diff --git "a/deduped/dedup_0147.jsonl" "b/deduped/dedup_0147.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0147.jsonl"
@@ -0,0 +1,54 @@
+{"text": "This last effect is potentially mutagenic in vivo. Biochemical studies performed in parallel with in vivo genetic analyses, would represent an extremely powerful approach to investigate further, both DNA replication and repair in eukaryotes.We and others have shown four distinct and presumably related effects of mammalian proliferating cell nuclear antigen (PCNA) on DNA synthesis catalyzed by mammalian DNA polymerase \u03b4(pol \u03b4). In the presence of homologous PCNA, pol \u03b4 exhibits 1) increased absolute activity; 2) increased processivity of DNA synthesis; 3) stable binding of synthetic oligonucleotide template-primers , can only substitute poorly for either calf thymus or human PCNA (~10% as well) in affecting calf thymus pol \u03b4. However, by mutating one or only a few amino acids in the region of Drosophila PCNA thought to interact with pol \u03b4, all four effects can be enhanced dramatically.Drosophila offers the potential for immediate in vivo genetic analyses. Although it has proven difficult to obtain sufficient amounts of homologous pol \u03b4 for parallel in vitro biochemical studies, by altering Drosophila PCNA using site-directed mutagenesis as suggested by our results, in vitro biochemical studies may now be performed using human and/or calf thymus pol \u03b4 preparations.Our results therefore suggest that all four above effects depend at least in part on the PCNA-pol \u03b4 interaction. Moreover unlike mammals,  Drosophila melanogaster homologs of the proteins required for both DNA replication and repair have been identified and in several cases purified to apparent homogeneity. These include DNA polymerase \u03b1 holoenzyme ) and respective proteins were expressed. Finally bacteria were lysed and his-tagged proteins were purified using various procedures including Ni2+-IDA Sepharose chromatography. The purity of each was determined by SDS-PAGE and is shown as indicated  and replacement of the entire fly interdomain connector loop with corresponding human amino acids (dr119-133h dPCNA) had demonstrable effects. Of note, at relatively high concentrations, Drosophila PCNA but with the entire fly interdomain connector loop replaced by corresponding human amino acids (dr119-133h dPCNA) was similarly effective to wild-type human PCNA at stimulating the activity of calf thymus pol \u03b4; however, it was considerably less effective at lower concentrations  was purCNA Fig. . Mutatio acid Q12V dPCNA aDrosophila PCNA had relatively much less effect on the processivity of calf thymus pol \u03b4  was readily detectable but neither gave results as robust as those seen with wild-type human PCNA . PCNA-dependent TLS by pol \u03b4 was first reported by O'Day et al.  and subssic site ) used prsic site ). The momer Fig.  lane 3. l \u03b4 Fig.  lane 4 aded Fig.  lane 5. ded Fig.  lane 6. Drosophila PCNA are more than 70% identical at the level of primary amino acid sequence, wild-type Drosophila PCNA is only a very poor substitute for human PCNA in cell-free reactions with calf thymus pol \u03b4. This is documented both in this report and previously ATP and [\u03b1-32P]dTTP were from Amersham Corp. E. coli DNA polymerase I Klenow fragment without 3'-5' exonuclease activity (exo-), was expressed and purified according to standard protocols ATP. Afterward, labeled primer was annealed to an unlabeled template. The standard reaction mixture for pol \u03b4 contained 40 mM Bis-Tris, pH 6.7, 6 mM MgCl2, 1 mM dithiothreitol, 10% glycerol and 40 \u03bcg/ml bovine serum albumin. Additional details are provided in the figure legends. Incubations were terminated by addition of standard stop solution and aliquots were subjected to 12% PAGE in the presence of 7 M urea and 15% formamide. After electrophoresis, gels were subjected to autoradiography and/or Molecular Dynamics 445 SI PhosphorImager analyses.Assays of pol \u03b4 on synthetic oligonucleotide template-primers were performed essentially as previously described . Primers~500 annealed to (dT)12\u201318 (both from Pharmacia) in a final volume of 5 \u03bcl containing 6 nmol poly(dA) (nucleotide), 0.2 nmol (dT)12\u201318 (nucleotide), 10 \u03bcM dTTP, 100 \u03bcCi [\u03b1-32P]dTTP, 40 mM Bis-Tris, pH 6.7, 6 mM MgCl, 1 mM dithiothreitol, 10% glycerol, 40 \u03bcg/ml bovine serum albumin, 10 ng of highly purified pol \u03b4 and various quantities of different PCNA samples as indicated. Assays were for 5 min at room temperature and were stopped by addition of standard PAGE stop solution and PAGE in the presence of 7 M urea. After electrophoresis, gels were subjected to autoradiography and/or Molecular Dynamics 445 SI PhosphorImager analyses.Processivity was evaluated qualitatively using (dA)2 and otherwise as detailed in the figure legend. EDTA was included in each incubation and in the gel electrophoresis buffer at a final concentration of 3 mM.Nondenaturing PAGE band mobility shift assays were performed essentially as previously described  but withDJuM performed all enzymologic and mobility shift assays with DNA polymerase \u03b4 in combination with both wild-type and various mutant PCNA molecules. He also designed, engineered and characterized all recombinant PCNA molecules. DJuM expressed several recombinant proteins in bacteria and purified them. Finally, he participated in DNA polymerase purification and drafted the original manuscript. MM expressed some recombinant proteins in bacteria and purified them. She also purified and characterized most DNA polymerase substrates. HM participated in DNA polymerase purification and manuscript preparation. PAF advised DJuM on execution and interpretation of experiments and assisted both in figure design and all other aspects of manuscript preparation. All authors read and approved the final manuscript."}
+{"text": "K164RPCNA mutation not only renders cells sensitive to DNA-damaging agents, but also strongly reduces activation induced deaminase-dependent single-nucleotide substitutions in the immunoglobulin light-chain locus. This is the first evidence, to our knowledge, that vertebrates exploit the PCNA-ubiquitin pathway for immunoglobulin hypermutation, most likely through the recruitment of error-prone DNA polymerases.Proliferating cell nuclear antigen (PCNA) is a DNA polymerase cofactor and regulator of replication-linked functions. Upon DNA damage, yeast and vertebrate PCNA is modified at the conserved lysine K164 by ubiquitin, which mediates error-prone replication across lesions via translesion polymerases. We investigated the role of PCNA ubiquitination in variants of the DT40 B cell line that are mutant in K164 of PCNA or in Rad18, which is involved in PCNA ubiquitination. Remarkably, the  PCNA that prevents the protein's ubiquitylation and SUMOylation are sensitive to DNA damage and are dramatically deficient in AID-induced hypermutation.Vertebrate DT40 cells with a mutation in RAD6 pathway of post-replicative DNA repair , allowing the detection of deleterious Ig light-chain mutations by loss of sIg expression . To compK164R/K164RPCNA (\u2212/\u2212REV1 (unpublished data) cells are similarly distributed as mutations from RAID\u03c8\u2212V cells [\u2212/\u2212, REV1\u2212/\u2212,RAD18 and K164R/K164RPCNA cells yield about 2-, 3-, and 7-fold fewer of mutations per sequence, respectively, than RAID\u03c8\u2212V cells do .All types of mutations are reduced in K164RPCNA single-codon substitution causes marked sensitivity to genotoxic stress and a strong decrease in Ig hypermutation in the DT40 cell line. Although the mutation prevents mono-ubiquitination as well as SUMOylation, the observed phenotype is most likely due to the lack of ubiquitination. This is consistent with the finding that the RAD18 knockout, which does not affect PCNA SUMOylation but decreases PCNA ubiquitination, shows a similar, though more modest, phenotype compared to the K164RPCNA mutation. The results indicate that PCNA ubiquitination has not only preserved its role for DNA repair from yeast to higher eukaryotes, but has been exploited additionally for Ig diversification in vertebrate B cells. It is currently difficult to assert the role of the PCNA SUMOylation, because the Srs2 protein, which is recruited by SUMOylated PCNA in S. cerevisiae [K164RPCNA mutant does not exhibit any obvious defects in proliferation.This study demonstrates that the revisiae ,21 is noK164RPCNA phenotype in DT40 is likewise a defect in the recruitment of error-prone translesion DNA polymerases. One of the polymerases activated by PCNA ubiquitination seems to be Rev1, because K164R/K164RPCNA and \u2212/\u2212REV1 cells show similar sensitivities to DNA-damaging reagents and a similar decrease in C-to-G and G-to-C mutations. The selective decrease of this type of hypermutation may reflect the deoxycytidyl transferase activity of Rev1, which would add cytosine opposite to an abasic site in the template strand [REV1 mutant in which the deoxycytidyl transferase activity is selectively inactivated does not rescue the Ig hypermutation defect seen in DT40 after REV1 disruption [K164R/K164RPCNA cells, but not in \u2212/\u2212REV1 cells, suggesting that PCNA ubiquitination directly activates other translesion DNA polymerases apart from Rev1. Vice versa, the low viability and increased DNA damage sensitivity of K164R/K164R REV1\u2212/\u2212PCNA cells indicates that Rev1 fulfills some functions independent of PCNA ubiquitination. C-to-T and G-to-A transitions predominate among the mutations still detected in K164R/K164RPCNAcells. Although these mutations could be due to an error-prone pathway operating independently of PCNA ubiquitination, they may also reflect AID-induced uracils, which have escaped excision by UNG-2 and have paired with adenines during replication.Studies in yeast  and evide strand . These ie strand  and thatsruption . Other t\u2212/\u2212RAD18 cells, recently also reported by another group [S. cerevisiae. The RAD18 knockout construct used in the studies most likely generates a RAD18 null mutation [RAD18 RING finger coding sequence. To rule out that the analyzed RAD18 mutant still possessed enzymatic activity, we generated a second RAD18 mutant in which the RING finger-coding region is deleted. Analysis of this new mutant confirmed the persistence of low-level PCNA ubiquitination seen in the first RAD18 mutant (unpublished data). These data point to the presence of a Rad18-independent back-up pathway of PCNA ubiquitination in vertebrate cells. A possible candidate for an E3 ligase involved in PCNA ubiquitination in \u2212/\u2212RAD18 cells may be the gene product of FANCL [\u2212/\u2212RAD18 cells compared to K164R/K164RPCNAcells. Whereas it was initially reported that RAD18 disruption in wild-type DT40 does not affect Ig hypermutation [\u2212/\u2212RAD18cells, and another group recently reported a strong decrease in hypermutation activity [The remaining low level of PCNA mono-ubiquitination in DT40 er group , is surpmutation , althougof FANCL . The resmutation , we deteactivity . We beliUNG-disrupted and \u03c8V-deleted DT40 suggests that about one in seven AID-induced uracils is converted into a mutation [If ubiquitinated PCNA functions as a link to the recruitment of error-prone polymerases during Ig hypermutation, it remains an intriguing question how it is coupled to upstream events in the hypermutation process. The DNA editing model assumes that AID first deaminates cytosine to uracil and that the resulting uracil is then excised by UNG-2 . A compamutation . This himutation  and exciRAD18 knockout constructs, which delete codons 163\u2013182 of the RAD18 gene, were obtained from Dr. Shunichi Takeda . The REV1 knockout constructs were designed to delete REV1 codons 119\u2013407 by targeted integration. These constructs were transfected into the RAID\u03c8\u2212V and K164R/K164RPCNA clones in a stepwise manner to generate the following homozygous knockout clones: \u2212/\u2212, PCNAK164R/K164R RAD18\u2212/\u2212, REV1\u2212/\u2212,RAD18 and K164R/K164R REV1\u2212/\u2212PCNA , 3H1 histone H3 , and L7E7 AID . For NiNTA purification, the coding sequences for His-tagged human ubiquitin  were clo137 was used for \u03b3 radiation resource. Each curve is derived from two to three separate experiments.Colony survival on methylcellulose-containing medium was performed as described . CisplatSubcloning, antibody staining, flow cytometry, and quantification of sIgM expression has been described previously .PfuUltra hotstart polymerase  was used for amplification prior to sequencing. Long-range PCR and sequencing were performed as previously described [RAID\u03c8\u2212V subclones were pooled with sequences previously obtained under the same conditions [PCNA, REV1, and RAD18 mutants could be compared.To minimize PCR-introduced artificial mutations, escribed . To mininditions ,18 to esFigure S1PCNA (A), RAD18 (B), and REV1 (C), respectively. The position and orientation of the primers used for the screening by long-range PCR are indicated. The identification of the desired clones relied on the appearance of new PCR fragments as well as the disappearance of germline fragments. \u03bb HindIII/\u03d5X HaeIII was used as size marker.Physical maps of the loci, the targeting vectors, and the targeted alleles are shown for (366 KB PDF)Click here for additional data file.http://www.ebi.ac.uk/swissprot) accession numbers for the sequences displayed in Schizosaccharomyces pombe (Q03392), and S. cerevisiae (NP_009645).The Swiss-Prot ("}
+{"text": "Remarkably, such susceptibility was integration independent, since retroviruses devoid of integration activity also showed enhancement of the initial steps of infection. Moreover, the elevated sensitivity of the Rad18\u2212/\u2212 cells was also observed with adenovirus. These data indicate that Rad18 suppresses viral infection in a non-specific fashion, probably by targeting incoming DNA. Furthermore, considering data published recently, it appears that the interactions between DNA repair components with incoming viruses, often result in inhibition of the infection rather than cooperation toward its establishment.Host factors belonging to the DNA repair machineries are assumed to aid retroviruses in the obligatory step of integration. Here we describe the effect of DNA repair molecule Rad18, a component of the post-replication repair pathway, on viral infection. Contrary to our expectations, cells lacking Rad18 were consistently more permissive to viral transduction as compared to Rad18 Various cellular factors are thought to interact with invading retroviruses, either assisting the viral proteins or functioning as protecting factors against them. Productive viral infection, therefore, depends on the way the equilibrium between these two opposite group of molecules is leaning. The authors find that Rad18, a component of the post-replication DNA repair pathway, instead of aiding retroviral infection suppresses its establishment, interfering with the accumulation of the invading DNA. They also find that such suppressive activity is not restricted only to retroviruses but also concerns adenovirus infection. These results, in conjunction with those recently published, lead the authors to hypothesize a role for DNA repair mediated genome stability maintenance in viral infection, or in other words, that viral invasion is also a matter of genome stability. The life cycle of retroviruses distinguishes itself from that of other viruses by the fact that it undergoes a process of reverse transcription and insertion of its genome into that of the host. This latest step is carried out by viral integrase (IN) in concert with host proteins most likely to be part of the various DNA repair machineries. A number of physical and/or functional interactions have been described between the viral constituents involved with the integration process and cellular elements that may act as cofactors for catalysis or gap repair, reviewed by Turlure et al. . MechaniWe have previously described that Rad18, a molecule belonging to a distinct DNA repair pathway known as post-replication DNA repair, associates with HIV-1 integrase when both proteins are overexpressed in human embryonic kidney (HEK) 293T cells . Under tStudies on the mechanism of post-replication DNA repair, both in yeast and mammalian cells, have shown that Rad18 is directly responsible for the specific mono-ubiquitylation of the polymerase adapter PCNA \u201316. ThesHere we present the results of a genetic study on the relevance of Rad18 in the early phases of viral infection. We show that Rad18 suppresses viral infection. Moreover, we determined that Rad18 inhibitory activity is not restricted to retroviruses, but extends to adenovirus as well. Furthermore, we provide evidence that suggests that Rad18 acts on the viral DNA, preventing it from reaching the replicative stage.\u2212/\u2212 primary murine embryonic fibroblasts (MEFs) [\u2212/\u2212 cells were approximately 5-fold more sensitive to infection than Rad18+/+ cells    and theis (MEFs) . Analysi= 0.007) A.\u2212/\u2212 cells was specific to HIV-1, we infected Rad18\u2212/\u2212 and Rad18+/+ cells with murine leukemia virus (MLV). Cells were inoculated with increasing amounts of an ecotropic envelope pseudotyped MLV-based retroviral vector expressing EGFP as reporter. +/+ cells .To investigate whether the enhanced susceptibility to infection of the Rad18\u2212/\u2212 MEF cell lines complemented with Rad18, most likely due to the toxicity of Rad18 long-term unregulated expression, we next tested whether transient expression of Rad18 in human cells would inhibit infection. Hela were cells transfected with a bicistronic vector encoding Rad18-IRES-HcRed or as a control IRES-HcRed only, and infected with HIV-1\u2013based EGFP reporter virus. t test p-value = 0.017) as compared to cells transfected with control plasmid.Because we failed to obtain stable Rad18Taken together, these results indicate that Rad18 has an inhibitory effect on retroviral infection.\u2212/\u2212 cells have a high frequency of sister chromatid exchange, and more efficiently incorporate selectable markers by stable transfection [\u2212/\u2212 cells even in the absence of a catalytically active viral integrase, facilitated by the absence of a functional post-replication DNA repair pathway. To test this assumption, cells were inoculated with HIV-1\u2013based VSV-G pseudotyped reporter viruses with integrase harboring a mutation in the catalytic domain at the position D116 [t test p-value = 0.00042) higher in Rad18 knockout cells than in RAD18+/+, suggesting that the increase in infection of Rad18\u2212/\u2212 cells is independent of integrase catalytic activity.Rad18sfection . Given oion D116 . Figure +/+ and Rad18\u2212/\u2212 cells were inoculated with a HIV-1 retroviral vector\u2013derived virus harboring a catalytically inactive integrase and split 1:10 at day 2, 5, and 9 post-infection. At the same time points, aliquots of the infected cells were analyzed by flow cytometry for EGFP expression. +/+ and in Rad18\u2212/\u2212 cells. Rad18+/+ EGFP-positive cells are barely detectable, whereas Rad18\u2212/\u2212 cells show a higher frequency of positive cells, with a steady time-dependent decline. These results show that EGFP expression from IN-defective virus originates from non-integrated viral cDNA that may accumulate in greater quantities in Rad18\u2212/\u2212 than in Rad18+/+ and is then lost by dilution during cell division.In order to assess whether the EGFP expressed in cells infected with a mutant virus originated from integrase-independent integrated provirus or from non-integrated episomal viral DNA, Rad18+/+ and Rad18\u2212/\u2212 cells with saturating amounts  of HIV-1\u2013derived retroviral vector\u2013carrying wild-type integrase to test whether the absence of Rad18 could cause upon infection premature death as the result of the failure to repair the integration site. Cells were split and analyzed 2, 5, and 9 days post-infection. +/+ cells and for the Rad18\u2212/\u2212 cells, indicating that Rad18 is dispensable for stable retroviral integration and that infection is not cause of widespread cell death, as confirmed by microscopy inspection (unpublished data).In parallel, we infected Rad18\u2212/\u2212 cells, we measured the levels of late reverse transcription products. Cells transduced with VSV-G pseudotyped integration-deficient HIV-1 retrovirus were harvested at different time points and late reverse transcription was estimated by quantitative PCR (QPCR). +/+ cells .To test the presence of an increased accumulation of viral cDNA in Rad18t test p-value = 0.02 and 0.014, respectively). This result is seemingly at odds with that observed with the Rad18\u2212/\u2212 MEFs in which the absence of Rad18 increased the accumulation of viral cDNA. However overexpression of Rad18 likely results in the titration of other components of Rad18-containing complexes, including those that influence retroviral cDNA metabolism. The saturation of these degradation complexes may preclude their contact with the incoming viral DNA and thereby result in the observed increased reverse transcription product accumulation. Nonetheless, both under- or overexpression of Rad18 affect both reverse transcription and infection, and those findings suggest that Rad18 modulates either the reverse transcription reaction or the stability of the reverse transcription product.In order to measure the levels of viral cDNA synthesis in the presence of overexpressed Rad18, Hela cells transfected with Rad18-IRES HcRed-expressing plasmid or HcRed control were infected with VSV-G pseudotyped integration-deficient HIV-1 retrovirus and sorted at 12 and 20 h post-infection. +/+ and Rad18\u2212/\u2212 cells with a recombinant replication-defective adenovirus expressing EGFP as reporter. As can be seen in \u2212/\u2212 cells are 4- to 5-fold more sensitive to adenovirus infection than Rad18+/+ controls . Since adenoviruses replicate independently of reverse transcription and integration, this finding suggests that the Rad18 effect on both adeno- and retro-virus infections is the consequence of a response to the presence of foreign DNA rather than the inhibition of reverse transcription.Because the effect of Rad18 on retroviral infection seemed to involve viral cDNA accumulation, we next asked whether this was due to an effect on reverse transcription or, alternatively, on the degradation of its product. To address this question, we infected both RAD18Prompted by the interaction of the HIV-1 integrase with DNA repair molecule Rad18 , we set +/+ controls. Moreover, Rad18-negative cells were not only more sensitive to HIV-1, but also to MLV and adenovirus. Notably, the increase of infection efficiency of the Rad18\u2212/\u2212 cells is integration independent, as the effect also occurs using HIV-1 lacking functional integrase. The absence of strong specificity suggests that the apparent anti-viral activity of Rad18 targets a common component in the early phases of infection of all three types of viruses, probably double-stranded DNA. This notion is consistent with the finding that the abundance of viral cDNA product was higher in the Rad18\u2212/\u2212 cells. The observation that differences in the accumulation of cDNA become evident after the eighth hour post-infection suggests that Rad18 inhibitory effect may be detectable only when the reverse transcription product has crossed the nuclear envelope and can therefore come in contact with this nuclear protein. Furthermore, this could also explain some of the earlier phenotypes observed in the original RAD18\u2212/\u2212 embryonic stem cells [Surprisingly, cells that lack Rad18 were consistently more susceptible to viral infection than their Rad18em cells . In thesThe fact that a DNA repair protein such as Rad18 suppresses retroviral infection instead of aiding its establishment is only partially counterintuitive. Indeed, studies in yeast have reported that a number of molecules involved in DNA repair and genome stability have an inhibitory effect on retrotransposition ,23. FurtIn principle, one might therefore consider DNA repair molecules as components of a broader intrinsic immunity to viruses . Within \u2212/\u2212 and Rad18+/+ MEFs established from Rad18\u2212/\u2212 knockout and Rad18+/+ mice were described earlier [Rad18 earlier . MEFs, HRetroviruses were produced by three plasmid transfection of either HIV-1 or MLV EGFP-bearing vectors in conjunction with Gag-Pol\u2013expressing plasmids and a third plasmid encoding the appropriate envelope protein. HIV-1 reporter vector pHR SIN CSGW was described earlier . HIV-1 GHEK 293T cells were transfected using Lipofectamine 2000 (Invitrogen) or polyethylenimine (PEI)  . About 4Escherichia coli strain BJ5153 as recommended by the manufacturer.Adenovirus reporter vector pAdenoVator\u0394E1/E3 CMV-5 EGFP, containing the genome of adenovirus serotype 5 (Ad5) with deleted E1 and E3, was constructed by cloning EGFP cDNA into pAdenoVator-CMV-5  and then inserting the adenovirus CMV-5 EGFP containing region of the construct into pAdenoVator\u0394E1/E3 by homologous recombination through transformation of EGFP reporter adenovirus was produced by transfection of pAdenoVator\u0394E1/E3 CMV-5 EGFP and serial amplification in HEK 293A (Qbiogene) following the manufacturer's recommendations.The bicistronic Rad18 vector consists of the human version of an N-terminal FLAG-tagged Rad18 followed by an EMCV IRES and HcRed sequence as reporter.\u2212/\u2212 and Rad18+/+ MEFs were plated in 24-well plates at 40,000 cells/well, and infected with serial dilutions of the various viruses. Infections were carried out overnight and, in the case of the retroviruses, in the presence of 8 \u03bcg/ml of polybrene. About 44 h after infection, cells were trypsinized, fixed with PBS 3% formaldehyde , and analyzed for EGFP expression by flow cytometry using FACScalibour instrument ; 20,000 events were acquired per sample.Rad18For transfection/infection experiments, Hela cells were transfected with plasmids encoding Rad18-IRES-HcRed or IRES-HcRed only, as control, using Lipofectamine 2000 . Twenty-four hours after transfection, cells were infected with serial dilutions of HIV-1\u2013derived EGFP reporter virus. After 48 h, cells were analyzed by flow cytometry and infection was determined as the percentage of HcRed-positive cells expressing the viral-derived EGFP reporter molecule.\u2212/\u2212 and Rad18+/+ MEFs were plated in 24-well plates at a density of 40,000 cells/well. The following day, cells were infected with VSV-G pseudotyped HIV-1 integration-deficient reporter virus previously treated with 150 units/ml of DNase I  for 30 min at 37 \u00b0C. Infections were carried out for 4 h in the presence of 8 \u03bcg/ml of polybrene, then cells were rinsed with PBS and fed with complete medium. Cells were harvested at time points 4-, 8-, 12-, and 24-h post-infection, pelleted, and frozen at \u221270 \u00b0C. In the case of the transfection/infection experiments, Rad18-IRES-HcRed and IRES-HcRed control transfected cells were infected with DNase I\u2013treated VSV-G pseudotyped HIV-1 integration-deficient reporter virus. Twelve and twenty hours post-infection, HcRed-positive cells were sorted with MoFlo cell sorter , pelleted, and frozen at \u221270 \u00b0C. Total genomic DNA was extracted using QIAamp DNA Blood kit  and eluted in 100-\u03bcl final volume; 2 \u03bcl of each sample were used in order to perform QPCR. Primers used for the detection of late reverse transcription products were the following: primer 1002 91\u2013119 TCTCTGGCTAACTAGGGAAC and 950 339\u2013320 GCCGCCCCTCGCCTCTTG. Reporter fluorophore for the labeling of double-stranded DNA product was SYBR green  and reactions and acquisitions were performed using ABI PRISM 7700 Sequence Detector  and 7500 Real Time PCR System (Applied Biosystems). Normalization was accomplished by measuring the DNA concentration of each sample using PicoGreen dsDNA Quantitation Reagent (Molecular Probes) following manufacturers instructions. Data are presented as number of late reverse transcription molecules per nanogram of total genomic DNA.Rad18http://www.ncbi.nlm.nih.gov/Genbank) accession numbers for the genes and gene products discussed in this paper are Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G (APOBEC3G) (NM_021822), proliferating cell nuclear antigen (PCNA) (NM_182649), polymerase (DNA directed), eta (POLH) (polymerase \u03b7) (NM_006502), RAD18 homolog (NM_020165), RAD52 homolog variant alpha (NM_002879), mRNA for uracil-DNA glycosylase (UNG2) (HS09008), excision repair cross-complementing rodent repair deficiency, complementation group 3 (XPB) (NM_000122), excision repair cross-complementing rodent repair deficiency, complementation group 2 (XPD) (NM_000400), and Mus musculus RAD18 homolog (NM_021385).The GenBank ("}
+{"text": "When immunologists discovered in the 1970s that human immune cell receptors recognize tens of millions of antigens\u2014telltale signs of a foreign invader\u2014they were mystified. How could a genome with just 100,000 genes  generate this staggering diversity? The answer came with the discovery of a gene rearrangement process that draws on millions of possible permutations to create a unique surface receptor on every T and B lymphocyte\u2014the immune system\u2019s main weapons. But gene diversification of B lymphocytes doesn\u2019t stop there. The immunoglobulin genes, which encode the Y-shaped antibodies that flag infectious microbes for destruction, undergo additional point (single\u2013base pair) mutations that enhance pathogen recognition.Rad6 DNA-repair gene) steps in to either recruit specialized translesion polymerases to bypass the damage, or to copy the correct base sequence from the intact sister strand. While adept at dealing with damaged DNA, the translesion polymerases are \u201cerror-prone\u201d compared to standard replicative DNA polymerases. This tendency can be beneficial within the immunoglobulin genes, however, because the introduced mutations can improve antigen recognition of the encoded antibodies. But it was unclear how translesion polymerases are recruited for immunoglobulin hypermutation.In a new study, Hiroshi Arakawa, Stefan Jentsch, and Jean-Marie Buerstedde find a surprising link between one of these mutation-inducing mechanisms, called immunoglobulin hypermutation, and a DNA repair pathway. When the transcription machinery encounters a DNA lesion, the RAD6 pathway (named after the Rad6 and Rad18 tag proliferating cell nuclear antigen (PCNA) with a small molecule called ubiquitin. The tag is added to a conserved lysine amino acid residue, called K164\u2014a ubiquitination target in eukaryotes from yeast to humans. Yeast PCNA can undergo modifications at K164 by one ubiquitin tag (mono-ubiquitination), multiple tags (poly-ubiquitination), or by small, ubiquitin-related modifiers (SUMOs) in response to DNA damage. An amino acid substitution from lysine (K) to arginine (R) at position 164 (K164R) in yeast prevents the ubiquitination and SUMOylation but does not compromise the functions of the unmodified PCNA.Studies in yeast show that K164RPCNA mutation either alone or in combination with mutations that inactivated the RAD18 or REV1 genes.The role of PCNA ubiquitination has been well characterized in yeast but not in higher eukaryotes. It had been reported that human PCNA undergoes only mono-ubiquitination at K164, which increases its affinity for two translesion polymerases, Pol\u03b7 and REV1. Working with a chicken B cell line whose genetic tractability has made it a favored model for studying DNA repair and immunoglobulin hypermutation, the authors generated a series of clones carrying the K164RPCNA mutation showed neither modification. PCNA mono-ubiquitination was markedly reduced, but not eliminated, in cells lacking functional RAD18 genes. The K164RPCNA mutation also made cells vulnerable to DNA-damaging agents\u2014likely because PCNA failed to recruit the translesion polymerases\u2014suggesting that vertebrates also require PCNA ubiquitination at the K164 site to survive DNA damage.The authors analyzed extracts from the progenitor line and mutant clones to look for PCNA modifications. Mono-ubiquitinated and \u201cSUMOylated\u201d PCNA was evident in nonmutant cells, but clones carrying the K164RPCNA mutant clone. Loss of RAD18 or REV1, however, reduced the rates of mutations by about 2-fold and 3- to 4-fold, respectively.All the clones under study expressed immunoglobulin on their surface, allowing the authors to easily track the appearance of harmful mutations in the immunoglobulin variable regions (the targets of hypermutation). Whereas the progenitor line (serving as a control) showed a high rate of immunoglobulin loss (about 35% after 2 weeks culture), the rate was 7-fold reduced in the K164RPCNA single amino acid substitution not only renders cells sensitive to DNA damage but also dramatically impairs their capacity for immunoglobulin hypermutation. Both effects most likely result from the absence of ubiquitination, since the RAD18 mutant clone displays a similar but less severe DNA repair and hypermutation defect. Now that it\u2019s clear that the immune system has tailored the ubiquitination-PCNA pathway to its own needs, researchers can begin to work out the molecular details of this appropriation\u2014and perhaps explain how vertebrates managed to maximize the benefits of one pathway by using it in two systems critical for the survival of the organism.These results demonstrate that the"}
+{"text": "The processivity of this polymerase complex is dependent upon its interaction with the sliding clamp PCNA and the polymerase-PCNA interaction is largely mediated through the p66 polymerase subunit. We have analysed the interactions of the human p66 DNA polymerase \u03b4 subunit with PCNA and with components of the DNA polymerase \u03b4 complex in vivo. Expression of EGFP-p66 shows that it is a nuclear protein which co-localises with PCNA throughout the cell cycle. p66 is localised to sites of DNA replication during S phase and to repair foci following DNA damage. We have identified a functional nuclear localisation sequence and shown that localisation to replication foci is not dependent upon active nuclear import. Sub-domains of p66 act as dominant negative suppressors of colony formation, suggesting that p66 forms an essential structural link between the p50 subunit and PCNA. Analysis of the C-terminal PCNA binding motif shows that deletion of the QVSITGFF core motif results in a reduced affinity for PCNA, while deletion of a further 20 amino acids completely abolishes the interaction. A reduced affinity for PCNA correlates with reduced targeting to replication foci. We have confirmed the p66-PCNA interaction in vivo using fluorescence resonance energy transfer (FRET) techniques.Using the two-hybrid system, we have mapped the interaction domains for binding to the p50 polymerase \u03b4 subunit and with PCNA to the N-terminus and the C-terminus of p66, respectively. Co-immunoprecipitation experiments confirm that these interaction domains are functional in vivo.We have defined the regions of p66 required for its interaction with PCNA and the p50 polymerase subunit. We demonstrate a functional link between PCNA interaction and localisation to replication foci and show that there is a direct interaction between p66 and PCNA in living cells during DNA replication. The dominant negative effect upon growth resulting from expression of p66 sub-domains confirms that the p66-PCNA interaction is essential  The polymerisation of deoxyribonucleotides into DNA is one of the most fundamental processes of life and is carried out by DNA polymerases. A wide variety of these enzymes exist, including the accurate polymerases \u03b1, \u03b2, \u03b4, \u03b5 and \u03b3 and also the more recently discovered translesion polymerases, which can show a more flexible substrate specificity . The repin vitro show that pol \u03b1 and pol \u03b4 are sufficient for the completion of DNA replication, suggesting that pol \u03b4 acts as the major DNA replicative polymerase [Chromosomal replication in eukaryotic cells requires three distinct DNA polymerases: \u03b1, \u03b4 and \u03b5. The pol \u03b1-associated primase subunits synthesise oligonucleotides which are elongated for a short length (approximately 35 nucleotides) by the large catalytic subunit of DNA polymerase \u03b1. These short RNA-DNA segments are then elongated by pol \u03b4 or \u03b5 through a series of reactions in which the pol \u03b1-primase complex is displaced by Replication Factor C (RFC)-PCNA. The precise roles played by pol \u03b4 and pol \u03b5 are still not completely clear. Studies using purified protein preparations in SV40 DNA replication lymerase . Howeverlymerase , base exlymerase ,8 and dolymerase ,10. The lymerase ,11,12.S. pombe) and mammalian cells have shown that the native form of DNA polymerase \u03b4 consists of four subunits acting as a heterotetramer [S. pombe, deletion of the p12 homologue, Cdm1, does not affect cell proliferation or cause sensitivity to DNA damaging agents [In vitro reconstitution experiments using purified human proteins have shown that p12 is not essential for PCNA-dependent DNA replication, but that it is required to give a polymerase activity comparable to that of the native pol \u03b4 complex isolated from cell extracts [S. pombe, over-expression of Cdm1 can rescue temperature sensitive alleles in each of the genes encoding the other DNA polymerase \u03b4 subunits [Recent studies in fission yeast  and to PCNA is essential for its biological function [S. pombe polymerase \u03b4 complex was previously thought to exist as a dimer with Cdc27 mediating the dimer interface [S. cerevisiae [Studies in it, Cdc1 . Cdc1 init, Cdc1 . Cdc27 iit, Cdc1 ,22. Reconit Pol3 . Geneticfunction . The p66nterface . It is nnterface . Similarrevisiae .S. cerevisiae is Pol32, although a homologue of Cdm1/p12 has not been found. In vitro experiments show that the addition of Pol32 to the purified dimeric form of the polymerase results in an increased processivity rate and Pol32 interacts with PCNA [POL32 gene results in a temperature sensitive phenotype and sensitivity to DNA damage [POL32 deletion is lethal when combined with a temperature sensitive mutation in POL3 which encodes the pol \u03b4 catalytic subunit. This suggests that, in contrast to S. pombe, the interaction between pol \u03b4 and PCNA can be mediated by some other mechanism in S. cerevisiae. In native gel analysis using purified proteins, a well-defined complex between polymerase \u03b4 and PCNA was only observed when Pol32 was present containing an intact PCNA-binding domain. However, in in vitro DNA replication assays, loss of the p50-binding domain had a far stronger effect than loss of the PCNA-binding domain on PCNA-dependent polymerase processivity. This suggests that a region in addition to the PCNA-binding consensus in Pol32 contributes to the interaction of PCNA with the polymerase complex [The homologue of Cdc27 in ith PCNA . SurprisA damage . POL32 dS. pombe or S. cerevisiae and some studies have failed to find it in human cells [A direct interaction between PCNA and the p125 subunit has been demonstrated in mammalian cells ,28,29, aan cells ,30-32.S. cerevisiae, DNA replication by a dimeric complex of Pol3-Pol31, which is equivalent to p125-p50 in human cells, was PCNA-dependent, though proceeded inefficiently and was characterised by frequent pausing. Addition of Pol32, which is equivalent to p66, resulted in significantly increased PCNA-dependent processivity [In mammalian cells, the Cdc27 homologue (p66) was identified as a polymerase \u03b4 subunit by affinity chromatography using either PCNA or anti-p125 antibodies to isolate the polymerase complex ,33,34. Iin vivo. We have mapped interaction domains by expressing various regions of the protein and also analysed their subcellular localisation. We have measured fluorescence resonance energy transfer (FRET) to determine if p66 forms direct, rather than complex-mediated, interactions in vivo.Here we describe results from our examination of the interactions of human p66 pol \u03b4 subunit with PCNA and with components of the DNA polymerase \u03b4 complex S. pombe PCNA. Human PCNA could not be used as a pACT fusion as this construct shows strong self-activation. There was no detectable p66-p66 interaction suggesting that the protein does not dimerise. This correlates with observations seen with S. cerevisiae: although the p66 homologue Pol32 was initially thought to dimerise in the two hybrid system it was later found that this was due to the bridging activity of the endogenous S. cerevisiae PCNA [S. pombe Cdc27 cannot be analysed in this way as it results in reporter activation when expressed as a fusion with the GAL4 DNA binding domain (data not shown). No interaction was seen between p66 and Cdc27, or between p66 and any other proteins tested, including those known to interact with PCNA in the replication complex such as Fen1 or uracil DNA glycosylase (UNG2). Although expression of pAS-p50 results in some background reporter activation, it is clear that there is a significant interaction between the p50 and p66 subunits  or the DNA binding domain (pAS-p66). As shown in Figure iae PCNA . S. pomb overall .6 clones were screened in two separate experiments and two independent positive clones identified with strong activation of the reporters His3 and \u03b2-galactosidase. These clones showed a very specific interaction with p66 when compared with a range of pACT constructs and were both found to encoded full-length clones of p50. To map the domain of p66 responsible for the interaction with p50, various regions of p66 were tested in the two-hybrid system. The smallest clone which showed an interaction was that encoding amino acids 1 \u2013 144 (pACT-p66S2) which is a region similar to, though slightly smaller than, the Cdc1-interacting region in Cdc27 in S. pombe [To identify other proteins which interact with p66, a two-hybrid screen was undertaken with the full-length protein fused to the GAL4 DNA binding domain. 1.4 \u00d7 10S. pombe .in vivo by the conserved PCNA-binding motif, though N-terminal flanking sequences are also important. They show that p66 can interact with p50 independently of its interaction with PCNA. We also show that p66 mutated in a putative nuclear localisation sequence is capable of binding to both p50 and PCNA (see below).To study the interaction of p66 with PCNA further we used various constructs expressing p66 in human U2OS osteosarcoma cells as fusions with Enhanced Green Fluorescent Protein (EGFP). A conserved PCNA-binding domain is localised at the C-terminus of p66 and this is conserved between other p66 homologues ,33-35. VFurther evidence to support the role of p66 of mediating the p50-PCNA interaction is shown in Figure We have shown that the p66 protein interacts with p50 and PCNA and mapped the regions involved in these interactions. We predicted that high-level expression of regions of p66 which interact with only one of p50 or PCNA would be deleterious to the cell by acting as a dominant negative. To investigate this phenomenon we undertook clonogenic assays to determine if expression of various domains was deleterious to the cell over a period of time. Our results show that while expression of EGFP-p66 was indistinguishable from the EGFP control, expression of either EGFP-p66\u039411 or EGFP-p66S2 which do not interact with PCNA, results in reduced cell proliferation following selection for plasmid maintenance Figure .-2. The upper cell shows a pattern of p66 and PCNA localisation which is typical of S phase, while the lower cell shows a pattern typical of DNA repair. This pattern of localisation is consistent with the role of DNA polymerase \u03b4 in repair, especially nucleotide excision repair, and confirms that the p66 subunit is specifically involved.During S phase, p66 localised to distinct nuclear spots which are typical of replication foci  . Using sMany proteins have been identified which interact with PCNA through the small conserved PCNA-binding motif . In somein vivo. To do this we used fluorescence resonance energy transfer (FRET) technology to determine whether the fluorescent tags (ECFP and EYFP) are closer than 100 \u00c5/10 nm [in vivo interactions in human cells. We calculated FRET from the mean intensities within a replication focus  and normalized these values against the different protein expression levels, NFRET, in cells co-transfected with ECFP-PCNA and EYFP- p66, ECFP-PCNA and EYFP-PCNA (positive control) and ECFP-UNG2 and EYFP-p66 (negative control) . By using FRET we can clearly distinguish between co-localisation and interaction.Since proteins that co-localise do not necessarily interact directly, we explored whether EYFP-p66 and ECFP-PCNA directly interact  \u00c5/10 nm . FRET ocS. pombe and S. cerevisiae, respectively. p66 homologues have now been identified in a wide range of organisms, but in general they have a very poor level of protein sequence similarity with the exception of the conserved PCNA-binding motif at the C-terminus.Several lines of conflicting evidence exist concerning the mechanism of interaction of DNA polymerase \u03b4 with PCNA. The catalytic subunit p125 shows low activity and little response to PCNA stimulation when over-expressed in insect cells. Although direct interaction between PCNA and the p125 subunit appears to take place in mammalian cells ,28,29 thin vivo. In our initial experiments using the two-hybrid system we were able to show that p66 was able to interact with both p50 and PCNA. This is similar to results seen in the S. pombe and S. cerevisiae homologues of p66. We also show that p66 does not dimerise in this system. In a two-hybrid screen using p66 as bait, the only positive clones identified were those expressing full-length p50. We did not expect to identify human PCNA in this screen, as the full-length protein when fused to the Gal4 activation domain results in a construct that is self-activating and so would be excluded as a false positive. The p50-interacting domain was mapped to amino acids 1\u2013144, which is similar, though slightly smaller than the Cdc1 interaction region in Cdc27.Here we describe the analysis the protein interaction domains of human p66 by expressing various tagged and fusion proteins in cultured cells and we have correlated their subcellular localisations with their interactions Using various domains of p66 expressed as fusions with EGFP in human cells, we were able to confirm that the domain identified as interacting with p50 using the two-hybrid system was also sufficient for the interaction in cell extracts using co-immunoprecipitation experiments. This domain showed no detectable interaction with PCNA. We also found that high levels of expression of either the p50-interacting or the PCNA-interacting domains are deleterious to cell proliferation over periods of growth selection in colony assays. This indicates that these domains can act as \"dominant negatives\" to compete for binding to the endogenous p50 and PCNA.WAF1. The crystal structure of the PCNA-binding region from this protein complexed with PCNA has been solved which shows that the conserved motif makes a helical turn which has interactions within a hydrophobic pocket on PCNA. Sequences C-terminal to the motif make a \u03b2-sheet interaction with the inter-domain linker region of PCNA. In proteins such as DNA ligase I and the largest subunit of RFC the conserved motif lies at the extreme N-terminus indicating that N-terminal regions do not play a role in the PCNA interaction. However, in p66 we see that sequences lying up to 20 amino acids N-terminal to the conserved motif clearly play a role in the interaction. The mechanism by which this region interacts with PCNA awaits further investigation. The conserved PCNA-binding motif has been linked to replication foci targeting: in DNA ligase I the N terminal 20 amino acids containing the PCNA-binding motif are capable of directing localisation of heterologous proteins to replication foci [Fine mapping of the PCNA-binding domain at the C-terminus showed that the p66\u039411 protein  significantly reduced, though did not completely abolish binding to PCNA in co-immunoprecipitation assays. The deletion of an additional 20 amino acids completely abolished the interaction, suggesting a region N-terminal to the core-conserved domain makes a significant contribution to the PCNA interaction. The best-characterised incidence of a PCNA-interacting motif is in the cell cycle regulatory protein p21ion foci . HoweverS. pombe where binding to PCNA and protein function in vivo could be correlated. Reynolds et al. showed that the C-terminal 20 amino acids of Cdc27 were essential both for PCNA binding and protein function. However, high level expression of a construct lacking the C-terminal 10 amino acids containing the core PCNA-binding motif was still able to rescue growth of a cdc27\u0394 strain, though quite poorly. This suggests that regions of Cdc27 N-terminal to the core PCNA binding domain may also contribute to PCNA binding [These results correlate with those found for the p66 homologue, Cdc27, in  binding .in vivo. We find that the NFRET between PCNA and p66 is similar to the NFRET shown by the extremely stable PCNA-PCNA interaction,  was a kind gift from Dr. Stuart MacNeill, University of Edinburgh. The pACT-p50 clone was identified by two-hybrid screening. pACT-p66S2 (which expresses amino acids 1 \u2013 144) was constructed by digesting pACT-p66 with SacI and religating. pACT-p66S1 (which expresses amino acids 1 \u2013 375) was constructed by cloning the SacI fragment interior to the p66 open reading frame into pACT-p66S2 to extend the open reading frame. Clones of eviously . Clones eviously .BglII-HindIII fragment and cloned into pECFP-C1. Further C-terminal truncations were generated from the original construct, using the QuikChange site-directed mutagenesis method (Stratagene) to incorporate stop codons. pEYFP-p66\u0394N145 contains a HindIII \u2013 BamHI fragment created by PCR cloned into pEYFP-C1. The cloning of ECFP-PCNA, EYFP-PCNA and UNG2ECFP constructs is as previously described [A NcoI \u2013 XhoI fragment was cloned from HA2030 into pEG202 to give pEG-p66. A BamHI \u2013 XhoI fragment was cloned from pEG-p66 into pEGFP-C3 (Clonetech) digested with BglII \u2013 SalI to give pEGFP-p66 which expressed full-length p66 fused to EGFP. Similarly, the insert from pACT-p66S2 was cloned as an NcoI \u2013 XhoI fragment into pEG202 to give pEG-KIA-S2 and the insert from this plasmid cloned as an EcoRI \u2013 SalI fragment into pEGFP-C3 to give pEGFP-p66S2. The deletion construct pECFP-p66\u039411 which does not express the C-terminal 11 amino acids of p66 was amplified by PCR as a escribed .S. cerevisiae strain Y190 which expresses LacZ and His3 reporter constructs under the control of the Gal1 promoter [2CO3, cell debris was removed by centrifugation, and the OD420 of the supernatant measured. Units of \u03b2-galactosidase were calculated as: Units = (1000 \u00d7 OD420)/(t \u00d7 v \u00d7 OD600) where t = time of reaction in minutes and v = volume of culture in ml.Two-hybrid analysis of proteins that interact with p66 was carried out essentially as previously described using the promoter . For twoCells were grown at 37\u00b0C and 5% carbon dioxide, in a humidified atmosphere. All cell types were grown in DMEM , supplemented with 10% v/v Foetal Calf Serum (FCS), 100 units/ml penicillin and 100 \u03bcg/ml streptomycin. Cells were transfected using Lipofectamine 2000 (Invitrogen) or using a calcium phosphate technique , according to the manufacturer's protocol, and harvested 24 hours post-transfection.2 dishes, and harvested by scraping into ice-cold PBS, followed by centrifugation at 1500 rpm for 3 minutes. Cell pellets were lysed using NP40 lysis buffer (50 mM TrisHCl (pH 8.0), 150 mM NaCl, 1% (v/v) NP-40) containing Complete\u2122 protease inhibitors , and incubated at 4\u00b0C for 30 minutes, followed by centrifugation at 14000 rpm for 15 minutes. The resulting supernatants were decanted into a fresh tube and stored at -20\u00b0C until used. Protein concentrations were measured at 595 nm using the BioRad protein assay reagent (BioRad). The antibodies used for immunoprecipitation were rabbit polyclonal anti-PCNA , rat monoclonal anti-p50  and rabbit polyclonal anti-GFP . For each immunoprecipitation (IP), 1 \u03bcl of purified antibody, or 50 \u03bcl of tissue culture supernatant, was added to 750 \u03bcg of soluble protein, previously pre-cleared against protein G, and incubated overnight at 4\u00b0C with gentle agitation. 20 \u03bcl of protein G slurry (50% (v/v) in PBS) was added and incubated at 4\u00b0C for 1 hr with gentle agitation. The beads were pelleted by centrifugation at 2000 rpm for 3 minutes, and subsequently washed extensively with lysis buffer, prior to final resuspension with 20 \u03bcl of SDS loading buffer.Cells were transfected in 100 mmElectrophoresis was performed using the NuPage system (Invitrogen). Either 10% or 4\u201312% Bis-Tris gradient gels were used and run with MES buffer as supplied by the manufacturer. Proteins were transferred to Immobilon-P membranes (Millipore) using the conditions directed by the manufacturer. Blots were blocked with 5% (w/v) milk in PBS for 1 hour at room temperature and then rinsed twice with PBS. Primary antibodies were diluted in 2% milk in PBS and added to the blot at a concentration of 2 \u03bcg/ml of purified antibody or 1:1000 ascites/serum. This was incubated for 1 hour at room temperature followed by extensive washing with PBS 0.2% Tween-20. HRP-conjugated secondary antibodies were added, incubated and washed as for primaries. Primary antibodies used were mouse monoclonal anti-PCNA antibody (PC10) and mouse monoclonal anti-EGFP antibody (Roche). Peroxidase-coupled donkey anti-mouse IgG (Jackson Immunoresearch) was used as secondary antibody. Immunoblots were visualised by enhanced chemiluminescence , according to the manufacturers instructions.Cells were grown and transfected in 2-well chamber slides (Lab Tek). Cells were washed twice with ice-cold PBS, and fixed with 4% (v/v) paraformaldehyde for 5 mins at room temperature (RT), followed by another PBS wash. Cells were subsequently permeabilised with 0.2% Triton X-100 in PBS for 10 minutes at RT. The primary antibodies used were rabbit polyclonal anti-PCNA  diluted 1 in 5000, and mouse monoclonal anti-EGFP  diluted 1 in 500. Secondary antibodies used were FITC-coupled donkey anti-mouse, and Texas Red coupled donkey anti-rabbit (both Jackson Immunoresearch), diluted as recommended. All antibodies were diluted with 3% BSA in PBS.Primary antibodies were added for 1 hour at 4\u00b0C. After washing twice with 3% BSA in PBS, secondary antibodies were added for 1 hour at 4\u00b0C, diluted as before. After washing twice with PBS, nuclei were stained with DAPI (Sigma) at a final concentration of 0.5 \u03bcg / ml in PBS. Cells were washed again in PBS before mounting with one drop of Hydromount  containing 2.5% (w/v) DABCO anti-fade (Sigma) and visualised on a Zeiss MC100 fluorescence microscope.et al (2003) [2 \u2013 I1(ID2/ID1) \u2013 I3(IA2/IA3) >0 where I represents intensities in three channels given in arbitrary units between 0 and 250. Normalised FRET is defined as NFRET = FRET/(I1 \u00d7 I3)1/2 [1, A1, D1 = excitation (ex.) at \u03bb = 458, detection (det.) at 470 nm <\u03bb>500 nm (ECFP); channel 2: I2, D2, A2 = ex. at \u03bb = 458 nm, det. at \u03bb>560 nm; channel 3: I3, D3, A3= ex. at \u03bb = 514 nm, det. at \u03bb >560 nm (EYFP). ID1, D2, D3 and IA1, A2, A3 are determined separately for cells transfected with only ECFP- and EYFP-fusion proteins respectively, under the same settings and at the same levels of fluorescence intensities (I1 and I3) as co-transfected cells.A Zeiss LSM 510 Meta laser scanning microscope equipped with a Plan-Apochromate 63x/1.4 oil immersion objective was used to examine images of 1 \u03bcm thick slices of live cycling HeLa cells grown in glass bottom culture dishes . Fluorescence energy transfer (FRET) was determined by modifying the general equations given by Matyus (1992) as described in Baynton l (2003) ,47. FRET\u00d7 I3)1/2 . Intensi4 cells per well and incubated overnight prior to transfecting with 6 \u03bcg per well of plasmid DNA. The medium was replaced with fresh 24 hours post-transfection and G418 added to a final concentration of 1.0 mg/ml at 48 hours post-transfection. Medium containing G418 was replaced as necessary until 10 to 14 days post-transfection. Cells were then washed twice in PBS, fixed for 15 minutes in ice-cold methanol, then stained with 10% (w/v) Giemsa for 15 minutes and rinsed in water.6 well plates were seeded with 2 \u2013 5 \u00d7 10EW conceived of the study, drafted the manuscript, carried out the two-hybrid analysis and the clonogenic assays. EW and JRGP made the expression constructs and performed the immunofluorescence analysis. JRGP performed the immunoprecipitation experiments. MO carried out the FRET experiments and analysis. All authors helped to draft and approved the manuscript."}
