface state is formed at 11. Despite the fact that due to AFM coupling, TRS  TI with 23. Moreover, it was found that the Dirac cone (DC) state remain practically temperature independent above and below the Ne\u00e9l temperature . At the same time, a series of works30 has appeared in literature where a \u201cgapless\u201d-like ARPES dispersion was observed for 30. The reduced gap for these samples has been attributed to the difference between the bulk and surface magnetic orders, although it should be noted that only a weak temperature dependence of the spectra has been revealed. The significant difference in the gap width observed for different samples of Experimentally measured DP gap varies from 50\u00a0to\u00a085\u00a0meV depending on photon energy and the measurements conditions, see, for instance, Refs.13. We have studied these samples by XMCD, CD and spin-resolved ARPES and have shown the possibility of differences in the formed surface magnetic moment, which affects the DC state differently, for the samples with different gap at the DP. These effects can be related to a shift of the topological DC state towards the second SL block, due to surface structural modification, where it senses simultaneously the opposite magnetic moments of the first and the second Mn layers, as it is revealed by our ab-initio simulations. Thus, this shift leads to a decrease in the effective magnetic moment, which acts on the DC state.In the present work we have carried out a detailed analysis of the DP gap in 13 for samples or surface areas which hereafter we will call as sample with a \u201clarge gap\u201d at the DP (a) and sample with \u201creduced gap\u201d at the DP (b), see details in the text below. In the bottom row in panels  the corresponding ARPES maps in the 31 with improved angle, energy and spatial resolutions. From the dispersion maps at 9\u00a0K  the positions of the edges of the conduction and valence bands (CB\u00a0and\u00a0VB) are located at about 0.22\u00a0eV and 0.36\u00a0eV binding energies (BEs), respectively. At temperature of 35\u00a0K the CB and VB edges respectively shift to BEs of approximately 0.19\u00a0and\u00a00.38\u00a0eV. This difference is due to the exchange splitting of the bulk states below 23 for more details and analysis of these states and their splitting).Figure 23).One can see from ARPES dispersion in panel (a) that the energy gap at the DP seems to be open both below and above mentclass2pt{minimTo investigate the evolution of the DP gap with temperature, we performed a set of measurements between 9\u00a0and\u00a035\u00a0K. In Fig.\u00a0mentclass2pt{minim30. Figure 23) for both samples below Besides, we observed samples of another type that, although being measured at the same conditions, demonstrate significantly reduced DP gap. Figure mentclass2pt{minim33 it was proposed that the DP gap in magnetically-doped TIs can have a non-magnetic origin and appears due to the avoided crossing hybridization of the DC with the impurity levels of magnetic atoms near the DP. Thus, to confirm possible magnetic-derived origin of the gap opening (i.e. absence of Mn-levels near the DP) we performed resonant PE measurements. This method allows one to enhance the contribution of the Mn-derived states in PE spectra and to indicate the exact energy range of localization of these states.In Refs.\u00a034 the Mn 3d states in d states at about 3.2\u00a0eV\u00a0BE (see panels (a), (e) and (f)) while there is no visible intensity change in the DC region (see panels (b\u2013d) and (g)). This proves the absence of any notable contribution of the Mn d states in the vicinity of the DP and shows the unlikeliness of an avoided-crossing-scenario in 35.According to theoretical calculationsentclass1pt{minimad)-Te(p) hybrid states34. However, these states are unlikely to have significant contribution to the DP gap opening via the avoided-crossing hybridization mechanism. All measured samples demonstrate analogous behavior during the resonant photoemission experiment with a small variation of the intensity of the Mn-derived peak at 3.2\u00a0eV\u00a0BE.Panels  show some weak intensity growth on-resonance in the VB region with 1\u00a0eV\u00a0BE and in the CB region that points to presence of some Mn-derived states there. They might be related to the formation of the Mn and the impact of the Mn\u00a03d states.Overall, the spin structure that is shown in Fig.\u00a025. Moreover, one can see that the spectrum measured with 38.In order to study the out-of-plane spin polarization inversion between the upper and lower parts of the DC in the vicinity of the  SR Fig.\u00a0a and LR  SR Fig.\u00a0b. In pand states34 which become more pronounced at the photon energies between 6\u00a0and\u00a015\u00a0eV. Their enhancement is well visible in Fig.\u00a0At the same time, one can see that the spin-resolved spectrum measured at entclass1pt{minimaThus, the presented spin-resolved spectra demonstrate a pronounced inversion of the out-of-plane spin polarization between the upper and lower parts of the DC at the However, in the presented measurements performed using the SR we did not distinguish between the samples (or surface areas) characterized by large or reduced gap. In order to estimate the difference in the DC spin structure of the samples with the \u201clarge gap\u201d and the \u201creduced gap\u201d we used circular dichroism (CD) ARPES method at mentclass2pt{minimp-polarized LR at In Fig.\u00a039). To confirm such a correlation, the spectra are presented in the region including also the Te-derived exchange-split states at the edge of CB located in the energy region 0.14\u20130.22 eV (see for comparison Ref.\u00a023). We have to note the presence of spin-polarized Mn-derived states weight in this energy region  one can assume that Mn atoms in Bi layer also possess out-of-plane moments. These magnetic moments may induce the chiral spin texture in the surrounding media (similar to Ref.\u00a036) that can affect the magnetic state of the crystal. On the other hand, competing magnetic interactions in 43). We speculate that the formation of the skyrmion-like spin textures can be generated at elevated temperatures in the Mn-Te bilayers inside SLs, like as it is in heterostructures MnTe/TI44.Above 14 the \u201cgapless\u201d-like DC can arise in Figure\u00a0To study the surface magnetic ordering, we have carried out measurements of X-ray Magnetic Circular Dichroism (XMCD) which are more surface sensitive in comparison to SQUID measurements. XMCD signal is proportional to the sample magnetization either intrinsic or induced under applied magnetic field. Figure 7). Moreover, an unusual deviation of FM-like M(H) curve is observed in the region between 2\u00a0and\u00a03.5\u00a0T where it demonstrates reversed direction to the \u201cmain\u201d loop. Appearance of these additional hysteresis loops can be observed in case of A-type AFM  on applied magnetic field M(H), see Fig.\u00a0Thus, our magnetic measurements indicate an out-of-plane FM ordering with an XMCD signal coming mostly from the topmost SL. At the same time, XMCD measurements can be consistent with the A-type AFM ordering inherent to 42. Due to the fact that Mn and Bi atoms have noticeably different size it is evident that presence of a number of 42 show that Mn-Te and outer Te-Bi interlayer spacings are respectively by 3\u20133.5% expanded and contracted as compared to our calculated equilibrium interlayer distances whereas the second, Bi-Te, distance differs only within one percent from the theoretical value. At the same time these data for defect containing samples also show that vdW spacing between neighboring SLs is of 25 for TIs with weak van der Waals coupling between building multilayered blocks is a broadening of vdW spacing near the surface caused by the mechanical cleavage or exfoliation implied for the surface preparation for ARPES and STM experiments. For ab-initio simulation of the structural effects we apply an approach that previously showed its efficiency in explaining the experimentally observed features in layered TIs spectra and which is based on consideration of changes in interlayer spacings within or between building blocks of TI47. In our simulation we restrict the structural changes only in the surface SL and in the first vdW gap, since it is known that the topological surface state is almost completely localized in this area. First we consider the effect of vdW spacing expansion on the surface electronic structure. As previously shown for layered TIs the gradual detachment of the outer block leads to progressive relocation of the topological state to the deeper QL45. For The alteration of the topological surface state localization is possible due to structure modification caused by natural unavoidable defects. It was revealed that 40. The spectrum of the To study the effect of the structural changes produced by antisite defects within SL we extracted the interlayer distances from the structural data presented by Zeugner et al.We have shown that both a large .Our results demonstrate complex behavior of electronic and spin structure in 31. For the experiment we used photons  SR with various photon energies at BL-9B endstation of HiSOR .The spin-resolved ARPES experiments were carried out using (1) s- polarized LR  at the Research park of Saint Petersburg State University.Clean surfaces of the samples were obtained by a cleavage in ultrahigh vacuum. The base pressure during all photoemission experiments was better that 51 as implemented in the VASP code53. The exchange-correlation energy was treated using the generalized gradient approximation54. The Hamiltonian contained scalar relativistic corrections and the Spin-orbit interaction was included in all types of calculations. In order to describe the van der Waals interactions we made use of the DFT-D355 approach. The Mn 3d-states were treated employing the 56 within the Dudarev scheme57. The d-states was chosen to be equal to 61.Ab-initio electronic structure calculations were carried out within the density functional theory using the projector augmented-wave (PAW) method"}
+{"text": "However, little is known about the developmental programs that govern human DA neuron development. With the advent of single-cell RNA sequencing (scRNA-seq) and bioinformatics, it has become possible to analyze precious human samples with unprecedented detail and extract valuable high-quality information from large data sets. This technology has allowed the systematic classification of cell types present in the human developing midbrain along with their gene expression patterns. By studying human development in such an unbiased manner, we can begin to elucidate human DA neuron development and determine how much it differs from our knowledge of the rodent brain. Importantly, this molecular description of the function of human cells has become and will increasingly be a reference to define, evaluate, and engineer cell types for PD cell replacement therapy and disease modeling.Parkinson\u2019s disease (PD) is a progressive neurodegenerative disorder that predominantly affects dopaminergic (DA) neurons of the substantia nigra. Current treatment options for PD are symptomatic and typically involve the replacement of DA neurotransmission by DA drugs, which relieve the patients of some of their motor symptoms. However, by the time of diagnosis, patients have already lost about 70% of their substantia nigra DA neurons and these drugs offer only temporary relief. Therefore, cell replacement therapy has garnered much interest as a potential treatment option for PD. Early studies using human fetal tissue for transplantation in PD patients provided proof of principle for cell replacement therapy, but they also highlighted the ethical and practical difficulties associated with using human fetal tissue as a cell source. In recent years, advancements in stem cell research have made human pluripotent stem cells (hPSCs) an attractive source of material for cell replacement therapy. Studies on how DA neurons are specified and differentiated in the developing mouse midbrain have allowed us to recapitulate many of the positional and temporal cues needed to generate DA neurons  Parkinson\u2019s disease (PD) is the second most common neurodegenerative disorder, and its prevalence continues to increase as the population ages . ClinicaCurrent treatment options for PD aim to correct the loss of striatal dopamine through pharmaceutical intervention, either with drugs that modulate DA neurotransmission or that increase dopamine levels in the brain, such as L-DOPA. As an alternative treatment, patients that develop drug-related complications can have electrodes surgically implanted for deep brain stimulation, which compensate for the loss of DA neurotransmission by inhibiting excitatory neurotransmission. However, all of these treatments are symptomatic, and they neither address the underlying cause of the disease nor prevent the progressive degeneration of mDA neurons. Moreover, as the disease progresses, these treatments lose efficacy and lead to undesirable side-effects, further highlighting the need for PD treatment strategies that address the underlying cause of the disease, rather than its symptoms .In addition to novel therapies that address the underlying cause of PD, there is a clear need for regenerative treatments capable of replacing the mDA neurons already lost in PD patients at the time of diagnosis. Therefore, cell replacement therapy is considered a promising treatment option as it could both provide a more physiological delivery of dopamine and replace other important functions of mDA neurons, such as the delivery of trophic factors, which can support other cell types within the basal ganglia that connect with mDA neurons. Human fetal ventral midbrain (VM) tissue has been successfully used for cell transplantation in clinical trials and has provided proof of concept for cell replacement therapy in PD . NotablyHuman pluripotent stem cells (hPSCs) have emerged as an ideal source of material for cell transplantation since they can expand indefinitely and provided the right cues, they can differentiate into any cell type of the body. However, to guide the differentiation of hPSCs into a specific cell type, it is necessary to have a detailed understanding of the developmental steps leading to the generation of that cell type. In the case of PD, mDA neurons are the cell type of interest, and their development has been intensively studied in recent years . HoweverIn mice, mDA neurons arise from the VM region, after regional specification of the neural tube. This regionalization process is accomplished through the combined action of two important signaling centers: the floor plate and the isthmic organizer. In this review, we will briefly discuss these two signaling centers, but for a detailed description, the reader is directed to the many excellent previous reviews in this area, including .Otx2 in the midbrain , that pattern the neural tube in the dorsoventral axis and specify neural identities . Howevermidbrain  and Gbx2indbrain . The IsOain side , which iogenesis .Foxa2 (Lmx1a (Neurog2 (Nr4a2 (Nurr1) (Pbx1 (Pitx3 (Th) (Vmat2/Slc18a2), and the dopamine transporter (Dat/Slc6a3)  of the floor plate begin to express two transcription factors required for mDA neuron development, Foxa2  and Lmx12 (Lmx1a . These p(Neurog2  that res (Nurr1) . Followi (Nurr1) . During 1)  , the ves/Slc6a3) .LMX1A and FOXA2, with the FOXA2 domain extending further laterally into the basal plate  clearly identifiable. Furthermore, human mDA neuron development also appears to follow a similar sequence of events to that of murine mDA neuron development. For instance, the human midbrain floor plate is defined by the expression of al plate . Moreoveobserved .The information gained from studying mDA neuron development, whether that be in the murine or human VM, has in recent years led to the development of several protocols that direct the differentiation of hPSCs into functional mDA neurons capable of rescuing motor deficits in rodent and non-human primate models of PD , as wellsubstantia nigra (SNc) and ventral tegmental area (VTA) phenotypes, have been described (With the advent of single-cell RNA sequencing (scRNA-seq), it has become possible to profile the transcriptome of every individual cell in a tissue and to define their molecular signatures in an unbiased and systematic manner. Moreover, analyzing cells at different stages of development by scRNA-seq can provide a description of developmental processes at an unprecedented depth and resolution . Recent escribed .Less is known about the development of embryonic mDA neurons at the single cell level. While in vitro from hPSCs as well as to guide the improvement of mDA neuron differentiation and reprogramming protocols. We argue that a detailed single-cell level knowledge of the cell preparations being used for cell replacement therapy is necessary to identify the cell types required for functional replacement as well as any unnecessary or undesirable cell types in the preparation. We expect that such knowledge will improve the therapeutic potential and safety of future cell preparations for cell replacement in PD and that the strategy followed here will be useful in addressing the challenge of performing cell replacement in other tissues or organs.In the next sections, we focus on the differences between human and murine midbrain development as identified by scRNA-seq. These include differences in cell-type composition, temporal dynamics of development, and the expression of transcription factors at the single-cell level. Furthermore, we describe how the knowledge gained from scRNA-seq analysis can be used to assess the quality of DA neurons generated We recently used scRNA-seq to analyze and compare the human and murine VM at different stages of development, covering mDA neuron specification, neurogenesis and differentiation in both the human (weeks 6\u201311) and the mouse (E11.5 \u2013 E18.5) . We usedHowever, it should be noted that while our scRNA-seq analysis provided the first unbiased classification of cell types in the developing human VM, it remains to be determined whether sampling a greater number of cells from additional human embryos will lead to the identification of additional cell types or a better definition of the cell types described in this review. As such, efforts are currently underway to sequence a greater number of cells and embryos, at additional developmental stages, using new and improved scRNA-seq methods, which are expected to improve the resolution of the analysis described here.in situ hybridization (smFISH) analysis also revealed the presence of Rgl2c in the embryonic mouse VM, suggesting that other homologous human Rgl2 subtypes may also be present in the mouse VM. Further experiments will be necessary to determine whether equivalent midbrain Rgl cell types exist in both species and whether their spatial organization is similar.Our analysis of the developing human VM (weeks 6\u201311) identified a greater diversity of radial glia cell types compared to the mouse (embryonic days 11.5\u201318.5)  and to wSox2 (Fabp7)  Sox2 , and the (Fabp7)   . Howeverogenesis   were identified by the expression of FOXA2 in the absence of the floor plate markers mentioned above, such as WNT1 and LMX1A. The final progenitor identified in the human VZ, NProg, is not characterized by the expression of genes in a defined medial-lateral compartment, but rather by the expression of pro-neural genes such as NEUROG2 and ASCL1  is defined by the expression of CORIN , a natriCORIN , as well of SOX2 , and JAD pathway . Both flor plate  , an early cytoskeletal neuronal marker   neuroblasts in the floor plate and TH+ mDA neurons in the VM   , a nucle (Nurr1) . While en the VM . The sammidbrain , indicatt (NbDA) , a cell t (NbDA) .Nkx6-2 (Nkx6-2 and Cartpt (cocaine- and amphetamine-regulated transcript prepropeptide), two markers labeling in the IZ/MZ of the basal plate , which is characterized by the expression of the transcription factor Nkx6-2 . In the al plate . Cart isal plate . In the  , and SLC6A3 (DAT). However, three distinct types of embryonic mDA neurons could be detected in the developing human and murine VM (DA0-2)  and RN neurons. All the neuronal cell types were identified based on the expression of components necessary for neurotransmission. This included the rate-limiting enzyme for neurotransmitter synthesis, the vesicular transporter responsible for loading the neurotransmitter into synaptic vesicles as well as the neurotransmitter reuptake transporters. In the case of mDA neurons, they were characterized by the expression of  (DA0-2) .TH but lacks SLC6A3, and thus it was classified as an incomplete DA neuron not yet capable of neurotransmission. At week 7 (E12.5 in mouse), the first mDA neuron cell type (DA1) that expresses SLC6A3, thus fulfilling all the criteria for neurotransmission, was detected. A second mDA neuron (DA2) was detected at week 8 (E13.5 in mouse) and was found to additionally express SOX6, a transcription factor , an enzyme involved in DA catabolism , and the ventral tier of the SNc pars compacta . This cell type expresses n factor , LMO3, aof Pitx3  and aldetabolism  as well tabolism  and GABAtabolism . In the compacta . Sox6 exeral VTA . Lmo3 is neurons . These rTH expression, appear at weeks 5\u20136 post-conception, mDA neurogenesis peaks around w7\u20138 and then ceases by w10\u201311  of E11.5], a day earlier than mRgl3 (E12.5). On the other hand, hRgl1 appears at w7 (hmt \u2248 E12.5), a day later than mRgl1 (E11.5). Finally, human Rgl2a-b appear at w7 , while hRgl2c is only found at w10  .Similar species differences are also detected when considering the average time of appearance for each radial glia, although they are less clear . In humaThese results, as well as species-specific differences identified in the transcriptional profile of the different Rgl cells, discussed below, raise the interesting question of whether human and murine Rgl cell types serve entirely homologous or some species-specific functions in midbrain development. Gain and loss of function experiments will be required to determine their individual function and how changes in their temporal order of appearance could affect midbrain development. An additional critical issue that also remains to be addressed is the lineage relationship between distinct radial glia subtypes and their relationship to the diverse progenitor cell types in the midbrain.Temporal differences between human and mouse midbrain development were also found in post-mitotic cell types. For instance, the two most abundant midbrain neuroblast cell types, the medial neuroblast (NbM) and the mediolateral neuroblast type 1 (NbML1), are both found at later stages in human development compared to the mouse. Indeed, the average time at which both cell types are detected in the mouse is E12.5, while their human counterparts are detected on average at w8 . Other neuroblasts that appear later in development, such as NbGaba, are also detected at non-homologous developmental times, but in this case, they are detected on average at earlier stages in human , compared to mouse (E15) . These rShh and Wnt1 (Slc1a3 (Glast) , with mDA progenitors expressing Shh between E8.5\u201311.5 and responding to Shh signaling between E7.5\u2013E9.5. Shh expressing progenitors contribute the most significant amount of mDA neurons at E9.5, at the time when Shh expression is detected in the entire Lmx1a domain of the FP   and the ) , mNProg and mNbM express Neurog2 (a gene required for mDA neurogenesis), while mNbM express NeuroD1 (a gene downstream in neurogenesis). This suggests a sequence of events in which mRgl1 becomes mNProg, which then gives rise to the first post-mitotic cell, mNbM. Finally, histological and knockout analysis in mice suggest that Neurog2+ cells in the VZ (mNProg) give rise to Nr4a2+ cells in the IZ (mNbM)  , which i neurons , with th neurons .LMX1A, a gene expressed in hRgl1, hProgM, hProgFPM, and hProgFPL , followed by hNbM, which expresses Neurog2 and NeuroD1. However, no human NbDA was detected and the next cell type detected in the mDA lineage is hDA0, followed by hDA1 and then hDA2  have been FACS sorted during mDA neuron differentiation have provided some interesting information. Antibodies targeting proteins such as CORIN , ALCAM  or CD47 hProgFPL , has beehProgFPL . These rhen hDA2 , which phen hDA2 .The results above suggest important species differences in mDA neuron development, such as the first candidate cell type in the human mDA lineage being a non-homologous cell type (hProgM vs. mRgl1), that NbDA is either not found or is a very transient population in humans (see discussion below), and that gene expression in any given cell type of the human mDA lineage is not identical to that in the homologous mouse cell type . UltimatUsing the model developed by Notably, the species difference in the kinetics for generating hDA1 neurons seems to be cell-type specific because other cell populations do not follow the same dynamics. For instance, NbML1 neuroblasts, which are thought to give rise to 15% of red nucleus (RN) neurons, take comparable homologous developmental time in both species; less than a day in the mouse and within half a week in the human . Thus, cIn addition to neural cells, the cells that make up the vasculature in the midbrain, such as pericytes and endothelial cells, appear relatively late in human development compared to the mouse. While human endothelial cells and pericytes are detected on average at w10 (hmt \u2248 E15), they are detected significantly earlier in the mouse, at E13 and E14, respectively . This fiIn sum, from this analysis, it becomes apparent that while some cell types are generated at homologous developmental time points, following the model by The function of transcription factors in mDA neuron development has been extensively studied in the mouse . Notably, their expression then rapidly decreases in hNProg and is low during differentiation in human cell types, but not in the mouse. Indeed, unlike mNProg, hNProg expresses significant levels of only two of these four factors: FOXA2 and WNT5A , mNbDA , and mDA0 . Indeed, the only human post-mitotic cell type expressing more than one of these factors is hDA0 (FOXA2 and LMX1A) (Another interesting finding is that markers such as nd WNT5A . Moreoved LMX1A)  (La Mannd LMX1A) . These rNeurog2 (ASCL1 (in NProg), or NEUROD1 (in NbM). Additionally, in both species, NProg cells share the expression of SOX2 and FOXA2   . Similarnd Ascl1 . These rnd Ascl1  also sugNr4a2 in post-mitotic neuroblasts is required for the acquisition and maintenance of the mDA phenotype , whereas human NR4A2 is only expressed at high levels in embryonic mDA neurons (DA0-2), suggesting that differences in gene regulation exist between mouse and human. Additionally, immunocytochemical analysis of fetal human VM tissue has indicated that NR4A2 protein is present in cells that have not yet acquired the expression of TH, pointing toward the existence of human DA neuroblasts (NbDA) that express NR4A2 , also found in mDA0, m/hDA1, and m/hDA2  or Calbindin1 , which in both species are found in the two mature embryonic mDA neurons, DA1 and DA2 (Slc18a2 (Vmat2) and Slc6a3 (Dat). Additionally, DA2 neurons in both species express ALDH1A, an enzyme involved in the synthesis of retinoic acid , are relatively immature and do not express the dopamine transporter  in human neurons than in mouse. Since Dcx is a microtubule associated protein essential for neuronal migration  than human DA0  were found in all DA neuron subtypes (DA0-2) (All mouse and human DA neurons (except hDA0) share the expression of  the SNc . This TF the SNc  and GWAS the SNc . On the  the SNc  was the igration , this reuman DA0 . However (DA0-2) , suggestSox6  and good quality basal plate progenitors (hProgBP). At the neuroblast stage, fewer cells acquire a well-characterized NbM and NbML1 identity, but a good number of high quality dopaminergic neurons  are generated . These differences may reflect the fact that the protocol used for the differentiation of hPSCs into mDA neurons (in vivo mDA neuron development.A detailed comparison between hPSC-derived and endogenous VM cell types by machine learning (using logistic regression) revealed significant differences between these two cell preparations. While human endogenous cells were all recognized as very similar to their respective prototypes as defined by machine learning  and randenerated . hPSC-de neurons  does notin vivo and the probability of capturing them is rather low. Conversely, the presence of a continuum of cell types in hPSC-derived cultures suggests that such transitions may be much slower in vitro, as many cells appear to be captured while transitioning from one cell type to the next. Thus, it appears that endogenous midbrain progenitors differentiate following a sequence of events connecting well-defined and stable intermediate states through rapid transitions to generate the mature state. In contrast, cells differentiating from hPSCs in vitro go through a more constant differentiation flow characterized by less defined and less stable intermediate states. These differences in differentiation kinetics might be related to the lack of sufficient spatial information and the asynchronous nature of cells differentiated as a monolayer in two-dimensional (2D) cultures. This is in contrast with normal embryonic development, in which progenitor cells are immersed in a three-dimensional (3D) structure and surrounded by specific micro-environments, referred to as niches. These niches are composed of neighboring cells, which provide spatially arrayed information, such as mechanical forces and secreted factors, including morphogens, growth factors, extracellular matrix, neurotransmitters, and metabolites. It remains to be determined whether moving away from the traditional 2D culturing systems and toward 3D culturing systems may improve the molecular definition of individual cell types. Indeed, cells grown in 3D cultures tend to self-organize into discrete domains, and integrate more signals from neighboring cells  will have an increasingly important role. For instance, scRNA-seq analysis can be used in an iterative process where the information gained from the analysis and comparison of endogenous cell types with hPSC-derived cell types is used to guide the improvement of differentiation protocols. For example, the presence of non-midbrain cell types in the culture, or differences in gene expression identified in midbrain cell types derived from hPSCs compared to their The next challenges for cell replacement therapy in PD with regard to cell composition and quality will then be two-fold. Firstly, subtype specification and late-stage maturation could be improved to generate cell preparations that are enriched in progenitor cells capable of selectively giving rise to mDA neurons of the ventral tier of the SNc. Secondly, those midbrain cell types unnecessary for transplantation should be identified and then eliminated from the culture so that only those cell types required for cell replacement would be transplanted. Additionally, future cell preparations could also be endowed with additional properties that may enhance their therapeutic value. For instance, by generating universal donor cells which cannot be targeted by the host immune system , the neein situ hybridization (FISH) methods, such as osmFISH (in situ sequencing (ISS)  , Slide-sng (ISS) , STARmapng (ISS) , and higng (ISS) , which pIn addition, several other single-cell methods that provide information about the cellular state beyond the transcriptome have recently been developed. In the field of single-cell epigenomics, several methods have now been developed that can be used to shed light on the epigenetic landscape, thus making it possible to gain information about the gene regulatory networks that govern lineage commitment and cell fate decisions during development. Several methods have been developed that provide information about chromatin accessibility, e.g., single-cell ATAC sequencing  and singUntil recently, most of our knowledge about mDA neuron development has come from studies in mice and little was known about the developmental programs that govern human mDA neuron development. Our scRNA-seq analysis of the developing human and murine VM has now generated a dataset that encompasses early mDA neuron development in both species, allowing us to study human development in an unbiased manner and to compare it to our current knowledge from the mouse . From thin vitro and in animal models of PD . Moreover, by adopting a multi-omics approach and integrating different levels of information at the single-cell level, followed by functional genomics strategies for validation, it may be possible to understand and address the differences observed between the murine and human VM during development. Additionally, these same strategies could be used to identify differences between the healthy and Parkinsonian adult brain. Furthermore, these technologies will help us to identify and address any discrepancies between brain endogenous and stem cell-derived cell types, leading to the development of improved cell preparations and cell replacement therapy for the future treatment of PD.Future studies should aim to correlate the molecular signature of cell types identified by scRNA-seq in the mouse and human to their morphological properties , as well as their functional properties both All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In Parkinson\u2019s disease (PD), there are currently no effective therapies to prevent or slow down disease progression. Cell replacement therapy using human pluripotent stem cell (hPSC)-derived dopamine neurons holds considerable promise. It presents a novel, regenerative strategy, building on the extensive history of fetal tissue grafts and capturing the potential of hPSCs to serve as a scalable and standardized cell source. Progress in establishing protocols for the direct differentiation to midbrain dopamine (mDA) neurons from hPSC have catalyzed the development of cell-based therapies for PD. Consequently, several groups have derived clinical-grade mDA neuron precursors under clinical good manufacture practice condition, which are progressing toward clinical testing in PD patients. Here we will review the current status of the field, discuss the remaining key challenges, and highlight future areas for further improvements of hPSC-based technologies in the clinical translation to PD. L-dopa, for restoring the dopamine deficiency is widely used to relieve disease symptoms, but long-term use shows decreased efficacy and can trigger debilitating side effects including motor complications as well as psychiatric problems (A key promise of human pluripotent stem cells (hPSCs), both human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs), is their ability to access unlimited number of specialized cell types for application in cell-based therapies for neurodegenerative diseases such as Parkinson\u2019s disease PD; . The chaproblems .L-dopa treatment  neuron protocols displayed a considerable risk of neural overgrowth , the most widely used GSK3-inhibitor for triggering canonical WNT activation and recombinant factor FGF8 which is added in some but not other protocols for distinct time periods of differentiation . The prein vivo graft outcome, across >30 batches, for mDA neuron populations expressing more caudal floor-plate markers including expression of EN1  or A10  mDA neurons. A9 mDA neurons are particularly vulnerable in PD  and are antation . Howeverin vitro. R-Spondin 2 treatment during floor-plate patterning increased ALDH1A1 expression by 5-fold compared to control by gene expression, but it remained unclear how those gene expression changes correspond to protein expression. Therefore, it will be important to determine the total numbers of ALDH1A1+/TH+ neurons that can be achieved under those conditions and the level of their functionality in vivo -matched iPSC-derived mDA cells has been proposed to minimize the risk of allograft rejection . There aAlternatively, there is considerable excitement in generating universal hPSC lines, which may provide immune tolerance without any immunosuppression. Using such an approach, theoretically, mDA neurons from a single universal hPSC line could be administrated to any PD patient worldwide. Proof-of-concept in establishing universal hPSC has achieved either by the combination of B2M gene knock-out with HLA-E overexpression  or by knLewy body formation is well known as one of the neuro-pathological hallmarks in PD , Interesin vivo ventral midbrain development. However, those cell preparations expressed many poorly defined radial glial and neuroblast markers and differed from the in vivo phenotypes in gene expression (in vitro culture environment that does not fully support mDA neuron development or lack of proper induction of certain subtype-specific genes. In either case, those results indicate that there is considerable room for further improvements in mDA neuron derivation and maturation strategies.Recently, single cell gene profiling has been used to define subtype compositions during mouse and human midbrain development . Such tepression . Additioin vitro to a fully functional mDA neurons many months after transplantation in vivo. Such data should enable a next generation of mDA neuron protocols to reap the full benefit of this approach for human clinical transplantation studies of the future.The developmental ontogeny of distinct mDA neuron subtypes remains a long-standing question in the field. Now with rapidly evolving high throughput sequencing technology and lineage tracking tools, it becomes possible to revisit questions about ontogeny and to monitor the developmental trajectory at a single cell resolution from the acquisition of mDA precursor stage both Given the extensive history of cell replacement therapy using human fetal tissue and the rapid recent advances in human stem cell technology, there is considerable current activity around establishing and translating clinical-grade protocols into early stage trials in PD patients. However, despite the progress made thus far and results from the first clinical studies emerging soon, the scientific effort to develop improved grafting strategies should not stop here. It remains essential to carefully consider and address remaining bottlenecks in the field as reviewed in this article. Next generation of mDA cell products should address those remaining barriers on the road to making cell replacement possibly a routine therapeutic strategy that could become available to PD patients world-wide. Only if basic and translational efforts continue hand in hand, we will be able to capture the full potential of this approach in PD and pave the way for other regenerative approaches in brain repair.All authors contributed to the writing, reviewing, and editing the manuscript, and to the preparation of figures and tables.LS is a scientific founder and paid consultant of BlueRock Therapeutics and an inventor on patents related to the differentiation of dopamine neurons from pluripotent stem cells. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Patients and Methods. 120 consecutive patients with Parkinson's diagnosis were chosen according to the United Kingdom Parkinson's Disease Society Brain Bank criteria. Subsequently, all the chosen dimensions were transformed into interval variables for which the formula proposed by Sturges was used. Once the dimensions were transformed into interval variables, optimal scaling was carried out. Subsequently, the following attributes were analyzed: quality and acceptability of the data; reliability: internal consistency, reliability index, Cronbach's alpha, and standard error of measurement; finally, validity: convergent validity and validity for known groups.  This study has been designed with the aim of using optimal scaling to perform the allocation of scores and to be able to construct an indicator of the Parkinson's Disease Gravity Index. Scores were assigned to interrelated dimensions that share information about the patient's situation, to have an objective, holistic tool which integrates scores so that doctors can have a comprehensive idea of the patient's situation. X2\u2009=\u200932.7, p \u2264 0.001).  There were no missing data. An appropriate Cronbach's alpha value of 0.71 was gathered, and all items were found to be pertinent to the scale. The item homogeneity index was 0.36. Precision evaluated with the standard error of measurement was 7.8. The Parkinson's Disease Gravity Index discriminant validity , assessed among the different stages of Hoehn and Yahr scale by the Kruskal\u2013Wallis test, showed major significance ( The Parkinson's Disease Gravity Index has shown adequate metric properties. Parkinson's disease (PD) is a heterogeneous neurodegenerative process, which, by 2016, was estimated to affect some 6.1 million people [pars compacta; subsequently, there is a widespread involvement of other circuits of the central and peripheral nervous system. Changes associated with genomic, epigenetic, and environmental factors lead to structural alterations and protein deposits, especially alpha-synuclein, due to dysfunction in the ubiquitin-proteasome system, alteration of mitochondrial function, and oxidative stress [The onset of neurodegeneration of Parkinson's disease is likely to occur several decades before the onset of motor symptoms. Possible risk factors include genetic predisposition and environmental factors such as exposure to toxins. Parkinson's disease is characterized by a selective loss of dopaminergic neurons in the substantia nigra e stress .PD is more than just a movement disorder. Other PD subtypes have been proposed, such as autonomic dysfunction, cognitive deterioration, and REM sleep disorder. However, there is still a clear emphasis on the motor symptoms associated with PD . There a\u03c1 (rhoS\u2009=\u20090.43)). This shows that the association between motor disorder and NMS varies at all stages of the disease, except for in the most advanced cases. Most importantly, there is a clear incongruity between motor and nonmotor abnormalities as patients in the milder stages of motor disorder may have considerable nonmotor symptoms. For example, in the study by Ray Chaudhuri et al. [We should point out that there is no clear correlation between motor involvement and nonmotor disorders. In a study of 935 patients, Ray Chaudhuri et al.  increasei et al.  and presThe International Parkinson and Movement Disorders Society offers MDS-owned rating scales, translated scales, and a listing of other recommended rating scales to carry out the evaluation of all the previously mentioned conditions. Using these scales, by the end of the evaluation of patients, a series of scores of different amounts are generated.These scores should be considered by the doctor. However, the doctor, in a personal and subjective manner, should assign their own scores based on their experience, with the goal of reaching a total score which is a comprehensive view of the situation of the patient, and create an appropriate treatment plan. There is a published proposal to perform the Parkinson's Disease Composite Scale (PDCS) that uses heterogeneous values to assess and categorize the severity of symptoms . The autHowever, a core issue remains unanswered: how should doctors assess the importance of symptoms? There are such diverse symptoms which belong to quite different fields, for example, the anxiety section of the HADS  which has a maximum score of 21 points and the motor SCOPA  which has a maximum score of 75. If the patient scores 7 points of anxiety, is it more (or less) important than 25 points of motor SCOPA? Similar questions can be asked of the other scales.On the other hand, we must assume that the scores of the scales are actually discrete scores, that is, that in a strict sense, they do not admit fragmentation and only positive integers belonging to the set of real numbers  are possible, and therefore, they could not be divided.Given the dispersion of the scores, we should treat them as interval variables  . In this type of measurement, the numbers assigned to the objects have all the characteristics of ordinal measurements, and the differences between the measurements represent equivalent intervals. Once these intervals have been created, we can consider them as ordinal categorical variables (classification and sorting), which must also be exhaustive, exclusive, and referenced to a single classifying principle .Due to this, it is necessary to have a mathematical algorithm that allows us to take all the scores and transform them so that, in the end, we have comparable scores.Fisher called this methodology \u201cthe appropriate scoring technique\u201d . Later, X that contains n individuals and m variables, that is to say, a matrix n\u2009\u00d7\u2009m, OS is a multivariate analysis technique, which analyses the relationship of the n random variables and allows for reducing the size of the data matrix with a minimum loss of information. Many of those m variables are categorical in nature . The idea is to assign quantitative values to these categorical variables using nonlinear methods since not all m variables are linearly correlated with each other.Briefly, if we have a matrix Since, in practice, multivariate systems never have maximum homogeneity , the reduction of dimensions always involves loss of information, which can be measured through a loss function. The functions most used for this purpose are made by averaging the sums of the squares of the differences between the score vector of the individuals and each of the variables.Y as the summary of the variables previously scaled or linearly transformed, so that each is weighted according to the amount of information shared with the other variables. The transformations that guarantee that the summary vector  collects as much information as possible are usually gained based on the breakdown of values and eigenvectors of the matrix [This is equivalent to gaining the vector e matrix \u201315.For this reason, this study has been designed with the aim of using OS to perform the allocation of scores and to be able to construct an indicator of the Parkinson's Disease Gravity Index (PDGI). The study's objective is to assign scores to interrelated dimensions that share information about the patient's situation, in order to have an objective, holistic tool which integrates scores so that doctors can have a comprehensive idea of the patient's situation.To calculate the sample size, parameters suggested by Beavers et al.  were appAll patients gave their informed consent to participate in the study, which was approved by the Teaching and Research Department of the Carlos Andrade Mar\u00edn Hospital and by the Bioethics Committee of the University of Navarra (Spain).The exclusion criteria involved the presence of any neurological disorder that caused disability: hemiplegia, blindness, deafness, or the presence of a serious acute illness.Patient Evaluations. All patients were evaluated during the \u201cON\u201d period.The following dimensions were included in the evaluation: (1) age dimension (AD) in years, (2) motor dimension (MD) evaluated with SPES-SCOPA , (3) depDemographic data of interest were collected. Besides the rating scales indicated, the stages of the disease were evaluated using the H&Y scale . The SchThe PDGI contains the 10 dimensions indicated above: (1) age dimension (AD), (2) motor dimension (MD), (3) depression dimension (DD), (4) anxiety dimension (AxD), (5) cognitive dimension (CD), (6) apathy dimension (ApD), (7) fatigue dimension (FD), (8) nonmotor dimension (NMD), (9) psychosis dimension (PsD), and (10) sleep dimension (SD).K\u2009=\u2009R/, where K is the number of intervals, R is the range, and log\u2009N is the natural logarithm (base 10) of N, which is the number of individuals. Then, we calculated W\u2009=\u2009K/R, where W is the width/width of each interval.Descriptive statistics of the central tendency and dispersion were gathered. Subsequently, all the chosen dimensions were transformed into interval variables, for which the formula proposed by Sturges  was usedOnce the dimensions were transformed into interval variables, OS was carried out. For this, the statistical package SPSS.v.17 was used.After retrieving the initial values of the intervals, OS was carried out, which assigns a value to each interval. We collected the minimum  and added to each of the previous values, and we were left with what we call the \u201ccorrected value of each interval.\u201dFrom each dimension, we took the \u201cmaximum corrected value of each interval\u201d and added them. In our case, there were 10 dimensions, the sum of which reached 36.44. Since we know that the maximum theoretical value is 100, we divided it by that sum (100/36.44)\u2009=\u20092.744, which is the \u201cindex factor.\u201dWe multiplied the \u201cindex factor\u201d by each of the \u201ccorrected values of each interval\u201d and thus found the new \u201ccorrected values multiplied by the factor.\u201d For confirmation, if we add up the \u201cmaximum corrected values multiplied by the factor,\u201d we will get 100 (model) .For example, for a patient who has an original score with the SPES-SCOPA in the interval of 24\u201330 points, the corrected value is 1.18. When multiplied by the factor of 2,744, the final value is 3.24 points, which is the number used in the PDSI .(i) Lost data must not exceed 5%; (ii) the difference between the average and median should not exceed 10% of the highest possible score; and (iii) the floor and ceiling effects must not exceed 15% . The ske\u0251) value, must be greater than 0.70 [\u0251\u2009=\u2009(SD\u2009\u2217\u2009\u221a1\u2009\u2212\u2009reliability coefficient) [(i) Internal consistency: the homogeneity index of the items must be \u22650.330; and (ii) the reliability index, Cronbach's alpha (C'ficient) , where Sficient) .(i) Convergent validity: for this, Spearman's correlation coefficient (rhoS) and the values suggested by Akoglu  were useThere were 120 patients with a mean age of 68.5 years, 9 years of illness, with 683.5\u2009\u00b1\u2009225.5\u2009mg of levodopa/day ; 60.8% of patients were males. The same number of patients were retired. Seventy-four (61.7%) were in stage III of the H&Y classification . The meaAll the details of the OS results are presented in Once the transformation of the scores of the variables studied was carried out using the OS, the PDSI analytical study was carried out.There were no missing data; all the information was analyzed. When analysing the items' metric characteristics, we found that PsD has a big floor effect (61.6%) and a kurtosis of 3.3 .\u0251 value of 0.71 was gathered, and all items were found to be pertinent to the scale. The item homogeneity index was 0.36 . Precision evaluated with the SEM ) was acceptable.An appropriate C'Convergent validity, assessed by Spearman's rho (rhoS) correlation between the PDSteI and the S&E, was moderately correlated (rhoS: \u22120.69), with PIMS (rhoS: 0.62) and CISI-PD total (rhoS: 0.58). .X2\u2009=\u200932.7, p \u2264 0.001) , assessed among the different stages of the H&Y scale by the Kruskal\u2013Wallis test, showed major significance (\u2264 0.001) .In the study, the population was characterized by having a wide representation in stages II and III  and 9.5 years of disease on average. This is a very common sample in outpatient studies .Regarding the acceptability of the PDGI items, we can point out that, in five items, the floor effect was observed: ApD (27.5), FD (21.6), NmD (21.6), PsD (61.6), and SD (15.8). Similar to what was found by Martinez\u2013Martin et al.  with theNone of the patients presented the ceiling effect. As for the asymmetry, only the PsD was outside the norm value (1.6), which evidences its high floor effect/consequent data of its high floor effect. Regarding kurtosis, the CD, AD, and NmD dimensions had minimum values outside the allowed range . The PsD presented a value of 3.3 .\u0251, if the item is deleted, then the item that contributes the most to the value of the alpha is the FD; without that item, the alpha fell to 0.61. The item that contributes the least is the CD; when it was removed, the alpha rose to 0.82. In these circumstances, the range between the alpha values was 0.2.The corrected item-total correlation ranged from 0.16 for the AD to 0.72 for the FD. Regarding the C'd \u22120.31, 0.2, and 0.2 values, with those same variables . The PsD showed similar behaviour, with ariables .Meanwhile, the MD reached moderate and strong correlation values: \u22120.76 against the S&E, 0.56 with PIMS, and 0.82 with CISI-PD total. The rest of the dimensions had moderate values. The total PDGI was correlated with moderate values: \u22120.69 with S&E, 0.62 with PIMS, and 0.58 with CISI-PD total. In the work of Martinez\u2013Martin et al., the PDCS reached values of 0.76 and 0.89, respectively, compared to PDQ-39, which measures the quality of life and before the CISI-PD total .Compared to other demographic variables such as years of disease and levodopa dose, the PDGI total had moderate correlation values . These correlations are like those gained with the PDCS [This PDGI is not considered as a tool for use in daily practice; its function is to be able to carry out a global and therefore extensive evaluation of the situation of a patient.Overall, our PDGI has adequate metric properties; acceptability, internal consistency, and convergent validity are adequate. This proposal is more in line with a holistic, inclusive evaluation, it does not assume a greater preponderance of motor symptoms, and it includes the different dimensions that affect people with PD. Likewise, it does not allow subjective appreciation to guide giving more or less weight to any of the dimensions, but rather, an objective mathematical algorithm assigns the scores.As noted at the beginning, this method allows each dimension to have a weight according to the amount of information it shares with the other variables and dimensions. This is the method's advantage over existing scales, which do not give values of different scales gathered under a certain category such as mild or severe. The PDGI groups the scores that share information about the subject. Therefore, each score offers part of the clinical situation of a patient, and this allows for a detailed summation of the patient's state."}
+{"text": "Although tea catechins in green tea and green tea beverages must be stable to deliver good sensory quality and healthy benefits, they are always unstable during processing and storage. Ascorbic acid (AA) is often used to protect catechins in green tea beverages, and AA is easily oxidized to form dehydroascorbic acid (DHAA). However, the function of DHAA on the stability of catechins is not clear. The objective of this study was to determine the effects of DHAA on the stability of catechins and clarify the mechanism of effects by conducting a series of experiments that incubate DHAA with epigallocatechin gallate (EGCG) or catechins. Results showed that DHAA had a dual function on EGCG stability, protecting its stability by inhibiting hydrolysis and promoting EGCG consumption by forming ascorbyl adducts. DHAA also reacted with (\u2212)-epicatechin (EC), (\u2212)-epicatechin gallate (ECG), and (\u2212)-epigallocatechin (EGC) to form ascorbyl adducts, which destabilized them. After 9 h of reaction with DHAA, the depletion rates of EGCG, ECG, EC, and EGC were 30.08%, 22.78%, 21.45%, and 13.55%, respectively. The ability of DHAA to promote catechins depletion went from high to low: EGCG, ECG, EGC, and EC. The results are important for the processing and storage of tea and tea beverages, as well as the general exploration of synergistic functions of AA and catechins. Tea catechins in green tea and green tea beverages make important contributions to flavor quality and health functions. Catechins belong to the group of flavanols and account for about 70% of the total amount of polyphenols ,2. ThereThe addition of ascorbic acid (AA) to green tea beverages is often used to protect catechins\u2019 stability. AA has both antioxidative properties and a broad range of bioactivities that protect against endogenous oxidative DNA damage ; reduce Some research found that AA significantly increased the stability of green tea catechins (GTC) . Su founA series of experiments using AA and DHAA with EGCG or catechins was conducted to both clarify the effect of DHAA on catechin stability and analyze the mechanism.After storing for 20 days, the substrates and products in the incubation system were analyzed using ultra-performance liquid chromatography coupled with a photo-diode array detector and QDA mass detector (UPLC-PDA-QDA); their representative chromatograms are shown in 2 value was 0.979, which indicated the validity of the assumption that EGCG degradation followed the first-order kinetics during storage.The EGCG degradation was assumed to follow first-order kinetics. The degradation kinetics of EGCG were expressed by first-order kinetics: To clarify the EGCG stability during storage, the changes of EGCG were divided into two parts: the reserve part and the degradation part. The degradation part of EGCG can also be summarized by three pathways, i.e., epimerization, hydrolysis, and oxidation. During our research, EGC, ECG, and GA were only produced by the hydrolysis of EGCG. Therefore, the percentage of hydrolysis was calculated by the concentration of EGC, ECG, and GA. The percentage of EGCG epimerization was calculated by the GCG concentration. Little dimers, TFs, and theasinensins (TSs) were detected in the experiments, but they were unstable and quickly disappeared. The color of the incubation system changed from colorless to brown. It meant that EGCG underwent oxidation during storage. In this research, the percentage of the oxidation pathway was counted by removing reserve, epimerization, and hydrolysis pathway percentage.The percentage of the different EGCG conversion pathways at 20 and 30 days were shown in EGCG incubation systems with different DHAA concentrations were stored at 25 \u00b0C to analyze the effect of DHAA on EGCG stability. p < 0.05). This implies that DHAA inhibited EGCG hydrolysis to protect its stability. The higher the DHAA concentration, the stronger the inhibitory effect of hydrolysis.The effect of different DHAA contents on the concentration of GA at 30 days is shown in p < 0.05). However, the maximum GCG content did not exceed 5 \u00b5mol/L, and the epimerization pathway had little effect on EGCG stability.The effect of different DHAA contents on the highest concentration of GCG during storage is shown in Hydrolysis and oxidation were the main degradation pathway when EGCG was stored at 25 \u00b0C. The inhibitory effect of 20 \u00b5g/mL and 200 \u00b5g/mL DHAA on the hydrolysis of EGCG was stronger than the effect of the promoting oxidation, resulting in the phenomenon that DHAA could protect EGCG stability. While the promoting effect of 2000 \u00b5g/mL DHAA on the oxidation of EGCG was stronger than the inhibitory effect on hydrolysis, 2000 \u00b5g/mL DHAA destabilized the EGCG stability. These results validated the previous hypothesis.A series of systems investigated the mechanism of forming DHAA\u2013EGCG, including AA and EGCG incubation, DHAA and EGCG incubation, and AA, DHAA, and EGCG incubation. The AA and DHAA concentration were 2000 \u00b5g/mL. The chemical pathway for the production of catechins ascorbyl conjugates was reported to successively undergo two-step nucleophilic additions at active sites . As showm/z of precursor and fragment ion of the substrates and products is shown in The formation of ascorbyl adducts of catechins  was evaluated in citrate phosphate buffer (pH 5.6) at 37 \u00b0C. New products were rapidly detected in all incubation systems, and the liquid chromatograph profile and mass spectrum of products are shown in m/z 631.2 [M \u2013 H], which was 174  higher than EGCG. The m/z of fragment ion was 513.1, 495.2, and 343.1. The mass spectral features of DHAA\u2013EGCG reported in our study were similar with previous research. Hung , which was 174 higher than ECG. The m/z of a fragment ion was 479.1 and 327.1. The m/z of a DHAA\u2013ECG fragment ion was 16 units less than DHAA\u2013EGCG. The molecular weight of EGCG was 16  mass units higher than ECG. Therefore, new products were identified as ascorbyl conjunctions of ECG, including 6C\u2013DHAA\u2013ECG and 8C\u2013DHAA\u2013ECG.As shown in m/z [M \u2212 H], which was 174 units higher than EC. The molecular weight of DHAA\u2013EC was 152 units less than DHAA\u2013ECG, which corresponded to the loss of the gallate group. The m/z of a fragment ion was 327.1 and 191.0. The DHAA\u2013EC fragment ion was 327.1 m/z and 152 units less than DHAA\u2013ECG (479.1), which corresponded to the loss of the gallate group. Therefore, the new products were identified as ascorbyl conjunctions of EC, including 6C-DHAA-EC and 8C-DHAA-EC.As shown in m/z 479.1 [M \u2212 H], which was 174 units higher than EGC. The m/z of a fragment ion was 451.2 and 343.1. Zhu [m/z, which was based on negative ESI-MS. Therefore, the new products were identified as EGC ascorbyl conjunctions, i.e., 6C\u2013DHAA\u2013EGC and 8C\u2013DHAA\u2013EGC.As shown in 3.1. Zhu  reportedThe consumption rate of four catechins is shown in The results showed that DHAA had dual effects on EGCG stability, protection, and destruction. DHAA can protect the EGCG stability by inhibiting the hydrolysis, while also promoting the consumption by forming DHAA\u2013EGCG adducts. When AA and DHAA coexist, AA could inhibit the formation of DHAA\u2013EGCG by inhibiting the first step. DHAA could trap EGCG, ECG, EC, and EGC to form ascorbyl adducts of catechins. Among the four catechins, the ability of DHAA to capture catechins was, from high to low: EGCG, ECG, EC, and EGC. DHAA could promote the degradation of catechins of tea, tea beverages, and tea foods by forming ascorbyl adducts. Zhu  conducteThe mechanism of DHAA inhibiting hydrolysis of EGCG was not clear. It may be related to the combination of DHAA and EGCG. The reaction of the carbonyl group at C-2 in DHAA to generate the key intermediate 6C- or 8C-adduct inhibited the loss of the gallate group.Liu  analyzedSu  found thIn recent years, the use of green tea extracts in foods such as bread, cereals, cakes, biscuits, dairy products, noodles, instant noodles, confectionery, and ice cream improved the marketing potential for these foods . These fResearch reported that AA can cause strand breakage in DNA in the presence of oxygen and AA can increase the OH radical in Fenton systems . Many ofIn conclusion, DHAA showed the properties of destabilizing catechins. Therefore, when AA was used to protect the stability of catechins in tea beverages and tea foods or synergize with catechins to improve health functions, the oxidation of AA and the properties of DHAA must be taken seriously.DHAA was purchased from Sigma  and AA was purchased from Aladdin . Purified EGCG powder (PEP) was purchased from Sigma, containing 98% EGCG. Purified EGC, ECG, and EC powders were purchased from Shanghai Yuanye biological technology company . UPLC grade of methanoic acid and acetonitrile were purchased from Merck . An ACQUITY UPLC BEH C18  column was used in chromatographic. Citric acid and disodium hydrogen phosphate were purchased from Sigma. Detail information of abbreviations and full name of regents is provided in Sharma  found thCitric acid\u2013phosphate buffer and EGCG solution was prepared as described above. In total, 3 mg, 30 mg, or 300 mg of DHAA was dissolved in 5 mL of a citric acid\u2013phosphate buffer. Then, DHAA solutions were mixed with the EGCG solution and citric acid\u2013phosphate buffer at the breaker. Four incubation systems were prepared; the total volume was 150 mL. The concentration of EGCG was 229 \u00b5g/mL, and the concentration of DHAA was 0 \u00b5g/mL, 20 \u00b5g/mL, 200 \u00b5g/mL, or 2000 \u00b5g/mL, respectively. The 150 mL mixed solution was divided into three parts and stored in a 50-mL centrifuge tube. The centrifuge tube was stored in incubator at 25 \u00b0C for 0, 5, 15, 20, 25, and 30 days, after which 2 mL of the mixture was taken and then filtered through a 0.22-\u00b5m filter for UPLC detection.The citric acid\u2013phosphate buffer and EGCG solution was prepared as described above. In total, 600 mg of AA and 600 mg of DHAA were respectively dissolved in 10 mL of a citric acid\u2013phosphate buffer. Four incubation systems were prepared; the total volume was 150 mL. The concentration of EGCG was 229 \u00b5g/mL. One of the reaction systems was used as the control without adding any AA or DHAA. Two of the reaction systems were respectively added with AA and DHAA, and the concentrations were all 2000 \u00b5g/mL. In the last incubation system, AA and DHAA were added simultaneously, and the concentrations were 2000 \u00b5g/mL. The 150 mL mixed solution was divided into three parts and stored in a 50-mL centrifuge tube. The centrifuge tube was stored in incubator at 25 \u00b0C for 0, 5, 15, 20, 25, and 30 days, after which 2 mL of the mixture was taken and then filtered through a 0.22-\u00b5m filter for UPLC detection.The citric acid\u2013phosphate buffer was prepared as described above. EGCG, EGC, ECG, and EC were dissolved in 10 mL of a citric acid\u2013phosphate buffer and stored at 4 \u00b0C in a refrigerator, determining the concentration by UPLC. In total, 1200 mg of DHAA was dissolved in 20 mL of a citric acid\u2013phosphate buffer, and 5 mL of DHAA solution was incubated with EGCG, EGC, ECG, or EC in buffer solution. Four incubation systems were prepared; the total volume was 150 mL. The concentration of DHAA was 2000 \u00b5g/mL. The concentrations of EGCG, EGG, ECG, and EC were 458 \u00b5g/mL, 442 \u00b5g/mL, 306 \u00b5g/mL, and 290 \u00b5g/mL, respectively. The concentrations of four catechins were all 1 mmol/L. The beaker was incubated at 37 \u00b0C in a water bath kettle for 60, 120, 180, 240, 300, 360, 420, 480, and 540 min. The beaker was covered with film, preventing water loss, after which 2 mL of the reaction mixture was taken and then filtered through a 0.22-\u00b5m filter for UPLC detection.The quantification of substrates and products was carried out using a UPLC , which was equipped with a PDA and a QDA detector. A waters BEH C18 column  and two mobile phases were used for chromatographic separations. Mobile phase A contained 0.1% formic acid in an aqueous solution, and phase B was pure acetonitrile. The cell temperature was maintained at 15 \u00b0C and the column temperature was maintained at 30 \u00b0C. The flow rate and injection volume were 350 \u03bcL/min and 2 \u03bcL/min, respectively. The gradient for solvent B was set as follows: 0\u20133 min, 60% B; 3\u20136 min, 90%\u201383% B; 6\u201312 min, 83%\u201373% B; 12\u201315 min, 73%\u201350% B; 15\u201315.5 min, 50% B; 15.5\u201316 min, 50%\u201390% B; 16\u201320 min, 90% B.m/z 50\u2013950. A capillary voltage of 0.8 KV, sampling cone voltage of 15 V, source temperature of 120 \u00b0C, and desolvation temperature of 600 \u00b0C were used.The monitoring UV wavelength was set at 280 nm, and the scan range for PDA was 200\u2013500 nm. Mass spectrometry detection was conducted on a QDA in negative ion mode using full-scan recording in a mass rang of Watanabe Y and Wang R ,27 foundThe rate constant of first-order kinetics was calculated to best fit the experiment results by the regression function of Origin 8.6. All kinetic reactions were performed in at least triplicate.p values less than 0.05 were set as the statistical significance level.Statistical analysis was conducted using SPSS 19 software. Statistical significance analysis of different groups was determined by one-way ANOVA with LSD test, while"}
+{"text": "Public speaking anxiety (PSA) is a common phobia in the student population. Traditionally, exposure therapy has been used as a treatment. However, the use of virtual reality (VR) is increasingly common to treat PSA. The purpose of this paper was to analyze the published scientific literature on VR as a treatment for PSA in students. The articles indexed in two databases (Web of Science and Scopus) were analyzed, with a time period from the beginning of the first publications until 2019 included. The systematic literature review was based on fixed inclusion and exclusion criteria. A total of 13 studies were identified which included 481 students. The results collected indicate that the duration of treatments to have positive effects was at least one week, where the number of sessions was between one and twelve. Furthermore, most VR treatments reported positive effects. Finally, this study showed evidence that VR treatment for PSA is effective while being less invasive than in vivo exposure. Social anxiety disorder (SAD) is one of the most common disorders affecting the population . This reIn recent years, cases of PSA have been common in the student population ,8. StudeCognitive therapy (CT) has traditionally been used to treat PSA ,13, as hExposure therapy combined with VR allows the user to face a digital version of the feared situation, rather than a real situation . It also(i)Analysis of VR exposure attrition rate and in vivo exposure therapy. The review collected 46 studies. The meta-analysis obtained concise data that both therapies show similar attrition rates .(ii)Applicability of VR to mental health disorders. Twenty-nine studies were identified that applied VR for anxiety disorders, depression, schizophrenia, psychosis, eating disorders, and obsessive-compulsive disorder .(iii)Effectiveness of VRET for social anxiety. The meta-analysis results of the six studies analyzed showed a significant overall effect size. Thus, VRET was effective in reducing social anxiety .(iv)Analysis of VR interventions for anxiety, depression, and treatment wasting outcomes. Meta-analysis results showed that VR interventions overcame control conditions for anxiety and depression, but did not improve desertion from treatment .(v)Applicability of VR to health problems. Fifty studies were analyzed where different VR uses were detected to treat problems related to fear of flying, PSA, arachnophobia, agoraphobia, body image disturbance, and obesity .(vi)Effectiveness of VRET for the treatment of anxiety disorders. The analysis found that VRET is effective for the treatment of anxiety, phobias, panic disorder, and post-traumatic stress disorder .(vii)Effectiveness of VRET for anxiety-related disorders. Forty-nine studies were included where the majority reported positive findings in favor of VRET .(viii)Comparison of the efficacy of VRET with classic treatments for anxiety. The 23 studies identified concluded in the meta-analysis that VRET is equally as effective as classical treatments, with no differences in dropout rate or stability of results over time .(ix)Reduction of anxiety of different types  through the VRET. Twenty-one studies were reviewed that found that anxiety symptoms were diminished with VR treatment .(x)Measurement of the size of the effect of VR for the treatment of anxiety disorders. The meta-analysis collected a large average effect size for VRET compared with in vivo exposure and control conditions .The inclusion of VR as a treatment for anxiety has been addressed in a number of previous systematic reviews and/or meta-analysis studies. All of them have different approaches and objectives: In short, previous revisions have analyzed studies that collect a general population, not based on a specific population such as students. In addition, PSA has not been addressed as a main topic. Therefore, prior to this study there is no systematic review or meta-analysis on the efficacy of VRET for the treatment of PSA in students. This led to the establishment of the following objective: (i) to analyze the published scientific literature on VR as a treatment for PSA in students.RQ1. How many studies were published over the years?RQ2. Who are the most active authors in the area?RQ3. In which sources appear this kind of study?RQ4. What is the educational stage and the country of the students?RQ5. How long was the treatment and what sequence was used?The research questions were as follows:This study used a systematic review methodology ,43. ThisThe analysis variables collected were typical of a systematic review . They anThe search was established from the application of different descriptors in the Web of Science (WoS) and SCOPUS databases. These two databases have internationally recognized impact indices: Journal Citation Reports (JCR) in WoS and Scimago Journal & Country Rank (SJR) in SCOPUS .The descriptors were applied in the search engine of both databases to proceed to further refining through the inclusion and exclusion criteria . The seaTo avoid bias in study selection, the systematic review was undertaken by three investigators (PhD in Education Sciences). All applied the same descriptors and inclusion/exclusion criteria. Although there was some discrepancy in the first round of search, in the second round the degree of agreement was 100%. The disagreement was between two investigators and was resolved by the third.n = 13) [The literature screening process followed the four phases of the PRISMA protocol  Figure . The iden = 13) ,58,59,60The analysis strategy used for the systematic review was comprehensive reading . Based oThe scientific literature on VR as a treatment for PSA in students began in 1997 , althougAs to the authorship of the articles, most were signed by several authors. However, most of the authors have only signed one article on this topic. Only three authors submit two articles and only one author appears in three articles .Networking presents two papers (15.38%). The rest only included an article on the topic. In addition, the greatest impact, based on the h-index, was presented by Cyberpsychology, Behavior, and Social Networking (h-index = 50).On the other hand, a total of 10 journals published articles on VR as a treatment for PSA in students . Annual M = 22.67; SD = 4.82). The countries of origin were USA (23.07%), Germany (23.07%), Netherlands (15.38%), Turkey (7.69%), UK (7.69%), Norway (7.69%), Sweden (7.69%), and Georgia (7.69%) . Only two papers focused on the High School stage . The ave (7.69%) .M = 20.25 days). The number of treatment sessions was a minimum of one and a maximum of 12, with the shortest lasting five minutes and the longest 90 minutes . In terms of group allocation, the majority were participant matching (53.84%). This type of study did not make a division between groups with VRET and control, and the treatment was applied to the whole group. The rest did divide into two distinct groups, with a quasi-random (23.07%) and random (23.07%) assignment. The content of the interventions was based on the exposure of real situations of public speech. The recreated spaces were a virtual classroom (46.15%), auditorium (38.46%), everyday situations (7.69%), meeting room (7.69%), wedding reception (7.69%), and party and presentation environment (7.69%). Regarding the effect of the interventions, most of them showed a positive effect of the VRET (76.92%), only three studies showed a zero effect (23.07%).With regard to treatment characteristics , in all The analysis of the scientific literature showed the application of the VR technique as a PSA treatment in 481 students. The effect of the studies reviewed checked the possible efficacy of VRET for the treatment of PSA. The applicability of VR as a treatment for PSA began in 2002. Since that year, there has been an inconsistency in the publications. However, in 2017, research increased, although in 2018 it decreased again. Therefore, VRET used for the treatment of PSA in students requires more empirical research, since the literature found is limited and inconsistent.In relation to authorship, the publications include a diversity of authors, where the manuscripts present a multiple authorship. This is a common feature in the health branch. The exception is found in a single article that is signed by a single author . In addition, this same author is shown as the author with the highest number of publications on the subject. In turn, the journal with the largest number of publications is the Annual Review of Cybertherapy and Telemedicine, which indicates some interest in the subject matter on the part of this journal.On the other hand, the most studied population is university students, over other educational stages. This reflects the fact that the university environment is a focus of interest for PSA research . WithoutAs for the application of VR, only VRET was applied ,18. It wThe duration of the treatments to have positive effects was at least one day, with four sessions or a single session with an extended duration. It was more common to apply four sessions with an average duration of 19 minutes.Based on the allocation of treatment to the sample, most did not allocate treatment randomly. In this regard, the only studies that could be generalized are those by Denizci et al. (2018) , Harris Among the virtual environments generated with VR, most researches recreated a virtual classroom and an auditorium with a fictitious audience ,21. In aWith regard to the limitations, the search for scientific documents in two databases (WoS and SCOPUS) is highlighted as a limitation of the study. In spite of this, the use of these databases is relevant, since the literature with the greatest scientific impact, indexed in the JCR and SJR indexes, has been analyzed. Another limitation was the possible bias of the researchers. To avoid this, a double-round system was used in which three independent researchers participated.VRET is emerging as a method that may be effective for the treatment of PSA in students. The creation of virtual environments allows to put the student in a fictitious situation where he can have control over the environment and be able to develop without fear. This makes it easier for him to speak in public without increasing anxiety levels. In this paper, we analyzed the published scientific literature on VR as a treatment for PSA in students. It is therefore a method that a priori obtains favorable results in the same way as traditional exhibition methods. Added to this is the advantage of being able to generate a controlled environment, where the student feels comfortable and safe.The results of this study may contribute to the selection of patterns for applying PSA treatments, as they show key aspects such as the duration of the treatments, number of sessions and minutes, type of assignment, and content of the virtual reality exposures. Thus, it is recommended that empirical research on VR for the treatment of PSA in students continues in order to have more examples and to put an end to the instability of the literature on this topic. On the other hand, in the literature consulted, there are different software programs used in VR as PSA treatment. It is interesting to point them out as part of future recommendations: RTT DeltaGen 12.2; VREAM\u2122 Virtual Reality Development Software Package and Libraries (VRCreator\u2122); CryEngine3 (Version PC v3.4.0 3696 freeSDK); Discreet 3D Studio Max 4; and Virtools.Finally, the clinical use of VR may be beneficial for students, to which is added the educational use and the possibilities that this technology can allow in order to teach professional skills. The use of VR in students should continue to be applied not only for the PSA treatment, but to develop skills that will enable them for the labor market in the 21st century."}
+{"text": "The induction of senescence/polyploidization and their role in cancer recurrence is still a poorly explored issue. We showed that MDA-MB-231 and MCF-7 breast cancer cells underwent reversible senescence/polyploidization upon pulse treatment with doxorubicin (dox). Subsequently, senescent/polyploid cells produced progeny (escapers) that possessed the same amount of DNA as parental cells. In a dox-induced senescence/polyploidization state, the accumulation of autophagy protein markers, such as LC3B II and p62/SQSTM1, was observed. However, the senescent cells were characterized by a very low rate of new autophagosome formation and degradation, estimated by autophagic index. In contrast to senescent cells, escapers had a substantially increased autophagic index and transcription factor EB activation, but a decreased level of an autophagy inhibitor, Rubicon, and autophagic vesicles with non-degraded cargo. These results strongly suggested that autophagy in escapers was improved, especially in MDA-MB-231 cells. The escapers of both cell lines were also susceptible to dox-induced senescence. However, MDA-MB-231 cells which escaped from senescence were characterized by a lower number of \u03b3H2AX foci and a different pattern of interleukin synthesis than senescent cells. Thus, our studies showed that breast cancer cells can undergo senescence uncoupled from autophagy status, but autophagic flux resumption may be indispensable in cancer cell escape from senescence/polyploidy. Despite the spectacular progress in cancer treatment made during recent years, some types of aggressive cancer are still able to spread easily and become resistant to anticancer treatment. One of the reasons for this could be the phenomenon of therapy-induced senescence (TIS).TIS, which halts cancer cell proliferation instead of inducing cell death, became a desirable outcome of cancer treatment ,2. HowevSenescent cancer cells, beside division arrest and secretory activity, known as the senescence-associated secretory phenotype (SASP), are, similarly to senescent normal cells, characterized by many other features, such as the increased activity of senescence-associated \u03b2-galactosidase , lipofuscin and lipid droplet accumulation, altered morphology (flattening and increased granularity), an increased level of cyclin-dependent kinase inhibitors, such as p16INK4A and p21WAF1/CIP1 , increasAutophagy is a catabolic process in which macromolecules and organelles are degraded and recycled, thus providing metabolites to maintain the energy supply in the cell. A characteristic feature of macroautophagy (herein referred to as autophagy) is the formation of vesicles, called autophagosomes, that enclose the degradation-bound cargo and, subsequently, fuse with lysosomes, giving rise to autolysosomes, wherein the cargo is degraded and recycled. The formation of the autophagosome includes phagophore nucleation, elongation and vesicle completion, which are tightly regulated by various autophagy-related proteins, e.g., the ULK1/2 complex, the class III PtdIns3K complex and LC3-II . AutophaAlthough the modulation of autophagy is a very important part of cancer therapy , no therAccordingly, in this study, we aimed to answer the question about autophagy modulation in breast cancer cells induced to senescence following doxorubicin treatment. We chose MDA-MB-231 and MCF-7 cells. MDA-MB-231 cells are triple negative breast cancer and have a mutated form of p53 ,26, wherFor the induction of cellular senescence in MDA-MB-231 breast cancer cells, we used the same protocol as described previously for colon cancer  and in aWe also observed transiently higher levels of p-p53 and p21 b in dox-We analyzed DNA content in dox-treated MDA-MB-231 cells using stoichiometric toluidine blue staining and image cytometry analysis, showing cell polyploidization after dox-treatment . Here, wIn our previous studies, by using an immunostaining method, we showed that giant cells, which originate due to the mitotic slippage, eventually acquired an amoeboid phenotype and bud the depolyploidized progeny, restarting the mitotic cycling . Here, wWe extended our studies by using live cell imaging, employing two different methods\u2014holographic microscopy  and scanning disc confocal microscopy . Independently of the technique used, we observed the asymmetric divisions of some giant polyploid cells, after which both maternal and descendant cells survived and thrived over the duration of the movies (3\u20135 days) . For comDescendant cells that appeared after the asymmetric divisions of polyploid/senescent cells were similar to parental cells in size, however, they had increased cellular granularity  that migNevertheless, the appearance of descendants in senescent MDA-MB-231 and MCF-7 cells was accompanied by a decrease in autophagy markers and a significant increase in autophagy activity, measured by autophagic index a\u2013d. InteTogether, our results show that autophagic flux in control  MDA-MB-231 cells, although very low, it is sufficient for cell survival and division. Dox-induced senescence is associated with the modulation of autophagy-regulated pathways, such as mTOR and AMPK, however, without visible enhancement in autophagic flux. This may be associated with the impairment of degradation function and abortive autophagy induction in senescent cells. In contrast to this, the appearance of senescence escapers is accompanied by the decrease in autophagic markers and autophagic flux resumption.The cargo overload of vesicles of lysosomal origin may cause their destabilization and impairment of degradation function. Thus, the increased level of LAMP-2 observed in senescent cells could be the result of either lysosome and autolysosome accumulation or the enhancement of lysosome biogenesis. To reveal this, the intracellular localization of transcription factor EB (TFEB), a crucial regulator of autophagy and lysosomal biogenesis, was analyzed. TFEB translocation into the nucleus results in the upregulation of lysosomal biogenesis, whereas TFEB phosphorylation (Ser142), catalyzed by mTORC1, prevents this translocation and leads to TFEB degradation in the cytoplasm ,40. As sWe cultured escapers for one month beyond day D1+19 or D1+13  and characterized them in terms of DNA content, senescence susceptibility and autophagic flux. As we mentioned before, MDA-MB-231 cells which escaped from senescence were slightly enlarged and their granularity was increased in comparison to parental cells . HoweverConsidering that the comparison of MDA-MB-231 parental cells and escapers revealed significant differences in the autophagic index, we were interested in whether enhanced autophagy in escapers may influence their ability to senesce. We used the same experimental schedule to induce senescence by dox in escapers and analyzed them on day D1+4 and D1+9. We found that up to 78% of escapers  were SA-\u03b2-gal positive and less than 20% of cells incorporated BrdU d,e. TheyIn the case of MCF-7 cells, the escapers were characterized by significantly higher population doubling than in parental cells . The autTogether, our result showed that escapers are different from parental cells not only in terms of autophagy but also size, cellular morphology and secretion. However, we showed that both MDA-MB-231 and MCF-7 escapers were susceptible to dox-induced cell senescence, uncoupled from the autophagy status of these cells.The induction of polyploid giant cells by anticancer therapy and their role in cancer resistance and metastasis has been well described, however, the issue of polyploid cell senescence has still not been extensively explored by researchers ,42,43,44DNA damage, especially DSBs and the subsequent DDR, are almost universal features of radio- and chemotherapy treatment  and cellDox-treated MDA-MB-231 cells had a very high number of \u03b3H2AX foci, sensing DSBs, and a relatively low number of 53BP1 foci. Both proteins, involved in the DDR, are markers of senescence and take part in homologous recombination (HR), an error-free process dependent on properly functioning autophagy . A higheThe crucial question concerns the molecular and cellular mechanisms of polyploidization/depolyploidization of breast cancer cells and the phenotype of the escapers. It seems that the paper already published in a Special Issue finally confirmed the role of mitotic slippage in reversible polyploidization in cancer cells induced to senescence. Moreover, the results of that study refreshed the old idea about the role of recapitulation in the amoeba-like agamic lifecycle, decreasing the mutagenic load and enabling the recovery of recombined, reduced progeny for a return to the mitotic cycle . Using aThe interesting question emerges whether reversible senescence leads to the production of progeny with a different phenotype than parental cells. To date, published data have mainly focused on the differences in stemness and aggressiveness between mother cells and their progeny ,58,59,60The main question we posed in these studies concerned the role of autophagy in breast cancer cells undergoing reversible senescence/polyploidization. In particular, there is a plethora of evidence showing that the majority of conventional therapies used to combat breast cancer induce autophagy . As mentIndeed, we have found that general autophagy, estimated by the autophagic index, was impaired during the senescence/polyploidy of breast cancer cells. On the other hand, the transient increase of phosphorylated AMPK and the decrease in phosphorylated mTOR observed in MDA-MB-231 cells suggested autophagy induction, but it was not accompanied by a decrease in mTOR-dependent ULK1/2 phosphorylation (involved in autophagy induction ). AltogeThe relationship between autophagy and cell senescence seems to be complicated, especially in senescent cancer cells as, generally, cancer cells have different basal levels of autophagy, including high and insufficient autophagy . Indeed,Moreover, we showed that MDA-MB-231 and MCF-7 parental cells, as well as escapers, underwent drug-induced senescence, although with different efficiencies. That allowed us to conclude that autophagy is not indispensable for senescence induction in MDA-MB-231 cells (with mutated p53 and a very low autophagic flux) and MCF-7 cells (with wild-type p53 and a high autophagic flux). Importantly, our results allowed us to conclude that unlocked autophagy was necessary to release descendants. Furthermore, we proved that the escapers were different from parental cells in terms of autophagy functionality, which is an obvious novelty of our studies. It is worth mentioning that the first study that pinpointed the involvement of autophagy in depolyploidization was published by Erenpreisa\u2019s group . The autIn short, our studies suggest that breast cancer cells can undergo drug-induced senescence, independently from the autophagy status. Furthermore, senescence is intertwined with insufficient autophagy. In turn, transient senescence ensured favorable conditions for the appearance of polyploid cells. However, the appearance of vital progeny is interconnected with functional autophagy. The mechanism of that phenomenon still needs to be unraveled. Although escapers had a similar DNA index to parental cells, they were characterized by a different phenotype. We are the first group to report that reversible polyploidization, intertwined with senescence escape, stably activates autophagic flux due to TFEB translocation to the nucleus and the reduction of the autophagy inhibitor, Rubicon.Primary antibodies are listed in 2) in DMEM low-glucose  or DMEM high-glucose  medium supplemented with 10% fetal bovine serum (FBS) , antibiotic\u2013antimycotic solution  and, in the case of, DMEM low-glucose medium, 2 mM l-Glutamine solution  was added. The cells were seeded 24 h before treatment at a density of 1 \u00d7 104 cells/cm2. To induce senescence, cells were treated with 100 nM dox  for 24 h and then cultured in fresh medium without the drug for several days (1 + n). Every third day, the medium was replaced by a fresh one. The escaper cell line was established after a monthly culture of small cells collected on D1+19 for MDA-MB-231 cells and on D1+13 for MCF-7 cells in four independent experiments.MDA-MB-231 (HTB-26) cells, obtained from the European Collection of Authentic Cell Cultures , were kindly provided by Prof. Jekaterina Erenpreisa . MCF-7 cells (HTB-22) were purchased from the American Type Culture Collection (ATCC). Cells were grown under standard conditions  staining was performed as described by Evangelou et al. .Cells grown on coverslips were fixed in 4% paraformaldehyde (PFA)  for 15 min at room temperature. Then, cells were washed with ddH2O, dehydrated (5 min incubation in 60% isopropanol) and stained with 0.3% Oil Red O  in 60% isopropanol for 7 min. The Oil Red O solution was discarded, stained cells were washed with ddH2O and covered with mounting medium.To assess the secretion of IL-8, IL-6 and VEGF proteins, the culture medium was collected and subjected to analysis by the DuoSet ELISA Development Kit, according to the manufacturer\u2019s instructions . Absorbance was measured using a Tecan Sunrise microplate reader .For DNA content analysis, stoichiometric DNA staining with toluidine blue  was performed as described previously . As a reDNA synthesis assay was performed as described previously .Cell size and cell granularity were determined with the use of flow cytometry as described previously . DNA indCells growing on a 35-mm glass bottom dish  were fixed with 2% paraformaldehyde  and 1% glutaraldehyde  in 0.2 M HEPES pH 7.3 and prepared for electron microscopy according to a published protocol, with minor changes . BrieflyTo determine the cell number parameters, cells were counted with a Neubauer camera by trypan blue dye exclusion. The quantification of PD as a measure of cell growth for each cell line was carried out on the basis of the total number of viable cells.The double staining method with Hoechst 33342/PI  was usedTo quantify autophagic flux in the subsequent days following treatment, we calculated the autophagic index (AI). This was achieved by establishing the difference between the ratio of the LC3B II/LC3B I protein level (\u0394LC3B) of cells treated with 200 nM bafilomycin A  or 50 \u03bcM chloroquine  for the last 3 h of culture and untreated ones and normalizing it to the \u0394LC3B of untreated ones according to the following equations: for bafilomycin A, AIBAF = (\u0394LC3BBAF \u2212 \u0394LC3BNT)/\u0394LC3BNT and for chloroquine, AICQ = (\u0394LC3BCQ \u2212 \u0394LC3BNT)/\u0394LC3BNT.To pinpoint the origin of escaper cells, live imaging techniques for the division of giant polyploidy MDA-MB-231 cells were employed. Two independent techniques were used: a holographic microscope, HoloMonitor4  and a spinning disc confocal microscope Zeiss Axio Observer Z.1 Inverted Microscope  with Yokogawa CSU-X1 Spinning Disc , with objective: C APO 40x/1.20 Water. Film acquisition took 3\u20135 days, time between each frame: 15\u201330 min.Immunofluorescence (IF) specimens were visualized either with a Nikon Eclipse Ti , a fluorescent microscope with a 40\u00d7/0.6 Nikon lens, or a confocal laser scanning microscope, Leica TCS SP8 , usingHC PL APO CS2 63x/1.40 Oil immersion lens. Electron microscope (EM) specimens were imaged with a transmission electron microscope, JEM 1400 , equipped with a 11 megapixel TEM camera MORADA G2 . Digital images of nuclei stained with toluidine blue were collected using a Sony DXC 390P color video camera.Computational analyses of cell, foci number and fluorescence intensity were performed using ImageJ (FiJi) software. The ratio of the intensity of TFEB fluorescence in the nucleus versus the cytoplasm was measured as corrected total cell fluorescence (CTCF), according to the equation: CTCF = integrated density of selected area (nucleus/cytoplasm) \u2212 (selected area (nucleus/cytoplasm)) \u00d7 mean fluorescence of background readings).DNA content was measured as the integral optical density (IOD), using Image-Pro Plus 4.1 software . More than 50 cells were counted per sample in each analysis.p-value is stated as: $ p < 0.051, * 0.01 < p < 0.05, ** 0.001 < p < 0.01, *** p < 0.001.Sample size was chosen according to previous observations, in which similar experiments were performed in order to see significant results, in this case with heterogeneous biological replicates. Therefore, all presented data concerning parental and escapers cells are shown as an average of at least three or four independent experiments. All biological replicates without exclusion were used to perform statistical analysis. In the case of bar graphs, the error bars represent the SEM, whereas in ANOVA graphs, the vertical bars indicate a 0.95 confidence interval. Statistical analysis was performed with the use of the STATISTICA 11 program  or GraphPad Prism 8 . ANOVA , analysis was used for the analysis of differences among three or more groups, followed by post hoc analysis . Multiple comparisons were done after a homogeneity test for variance. Variance was similar between the groups that were being statistically compared. Normal distribution of the data was tested with a Shapiro\u2013Wilk test. Statistical significance in relation to the control is marked with an asterisk (* or $), whereas that between subsequent days of treatment is shown with a hash (#). The"}