+{"text": "Dynamic switching of PCNA-partner interactions is essential for normal DNA replication and repair in yeast. The robustness of complex biological processes in the face of environmental and genetic perturbations is a key biological trait. However, while robustness has been extensively studied, little is known regarding the fragility of biological processes. Here, we have examined the susceptibility of DNA replication and repair processes mediated by the proliferating cell nuclear antigen (PCNA). Using protein directed evolution, biochemical, and genetic approaches, we have generated and characterized PCNA mutants with increased affinity for several key partners of the PCNA-partner network. We found that increases in PCNA-partner interaction affinities led to severe in vivo phenotypic defects. Surprisingly, such defects are much more severe than those induced by complete abolishment of the respective interactions. Thus, the subtle and tunable nature of these affinity perturbations produced different phenotypic effects than realized with traditional \u201con-off\u201d analysis using gene knockouts. Our findings indicate that biological systems can be robust to one set of perturbations yet fragile to others. Many biological processes are mediated by complex protein-protein interaction networks. The most highly connected proteins in such networks, termed hub proteins, precisely regulate biological processes by the regulated and sequential binding and releasing of partner proteins. In the case of DNA replication and repair, proliferating cell nuclear antigen (PCNA) is a hub protein that encircles the DNA to dynamically bind and release a variety of DNA-modifying enzymes. In this work, we explored the impact of subtle alterations of PCNA-partner interaction affinities on DNA replication and repair in yeast. Using directed evolution approaches, we generated a large library of PCNA mutants and selected for those with enhanced affinity for five different PCNA partners. In vivo analysis of such mutants indicated the high sensitivity of DNA replication and repair processes to minor alterations in PCNA-partner interaction affinities. Importantly, we discovered that some of the defects observed in the strains with increased PCNA-partner protein interaction far exceed the defects observed when the same partner protein is deleted altogether. Our analysis suggests that the cost of misregulating biological processes through disruption of the carefully orchestrated action of hub-interacting proteins can be much higher than the cost of deleting parts of the network altogether, demonstrating both the fragility and robustness of biological processes. Robustness, the ability to maintain performance in the face of environmental and genetic perturbations, is a fundamental trait of biological processes In eukaryotes, DNA replication and repair processes are mediated by the proliferating cell nuclear antigen (PCNA) through the recruitment of various DNA-modifying enzymes to the replication fork To investigate the importance of PCNA-partner interactions for DNA replication and repair, previous studies have focused on abolishing these interactions via mutational approaches In this study, we have examined the robustness or fragility of PCNA-mediated DNA replication and repair processes in the face of perturbations altering PCNA-partner interaction affinities. To do so we have generated and thoroughly characterized a collection of novel PCNA mutants exhibiting higher binding affinities for five different partners taking part in a variety of PCNA-mediated processes, including Pol32, Rad27, Rad30, Msh6, and Ung1, participating in lagging strand replication, TLS, MMR, and BER, respectively . SurprisE. coli cells for mutants showing enhanced affinity for the target partners, using an enzyme-linked immunosorbent assay (ELISA). The ELISA experiment for the detection of PCNA-PIP peptide interactions was performed with crude E. coli cell lysates containing the different mutants incubated with biotinylated PIP peptide-coated plates. The amount of bound PCNA was analyzed using antibodies against the 6\u00d7histidine-tagged PCNA  that connects the two domains of the PCNA monomer  [25]. OtTo establish a high-throughput screening system for the detection of PCNA binding to PIP peptides derived from the different partners , we effi6 cells were analyzed and sorted by FACS . We immobilized PCNA from the crude yeast extracts onto ELISA plates and analyzed the amount of bound partner, relative to the amount of total PCNA immobilized on the plate  that is modulated by ubiquitination or SUMOylation  and thatmutation , Table 2tination , Table 2CAN1 locus for pol30 mutant strains with increased affinity to Pol32 or Rad27, we sequenced the CAN1 gene in individual canavanine resistance clones. We sequenced 37 and 26 CAN1-inactivating mutations isolated from the pol30-Pol32E5 and pol30-Rad27E6 mutants, respectively. We found that pol30-Pol32E5 mutant accumulated a broad range of mutations, including substitutions, frame-shifts, or deletions (pol30-Pol32E5 mutant strain pol30-Rad27E6 accumulated a very low frequency of deletions (4%) but a high rate of substitutions and frame-shifts  to generate PCNA mutants with increased affinity for different partners, (2) to perform binding characterization of the mutants for many different partners in order to profile changes in binding specificity, and (3) to perform detailed in vivo characterization of the mutants for the detection of defects in DNA replication and repair. The generation of PCNA mutants with increased affinity for five different partners revealed the high plasticity of PCNA for increases in partner interaction affinities, implying that the WT IDCL sequence naturally evolved to bind multiple partners with moderate affinity, rather than adopting higher binding affinities for specific partners. This property could be a selectable evolutionary trait designed to maintain the dynamic nature of PCNA-partner interactions and to facilitate partner switching on PCNA. The large number of mutations and the lack of conservation observed in the selected mutants  suggestsIn vivo analysis of the different mutants revealed severe phenotypic defects, ranging from non-viability to high sensitivity to DNA-damaging agents . In contpol30-Rad30E9p mutant . The integrated approach that we have developed allows for the generation of much more subtle and controlled perturbations to reveal new properties of the DNA replication system. This approach does not directly affect the expression level of the proteins or the catalytic activities of the different partners, thus allowing for dissection of the effects of subtle alterations in PCNA-partner binding affinities on the replication process. In future studies, the mutants generated in this study could prove useful in efforts aimed at obtaining mechanistic insight into PCNA-partner binding and dissociation events during DNA replication and repair processes.In summary, using DNA replication and repair as a model system, we have shown that biological processes can be highly robust to one set of perturbations yet at the same time be highly fragile to completely different perturbations. Our data thus provide a more balanced view on the robustness of biological processes and reveal that similar to many man-made complex systems, these processes possess both properties of robustness and fragility. Finally, the approach developed in this study, which allows for the generation of a variety of minor perturbations in a protein-protein interaction network, can be applied to study the molecular basis, mechanism, and fragility of other networks promoting different biological processes, including signal transduction and gene transcription.E. coli expression, WT PCNA and the different mutants were cloned into plasmid pET28 (Novagen) using the NdeI and XhoI sites to yield a 6\u00d7Histidine-tagged version of the protein. For YSD, WT PCNA was cloned into plasmid pCTCON For 6 of cells were washed, resuspended in SGCAA induction media, and grown at 20\u00b0C with shaking for an additional 18 h. Induced cells (1\u00d7106) were collected by centrifugation, washed with PBSF (PBS+ 1 g/L BSA), and incubated for 1 h at 25\u00b0C with mouse \u03b1-Myc antibodies  and 100\u2013400 \u00b5M of biotinylated PIP peptide  displaying the PCNA library were labeled, analyzed, and sorted using a FACS . Three to five iterative rounds of enrichment were performed. In each round, multiple \u201cpositive\u201d events (3\u20135\u00d7104), corresponding to cells found within the top 1%\u20132% of the green and red fluorescence intensity area, were collected into growth media and plated on agar plates for a new round of enrichment. For initial sorting of the na\u00efve library, a sort gate of the top 5% of fluorescent cells was used. To increase the stringency of selection, a decreased peptide concentration was used in each subsequent round. Selection rounds were continued until no further enrichment was obtained.The na\u00efve library was induced and labeled with different PIP peptides, as described above. EBY100 cells  for 5 h at 30\u00b0C. The cells were then harvested, lysed in PBS supplemented with 0.1% Triton and 200 \u00b5g/ml lysozyme, centrifuged, and the cleared supernatant was collected. Total protein concentration of the different mutants was determined using a BCA protein assay kit (Thermo Scientific) and analyzed by SDS-PAGE to verify the similarity of PCNA expression levels.A pool of plasmids from the last round of FACS enrichment was PCR-amplified using the primers fr-pET/PCNA and rev-pET/PCNA  and clonELISA plates (Griener Microlon 96W) were coated with 0.2 \u00b5g/ml streptavidin (Pierce) and 0.1 \u00b5g/ml of biotinylated PIP peptides, as described E. coli BL21 cells were induced and lysed as above in a volume of 0.5 L with minor modifications. Briefly, following centrifugation the cell pellet was sonicated in 20 ml of lysis buffer, centrifuged, and the cleared supernatant was loaded on a pre-equilibrated column containing 2 mL Ni-NTA resin (Qiagen). The columns containing the lysates were gently shaken by inversion for 30 min at 25\u00b0C. The resin was then washed with 30 ml of wash buffer and PCNA was eluted in 1 ml fractions upon addition of elution buffer. Fractions containing PCNA were pooled and dialyzed against storage buffer. Protein concentration was determined with a BCA protein assay kit (Pierce) and analyzed by SDS-PAGE. The protein solutions were stored in 1 ml aliquots of 2 mg/ml at \u221220\u00b0C. Lysis, wash, elution, and storage buffers were derived from the activity buffer based on 300 mM NaCl, 50 mM Tris-HCl, pH 8, and supplemented with imidazole, according to the manufacturer's recommendations.WT and mutant PCNA were purified as described above. Gel filtration chromatography was performed on a Superdex 200 10/300 GL column  using the \u00c4KTApurifier FPLC system. All proteins were run in activity buffer at monomer concentrations of 3\u20138 \u00b5M at which WT PCNA is a trimer and Pol30-52 is a monomer Protein interaction assays were carried out using the ProteOn XPR36 (Bio-Rad) instrument. WT or PCNA mutants (0.4 to 5.2 fmol) were immobilized on the surface of a GLM sensor chip by a carbodiimide-activated succinimide-coupling method, as specified by the manufacturer. All SPR experiments were performed by flowing 150 \u00b5l of the target peptide at a flow rate of 30 \u00b5l/min onto the PCNA-bound chip. Different concentrations  of PIP peptides  were inj600 10, washed twice with DDW, and diluted to an initial OD600 of 0.3. A series of 10-fold serial dilutions was then spotted onto selective SC-Leu-Trp-His plates and incubated at 30\u00b0C for 3 d. For quantitative Y2H, the generation time of the indicated mutants and their respective partners were calculated from their growth curves in liquid SC-Leu-Trp-His media. Cells were grown overnight in SC-Leu-Trp, washed twice with ddH2O, and diluted by a factor of 1\u223650 into 10 ml of pre-warmed SC-Leu-Trp-His. O.D600 measurements of the cultures were taken at the indicated time; the generation time (\u03c4) was calculated from the growth curves according to the equation ODt\u200a=\u200aOD0\u00d72t/\u03c4. The generation time calculated for each culture is an average of at least 3 independent experiments.Y2H analysis was performed using the Yeast Two Hybrid Phagemid vector kit (Stratagene), following the manufacturer's instructions. The pAD-PCNA-WT/mutant plasmids were used as bait while plasmids encoding 12 different PCNA partners  were usePOL30. Following dissection of the diploid, a haploid containing the CAN+ gene and plasmid pRS316-POL30 as a sole source of PCNA was generated. This host strain was transformed with selected pRS315-pol30 mutants, plated on SC-Ura-Leu plates, followed by replica plating to SC-Leu+5FOA plates. Haploids, containing PCNA mutants as a sole source, were further verified by plating on either SC-Leu or SC-Ura plates. For testing selected PCNA mutants, a haploid containing rad27::HYG, rad30::HYG, pol32::HYG, msh6::HYG, or ung1::HYG were generated using plasmid pAG32 by conventional genetic approaches. Growth of the PCNA mutant strains in the presence of 120 mM HU  or 0.02% MMS (Sigma) was performed as described Novel haploids containing PCNA mutants were generated using the plasmid shuffling method. Briefly, a pol30::KanMX magic marker heterozygote diploid strain BY4743 (Open Biosystem) was transformed with plasmid pRS316-pol30 mutant strains described in this study were determined by fluctuation test analysis using the Lea and Coulson method 600 of 0.7. Appropriate dilutions of the cells were then plated on SC-Leu and SC-Leu-Arg+canavanine (60 mg/ml) to obtain the number of viable cells (Nt) and the number of canavanine-resistant cells (r), respectively. Using the Lea and Coulson method http://www.keshavsingh.org/protocols/FALCOR.html) p values. To analyze the mutation spectra of pol30 mutant strains, genomic DNA was extracted from individual CAN1-resistant colonies. The CAN1 locus was PCR amplified using upstream and downstream primers and the PCR product was sequenced using 3 primers spanning the entire ORF. Analysis of sequences was performed using the Geneious program.The mutation rates for the different Yeast cell extracts were generated from 0.5 L of logarithmic cultures using conventional methods. Briefly, cell pellets were lysed with Cell Lytic (Sigma), supplemented with protease inhibitors (Sigma) and glass beads, as suggested by the manufacturer. Following centrifugation, cell extracts were collected and protein concentration was determined by the BCA method. ELISA plates coated with rabbit \u03b1-PCNA antibodies  were incubated with 100 \u00b5l of yeast cell extract at a protein concentration of 3 mg/ml for 1 h at RT. Following 3 washing steps with PBST, wells were incubated with either mouse \u03b1-His antibodies , to detect PCNA adsorption, or \u03b1-GFP antibodies , to detect the presence of GFP-tagged PCNA partners bound to PCNA see . Plates 600 0.8, centrifuged, and lyzed using cell lytic solution (Sigma) supplemented with protease inhibitor cocktail (Sigma), following the manufacturer's instructions. Following TCA treatment, samples containing 10 \u00b5g of crude lysates were loaded on a 10% SDS-PAGE gel and subjected to western blot analysis using rabbit \u03b1-PCNA  and mouse \u03b1-Pgk1  antibodies. Antibody binding was detected using either HRP-conjugated goat \u03b1-rabbit  or HRP-conjugated goat \u03b1-mouse  antibodies, respectively. The latter were used to detect the yeast Pgk1 protein that served as a loading control.Selected haploid PCNA mutants were grown to ODFigure S1PIP peptide sequences derived from the different target partners (see text for detailed explanation). Conserved residues are highlighted.(0.50 MB TIF)Click here for additional data file.Figure S2Sequence alignment of the IDCL region of PCNA from different organisms. The four non-conserved residues that were completely diversified in the mutant library are highlighted with a red arrow. The PCNA SUMOylation site was not mutated and is highlighted with a blue arrow.(0.85 MB TIF)Click here for additional data file.Figure S3Yeast surface display of PCNA. (A) PCNA is displayed as an Aga2 (grey) fusion on the yeast cell surface. Expression is detected through fluorescent antibody binding to the c-Myc epitope tag (light blue) while binding of the biotinylated PIP peptide (orange) is detected using fluorescently-labeled streptavidin (green). (B\u2013D) Flow cytometry dot plots of yeast cells displaying WT PCNA (B\u2013C) and the inactive PCNA79 mutant (D) incubated with fluorescein isothiocyanate (FITC)-labeled antibodies to the c-Myc epitope (x-axis) to analyze PCNA display levels. The specificity of PCNA binding for PIP peptides was detected following incubation with biotinylated PIP peptide derived from Rad30 (B and D) and mutated Rad30 in which the two conserved phenylalanine residues of the PIP peptide are mutated to alanine (C), followed by incubation with allophycocyanin (APC)-labeled streptavidin (y-axis).(0.06 MB PDF)Click here for additional data file.Figure S4Yeast two hybrid analysis of selected PCNA-partner interactions. The WT and mutant PCNA were fused to the DNA-activating domain (pAD) and the Rad30 (A), Rad27 (B), Pol32 (C), MSH6 (D), and UNG1 (E) partners were fused to the DNA-binding domain (pBD). The transformed YRG2 yeast strains were grown on liquid selective media lacking leucine (L), tryptophan (W), and histidine  to detect for PCNA-partner interactions.(0.15 MB TIF)Click here for additional data file.Figure S5Yeast two hybrid analysis of selected PCNA-partner interactions. The WT and mutant PCNA were fused to the DNA-activating domain (pAD) and the Rad30 (A), Rad27 (B), Pol32 (C), MSH6 (D), and UNG1 (E) partners were fused to the DNA-binding domain (pBD). The transformed YRG2 yeast strains were serial diluted and spotted on selective plates lacking leucine (L) and tryptophan  and then spotted on selective plates further lacking histidine  to detect for PCNA-partner interactions.(0.30 MB TIF)Click here for additional data file.Figure S6Analysis of PCNA trimers and secondary structure contents of six PCNA mutants and WT PCNA. (A) Gel filtration chromatography analysis of WT PCNA (Pol30p) and the six PCNA mutants indicate no significant alterations in trimer formation. The previously identified PCNA mutant defective in trimerization Click here for additional data file.Figure S7Western blot analysis of the expression level of WT and selected PCNA mutants in yeast (upper panel): 1-pol30-Rad27E6, 2-pol30-Rad30E2, 3-WT PCNA, 4-pol30-79, 5-pol30-Pol32E5, 6-pol30-Ung1E2, 7-pol30-Msh6E2 (see  in the main text for sequence and characterization of the mutants) using anti-PCNA antibodies. The expression of Pgk1 was monitored as a loading control using anti-Pgk1 antibodies (bottom panel).(0.03 MB PDF)Click here for additional data file.Figure S8WT and pol30 mutant sensitivity examined on the background of the parent (left) or rad27-deleted (right) strains. The rad27 deletion results in suppression of the growth sensitivity in the case of the pol30-Rad30E2 or pol30-Ung1E2 strains. In contrast, the rad27 deletion had only weak effect on the growth sensitivity of the pol30-Rad27E6 or pol30-Msh6E2 mutant strains.(0.28 MB DOC)Click here for additional data file.Figure S9The effects of overexpression of Rad27, Rad30, Pol32, and Msh6 on the growth sensitivity of the POL30, pol30-79, pol30-Rad27E6, or pol30-Pol32E5 strain. Overexpression of the different partners did not reduce the growth sensitivity of the strains to DNA damaging agents.(0.43 MB TIF)Click here for additional data file.Table S1Yeast two hybrid analysis of binding of selected PCNA mutants with seven additional partners not described in  of the main text.(0.01 MB DOC)Click here for additional data file.Table S2CAN1 mutation spectra for POL30 mutants.(0.08 MB DOC)Click here for additional data file.Table S3Sequences of oligonucleotides used in this study.(0.05 MB DOC)Click here for additional data file."}
+{"text": "Hemorrhagic fever with renal syndrome (HFRS) is an important public health problem in the People\u2019s Republic of China, accounting for 90% of human cases reported globally. In this study, a landscape epidemiologic approach, combined with geographic information system and remote sensing techniques, was applied to increase our understanding of HFRS due to Hantaan virus and its relationship with landscape elements in China. The landscape elements considered were elevation, normalized difference vegetation index (NDVI), precipitation, annual cumulative air temperature, land surface temperature, soil type, and land use. Multivariate logistic regression analysis showed that HFRS incidence was remarkably associated with elevation, NDVI, precipitation, annual cumulative air temperature, semihydromorphic soils, timber forests, and orchards. These findings have important applications for targeting HFRS interventions in mainland China. Hemorrhagic fever with renal syndrome (HFRS) is a zoonosis caused by different species of hantavirus (HV). It was first recognized in northeastern China in 1931 and has been prevalent in many other parts of China since 1955. At present, HFRS is endemic in 28 of 31 provinces of the People\u2019s Republic of China, autonomous regions, and metropolitan areas and accounts for 90% of the HFRS cases reported globally  was identified recently in A. peninsulae from far eastern Russia and subsequently identified in a few patients from China  and Seoul virus (SEOV), each with a distinct rodent host. HTNV, which causes more severe disease, is carried by Previous studies indicated that HFRS incidence seemed to be associated with environmental factors, including topography, hydrologic features, and rainfall. HFRS cases were mainly reported from areas <500 m above sea level and in the regions with very moist soil. HFRS cases were rarely reported in areas that were very dry or very wet  spatial analysis , precipitation, annual cumulative air temperature, land surface temperature (LST), soil type, and land use. The study focused on HFRS cases caused by HTNV only and restricted study sites to rural areas of the country and the areas with population density <1,000/kmAll the cases reported in mainland China from 1994 through 1998 were obtained from the National Notifiable Disease Surveillance System (NNDSS). NNDSS is supported by a special monitoring network and produces these data annually according to county, a political subdivision of a province, which usually contains several townships and has a population of \u2248500,000 persons.2, to capture most, if not all, of the patients infected with HNTV.Because the number of cases was small and varied yearly in each county, we used the mean number of HFRS cases from each county from 1994 to 1998. All HFRS cases were coded according to geographic area (geo-coded) and matched to the corresponding polygon and its label point on a digital map of China by using the software ArcGIS 9.1 . The NNDSS HFRS data do not differentiate HTNV from SEOV infections. The study was limited to the rural areas of the country and areas with population density <1,000/kmDemographic data at the county level were obtained from the 1995 and 2000 censuses. To overcome difficulties due to changes in administrative boundaries, the vector map of the demographic data was converted to a raster map of the population with a 1-km grid  with a 1:100,000 scale. The elevation data obtained from DEM was transferred into a raster map with a 1-km grid  images. Monthly and annual NDVI in 1998 were calculated by using ERDAS Imagine 8.7  , wetland, saline-alkali land, and bare land  was used to compare HFRS incidence across the different levels of each landscape element, including elevation, NDVI, precipitation, annual cumulative air temperature, and LSTl; odds ratios (ORs) were obtained by comparing the HFRS incidence of different categories of the landscape elements. To determine the associations between HFRS and soil type as well as land use, univariate logistic analysis was conducted, and ORs were computed by comparing counties where HFRS was found with non-HFRS\u2013endemic counties. Through GIS, different thematic maps were also generated to facilitate graphic and spatial visualization of HFRS occurrence at the county level in China and geographic distribution of the different landscape elements . Backward stepwise selection was performed with the criterion of p>0.05.The possible interaction between individual elements was considered..Condition indexes and variance decomposition proportions were used to test colinearity among the independent variables and identify the sources of colinearity. When the condition index was >30, the independent variables had strong colinearity. If a large condition index is associated with variables that have variance decomposition proportions >0.5, these variables may be causing colinearity problems . The highest incidence  was observed in areas with elevation of 100\u2013200 m. No cases were reported in areas >3,000 m except in 3 counties of Gansu Province . Approximately 86.4% HFRS cases occurred in areas with 0\u2013500 m elevation in the eastern part of China and the Sichuan Basin .The frigid-temperate zone, with annual cumulative temperature of <1600\u00b0C, had the highest HFRS incidence at 10.2/100,000. This was followed by the warm zone  and semitropical  zones with HFRS incidences of 8.0 and 2.6 per 100,000, respectively. Among different cumulative temperature zone, the HFRS incidences were significantly different . There was also a significant difference in HFRS incidence regarding LST . The highest incidence of 10.8/100,000 was found in areas with LST <28\u00b0C. The incidence dropped when the LST value increased to 28\u00b0\u201334\u00b0C and increased again to 4.7/100,000 when LST levels reached 34\u00b0\u201337\u00b0C .As to the soil types, the univariate logistic regression analysis showed that anthrosols, alfisol, and semihydromorphic soils, which are good for cultivation, had higher risk for HFRS prevalence. All other soils seemed to be less likely to harbor the disease agent .The univariate logistic regression analysis also showed that land for agriculture use, including paddy land, irrigated farmland, nonirrigated farmland, and orchard land, were the landscape elements with high risk for HFRS. Other types of land use, except for timber forest land and wetland, were protective against the disease .Multivariate logistic regression analysis indicated that elevation, NDVI, precipitation, and annual cumulative temperature were significantly associated with HFRS incidence. Semihydromorphic soils (OR = 1.53), timber forest land (OR = 2.04), and orchard land (OR = 1.97) were risk factors for HFRS incidence .In the early 1990s, the spatial distribution of HFRS and its variation regarding to geographic and meteorologic features were well described in China, based on a national investigation  of HTNV usually lives in rural areas, large cities and counties with population density >1,000/km2 were excluded from the analyses to remove most, if not all, HFRS cases caused by SEOV and to restrict the study to mainly HTNV-type infections.HTNV and SEOV, the major causative agents of HFRS in mainland China, are associated with 2 distinct rodent hosts, i.e., The reason for the increased risk for HFRS in regions with lower elevation is not clear; population density and human activities are likely explanations. Population density remarkably increases as elevation decreases and most likely facilitates transmission of HV from rodent hosts to human, subsequently leading to increases in HFRS incidence.A. agarius in temperate zones was much higher than those in other areas .Timber forest and orchard land were also appropriate environments for rodent hosts. Forest workers and farmers had more chances to come into contact with contaminated urine and feces of rodents infected with HTNV. An investigation conducted on various land types showed that the highest trap-success rate of This study characterized the landscape attributes that seem to be favorable for HFRS incidence. Although analyses are still preliminary, the findings can be helpful for generating hypothesis for further investigation. For better analyses, the human and rodent HFRS surveillance in China, including discrimination of HFRS cases due to different HVs, should be enhanced."}
+{"text": "P = 0.0180), lymph node metastasis (P = 0.0033), lymphatic involvement (P = 0.0104), venous involvement (P = 0.0224), perineural involvement (P = 0.0351) and stage by the tumour, nodes and metastases (TNM) classification (P = 0.0026). Thus, RCAS1 expression may be a relatively late event in gallbladder carcinogenesis  possibly promoting tumour progression. Cox regression multivariate analysis demonstrated RCAS1 positivity to be an independent negative predictor for survival . High expression of RCAS1 significantly correlated with tumour progression and predicted poor outcome in gallbladder cancer. \u00a9 2001 Cancer Research Campaign http://www.bjcancer.comReceptor-binding cancer antigen expressed on SiSo cells (RCAS1) induces apoptosis in immune cells bearing the RCAS1 receptor. We sought to determine RCAS1 involvement in the origin and progression of gallbladder cancer, and also implications of RCAS1 for patient survival. RCAS1 expression was examined immunohistochemically in 110 surgically resected gallbladder specimens. The gallbladders represented 20 cases of cholecystitis with no associated pancreaticobiliary maljunction; 23 cases of cholecystitis with pancreaticobiliary maljunction; 14 cases of adenomyomatosis; 7 adenomas; and 46 cancers. High expression of RCAS1 (immunoreactivity in over 25% of cells) was observed in 32 of the 46 cancers (70%), but not in other diseases, including pre-cancerous conditions. RCAS1 immunoreactivity was associated with depth of tumour invasion ("}
+{"text": "The transmission of hemorrhagic fever with renal syndrome (HFRS) is influenced by climatic variables. However, few studies have examined the quantitative relationship between climate variation and HFRS transmission.We examined the potential impact of climate variability on HFRS transmission and developed climate-based forecasting models for HFRS in northeastern China.We obtained data on monthly counts of reported HFRS cases in Elunchun and Molidawahaner counties for 1997\u20132007 from the Inner Mongolia Center for Disease Control and Prevention and climate data from the Chinese Bureau of Meteorology. Cross-correlations assessed crude associations between climate variables, including rainfall, land surface temperature (LST), relative humidity (RH), and the multivariate El Ni\u00f1o Southern Oscillation (ENSO) index (MEI) and monthly HFRS cases over a range of lags. We used time-series Poisson regression models to examine the independent contribution of climatic variables to HFRS transmission.Cross-correlation analyses showed that rainfall, LST, RH, and MEI were significantly associated with monthly HFRS cases with lags of 3\u20135 months in both study areas. The results of Poisson regression indicated that after controlling for the autocorrelation, seasonality, and long-term trend, rainfall, LST, RH, and MEI with lags of 3\u20135 months were associated with HFRS in both study areas. The final model had good accuracy in forecasting the occurrence of HFRS.Climate variability plays a significant role in HFRS transmission in northeastern China. The model developed in this study has implications for HFRS control and prevention. Hantaviruses (family Bunyaviridae) are the causative agents of hemorrhagic fever with renal syndrome (HFRS) in Eurasia and hantavirus pulmonary syndrome (HPS) in the Americas . HFRS anHantaan virus and Seoul virus, which have Apodemus agrarius and Rattus norvegicus, respectively, as their rodent hosts , and land surface temperature (LST) for the study period were obtained from the Chinese Bureau of Meteorology . ENSO isWe summarized a description of climate variables and disease incidence and performed cross-correlation analysis to assess the associations between climate variables and the number of HFRS cases for a range of lags . In thisWe performed time-series Poisson regression analysis that allowed for autocorrelation, seasonality, and lag effects after correcting for overdispersion . Temporap, q, r, s, t, u, and v were lags determined by correlation analyses   and the pseudo-R2  . Associaseudo-R2 . FinallyElunchun had 1,918 notified HFRS cases during the study period, with an annual average incidence of 59.69 per 100,000. We observed a peak of HFRS cases in winter (November through January). The monthly mean LST was 1.7 \u00b0C, and the monthly mean rainfall was 40.5 mm during the study period. A total of 1,980 HFRS cases were reported in Molidawahaner during the study period, with an annual average incidence of 61.12 per 100,000. We also observed a peak of HFRS cases in winter. The monthly mean for LST and for rainfall were 1.3 \u00b0C and 39.4 mm, respectively. In both study locations, rainfall, LST, RH, and MEI were significantly correlated with the monthly reports of HFRS with lags of 3\u20135 months . HoweverFor Elunchun, the Poisson regression model showed that the occurrence of HFRS cases was first-order autoregressive. This findng indicated that the number of notified cases in the current month was related to the number of cases that occurred in the previous month . SeasonaR2 value for the fitted model was 79.43%. The goodness-of-fit analyses showed no significant autocorrelation between residuals at different lags in the final model .The results of the model validation also were similar in Molidawahaner ; the pseA key finding from this study was that climate variability is an important predictor of the intensity of HFRS transmission in northeastern China. We found a consistent relationship between climatic factors with lags of 3\u20135 months and HFRS transmission. This lead time is of practical importance in predicting epidemics of HFRS and giving health authorities sufficient time to formulate plans, disseminate warnings, and implement public health interventions, such as vaccinating high-risk populations, killing the rodent hosts, and managing environments for the prevention and control of the disease . InteresMolidawahaner is somewhat cooler and drier than Elunchun, and this may affect the dynamics of reservoir populations as well as viral transmission within reservoir populations. These regional differences suggest that variation of other local environmental variables such as types of land use and patterns of agricultural production may also affect the short-term dynamics of HFRS epidemics .A deeper understanding of the relationship between climate variability and disease dynamics provides a foundation for anticipating the health effects of global climate change . In thisTemperature affects rodent dynamics and activity as well as infectivity of hantavirus . We usedVariability in rainfall can have important consequences for the transmission of rodent-borne diseases  by increex vivo environment (R. norvegicus and wet habitats (RH was also positively associated with the transmission of HFRS in northeastern China. Higher levels of humidity may be indicative of moisture influencing the survival of rodent hosts but also is known to influence the infectivity and stability of the virus in the ironment . Previouhabitats . The preMEI, as an indicator of global climate pattern, was an important contributor for characterizing changing patterns of HFRS, which supports the notion that large-scale climate indices may be critical for forecasting patterns of disease risk, especially among larger geographic areas . The MEIClimate variability can affect the dynamics of infectious diseases through either linear or nonlinear pathways. It can affect several biological traits of the rodent hosts, from individual life histories to population dynamics , and modThis is the first study to look for the responses of HFRS to climate variability at a fine timescale in two locations where hundreds of thousands of people are at risk. The statistical approaches using various sources of data identified models that accounted for a high proportion of the variation in HFRS case numbers and forecast HFRS with good accuracy.The limitations of this study should also be acknowledged. First, the data are from a passive surveillance system, so the quality of data is not as good as that collected from active surveillance. Some cases of HFRS might go unreported because of their milder clinical symptoms. It is likely that underreported cases influence the precision of models. However, it seems unlikely that disease severity would have an interannual component that would influence the general pattern of the observed results. Second, not all of the variation in the occurrence of HFRS cases in each region is caused by climate alone. In addition to factors such as virus and host dynamics that may be influenced directly by climate, human activities and movement, socioeconomic status, and population immunity may contribute to the transmission of HFRS. Clearing forests for agricultural use and urbanization may increase the potential for HFRS transmission . TourismThe results of this study suggest that antecedent patterns of LST, ENSO index, precipitation, and RH were among the key determinants of HFRS transmission in northeastern China that are easily monitored over large geographic areas. As such, whether directly influencing virus transmission or acting as surrogates for those factors, they act as a basis for a forecasting system to control and prevent rodent-borne diseases. Early warning systems based on climatic forecasting can assist in improving reservoir control and personal protection. The results of this study provide an impetus to build a predictive capacity for HFRS epidemics and to develop an early warning system for enhancing public health measures, especially for developing countries and areas of the world that are vulnerable to the impact of climate change."}
+{"text": "Hemorrhagic fever with renal syndrome (HFRS) is a rodent-borne disease caused by Hantaviruses. It is endemic in all 31 provinces, autonomous regions, and metropolitan areas in mainland China where human cases account for 90% of the total global cases. Shandong Province is among the most serious endemic areas. HFRS cases in Shandong Province were first reported in Yutai County in 1968. Since then, the disease has spread across the province, and as of 2005, all 111 counties were reported to have local human infections. However, causes underlying such rapid spread and wide distribution remain less well understood.Here we report a spatiotemporal analysis of human HFRS cases in Shandong using data spanning 1973 to 2005. Seasonal incidence maps and velocity vector maps were produced to analyze the spread of HFRS over time in Shandong Province, and a panel data analysis was conducted to explore the association between HFRS incidence and climatic factors. Results show a rapid spread of HFRS from its epicenter in Rizhao, Linyi, Weifang Regions in southern Shandong to north, east, and west parts of the province. Based on seasonal shifts of epidemics, three epidemic phases were identified over the 33-year period. The first phase occurred between 1973 and 1982 during which the foci of HFRS was located in the south Shandong and the epidemic peak occurred in the fall and winter, presenting a seasonal characteristic of Hantaan virus (HTNV) transmission. The second phase between 1983 and 1985 was characterized by northward and westward spread of HFRS foci, and increases in incidence of HFRS in both fall-winter and spring seasons. The human infections in the spring reflected a characteristic pattern of Seoul virus (SEOV) transmission. The third phase between 1986 and 2005 was characterized by the northeast spread of the HFRS foci until it covered all counties, and the HFRS incidence in the fall-winter season decreased while it remained high in the spring. In addition, our findings suggest that precipitation, humidity, and temperature are major environmental variables that are associated with the seasonal variation of HFRS incidence in Shandong Province.The spread of HFRS in Shandong Province may have been accompanied by seasonal shifts of HTNV-dominated transmission to SEOV-dominated transmission over the past three decades. The variations in HFRS incidence were significantly associated with local precipitation, humidity, and temperature. Hemorrhagic fever with renal syndrome (HFRS), a rodent-borne disease caused by Hantaviruses, is characterized by fever, acute renal dysfunction and hemorrhagic manifestations. At present, it is endemic in all 31 provinces, autonomous regions, and metropolitan areas in mainland China where human cases account for 90% of the total global cases. Historically Shandong Province bears the largest HFRS burden in China\u2014the cumulative number of human cases accounted for 1/3 of the national total. Here we report a spatiotemporal analysis of human HFRS cases in Shandong using reported case data spanning 1973 to 2005. Through the analysis of seasonal incidences and use of velocity maps, three phases of seasonal shifts of HFRS epidemics and the expansion pattern of HFRS endemic areas were identified over the 33-year period. In addition, precipitation, humidity, and temperature were found to be significantly associated with the seasonal variation of HFRS incidence in Shandong Province. These findings offer insights in understanding possible causes of HFRS spread and distribution and may assist in informing prevention and control strategies. Apodemus agrarius, while SEOV is typically carried by Rattus norvegicus. Occurrence of HFRS cases is seasonal with a bimodal pattern and studies suggest that the pattern is linked to varying transmission dynamics of the two serotypes of HVs among their animal hosts - HTNV-caused HFRS cases occur year-round but tend to peak in the winter while SEOV-caused infections typically peak in the spring Hemorrhagic fever with renal syndrome (HFRS), a rodent-borne disease caused by Hantaviruses (HV), is characterized by fever, acute renal dysfunction, and hemorrhagic manifestations. HFRS, initially described clinically at the turn of the 20th century, is primarily distributed in the Asian and European continents, and worldwide approximately 150,000 to 200,000 hospitalized HFRS cases are reported each year, with the majority occurring in developing countries The study area covers Shandong Province, a coastal province in Eastern China, located between latitude 34\u00b025\u2032 and 38\u00b023\u2032 north, and longitude 114\u00b035\u2032 and 112\u00b043\u2032 east . In Shanhttp://cdc.cma.gov.cn/index.jsp). Raster format of meteorological data including monthly average temperature, relative humidity, and monthly cumulative precipitation was created using a spatial interpolation method (Kriging model). The monthly meteorological factors for each county of Shandong Province from 1973 to 2005 were then extracted in ArcGIS 9.2 .In 1950, HFRS was included on the list of Class B Notifiable Diseases in China. Since then, data reporting has followed a standard protocol determined by Chinese Center for Disease Control and Prevention and consistent throughout the country To characterize the spatial and seasonal patterns of HFRS distribution, monthly incidences from 1973 to 2005 and for different epidemic phases in Shandong Province were plotted. Furthermore, annualized incidences and the proportion of monthly average incidence over different epidemic phases for each county were mapped in gradient colors and pie charts, respectively. To explore the diffusion trend of HFRS endemic areas, a vector velocity map P-values were estimated using the maximum likelihood method. For PC estimation, a 10 mm difference was used for monthly cumulative precipitation, while 10\u00b0C and 10% differences were used for monthly average temperature and monthly average relative humidity, respectively. Univariate analysis was conducted to examine the effect of individual variables. Additionally, the time lag variables from 1 to 3 months for the three meteorological factors were tested. Multivariate analysis was then performed using variables with a P-value <0.1 from the univariate analysis as covariates. Correlations between covariates were quantitatively assessed and models were optimized by comparing -2 log likelihood when correlated variables were added or removed one by one. It was discovered that adding these variables with the smallest -2 log likelihood value for precipitation, humidity, and temperature, respectively, could derive a more accurate model. STATA (Version 10.0) was used in the panel data analysis .To explore associations between the HFRS incidence and meteorological factors from 1973 to 2005, Granger causality  tests were performed using the monthly HFRS incidence and meteorological factors  in EViews 3.1 software . To assess possible time-lag effects resulting from meteorological factors, time lags from 1 to 3 months were included in the analysis The first HFRS cases in Shandong were reported in 1968 in Yutai County in the southwest region of the province, and no cases were reported again until 1973. Since then, new cases emerged in the central and southern parts of the province and endemic areas began expanding throughout Shandong Province. A total of 282,442 HFRS cases were reported in Shandong Province from 1968\u20132005. Because only one case was reported between 1968 and 1972, the epidemic curve was created to show the temporal distribution of HFRS from 1973\u20132005 in Shandong Province. The incidence curve over the 33-year period is reasonably characterized by three phases: Phase I spanning from 1973 to 1982 with a typical fall-winter peak of incidence, Phase II covering the period between 1983 and 1985 with an emerging spring peak of incidence, and Phase III spanning from 1986 to 2005 with a dominance of spring peak of incidence .Pairwise G-causality analysis showed the association between HFRS incidence and meteorological factors with different time lags at the provincial level . The resA. agrarius mice peaks in the winter, while R. norvegicus rat-associated infections mainly occurred in the spring A. agrarius was found predominantly on the eastern coast, and R. norvegicus was distributed in almost all areas of Shandong Province according to surveillance studies of HFRS in China since the 1980s A. agrarius, Apodemus peninsulae, and R. norvegicus rats remain predominant in rural areas, forest areas, and urban areas, respectively This study, utilizing a longitudinal dataset spanning 33 years, characterized the spatiotemporal distribution and three phases of HFRS epidemics in Shandong Province. Over the past three decades, HFRS endemic areas have spread from their initial centers - Rizhao, Linyi, and Qingdao regions - towards the northern, western, and eastern parts of the province. Notably, shifts of seasonal peaks of HFRS, as characterized by the three epidemic phases, are suggested to be associated with shifts of causal agents of HFRS - HTNV and SEOV, each with different epidemiological characteristics. For example, the HFRS epidemic shift from phase I (1973 \u2013 1982) to phase II (1983\u20131985) suggest that SEOV may have emerged as dominant causal agent for the spring peak of HFRS incidence. Early studies reported that the transmission of Hantaviruses through Our meteorological factor analysis shows monthly cumulative precipitations with 1-month lag, monthly average relative humidity with 1-month lag, and monthly average temperature with 2-month lag are significantly associated with the seasonal variation of HFRS incidence in Shandong Province. As we know, rodent populations, the reservoirs of HFRS, respond rapidly to conducive weather conditions The transmission of Hantaviruses to humans is also related to other factors such as human activities, farming patterns, and rodent abatement strategies Despite insights gained from the present study, the limitations of our study should also be acknowledged. Firstly, due to a lack of time series data on the Hantaviruses of HFRS cases, population densities of rodents, and other influencing factors, it is difficult to further uncover the probable causes of the shifts of seasonal patterns of HFRS incidence from 1973 to 2005. Secondly, although the accuracy of clinically diagnosed HFRS cases is high (greater than 80%), atypical cases of HFRS and mistaken diagnoses of HFRS patients infected by Seoul virus existed Alternative Language Abstract S1Translation of the Abstract into Chinese by Li-Qun Fang(0.04 MB DOC)Click here for additional data file."}
+{"text": "The cause and pathophysiology of ulcerative colitis are both mainly unknown. We have previously used whole-genome microarray technique on biopsies obtained from patients with ulcerative colitis to identifiy 5 changed mucosal transcripts. The aim of this study was to compare mucosal expressions of these five transcripts in ulcerative colitis patients vs. controls, along with the transcript expression in relation to the clinical ulcerative colitis status.n = 49) with defined inflammatory activity and disease extension, and from controls (n = 67) without inflammatory bowel disease. The five mucosal transcripts aldolase B, elafin, MST-1, simNIPhom and SLC6A14 were analyzed using quantitative real-time PCR.Colonic mucosal specimens from rectum and caecum were taken at ambulatory colonoscopy from ulcerative colitis patients (Significant transcript differences in the rectal mucosa for all five transcripts were demonstrated in ulcerative colitis patients compared to controls. The grade of transcript expression was related to the clinical disease activity.The five gene transcripts were changed in patients with ulcerative colitis, and were related to the disease activity. The known biological function of some of the transcripts may contribute to the inflammatory features and indicate a possible role of microbes in ulcerative colitis. The findings may also contribute to our pathophysiological understanding of ulcerative colitis. Ulcerative colitis (UC) is a disorder characterized by chronic mucosal inflammation of the large intestine. It is frequently associated with various extraintestinal manifestations. The inflammation may be limited to the rectum (proctitis), but mucosal lesions often continue more proximally (left-sided UC) or additionally embrace the transverse colon (extensive colitis) or the entire large bowel (pancolitis). The immune and cellular (non-immune) response is dysregulated in both the acute and the chronic phase of UC ,2. In ScThe pathogenesis and pathophysiology of UC are still under investigation . We can The primary aim of the present study was to define differences in the mucosal expression of five selected transcripts, retrieved from two different colonic locations in UC, by using a quantitative RT-PCR technique. We also aimed to evaluate the influence of ongoing anti-inflammatory treatment as well as the importance of the colonic UC extension and the severity class.Before the colonoscopy procedure, consecutive male and female subjects  were recruited to the present study. The UC diagnosis was based on the medical history, endoscopic findings, histological examination, laboratory tests, and the clinical disease presentation. The extent of UC and the clinical activity were classified in accordance with the Montreal Classification . In brieNo uses of corticosteroids, aminosalicylates, or immunosuppressants were registered in the control group, while 9 patients (18%) in the UC group were treated systemically with corticosteroids (prednisolone 10\u201320 mg). Twenty-seven UC patients (55%) were treated systemically with aminosalicylates . Among these, two patients had additional ongoing therapy with aminosalicylate  enemas and three patients were treated with corticosteroid enemas (prednisolone 37.5 mg QD or BID). Seven patients had stable (>3 months) ongoing immunosuppressant treatment .The remaining demographic and clinical data are presented in Figure The biopsy specimens were immediately stored in RNA-later solution for isolation of RNA. The RNA-later-preserved biopsies were homogenized in a lysis buffer from the GenElute Mammalian Total RNA kit  and total RNA was isolated according to the manufacturer's instructions. The RNA concentration was measured spectrophotometrically.T- formula  - \u0394CT(sample)).Two \u03bcg of total RNA from each sample were converted into cDNA. The cDNA synthesis was performed as described previously . Oligonu\u00ae) were used. Median values are presented.Descriptive statistics and the Wilcoxon signed rank test . Neither age nor gender was matched between the UC group and the control group.In order to evaluate any differences in transcript expressions within the control group (n = 67) with respect to background diagnoses , statistical analysis of each background diagnosis were compared to the remaining group of controls. No significant differences (p > 0.05) were detected for any of these diagnoses.Significantly higher transcript expressions of aldolase B and SimNIPhom and significantly lower transcript expressions of elafin, MST-1, and SLC6A14 were found in caecal biopsies in comparison to rectal biopsies from the control group Figure . The onlComparison of rectal biopsies from controls (n = 67) with rectal biopsies from UC patients with inflammatory activity in accordance with Montreal classifications S1\u2013S3 (n = 28) showed significant elevations (p < 0.05) in UC patients of all transcript expressions with the exception of MST-1, which showed significantly (p < 0.05) decreased expression in UC patients. The same analysis of caecal biopsies from controls and patients with S1\u2013S3 UC (n = 16) showed significantly elevated transcript expressions of aldolase B and SLC6A14 only. Distal biopsies from controls, compared with UC patients without inflammatory activity (S0), showed increased transcript expression in aldolase B only . All other transcript analyses from both locations showed no significant differences (p > 0.05).All transcript analysis with respect to UC extension showed that left-sided (E2) and total colitis (E3) differed significantly from controls (p < 0.05); this was not the case for proctitis (E1).Statistical analysis concerning the influence of anti-inflammatory treatment on the transcript expressions within the UC cohort showed no statistical differences (p > 0.05) when comparing UC patients with ongoing corticosteroids (n = 9) or azathioprine (n = 7) respectively with the remaining UC patients. However, the 27 patients treated with mesalazine show a significant increase in aldolase B  in comparison to the remaining UC patients.Genetic predisposition, psychological stress, nutritional and environmental influences, intestinal pathogens and disturbed intestinal barrier function have all been proposeas pathogenetic factors in UC . HoweverOn the basis of exsisting knowledge of the biological functions of the transcripts investigated in this study, it is reasonable to believe that the demonstrated alterations might be related to predisposition and/or the pathophysiological response in UC.+/Cl- driven amino acid transporter B(0+) [It is intriguing that aldolase B and SLC6A14 were up-regulated in rectal as well as caecal mucosa in UC compared to controls. Aldolase B is known to be mainly expressed in the intestinal villus cells and it has a central role in the glycolytic pathway. It also participates in regulation of intestinal secretion . Since Ser B(0+) , the up-The involvement of the microflora and its importance in the onset, development and preservation of UC has been discussed . The SLCMST-1 was included in the present study due to its alterations in UC, as shown in our previous experiment , althougThe fifth identified significantly up-regulated transcript (in rectum only) SimNIPhom (similar to the numb-interacting homolog), encodes a hypothetical protein, at present of unknown pathophysiological importance.Our results supports that specimens from the rectal mucosa are more suitable for further analysis of the selected transcripts, due to the more predictable inflammatory involvement in the rectum and its availability for direct inspection and easy biopsy sampling.Our data can not answer whether the observed changes in expressions of the five selected transcripts may be present in e.g. other inflammatory, infectious or autoimmune conditions since this study uniquely focused on UC patients compared to non-inflamed controls.The five changed gene transcript expressions have relation to UC, its extension and clinical severity. Whether the presented results will contain discriminative potential of importance for the medical care of patients with UC in future clinical practice remains to be elucidated.The authors declare that they have no competing interests.AE designed the study, preformed sampling of biopsies, analyzed the data, and prepared the manuscript. C-FF analyzed the data. AL preformed sampling of biopsies. EK coordinated the study. SL designed the study, analyzed the data and prepared the manuscript. All authors read and approved final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "RCAS1, which acts as a ligand for a putative receptor on immune cells such as peripheral lymphocytes and natural killer cells, is strongly expressed in human cancers. RCAS1 can induce these cells to undergo apoptotic cell death, which suggests that RCAS1 expression may prohibit the stromal reaction occurring in a tumour. To clarify the clinical significance of RCAS1 expression in uterine endometrial cancer, we analysed the association between RCAS1 expression and clinicopathologic variables by statistical methods. With the use of immunohistochemical techniques, we performed a retrospective study of RCAS1 expression in resected tumour tissue from 147 patients with uterine endometrial cancer. We evaluated the statistical correlation between RCAS1 expression and clinicopathologic variables. RCAS1 was expressed in 106 of 147 patients with uterine endometrial cancer\u2009; 30 of these 147 patients showed RCAS1 overexpression. Overexpression of RCAS1 was significantly correlated with age at surgery, stage, extent of myometrial invasion, and positive peritoneal cytologic results. Multivariate analysis revealed that RCAS1 expression and metastasis were clinically significant prognostic factors for the overall survival. These findings indicated that analysis for RCAS1 expression can provide crucial information about the clinical behaviour of uterine endometrial cancer, which may be valuable for the management of patients with this disease. Uterine endometrial cancer is one of the most frequently diagnosed gynaecologic malignancies in Western countries. Approximately 38\u2009300 new cases and 6600 deaths caused by uterine endometrial cancer occurred in the year 2001 in the US . In Japa-ras and c-erbB2/neu oncogenes and the p53 and PTEN tumour suppressor genes are associated with the development of uterine endometrial cancer  is a type II membrane protein able to form oligomers through a coiled-coil structure in its C-terminal portion . After the operation, certain patients received additional therapy: 39, 15, and 14 cases received radiation, hormonal therapy, and platinum-based chemotherapy, respectively; and 29 cases received a combination of surgery, radiation, and hormonal treatment or platinum-based chemotherapy. The overall survival time was defined as the time from the surgery date to the final date of observation in this study (31 March 2002) or the time from the surgery date to the date at death caused by the cancer.Tissue specimens of uterine endometrial hyperplasia were obtained from 30 patients at surgery. These 30 endometrial hyperplasia samples included 10 cases each of simple, complex, and atypical hyperplasias. Normal uterine endometrial tissue specimens were also obtained at surgery from 30 Japanese patients: 10 cases in the follicular phase of the menstrual cycle, 10 cases in the secretory phase of the menstrual cycle, and 10 cases in the postmenopausal state.Informed consent was obtained from all patients.\u03bcm thick were cut from paraffin-embedded blocks. Endogenous peroxidase was blocked with 3% hydrogen peroxidase for 5\u2009min. The slides were then washed twice in Tris-buffered saline (TBS) and were incubated with normal goat serum diluted in a cell staining buffer  for 30\u2009min. Next, mouse anti-human RCAS1 monoclonal antibody was applied, and the slides were incubated in a moist chamber for 30\u2009min. After two additional washes, the sections were incubated for 30\u2009min with biotinylated second antibody . The sections were washed three times in TBS and were incubated with avidin-biotinylated peroxidase complex  for 30\u2009min. After three additional washes in TBS, a 3,3\u2032-diaminobenzine tetrahydrochloride working solution was applied. The sections were then counterstained in haematoxylin and mounted in Permount. The entire procedure was performed at room temperature. Negative controls were treated in the same way, but anti-RCAS1 monoclonal antibody was replaced by mouse IgM.For immunohistochemical analyses, one or two representative sections were selected for each case, and the streptavidin\u2013biotin method was used for formalin-fixed, paraffin-embedded specimens  and anti-Fas-L  monoclonal antibodies, and the relation between the expression of RCAS1 and that of TNF-\u03b1 or Fas-L was evaluated.The 30 specimens of normal endometrium and 34 specimens of endometrial cancer were also stained with anti-TNF-\u03b1, and Fas-L was reviewed independently by two observers (K Sonoda and S Miyamoto) who had no knowledge of the clinicopathologic data. Five representative fields were examined, and a total of 1000 tumour cells (200 for each field) was counted via a microscope with a high-power field (\u00d7 400) objective. The observers counted each slide twice, so that there were four counts for each slide, and the average of the four scores was recorded. Criteria for scoring the overall extent of immunoreaction were as follows: more than 50% positive cells=overexpression, from 25 to 50% positive cells=positive expression, and less than 25% positive cells=normal expression.The immunohistochemical expression of RCAS1, TNF-\u03b1 and Fas-L expression, we examined 30 specimens of normal endometrium and 34 specimens of endometrial cancer. The latter consisted of 12 cases with normal expression of RCAS1, five cases with positive expression of RCAS1, and 17 cases with overexpression of RCAS1. The numbers of cells positive for TNF-\u03b1 and Fas-L expression among the 1000 tumour cells in the tissue sections were counted.For evaluation of TNF-\u03b1 and Fas-L, was used to find the significant factors that affected the expression of RCAS1 as univariate variables. The Mann\u2013Whitney test was performed to check the equality of the distribution of age at surgery between the group showing RCAS1 overexpression and the other groups of RCAS1. The Overall survival curves were estimated by using Kaplan\u2013Meier methods and were analysed by the log-rank test. Cox's proportional hazards regression analysis for the overall survival was used to select a set of prognostic factors from the nine variables, which were RCAS1 plus eight factors given in the first column of The Fisher exact test, for each clinicopathologic factor and the expression levels of TNF-Diffuse staining for RCAS1 was observed both in the cytoplasm and on the cell membrane of cancer cells .The overall survival curves according to the level of RCAS1 expression are shown in Figure 2P<0.0001). There were significant associations between overexpression of RCAS1 and surgical stage (P=0.009), extent of myometrial invasion (P=0.043), and peritoneal cytologic results (P=0.017).To evaluate the clinical significance of overexpression of RCAS1, we used statistical methods to analyse the relation between RCAS1 expression level and clinicopathologic variables. As shown in \u03b1 and Fas-L expression were 32.2\u00b111. 2 and 22.6\u00b112.3 (mean\u00b1s.d.), respectively. All cases showed less than 10% expression of TNF-\u03b1 and Fas-L. In cancer patients with normal expression, positive expression, and overexpression of RCAS1, the numbers of cells positive for TNF-\u03b1 expression were 35.2\u00b112.2, 29.2\u00b112.5, and 30.4\u00b114.2, respectively. The corresponding numbers for Fas-L expression in these groups were 21.2\u00b110.3, 25.2\u00b111.5, and 20.6\u00b114.2. All these patients also showed less than 10% expression of TNF-\u03b1 and Fas-L. These results indicated that RCAS1 expression had no association with TNF-\u03b1 and Fas-L expression levels.In cases with normal endometrium, the numbers of cells positive for TNF-P=0.009), extent of myometrial invasion (P=0.043), and peritoneal cytologic results (P=0.017). These findings suggested that RCAS1 may have a role in the invasive properties of endometrial cancer. Patients with overexpression of RCAS1 had a significantly poorer prognosis than those with normal RCAS1 expression and those with positive RCAS1 expression. Multivariate analysis indicated that overexpression of RCAS1 and metastasis were independent significant prognostic factors for overall survival in patients with uterine endometrial cancer.In this study, a significant association was found between RCAS1 expression level and surgical stage (O-tetradecanoylphorbol 13-acetate (TPA) as TNF-\u03b1 and Fas-L are processed (manuscript in preparation). It is plausible that RCAS1 is secreted from the cancer cells with overexpression of RCAS1. RCAS1 induces apoptosis of lymphocytes by binding to a putative RCAS1 receptor (\u03b1 and Fas-L were little expressed in endometrial cancers. According to these evidences, lymphocyte apoptosis is possibly induced by the expression of RCAS1 in stromal tissue surrounding cancer cells with overexpression of RCAS1. Thus, RCAS1 may facilitate the invasion of cancer cells into connective tissue in endometrial cancer, because of an inhibition of the stromal reaction occurring in a tumour.Fas-L-expressing carcinomas induce apoptosis in lymphocytes with Fas expression (Reportedly, RCAS1 is localised to chromosome 8q23, and its expression is induced by oestrogen (\u03b1 and Fas-L are secreted by proteolytic processing and induce programmed cell death of target cells (In principle, apoptotic factors including TNF-et cells . RCAS1 iOur results presented here are the first to demonstrate that analysis of expression levels of RCAS1 can provide clinical information related to the aggressive behaviour of uterine endometrial cancer. Thus, evaluation of not only clinicopathologic parameters but also RCAS1 expression level may have clinical value for management of endometrial cancer patients.In previous studies, RCAS1 expression was associated with poorer clinical prognosis for uterine cervical adenocarcinoma and non-small-cell lung carcinoma ("}