+{"text": "Overexpression of these two miRNAs was observed, especially in subgroups of severe and late-onset PE compared to healthy pregnancies. Although we hypothesised that the expression level of studied miRNAs could vary between PE subtypes , no obvious differences were detected. In conclusion, our study could contribute to the large-scale studies for the identification of non-invasive biomarkers for PE detection to improve outcomes for women and their new-borns.MicroRNAs (miRNAs) are one of the important regulators of cellular functions fundamental for healthy pregnancy processes, including angiogenesis and differentiation of trophoblast cells, and their deregulation could be implicated in the pathogenesis of pregnancy complications, including preeclampsia (PE). The aim of this study was to assess the association of miRNA expression in plasma samples with PE, its onset, and severity. Our study enrolled 59 pregnant women, 27 in the preeclamptic study group and 32 in the control group with physiological pregnancy. Preeclamptic pregnancies were divided into subgroups based on the severity and onset of disease. Relative expression of miR-21-5p, miR-155-5p, miR-210-5p, miR-16-5p, and miR-650 isolated from plasma samples was analysed by quantitative real-time PCR and normalised to experimentally established reference genes. Our results revealed upregulation of miR-21-5p (1.16-fold change,  Preeclampsia (PE) is one of the most severe pregnancy complications that poses a risk to both mother and baby. This multisystem disorder affects approximately 5\u20138% of pregnancies, usually after the 20th gestational week, and is a leading cause of maternal and foetal mortality and morbidity . PE is cMicroRNAs (miRNAs) are single-stranded, 20\u201324 nt long, non-coding RNAs representing the epigenetic mechanism of posttranscriptional gene expression regulation. It is known that miRNAs act as regulators in various physiological processes, and their deregulation is one of the pathomechanisms of many diseases, including PE . During The aim of our study was a comparison of expression profiles of selected miRNAs with a supposed role in PE pathogenesis between PE patients and physiological pregnancies. We also focused on the possible discrimination between mild and severe PE based on the expression of these miRNAs. Because there are differences in the pathogenesis of early and late-onset PE, we hypothesised that there could be differences in the expression pattern of selected miRNAs between these subtypes.For this pilot study, we selected five miRNAs based on the literature review, namely, miR-210-5p, miR-155-5p, which are extensively studied in the context of PE; miR-21-5p and miR-16-5p with known expression in placenta, and also the little-studied miR-650. Based on current knowledge, these miRNAs are implicated in the regulation of cell processes important for proper placentation. Although these miRNAs were studied previously, study design and methodology were different among studies. In our pilot study, we decided to compare expression levels of selected miRNAs in maternal plasma collected just before delivery, similar to studies of placental tissue obtained after delivery. We believe that this study could be the basis for prospective studies monitoring differently expressed miRNAs during pregnancy, even before clinical manifestation of PE in suspected pregnancies that could be stratified based on other biochemical biomarkers.n = 27) and normal pregnancy (n = 32), was collected from 1st January 2016 at the Department of Obstetrics and Gynaecology, Jessenius Faculty of Medicine and University Hospital Martin . The inclusion criteria for women with diagnosed PE was based on concomitant symptoms, such as high blood pressure as two or more entries of diastolic blood pressure of \u226590 mmHg taken \u2265four hours apart and proteinuria as the secretion of \u2265300 mg of protein over 24 h [The plasma of patients with PE  at the Jessenius Faculty of Medicine, Comenius University in Bratislava, Martin, Slovakia.A total of 10 mL of venous blood was taken from patients on admission to the hospital before delivery and processed within two hours after sampling. The blood was centrifuged in two steps to separate plasma at 3000 rpm for 10 min and pellet the cell debris at 14,000 rpm for 10 min. Plasma samples were stored at \u221280 \u00b0C prior to analysis. The presence of haemolysis in plasma samples was detected by measurement of oxyhaemoglobin absorbance at 414 nm. Only samples without apparent haemolysis were included in the study.Total RNA with miRNA fraction was extracted from 200 \u03bcL of plasma by miRNeasy Serum/Plasma Advanced kit , according to manufacturer instructions. To control the isolation process, the mixture of synthetic spike-ins  was added to the lysis buffer. RNA was dissolved in 20 \u03bcL of elution buffer and stored at \u221280 \u00b0C until the next step. One microliter of total RNA was reversely transcribed  into complementary DNA (cDNA) and stored at \u221220 \u00b0C.One microliter of cDNA was diluted in 1:30 ratio, and three microliters of dilution were added into each real-time PCR reaction using miRCURY LNA miRNA PCR system  with miRCURY LNA miRNA assays  specific for reference  and target  miRNAs. Details of the miRNAs selected for this study are stated in https://geneglobe.qiagen.com/us/ (accessed on 24 June 2020). The tool enables quality control of samples on the basis of spike-ins added during RNA extraction and reverse transcription, in addition to normalisation of data with a calculation of stability factor for reference miRNAs, according to the geNorm algorithm [The raw analysis of Cp values was performed by the GeneGlobe data analysis tool, which is available at lgorithm . Samplesp value < 0.05 were considered statistically significant. The predictive ability of miRNA expression was assessed by the random forest (RF) machine learning algorithm. RF was trained on the data, and the nested cross-validation algorithm with the minimum graph depth criterion was used to select important features (miRNAs). The receiver operating characteristic (ROC) curve generated by the RF with selected miRNAs was used to quantify their predictive ability. The ROC curve was constructed from the out-of-bag data. The data analyses were performed in R [Expression and fold change (FC) were computed using the standard formula . The datmed in R  v. 3.5.2med in R , robustbmed in R , randomFmed in R , ggRandomed in R .n = 7), and late-onset PE, which occurs after the 34th gestational week (n = 17). The characteristics of these subgroups are summarised in Our study enrolled 59 pregnant women aged 21\u201350 years old, of whom 27 were diagnosed with PE, and 32 women with physiological pregnancies were included in the control group. All pregnancies were singleton. Characteristics and basic clinical data of both groups are summarised in Based on quality control of isolation and reverse transcription procedure through synthetic spike-ins, three samples from the control group were excluded from further miRNA expression analysis.Considering there are no miRNAs commonly used as endogenous reference genes, four candidate reference miRNAs were tested, namely miR-103a-3p, miR-188-5p, miR-191-5p, and miR-222-3p, for their stable expression across all our samples. The stability of expression was evaluated by using the geNorm algorithm. Our data were normalised to miR-103a-3p and miR-222-3p, which were identified as the most stably expressed genes across our samples in the control and study groups. The stability factor for miR-103-3p was 0.153, and for miR-222-3p, 0.094, which indicated low variability and high stability in expression between samples. The difference in average arithmetic mean for these two reference miRNAs was 0.12 cycles between cases and controls.p < 0.05) in PE patients relative to controls  in plasma samples was analysed by qRT-PCR in 27 PE patients and 29 women with physiological pregnancies. Using this method, we detected a very poor expression of miR-650 in plasma samples, and therefore, we excluded this miRNA from further analysis. The relative expression of the remaining four miRNAs was computed by the delta\u2013delta Ct method. Out of four studied miRNAs, miR-21-5p (1.16-fold change) and miR-155-5p (1.62-fold change) were upregulated with statistical significance     and late= 0.011)  compared= 0.011)  with resPreeclampsia is classified as a complex, multisystemic, and multifactorial disease. Understanding its pathomechanisms is complicated, and the results of various studies are like pieces of the puzzle in this process. From a molecular point of view, deregulation of critical cellular processes, such as cell proliferation, migration, invasion, and apoptosis, is associated with improper placental development and function during pregnancy that leads to gestational complications. One of the molecular regulators of these processes is miRNAs expressed in the placenta. Their expression level is modulated by other factors, such as hypoxia, signalling pathways, or epigenetic modifications ,26,27. ABased on the role of miRNAs in the pathogenesis of PE, miR-210 and miR-155 are the most extensively studied miRNAs in the context of PE biomarkers. Elevated levels of miR-210 have been detected in the placenta, and plasma of PE pregnancies in general ,33,34,35In preeclamptic conditions, the expression of miR-155 is induced by inflammatory factors , and itsMiR-21 is an apoptosis-associated miRNA, and its expression was observed in the placenta, trophoblast, and even in maternal plasma ,45,46. TIt has been shown that cell processes as proliferation ,52, cellThe function of miR-650 is not completely known. In previous studies, miR-650 was associated mainly with tumorigenesis ,61,62. TIn our study, miRNA expression was analysed by qRT-PCR, the most frequently used quantification method. Comparing the data obtained by this method between studies often leads to inconsistent results. This discrepancy could arise from the different sample sizes, study design, sample processing, procedures used, and the selection of reference genes used for normalisation that is critical for further data analysis . There iThe results of our pilot study reflect the association of circulating miRNAs with PE and its subtypes after PE onset, in time before delivery. This study design is similar to studies of miRNA expression in the placenta which are obtained after delivery. By this strategy, we are not able to distinguish whether aberrant miRNA expression detected in the plasma of PE pregnancies contributes to PE development or it is a consequence of pathological processes and endothelial damage. However, observed differences can indicate the potential of miR-155-5p and miR-21-5p in the detection of PE, especially severe and late-onset form. To confirm this assumption, it is necessary to study their expression profiles in different stages of PE pregnancy in comparison with gestational week-matched healthy pregnancies. When considering these miRNAs as early biomarkers, it would be appropriate to focus future studies on the detection of their expression level in the preclinical stages of PE. Unfortunately, this is very complicated as PE is diagnosed after clinical manifestation based on gold standard clinical, ultrasound, and laboratory criteria. Diagnostics of PE can be improved also by biochemical biomarkers detectable in serum.Based on three large-scale prospective studies, screening of maternal factors, uterine artery pulsatility index (UtA-PI), mean arterial pressure (MAP) and placental growth factor (PlGF) at 11\u201313 gestational week is the best screening approach for prediction of PE, especially early PE, in the first trimester so far ,70,71. DIn conclusion, our study of miRNA expression profiles in PE and its subtypes revealed the slight upregulation of circulating miR-155-5p and miR-21-5p. Our predictive model involving miR-155-5p, miR-21-5p, and miR-16-5p as predictors of PE showed poor discrimination power. The mild differences could be due to relatively small study groups. Therefore, more studies with a greater sample size will be necessary to assess the diagnostic potential of these miRNAs. Although we hypothesised that the expression level of studied miRNAs could vary between PE subtypes , no statistically significant results were observed. Mild overexpression of miR-155-5p and miR-21-5p was observed in the case of a severe form of PE and PE with late-onset. Moreover, mild downregulation of miR-16-5p was associated with early onset PE. We did not detect the expression of miR-650 in plasma samples.In our future study of the association between miRNA expression and PE, we plan to implement an NGS (next generation sequencing) methodology that provides a sensitive and complex approach for absolute miRNA quantification, and detection of novel miRNAs. We hope that our current study and our future studies will provide pieces of the puzzle in search of reliable biomarkers for PE detection to improve outcomes for women and their new-borns."}
+{"text": "Staphylococcus aureus (MRSA) colonization leads to increased infection rates and mortality. Decolonization treatment has been proven to prevent infection and reduce transmission. As the optimal antimicrobial strategy is yet to be established, different regimens are currently prescribed to patients. This study aimed to evaluate the efficacy of the decolonization treatments recommended by the Dutch guideline. A retrospective multicenter cohort study was conducted in five Dutch hospitals. All patients who visited the outpatient clinic because of complicated MRSA carriage between 2014 and 2018 were included. We obtained data on patient characteristics, clinical and microbiological variables relevant for MRSA decolonization, environmental factors, decolonization regimen, and treatment outcome. The primary outcome was defined as three negative MRSA cultures after treatment completion. Outcomes were stratified for the first-line treatment strategies. A total of 131/224 patients were treated with systemic antibiotic agents. Treatment was successful in 111/131 (85%) patients. The success rate was highest in patients treated with doxycycline-rifampin , but the difference from any of the other regimens did not reach statistical significance. There was no difference in the success rate of a 7-day treatment compared to that with 10 to 14\u2009days of treatment . Side effects were reported in 27/131 (21%) patients and consisted mainly of mild gastrointestinal complaints. In a multivariable analysis, an immunocompromised status was an independent risk factor for failure at the first treatment attempt . The antimicrobial combinations recommended to treat complicated MRSA carriage yielded high success rates. Prolonged treatment did not affect treatment outcome. A randomized trial is needed to resolve whether the most successful regimen in this study (doxycycline plus rifampin) is superior to other combinations.Methicillin-resistant  Staphylococcus aureus (MRSA) is a challenging global health problem. Colonization with MRSA leads to increased infection risks, which range from mild skin infections to severe clinical syndromes, i.e., pneumonia and bloodstream infection  lived alone, 103 (79%) lived with one or more household members, and for 9 patients (7%) data on household members were missing. In the cases of 91/103 (88%) patients, all household members were screened for carriership. In 5/103 (5%) cases only some of the household members were screened, and in 7/103 (7%) none of the household members were screened. In total, 229 household members were screened, of which 91 (40%) tested positive for MRSA.In 131 patients, systemic antibiotic treatment was prescribed , and in The success rate of the first decolonization attempt was 97/131 (74%). Not all patients that failed on a first treatment were treated again. Of the 34 patients in whom the first decolonization attempt failed, 17/34 (50%) underwent a second treatment . The sucP\u2009=\u20090.16). There was no difference between outcomes with addition of trimethoprim alone  or in combination with sulfamethoxazole .For the treatment of complicated colonization in this cohort, 12 different combinations of antibiotic agents were prescribed with a duration ranging from 5 to 14\u2009days. The most frequently prescribed combinations of antibiotic agents were doxycycline-rifampin, trimethoprim (with or without sulfamethoxazole)-rifampin, and clindamycin-rifampin. The success rates of the different antibiotic combinations at the consecutive decolonization attempts are summarized in P =\u20091.00). There was a trend toward a higher success rate in the patients in whom the guideline for treatment choice was followed  compared to that in the patients in whom the guideline was not followed .Prolonged antibiotic treatment (10 to 14 days) was not associated with a better treatment outcome  compared to a 7-day treatment   and an immunocompromised status  were associated with failure at first decolonization attempt .Panton-Valentin leucocidin (PVL) was tested in 88 patients and was positive in 27/88 (31%). There was no correlation between PVL positivity and success of eradication in these patients   .The main finding of our study is the success rate of decolonization of 74% after the first treatment attempt, which is relatively high compared to those reported in previous literature. In the Dutch study by Ammerlaan et al. in 2011, this rate was 56% . A possiThe success rate of topical treatment in combination with systemic antibiotics in our study is decidedly high compared to that of topical treatment without systemic antibiotics reported in the literature, supporting the current guideline. Earlier studies have shown a success rate of approximately 40% after the first decolonization attempt in patients that were treated with topical treatment alone , 20.There were no apparent differences in success rates between different antibiotic regimens. The combination of doxycycline-rifampin had the highest success rate, but this did not reach statistical significance. This combination is one of the first-choice regimens in the Dutch guideline. There was no difference in effectivity between a treatment duration of 7\u2009days and a duration of 10 to 14\u2009days. This supports the guideline recommendation of a minimum antibiotic treatment of 7\u2009days .Being part of a known household cluster and immunocompromised status were associated with failure at the first treatment attempt. In the multivariable analysis, only immunocompromised status remained an independent risk factor for failure at the first treatment attempt, although there were few patients  in this The fact that 27/224 (12%) of the referred patients were no longer colonized with MRSA at the time of visiting the outpatient clinic is a relevant observation. It illustrates the possibility of spontaneous clearance and the importance of repeated screening before starting treatment.In the current search and destroy strategy, MRSA carriers are exposed to systemic antibiotic therapy, for the benefit of society, even if they are asymptomatic. The side effects of treatment should be weighed against the benefits of a search and destroy policy. Reported side effects in this study were mild and the effectivity of decolonization was high, supporting the current MRSA decolonization strategy in a low-prevalence country like the Netherlands.There are several limitations of our study. Due to its observational design, confounding limits the determination of the most effective antibiotic strategy. However, so far, there has only been one small randomized trial published comparing the efficacy of ciprofloxacin-rifampin and trimethoprim-sulfamethoxazole combinations in MRSA decolonization. This study showed no significant difference in success rates, but it did not include a doxycycline-based regimen and was underpowered . The majA second limitation of our study is that group sizes are small due to the low prevalence of MRSA colonization and the variety of different antibiotic regimens that were prescribed, reflecting the current guideline.A third limitation is that a proportion of patients were lost to follow-up 1 year after treatment. However, only 5% of the initially successfully treated patients that were cultured after 1 year were recolonized with MRSA. In the study by Lekkerkerk et al. , the medIn conclusion, treatment for complicated MRSA colonization according to the guideline has a high success rate. These findings endorse the current strategy of \u201csearch and destroy.\u201d For future research, a randomized trial would be necessary to further distinguish whether doxycycline-rifampin has a higher efficacy rate than those of alternative treatment combinations, as suggested in this study.A multicenter retrospective cohort study was conducted in five Dutch hospitals .All consecutive patients referred to the outpatient clinic with complicated MRSA colonization from January 2014 until December 2018 were eligible for inclusion. Exclusion criteria were the absence of MRSA colonization upon screening at the outpatient clinic, uncomplicated carriership, and/or a patient\u2019s objection to the use of their medical file for research purposes.in vitro susceptibility , and hygienic measures. Hygienic measures included daily changing of underwear, clothes, and towels, as well as changing of bed linen on days 1, 2, and 5. The first-choice recommended systemic antibiotic agent combinations were doxycycline-rifampin and trimethoprim-rifampin, according to tibility . Alternatibility . The staCulturing and susceptibility determination was performed according to the Dutch Society of Medical Microbiology guideline for laboratory detection of highly resistant microorganisms. MIC breakpoints and zone diameter breakpoints for resistance and intermediate sensitivity were based on EUCAST criteria .The electronic patient files were reviewed to record patient characteristics, clinical data relevant for MRSA decolonization , environmental factors , and microbiological data . In each hospital, the prescribed antibiotic therapy and treatment duration for all treatment episodes were extracted from the hospital\u2019s electronic prescribing system. Microbiological data were retrieved from the Department of Medical Microbiology of each hospital.in vitro sensitivity for mupirocin, (iv) the absence of active skin lesions, (v) the absence of foreign material that connects an internal body site with the outside , and (vi) no previously failure of decolonization treatment. All other situations were considered complicated colonization  the presence of MRSA exclusively located in the nose, (ii) no active infection with MRSA, (iii) nization .An \u201cisolated patient\u201d was defined as a solitary carrier without any known family or household members with MRSA colonization. In the case of any known positive family or household member, these patients together were considered a cluster. A household member was defined as a person sharing the same house by day and night and sharing a bedroom and/or bathroom and/or living room and/or kitchen .Immunocompromised status was defined as either a hematologic malignancy, stem cell transplantation, organ transplantation, immunosuppressive medication , or HIV infection.The primary outcome of the study was the success rate of decolonization treatment, defined by three successive negative MRSA cultures from swabs taken from nose, throat, and perineum. The first culture needed to be taken at least 48\u2009h after treatment, with the follow-up cultures obtained at 1-week intervals. The long-term success rate was defined as an additional set of negative MRSA swabs 1 year after decolonization treatment .Data are presented as rates (percentages or proportions) for categorical variables and as medians plus interquartile range (IQR) for continuous variables. The overall success rate of decolonization treatment is presented as a rate, with 95% confidence interval, and is stratified for different treatment strategies.P\u2009value of <0.05 in the univariate analysis were included, together with variables that were previously reported to be associated with treatment failure, namely, MRSA throat carriage and perineal carriage  and Fisher\u2019s exact tests were applied to identify clinical risk factors of treatment failure. In the multivariable regression analysis, variables with a carriage , 21.Ethical approval was granted by the institutional ethical review committee of the Leiden University Medical Center and the participating hospitals."}
+{"text": "As the incidence of shoulder arthroplasty continues to increase, there is growing interest in patient-based factors that may predict outcomes. Based on existing literature demonstrating gender-based disparities following total hip and knee arthroplasty, gender may also influence shoulder arthroplasty. The purpose of this review is to discuss the recent literature on the influence of gender on shoulder arthroplasty, focusing on differences in preoperative parameters, perioperative complications, and postoperative outcomes.While both female and male patients generally benefit from shoulder arthroplasty, several differences may exist in preoperative factors, acute perioperative complications, and postoperative outcomes. Preoperatively, female patients undergo shoulder arthroplasty at an older age compared to their male counterparts. They may also have greater levels of preoperative disability and different preoperative expectations. Perioperatively, female patients may be at increased risk of extended length of stay, postoperative thromboembolic events, and blood transfusion. Postoperatively, female patients may achieve lower postoperative functional scores and decreased range of motion compared to male patients. Differences in postoperative functional scores may be influenced by gender-based differences in activities of daily living. Finally, female patients may be at greater risk for periprosthetic fracture and aseptic loosening while male patients appear to be at greater risk for periprosthetic infection and revision surgery.Current literature on the influence of gender on shoulder arthroplasty is limited and conflicting. Further research is necessary to delineate how gender affects patients at the pre- and postoperative levels to better inform decision-making and outcomes. Shoulder arthroplasty is an effective treatment for shoulder pathology including glenohumeral osteoarthritis (OA), rotator cuff arthropathy, and proximal humerus fractures. Since P\u00e9an performed the first documented shoulder arthroplasty in 1894, there have been significant advances in implant development and surgical technique . There hAlthough the exact incidence of glenohumeral OA is unknown, cadaveric and radiographic studies have demonstrated evidence of glenohumeral OA in up to 32.8% of adults over the age of 60 , 8. As tPrevious studies have described disparities in outcomes for total hip and knee arthroplasty patients based on gender \u201314. Thesp < .01) [p = 0.01) [p = 0.078) [Several studies have described differences in preoperative factors between male and female patients undergoing shoulder arthroplasty. These factors include patient age at presentation, preoperative disability level, and preoperative patient expectations. Female patients typically undergo shoulder arthroplasty at an older age compared to male patients , 17\u2022\u2022. I = 0.01) . In a st= 0.078) \u2022\u2022.There is mixed evidence on whether female patients undergoing shoulder arthroplasty have greater levels of preoperative disability and lower baseline functional status. In a recent prospective study, Wong et al. found similar baseline range of motion in all planes in female and male patients undergoing RTSA \u2022\u2022. Additp < 0.01) in female patients compared to male patients undergoing TSA and RTSA. This study also described decreased range of motion in female patients preoperatively, specifically decreased active abduction (p < 0.01), forward flexion (p < 0.01), and external rotation (p = 0.02) [p < 0.001) as well as more limited motion in abduction (p = 0.001) and passive external rotation (p < 0.001) [In contrast, Okoroha et al. recently reported significantly lower preoperative clinical outcome scores ,  = 0.02) \u2022\u2022. In a < 0.001) \u2022\u2022.p < 0.01). Despite this difference, female patients also valued sleeping through the night and exercising/participating in sports [p < 0.05), improving psychological well-being (p < 0.05), and improving driving ability or ability to put on a seatbelt (p < 0.05) [Female and male patients who undergo shoulder arthroplasty appear to have different preoperative expectations. In a prospective study of 63 patients undergoing TSA by Jawa et al., male patients identified participation in sports, sleeping through the night, and maintaining employment as the top three preoperative expectations. On the other hand, female patients selected ability to independently perform household chores and daily routine as the top consideration, which differed significantly from men (n sports . Accordi < 0.05) . Additio < 0.05) .p = 0.001) and TSA  [p < 0.0001) [Existing literature suggests that female patients are at an increased risk of prolonged hospitalization after undergoing shoulder arthroplasty; however, recent studies challenge these findings \u201325. Thro 0.0001) . Additio 0.0001) .p = 0.18) [In contrast to these studies, Okoroha et al. did not find an association between female sex and increased length of stay following shoulder arthroplasty \u2022\u2022. Wong  = 0.18) .p < 0.03) [p = 0.04) [Additional perioperative complications to consider include thromboembolic events, blood transfusions, short-term readmission, and opioid use. While female patients do not appear to be at increased risk of short-term readmission or increased inpatient opioid use after shoulder arthroplasty, there is an association between female sex and increased risk of thromboembolic events and blood transfusion after shoulder arthroplasty , 26, 27. < 0.03) . FinallyAlthough female and male patients both appear to benefit from shoulder arthroplasty in pain relief and ROM, disparities in postoperative functional outcomes may exist \u201319, 28. In contrast, Wong et al. found comparable improvements in pain and ROM after RTSA for male and female patients; however, male patients had higher postoperative ASES function and SF-12 PCS scores at 1- and 2-year follow-up. For SF-12 PCS scores, female patients only improved 69% (1-year follow-up) and 42% (2-year follow-up) as much as the male patients. A similar trend in improvement was noted with ASES function scores at 1- (94%) and 2-year (75%) follow-up \u2022\u2022.p = 0.0001); however, this finding may be confounded by the inclusion of hemiarthroplasties and patients with rheumatoid arthritis [p < 0.0001), social function (p < 0.0001), mental health (p < 0.0001), and preoperative shoulder function (p < 0.0001) [Findings from several older studies also suggest worse postoperative functional outcome in female patients , 29. Donrthritis , 28. Mat 0.0001) .p = 0.03) and periprosthetic fracture (p = 0.01) while male patients had a higher incidence of periprosthetic infection (p < 0.01). However, the overall complication rate between the two cohorts was similar  [Differences between female and male patients after undergoing shoulder arthroplasty may also exist in rates of implant-related failure, periprosthetic fracture, and periprosthetic infection. Okoroha et al. found that female patients were more likely to experience implant loosening ( = 0.61) \u2022\u2022.p < 0.001) [Male patients may be at higher risk of revision after shoulder arthroplasty. An older German registry study showed that male sex was associated with a higher revision burden compared to that of female patients following TSA . Similar< 0.001) . Contrar< 0.001) .Both female and male patients typically benefit from shoulder arthroplasty. Yet, differences in preoperative factors, acute perioperative complications, and postoperative outcomes may exist. Female patients typically undergo shoulder arthroplasty at an older age compared to male patients. They may also have worse preoperative disability and different preoperative expectations compared to male patients undergoing shoulder arthroplasty. Female patients may place greater importance on performing ADLs and household chores compared to male patients when considering preoperative expectations.Age, preoperative disability, and preoperative expectations are likely interconnected. Age has been shown to influence preoperative expectations and worsen preoperative disability levels , 21. TypIn terms of acute perioperative complications, older studies suggest that female patients have increased length of stay following shoulder arthroplasty, but findings from more recent studies contradict this trend. These differences may be due to confounding factors such as demographics and inclusion criteria of the older studies. For example, in Matsen\u2019s study, hemiarthroplasty was included in procedure types, and proximal humerus fractures constituted a greater percentage of surgical indications; this diagnosis was independently associated with increased length of stay . AdditioWhile both female and male patients benefit from shoulder arthroplasty similarly in pain score improvement, there are apparent differences in ROM improvement and postoperative functional scores. Existing literature has shown a trend towards lower postoperative functional scores and possibly less improvement in ROM postoperatively in females. However, a recent prospective study contradicted these findings, reporting similar postoperative ASES and SF-12 scores after TSA . As WongFemale and male patients appear to be at risk of different postoperative complications, although the overall complication rate seems to be comparable. Female patients may be more likely to experience implant loosening and periprosthetic fracture while male patients may be more likely to sustain periprosthetic infection and undergo revision surgery. Okoroha et al. hypothesized that this difference is partially explained by increased fall rate in female patients leading to mechanical complications \u2022\u2022.The current literature on gender-based differences in shoulder arthroplasty is limited in scope and often conflicting in conclusions. Further research is needed to comprehensively evaluate the influence of gender on shoulder arthroplasty, especially as the incidence of shoulder arthroplasty continues to increase. With a deeper understanding of how gender specifically impacts patients undergoing shoulder arthroplasty at the preoperative and postoperative levels, we can better inform patient expectations and decision-making, and ultimately improve patient outcomes."}
+{"text": "Chain exchange behaviors in self-assembled block copolymer (BCP) nanoparticles (NPs) at room temperature are investigated through observations of structural differences between parent and binary systems of BCP NPs with and without crosslinked domains. Pairs of linear diblock or triblock, and branched star-like polystyrene-poly(2-vinylpyridine) (PS-PVP) copolymers that self-assemble in a PVP-selective mixed solvent into BCP NPs with definite differences in size and self-assembled morphology are combined by diverse mixing protocols and at different crosslinking densities to reveal the impact of chain exchange between BCP NPs. Clear structural evolution is observed by dynamic light scattering and AFM and TEM imaging, especially in a blend of triblock + star copolymer BCP NPs. The changes are ascribed to the chain motion inherent in the dynamic equilibrium, which drives the system to a new structure, even at room temperature. Chemical crosslinking of PVP corona blocks suppresses chain exchange between the BCP NPs and freezes the nanostructures at a copolymer crosslinking density (CLD) of \u223c9%. This investigation of chain exchange behaviors in BCP NPs having architectural and compositional complexity and the ability to moderate chain motion through tailoring the CLD is expected to be valuable for understanding the dynamic nature of BCP self-assemblies and diversifying the self-assembled structures adopted by these systems. These efforts may guide the rational construction of novel polymer NPs for potential use, for example, as drug delivery platforms and nanoreactors. Self-assembly of amphiphilic block copolymers (BCPs) has been viewed as a scalable and robust method for the fabrication and engineering of nanomaterials . The spoblock-poly(acrylic acid) (PS-b-PAA), PS-block-poly(2-vinylpyridine) (PS-b-PVP) or polybutadiene-block-poly(ethylene oxide) (PB-b-PEO) diblock or PEO-block-poly(propylene oxide)-block-PEO (PEO-b-PPO-b-PEO) triblock copolymers.In terms of diblock copolymers, Mattice and coworkers described three distinct types of exchange mechanisms, which are 1) chain insertion/expulsion, 2) micellar merger/splitting, and 3) micellar spanning . HoweverDespite these achievements, direct and accurate observation of chain exchange behaviors in BCP NPs is still challenging because of the lack of morphological diversity in self-assembled BCP NP structures\u2014most often, self-assembly of linear BCPs generates spherical structures. In addition, the inherent dispersity of the micelle size distribution and aggregation of micelles can complicate attempts to observe the structural evolution in these systems. Therefore, a useful strategy may be to use pairs of homologous BCP NPs having distinct structures, such as spherical-cylindrical or solid-hollow NPs. In principle, events such as chain exchange will result in structural changes that can be assessed in a direct fashion.One way to accomplish this is to make use of architectural and compositional complexity of BCPs that is achieved by the precise control afforded through advanced polymerization methods . A varieHerein, we describe the self-assembly of architecturally and compositionally diversified PS\u2013PVP BCPs in a PVP-selective solvent mixture (of methanol and THF at 3:1 v/v). Systems consisting of binary mixtures of linear and branched star-like BCPs with decidedly different macromolecular structures and compositions were chosen so that changes in structure could be witnessed by imaging and light scattering methods. The binary systems were blended by different mixing protocols, which facilitates inferences related to how nanostructures evolve in these complex systems. In some cases, the solvated corona domains of the parent BCP NPs were selectively crosslinked before mixing by utilizing the interaction between 1,4-diiodobutane (DIB) and pyridine groups in the PVP segments. Based on the structural differences between the specific linear and star BCP NPs as well as the contrast in the kinetics of chain exchange between crosslinked and non-crosslinked BCP NPs, it is possible to observe the structural evolution of binary BCP NPs induced by chain exchange between two types of BCP NPs at room temperature.1H NMR spectroscopy, elemental analysis, and multiangle laser light scattering  Postmixing involved independently prepared methanol/THF (v:v = 3:1) solutions of BCPs I and II at C = .25\u00a0mg/ml, which were subsequently mixed together under sonication. Each of these protocols was also applied to cross-linked systems. 3) Postmixing of crosslinked NPs involved combining premade methanol/THF (v:v = 3:1) solutions of DIB-crosslinked NPs made from BCPs I and II under sonication (C = .25\u00a0mg/ml). 4) Postmixing of crosslinked NPs with non-crosslinked NPs involved mixing methanol/THF (v:v = 3:1) solutions of crosslinked NPs made from BCP I with non-crosslinked NPs of BCP II. Both of these BCP NP solutions were mixed together under sonication at C = .25\u00a0mg/ml. Following each of these preparations, the solutions were stored at room temperature for a minimum of 5\u00a0days before use.Four different mixing protocols were used to prepare binary mixtures of two different PS\u2013PVP BCPs at room temperature. These protocols are schematically depicted in 2O2 and 98% H2SO4) and heated until no bubbles were released. (Warning: piranha acid is a strong acid and strong oxidizer.) After cleaning, the silicon substrates were dried with a stream of dry N2. The presence of silanol groups on the silicon substrate after piranha acid treatment promotes adsorption of BCPs on these surfaces based on the hydrogen bonding between surface hydroxyl and pyridine groups. Silicon substrates were immersed in BCP solutions overnight to allow adsorption of BCPs on surface. The BCP-modified substrates were then rinsed with methanol, sonicated in methanol for 5\u00a0min twice, and finally dried under ambient conditions.Silicon substrates obtained from Silicon Quest were ultrasonically cleaned successively in toluene, 2-propanol, methanol, and deionized water, each for 15\u00a0min, and then immersed in a piranha acid solution (1:3 v/v mixture of 30% HRh) values reported herein are apparent hydrodynamic radii because they are determined at a finite concentration (at .25\u00a0mg/ml). For convenience we refer to these simply as the hydrodynamic radius. As an example, a single set of DLS results for sample S1 is presented in q2 as a function of the angularly dependent amplitude of the scattering wave vector, q) (Dynamic light scattering (DLS) measurements were performed using a goniometer-based, four-detector ALV instrument according to our previous reports . The hydctor, q)  for otheb-PS-b-PVP), and each of the arms of the stars have a diblock structure, with PS as the first block emanating from the central core and PVP as the second (outer) block. Stars having 8-arms or, on average, 26- and 40-arms were used. The synthesis and characterization of these copolymers were described previously  were prepared using a cosolvent method. The BCPs were first dissolved in THF, a good solvent for both the PS and PVP blocks, and then a selective solvent for PVP blocks, methanol, was added dropwise into the systems to promote the formation of BCP NPs. In the mixed solvent (methanol/THF (v:v = 3:1)), which is selective for PVP blocks, the PS\u2013PVP BCPs generally self-assembled into NPs of different structures based on the different copolymer architectures and compositions. Rh, distributions for the BCPs in a methanol/THF (v:v = 3:1) mixture at a concentration of .25\u00a0mg/ml determined by DLS. The Rh distributions for most BCPs display a single peak, which means there is only one population of scatterer in solution. Two peaks can be observed in the Rh distributions for samples D2, T2, T3, and S3, which indicates that more than one type of BCP NPs exist in these solutions. The characteristic Rh values presented in Rh for BCPs with the same macromolecular architecture generally increase with increasing styrene to 2-vinylpyridine (S/V) ratio, due to the decrease in the content of soluble PVP segments in the BCPs. Additionally, some of the 26- and 40-arm star BCPs  self-assemble into complex macroscopic aggregates and precipitate in the methanol/THF (v:v = 3:1) mixture owing to their multiple arms, large molecular weights and large S/V ratios  were crosslinked by DIB at target crosslinking densities (CLDs) of 20% and 70% for PVP blocks by altering the molar feed ratio of alkyliodide to pyridine groups. The amount of DIB added to solution to hit the target CLDs  for polymeric vesicles (\u201cpolymersomes\u201d) constructed from BCPs when an excess of crosslinkers exist in the systems , D2+S5 , and S2+T3 . With these choices, the two parent NPs have completely different self-assembled structures, which benefits the effort to examine chain exchange behaviors by directly observing structural evolution as affected by mixing of self-assembled or crosslinked BCP nanoparticles.Rh distribution with two resolved, narrow peaks located at \u223c33 and \u223c82\u00a0nm  during the crosslinking process suggests that crosslinking has an impact on the structures resulting from equilibration of the D1+S1 systems. For D2+S5 mixtures, the NP size for the premixed blend (D2S5-1) is larger than that for the postmixed systems (D2S5-2). In addition, the NP shapes for these two blends are different, as reflected in the AFM images acquired from these systems.  mixture, sample S2 self-assembles into solid spheres with an average diameter of \u223c50\u00a0nm (determined from AFM imaging), while the self-assembled NPs for sample T3 exhibit disperse particle sizes (average diameter \u223c85\u00a0nm), including hollow NPs having a diameter exceeding 100\u00a0nm. When samples S2 and T3 were combined by the premixing protocol (the resulting mixture is noted as S2T3-1), AFM imaging indicates that the system hybridizes into small spheres . In thisnd 70\u00a0nm . Both thAs shown in Rh distributions for S2T3-2, S2T3-3, S2T3-4, S2T3-5, and S2T3-6 mixtures generally exhibit two constant peaks located at Rh1 \u223c30\u00a0nm and Rh2 \u223c110\u00a0nm, which means two types of NPs exist in these systems.  Among these binary mixtures, S2T3-3 shows the weakest signal from the scatterers having a size of Rh1 and the broadest peak corresponding to large aggregates (Rh2), suggesting that the main population of scatterers in this crosslinked system are large particles. Furthermore, TEM imaging of the structures of BCP NPs in mixtures S2T3-2 and S2T3-3 indicates that sample S2T3-2 exhibits solid spherical NPs with a uniform particle size of \u223c45\u00a0nm, but no large hollow NPs similar to those observed in the parent sample T3 are observed , as well as the number of large NPs and the RMS roughness that increase with increasing PVP CLDs, we conclude that the chain exchange behaviors in BCP NPs and the structures of BCP NPs can be manipulated through careful variation in the PVP CLD. As shown in observed . On the observed . This diobserved  show no observed , which iWe investigated the polymer chain exchange behaviors by directly observing the structural evolution during the mixing of self-assembled or crosslinked BCP NPs. These studies were enabled by using BCPs with different architectures and compositions, some of which self-assembled into different structures, including spheres, rods, and hollow vesicles. Thus, by imaging we can observe structural changes, which we attribute to chain exchange. Interestingly, the structural change did not occur in (non-crosslinked systems of) D1+S1 and D2+S5, but did occur in the S2+T3 binary mixture. We suspect that the stability of the self-assembled NPs is a key factor that influences the ability to undergo structural changes. As mentioned earlier, the exchange of chains between BCP NPs is often suppressed due the micelles having \u201cfrozen cores.\u201d We suspect that this is at play in D1+S1 and D2+S5 systems. Self-assembly of copolymer T3 resulted in the formation of two different types of NPs, namely small solid spheres and large hollow spheres  of nano-objects produced by BCP self-assembly. We believe that this work enables other interesting pursuits, including studies directed at the relation between nanocarrier structures and drug delivery behaviors, and how thermodynamic factors impact the morphologies of BCP NPs created from BCP mixtures, especially copolymer systems relying on self-assembly of architecturally complex copolymers."}
+{"text": "Intestinal obstruction with strangulation can be life-threating, and it is critical to make an accurate and timely diagnosis for emergency surgery.This was aimed to investigate the value of coagulation indicators and inflammatory markers in distinguishing between strangulated and simple intestinal obstruction.Fifty-four patients with intestinal obstruction were retrospectively studied. The correlation between coagulation indicators and inflammatory markers with intestinal obstruction was analyzed. Receiver operating characteristic curves were created to assess their ability in discriminative diagnosis.Levels of fibrinogen (Fib), C-reactive protein (CRP), neutrophil ratio, and D-Dimer were significantly greater, while thrombin time was significantly shorter in strangulated intestinal obstruction compared with simple intestinal obstruction. Furthermore, Fib levels in the necrosis subgroup of strangulated intestinal obstruction were significantly higher than those in the ischemia subgroup and simple intestinal obstruction group. The areas under the receiver operating characteristic curve were 0.58 for white blood cells, 0.78 for CRP, and 0.80 for Fib. Using the optimal cutoff values of Fib (3.71\u2009g/L) and CRP (14.54\u2009mg/L), the sensitivity, specificity, positive predictive value, and negative predictive value in discriminating between strangulated intestinal obstruction and simple intestinal obstruction were 51.43%, 100%, 100%, and 52.78% for Fib, and 56.25%, 94.44%, 94.74%, and 54.84% for CRP, respectively.Fib and CRP demonstrate good performance in predicting strangulation and are indicative of intestinal necrosis and ischemia. The combination of this coagulation indicator and inflammatory marker holds potential for better discrimination between strangulated and simple intestinal obstruction. Intestinal obstruction, also known as small bowel obstruction, is a common clinical condition requiring gastrointestinal surgery; it is generally classified into the following 2 types: simple intestinal obstruction and strangulated small intestinal obstruction.Coagulation indicators, particularly fibrinogen (Fib), have been reported previously to be useful markers in the diagnosis of coagulation disorders that may result from ischemia and hypoxia.In this retrospective study of patients with intestinal obstruction, we aimed to determine whether an association between coagulation indicators as well as inflammatory markers and the 2 types of intestinal obstruction exists. In addition, we assessed their diagnostic value in differentiating strangulated and simple intestinal obstruction.All patients with intestinal obstruction who underwent surgical treatment in our hospital from January 2013 to November 2017 were retrospectively studied. All patients who had coagulation disorders or special physiological conditions after taking anticoagulant drugs were excluded. Patients meeting inclusion criteria for: (1) all cases were hospitalized patients with intestinal obstruction; (2) all cases were surgical patients with intestinal obstruction; (3) all cases were confirmed by operation and detailed intraoperative records and/or pathologic confirmation; (4) all cases met the diagnostic criteria of intestinal obstruction in the seventh edition of Huang Jiasi surgery. And exclusion criteria for: (1) diseases affecting coagulation function, such as coagulation diseases, leukemia, and advanced malignant tumor; (2) special physiological conditions, such as middle and late pregnancy and people over 80 years old; (3) people who have used anticoagulants; (4) dynamic and hemodynamic ileus. All the patients hemodynamically stable at time of operation. A total of 54 intestinal obstruction patients, including 21 cases of adhesive intestinal obstruction, 11 cases with intestinal obstruction due to external hernia, 10 cases with intestinal torsion, 5 cases with intestinal obstruction in the megacolon because of long term intestinal feces, 5 cases with intestinal obstruction due to fecalith, and 2 cases with intestinal obstruction due to a benign tumor, were retrospectively enrolled in this study. According to the intraoperative records, postoperative diagnosis, and pathologic results, the patients were divided into the simple intestinal obstruction group (n=19) or the strangulated intestinal obstruction group (n=35), which consisted of 16 cases of ischemia and 19 cases of necrosis. All patients were tested for coagulation indicators, C-reactive protein (CRP), and whole blood count.The study protocol was reviewed and approved by the Research Ethics Committee at the Boai Hospital of Zhongshan affiliated to Southern Medical University.t test, the Mann-Whitney U test, and Pearson Correlation Analysis test, respectively. We conducted analysis of variance or the Kruskal-Wallis test among the groups. P<0.05 was considered statistically significant. The diagnostic value of routine coagulation indicators for strangulated intestinal obstruction was determined using receiver operating characteristic curve (ROC) analysis.Statistical analysis was performed using SPSS 22.0, with the values shown as mean\u00b1SD. We performed descriptive analysis, univariate analysis, and correlation analysis for any 2 groups using the Student P<0.05) due to the fact that the majority of cases in the simple group were treated with gastrointestinal surgery following a long period of time after conservative treatment was ineffective. And all the patients were hemodynamically stable at time of operation. As simple intestinal obstruction did not worsen, it did not affect the statistical analysis.A total of 94 patients underwent gastrointestinal surgery for suspicion of intestinal obstruction, 54 of whom were finally included and retrospectively studied. Forty patients were excluded from this study due to the following conditions: intestinal cancer (32), urinary tract cancer 1), cerebral infarction (1), tuberculosis (1), late pregnancy (1), heparin treatment (1), and aged more than 80 years old (3). The characteristics of the study subjects are summarized in Table , cerebraP<0.01). In addition, the TT values were significantly lower in the strangulated intestinal obstruction group than in the simple intestinal obstruction group (P<0.05).The results of the preoperative blood examinations, including WBC, neutrophil ratio (NEUT), platelet count, CRP, prothrombin time (PT), activated partial thromboplastin time (APTT), Fib, thrombin time (TT), and D-dimer (DD), were compared between the simple intestinal obstruction group and the strangulated intestinal obstruction group. As shown in Table P<0.01 and <0.05, respectively). The values of CRP between in the simple intestinal obstruction group and the necrosis subgroup as well as between the ischemia subgroup and the necrosis subgroup were also statistically different (P<0.01). In addition, the values of NEUT, PT, and D-D between the simple group and the necrosis subgroup were significantly different (P<0.05). Finally, TT was significantly shorter in the simple intestinal obstruction group compared with the necrosis subgroup (P<0.01). Due to the relatively small number of cases with D-D examination results, no further analysis was made.To examine the potential correlation between the coagulation indicators and the severity of the strangulated intestinal obstruction, the patients in the strangulated group were further divided into 2 subgroups: ischemia subgroup and necrosis subgroup, and the values of WBC, NEUT, platelet count, CRP, PT, APTT, Fib, TT, and D-D were compared. We found that the Fib level in the necrosis subgroup was significantly higher than that in the simple intestinal obstruction group and the ischemia subgroup . Moreover, the values of Fib and CRP were negatively correlated with the TT . Furthermore, Fib also had a positive correlation with CRP but a negative correlation with TT in the simple and the strangulated groups  Fib, CRP, NEUT, and D-D were significantly greater in the patients with strangulated intestinal obstruction compared with those with simple intestinal obstruction; (2) TT was significantly lower in the strangulated intestinal obstruction group than in the simple intestinal obstruction group; (3) The Fib level was positively correlated with the severity of intestinal obstruction, with the highest values in the group with strangulated intestinal obstruction and necrosis; (4) The sensitivity, specificity, positive predictive value, and negative predictive value were 51.43%, 100%, 100%, and 52.78%, respectively, for Fib at the optimal cutoff point; while those values were 56.25%, 94.44%, 94.74%, and 54.84% for CRP at the optimal cutoff point, respectively, in discriminating strangulated intestinal obstruction from simple intestinal obstruction.P=0.027) and was related to intestinal necrosis. Moreover, the WBC was significantly increased at 6 hours compared with the control group (P=0.015). Altogether, these findings indicate that the serum D-D level is more valuable than the WBC in the diagnosis of early intestinal ischemia. Altinyollar et alStrangulated intestinal obstruction is a serious clinical condition, and it requires a timely diagnosis and prompt surgical treatment. Extensive previous efforts have been made to search for diagnostic methodology to be used for patients with strangulation. The following pathologic changes can occur during the course of intestinal obstruction: dehydration, electrolyte disorders, secondary infection, intestinal microcirculation, blood clotting, microthrombosis, blood disorders, tissue ischemia, hypoxia, and ultimately necrosis; some of these effects  can cause coagulation disorders. Thus, the coagulation tests were expected to indirectly reflect the status of the tissue blood flow. Schoots et alOf a number of coagulation indicators, including PT, APTT, Fib, TT, and D-D, Fib can be used as a screening or diagnostic indicator of hypercoagulability, and it is also one of the molecular markers for monitoring coagulation, fibrinolysis, and thrombosis. During coagulation, Fib is eventually degraded into D-D with the help of thrombin and plasmin. However, the plasma D-D index is related to the degree of intestinal lesions and necrosis in the intestinal obstruction when the intestinal obstruction occurred. Yang et alP<0.05). The sensitivity, specificity, positive predictive value, and negative predictive value of the disease for intestinal necrosis were 70%, 89%, 87.5%, and 73%, respectively. Likewise, Lv and colleagues demonstrated that the concentration of D-D has an important predictive value for intestinal necrosis. Some other studiesIn addition, Chen and HuP<0.01). Compared with the PT, only the coagulation index was significantly different between the simple and necrosis subgroups (P<0.05). The Fib level was higher in the simple group relative to the strangulated group (both the ischemia subgroup and the necrosis subgroup) (P<0.05). This result implied that an elevated Fib level was not only due to acute-phase protein but also coagulation factors. Therefore, the Fib level can be used to indirectly reflect the degree of intestinal obstruction and intestinal necrosis as well as intestinal blood flow in the case of intestinal obstruction.In our study, TT differed not only between the simple and strangulation groups but also among the subgroups, including simple, strangulation with ischemia, and strangulation with necrosis (P<0.01), as well as the ischemic subgroup and the necrosis subgroup of the patients with strangulated intestinal obstruction (P<0.01). We confirmed that the CRP level was able to reflect the inflammatory condition of strangulated intestinal obstruction with necrosis, which was consistent with previous studies.r=0.63, P<0.01) but was negatively correlated with the TT . Our results showed that coagulation indicators, except for indicators of inflammation, can also reflect intestinal strangulation of intestinal obstruction. Meanwhile, we demonstrated that an elevated level of Fib in strangulated intestinal obstruction was caused by coagulation factors. Moreover, our findings also showed that a combination of coagulation indicators and inflammatory markers may be better for the diagnosis of strangulated intestinal obstruction. Fib and CRP have high specificity and positive predictive value, indicating that both of them have a certain significance for intestinal strangulation in patients with intestinal obstruction (but other factors affecting coagulation must be excluded).In the past, the WBC had been used as an indicator for the diagnosis of strangulation ileus, but our data showed that the WBC was not significantly different between the 2 groups. We compared WBC, CRP, and Fib by ROC curve analysis and found that the areas under the ROC curve for CRP (0.78) and Fib (0.80) were greater than that for WBC (0.58). Therefore, CRP and Fib have a greater value in the diagnosis of strangulated intestinal obstruction. As infection often occurs from simple intestinal obstruction to strangulated intestinal obstruction, our data also showed that inflammatory markers like CRP and NEUT also increased. In particular, the CRP level was significantly different between the simple intestinal obstruction group and the strangulated intestinal obstruction group (The value of lactic acid in intestinal strangulation was rarely reported. Because only a few patients in this group had examined lactic acid, it was not analyzed in our study.In summary, Fib and CRP showed a good ability to distinguish between strangulated intestinal obstruction and simple intestinal obstruction. Therefore, coagulation indicators and inflammatory markers have the potential to be used as markers for predicting strangulation in patients with intestinal obstruction."}
+{"text": "The prevailing rights and quality of life approaches call for the inclusion of people with diversity and/or disabilities in society, including their participation in the educational system. Therefore, different institutions are urging countries to take action to ensure that students with disabilities receive the accommodations and supports they need within the framework of inclusive education. The idiosyncrasies of physical education (PE) classes can be an opportunity to encourage the participation and inclusion of these students. Thus, this study aims to evaluate the PE teachers\u2019 perception about their preparation to address inclusive education. The study involved 260 Spanish primary and secondary PE teachers who answered a sociodemographic questionnaire, three dichotomic questions about their initial and ongoing preparation and the Evaluation of Teacher Training for Inclusion Questionnaire (CEFI-R). PE teachers believe that they have not received the necessary initial preparation and they consider it important to assist in ongoing courses to address their students\u2019 diverse needs. PE teachers are aware of the importance of inclusive education and perceive greater difficulties in secondary education. PE teachers also showed a good predisposition to teach students with special educational support needs, especially found in primary school teachers through the CEFI-R Dimension 1, with statistically significant differences. Inclusive education is defined as the process of identifying and responding to the diversity of learners\u2019 needs, seeking increased learning and participation in their communities and reducing social exclusion . AlthougHowever, a set of barriers must be overcome to achieve an inclusive school, including inflexible teaching systems focused on conceptual content, the lack of shared responsibility among educational agents or the lack of leadership, which can cause frustration among teachers ,13. For Teachers have a great responsibility in achieving inclusive education, as they must organize the educational response, design and develop personalized educational practices, motivate students, work collaboratively and use different resources and technologies ,16,17. IThe inclusion of students with disabilities in PE classes without neglecting the rest of the students has been a challenge for PE teachers . TherefoTherefore, this study aims to analyze the perception of Spanish PE teachers concerning their preparation to cope with the variety of educational needs that their students may present and towards inclusive education. This update of scientific knowledge subsequently will allow the proposal of measures to support educative inclusion in general, and specifically in PE lessons.The sample was made up of 260 primary and secondary PE teachers from public schools in Spain. The mean of the years of teaching experience was 13.4 years (standard deviation 9.5). A non-probabilistic sampling method based on convenience sampling was used .A socio-demographic questionnaire, three dichotomous questions and a tool to measure perceptions about their preparation for inclusion were administered using the Google Forms tool, since e-questionnaires allow savings in costs and time, obtaining a higher rate of return . The timThe study took place between September and December 2020. To access the sample, an e-mail was sent to all public school PE teachers in public primary and secondary schools in the region of Extremadura (Spain), providing information about the aim of the study, an informed consent form and the URL to fulfil the instruments. The participation was voluntary, after providing informed consent to the research team.All data were collected anonymously and kept private. The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Bioethics and Biosafety Committee at the University of Extremadura (protocol code: 186/2021).Sociodemographic data: An electronic questionnaire was designed using Google Forms with six sociodemographic questions: sex, age, university degree, province of the school, educational stage and years of teaching experience.Teachers\u2019 perceptions about their preparation for inclusive education:They were asked three dichotomous questions about their initial and ongoing training: (1) Do you think that you were properly prepared through your initial preparation to respond to the diversity of your students\u2019 needs? (2) Has ongoing preparation helped you to respond to the diversity of your students\u2019 needs? (3) Would you be willing to attend courses on inclusive education? These basic questions are intended for further comparison between different educational actors and educational stages .The Evaluation of Teacher Training for Inclusion Questionnaire, CEFI-R , was usep = 0.000; and Bartlett\u2019s = 36.607; p = 0.000) and the CEFI-R items , non-parametric tests were chosen. Pearson\u2019s Chi-Square test was performed to analyze the differences between the three dichotomous questions according to teachers\u2019 sex and educational stage. The Mann\u2013Whitney U test was used to analyze the differences between the responses to the dichotomous questions and the CEFI-R dimensions. This test was also used to analyze the differences between the dimensions according to the sex of the teachers and the educational stage. The Spearman Rho was performed to explore the association between the CEFI-R dimensions and age. Cronbach\u2019s Alpha was used to calculate the reliability of each of the dimensions from the CEFI-R. Reliability values between 0.60 and 0.70 can be considered acceptable, while values between 0.70 and 0.90 are excellent [The Statistical Package for Social Sciences  was used. The Kolmogorov-Smirnov test was carried out to determine if the data followed a normal distribution. As this assumption was not met, for both the dichotomous questions  are shown in This study aimed to investigate the perception of Spanish PE teachers on their preparation to cope with the variety of educational needs that their students may present. The main findings showed that a significant number of PE teachers reported not feeling prepared to cope with diversity but showing a positive attitude to address the challenges to promote inclusive education, at least as far as their preparation is concerned. Therefore, the hypothesis of this study was confirmed, suggesting that measures to support educational inclusion in the PE lessons could be considered as a valid tool to achieve inclusive and transformative education.Thus, teachers answered three dichotomic questions about their initial and ongoing preparation. Regarding the first question, 76.5% denied being prepared to deal with the diversity of their students\u2019 educational needs. In this way, one study performed with PE teachers  showed tThe studies reviewed indicate some PE teachers have negative attitudes towards inclusive PE lessons , but halThe CEFI-R was also used to check sex and educational stage differences. The results of this research reinforce the studies by several authors ,66,67 stThis research has several limitations. The sample size was limited. No questions were included about the specific courses that participants took during their initial or ongoing education, so it is not possible to predict which type of courses enhance readiness for inclusion. For future studies, it can be proposed to extend this study to other regions and territories, as well as to involve other educational stages such as early childhood education and teachers of other levels of education. Another future aim would be to carry out a more in-depth analysis based on the descriptive data of the CEFI-R dimensions according to the dichotomous questions about teachers\u2019 initial and ongoing preparation , considePE teachers believe that they have not received the necessary initial preparation and that they consider it important in order to assist in ongoing courses and to deal effectively with the diversity of their students. They are aware of the importance of inclusive education, showing that they should carry out more hours of practice with these students for proper teaching. They perceive greater difficulties at the secondary stage. The participation and collaboration of the whole of society, the educational environment and educational agents should be as coordinated as possible.PE teachers showed a good predisposition to teach students with specific educational support needs; statistically significant differences were found in the teachers\u2019 educational stage through CEFI-R Dimension (1)."}
+{"text": "Attention to educational diversity in educational centers has become an important topic, so it is necessary to address challenges to offer an individualized educational response. Thus, specialist teachers must adopt a leading role in order that education systems move towards inclusion. The objective of this study is to measure Spanish primary school teachers\u2019 perceptions about their preparation for inclusive education, considering possible differences between specialist teachers (therapeutic pedagogy and hearing and speech) and non-specialist teachers. The sample was made up of 284 teachers who work in the primary education stage in public Spanish schools, who responded to the Questionnaire for the Evaluation of Teacher Preparation for Inclusion (CEFI-R). Significant differences were found according to the specialism of the participants. It can be concluded that teachers consider their initial preparation in this subject insufficient but show positive conception towards educational inclusion. Inclusive education has become one of the major challenges for the educational systems, schools, teachers, and society . AttentiThe Department of Education and University Planning  defines A key aspect of this process is teacher preparation . TeacherIn addition to the teachers\u2019 initial preparation, other factors that influence the achievement of inclusive education are school leadership, collaborative culture, adaptations of equipment and infrastructure, multidisciplinary work, professional development, and teachers\u2019 attitudes and perceptions . The stuThe Spanish education system is divided into several levels. The preschool stage is designed for children up to 6 years (non-compulsory). Primary education (compulsory) comprises six academic years between 6 and 12 years. Secondary education comprises Compulsory Secondary Education from the age of 12 to 16 (the last compulsory stage), and it can be followed by Professional Education or Baccalaureate. Regarding the initial training of primary school teachers, they obtain the specialist title when they complete a concrete pathway during their undergraduate preparation. Ongoing training is mainly supported through the Teachers\u2019 and Resources Centers, which are devices managed by the education administration whose aim is to support their pedagogical work.Most of the scientific literature regarding inclusive education has been produced in the last decade . Thus, tThe sample was made up of 284 teachers working in public schools at the primary education stage: 20.1% (57) men and 79.9% (227), women. Regarding their academic qualification or university degree, 44% (125) were specialists in educational inclusion (therapeutic pedagogy or hearing and speech), and 56% (159) were non-specialist. The mean number of years of experience of the teachers was 14.20 years (SD = 9.3). Participants were selected using a non-probability sampling method based on convenience sampling . Table 1Sociodemographic data: Participants were asked about their sex, age, university degree and specialism, province of the school, teacher position, and years of teaching experience. Additionally, three questions about their preparation were asked: referring to (1) their initial preparation, (2) their ongoing preparation, and (3) their possible assistance to ongoing formation related to attention to diversity.Teacher preparation for inclusion: The Questionnaire for the Evaluation of Teacher Preparation for Inclusion (CEFI-R)  was usedBefore analyzing the results obtained, the indirect items were inverted. Thus, in these items, a higher score implies greater synchrony with an adequate \u201cConception of diversity\u201d (dimension 1), greater consonance with an adequate \u201cMethodology\u201d (dimension 2), an adequate conception of \u201cSupport\u201d (dimension 3) and a correct concordance with correct \u201cCommunity participation\u201d (dimension 4). This instrument uses a Likert scale where the values range from 1 to 4, 1 being \u201cStrongly disagree\u201d, 2 \u201cPartially disagree\u201d, 3 \u201cPartially agree\u201d and 4 \u201cStrongly agree\u201d.The CEFI-R Cronbach\u2019s alpha value is 0.79, and each of the four factors < 0.70, so it is a reliable instrument.The directory of the Ministry of Education and Employment of the Regional Government of Extremadura (Spain) was used to collect the emails from all the primary public schools in Extremadura. An email was sent providing information on the purpose of the research, written informed consent, and the URL to fill the questionnaires. All data were collected anonymously. The average time needed to answer the questionnaire was approximately 10 min. Data collection was performed using the Google Forms application, as electronic questionnaires have been proven to save costs and obtain higher participation . The resData were analyzed using the Statistical Package for Social Sciences (SPSS) version 23.0 for MAC . The Kolmogorov Smirnov, asymmetry and kurtosis tests were performed to determine whether the data followed a normal distribution or not. This assumption was not met, so it was decided to use non-parametric tests.The Pearson\u2019s Chi-Square test was used to search for differences between the questions referring to initial and ongoing preparation according to the specialism of the teachers. The Mann\u2013Whitney U test was used to analyze the relationships between the items of the CEFI-R dimensions according to the teachers\u2019 specialism. The Spearman Rho was carried to measure the association between the CEFI four dimensions and the age groups. Cronbach\u2019s Alpha was used to calculate the reliability of each of the dimensions in this study. Following the method of authors such as Nunnally and Bernstein , reliabiDifferences between the questions referring to initial and ongoing preparation according to the specialism of the teachers were analyzed using Pearson\u2019s Chi-Square test. n = 90) answered yes, but 68.3% (n = 194) denied having been prepared to deal with the diversity of their students\u2019 educational needs. The results showed that there was no significant association with the specialism (p = 0.05). Regarding the second question, 86.6% (n = 246) stated that they had been prepared through outgoing preparation to respond to the educational needs diversity, although 13.4% (n = 38) responded negatively to this aspect, and statistically significant differences according to the specialism were found (p < 0.01). Last, in the third question, 95.8% (n = 272) of the sample responded they would attend preparation courses in this respect, compared to 4.2% (n = 12) who responded negatively to this aspect. Again, statistically significant differences were found (p = 0.01).Distribution of frequencies to questions 1, 2 and 3 are shown in p < 0.01). High scores ) were obtained in almost all the items, showing greater synchrony concerning an adequate conception of diversity.The first dimension \u201cConception of diversity\u201d showed that Me = 3.4 and an IQR = 1. specialist teachers obtained slightly higher values than non-specialist teachers, with Me specialist = 3.6 (IQR = 0.8), Me non-specialist = 3 (IQR = 1.2), and statistically significant differences were found (p < 0.01). The items belonging to this second dimension revealed similar values and significant differences depending on the specialism of the participating teachers ).The second dimension \u201cMethodology\u201d showed values of Me = 3; IQR = 1.2. Specialist teachers scored higher compared to non-specialists, with Me specialists = 3.6 (IQR = 1), and Me non-specialists = 3 (IQR = 1). Again, significant differences were obtained according to the specialism of the teachers (p = 0.13) according to the specialism. The highest score was obtained in item 11 ) and the lowest in item 13 ).The third dimension, \u201cSupports\u201d, showed Me = 2.4 (IQR = 0.8). Likewise, specialist ) and non-specialists ) scores were similar. There were no significant differences (p < 0.01). All items showed similar scores, with a value of Me = 4 (IQR = 1), with statistically significant differences found in items 15 and 16 of these dimensions (p < 0.01).Concerning the fourth dimension, \u201cCommunity Participation\u201d, the scores showed Me = 3.8 (IQR = 0.8). Again, specialists showed higher values than non-specialists, with Me specialists = 4 (IQR = 0.4), Me non-specialists = 3.6 (IQR = 1), obtaining significant differences according to the teachers\u2019 specialism . The dimension \u201cMethodology\u201d showed a very similar correlation to the previous one, being low and inversely significant with age . Looking at the third dimension of \u201cSupports\u201d, it again showed a low and inversely significant correlation with age . Finally, the only dimension that shows statistically significant differences in its results is the fourth dimension \u201cCommunity participation\u201d, although it is still low .The results indicate that in dimension 1, \u201cConception of diversity\u201d, there is a low and inversely significant correlation with age; as the age range increases, the score for dimension 1 decreases , \u201cConception of diversity\u201d, all items showed high score values, and the item \u201cStudents with specific educational support needs can follow the day-to-day curriculum\u201d was the one with the lowest value. In this respect, authors such as Benavides-Lara  or Duk aIn dimension (2), \u201cMethodology\u201d, the results indicate that both specialists and non-specialists felt competent to teach, adapt and develop for their students. Furthermore, in this dimension, statistically significant differences were found according to the specialism. In this regard, Orozco and Mori\u00f1a  indicateDimension (3), \u201cSupports\u201d, was the one with the lowest values. The most positive values are found in the item \u201cJoint teacher-support teacher planning would make it easier for support to be provided within the classroom\u201d, highlighting that teachers approve of sharing knowledge regarding the needs of the group, guaranteeing more personalized attention . The lowLastly, in dimension (4), \u201cCommunity Participation\u201d, statistically significant differences were found according to the teachers\u2019 specialism. All the items addressed the urgent need for participation of all stakeholders involved in education to provide the best educational and inclusive response to the needs of students. ,38. SaliIn sum, the results on the four dimensions analyzed in the CEFI-R were quite positive. Statistically significant differences were found in dimensions 1, 2 and 4 when comparing specialist and non-specialist teachers. Schools must have teachers specialized in therapeutic pedagogy and in hearing and language to deal with the educational needs of every student . HoweverGood reliability values are an indispensable characteristic for the use of these results . In our Given all the above, it seems clear that teachers must constantly update their preparation to ensure the quality of learning among diverse students. Specialized and properly trained teachers with the right attitudes and knowledge are required in order to respond properly to the needs of learners . It is aOur results should be interpreted considering several limitations. The sample was one of convenience. All participants were from the autonomous community of Extremadura, so socio-cultural factors could affect the results, which should be interpreted with care. Regarding future research, the recruitment of a larger sample, randomization of participants and multi-center studies would be interesting alternatives to explore.Both specialist and non-specialist teachers consider that their preparation concerning inclusive education should be improved, with greater emphasis on ongoing preparation. Participants demonstrate positive attitudes towards inclusion, recognizing the importance of multidisciplinary work, feeling competent to teach and being able to develop appropriate teaching materials adapted to their students. Statistically significant differences were found between specialist and non-specialist teachers in the application of the CEFI-R in three of the dimensions: (1) \u201cConception of diversity\u201d, (2) \u201cMethodology\u201d, and (4) \u201cCommunity Participation\u201d."}
+{"text": "KIAA0319, encoded in the DYX2 locus of human chromosome 6p22. The association of KIAA0319 with reading performance has been replicated in independent studies and different languages. Rodent models suggest that kiaa0319 is involved in neuronal migration, but its role throughout the cortical development is largely unknown. In order to define the function of KIAA0319 in human cortical development, we applied the neural developmental model of a human embryonic stem cell. We knocked down KIAA0319 expression in hESCs and performed the cortical neuroectodermal differentiation. We found that neuroepithelial cell differentiation is one of the first stages of hESC differentiation that are affected by KIAA0319 knocked down could affect radial migration and thus differentiation into diverse neural populations at the cortical layers.Dyslexia, also known as reading disability, is defined as difficulty processing written language in individuals with normal intellectual capacity and educational opportunity. The prevalence of dyslexia is between 5 and 17%, and the heritability ranges from 44 to 75%. Genetic linkage analysis and association studies have identified several genes and regulatory elements linked to dyslexia and reading ability. However, their functions and molecular mechanisms are not well understood. Prominent among these is  KIAA0319 and DCDC2  and induced pluripotent stem cells (iPSCs), have been successfully used to model the effects of genetic variants on neuronal differentiation . PluripoKIAA0319 variants associated with dyslexia are at the promoter region and thus the cell type and the temporal regulation of KIAA0319 expression is perhaps a major cause of the dyslexia. Here, as one of the first attempts to understand how KIAA0319 regulates the human cortical development, we set out to investigate the function of KIAA0319 in the context of the loss of function. We used a hESC model of cortical neural differentiation and probe the function of KIAA0319 during neurogenesis. We knocked down KIAA0319 in hESCs and performed neuroectodermal differentiation to examine how the neural differentiation is affected by loss of function of KIAA0319 throughout the neuronal development. We found that KIAA0319 is critical in neuroepithelial cell differentiation, which could affect radial migration and further differentiation into diverse populations of brain cells. These results suggest that one of the mechanisms whereby dysregulated expression of KIAA0319 could influence human cortical neurodevelopmental process is the neuroepithelial differentiation, which could underlie the complex traits such as reading.The KIAA0319 gene expression changes, we first examined transcriptome profiles of somatic tissues during human fetal development. KIAA0319 is strongly expressed throughout human cortical development and in all brain regions  expression using CRISPRi/dCas9-KRAB in H7b6 hESCs  targetti, and 28 . We thenKD cells . Convers4 and 21 . TogetheKIAA0319 regulates PAX6+ neuronal progenitor cells at later stages of differentiation. We simultaneously measured KI67, a marker for proliferation, and PAX6 by qRT-PCR and immunofluorescence, and quantified the proliferation of neuronal progenitor cells at two later time points of differentiation (days 28 and 42)  . We founcontrols , while tcontrols . Howevercontrols . OverallKIAA0319 KD did not induce apoptosis, suggesting that the decrease in KI67 + PAX6+ neuronal progenitor cells was not due to dying cells. Next, we examined markers at later stages of neuronal differentiation to quantify if KIAA0319 KD induces the premature transition from neuronal progenitor cells into downstream stages of neuronal differentiation. Compared to controls at day 28, KIAA0319 KD significantly decreased the expression of markers of intermediate progenitor cells (TBR2), immature neuronal cells (TBR1 and \u03b2-Tubulin), and mature neuronal cells (MAP2)  . The resKIAA0319 regulates proliferation in neuronal progenitor cells, we performed RNA-sequencing on the differentiating cells from day 7, 14, 21, and 28  human ESCs were maintained in feeder-free culture conditions using Matrigel-coated cell culture dishes and mTeSR1 media at 37\u00b0C and 5% CO2. Cells were tested for mycoplasma and passaged every 7 days following dissociation with Dispase (0.83\u00a0U/ml). All experiments involving hESCs were approved by the Yale Embryonic Stem Cell Research Oversight Committee (ESCRO).HEK 293T cells were maintained in 6-well plates at 37\u00b0C with 5%COPre-differentiated cells were removed before hESC colonies, dissociated into single cells using Accutase, and plated on 24-well plates at 500,000 cells/well with 50\u00a0\u00b5M Y27632 and mTeSR1. Once plates reached 90% confluency, cells were grown for 10 days with neural induction media , changing media every day. Cells were dissociated using Accutase on day 11 and plated on new 24-well plates along with 50\u00a0\u00b5M Y27632 and progenitor expansion media , changing media every other day. On day 19, culture media was changed to maturation media  with 25\u00a0ng/ml BDNF, changing media every 2\u00a0days for 2\u00a0weeks and every 4\u00a0days thereafter. Cells were dissociated using Accutase and replated on new 24-well plate on day 25\u00a0at 100,000 cells/well when confluency was reached.crispr.mit.edu) targeting the transcription start site of KIAA0319 (KIAA0319 KD plasmid) and synthesized by Keck , and 5% v/v T4 Ligase at room temperature for 1\u00a0h.Single Guide RNA (sgRNA) and reverse complement were designed using CRISPR PAM sites  plates from Recombinant Technologies, LLC at 37\u00b0C for culture overnight. Surviving colonies were cultured overnight in Gibco LB Broth with Ampicillin at 100ug/ml in a 37\u00b0C shaker, followed by plasmid purification using QIAGEN Plasmid Mini Kit and sequence confirmation.KIAA0319 KD and Control plasmids were individually transfected into HEK293T cells along with 2.5 ugs of packaging plasmids using X-treme GENE nine DNA transfection reagent following manufacturer\u2019s instructions. Supernatants containing lentivirus were collected and concentrated 48\u00a0h after transfection and stored at \u221280\u00b0C. H7 cells were infected with KIAA0319 KD lentivirus and control lentivirus. Infected cultures were selected following puromycin selection for 5 days.KIAA0319 KD or control samples were collected on days 7, 14, 21, and 28 of neuronal differentiation per replicate. Samples were homogenized using QIAGEN QIAshredder columns, and total RNA was isolated using the RNeasy Mini Kit following the manufacturer\u2019s instructions. One ug of total RNA was used to synthesize cDNA using amfiRivert cDNA Synthesis Platinum Master Mix. Real-time quantitative PCR (RT-PCR) was performed using amfiSure qGreen Q-PCR Master Mix (2X), Low Rox on a CFX96 R-PCR System at amfiSure manufacture cycling conditions with primers listed in T method with GAPDH as a housekeeping gene control. t-test was performed for the statistical analysis. p values are given at each figure.Four wells of a 24-well plate of H7 cells transfected with KIAA0319 KD or Control cells were washed once in PBS before fixing in 4% formaldehyde/PBS at room temperature for 15\u00a0min and then washed in PBS (3 \u00d7 for 15\u00a0min). In addition, samples were permeabilized by incubating with 0.1% Triton-100/PBS at room temperature for 1\u00a0hour and then washed in PBS (3 x for 15\u00a0min) before storing at 4\u00b0C in PBS.Twelve wells of a 24-well plate of Blocking was done with 3% BSA/0.1% Triton-100/PBS at 4\u00b0C for 2\u00a0hours before incubating with primary antibodies diluted to the manufacturer\u2019s recommendation in 3% BSA/0.1% Triton-100/PBS at 4\u00b0C overnight. Samples were then washed in PBS (3 x for 15\u00a0min) before incubating with secondary antibody diluted in 3% BSA/0.1% Triton-100/PBS at room temperature for 1\u00a0h. Samples were washed in PBS (3 x for 15\u00a0min) before staining with DAPI to highlight nuclei for 5\u00a0minutes before final PBS wash. Immunofluorescence images were captured on a Leica TCS SP5 Spectral Confocal Microscope using Leica LAS AF software. Images were processed using ImageJ-Fiji.KIAA0319 KD and controls for days 7, 14, 21, and 28 were collected. RNA were isolated from cell pellets, processed for library prep, and then subjected to 150bp paired-end sequencing on a NOVA-seq for 50 million reads per sample at the Yale Center for Genomic Analysis (YCGA).Cell pellets from three biological replicates of FASTQ files were processed using an RNA-Sequencing pipeline developed at the YCGA. Raw RNA-Sequencing reads were trimmed and aligned using Hierarchical Indexing for Spliced Alignment of Transcripts 2 (HISAT2) . Alignedp-value threshold of 0.05. Finally, the pathways and genes were grouped by GO Term.Ingenuity Pathway Analysis   was used"}
+{"text": "Interestingly, our follow-up attempts to create Au@V2O5 core@shell particles do not yield the expected encapsulated structure. Instead, Janus particles of Au and V2O5 with diameters between 10 and 20 nm are identified after deposition. At the interface of the Au and the V2O5 parts we observe an epitaxial-like growth of the vanadium oxide next to the Au structure. To test the temperature stability of these Janus-type particles, the samples are heated in situ during the STEM measurements from room temperature up to 650 \u00b0C, where a reduction from V2O5 to V2O3 is followed by a restructuring of the gold atoms to form a Wulff-shaped cluster layer. The temperature dependent dynamic interplay between gold and vanadium oxide in structures of only a few nanometer size is the central topic of this contribution to the Faraday Discussion.Nanoparticles with diameters in the range of a few nanometers, consisting of gold and vanadium oxide, are synthesized by sequential doping of cold helium droplets in a molecular beam apparatus and deposited on solid carbon substrates. After surface deposition, the samples are removed and various measurement techniques are applied to characterize the created particles: scanning transmission electron microscopy (STEM) at atomic resolution, temperature dependent STEM and TEM up to 650 \u00b0C, energy-dispersive X-ray spectroscopy (EDXS) and electron energy loss spectroscopy (EELS). In previous experiments we have shown that pure V Nanoparticles with diameters in the range of a few nanometers, consisting of gold and vanadium oxide, are synthesized by sequential doping of cold helium droplets in a molecular beam apparatus and deposited on solid carbon substrates. Due to the different oxidation stages of vanadium, the chemical properties vary strongly, and nanostructured vanadium oxide, prepared in a specific oxidation state, is a highly desired but challenging goal.11 Battery electrodes could be improved by using two-dimensional V2O5 polymorphs as alkali intercalation compounds.12,13 Combinations with gold are considered promising for catalytic oxidation of hydrocarbons or CO14,15 as well as for enhanced sensing properties.16 Significant amounts of clusters can be synthesized from precursor molecules in solution by chemical methods yielding so-called ligand stabilized clusters, see for example ref. 18 For the last decade, we have followed an approach to create clusters of atoms or molecules in a cold superfluid helium environment. The method is based on the development of an efficient source for generating superfluid helium droplets in a beam expansion. The droplets can serve as cold traps for the accumulation of other species to form clusters that may be deposited on solid substrates. As we have shown, nanoparticles of virtually any combination of elements can be produced in this way.19 Due to the inert environment of superfluid helium, they are free of any other chemicals or additives. With all processes including the deposition taking place in ultrahigh vacuum (UHV), contaminations of the produced samples are excluded. In this paper, we report the synthesis of mixed gold\u2013vanadium oxide nanoparticles and their deposition on amorphous carbon substrates. The created samples were studied by electron microscopy, energy dispersive X-ray spectroscopy (EDXS), and electron energy loss spectroscopy (EELS). Our focus was set on the temperature dependence of the observed structures and corresponding phase transitions in the range from room temperature to about 650 \u00b0C. Prior to this work on the mixed nanoparticles, we have shown that clusters of vanadium pentoxide can be produced in superfluid helium droplets by accumulation of sublimated (V2O5)2 from a hot pick-up oven.20 V2O5 nanoparticles of sizes around 10 nm were clearly identified after deposition at room temperature by scanning transmission electron microscopy (STEM), EELS, and UV-visible absorption spectroscopy.21 This article is structured as follows. First, we provide the details of the helium droplet experiment and our measurement techniques. This section is then followed by a brief overview of our computational attempts to better understand the interactions between gold and vanadium oxide. In Section 4 we present the results of our temperature-dependent studies and discuss the observed structures and phase transitions.With numerous potential applications, nanosized metal and metal oxide particles have become increasingly interesting also for fundamental research.2N). The produced droplets have an internal temperature of 0.4 K, which makes them ideal for preserving the structures of dopants and allows to synthesise weakly bound aggregates not achievable otherwise. Due to the He environment chemical interactions can be excluded. The droplet beam is directed through two pick-up zones, where the desired elements are placed in heating crucibles  was placed in the first pickup oven and V2O5 (MaTeck 99.9%) powder in the second one. Subsequently, the doped helium beam passes through the UHV chamber with various molecular beam diagnostics like time-of-flight and quadrupole mass spectrometers. It is then terminated on a heatable substrate, suitable for Scanning Transmission Electron Microscopy (STEM) (DENSsolutions Nano-Chip XT carbon) analysis. For the purpose of core\u2013shell cluster creation, we usually take care that the number ratio of core to shell particles is smaller than one to ensure a complete coating of the shell. The dopant numbers cannot be determined quantitatively but we have described a procedure for an estimate based on the shrinkage of the helium droplets after doping.24The experimental setup is depicted in 3 G2 60-300 was used, set up for High-Angle Annular Dark-Field (HAADF) imaging. The electron energy was set to 300 keV and the convergent angle was 19.6 mrad. The predominant Rutherford scattering in this imaging mode results in a contrast which is highly dependent on the atomic number, causing Au to appear brighter than vanadium oxide. Note that a transition between the oxidation states of vanadium oxides is well described in the literature and is induced by several effects, e.g. by electron bombardment and changes in temperature.25\u201328 Therefore, the exposure time for all STEM measurements in this work is reduced to 2.4 \u03bcs (the minimum in this mode), if not stated differently. Elemental maps are obtained by EDX and EELS analyses.After deposition, the samples were taken out of the UHV and kept at ambient conditions for several minutes during transport to the microscope. For STEM analysis, a probe-corrected FEI Titan319 that sequential doping is preferably leading to layered structures, which, due to the isotropy of the growth process, translates into e.g. core\u2013shell structures for bimetallic setups. Little is known about scenarios involving metals and metal oxides; however, the substantially different character of the chemical bond in terms of directionality, strength and structural parameters makes any predictions difficult. From the theoretical point of view, a first step is the comparison of binding energies per particle for the two components Au and V2O5. The presence of vanadium(v) oxide is assumed here since it could be confirmed20 as the typical oxide forming in helium droplets after pickup of V2O5 fragments in the helium beam experiment. Note that, in the following computational study, the term \u2018unit\u2019 refers to a single Au atom in the case of gold clusters, while it refers to a whole V2O5 unit in the case of the vanadium(v) oxide clusters.Despite the fact that the details of the growth process of mixed-metallic impurities in helium nanodroplets are still an open debate in the community, there is consent and experimental evidence29 a less expensive method for pre-optimization and structural search based on a tight binding approach, with the application of density functional theory. For the latter part, the \u03c9B97X-V functional,30 a range-separated hybrid GGA density functional with VV10 nonlocal correlation,31 as it is implemented in the Q-Chem program package,32 is used. For O we use the polarized triple-zeta basis set of Weigend and Ahlrichs,33 for V and Au the effective core potential and basis sets of the LANL family.34Our computational approach for the free-gas oligomers is based on the combination of the GFN-xTB method of Grimme,En denoting the total energy of a cluster consisting of n units, and calculate this value for clusters of up to six units, i.e. for Au6 and (V2O5)6. Our results are summarized in 35,36 and the lowest spin multiplicity possible. The corresponding geometries of the vanadium(v) clusters can be found in our previous study on vanadium oxide condensation in helium droplets, see ref. We define the binding energy per unit asv) oxide at n = 6, while the energy per Au atom is still far from convergence to the bulk value of cohesion energy per particle  at this size for the metal cluster. It further reveals a substantial difference in binding energies per unit for the two compounds. It is interesting to compare these values to a representative interaction energy between the two components, e.g. the binding energy of a single Au atom to (V2O5)4, for which we obtain a value of Ei = 3.30 eV with the same computational approach. The corresponding geometry of this mixed structure is depicted in 2O5 units might become energetically more favorable than homonuclear coagulation among gold atoms, if these atoms are only loosely connected to the main gold cluster, for example at edges.2O5 units, presumable in the form of dimers,20 are added one by one. In this case, the situation seems to amount to a question about \u2018nano-wetting\u2019 of the gold cluster surface by (V2O5)2. Still comparing with our previous experience about core\u2013shell formation, we would expect a similar result for the newly formed Au\u2013V2O5 particles. While we cannot give precise numbers of our dopant particles, our experimental procedure always aims at a relation of the number of shell particles to core particles larger than one to ensure a full coating. From the theoretical side, calculations of binding energies of V2O5 molecules and/or dimers to gold cluster surfaces or at least to Au(111) would be desirable but are not available to our knowledge. Observations by the