+{"text": "Streptococcus sinensis has been described as a causative organism for infective endocarditis in 3 Chinese patients from Hong Kong. We describe a closely related strain in an Italian patient with chronic rheumatic heart disease. The case illustrates that S. sinensis is a worldwide emerging pathogen. Streptococcus sinensis in honor of China; the sequencing showed that it was closely related to Streptococcus gordonii (96.4% homology) and to Streptococcus intermedius (96.3%)  , rigors, and weight loss of 4 kg in 3 weeks. There was no history of prior endocarditis, drug abuse, traumatism, or concomitant disease. At admission he was hemodynamically compensated and without fever. Over the cardiac apex, a grade 5/6 proto-mesosystolic murmur was audible. Transesophageal echocardiography showed vegetation on the mitral valve without abscesses. An ophthalmologic examination showed an embolus near the right macula. The urinary sediment exhibited microhematuria. In all blood-culture bottles, a gram-positive An antimicrobial drug treatment with intravenous (i.v.) penicillin G 6 \u00d7 4 million units/day and gentamicin 3\u00d7 1 mg/kg/day for 3 weeks was initiated. After an excellent clinical course and normalization of inflammation markers, treatment was switched to i.v. ceftriaxone 1\u00d7 2 g/day for another 3 weeks to enable outpatient therapy  was used to attempt the identification. The numerical profile was 4241450, indicating S. sanguinis (95% similarity). Agglutination with Lancefield antisera  was negative for groups A, B, C, D, F, and G. Antimicrobial MICs were determined with Etest . Results were interpreted according the available Clinical Laboratory Standard Institute  criteria  were positive with gram-positive cocci in chains. The isolate grew as transparent \u03b1-hemolytic colonies (0.5- to 1-mm diameter) on sheep blood Columbia agar after an incubation of 24 h at 35\u00b0C in 4% COcriteria .S. sinensis HKU4 (AF432856) (sodA) (primer from reference rpoB)  of the S. sinensis strain AF199923  and compared with the nucleotide sequences in GenBank. Of >1,000 bp in the 16S rRNA sequence, only 2 differed from the previously published S. sinensis. Information on this novel pathogen has been published for 3 Chinese patients .We report a case outside Hong Kong of infective endocarditis caused by a strain of S. sinensis. From a clinical point of view, all reported patients  without necessity for surgical intervention. In light of other streptococcal endocarditic recommendations , and other sequences have been reported by a French group  and a British group . We do not know more about these cases. Our Geneva strain differed only in 2 nt bases from the HKU4 strain (on positions 43 and 48) and only in 1 base (position 66) from the German sequence, whereas it is identical with the French sequence. This might suggest the emergence of a European strain of S. sinensis causes endocarditis throughout the world. Like other viridans streptococci, S. sinensis might be part of the human oral flora. The real number of cases is probably underestimated because commercial kits misidentify S. sinensis as S. intermedius or S. anginosus (In conclusion, our case outside Hong Kong confirms that"}
+{"text": "Arabidopsis shoot meristems, based on the assumption that meristems are self-organizing systems. The model comprises two coupled feedback regulated genetic systems that control stem cell behaviour. Using a minimal set of spatial parameters, the mathematical model allows to predict the generation, shape and size of the stem cell domain, and the underlying organizing centre. We use the model to explore the parameter space that allows stem cell maintenance, and to simulate the consequences of mutations, gene misexpression and cell ablations.Plants maintain stem cells in their meristems as a source for new undifferentiated cells throughout their life. Meristems are small groups of cells that provide the microenvironment that allows stem cells to prosper. Homeostasis of a stem cell domain within a growing meristem is achieved by signalling between stem cells and surrounding cells. We have here simulated the origin and maintenance of a defined stem cell domain at the tip of  Growth of the aerial parts of higher plants relies on a life-long supply with cells by the shoot apical meristem (SAM). The SAM contains a small population of non-differentiating stem cells in the central zone at the meristem tip Arabidopsis thaliana secrete the CLAVATA3 (CLV3) peptide, consisting of 12 amino acids ARABIDOPSIS RESPONSE REGULATOR (ARR) genes, which are negative regulators of cytokinin signalling, are repressed by WUS, thus involving cytokinin in meristem maintenance WUS induces stem cell fate only at the meristem tip, and not in the (WUS expressing) OC cells or other surrounding cells, indicating that a spatially restricted cofactor, or a competent cellular state is required to respond to WUS activity Maintenance of the undifferentiating stem cell population depends on signals from cells of the organizing centre or OC, which reside underneath the SCD in a deeper region of the meristem. Several gene products have been identified that enable these adjacent cell groups to communicate with each other. The stem cells of WUS expression, a feedback circuitry is established that maintains a stable stem cell population. Support for this model of stem cell homeostasis comes from a number of experimental observations: 1) loss-of-function mutants of WUS cannot maintain stem cells CLV3  allow for less restricted WUS expression and production of excessive stem cells CLV3 represses WUS, causing stem cell loss WUS expression is uncoupled from repression by CLV3, e.g. when controlled from a heterologous promoter, the stem cell domain expands CLV3/WUS circuitry is capable of self-organization. This was revealed by laser ablation experiments in tomato, showing that after elimination of both SCD and OC, new domains of WUS expression are generated at peripheral sites that then initiate new SCDs, which support further growth of the SAM Because stem cells signal back to the OC via CLV3 and its receptors to restrict CLV3/WUS circuitry at a shorter timescale required rapid and transient perturbations of gene expression. In a first study of this type, CLV3 expression was silenced by Dexamethason-induced expression of a foldback CLV3 RNA CLV3 silencing showed that expression of a CLV3:GFP transgene, acting as a reporter for stem cell identity, extended into cells adjacent to the central zone within 24 hours after induction. Importantly, this re-specification of peripheral cells to stem cell identity was not preceded by cell divisions. In a similarly designed experiment, induction of high level CLV3 expression downregulated both WUS expression, and the stem cell marker CLV3, within 3 hours CLV3/WUS circuitry is acting throughout development, and that the output, stem cell number, can be continuously readjusted in response to changing amounts of the signalling components. In line with this, fluctuations of central zone size were observed, indicating continuous activity of the circuitry However, all previous studies performed on various mutants or constitutive misexpression lines did not allow studying the immediate consequences of system perturbations. Cell ablation experiments are further complicated by wounding effects, and ectopic cell divisions in the SAM which are required for regeneration. Analyzing the dynamics of the CLV3/WUS circuitry was also found to be surprisingly robust and to tolerate changes in CLV3 expression levels over a tenfold range CLV3 signalling rapidly repressed WUS expression, a slowly acting compensation mechanism appeared to upregulate WUS with time. The components of this compensatory circuitry are unknown, but may be found among the gene set that controls WUS expression. SPLAYED (SYD) encodes a SNF2-type chromatin-remodelling ATPase that is required for WUS transcription WUS expression to the OC HANABA TARANU (HAN), coding for a GATA-transcription factor, represses WUS postembryonically from the developing vasculature WUS expression domain when meristems are generated. During development, a second feedback mechanism could operate via the cytokinin signalling pathway. WUS represses the expression of several ARRs in the meristem, which restrict cytokinin signalling ARRs arrests meristem activity and WUS expression, suggesting that WUS and ARRs mutually repress each other.However, the CLV3/WUS circuitry in the shoot apical meristem. Our model incorporates two feedback regulatory systems that merge upon WUS regulation. The driving force for modelling was to better understand the forces that shape the CLV3 and WUS expression domains, while making the minimal number of necessary assumptions about the factors to be involved. We used the model to study the effects of targeted system perturbations, and to explore the parameter space that allows for stem cell homeostasis under fluctuating conditions.We have generated a computational model of stem cell fate regulation by the WUS via two separable feedback operated reaction-diffusion systems, a commonly used type of differential equation models for developmental processes in biology We propose a partial differential equation (PDE) model to follow the dynamics of gene regulation across the SAM . Conceptstemness, which is controlled by a WUS-dependent signal . We avoided an artificial and static cut-off concentration for WUS-signal, above which cells switch to the stem cell status, and instead established a dynamic but sigmoidal response to WUS-signal, that results in variable levels of stemness to represent a cell's state.Cells of the meristem can acquire stem cell identity, reflected in their level of WUS-signal and we restricted stemness to the outer layers. Stem cells express the signalling molecule CLV3, proportional to their stemness level. The stemness levels are expressed by the model variable [st].Experimental evidence from WUS misexpression shows that only outer cell layers acquire stem cell identity. The underlying factors responsible for this are not known. We are now not postulating another signal, but take this observation into account by allowing only cells in outer cell layers to acquire stem cell identity. Therefore, only cells in the outer layers of the meristem are competent to react to CLV3 levels are expressed by the model variable [CLV3].CLV3 freely diffuses to neighbouring cells. To avoid flooding the entire model with CLV3, the CLV3 peptide is regarded to decay with time. We eliminated the need for receptor proteins or other signalling components because insufficient quantitative data are available to assess their contribution. Furthermore, CLV-signalling appears to be largely controlled by the amount of available CLV3 peptide WUS gene is expressed WUS, we added a spatial parameter which makes cells that reside closer to the meristem tip more competent to activate WUS expression . At the start of the simulation, facX is expressed homogeneously in all cells and is freely diffusing. FacX induces WUS expression, but is itself under negative feedback regulation by WUSfacX by WUS. The interactions between WUS and facX are thus based on an activator-substrate-like mechanism that will generate a discrete WUS domain. The facX levels are expressed by the model variable [facX].To account for The described entities are compiled into a PDE representation of the intracellular gene regulative program given by Eqs. (0.1)\u2013(0.5) see  section.CLV3-expressing SCD and the WUS-expressing OC, at approximately those locations which are experimentally observed in wildtype meristems  in facX and the feedback between WUS and facX are vital for the model to initiate stable Turing patterning. Candidates to realize the role of facX are genes and functions that control WUS expression. Because eliminating facX destabilizes the OC, we predict that mutations in genes contributing to facX function should result in either unrestricted WUS expression and meristem overproliferation  which were linked via WUS as the common node. Conceptually, the underlying assumption was that SCD and OC could originate independently of each other, but that their maintenance and relative position are controlled by mutual feedback regulation. However, such a model failed to reproduce the domain arrangement observed in actual meristems for the model's parameter space which we explored using a stochastic parameter estimation technique, namely an evolutionary algorithm WUS had previously shown that the cellular response to WUS-derived signals depends on a cells' relative position within the meristem, corresponding to its developmental trajectory. Only by adding spatial components to our model we were able to achieve a realistic sizing and arrangement of the two domains within the meristem; removal of this spatial component causes extensive spatial overlapping of the SCD and OC.Mathematical modelling is a tool that allows asking the most stringent questions concerning the dynamic behaviour of predicted gene regulatory networks; it also quickly uncovers the restrictions and shortcomings of assumed interaction maps, and thus provides guidance to direct future experiments. We had initially attempted to build a model for the SCD and OC, based solely on the interaction between two activator-inhibitor based systems (WUS/CLV3 interaction that concentrated on the generation of the CLV3 domain (the SCD in our model) by a WUS derived signal CLV3 signalling upon WUS expression, and the creation and maintenance of the WUS domain was not simulated. To confine the CLV3 domain to the meristem tip, the authors proposed that an (unidentified) factor diffusing from the outermost meristem layer, the L1, together with the WUS-dependent signal, induced CLV3 expression. They later used a reaction-diffusion model combined with two repressive signals, derived from the L1 and stem tissue, to activate WUS expression in a deeper meristem region J\u00f6nsson et al. had previously described a model for the X is produced by OC or SCD, which can buffer the response of the cell pools against changes in proliferation rates. Although this model did not allow reproducing all mutant and overexpression experiments that we have simulated here, it combined modelling approaches with quantitative data, and highlighted the enormous developmental plasticity of the meristem.A recently published model by Geier et al. WUS/facX system, acts as a buffer that dampens fluctuations in WUS levels. Furthermore, the reaction rates that influence WUS expression in our simulations are one order of magnitude smaller than those controlling CLV3 levels. Increased stability against signalling noise was uncovered in the analysis of coupled positive feedback systems if the two linked regulatory loops operated at different speeds We challenged our model by altering central system parameters to simulate mutant phenotypes and published transgenic experiments. In all experiments, our model proved to be robust against small-scale perturbations see . This stBased on the gene interaction diagram shown in  section . This seThe model depends on the following parameters: reaction rates stem tip . It is aCLAVATA background in all cells. In a wildtype scenario On top of the parameters we already described, the model contains a set of parameters that is used to accommodate the different modelled mutants and experiments. In this context, The model parameter setting for the wildtype simulations as well as for the simulations of mutants are given in The model parameters have been tuned by hand using a type of hierarchical decomposition of the system: from a developmental perspective firstly the OC is formed which then induces the formation of a SCD. For the parameter tuning process we therefore divided the system into two parts. (i) Equations (0.1) and (0.2) which are responsible for the formation of the OC, and (ii) Eqs. (0.3) to (0.5) that constitute the SCD generating part of the system. During a three-stage process we started the tuning process of the model parameters by considering only the OC generating system, in order to identify parameters resulting in a single and spatially confined OC domain. For this subsystem, we started with parameter settings as documented previously , and we were able to identify fitting parameters reasonably close to the initial settings. Using the resulting OC as input, we then tuned the parameters for the SCD generating part of the system. Here we ignored the feedback of WUS dependent signalling is still unknown, free diffusion represents a sort of \u2018maximum entropy choice\u2019. In terms of modelling complexity we benefit from this fact: with free diffusion, extracellular spaces, cell walls and membranes can be neglected during the simulation process. In addition, due to the Voronoi decomposition used to generate the considered section through the meristems, cell volumes and surfaces tend to even out. Since the model is not supposed to generate quantitative data, but rather to investigate qualitative behaviour, we neglect the influence of cell surfaces and volumes during simulations.For the numerical simulation of the PDEs, we assume zero flux conditions on the boundaries of the cell plane. In order to simulate the time evolution of the model, the model equations are numerically integrated. The equations have to be discretized with respect to time and space, here using a constant time step The diffusion terms in the considered system tend to be stiff and we therefore chose to use a variant of the second order implicit Crank-Nicolson integrator as presented previously by others The numerical simulations for the considered scenarios are done in a two-stage process. The first stage is used to equilibrate the system starting from the initial conditions. Here, under \u2018equilibrium state\u2019 we understand a system state in which all derivates are reasonably close to zero. During the second stage the parameters are adapted in order to accommodate the considered scenarios. As initial condition for the first stage, the To model biological systems there exists a range of different mathematical modelling approaches, e.g. stochastic molecular simulations, differential equation models, or discrete dynamic models. The available models vary with respect to possible level of detail where a gain in detail comes at the cost of additional computational effort. Since the focus of this study is to provide a model capable of reproducing the intricate dynamics underlying the maintenance of the SAM, we chose a differential equation model\u2013\u2013an approach that provides the necessary level of detail and is commonly used to model the considered type of systems.stemness and neighbouring cells with low levels of stemness. In turn, such parameter choices reflect possible underlying biological reactions like the formation of homodimers or other forms of cooperativity.From a qualitative perspective, SAM maintenance is a question of developing and maintaining a patterning of a tissue with respect to distinct domains with specific gene expression profiles. A popular approach in developmental biology to capture pattern formation are reaction diffusion systems developed by Turing in the 1950s Figure S1st\u200a=\u200a0.21, for WUS: \u03b4WUS\u200a=\u200a0.31.Effects of reduced CLV3 levels on OC and SCD. (A) Time course simulation for a conditionally reduced CLV3 expression. (B) Impact of CLV3 expression levels on the sizes of OC and SCD. To assess the number of cells in the respective domains, the concentrations were discretized using thresholds relative to the wild type concentrations: For stemness: \u03b4(1.26 MB EPS)Click here for additional data file.Figure S2ko\u200a=\u200a0), (B) a simulation where CLV1 retains some activity (c1ko\u200a=\u200a0.2).Simulating loss-of-function mutants in CLV1. (A) clv1 loss-of-function scenario (c1(1.69 MB EPS)Click here for additional data file.Figure S3ext]\u200a=\u200a0.7). (B) Graded system response to different exogenous CLV3 expression levels. The [CLV3ext] level is varied in . To assess the number of cells in the respective domains, the concentrations of stemness and WUS were discretized using thresholds relative to the wild type concentrations. For stemness: \u03b4st\u200a=\u200a0.21; for WUS: \u03b4WUS\u200a=\u200a0.31 is used.Gradual increase of exogenous CLV3 expression levels. (A) Time course simulation for a low level CLV3 overexpression ([CLV3(1.22 MB EPS)Click here for additional data file.Figure S4ko\u200a=\u200a0.6), (B) a simulation for with intermediate WUS expression (wko\u200a=\u200a0.4), (C) a simulation for a WUS loss-of-function scenario (wko\u200a=\u200a0).Altering WUS expression. (A) A simulation for slightly reduced WUS expression level (w(2.38 MB EPS)Click here for additional data file.Figure S5st\u200a=\u200a0.21, for WUS: \u03b4WUS\u200a=\u200a0.31 is used.Regeneration and de-novo generation of OC and SCD. To assess the number of cells in the respective domains, concentrations were discretized using thresholds relative to the wild type concentrations. For stemness: \u03b4(0.46 MB EPS)Click here for additional data file.Text S1Reducing CLV3 expression.(0.03 MB RTF)Click here for additional data file.Text S2Simulating loss-of-function mutants in CLV1.(0.86 MB RTF)Click here for additional data file.Text S3Gradual increase of exogenous CLV3 expression levels.(0.03 MB RTF)Click here for additional data file.Text S4Altering WUS expression.(0.18 MB RTF)Click here for additional data file.Text S5Regeneration and de-novo generation of OC and SCD.(0.08 MB RTF)Click here for additional data file.Text S6Sensitivity analysis for model parameters.(0.17 MB PDF)Click here for additional data file."}
+{"text": "Pneumocystis are microscopic yeast-like fungi that reside in the lungs of almost every mammal that has been evaluated for their presence. They grow extracellularly in the alveoli of mammals and are considered to be host obligate, as they cannot grow outside the lung on artificial media. Pneumocystis species (spp.) are typically restricted to the lungs, although extra-pulmonary manifestations have been reported Pneumocystis carinii\u201d. It is now clear that distinct species of Pneumocystis infect different mammalian hosts. Each mammalian species has at least one species of Pneumocystis that it harbors which cannot infect another mammalian species (species specificity).Members of the genus Pneumocystis spp. have suffered many identity crises, beginning with their initial identification in 1909, when they were thought to be part of the life cycle of the protozoan parasite Trypanosoma cruziPneumocystis carinii\u201d, which reflected their preference for the lung, \u201cpneumo\u201d-; their characteristic morphological form, the cyst, -\u201ccystis\u201d; and \u201ccarinii\u201d to honor the Italian investigator, Antonio Carini, who provided the slides for study. Presumed to be a protozoan parasite, the potential fungal nature of P. carinii was first raised in the 1950s, and the controversy over their protozoan or fungal nature continued into the late 20th century P. carinii were the fission yeast Schizosaccharomyces pombe and the plant pathogen Taphrina deformansPneumocystis species, only five have been formally described: P. carinii and Pneumocystis wakefieldiae, which infect rats; Pneumocystis murina in mice; Pneumocystis oryctolagi in rabbits; and Pneumocystis jirovecii, which infects humans Molecular biological techniques have been essential for providing the breadth of knowledge that is currently available for these intractable fungi. Phylogenetic determinations based on gene sequences not only permitted the fungal identity of the genus to be clarified, but provided the basis for species distinctions within the genus. Although it is anticipated that there are thousands of Pneumocystis has not been without controversy, particularly with the name P. jiroveciiP. carinii to P. jirovecii, which had the potential to cause confusion among patients and clinicians alike P. jiroveciiIt should be noted that the nomenclature of Pneumocystis spp. are considered ubiquitous fungi and are found in the lungs of terrestrial mammals from almost all geographic regions with the possible exception of the Arctic and Antarctica, where their presence has not yet been surveyed. Definitive studies of Pneumocystis in marine mammals have not been reported. No environmental forms of Pneumocystis have been identified providing additional evidence that they are dependent upon their hosts for growth and transmission without need of an intermediate vector or requirement for maturation outside mammals. Human beings develop antibodies to P. jirovecii by the age of 4 years, but likely are exposed at a much earlier age P. carinii was present in their oral cavities 1\u20132 hours after birth, even before the first feeding, providing evidence that mammals contact Pneumocystis early in life Pneumocystis has not been completely defined, but most putative schemes contain an asexual mode of replication via binary fission of the trophic form and a sexual mode resulting in formation of an ascus (cyst) containing eight ascospores  where the host is a dead end.The life cycle of cospores . Unlike Pneumocystis-infected mice and rats with echinocandins  were shown to eliminate cysts, which contain glucan in their walls P. carinii and P. murina to form biofilms suggests this mechanism may be one way in which the infection can spread After inhalation, the infection is thought to be initiated by attachment of the trophic forms to the Type I pneumocyte in the host alveoli. Investigators in the field have long pondered the identity of the infectious propagule without any clear answers. However, recent studies provide evidence that the cyst may be the agent of transmission. Treatment of Pneumocystis spp. cause pneumonia in immunologically impaired mammals, which is oftentimes lethal if untreated. P. jirovecii pneumonia (PCP) was a leading cause of morbidity and mortality in patients with AIDS during the last two decades P. jirovecii in new patient populations suggests that P. jirovecii is taking advantage of these evolving niches in the human population. Anti-tumor necrosis factor-alpha (anti-TNF\u03b1) therapy, such as inflixamab, is now commonly used to treat rheumatoid arthritis and Crohn\u2019s disease. A recent survey of the US Food and Drug Administration Adverse Event Reporting System for P. jirovecii pneumonia from 1998 through 2003 identified 84 cases of PCP associated with inflixamab therapy, 27% of which resulted in death Standard antifungal drugs targeting ergosterol and ergosterol biosynthesis, such as amphotericin B and the azoles, are not effective against PCP Pneumocystis spp. has been derived from the study of organisms in the lungs of mammals with debilitated immune systems. No information is available on the life cycle in the non-immunosuppressed host, where their widespread presence has been confirmed in commercial animal colonies Pneumocystis can exist with little consequence to hosts with intact immune systems Pneumocystis is virtually undetectable by symptomatic manifestations. A survey of 137 rats from three different commercial vendors showed a 98% prevalence in normal healthy rats P. jirovecii has been associated with underlying immune debilitation, but rarely in healthy populations All of the current information on the life cycle of P. jirovecii detected by PCR amplification or histological staining of resected lung tissue, oropharyngeal or nasopharyngeal washes, or bronchoalveolar fluids, can be associated with poorer outcomes for the colonized individuals. The changes in immune function that support colonization can be subtle, including pregnancy, chronic lung disease, or even immature immune systems, such as that in infants P. jirovecii was detected by PCR amplification in resected lung tissue of 36.7% of patients with severe disease versus 9.1% of control subjects P. jiroveciiHowever, colonization, as defined by the presence of Pneumocystis populations may occur indefinitely until it is perturbed by debilitation of the immune system, induced by various means including infectious or immunosuppressive agents, congenital defects, or malnutrition, which can then lead to proliferation within the lung alveoli and eventually a lethal pneumonia if untreated. These fungi could be considered both opportunistic in self-limiting infections and pathogenic, taking advantage of the loss of the host\u2019s immune system to increase in number, which ultimately leads to the host\u2019s demise. However, it appears that host death is not the intent, since Pneumocystis rely on the host for proliferation and transmission and probably have evolved to cause as little damage as possible to this relationship to ensure their survival.It is likely that the organism replicates at low levels within an immune intact host, evading the immune system by its vast repertoire of surface antigens Pneumocystis spp. exert little to no pathogenic effects and enjoy widespread distribution among their host of choice. Since the mammalian host appears to be necessary for Pneumocystis spp. survival and complete life cycle including sexual replication, it would seem advantageous to keep it alive. Should the host lose some immune function, by disease or chemotherapeutic agents, the organisms can take advantage of the decreased host defenses, as would an opportunist, and enter into a more aggressive state with detectable colonization, which in some cases can be associated with clinical symptoms. This phase can be self-limiting if the immune function does not further decline, or if the source of immunosuppression is alleviated. More sustained or severe loss of immune competence by the host permits the organisms to expand and more extensively invade the lung, resulting in pneumonia and associated pathogenesis. Pneumocystis is opportunistic in the sense that it takes advantage of the change in the host immune response to grow and expand, but the apparent lack of clinical consequences in immunologically intact hosts, the host specificity, and the lack of innate virulence factors suggest that these fungi have adapted to form a compatible relationship rather than a pathogenic one within their natural habitat, the immune intact mammalian host.I would argue the answer is (d). The species specificity and host-obligate nature of the members of this genus argue for a co-evolution with their respective mammalian hosts in which their preferred life style seems to be commensal like. In immunologically intact mammals,"}
+{"text": "Melanolipofuscin (MLF) is a complex granule, exhibiting properties of both melanosomes and lipofuscin (LF) granules, which accumulates in retinal pigment epithelial (RPE) cells and may contribute to the etiology of age-related macular degeneration (AMD). MLF accumulation has been reported by Feeney-Burns to more closely reflect the onset of AMD than the accumulation of lipofuscin. In an effort to assess the possible contribution MLF may have to the onset of AMD, we analyzed the phototoxicity and protein composition of MLF and compared those results to that of LF.Specifically, we observed the accumulation of MLF in human RPE from different decades of life, and assessed the phototoxicity of these granules. We also employed fluorescence spectroscopy, atomic force microscopy, transmission and scanning electron microscopy and proteomic analysis to examine the composition of MLF granules in an effort to ascertain their origin.Our results show that MLF granules are phototoxic and their accumulation more closely reflects the onset of AMD than does LF accumulation. Our compositional analysis of MLF has shown that while these granules contain some similarities to LF granules, MLF is substantially different. Of significant interest is the finding that MLF, in contrast to LF, does not contain photoreceptor-specific proteins, suggesting that MLF may not originate from the phagocytosis of photoreceptor outer segments. Instead the presence of RPE- and melanosome-specific proteins would suggest that MLF accumulates as a result of the melanosomal autophagocytosis of RPE cells.Our results provide significant insight into understanding the formation and toxicity of MLF and suggest a possible contribution to the etiology of retinal diseases. Several retinal diseases, including age-related macular degeneration (AMD), have been associated with the accumulation of autofluorescent granules in retinal pigment epithelial (RPE) cells. One such autofluorescent granule, lipofuscin (LF), may relate to the onset of these ocular diseases because it has been shown to generate reactive oxygen species via photosensitization with blue light -4; whichAnother autofluorescent granule that accumulates in RPE cells and may contribute to the etiology of AMD is a complex granule exhibiting properties of both melanosomes and lipofuscin granules called melanolipofuscin (MLF). Although it is generally accepted that dermal melanin protects the skin from UV light damage, the biological function of RPE melanin is not completely understood. Melanin is known to absorb excess light passing through the eye, thereby reducing scatter and improving image resolution. It has also been suggested to play a photoprotective role in RPE cells ,7 by scaOxidative stress has been suggested to be a major contributing factor for retinal degeneration in AMD. The retinas constant exposed to light and a relatively high oxygen pressure, which is close to that found in arterial blood, contributes to light-induced oxidative stress in the retina which may result in oxidative damage to biomolecules in these cells. RPE cells are post mitotic and therefore must respond to a life time of oxidative insult. While there are numerous mechanisms for preventing and combating oxidative injuries, by middle-age many of these anti-oxidative mechanisms have begun to break down, which can increase the susceptibility of RPE cells to accumulated damage. LF and MLF granules are thought to result from the accumulation of undegradable material in RPE cells. Modifications, including oxidation, may render the molecules in these granules undegradable by the cell, contributing to their accumulation.While the identification of photoreceptor- and lysosomal-specific proteins in LF granules has provided evidence that LF originates from the accumulation of undigested material from the phagocytosis of photoreceptor disc in RPE lysosomes , little In the present study we observed the accumulation of MLF in human RPE from different decades of life and assessed the phototoxicity of these granules. We also employed fluorescence spectroscopy, atomic force microscopy, transmission and scanning electron microscopy and proteomic analysis-using 1D gel electrophoresis coupled with ESI mass spectrometry-to examine the composition of MLF granules in an effort to ascertain their origin. Collectively these data provide significant insight into understanding the formation and toxicity of MLF and suggest a possible contribution to the etiology of retinal diseases. Specifically, these data do not provide direct support for either previously suggested hypothesis for the origin of MLF, but instead suggest that MLF accumulates as a result of the melanosomal autophagocytosis of RPE cells. To our knowledge this is the first report of the phototoxicity and biochemical analysis of retinal melanolipofuscin.Lipofuscin and Melanolipofuscin Isolation and Fluorescence - Lipofuscin and melanolipofuscin granules were isolated as previously described ,22, usinTo study the accumulation of LF and MLF over time, sucrose gradient centrifugation was employed using four groups of RPE, each consisting of 6 RPE and representing a different decade of life. The first group had an average age of 33\u00b11.6 yrs; the second group had an average age of 43\u00b10.9 yrs; the third group had an average age of 54.3\u00b11.9 yrs; and the fourth group had an average age of 64\u00b10.0 yrs. To compare the LF and MLF content in young and old eyes, sucrose gradients were run with 11 RPE from young eyes (average age of 21.2\u00b15.9 yrs) and 14 RPE from old eyes (average age of 66.5\u00b15.9 yrs). Pictures of the gradients were taken using an Olympus Camedia digital camera. Image J  was used to measure the optical density of LF and MLF bands in the sucrose gradients.All other experiments were performed using LF and MLF isolated from RPE's taken from a random donor population between 40 and 80 years old.Human retinal pigment epithelial cells  were grown in 24-well tissue culture plates in RPMI 1640 media supplemented with 10% fetal bovine serum (FBS). Upon reaching confluency the fetal bovine serum (FBS) in the media was reduced to 1%. Cells were either maintained in RPMI 1640 media supplemented with 1% FBS or incubated in the same media which also contained about 300 melanolipofuscin or lipofuscin granules/cell for 24 h to allow for ingestion of the granules. After the 24 h incubation, the melanolipofuscin- or lipofuscin-fed RPE cells were transferred back to RPMI 1640 media supplemented with 1% FBS and maintained for 3 days before bioactivity assay.2 or maintained in the dark. This intensity of light, or even higher intensities, have previously been used by investigators to determine the effect of blue light exposure on the retina [2 humidified cell incubator using a Mille Luce M1000 Fiber Optic Illuminator with a 150 W quartz halogen bulb, a 25 mm dichroic blue light filter, and a 48 inch fiber optic cable . Photocytotoxicity of the lipofuscin and melanolipofuscin granules was assessed using Sulforhodamine B  to measure cell viability. Briefly, cultures were fixed with trichloroacetic acid and stained with 0.4% sulforhodamine B in 1% acetic acid. The cultures were washed 4 times with 1% acetic acid to remove any unbound dye; protein-bound dye was extracted with 10 mM unbuffered Tris base and transferred to a 96 well culture plate. Absorbance was measured at 570 nm on a CERES UV900 HDi plate reading spectrophotometer .To investigate the bioactivity of MLF, ARPE-19 cells that were fed LF, MLF or neither (control cells) were either subjected to blue light (390-550 nm) for 48 h at an intensity of about 2.8 mW/cme retina ,23. BlueMLF granules were prepared for scanning electron microscopy (SEM) analysis by drying the granules on a silicon wafer and sputter coating them with gold. The granules were analyzed on a Phillips XL30 ESEM FEG using a 5 kV accelerating potential. For transmission electron microscopy (TEM) analysis MLF granules were fixed in glutaraldehyde, postfixed in osmic acid, dehydrated and embedded in epoxy resin. 100 nm slices of the sample were imaged and photographed on a JOEL JEM 2000 FX.MLF samples for atomic force microscopy (AFM) were prepared by drying the granules onto a mica slide. Images were taken with a Multimode IIIa AFM instrument with microfabricated Si cantilever tips . Vibrational noise was dampened using an active isolation system . Typical imaging parameters were (a) tip resonance frequency, 55-65 kHz; (b) amplitude setpoint, 2.0-2.5 V; (c) scan rate, 2.0 Hz. Images were processed offline to remove the background slope using software bundled with the AFM instrument.To determine the size distribution and concentration (granules/unit volume), suspensions of MLF granules were diluted 1:100 and 1:1000 with PBS and 200,000 Flow Check High Intensity Green Alignment Beads , 5.726\u00b10.375 \u03bcm in diameter, were added to each sample to serve as an internal standard. The samples were excited with an argon laser at 488 nm on a Beckman Coulter  EPICS-XL Flow Cytometer with EXPO 32 ADC software for flow cytometric analysis. The samples were analyzed for forward light scatter and autofluorescence by collection of data for 300 s, which allowed visualization of at least 10,000 beads and at least 95,000 MLF granules.Melanolipofuscin granules were pelleted using centrifugation and lyophilized in an evaporative centrifugal concentrator. The granules were weighed using a Mettler UMT2 microbalance  to determine their total mass. After weighing the dried granules, the protein in these melanolipofuscin samples was quantified by solubilizing the granules in 1% SDS followed by the BCA Protein Assay . Three independent measurements were used to calculate the percent protein and standard deviation.Matrix Science) website for peptide identification. Proteins in MLF granules from three independent preparations were examined. Each 1D gel lane containing MLF or LF proteins was cut into 24 gel slices for mass spectrometric analysis. Four gel slices  from two preps of LF granules were selected for analysis to provide a direct comparison of the differences in LF and MLF proteins. Relative quantization of proteins was estimated using the method of spectral counting [Melanlolipofuscin and lipofuscin granules containing 100 _g of protein were pelleted by centrifugation, solubilized in 4X Laemmli buffer  and separated on a 10% SDS-PAGE gel (8.3x6.4x0.1 cm). The gel lanes were sliced into sections and the proteins were digested in-gel as described by Shevchenko et al. , injectecounting .Human retinas were obtained from Dr. Paul Bernstein from the Moran Eye Institute to make a positive control for rhodopsin. A retina was gently triturated in 0.75 M sucrose, 0.68 mM calcium chloride, 20 mM tris and 1 mM DTT pH 7.4 to rupture the cells. The suspension was poured over 4 thicknesses of cheesecloth to remove debris. The sample was spun at 1475 xg for 20 min and the pellet was resuspended in 1% SDS. Total protein was determined using the BCA assay. An \u03b1-rhodopsin antibody   was usedOxidized bovine serum albumin (BSA) samples were made by incubating BSA in hypochlorous acid at 37 \u00b0C for 30 min. LF, MLF and BSA samples were derivatized by incubating them in 5% sodium dodecyl sulfate and 10 mM 2,4-dinitrophenylhydrazine (DNPH) in 10% (v/v) trifluoroacetic acid for 30 min at room temperature. The solutions were neutralized by adding 2M Tris and Laemmli buffer  and loaded directly onto a gel. Anti-DNP antibody from rabbit was purchased from Sigma.Side by side comparison of the LF and MLF content in RPE from young (21.2\u00b15.9 yr) and old (66.5\u00b15.9 yr) individuals as seen in sucrose gradients is shown in Analysis of the phototoxicity of MLF revealed that these granules cause a 58% decrease in cell viability in ARPE-19 cells fed with MLF and exposed to blue light for 48 h. This is compared to an 80% decrease in cell viability in ARPE-19 cells fed with the same number of granules of LF . AlthougSeveral physical measurements of MLF granules were made using fluorescence spectroscopy, electron microscopy, atomic force microscopy, and flow cytometry. Fluorescence of MLF and LF granules is shown in SEM and AFM analyses of MLF granules  show neaFlow cytometric (FC) analysis allowed a quantitative determination of granule size. Forward light scatter in FC instruments is directly proportional to the size of the objects passing through the beam. The MLF granules were found to have a mean diameter of 0.93 \u03bcm and a broad standard deviation of 0.60 \u03bcm. Flow cytometry also enabled a quantitative determination of the concentration of granules in our suspensions. Having a count of the MLF granules, we were able to determine their average weight, which proved to be 2.2\u00b10.1 pg/granule. When compared to LF, MLF is about 35% larger but weighs about 69% more, again indicating the presence of a more dense substance.To determine the percent protein composing MLF granules, the protein in a known quantity of MLF was solubilized in 1% SDS and quantified by BCA assay. MLF proved to consist of 60.7\u00b16.4% total protein. Compared to LF, MLF contains more protein and therefore less extractable lipids (see Warburton 2005) [Because of the possibility that the proteins in MLF granules are highly modified exhibiting highly heterogeneous populations and therefore unfocusable on 2D gels, we employed 1D SDS-PAGE coupled with automated LCMSMS to identify the protein constituents of MLF. Four gel slices from MLF and LF 1D gels were analyzed for a direct semi-quantitative comparison of RPE- and photoreceptor-specific proteins in these granules. Spectral counting of two photoreceptor-specific proteins, rhodopsin and peripherin, and two RPE-specific proteins, RGR and rpe65, from these four gel slices is show in Rhodopsin was previously shown to be abundant in LF granules , howeverBecause of the extensive modifications on proteins in LF granules that have been previously reported , we usedSucrose density gradients of human RPE from different decades of life illustrated that MLF is virtually non-existent in the RPE of younger individuals even though LF granules appear to be abundant in these RPE and has been detected in RPE as young as 18 years of age (data not shown). Consistent with Feeney-Burns results , MLF doeOf significant interest is the fact the MLF is biologically active, showing a light-dependent decrease in cell viability in ARPE-19 cells fed MLF and placed in blue light for 48 h. To our knowledge this is the first report of the phototoxicity of MLF. The phototoxicity of MLF granules in ARPE-19 cells is at least 72% as potent as that of LF granules. These data show that MLF granules have the potential for deleterious affects on RPE cells in the retina.The physical characteristics of MLF granules support the description of MLF as a complex granule with characteristics of both melanosomes and LF. The most compelling characteristic of MLF is the protein complement identified in the granules. Of the 110 proteins identified as components of MLF, 23 were previously identified in mature RPE melanosomes , 18 wereOf interest is the presence of RPE65, which we previously identified in LF granules where it appeared to be far less abundant than we observe in MLF granules. RPE65 was previously identified in 3 of 15 gel slices from a 1D lane of LF proteins and in 12 of 24 gel slices from a 1D lane of MLF proteins. RPE65 plays a key role in the isomerization of retinol as part of the visual cycle in the RPE and is therefore crucial to proper visual acuity. In contrast to RPE65, rhodopsin-which is abundant in LF is practically absent from MLF.Of significant interest is the finding that MLF, in contrast to LF, does not contain photoreceptor-specific proteins, suggesting that MLF does not originate from the phagocytosis of photoreceptor outer segments as does LF, or by the fusion of melanosomes and lipofuscin. Instead, the presence of RPE- and melanosome-specific proteins would suggest that MLF accumulates as a result of the melanosomal autophagocytosis of RPE cells. Our results appear to support neither of the two previously proposed hypotheses for the origin of MLF, because both hypotheses suggest the fusion of LF granules with additional material to form MLF. Our results instead suggest a new hypothesis for the origin of MLF which excludes the involvement of previously existing LF granules. This new hypothesis for the formation of MLF granules is supported by recent evidence that melanosomes function as specialized lysosomes. Evidence for this specialized function includes the related biogenesis of melanosomes and lysosomes ,33, the The proteins in MLF granules were shown to be extensively modified by oxidative damage. The degree of oxidative damage is comparable to that found on LF proteins. The prevalence of oxidative damage on these proteins may render them undegradable by the cell and therefore lead to their accumulation in MLF granules.Collectively these data provide significant insight into understanding the formation and toxicity of retinal MLF and suggest a new theory for its formation as well as support a possible contribution to the etiology of retinal diseases. Our findings suggest that MLF might result from the accumulation of undegradable material perhaps undegradable due to oxidative damage in the autophagocytic melanosomes of RPE cells. Furthermore, MLF granules might pose serious risk of photosensitization of these cells allowing blue light to produce cell death by liberation of reactive oxygen species, perhaps contributing to AMD."}
+{"text": "Tumour growth depends on neovascularisation and tumour cell proliferation. Factor VIII-related antigen (F-VIII RA) localises to vascular endothelium. Expression of proliferating cell nuclear antigen (PCNA) is correlated with cell proliferation. We investigated the correlation between the expression of these antigens and prognosis in gastric carcinoma. A total of 108 specimens resected from patients with gastric carcinoma were investigated by staining with monoclonal antibodies against F-VIII RA and PCNA. Microvessel count  and PCNA labelling index  were determined. The results showed that prognosis was significantly worse in patients who had a tumour with a high MVC (16 or greater) or a high PCNA LI (42% or greater) than in those patients who had a tumour with a low MVC (less than 16) or a low PCNA LI (less than 42%). Furthermore, MVC was significantly associated with the risk of hepatic recurrence. In conclusion, both MVC and PCNA LI may be good prognostic indicators in patients with gastric carcinoma."}
+{"text": "The implantability and durability have been for decades the focus of artificial heart R&D. A mini axial and a maglev radial pump have been developed to meet with such requirements.The mini axial pump weighing 27g (incl.5g rotor) has an outer diameter of 21mm and a length of 10mm in its largest point, but can produce a maximal blood flow of 6l/min with 50mmHg pressure increase. Therefore, it is suitable for the patients of 40-60kg body weight. For other patients of 60-80kg or 80-100kg body weight, the mini axial pumps of 23mm and 25mm outer diameter had been developed before, these devices were acknowledged to be the world smallest LVADs by Guinness World Record Center in 2004.The permanent maglev radial pump weighing 150g is a shaft-less centrifugal pump with permanent magnetic bearings developed by the author. It needs no second coil for suspension of the rotor except the motor coil, different from all other maglev pumps developed in USA, Japan, European, etc. Thus no detecting and controlling systems as well as no additional power supply for maglev are necessary. The pump can produce a blood flow up to as large as 10l/min against 100mmHg pressure.An implantable and durable blood pump will be a viable alternative to natural donor heart for transplantation. Thereafter, many rotary pumps were developed worldwide and a Jarvik 2000 axial pump has worked in a patient for about 7 years [The R&D of artificial heart has just 50-year history. In the first 25 years from first animal experiment in 1957 to the first human trial in 1982, the work was done to show the feasibility of a man-made mechanical pump, mainly the diaphragm pump, in supporting or replacing the heart function partly or totally. The negative results of the first clinical trial, such as thrombosis in the pump, low quality of patient life because of the bulky driver of the heart pump, forced the people to search the new pumping principle instead of imitating the natural heart. In the second 25 years until now, most attention was attracted to simple and small rotary pumps. The author published the world-first implantable rotary pump in 1983[The miniaturization of the heart pump has continuously achieved progress in the author\u2019s laboratory recently. A mini axial pump with 21mm OD and 27g weight has been developed and acknowledged as the world-smallest left ventricular assist device (LVAD) by Guinness World Records Center.The durability has been another key point in improving the heart pump meanwhile. The bearing wear and the heat generation along the bearing, which was recognized to be one of the most possible sites of thrombosis, had limited the rotary heart pump to short-term and/or rescue applications. For eliminating the mechanical contact and wear between the rotor and the stator, other investigators in USA, European, Japan and etc, developed electromagnetic bearings, resulting in need of extra coil and rotor position detection system, feed-back control and additional energy consumption -7. The aThis paper presents briefly the principle and structure of a mini axial and a maglev radial pump developed by the author in the recent years and calls for cooperation in further R&D of these devices.2). It consists of a stator and a rotor. The stator has a motor coil with iron core and the rotor is composed of a rotor magnets assemble and an impeller. The device weighing 27 gram (incl. rotor 5g) has an outer diameter of 21 mm and a length of 10mm in its largest point, and can be then placed in aortic valve annulus of a patient or an animal with 40-60kg body weight. Thus the pump can deliver the blood directly from the ventricle to aorta without need of inlet and outlet connecting tubs that are thought to be the most favorite sites of thrombus formation. The bench testing with saline demonstrated the pump produced 6 liter per minute flow against 50mmHg pressure increase at its rotating speed of 17,500 rpm. The flow rate and the pressure increase can be adjusted by changing the rotating speed of the pump, via increasing or decreasing the input voltage.The mini axial pump is shown in Fig.  indicated the device can sewed onto the aortic valve annulus without any harm to adjacent cell, tissue or/and organ function.For other patients of 60-80kg or 80-100kg body weight, the mini axial pumps of 23mm and 25mm outer diameter had been developed before.3).To simplify the electrically maglev rotary pumps, a shaft-less full-permanent maglev impeller pump without actively controlled coil for rotor suspension has been developed in author\u2019s Institute , an impeller (in the middle) and a magnet disc for suspension (in the right). The attractive force between the motor coil iron core and the rotor magnet disc for rotation is balanced by the attractive force between the magnet disk for suspension and the balancing iron ring. Furthermore, two novel patented permanent magnetic bearings are devised on both sides of the rotor, eliminating the remaining attractive forces and preventing the rotor being affiliated axially to the stator either in the left or in the right. Each bearing is composed of a small and a big permanent magnetic ring, the small ring is inlaid into the rotor and the big ring is buried in the stator. Two rings magnetized in the same axial direction reject each other, providing an axial bearing force. The attractive force between the rotor and the stator resists the radial eccentric movement of the rotor and thus serves as a radial bearing. The inlet and outlet of the pump are located respectively in the center of the balancing iron ring and onto the periphery of the PU housing. By the bench testing with water the pump produces a flow as large as 10 l/min with 100mmHg pressure head. The pump weighing 150 g has a maximal diameter of 42 mm and a length of 35 mm (excluding inlet and outlet tubes).It is concluded that a maglev pump without electromagnet may be possible and is therefore worthy for further more extensive investigation."}
+{"text": "Saccharomyces             cerevisiae (ASCA) are frequently found in CD. Immune-mediate phenomena             include a variety of abnormalities of humoral and cell-mediated immunity, and             a generalized enhanced reactivity against intestinal bacterial antigens in both CD             and UC. It is currently believed that loss of tolerance against the indigenous enteric              flora is the central event in IBD pathogenesis. Various complementary factors               probably contribute to the loss of tolerance to commensal bacteria in IBD. They               include defects in regulatory T-cell function, excessive stimulation of mucosal               dendritic cells, infections or variants of proteins critically involved in bacterial               antigen recognition, such as the products of CD-associated               NOD2/CARD15 mutations.The pathogenesis of Crohn's disease (CD) and ulcerative colitis (UC), the two            main forms of inflammatory bowel disease (IBD), is still unclear, but both            autoimmune and immune-mediated phenomena are involved. Autoimmune            phenomena include the presence of serum and mucosal autoantibodies against            intestinal epithelial cells in either form of IBD, and against human tropomyosin             fraction five selectively in UC. In addition, perinuclear antineutrophil cytoplasmic             antibodies (pANCA) are common in UC, whereas antibodies against"}
+{"text": "Cerebral radionecrosis is a delayed and rarely observed complication of radiotherapy. Cerebral radionecrosis may occur as cystic encephalomalasic formations which cover the intracranial region. These cysts may, in rare cases, become quite large. They may cause drug-resistant seizures, neurological deficits and consciousness disorders.A 55-year-old, Turkish female patient was admitted to hospital with seizure, consciousness disorder and weakness in the right side of her body. The patient had history of an operation in the left maxillary area due to basal cell carcinoma 7 years previously and then history of radiotherapy due to relapse 2 years later the operation. The patient had large cystic encephalomalasic lesions. Despite steroid and dual antiepileptic treatments, the patient's complaints had significantly worsened and seizures continued. Surgical treatment resulted in a significant improvement.This report underlines the significance of surgery in cerebral radionecrosis treatment in well-selected cases using appropriate approaches. Post radiotherapy cerebral radionecrosis development is a rare complication which occurs months or even years after treatment. This complication was associated with dose and fractions -3. VarioThe 55-year-old, Turkish female patient experienced generalized tonic clonic seizures which started 2 years previously and had become persistent during the last 3 months, despite antiepileptic treatment. In addition, the patient had complained of speech defects, forgetfulness, perception deficit for 2 months, cognitive disorders and a weakness in the right side of the body for the 2 days prior to admission. The patient had history of an operation in her left maxillary area due to basal cell carcinoma 7 years previously and then history of radiotherapy due to relapse 2 years later the operation. She had treated with a total dose of 56 Gy radiation, administered in 15 fractions to her left maxillary region, and she had no chemotherapy history.During neurological examination it was found that the patient experienced confusion and disorientation. However bilateral papilledema was detected on neurological examination. In addition, the patient had right hemiparesis. Her muscle strength grade was 3 (active movement against gravity) in the right side of her body. A cranial CT scan showed hypodense lesions in the left frontal lobe (3 \u00d7 4 cm) and in the left temporal lobe (6 \u00d7 4 cm). No significant edema was observed around the lesions, which compressed the left lateral ventricle and did not show contrast enhancement . CranialUnder microscopic examination of the cyst fluid, blood elements, an amorphous substance consisting of fibrinoid and hyaline material, low number of histiocyte and lymphocyte cells were observed. In the examination of material taken from the walls of the cyst and surrounding brain parenchyma, perivascular lymphocyte infiltration and macrophages were observed and hemosiderin loaded macrophages were found. These findings made us think of reactive gliosis. Also there were no evidence of neoplastic cells in the examination of cyst fluid, cyst wall and surrounding brain parenchyma.In the early post-operative period, significant improvements were observed in the patient's consciousness, speech and right hemiparesis. Her muscle strength grade became 4 (active movement against gravity and resistance). The patient, whose follow-up still continues at our clinic, has not been experienced any postoperative seizure or neurologic deterioration. In postoperative follow-ups using images made for control purposes, it was observed that both cystic structures got smaller  and 2b.Previous studies have reported that delayed cerebral radionecrosis has been observed after radiotherapy for various malignities such as nasopharyngeal cancers, brain tumors, maxillary carcinomas, ear carcinoma and following stereotactic treatment of tumors or vascular malformations -9.The actual incidence of radiation necrosis in the brain is uncertain, but is approximately 5% ,2. RadiaAcute RE, which develops a few days after radiation at the end of the radiotherapy; 2. Sub-acute RE, which occurs a few weeks to 6 months after the therapy; 3. Delayed RE, which takes place 6 months to possibly years after the therapy. Delayed RE is generally irreversible and sometimes even fatal. Temporal lobe damage is the most common and most serious condition in radiation encephalopathies. This constitutes 65% of the deaths caused by this medical status [According to their occurrence times, radiation encephalopathies are analyzed under 3 groups: 1. In recent studies radiation necrosis was demonstrated to vary depending on the total radiation dose, frequency, dose per fractions, duration of administration and the size of the exposed area ,10. A toThe pathophysiology of cerebral radionecrosis is not well known. However, 3 main mechanisms were underlined. These are: 1.The occurrence of vascular lesions may be responsible for local thrombosis and cerebral ischemia 2. Radiation can have a direct toxic effect on glial cells; 3. An autoimmune reaction can occur which can cause damage in glial cells [et al. [The symptoms and findings in our patient bear similarities to the principal symptoms and findings in previously reported cases. According to the literature, the possible symptoms and findings in cerebral radionecrosis patients are headache, seizure, vomiting, difficulty in maintaining concentration, loss of consciousness, dysphasia, walking disorders, confusion and hemiparesis ,2,6-8. ISince cerebral radionecrosis does not have many specific findings its diagnosis with imaging technologies presents some difficulties. It is difficult to distinguish it from a primary brain tumor, intracerebral relapse of a cutaneous tumor or from a cerebral tumor induced by radiation. MR spectroscopy and PET are advanced diagnosis methods recommended for the distinction of radionecrosis and tumor recurrences -3,5-7. HIn the reported cases, the histological analysis of the cyst wall include focal necrosis  and astroglial proliferation without observing any tumor cells ,7. Also et al. [et al. [With Gammaknife surgery, radiation passes through the head along as many as 201 different trajectories, and, therefore, even distant areas of the brain are exposed to low doses of radiation. Because of the low doses of the radiation, in the relatively remote areas from the treatment area can\u2019t be associated with delayed radionecrosis, but this can be associated with secondary tumor formation for the interval of 20 to 25 years . Whereaset al.  reported [et al.  noted th [et al.  reportedSince it was known that free oxygen radicals have a role both in edema and necrosis development, the benefits of using antioxidants such as melatonin and vitamin E for protection purposes were indicated, especially in animal experiments . Howeveret al. [Wang et al.  reportedet al.  applied Patients treated with radiotherapy or radiosurgery, are at the risk for delayed cyst formation. Because of this, follow-up examinations and imagings are necessary years after the procedure. Patients with incidentally discovered micro cysts were followed up with serial imaging, whereas patients with symptoms related to mass effects from the significantly enlarged cysts underwent surgery intended to decompress the cyst. Cyst aspiration was performed initially, as the simplest operation possible for cyst treatment. In case of a relapse placement of Ommaya reservoir or cystoperitoneal shunt may provide permanent diversion of the cyst fluid. Also, if the structure and the location of the cyst is convenient, cyst excision may be preferred.In epilepsy patients, quality of life decreases and mortality rate increases when compared to the general population. A positive correlation was indicated between the number of seizures and mortality. For this reason, the purpose of epilepsy treatment should be to provide the patient with a life without seizures . It is kIn conclusion, cerebral radionecrosis is a rare complication of radiotherapy which occurs months or even years after treatment. The isolated use of corticosteroids can affect a clinical cure in some cases. However, in cystic radionecrosis cases, surgical approaches such as cyst excision or aspiration should also be considered. Particularly in patients like ours, who experienced drug-resistant seizures, deterioration in consciousness, and deterioration in hemiparesis, if the structure and the location of the lesion is convenient, we suggest surgical intervention without delay."}
+{"text": "Exposure to particulate matter (PM) has been linked to several adverse cardiopulmonary effects, probably via biological mechanisms involving inflammation. The pro-inflammatory potential of PM depends on the particles\u2019 physical and chemical characteristics, which again depend on the emitting source. Wood combustion is a major source of ambient air pollution in Northern countries during the winter season. The overall aim of this study was therefore to investigate cellular responses to wood smoke particles (WSPs) collected from different phases of the combustion cycle, and from combustion at different temperatures.WSPs from different phases of the combustion cycle induced very similar effects on pro-inflammatory mediator release, cytotoxicity and cell number, whereas WSPs from medium-temperature combustion were more cytotoxic than WSPs from high-temperature incomplete combustion. Furthermore, comparisons of effects induced by native WSPs with the corresponding organic extracts and washed particles revealed that the organic fraction was the most important determinant for the WSP-induced effects. However, the responses induced by the organic fraction could generally not be linked to the content of the measured polycyclic aromatic hydrocarbons (PAHs), suggesting that also other organic compounds were involved.The toxicity of WSPs seems to a large extent to be determined by stove type and combustion conditions, rather than the phase of the combustion cycle. Notably, this toxicity seems to strongly depend on the organic fraction, and it is probably associated with organic components other than the commonly measured unsubstituted PAHs. Exposure to particulate matter (PM) in ambient air has been associated with effects on the pulmonary as well as the cardiovascular system. These effects include exacerbation of asthma and allergy, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, increased risk of lung cancer, atherosclerosis and acute cardiac effects -4. The bDuring the winter season, wood combustion is a major source of particulate air pollution in many developed countries, and the adverse health effects associated with exposure to wood smoke do not seem to be weaker than for ambient particles from other sources ,7. An asin vitro studies indicate that particles from different combustion conditions may induce differential pro-inflammatory response patterns [The potential of PM to induce biological effects seems to depend strongly on its physical and chemical properties such as size, structure and surface area, as well as components absorbed on the particle surface including metals, organic compounds, allergens and endotoxins ,14. The patterns ,21. In apatterns ,22.In the alveoli of a healthy lung, resident macrophages and epithelial cells lining the pulmonary surface are primary cellular targets for deposited particles. Monocytes, the precursors for alveolar macrophages, accumulate in the lung during inflammation, and have also been suggested to assist in clearance of deposited particles and to be essential in coordination of the inflammatory response -26. InflThe aim of the present study was to compare the inflammatory and toxic effects of wood smoke particles (WSPs) from different phases of the combustion cycle, as well as WSPs from two different combustion temperatures. A co-culture of pulmonary epithelial cells and monocytes was used as a model system. The particle samples were analysed with respect to the content of polycyclic aromatic hydrocarbons (PAHs) and selected elements. In addition, near edge x-ray absorption fine structure (NEXAFS) spectroscopy was performed for two WSPs from different combustion temperatures to determine the major groups of organic compounds present in the organic fraction. Finally, the role of the organic fraction in the observed cellular effects was investigated by comparing the responses induced by organic extracts and washed particles to the effects of the corresponding native particles. In order to relate the inflammatory and toxic potential of the WSPs to that of particles from another relevant ambient combustion source, a traffic-derived sample was also included in the study.0.1\u20132.5 and PM2.5\u201310[WSPs from different phases of the combustion cycle were collected in an exposure chamber  during combustion of a mixture of hardwood and softwood  in a small cast-iron wood stove. Wood smoke was generated during three different days (10 hours/day) with wood smoke entering the chamber from the whole burning cycle on the first day (mixed wood smoke), from the start-up phase on the second day and the burn-out phase on the third day. A high-volume cascade impactor was used for collection of WSPs for the toxicological tests in two size fractions, PM PM2.5\u201310. The rat PM2.5\u201310,36. The 2.5), in [Two samples were included as reference particles; Wood(high-temp) and Traffic. The Wood(high-temp) sample was collected in a laboratory from a conventional stove with single-stage combustion during high-temperature incomplete combustion (approximately 700\u20131000\u00b0C) of birch wood with moisture content 15-20% . In comp2.5), in ). The sa2.5), in ,38. The 2.5), in . The mot0.1\u20132.5 particle samples collected in the exposure chamber were analysed for the content of a selection of PAHs and elements  and the reference wood smoke sample Wood(high-temp). NEXAFS spectra from the C(1s) absorption threshold typically exhibit multiple peaks indicating the presence of various carbon functional groups [To determine the molecular structure of the organic fraction of the WSPs, near-edge x-ray absorption fine structure (NEXAFS) spectra were recorded for one wood smoke sample from the exposure chamber , samples which were included as reference sampels in the present study. Since 10 and 20 \u03bcg/cm2 did not increase the cytokine release significantly for both particle samples, 40 \u03bcg/cm2 was chosen for the present study. Exposure times of 12 or 40 hours were used as specified in the figure legends.A co-culture of two human cell lines, A549 pneumocytes and THP-1 monocytes, was used for the toxicological experiments. The model system allowed for contact between the two cell types, and after 1 hour incubation visual inspection by microscopy revealed that the majority of the THP-1 cells rested on the A549 cells. This co-culture has previously been described in Kocbach et al. 2008 . In shorus study , the samParticle suspensions of 1 mg/ml were prepared in cell culture medium without FBS, but supplemented with 2% dimethyl sulfoxide (DMSO), and sonicated for 30 min in a water bath. Methanol was used to aliquot the particle samples, and the subsequent evaporation of the methanol caused adherence of the particles to the tube walls. Therefore, when preparing particle stock solutions, DMSO was added to the particles before the culture medium to increase dispersion of particles into suspension. All samples were vortexed for 30 sec immediately before cell exposure. Organic extracts and washed particles were prepared by methanol extraction. A two step extraction procedure was applied where the two fractions were separated by centrifugation as described in . The wasThe collected cell culture supernatants were analysed by enzyme-linked immunosorbent assay (ELISA) kits  to determine the levels of the pro-inflammatory cytokines TNF-\u03b1 and IL-6 as well as the chemokine IL-8. All ELISA kits were used according to the manufacturer\u2019s manual and the detection limits for all kits were in the range 7 to 10 pg/ml. The increase in colour intensity was quantified using a plate reader .Cytotoxicity was estimated by measuring the release of lactate dehydrogenase (LDH) from the cytosol of damaged cells into the cell culture medium, using a colorimetric cytotoxicity kit . The kit was supplemented with a standard with maximum concentration of 250 mU/ml (Roche). The maximal releasable LDH was determined in a suspension of unexposed cells (controls) lysed with 1% Triton x-100 and diluted with cell culture medium to the total volume applied in the well . The max levels are indicated as dotted lines in the graphs showing the detected LDH levels.6 cells/ml.As an additional indicator of cytotoxicity, particle-induced changes in the number of viable cells were detected by trypan blue exclusion. Non-adherent monocytes were removed with the supernatant and collected, while the adherent pneumocytes were removed by trypsination. Monocytes and pneumocytes were then mixed and stained with trypan blue for 3 minutes. The numbers of living cells were counted in a B\u00fcrker chamber, and the cell numbers for unexposed and exposed cells are presented as 10Cell cycle analysis was performed by Hoechst 33258 staining and flow cytometry in combination with curve fitting to obtain a measure of the approximate proportion of cells in each phase of the cell cycle. The cells were not synchronised prior to exposure. The WSPs and extracts introduced an artefact to the analysis. The full methodological description, the method used to account for this artefact and the results obtained from the analysis are included in Additional file The binding of IL-6 and IL-8 to a selection of the applied particle samples was investigated using a cell free test described in Kocbach et al. 2007 . No signhttp://www.graphpad.com). One- or two-way analysis of variance (ANOVA) was used to analyse the data sets, as specified in the figure legends, and post-tests with Bonferroni correction were used to compare groups. As indicated in the figure legends, some data were log transformed before performing ANOVA to fulfil the assumption of equal standard deviations of all sets of replicates, whereas repeated measures ANOVA was applied in some cases to account for variations in response levels between experiments [p values\u2009<\u20090.05 were considered to reflect statistically significant differences.Statistical analysis was performed with GraphPad Prism  had a lower content of refractory elements, suggesting a lower ash-content than in the samples from the \u2019mixed smoke\u2019 and \u2019burn-out\u2019 sessions. However, these differences must be considered as minor, when comparing these samples with the reference samples, Wood(high-temp) and Traffic. Compared to the mixed WSPs, Wood(high-temp) contained more than five times as much PAHs, while the level of refractory elements was 3300 times higher fluoranthene was the dominating species in the WSPs from the different phases of the medium temperature combustion, whereas the reference samples Traffic and Wood(high-temp) contained highest relative levels of Fluoranthene and Pyrene. The PAH profiles of all five samples showed similar relative levels of Benzo(a)pyrene, Benzo(e)pyrene, Benzo(a)antrachene, Chrysene, Perylene, Benzo(a)fluorene and Benzo(e)fluorene. The absolute levels of the individual PAHs in ng/mg are presented in Additional file The PAH profiles provide the relative content of the individual PAHs compared to the total PAH content in each sample, and are presented in Additional file The elemental profiles representing the content of single elements relative to the total elemental content, are presented in Additional file Overall, the differences between the three phases of the wood combustion cycle were relatively small, both with respect to the sum of the measured PAHs and refractory elements, as well as the PAH and elemental profiles. There were however more evident differences between these samples and the reference samples.0.1\u20132.5) are included in Additional file 0.1\u20132.5) seemed to contain more quinones, methoxyphenols and lignin decomposition products such as levoglucosan. In addition, the spectrum from Wood(high-temp) showed a potassium peak at 298 eV, whereas the Wood spectrum did not. This pointed towards a higher ash content in the sample from the higher combustion temperature.The NEXAFS spectra from Wood(high-temp) and Wood that also increased the TNF-\u03b1 release significantly. Generally, organic extracts appeared to be more potent than the corresponding washed particles, although statistically significant differences between washed particles and organic extracts were only detected for a few samples for TNF-\u03b1 and IL-6 , but not Traffic, increased the number of cells in the S/G2 phase, suggesting an accumulation in the S/G2 phases. This is in accordance with the significant reduction in cell numbers induced by the WSPs, but not by Traffic.Cell cycle analysis was performed by flow cytometry and curve fitting to investigate if the observed reduction in cell numbers was due to a cell cycle arrest that in turn caused a decreased proliferation. Due to particle- and extract-induced artefacts in the flow cytometry analysis, only samples of THP-1 monocytes from co-cultures exposed to organic extracts were analysed . With some exceptions, the R2 values below 0.1, with the exception of the release of IL-6 which gave a R2 value of 0.39. The slope of the corresponding linear regression line was however too low to have biological relevance. Linear regression analysis for three of the most abundant PAHs, Benzo(b)fluoranthene, Pyrene and Benzo(ghi)perylene, also gave highest R2 values for IL-6. Moreover, analysis of Benzo(b)fluoranthene vs, IL-8 release and cell number resulted in R2 values of approximately 0.25. For these single PAHs the slopes significantly different from zero could have biological relevance. For instance, IL-6 vs. Benzo(b)fluoranthene resulted in a negative slope of 70 pg/ml for 100 ng/mg PM. As a reference, the Benzo(b)fluoranthene levels varied from 5 to 810 ng/mg in the included particles samples, and the general IL-6 levels from 250 to 1250 pg/ml.The linear regression analysis of the sum of the 18 measured PAHs versus the various biological endpoints generally resulted in RIn order to develop more targeted abatement strategies it is important to investigate whether particle-induced health effects can be attributed to specific sources or to compounds present in the complex PM mixture. The aim of this study was to compare cellular responses to WSPs from different phases of the combustion cycle and from different combustion conditions. In addition, the effects induced by the WSPs were compared to those induced by a reference sample from traffic. WSPs from different combustion phases did not differ in their potency to induce cytokine release, cell death or reductions in cell numbers. However, particles collected during medium-temperature combustion were more toxic than the reference particles collected from traffic or during a higher wood-combustion temperature. WSPs collected during medium-temperature combustion were also more potent inducers of IL-6 than WSPs collected during high-temperature incomplete combustion.Since the chemical composition of WSPs is known to depend on the combustion process and temperature ,19,49, wThe differences in chemical composition between the high-and medium-temperature wood smoke samples reflect differences in combustion conditions. The 3300 times higher level of refractory elements in the high-temperature compared to the medium-temperature wood smoke sample is in agreement with the potassium K-shell absorption edge observed only in the Wood(high-temp) NEXAFS spectrum. This difference is also in accordance with the higher levels of refractory elements reported for increasing combustion temperatures in the literature ,50,51. SPresently, particles from incomplete combustion with medium-temperature were more potent inducers of cytotoxicity and IL-6 release than particles originating from incomplete combustion with higher temperature. In line with this, particles from poor combustion conditions have been reported to be more toxic in macrophage and fibroblast cell lines than particles from more complete combustion conditions ,22,60. Win vitro toxicity data to the respective emission factors (mg PM1/MJ fuel energy) [Although the present as well as previous findings suggest that both the cytotoxic and inflammatory effects of WSPs increase with decreasing combustion temperatures, it is necessary to perform more extensive toxicological studies to verify this hypothesis. Preferentially, the effects of well-characterised particles from a wider range of combustion conditions should be investigated simultaneously in the same biological model system. A recent study compared emissions from two different combustion conditions and related their  energy) . The par energy) . MoreoveComparison of the effects induced by native WSPs and the corresponding organic extracts and washed particles, indicated that the organic fraction was of major importance for the biological effects induced by WSPs from the different combustion phases. The washed particles did however also increase the release of IL-6 and IL-8 significantly. This could be due to an incomplete removal of the organic compounds, effects induced by the insoluble carbon core, or possibly by adsorbed metals. The organic extracts of the reference samples Traffic and Wood(high-temp) were investigated in the same series of experiments, but the data were published previously . In line2 values were relatively low in the regression analysis, and it is necessary to do further experiments to investigate the role of these single PAHs in wood smoke induced effects. Generally, the present data and data from the literature [in vitro toxicity and inflammatory potential of the particles increases with decreasing combustion temperatures, and none of these studies show a positive correlation between biological effects and PAH content. Thus, other organic compounds than PAHs seem to also be involved in the wood smoke-induced effects. Future studies of the toxicological effects of wood smoke should therefore include analysis of other organic compounds than the traditionally analysed unsubstituted PAHs like EPA PAH16.Although the organic fraction was found to influence the release of inflammatory mediators, toxicity and cell numbers, the total PAH content was not associated with any of the biological effects in the linear regression analysis. This may point towards a limited importance of the PAHs in the inflammatory and toxic effects. Cellular studies of individual PAHs report effects on cytokine release, cytotoxicity and DNA damage -66. Thisterature -22 show To further characterise the organic fraction of the WSPs applied in the present study, two samples were analysed by NEXAFS. The results suggested a higher content of quinone-like compounds in the medium-temperature than the high-temperature wood smoke sample. Since the medium-temperature particles also induced the highest effects on release of IL-6 and toxicity, the content of quinone-like compounds appears to co-vary with the inflammatory and toxic effects. Interestingly, a study that applied fractionation of organic extracts of WSPs into different polarity extracts suggested that oxy-PAHs and quinones contributed to cellular oxidative stress to a larger extent that the unsubstituted PAHs . MoreoveThe reference WSPs from high-temperature incomplete combustion have previously been associated with reduced proliferation in this co-culture . Actuall0.1\u20132.5 and PM2.5\u201310 fractions induced very similar biological effects, and few statistically significant differences were detected. This is in contrast to in vitro studies of other particle samples in which the PM2.5\u201310 fractions seem to be more potent than the PM2.5 fractions in inducing a pro-inflammatory response [0.1\u20132.5 fraction accounted for 79\u201386% of the total PM10 emissions (data not shown), which is in agreement with the PM1 to PM10 ratio of 0.8 reported for the PM mass emissions from both smouldering and flaming combustion conditions [2.5 fraction both with respect to number and mass concentrations [2.5 fraction rather than the PM2.5\u201310 fraction appears to be feasible in future toxicological studies.Presently, the PMresponse ,36. Possresponse ,79. A ponditions . Since etrations , charactin vitro effects of particles collected from wood smoke and traffic and concluded that traffic-derived particles were more potent in inducing inflammatory responses, while WSPs were more potent in reducing cellular proliferation [in vitro, but that WSPs seem more cytotoxic and more potent in reducing proliferation than traffic derived particles. However, the pulmonary effects depend on the deposited dose, and WSPs from poor combustion conditions were recently found to deposit to a lower extent in the lungs than diesel exhaust particles, providing different pulmonary doses [We have previously compared feration . In the ry doses . To compry doses ,11,81,82ry doses . It shou2 is likely to be higher than the average deposition on the lung surface during normal ambient concentrations. Particle deposition in the human airway is highly uneven, but the retention for fine particles has been suggested to be highest in the proximal alveolar region [in vitro studies, including altered cellular characteristics of cell lines and limited communication with other cells compared to cells in tissue.The applied particle concentration of 40 \u03bcg/cmr region ,84,85. Tr region . The appWSPs from three different phases of the combustion cycle induced very similar effects on release of pro-inflammatory mediators, cytotoxicity and decrease in cell number in a co-culture of monocytes and lung epithelial cells. The particles from medium-temperature combustion were, however, more cytotoxic than the particles from high-temperature incomplete combustion and also induced a higher release of IL-6. Thus, stove type and combustion conditions may be more important than phase of combustion cycle with respect to the toxicity of the emitted particles.The organic fraction was the most important determinant for the biological effects induced by the different wood combustion particles, but the responses induced by the organic fraction could generally not be linked to the PAH content. This suggests that other organic compounds were also involved in the biological effects, with quinone-like compounds as a possible candidate. Based on the present results and the literature we therefore recommend that future toxicological studies include analysis of other groups of organic compounds, in addition to the traditionally analysed PAHs.Although the present study suggests that particles from medium-temperature combustion have a higher toxic and inflammatory potential than particles from more complete combustion conditions, a differential deposition of PM from varying combustion conditions might influence the deposited dose. In order to properly evaluate the relative toxicity of WSPs from varying combustion conditions it is therefore of major importance to perform inhalation studies.The authors declare that they have no competing interests.in vitro experiments and the analysis of biological effects. HJD performed the flow cytometry analysis. AKB interpreted the cell cycle data, performed the statistical analyses, and prepared the figures. AKB, JIH and AT had the main responsibility for preparation of the manuscript, but all authors were involved in drafting the manuscript or revising it critically. All authors read and approved the final manuscript.AKB coordinated the study. GS was responsible for generation and collection of WSPs, and MS participated in the particle collection. TS and FC coordinated the extraction and aliquotation of particles. JB performed the EDXRF analysis, while RW and CB were responsible for the PAH analysis. AB carried out the NEXAFS analysis and interpretation. AKB and JIH designed and performed the Generation of wood smoke in exposure chamber.Click here for fileChemical characterisation of particle samples.Click here for fileNEXAFS.Click here for fileCell cycle analysis.Click here for fileCytokine binding to particles.Click here for fileStatistical comparison of cytokine release induced by the various particle samples.Click here for file"}
+{"text": "Archaeopteryx lithographica (HMN1880) were overlaid by long covert feathers, and that a multilayered feathered wing was a feature of early fossils with feathered forelimbs. The proposed long covert feathers of Archaeopteryx were previously interpreted as dorsally displaced remiges or a second set of impressions made by the wing. The following study shows that the qualitative arguments forwarded in support of the elongated covert hypothesis are neither robust nor supported quantitatively. The idea that the extant bird wing with its single layer of overlapping primaries evolved from an earlier multilayered heavily coveted feathered forelimb as seen in Anchiornis huxleyi is reasonable. At this juncture, however, it is premature to conclude unequivocally that the wing of Archaeopteryx consisted of primary feathers overlaid with elongated coverts.Recently it was proposed that the primary feathers of  There are broadly two competing hypotheses  for the evolution of flight in birds et al. Anchiorniset al. Archaeopteryx lithographica were overlaid by long covert feathers. These proposed coverts were previously interpreted as dorsally displaced remiges Archaeopteryx. For example, multiple layers of feathers would add strength to the wing surface and would mean that slots between the primary feathers could not be produced Archaeopteryx, which are thin relative to body mass in comparison with extant birds Archaeopteryx being coverts and not primary feathers A recent paper by Longrich et al. The angles of the feather rachises were calculated relative to the vertical in figures 1D and 2D of Longrich t\u200a=\u200a0.295, p\u200a=\u200a0.776) between the angles of the primary feathers (16.54\u00b10.69\u00b0) and proposed coverts (17.01\u00b11.42\u00b0) on the left wing of Archaeopteryx. Neither is there a difference  between the angles of the primary feathers (57.09\u00b10.62\u00b0) and proposed coverts (56.72\u00b10.64\u00b0) on the right wing , the primitive arrangement in Archaeopteryx was for the primaries to lay completely above or below, successively, the adjacent feathers when the wing was partially or completely folded. The anatomy of the Archaeopteryx manus and wrist, where the primary feathers attach, is certainly very different to that seen in extant birds The third argument put forward is that interpreting the obscured feathers as primaries requires that every other primary has been displaced post-mortem on both the left and right wings, without disturbance of the other primaries or ventral coverts and no taphonomic mechanism is known that could produce such a pattern et al. Archaeopteryx functioned bauplan of a single, albeit overlapping, layer of primary feathers evolved from an earlier multilayered heavily coveted feathered forelimb as seen in AnchiornisArchaeopteryx were overlaid by elongated coverts.Therefore, contrary to the assertion of Longrich"}
+{"text": "In recent years, yeast was confirmed as a useful eukaryotic model system to decipher the complex mechanisms and networks occurring in higher eukaryotes, particularly in mammalian cells, in physiological as well in pathological conditions. This article focuses attention on the contribution of yeast in the study of a very complex scenario, because of the number and interconnection of pathways, represented by cell death. Yeast, although it is a unicellular organism, possesses the basal machinery of different kinds of cell death occurring in higher eukaryotes, i.e., apoptosis, regulated necrosis and autophagy. Here we report the current knowledge concerning the yeast orthologs of main mammalian cell death regulators and executors, the role of organelles and compartments, and the cellular phenotypes observed in the different forms of cell death in response to external and internal triggers. Thanks to the ease of genetic manipulation of this microorganism, yeast strains expressing human genes that promote or counteract cell death, onset of tumors and neurodegenerative diseases have been constructed. The effects on yeast cells of some of these genes are also presented. Regulated cell death (RCD) can be executed through distinct subroutines, sometime partially overlapping, leading to apoptosis, autophagy and programmed necrosis , and sucIn mammals, RCD can be observed during aging or in consequence of pathologies including neurodegenerative disorders, hypoxia and heart strokes. In the opposite direction, loss of RCD can result in the onset of cancer.Due to its simple handling, yeast represents a very useful eukaryotic model system for deciphering the complex network of the different and often interwoven RCD pathways occurring in mammals, aiming, in particular, to the identification of executors, to the role of cellular organelles and compartments, and to the detection of new cell phenotypes in response to external and internal triggers.CDC48 gene (cdc48S565G), which codes for the AAA-ATPase and has roles in cell division, ubiquitin-dependent ER-associated protein degradation (ERAD) and vesicle trafficking [CDC48, gave rise to apoptotic phenotypes in mammalian cell cultures [trypanosomes [Drosophila [c release from mitochondria. In nature, this process might favor the elimination from the yeast population of old and/or unhealthy cells, increasing the availability of nutrients for young and healthy cells [Yeast apoptosis was first described in cells carrying a mutated fficking . Later ocultures , 4, in tne cdc48S65G, whicosophila . Like ma2O2, acetic acid and many others [AIF1 (AIF), NUC1 (EndgoG), MCA1/YCA1 (metacaspase), NDI1 (AMID), NMA111 (HtrA2/Omi) and others, have been identified, demonstrating that the basal apoptotic machinery is present in this unicellular organism [In this organism, apoptosis is induced by internal and external triggers including cellular dysfunctions, Hy others , 10. Alt2O2, acetic acid and heavy metals, well-known triggers of apoptosis at low doses, can also induce accidental necrosis at higher concentration because of the excessive damage to cellular components [Necrosis in mammals is a physiological cellular process that becomes more evident in some disorders and after virus and bacterial infection. In contrast to apoptosis, necrotic cells release intracellular contents following the plasma membrane rupture. In yeast cells, Hmponents , 10, 12.Saccharomyces cerevisiae genome but additional studies are still needed to identify the executors and clarify a putative altruistic meaning of necrotic cell death in unicellular yeasts. Liponecrosis has been recently reported as an additional cell death module of RCD in yeast cells exposed to exogenous palmitoleic acid (POA) [ATG32, the gene encoding a mitochondrial outer membrane protein required to initiate mitophagy, results in increased sensitivity to death triggered by POA, pointing to macromitophagy as an opponent of POA-induced cell death. Interestingly, the absence of the serine/threonine kinase Atg1p, which is required for the execution of macroautophagy, while lowering clonogenic survival of yeast cells submitted to apoptosis by H2O2, reduces the lethality induced by POA [Yeast cells also posses a programmed necrotic pathway under conditions similar to those regulating programmed necrosis in mammals . Necrosiid (POA) . Cells uid (POA) . Deletiod by POA . Moreoved by POA .These results altogether reinforce the idea that POA-triggered death is in fact an additional new form of RCD.ATG genes are repressed at transcriptional level in consequence of the inhibition of activators and/or activation of repressors of autophagy [S. cerevisiae following the expression of human p53, BAX and under starvation conditions [Macroautophagy is a conserved process required for the degradation and recycling of cytoplasmic components by delivering molecules and entire organelles to the vacuole or to lysosomes, depending on the eukaryotic cell type. The morphological hallmark of autophagy is the formation of the autophagosome, a vesicle bounded by a double membrane, within which cytoplasmic components remain randomly (non-selective autophagy) or selectively (selective autophagy) sequestered. Selective autophagy ensures the health of cells by removing protein aggregates and carrying the turn-over of mitochondria (mitophagy), peroxisomes (pexophagy), lipids (lipophagy), and ER (ER-phagy), which might represent potential triggers of apoptosis. After fusion with the vacuole, the material is degraded to simpler molecules, which are then released again into the cytoplasm for reuse. Autophagy, as well selective autophagy , occurs utophagy . In seveutophagy . In yeasnditions \u201321.MCA1/YCA1, which codes for a protein showing a caspase activity and plays an important role in regulating apoptosis in yeast [2+ ions and the crystal structure of the protein revealed a canonical caspase-like fold and it can exist as a monomer in both solution and crystals [cdc48S565G mutant [cdc48 conditional mutant negatively interacted with the mca1 null mutant, suggesting that Mca1p can buffer the absence of Cdc48p [2O2 cell exposure, cleaves cohesin Mcd1/Rad21. The truncated C-terminal fragment of Mcd1p translocates from the nucleus to mitochondria, causing the decrease of mitochondrial membrane potential and the release of cytochrome c [wbp1-1\u00a0N-glycosylation mutants, during chronological aging, following tunicamycin and acetic acid treatments [One of the first genes involved in yeast RCD was in yeast . Mca1p hin yeast . The autcrystals . While ccrystals . Concerncrystals . Mca1p hcrystals \u201329. As aG mutant , from a f Cdc48p . It has chrome c . Moreoveeatments .NDI1, which codes for the inner mitochondrial membrane NADH dehydrogenase and catalyzes the oxidation of intramitochondrial NADH, is the human homologue of the AIF-homologous mitochondrion-associated inducer of cell death (AMID). In facts, NDI1 overexpression causes cell death while its deletion lowers ROS production and extends CLS [Apoptosis-inducing factor (AIF1), homologue to mammalian AIF, is a mitochondrially localized protein that, upon apoptotic insults, translocates to the nucleus where it mediates chromatin condensation and DNA degradation . As its ends CLS . Similarends CLS .NUC1, the yeast ortholog of mammalian endonuclease G (EndoG), is another cell death effector that translocates from mitochondria to nucleus upon apoptosis induction [nduction . Nuc1p pNUC1 protects yeast from cell death only in respiratory conditions while, in fermentative conditions, it enhances necrotic cell death [NMA111 causes protection or induction of cell death, respectively [The absence of ll death . EndoG hll death . Nma111pectively .Bir1p, the target of the Nma111p activity, acts as an inhibitor of apoptosis (IAP) in yeast .2O2-induced apoptosis [pep4 mutant strains undergo both apoptosis and necrosis during chronological aging.Pep4p, a pepsin-like aspartic protease ortholog of human Cathepsin (CatD), translocates from the vacuole to the cytosol and is involved in the degradation of nucleoporins following Hpoptosis . Yeast pYNL305c gene has been reported in yeast, later renamed YBH3. Overexpression of Ybh3p sensitizes yeast to apoptotic stimuli, while its absence protects cells against H2O2, acetic acid, murine BAX expression and extends both replicative and chronological lifespan. Ybh3p-mediated cell death is independent of Mca1p, Aif1p, Nma111p and Nuc1p, suggesting that Ybh3p triggers its own mitochondrial cell death pathway [BXI1 (for Bax inhibitor) in this occasion, has been reported to be involved in unfolded protein response (UPR) and to play a protective role in heat shock response, ethanol and glucose induced cell death [The proteolytic activity of Pep4p is required to contrast apoptotic cell death while the non-proteolytic part of this protein is involved in its anti-necrotic function . In addi pathway . The samll death . The oppAlterations of fundamental cellular pathways, such as DNA replication, actin cytoskeleton, mRNA stability and protein modifications and degradation, produce triggers that induce various forms of yeast cell death \u201353.MCA1 gene [Some forms of cell death require the activity of the metacaspase encoded by the CA1 gene . DiffereYeast cells accumulating ROS show morphological markers peculiar for apoptosis in mammals. The phenomenon is caspase dependent in that, in the absence of the metacaspase Mca1p, apoptosis is prevented .ROS in yeast are mainly produced within mitochondria  during aMCA1 prevents apoptotic cell death during CLS while, in contrast, reduces the numbers of cell divisions in RLS [Replicative life span (RLS) and chronological life span (CLS) are two models of aging in yeast cells. RLS refers to the number of divisions of an individual cell before budding arrest while CLS represents the time a culture maintains viability during stationary phase. In both cases, cell death eliminates old and damaged cells and is accompanied by typical markers of apoptosis \u201360. Neves in RLS , 59. Durs in RLS .ORC), constituted by a six-subunit complex of proteins [ORC2 codes for a subunit of the ORC complex and orc2-1 ts mutant cells, at non-permissive temperature, show defects in initiation of DNA replication, activate DNA damage responses, premature aging and undergo apoptosis following the Mca1p-dependent pathway [Initiation of DNA replication is a conserved process that requires the origin recognition complex , apoptotic death was demonstrated to be Mca1p dependent [HIR1, PGK1 and NEM1, the genes encoding a subunit of the HIR complex involved in histone gene transcription, the phosphoglycerate kinase and the catalytic subunit of Nem1p-Spo7p phosphatase holoenzyme that regulates Pah1p (lipin) activity, respectively, [The steady-state level of mRNAs is another fundamental cellular process, which depends on the equilibrium between mRNA synthesis and decay . Mutantsal aging , 65. At ependent , and mosctively, \u201369. Thisski2\u2206 mutants) or deadenylation (ccr4\u2206pan2\u2206 mutants) pointing to mRNA degradation as a relevant pathway involved in yeast cell death [Metacaspase-dependent apoptotic cell death has been recently reported in strains defective in cytoplasmic exosome function  Hos3p, is necessary to allow the phosphorylation of the apoptotic mark H2B-S10 (H2B-S16 in human) by Ste20p kinase, the yeast homolog of mammalian Mst1 kinase , 78. Sinbre1 and ubiquitin protease ubp10 mutants, sensitizes metacaspase-dependent cell death [Histone H2B ubiquitination is required for nucleosome stability and its loss, in the E3 ubiquitin-ligase ll death , 81.H2B ubiquitination is a prerequisite for histone H3K4 and H3K79 methylation and it was recently reported that loss of H3K4 methylation, due to the inactivation of the methyltransferase Set1p, triggers apoptotic cell death partially dependent on Mca1p during chronological aging and on EndoG/Nuc1p after hydrogen peroxide treatment .mca1 mutant, indicated the presence of Asp-ase or another caspase-like activity [In liquid media, yeast population develops in the form of single cells that replicate several times and finally die through the apoptotic process. During growth on solid media, both in nature and in laboratories, cells remain in contact giving rise to colonies that enlarge over time. In this case, apoptotic death occurs in oldest cells, located in the middle of the colony, through a Mca1p or Aif1p-independent pathway in response to an ammonia signal emitted by aged surrounding colonies. Nevertheless, D2R staining of cells from colonies of the activity .c release. These events can be reverted by the contemporary heterologous expression of Bcl-2 or Bcl-xL, as well of 14-3-3\u03b2/\u03b1 and human LDH [Expression in yeast of the human key apoptotic inducer Bax leads to apoptotic cell death accompanied by cytochrome uman LDH \u201386.Yeast models expressing neurotoxic proteins have been recently reviewed .Expression in yeast of \u03b1-synuclein, an intracellular trigger of Parkinson\u2019s disease, results in apoptosis as well as necrosis, which are modulated by the activities of the ubiquitin\u2013proteasome system (UPS), autophagy, and ubiquitin-dependent vesicular trafficking \u201389. MoreExpanded poly-glutamine (poly-Q) domains cause protein aggregation and neurodegeneration , 92. AltThe spinocerebellar ataxia type-3 (SCA3) is another disease caused by the expansion of poly-Q in the gene atxn3, which encodes a protein known as ataxin-3 (AT3) . The expPseudomonas syringae [Expression in yeast of a mutated form of DFNA5, a gene responsible for autosomal dominant hearing loss (HL), induces ROS accumulation leading to a caspase-independent cell death that relies on mitochondrial functions such as the mitochondrial fission protein Fis1p, the voltage-dependent anion channel Por1p, and the mitochondrial adenine nucleotide translocators Aac1p and Aac3p . More resyringae  led to rS. cerevisiae does not contain p53 homologues and, in this respect, it can be considered a powerful \u2018clean room\u2019 model to study the different molecular pathways associated with the presence of this protein. Mammalian p53 can function as a transcription factor in yeast [Yeast has also been used as a model for the study of tumors, also because of similarities in carbon metabolism with cancer cells. The p53 tumor suppressor protein is a nuclear phosphoprotein that plays a key role in safeguarding genome integrity . Mutatioin yeast  and sevein yeast . More rein yeast , 103. Cein yeast , 105. Vein yeast . The expin yeast . More rein yeast .Many external triggers have been shown to induce apoptosis in budding yeast including hydrogen peroxide, acetic acid, ethanol, high salt, osmotic stress, lipids, UV irradiation, heat stress, and numerous heavy metal ions .S. cerevisiae can utilize acetate as carbon source, high concentration of acetic acid induces cell death (referred as AA-PCD) accompanied by all apoptotic hallmarks. In yeast, as in mammalian cells, mitochondria play a primary role in AA-PCD. In the course of exposure to acetic acid, yeast cells show mitochondrial swelling [c and Aif1p [c. In these mutants, acetic acid can still induce cell death, although at lower rate compared to the respective wild-type strains, suggesting the existence of Yca1p and ROS-independent pathways [A detailed description of the cellular events accompanying yeast cell death during exposure to acetic acid has been recently reported . Acetic swelling , membrannd Aif1p , 110. Thpathways , 112.c could be in relation with the increased mitochondrial membrane potential and with the lack of cytochrome c oxidase activity. According to this, respiratory deficient cells lacking mitochondrial DNA (\u03c10 cells) display resistance to acetic acid-induced death [c release [The partial prevention of AA-PCD by disrupting cytochrome ed death . AA-PCD  release . Other f release , and Pep release , 110. Rec release from mitochondria was not detected in acetic acid-treated bck1\u0394 or slt2\u0394 mutants, indicating that the CWI pathway mediates acetic acid-induced apoptosis through a mitochondrial pathway [In addition, cytochrome  pathway .mca1 null mutants indicating that in the absence of Yca1p cell death is induced through the activation of ceramides, whereas in the presence of the gene yeast cells underwent an AA-PCD pathway characterized by the shift of the main glycolytic pathway to the pentose phosphate pathway and by a proteolytic mechanism to cope with oxidative stress [It has been recently reported a proteomic study during AA-PCD in both wt and e stress .S. cerevisiae cells exposed to hyperosmotic stress in the presence of high glucose or sorbitol concentrations increase ROS production and show all peculiar apoptotic markers that require the involvement of mitochondria and of a partially cyt c-dependent Mca1p activation [Hyperosmotic stress, an additional external trigger of cell death observed in mammalian cells, induces apoptosis in several pathological states such as diabetes, inflammatory bowel disease and hypernatremia . Yeast ctivation . It has tivation  that foltivation .The \u201ckiller phenomenon\u201d is widespread in different yeasts and consists of the secretion of protein toxins by killer strains that kill sensitive cells. Depending on the toxin nature, the killing mechanism is different in that some toxins act as ionophores disrupting the cytoplasmic membrane while others enter sensitive cells by receptor-mediated endocytosis, block DNA synthesis and arrest cell cycle in G1/S phase .At low toxin concentrations, which are closer to the natural environmental situation, killer toxins, whatever the mode of cell killing, induce ROS production and Mca1p-dependent apoptotic cell death. In contrast, yeast cells exposed to high toxin undergo necrotic cell death .Yeast pheromones are short peptides secreted by cells of opposite mating types required for mating.2+, ROS generation, formation of the permeability transition pore, Ysp1p-dependent mitochondrial fragmentation and release of cytochrome c [Pheromones, after binding to a G protein-coupled receptor (Ste2p or Ste3p), activate a specific MAP kinase signaling pathway allowing the induction of mating genes. The main component of the mating pathway is kinase Ste20p, the deletion of which prevents pheromone-induced death and the formation of ROS . Pheromochrome c , 126.When cells are exposed to elevated concentrations of pheromone, as well after failure of mating, cell death seems to occur without showing certain peculiar apoptotic markers in a metacaspase-independent way, suggesting the activation of necrosis-like pathways . This coS. cerevisiae as a model organism in the drug-discovery process [The availability of gene deletion collection, together with the advancing development of yeast-based functional genomic and proteomic technologies, supports the utility of  process . Due to Among antitumor drugs, the apoptotic phenotypes induced in yeast cells following paclitaxel, arsenic, bleomycin and valproate treatment, as well their mechanism of action, have been studied in detail. In the case of inhibitors of topoisomerases and/or cell cycle progression, there is not sufficient evidence for their role as RCD inducers, although many of them stimulate ROS production .MCA1 and EndoG [Some bioisosteres of arylthioindoles, which are potent tubulin assembly inhibitors, arrest growth of yeast and MCF-7 human breast carcinoma cells. Interestingly, the inhibition of tubulin polymerization in yeast triggers apoptosis mainly through nd EndoG , 130.Saccharomyces cerevisiae and/or Candida albicans [Free fatty acids, in dependency on the degree of unsaturation, as well as ceramide, stimulate yeast cells to undergo regulated necrosis, . Due to albicans .fzo1 yeast mutants, which are impaired in mitochondrial fusion [l-carnitine (ALC), used as therapeutic for stroke, myocardial infarction and neurodegenerative diseases, prolongs yeast lifespan in the presence of Mca1p, functional mitochondria and counteracts apoptosis [2O2-induced cell death [SIR2 in yeast. Spermidine, a polyamine found in citrus fruit and soybean, is an acetylase inhibitor and also an inducer of autophagy independent of human SIRT1 and yeast SIR2 genes. It has been reported that both compounds induce autophagy by distinct pathways converging on the acetylproteome [The yeast model system can be applied also to study the beneficial effects of a range of molecules and nutrients on cells and large-scale search for anti-apoptotic molecules has been performed by the use of l fusion . Some copoptosis . Ascorbill death . Apple\u2019sll death . Resveraproteome . In yeasproteome .c, AIF1, EndoG and Omi/HtrA2 [c from mitochondria, one of the signals triggering cell death, was firstly demonstrated in cells expressing the human pro-apoptotic protein Bax [AAC1/2/3 and POR1 are the yeast orthologs of mammalian adenine nucleotide translocase (ANT) and voltage-dependent anion channel protein (VDAC), respectively. Their role in the release of cytochrome c during Bax-induced cell death is controversial, depending on the experimental conditions [2O2, while deletion of POR1 enhances apoptosis triggered by all these compounds [Mitochondria play a central role in cellular functions including energy production, iron\u2013sulfur biogenesis, calcium homeostasis, and RCD in eukaryotes. Most of the mitochondrial functions depend on the maintenance of tubular network deriving from the equilibrium between fusion and fission events. Mitochondrial fragmentation into punctuate structures is a common early feature of apoptosis in both mammalian and yeast cells , 138. Aptein Bax . AAC1/2/nditions \u2013142. Theompounds .The overexpression of the human gene VDAC1 induces the accumulation of ROS and is toxic for yeast cells growing on respiratory carbon sources but not on glucose . This coOther proteins, involved in mitochondrial functions, protect cells from death. As an example, the absence of Cit1p, the major mitochondrial citrate synthase, or Isc1p, the inositolphosphosphingolipid phospholipase C, results in oxidative stress hypersensitivity associated with apoptotic markers that were suppressed by the contemporary absence of the Mca1p metacaspase , 148.Among cellular organelles, peroxisomes perform fundamental metabolic pathways such as \u03b2-oxidation of fatty acids and hydrogen peroxide detoxification.Peroxisomes are ubiquitous in eukaryotes varying in shape, size and number adapting to cellular requirements. Like mitochondria, peroxisomes increase in their number by a fission mechanism, which in yeast requires Dnm1p or Vps1p, and it has been recently reported that the inhibition of peroxisome fission increases yeast chronological lifespan .PEX6, the gene encoding a protein involved in peroxisomal protein import, results in increased ROS production and loss of viability upon acetic acid treatment and during early stationary phase. Moreover, cell death in aging yeast cells lacking PEX6 is not dependent on Mca1p and Aif1p and shows necrotic rather than apoptotic markers. The exact role of Pex6p in cells during acetic acid stress, as well in aging cells, remains to be clarified [PMP20 gene in the yeast Hansenula polymorpha results in enhanced ROS production and accumulation of lipid peroxidation in methanol growing cells. Similar to the scenario observed in mitochondria-mediated apoptosis, the absence of Pmp20p leads to loss of peroxisome membrane integrity with the release of matrix proteins into the cytosol followed by necrotic cell death [Together with mitochondria, peroxisomes are the main source of reactive oxygen species that accelerate aging and cell death, but their role in these processes still requires elucidation. Peroxisomes are involved in regulation of yeast necrosis. In fact, it has been reported that the deletion of larified . Interesll death .The yeast ER, as in all eukaryotes, is required for many relevant cellular functions such as the translocation and folding of proteins, the synthesis of lipids and the homeostasis of calcium.IRE1), complementary\u00a0to IRE1 of plants where it plays an essential role in viral infection [2\u00b7\u2212), induces yeast cell death dependent on the presence of Mca1p [In mammalian cells, loss of ER function leads to ER stress, which in turn can trigger endoplasmic reticulum stress-associated cell death (ER-SAD) . Overloanfection . The UPRof Mca1p .The current scenario of cell death has become more and more complex following the discovery of new forms of this process. The existence of the basal machinery of apoptosis, necrosis and apparently of autophagic cell death in yeast, makes this microorganism an easy model for the study of these phenomena. Figure\u00a0Due to the easy manipulation by classical and molecular genetic approaches, yeast may be useful for the identification of new mammalian regulators and executors of cell death and, in the opposite direction, for the study of the effects of human genes in promoting or counteracting the different forms of RCD.Finally, humanized yeast strains, expressing human genes not present in the yeast genome, constitute very powerful models for the study of aging, tumor progression, neurodegenerative disorders and for the development of new diagnostic assays and therapeutic molecules."}