Freund group40 during the experimental creation of thin V2O5 films on Au(111) indicated island formation due to coalescence at preferred locations. Although their experiments differ from our procedures, there remains the question whether our coating by subsequent doping will work as in the case of two metals or result in nano-islands.In the process of our mixed cluster formation, this kind of competition should only represent an exception. As observed in all our preceding experiments for the generation of clusters of two materials in helium droplets, the formation of a cluster of thousands of atoms of the material picked up in the first cell has been finished in the millisecond flight time before the second material is added. This means that in the current case, a gold cluster of about 2000 atoms has aggregated when VThe above calculations for individual units will become relevant when the dynamics after cluster deposition and the thermal and electron beam treatment have started. Then situations may occur where diffusion or migration of individual gold atoms leads to the described bond competition.441 on the structure surrounded by the green frame in 2,3 ionization edge which correlates with the medium gray regions in the HAADF image of 2,3 edge with the O K edge it was not possible to record oxygen maps using the O K edge.42 Although the near edge-fine structures (ELNES) of the EELS signal has been successfully employed for the identification of vanadium oxides and their oxidation states in previous experiments on vanadium oxide particles as well as thin films,43 we could not employ this method for the identification of the vanadium oxidation state in our STEM measurements. In order to avoid particle damage and to prevent electron beam induced reduction, we have to use a low dose electron beam and extremely small exposure times for all STEM measurements in this work. We reduced the exposure time to 2.4 \u03bcs which is the minimum in this mode. Therefore, we have a rather weak EELS signal and a lower spatial and energy resolution compared to other published spectra.42,432O5 nanostructures,21 therefore we identify these clusters as Au\u2013V2O5. When inspecting the overview image in 2O5 part of any structure. Our previous two-component metal cluster aggregation had yielded core@shell structures such as Au@Ag, Co@Au, Ni@Au, Fe@Au, and Ag@ZnO.44\u201349 Therefore, we expected an Au core surrounded by a V2O5 shell, but in the current images, most Au clusters are connected to larger vanadium structures at their tail, while a complete coating is never observed.Nonetheless, our previous measurements of vanadium oxide nanoparticles alone under the same conditions and on the same substrates, were shown to be pure V2O5 cluster is depicted in 2O5 portion. Within both structures the lattice plane distances are visible as periodic lines. Only planes that are oriented parallel to the incoming electron beam can be clearly identified. Some portions of the image appear washed-out and do not allow lattice structure assignments due to tilted angles with respect to the beam direction. Intensity plots for the areas in the black rectangle, assigned as thin Au layer, and the blue marked area, assigned as vanadium oxide, are shown in the right-hand part of 2O5(211) are 2.36 \u00c5 and 2.48 \u00c5, respectively, which lets us choose these assignments in reasonable agreement within the spatial resolution of 0.1 \u00c5 of the microscope. In our work on pure vanadium oxide depositions from the helium droplet source,21 corresponding STEM images of V2O5 clusters exhibited (020), (011), and (200) lattice portions with 2.2 \u00c5, 2.7 \u00c5, and 5.7 \u00c5 lattice distances, respectively. We have no control of the nanocrystal orientation. Furthermore, the contrast of the vanadium oxide part is not high enough for 3D imaging, a technique which we had demonstrated for Au@Ag core@shell clusters with our instrument before.50 As it also turns out, the Au\u2013V2O5 particles alter their shape during longer electron beam exposure as previously shown for other transition metal oxide particles which have been also prepared by the helium droplet method.51 This makes a reconstruction of a 3D image from sequentially taken exposures unreliable. In the past, V2O5 films have been grown on plane Au(111) surfaces by oxidation of a previously deposited V layer with a sufficiently high pressure of O2.28 In our experiments, primarily V2O5 dimers are added one by one to a gold cluster core grown inside the droplets before,20 without the need for subsequent oxidation. As shown in a model calculation,52 the kinetic energy of the impact of the droplets on the substrate surface is small compared to the binding energy between the atoms and molecules of the grown cluster. Therefore, we believe that the observed V2O5 portions represent regular nanocrystals with typical literature lattice constants.A representative Au\u2013V2O5 nanosystem, in situ heating was performed with a MEMS-based heating chip during the STEM measurement.53 A Janus-type particle of gold and vanadium oxide was monitored upon heating and appeared to maintain the described Au and V2O5 lattice parts stably up to 300 \u00b0C. Changes were observed when the samples were further heated in situ up to a temperature of 650 \u00b0C during the STEM measurements. In 7 electrons when the first image was taken, and for every 80 seconds of additional exposure the same number of electrons per second can be assumed if the projected area is approximately constant. In the 237 s from the beginning to the end of this sequence, a significant change is observed and a hexagonal shape seems to evolve with a partial coating of the gold portion with vanadium oxide.For further understanding of this Au/V2O3(104) lattice planes with 2.7 \u00c5 (blue) and Au(200) planes with 2.1 \u00c5. In the third image, probed by two rectangular selections (green and blue), a lattice distance of 2.3 \u00c5 can be identified which indicates the V2O3(006) plane. In the last image, the formation of 120\u00b0 angles seems to start, and a spacing of 2.4 \u00c5 is measured within the red and green rectangles, which could refer to the Au(111) and/or V2O3(111) plane.The first image shows the typical Au fcc lattice in (200) orientation with a plane distance of 2.1 \u00c5, while the second image shows V2O5 and V2O3 being such that one can find orientations for either one of them with the determined values, an unambiguous assignment is difficult. For example, 2.7 \u00c5 distance can be assigned to V2O3(104) but also to V2O5(011). We assume that our vanadium oxide samples show the same thermal reduction behaviour as observed by other groups who report a reduction from V2O5 to V2O3 in TEM studies for temperatures above 600 \u00b0C. Su and Schl\u00f6gl have suggested a transition from V2O5via VO2 to V2O3, where V2O3 remained at 600 \u00b0C . While such interpretation is somewhat speculative, it may provide an explanation for the structural change upon the impact of thermal and electron beam exposure. In our previous temperature studies of metal core@shell nanoparticles including our model calculations, we have seen different diffusion processes. In the case of Au@Ag and Ag@Au,44 we observe nanoalloys at high temperature; in Ni@Au, nickel diffuses through the gold protective cover,45 as does Fe in Fe@Au.46 Among the iron triad combined with a gold shell, increased temperature tends to promote gold diffusion in Co@Au such that the formerly spherical Au shell becomes thinner on one side of the Co core and thicker on the other.48,55 So far, this is just a qualitative comparison. The binding energies of a gold atom to a gold cluster and a (V2O5)2 unit to a V2O5 cluster20 are comparable with about 3.5 to 4 eV, but the Au\u2013VO system is much more complex and the reduction from V2O5 to V2O3 \u2013 perhaps even through intermediate oxidation states \u2013 will influence the diffusion dynamics significantly.In order to follow the described dynamics further, we produced a movie sequence on a different cluster which we started after a visual state similar to image 237, maintaining the same electron dose at constant 650 \u00b0C for another 250 seconds. 5via STEM imaging. Several interesting features and processes were observed. In contrast to our metal core@shell helium droplet assisted cluster production, the Au\u2013VO nanostructures exhibit rather a Janus type particle character. Thanks to our high resolution instrument, lattice planes could be identified for the nanocrystals and assigned. At room temperature, V2O5 cluster structures were assigned similar to our earlier investigations.21 Above 600 \u00b0C, a reduction to V2O3 was assumed due to other studies on VO films,26\u201328,43 and corroborated by our lattice plane distance measurements on the deposited structures.Gold\u2013vanadium oxide clusters of about 10 nm diameter were grown inside superfluid helium nanodroplets in a molecular beam expansion and deposited on amorphous carbon substrates. The samples were subsequently studied by scanning transmission electron microscopy, electron energy loss spectroscopy, and energy-dispersive X-ray spectroscopy over a temperature range from room temperature to 650 \u00b0C. At 650 \u00b0C, the diffusion dynamics inside individual clusters on the surface was monitored Continued electron beam exposure at 650 \u00b0C led to a restructuring of the whole nanoparticle towards a hexagonal shape, which we interpret as the formation of an Au Wulff-shaped cluster with a surrounding vanadium oxide layer and an Au-rich surface layer.There are no conflicts to declare.FD-242-D2FD00089J-s001"}
+{"text": "General transcription factor IIi (GTF2I) mutations are very common in thymic epithelial tumors (TETs) and are related to a more favorable prognosis in TET patients. However, limited research has been conducted on the role of GTF2I in the tumor immune microenvironment (TIME). Further, long non-coding RNAs (lncRNAs) have been associated with the survival of patients with TETs. Therefore, this study aimed to explore the relationship between GTF2I mutations and TIME and build a new potential signature for predicting tumor recurrence in the TETs. Research data was downloaded from The Cancer Genome Atlas database and the CIBERSORT algorithm was used to evaluate TIME differences between GTF2I mutant and wild-type TETs. Relevant differentially expressed lncRNAs based on differentially expressed immune-related genes were identified to establish lncRNA pairs. We constructed a signature using univariate and multivariate Cox regression analyses.GTF2I is the most commonly mutated gene in TETs, and is associated with an increased number of early-stage pathological types, as well as no history of myasthenia gravis or radiotherapy treatment. In the GTF2I wild-type group, immune score and immune cell infiltrations with M2 macrophages, activated mast cells, neutrophils, plasma, T helper follicular cells, and activated memory CD4 T cells were higher than the GTF2I mutant group. A risk model was built using five lncRNA pairs, and the 1-, 3-, and 5-year area under the curves were 0.782, 0.873, and 0.895, respectively. A higher risk score was related to more advanced histologic type.We can define the GTF2I mutant-type TET as an immune stable type and the GTF2I wild-type as an immune stressed type. A signature based on lncRNA pairs was also constructed to effectively predict tumor recurrence. Thymic epithelial tumors (TETs) are tumors originating from thymic epithelial cells, with an incidence of approximately 1\u20133 cases/million, and are the most common type of anterior mediastinal tumor . AccordiIn this study, we first examined the TIME differences between GTF2I mutant and wild-type TETs based on The Cancer Genome Atlas (TCGA) patient data. Relevant differentially expressed lncRNAs were selected based on differentially expressed immune-related genes between GTF2I mutant and wild-type TETs. Next, we constructed a novel lncRNA signature to predict tumor recurrence in patients with TETs by applying the lncRNA pairs method.Gene mutations in all TET samples are shown in Fig.\u00a0Based on the GTF2I mutations, we divided all TET patients into two groups: the GTF2I mutant and GTF2I wild-type. Survival curves showed that patients in the GTF2I mutant-type group had more favorable prognostic results with lower probabilities of tumor recurrence than the GTF2I wild-type group Fig. B. The clp\u2009=\u20090.98) in estimate scores between the GTF2I mutant and wild-type groups  beta signaling pathway, and wingless/integrated (WNT) signaling pathway Fig. A.Fig. 3Ap\u2009<\u20090.05) expressed between GTF2I wild-type and mutant TETs   and 93 differentially expressed lncRNAs (DERs) visualized as volcano plots Fig. B-C. The ETs Fig. D-E. GeneETs Fig. F. The Ky05) Fig. G.Eight immune-related differentially expressed genes (IRDEGs) and 53 immune-related differentially expressed lncRNAs (IRDERs) were identified by taking the intersection and performing Spearman\u2019s correlation analysis. We used an iterative cycle among the 53 IRDERs and identified 1266 IRDER pairs. We performed univariate Cox regression analysis on all IRDER pairs and identified 19 IRDER pairs Fig.\u00a0A. Next, Risk score\u2009=\u2009\u2212\u20090.700794392573432\u00d7 CCDC144NL-AS1|LINC01748\u20131.60567899345149\u00d7 AC074389.2|LINC02542+\u20091.19279714426103\u00d7 AC131902.1|AL365356.5\u20130.725120180351969\u00d7 AC005383.1|AC023906.2\u20130.755363912198633\u00d7 AC009041.2|LINC02384. We divided the groups into high- and low-risk using the cut-off value of 0.1 , respectively. HR of the risk score and 95% CI were 3.351 and 2.161\u20135.196 (p\u2009<\u20090.001), respectively  was an independent prognostic predictor  to more aggressive histologic subtypes  curves were used to assess the specificity and sensitivity of the risk model and the 1-, 3-, and 5-year AUCs were 0.782, 0.873, and 0.895, respectively Fig.\u00a0A. UnivarA nomogram was established using risk score and common clinical factors of patients with TETs, including age, GTF2I mutation, gender, Masaoka stage, and histologic subtype Fig.\u00a0A. The 1-Through the analysis of thymoma mutation data from TCGA, we determined that GTF2I mutations were highly common in thymoma and were mostly missense mutations, which was consistent with previous findings , 25, 26.Due to the limited studies exploring the relationship between GTF2I mutations and TIME worldwide, we investigated the differences in the TIME between TET patients with GTF2I mutant thymoma and wild-type, with the aim to illustrate prognostic differences between the two groups. According to the TIME infiltration characterization of patients with mutant and wild-type TETs, we defined GTF2I mutant type as the most immune stable type because the peak of immune response passed and the immune response was more stable. We defined the GTF2I wild-type as the more immune stressed type because the immune response had not yet reached the peak, the immune response to tumor antigen stimulation was strong, the immune response continued to enhance in the development to the peak, and various immune checkpoints were highly expressed with great immunotherapy potential \u201329. InclFor the GTF2I wild-type TETs, multiple immune cells were highly infiltrated. The immune response was in a state of continuous activation, which was too strong and would attack their own normal tissues and organs, hence, the patients were in a state of continuous stress. Therefore, GTF2I wild-type TET patients were more likely to form autoimmune diseases as well as develop symptoms of MG than patients with a mutant type. At the same time, our results suggested that the use of PD-1, PD-L1 or CTLA4 inhibitors in the treatment of patients with advanced TETs required close attention on the generation of immune-related adverse reactions such as MG while treating tumors. Anti-PD-L1 or anti-PD-1 antibodies have been reported to cause adverse reactions such as MG, myocarditis and pneumonia in patients with TETs \u201335. FurtThe Notch, TGF beta and WNT signaling pathways were enriched in the GTF2I mutant group. Previous studies have reported that these signaling pathways play an important role in regulating TIME and cancer progression \u201341. The Several studies have shown that lncRNAs could be used as prognostic marker in multiple cancers \u201346, and Despite the implications of our results, this study still has several limitations. The number of TET patient samples used to compare clinical features and TIME between GTF2I mutant-types and wild-types and used to establish the lncRNA pairs signature was small (119) and external validation was not available.We analysed TIME differences between patients with GTF2I mutant and wild-type TETs, and defined GTF2I mutant-type as immune stable and the GTF2I wild-type as immune stressed. In addition, we established a signature based on IRDEGs to predict tumor recurrence, and a risk score was determined as an independent clinical prognostic factor. Our study improves the understanding of GTF2I mutations in the TIME and provides more insight into effective immunotherapy strategies.http://www.gsea-msigdb.org/gsea/index.jsp).We downloaded the tumor mutation and transcription data of 119 patients with TETs and their clinicopathological information from TCGA database, however, clinical information was missing from some patients. Three hundred and thirty-two immune related genes were obtained from the immune system process gene set (systemic name: M13664) in the Gene Set Enrichment Analysis (GSEA)  can evaluate immune cell infiltration levels on the basis of the gene expression profiles from complex tissues [CIBERSORT ( tissues . Using t tissues . We idenhttps://www.gsea-msigdb.org/gsea/login.jsp) to investigate differences across pathway activity between GTF2I mutant and wild-types (p\u2009<\u20090.05).We utilized gene sets (c2. cp. kegg.v6.2.-symbols) with GSEA software  |\u2009>\u20092 using the R package \u201climma\u201d. We performed KEGG and GO enrichment analyses of these DEGs using the R package \u201cclusterProfiler\u201d, \u201corg.Hs.eg.db\u201d and \u201cenrichplot\u201d to investigate the biological processes difference between GTF2I mutant and wild-type TETs.p\u2009<\u20090.05. We compared all IRDERs pairwise with ifelse function; in a lncRNA pair, one lncRNA was defined as a lncRNA a and the other is defined as lncRNA b. When lncRNA a was larger than lncRNA b, its value was defined as 1. When lncRNA a was smaller than lncRNA b, it was defined as 0.We obtained IRDEGs by taking the intersection of immune genes and DEGs. Using Spearman\u2019s correlation analysis between the IRDEGs and DERs, we received IRDERs with correlation coefficients >\u20090.4 and p\u2009<\u20090.01 in all IRDER pairs. Then, we performed multivariate Cox regression and identified five IRDER pairs to build the risk model for predicting TET recurrence. The formula used to calculate the risk score is as follows:First, we performed a univariate Cox regression analysis with The maximum knee was determined by the AIC value of the 1-year ROC curve, which was used as a cut-off point of the risk score for classifying patients into the high- and low-risk groups. We used the R package \u201csurvivalROC\u201d and polygon function to plot the 1-, 3-, 5-year ROC curves. We performed Kaplan-Meier analysis to assess the disease-free survival difference between the high- and low-risk groups and was visualized through survival curves by using the R packages \u201csurvival\u201d and \u201csurvminer\u201d, and ggsurvplot function. Univariate and multivariate Cox regression analyses were performed between risk score and clinical features such as age, gender, histologic type, Masaoka stage, and GTF2I mutation. We also conducted a Wilcoxon signed-rank test to compare the risk score differences between groups with different clinical features.Common clinical features in patients with TETs, such as age, GTF2I mutation, gender, Masaoka stage, and histologic type, were used to construct a nomogram using the R package \u201crms\u201d and calibrate function. The time-dependent calibration curves from the R package \u201crms\u201d were used to determine prediction accuracy of the nomogram , 56."}
+{"text": "Post-pandemic, the use of medical supplies, such as masks, for epidemic prevention remains high. The explosive growth of medical waste during the COVID-19 pandemic has caused significant environmental problems. To alleviate this, environment-friendly epidemic prevention measures should be developed, used, and promoted. However, contradictions exist between governments, production enterprises, and medical institutions regarding the green transformation of anti-epidemic supplies. Consequently, this study aimed to investigate how to effectively guide the green transformation. Concerning masks, a tripartite evolutionary game model, consisting of governments, mask enterprises, and medical institutions, was established for the supervision of mask production and use, boundary conditions of evolutionary stabilization strategies and government regulations were analyzed, and a dynamic system model was used for the simulation analysis. This analysis revealed that the only tripartite evolutionary stability strategy is for governments to deregulate mask production, enterprises to increase eco-friendly mask production, and medical institutions to use these masks. From the comprehensive analysis, a few important findings are obtained. First, government regulation can promote the green transformation process of anti-epidemic supplies. Government should realize the green transformation of anti-epidemic supplies immediately in order to avoid severe reputation damage. Second, external parameter changes can significantly impact the strategy selection process of all players. Interestingly, it is further found that the cost benefit for using environmentally friendly masks has a great influence on whether green transformation can be achieved. Consequently, the government should establish a favorable marketplace for, and promote the development of, inexpensive, high-quality, and effective environmentally friendly masks in order to achieve the ultimate goal of green transformation of anti-epidemic supplies in the post-pandemic era. Since the outbreak of the COVID-19 pandemic in 2020, with several iterations of the epidemic, non-pharmaceutical interventions, such as indoor facemasks, lateral-flow testing, etc., have been studied and recognized by researchers and used by governments . Polypro2 emission from 0.06 kg/piece to 0.036 kg/piece, along with other pollutants [To alleviate the environmental deterioration caused by the sharp increase in medical waste, researchers have explored new ways to effectively reduce the pollution from medical waste, and it has been shown that reusable masks have a positive effect on reducing the environmental burden. If properly disinfected, reusable masks can maintain the same filtering effect as disposable masks ,11. Morellutants . Lee et llutants  discoverllutants , Swennenllutants , and Thollutants  studied llutants  and the llutants , collectWith the continuous development of EFMs, some countries have recognized their economic and environmental advantages and have begun to produce and promote them. The EFL reusable face mask developed by Singapore Forever Family Co., Ltd. (Singapore) can be reused 30 times and is certified by EN14683 and ASTMF2101, meaning that this type of reusable face mask has the same performance characteristics as disposable surgical masks . The HonHowever, the promotion process of EFMs is not smooth. Scholars have found that, owing to the influence of cleaning, price, trust, and other factors, consumers are prone to form negative attitudes toward EFMs. Moreover, owing to the relatively complex washing procedure, not all consumers are willing to use EFMs. Incorrect cleaning methods can destroy EFMs\u2019 protective performance and increase the risk of viral infection . FurtherIn response to the difficulties encountered in the promotion process, scholars have suggested that government regulation is an important solution to consumers\u2019 possible negative attitudes toward EFMs. Makki et al.  believe Government regulations not only directly affect consumer behavior, but also affect enterprise production behavior, indirectly affecting consumer behavior and reducing environmental pollution. Environmental regulation is beneficial to improve the green technology innovation level and to promote and upgrade green transformation ,27,28,29What is the impact of government regulations on green transformation?How do enterprises and medical institutions make decisions in the presence of government regulations?What are the factors influencing the green transformation?After reviewing the above literature, this paper found that in reality, there are contradictions among various stakeholders in the use, production, and promotion of EFMs. These contradictions cause stakeholders to interact with each other in the selection process, and it is necessary to continuously adjust and improve their strategic choices to gradually reach a balanced state. This paper attempts to address the following three questions:To address these questions, this paper proposed an evolutionary game theory based on bounded rationality. Evolutionary game groups gradually achieve stable strategy equilibrium through processes such as selection, imitation, or mutation that can describe the changing trend of group behavior, predict individual strategy choices and final states, and study and discuss the behavior of interest groups ,36. EvolIn the study of green transformation, Sun et al.  used an The COVID-19 pandemic will continue, even if most people are vaccinated . The conPromoting green transformation requires joint efforts by governments, enterprises, medical institutions, and market consumers. However, the process of green transformation is easily affected by factors such as irrationality and information asymmetry among groups or individuals. Simultaneously, there are significant differences in interest appeals between different stakeholders. To predict equilibrium states in unstable environments, Smith and Price  proposedThis study adopted an evolutionary game approach, considered the repeated interactions of multiple enterprises, medical institutions, and governments, and predicted tripartite evolutionary stability strategies. Government strategies include regulating and deregulating the use and production of EFMs, abbreviated as \u201cregulate\u201d and \u201cderegulate,\u201d respectively. The strategies of enterprises include increasing and not increasing the production of EFMs, abbreviated as \u201cincrease production\u201d and \u201cno production increase,\u201c respectively. The strategies of medical institutions include using EFMs, and using disposable medical masks or disposable regular masks, abbreviated as \u201cuse EFMs\u201d and \u201cuse regular mask,\u201d respectively.Compared with regular masks, EFMs have the same indicators, that is, the protection ability and comfort are the same, except for the difference in reusability, cleaning, and replacement.The number of masks used daily by medical institutions is fixed. Therefore, the increase in the use of EFMs is equal to the reduction in the use of regular masks.The market price of any type of mask does not change with the increase or decrease in supply or demand.The difference between the cost of detergent, electricity, and labor, and the advantage of reusable EFMs, is the cost benefit of these masks. The cost benefit is positive if the savings from using EFMs exceed the cost of reuse. Otherwise, the cost benefit is considered negative ,54.Liquidated damages for the termination of medical institutions\u2019 purchase of ordinary masks imply that medical institutions have long-term purchase orders for regular masks. If medical institutions reduce orders for regular masks, they must pay liquidated damages .The study made the following assumptions:The specific model parameters and the evolutionary game payoff matrix are shown in Consider that the proportion of government regulations is According to the expected payoff expression of governments, the replicator dynamic equation of governments is:x on the evolutionary stable equilibrium strategy of all governments is calculated as:The influence of Consider that the proportion of enterprises increasing production is According to the expected payoff expression of enterprises, the replicator dynamic equation of enterprises is: The influence of Consider that the proportion of medical institutions that use EFMs is According to the expected payoff expression of medical institutions, the replicator dynamic equation of medical institutions isz on the evolutionary stable equilibrium strategy of all medical institutions is calculated asThe influence of Proposition\u00a01.The proportion of government regulation decreases with an increase in the proportion of enterprises that have increased EFM production.Proof.\u00a0Let When When When Proposition\u00a02.The proportion of government regulation decreases with an increase in the proportion of medical institutions using EFMs.Proof.\u00a0Let When When When Similarly, obtain Proposition 3 and Proposition 4.Proposition\u00a03.The proportion of enterprises that increase EFM production increases with an increase in the proportion of government regulations and the proportion of medical institutions using EFMs.Proposition\u00a04.The proportion of medical institutions using EFMs increases as the proportion of government regulations and the proportion of enterprises that produce EFMs increase.Proposition\u00a05.When reputation loss is greater than the critical reputation loss, the government group will choose to regulate, regardless of the decisions made by medical institutions. When reputation loss is greater than the critical reputation loss, the government group will choose to regulate, regardless of the decisions made by enterprises.Proof.\u00a0Because When Setting Similarly, getSetting Proposition\u00a06.When reputation loss is less than the critical reputation loss, the proportion of government regulations increases as reputation damage increases. The proportion of government regulations decreases as government regulation costs and subsidies increase.When reputation loss is less than the critical reputation loss The proportion of enterprises producing EFMs decreases with an increase in liquidated damages for the termination of medical institutions\u2019 purchase of ordinary masks, EFM production machine transformation costs, and the average cost of EFMs. On the contrary, the proportion of enterprises producing EFMs increases with an increase in the average price of EFMs and subsidies for enterprises.The proportion of medical institutions using EFMs decreases with an increase in the average price of EFMs, medical institution management cost, liquidated damages for the termination of medical institutions\u2019 purchase of ordinary masks, and the environmental penalty of medical institutions. The proportion of medical institutions using EFMs and the cost benefit for using EFMs increases as subsidies increase.Proof.\u00a0When As shown in In conclusion, The proportion of government regulation:The proportion of enterprises increasing production,The proportion of enterprises increasing production,The influence of each parameter on the decision of each group is obtained using Equations (16)\u2013(21), as shown in System dynamics simulation is a quantitative feedback method for complex economic systems that uses computer simulation technology to test the accuracy and effectiveness of evolutionary game models through numerical simulations. In this model, this paper used system dynamics simulation analysis to study the impact of variables, such as cost and price, on evolutionary stability strategies to determine the impact of the strategic interaction among governments, enterprises, and medical institutions on the EFMs industry and to test the validity of the model.Government-related variables are: the environmental benefits of using EFMs Enterprise-related variables are: the average price of a regular mask The variables related to medical institutions are: medical institution management cost We drew a flow chart of the system to provide a quantitative analysis of the game players, as shown in The dynamic equation of the system is established according to each variable. We determined the functional relationship between various variables in the system and analyzed the behavioral trends of each subject and the impact of policy changes on the system. This study used data as close to real life or actual data as possible to assign values to the exogenous variables in Simulation analysis was performed using the Vensim system dynamics modeling software, setting parameters as: INITIAL TIME = 0, FINAL TIME = 15, and TIME STEP = 0.05. A simulation analysis of each influencing factor was conducted using the strategic ratios of governments, enterprises, and medical institutions as the main measurement indicators. From the above analysis of the dynamic equation of replication, eight pure strategy combinations can be observed: , , , , , , , and . A stable equilibrium was obtained using the Jacobian matrix.The Jacobian matrix for government regulation of medical institutions using EFMs and enterprises to increase EFM production is as follows:The eigenvalues of each equilibrium point and attributes of the corresponding points are listed in The ESS point is The government\u2019s emphasis on regulation in the early stages of the green transformation of anti-epidemic supplies can promote cooperation among various groups. In the middle of the process, the proportion of regulations peaks and then decreases. Even if the government cancels relevant regulatory policies at a later stage . The government should formulate appropriate rules and regulations to encourage tripartite cooperation for effective epidemic prevention and environmental protection. Furthermore, the government should also actively promote the realization of environmental protection goals without affecting epidemic prevention and control;Through a system dynamics simulation analysis, it is revealed that changes in external parameters have a significant impact on the strategy selection process of all players, as shown in When the cost of using EFMs is the same as, or even higher than, that of disposable masks, medical institutions will treat green transformation negatively and, regardless of government subsidies, it will be hard to complete the green transformation. Therefore, the government should, on the basis of regulations, increase investments in scientific and technological research and development, as well as lower the price and usage cost of EFMs. Moreover, the government should motivate medical institutions to use EFMs, thereby encouraging enterprises to produce EFMs.If there is a penalty for terminating the purchase of ordinary masks for medical institutions and businesses during the transformation period, it can negatively impact the cooperation between the two entities. Consequently, the green transformation process will also be adversely affected.When the reputation damage from government inaction is greater than the cost of regulation, regardless of the initial conditions of evolution, it is always an optimal strategy for the government to regulate the production and use of EFMs. Environmental protection and sustainability are currently among the most important national strategies. People have increasingly higher requirements for the ecological environment, and reputation loss is increasing daily. Therefore, reasonable and feasible regulations should be formulated immediately to realize the green transformation of anti-epidemic supplies.Through the tripartite evolutionary game, this study examined the behavioral strategies of governments, enterprises, and medical institutions, aiming to promote, produce, and use EFMs. The study obtained the dynamic replicator equations and evolutionary stabilization strategies for different groups, conducted a simulation analysis using system dynamics, and drew the following conclusions:The COVID-19 pandemic will continue, and conflicts between medical and environmental protection need to be solved. With the continuous development of EFMs, such as CuMask+, EFL, etc., as the leaders of green transformation, governments, should consider reasonable regulatory measures to promote the production and use of EFMs by enterprises and consumers in order to reduce the contradiction. As a whole, the government should invest management costs and establish a reward and punishment system under the conditions of low manufacturing costs, low price, and low reuse costs in the early and mid-stages of EFMs development. This measure will effectively speed up the green transformation of anti-epidemic supplies. In the mid-transformation period, enterprises and medical institutions will continue to opt for green transformation if the government reduces regulations. In the later stages of the transformation, the government will stop regulating, as enterprises and medical institutions are more likely to produce and use EFMs. Furthermore, there were two interesting findings during the simulation process. On the one hand, liquidated damages imposed by enterprises on medical institutions for terminating the purchase of ordinary masks will have a negative impact on green transformation. Medical institutions, on the other hand, perceive green transformation negatively when the cost of using EFMs is the same as, or even higher than, that of disposable masks. No matter how much the government subsidizes it, green transformation will be hard to complete. Synthesizing the research of this paper, the government should, on the basis of regulations, increase investments in scientific and technological research and development, as well as lower the price and usage cost of EFMs. Moreover, the government should motivate medical institutions to use EFMs, thereby encouraging enterprises to produce EFMs in order to achieve the ultimate goal of green transformation of anti-epidemic supplies in the post-pandemic era.This paper studied the influence of the three players , constructed a replica dynamic system of an asymmetric evolutionary game, and conducted a dynamic simulation analysis. The evolutionary game and system dynamics are used to study the relationship between parameters. By conducting further research on epidemic protection behavior ,38,39, tResearch has shown that the value of external variables directly affects the strategic choices of all players, and the only tripartite evolutionary stability strategy is for governments to deregulate mask production, enterprises to increase eco-friendly mask production, and medical institutions to use them. The optimal strategy for evolution is deregulation. It can be seen that the green transformation of anti-epidemic supplies cannot be achieved solely by relying on government regulations. The best way to achieve it is to promote environmental protection knowledge in various aspects, encourage the use of eco-friendly products, vigorously develop productivity, reduce costs, reduce the production and recycling costs of EFMs, lower the threshold for use and cleaning, and establish a good market environment for EFMs. In addition, it can be seen from the simulation that the production and use of EFMs is a trend in the post-pandemic era. When effective and economical EFMs are developed and produced, epidemic prevention measures undergo green transformation. This further confirms that government regulation has a positive impact on green transformation. This research can help governments, enterprises, and medical institutions to better understand the role of epidemic prevention materials during the green transformation period, as well as serve as a guide for governments in determining the most appropriate regulatory measures.Considering the need for epidemic prevention, this study did not consider environmental fines levied on enterprises by governments. Therefore, enterprises, as the most direct beneficiaries, have an obligation to undertake the responsibility of environmental protection. Enterprises need to invest in research and development to improve the effectiveness of EFMs while considering their own interests. This will encourage medical institutions to consistently purchase and use EFMs and facilitate green transformation. Medical institutions, as the primary practitioners of the green transformation of anti-epidemic supplies, must approach EFMs and other products with optimism, and actively explore ways to make the healthcare sector environmentally sustainable.The simulation research in this study is closely related to the selection of the initial values of the exogenous variables. When the relevant policies are changed and adjusted, the results of each parameter will show different trends. Therefore, future research must establish different models for flexible policies. Moreover, this study does not consider the impact of the supply and demand of new EFMs on the price of existing ones in the market, as well as the impact of consumer preferences on the EFMs market. These factors must be considered in future studies.https://vensim.com/support/ (accessed on 9 April 2022).The system dynamics model was implemented using Vensim PLE for Windows Version 7.3.5  to draw the flow chart of the system and simulation analysis. Specific operational instructions are available at"}
+{"text": "Presently, the COVID-19 vaccine is seen as a means to an end in light of other challenges, such as vaccine inequity. Through COVID-19 Vaccines Global Access (COVAX), an initiative founded to guarantee fair and equitable distribution, vaccine hesitancy remains a critical component that needs to be addressed in sub-Saharan Africa. Utilizing a documentary search strategy and using the keywords and subject headings Utilitarianism and COVID-19 or Vaccine hesitancy and sub-Saharan Africa, this paper identified 67 publications from different databases , which were further screened by title and full text to achieve (n = 6) publications that were analyzed. The reviewed papers demonstrate that vaccine hesitancy occurs against a colonial backdrop of inequities in global health research, social\u2013cultural complexities, poor community involvement and public distrust. All of these factors undermine the confidence that is crucial for sustaining collective immunity in vaccine programs. Even though mass vaccination programs are known to limit personal freedom, the exchange of information between healthcare professionals and citizens must be improved to encourage complete disclosure of vaccine information at the point of delivery. Moreover, addressing components of vaccine hesitancy should involve relying not on coercive public policies but on consistent ethical strategies that go beyond current healthcare ethics toward broader bioethics.  Infectious diseases such as the influenza pandemic, the Ebola epidemic, and other outbreaks have historical, geographical and socioeconomic implications that have become difficult to address even though vaccines are a sure mode of infection control. It is argued that individuals who have access to vaccines and who do not suffer from the adverse effects of vaccinations have a moral duty to be vaccinated and contribute to herd immunity. It is further asserted that the moral obligation to be vaccinated strengthens vaccination policies. The ethical theory of utilitarianism is based on maximizing good, meaning producing the most good for the most people who are equally affected. Furthermore, utilitarianism strives to balance good over harmful consequences by focusing on society rather than individuals . There aHerd immunity is a collective and a public good since it involves the cooperative action of people ; it beneAn ethically framed vaccination policy is essential in a society since it provides fairness, democracy and respect for individuals, which are predicted to increase trust and vaccine coverage . Thus, eMost often, vaccine hesitancy is specific to subgroups and populations, and it is characterized by long-standing anxieties toward vaccine uptake due to reasons such as trust, perceived safety, concerns over restrictive legislation that may seek to mandate vaccination coverage, the motive of the pharmaceutical company that is developing the new vaccines and perceptions of professional expertise and authority ,9. As suVaccine skeptics have been present since the smallpox vaccination exercise carried out in the 19th century. The arguments put forward have been more or less consistent, but with evolving media communications ,11, the The skepticism toward, refusal of and lack of trust in vaccines can be attributed to social, political or safety-related assumptions and concerns indicative of a complex issue . MoreoveThe outbreak of coronavirus disease (COVID-19) led to high morbidity and mortality across the world. Recently, the COVID-19 vaccine was rolled out in many countries. However, there have been reported incidences of vaccine hesitancy in many parts of the world, including in sub-Saharan Africa (SSA), which has a history of hesitation, especially when it comes to the introduction of new vaccines . TherefoRus and Groselj  argue thCountries in SSA have faced challenges in COVID-19 vaccine administration. Some of these challenges include poor infrastructure for distributing the vaccine, limited cold chain facilities and growing vaccine hesitancy . At the This systematic review followed the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) guidelines and is being reviewed for registration into PROSPERO. The documentary search strategy involved keywords and subject headings Utilitarianism and COVID-19 or vaccine hesitancy and sub-Saharan Africa. A review of the journal titles and abstracts was performed to establish a match within the selection criteria. Based on the parameters of interest, this paper included publications that explicitly mentioned vaccines or vaccine hesitancy in the COVID-19 pandemic. The publications that fit the inclusion criteria were obtained for a full-text review. The review excluded publications that reported any form of vaccine hesitancy before the year 2000. This paper utilized a data analysis approach to obtain key details and develop themes for analysis. The data extraction approach took into consideration the publications and database search, study selection criteria, information retrieval and major outcomes . The appThe data extraction approach resulted in identifying 67 publications from the databases that were searched . Out of the 67 publications, 28 publications were duplicates (when screened by title), hence the remaining 39 publications were considered for screening based on title and abstract. After the screening process by title and abstract, 24 publications were excluded as they were not full texts (they were abstracts only), leaving a final pool of 15 publications that matched the keywords and date of publication and were full texts (eligible). A further 9 publications were excluded as they fell outside the scope of the main theme of the review and the remaining 6 publications were analyzed .The results of the reviewed papers demonstrate various levels of vaccine hesitancy which risk undermining the trust that is necessary for sustaining herd immunity in vaccine programs. The first paper, by Afolabi and Ilesanmi , reportsThe paper by Flint  discusseNihl\u00e9n  analyzesThis paper aimed to investigate vaccine hesitancy in sub-Saharan Africa in the context of the COVID-19 vaccination exercise using utilitarianism, which is an ethical theory that prescribes the maximization of a common good. As such, utilitarianism promotes collective good while preserving as much freedom as possible. In this case, an effective rollout of COVID-19 vaccinations and acceptance offers the most promising protection from severe disease, which enhances wellbeing and maximizes utility. Moreover, utilitarianism provides an outlook broader than the individual toward the collective, in this case, the community; thus, public health prevention of COVID-19 is a utilitarian goal since it prevents the public transmission of the virus. Therefore, individuals have a moral obligation toward the collective for a positive outcome ; the morThe reviewed papers demonstrate that vaccine hesitancy in SSA occurs against a backdrop of colonialism and inequities in global health research, social\u2013cultural complexities, poor government response in debunking social and traditional media theories and poor community involvement in public health measures. In addition, there is public distrust resulting from delayed responses to border closures and the importation of the virus to Africa; conspiracy theories advanced by social influencers, religious leaders, anti-vaccinists and political leaders; and the anticipated and observed vaccine side effects. All of these factors undermine the confidence that is crucial for sustaining collective immunity in vaccine programs.This systematic analysis found that the utilitarian goal of promoting public health practices during a vaccination process considers the ethical concepts of personal liberty, freedom of consciousness and the right to autonomy ,12. The In the quest to remedy vaccine hesitancy, it has been earlier suggested that governments communicate vaccine risks and benefits in a responsible manner and take responsibility for individuals negatively affected by the adverse effects of the vaccines . FurtherThis systematic review identified 67 publications, but only 6 were included for the analysis of COVID-19 vaccine hesitancy in SSA. The other limitations that were encountered during the systematic review include the following: First, at the onset of the pandemic, the low-resourced nature of many African countries made it challenging to report on the current state of COVID-19 vaccines in the continent. Second, there was the challenge of finding literature that solely tackles religious, cultural and other context-specific concerns relating to vaccine information trends in the African continent. Third, certain persistent challenges in vaccine rollout fall within narrow and clinically oriented modes of thinking. Fourth, vaccine hesitancy is not a new phenomenon, but the current arguments that vaccine skeptics have raised have remained more or less consistent in light of recent developments, as portrayed in traditional and contemporary media. Fifth, COVID-19 vaccines have been shown to have benefits that outweigh the risks; however, studies that contextualize this phenomenon as it relates to vaccine hesitancy in SSA are still few in number.Vaccine hesitancy is a growing problem that threatens vaccination uptake; thus, it is essential that governments and other stakeholders understand why individuals are hesitant and what actions can be undertaken to minimize hesitancy. First, addressing vaccine hesitancy requires improving the exchange of information between healthcare professionals and citizens, complete with full disclosure of vaccination information at the point of delivery. Furthermore, addressing vaccine hesitancy should involve relying not on coercive public policies but on an ethically consistent strategy that goes beyond current health care ethics and toward broader bioethics. In doing so, the citizens of SSA will have the right to education, the right to make informed decisions for themselves and the right to support and advise persons who may hesitate to take vaccines. Second, the misconceptions around the COVID-19 vaccine hinder the anticipated success of vaccine rollout. Therefore, response strategies need to be adopted to address misconceptions, and all potential hindrances to vaccine acceptance need to be proactively addressed in a culturally and language-sensitive manner that involves sociocultural influencers and engages community leaders. Third, identifying previous biomedical histories could help to avoid past problems related to clinical trials and vaccine rollout as this may contribute to rethinking and creating more equitable relations in terms of global health. Fourth, there is a need to achieve vaccine confidence through public health, which entails having programs broader than the delivery of the vaccine technology. Moreover, developing a COVID-19 vaccine should not be the sole indicator of a successful response nor an indicator of an improved public health system but a determinant of vaccine confidence. Fifth, effective communication in vaccine rollout entails respect by not treating vaccine skeptics as ill-informed. Instead, it requires considering the concerns of the vaccine-hesitant. This is because the vaccine-hesitant could change their minds and be open to an inclusive discussion. Inevitably, there will be individuals who will suffer from the side effects of population-based health promotion, but the general public should be able to trust the recommended vaccines since vaccines are among the greatest innovations of all time."}