+{"text": "Elucidating the biology of yeast in its full complexity has major implications for science, medicine and industry. One of the most critical processes determining yeast life and physiology is cellular demise. However, the investigation of yeast cell death is a relatively young field, and a widely accepted set of concepts and terms is still missing. Here, we propose unified criteria for the definition of accidental, regulated, and programmed forms of cell death in yeast based on a series of morphological and biochemical criteria. Specifically, we provide consensus guidelines on the differential definition of terms including apoptosis, regulated necrosis, and autophagic cell death, as we refer to additional cell death routines that are relevant for the biology of (at least some species of) yeast. As this area of investigation advances rapidly, changes and extensions to this set of recommendations will be implemented in the years to come. Nonetheless, we strongly encourage the authors, reviewers and editors of scientific articles to adopt these collective standards in order to establish an accurate framework for yeast cell death research and, ultimately, to accelerate the progress of this vibrant field of research. Candida albicans, Candida glabrata and Cryptococcus neoformans in immunocompromised individuals. This socioeconomic burden is further amplified by the unprecedented rise in fungal diseases that are affecting plants and animals Yeast, a fungus that predominantly lives as a unicellular organism, has had an extraordinary influence on humanity throughout millennia, from its usage for baking and brewing to the potential of some species to cause life-threatening human diseases. The cultural, industrial, biotechnological, and medical impact of this organism remains unparalleled. The use of yeast fermentation to produce alcoholic beverages and to leaven bread coincided with the rise of ancient civilizations and has persisted until our days. Importantly, the continued development of yeast strains as vehicles for the development of new technology, for example in bioethanol, drug, and enzyme production, as well as the implementation of unconventional yeast species in industrial processes, highlights the ever increasing importance of yeast now and in the future 1Saccharomyces cerevisiae (the budding yeast) being one of the most thoroughly studied eukaryotes at the cellular and molecular levels. Indeed, yeast continues to be one of the preferred model organisms to explore eukaryotic cell biology, both due to its technical advantages in devising/sophisticating molecular tool kits to study cellular biology, and to a high degree of functional conservation 1011121314161718202223242729313334Yeasts have served as a successful research tool for the last century, In addition, studies on yeast have shed light on human diseases, providing a cellular platform to examine, for instance, prion biology, virus-host interactions, metabolic diseases, neurodegenerative disorders, cancer, or aging 373839404142434445464748495051525354555657585960216263646563697072de facto behave as a multicellular entity of communicating individuals rather than a group of isolated cells that do not interact with each other. In fact, a given yeast population originates from a single clone, and the ultimate biological goal of that population is the survival of the genetic information representing that very clone. Thus, under certain circumstances, the death of unfit or damaged yeast cells promotes the survival of the population as a whole. A number of physiological scenarios have been described that corroborate this teleological explanation for a cellular suicide program in yeast, including antagonistic interactions between yeasts, aging, mating, or colony formation 5461757677787980818283848687888990In multicellular organisms, the controlled suicide of single cells is crucial for development and homeostasis, providing a system that eliminates superfluous cells. The presence of such a mechanism also allows for the removal of damaged cells that might compromise organismal fitness. In a single-celled organism like yeast, this paradigm does not seem to apply at first sight, since - in this case - cellular suicide entails the death of the whole organism. However, in a way, a population of yeast cells Figure 1). In this paper we thus attempt for the first time to formulate a series of recommendations and caveats with respect to cell death-related results obtained in yeast. To this aim, we have followed the directions of the Nomenclature Committee on Cell Death (NCCD) 929394Saccharomyces cerevisiae, which we think can be extended to other yeast species and to multicellular filamentous fungi. Our goal is to frame a uniform set of guidelines that facilitate the communication among yeast cell death researchers, ultimately supporting and accelerating scientific advance (Box 1). In that respect, the nomenclature presented herein will likely need to be revised and updated as the field of yeast cell death moves forward and even more precise definitions are required.Even though it is now clear that yeast can indeed undergo cellular suicide, the corresponding terminology to describe this multifaceted process remains heterogenous and potentially misleading. Thus, we believe that there is timely need for a more precise and consistent nomenclature that clearly defines the concept of \u201cyeast cell death\u201d, considering morphological, enzymological, and functional aspects. Such standardization seems of importance, given that the field of yeast cell death is continuously expanding with significant progress being made at the phenotypical and mechanistic levels, including the finding that, akin to higher eukaryotes, yeast can also engage in distinct cell death modalities (in vivo is to use propidium iodide (PI). PI is a fluorescent nucleic acid intercalator that can only enter cells with a ruptured cell membrane, and can be routinely employed in both low and high throughput formats 969799100A crucial issue that demands a clear definition is the question of cell death itself. When is a cell dead? According to the NCCD guidelines this is only the case upon irreversible plasma membrane breakdown or complete cellular fragmentation, because only then the cell is factually disintegrated, irrespectively of which upstream pathway or routine has been engaged per se are still alive . Additional caveats include the possibility that live cells at the point of plating might die before forming a colony and/or that the plating procedure itself might drive (a fraction of) cells into death, which would be indistinguishable from cell senescence. Nonetheless, the literature suggests clonogenic capacity as a very good correlate to cell death in a plethora of different settings 6996104106Assessing clonogenicity with plating assays is the most commonly used method to quantify cell viability 62A further technique to assess yeast viability follows the growth rate of a given culture, which may decrease as a consequence of increased cell death. For this purpose, an aliquot is inoculated into fresh liquid medium and the growth is monitored, for instance, via photometric measurement of optical densities over a specific period of time 1086(3)) 120., viability or vitality) cannot be placed on a par with an increase in cell death. In conclusion, as mentioned above, the term cell death should be used only upon observing breakdown of the plasma membrane and thus loss of cell integrity . In addition, we suggest to strengthen this observation by simultaneously assessing clonogenic capacity , since (i) it represents the best-established output to accurately monitor overall cellular viability and (ii) it empirically correlates very strongly with actual cell death markers. Importantly, both methods are easy, quick and relatively inexpensive. The use of additional dyes/stainings/assays provides valuable complementary information, but cannot be used alone to unequivocally define a cell as dead.One possibility to evaluate yeast cell vitality is to directly assess the activity of specific enzymes directly. Although this is not widely employed in yeast cell death research, it represents an avenue to assay the physiological state of a metabolic pathway within the cell 1001121141002-DCF-DA) are converted by a broad range of other ROS, but only poorly by superoxides 127129130131133134131136137138Yeast cell death is often accompanied by oxidative damage and thus, a widely employed method in the field is the detection of reactive oxygen species (ROS) 96122123124Cellular demise in yeast may occur in two mutually exclusive variants: either as an accidental event or through a regulated pathway. Accidental cell death (ACD) occurs upon exposure to severe conditions, resulting in a rapid, uncontrollable and unavoidable form of death. ACD may follow a series of extreme stimuli, including physical conditions, such as very high temperatures or pressures, severe chemical insults like strong detergents and high concentrations of acids or bases as well as mechanical challenges, for instance, vigorous shearing or ultrasonic treatment. The immediate nature of ACD, which is characterized by a virtually immediate structural breakdown of cells, allows no form of pharmacologic or genetic inhibition. Thus, this form of cell death does not constitute a direct target for modulation or prevention. However, it remains unclear whether yeast cells undergoing ACD may release endogenous, bioactive molecules to the extracellular space 75140141142143versus regulated) modalities of yeast cell death manifesting with a necrotic morphology (see below).ACD is often equated with necrosis, which in yeast is usually identified as a cellular condition of early plasma membrane permeabilization in the absence of typical apoptotic markers and of complete disintegration of subcellular structures ., upon exposure to mild stress or as a consequence of mutations. Cell death occurring in the former scenario is termed \"programmed cell death\" (PCD), while the expression \"regulated cell death\" (RCD) encompasses both PCD as well as all other instances of cell death that depend on a molecular machinery 145146147That said, many lethal stimuli result in a form of yeast cell death that - at odds with ACD - is executed by a genetically encoded, dedicated molecular machinery. In higher eukaryotes, a distinction is made between such a controlled form of cell death when it occurs (i) in the framework of a purely physiological program, e.g., during (post-) embryonic development or tissue homeostasis, or (ii) as a response to either a perturbation of intracellular or extracellular homeostasis, e.gde facto representing an instance of PCD. During yeast chronological aging, the cellular community maintains homeostasis thanks to the programmed death of dysfunctional or old cells, which spares and provides nutrients to the fitter individuals 75151For yeast cell death, many authors have used the term PCD to interchangeably refer to all types of cellular demise that are not accidental . However, emerging evidence is confirming that a yeast population, be it a liquid culture or a solid colony, bears a degree of complexity reminiscent of multicellular organisms that demands a revision of this terminology. For instance, during yeast gametogenesis (or sporulation), immature meiotic products as well as the mother cell itself succumb via activation of vacuolar rupture 149Importantly, since RCD depends on a defined molecular machinery, it can be modulated with pharmacologic or genetic means. The extent of such modulation depends on the progression of the process across a hitherto poorly defined point-of-no-return. According to the NCCD, the processes preceding such point are part of cellular stress responses, while those following it belong to actual cell death signaling Figure 2). Finally, it should be noted that in cell death research, it is generally advisable to determine the kinetics of the parameters under scrutiny Table 1). Beyond the specificities outlined below, a number of general issues and notes of caution also need to be considered (Box 2).Yeast RCD may follow different subroutines (see below) that can be differentiated from each other by a series of morphological and biochemical features. To precisely characterize the lethal phenotype, we recommend (i) to first determine if cell death actually occurs , (ii) if it does, to then examine the subroutine(s) involved via morphological and biochemical observations, using at least two different detection methods Saccharomyces cerevisiae. This includes the first observation of an apoptotic phenotype in yeast, specifically in a strain with a point mutation in the gene coding for the cell cycle protein Cdc48 de novo protein synthesis, e.g. by cycloheximide Most studies on RCD in yeast have been conducted in the budding yeast One of the events most commonly associated with apoptosis is the exposure of phosphatidylserine (PS) on the outer leaflet of the plasma membrane 931836396104ab initio\" 185We believe that the second (Annexin V positive) and third (PI positive) subpopulations can be readily interpreted as apoptotic and primary necrotic, respectively, provided that at least one more assay is performed to validate this assumption. For the fourth subpopulation (Annexin V/PI double positive cells), we favor the following interpretation: unlike multicellular animals, a yeast population presumably does not eliminate apoptotic cells via the phagocytic activity of other yeast cells. In the absence of such clearance by scavengers, an apoptotic cell eventually undergoes a metabolic collapse that results in breakdown of the plasma membrane integrity and thus a necrotic phenotype. This phenomenon is termed \"secondary necrosis\" to discriminate it from \"primary necrosis\", which describes the phenotype of \"cellular necrosis occurring Still, these cells might also have undergone secondary necrosis following other cell death subroutines, but at this point there is no evidence for this possibility, which should be evaluated earlier in the cascade of events leading to cellular demise. Importantly, the phenotypical shift from apoptosis to secondary necrosis might reflect defined mo-ecular events and thus be experimentally distinguishable from ACD with necrotic features and primary necrosis also at the functional level 187189190191192In vitro, cultured metazoan cells that are left to finalize the apoptotic process without interruption  eventually succumb with features of secondary necrosis 186194In vivo, secondary necrosis may occur in multicellular animals, for example, when apoptotic cells are shed into the lumina of hollow organs with low probability to encounter scavengers or when apoptotic cell death occurs at a pace that surpasses the local scavenging capacity 186196In multicellular animals, clearance of apoptotic cells is a central physiological feature for maintenance of organismal homeostasis. Still, secondary necrosis does occur under certain circumstances 0/G1) has been previously employed as an alternative to assess apoptotic DNA degradation Besides PS externalization, apoptotic cells exhibit chromatin condensation, which can be readily assessed by nuclear staining with dies such as 4',6-diamidino-2-phenylindole (DAPI) followed by microscopic inspection 6363961049610415719920020120220379\u03c8m) 96159160162163164209c release, which depends on the ADP/ATP carrier Apoptotic cell death often follows mitochondrial outer membrane permeabilization (MOMP), which culminates with the release of pro-apoptotic proteins from the intermembrane space and irreversible loss of mitochondrial transmembrane potential , endonuclease G (Nuc1) and the yeast metacaspase (Yca1), exert both lethal and vital functions 626996159160213214215A large number of apoptotic regulators and executors have been identified in yeast so far yca1 knockout strains may point towards an apoptotic mechanism. However, under certain conditions, apoptosis is not executed via Yca1, but instead relies on other factors, including Aif1, Nuc1, the human cyclophilin D ortholog Cpr3, the BH3-only protein Ybh3 or ceramides 96160217218219220221222YCA1), it is possible that other proteases might functionally substitute for metacaspases 22422570227For exploring a putative apoptotic mechanism in a given cell death scenario, the deletion strains of known apoptotic regulators should be harnessed, since distinct apoptotic subroutines exist that rely on different factors that may act independently from each other to orchestrate cellular demise. For instance, the yeast metacaspase Yca1 is involved in many apoptotic RCD and PCD settings 6269In human cells, extrinsic apoptosis defines a caspase-dependent cell death subroutine that is induced by extracellular lethal ligands. These ligands are sensed and transmitted either via specific transmembrane death receptors or through so-called \u2018dependence receptors'. Dependence receptors can trigger two opposite signaling pathways: in the presence of ligand, they elicit signals involved in cell survival, migration and differentiation, but in the absence of ligand, they promote apoptotic RCD. Thus, dependence receptors only exert lethal functions when the concentration of their specific ligands falls below a critical threshold level 8223023123279236237In dying yeast, necrotic characteristics may appear in the frame of a primary or secondary necrotic process. While secondary necrosis is probably a consequence of apoptosis in most if not all cases (see above), a primary necrotic phenotype (which occurs without any preceding apoptotic traits) may result from two cell death modalities: ACD or RCD. Indeed, yeast primary necrosis can not only be the outcome of severe insults , but also develop as an event orchestrated by a genetically controlled machinery (regulated necrosis) bona fide primary necrosis in yeast. In addition, viability should be measured with at least one assay (preferably by assessing clonogenic capacity) to corroborate cellular demise. Finally, we strongly recommend to exclude the presence of apoptotic death indicators, and most importantly to differentiate the observed phenotype from secondary necrosis.Necrosis first leads to a gain in cell volume and organelle swelling (oncosis), which may be observed, for instance, using fluorescent microscopy of GFP-fused proteins that mark organellar membranes 103104157165144bona fide instance of ACD. This is in line with the concept that not only the type but also the intensity of a given perturbation determines the form of death 91As in higher eukaryotic cells, in yeast, ACD may be triggered upon the challenge to extremely detrimental conditions. Thus, agents like hydrogen peroxide, acetic acid, amphotericin B, or several metals that are pro-apoptotic at low doses may induce necrosis at high concentrations 125218241As mentioned above, yeast can undergo regulated necrosis, reminiscent of the RCD instances detected in human cells 104246247248249m dissipation 2511491652540 strain . However, as previously mentioned, mitochondria are the main executors of apoptotic cell death. Thus, mitochondrial dependence cannot be used as a sole determinant to characterize regulated necrosis and must be accompanied by a set of other assays that demonstrate the primary necrotic nature of cell death. Of note, several known mammalian mediators of regulated necrosis have homologs in yeast, including cathepsins, cyclophilin D, calpains, Hsp90, or protein kinase A, among others 103bona fide regulated necrosis. Similarly, it remains to be seen whether known inhibitors of regulated necrosis in mammals also interfere with some cell death scenarios in yeast as well Under certain circumstances, regulated necrosis in mammalian cells may be mechanistically linked to primary \u0394\u03c8A number of questions remain to be answered with regard to the actual existence of a necrotic RCD subroutine in yeast. In mammals, regulated necrosis plays a number of key roles, most prominently due to its immunogenic nature, for instance upon pathogen infection 6175104In human cells, different types of regulated necrosis have been defined, with MPT-driven regulated necrosis and necroptosis among the most extensively studied forms 258Drosophila melanogaster and human cells 243262263264265D. melanogaster) 267In mammalian cells, a series of other RCD modalities have been defined. Macroautophagy (hereafter referred to as autophagy) is a conserved catabolic process that orchestrates the digestion of intracellular material  in the vacuole. During autophagy, double-membraned vesicles  form and engulf cytoplasmic components, followed by the fusion of autophagosomes with the vacuole, where the cargo is degraded and the resulting macromolecules are released into the cytoplasm for reuse 16In yeast, the term ATCD has been used to describe cellular demise occurring under specific external stress conditions like zinc-induced cell death 37272274275277A number of microscopic, biochemical and enzymatic assays are available and established 175279175166167168169118., by deleting PEP4 or PRB1) or pharmacologically  as well as by neutralizing the vacuolar pH  175262The causative implication of autophagy in cell death may be explored by deletion of autophagy-related (ATG) genes, which are the key orchestrators of the process 178179180175The expression \"mitotic catastrophe\" (MC) was first employed to illustrate the lethal phenotype of a temperature-sensitive fission yeast mutant strain that enters mitosis prematurely without effectively completing it 28228328463286287bona fide cell death executioner mechanism by itself In mammalian cells, death following mitotic aberrations can, indeed, be either apoptotic or necrotic 94A series of other cell death subroutines have been defined in human cells that, however, are restricted to specific cell types and thus do not apply to yeast.S. cerevisiae. However, other yeast species have been shown to share similar cell death characteristics and also bear a set of comparable cell death subroutines. Thus, we propose to extend the above-described recommendations formulated above to all yeast species.As previously mentioned, yeast cell death has been most extensively studied in Schizosaccharomyces pombe (fission yeast) has been shown to express an RCD machinery that responds to various stimuli. These include physiological triggers such as aging, defects like the abnormal metabolism of intracellular lipids 291292293292S. pombe (yet). Among the described S. pombe apoptosis executors are the chaperone Cnx1  and the metacaspase Pca1 295295S. pombe apoptosis is expected to involve additional players, as there is evidence for the presence of different factors in fission yeast that are homologous to effectors of S. cerevisiae apoptosis, including the protease Nma111 Candida albicans, which has become a molecular genetics model to study pathogenicity, virulence and fungal development 302242304305Candida biofilms, which are highly tolerant to standard antimycotics and hence difficult to eradicate. Exploiting the apoptosis machinery in cells constituting biofilms may pave the way to their effective eradication, and hence limit the incidence of indwelling device-associated infections (IDAIs) 307308C. albicans also harbors a gene encoding a metacaspase (CaMCA1) 311316Candida species, e.g., Candida glabrataCandida kruseiCandida dubliniensisCandida tropicalisCandida parapsilosis232The major opportunistic human pathogen Cryptococcus neoformans, an important pathogen of immunocompromised and immunocompetent patients, also undergoes apoptosis 323Cryptococcus genus member, Cryptococcus laurentii, has also been shown to respond to some stimuli with apoptotic RCD ., Kluyveromyces lactis326Pichia pastorisRhodotorula glutinis  Zygosaccharomyces bailii330332Aspergillus fumigatus, which has also been demonstrated to undergo apoptosis under certain conditions 334A. fumigatus codes for two metacaspases (CasA and CasB), whose relative contribution to cell death seems to depend on the scenario 335336Aspergillus nidulans is another member of the Aspergillus spp. that has been demonstrated to undergo RCD 338A. nidulans appears to code for an apoptotic machinery with relevant players like apoptosis-inducing factor and two putative metacaspases 339Podospora anserina, is used as an aging model that incorporates crucial apoptotic factors, including two metacaspases (PaMCA1 and PaMCA2) and at least five Aif members, of which only mitochondrial (but not cytosolic) isoforms seem to be relevant for aging-driven RCD 341P. anserina cyclophilin D ortholog in RCD 343344P. anserina346306Paracoccidioides brasiliensis Colletotrichum gloeosporioides Fusarium oxysporum Fusarium graminearum Mucor racemosus Botrytis cinerea Penicillium expansum Rhizopus oryzae Scedosporium prolificans Neurospora crassa 358. As multicellular organisms, filamentous fungi have developed programs that are reminiscent of organismal RCD. For instance, several putative homologs of factors relevant for animal apoptotic control that are not found in unicellular yeast are present in the genomes of filamentous species It should be noted that a growing body of work is addressing RCD in multicellular fungi. A major human pathogenic fungus that causes life-threatening disease is The impact of yeast  on our lives at multiple socioeconomic, scientific and medical levels emphasizes the importance of decoding the mechanisms that determine its survival and control its demise. Therefore, the molecular comprehension and potential manipulation of yeast cell death hold major promise for biotechnological and biomedical applications. We anticipate that numerous fields might benefit from the possibility to modulate yeast cell death. For instance, the productivity of yeast during large-scale processes in the pharmaceutical and industrial arenas largely depends on its viability and ultimately on its tolerance to stress and its demise in stationary cultures. Also, novel pharmacological approaches that specifically target the RCD machinery of yeast pathogens may bypass the ever-increasing resistance to classical antimycotics, which is an emerging public health problem. Other medical manipulations of yeast RCD are also conceivable, e.g., strategies to intervene on pathogenic deviations of the mycobiome. Finally, yeast will continue to help the community in deciphering eukaryotic cell death pathways as it serves as an important model for human disease. Given its power to study the relationship between genotype and phenotype, we expect to gain further insights from yeast to identify actionable targets that may be subjected to pharmacological (drug discovery) or genetical manipulation.For all these reasons, it is now imperative to set the standards for defining and studying cell death in yeast. That said, we want to emphasize that the present set of recommendations should be taken - as any scientific overview - as a snapshot of the current knowledge, rather than as a definitive compilation. Indeed, as research continues, we surmise that the present guidelines will have to be extended and revised. For instance, other nuanced changes to - or even novel types of - RCD may emerge from continued efforts to characterize the multicellular character of yeast populations, including but not restricted to uncovering intercellular communication, interaction between populations or cellular differentiation within colonies and biofilms. Still, neologisms should be introduced with care and only when the characterization of a lethal process that bears new functional and biochemical aspects requires it. Otherwise, new expressions should be avoided to limit confusion.Another crucial point is to acknowledge the inherent complexity and dynamic nature of RCD in general and its different subroutines in particular. In fact, it is the crosstalk between pro-life and pro-death signals that determines cellular fate, and the activation of pro-survival pathways (such as autophagy) may often accompany lethal signals. Also, stress conditions may activate different RCD subroutines that can be interconnected or may occur independently, sequentially, or in parallel. Indeed, the inhibition of one specific RCD modality might trigger backup mechanisms that still ensure cell death execution. It is thus important to keep these points in mind when classifying a lethal phenotype.Altogether, the present guidelines attempt to unify the nomenclature and definition of yeast cell death modalities and - in our opinion - will help other fields of unicellular research  to establish their set of recommendations using the present one as a basis. We are convinced that some degree of linguistic and experimental standardization is necessary for facilitating communication among researchers, especially at a point where the existence of yeast RCD is scientifically accepted and its socioeconomical impact is ever growing."}
+{"text": "This year, more than 100 participants, among which senior and young scientists from Europe, USA, North Africa and Japan, had an intense and open exchange of achievements and ideas. This open and informal communication among researchers has been a constant hallmark of all the IMYA meetings. The global yeast death community was embraced and inspired by the lively and warm atmosphere of Bari, the capital city of Apulia, and its beautiful surroundings, with colorful landscapes, historical and artistic heritage, tastes and scents that reflect the interface between Eastern and Western culture.Over the last 14 years, the field of yeast regulated cell death (RCD) has been expanding to more and more biomedical research themes, including aging, human diseases, cell stress response, metabolism and systems biology. The 12Frank Madeo (Austria), a pioneer of yeast apoptosis studies. He presented data on the anti-aging effects of spermidine in different model organisms, including yeast, nematodes and flies. He demonstrated that this ubiquitous polycation induces autophagy and significantly reduces age-related oxidative protein damage in mice. Spermidine supplementation was also shown to have a strong cardio protective effect on diastolic parameters. These findings support the evidence that autophagy mediates cytoprotection against a variety of noxious agents, thereby conferring longevity when induced at the whole-organism level. Outstanding scholars gave their plenary lectures in several thematic sessions as follows.The meeting started with the keynote lecture of Marie Hardwick (USA), the first speaker of the opening session on fungal cell death pathways reported the identification of certain death-resistant deletion strains through a genome wide screen analysis in Saccharomyces cerevisiae. These strains were knockouts for all subunits of a vesicle trafficking complex involved in responding to amino acid levels, thus supporting the evidence that yeast cell death and nutrient-sensing pathways merge and can affect survival following stress conditions.The perception of mammalian \"cell death\" has evolved from being a passive incident to an active process as supported by the characterization of several active death pathways, such as apoptosis, necroptosis, or pyroptosis. In contrast, although the evidence of apoptosis in dying fungal cells is clear, less is known about its molecular mechanisms and the impact of the environmental cues on cell fate control. Campbell Gourlay (UK) presented results on the conserved link between environmental signals, cytoskeletal integrity and cell fate control. Particularly, he showed that defects in actin regulation lead to the inability to control the fidelity of MAPK signaling pathways. He observed that the yeast filamentous growth and mating MAPK pathways become inappropriately activated in response to a reduction in actin dynamics and that actin stabilization leads to the constitutive activation of the MAPK controlled cell wall integrity pathway. He also observed that the de-regulation of MAPK signaling leads to vacuole dysfunction, ROS production and cell death that can be reversed by porin deletion.Katrina Cooper (USA), who is working on cyclin C-mediated cell death, proposed a model in two steps for cyclin C release from the nucleus to the cytoplasm, representing a key cell-fate checkpoint control. She found that first cyclin C is phosphorylated by the MAP kinase Slt2 permitting its disassociation from the Mediator component Med13 and after that Med13 destruction allows full cyclin C release and prevents re-accumulation of the cyclin in the nucleus.Manuela C\u00f4rte-Real  analyzed the selective anticancer activity of lactoferrin showing that this glycoprotein activates a mitochondria- and caspase-dependent apoptotic process in yeast, which led to the hypothesis that lactoferrin could act as a V-H+-ATPase inhibitor in highly metastatic cancer line cells. In addition, she showed that bovine lactoferrin causes intracellular acidification in metastatic breast cancer cells. Her data demonstrate how yeast can provide relevant clues in the identification of the molecular target/mechanisms of action of lactoferrin.Benedikt Westermann (Germany) added information to this understanding by presenting data on the unexpected link between mitochondrial transport and fusion. Genetic analysis, live cell microscopy and simulations in silico showed that this link is critical for a correct mitochondrial partitioning and that mitochondrial quantity causes a severe decline of replicative lifespan of daughter cells. This suggests that coordination of mitochondrial transport, fusion, and fission is critical for asymmetric division and rejuvenation of daughter cells.During cell division, the partitioning of cell organelles involves both stochastic and ordered mechanisms and budding yeast is a useful model to study organelle inheritance during asymmetric cell division. Michal Eisenberg-Bord (Israel) discussed lipid droplets and their key functions in bioenergetics homeostasis and membrane biosynthesis. In particular, she focused on a specialized lipid droplet subpopulation equipped with a unique set of surface proteins that is localized in proximity of the nucleus vacuole junction. By using high-throughput screening, she identified two Lipid Droplet Organization (Ldo) factors, which are required for proper localization of Pdr16 residing in this lipid droplet subpopulation.Jens Nielsen (Sweden) addressed how different parts of cellular metabolism are connected, how metabolism can be modelled at the genome-scale and how incorporation of protein crowding and proteome homeostasis may be key determinants for cellular function. He also showed how regulation of metabolism can be studied using different omics analysis.As metabolism represents the core of cellular functions and since most cellular processes interact with metabolism, a highly complex network is established. Hiroshi Takagi (Japan) presented data on the signaling molecule nitric oxide (NO) and the flavoprotein Tah18, which is involved in nitric oxide synthase-like activity. He reported that cell death induced by Tah18-dependent NOS activity can be prevented by enhancing the interaction between Tah18 and its molecular partner Dre2. Appropriate nitric oxide levels were found to confer cellular tolerance either to high temperature, via Mac1-mediated Sod1 activation, or to low levels of hydrogen peroxide. In contrast, under severe stress conditions, such as high levels of hydrogen peroxide, excess NO may induce cell death. Tah18-dependent NO production may thus exhibit two opposite effects in yeast, similar as in mammalian cells.Francesco Cecconi  discussed the role of AMBRA1, the activating molecule in beclin 1-regulated autophagy, and he placed this in the context of evolution and development. Beyond AMBRA1\u2019s recognized role in embryonic development, neurological disorders and carcinogenesis, he showed that AMBRA1 can coordinate a cell response to starvation or other stresses by translocation of the autophagosome core complex to ER, by regulative ubiquitination and stabilization of the kinase ULK1, and by selective mitochondria removal and cell cycle down-regulation. AMBRA1 appears also to be targeted by different regulators, such as Culling-dependent degradation, caspase cleavage and several modifications, from phosphorylation to ubiquitination.Autophagy is a conserved process that functions during cellular stress and nutrient starvation as part of an adaptive response to maintain homeostasis and quality control. Ted Powers (USA) discussed the role of the rapamycin-insensitive TORC2 as a positive regulator of autophagy, specifically under amino acid starvation. He described the architecture and the activity of this regulatory pathway, showing that TORC2, through its downstream target kinase Ypk1, inhibits calcineurin. On the other hand, calcineurin activation requires Mid1, a calcium channel regulatory protein and when TORC2-Ypk1 signaling is compromised, the normal mitochondrial respiration is perturbed resulting in the accumulation of reactive oxygen species and the inhibition of the general amino acid control and autophagy.Zdena Palkov\u00e1 (Czech Republic) focused on the regulatory role of mitochondria and certain mitochondrial pathways during cell subpopulation longevity as well as on the regulation of metabolic differentiation and the production of specific metabolic proteins and transporters in specific cell subpopulations.Similar as multicellular organisms, growing yeast cells are able to differentiate in organized communities, such as colonies. In such colonies, cells initiate various metabolic reprogramming leading to the formation of cell subpopulations that mutually interact in order to fulfill specific tasks. Tiago Outeiro opened this part of IMYA12 with an inspiring talk in memory of his mentor Susan Lindquist, who pioneered on the use of budding yeast as model system for studying human disease, evolution, and biomaterials. The following sessions then ensued.It is well known that yeast offers an excellent tool to study the molecular basis of human diseases as it: allows mimicking a variety of physio-pathological aspects under different environmental conditions. By avoiding complex ethical issues associated with mammalian models or human subjects, the use of yeast models enable the discovery of novel targets via high-throughput screens, thereby accelerating therapeutic research provided that such targets are further validated in more complex models.  S. cerevisiae have significantly contributed to our understanding of the cellular mechanisms underlying neurodegenerative diseases, such as Parkinson\u2019s (PD) and Alzheimer\u2019s diseases (AD), for which the pathobiology remains largely unclear. Tiago Outeiro (Germany) has investigated the role of alpha-synuclein in PD in a yeast model. He presented data about the effect of post-translational modifications, such as phosphorylation and glycation, on alpha-synuclein aggregation and toxicity. His findings on phosphorylation of alpha-synuclein at a specific serine residue have been validated in mammalian cell models and may open novel perspectives for therapeutic intervention in synucleopathies.Studies inDina Petranovic (Sweden) presented results on the expression in yeast of two forms of the amyloid \u03b2-peptide (A\u03b2), which typically deposits in the amyloid plaques found in AD brain, but whose mechanisms of toxicity are not fully understood. By comparative analysis of the physiology, molecular markers and genome-wide transcriptional responses in strains constitutively expressing either A\u03b21-42 or A\u03b21-40, she identified some mechanisms that seem to be implicated in the toxicity of A\u03b2 peptides. She also described recent findings on a mutant protein, named ubiquitin B protein+1 (UBB+1), which accumulates in an age-dependent manner and appears to correlate with AD. Differently from other data, low level of UBB+1 can induce a protective response assisting yeast cells to cope better with misfolded proteins during chronological aging, including the reduction of the A\u03b2 toxicity associated to lower levels of A\u03b2 aggregates.Joris Winderickx (Belgium) has been using yeast as a model to decipher fundamentals of age-associated human disorders. Particularly, he focused on the interplay of PKA-, TORC1- and Sch9- controlled nutrient-sensitive pathways that have a profound impact on growth, stress resistance and longevity. He gave an overview on recent findings about the connections of intracellular pH and calcium homeostasis with these pathways and he discussed their effect on the overall cell physiology.Richard Y. Zhao (USA) presented evidence that fission yeast can be used as a surrogate system for the rapid identification and genome-wide functional analysis of Zika virus (ZIKV) proteins. ZIKV causes various congenital neurologic disorders including microcephaly in newborns and Guillain-Barr\u00e9 Syndrome in adults. Through the yeast studies, seven ZIKV proteins were identified that cause different levels of cytopathic effects including cell growth restriction, cell cycle dysregulation and cell death. Those initial findings generated from yeast provide a primary reference for future mammalian studies on their potential links to ZIKV-induced neurologic disorders. Ongoing mammalian translation studies were also presented and discussed.Ali Gargouri (Tunisia) described the effects of p53 ectopic expression in S. cerevisiae by illustrating different aspects: the occurrence and analysis of apoptosis, the structural and functional connection with mitochondria, the impact on gene expression and screening of intragenic or over-expressing p53-inactivating mutations. He also showed the selection of biomolecules suppressing the p53-mediated cell death, including a very potent macromolecule, extracted from Nigella sativa that is able to rescue apoptosis without affecting p53 expression.Carlo Bruschi (Austria) underlined the complex apoptotic dynamics seen following chromosome translocation events that depend on the subsequent genomic rearrangements and epigenetic alteration of the primary homeostatic structure of the chromatin. In particular, he reported death rates and expression profiles of apoptosis-related genes in yeast cells in which the primary event of chromosome translocation was induced ad hoc by Bridge-Induced Translocation (BIT) technology. He also showed that the BIT system was successfully applied to reproduce in yeast precisely the peculiar chromosome translocation associated with acute myeloid leukemia and that this yeast model can be used to test the constitutive expression of human P53.S. cerevisiae has been successfully used as a model organism in phenotypic screens aiming to identifying molecules of pharmacological interest or with anti-aging properties, to understand mechanism of action of drug or to reveal novel drug targets and target pathways. Ralf Braun (Germany) presented results on the expression and clearance of the nuclear RNA-binding neurotoxic protein, TDP-43, which accumulates and aggregates in the cytoplasm of patients affected by motor neuron disorder amyotrophic lateral sclerosis. He demonstrated that TDP-43 interferes with its own degradation via the lysosomal clearance pathway, potentially by entrapping its pivotal components. Modulating the fine balance between cell survival and protein degradation systems might delay the loss of neuronal activities during disease progression.Paula Ludovico  showed how metabolite supplementation, such as certain amino acids, can have anti-aging effects when cells suffer proteotoxic stress elicited by the heterologous expression of human \u03b1-synuclein (\u03b1-syn). These effects are associated with a decreased accumulation of reactive oxygen species, Sch9-mediated increased superoxide dismutase activity and alterations in the mitochondrial network. These findings might be an attractive mechanism to rescue cells from \u03b1-syn mediated toxicity and for future pharmacological research designed to improve the prognosis of age-associated diseases. Charles Boone (Canada) presented the quantitative genetic interaction data produced by genome-scale Synthetic Genetic Array (SGA) experiments with S. cerevisiae. He outlined the functional interactions and the relationships genotype-phenotype, revealing the potential of genetic interactions for assembly of a hierarchical model of cell function, including modules corresponding to protein complexes and pathways, biological processes, and cellular compartments. He also introduced the in fieri work on the extent and composition of the global yeast trigenic interaction network.Systems biology studies in yeast are supporting the development and understanding of the complexity and interplay of biological networks with their dynamics, basic principles, rules and balanced orchestrated functions in direct interaction with the environment.Duccio Cavalieri  discussed the physiological significance of PCD in the framework of ecological interactions of \"natural\" yeast strains with different life span and different levels of toxins production, such as ethanol and acetic acid, in sugar rich environment. He presented evidences for the role of released Hsp12p and Pau5p in modulating cell growth under the effect of quorum sensing molecules and determining yeast community level fitness in different ecological settings. Maurizio Bettiga (Sweden) presented results on the relationships between plasma membrane properties and acetic acid stress tolerance. He demonstrated that an increase of the sphingolipids content in the plasma membrane is associated with acetic acid stress response in Zygosaccharomyces bailii. These studies point to the possibility to engineer the membrane composition of an industrial yeast strain towards reduced permeability as to obtain higher acetic acid tolerance.Several industrial yeast-based processes, such as the production of ethanol from lignocelluloses or wine making, are inhibited by the accumulation of organic acids, including acetic acid, which is known to inhibit metabolism and affect cell viability. Thus, one of the central issues for the improvement of their robustness is to gain insight into the molecular mechanisms of acetic acid toxicity.International Meeting on Yeast Aging and Apoptosis, though maintaining the winning-horse acronym IMYA. The next meeting, i.e. IMYA13, will be organized in Leuven, Belgium. Thus, \"tot binnenkort in Belgi\u00eb\"!With 37 selected oral presentations and 26 posters, IMYA12 has been a showcase for the latest advances in the knowledge on the molecular basis of many fundamental cellular processes governing cell homeostasis. IMYA12 also presented cutting-edge achievements in the exploitation of yeast as outstanding model for deciphering at the system level different aspects related to biomedical and bio-industrial science. With the aim of witnessing this new fascinating era of yeast research, the IMYA Scientific Advisory Board has decided to update the title of the conference series into"}
+{"text": "It is well known that dyslipidemia and chronic hyperglycemia increase the onset of diabetes and diabetic complication. The aim of this study is to see the association of trace metals elements and lipid profile among type 2 diabetes mellitus patients.+2), magnesium(Mg+2), chromium(Cr+3), calcium(Ca+2), phosphorus(Po4\u22123), manganese(Mn+2), copper(Cu+2), and iron(Fe+3)) and lipid profiles , low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein (HDL-C), and triglycerides (TG)) were measured by atomic absorption spectrophotometry and enzymatic determination method respectively. Data were analyzed by SPSS version 24 software for windows. Bonferroni correction for multiple statistical comparisons was used and a p-value less than 0.01 were accepted as a level of significance.The study was conducted on 214 type 2 diabetic patients at Jimma University Specialized Hospital, Jimma, Ethiopia. All the eligible study participants responded to the structured interviewer administered questionnaire and fasting venous blood was drawn for biochemical analysis. Trace metal elements (zinc(Znp\u00a0<\u00a00.01) association with lipid profiles  among type 2 diabetic patients in the liner regression model. In addition, WH-R was positively associated with TG. In Pearson partial correlation adjusted for sex and age, Za+2 shown to have statistically significant and negative correlations with TC, LDL-C and with TG. Mg+2 and Cr+2 negatively and significantly correlated with the lipid profile TC and LDL-C. Ca+2 negatively correlated with TC and TG. Po\u221234 positively correlated with HDL-C; iron negatively correlated with TC. However, in the liner regression model, only calcium positively and significantly  associated with TG.The mean age of study participants was 42.95(\u00b112.6) with an average of 5.83(\u00b13.1) years being diagnosed with diabetes mellitus. The BMI of female (27.1(\u00b14.9)) was significantly higher than male (25.21(\u00b14.2)). BMI shows positive and significant  and lipid profile  among type 2 diabetes mellitus patients. In addition, Ca+2 observed to be associated with TG. Future studies are highly advised to uncover the bidirectional association between trace metal element and dyslipidemia in diabetic patients.In the current study, a negative correlation was observed between trace metal elements (Zn It is a scientific fact that dyslipidemia and chronic hyperglycemia increase the onset of diabetes and diabetic complication , 2. Now,A cross-sectional study was conducted in the outpatient department of Jimma University Specialized Hospital (JUSH) from February 15, 2015-October 30, 2015. Informed consent was obtained from 214 type 2 diabetes mellitus patients. Patients who are pregnant or lactating; using any drugs affecting electrolytes, taking nutritional supplements, such as magnesium-containing laxatives; suffering from chronic disorders of the liver, kidney and cardiovascular system, endocrine disorders, established psychiatric disorder and on antidepressant and /or antipsychotic therapy, HIV/AIDS, malignancy and, substance abuse were excluded from the study. The study participants were selected by consecutive sampling technique.2). Waist and hip circumference were measured in centimeters and eventually, a waist-hip ratio was calculated.Anthropometric data such as weight (Kg) and height was determined to the nearest 0.1\u00a0kg and 0.1\u00a0cm respectively. Body mass index (BMI) was calculated by dividing weight (Kg) by the square of height in meter -containing vacuum tubes  and plain vacutainer tubes . Blood sample in the EDTA K3 containing tube used for Fasting blood glucose (FBG) determination. Blood in the plain vacutainer tube was allow clotting and centrifuged at 3000\u00a0rpm for 10\u00a0min to separate the serum from the whole blood for lipid profile and Trace metal element determination.+2), magnesium (Mg+2), chromium (Cr+3), calcium (Ca+2), phosphorus (Po4_3), manganese (Mn+2), copper (Cu+2), and iron (Fe+3) were determined using wet acid digestion method. All the sample containers were washed and rinsed with distilled water and dried in the oven at 80\u00a0\u00b0C for 24\u00a0h. Then, the serum in each container mixed with 3\u00a0mL concentrated nitric acid and hydrogen peroxide [HNO3\u2013H2O2] solution  for 10\u00a0min. Then, the beaker was covered by 150\u00a0mm pyrex watch glass and allowed to be heated on a hot plate until complete digestion had taken place at 120\u00a0\u00b0C. After the solution has cooled, the digested samples were centrifuged at 10,000\u00a0rpm for 30\u00a0s. Then, the organic supernatant aspirated directly into the flam and the sample was analyzed by atomic absorption spectrophotometry  as described in our previous publications [Fasting plasma glucose (FBG) and serum TC, HDL-C, LDL-C, and TG were determined by glucose hexokinase and by enzymatic method. Both clinical methods were performed using automated chemistry analyzer ABX Pentra 400  . Serum tications .Pretest before the actual dates of data collection and subsequent revisions during and after data collections days has been done to ensure the quality of the data. Experienced and trained data collectors were recruited for Scio demographic, clinical and laboratory data collections. Careful attention was given from the beginning of blood withdrawal until analysis. All reagents, controls, and calibrators used were checked for their expiry date and used according to the manufacturer\u2019s instructions.The study was approved by the institutional review board of Jimma University, college of health sciences, Ethiopia with the reference number RPGC/4010/2015. The research has been conducted according to the declaration of Helsinki for medical research. Consent for participation in the study was obtained from study participant voluntarily after having a clear understanding of all the purpose of the study.p-value less than 0.01 was set as level of significant.Statistical Package for the Social Sciences (SPSS) software version 24  was used to analyze data. Descriptive statistics, Pearson partial correlation test and linear regression analysis were compute to addresses the research questions. All the assumption of the model was satisfied. Moreover, adjustment for multiple tests (Bonferroni adjustments) was used \u201319 and aInitially, a total of 239 type 2 diabetes mellitus patients were recruited. However, 214 patients were eligible for the study. The mean age of diabetes patients, diabetes durations, BMI, WH-R SBP and DBP were 42.95\u00a0\u00b1\u00a012.64, 5.83\u00a0\u00b1\u00a03.11, 26.15\u00a0\u00b1\u00a04.53, 1.45\u00a0\u00b1\u00a00.56, 134.2\u00a0\u00b1\u00a022.62, and 88.36\u00a0\u00b1\u00a013.23 respectively. Female type 2 diabetic patients showed significantly higher mean BMI as compared to male type 2 diabetes patients. However, a significant mean difference was not detected among male and female type 2 diabetic patients with respect to age, diabetes duration, WH-R, SBP, and DBP. Based on the International Diabetic federation (IDF) cut of points , majoritp\u00a0<\u00a00.001) and positively associated with patients\u2019 serum TC, LDL-C, and TG  are not associated significantly with the lipid profiles  of the patients. However, BMI significantly   Table\u00a0.Table 4l+2 were the only trace metal element strongly shows significant negative correlation with TC, LDL-C, TG and positive significant correlation with HDL-C. It is a mineral that plays a vital role in many biological processes and plays an important role in the action of insulin and carbohydrate metabolism [+2 have been associated with low blood cholesterol level and reduction from any form of metabolic risks  [+2 with TC, LDL-C, and TG among type 2 diabetic patients, in the current study, is in harmony with other clinical trial and intervention studies [+2 and Cr+3in the blood would play a greater role in controlling metabolic crisis among diabetes mellitus patients [+2 plays an extremely important role in the activation and modulation of many enzymes that are involved in carbohydrate and insulin metabolism. Furthermore, it is playing a crucial role in the metabolism of lipid peroxidation since it acts as a cofactor in the cholesterol synthesis and 3-Hydroxy-3-methyl-glutaryl-CoA (HMG-CoA) reductase enzyme [+2 with TC and LDL-C in the current study is in agreement with the study amid to assess the correlation between Mg+2 and glycemic control and lipid profile among children with type 1 diabetes and adult patients with type 2 diabetes [+2 supplementation [+2 and lipid profiles [+3 enhances the action of insulin in the uptake of glucose at the cellular level [+3 serves as an important antioxidant element that improves glucose intolerance and dyslipidemia [+3 negatively correlated with TC and LDL-C. In addition, Cr+3 positively correlated with HDL-C. This funding got similarity with the study where Cr+3 supplementation showed to improve HDL-C and reduce the TC level among patients with diabetes as it is stated in the review paper [+2 is a chief divalent metal element that would play a key role in the muscle contraction, nerve excitability, blood coagulation, and secondary messenger system. In addition, it is also involved in the bone and tooth physiology. The blood Ca+2 level should be regulated in a narrow range otherwise; it may cause undesirable physiological changes immediately. Impaired insulin secretion and action in the peripheral cells might be associated with low calcium concentration [+2 negatively predicted the serum concentration of TG level in the linear regression model. Lastly, Fe+3 showed a negative correlation with TC. Iron plays an essential role as a cofactor for fuel oxidation and electron transport, but it also has the potential to cause oxidative damage if not carefully regulated [Diabetes is a chronic metabolic disease affecting the whole world. Especially peoples living in the developing part of the world are becoming more victim of diabetes because of globalization; urbanization and sedentary life. Generally, research findings in the past revealed the strong associations between disturbed blood parameters and end glycated products in the blood sample of diabetes patients. For example, findings were reported an abnormal relationship between plasma trace metal element amount and hyperglycemia in the blood sample of diabetic patients. However, osmotic dieresis due to hyperglycemia has been mentioned as a potential factor for the presences of disturbed trace metal elements in the blood sample of diabetic patients . In the tabolism . Daily iridemia) , 30. The studies \u201333. Some studies \u201336. The patients \u201340. Mg+2e enzyme . The invdiabetes , 42. Morentation \u201346. Howeprofiles . The triar level . Cr+3 seipidemia , 50. Accew paper . Ca+2 isntration , 52. Hypegulated . Iron acegulated \u201356. Our egulated  shows thBecause of the limited fund, we had, postprandial glucose, insulin, and glycated hemoglobin level of patients not measured. Selection bias might be there since study participants were selected by consecutive sampling technique. Moreover, the study was cross-sectional and the relationship between the measured parameters may not be truly associated.Our study shows positive and negative correlation and association of trace metal elements with the lipid profile of the T2DM patients."}
+{"text": "Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments.The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species ( Mangroves are unique intertidal ecosystems in tropical and subtropical regions, where they play an essential roles in providing nursery habitats for aquatic animals, degrading contaminants and protecting the coast , 2. AdapMangrove trees can oxidize the sediment by supplying oxygen to the anaerobic subsediment through their aerial roots . In addiZygophyllumdumosum and Hammadascoparia. Lee et al. [Most of the previous studies focused on the bacterial distribution from mangrove surface sediment in the horizontal direction \u201314. In ae et al.  also shoBruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum). In order to reduce possible anthropogenic effects, a pristine site in Beilun Estuary National Nature Reserve  was used as the study site, which constructed to protect mangrove located in Guangxi province, China. To thoroughly investigate the bacterial community, a barcoded pyrosequencing analysis of 16S rRNA gene was employed to understand bacterial communities in the mangrove rhizosphere from Beilun Estuary, China.The aim of the present study was to compare the vertical profiles of bacteria in the rhizospheres of three mangrove tree species , Kandelia candel (Kan) and Aegiceras corniculatum (Aeg) which were the common and dominant species in this reserve. Three plants of each species  were selected within distance of 1 to 10 m from each other. For each individual plant, the rhizosphere sediments were sampled vertically along the base of the plant. Then, the rhizosphere sediments corresponding to 0 (surface), 10 and 20 cm depths were collected. Finally, samples of each species in triplicate from each depth were mixed to homogeneity to generate a representative composite sample for further analysis. Samples were kept in sterile plastic bags, maintained in an ice box for transporting to the laboratory, and stored at -20\u00b0C for DNA extraction.Sediment samples were collected on September 28, 2015 from Beilun Estuary National Nature Reserve, which was located in South China  with an area of 3000 hm\u00aespin kit  following the manufacturer\u2019s protocol. The bacterial community was analyzed using Illumina HiSeq sequencing of 16S rRNA gene amplicons. PCR amplifications were conducted in triplicate with the primer set 515F (5\u2019-GTGCCAGCAGCCGCGGTAA-3\u2019) and 907R (5\u2019-CCGTCAATTCCTTTGAGTTT-3\u2019) that amplified the V4-V5 region of the 16S rRNA gene. The reverse primer contained a 6-bp error-correcting barcode unique to each sample. DNA was amplified following the protocol described previously [Total genomic DNA was extracted directly from 1.0 g of the sample using FastDNAeviously . PyroseqPairs of reads from the original DNA fragments were merged by using FLASH . SequencThe significant differences of bacterial composition were analyzed by one-way ANOVA using SPSS 22.0 software package (p<0.05). Principle component analysis (PCA) was applied to compare the bacterial communities among all the samples in R software (version 3.2.3). Moreover, the representative sequences of the most dominant OTUs (>20 sequences) were determined using ternary diagrams to find out the differences of bacterial community from sediments of the three mangrove species. All sequences obtained from this study were deposited in NCBI sequence read archive (SRA) under accession number SRP081285.A. corniculatum harboring the least number of OTUs among sediments of the three mangrove species  to 68,687 (Kan-0) with a mean of 61,808 . The rar species . The aveiculatum . Howevericulatum . The coviculatum .Proteobacteria was the most dominant phylum covering 47.2\u201358.9% of the total amplicons which detected in all the nine samples. Chloroflexi was the second major phylum observed in this study, followed by Bacteroidetes, Planctomycetes and Acidobacteria. Interestingly, the relative abundance of Chloroflexi (9.1\u201317.2%) from each mangrove species increased with sampling depth, while Bacteroidetes (3.0\u20139.4%) decreased with sampling depth. However, the relative abundance of Planctomycetes (3.7\u20135.5%) and Acidobacteria (3.0\u20134.2%) showed a little difference between each sample , followed by Gammaproteobacteria (8.9\u201322.6%) and Alphaproteobacteria (1.8\u20134.4%). Further, the relative abundance of Gammaproteobacteria apparently decreased with sampling depth. Betaproteobacteria (0.4\u20132.1%) and unclassified Proteobacteria (0.4\u20131.2%) were also found in different samples but they accounted for only small portions  analysis on Shannon and Chao1 indices showed bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths . FurtherRhodospirillales, and the candidate divisions (GCA004 and envOPS12) were significantly different among sediments of the three mangrove species (p<0.05). Rhodospirillales was highly abundant in rhizosphere sediment from A. corniculatum, while GCA004 and envOPS12 dominated in B. gymnorrhiza. In addition, Bacteroidales and NB1-j showed an obvious difference with the mangrove species  were abundant in the rhizosphere of K. candel, while OTUs  dominated in A. corniculatum , Venn diagram were plotted to compare bacterial compositions from sediments of the three mangrove species. In rhizosphere sediments, 5,001 OTUs were shared by all the three mangrove species. On the other hand, 776 OTUs were only detected from the rhizosphere of ectively . The terectively . Six OTUiculatum . From thiculatum . The periculatum .B. gymnorrhiza, K. candel and A. corniculatum) were examined using high throughput DNA pyrosequencing of the 16S rRNA gene. However, bacterial composition from rhizosphere sediments mainly focused on the mangrove tree species, such as Rhizophora mangle, Avicennia schaueriana, Laguncularia racemosa and Avicennia marina [B. gymnorrhiza, K. candel or A. Corniculatum is lacking, while the three mangrove species are common in Guangxi Province of China.In the present study, bacterial communities of different rhizosphere sediments from three mangrove tree species  was found to be the most abundant phylum in the rhizosphere sediment from B. gymnorrhiza, K. candel or A. corniculatum  were prevalent in this study  as their sole mode of energy conservation [Anaerolineae appears to take key role in electron transfer to anodes; however, it is presently unclear whether they are directly involved or whether they produce metabolic intermediates from root exudates or soil organic matter, utilized subsequently by other directly anode-coupling microorganisms [Besides, y et al.  suggesten summer . The phyme sites . Membersc matter . This ph cluster . The twois study . Dehalocervation . Anaerolrganisms .Planctomycetes, nitrospirae and Cyanobacteria Click here for additional data file.S2 Fig(TIF)Click here for additional data file."}
+{"text": "Transcriptional co-activator with PDZ-binding motif (TAZ) is a downstream effector of the Hippo signaling pathway that participates in tumorigenesis. The aim of this study was to identify the miRNA counterpart for TAZ and elucidate the mechanism underlying the tumorigenic effect of TAZ. We demonstrated that TAZ is upregulated in osteosarcoma (OS) tissues and cell lines, and that TAZ overexpression can induce cell migration, invasion and proliferation. Moreover, miRNA-224 (miR-224), a TAZ phenocopy that functions downstream of TAZ, was found to be upregulated with TAZ overexpression. Further, a mechanistic study revealed that miR-224 functions by inhibiting the tumor suppressor, SMAD4, to support the proliferation and migration of OS cells. Our findings indicate that targeting TAZ and miR-224 could be a promising approach for the treatment of OS. Under these circumstances, further refinement with cytotoxic chemotherapy regimens is unlikely.4 Hence, novel therapeutic approaches based on targeting oncogenic driver pathways in OS are needed urgently.Osteosarcoma (OS) is the most common primary malignant bone tumor diagnosed in young people below the age of 20. Formerly, patients with only localized disease were treated with surgery alone, leading to a low survival rate of 20%. This may be attributed to overlooking the micrometastasis likely present at diagnosis.6 and dysregulation of the Hippo pathway exerts significant impact on malignant transformation.7 Mst1/2 are pro-apoptotic kinases and core components of the Hippo pathway; Mst1/2 are activated by caspase-mediated cleavage upon apoptotic stress. Subsequently, Lats1/2 are activated and phosphorylated.8 The major downstream effectors of the Hippo pathway are Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ),8 which can be phosphorylated and inactivated by Lats1/2 in complex with the scaffold protein Mob1.11 As transcription co-activators, YAP/TAZ activate gene expression by interacting with the TEAD family of transcription factors.14 Increasing evidence has confirmed the aberrant expression of TAZ in multiple human tumors, including breast cancer, lung cancer and hepatocellular carcinoma.17 Moreover, it has been demonstrated that TAZ can function as an oncogene, activating TEAD-mediated gene transcription to promote tissue growth and inhibit apoptosis.16 However, the downstream function of YAP/TAZ in the Hippo signaling pathway remains unclear.The Hippo signaling pathway has a critical role in organ size control, tissue homeostasis and tumorigenesis,19 Shen et al.6 reported that miR-130a is directly induced by YAP, leading to the amplification of YAP activity. A similar mechanism has been reported in the case of Bantam \u2013 a well-known Yki-induced miRNA in Drosophila.21 Moreover, YAP has been identified as a regulator of global miRNA biogenesis via modulation of the miRNA-processing enzymes, microprocessor or Dicer complex, suggesting a transcription-independent role for YAP.23MicroRNAs (miRNAs) are a class of 22-nucleotide noncoding RNAs that have emerged as critical components of the gene regulatory networks controlling numerous important pathophysiological processes, including the initiation and progression of cancers. Dysregulated miRNA has been demonstrated to have critical roles in OS.\u03b2 has a confirmed yet complicated role in directing the autonomous, local and systemic cellular responses that together regulate the initiation, progression and prognostic outcome of human cancers.26 Other pathways altered in human cancer may also contribute to the TGF-\u03b2-mediated regulation of tumorigenesis to some extent.28 During initiation and early progression of the tumor, TGF-\u03b2 serves as a tumor suppressor by inhibiting proliferation and accelerating apoptosis, as evidenced by the fact that loss or mutation of the members of the TGF-\u03b2 signaling pathway in humans causes unregulated cell growth and eventually, cancer. SMADs are key intracellular mediators of transcriptional responses to TGF-\u03b2. SMAD4 is the pivotal factor of the TGF-\u03b2 pathway and functions as a key tumor suppressor. Dysregulated SMAD4 expression has been reported in some cancers, including OS.29Tumor growth factor (TGF)-in vitro and in vivo. Our results may provide the basis for a novel treatment and diagnosis strategy for TAZ-upregulated OS.In this study, we aimed to identify the miRNA counterpart of TAZ and elucidate the mechanism underlying the effect of TAZ in OS. We found that TAZ expression is upregulated in OS tissues. Through miRNA sequencing, we investigated the potential roles of TAZ and its related target miRNA-224 (miR-224) in OS development. Then, we demonstrated that TAZ and miR-224 are tumor promoters that accelerate OS progression by promoting cell growth, invasion, tumorigenesis and metastasis. In addition, SMAD4 was identified as a pro-tumorigenic gene and a direct functional target of miR-224 in OS. This study, for the first time, demonstrated the pro-OS effect of TAZ and miR-224, both P<0.01; Expression of TAZ was detected in OS and control tissues. In most human chondroma-innocent tumor tissues , only a low level of TAZ or vacant labeling was detected P<0.01; . Consist15 To identify the function of TAZ in OS, TAZ knockdown cells of U2OS and MG-63 were generated. The rate of cell growth in both types of knockdown cells was suppressed on day 7, compared with those transfected with empty vectors  of SMAD4 mRNAs contained sequences complementary to the miR-224 seed sequence . We focuobserved . To valiobserved , indicatobserved . Moreoveobserved . Howeverobserved , suggest\u03b2 signaling pathway, where it binds to SMAD2/3 and translocates to the nucleus upon TGF-\u03b2 stimulation.30 To evaluate whether miR-224 affects TGF-\u03b2 signaling by targeting SMAD4, we further treated miR-224-overexpressing and control cells with TGF-\u03b2. miR-224 impaired the TGF-\u03b2\u2013induced nuclear transportation of SMAD4 to some extent .39 The Hippo pathway influences SMAD function through miRNA, and has a vital effect on stem cells, cancer stem cells, and strong proliferative cells. Previously, we believed that YAP/TAZ possessed dual function, including the promotion of proliferation by upregulating CTGF and BIRC5 and inhibition of apoptosis by downregulating the corresponding genes. For instance, overexpression of YAP/TAZ or aberrant activation of YAP/TAZ caused by mutations of other factors in the Hippo pathway could facilitate the expression of downstream transcription factors like cyclin E and DIAP1, which led to the inhibition of apoptosis.40 Our model described and complemented the anti-apoptotic function of TAZ and enriched the variability of the network involving TGF-\u03b2, miRNA and Hippo.The TGF-\u03b2 signaling pathway induces EMT during cancer progression. A recent report revealed that CTGF is required for TGF-\u03b2-induced EMT.41 Although TAZ is thought to contribute to EMT,42 the molecular mechanism by which the transcription factor achieves its deleterious effects is unknown. Although we identified the cross talk of the two pathways and demonstrated that miR-224-mediated migration is controlled by TAZ, the specific mechanisms of invasion and migration need to be clarified in future studies.The TGF-43 Thus, the identification of the remarkable role of miR-224 in sustaining TAZ activity would pave the way for modulating TAZ-miR-224 and TGF-\u03b2 as exciting new therapeutic targets for OS with high TAZ expression.In conclusion, in this study, we demonstrated that the expression levels of TAZ and miR-224 are upregulated in OS tissues. Moreover, we proposed a novel TAZ\u2013miR-224\u2013SMAD4 axis in OS cells that mediates cell invasion and migration, and drives cell proliferation and tumor growth. These findings suggest that TAZ and miR-224 may represent new targets for OS therapy. Notably, the similarity of YAP and TAZ in TEAD-binding indicates that YAP may mediate miR-224 onco-activity in a similar manner, although we did not investigate the role of miR-224 in mediating YAP function in this study. Technical advances on antisense miRNA oligomers (antimiRs) have rendered miRNAs drug targets for anticancer therapy with unique advantages.All animal experiments were carried out according to relevant national and international guidelines and approved by the Stanford Institutional Animal Care and Use Committee (IACUC). All experiments strictly followed the panel's specific guidelines regarding the care, treatment and killing of animals used in the study.Slices of formalin-fixed and paraffin-embedded primary OS and chondroma tissues were obtained from biopsies in 16 and 20 patients before administration of neo-adjuvant chemotherapy according to the Chinese national ethical guidelines . Adjacent normal bone tissue samples were obtained from these 16 OS patients after surgical resection. OS, chondroma and normal bone tissue biopsies were histologically characterized by pathologists according to the criteria defined by the World Health Organization. Written informed consent was obtained from each patient before entering this study, and all study protocols were approved by the Ethics Committee for Clinical Research of Zhejiang University, Hangzhou, China.Immunohistochemical analysis was performed. The primary antibodies against TAZ was diluted 1\u2009:\u2009200 and were incubated at 4\u2009\u00b0C overnight in a humidified container. After washing with PBS three times, the tissue slides were treated with a non-biotin horseradish peroxidase detection system according to the manufacturer's instructions .Information regarding the materials used in this study is included in the Cell culture procedures are described in the 7 MG-63 stable cells. Tumor volumes were calculated from the length (a) and the width (b) by using the following formula: volume (ml3)=ab2/2. Five weeks after injection, the animals were killed, and tumors were harvested (measured and weighed) and fixed in 4% paraformaldehyde. Wet tumor weight was calculated as mean weight\u00b1S.D. in each group.Nude mice  were injected subcutaneously with 1 \u00d7 10\u03b2-gal and the indicated plasmids. Twenty-four hours after transfection, cells were lysed. Luciferase activity was measured by using the Luciferase Assay System  following the manufacturer's instructions. All luciferase activities were normalized to \u03b2-gal activity.For miR-224 promoter reporter and 3\u2032-UTR reporter luciferase assays, HEK293T cells were transfected with the reporter, together with CMV-\u03b2 and BMP luciferase reporter assays, Id1-luc and SBE-OC-luc were used to measure BMP-induced transcription, and SBE-luc for TGF-\u03b2-induced transcription. Cells were transfected with reporter plasmids together with Renilla luciferase plasmid to normalize transfection efficiency. Briefly, 24\u2009h after transfection, cells were treated with BMP2 (20\u2009ng/ml) or TGF-\u03b2 (2\u2009ng/ml) for 12\u2009h. Cells were then harvested, and luciferase activity was measured using Dual-Luciferase Reporter Assay System (Promega). All assays were carried out in triplicate and normalized against Renilla Luciferase activity.For TGF-\u03bcg antibodies against Flag or control IgG, after 14\u2009h of incubation. The immunoprecipitants were washed and eluted. The eluents were then de-cross-linked, and DNA was purified for polymerase chain reaction (PCR) analysis.ChIP assay was performed using the Millipore ChIP kit  according to the manufacturer's instructions. Briefly, cells were cross-linked and lysed, and DNA fragments were sonicated to an average size of 0.5\u2009kb. ChIP was then performed using 5\u2009\u03b2-Actin was used as a standard for normalization. miRNAs were extracted using the mirVanamiRNA isolation kit (Life Technologies). The relative expression levels of the miRNAs were determined using TaqmanmiRNA Assays (Life Technologies) normalized to RNU6B. All experiments were performed at least in triplicate. Detailed experimental procedures can be found in the To determine the mRNA expression levels of regular genes and pri-miR-224, total RNA was isolated from cultured cells using TRIzol reagent . cDNA was synthesized by reverse transcription using random hexamers and subjected to real-time PCR with the indicated primers in the presence of SYBR Green . 4 cells per well in serum-free medium. The lower chamber received 500\u2009\u03bcl of 10% fetal bovine serum-containing medium. Incubation was carried out for 36\u2009h at 37\u2009\u00b0C in humidified air with 5% CO2. Migrated cells on the lower surface were fixed with methanol and stained with Giemsa. The number of migrating cells was determined by counting five high-powered fields (200 \u00d7) on each membrane. The migration assay was a modification of the invasion assay described previously. A total of 3 \u00d7 104 cells were placed in the upper chamber in serum-free medium. The lower chamber was filled with medium containing 10% fetal bovine serum. Cells were allowed to migrate through a porous, uncoated membrane for 24\u2009h at 37\u2009\u00b0C. The membrane was processed as described for the invasion assay. The number of migrating cells was determined by counting five high-powered fields (200 \u00d7) on each membrane. Each test group was assayed in triplicate.Invasion assays were performed using a 24-well invasion chamber system . Cells were trypsinized and counted with a hemocytometer using Trypan blue, and viable cells were seeded in the upper chamber at a density of 3 \u00d7 1044 Further details are provided in the The MTT assay, colony formation assay, soft agar colony formation assay, apoptosis flow cytometry and immunohistochemistry (IHC) were conducted according to previously described methods.t-tests, unless indicated otherwise. P-values <0.05 were considered statistically significant.Statistical analyses were performed with SPSS . Data are represented as means with S.D., and statistical significance was determined with unpaired Student's"}
+{"text": "STAT3 and STAT5 proteins are oncogenic downstream mediators of the JAK\u2013STAT pathway. Deregulated STAT3 and STAT5 signaling promotes cancer cell proliferation and survival in conjunction with other core cancer pathways. Nuclear phosphorylated STAT3 and STAT5 regulate cell-type-specific transcription profiles via binding to promoter elements and exert more complex functions involving interaction with various transcriptional coactivators or corepressors and chromatin remodeling proteins. The JAK\u2013STAT pathway can rapidly reshape the chromatin landscape upon cytokine, hormone, or growth factor stimulation and unphosphorylated STAT proteins also appear to be functional with respect to regulating chromatin accessibility. Notably, cancer genome landscape studies have implicated mutations in various epigenetic modifiers as well as the JAK\u2013STAT pathway as underlying causes of many cancers, particularly acute leukemia and lymphomas. However, it is incompletely understood how mutations within these pathways can interact and synergize to promote cancer. We summarize the current knowledge of oncogenic STAT3 and STAT5 functions downstream of cytokine signaling and provide details on prerequisites for DNA binding and gene transcription. We also discuss key interactions of STAT3 and STAT5 with chromatin remodeling factors such as DNA methyltransferases, histone modifiers, cofactors, corepressors, and other transcription factors. Over the past decade, extensive next-generation sequencing (NGS) efforts and comparative data integration have provided insights into the mutational landscape of human cancer genome coding exons. These studies defined ~140 different cancer driver genes within 12 core cancer pathways that, when mutated, can promote tumorigenesis . It is sRecent technological advances in molecular biology, resulting from the rise in \u201cnext-generation\u201d techniques, have revealed new aspects of JAK\u2013STAT signaling including recurrent somatic mutations of STATs, a plethora of novel DNA-binding sites, post-translational modifications (PTMs), and protein\u2013protein interactions (PPIs), all of which have significant impact on the chromatin landscape. These findings have led to new mechanistic insights into the molecular processes of tumorigenesis that are not only induced by constitutively active STAT, but also regulated by non-canonical STAT functions. STAT3 and STAT5 are of particular interest because they are not only activated by a wide variety of ligands that control proliferation, survival, cell\u2013cell communication, adhesion, and angiogenesis , but theGiven that chromatin remodeling and the JAK\u2013STAT pathway are both core cancer pathways Fig.\u00a0 and are STAT proteins act as transcriptional activators upon phosphorylation of a conserved tyrosine residue at the C terminus followed by translocation into the nucleus, where they bind to DNA and activate target gene transcription . STAT-biOverall, STAT5A dimers do not bind as efficiently to DNA as STAT5B dimers, which can also recognize 4\u2009bp spaced motifs of TTCT/CN2A/GGAA. STAT5A preferentially forms tetramers even when two weak STAT5 affinity sites are in close proximity. Tetramerization has not been prominently reported for STAT5B, however upon heterodimerization with STAT5A, STAT5B can efficiently take part in the formation of DNA oligomers that are bound at enhancer or promoter regions. There are several amino acid differences in both the oligomerization and DNA-binding domains of STAT5A/B and these could impact DNA-binding efficiency as dimers or oligomers. However, to date there are no crystal structure analyses to provide a deeper understanding of STAT5A or STAT5B oligomer configuration.The occupation of STAT-binding sites is cell-type specific. In fact, STAT binding is generally enriched in genes that are particularly important for the respective cell type. Bioinformatics analysis of murine and human ChIP-seq data estimated up to ~100,000 sequences occupied by STATs in cells that display high STAT activity , but binding sites were up to 20-fold lower in cell lines with less STAT abundancy , where ~94% of such sites contained a GAS-like core sequence . InteresThe use of various transgenic mice and cell types for extensive analysis of genomic STAT5-binding patterns led to the identification of binding motifs for different transcription factors, which are enriched around the center of STAT5-binding sites Fig.\u00a0. These iFurther interactions of STAT5 with chromatin-binding proteins or other transcription factors such as nuclear factor kappa B (NF\u03baB), the ubiquitously expressed octamer-binding factor 1 (OCT1) and the more B-cell-restricted OCT2 transcription factors were shown. Furthermore, centrosomal P4.1-associated protein (CPAP) was reported to act as a STAT5 coactivator to enhance transcription . These pFH) cells [B cell lymphoma protein 6 (BCL6) is an evolutionarily conserved zinc finger transcription factor, which functions as a transcriptional repressor and has essential roles in germinal center B cell differentiation, self-renewal of memory B cells, as well as in the development of follicular helper T (TH) cells . BCL6 isH) cells . IntriguH) cells , and STAH) cells , suggestFH cell generation due to upregulation of BLIMP-1, which results in repression of BCL6 expression [FH generation. A recent analysis of BCL6-binding sites in TFH cells revealed shared BCL6 and STAT5-binding sequences, as well as reduced IL-7 receptor/STAT5 signaling by BCL6 [The roles of STAT5A and STAT5B in the regulation of BCL6 expression are quite controversial. It has been demonstrated that STAT5B upregulates BCL6 in a subset of germinal center cells . On the pression . Since B by BCL6 . These rRecently, it was shown that BCL6 serves as a male-specific transcription factor mediating GH-regulated sexual dimorphism of gene expression in the liver . SpecifiCytokine-dependent STAT3 and STAT5 activation and effects on chromatin are physiologically transient. In contrast, cells that harbor STAT5-activating mutated or modified oncoproteins, like BCR-ABL, JAK2 V617F, mutant MPL (thrombopoietin receptor), and mutant calreticulin in myeloproliferative neoplasms will exhibit persistent activation of STAT5, with high constant levels in the nucleus . Both BCSince the STATs were discovered it has become increasingly evident that, in addition to their binding to GAS elements, epigenetic regulation is a crucial and dynamic part of their gene regulation activity. In response to DNA element binding of transcriptional activators or repressors, the modification of histones by methylation, acetylation, and phosphorylation results in important changes to chromatin structure regulating gene transcription . Histonereg) cells, FOXP3 acts as a co-transcription factor that facilitates STAT3-mediated IL-10 expression by recruiting HAT1 to the IL-10 locus [IL-10 promoter, creating space for subsequent docking of STAT3\u2013FOXP3 complexes.STAT3 acetylation on Lys685 within the SH2 domain by the histone acetyltransferase (HAT) p300/CBP promotes STAT3 dimerization, DNA binding, and transcriptional activation in human liver and prostate cancer cell lines  Fig.\u00a05a5a. Howev10 locus  Fig.\u00a05creg cellsmiR-200c, in leptin-treated breast cancer cells [EZH2 gene in gastric cancer cells, implicating STAT3 as direct regulator of EZH2 [Notably, STAT3 can also be methylated on Lys49 and Lys180 by EZH2, the lysine methyltransferase subunit of the polycomb repressive complex 2 (PRC2) in glioblastoma, colon cancer, and breast cancer cell lines , 53 Fig. Methylaer cells   complex were originally identified to associate with nuclear hormone receptors thereby conferring transcriptional repression and subsequently has been shown to be recruited to many classes of transcription factors and is also a component of multiple protein complexes containing HDAC proteins . This asPTPN6, IL-2R\u03b3, CDKN2A, DLEC1, and STAT1 by CpG methylation in malignant T lymphocytes and breast cancer cells [DNMT1 gene promoter in malignant T cells inducing its expression [PTPN6 gene product SHP-1 [STAT3 also mediates oncogenesis by recruiting DNA methyltransferase 1 (DNMT1) to gene promoters to silence tumor suppressor genes, such as er cells , 60 -dependent transcription  Fig.\u00a06a6a. The Peg cells   and HDAC3 exert transcriptional regulation of STAT5A targets and facilitate target gene repression by either deacetylation or histone demethylation, respectively Fig.\u00a0. Like STDNMT3A in human CD34+ AML cells and thereby increases its transcriptional activity, which leads to methylation and thus transcriptional silencing of the tumor suppressor PTEN [reg cells could not be shown [Intestinal STAT5 has an important function in maintaining genome integrity, which was shown for gamma irradiation-mediated intestinal crypt damage. This damage was more severe upon complete STAT5 loss, and could be antagonized by inducible STAT5 expression . pYSTAT5sor PTEN . On the be shown .These results suggest a mechanism that governs the switch between recruitment of coactivators versus recruitment of corepressors by STAT5. Attractive alternatives are either dimers versus tetramers or differential PTMs of STAT5 discriminating between coactivator or corepressor recruitment. Graded pYSTAT5 levels are likely key determinants in opening or closing gene loci. Upon cytokine-dependent activation, STAT5 not only binds to canonical DNA-binding sites as a dimer, but is also able to increase its transcriptional repertoire through binding to tandem repeats of such binding sites as a homo- or heterooligomer with STAT1/3/4 . OligomePrior to activation, uSTAT is maintained as a pre-formed anti-parallel homo- or heterodimer in the cytoplasm, via interaction between the coiled-coil domains . NotablySTAT proteins have three different functions in the non-tyrosine phosphorylated state : (i) as Drosophila STAT92E [Besides transcriptional regulation, uSTATs might have important roles in cellular compartments other than the nucleus, including mitochondria, Golgi apparatus, and endoplasmic reticulum (ER). Recent work highlights important roles of serine phosphorylated STAT3 in the mitochondria, where it supports RAS-dependent oncogenic transformation in myeloproliferative neoplasms and participates in cellular respiration , 94. Sim STAT92E . AlthougSmc3, another subunit of multimeric cohesin [Smc3 mutation, with enhanced STAT5 binding at its response elements due to more relaxed/accessible chromatin.A recent study demonstrated that DNA-associated uSTAT5 and CTCF might influence each other\u2019s transcriptional activity  Fig.\u00a07)7). CTCF  cohesin . Here, tEnhancer selection by STAT5 is cytokine-dependent, and the stability and function of STAT5 at enhancers and promoters is well characterized . HoweverSTAT3/5 proteins are the predominant oncogenic transcription factors of the JAK\u2013STAT pathway and regulate gene expression in conjunction with other transcriptional regulators. Therefore, their expression levels and activity are crucial factors, in addition to their interaction with other transcription factors and various epigenetic modifiers such as EZH2, TET1/2, DNMT3A, the corepressor, and histone deacetylase NCoR1/2 and the coactivator histone acetyl transferases p300/CBP. How these interactions are sustained in different cell types and how they change the chromatin landscape dependent on cytokine stimulation remains to be investigated. However, the concept of classic cytokine-mediated JAK\u2013STAT signaling will need to be redefined in the era where we begin to understand chromatin dynamics and gene regulation.Insights into cancer genome landscapes provide evidence that constitutive activation of STAT proteins and epigenetic gene reprogramming are important hallmarks of human cancer initiation, progression, and metastasis. Future studies will be required to elucidate which transcription factors act as pioneer factors that recruit other transcription factors or cofactors/corepressors to shape chromatin, and how they interplay with chromatin regulators. Detailed 3D chromatin architecture and transcription factor binding analyses combined with chromatin proteomic studies will increase our understanding of how the same key molecules participate in different cellular aspects, ranging from physiological processes like survival, differentiation, and senescence, to transformation and cancer progression. Given the clear importance of the JAK\u2013STAT pathway and their interplay with chromatin remodeling enzymes in the initiation and progression of cancer, targeting of STAT3 and/or STAT5 is of high therapeutic relevance. Furthermore, targeting these pathways in combination with inhibitors against epigenetic modifiers could provide novel treatment avenues."}
+{"text": "Although most of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs are thymus-derived, their repertoire adapts to microbial flora. Here, using high throughput TCR sequencing we examined how clonal diversity of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs changes upon exposure to commensal-derived antigens. We found that fraction of CD8\u03b1\u03b1+ IELs and CD4+ T cells express identical \u03b1\u03b2TCRs and this overlap raised parallel to a surge in the diversity of microbial flora. We also found that an opportunistic pathogen (Staphylococcus aureus) isolated from mouse small intestine specifically activated CD8\u03b1\u03b1+ IELs and CD4+ derived T cell hybridomas suggesting that some of TCR\u03b1\u03b2CD8\u03b1\u03b1+ clones with microbial specificities have extrathymic origin. We also report that CD8\u03b1\u03b1CD4+ IELs and Foxp3CD4+ T cells from the small intestine shared many \u03b1\u03b2TCRs, regardless whether the later subset was isolated from Foxp3CNS1 sufficient or Foxp3CNS1 deficient mice that lacks peripherally-derived Tregs. Overall, our results imply that repertoire of TCR\u03b1\u03b2CD8\u03b1\u03b1+ in small intestine expends in situ in response to changes in microbial flora.In the gut, various subsets of intraepithelial T cells (IELs) respond to self or non-self-antigens derived from the body, diet, commensal and pathogenic microbiota. Dominant subset of IELs in the small intestine are TCR\u03b1\u03b2CD8\u03b1\u03b1 Most TCR\u03b1\u03b2+ IELs express CD8\u03b1\u03b1 homodimers and can bind to classical MHC class I and epithelial cell-associated non-classical MHC molecules, including mouse thymic leukemia antigen (TL)2. It is anticipated that majority of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs are thymus-derived, and this subset contribute to induction of tolerance to self-antigens, whereas peripherally-induced TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs co-express CD4 coreceptor and tend to recognize microbe-derived antigen(s). This notion is supported by the evidence that immature thymocytes from T cell receptor (TCR) transgenic mice differentiate to TCR\u03b1\u03b2+CD8\u03b1\u03b1+ IELs when the former cells become exposed to a high dose of their cognate antigen4. In contrast, TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ IELs differentiation occurs upon contact with exogenous antigens instead of self-antigens, and therefore this subset is considered as an antigen-specific \u201cadaptive\u201d counterparts of innate-like TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs of thymic origin5. This paradigm is also corroborated by experiments which showed that germ-free (GF) mice and mice fed with an elementary diet lacking protein antigens had fewer intestinal TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ but normal number of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs, suggesting that only former subset sustainability depends on microbiota or external antigens7. Notably, in GF mice the repertoire of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs is surprisingly diverse, but it changes following microbial colonization, indicating that this IEL subset also evolves locally upon contact with antigens derived from commensal flora9. How cross talk between gut commensal flora and TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs is orchestrated is an outstanding question that must be answered to understand the relationship between dysbiosis and intestinal inflammation, and to design new therapeutic approaches10.The intraepithelial layer of a small intestine is inhabited by several subsets of TCR\u03b1\u03b211. First, cloning and retroviral expression of several \u03b1\u03b2TCRs from various CD8\u03b1\u03b1+ IEL clones showed that these receptors are unique, recognize various classical and non-classical MHC molecules for their selection and antigen recognition, and serve a nonredundant function in the gut12. This motion was further reinforced by results of cloning and re-expression of \u201cunconventional\u201d \u03b1\u03b2TCRs from CD4\u2212CD8\u2212 (DN) thymocytes that biased these cells differentiation to CD8\u03b1\u03b1+ IEL lineage, demonstrating that these cells development is guided by \u03b1\u03b2TCRs specificity13. Unexpectedly, thymocytes expressing monoclonal TCR\u03b1\u03b2 cloned from pTreg cells also differentiated to TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs lineage unless their precursor frequency in the thymus was low, which redirected their commitment to pTregs14. This result implied that Tregs and IELs can express common \u03b1\u03b2TCRs that can support commitment to both lineages depending on precursor frequency. Finally, pTregs have been found to be a main reservoir of induced TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ (iIELs) in the small intestine7, inferring that although differentiation of thymocytes or peripheral T cells to IELs is guided by their receptors specificity, other cues including clonal competition and cytokines also contribute to IEL\u2019s precursors commitment.Not surprisingly, multiple experimental evidence suggests that specificity of \u03b1\u03b2TCRs for self or microbial antigens influences these cells lineage commitment+ IELs isolated from the small intestine from individual mice can share identical \u03b1\u03b2TCRs, indicating that the two mucosal compartments may exchange individual T cell clones15. Although it is likely that an induction of CD8\u03b1\u03b1 homodimer can be controlled by the \u03b1\u03b2TCR signal strength and the stronger the signal, the higher the level of CD8\u03b1\u03b1 induction on primary effector cells, the specific ligands that induce this coreceptor locally in the gut remain unknown. Furthermore, because in appropriate environment anergic T cells become pTregs which then may convert to TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ IELs, it is possible that the repertoire of the latter subset is continuously amended in the periphery in response to encountered microbiota, their metabolites or food-derived antigens7. An identification of gut-specific ligands that are recognized by CD8\u03b1\u03b1+ IELs should help us understand how these cells become activated and in what circumstances they get involved in intestinal homeostasis. In the past, an origin of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs has been investigated at the population rather than clonal level, and when individual IELs were examined these cells expressed identical, transgenic TCR\u03b1\u03b2, whereas an all-inclusive fate mapping at the level of individual CD8\u03b1\u03b1 clones that comprise this subset has not been performed.Reportedly repertoires of conventional T cells and intraepithelial TCR\u03b1\u03b2CD8\u03b1\u03b1mini mice) in addition to Foxp3GFP reporter, to examine how contact with microbiota-derived antigens induces CD4+ T cells reprogramming to IELs in vivo. We report that: 1/Direct comparison of \u03b1\u03b2TCRs expressed on DN thymocytes and TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs showed that no more than 50% of IELs expressed TCRs shared with their anticipated thymic precursors 2/Upon an introduction of new commensal(s) strains to GF TCRmini mice, both natural and induced TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs subsets responded by selective clonal expansions, 3/Introduction of a broad microbial flora resulted in increased similarity between intestinal CD4+ and both TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs subsets, which only in part depended on the presence of pTregs. 4/A microbial strain isolated from small intestine of TCRmini mice and identified later as Staphylococcus aureus, activated both TCR\u03b1\u03b2CD4+ and TCR\u03b1\u03b2CD8\u03b1\u03b1+ derived T cell hybridomas, suggesting that some of TCR\u03b1\u03b2+CD8\u03b1\u03b1+ IELs have peripheral origin and recognize microbial antigens. 5/Mice lacking pTregs had reduced diversity of TCR\u03b1\u03b2 CD8\u03b1\u03b1CD4+ but not TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs. Thus, our results suggest that outside of the main, intrathymic pathway of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs differentiation, mature CD4+ T cells can acquire CD8\u03b1\u03b1 expression and downregulate the original co-receptor.Here, we used mice where T cells co-express a heterogenous but restricted and fully controllable \u03b1\u03b2TCR repertoire  and Nur77GFP labels antigen-triggered lymphocytes18. In TCRmini mice timely expression of \u03b1\u03b2TCR guides natural commitment of thymocytes to various T effector subsets including CD4+Foxp3+ regulatory17 and IEL lineages. Accordingly, as shown in Fig.\u00a0mini and wild type mice expressed \u03b1\u03b2TCRs, albeit at slightly lower level as compared to CD4+ and CD8+ thymocytes presumably because these TCRs have higher affinities for self MHC/peptide complexes20. In the lymph nodes and spleen, most cytotoxic T cells represented conventional CD8\u03b1\u03b2+ lineage, although in both strains a small subset of the TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs was spotted in their spleens . When entire repertoires were compared, the \u03b1\u03b2TCRs shared by DN TCR\u03b1\u03b2+ thymocytes and intestinal TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs constituted 23% in GF mice and 13% in SPF mice, and in both strains these cells accounted for approximately 50% of all sequences retrieved from TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs . This small consortium consists of eight, well defined microbial species and has been used to study plasticity in T cells lineage commitment upon an encounter of specific microbial flora21. As shown in Fig.\u00a0+ IELs increased significantly in colonized GF mice as compared to GF controls, and further analysis of \u03b1\u03b2TCR repertoire on IELs from these mice showed that introduced microbial antigens lead to an expansion of several clones expressing \u03b1\u03b2TCRs not found on a respective subset in GF TCRminiFoxp3GFP mice. New TCRs not found on TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs in GF TCRmini mice become abundant on this subset . These observations suggested that some of commensals or opportunistic pathogens found in conventional mice support in situ expansion or differentiation of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs.To further examine the role of microbe-derived antigens on IELs heterogeneity, we examined an impact of microbial flora on TCR\u03b1\u03b2CD8\u03b1\u03b1ice Fig.\u00a0. ConventELs Fig.\u00a0. A 16S rice Fig.\u00a0. In addi+ IELs, we used an oral gavage to transfer fresh content of small intestine from conventionally reared TCRmini mice to SPF mice. Three weeks after this transfer the SPF TCRmini mice colonized with flora from conventional TCRmini animals were sacrificed, we isolated their IELs and examined their TCR\u03b1 CDR3 repertoires. Though as previously noted the total number and proportions of IELs in mice reared in SPF or conventional facilities appeared similar   Fig.\u00a0. In addiome Fig.\u00a0. We alsoome Fig.\u00a0). These + IELs continues in the gut, and that this process involves recruitment of microbe-specific CD4+ cells. To further test this possibility, we sort-purified peripheral TCR\u03b1\u03b2CD4+ T cells from either wild type B6 or TCRminiNur77GFP mice (purity 98.6%) and adoptively transferred these cells into lymphopenic TCR\u03b1\u2212 deficient, double deficient (TCR\u03b1\u2212Ab\u2212) or TCR\u03b1\u2212AbEp63K recipients where all Ab molecules remain covalently bound with a single self-peptide (Ep63K). The Ep63K peptide is an analog of naturally occurring E\u03b1(52\u201368) peptide with a single substitution in position 63, and the AbEp63K complex is recognized as agonist by a fraction of CD4+ T cells derived from TCRmini mice22. Only in the first type of recipient microbial antigens can bind to Ab, whereas other recipients lacked Ab or have Ab bound with a single, covalently- linked self-peptide. Three weeks after transfer, we sacrificed all recipient mice and examined them for a presence of transferred CD4+ cells in small intestine and mesenteric lymph nodes  or upon contact with only a single self-peptide (TCR\u03b1\u2212AbEp recipients) most transferred CD4+ cells died off due to lack of subtle survival signals provided by their \u03b1\u03b2TCRs. In contrast, last two recipients had a sizable population of CD8\u03b1\u03b2+ IELs residing in LNs and the epithelium of the small intestine .Therefore, reprogramming of CD4+ T cells to CD8\u03b1\u03b2 lineage most likely represents these cells alternative lineage commitment rather than a temporary phase that mirrors TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs phenotype24. Thus, these data support the hypothesis that peripheral recruitment of CD4+ T cells to TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs compartment depends on specific antigen(s) bound to class II MHC (Ab).Presented above results suggested that an expansion of repertoire expressed by TCR\u03b1\u03b2CD8\u03b1\u03b1des Fig.\u00a0. Interesine Fig.\u00a0, resemblium Fig.\u00a0 and abun+ T cells and TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs sharing identical \u03b1\u03b2TCRs was found in conventionally reared TCRmini mice, we hypothesized that microbe-derived antigens that bind to Ab and are exclusive for this colony facilitate conversion of intestinal CD4+ clones. To identify intestinal commensals that may provide these antigens, we propagated ex vivo several bacteria retrieved from conventionally reared TCRmini mice. When these bacteria phylogenetic affiliation was revealed by 16S sequencing, we found that one sample represented an opportunistic pathogen Staphylococcus aureus  hybridomas that showed elevated expression of Nur77GFP reporter following co-culture with autologous APCs preincubated for 6\u2009hours with S. aureus isolate, but not with control isolate from other bacteria (labelled as 5.2)  had same \u03b1\u03b2TCRs expressed by TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs  Fig.\u00a0. Notablymas Fig.\u00a0, supportELs Fig.\u00a0, support+ IELs in the small intestine originate from CD4+Foxp3+ peripherally-derived regulatory cells (pTregs)7. Peripherally-derived Tregs (pTregs) are abundant in the colon, but sparse in the small intestine because upon entry to epithelial layer these cells downregulate Foxp3, retain CD4 and acquire CD8\u03b1\u03b1 expression26. Therefore, we next examined whether mice that lack pTregs will continue to expand their CD8\u03b1\u03b1+ IELs repertoire via an extrathymic recruitment of TCR\u03b1\u03b2CD4+ cells. For this purpose, we crossed TCRminiFoxp3GFP strain with pTregs-deficient CNS1mut mice that harbor mutation in regulatory element controlling extrathymic induction of Foxp327, and examined the number and clonal diversity of different subsets of IELs in the small intestine in these animals. As shown in Fig.\u00a026, TCRminiCNS1mut mice had reduced total number of TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ cells in the small intestine as compared to respective subset in TCRminiCNS1+ control mice. However, the subset of TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs was also reduced although not as much as in case of TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ population, suggesting that pTregs may convert in situ to both TCR\u03b1\u03b2CD8\u03b1\u03b1+ subsets of IELs. Further comparison of dominant \u03b1\u03b2TCRs expressed by TCR\u03b1\u03b2CD4CD8\u03b1\u03b1+ IELs vs CD4+Foxp3GFP+ cells from small intestine of TCRmini and TCRminiCNSmut mice showed that in both strains many \u03b1\u03b2TCRs were shared by both lineages, irrespectively of the presence or absence of pTregs, although in the former strain the similarity between both repertoires appeared to be higher  that in humans predominantly inhabits nose and skin, and in mice colonizes the small intestine28 and induces CD8\u03b1\u03b1 expression on TCR\u03b1\u03b2CD4+cells. However, in contrast to other microbial species that have a similar ability to support T cells lineage conversion, a portion of S. aureus induced CD4+ clones lost this co-receptor expression. This observation is in odd with the current view that TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs exclusively originate from immature DN thymocytes rather than peripheral cells, and their antigen specificities encompass self rather than microbe-derived antigens31. In the past, IELs that specifically reacted to antigens derived from Lactobacilli or Fecalibacterium species were TCR\u03b1\u03b2CD8\u03b1\u03b1CD4+ DP IELs which upon contact with microbiota-derived antigens downregulated Thpok expression33. However, other reports showed that TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs can differentiate from peripheral mature T cells but the specific cues responsible for this route of conversion or whether \u03b1\u03b2TCRs recognition of commensals species was involved has not been addressed34.Our study reveals yet another genus of Gram-positive bacterial strain , and activation markers  as respective subsets isolated from wild type mice. These findings suggested that restriction of T cells clonal diversity implemented in this mouse model did not limit these cells ability to naturally differentiate to IEL subsets in the thymus or in the periphery. This conclusion is also supported by a detailed analysis of repertoires on \u03b1\u03b2TCR+ DN thymocytes and TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs. When these subsets were retrieved from GF mice they had 23% of dominant TCRs shared, which accounted for almost half of all \u03b1\u03b2TCRs sequences retrieved from TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs. Thus, thymic imprint on TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs subset was foremost visible, implicating their mutual origin. However, we also found TCRs exclusive for \u03b1\u03b2TCRCD8\u03b1\u03b1+ IELs, which were not expressed on their anticipated thymic precursors, and their proportion was even higher in mice that were housed under SPF conditions. An origin of IELs expressing those \u03b1\u03b2TCRs remained to be determined.We found no evidence that expression of the restricted \u03b1\u03b2TCR repertoire somewhat modified differentiation or phenotype of intestinal TCR\u03b1\u03b2CD8\u03b1\u03b1+ cells, and their presence increased due to presence of microbes inhabiting TCRmini in conventional facility. In this facility, the small intestine microbiome of TCRmini showed an expansion of Lactobacilli at the cost of Bacteroidetes. Further analysis identified S. aureus as prominent, aerobic strain found only in conventional or conventionalized SPF but not SPF TCRmini mice. Although this bacteria was originally described as natural inhabitant in the mouse intestine35, so far its impact on the stability of CD4+ T cells lineage commitment has not been examined. We found that bacterial isolates from S. aureus were recognized by T cell hybridomas derived from TCR\u03b1\u03b2CD4+ and TCR\u03b1\u03b2CD8\u03b1\u03b1+ IELs, of which several were retrieved from SPF TCRmini mice co-housed with Staphylococcus-positive TCRmini cohort. The co-housing TCRmini SPF mice with their identical, conventional mice also increased the proportion of shared, abundant \u03b1\u03b2TCRs expressed by intestinal TCR\u03b1\u03b2CD8\u03b1\u03b1+ and TCR\u03b1\u03b2CD4+ IELs subsets.Unexpectedly the same \u03b1\u03b2TCRs were also sequenced from CD4e, and physiological function of these T cells remains unclear. Similarly, to supplementation of daily diet with L. reuteri to combat inflammation via enhanced production of inosine and idole-3 lactic acid, discriminatory fermentation and growth patterns of selected, nonpathogenic Streptococcus strains can directly modulate mucosal immune responses by reprograming mature T cells to regulatory lineages. To this time point, elucidating the role of the small intestinal microbiota, especially of the abundant and diverse Streptococcus species and how their protein homologs and/or metabolites impact the immune response is a task for the future36.The intestinal epithelium is unique in that it harbors auto-reactive T cells which \u03b1\u03b2TCRs are largely absent from the peripheral repertoire in normal micmini strains and mice with Foxp3GFP reporter were produced as previously described17. In brief, The TCRmini mice were obtained by crossing transgenic mice expressing V\u03b12 and J\u03b126 segments in germ line configuration with transgenic mice expressing TCR\u03b2 chain of the AbEp63K-specific \u03b1\u03b2TCRs and TCR\u03b1- mice. The TCRmini strain was also backcrossed with Nur77GFP reporter mice obtained from The Jackson Laboratory. The TCR\u03b1-, Ab- and C57BL/6 mice were purchased from Jackson Laboratory. Both females and males were used that were approximately 8 to 12 weeks old unless stated differently in the text. CNS1mutFoxp3GFP (CNS1mut) strain was obtained by mating Foxp3CNS1mut 37) with C57BL/6Foxp3GFP mice38. Only males were used from this strain. All animals were housed under specific pathogen-free conditions in the AU Animal Facility at Augusta, GA, and after we relocated our laboratory at GSU Animal Facility in Atlanta, GA. All experimental procedures were carried out in accordance with the relevant guidelines and regulations, which were reviewed and approved by the AU and GSU Institutional Animal Care and Use Committees.The TCR2+Mg2+-free PBS to remove feces and mucus, which was followed by a removal of Peyer\u2019s patches from the intestine wall. Next intestine was cut in pieces and shaken in Ca2+Mg2+-free HBSS which also contained 5% FBS, 2\u2009mM EDTA, and 1\u2009mM DTT for 15\u2009min at 37\u00b0. Then IELs were further purified with Percoll gradient and the single-cell suspension was further analyzed by flow cytometry.Thymii, lymph nodes and spleens from individual mice were harvested and passed through 100 \u03bcm net to obtain single-cell suspension. To isolate IELs from small intestine, this organ was cut off, flushed with Ca\u22121), anti-CD4 , anti-CD8\u03b1 , anti-CD8\u03b2 , anti-CD5 , anti-CD69 , anti-TCR V\u03b12 , anti-TCR V\u03b214 , anti TCR\u03b1\u03b2 . Intra-cellular staining was performed after treatment with cell fixation/permeabilization kit (eBioscience), according to the manufacturer\u2019s protocol. Monoclonal antibodies were obtained from: BD Biosciences, BioLegend or eBioscience. After staining, cells were analyzed using FACSCanto (BD) or Cytoflex (Beckman) cytometer, and data were analyzed using Flowjo V10 (TreeStar Inc.).Cell surface staining with monoclonal antibodies was done by standard procedures. The following antibodies were used: anti-CD4  or Sony (SH800) sorter with purity above 98%.For sorting, cells were stained with anti-CD4, anti-CD8\u03b1, anti-CD8\u03b2, anti-TCR V\u03b12. CD422. Total RNA was isolated from the sorted subsets using RNeasey Mini Kit (Qiagen) according to the manufacturer\u2019s protocol. Synthesis of the first complementary DNA (cDNA) strand was performed with a primer specific for the TCR C\u03b1 region (5\u2032-TCGGCACATTGATTTGGGAGTC-3\u2032) using Superscript III cDNA synthesis kit (Invitrogen). Incorporation of Ion Torrent sequencing primers (A-Kay and P1-Kay) to each TCR cDNA together with \u2018bar-coding\u2019 of DNA material was performed during the first amplification step using Accuprime Taq Polymerase (Invitrogen). The PCR reaction was carried out with a pair of primers specific to the V\u03b12 and C\u03b1 regions of the TCR\u03b1 chain. The sequence of the 1st primer was as follows: 5\u2032-CATCCCTGCGTG TCTCCGACTCAGXXXXXXXXXXGACTCTCAGCCTGGAGACT-3\u2032, where the embolden font highlights sequence specific to the V\u03b12 segment of TCR, italic font marks a bar-code sequence, and the bold font is a sequence of the forward sequencing primer A-Kay. The sequence of 2nd primer was as follows: 5\u2032-CCTCTCTATGGGCAGTCGGTGATTGGTACACAGCA GGTTCTG-3\u2032, where embolden font highlights nucleotides specific to constant region of TCR\u03b1 and bold font marks sequence of reverse sequencing primer P1-Kay. After denaturation (95\u2009\u00b0C for 2\u2009min) four cycles of PCR proceeded as follows: three cycles at 94\u2009\u00b0C for 15\u2009s/54\u2009\u00b0C for 15\u2009s/72\u2009\u00b0C for 40\u2009s and one cycle 94\u2009\u00b0C for 15\u2009s/58\u2009\u00b0C for 15\u2009s/72\u2009\u00b0C for 40\u2009s. The obtained cDNA was cleaned using AMPure XP kit (Beckman Coulter) and used for emulsion PCR amplification. PCR products were cleaned again with the AMPure XP kit and the molarity of each product containing various CDR3 libraries was calculated using quantitative PCR performed with A-Kay and P1-Kay primers, according to the manufacture\u2019s protocol . The libraries were mixed in equal molarity, subjected to the final amplification in the same conditions as described above, and sequenced at EdgeBio Systems . Low quality reads and incomplete and erroneous sequences were eliminated during data processing using filters provided by Ion Torrent Suite software. All sequences were aligned to the constant V\u03b12 and C\u03b1 regions and examined as described.Preparation of library for high throughput sequencing was performed as previously described6 of sorted CD4+CD25\u2212Foxp3GFP\u2212 cells from wild type or TCRmini mice to different TCR\u03b1\u2212 hosts. Mouse weight was monitored daily and the experiment was terminated when the recipient\u2019s weight reached 80% of starting weight.We transferred intravenously 2\u2009\u00d7\u200910+ or CD8\u03b1\u03b1 IELs from TCRmini mice were sort-purified and expanded in vitro for 3 (CD4+) or 7 (CD8) days in the presence of antiCD3 (10 \u00b5g ml\u22121) and IL-2 (50\u2009U/ml). Production of the T cell hybridomas from CD4+ and CD8+ were previously described, with the modification that CD8\u03b1\u03b1+ IELs were fused with BW variant transfected with CD8\u03b1\u03b1 as described40, and after fusion cultured in selecting medium that in addition to HAT contained 0.7\u2009mg/ml of G418. Reponses of hybridomas to APCs presenting antigens derived from cecal or bacterial lysates were determined based on change in the relative expression of Nur77GFP reporter using standard flow cytometry procedures, and by detecting the amount of IL-2 produced following activation. The two-sample t-test and one-way ANOVA test was used to calculate statistical significance.To identify antigen-specific \u03b1\u03b2TCRs, CD422. For the comparative analysis of the overlap a mutual information index (I-index) was used as defined41 together with a hierarchical (agglomerative) clustering procedure with Ward linkage method42. Stability of clustering was assessed via parametric  bootstrap - the 95% confidence bounds for similarity matrices were constructed based on the Frobenius norm. The sample coverage  was estimated according to the Good-Turing formula41. The CVG index was calculated using a resampling procedure  with varying sample sizes  to assess the effect of under-sampling on the analysis. Diversity was quantified using the effective number of species (ENS) and presented in the form of diversity profiles41. These profiles are plots of the order of the index versus the value of the index, thus enabling comparisons of diversity with more weight put on rare (the order of index lower than one) or abundant (the order of index higher than one) receptors. The 95% confidence bounds were constructed as described above. The significance of differences between individual samples or groups of mice was determined by two sample t- test and one-way ANOVA test using Origin 9.1 software, and 3 levels of statistical significance were used: p values\u2009<\u20090.1\u2009<\u20090.05 and\u2009<\u20090.01.Analysis was performed as previously described using the R statistical software (R 2.15.0)mini were sacrificed using carbon dioxide according to approved animal protocol, the content of their cecum was isolated and resuspended in phosphate-buffered saline in several concentrations. Next solutions were spread onto LB agar using sterile glass spatula, and plates were incubated under aerobic conditions (5% CO2) for 6 days at 37\u2009\u00b0C. Culture purity of single colonies was assured by streaking twice onto agar and was examined by observing cell morphology after Gram-staining and colony morphology. DNA was extracted from washed bacterial cell pellets using the DNeasy for pretreatment of Gram-positive bacteria.Two conventional reared TCR43. Amplicons were purified using agarose gel electrophoresis and the Wizard SV Gel and PCR Clean-Up System (Promega) and sent to Genewiz US for sequencing. Sequences of closely related organisms were obtained using the BLAST function of the NCBI server. All sequences were aligned using the BioEdit software, version 7.0.5.3 Percentages of similarity were calculated after unambiguous alignment of each isolated sequence with those of the most closely related species, using the DNA Distance Matrix function of the BioEdit and SILVA rRNA database available at www.arb-silva.de.The 16S rRNA genes were amplified using appropriate primersAll experimental protocols were approved by Augusta University or Georgia State University Biosaftety, Chemical and IACUC Institutional Committees. Methods were carried out in accordance with the relevant guidelines and regulations.All data generated or analysed during this study are included in this published article (and its Supplementary Information files).All resources will be made available to the academic community consistent with the spirit of scientific collaboration. To request mice or reagents, please contact corresponding author. Genetically modified mouse strains will be made available to investigators at academic institutions conducting non-commercial research.Supplemental information"}