+{"text": "Recent pandemics have provided important lessons to inform planning for public health emergencies. Despite these lessons, gaps in implementation during the COVID-19 pandemic are evident. Additionally, research to inform interventions to support the needs of front-line nurses during a prolonged pandemic are lacking. We aimed to gain an understanding of critical care nurses\u2019 perspectives of the ongoing pandemic, including their opinions of their organization and governments response to the pandemic, to inform interventions to improve the response to the current and future pandemics.This sub-study is part of a cross-sectional online survey distributed to Canadian critical care nurses at two time points during the pandemic . We employed a qualitative descriptive design comprised of three open-ended questions to provide an opportunity for participants to share perspectives not specifically addressed in the main survey. Responses were analyzed using conventional content analysis.One hundred nine of the 168 (64.9%) participants in the second survey responded to the open-ended questions. While perspectives about effectiveness of both their organization\u2019s and the government\u2019s responses to the pandemic were mixed, most noted that inconsistent and unclear communication made it difficult to trust the information provided. Several participants who had worked during previous pandemics noted that their organization\u2019s COVID-19 response failed to incorporate lessons from these past experiences. Many respondents reported high levels of burnout and moral distress that negatively affected both their professional and personal lives. Despite these experiences, several respondents noted that support from co-workers had helped them to cope with the stress and challenges.One year into the pandemic, critical care nurses\u2019 lived experiences continue to reflect previously identified challenges and opportunities for improvement in pandemic preparedness and response. These findings suggest that lessons from the current and prior pandemics have been inadequately considered in the COVID-19 response. Incorporation of these perspectives into interventions to improve the health system response, and support the needs of critical care nurses is essential to fostering a resilient health workforce. Research to understand the experience of other front-line workers and to learn from more and less successful interventions, and leaders, is needed. As of April 2022, approximately3.59 million Canadians have contracted COVID-19 and just over 38 095 have died from the disease  in 2009,Although shorter than the ongoing COVID-19 pandemic, these incidents provided a number of lessons in how to plan and prepare for future pandemics , 6. MaunDespite these findings, studies of HWs\u2019 experiences during the H1N1pandemic yielded similar results. For example, Mitchell et al.\u2019s study  on the eAgain, despite these findings, the Canadian response to COVID-19 indicates that these lessons from previous outbreaks were not fully considered , 8, 9, wIn addition, while HWs are recognized to play a key role in the ongoing response to COVID-19, several studies have found that their unique perspectives and experiences have often been largely overlooked , 6, 10. However, knowledge is still lacking around whether or not nurses in all fields/specialties are experiencing the impact of the COVID-19 pandemic in similar (or different) ways, with critical care nurses likely to experience unique challenges. For example, critical care nurses are often at an increased risk of COVID-19 infection as they spend more time directly caring for critically ill patients, and are exposed to higher risk procedures (i.e. aerosol generating procedures) that require reliable access to PPE specific to this higher risk setting. In addition, the complex needs of critical care patients and their families may be particularly difficult to meet within the context of the both human and material resource shortages experienced, and infection control restrictions encountered during the pandemic, which can increase both the physical and psychological/emotional toll on nurses in this setting. By identifying unique challenges faced by critical care nurses during this pandemic, policy makers and health care researchers can design interventions and strategies tailored to support the unique needs of critical nurses on the front lines of future pandemics.This manuscript reports the findings of a sub-study, which is part of larger study aimed at evaluating nurses\u2019 readiness to follow infection prevention and control guidelines in the workplace, and to understand their perceptions of trust in organizational preparedness, communication, and their perceptions of personal risk. The aim of this sub-study was to gain an understanding of critical care nurses\u2019 perspectives of the ongoing COVID-19 pandemic based on their lived experiences, including their opinions on how their organization and various levels of government responded to the pandemic. The overall goal of the sub-study is to inform interventions to improve the Canadian health care systems response to both the current and future pandemics, including interventions to support the unique needs of critical care nurses.This sub-study is part of a larger study that used a cross-sectional online survey to assess the perspectives of Canadian HWs at two points during the COVID-19 pandemic. A detailed description of the original survey's development and findings was previously published . The oriThe sub-study questions were purposely designed to provide an opportunity for participants to elaborate on questions from the larger survey, and to allow for the emergence of perspectives of importance to participants that were not specifically addressed in the main survey. Open-ended questions capture data that cannot be obtained using quantitative surveys alone , 16. OpeFor the second distribution, we employed convenience sampling via the email distribution list and slack channels of the Canadian Association of Critical Care Nurses. This is a large national network of critical care nurses (1100 list serve members), which was felt to be representative of nurses in a variety of Canadian critical care settings  \u201care expected to wear the same mask in and out of COVID rooms for the duration of that period\u2026this prolonged wear [is] uncomfortable and sometimes the mask seal is sketchy after several hours\u201d. In addition to PPE shortages, participants also noted shortages in medical supplies, including inadequate supplies of oxygen during COVID surges, a lack of bed space for patients, and improperly ventilated hospital rooms.\"We need higher baseline capacity of ICU beds and staff. We learned quickly that physical space and equipment were not the bottleneck. It was experienced ICU nurses.\"Severe staffing shortages were noted to be an ongoing and constant concern throughout the pandemic for most respondents. Staffing shortages worsened over the course of the pandemic due to illness and issues around retention, and the redeployment of nurses to address staffing shortages in critical areas. As one respondent noted, it was the lack of human resources more so than material resources that made it difficult to manage high volumes of patients during surges in the pandemic:As well, many respondents felt there were several times when \u201cnurses [ended] up doing everyone\u2019s job\u201d and had \u201cto pick up slack\u2026when they were already stretched too thin\u201d. This left many participants feeling overwhelmed as reported below in the \u2018Impact on Staff\u2019 section of the results. In order to address critical staffing shortages, many organizations redeployed their staff into different roles.Participants\u2019 perspectives about redeployment to different positions within the hospital were generally negative and were usually tied to views about the quality of training received by redeployed staff. As one respondent shared, their organization did not \u201chave transparent information on how people are being redeployed and how it [was] happening\u201d. Likewise, another participant said, \u201cI\u2019m a PICU RN forcefully redeployed to bedside care in adults. It has been an experience, little to no training\u201d. Some respondents also expressed frustration about having to work with redeployed staff who did not know how to work in specific areas, or as one respondent shared, \u201cI am stretched to the limit working with inexperienced poorly trained \u2018extenders\u2019\u201d. Likewise, another participant stated, \u201credeployed nurses: some do bedside [care] and some do not \u201d.Subthemes under this theme focus on preparedness to respond and actual response to the pandemic with respect to public health policy and guidance at both the government and organization levels.Respondents\u2019 perspectives about the effectiveness of both their organization\u2019s and the government\u2019s ongoing response to the pandemic were mixed. As one respondent stated, \u201cI think we have been lagging behind in the pandemic in both organization and governmental response\u201d. Another participant wrote, \u201cnothing has changed in my facilities\u2019 approach to this pandemic\u2026 [we] did not implement any rules or guidance after H1N1\u2033. In addition, eight respondents specifically noted that \"nothing\" or \"not enough\" was done by the government and/or their organization. On the other hand, another participant shared that their hospital has done well [by] providing staff with regular education\u2026ample PPE\u2026 [and] frequent organizational updates on the status of our response\u201d.Many participants agreed that the government\u2019s response was inadequate. As one participant shared, the \u201cgovernment [responded] too slowly to rising cases [and] is too passive with enforcement of restrictions\u201d and another said, \u201cthe provincial and federal governments need to listen to experts in [the] field\u2026 [they] should have kept lockdown in Jan 2021 longer\u2026 [governments] too worried about businesses\u201d. While the majority of respondents shared negative views on this point, some noted that \u201cthe government, both provincial and federal, sought out the best advice available\u201d and others wrote that their provincial government \u201chad done an incredible job in coordinating limited provincial resources to relieve hospitals\u2026done an amazing job in promoting and organizing COVID 19 testing\u201d.Respondents also had mixed views with respect to organizational pandemic preparedness and policy. While some felt that their \u201chospital[s] had done well\u2026 [in] providing staff with regular education on prevention and control and\u2026and frequent organizational updates\u201d, others found their organization\u2019s response to be \u201cvery unorganized\u201d and found it \u201chard to think of anything they've done well\". As one respondent shared, \u201cthe constant changing policies made a difficult situation worse\u201d as it left them wanting a \u201cbetter sense of transparency\u201d from their organization\u2019s leadership teams.\"I have worked through the AIDS crisis, SARS, MERS, H1N1 and now this\u2026from my experience very little was learned in the previous crisis situations\u201d.Several participants, who shared that they had worked during previous infectious outbreaks (i.e. SARS and H1N1), expressed concern when it seemed like their organization\u2019s pandemic policy had not taken into account lessons learned from these previous experiences:Some respondents attributed this to a lack of pre-planning and a failure to \u201cimplement any [new] rules or guidance after H1N1 [which] leads to last minute and dangerous decisions\u201d in the midst of an ongoing crisis.This theme focused on leadership at both the government and organizational level, with effectiveness of communication frequently noted as a specific aspect of leadership.\"The provincial government\u2026refused to listen to the health care professionals and scientists \u2026... NO ONE asked for or sought out critical care nursing opinion. There is a GREAT divide between federal and provincial health care responsibilities. Communication between the two is very sadly lacking.\"Participants\u2019 opinions about the quality of government leadership were generally critical. As one respondent stated, \u201cI don\u2019t believe our government  have handled this pandemic well. They have lacked transparency and clarity, which has only enhanced public mistrust and has negatively impacted people\u2019s willingness to comply with public health measures\u201d. Some participants also felt that government decision makers did not listen to advice from health care professionals:Participant views of hospital leadership and communication were mixed. Some participants expressed positive views of the leadership and communication within their hospitals by saying \u201cI think [managers] are doing their best. We have support with PPE for code blues, management and upper leadership tries to make themselves available to hear about issues\u201d. Likewise, \u201cour unit managers were honest with us every step along the way, recognizing errors that were made and good decisions that were taken. Every week, they told us what the plan was for the following week\u201d. However, other respondents shared views critical of hospital leadership: \u201cWe are flying by the seat of our pants, the expectations for front line staff are unclear, and even when they are clear no one in management takes responsibility to ensure the expectations are met\u201d. One participant wrote, \u201cI have never been as disappointed and saddened by the response from nursing executives and nursing managers as I am during this pandemic\u201d.Although somewhat mixed, one of the most common critiques that participants had about both their organization\u2019s response and the effectiveness of leadership at all levels , focused on the quality and frequency with which they received information. While one respondent noted that, \u201cthe hospital tried to keep staff up to date on the ever changing rules regarding COVID-19\u201d, others noted a variety of problems with communication. As another participant stated, \u201cwhen directives are being changed almost daily, it leads to lack of trust in the system. Recognizing that knowledge on a virus changes frequently and protocols are adapted to meet the growing body of knowledge, it must equally be recognized that making frequent changes can be unsettling to bedside staff and develop a sense of dishonesty and lack of trust\u201d. Miscommunication occurred at multiple levels according to respondents. Several pointed out that unclear messaging at both the organization and government levels made it difficult to trust the information being shared at all levels.Subthemes under this theme reflect specific categories of participants\u2019 personal and professional life noted to have been impacted by the pandemic. While categories overlap or occur together in some cases, subthemes are titled to reflect relatively distinct categories to facilitate understanding.For many participants, working on the front lines of the pandemic has \u201cbeen exhausting\u201d and several reported feeling \u201cstretched to the limit\u201d. Many respondents shared this perspective, with several noting that the toll the pandemic has had on nurses was largely overlooked by both their organization and various levels of government. Or, as one participant stated, \u201cI don\u2019t feel like sharing anymore because no one listens\u201d. While there was some variation in how participants described these feelings, many responses reflected strong feelings of \u2018burnout\u2019 and \u2018moral distress\u2019.A number of respondents noted \u2018burnout\u2019 to be a common issue among nursing staff. As one participant wrote, \u201cstaff is being burnt out fast\u201d. Many respondents felt like they \u201creceived very little support from [their] management teams for the sacrifices [they have] made to care for the sickest of the sick\u201d and at times made them feel like \u201cthey were doing everyone\u2019s job [and] were stretched too thin\u201d.There were several respondents who made note of the \u201cneed [for] more outlets to help with the mental health of staff\u201d and some also shared that a loss of a loved one to COVID-19 amplified these feelings. There was a shared perspective among many respondents that \u201cthe long-term effects of this pandemic will be felt for years to come\u2026[and] we need a strategy to address the mental health toll this pandemic is taking on our staff\u201d.\"the current situation makes me feel unprepared to care for my patients in the ICU. We often have 2-3 patients per ICU nurse\u2026in the event of an acute deterioration you are really stretched for ICU level help\u2026if more than one patient deteriorates it is traumatizing to staff who are unable to get any assistance.\"Several participants noted experiencing substantial feelings of moral distress caused by patient suffering and/or loss, and their inability to provide optimal care. As one respondent shared,Another respondent described distress due to the understaffing of COVID units, which caused patients to suffer tremendously because of \u201cthe poor care that was given due to lack of staff, untrained staff\u2026as well as absent intervention[s] by management team[s] to improve conditions for isolated patients\u201d.Many respondents also shared how they watched their patients suffer alone and that it was \u201cextremely difficult [to interact] with families when they are unable to be at the bedside of critically ill patients\u201d. This added to feelings of moral distress for many participants because \u201cillness and deaths are one thing but [when] so much more suffering [is] created not only by disease but by policies and planning that seem misguided or ineffective\u201d it becomes overwhelming and impacts how people do their jobs.\"This has been the most stressful year of my professional practice. I\u2019ve been constantly inundated with all things COVID. There has been nowhere for me to escape it-personally or professionally.\"A number of respondents shared that both working and living through the pandemic has also taken a significant toll on their personal well-being and sense of safety:Several participants also described how they \u201creceived very little support from [their] management teams for the many sacrifices [they\u2019ve] made\u201d and have \u201ccontemplated leaving [their] career\u201d. Or, as one respondent shared \u201cit's been very scary & challenging\u2026the hardest time\u2026within\u2026my 25\u00a0years as an RN\u201d.Participants also worried about the safety of their loved ones and described the burden of carrying the extra \u201cstress of infecting family members\u201d. Some also described the day-to-day struggle they had figuring out how to manage things like \u201cchildcare when spouse[s] also work shift work and [were] unable to work from home\u201d. As well, several respondents talked about their personal safety when sharing their experiences of being pregnant during the pandemic and described it as \u201cvery stressful\u2026 [especially] with little research on the vaccines\u201d impact on pregnancies.\"I have noticed an ongoing lack of care for nurses. I hide the fact that I am a nurse as people react poorly in many cases. Even friends have made comments\u2026that indicate that they feel I am a cesspool of the COVID-19 virus.\"Negative public opinions about nurses had a significant impact on a number of our respondents, and greatly affected their sense of well-being and at times their personal safety as well. As one participant shared:This sense of frustration was shared by a number respondents who were angry to \u201csee and hear members of the public [continuously] saying that masks don\u2019t work and restrictions don\u2019t work and that the pandemic is a hoax\u201d, when \u201cevery shift [they] see physical evidence of the reverse of all those statements\u201d. The majority of people outside of hospitals \u201chave very little idea of what is going on behind the hospital doors\u201d and there was consensus among participants that if more people understood the realities of the pandemic \u201cmore people would follow the public health guidelines and\u2026give real support to the healthcare workers\u201d.Lack of professionalism or work ethic among some HWs was a theme noted principally by senior nurses, . As one participant stated, \u201cas a critical care nurse in a tertiary hospital, we are doing everyone\u2019s job\u2026just about everyone is abusing us and taking advantage of us\u201d. Likewise, another participant said, \u201cour allied health staff are not supporting nurses at all\u2026none of us are on the same page\u201d. Several respondents expressed dismay over \u201cthe lack of compassion and work ethic in young nurses coming into [the] profession\u201d.\"We emptied the hampers because hospital assistants do not come into \u201cisolation rooms\u2026respiratory techs ask nurses to adjust vents (ventilators) settings because they would not want to \u2018expose\u2019 themselves. It means nurses have to pick up the slack\".In some cases, respondents indicated that this lack of professionalism was also a failure in morality as \u201cit is morally wrong to come to work to do nothing\u201d and in other cases participants noted that it was because other health care professionals were scared of being exposed to the virus:Some respondents noted that better resources for Staff Wellness would be beneficial. As one participant stated, \u201cthere isn\u2019t appropriate supports in place for staff wellness as this pandemic rages on\u2026the [current] wellness program [was] created [with] strategies that they thought would benefit people without asking us what we need\u201d. Or, as one participant shared, \u201ccreating a program without consulting what trained professionals need to support them\u201d will just mean the program is ineffective.Several participants also expressed interest in receiving financial compensation for their efforts or talked about the way financial incentives could be used to offset the increased burden they experienced while providing care during the pandemic. As one participant wrote, \u201cI would like pandemic pay to be carried through the entire pandemic for health care staff. It is a small way of [showing] appreciation\u201d. Higher pay wages for nurses may also keep them in their jobs\u201d. Some of these opinions were driven by the belief that by putting themselves at risk and \u201cworking in stressful riskier environments\u201d they needed the incentive and support to \u201cfeel better about getting up everyday to risk [themselves] and [their] families for others\u201d. Others expressed feeling that their knowledge and expertise were not recognized or valued, as one participant noted [there is a lack of] \"The recognition that a nurse is not a nurse. They are specialists in their roles\".Our sub-study of critical care nurses\u2019 perspectives 1\u00a0year into the COVID-19 pandemic highlight important insights from the unique lived experiences of individuals working on the front lines of this ongoing crisis. Overall, respondents reported that working in critical care during a pandemic was highly stressful and that these feelings of stress were amplified when respondents did not feel supported by their organization and/or government. In our study, the majority of respondents noted that inconsistent and unclear communication had a significant impact on their personal sense of well-being and while our study captured a variety of views, participants\u2019 perspectives on these points were generally quite critical.Our findings in this sub-study, with respect to perceptions of organizational preparedness and communication, align with the results from round two of this survey and suggests there has been a shift in critical care nurses perspectives from round one of the survey conducted in 2020 . SilverbHowever, responses to the 2021 survey showed a significant drop in perceptions of the readiness, honesty, and trust in institutions to act in the best interests of citizens at the level of region and national governments . Our subOur findings are consistent with previous research that defines burnout as the \u201cemotional exhaustion, depersonalization, and [a] diminished [sense] of professional achievement\u201d , 23, witPrevious research has also shown that pandemics can have a significant psychological, physical, and emotional impact on nurses , 23, 24.Although there is an increasing number of studies detailing the experiences of nurses during the pandemic, there are few focused on the specific perspectives of critical care nurses. As Rh\u00e9aume et al. note, specific research is needed in this area because critical care nurses often face a number of challenges that are unique to their field of practice . ExampleSimilarly, a study by Moradi et al. also found that the challenges faced by critical care nurses are unique and directly related to the type of care they provide patients . This stOur research adds to this body of knowledge by providing critical care nurses in this study an opportunity to describe their lived experiences of caring for patients during the pandemic. Many of the experiences of our participants in this study were similar to those shared by participants in the studies by Rh\u00e9aume and Moradi. Like the critical care nurses in these other studies, the respondents is this survey also described feelings of moral distress, burnout, and being unsupported by the organization. As a result, our research will also contribute to a better understanding of the unique challenges critical care nurses face and demonstrate why interventions that are specifically tailored to the experiences of critical care nurses need to be developed to bolster the Canadian health care system\u2019s response to both the current and future pandemic.Strengths of this sub-study include the use of an open-ended question format and the timing of the second survey distribution. Open-ended questions provide an opportunity for respondents to expand/elaborate on their perspectives and to introduce concepts not assessed through standard closed-ended survey questions. This allows for a broader understanding of nurses\u2019 lived experience of working on the front lines of a pandemic. In addition, distributing the survey approximately 1\u00a0year into the pandemic provided an opportunity to assess the lived experience of nurses working in the unique context of a prolonged pandemic.Our sub-study also has several limitations. Overall, the response rate to the survey was low. As well, most of the respondents were critical care nurses working in academic hospitals, which may not reflect the experience non-critical care nurses or those working in different settings. Finally, as overwhelming majority of our respondents self-identified as female, we were unable to assess whether gender played a role in respondents\u2019 perspectives.Our-sub study found that approximately 1\u00a0year into the COVID-19 pandemic, although perspectives were mixed in some areas, the lived experiences of critical care nurses continue to reflect previously identified challenges and opportunities for improvement. In particular, challenges with organizational and government preparedness, response, leadership, and communication, were frequently noted, as were failure to adequately recognize the contributions of, and support the health and wellness needs of front line workers.Although the prolonged nature of the COVID-19 pandemic has placed an unprecedented challenge on the Canadian health care system, the experiences shared by the participants in this survey suggest that lessons from early in the current pandemic, and those from prior pandemics, have been inadequately incorporated into interventions to lessen the impact on front line HWs and critical care nurses in particular. Future pandemic preparedness needs to incorporate these perspectives to foster a resilient critical care health workforce.Future work to compare and contrast more and less successful sites, interventions and leaders, and to understand the experiences of other front line HWs, including those working outside critical care in other high burden health care settings such as long-term care, is needed to inform current and future interventions."}
+{"text": "Probiotics may be an ideal choice for these patients, given it can improve the defecation and quality of life of individuals with chronic diarrhoea. However, evidence-based medical research is still limited to support its use as a diarrhoea agent.Lactobacillus plantarum p9 probiotics powder) or a placebo group. Except an independent project administrator who will be responsible for unblinding, the other researchers are blinded. Primary outcome is diarrhoea severity score, and secondary outcomes include weekly mean frequency of defecation, weekly mean stool appearance score, weekly mean stool urgency score, emotional state score, gut microbiome, and faecal metabolome. Each outcome measure will be assessed at the timepoints of pre-administration (day 0), administration (day 14 and/or 28), and post-administration (day 42) to identity inter- and intra-groups differences. Adverse events will be recorded to evaluate the safety of L. plantarum p9.A randomized, double-blind, placebo-controlled clinical trial is designed to pinpoint the efficiency and possible action modes of probiotics for chronic diarrhoea. 200 eligible volunteers with chronic diarrhoea are randomly assigned to a probiotic group  (NO. ChiCTR2000038410). Registered on November 22, 2020,  And an Probiotics always hold the advantages of safety and widely public acceptance . Evidenc22.1L. plantarum p9 or placebo at home and are followed up online via completing designed online questionnaires. For the stool sample collection, volunteers are required to immediately inform researchers as soon as prepared according to instructions, and the researchers timely take it back for further detection. This paper is written according to the Standard Protocol Items: Recommendations for Interventional Trials (SPIRIT) ) 2.3(1)Personal or family history of colon cancer, celiac disease, or inflammatory bowel disease.(2)Confirmed Intestinal organic diseases by colonoscopy.(3)Plans to be pregnant with or father a child in near future, or at the status of pregnancy or breastfeeding in women.(4)plantarum p9 or placebo.Allergies to L. (5)Intaking antibiotics or probiotics within the past two weeks.(6)Intaking antianxiety, antidepressant, or other psychotropic drugs within the past month.(7)Need for long-term use of medications for diarrhoea.(8)History of severe diseases, such as myocardial infarction, cerebral infarction, and malignant tumour, judged by the investigators as disqualifying conditions.(9)Major mental illnesses, inability to control one's actions, or inability to cooperate.(10)Illiteracy, inability to understand the informed consent form, or inability to independently sign the informed consent form.Volunteers have one of the following situations are excluded.2.4The investigators recruit volunteers from the public via oral communication, posters, and dissemination of WeChat official account. With the help of WeChat, a two-dimensional (QR) code is available for volunteers to scan and register for enrolment, submitting demographic data, and answering questions related to inclusion and exclusion criteria. Then, the potentially eligible volunteers will undergo three rounds of screening, as follows.First, the registration information is collected and collated, according to which potentially eligible candidates are invited to participate in a face-to-face consultation with clinicians and researchers for the further screening.Second, a series of face-to-face consultations are organized: 1) Trained researchers introduce the trial to the potentially eligible volunteers through video and information sheets regarding the main aspects of the trial, especially the content of informed consent materials, and discuss the trial with the potentially eligible volunteers. 2) Then, the clinicians also have an informed face-to-face consultation with the potentially eligible volunteers to confirm the registered information, further selecting out potentially eligible volunteers according to inclusion and exclusion criteria to proceed in the next procedure. The selected potentially eligible volunteers are essential to sign an informed consent form directly with a member of data management team (DMT) before proceeding into the next procedure.Third, the potentially eligible volunteers undergo a 14-day screening period. During the third round of selecting, the potentially eligible volunteers are not allowed to take any medicines or health products to improve their diarrhoea symptoms. And each volunteer will be asked to collect one stool sample and complete an online defecation diary . At the 2.5Based on the order of registering during above recruitment, eligible volunteers are given a serially unique number, i.e., 001, 002, 003, 004, 005, and so on. The unique number is used as volunteer's identification card throughout the whole research periods instead of volunteer name or any other information, so as to guarantee confidentiality for volunteers. For each unique number, a random sequence is automatically generated using the computer software by two independent project administrators. The unique number with an odd random sequence is assigned into probiotic group, while the unique number with an even random sequence is assigned into placebo group. During the study, except two independent project administrators, the other participants of the study, including volunteers, treatment packs distributors, data collectors and analysts are blinded to the randomization sequence, namely the grouping. The randomization sequence is maintained by two independent project administrators and will only be unblinded in the case of major safety issues or when performing the interim or final data analysis. Moreover, the probiotics or placebo treatment packs are labelled with the foregoing unique numbers according to the grouping of the unique numbers, and the treatment packs distributors distribute the treatment packs according to the unique number on the packs to the corresponding volunteers, in such a way, allocation concealment is achieved.2.6L. plantarum P9. L. plantarum P9 powder comprises L. plantarum P9 (40%), maltodextrin (20%), orange powder (20%), and maltitol (20%). The placebo comprises maltodextrin (60%), orange powder (20%), and maltitol (20%) and has the same appearance, packaging, and taste as the L. plantarum P9 powder. Both probiotics and placebo packs are stored in a 4\u00a0\u00b0C, dry place away from direct sunlight. At the end of the phase, all unused probiotics or placebo and used (empty) packs are collected, so as to calculate volunteers\u2019 compliance.One probiotics or placebo powder pack per day. One probiotics powder pack contains 100 billion colony-forming units (CFU) of (1)Period of screening (observation period of pre-administrating) (days \u221214 to 0): volunteers do not receive probiotics or placebo. Eligibility screening are performed as described in \u201cvolunteer recruitment part\u201d .(2)L. plantarum P9 powder with warm boiled water (below 40\u00a0\u00b0C) on a full stomach, 1 pack per day ; if volunteers have to take antibiotics during the administration, the probiotics is taken 2\u00a0h later. 2) For placebo group: volunteers take the placebo in the same manner as probiotics group.Observation period of administrating (days 0\u201328): 1) For probiotics group: volunteers take (3)Observation period of post-administrating (days 29\u201342): No interventions are taken during the study.The study is designed to include three phases, a period of screening (an observation period of pre-administrating), an observation period of administrating, and an observation period of post-administrating . The int2.7The following interventions or factors may confound the results of the study and are prohibited: 1) other kinds of probiotics, prebiotics, and foods containing probiotics (such as yoghurt); 2) antianxiety, antidepressant, and other psychotropic drugs; 3) other substances may benefit intestinal symptoms. Furthermore, antibiotics are not advised, and normal dietary habits are recommended during the study. All concomitantly used substances/drugs related to defecation are required to record with an explanation via online daily diary .2.8The primary outcome is the diarrhoea severity score, which is set as to the gastrointestinal symptom rating scale (GSRS) . The outA defecation diary developed with reference to the literatures ,34,37 wi2.9(1)Similarly, based on the diary , the wee(2)The Depression, Anxiety and Stress Questionnaire (DASS-21)  Appendi will be (3)For the indicator of gut microbiome, DNA are extracted from stool sample using the QIAamp Fast DNA Stool Mini Kit . An agarose gel electrophoresis and Nanodrop spectrophotometer are used to examine the quality of DNA. Then, shotgun metagenomic sequencing are performed for all samples using an Illumina HiSeq 2500 instrument. And sequence libraries are constructed by DNA fragments of \u223c300 bp length which obtained from paired-end reads of \u223c150 bp lengths generated by sequencing in bi-directions. In addition, the metagenomic analysis is performed from the following aspects: analysing alpha diversity and beta diversity in each group to determine the intra-groups differences in the microbiota compositions; analysing the inter- and intra-groups taxonomic characteristics at the levels of phylum, genus, and species to identify specific genes related to diarrhoea. Metagenomic biological pathway analysis are used to evaluate the effect of probiotics on the function of the gut metagenomics in patients with diarrhoea and hopefully to explore the metagenomic biological pathways contributing to the mechanism of probiotics on the treatment of diarrhoea.(4)For the indicator of faecal metabolome, briefly, stool samples treated by protein precipitation method and the supernatant are used for liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis. The original data is subjected to peak alignment, retention time correction and peak area extraction through the XCMS-Plus program. The structure of metabolites is identified by accurate mass matching (<5\u00a0ppm) and two-level spectrum matching, and METLIN database is retrieved. After deleting the missing value\u00a0>\u00a050% and normalizing the data, multi-dimensional statistical analysis is performed, like unsupervised principal component analysis (PCA), supervised partial least squares discriminant analysis (PLS-DA) and potential difference metabolite analysis. Metabonomic analysis can further identify the potential differential metabolites of probiotics in treatment of diarrhoea and examine the correlation analysis between the gut microbiota and metabolites.The secondary outcome measures include weekly mean frequency of defecation, weekly mean stool appearance score, weekly mean stool urgency score, emotional state score, gut microbiome, and faecal metabolome.2.10L. plantarum P9 powder will be evaluated as the following four levels: excellent (safe with no AE); good (relatively safe with moderate AEs that disappear on their own without any specific treatment); conditional ; and unsafe  , where k is the number of sample groups in the comparison. More detailed information about how to analyse and present inter-group differences is clearly provided in Then, to identify the intra-group changing trends with the consecutive phases, namely, pre-, during and post-probiotic administrating, the P-value will be generated based on 999 permutations. t-test, Wilcoxon test and Kruskal-Wallis test will be used to evaluate differences in various variables between and within groups; P values will be corrected for multiple testing using the Benjamini-Hochberg procedure. Meanwhile, Pearson and spearman correlations will be used to analyse the correlations between different indicators in clinical, metagenomics and metabolomics.In addition, the statistical analyses of metagenomics and metabolomics will be performed using the R software (v.4.0.2) and Adobe Illustrator. PCA and PLS-DA analysis will be performed and visualized using the R package vegan, ggplot and ggpubr, and the adonis 3Chronic diarrhoea can disturb the patient's quality of life, work performance and wellbeing, increase patient's expenses , and leaL. plantarum p9, belongs to Lactobacillus species, which is one of the most studied probiotics [Clostridium difficile-associated diarrhoea [Some special steps are taken to guarantee the eligibility of volunteers, the feasibility of study, and interpretability of results, including completing diary online daily , face-to-face consultation with the clinical specialist , and stool test  in the 14 days screening period. The study intervention, obiotics ,42 and riarrhoea ,43 and tiarrhoea .L. plantarum P9 on defecation and quality of life in individuals with chronic diarrhoea. Moreover, the study will try to explore the possible action modes of probiotics to improve chronic diarrhoea, from the aspects of gut microbiome and faecal metabolome. Gut microbiome has been found to be altered in chronic diarrhoea patients and may be a cause of chronic diarrhoea [L. plantarum P9 on chronic diarrhoea. Thus, the set of multidimensional outcomes will form a chain of evidence.Multidimensional outcomes are examined to produce a chain of evidence from causal improvements in metagenomic and metabolomic data to clinical symptoms and then to the emotional state. Chronic diarrhoea can disturb the patient's quality of life, work performance and wellbeing ; therebyiarrhoea . Probiotiarrhoea ,26. The A limitation is the way of follow up in this study (completing diary online daily), which may lead to bias about the effectiveness of probiotics. To overcome the limitation, a WeChat group is established for the cohort of volunteers, so the researcher can timely post messages via the WeChat group, keeping a good compliance; and an DMT is formed to promptly assess the study quality and safety. during the assessment, once an uncertainty about the data arises, the DMT can urge the data collectors to resolve it. The confounding factors are also prohibited. In such a way, the bias would be minimized as far as possible.L. plantarum p9 can improve the defecation and well-being of individuals with chronic diarrhoea. If the study findings are as expected, L. plantarum p9, taken as probiotics, may become an optimal nonmedical intervention option for patients with chronic diarrhoea.Collectively, the study protocol will provide high-quality evidence for the use of probiotics as a diarrhoea agent when it is strictly conducted out, providing evidence regarding whether and to what extent 4This study started recruiting patients on October 1, 2020. To date, 174 patients have been enrolled. The enrolment is expected to be completed by October 31, 2022, and all follow-ups are expected to be completed by December 31, 2022. The protocol is 2.0 version, and the date of edition was September 10, 2020.Not applicable.This study was registered at Chinese Clinical Trial Registry (ChiCTR) (NO. ChiCTR2000038410) on November 22, 2020 , and appData sharing is not applicable to this trial as no database is generated or analysed for the current study. And when the study completed, the study results will be released to the public, volunteers, and the general medical community via publishing journal article, with all the related data being available. The process of publication will be independent from the funder and sponsor.National Natural Science Foundation of China (31720103911) to Heping Zhang . Jiangzhong Pharmaceutical Company Limited also is a sponsor and can be contacted to Jianhua Wan at email: wanjianhua@crjz.com. The funders play no role in the design of study, data collection and analysis, or preparation of the manuscript.The trail is supported by the ng Zhang . L. planWJL, The authors declare that they have no competing interests. And the study has not received funding/assistance from a commercial organization."}