+{"text": "In most human societies, there are taboos and laws banning mating between first- and second-degree relatives, but actual prevalence and effects on health and fitness are poorly quantified. Here, we leverage a large observational study of ~450,000 participants of European ancestry from the UK Biobank (UKB) to quantify extreme inbreeding (EI) and its consequences. We use genotyped SNPs to detect large runs of homozygosity (ROH) and call EI when >10% of an individual\u2019s genome comprise ROHs. We estimate a prevalence of EI of ~0.03%, i.e., ~1/3652. EI cases have phenotypic means between 0.3 and 0.7 standard deviation below the population mean for 7 traits, including stature and cognitive ability, consistent with inbreeding depression estimated from individuals with low levels of inbreeding. Our study provides DNA-based quantification of the prevalence of EI in a European ancestry sample from the UK and measures its effects on health and fitness traits. Mating between first or second-degree relatives is prohibited in most countries, yet it occurs and is under-studied. Here, Yengo et al. use large runs of homozygosity from the UK Biobank resource to provide DNA-based quantification of extreme inbreeding and its consequence for health and other complex traits. In humans, consanguineous mating leads to higher childhood mortality12 and to adverse effects on traits such as lung function13 and cognitive ability13. Because of its detrimental consequences, also referred to as inbreeding depression, a number of species have developed inbreeding avoidance mechanisms to limit its effects14. In humans, inbreeding avoidance mechanisms, include cultural and religious taboos on incest, and laws explicitly forbidding certain types of mating. For instance, the Sexual Offences Act (2003) in the UK specifically forbids mating between first-degree (parent\u2013offspring or fullsibs (FS), i.e., coefficient of relationship of 0.5) and second-degree , grandparent\u2013grandchild, avuncular or double-first cousins, i.e., coefficient of relationship of 0.25) relatives; and also forbids mating between step and relatives when one of the family members is below 18 years old. Cultural, legal, religious and health-related constraints strongly weigh on the ability to observe, and therefore study the causes and consequences of inbreeding between first- and second-degree relatives, hereafter referred to as extreme inbreeding (EI). A number of previous studies have attempted to quantify the prevalence and incidence of EI20. However, as underlined by van den Berghe21, the estimates which they produced are questionable given the \u201cdisinclination of family members to report incest when it occurs, and the countervailing bias of many scholars and crusaders to magnify the problem on which they build their career\u201d. Add to these limitations, the relatively small size of these studies (often <1000 participants) and the discrepancies between them with respect to the definition of EI, as some of these studies included mating between step-relatives21. Here, we leverage a large observational study of ~450,000 participants, the UK Biobank (UKB), to quantify EI and its consequences in contemporary European descents from the UK population. We compare our estimates with the prevalence of police-recorded cases of incest offences reported in the Crime Survey for England and Wales (CSEW) between April 2002 and March 2017. We also characterise the distribution of runs of homozygosity (ROHs) in EI cases and assess its consistency with theoretical predictions. Finally, we characterise the phenotypic consequences of EI on a number of health-related traits measured in UKB participants.Mating between close relatives, that is inbreeding, is reported in many species to yield deleterious outcomes, such as reduced fertility22 456,426 individuals of European ancestry among the 487,409 UKB participants who have been genotyped. Ancestry was called in our previous study using projected principal components analysis based on known ancestry and whole-genome sequence data from 2504 participants of the 1000 Genomes Project23 (Methods). Given that 12 participants had retracted consent, we only analysed 456,414 UKB participants in the present study. We used 301,412 quality-controlled genotyped single-nucleotide polymorphisms (SNPs) to call ROHs using the PLINK software (Methods). As in previous studies10, ROHs were defined as homozygous >1.5\u2009Mb long genomic segments (Methods). We then estimated for each study participant the percentage of their autosome comprising ROHs as a measure of inbreeding. Such inbreeding measure, hereafter denoted FROH, is a well-established predictor of pedigree inbreeding25. Following guidelines from the American College of Medical Genetics and Genomics (ACMG)27, EI was called for individuals with FROH\u2009>\u20090.1. The use of both FROH as a measure of inbreeding and of this threshold are recommended by the ACMG for detecting suspected consanguinity between parents.We previously identified95%: [1/4428\u20131/3106]). As a sensitivity analysis, and consistent with theory predicting much longer ROHs under EI, we re-estimated the prevalence of EI considering only ROHs\u2009>\u20092\u2009Mb or >5\u2009Mb long. Using these alternative definitions of ROH, also recommended in the ACMG guidelines, we detected 115  and 98  cases of EI, respectively. We also estimated the prevalence of EI using allele-frequency based inbreeding measures or using ROHs detected on both autosome and X-chromosomes of female participants. (Supplementary Table\u00a0t test: p\u2009>\u20090.05) from our first estimate based on ROHs\u2009>\u20091.5\u2009Mb, we will hereafter only consider ROHs\u2009>\u20091.5\u2009Mb.We thus identified 125 unrelated participants  whose genomes are consistent with their parents being first- or second-degree relatives. That represents a prevalence of EI ~0.03%, i.e., ~1/3652  to 1/4699 (CI95%: [1/4787\u20131/4612]). The latter estimate is of the same order of magnitude as our estimated prevalence of EI in the UKB although these two estimates are based on different time periods (births 1938\u20131967 in the UKB vs. reports 2002\u20132017 in the CSEW). We then compared the mean years of birth among EI cases with the rest of UKB participants and found no statistical difference (p\u2009=\u20090.11). That suggests that the prevalence of EI is relatively unchanged over time although mean inbreeding coefficients have significantly decreased over the years . However, it is important to note that the prevalence of EI and that of police-recorded incest offences cannot na\u00efvely nor strictly be compared because (i) only an unknown but likely small fraction of incest cases are reported to the police, (ii) not all cases of incest would result in viable offspring as observed in this study, and (iii) viable offspring with severe cognitive impairment due to inbreeding are unlikely to enrol themselves as participants in the UKB.We then compared our estimate of the prevalence of EI with the prevalence of incest offences reported in the CSEW between April 2002 and March 2017. That survey reports a total of 11,196 cases of police-recorded incest offences over this time period (URLs). Relative to the population of England and Wales, which varied from 52,602,200 to 58,744,600 between those years (URLs), this represents a prevalence ranging from ~1/5247  or height28), may lead the prevalence of EI in the UKB to be an underestimation of the actual prevalence of EI in the UK population. As a consequence, our estimate of prevalence of EI is likely conservative, although the magnitude of the underestimation is difficult to predict as it depends on many other unknown factors which might differ between UKB participants and the general population.Fry et al.FROH. To determine an optimal threshold, we simulated inbreeding under MT1 and MT2 using phased genotypes from 972 unrelated UKB participants  we found that FROH as a predictor of underlying mating type (MT1 vs. MT2) yields an area under the receiver operating characteristic curve (AUC) of ~0.97 and that using FROH\u2009>\u20090.17 as a threshold yields optimal sensitivity and specificity both >0.92  vs. second-degree relatives MT2) using a threshold-based approach based on  using a \u03c0PO/FS). Given that the theoretical expectation of FROH is 0.25 both under PO and FS mating, we found, as expected, that FROH alone cannot discriminate PO from FS in our simulations (AUC of ~0.5).We further attempted to quantify the proportion of MT1 born from PO vs. FS mating  under PO or FS mating are different and if so can discriminate those two types of mating. We found on average over ~20,000 simulation replicates that NROH ~45 ROHs are detected in offspring of FS mating as compared to NROH ~38 ROHs detected in offspring of PO mating  EI cases with FROH\u2009>\u20090.17 are likely offspring of parent\u2013offspring mating. We also considered an alternative approach that aims at directly estimating the proportion of EI cases born from PO vs. FS mating from modelling the length distribution of ROHs (Methods). We applied this method to 2244 ROHs segments detected in 54 EI cases with FROH\u2009>\u20090.17 and estimated that \u03c0PO/FS ~67.6% (CI95%: [45.2\u201390.1%]). To confirm this finding, we analysed the distribution of FROH from X-chromosome ROHs (hereafter denoted FROH-X) in 26 female EI cases with FROH\u2009>\u20090.17. This analysis is justified by the fact that the theoretical expectation of FROH-X equals 0.5 under PO mating vs. 0.25 under FS mating. We first stratified these 26 female EI cases into two groups (Group 1 and Group 2) depending on whether the likelihood of their autosomal segments lengths is larger under PO mating or under FS mating. More specifically, Group 1 (N\u2009=\u200910) and Group 2 (N\u2009=\u200916) contain female EI cases predicted to be offspring of FS and PO, respectively , consistent with PO mating, while the mean FROH-X in Group 1 is 0.34 (CI95%: [0.19\u20130.49]), which is consistent with FS mating, although standard errors are large. Altogether, we found that between 44.4 and 67.6% of EI cases with FROH\u2009>\u20090.17 are likely offspring of PO mating.However, ng Table\u00a0. Moreoveng Table\u00a0. ConsistFROH\u2009>\u20090.1 threshold recommended by the ACMG guidelines to discriminate MT1 or MT2 from MT3. We recall here that the coefficient of relationship between first-cousins is 0.125, and therefore the expected inbreeding coefficient of their offspring is E[FROH]\u2009=\u20090.5\u2009\u00d7\u20090.125\u2009=\u20090.0625. Also, MT3 is legal in most countries and thus more common in the population. We found over ~20,000 simulation replicates that FROH yields an AUC of ~0.95, and that using FROH\u2009>\u20090.1 as a threshold yields a sensitivity of ~0.94 and a specificity of ~0.79 to discriminate MT1 or MT2 from MT3  in order to quantify the ability of the FROH\u2009<\u20090.01) in the population . Mixtures of exponential distributions represent a flexible family of probability distributions, from which the exponential distribution is a special case. We selected the number of mixture components best fitting the data using the Bayesian Information Criterion (BIC). To calibrate our inference, we first estimated the length distribution of >282,635 simulated true HBD segments under various mating types. Our simulations are based on observed recombination maps from the 1000 Genomes Project23, and therefore do not make additional assumptions regarding recombination rates (Methods). We found for all simulated mating types that BIC selects two mixture components, which suggests that the single exponential distribution is likely too simple to characterise the length distribution of HBD segments. Of note, mixtures of two exponential distributions also yield a better fit than gamma distributions that have previously also been proposed1. Similarly, we estimated the length distribution of >99,794 ROHs detected in our simulated data. We found consistently that the length distribution of simulated ROHs is also well characterised by a mixture of two exponential distributions. We report in Table\u00a0Previous theoretical studies have often considered the length of genomic segments homozygous by descent (HBD) to follow an exponential distributionAnother observation in our simulations was that that the mean number of ROHs detected in an individual was larger than the number of true HBD segments simulated. This somewhat counterintuitive observation is explained by the fact that HBD were defined as segments identical-by-descent (from parents to offspring), while ROHs were re-estimated from the genotypes of simulated offspring. As a consequence, although simulated offspring of matings between unrelated parents have exactly zero HBD segments, they still harbour ROHs\u2009>\u20091.5\u2009Mb given that their chromosomes were sampled from 972 existing UKB participants. Despite not being closely related (genomic relationship (GRM)\u2009<\u20090.05), these 972 UKB participants are still likely to have a distant common ancestor (>25 generations ago), which would lead to detection of ROHs\u2009>\u20091.5\u2009Mb in their (simulated) offspring. We found that simulated offspring of matings between unrelated parents had on average 4.8 ROHs\u2009>\u20091.5\u2009Mb , handgrip strength , lung function measured as the peak expiratory flow (PEF), visual acuity (VA), auditory acuity (AA), number of years of education (EA), fluid intelligence score (FIS), cognitive function measured as the mean time to correctly identify matches (MTCIM) and fertility measured as the number of children (NCh). We performed linear regressions of these traits on the EI status adjusted for age at recruitment, recruitment centre , sex, year of birth (treated as a continuous variable), genotyping batch (treated as a factor), socioeconomic status measured by the Townsend deprivation index and population structure measured by ten genetic principal components estimated from HM3 SNPs. As expected, we found that EI cases had a reduced mean in these ten traits as compared to EI controls. More specifically, we found phenotypic means in EI cases to be between 0.3 and 0.7 standard deviation below the population mean (Table\u00a0p\u2009<\u20090.5/10\u2009=\u20090.005) for 7 out the 10 traits (Table\u00a0B), which represents the number of loci with deleterious alleles that would cause one death on average if made homozygous3. As previously recommended34, we estimated B using Poisson regression of the number of children engendered onto FROH. Poisson regression was performed using a logarithmic link function as also previously recommended34 and adjusted for the same covariates listed above. For this analysis, we used the entire distribution of FROH,  and found an estimate of B ~1.46 , which we previously showed to be more powerful for detecting inbreeding depression4. The latter analysis did not reveal a significant deviation from the linear prediction  regardless of the inbreeding measure used, which therefore underlines that the observed phenotypic reduction in EI cases is consistent with inbreeding depression observed within EI controls , phenotypes are expected to decline linearly with increased inbreeding. However, if epistasis contributes to inbreeding depressionp\u2009=\u20093.6\u2009\u00d7\u200910\u22125; Table\u00a0p\u2009=\u20094.4\u2009\u00d7\u200910\u22124; Table\u00a0We next analysed the number of diseases diagnosed in an individual as an overall measure of health (Methods). We used overdispersed Poisson regression to estimate the relative risk (RR) of being diagnosed with at least one disease in EI cases as compared to EI controls. We found a RR of ~1.44 , consistent with a previous study13, which reported association between FROH and the same index in the UKB.We tested the association between EI and the Townsend depression index, which quantifies the level of socioeconomic deprivation in areas where UKB participants live. We found significant evidence that EI is enriched in more socioeconomically deprived area . Given the significance of this difference we therefore focused all subsequent comparisons in nonadopted participants  in order to minimise biases due to differential reporting of parental traits.We further investigated the social contexts in which EI arose. For that we compared different characteristics of the parents of EI cases with that of the parents of EI controls. We found that 14.5%  of EI cases vs. 1.5% of controls reported to be adopted as a child . Note that the absence of geographical clustering that we report only applies to these extreme events and could also reflect lack of statistical power as we still observed variance in mean FROH between different geographical areas of the UK. Altogether, although we observed that EI is more prevalent in more socially deprived areas of the UK, our results point to an absence of evidence that social and geographical stratification of parents contribute to the prevalence of EI in the population.Previous studies28. It also worth mentioning that our estimate only accounts for mating between close relatives that have led to viable offspring. Altogether, our findings suggest that the prevalence of EI in the population is small and that very large observational studies are required to quantify it accurately.In this study, we estimated a prevalence of EI of ~1/3652 in individuals of European ancestry born in the UK between 1938 and 1967. Importantly, our estimate of the UK prevalence of EI is likely downwardly biased partly because of the ascertainment of UKB participants, who are on average healthier and more educated than the rest of the UK populationFROH and a threshold at 0.1. Nevertheless, we acknowledge that ACMG guidelines may be suboptimal with respect to detection of EI and that other approaches could have been in implemented42. We found in our simulations that a threshold 0.1 may in fact be too conservative, while using a threshold of ~0.08 is optimal with respect to specificity and sensitivity to detect EI . However, it is worth mentioning that previous studies have addressed a similar question using more elaborate models. For example, Druet and Gautier33, and we show that mixtures of exponential distributions provide a mathematically tractable framework to accommodate arbitrary recombination maps. We note that Druet and Gautier acknowledged that violation of the assumption of a constant recombination rate across the genome could limit the interpretation of their model parameters.One similarity between Druet and Gautier\u2019s approach and ours, is that we both assumed the distribution of HBD segments to follow a mixture of exponential distributions. However, our approach relies on observed ROHs, which we have assumed to be HBD, whereas Druet and Gautier models HBD segments as unobserved states of a hidden Markov chain. Consequently, their inference is likely more robust to biases from ROHs calling, which often requires arbitrary choices to be made . On the other hand, the Druet and Gautier method relies on the assumption that the length of HBD segments follows an exponential distribution as a consequence of assuming a constant recombination rate. Our study provides a simulation-based (using observed genetic maps) and an empirical quantification of the length distribution of long genomic segments identical-by-descent, which we found to best fit a mixture of two exponential distributions. Therefore, our results confirm that the assumption of constant recombination rate is inappropriate for describing segments length distribution43. If inbreeding depression in EI controls is well estimated then the latter finding would suggest that gene\u2009\u00d7\u2009gene or gene\u2009\u00d7\u2009environment interactions contribute little to inbreeding depression in the traits analysed and also that variants causal of inbreeding depression in these traits are well tagged  by common SNPs. However, because of ascertainment of UKB participants who are on average healthier and more educated than the general population28, estimates of inbreeding depression in UKB participants may also be underestimated. Moreover, Curik et al.44 showed using computer simulations that the absence or presence of a nonlinear relationship between inbreeding and traits should be interpreted with caution in particular when inbreeding depression is estimated using an inbreeding measure which only partially reflects realised autozygosity, as is the case for FROH.We showed in this study that the reduction in measured values of multiple complex fitness-related traits resulting from EI is consistent with inbreeding depression estimated within EI controls, who still harbour ROHs in their genomeLastly, we attempted to quantify the contribution of social contexts to the prevalence of EI. Despite the sparsity of parental information for EI cases, we found no evidence that EI is more prevalent in health-deprived families nor that low education contributes to increase the likelihood of EI in the population. In conclusion, our study provides an objective quantification of EI in the UK population and shed lights on its causes and phenotypic consequences.45 imputation reference panel, in 487,409 participants of the UKB46. Extensive description of data can be found here26. We restricted our analysis to 456,414 participants of European ancestry identified using projected principal components based on sequenced participants of the 1000 genomes projects with known ancestry26. This subset of the UKB contains 348,502 conventionally unrelated participants, i.e., whose estimated pairwise SNP-based GRM\u2009<\u20090.05, estimated using 1,124,803 common \u2009\u2265\u20091%) HapMap347 SNPs using GCTA (v1.9)48. The North West Multi-Centre Research Ethics Committee (MREC) approved the study and all participants in the UKB study analysed here provided written informed consent.We used genotyped and imputed allele counts at 16,652,994 SNPs imputed to the Haplotype Reference Consortium49 GWAS of EA to calculate polygenic score predicting EA. HM3 SNP effects were re-estimated after excluding data from the UKB. Marginal SNP effects were then transformed into conditional SNP effects using the LD-pred method50 assuming all SNPs to be causal. The latter analysis used genotypes at HM3 imputed SNPs of ~300,000 unrelated UKB participants as linkage disequilibrium reference panel.We used estimated SNP effects from the Lee et al.p value\u2009>\u20090.0001. As in previous studies10, we used the following PLINK (versions 1.07 and 1.9)52 command to call ROH: --maf 0.05 --homozyg --homozyg-density 50 --homozyg-gap 1000 --homozyg-kb 1500 --homozyg-snp 50 --homozyg-window-het 1 --homozyg-window-missing 5 --homozyg-window-snp 50. That command detects ROHs at least 1.5\u2009Mb long, at least 1\u2009Mb apart from one another, containing at least 50 SNPs, and such that SNPs overlapping ROH can have at most 5 missing values and 1 occasional heterozygote. Once ROHs detected, we calculate an inbreeding measure FROH for each individual by dividing the cumulated length of ROH in Mb by an estimate of the length of the human autosome, i.e., ~2881\u2009Mb under genome build hg19. Note that this estimate of autosome length may vary between genome builds, and therefore may impact the number of individuals detected above a given threshold.ROH were called using only 301,412 SNPs genotyped in 456,414 UKB participants of European descent. These SNPs were filtered on missingness rate (missingness\u2009<\u20091%), MAF\u2009>\u20095% and Hardy\u2013Weinberg equilibrium test 29. We used the same set of 301,412 genotyped and quality-controlled SNPs as to call ROH to phase haplotypes using SHAPEIT 2 with the following options: --duohmm -W 5 -T 10 and using genetic maps from the 1000 Genomes (1KG) Project phase 3 23. We considered eight different mating types (pedigrees): mating between unrelated individuals , between first-cousins, between double-first cousins, between grandchildren and grandparents, between uncles/aunts and nieces/nephews, between HSs, between fullsibs and between parents and offspring. Nonetheless, we describe here the case of PO mating. First, we sample a random pair of individuals (denoted P1 and P2) out of 972\u2009\u00d7\u2009971/2\u2009=\u2009471,906 possible pairs. We then create recombined chromosomes from haplotypes of P1 and P2. For all genetic intervals defined in the 1KG genetic maps, we sample the Bernoulli distributed indicator of the presence of a recombination breakpoint with probability equal to 0.01\u2009\u00d7\u2009genetic distance of the interval in Morgan(s). Once the recombined chromosomes of the offspring O of P1 and P2 are simulated, we then repeat this procedure to simulate an offspring resulting from mating of O with one of the parent, i.e., P1 or P2. To then mimic real data, which contain genotyping errors, we also add a random number of errors to the simulated genotypes. The number of errors is sampled from a Poisson distribution with a mean corresponding to the mean number of genotyping errors estimated, for each chromosome, from comparing genotypes of 168 twin pairs  trios (both parents and one offspring) out of 1066 identified in the UKB48. That statistic denoted FUNI  is an estimate of inbreeding using allele frequencies in the current population and was previously shown to be more powerful to detect ID4. We nonetheless condidered FROH as a reference inbreeding measure in this study in accordance with the ACMG guidelines. We tested the association between inbreeding measures (FROH and FUNI) and traits using linear regression adjusted for age at recruitment (UKB field 21022\u20130.0), sex, assessment centre (UKB field 54\u20130.0), genotyping chip and batch, year of birth (UKB field 34\u20130.0), socioeconomical status measured by the Townsend deprivation index (UKB field 189\u20130.0) and 10 genetic principal components calculated using PLINK 2.0. Analyses were performed in 345,276 unrelated EI controls (FROH\u2009<\u20090.01). Traits were pre-adjusted and inverse normal transformed and phenotypic values larger than >4 standard deviations were excluded. UKB identifiers for tested traits are: height (UKB field 50-0.0), hip-to-waist ratio (HWR: ratio of UKB field 49-0.0 over UKB field 48-0.0), HGS (average of UKB fields 46-0.0 and 47-0.0), lung function measured as the PEF (UKB field 3064-0.0), VA measured on log MAR scale (VA: average between UKB field 5201-0.0 and UKB field 5208-0.0), auditory acuity measured as te speech reception threshold , number of years of education (EA), fluid intelligence score , cognitive function measured as the mean time to correctly identify matches  and fertility measured as the number of children . To test the association between number of diseases diagnosed and inbreeding, we used overdispersed Poisson regression implemented in R 3.2.0 (glm function with option family\u2009=\u2009\u201cquasipoisson\u201d). Number of diseases diagnosed was estimated as the number International Classification of Diseases, Tenth Revision (ICD10) codes reported for UKB participants. We also analysed reported illnesses in fathers and mothers of UKB participants  as measure of health deprivation in the family. Illnesses of parents were reported among 12 groups of diseases (URLs). We created for each participant a count of diseases in both parents. Analysis were adjusted for adoption status (UKB field 1767) and missing values on the parental diseases were excluded.We used GCTA with the --ibc command to estimate for each UKB participants the correlation between uniting gametesX follows an exponential distribution of rate \u03bb, then Y\u2009=\u2009X|X\u2009>\u2009s, i.e., the truncated distribution of X with values larger than a given threshold s, is such that (Y-s) also follows an exponential distribution with the same rate (\u03bb) as X. Estimation of mixture distribution was performed using the R package Renext. Model selection was performed using BIC criterion.We estimated the length distribution of ROHs using a mixture of exponential distributions with a number of components from 1 to 10. Given that only ROHs larger than 1.5\u2009Mb are detected, we therefore analysed lengths of ROHs in Mb minus the minimum threshold  segments length under PO and FS, respectively. We assume that the length distribution of the set of ROHs used for inference is a mixture of fPO and fFS and we denote \u03c0PO/FS as the mixture proportion. We also assumed fPO and fFS to be known so that the parameter of interest, i.e., that we want to estimate, is \u03c0PO/FS.Given a collection of autosomal ROH segments lengths, we developed a method for estimating the proportion l of one segment of length x can be written asThe log-likelihood X \u2019s probability log density function is l. Therefore the asymptotic variance of the maximum likelihood estimator \u03c0PO/FS would beN is the number of segments used to estimate \u03c0PO/FS.From that we can write the Fisher information asfPO and fFS. Each of these two distributions were approximated using mixtures of two exponential distributions which parameters were estimated from >648,125 simulated ROHs under PO and FS. Conditional on fPO and fFS, estimating \u03c0PO/FS is therefore a straightforward univariate optimisation problem. We used Eq. .For Population sizes in England and Wales, seehttps://www.ons.gov.uk/peoplepopulationandcommunity/populationandmigration/populationestimates.For Educational attainment in the UK from 2011 Census, seehttp://www.nomisweb.co.uk/census/2011/DC5102EW/view/2092957703?rows=c_age&cols=c_hlqpuk11.ftp://ngs.sanger.ac.uk/production/samtools/genetic-map.tgz.For Genetic maps from the 1,000 Genomes Project, see For UK Biobank groups of diseases affecting parents, seehttps://biobank.ctsu.ox.ac.uk/crystal/coding.cgi?id=1010.Further information on research design is available in the\u00a0Supplementary InformationReporting Summary"}
+{"text": "Saccoglossus kowalevskii, a flatworm, Metazoan, and hemichordate.Lateral gene transfer (LGT), also known as horizontal gene transfer, into multicellular eukaryotes with differentiated tissues, particularly gonads, continues to be met with skepticism by many prominent evolutionary and genomic biologists. A detailed examination of 26 animal genomes identified putative LGTs in invertebrate and vertebrate genomes, concluding that there are fewer predicted LGTs in vertebrates/chordates than invertebrates, but there is still evidence of LGT into chordates, including humans. More recently, a reanalysis of a subset of these putative LGTs into vertebrates concluded that there is not horizontal gene transfer in the human genome. One of the genes in dispute is an N-acyl-aromatic-L-amino acid amidohydrolase (ENSG00000132744), which encodes ACY3. This gene was initially identified as a putative bacteria-chordate LGT but was later debunked as it has a significant BLAST match to a more recently deposited genome of ACY3/ASPA homologues, the most parsimonious explanation for the distribution of ACY3/ASPA genes in eukaryotes involves both gene loss and bacteria-animal LGT, albeit LGT that occurred hundreds of millions of years ago prior to the divergence of gnathostomes.Using BLAST searches, HMM searches, and phylogenetics to assess the evidence for LGT, gene loss, and rate variation in ACY3/ASPA is most likely a bacteria-animal LGT. LGTs at these time scales in the ancestors of humans are not unexpected given the many known, well-characterized, and adaptive LGTs from bacteria to insects and nematodes.The online version of this article (10.1186/s12864-018-4832-5) contains supplementary material, which is available to authorized users. In 1859, Darwin published \u201cOn the Origin of Species\u201d describing the role natural selection plays on the evolution of species, elucidating an interplay between competition and survival . SeventyToday, the field of molecular evolution focuses on understanding Darwinian evolution of genomes along with Kimura\u2019s neutral theory with an emphasis on using phylogenetic techniques to analyze nucleotide sequence variation in protein coding genes. With some exceptions, this research in eukaryotes focuses on nucleotide substitutions in conserved protein-coding regions from genes deemed a priori to be vertically inherited. But as Avery et al. discovered , traits When we started working on LGT of bacterial DNA into animal genomes more than a decade ago, the prevailing paradigm was that it was non-existent. Subsequently, instances of bacteria-animal LGT have been observed in multiple invertebrates \u201334, inclenv genes multiple times during the evolution of placental mammals [Despite this, LGT in multicellular eukaryotes with differentiated tissues, particularly gonads, continues to be met with skepticism. For example, Crisp et al. conducted a detailed examination of 26 animal genomes in order to identify putative LGTs in invertebrate and vertebrate genomes, including the human genome . They fo mammals . However. ACY3 can convert N-acyl-aromatic-L-amino acid to the corresponding aromatic-L-amino acid and a carboxylate, or alternatively ACY3 can convert N-acetyl-L-cysteine-S-conjugate to L-cysteine-S-conjugate and acetate [N-acetylaspartate to aspartate and acetate [More recently, Salzberg re-analyzed a subset of the putative LGTs in vertebrates that were proposed by Crisp et al.  and conc acetate . ACY3 ha acetate . It is h acetate , 41. BLA acetate . In huma acetate . It is e acetate , 41. Giv acetate  and Salz acetate , return Saccoglossus kowalevskii [ACY3/ASPA homologues further in an effort to better understand the evidence for LGT, gene loss, and rate variation.Salzberg discounted the ACY3/ASPA homologues as \u201cno HGT\u201d  because alevskii , a flatwBLASTP was used to identify homologues of the human aspartoacylase gene  in NR using the NCBI website. This search largely confirmed the BLAST-based results from Crisp  and Salzn\u2009=\u20092), chromophytes (n\u2009=\u20096), cnidaria (n\u2009=\u20092), and hemichordates (n\u2009=\u20091) n\u2009=\u20092), cThe relationship between bacteria and eukaryote proteins is less clear in non-animals. Proteins from chromophytes and alveolates are nested amongst proteins from disparate bacterial taxa (88% support), predominantly cyanobacteria, fibrobacteria, and gamma-proteobacteria, but also two Campylobacter, which are epsilon proteobacteria Fig. . ChromopProtein phylogenies only examine the relationship between extant proteins that have been sequenced. Two alternate hypotheses to consider when examining evidence for/against LGT are gene loss and rate variation. To consider gene loss, information about lineages lacking these proteins is required since some taxa are more abundant on earth, and genome sequencing has been unevenly applied across taxa. For example, despite many arthropod and nematode sequences in NR, arthropod and nematode homologues of ACY3/ASPA were not identified in the BLASTP searches. To account for this, the numbers of ACY3/ASPA homologues for given taxonomic levels were compared to the number of organisms at that taxonomic level that have >\u20095000 protein sequences in NR. If an organism has >\u20095000 protein sequences in NR, any ACY3/ASPA homologues are likely to have been sequenced and identified through the BLASTP searches of NR. Nearly identical results were obtained for thresholds between 5000 and 10,000 proteins, giving confidence that a threshold of 5000 proteins was neither too stringent nor lenient. However, it is important to note that while it is likely that ACY3/ASPA homologues have been sequenced, genome and transcriptome assemblies can be incomplete and as such absence may be over-predicted. Contamination is also a concern, which would lead to under-predicting absence. However, in most cases at least two organisms of a taxa were sequenced and had concordant results.Among the chordates, ACY3/ASPA homologues are distributed among all of the vertebrate lineages that were sequenced sufficiently Fig. . In all Among the deuterostomes, there is very limited sequencing outside the chordates such that only 3 echinodermata, 1 hemichordata, 2 urochordata, 2 cephalochordata, and no hyperotreti have >\u20095000 proteins characterized in NR Fig. . Of thosWhile ACY3/ASPA homologues are prevalent among the deuterostomes, they are noticeably absent in the 202 ecdysozoa with >\u20095000 proteins in NR, including arthropods, nematodes, and tardigrades. Likewise, they are also absent from the 10 lophotrochozoa with >\u20095000 proteins in NR, including annelids, brachiopods, and mollusks. They are also missing in unplaced bilateria taxa, including platyhelminths and mesozoa Fig. . TherefoIn animals, there were two ACY3/ASPA homologues in cnidaria, which are not bilateria Fig. . While tAnother alternate explanation to LGT and/or gene loss is rate variation. When considering rate variation, some proteins are under accelerated rates of evolution relative to other proteins. For example, following duplication, two proteins may diverge at different rates. Following LGT, genes might be expected to undergo different rates of evolution as they enter a new environment. As such rate variation and LGT are not mutually exclusive. However, when considering rate variation as an alternative to LGT we are looking for signatures that might suggest that one lineage has vertically inherited genes that are evolving at a different rate confounding BLAST- and phylogeny-based methods.To examine this, we relied on the results of two large pre-computed datasets, eggNOG and PFAM. EggNOG is an algorithm that currently uses graph-based unsupervised clustering to identify orthologous genes in 2031 eukaryote and prokaryote genomes. When eggNOG is interrogated with ACY3 or ASPA, an orthologous group is identified that is found to contain proteins from bacteria and metazoans, making it largely similar to the results returned with the BLAST-based results described above .PFAM uses hidden Markov model (HMM) searches to find functionally-related, but substantially-diverged, proteins. HMM searches rely on the use of probabilistic, hidden Markov models to identify protein homologues with great sensitivity and specificity; these models quickly and efficiently find homologues based on the presence of protein features shared between homologues  not identified through traditional BLAST-based searches. These HMM results can be overlaid on a species tree (e.g. for Acy3/ASPA: Acyrthosiphon pisum (pea aphid) which is an arthropod. The match is not to a protein in NR, but instead to a nearly 1 kbp region that has closest similarity to proteins annotated as succinylglutamate desuccinylase from Pantoea endosymbionts that is on a 7.6 kbp contig from the whole genome sequencing project (NW_003385628.1)  and Monoraphidium neglectum  as well as 49 fungi across many diverse fungal lineages contain proteins with the ACY3/ASPA domain. Unfortunately, and similar to the problem with phylogenetic trees, no information can be gleaned about taxa lacking ACY3/ASPA domain-containing homologues. However, it is clear that the functional domain exists in taxa beyond those identified with BLAST or eggNOG searches suggesting that there can be substantial sequence divergence. However, the sequence divergence and our inability to produce high quality alignments of these sequences precludes further analyses.However, in more distant eukaryotic lineages, the HMMs gave different results from eggNOG and BLAST. Two taxonomically disparate plant taxa, Salzburg  and otheACY3/ASPA genes in eukaryotes involves both gene loss and bacteria-animal LGT, albeit LGT that occurred hundreds of millions of years ago. Given the many known, well-characterized, and adaptive lateral gene transfers from bacteria to insects and nematodes in this time frame, lateral gene transfers at these time scales in the ancestors of humans is expected.Collectively, this analysis demonstrates our need for further high quality complete genome and transcriptome assemblies from key phylogenetic groups in order to have the power to infer the correct relationships between both taxa and proteins of interest in order to properly evaluate claims of LGT and gene loss. Regardless, the most parsimonious explanation for the distribution of ACY3/ASPA homologues were identified from a BLASTP search  using ACAll of the protein sequences identified from the ACY3-based BLASTP searches were downloaded locally and aligned with CLUSTALW v.1.4  as implehttps://www.ncbi.nlm.nih.gov/protein) to search PDB, RefSeq, UniProtKB/Swiss-Prot, DDBJ, EMBL, GenBank, and PIR with the appropriate taxon_id in November 2017. These results were overlaid on reference phylogenetic trees for the eukaryotic lineages that were concatenated from trees retrieved from the Tree of Life website (tolweb.org) [Taxa with >\u20095000, >\u20096000, >\u20097000, >\u20098000, and\u2009>\u200910,000 known proteins in NR were determined by using the NCBI protein server (web.org) \u201362.http://pfam.xfam.org/family/AstE_AspA#tabview=tab7).In order to identify ACY3/ASPA homologues that may be subject to rate variation, pre-computed orthologous clusters in eggNOG were examined (http://eggnogdb.embl.de/#/app/results#COG2988_datamenu) as well as hidden markov model (HMM) search results generated by PFAM were overlaid on a species tree using the PFAM server Additional file 2:A. pisum sequence from PFAM (J9KVH7) with homology to ASPA/ACY3 homologues. (PDF 264 kb)TBLASTN search results against NR of Additional file 3:A. pisum strain LSR1 unplaced genomic scaffold, Acyr_2.0 Scaffold2139 (NW_003385628.1) against NT allowing for 20,000 matches with an e-value below 0.00001. (PDF 284 kb)BLASTN search of Additional file 4:A. pisum strain LSR1 unplaced genomic scaffold, Acyr_2.0 Scaffold2139 (NW_003385628.1) against NR allowing for 20,000 matches with an e-value below 0.00001. (PDF 269 kb)BLASTX search of"}
+{"text": "Thrombosis of the internal jugular vein occasionally occurs in association with long-term placement of a central venous catheter; however, such complications rarely involve calcification within the blood vessels. We report a case of calcification and abscess formation around a central venous catheter tip.Our patient was an 84-year-old Asian woman who developed a fever that had started approximately 5\u2009months after the placement of a central venous catheter. At the time of presentation, blood tests showed a marked inflammatory response, and chest computed tomography showed a high absorption area and air density around the catheter tip. Therefore, the patient was diagnosed with abnormal intravascular calcification and a deep neck abscess associated with long-term central venous catheter placement. The initial plan was to administer antibiotics and remove the central venous catheter. However, central venous catheter removal was deemed difficult due to the calcification and therefore required an incision. Because of the patient\u2019s advanced age and dementia, her family requested antibiotic treatment only. Following antibiotic treatment, the patient\u2019s inflammatory response normalized, and her fever resolved. The treatment was discontinued, and the patient\u2019s condition gradually stabilized.Catheter-related complications of central venous catheter placement include vascular occlusion, extravasation of the infusion, and infection. However, abnormal calcification in the blood vessels is extremely rare, and there has been only one case report of a neonate with central venous catheter-related vascular calcification in Japan. The etiology of intravascular calcification is considered to be related to the infusion content and the infusion rate of high caloric infusions and blood products. The incidence of complications associated with long-term central venous catheter placement is expected to increase with the increasing aging of the population and advances in chemotherapy. The report of the clinical course of this rare case adds to the body of knowledge in this area. Thrombosis of the internal jugular vein is a relatively rare form of deep vein thrombosis, but this condition has been reported in association with long-term placement of a central venous catheter (CVC) , 2. HoweOur patient was an 84-year-old Asian woman who had experienced persistent anorexia since being treated for acute myocardial infarction about 1\u2009year prior to the current presentation. Her anorexia was thought to be related to aging. Because it was difficult to secure a peripheral venous infusion route, a CVC was placed about 5\u2009months before the current presentation to ensure the provision of adequate nutrition. After CVC placement, the patient\u2019s condition remained stable, but she developed a persistent fever. Infection around the CVC was suspected, so she was referred to our hospital. Her medical history included hypertension and dementia. Her regular medications were antiplatelet drugs, proton pump inhibitors, laxatives, and diuretics.On physical examination, the patient had a temperature of 37\u2009\u00b0C, blood pressure of 142/91\u2009mmHg, heart rate of 93 beats/minute, and respiratory rate of 18 breaths/minute. No redness or warmth was noted around the CVC port. Blood tests revealed a marked inflammatory response. The patient\u2019s white blood cell count was 16,600/\u03bcl, C-reactive protein concentration was 9.42\u2009mg/dl, hemoglobin concentration was 11.2\u2009g/dl, platelet count was 139,000/\u03bcl, blood urea nitrogen concentration was 23\u2009mg/dl, and creatinine concentration was 0.69\u2009mg/dl. Chest computed tomography (CT) showed a CVC port located subcutaneously in the left anterior chest, but there were no signs of infection such as a subcutaneous abscess around the port or increased fat deposition. The catheter tip was located within the lumen of the left brachiocephalic vein, but there was a high absorption area around it with some air density  for a total of 15\u2009days. The patient\u2019s clinical course was uneventful, her fever subsided, and the inflammatory response improved. Chest CT performed 20\u2009days after hospital admission showed that the abscess cavity had shrunk and that there was no infection recurrence. The patient was subsequently followed up at our hospital for about 1\u2009month.The patient was hospitalized and started on antibiotics (cefmetazole 1\u2009g every 8\u2009hours). Bacterial culture of a blood sample collected on the day of hospitalization revealed multidrug-resistant In general, cases of catheter-associated infection warrant early removal of the catheter. However, in the present case, the catheter tip was fixed to the calcified venous wall, and forcible removal would have damaged the catheter and left parts of it in the blood vessel. Therefore, surgical removal was recommended, but the family declined surgery because of the patient\u2019s advanced age, so only antibiotic treatment was administered. Although the patient\u2019s family was advised that the infection could recur around the CVC, they elected to avoid surgical CVC removal for the same reason.Cases of infection and deep vein thrombosis associated with CVC placement have been reported , 5, but in situ for a long time, the vascular endothelial cells had been physically damaged, the blood flow dynamics had been altered due to the catheter placement, and there were coagulation abnormalities due to the infection; these factors all contributed to the venous calcification.Calcification around the CVC is reportedly caused by the infusion of high-calorie solutions that have a higher concentration of calcium phosphate than the contents of the central vein, which can cause rapid calcium salt precipitation in the catheter . TherefoIn general, an infected CVC should be removed. However, calcification can damage the catheter tip, leaving some remnant fragments in the blood vessel after the catheter is \u201csuccessfully\u201d withdrawn. This situation will eventually require surgical resection, but only conservative treatment was administered in our patient\u2019s case, because the her family did not want her to undergo surgery due to her advanced age.Surgical resection is also generally recommended for blood clots around CVCs, but long-term indwelling CVCs tend to cause calcification and abscess formation. Therefore, CVCs should be removed as soon as possible after treatment is discontinued , 12, 13.In our patient\u2019s case, the CVC was placed because the facility where the patient was being treated was unable to manage the feeding tube. In Japan, it is common for gastric fistulas or infusions to be initiated to treat physical deterioration due to poor food intake. Furthermore, in Japan, when a patient is incapable of making their own medical decisions, nutritional tubes are often selected in accordance with the wishes of the patient\u2019s family, and a CVC is selected by the facility or hospital. However, long-term use of equipment for parenteral nutrition causes complications such as infection. Therefore, to prevent complications such as the infection and venous calcification seen in our patient\u2019s case, it is necessary to reexamine the indications for an indwelling CVC for parenteral nutrition. In recent years, an increasing number of people and facilities in Japan have chosen not to use a gastric fistula or infusion to manage patients with poor food intake due to aging. However, this issue involves complex ethical considerations, because many families still desire parenteral nutrition for their older adult relatives; this problem needs to be discussed throughout Japan.Long-term CVC placement may result in various complications, but this is the first report of calcification with abscess formation. In our patient\u2019s case, improvement was achieved with antibiotic treatment alone, which was selected because surgical treatment of the deep neck abscess was considered too invasive due to her advanced age. The CVC was removed as soon as it had served its purpose; however, our patient\u2019s case highlights the need to reconsider the indications for CVC placement."}