+{"text": "Functional outcomes markedly improved with increasing experience in managing IOI.Early poor outcomes of intraocular inflammation (IOI) after intravitreal brolucizumab (IVB) have negatively affected the use of brolucizumab in clinical routine. We wished to identify factors related to the treatment details of IOI involving the posterior segment resulting from IVB for neovascular AMD (nAMD), if these were reported in detail. Articles were retrieved from PubMed, Scopus, ClinicalTrials, and CENTRAL using the following search terms: <Brolucizumab> AND <AMD> AND <intraocular inflammation>. The risk of bias was rated using the JBI Critical Appraisal Tool. We included 31 reports (41 patients and 46 eyes). Patients were 75.9 \u00b1 8.5 years, and 58.5% were female. IOI occurred 41.7 \u00b1 37.5 (median 37.0) days after treatment initiation with 2.0 \u00b1 1.3 (1\u20136) IVB injections. A mean change in visual acuity of \u221214.6 \u00b1 21.0 (median \u22126.5) letters was reported. The mean time from first IOI signs to the initiation of any anti-inflammatory treatment was 3.3 \u00b1 6.2 days, with 63% of the patients receiving systemic corticosteroids as standard treatment. Finally, a period effect was observed, with a change in visual acuity of \u221225.3 \u00b1 27.1 and \u22122.6 \u00b1 7.3 letters in the chronologically first and last third, respectively, of treated eyes (effect size: r = 0.71;  The introduction of anti-vascular endothelial growth factor (VEGF) agents for treating exudative or neovascular age-related macular degeneration (nAMD) in 2006 and diabetic maculopathy (DME) in 2010 has dramatically improved the treatment outcomes of these previously blinding diseases ,4,5,6,7 A major concern related to long-term anti-VEGF treatment for nAMD, but not for DME, is the occurrence of macular geographic atrophy (MA). Permanent VEGF suppression may contribute to choroidal thinning; contrastingly, persistent subretinal fluid may exert protective effects. Treatment with anti-VEGF agents increases the overall risk of MA ,17, whicBrolucizumab is a newer, stronger\u2014regarding its effects on retinal fluid\u2014and longer-acting anti-VEGF agent, which allows a lower rate of incomplete treatment, a reduction in the treatment burden, and an extension of the mean treatment intervals, as demonstrated in two large-scale phase 3 randomized clinical trials (HARRIER and HAWK)  as well Brolucizumab-induced IOI without retinal vascular changes has a mild course in >50% of cases upon the permanent discontinuation of brolucizumab ,37,49. TWe performed a systematic literature search for articles published until 3 November 2022 on the PubMed, Scopus, ClinicalTrials, and CENTRAL databases using the following key terms: <Brolucizumab OR Beovu> AND <AMD OR macular degeneration OR macula> AND <inflammation OR vasculitis OR occlusion OR uveitis>, without any exclusion criterion, based on the PRISMA  guidelines. The full search strategies are presented in the Two independent researchers screened all the articles based on the inclusion criteria, with discrepancies being resolved in discussions. One author extracted the data from all suitable articles in a two-step process. First, all necessary information based on a coding sheet draft was entered, with additional categories being added as appropriate. Second, missing data were specifically searched for in the research papers. All data entries were confirmed by the first author. We extracted the following information: general information including identification (first author and publication year), demographic characteristics , timing and type of pretreatment with other anti-VEGF agents, confirmatory diagnostic tests, treatment of nAMD until the IOI diagnosis, time until IOI treatment, IOI treatment, and treatment outcomes. We only included peer-reviewed journals to ensure an appropriate level of methodological robustness. Generally, inherent bias could not be avoided given the small number of observations per paper and the multiple confounding factors, including time until IOI diagnosis, treatment initiation, treatment route, and therapy duration. The risk of bias was assessed using the JBI Critical Appraisal Checklist for Case Series, which was found to be medium to high due to missing and inconsistent longitudinal outcome reports see  52]. In. In52]. p < 0.05. Statistical analyses were performed using the SPSS software package 28.0.1  and R .Descriptive statistics were applied since we sought to summarize the existing evidence without a control group. Since the data were not normally distributed, we performed group comparisons using the Mann\u2013Whitney U test. For significant results, we also reported the effect size using the Pearson\u2019s correlation coefficient r. All visual acuity results were transformed into early treatment of diabetic retinopathy score (ETDRS) values, where a Snellen decimal best-corrected visual acuity (BCVA) of 1.0 was defined as 85 ETDRS letters. Statistical significance was set at Initially, 568 articles were screened; among them, 31 studies  in the analysis . NotablyThe mean age of patients  was 75.9 \u00b1 8.5 (52\u201394) years; further, 58.5% (24/38) of the patients were females. Until the occurrence of IOI, the eyes had received one to six  intravitreal brolucizumab injections (n = 45). The duration of brolucizumab treatment until IOI development was 41.7 \u00b1 37.5  days. Moreover, 20 and 25 eyes received only one and two to six brolucizumab injections, respectively (one eye was not reported). The mean time from initial IOI symptoms and signs  until any anti-inflammatory treatment  was 3.3 \u00b1 6.2 days ; among them, 13 eyes received immediate (same-day) treatment, while the treatment of 14 eyes was initiated within 1 to 7 days, while the remaining 10 were treated between 8 and 28 days. Accordingly, we could not evaluate the impact of time to treatment. Clinical manifestations  includedTreatment initiation in response to intraocular inflammation  was repoVisual outcomes did not differ between eyes treated with systemic  and local  corticosteroids; however, patients who received local corticosteroids had better visual outcomes 18\u201356 days after onset of IOI. This suggested that the intensity of treatment depended on the baseline severity of the inflammatory signs and vision loss. p = 0.006, effect size: r = 0.71) and \u22122.6 \u00b1 7.3  ETDRS letters, respectively .Furthermore, we assessed the potential impact of the number of intravitreal injections prior to the switch to brolucizumab treatment. We observed no difference in baseline BCVA and temporal changes in vision or in the time from brolucizumab initiation to IOI onset (<20 (5\u201318) injections before switch: 15.9 \u00b1 9.5  days; >30 (32\u201394) injections before the switch: 16.5 \u00b1 13.1  days; Given the extensive real-world reports on the therapeutic potential of brolucizumab to treat newly diagnosed and insufficiently responsive pre-treated nAMD ,31,48,49Notably, only 31 papers referring to 47 eyes sufficiently detailed the outcomes of IOI involving posterior segments, which limited the analysis of several parameters, including baseline visual acuity, the presence of macular involvement, the severity of vitreal infiltration, vascular occlusion and vasculitis, the impact of time to treatment, and the treatment route. Nevertheless, we observed a period effect, which indicated progressive learning as demonstrated by mean losses of 25.3 and 3.2 letters in early and recent cases, respectively. This is suggestive of regained interest in brolucizumab at least in cases with high treatment demand . FurtherIn patients with IOI involving the posterior segment, significant vitreal infiltration may obscure the visualization of retinal details . TherefoSince brolucizumab has only recently been approved for use in DME by the FDA, only one case of retinal arterial occlusion possibly related to brolucizumab has been reported , with noThis systematic literature search assessed all articles related to brolucizumab-induced IOI and its treatment outcomes on a single-patient basis. The reporting quality varied remarkably between the single case reports, which unescapably induces heterogeneity bias. For instance, the time from brolucizumab initiation until IOI was reported in 41/46 cases (89%), but the time from initial signs of IOI involving posterior segment to anti-inflammatory treatment was reported in only 37 out of 46 eyes (80.4%). Even visual acuity before the start of brolucizumab was not always reported (82.6%). The absence of such crucial information hindered addressing important points such as the impact of time to treatment. As indicated by the severity of baseline findings, this analysis of cases reporting treatment outcomes over time may have an inherent reporting bias given that they represent more spectacular cases. Therefore, the real-life outcomes might be even more favorable . This reIn conclusion, our findings of a mean vision loss of 3.2 letters in recently reported cases and the downward trend of reported severe functional outcomes justify the use of brolucizumab from a benefit\u2013risk perspective in cases with insufficient responses to other available and approved anti-VEGF drugs, prior to the establishment of systematic evidence or the development of comparably effective and durable new therapies."}
+{"text": "Unresolved retinal fluid and high injection burden are major challenges for patients with neovascular age-related macular degeneration. Brolucizumab addresses these challenges by providing robust vision gains and superior fluid resolution, with the potential for longer treatment intervals.Brolucizumab has been associated with adverse events of retinal vasculitis and retinal vascular occlusion typically in the presence of intraocular inflammation (IOI). To define the incidence of the adverse events, Novartis convened an external safety review committee, which found a rate of 4.6% for definite or probable IOI, 3.3% for retinal vasculitis, and 2.1% for retinal vascular occlusion in the HAWK and HARRIER trials. Novartis also established a coalition to explore 4 areas regarding the adverse events: root cause, patient characterization, event mitigation and vigilance, and treatment protocols for the adverse events. Based on the coalition findings, a risk mitigation framework was developed. Prior to initiating treatment with brolucizumab, it is important to weigh the potential benefit against risk of adverse events and to consider patient risk factors such as prior history of IOI and/or retinal vascular occlusion. To mitigate the potential for IOI-related adverse events, it is important to conduct a thorough dilated eye examination before each injection and closely monitor patients throughout treatment. Patients should be educated on symptoms of IOI to monitor for. Brolucizumab should not be injected in the presence of active IOI. If an adverse event is identified, prompt and intensive treatment should be considered.Progress has been made in understanding how to mitigate IOI-related adverse events following treatment\u00a0with brolucizumab. Despite the benefit of anti\u2013vascular endothelial growth factor (anti-VEGF) therapy, significant unmet needs exist in the management of patients with neovascular age-related macular degeneration (nAMD). Patients with nAMD may have unresolved fluid, even with monthly injections . In a reIn 2019, brolucizumab received US Food and Drug Administration (FDA) approval for treatment of nAMD, and was subsequently approved in more than 40 countries . BroluciBrolucizumab demonstrated an overall favorable benefit-risk profile in the HAWK and HARRIER trials. At 96 weeks, pooled data showed intraocular inflammation (IOI) in 4.5% of eyes and retinal artery occlusion in 0.9% of eyes treated with brolucizumab 3\u00a0mg or 6\u00a0mg compared with 0.8% and 0.1%, respectively, of eyes treated with aflibercept 2\u00a0mg . DespiteMedical Dictionary for Regulatory Activities (MedDRA) terminology used in the trials. The SRC found a rate of definite or probable IOI of 4.6% in the HAWK and HARRIER trials, which was similar to the incidence of IOI (4.5%) reported by the study investigators [After the FDA approval of brolucizumab , postmartigators , 15; a rtigators , 15. TheIn addition to the SRC, Novartis established a coalition composed of a fully dedicated internal team of 150 Novartis associates, who worked with more than 40 external medical experts from leading universities, hospitals, medical centers, and clinics around the world to explore 4 key areas regarding the AEs: the root cause of the AEs, patient characterization, event mitigation and vigilance, and treatment protocols for the AEs , 12. FinPatients who have persistent retinal fluid and are showing deterioration in vision because of uncontrolled disease with other therapies should be considered as possible candidates for treatment with brolucizumab. Before treatment is initiated, it is important to weigh the potential benefits of brolucizumab against the risks of retinal vasculitis, retinal vascular occlusion, and vision loss. Prior history of IOI, retinal vasculitis, and/or retinal vascular occlusion in the previous 12 months has been identified as an important potential risk factor for IOI-related AEs following brolucizumab , 17. FemA thorough dilated eye examination should be conducted before each brolucizumab injection, and patients should be closely monitored throughout treatment \u201321. The In the event of IOI, retinal vasculitis, or retinal vascular occlusion, prompt and intensive treatment should be considered, , 19 applA thorough root-cause analysis was performed to identify, characterize, and prioritize potential mechanistic drivers of the AEs of interest following treatment with brolucizumab. The parameters studied included but were not limited to manufacturing, pharmacology, antidrug antibodies, neutralizing antibodies, and other immune-mediated mechanisms . Immunog+1 . Every time this patient comes to the clinic, the eye is dilated and examined for inflammation so that any AEs can be promptly treated. A discussion about the risks and benefits of brolucizumab occurs at every visit. The patient reports benefit from coming to the clinic every 3 months instead of every 4 to 5 weeks.The following case study provides an example of the use of brolucizumab to increase treatment durability. A 70-year-old woman, who was diagnosed with nAMD in 2013, required intravitreal injections every 4 to 5 weeks. Treatment history included 15 injections of bevacizumab, 8 injections of ranibizumab, and 37 injections of aflibercept. She received 8 injections of aflibercept in 2019. On August 5, 2019, 6 weeks after an aflibercept injection, the patient showed disease activity, with subretinal fluid on optical coherence tomography (OCT) and best corrected visual acuity (BCVA) of 20/30 . Three weeks after injection with brolucizumab OS (at the time of the urgent visit to the clinic), BCVA OS dropped to counting fingers. Keratic precipitates were visible in the cornea. The anterior chamber showed 3\u2009+\u2009cells and 2\u2009+\u2009flare and the anterior vitreous showed 3\u2009+\u2009cells and 3\u2009+\u2009haze. Intraocular pressure remained at 11\u00a0mm Hg. Fundus examination showed vitreous haze, optic nerve hyperemia, and retinal vessel sheathing (Fig.\u00a0This case is consistent with the finding that IOI with brolucizumab can occur after the first or any subsequent injection , 24, 25.A large unmet need still exists for patients with nAMD, with patients experiencing unresolved fluid, high injection burden, and drop-off in adherence , 4, 5. B"}
+{"text": "At the end of the last ice age, several Atlantic salmon populations got caught up in the lakes and ponds of the Northern Hemisphere. Occasionally, the populations also got locked when the flow of rivers terminated from reaching the sea due to land upheaval. Therefore, the pattern of evolution shaping the landlocked salmon populations is different from the other anadromous salmons, which migrate between the sea and rivers. According to the theories of population genetics, the effect of genetic drift is expected to be more pronounced in the former compared to the latter. Here we examined this using the whole genome data of landlocked and anadromous salmon populations of Norway. Our results showed a 50\u201380% reduction in the genomic heterozygosity in the landlocked compared to anadromous salmon populations. The number and total size of the runs of homozygosity (RoH) segments of landlocked salmons were two to eightfold higher than those of their anadromous counterparts. We found the former had a higher ratio of nonsynonymous-to-synonymous diversities than the latter. The investigation also revealed a significant elevation of homozygous deleterious Single Nucleotide Variants (SNVs) in the landlocked salmon compared to the anadromous populations. All these results point to a significant reduction in the population size of the landlocked salmons. This process of reduction might have started recently as the phylogeny revealed a recent separation of the landlocked from the anadromous population. Previous studies on terrestrial vertebrates observed similar signatures of a bottleneck when the populations from Island and the mainland were compared. Since landlocked waterbody such as ponds and lakes are geographically analogous to Islands for fish populations, the findings of this study suggest the similarity in the patterns of evolution between the two. This was called Foster\u2019s rule or the Island effect. While the dwarfism was owing to the limited resource availability, the absence of predators was thought to be the reason for gigantism. On the other hand, studies based on molecular markers such as allozymes, microsatellites, and mitochondrial sequence data found a reduction in heterozygosity in island populations compared to their mainland relatives10. This could be due to the reduction in the effective population size that is forced by the limited availability of space in islands. The heterozygosity is determined by the effective population size and mutation rate11. Since the mutation rate does not change significantly between the Island and mainland populations of the same species, the decline in the population size leads to a proportional reduction in the heterozygosity. Apart from heterozygosity, recent studies based on whole genome data found a much higher number of runs of homozygosity (RoH) segments in Island populations than their mainland counterparts12. For example, the RoH segments constitute 23% of the mammoth genome from Wrangel Island, but these segments comprise only 0.83% of the mainland European mammoth7.The evolution of vertebrate populations on islands is quite different from that of those living on the mainland. Previous studies observed a reduction in the body sizes of island populations for most of the vertebrates, but an increase was reported in a few small animals15. Most of these studies used the ratio of divergence or diversity at nonsynonymous and synonymous sites (dN/dS) to quantify the mutational load and found that this ratio was much higher in the island population than in their mainland counterparts. For instance, a previous study using 70 phylogenetically independent comparisons of populations from the island and mainland taxa showed that the dN/dS ratios of the former were significantly higher than those of the latter15. Using whole genome data from human populations found a much higher proportion of deleterious SNVs in Greenland populations compared to mainland Europeans13. Furthermore, whole genome-based studies comparing Island and mainland fox8 and kakapo6 populations observed similar results. These studies also observed a much higher proportion of homozygous deleterious SNVs in Island populations than the mainland ones.The accumulation of deleterious mutations is also a hallmark of population bottleneck, and therefore a number of studies compared the deleterious mutation load between the Island and mainland populations18. In a different scenario, salmon populations had also become landlocked when a group of anadromous salmons prevented from reaching back to the sea when the river got terminated. A perfect example of this is the Trongfoss waterfall, which is part of the river Namsen of Norway that was isolated after the land upheaval19. The salmons in this river became landlocked and potentially descended from the anadromous population before the isolation. Hence this was reported to be the only river-living landlocked salmons as others survived in large lakes and ponds19. A previous study using over 6000 SNVs showed that the landlocked salmons in the river Namsen and the lake Byglandsfjorden had lower diversity than their North American and European anadromous counterparts20. Another study using pooled genome sequencing identified genomic regions that showed reduced diversity in the two groups of salmons17. Although the diversity estimates of landlocked salmons are known, many other important genomic signatures, such as the length of RoH, dN/dS ratio, and the accumulation of deleterious homozygous SNVs, could provide evidence for the potential bottleneck that could have occurred in landlocked salmons. Therefore, it is important to examine these genomic footprints in the landlocked populations and compare them with those of anadromous salmons. Since the aquatic animal populations in landlocked waterbodies are isolated from their counterparts in the ocean, this scenario is similar to the isolation of terrestrial animal populations in Islands from their mainland populations. Therefore, the same Island rule will hold true for the landlocked salmon, and the forces of evolution shaping these salmon populations are expected to be similar. Therefore, we examined this by comparing the whole genome heterozygosity, runs of homozygosity (RoH), and nonsynonymous and deleterious SNVs of a landlocked and five anadromous salmon populations of Norway. We also examined the phylogeny of the six populations to understand the relationship between the landlocked and anadromous salmon populations.During the last ice age, salmon populations from the Northern Oceans were translocated to the water bodies such as ponds and lakes in Europe and Northern America and were eventually got locked up after the glacial epoch21. For comparison, we obtained the whole genome data for 24 anadromous salmons belonging to five locations that were selected in order to include those representing a wide geographic area of Norway. The landlocked salmons were from an enclosed part of the river Namsen with a surface area of 12 km2. For comparison, we included five anadromous salmons from the Namsen river that was open to the sea. Additionally, five anadromous salmons from Southern Norway , five from Northern Norway (Tana river), five from the Baltic Sea, and four from the White Sea were included. Furthermore, we included the reference genome data  of river trout  to use as the outgroup  using the bwa aligner22. The mapped reads in the sequencing alignment mapped (SAM) format was converted to binary alignment/mapped (BAM) format using Samtools23. The aligned reads were then sorted based on the chromosomal positions, and then the PCR duplicates were removed using the Picard tool (https://broadinstitute.github.io/picard/). The genotypes for all chromosomal positions were called using Samtools. All 29 vcf files were merged into one file, and this was done for each chromosome. Finally, we filtered biallelic variant sites using an in-house awk script, which resulted in 41 million SNVs. In addition, we also estimated the average read depth for each sample using the \u201cdepth\u201d module of the software Samtool. The total number of sites covered was calculated for each sample using an in-house script. The number of runs of homozygosity segments was estimated using the plink software24 with following parameter (\u2013geno 0.01 \u2013homozyg \u2013homozyg-window-het 0 \u2013maf 0.05). We used the whole genome data of the river trout to determine the direction of mutational change and to identify the derived alleles.The 25 to compute the Neighbour-Joining tree. For generating bootstrap replicates, we randomly sampled SNVs from the genome data and created 500 pseudoreplicates. This was automated using an in-house Perl script, which also called on the program MEGA-CC26 to create an NJ tree for each pseudoreplicate dataset. All trees were then combined and fed to the program RaxML27 to compute bipartisan bootstrap scores for each node. Finally, the program FigTree (http://tree.bio.ed.ac.uk/software/figtree/) was used to draw the tree, and the bootstrap scores were displayed on each node. The genome sequence of Salmo trutta was used as the root for the salmon tree.To examine the phylogenetic relationship using the genome data, we first estimated the genetic distances of all pairwise combinations of six salmon populations and the outgroup . We then used the program MEGAH) is the product of mutation rate (\u03bc) and effective population size (Ne) i.e., H\u2009=\u20094Ne\u03bc28. Recently, using the whole genome data on Atlantic herring29, Siamese fighter fish30, and Malawi cichlid fish31, three studies estimated the mutation rates in these fish to be 2.0\u2009\u00d7\u200910\u22129, 3.5\u2009\u00d7\u200910\u22129 and 3.8\u2009\u00d7\u200910\u22129 per site per generation respectively. Although these estimates were obtained from widely different fish species, their rates were very similar (2.0\u20133.8\u2009\u00d7\u200910\u22129). Hence, we used a middle value of 3.0\u2009\u00d7\u200910\u22129 as the potential mutation rate of salmons and estimated the effective population size by rearranging the formula Ne\u2009=\u2009H/4\u03bc.The heterozygosity . We used a threshold of >\u20094 to designate an SNV to be deleterious in nature. Using the genome annotations, we also identified the highly deleterious SNVs that cause premature termination or loss of function (LoF) of proteins. The keywords \u201cstop_lost\u201d, \u201cstop_gained\u201d, \u201cstart_lost\u201d, \u201csplice_donor\u201d and \u201csplice_acceptor\u201d were used to detect the LoF SNVs.In addition, we also used the GERP scoreshttp://vassarstats.net/tabs_z.html). A Pearson correlation coefficient was used to determine the strength of the correlation. The statistical significance of the correlation was determined by converting the correlation coefficient r to the normal deviation Z, and this was accomplished using the online software r to P (http://vassarstats.net/tabs_r.html).The average number of LoF and deleterious SNVs per genome, along with the standard errors, were also estimated for each genome. The significance between the mean counts was determined using the Z test, and the statistical significance was determined using the software Z to P  smaller than those observed for the five anadromous populations, including the one (Namsen_Bjoera) that was closely located to the former. The estimate for the anadromous Baltic Sea population was 50% higher than that of the landlocked population, and those obtained for other anadromous populations were 72\u201380% higher than that of the landlocked ones. Furthermore, except for the estimate of the Baltic Sea populations, the heterozygosity obtained for other anadromous populations was similar-statistically not different (P\u2009=\u20090.31).We estimated the heterozygosity per site . We then compared the size of the RoH segments, which also revealed that the mean size of RoH segments in landlocked salmons was significantly  higher than those observed for anadromous salmons  negative correlation between the two variables. This suggests that individuals with small population sizes have high dN/dS ratios. Importantly, the dN/dS ratio of landlocked salmons was much higher than that of anadromous salmons, as the mean population size of the former  was much smaller than the latter . This has been clarified in Fig.\u00a0P\u2009=\u20090.0018) higher than those observed for the anadromous salmon populations.To measure the accumulation of deleterious variants, we first used the ratio of nonsynonymous and synonymous variations (dN/dS) see \u201c\u201d. As expP\u2009<\u20090.0001). A similar analysis was performed using genome-wide deleterious SNVs, and we used the GERP score to identify deleterious SNVs (see \u201cP\u2009<\u20090.0001) than those of the latter (457\u2013536). Finally, the analysis using the loss of function (LoF) SNVs also revealed the same pattern  than those observed for the anadromous ones (954\u20131120).We then calculated the number of homozygous and heterozygous nonsynonymous SNVs and plotted their proportions in stacked column graphs. Figure\u00a0NVs see \u201c\u201d. This sNVs see \u201cB. The me latter 47\u2013536. Fi19. The result from the phylogenetic analysis also informs that the genetic relationship is in concordance with the geographical proximity of the salmon populations.Using the whole genome data from anadromous and landlocked salmon populations, we performed phylogenetic and population genomic analyses. The phylogeny of salmon populations suggests that the landlocked salmon separated from the common ancestor of the anadromous populations that currently live in the Namsen (Bjoera) and Suldalslaagen rivers. Hence, the reduction in the population size might have occurred more recently after the separation of the landlocked populations. This is in contrast with other landlocked salmons found in lakes and ponds, which have potentially been locked up after the ice ages36. Furthermore, this result is similar to earlier studies on many terrestrial mammals and birds13. The heterozygosity estimated for the Island populations were 20% to 84-fold  higher than those observed for their respective mainland counterparts8. Second, the number and total size of RoH estimated for the landlocked genomes were two eightfold higher than those of anadromous populations. Earlier studies comparing Wrangel Island and European mainland mammoth populations showed a several-fold increase in the RoH content of the former7. A similar observation was reported comparing the Steward Island and mainland New Zealand populations of kakapo6 and between the wolves of Isle Royale and mainland Minnesota12. These studies showed that the Island populations had higher proportions of both medium-sized (0.2\u20131\u00a0Mb) and long (>\u20092\u00a0Mb) RoH. While there was a significant number of medium-sized RoH in landlocked salmons (Fig.\u00a037.The whole genome-based population genetic analysis conducted in this study provided four lines of evidence of severe bottleneck in the landlocked salmons. First, we observed a much-reduced genomic diversity in landlocked populations compared to anadromous ones. The result from our whole genome data analysis confirms previous studies based on a few microsatellite and allozyme data from a few loci38. Therefore, the high accumulation of potentially harmful nonsynonymous SNVs further confirms the population bottleneck that occurred in the landlocked salmons. A number of previous studies have shown a much higher dN/dS ratio in the Island populations of terrestrial vertebrates compared to their mainland relatives39. Fourth, our findings revealed a much higher proportion of homozygous deleterious SNVs in landlocked salmons than in anadromous populations (Fig.\u00a038, and hence heterozygous SNVs are not allowed to be converted to homozygous ones. Similar patterns were reported in Island foxes8, Isle Royale wolves12, and Greenland Inuit populations13 in comparison with their respective mainland cousins.Third, we showed a much higher dN/dS ratio for landlocked salmons than anadromous ones Fig.\u00a0. The dN/ons Fig.\u00a0. This su2. This is similar to those observed for the water-locked Island populations of terrestrial vertebrates. Therefore, we can predict that the pattern of evolutionary forces shaping the landlocked populations will be very similar to those operating on the terrestrial vertebrate populations living on the Islands.All results of this study point out that there was a significant reduction in the population size of the landlocked salmons after they had been captured in the land-encircled section of the Namsen river with a surface area of 12\u00a0kmSupplementary Information."}
+{"text": "In a previous study, we found that dietary inclusions of Bacillus subtilis (BS) and Macleaya cordata extract (MCE) increased dry matter intake and milk production, while reduced enteric CH4 emission in dairy cows. The objective of this study was to further elucidate the impact of feeding BS and MCE on rumen methanogenesis in dairy cows using rumen metagenomics techniques.Ruminant livestock production is a considerable source of enteric methane , control diet plus BS (BS), and control diet plus MCE (MCE). After 75 days of feeding experimental diets, 12 cows were selected from each treatment for collection of rumen samples for the metagenomic sequencing. Results showed that BS decreased ruminal acetate and butyrate, while increased propionate concentrations, resulting in decreased acetate:propionate ratio. The metagenomics analysis revealed that MCE reduced relative abundances of The present results provided new information for mitigation of enteric methane emissions of dairy cows by feeding BS and MCE to influence rumen microbial activities. This fundamental knowledge is essential for developing enteric CH4 reduction strategies to mitigate climate change and reduce dietary energy waste.Video AbstractThe online version contains supplementary material available at 10.1186/s40168-023-01654-3. To date, CH4 emissions from livestock production account for about 12% of anthropogenic warming [4 from agriculture, with enteric fermentation alone producing 87\u201397 Tg of CH4 per year [4 emissions from ruminants is critical for the achievement of the Paris Agreement\u2019s temperature targets.Anthropogenic greenhouse gas emissions have already raised global temperatures by a mean of 1\u00b0C above pre-industrial levels, with annual emissions continuing to rise, so slowing global warming is a huge global challenge [ warming , as live4 emissions are projected to increase by about 30% in 2050 from 2010 levels [4 emissions can also reduce energy waste and thus improves dietary energy utilization efficiency in ruminants.Dairy cattle and other ruminants play a major role in the sustainability of global agricultural systems. They use microorganisms in the rumen to convert feed resources unsuitable for human consumption into meat and dairy products. In particular, cows produce 80% of the milk in the global human food supply chain . Over th0 levels . Dairy i4 emissions in the ruminant livestock industry. Bacillus subtilis (BS) is a gram-positive bacterium, which can form cold- and heat-resistant spores and has metabolic activity of producing extracellular enzymes [Macleaya cordata, which is a perennial herb of traditional Chinese medicine [Macleaya cordata extract (MCE) has the immune boosting capability, as well as antioxidant, antibacterial, anti-inflammatory, and anti-tumor activities [4 emissions per kilogram of fat-corrected or energy-corrected milk in dairy cows [Feed additives have been widely used to manipulate rumen microbial activity for mitigation of enteric CH enzymes . Studies enzymes , 10. Sanmedicine . Macleaytivities . Our preiry cows .4 emissions from ruminants to cope with the increasing atmospheric concentrations of CH4 depends on our knowledge of the mechanisms of methanogenesis. Deciphering the details of methanogenic mechanisms to propose enteric CH4 mitigation strategies is a subject of growing international concern. Complex rumen microbes enable ruminants to digest fibrous feed through microbial-mediated fermentation; however, this process also inevitably produces CH4. Understanding of the rumen ecosystem can help scientists manipulate rumen microbial activity for the development of sustainable dairy production systems. The metagenomics technique is a culture-independent method that enables the assembly of near-complete microbial genomes directly from metagenomic sequencing data [How to abate CHing data . The meting data . The cur10 CFU/g) and MCE  were fed to each cow individually during morning feeding every day [The experiment was conducted at the Yinxiangweiye International Third Farm . The cows involved in the experiment were managed and cared for according to the protocols approved by the Institute of\u00a0Feed Research of Chinese Academy of Agricultural Sciences. The experiment was conducted with 60 multiparous lactating Holstein cows averaging (\u00b1\u2009SD) day in milk 145\u2009\u00b1\u200912.5 days, milk yield 38.3\u2009\u00b1\u20093.3 kg/day, and parity 2.5\u2009\u00b1\u20090.9. Treatments were as follows: (1) control (CON), (2) control diet supplemented with BS at 50 g/head/day (BS), or (3) control diet supplemented with MCE at 450 mg/head/day (MCE). The control diet was formulated to yield a 43:57 forage-to-concentrate ratio  analysis [The measurements of milk production, milk composition, and enteric CHescribed . Rumen sescribed , 2 h aftescribed ; anotheranalysis . These tTwelve cows were randomly selected from each group for further metagenomic analysis. Total genomic DNA was extracted from each rumen content sample based on modified repeated bead-beating plus column method . DNA inthttps://github.com/najoshi/sickle). The quality-filtered reads were aligned to the bovine genome using BWA (http://bio-bwa.sourceforge.net) to filter out host DNA [https://github.com/voutcn/megahit) [The quality control of each metagenomic sequence reads was performed using Sickle  . Open remegahit) . Assemblmegahit) . Originamegahit) .http://www.genome.jp/kegg/) with an E value of 1e-5. The CAZy annotation was performed using USEARCH (http://www.drive5.com/usearch/). Abundances of KEGG Orthology (KO), pathway, KEGG enzyme, Module, and CAZymes were normalized into counts per million reads (cpm) for downstream analysis. The KEGG modules, pathways, KEGG enzymes, and CAZymes with cpm\u2009>\u20095 in at least 50% of animals within each group were used for the downstream analysis.The rumen microbiota was taxonomically assigned using DIAMOND  against P value of\u2009<\u20090.05 were used in cooccurrence network analysis. The Cytoscape  was used to visualize networks. The \u201cCytoHubba\u201d function in Cytoscape software based on Maximal Clique Centrality method was used to calculate the hubs of microorganisms in the networks.Co-occurrence among the bacterial taxa or archaeal taxa was analyzed using the SparCC program with the default settings. Spearman correlation analysis was performed to associate microbial taxa with functions. Only the species-level bacterial taxa or archaeal taxa with a relative abundance\u2009>\u20090.1% were used in the co-occurrence and correlation analysis, and only those with a correlation coefficient of\u2009>\u20090.6 or\u2009<\u2009\u2009\u2212\u20090.6 and a The randomForest package in R was used for random forest analysis, and rumen microorganisms were used as input of the random forest model. Rank the importance of microorganisms in the model according to mean decrease accuracy score. The UC-RF algorithm was used to determine the best predictive microorganisms based on the maximum area under the curve. The model was further evaluated by applying a 99-fold cross-validation scheme using the rfUtilities package in R . The top three microbiomes were selected to make a correlation heat map with cow phenotypes and rumen fermentation characteristics.P value\u2009<\u20090.05 being considered as significantly different. The abundances of microbial metabolic pathways, modules, KEGG enzymes, and CAZymes were also compared among three groups using Kruskal\u2013Wallis multiple comparisons test, and significant differences were considered by a P value\u2009<\u20090.05. The SPSS 19.0 was used to complete the Spearman rank correlation coefficients and significance tests between rumen microbial taxa, with the P value\u2009<\u20090.05 being considered as significantly different.Cow phenotypes and rumen fermentation characteristics were compared using one-way ANOVA procedure of SAS version 9.2. Rumen microbial domains, phyla, genera, and species were compared using Kruskal\u2013Wallis multiple comparisons test, with the P\u2009<\u20090.01) fat- and protein-corrected milk (FPCM) yield and decreased (P\u2009<\u20090.05) CH4/FPCM compared with CON (Table 3-N in rumen was increased (P\u2009<\u20090.05) by the MCE diet, relative to the BS diet. We detected no effect (P\u2009>\u20090.05) of treatments on rumen pH value and total VFA concentration. However, acetate:propionate ratio was reduced (P\u2009<\u20090.01) by the BS diet, due to decreased (P\u2009<\u20090.01) the molar proportion of the acetate and increased (P\u2009<\u20090.01) the molar proportion of the propionate, compared with CON. Compared with CON and MCE, BS reduced (P\u2009<\u20090.05) the molar proportion of the butyrate.BS and MCE in the diet increased P\u2009<\u20090.0 fat- andMetagenome sequencing generated a total of 1,528,562,031 reads, with 43,673,201\u2009\u00b1\u2009622,514 reads (mean\u2009\u00b1\u2009standard error of the mean) per sample. Furthermore, a total of 1,523,315,546 reads were retained, with 43,523,301\u2009\u00b1\u2009619,687 per sample  and Chao (P\u2009<\u20090.05) indexes compared to the CON group, but there were no differences (P\u2009>\u20090.05) in these measures between the CON and MCE groups  than that of the CON and MCE groups and MCE had a lower Shannon index (P\u2009<\u20090.05) compared to the CON and BS groups , followed by Bacteroides (5.98\u2009\u00b1\u20090.98%), Clostridium (5.48\u2009\u00b1\u20091.03%), and Ruminococcus (3.30\u2009\u00b1\u20090.65%); and the dominant bacterial species included Prevotella ruminicola (5.75\u2009\u00b1\u20091.23%), Prevotellaceae bacterium HUN156 (1.36\u2009\u00b1\u20090.29%), Prevotella brevis (1.36\u2009\u00b1\u20090.18%), Ruminococcus flavefaciens (1.10\u2009\u00b1\u20090.37%), and Prevotella bryantii (1.00\u2009\u00b1\u20090.46%). For differential abundance comparison analysis at the phylum level, the abundance of Proteobacteria was higher (P\u2009<\u20090.05) in the rumen of BS than MCE , while the abundance of Lachnospira was significantly lower in the rumen of the MCE cows than CON and BS cows (P\u2009<\u20090.05). The Oscillibacter was more abundant in the MCE cows than BS cows (P\u2009<\u20090.05)  abundances, while other 4 species  showed lower (P\u2009<\u20090.01) abundances in the rumen of BS than CON and MCE. Furthermore, Firmicutes bacterium CAG 103, Prevotella sp. tf2-5, and Lachnospiraceae bacterium AD3010 exhibited lower (P\u2009<\u20090.01), while Prevotella corporis exhibited higher (P\u2009<\u20090.05) abundances in the rumen of BS than MCE , Firmicutes (41.96\u2009\u00b1\u20094.83%), and Proteobacteria (2.32\u2009\u00b1\u20090.62%); the dominant bacterial genus was Methanobrevibacter (84.09\u2009\u00b1\u20095.73%), Methanosphaera (4.16\u2009\u00b1\u20092.03%), and Methanobacterium (1.12\u2009\u00b1\u20090.27%); the dominant bacterial species included Methanobrevibacter millerae (31.45\u2009\u00b1\u200910.95%), Methanobrevibacter ruminantium (13.86\u2009\u00b1\u20093.04%), Methanobrevibacter sp. YE315 (11.23\u2009\u00b1\u20092.93%), and Methanobrevibacter olleyae (11.46\u2009\u00b1\u20092.85%). For the differential abundance comparison analysis of archaea, no difference (P\u2009>\u20090.05) was found among groups at the phylum level  had a lower abundance in the MCE cows than in the CON and BS cows (P\u2009<\u20090.05); Methanosphaera had a lower abundance in the MCE and BS cows than in the CON cows (P\u2009<\u20090.05)  abundances in the rumen of MCE than CON and BS; Methanosphaera sp. WGK6 and Methanosphaera stadtmanae showed lower (P\u2009<\u20090.05) abundances in the rumen of MCE and BS than CON; four species  exhibited lower (P\u2009<\u20090.05) abundances in the rumen of MCE than BS ; the dominant archaeal genera included \u2009\u00b1\u20090.87%;P\u2009>\u20090.05) in the abundance of the ciliate protozoa among the three groups  in the MCE group  in the rumen of the MCE cows than BS cows  KEGG modules were compared, 20 modules were enriched in the rumen microbiomes of the MCE cows compared with BS cows, five modules were enriched in the rumen microbiomes of the CON and MCE cows compared with BS cows, three modules were enriched in the rumen microbiomes of the CON cows compared with BS cows, and two modules were enriched in the rumen microbiomes of the MCE cows compared with CON and BS cows  profiles and the genes encoding CAZymes were used to identify the functions of the cows\u2019 rumen microbiome. The metagenomic sequences were mapped to 165 KEGG third-level pathways which were considered as rumen microbial metabolic pathways. These pathways belonged to six first-level categories, including \u201cMetabolism\u201d 63.04\u2009\u00b1\u20094.78%), \u201cGenetic Information Processing\u201d (14.46\u2009\u00b1\u20090.83%), \u201cEnvironmental Information Processing\u201d (6.41\u2009\u00b1\u20091.01%), \u201cOrganismal Systems\u201d (5.82\u2009\u00b1\u20092.30%), \u201cHuman Diseases\u201d (5.65\u2009\u00b1\u20091.47%), and \u201cCellular Processes\u201d (4.61\u2009\u00b1\u20090.64%). At the second level, 46 categories were observed, with \u201cCarbohydrate metabolism\u201d (16.07\u2009\u00b1\u20091.12%), \u201cGlobal and overview maps\u201d (10.39\u2009\u00b1\u20090.85%), \u201cAmino acid metabolism\u201d (8.58\u2009\u00b1\u20090.73%), \u201cNucleotide metabolism\u201d (7.54\u2009\u00b1\u20090.57%), \u201cReplication and repair\u201d (6.80\u2009\u00b1\u20090.68%), and \u201cEnergy_metabolism\u201d (6.33\u2009\u00b1\u20090.49%) being the most abundant. When comparing the KEGG pathways identified in the BS and CON groups, a total of top 30 significantly different level-3 pathways, including 10 \u201cHuman Diseases\u201d pathways, 10 \u201cOrganismal Systems\u201d, six \u201cCellular Processes\u201d, three \u201cEnvironmental Information Processing\u201d, and one \u201cGenetic Information Processing\u201d pathways, were enriched in the rumen microbiomes of the CON cows  in the abundance of CAZymes with respect to the CON  in the abundance of genes belonging to those six classes  in the rumen of MCE than CON, one was enriched (P\u2009<\u20090.05) in the rumen of CON and BS than MCE, two were enriched (P\u2009<\u20090.05) in the rumen of CON and MCE than BS; two were enriched (P\u2009<\u20090.05) in the rumen of BS than MCE, while five were enriched (P\u2009<\u20090.05) in the rumen of MCE than BS  in the rumen of MCE than BS  in the rumen of CON than BS, one was enriched (P\u2009<\u20090.05) in the rumen of CON than MCE, two were enriched (P\u2009<\u20090.05) in the rumen of CON and MCE than BS, and four were enriched (P\u2009<\u20090.05) in the rumen of MCE than BS , 65 carbohydrate-binding modules (CBMs), 16 carbohydrate esterases (CEs), 115 glycoside hydrolases (GHs), 87 glycosyltransferase (GTs), and 20 polysaccharide lyases (PLs). The BS or MCE showed no difference (P\u2009<\u20090.05), while had no differences (P\u2009>\u20090.05) between these two additives groups and the CON group  abundance in the rumen of CON and MCE than BS cows, and Actinobacteria showed higher (P\u2009<\u20090.05) abundance in the rumen of MCE than BS cows  in the abundance of the 32 enzymes were observed between the two additive groups and the CON group . In the rumen bacteria of the CON cows, 881 connections (P\u2009<\u20090.05) were found, with the most positive relationships existing among taxa of Bacteroidetes and the most negative relationships existing between taxa of Firmicutes and taxa of Bacteroidetes. The 952 connections (P\u2009<\u20090.05) were found in the rumen bacteria of BS cows, among which the taxa of Bacteroidetes had the most positive relationships, while the taxa of Bacteroidetes and taxa of Firmicutes had the most negative relationships. In the rumen bacteria of the MCE cows, 1507 connections (P\u2009<\u20090.05) were found, with taxa of Bacteroidetes positively correlated with each other but negatively correlated with Ruminococcaceae bacterium P7.Co-occurrence network among rumen bacteria analysis revealed a total of 3340 co-occurrence relationships, with distinct co-occurrence patterns being found in each group of the cows Fig.\u00a0a. In theP\u2009<\u20090.05) were found, with the most positive relationships existing among taxa of Euryarchaeota, the Candidatus Bathyarchaeota archaeon B26.2 negatively correlated with Methanococcus aeolicus, Methanosphaera sp. WGK6, and Methanoculleus sp. SDB. In the rumen archaea of BS cows, 1255 connections (P\u2009<\u20090.05) were found, with the most positive relationships existing among taxa of Euryarchaeota. The uncultured Methanoplanus sp. negatively correlated with Candidatus Methanomassiliicoccus intestinalis, Methanohalophilus sp. T328.1, and Methanosarcina horonobensis. The methanogenic archaeon ISO4.H5 negatively correlated with Methanolobus psychrophilus. In the rumen archaea of the MCE cows, 1257 connections (P\u2009<\u20090.05) were found, and all taxa were positively correlated.Co-occurrence network among rumen archaea analysis revealed a total of 3512 co-occurrence relationships Fig.\u00a0b. In theClostridium sp. CAG 269 and Clostridium sp. 27 14 were negatively associated (P\u2009<\u20090.05) with acetate, butyrate, acetate:propionate ratio, isobutyrate, and pH value, while Selenomonas ruminantium was positively associated (P\u2009<\u20090.05) with acetate, butyrate, and acetate:propionate ratio. Furthermore, both Clostridium sp. CAG 269 and Clostridium sp. 27 14 were positively associated (P\u2009<\u20090.05) with propionate and total VFA, while Selenomonas ruminantium was negatively associated (P\u2009<\u20090.05) with propionate. Of the identified archaeal biomarkers by the random forest model and heatmaps, both Haloarcula rubripromontorii and Methanobrevibacter curvatus were negatively associated (P\u2009<\u20090.05) with acetate, butyrate, and acetate:propionate ratio. However, Halopenitus persicus was positively associated (P\u2009<\u20090.05) with FPCM, and Methanobrevibacter curvatus was positively associated (P\u2009<\u20090.05) with propionate.The random forest model and heatmaps were performed to identify the rumen microbiomes that were related to cow phenotypes and rumen fermentation characteristics Fig.\u00a0a,b. Of t4 emissions per kilogram of FPCM. Both additives have been shown to benefit the health of cattle, BS improved digestion and increased serum IgG and IFN-\u03b3 levels [4 emissions in the BS group.Our results indicated that BS and MCE increased FPCM yields, while decreased CH\u03b3 levels , 32 and \u03b3 levels , 34. In \u03b3 levels , 36 also\u03b3 levels . Therefo\u03b3 levels , 38. VFA\u03b3 levels , and a h\u03b3 levels . The alt4 emissions and lactation performance of dairy cows are largely affected or determined by the rumen microbiome [4 emissions, ruminal microbial composition, and functions, contributing to clarifying the effect of additives on methanogenesis in a lactating dairy cow model.The CHcrobiome , 42. In Selenomonas are regarded as starch-degrading bacteria, and most of their strains can utilize starch to produce acetate, succinate, and propionate [Selenomonas [Selenomonas in the BS was lower than that in the CON, but the molar proportion of propionate was higher. The species Selenomonas ruminantium and Selenomonas sp. AE3005 belonging to the genus of Selenomonas also exhibited lower abundances in the BS than CON. The results of the random forest model and heatmaps showed that the abundance of Selenomonas ruminantium was negatively correlated with the molar proportion of propionate, while positively correlated with the molar proportions of acetate and butyrate, and the acetate: propionate ratio. Ramayo-Caldas et al. [4 yield had a higher abundance of Lachnospiraceae in the rumen. In the current study, the genus Lachnospira was more abundant in the CON cows than in the MCE cows, which could explain, at least in part, the lower CH4 intensity in the MCE cows than in the CON cows.opionate , 44. A penomonas . Inconsis et al.  demonstrMetanobrevibacter is the predominant methanogen in the rumen, followed by Metanosphaera, Methanobacterium, and Metanomassilicoccals [Methanosphaera is an obligate H2-dependent methanol-utilizing methanogen, Metanomassilicoccals and Methanohalophilus are methanol- and methylamine-reducing methanogens. The genera Metanobrevibacter, Methanobacterium, Methanomicrobium, Methanococcus, and Methanoplanus belong to hydrogenotrophic methanogens, which form CH4 through the reduction of CO2. Metanobrevibacter was also the predominant methanogen in the present study. However, S\u00f6llinger et al. [Methanosphaera and Metanomassilicoccals may account for a larger share of overall CH4 production than previously thought, compared to CO2-reducing Metanobrevibacter. It was also shown that CH4 emissions in cows are positively correlated with Methanosphaera and Metanomassilicoccals, though not with CO2-reducing methanogens (Metanobrevibacter) [Metanosphaera, Methanobacterium, Metanomassilicoccals, Methanomicrobium, Methanococcus, Methanoplanus, and Methanohalophilus had a lower abundance in the MCE cows than in the CON cows, which could support that MCE decreased CH4 intensity. The lower abundances of Metanosphaera, Methanosphaera sp. WGK6, and Methanosphaera stadtmanae in the BS group also support the reduction of methane intensity by BS. We obtained the non-redundant genes involved in CH4 metabolism and annotated these non-redundant genes to obtain information about the corresponding archaeal genera and their abundance  . The gen4 emissions were less associated with rumen microbial taxonomic profiles than functional profiles. Therefore, analysis of rumen microbial community or functional features alone may be insufficient to find a true biological linkage between the rumen microbiome and methanogenesis.Metagenomics identified no differences in amino acid metabolism, energy metabolism, carbohydrate metabolism, and lipid metabolism pathways in the present study. Similarly, Xue et al.  reportedPrevotella is involved in the degradation of starch, hemicellulose, and pectin [Prevotella was the highest in CAZymes in the rumen of dairy cows [Prevotella and Eubacterium in the present study. Liu et al. [Compared with BS cows, genes encoding CAZymes involved in deconstructing carbohydrates  in the rumen microbiomes were enriched in the CON cows. This result did not indicate that BS improved the ability of cows to degrade complex substrates. Although both BS and MCE decreased the gene abundance of the CAZymes involved in carbohydrate synthesis  compared with the CON group, neither additive affected ruminal total VFA concentration in dairy cows. BS and MCE did not affect the gene abundance of the GH family gene-coded fibrinolytic enzymes in the current study. Firmicutes plays an important role in the degradation of carbohydrates, including starch, cellulose, hemicellulose, and oligosaccharides . Prevoted pectin . The preiry cows . Guo et iry cows , 60 repou et al.  showed t2 utilizer, whereas Firmicutes is an H2 producer [4 production. However, at a high concentrate level, the relative abundance of the Firmicutes was increased in the rumen, whereas that of Bacteroidetes was increased in the rumen at a high forage level [As we all know, the phyla Bacteroidetes and Firmicutes are the dominant bacteria in the rumen of dairy cows . This inproducer , 64. In producer . These pge level , 58. In ge level . Therefoge level . Furtherge level  reportedFaecalibacterium prausnitzii had the highest number of negative correlations among bacteria of BS cows, and these negative correlations were associated with species belonging to the genus of Prevotella. This result could be attributed to Faecalibacterium prausnitzii is a butyrate-producing bacteria [Prevotella is an acetate- and propionate-producing bacterium [Ruminococcaceae bacterium P7 belongs to the phylum of Firmicutes and the Prevotella belongs to the phylum of Bacteroidetes. Ruminococcus and Prevotella are both major contributors to CAZymes and were found in the GH, GT, CBM, CE, and PL families [Ruminococcus was highly negatively correlated with feed conversion efficiency, while Prevotella was enriched in dairy cows with high feed conversion efficiency [Ruminococcus may be an important contributor to hemicellulose degradation, but appears to have little effect on oligosaccharide degradation [Prevotella does not degrade cellulose, however, is a contributor to the degradation and utilization of starch and plant cell wall polysaccharides such as xylan and pectin. Furthermore, Ruminococcus was more abundant in the rumen of dairy cows fed high-forage diets, whereas Prevotella was more abundant under low-forage diets [Ruminococcus and Prevotella were associated with enteric CH4 emissions; specifically, Ruminococcus was enriched in sheep with high CH4 yield, whereas Prevotella was negatively correlated with CH4 emissions [Ruminococcus and Prevotella in the present study can be explained as shown above, but the role at the species level is unclear and needs to be interpreted with caution. In the present study, the co-occurrence network among rumen archaea analysis revealed that almost all correlations exist among taxa of the Euryarchaeota, and almost no negative correlations existed. The archaeal communities are dominated by the phylum Euryarchaeota, and the average relative abundance of Euryarchaeota was 98.1% in the present study. Moissl-Eichinger et al. [bacteria , while Pacterium . Notablyfamilies . The preficiency , 71. It radation . Zened eradation  indicatege diets . Ruminocmissions , 74. Ther et al.  reportedSelenomonas ruminantium is an amylolytic bacteria in the rumen, which is involved in the conversion of succinate to propionate [Selenomonas ruminantium was negatively correlated with propionate but positively correlated with acetate and butyrate in the present study. Moreover, the random forest model and heatmaps revealed that the species Clostridium_sp._CAG_269 and Clostridium_sp._27_14 belong to the genus of Clostridium were positively correlated with total VFA and propionate, however, negatively correlated with acetate, butyrate, acetate:propionate ratio, isobutyrate, and pH value in the present study. Not similar to our findings, some previous studies showed that Clostridium can produce butyrate, which is a cellulolytic bacterium and is positively correlated with the acetate:propionate ratio [Methanobrevibacter curvatus, Haloarcula rubripromontorii, and Halopenitus persicus were related to the proportion of VFA, as well as FPCM yield. Methanobrevibacter curvatus was originally isolated from termites and positively correlated with CH4 production [Haloarcula rubripromontorii; Halopenitus persicus was isolated from the salty lake [opionate . Inconsite ratio \u201379. Howeoduction , 81. S\u00e1noduction  drafted lty lake . Beyond 4 intensity  in dairy cows. BS decreased molar proportions of acetate and butyrate but increased the molar proportion of propionate. MCE reduced relative abundances of seven archaeal genera and nine archaeal species, and BS reduced relative abundances of one archaeal genus and two archaeal species. These results suggest that the mitigation function of BS and MCE on ruminal methanogenesis might be attributed mainly to their effects on VFA production and the relative abundance of archaea in the rumen. The co\u2011occurrence network analysis of rumen bacteria revealed that interaction patterns were different among dietary treatments, and the MCE cows had the most microbe\u2013microbe associations in bacteria. On the other hand, the co\u2011occurrence network analysis of rumen archaea found that there was almost no negative correlation among taxa, and both BS and MCE cows had more microbe\u2013microbe associations in archaea than the CON cows. The random forest and heatmaps analysis revealed correlations between the six microbial species with cow phenotypes and rumen fermentation characteristics.The present result shows that both BS and MCE additives improved FPCM yield, while reduced CHAdditional file 1: Table S1. Ingredient and chemical composition of the basal diet fed to dairy cows. Table S2. Summary of sequence data generated from rumen samples. Table S3. Comparison of microbial domains among CON, BS or MCE cows. Table S4. The relative abundances of differential rumen bacteria and archaea among CON, BS or MCE cows. Table S5. The relative abundances of protozoa in rumen of dairy cows. Table S6. The CAZymes families with significant difference in gene abundance among three groups. Table S7. The relative abundances of GH family genes coded fibrolytic enzymes. Figure S1. Fold changes of metabolic pathways identified in the metagenomes of the cows. Figure S2. Comparisons of the abundance of KO enzymes related to the acetate, propionate, and butyrate production pathway of cows. The Kruskal\u2013Wallis multiple comparisons was used for mean comparison, and asterisk indicated the significant difference (P < 0.05). CON = control diet; BS = control diet plus Bacillus subtilis; MCE = control diet plus Macleaya cordata extract."}
+{"text": "This \u2018cohort profile\u2019 aims to provide a description of the study design, methodology, and baseline characteristics of the participants in the Corona Behavioral Unit cohort. This cohort was established in response to the COVID-19 pandemic by the Dutch National Institute for Public Health and the Environment (RIVM) and the regional public health services. The aim was to investigate adherence of and support for COVID-19 prevention measures, psychosocial determinants of COVID-19 behaviors, well-being, COVID-19 vaccination, and media use. The cohort also examined specific motivations and beliefs, such as for vaccination, which were collected through either closed-ended items or open text responses. In April 2020, 89,943 participants aged 16 years and older were recruited from existing nation-wide panels. Between May 2020 and September 2022, 99,676 additional participants were recruited through online social media platforms and mailing lists of higher education organizations. Participants who consented were initially invited every three weeks (5 rounds), then every six weeks (13 rounds), and since the summer of 2022 every 12 weeks (3 rounds). To date, 66% of participants were female, 30% were 39 years and younger, and 54% completed two or more questionnaires, with an average of 9.2 (SD = 5.7) questionnaires. The Corona Behavioral Unit COVID-19 cohort has published detailed insights into longitudinal patterns of COVID-19 related behaviors, support of COVID-19 preventive measures, as well as peoples\u2019 mental wellbeing in relation to the stringency of these measures. The results have informed COVID-19 policy making and pandemic communication in the Netherlands throughout the COVID-19 pandemic. The cohort data will continuously be used to examine COVID-19 related outcomes for scientific analyses, as well as to inform future pandemic preparedness plans. Behavior plays a significant role in reducing the spread of SARS-CoV-2, the virus that causes the disease known as COVID-19 . Such inIn March 2020, during the early stages of the COVID-19 pandemic in the Netherlands, the Corona Behavioral Unit (CBU) was established by the Dutch National Institute of Public Health and the Environment (RIVM). In collaboration with the 25 regional Public Health Services (GGDs), in April 2020 the CBU launched a longitudinal cohort study using an online questionnaire to monitor behavior, its determinants, the support base for COVID-19 preventive measures, and well-being over time. We opted for a cohort rather than representative cross-sectional polls, as this would allow us to conduct longitudinal explanatory analyses. Also, in-depth qualitative research was integrated in the design using open-ended questions, and after finishing the questionnaire participants were invited to be interviewed or to participate in focus groups.Findings from the cohort study have informed national as well as regional-level COVID-19 policies, communication strategy and campaigns. Results have also been used by the media to inform citizens of developments during the pandemic. The objectives of this Cohort Profile are to describe the cohort\u2019s design, recruitment, data collection (including an overview of some of the key questionnaire items), baseline participant characteristics, key published findings to date, and plans for future research and publications.The study adopted a nationwide longitudinal dynamic cohort approach, of both quantitative research methods (online questionnaire including closed- and open-ended questions) and qualitative research methods . The frequency of the online questionnaire was every three weeks , every six weeks , and between rounds 19 and 21 (March\u2013June 2022) there was an interval of 13 weeks.In April 2020, individuals aged 16 years and older who participated in one of 25 regional public health service (GGD) panels  and eight municipal panels  were invited to participate in a questionnaire on behavior and subjective well-being during the corona pandemic. These panels each consist of 1,000 to 10,000 participants who are invited to fill in questionnaires about health-related topics or other topics a few times each year. Participants who completed the questionnaire were asked if they were willing to receive invitations for future questionnaires. As we anticipated dropout over time, we decided to recruit additional participants every other round of data collection. Therefore, a link (referred to as \u2018open link\u2019) was shared on social media channels  and through mailing lists of higher education organizations such as The Dutch National Youth Council (NJR) and MBO Council (MBO Raad) to recruit as many people as possible. Due to holiday periods, availability of staff and other practicalities , this took only place during rounds 3, 5, 6, 8, 10, 12, 13, 15, 17 and 19. There was a focus on recruiting those people who were underrepresented in the cohort, particularly individuals aged 16 to 24 years.All participants 16 years and older provided online written informed consent before filling out each questionnaire, in compliance with the Dutch Law for Research Involving Human Subjects WMO; see . RespondAt baseline, all participants completed an extensive section on demographics , socioeconomic status , health status , and questions on COVID-19 vaccination, testing and infection. Then, they were randomly assigned to the following (combination of) modules : (a) behWhere possible, existing validated scales or items were used . The specific and novel context of the COVID-19 pandemic also demanded developing new items . This was done by senior researchers from the Corona Behavioral Unit and by at least two external senior researchers from the academic advisory board with expertise in both the specific area and survey design. Every module was introduced to the participant and specific care was taken to formulate questions in a way to minimalize socially desirable answers  and prompt reliable responses .A selection of the measures as used in our questionnaires are presented in Items in the well-being module related to mental health , life sItems in the policy support module related to support for current and future COVID-19 preventive measures as taken by the Dutch government to control the spread of the coronavirus in the Netherlands. Items in the psychosocial determinants of adherence module related to risk perception, emotional response to the virus  are available at Open-ended questions were embedded in the online questionnaire to obtain an understanding of participants\u2019 beliefs, experiences or concerns across a range of behaviors throughout the rounds. Examples include reasons (not) to participate in testing, tracing and isolating, (not) getting a COVID-19 vaccine, or experienced positive and negative effects of the pandemic and its policies on well-being. At the end of each questionnaire an open-ended question was included where participants could indicate whether they missed any questions related to COVID-19 (round 1\u20137), had remarks related to the questionnaire (from round 7 onwards) and whether they had any additional thoughts in relation to the COVID-19 preventive measures in general (from round 7 onwards).Responses were coded using a thematic codebook. For every question a fitting codebook was developed, based on theoretical foundations of the (or most closely relevant) behavior identified from the literature and aligned with previous questionnaire and interview findings (top-down). This was supplemented by themes mentioned in the response set (bottom-up). To test the codebooks and identify new codes, a sample of responses was coded by two independent primary coders. Findings were discussed, and the codebook was refined. A team of secondary coders (between two and ten) then used the codebook and protocol to code the rest of the data. Following instructions, each secondary coder coded 100\u2013200 responses to become acquainted with the data. They discussed cases of doubt with one of the primary coders, after which the codebook was updated, and decisions were logged. Cases of doubt were discussed within the coding team throughout the coding process. In case of a large number of responses, coders were asked whether shifts in key themes still occurred or new themes came up (saturation check). After coding, the codebook underwent further refining and accuracy checks were performed against the final codebook and decision log by one of the primary coders. Codes were integrated to identify main themes for each question. If new codes or themes were identified, in case of longitudinal questions at the end of the questionnaire, earlier data sets were recoded to allow for comparison across time. Additionally, answers could be linked to the corresponding participant number, allowing for mixed-method approaches . Themes were used to inform interview topic guides, survey design . After the selection, email addresses and phone numbers of the selected participants were requested at the research agency. Email addresses were used to inform people that they could expect a phone call from the interview team at the RIVM.Interviews were conducted by multiple interviewers using a standardized topic guide, recorded and were then sent to an external company for transcription. Two types of qualitative analysis are being used, 1) analyses to inform COVID-19 reports, policy makers and to improve the survey, and 2) analyses for scientific publications. For the first type of analysis, responses were added into a predetermined matrix with all topic guide themes and questions on the x-axis and each interviewee on the y-axis. Responses were added directly after each interview by interviewers, and were kept as literal quotes as much as possible. Thematic analysis was performed on this matrix by multiple researchers. Two analyses took place in parallel: one entailed getting a general overview, while the other had the aim to look at each theme separately. Both analyses were performed by at least two researchers simultaneously. After the parallel analyses , all researchers discussed their findings in a group session. This procedure made it possible to complete analyses and present the results within a few days after the last interview was conducted. Results derived from the thematic analyses of the interviews were used to identify perceptions and beliefs to generate response options for new survey questions. For example, interviews were used to identify concerns and beliefs surrounding COVID-19 vaccination, and these items in turn have been reported on in several policy reports and a scientific paper .Regarding analyses for scientific papers based on the interview data, transcripts were analyzed through inductive thematic analysis using MAXQDA 2018 . Three sStepwise deterministic linking for the quantitative data, using participant id number, age (divided into 7 categories) and sex  from the baseline questionnaires, was performed to match participants on different records across the data collection rounds. In the case that participants\u2019 responses to these questions at their follow-up questionnaire matched those at their baseline questionnaire, or in the case that participant number and sex were identical, and age was one category higher, consecutive records were considered to be of the same individual and thus were kept in the data set.Stata [In this Cohort Profile, we have used descriptive statistics to summarize the baseline characteristics of the study participants, overall and according to method of recruitment, whether participants were lost to follow-up (defined as not participated for at least four rounds), and whether participants subscribed for receiving follow-up questionnaires. For comparisons between groups, Pearson\u2019s chi-square tests were performed. Analyses were performed using Stata .Participants or the public were not invited to contribute to the design, recruitment, reporting and dissemination of this research.The cohort study does not meet the requirement as laid down in the Dutch Law for Research Involving Human Subjects (WMO) and was therefore exempted by the Centre for Clinical Expertise at RIVM from formal ethical review (Study number G&M-561). Written informed consent was provided by all participants in each data collection round. Data collection was outsourced to a research agency (\u2018Research 2Evolve\u2019), as well as management of email addresses and phone numbers, for the duration of the project.Between April 2020 and September 2022 (21 rounds of data collection), in total 189,619 individuals 16 years and older were recruited, 47%  in round 1 via the existing Public Health Services (GGD) and municipal panels, and by sharing an \u2018open link\u2019 on social media channels such as Instagram, and 53%  via such an open link from round 3 onwards . An emaiIn total, 57% of the questionnaires were completed, and 43% were not completed . Of thosDemographic characteristics of all cohort participants are shown in Comparisons between baseline characteristics for different groups in the study are also shown in p<0.001), to have an underlying medical condition , to have not been vaccinated , to have a higher educational level , and less likely to be 70+ years old . In each round, between 6%  to 25%  of participants answered the open question about whether they had remarks related to the questionnaire . See From round 7 onwards, between 16%  to 39%  of participants responded to the open-ended question asking about whether they had any additional thoughts on the imposed COVID-19 preventive measures in general. This was completed by a selective sample of participants, as illustrated by an analysis in round 20: compared to those who did not answer this question , respondents who did  were more likely to be female , to be 40 years or older , to have a higher educational level , to live with someone , and to not have an underlying medical condition .At their baseline questionnaire, 21%  of participants responded positively to the question if they were willing to engage in in-depth interviews or focus groups. Compared to those who were not willing to do so , those who agreed to participate in interviews or focus groups were more likely to be male (39% vs. 32%); Because of the large group of participants that was willing to participate in interviews, we were able to invite those that were eligible and most informative based on the research question at hand at time of data collection . Each round, between 16 and 106 participants were selected and invited. The response rate ranged from 57% to 97%. Participants were typically invited once, except for 17 participants who were invited to be part of a qualitative interview cohort group. Because two of them dropped out, two extra participants were recruited. Of those 19 participants, 12 participated 12 times.At the time when COVID-19 vaccination became available in the Netherlands (January 2021), the vaccination intention increased from around 60% in November 2020 to (77\u201394%) in January 2021 among all age groups . In rounCOVID-19 preventive measures have been introduced to protect public health, but their adverse psychological, social, and economic impact may have weakened their popular support over time. We found that during the first two years of the pandemic, overall support declined for all measures and was systematically lower for those measures that were more socially restrictive . More spWe found that younger participants (under 40s and even more so with the under 26 age group) reported increasingly higher levels of loneliness throughout the pandemic compared to older participants, particularly in times when COVID-19 preventive measures were stricter . Youngerrivm.nl/gedragsonderzoek/maatregelen-welbevinden , and rivm.nl/en/coronavirus-covid-19/research/behaviour.The Corona Behavioral Unit has published its survey findings  on the website of the National Institute for Public Health and The Environment (RIVM), as commissioned by the Dutch Ministry of Health, Welfare and Sport, see The cohort has several strengths. It is a large, nation-wide, dynamic on-going cohort with more than 189,000 participants that have contributed to more than 1,000,000 records  during more than two years into the COVID-19 pandemic, with an attrition rate of 31% . The cohort has provided extensive questionnaire data on self-reported adherence to COVID-19 preventive measures, support for and determinants of those measures, trust in the Dutch government, well-being, use of media. These insights have informed nation-wide governmental policies , that might have otherwise relied on assumptions about people\u2019s well-being and behavior. The questionnaire was informed by a theoretical model, comprised of the Health Belief Model and five key constructs relevant for the maintenance of behavior change . In addiSeveral weaknesses of the cohort should also be mentioned. Participants are recruited via existing Public Health Service (GGD) panels , municipal panels, via social media , and via mailing lists of higher education organizations. Furthermore, our questionnaire is only available online and for those who master the Dutch language. With respect to the interviews, only those who first fill in the questionnaire and subsequently answer their phone are interviewed. All these approaches are sensitive to selection bias, so that results from this cohort should not be generalized to the general Dutch population. However, the cohort results are compared to those from a 3-weekly, cross-sectional trend study in a demographically representative sample of the Dutch population completing partly the same questionnaire . Cross-sIn response to the COVID-19 pandemic, the Corona Behavioral Unit cohort was established at the start of the pandemic in April 2020 by the Dutch National Institute for Public Health and the Environment (RIVM) and the 25 regional public health services in the Netherlands. Over a two-and-a-half year period, the cohort provided detailed insights in trends over time about COVID-19 preventive behaviors of Dutch citizens, what they thought of the imposed measures and how they were doing physically, mentally and socially. These insights informed COVID-19 policy making and pandemic communication in the Netherlands during the pandemic by identifying key beliefs and misconceptions underlying people\u2019s behaviors. The cohort data will continuously be used to examine longitudinal between- and within-person associations on demographics, health, social and adherence behaviors with key themes such as psychosocial variables, trust and well-being. As we have been able to run this cohort during more than two and a half years of the COVID-19 pandemic, we are also planning to include in the analyses the effects of contextual factors such as the imposed COVID-19 preventive measures and the Dutch government\u2019s COVID-19 press conferences that were used to inform the public. These data will not only add to our understanding of people\u2019s perceptions, behaviors and well-being during the COVID-19 pandemic for future pandemic preparedness, they also provide a unique opportunity to study how beliefs, affect, and behaviors evolved in the context of health behaviors that are completely new to people.S1 Text(DOCX)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file."}
+{"text": "Plasmodium falciparum prepatent period, parasite density, and multiplication rates in a controlled human malaria infection trial (CHMI).Pre-vaccination monocyte-to-lymphocyte ratio was previously suggested as a marker for malaria vaccine effectiveness. We investigated the potential of this cell ratio as a marker for malaria vaccine efficacy and effectiveness. Effectiveness was investigated by using clinical malaria endpoint, and efficacy was investigated by using surrogate endpoints of We evaluated the correlation between monocyte-to-lymphocyte ratio and RTS,S vaccine effectiveness using Cox regression modeling with clinical malaria as the primary endpoint. Of the 1704 participants in the RTS,S field trial, data on monocyte-to-lymphocyte ratio was available for 842 participants, of whom our analyses were restricted. We further used Spearman Correlations and Cox regression modeling to evaluate the correlation between monocyte-to-lymphocyte ratio and Whole Sporozoite malaria vaccine efficacy using the surrogate endpoints. Of the 97 participants in the controlled human malaria infection vaccine trials, hematology and parasitology information were available for 82 participants, of whom our analyses were restricted.The unadjusted efficacy of RTS,S malaria vaccine was 54% . No correlation was observed between monocyte-to-lymphocyte ratio and RTS,S vaccine efficacy (Hazard Rate (HR):0.90, 95%CI:0.45\u20131.80; p = 0.77). The unadjusted efficacy of Whole Sporozoite malaria vaccine in the appended dataset was 17.6% . No association between monocyte-to-lymphocyte ratio and the Whole Sporozoite malaria vaccine was found against either the prepatent period , parasite density  or multiplication rates .Monocyte-to-lymphocyte ratio alone may not be an adequate marker for malaria vaccine efficacy. Further investigations on immune correlates and underlying mechanisms of immune protection against malaria could provide a clearer explanation of the differences between those protected in comparison with those not protected against malaria by vaccination. Between 2000 and 2019, malaria incidence rates have decreased by 27% globally and 40% in the WHO African region, and mortality rates fell by 57% globally and 63% in the African region [Assessing heterogeneity in natural malaria exposure and its impact is a key element in evaluating the effectiveness of antimalarial interventions, including malaria vaccines , 8. A nuExperimental malaria vaccine study followed by controlled human malaria infection (CHMI) holds potential for overcoming the challenges of heterogeneity to malaria exposure often encountered in field trials \u201315. CHMIIn clinical trials, hematological and immunological markers bear potential to help stratify vaccine recipients that are most likely to be protected by a vaccine from those that are refractory to vaccine protection. Identifying predictors for low vaccine efficacy may lead to hypotheses and thus inform research strategies for improving vaccine performance .Some cells of the immune system such as neutrophils, eosinophils, monocytes and lymphocytes are suggested markers for immune responses , 19. SucP. falciparum sporozoite malaria vaccine studies followed by CHMI in adults with surrogate efficacy endpoints of P. falciparum parasite density, prepatent period and multiplication rates.This study investigated whether peripheral blood ML ratio measured at study enrolment is a marker for the efficacy of candidate malaria vaccines in a secondary analysis from two reported vaccine trials. First, from reported pediatric RTS,S malaria vaccine trial with natural malaria parasites exposure and with clinical malaria as primary endpoint. Secondly, from reported attenuated 0S, 38.89890E) is one of the six districts of the Pwani region located in the coastal area of Tanzania. It is bordered by the Indian ocean to the east, and is 13 meters above sea level. Bagamoyo is 8,463 km2 in size, with around 311,000 inhabitants in 2012 [This report is according to the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) guidelines . The main aim was to relate pre-vaccination ML ratio to the efficacy of malaria vaccine both in the field using RTS,S malaria vaccine and in experimental setting using Whole Sporozoite malaria vaccine. We used data from three distinct studies, all conducted in Bagamoyo, Tanzania; one phase III malaria vaccine field trial, and two experimental malaria vaccine trials whose data were pooled and jointly analyzed. Bagamoyo . A licensed rabies vaccine or meningococcal conjugate C vaccine was administered in the children and infant control groups respectively. This was a multicenter study of up to 16,000 children enrolled from 11 trial centers covering a wide range of transmission settings in seven countries of the African Sub-Saharan region including Burkina Faso, Gabon, Ghana, Kenya, Malawi, Mozambique and Tanzania , 32. TheP. falciparum parasites per microliter of blood in children or > = 500 P. falciparum parasites per microliter of blood in infants) were detected and recorded through passive surveillance at local health facilities within the study centers. The median of the follow-up period per child was 17.4 months.Screening of study participants was done after invitations and public meetings in the respective communities. Children and infants with any clinically significant acute or chronic illness, abnormal blood tests or severe malnutrition were excluded from the study. Exclusion criteria however were kept at a minimum in order to mirror the general population as far as possible while minimizing participant exposure to safety risks. Further details as inclusion and exclusion criteria are further elaborated in the original publication . VaccinaPlasmodium falciparum sporozoite vaccine (pfSPZ vaccine)  [Plasmodium falciparum sporozoites (pfSPZ vaccine), followed by an intravenous controlled human malaria infection (CHMI) using a homologous strain . A normal saline solution was administered intravenously to the control group. The volunteers in this trial were inpatients from day 9 after pfSPZ challenge injection for observation until diagnosed and treated for malaria, or until day 21 of follow-up. Over the course of follow-up, P.falciparum parasitemia was continuously monitored by the thick blood smear (TBS) approach until malaria treatment based on TBS positivity [The first of the two experimental malaria vaccine studies whose data were pooled and jointly analyzed was known as the Bagamoyo Sporozoite Vaccine 1 (BSPZV1) trial. This was a double-blind, randomized, controlled trial conducted between April 2014 and August 2015 to assess the safety, immunogenicity and protective efficacy against controlled human malaria infection (CHMI) of whole attenuated Plasmodium falciparum sporozoites followed by a controlled human malaria infection (CHMI) with homologous strain . The control group received a normal saline solution administered by direct venous inoculation. P. falciparum parasitemia was continuously monitored by TBS paired with qPCR tests. All volunteers were observed as inpatients from day 9 post CHMI until diagnosed and treated for malaria, or until day 21 of follow-up. Volunteers with positive TBS confirmed by qPCR, as well as those who were TBS negative throughout the follow-up period were treated with artemether-lumefantrine (AL) at day 28 [The second experimental malaria vaccine study was the Bagamoyo Sporozoite Vaccine 2 (BSPZV2) trial. This was a double blind, randomized, placebo-controlled trial with an age de-escalation, dose escalation component to assess safety and immunogenicity of PfSPZ vaccine, and a CHMI component to assess efficacy of the vaccine . The trial was conducted between December 2015 and March 2017, with 30 healthy, adult Tanzanian volunteers (18\u201345 years of age) recruited from the Bagamoyo region constituting the CHMI component. The present analysis is restricted to the CHMI component, whose volunteers were inoculated three times with whole, irradiation attenuated purified and cryopreserved t day 28 . Of the The RTS,S clinical trial  was approved by the Ifakara Health Institute Institutional Review Board (IHI-IRB), the National Health Research Ethics Review Committee (NatREC), and the Tanzania Medicines and Medical Devices Authority (TMDA), as detailed in the primary publication , 32. WriThe BSPZV1 study was approved by institutional review boards (IRBs) of the IHI (Ref. No. IHI/IRB/No:02\u20132014), the National Institute for Medical Research Tanzania (NIMR/HQ/R.8a/Vol.IX/1691), the Ethikkommission Nordwest-und Zentralschweiz, Basel, Switzerland (reference number 261/13), and by the Tanzania Food and Drug Authority (Ref. No. TFDA 13/CTR/0003). It was registered at Clinical Trials.gov (NCT02132299); and conducted under the U.S. Food and Drug Administration Investigational New Drug application (FDA IND) . In bothIn The RTS,S trial, hematology data were assessed using automated machines available at the study site in accordance to the manufacturer instructions and standard operating procedures (SOPs). Blood samples were collected in K2EDTA tubes at the study clinic and transported to the research laboratory located within the grounds of Bagamoyo district hospital. Full blood counts with differentials were assessed using Sysmex XS 800i hematology machine at baseline and multiple timepoints after vaccination. The machine provided absolute cell counts of the following parameters; white blood cells (WBC), neutrophils, basophils, eosinophils, platelets, Hemoglobin (Hb), mean corpuscular hemoglobin (MCH), mean corpuscular volume (MCV), monocytes and lymphocytes. The present analysis adopted the absolute counts of monocytes and lymphocytes to arrive at the reported ML ratios. ML ratio in this case was defined as the ratio of the absolute numbers of monocytes to lymphocytes measured from peripheral blood at baseline, before vaccination.In both the BSPZV1 and BSPZV2 studies, T-cell immune responses were assessed using multi-parameter flow cytometry from peripheral blood mononuclear cells (PBMC) on cryopreserved samples, in a single batch, at the completion of the study , 34. TheP. falciparum parasites per microliter of blood in children or > = 500 P. falciparum parasites per microliter of blood in infants. The criteria for parasitemia were assessed by thick blood smear tests. The time interval (in days) between vaccination and occurrence of first clinical malaria episode was used to analyze the effectiveness of the vaccine, and was interpreted as one minus the hazard rate (HR) (i.e. 1\u2014HR) following a cox regression modeling.The primary outcome variable used for assessing the efficacy of RTS,S malaria vaccine was the occurrence of clinical malaria. Clinical malaria cases were detected through passive surveillance at local healthcare facilities. These cases were defined as axillary temperature > = 37.5\u00b0C accompanied by >2500 P. falciparum parasite density, prepatent period, and multiplication rates. Parasite density was defined as the absolute number of P. falciparum parasites per microliter of blood obtained by quantitative PCR approach from peripheral blood post CHMI. Prepatent period was defined as the time interval (in days) between homologous CHMI and the first P. falciparum positive qPCR diagnosis in peripheral blood. Parasite multiplication rates (PMR) were defined as the kinetic growth rate of P. falciparum parasites in peripheral blood following homologous CHMI, and was derived from parasite density and prepatent period estimations. In both BSPZV1 and BSPZV2 trials, qPCR samples were obtained every 12 hours from day 8 to day 14 post CHMI inoculation, and then daily from day 15 to day 21 post CHMI inoculation, or until positive diagnosis by TBS test. Analyses of all qPCR samples was done retrospectively after conclusion of CHMI, except when a TBS test was positive. Vaccine efficacy was estimated by proportional analysis, and was interpreted as the proportionate reduction in incidence of developing parasitemia among the vaccinated group compared to the controls within 21 days of follow up, post CHMI.Data from the BSPZV1 and BSPZV2 trials were pooled and jointly analyzed. The primary outcome variables of interest were the surrogate efficacy endpoints of Participant\u2019s characteristics including age and gender were analyzed by descriptive statistics.power cox command in Stata .Cox regression modelling was used to estimate the efficacy of RTS,S vaccine against clinical malaria. We considered possible confounding by covariates previously reported to be associated with the risk for clinical malaria, namely age, sex, distance from health facility, bed net use, and ML ratio , 35. StePlasmodium falciparum sporozoite vaccine in the BSPZV1 and BSPZV2 pooled dataset. Cox regression modelling was used to analyze parasite pre-patent periods, and an interaction term between ML ratio and vaccination was added to estimate the efficacy of the pfSPZ vaccine at different levels of ML ratios. Parasite multiplication rates (PMR) were derived from log-linear modeling fitted to log10-transformed quantitative PCR (qPCR) data [Proportional analysis was used to estimate the efficacy of whole attenuated CR) data , 37, andDemographic and clinical characteristics of participants in the RTS,S trial are tabulated in In an unadjusted Cox regression model, the crude efficacy of RTS,S vaccine against the primary endpoint of time to first clinical malaria episode was 54% :37%-66%, p <0.001). ML ratio, age and distance from health facility confounded the relationship between vaccination and risk for clinical malaria and contributed to model fit. Sex and bed net use were not related nor confounding and were removed in the final model. There was a negative correlation between ML ratio and risk for clinical malaria . However, when stratified by exposure status to the vaccine, ML ratio did not directly correlate with clinical malaria risk in either the vaccinated arm  or the control arm . The test for interaction between ML ratio and vaccination in the final multivariate model did not reach statistical significance (adjusted Hazard Rate (adjHR):0.90, 95%CI 0.45\u20131.80; p = 0.77). When stratified by vaccination status, the adjHR in a model with interaction was 0.80 (95%CI 0.47\u20131.39) for the vaccinated group and 1.14 (95%CI 0.67\u20131.84) for the control group.Data from 65 participants of the BSPZV1 trial and 17 participants of the BSPZV2 trial were appended and jointly analyzed. 91% of participants in the pooled dataset were males, and the median age in years was 24 (IQR: 22\u201324). Baseline ML ratio did not differ significantly between vaccinated and control arms. As expected, there was a significant difference between the groups with respect to the surrogate endpoints at first qPCR diagnosis. Demographic and laboratory characteristics in the vaccinated and control arms are further elaborated in In the pooled dataset for BSPZV1 and BSPZV2, the unadjusted efficacy of whole Sporozoite malaria vaccine by proportional analysis was 22.7% . In the Cox regression model, the correlation between ML ratio and parasite prepatent period did not reach statistical significance , and it did not interact with vaccine efficacy (p = 0.36). Furthermore, the correlation between ML ratio and either parasite density at time of qPCR diagnosis or PMR did not reach statistical significance  and  respectively .We investigated pre-vaccination ML ratio as a marker for effectiveness of RTS,S malaria vaccine using the clinical malaria endpoint, and as a marker for efficacy of Whole Sporozoite malaria vaccine using the surrogate endpoints. In our analysis, we could not demonstrate that the protective effect of RTS,S malaria vaccine is modified by baseline levels of ML ratios, evidenced by a non-significant statistical interaction between ML ratio and RTS,S vaccination in a Cox regression model (p = 0.77), even after stratifying ML ratios by age groups: infants (p = 0.67) and children (p = 0.59). Consistent with observations for vaccine effectiveness, we found no association between baseline ML ratios and vaccine efficacy, evidenced by a non-significant statistical interaction between ML ratio and vaccination (p = 0.36), and the absence of statistical correlations between ML ratio and the surrogate endpoints of parasite density at time of PCR diagnosis and parasite multiplication rates.A total of 1704 children were randomly assigned to the RTS,S group or the control group. Of these, pre-vaccination ML ratios were available for 842 children , of whom our analysis is restricted. The median age of the participants was 5 months at the time of vaccination. 76 clinical malaria episodes were reported in the RTS,S group and the control group . The unaDespite the similarities between the current RTS,S field study and that previously reported by Warimwe et.al, 2013 , there aIn addition to the RTS,S field trial, our investigation also analyzed the relationship between ML ratio and PfSPZ vaccine efficacy in an experimental setting following a CHMI model. To the best of our knowledge, this is the first investigation of the relationship between peripheral blood ML ratio and the efficacy of a malaria vaccine within the context of a CHMI model. A CHMI model offers unique advantages over a field trial. Firstly, it offers a possibility for defining the precise number of sporozoites each trial participant is exposed to, thus enabling trialists to standardize parasite inoculum dosages between study groups , 43, 44.A total of 97 volunteers were randomly assigned to PfSPZ vaccine group or the control group in the original BSPZV1 and BSPZV2 studies. Of these, pre-vaccination ML ratios were available for 82 participants, of whom our analysis is restricted . As tabuWe acknowledge several limitations in the analysis of experimental malaria vaccine trial followed by homologous CHMI. Firstly, although statistically significant, the efficacy of pfSPZ vaccine in the combined dataset was relatively low, at 17.6% . Since the low efficacy implies that the difference between the groups with respect to the outcome variable was only slight, it is difficult to identify factors responsible for the differences, unless such factors have very large effect size. Therefore, the low efficacy of the vaccine, although significant, might have missed the detection of possible marginal influences of ML ratio on efficacy of the vaccine. Secondly, the CHMI trials were performed in adult participants who have been repeatedly exposed to malaria parasites and thus have developed semi-immunity to clinical malaria . ModulatIt is important to note that studies investigating the role of monocytes in malaria infections need to be interpreted with caution. Monocytes are a heterogeneous population of cells whose behavior and functionalities are shaped by many factors, as pointed out earlier. Because of this, contradictory observations of monocyte behavior across studies are not uncommon, independent of study protocols and analytic techniques . FurtherWe could not demonstrate that the variation in efficacy of malaria vaccines between recipients is attributed to differences in pre-vaccination monocyte-to-lymphocyte ratios. Our observations have been consistent in both RTS,S subunit vaccine administered in children in a field study and in Attenuated Whole Sporozoite malaria vaccine administered in adults in experimental malaria vaccine study followed by controlled human malaria infection. It appears that monocyte-to-lymphocyte ratio is not an adequate independent marker for protection or refractory to protection with immunization by malaria vaccines. Further investigations on immune correlates of protection are important in context of malaria vaccination as it will inform what to measure in individuals to tell if they will be protected or not protected by vaccination. Furthermore, Molecular investigations of underlying mechanisms of protected immunity are important as they could provide a clearer explanation of the differences between those protected in comparison with those not protected.S1 Data(ZIP)Click here for additional data file."
\ No newline at end of file