+{"text": "Publication bias was assessed using a Funnel plot and the Egger's test. In total, 45 studies were analysed with data from 11 232 patients. The pooled sensitivity and specificity of semi-quantitative methods were 85% (95% CI 79\u201390%) and 84% (95% CI 79\u201388%), respectively; and for quantitative methods were 85% (95% CI 79\u201390%) and 95% (95% CI 91\u201397%). Considerable heterogeneity was statistically evident (P < 0.001) by both methods with a correspondingly symmetrical Funnel plot that was confirmed by a non-significant Deek's test. We conclude that both semi-quantitative and quantitative methods are highly useful for screening for CRBSI in patients and display high sensitivity and specificity. Quantitative methods, particularly paired quantitative cultures, had the highest sensitivity and specificity and can be used to identify CRBSI cases with a high degree of certainty.Catheter-related blood-stream infections (CRBSIs) are the most common healthcare-associated blood-stream infections. They can be diagnosed by either semi-quantitative or quantitative methods, which may differ in diagnostic accuracy. A meta-analysis was undertaken to compare the diagnostic accuracy of semi-quantitative and quantitative methods for CRBSI. A systematic search of Medline, Scopus, Cochrane and Embase databases up to January 2020 was performed and subjected to a QUADAS  tool to evaluate the risk of bias among studies. The pooled sensitivity and specificity of the methods were determined and heterogeneity was evaluated using the  Central venous or peripheral artery catheters are used for managing critically-ill or emergency patients admitted to intensive care units (ICUs) or emergency units of tertiary care centres. The most common complication associated with their use is catheter-related blood-stream infection (CRBSI) , 2, whicet al. [CRBSI diagnoses remain challenging as the most common signs of these infections are often non-specific-like fever and chills; inflammation at the catheter-insertion site has a sensitivity of only 8% . Microbiet al.  in whichet al. . The diaWe selected all studies examining the diagnostic accuracy of either semi-quantitative or quantitative methods for CRBSIs using catheter segments or blood culture, irrespective of study design. All studies included reported sensitivity and specificity values or provided data to allow calculation. They comprised published full-text articles, short communications and conference abstracts. Unpublished studies, thesis reports and those with sample sizes of <10 subjects were omitted. Participants were patients suspected of having a CRBSI in medical, surgical or neonatal ICUs of a tertiary care hospital, irrespective of their age groups or comorbid status. The reference standard was the isolation of the same microbial species from catheters and blood cultures.Pooled sensitivity, specificity, diagnostic odds ratio (DOR), likelihood ratio positive (LRP) and likelihood ratio negative (LRN) from the studies were calculated.We performed a systematic and extensive electronic search from inception to January 2020 in databases and search engines  without language restriction. Medical subject headings (MeSH) were applied along with free-text search terms ; the resulting relevant articles were included in the review.Two authors independently performed the primary screening of title, keywords and abstracts, and retrieved full-text articles for the relevant studies. They then undertook a secondary screening of the articles to select those satisfying the inclusion criteria. Conflicts of opinion were resolved either by consultation with a third author or through consensus.The primary investigator extracted the data from the selected studies pertaining to the study setting, design, participants, inclusion and exclusion criteria reference standards, index test, total participant numbers, and criteria for positivity, sensitivity and specificity. Finally, we compared the data in the review and the study reports to ensure correct entries.The quality assessment of diagnostic accuracy studies 2 (QUADAS 2) tool was used to appraise the risk of bias among studies . This to\u03c72 and I2 statistics. The source of heterogeneity was explored after subgroup analyses using study-related covariates such as type of diagnostic test, country and region. Publication bias was assessed using Deek's test and graphically depicted in a funnel plot. Some statistical analyses were performed using the Midas Command package.The meta-analysis was carried out using the STATA 14.2 software . We calculated pooled estimates of sensitivity, specificity, LRN, LRP and DOR for the semi-quantitative and quantitative methods using the bivariate method. A summary receiver operator characteristic curve (sROC) was constructed to determine the area under the curve (AUC); an AUC value closer to 1 being indicative of a better diagnostic value. Graphical representations were plotted of sensitivity and specificity of individual study-specific and pooled estimates using a forest plot. We determined the clinical values of the semi-quantitative and quantitative methods based on a Likelihood Ratio (LR) scattergram, and the probability of patients having CRBSI using Fagan plots. Heterogeneity was represented graphically using a bivariate boxplot and tested using A total of 3239 records  of studies were identified on the diagnostic accuracy of semi-quantitative and quantitative methods for CRBSI diagnosis (from inception till January 2020). After the first screening stage, 242 relevant studies were retrieved and full-text of these articles was assessed against the eligibility criteria. Finally, 45 studies with 11\u00a0232 participants that met the inclusion criteria were included  6, 7, 1\u201352.Fig.Supplementary Table S1 shows the characteristics of the studies in our analyses. Most studies (39 out of 45) , 45\u201352 wThere was a low risk of patient selection bias in more than 90% of the studies ; 18 of 4We analysed 26 studies , 50, 52 \u03c72 \u2013 P\u00a0<\u00a00.001 \u2013 and an I2 value of 97%. The bivariate box plot (P\u00a0=\u00a00.07). We explored the source of heterogeneity using subgroup analyses across regions and countries and found wide variation in the sensitivities and specificities of the semi-quantitative methods across regions; studies conducted in the Americas had maximum sensitivities (89%) and specificities (89%), while those from Australia had sensitivities as low as 71% and specificities of 80%.A considerable degree of heterogeneity was evident  and I2 values (99%). The bivariate box plot (P\u00a0=\u00a00.51).In total, 30 studies , 50, 51 box plot  revealedbox plot  and the n\u00a0=\u00a010) and specificity  followed by IVD-drawn quantitative blood cultures , and by quantitative catheter segment cultures . Sensitivity and specificity of the quantitative methods were maximal in studies from European countries.Our subgroup analyses based on the type of test showed that paired quantitative blood cultures had the maximum sensitivity , while quantitative methods  have a similar sensitivity (85%), but higher specificity (95%) along with higher diagnostic accuracy (AUC\u00a0=\u00a00.96). Among the latter methods, paired quantitative blood cultures had the highest sensitivity (89%) and specificity (99%) followed by IVD-drawn quantitative blood cultures (sensitivity\u00a0=\u00a084% and specificity\u00a0=\u00a094%), and by quantitative catheter segment cultures (sensitivity\u00a0=\u00a083% and specificity\u00a0=\u00a091%). These diagnostic accuracy values were similar to that reported by Safdar The LR scattergram of semi-quantitative methods showed that the LRP and LRN occupied the right lower quadrant indicating that these approaches cannot be used for CRBSI exclusion or confirmation. However, our analysis suggests that quantitative methods can be used for diagnostic confirmation. The clinical values of both methodological strategies for CRBSI were high as Fagan's nomogram showed significant increases in the post-test probabilities compared to the pre-test probabilities. However, while accepting these results at face value, we must consider that different quality standards and methodologies of the studies may have influenced our summary findings. As a consequence, we evaluated the degree of heterogeneity between the studies and found this to be statistically significant. On further exploration of the source of heterogeneity via subgroup analyses, we found wide variation across regions and countries in the final pooled estimates that may have influenced the between-study variability. Nevertheless, Deek's test and funnel plot results both suggested an absence of publication bias among the studies for both semi-quantitative and quantitative methods.Our study has some limitations. First, we found some studies to have high risks of bias, which may have influenced our final estimates. Second, the significant degree of heterogeneity limits our ability to interpret the pooled results. However, we tried to overcome this by exploring the potential source of heterogeneity among the studies. In spite of these limitations, our results provide valuable insights into the diagnostic performance of various methods for screening patients for CRBSI. Although the semi-quantitative methods had satisfactory levels of sensitivity and specificity, they did not meet the SnNout triage test criteria for sensitivity and the SpPin criteria for specificity of diagnostic tests . This meThese findings should be considered to bring about changes in international guidelines and practices for CRBSI diagnoses. In our opinion, quantitative methods should be recommended as a first-line modality to confirm the infection in a patient. However, further studies assessing the performance of each of the quantitative methods should be carried out in different geographical regions as the evidence in low- and middle-income countries is limited. Such studies will inform the framing of guidelines and practices for patients admitted to tertiary care irrespective of the setting. Moreover, the affordability of the tests should also be considered by comparing their relative cost-effectiveness as a diagnostic modality for CRBSI.In conclusion, both semi-quantitative and quantitative methods have high sensitivity and specificity for CRBSI screening. Quantitative methods, particularly paired quantitative culture, offer the highest sensitivity and specificity and can be used for diagnosis with a high degree of confidence. However, additional studies are warranted across all geographical regions to further inform international guidelines and practices."}
+{"text": "Partial least square-discrimination analysis (PLS-DA) and a variance im portance in projection (VIP) score was used to identify the key sex-specific metabolites. All groups of metabolites, as the main markers of energy metabolism, showed a significant sex-dependent pattern. The most important features calculated in PLS-DA according to VIP score were free carnitine (C0), tyrosine (Tyr), and acylcarnitine C5-OH. While aromatic amino acids, such as Tyr and phenylalanine (Phe), were significantly elevated in the blood plasma of males, tryptophan (Trp) was found in higher levels in the blood plasma of females. Besides, significant sex-related changes in urea cycle were found. Our study provides an important insight into sex-specific differences in energy metabolism in rats and indicates that further studies should consider sex as the main aspect in design and data interpretation.The prevalence of some chronic diseases, such as cancer or neurodegenerative disorders, differs between sexes. Animal models provide an important tool to adopt potential therapies from preclinical studies to humans. Laboratory rats are the most popular animals in toxicology, neurobehavioral, or cancer research. Our study aimed to reveal the basic differences in blood metabolome  of the adult male ( Many studies, including brain research, evolutionary psychology, and anthropology, demonstrate that males and females are physically and mentally different. Sex differences are prominent also in many disorders, such as mood and anxiety disorders , cancer Animal models provide a key tool to adopt potential therapies from preclinical studies to humans . NotablyUnderstanding the basic metabolism in males and females is the first step in revealing further differences between sexes. Aside from ovarian cyclicity and menopause, there are many factors  that might complicate the interpretation of the results obtained from females . Exercisp < 0.001) throughout the experiment. In the third and eighth experimental weeks, food intake was monitored. Males had significantly elevated food intake (p < 0.001). However, there were no differences between male and female groups in food intake per gram of body weight  when compared with males  when compared to males. As seen in Because some acylcarnitines are derived from amino acids, we looked for the correlations. In both sexes, free carnitine (C0) and Met were significantly correlated. We also found positive correlations between propionylcarnitine (C3) and Val/Leu/Ile in males, and between C3 and Ile in females. For more correlations see Significance analysis of metabolites (SAM) is a well-established statistical method for identification of differentially expressed metabolites in data analysis. It is designed to address the false discovery rate (FDR) when running multiple tests on high-dimensional data. For a variable with scores greater than an adjustable threshold, its relative difference is compared to the distribution estimated by random permutations of the class labels. For each threshold, a certain proportion of the variables in the permutation set will be found to be significant by chance. t-test are listed in According to univariate analysis, a preliminary overview of potentially significant features of discriminating the conditions was performed. For paired fold change analysis, the algorithm first counts the total number of pairs with fold changes that are consistently above/below the specified Fold Change threshold for each variable. The three most significant features identified by As seen on separate cluster analysis A, the daIn our study, using a metabolomics approach and data mining analyses, the intersexual differences in the energy metabolism of Wistar rats were revealed. The most important features calculated in the PLS-DA model, according to VIP score, were C0, Tyr, and C5-OH significantly elevated in males.Basic genetic and physiological differences together with environmental factors result in behavioral and cognitive differences between males and females. Sex differences in the brain and/or in sex-typed behavior and sexual identity should be studied at all points in the life span especially because there are important relationships between sexes and the occurrence, prevalence, age of onset, symptoms, and severity of some diseases .Laboratory rats are an inevitable part of current biomedical research. They are recognized as the preeminent model in numerous fields, including neurobehavioral studies, cancer, and toxicology . Rodent l-Arginine-l-Arg), Orn and Asp, as well as sarcosine, spermidine, and spermine, were markedly higher in the blood plasma of male rats. These results are consistent with previously published data from a large human population-based study, showing elevated concentrations of Orn, Arg, Gly, and Serine in the blood of males [In our study, amino acids and biogenic amines, as well as acylcarnitines, showed sex-specific pattern. Aromatic amino acids  are the biosynthetic precursors for the neurotransmitters serotonin, dopamine, and norepinephrine. While aromatic amino acids, such as Tyr and Phe, were significantly elevated in the blood plasma of males, Trp was found in higher levels in the blood plasma of females. As shown previously, there is a similarity between rats and humans: The levels of Phe were found to be elevated also in cardiac ventricles of male Sprague\u2013Dawley rats and, more importantly, in human serum of males ,22. On tof males . From thof males . Signifiof males  or diabeof males ,26. Thisof males . BCAAs . Acylcarnitines are formed to facilitate the transport of long-chain fatty acids into mitochondria. They are also formed by equilibration of mitochondrial acyl Coenzyme A with their cognate acylcarnitines through the action of carnitine acyltransferase enzymes . What isIn the experiment, 10 adult  females and 10 adult  males of Wistar rats  aged 60 days were used. Animals were kept under standard conditions with a room temperature of 21\u201324 \u00b0C, relative humidity of 50\u201365%, and a 12:12 h regimen. Animals were fed with a standard rat pelleted diet  ad libitum according to EU animal feed legislation and guidance and water was freely available. The animals were weighed and food intake was monitored twice during the experiment. To mimic human conditions, sex differences of selected amino acids and acylcarnitines were monitored independently on the stage of the reproductive cycle. The female rats were born on the same day and we assume that they were synchronized. From previous studies, we know that female rats become sexually mature at about the sixth week [vena saphena magna) in a total volume of 100 \u00b5L into microtubes with heparin. The place of the collection was preshaved and treated with a disinfectant. After isolating, blood plasma was stored at \u221280 \u00b0C. Frozen plasma was thawed on ice and centrifuged and the supernatant was used for further analysis. The samples were measured by the AbsoluteIDQ p180 kit in the laboratory of BIOCRATES Life Sciences AG in Innsbruck (Austria). Flow injection analysis (FIA-MS/MS) and liquid chromatography-tandem mass spectrometry-based (LC-MS/MS) targeted-metabolomics\u2019 measurement of a selected groups of amino acids, biogenic amines, and acylcarnitines (as the representatives of energy metabolism) was performed on plasma samples  or a Waters XEVO\u2122 TQMS  instrument with electrospray ionization. The assay was based on the principle described in the study of [The blood from all experimental animals was collected at one session (10:00 a.m.) from the great saphenous vein (study of . Determit-test) and multivariate statistics  as well as the variable importance in projection (VIP) plot, were performed using MetaboAnalyst 3.0  [Quantification of metabolite concentrations and quality assessment was performed using the MetIQ software package . Internal standards served as the reference for the metabolite concentration calculations. Univariate  . Cross-vComplex metabolic processes represent an important understanding of biological body functioning. Because laboratory rats represent a key preclinical step to clinical investigations, there is a need to define the similarities and differences between rats and humans. In order to achieve an individual therapeutic approach, it is essential to know the fundamental differences between male and female metabolism. In our study, we revealed C0, Tyr, and C5-OH as the most important features elevated in males. It is obvious that many differences emerge, in particular, in energy metabolism related to sex, and that metabolomics along with other \u2013omics\u2019 technologies can help to dissect sex-related traits in pathophysiology. Our study provides an important insight into preclinical sex-specific differences of metabolism and may help in the future in clinical diagnostics of many diseases. It is of note that the metabolomic status of individuals may be dependent not only on sexual differences but also on age and, thus, the sex-dependent characteristics of individual metabolites seen in this study might vary with different age of rats. Moreover, the results might differ with the strains of rats. Therefore, further studies are necessary to reveal these differences."}
+{"text": "Our aim was to determine the influence of pulmonary rehabilitation conducted in therapeutic salt mine chambers on the functional fitness of older adults.The study included 22 individuals of age >65\u2009years with chronic respiratory conditions. The patients underwent the Fullerton test before and after a 3-week outpatient pulmonary rehabilitation in the \u201cWieliczka\u201d Salt Mine Health Resort.After the rehabilitation stay, the results showed statistically significant improvements within five of the six parameters evaluated. In the Arm Curl, the mean number of repetitions within 30\u2009s increased from 14.55\u2009\u00b1\u20093.63 to 16.68\u2009\u00b1\u20093.83 and in the Chair Stand from 11.86\u2009\u00b1\u20092.55 to 14.41\u2009\u00b1\u20092.95. Beneficial changes were observed in the Back Scratch, but without statistical significance. In Sit and Reach results increased from -2.3\u2009\u00b1\u200911.11cm to 2.14\u2009\u00b1\u20099.19\u2009cm. Time for performing the 8-Foot Up and Go decreased from 6.63\u2009\u00b1\u20091.27\u2009s to 5.8\u2009\u00b1\u20090.86\u2009s and in 2-Minute Step results increased from 88.27\u2009\u00b1\u200920.64 to 96.55\u2009\u00b1\u200916.38 repetitions.Functional fitness of examined older adults with pulmonary disorders has increased after a rehabilitation and treatment stay in underground salt mine chambers.The reviews of this paper are available via the supplemental material section. The World Health Organization (WHO) defines healthy ageing as \u201cthe process of developing and maintaining the functional ability that enables wellbeing in older age.\u201d2With life expectancy projected to continue rising across all regions of the globe,3 Resistance training is considered important for adults to promote healthy aging and also appears to be indicated in individuals with chronic respiratory disease: those who have reduced muscle mass and strength of their peripheral muscles and also suffer from respiratory muscle weakness due to limitations of inspiratory muscle strength and endurance. In pulmonary rehabilitation, an improvement in skeletal muscle function after exercise training lead to gains in exercise capacity despite the absence of changes in lung function.4Pulmonary rehabilitation is a core component of the treatment of patients with chronic respiratory disease and this intervention is beneficial, irrespective of baseline age and levels of disease severity.2 In order to improve the efficacy of healthy ageing measures, it is recommended to perform physical activities in conditions of good air quality and appropriate climate. Speleotherapy is a special kind of climate therapy which takes advantage of certain conditions specific to caves and historic subterranean salt-mining excavations.5The WHO indicates that the surrounding environment, and particularly pollution, significantly increases the risk of developing an illness.3, causing an osmotic effect which improves the activity of the respiratory epithelium cilia of the upper tracts and bronchi, and also has anti-inflammatory and anti-allergic effects.7 Other factors that affect the human body in a subterranean environment are: purity of the air, which isolates patients from anthropogenic pollution and allergens; elevated atmospheric pressure, increasing partial pressure of oxygen in the blood; high humidity, preventing excessive drying of the airway epithelium; and favorable ionization.710The subterranean atmosphere of the \u201cWieliczka\u201d Salt Mine is characterized by a high concentration of salt aerosol. The concentration of mineral components is 2.7\u20138.1\u2009mg/m3Pulmonary rehabilitation in speleotherapy conditions aims to increase tolerance to physical effort, improve functional fitness including the functioning of the respiratory system, educate the patient with regards to an effective breathing technique and strategy to deal with dyspnea, and also inspire motivation for systematic physical activity.From the literature review it appears that no research regarding using speleotherapy in pulmonary rehabilitation in older adults has yet been published.The aim of the study was to determine the efficiency of speleotherapy combined with pulmonary rehabilitation for improvement of functional fitness in older people and to verify if the strength, upper and lower body flexibility, endurance, and dynamic balance in the test group of patients with respiratory disorders are comparable with the standards defined for the Senior Fitness Test (SFT).The initial test group consisted of 26 individuals (21 women and 5 men) referred to a pulmonary rehabilitation program conducted in the \u201cWieliczka\u201d Salt Mine Health Resort. The test group for the eventual trial included 17 women and 5 men .Inclusion criteria were as follows.10Chronic upper and lower respiratory tract conditions. The participants were examined by a medical doctor to exclude contraindications for pulmonary rehabilitation and subterranean therapy.11 to assess the risk of disability in older people.Obtaining a minimum of 10\u2009points in the Short Physical Performance Battery testPatients aged 65\u2009years and older.Informed, written consent to participate in the project.The project was carried out on the basis of a study protocol approved by the Bioethical Commission of the Regional Medical Chamber in Krakow .All individuals included in the study took the SFT, which includes six consecutive tests:30-second Arm Curl test for upper body strength evaluation;30-second Chair Stand test for lower body strength evaluation;Back Scratch test for upper body flexibility evaluation;Chair Sit and Reach test for lower body flexibility evaluation;8-Foot Up and Go test for agility/dynamic balance evaluation;122-Minute Step test for endurance evaluation.1316 For this study the assessment was carried out twice: before and after the pulmonary rehabilitation program, according to the recommended procedure, in the same spacious room on the surface and assisted by a group of trained researchers.SFT, known also as the Fullerton Fitness Test, is a reliable research tool for evaluating the functional fitness of individuals over 60\u2009years old.The 3-week outpatient pulmonary rehabilitation program included 6-h daily treatment stays in a subterranean salt chamber 5 days a week (Monday\u2013Friday). The underground pulmonary rehabilitation program was performed in a complex of salt chambers in the \u201cWieliczka\u201d Salt Mine: Wessel Lake Chamber , EasternThe pulmonary rehabilitation program included 15 treatment sessions, with 3 sessions (90\u2009min) of supervised, group training run by a physiotherapist. The patients were divided into small groups by a qualified therapeutic team according to the diagnosis given by a qualifying doctor and the patient\u2019s age, comorbidities, and level of physical fitness. The training sessions were implemented according to the following scheme.-\u2003Gait training. Patients went down the shaft and then walked with the assistance of the medical staff along the 500-m long mine corridors to reach the salt chambers complex for the daily exercise program. After the 6-h underground treatment stay, the elderly individuals walked back the same distance to the shaft to exit the mine.-\u2003Strength training of upper and lower limbs for 30\u2009min. Strength training of upper and lower limbs was conducted with the use of dumbbells, elastic bands, gym balls, step platforms, and body weight. In the following weeks, the training was gradually intensified by increasing the load-\u2003Endurance training to music (aerobic exercise) or on a stationary bike for 30\u2009min-\u2003General fitness exercise combined with different breath control strategies for 30\u2009min.17 Each training workout started with a short 5-min warm-up and there was a minimum 20\u201330-min break between individual types of classes.Breathing exercises included pursed lip breathing, breathing control exercises coordinated with physical effort, diaphragmatic breathing, respiratory pattern correction, relaxation, and postural control exercises with the use of neuro-orthopedic activity-dependent plasticity (NAP) therapy.t-test for paired samples when the variables were normally distributed or Wilcoxon\u2019s tests for paired samples otherwise. Analysis was conducted using the R software package version 3.5.1.18An important part of the pulmonary rehabilitation program were health education classes performed additionally two times a week (30\u2009min). The aim of health education was to motivate patients to improve their physical activity, monitor their own health condition and self-esteem, and broaden their knowledge necessary to cope with their health problems. Quantitative comparison of values in two repeated measurements was performed using Student\u2019s 2 (mean 27.8\u2009kg/m2). A normal body weight was registered in 1 person, overweight in 14 individuals and obesity in the remaining 7. Among the conditions taken as an indication for pulmonary rehabilitation combined with speleotherapy, there were chronic diseases of the lower respiratory tract  including: bronchial asthma (8), chronic obstructive pulmonary disease , and bronchiectasis (1). There were also chronic diseases of the upper respiratory tract  including: sinusitis (4), pharyngitis (2), and laryngitis (2). Among comorbidities, we registered back pain in nine people (40% of patients), lower limb pain in eight people (36% of patients), and upper limb pain in six people (27%). Eight women and one man registered between one and five falls in the last five years.The study was conducted between March and July 2018. From the initial group of 26 patients, one woman did not complete the full program of pulmonary rehabilitation due to influenza and three women refused to participate in the second examination due to personal reasons. A total of 22 patients were included in the analysis (17 women and 5 men). The age of the participants ranged from 65 to 77\u2009years and the mean age was 68.3\u2009years, . The height of participants ranged from 150 to 174\u2009cm (mean 161.0\u2009cm), body weight ranged from 56 to 96\u2009kg (mean 72.2\u2009kg), and body mass index for the group was between 21 and 35\u2009kg/m19 After trials assessing upper and lower body strength and aerobic endurance, it was found that the majority of individuals obtained results within the norm. For the elasticity of both upper and lower body parts, nearly half of the results  were below the norm in the assessment before the rehabilitation in the underground salt chambers.Analysis of the patients\u2019 functional fitness before and after the pulmonary rehabilitation program was performed, with reference to the standards set for the SFT, regarding the age and sex of the patients.After the treatment stay, more than 70% of the elderly patients obtained results in the Sit and Reach test within the norms, however for Back Scratch the results of 8 patients (36% of examined group) were below the standards set by the SFT. In the test evaluating complex coordination, 58% of patients before the pulmonary rehabilitation did not achieve the established standards, but after the treatment stay 64% of the examined seniors fell within the normal range in the agility trial .In terms of lower body strength after the pulmonary rehabilitation, none of the subjects obtained values below the norm whilst five patients\u2019 performance (23% of patients) was above the norm.Before the exercise program in subterranean salt chambers, the results for lower body elasticity were found to occupy the low range in 11 seniors (42% of patients), whilst after the treatment stay only two persons were in the low range (9% of patients).p\u2009<\u20090.05). Only in the elasticity test for the upper body (Back Scratch test) the noted improvement was found to be not statistically significant  a significant improvement in performance was observed after the rehabilitation and treatment stay , PM4, which is independent of the season and weather above ground and demonstrates the significant air quality in the complex of therapeutic chambers.8Pulmonary rehabilitation performed in therapeutic salt chambers offer older adults who suffer from chronic respiratory diseases the possibility to exercise and relax in conditions of microbiological and palynological purity. According to Kostrzon 23 Moreover, the increased atmospheric pressure and air ionization play a significant role in the treatment process. In the conditions of the \u201cWieliczka\u201d Salt Mine\u2019s therapeutic chambers, the concentration of light  aeroions is 1200\u20134700 aeroions/cm3.24 According to Ponikowska and Ferson,10 negative air ionization has a good influence on the autonomic nervous system, hormonal system, respiratory tracts, and motor activity of the muscles groups causing, in particular, a reduction in oxygen consumption, an increase in biological activity, and decrease in blood pressure. Taking into consideration all the benefits the atmosphere inside the salt mine chambers can contribute, speleotherapy can be classified as one of the supportive methods for healthy ageing. Exercise training is a major component of pulmonary rehabilitation and therefore exercise performance-related outcomes are consistently used to objectively assess the individual patient\u2019s response to pulmonary rehabilitation and to evaluate the efficacy of the intervention.3 When evaluating the functional fitness of senior patients who suffer from pulmonary diseases, it was observed before starting the treatment in the underground resort that the majority of the patients obtained better results than the set American standards with regards to the complex coordination test of the SFT. In three other tests of the pre-treatment trial, that is, upper and lower body strength and endurance, they obtained the results within the established normal range. When flexibility was measured, more than 30% of the participants achieved the required norm for the upper body and nearly half of the group for the lower body. After the treatment stay, more than 70% of individuals reached the normal range in the Sit and Reach test. In the Back Scratch test a significant percentage (42% of the patients before the pulmonary rehabilitation and 36% of the seniors after the treatment program underground) were below the set standards.Staying in this kind of underground atmosphere free from anthropogenic pollution with a very low concentration of allergens , high air quality in terms of bacteriology, and a much lower concentration of micromolecular dust than above ground is very important for the treatment process. The synergistic influence of the aforementioned factors provides a strong therapeutic stimulus with anti-inflammatory, regenerating, and anti-allergic properties.21 indicates a weakening of the chest muscles progressing with advanced age and mechanical limitations arising from the changing shape of the chest into barrel-chest shape, collapsing of the respiratory tracts during vigorous breathing effort, and changes to the sensory input or central neuronal processing associated with stiffening of the rib cage.In daily life, these physical functional shortcomings can make it difficult to perform activities requiring a raising of the arms or dressing one\u2019s upper body. The authors of this report believe that the presence of pulmonary diseases and the older ages in the group of patients resulted in limitations in body flexibility being present. Shephard3 In a controlled study, Lim et al.25 examined 80 patients with COPD . From their evaluations with the aid of computed tomography, they conclude that the patients with COPD exhibited an increased anterio-posterior diameter of the thoracic cage in comparison with normal controls without any respiratory problems. Szczygie\u0142 et al.26 identified the tendency for the amplitude of rib cage movements to decrease with advancing age. Moreover, these authors point to the expiratory position of the chest and ossification of costal cartilage and shortening of skeletal muscles within the rib cage linked to ageing, which negatively influences both their length-tension relation and their ability to perform mechanical respiratory work.In patients with chronic respiratory diseases there are also postural impairments because respiration and posture have a coupled relationship.et al.27 examining the influence of an 8-month multi component physical training program performed twice a week on the functional fitness of women over 65\u2009years old. However, it was further observed that upon discontinuation of the program there was significant deterioration in upper and lower body strength and flexibility after just 3 months, whilst dynamic balance and aerobic endurance were less affected. These authors suggest that emphasis on flexibility training may help to retain functional fitness of older adults.The analysis of the research results presented in this paper shows that after 15 sessions of a complex pulmonary rehabilitation program in the underground salt chambers, there is an observed significant improvement in performance in five of the six tested parameters of functional fitness in older adults. Only flexibility of the upper body, as evidenced by the Back Scratch test, was not significantly improved after the pulmonary rehabilitation program. A significant improvement within all the parameters of SFT test was found in the research of Carvalho et al.28 used the Sit and Reach test to evaluate the influence of a 6-month sensorimotor training program, performed twice weekly for 50\u2009min on unstable surfaces, on the body flexibility of 37 women aged over 65\u2009years. No significant increase in body flexibility was observed, either immediately upon completing the training program or at a 3-month follow-up assessment.M\u0119tel et al.29 investigated the influence of traditional Greek dance classes, in twice weekly 75-min sessions over 32\u2009weeks, on a group of 130 people over 60\u2009years old. Employing the SFT, significant positive changes in all functional fitness parameters were observed. As an alternative form of therapeutic intervention that perhaps encourages the continued participation of older adults by its enjoyable nature, and given its potential to increase flexibility in the upper body, it is worth pursuing the inclusion of progressive dance activities or other effective forms of flexibility training in the complex pulmonary rehabilitation of seniors.Douka The present study suffers for the lack of a control group for comparison, where participants would undertake the same program in regular, over-ground conditions. Nevertheless, the results confirm that promoting healthy ageing should be cross-curricular and take into account functional activities. The SFT test battery enables a consistent trans-global evaluation of older adults\u2019 fitness levels. However, there are no standards agreed for the population of Polish seniors. It would be advisable to additionally formulate them for patients with pulmonary conditions.Speleotherapy combined with pulmonary rehabilitation improves the functional fitness of the examined older adults as measured by the SFT, in terms of upper and lower body strength, lower body flexibility, and dynamic balance. Before the treatment stay, the majority of individuals obtained results within the norm established for the SFT in 30-second Arm Curl, 30-second Chair Stand, and 2-Minute Step test. After the pulmonary rehabilitation conducted in subterranean conditions, the results of seniors were not comparable with the standards defined for the Back Scratch test for upper body flexibility evaluation.As a limitation of this study, it must be noted that there was no control group to go through the same rehabilitation program without the speleological conditions of the salt chamber, which would allow us to identify the relative contributions of both factors to any improvements observed. It is suggested to conduct the same intensive 3-week training program above ground to investigate the impact of climate conditions on the physical performance of seniors.Achieving an improvement in upper body flexibility in seniors with pulmonary diseases constitutes a therapeutic challenge and may require alternative methods for rehabilitation, for instance with the use of dance or other forms of activity shown to improve this element of functional fitness for older people.Click here for additional data file.Supplemental material, Author_Response for The influence of speleotherapy combined with pulmonary rehabilitation on functional fitness in older adults \u2013 preliminary report by Sylwia M\u0119tel, Magdalena Kostrzon, Justyna Adamiak, Halina Gattner, Dominika Ko\u015bcielecka, Angelika Sosulska, El\u017cbieta Szczygie\u0142 and Joanna Golec in Therapeutic Advances in Respiratory DiseaseClick here for additional data file.Supplemental material, Reviewer_1_v.1 for The influence of speleotherapy combined with pulmonary rehabilitation on functional fitness in older adults \u2013 preliminary report by Sylwia M\u0119tel, Magdalena Kostrzon, Justyna Adamiak, Halina Gattner, Dominika Ko\u015bcielecka, Angelika Sosulska, El\u017cbieta Szczygie\u0142 and Joanna Golec in Therapeutic Advances in Respiratory DiseaseClick here for additional data file.Supplemental material, Reviewer_1_v.2 for The influence of speleotherapy combined with pulmonary rehabilitation on functional fitness in older adults \u2013 preliminary report by Sylwia M\u0119tel, Magdalena Kostrzon, Justyna Adamiak, Halina Gattner, Dominika Ko\u015bcielecka, Angelika Sosulska, El\u017cbieta Szczygie\u0142 and Joanna Golec in Therapeutic Advances in Respiratory DiseaseClick here for additional data file.Supplemental material, Reviewer_2_v.1 for The influence of speleotherapy combined with pulmonary rehabilitation on functional fitness in older adults \u2013 preliminary report by Sylwia M\u0119tel, Magdalena Kostrzon, Justyna Adamiak, Halina Gattner, Dominika Ko\u015bcielecka, Angelika Sosulska, El\u017cbieta Szczygie\u0142 and Joanna Golec in Therapeutic Advances in Respiratory DiseaseClick here for additional data file.Supplemental material, Reviewer_2_v.2 for The influence of speleotherapy combined with pulmonary rehabilitation on functional fitness in older adults \u2013 preliminary report by Sylwia M\u0119tel, Magdalena Kostrzon, Justyna Adamiak, Halina Gattner, Dominika Ko\u015bcielecka, Angelika Sosulska, El\u017cbieta Szczygie\u0142 and Joanna Golec in Therapeutic Advances in Respiratory Disease"}
+{"text": "Laccase is a copper-containing enzyme which inhibition might prevent or reduce the activity of the plant pathogens that produce it in various biochemical processes. The kinetic and molecular modeling studies were performed and for selected compounds, the docking results were discussed. Seven 4-hydroxybenzhydrazide (4-HBAH) derivatives exhibited micromolar activity Ki = 24\u2013674 \u00b5M with the predicted and desirable competitive type of inhibition. The structure\u2013activity relationship (SAR) analysis revealed that a slim salicylic aldehyde framework had a pivotal role in stabilization of the molecules near the substrate docking site. Furthermore, the presence of phenyl and bulky tert-butyl substituents in position 3 in salicylic aldehyde fragment favored strong interaction with the substrate-binding pocket in laccase. Both 3- and 4-HBAH derivatives containing larger 3-tert-butyl-5-methyl- or 3,5-di-tert-butyl-2-hydroxy-benzylidene unit, did not bind to the active site of laccase and, interestingly, acted as non-competitive (Ki = 32.0 \u00b5M) or uncompetitive (Ki = 17.9 \u00b5M) inhibitors, respectively. From the easily available laccase inhibitors only sodium azide, harmful to environment and non-specific, was over 6 times more active than the above compounds.A series of hydrazide-hydrazones  Sclerotniaceae family, for instance, gray mold (Botrytis cinerea) which attacks flowers, green tissues of crop plants methyl}benzenesulfonate (1d). For this compound, the spectra were measured in fully deuterated CH3OH. In the 1H-NMR spectra measured in DMSO-d6, the amide proton (NHCO), phenolic hydroxy group of the 4-HBAH fragment (4\u2013OH) and conjugate imine (CH=N) resonances were observed at ca.: 11.24\u201312.18, 9.83\u201310.80 and 8.32\u20138.93 ppm, respectively. In the 13C-NMR spectra, the resonances of the conjugated carbonyl and imine C=O and C=N carbond, and tertiary C-4 phenolic carbon atoms, and ArC-2 were observed at ca.: 161.93\u2013162.80 and 142.19\u2013150.36, 160.43\u2013161.04 and 154.72\u2013160.77 ppm, respectively. For the sulfonic acid sodium salt derivative 1d, similar chemical shifts were observed in the 1H-NMR resonance. The hydrazide-hydrazones which had phenyl or alkyl group near the salicylic hydroxy group caused a weak bathochromic effect. The spectroscopic data were consistent with the data published in the literature ..tert-but6d) and 3-isopropyl-6-methylsalicylaldehyde (7e) were prepared by the Reimer-Tiemann formylation of 4-bromophenol (10d) + or [M + Na]+ molecular species are reported. The literature procedure was adapted for the preparation of benzoic acid hydrazide 4b\u2013c 4 and CaH4 and CaH 4 and CaH 4 and CaH 4 and CaH 4 and CaH 4 and CaH 4 and CaH 4 and CaH 4 and CaH 4 and CaH4 and CaHr 1c 4 and CaH benzohydrazide (1a). The general procedure starting from benzaldehyde , 4-hydroxybenzohydrazide , CH3OH (5.0 mL), and AcOH (100 \u00b5L) was employed with a 2 h reaction time, and solvent was slowly distilled to a volume of cas 2.5 mL before crystallization to obtain hydrazide-hydrazone 1a. Colorless crystals; 462 mg, 1.92 mmol, 96% yield; m.p. 242\u2013244 \u00b0C (from CH3OH) , 3056 (C-H), 3039 (C-H), 3027 (C-H), 1614 (C=O), 1588 (C=C), 1548 (CH=N), 1509, 1356, 1280 (C-O), 1212, 1172, 1110, 1056, 960, 844, 763, 661, 630, 614, 510, 492; 1H-NMR : \u03b4 11.64 , 10.13 , 8.43 , 7.81 , 7.71 , 7.38\u20137.48 , 6.87  ppm; 13C-NMR : \u03b4 162.77 (C=O), 160.66 (C-4), 146.82 (CH=N), 130.47 (ArC-1), 129.79 (ArC-4), 129.65 , 128.75 , 126.90 , 123.81 (C-1), 114.98  ppm; HRMS (Time-of-Flight (TOF), Mass spectrometry (MS), Electrospray ionization (ESI)) calculated for C14H12N2O2 [M + Na]+m/z 263.0786, found 263.0806.4-Hydroxy-N\u2019-[(E)-3-phenylpropylidene]benzohydrazide (1b) +m/z 269.1279, found 269.1288.ide (1b) . The gen4-Hydroxy-N\u2019-[(E)-(4-methylphenyl)methylidene]benzohydrazide monomethanolate (1c). The general procedure starting from 4-methylbenzaldehyde , 4-hydroxybenzohydrazide , in CH3OH (15 mL) was employed with a 2 h reaction time to obtain hydrazide-hydrazone 1c in 92% yield, which was recrystallized slowly from hot CH3OH (30 mL/g) to obtain hydrazide-hydrazone 1c crystallized with one molecule of CH3OH. Colorless crystals; 456 mg, 1.59 mmol, 80% yield; m.p. 246\u2013247 \u00b0C , 1622 (C=C), 1605 (C=O), 1538 (CH=N), 1500, 1351, 1280 (C-O), 1265, 1208, 1173, 1110, 1012, 956, 907, 854, 843, 814, 767, 742, 591 (br), 513, 478; 1H-NMR : \u03b4 11.59 , 10.13 , 8.39 , 7.81 , 7.60 , 7.25 , 6.86 , 4.12 , 3.17 , 2.33  ppm; 13C-NMR : \u03b4 162.67 (C=O), 160.61 (C-4), 146.85 (CH=N), 139.60 (ArC-4), 131.76 (ArC-1), 129.60 , 129.38 , 126.89 , 123.88 (C-1), 114.96 , 48.56 (CH3OH), 20.97 (Me) ppm.Sodium 2-{(E)-[2-(4-hydroxybenzoyl)hydrazinylidene]methyl}benzenesulfonate (1d). The general procedure starting from \u226595% sodium 2-formylbenzenesulfonate , 4-hydroxybenzohydrazide , CH3OH (5.0 mL), in the absence of AcOH, was employed with a 2 h reaction time. The reaction mixture was concentrated in vacuum to a small volume of ca. 2 mL, then the product was isolated by slow crystallization in an open vessel to obtain hydrazide-hydrazone 1d which crystallized with 2/3 a molecule of CH3OH. Yellow powder; 720 mg, 1.94 mmol, 97% yield, m.p. 251 \u00b0C (from CH3OH) with decomposition; selected FT-IR (ATR) \u03bdmax/cm\u22121: 3635 (CH3OH), 3377 (O-H), 3307 (N-H), 1608 (C=O), 1578 (C=C), 1556 (CH=N), 1510, 1272 (C-O), 1178 (SO3Na), 1134, 1017, 850, 760, 615, 563, 526, 482; 1H-NMR : \u03b4 9.24 , 8.32 , 7.98 , 7.87 , 7.51 , 7.45 , 6.88 , 3.35  ppm; 13C-NMR : \u03b4 167.07 (C=O), 162.80 (C-4), 148.93 (CH=N), 145.22 (ArC-2), 132.84 (ArC-1), 131.51 (ArC-5), 131.02 , 130.60 (ArC-4), 128.29 , 124.62 (C-1), 116.32 , 49.90 (CH3OH) ppm; HRMS  calculated for C14H11N2O5S [M + Na]+m/z 365.0173, found 365.0185.4-Hydroxy-N\u2019-[(E)-(2-hydroxyphenyl)methylidene]benzohydrazide (1e). The general procedure starting from salicylic aldehyde , 4-hydroxybenzohydrazide , CH3OH (40 mL) and AcOH (200 \u00b5L) was employed, with a 2 h reaction time. The reaction mixture was slowly concentrated to a small volume before crystallization to obtain compound 1e. Colorless powder; 440 mg, 1.72 mmol, 86% yield; m.p. 265.0\u2013266.5 \u00b0C (from CH3OH) (257\u2013258 \u00b0C +m/z 279.0735, found 279.0745.7\u2013258 \u00b0C ); select4-Hydroxy-N\u2019-[(E)-(3-hydroxyphenyl)methylidene]benzohydrazide monohydrate (1f). The general procedure starting from 3-hydroxybenzaldehyde , 4-hydroxybenzohydrazide , CH3OH (2.5 mL), and AcOH (100 \u03bcL) was employed, with a 2 h reaction time. To the reaction mixture, cooled to RT, H2O (2.5 mL) was added before crystallization, to obtain 1f which crystallized with one molecule of H2O. Pale crystals; 255 mg, 0.93 mmol, 93% yield; m.p. 254 \u00b0C  with decomposition (>250 \u00b0C +m/z 279.0735, found 279.0747. 1H-NMR and 13C-NMR data and elementary analysis calculated for C14H12N2O3 \u00d7 1H2O are consistent with literature values benzohydrazide (1g). The general procedure starting from 4-hydroxybenzaldehyde , 4-hydroxybenzohydrazide , CH3OH (2.5 mL) and AcOH (200 \u03bcL) was employed, with a 2 h reaction time to obtain of hydrazide-hydrazone 1g which crystallizes with 1/3 a molecule of CH3OH. Pale crystals; 512 mg, 1.92 mmol, 96% yield; m.p. 261 \u00b0C (from CH3OH) with decomposition (>265 \u00b0C +m/z 279.0735, found 279.0747.(>265 \u00b0C ); select4-Hydroxy-N\u2019-[(E)-(2-methoxyphenyl)methylidene]benzohydrazide (1h). The general procedure starting from 2-methoxybenzaldehyde , 4-hydroxybenzohydrazide , CH3OH (10 mL), and AcOH (150 \u03bcL) was employed, with a 4 h reaction time. The reaction mixture was cooled to RT and H2O (2.5 mL) was added before crystallization to obtain hydrazide-hydrazone 1h. Pale powder; 383 mg, 1.42 mmol, 71% yield; m.p. 236\u2013237 \u00b0C  , 2971 (C-H), 2942 (C-H), 2840 (C-H), 1607 (C=O), 1558 (C=N), 1508, 1468, 1360, 1315, 1286 (C-O), 1253 (C-O), 1235, 1172, 1055 (C-O), 1046, 835, 755, 618, 489; 1H-NMR : \u03b4 11.66 , 10.11 , 8.79 , 7.86 , 7.83 , 7.40 , 7.09 , 7.01 , 6.86 , 3.86  ppm; 13C-NMR : \u03b4 162.52 (C=O), 160.57 (C-4), 157.57 (ArC-2), 142.19 (CH=N), 131.24 (ArC-4), 129.59 , 125.36 (ArC-6), 123.79 (C-1), 122.46 (ArC-1), 120.66 (ArC-5), 114.92 , 111.73 (ArC-3), 55.58 (OMe) ppm; HRMS  calculated for C15H14N2O3 [M + Na]+m/z 293.0891, found 293.0889.nd AcOH 1 \u03bcL was e4-Hydroxy-N\u2019-[(E)-(3-methoxyphenyl)methylidene]benzohydrazide (1i). The general procedure starting from 3-methoxybenzaldehyde , 4-hydroxybenzohydrazide , CH3OH (5.0 mL), and AcOH (100 \u00b5L) was employed, with a 5 h reaction time. The reaction mixture was concentrated to a volume of ca. 2.2 mL, and H2O (300 \u00b5L) was added before crystallization to obtain hydrazide-hydrazone 1i. Colorless powder; 213 mg, 0.79 mmol, 79% yield; m.p. 210\u2013212 \u00b0C  (205\u2013206 \u00b0C +m/z 293.0891, found 293.0895.5\u2013206 \u00b0C ); select4-Hydroxy-N\u2019-[(E)-(4-methoxyphenyl)methylidene]benzohydrazide (1j). The general procedure starting from 4-methoxybenzaldehyde , 4-hydroxybenzohydrazide , and CH3OH (10 mL) in the absence of AcOH, with a 5 h reaction time to obtain hydrazide-hydrazone 1j. White needless; 443 mg, 1.64 mmol, 82% yield; m.p. 223\u2013224 \u00b0C (from CH3OH) , 3043 (C-H), 3006 (C-H), 2839 (C-H), 1595 (C=O), 1576 (C=C), 1553 (CH=N), 1505, 1439, 1361, 1312, 1277, 1249 (C-O), 1230 (C-O), 1167, 1060 (C-O), 1020, 962, 842, 827, 756, 682, 619, 546, 529; 1H-NMR : \u03b4 11.50 , 10.09 , 8.37 , 7.79 , 7.65 , 7.01 , 6.85 , 3.80  ppm; 13C-NMR : \u03b4 162.58 (C=O), 160.60 (ArC-4), 160.52 (C-4), 146.73 (CH=N), 129.52 , 128.47 , 127.01 (ArC-1), 123.96 (C-1), 114.93 , 114.23 , 55.20 (OMe) ppm; 1H-NMR : \u03b4 11.52 , 10.11 , 8.37 , 7.80 , 7.65 , 7.01 , 6.86 , 3.80  ppm; 13C-NMR ; \u03b4 162.56 (C=O), 160.61 (ArC-4), 160.52 (C-4), 146.71 (CH=N), 129.53 , 128.47 , 127.02 (ArC-1), 123.97 (C-1), 114.93 , 114.25 , 55.21 (OMe) ppm; HRMS  calculated for C15H14N2O3 [M + H]+m/z 271.1072, found 271.1098.0\u2013221 \u00b0C ); select4-Hydroxy-N\u2019-[(E)-(2-hydroxy-3-phenyl-phenyl)methylidene]benzohydrazide monomethanolate (2a). The general procedure starting from 3-phenylsalicylic aldehyde  +m/z 333.1228, found: 333.1227.50 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-(3-tert-butyl-2-hydroxyphenyl)methylidene]benzohydrazide (2b). The general procedure starting from 3-tert-butyl-salicylic aldehyde  +m/z 313.1547, found: 313.1540..0 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-methylidene]benzohydrazide (2c) +m/z 273.0870, found 273.0872.ide (2c) . The gen4-Hydroxy-N\u2019-[(E)-(5-bromo-2-hydroxyphenyl)methylidene]benzohydrazide (2d). The general procedure starting from 5-bromosalicylic aldehyde  +m/z 356.9845, found 356.9857..0 mmol) , 4-hydro9\u2013280 \u00b0C ); select4-Hydroxy-N\u2019-[(E)-(6-methoxy-2-hydroxyphenyl)methylidene]benzohydrazide (2e). The general procedure starting from 6-methoxysalicylic aldehyde  +m/z 287.10263, found 287.1035..0 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-methylidene]benzohydrazide (2f). The general procedure starting from 2,6-dimethoxybenzaldehyde  +m/z 323.1002, found 323.1002..0 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-(4-hydroxy-3-methoxyphenyl)methylidene]benzohydrazide (2g) +m/z 309.0851, found 309.0845.ide (2g) . The gen(226\u2013227 ); select4-Methoxy-N\u2019-[(E)-2-hydroxy-3-phenyl-benzylidene]benzohydrazide (2h). The general procedure starting from 3-phenylsalicylic aldehyde  +m/z 369.1210, found 369.1198..0 mmol) , 4-metho.0 mmol) , CH3OH (4-Hydroxy-N\u2019-[(E)-2-hydroxy-3-hydroxymethyl-5-methyl-benzylidene]benzohydrazide (3a). The general procedure starting from 3-hydroxymethyl-5-methylsalicylic aldehyde  +m/z 323.1002, found 323.1008..0 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-(5-hydroxymethyl-3-methyl-2-hydroxyphenyl)methylidene]benzohydrazide (3b). The general procedure starting from 5-hydroxymethyl-3-methylsalicylic aldehyde  +m/z 323.1002, found 323.1002.50 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-methylidene]benzohydrazide (3c). The general procedure starting from 3,5-di-tert-butyl-salicylic aldehyde , 4-hydroxybenzohydrazide , CH3OH (10 mL), and AcOH (100 \u00b5L) was employed, with a 6 h reaction time to obtain of compound 3c. Colorless needles; 1.22 g, 3.31 mmol, 83% yield; m.p. 274.5\u2013275.5 \u00b0C (from CH3OH); the second fraction of 3c was obtain from concentrated filtrates: 156 mg, 0.42 mmol, 10.5% yield; m.p. 274\u2013275 \u00b0C; selected FT-IR (ATR) \u03bdmax/cm\u22121: 3161 , 2955 (C-H), 2907 (C-H), 2867 (C-H), 1642 (C=C), 1607 (C=O), 1583 (CH=N), 1558, 1511, 1435, 1355, 1280, 1248, 1233 (C-O), 1172 (C-O), 891, 844, 769, 665, 618, 494; 1H-NMR : \u03b4 12.35 , 11.99 , 10.21 , 8.54 , 7.84 , 7.30 , 7.20 , 6.89 , 1.41 , 1.28  ppm; 13C-NMR : \u03b4 162.37 (C=O), 160.95 (C-4), 154.60 (ArC-2), 150.26 (CH=N), 140.26 (ArC-5), 135.53 (ArC-3), 129.70 , 125.52 (ArC-6), 125.26 (ArC-4), 123.00 (C-1), 117.06 (ArC-1), 115.13 , 34.59 (C-3-tBu), 33.81 (C-5-tBu), 31.25 (3 \u00d7 CH3 \u2013 5-tBu), 29.24 (3 \u00d7 CH3 \u2013 3-tBu) ppm; HRMS  calculated for C22H28N2O3 [M + H]+m/z 369.2173, found 369.2177.4-Hydroxy-N\u2019-[(E)-3-tert-butyl-2-hydroxy-5-methylbenzylidene]benzohydrazide (3d). The general procedure starting from 3-tert-butyl-5-methylsalicylic aldehyde  +m/z 349.1523, found 349.1517..0 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-(2-hydroxy-3-isopropyl-6-methylphenyl)methylidene]benzohydrazide (3e). The general procedure starting from 3-isopropyl-6-methylsalicylic aldehyde  +m/z 313.1547, found: 313.1548..0 mmol) , 4-hydro4-Hydroxy-N\u2019-[(E)-methylidene]benzohydrazide (3f). The general procedure starting from 4,6-dimethoxysalicylic aldehyde  +m/z 317.1132, found 317.1145..0 mmol)  and 4-hy3-Hydroxy-N\u2019-[(E)-(3-tert-butyl-2-hydroxy-5-methylphenyl)methylidene]benzohydrazide (3g). The general procedure starting from 3-tert-butyl-5-methylsalicylic aldehyde  +m/z 349.1523, found 349.1524..0 mmol) , 3-hydrov/v) at 25 \u00b0C was investigated (see 0 = 65000 M\u22121\u00b7cm\u22121 , k3 [min\u20131] \u2013 kinetic constants, Vmax \u2013 maximal velocity [\u00b5M\u00b7min\u20131], CS \u2013 substrate concentration [\u00b5M], CE \u2013 enzyme concentration [\u00b5M].The activity of laccase was determined using the procedure described by Leonowicz and Grzywnowicz . Basicalated see . The samM\u22121\u00b7cm\u22121 . Kinetiction (1) :V = Vmax2); the sum of squared errors (SSE) and root mean squared error (RMSE). The 25 hydrazide-hydrazones, 4-hydroxybenzoic acid , 4-hydroxybenzohydrazide (4a \u2013 4-HBAH), and sodium azide (control) were tested against laccase in the standard reaction mixture. Prior to the substrate addition, the laccase and tested compound were pre-incubated for 10 min at 25 \u00b0C. At least three inhibitor concentrations were used in each experiment. All measurements were performed in triplicate. To determine the type of inhibition Lineweaver\u2013Burk transformation was used applying the following equations for competitive (2), uncompetitive (3) and non-competitive model (4) [Km [\u00b5M]\u2014Michaelis-Menten constant, Vmax\u2014maximal velocity [\u00b5M\u00b7min\u20131], Ki\u2014inhibition constant [\u00b5M], CS\u2014substrate concentration [\u00b5M], Ci\u2014inhibitor concentration [\u00b5M].The parameters of the function were estimated using the nonlinear least square method in Matlab . The method was used simultaneously for datasets obtain for different enzyme concertation. The common minimum of error function was found for all considered datasets resulting in one common estimate of each model parameter. The goodness of fit was assessed using the coefficient of determination (Rodel (4) . The parBind energy for each inhibitor were selected as the final results.A crystal structure of an enzyme was obtained from the RCSB Protein Data Bank (PDB). The 1GYC  was preppara-hydroxybenzoic acid unit that served as a decoy, reminiscent of typical phenolic laccase substrates. In addition, salicylic aldehydes with bulky groups in the adjacent 3rd position provided strong interaction with the hydrophobic part of the substrate-binding centre. In this regard, the reversible competitive action on laccase of the tested hydrazide-hydrazones is beneficial for further design of inhibitors for bio-application.In this article, we identified a novel class of low-molecular-weight hydrazide-hydrazones, which contained naturally derived units of aldehydes having an aromatic motif and/or hydroxybenzoic acids. We presented the characteristics of 25 molecules, including 14 new ones, and their inhibition potency toward laccase of fungal origin. The results of the syringaldazine oxidation in the presence of the compounds indicated that they essentially acted as reversible competitive inhibitors, with some exceptions. The computational docking simulations showed that both aromatic fragments connected by a hydrazide linker in the molecules were crucial for their activity. The hydrazide fragment contained a"}
+{"text": "The formation of silenced and condensed heterochromatin foci involves enrichment of heterochromatin protein 1 (HP1). HP1 can bridge chromatin segments and form liquid droplets, but the biophysical principles underlying heterochromatin compartmentalization in the cell nucleus are elusive. Here, we assess mechanistically relevant features of pericentric heterochromatin compaction in mouse fibroblasts. We find that (1) HP1 has only a weak capacity to form liquid droplets in living cells; (2) the size, global accessibility, and compaction of heterochromatin foci are independent of HP1; (3) heterochromatin foci lack a separated liquid HP1 pool; and (4) heterochromatin compaction can toggle between two \u201cdigital\u201d states depending on the presence of a strong transcriptional activator. These findings indicate that heterochromatin foci resemble collapsed polymer globules that are percolated with the same nucleoplasmic liquid as the surrounding euchromatin, which has implications for our understanding of chromatin compartmentalization and its functional consequences.  \u2022HP1 has only a weak capacity to form droplets in living cells\u2022Size, accessibility, and compaction of heterochromatin foci are independent of HP1\u2022Heterochromatin compaction is \u201cdigital\u201d and can toggle between two distinct states\u2022Methodological framework to assess hallmarks of phase separation in living cells Mouse cells package heterochromatin into compact foci. Erdel et\u00a0al. show that these foci lack hallmarks of liquid droplets and rather resemble collapsed polymer globules. Their size, accessibility, and compaction are independent of HP1. They can adopt two distinct folding states that possibly represent the fundamental modes of chromatin compaction. Cells partition their genome into distinct chromatin domains with specific functions. Some of them form micrometer-sized chromatin subcompartments in three-dimensional nuclear space . A promiHeterochromatin formation involves recruitment of HP1, which can form bridges between nucleosomes  and can Whether heterochromatin is established by droplet formation of HP1, collapse into a chromatin globule, or weak bridging without globule or droplet formation has a number of functional implications. The droplet model predicts that the size of chromocenters increases when the total cellular HP1 level increases, whereas the HP1 concentration inside chromocenters remains constant, a behavior known as \u201cconcentration buffering\u201d . Accordiin\u00a0vitro, in the nucleoplasm and when tethered to chromatin, and found that it does not form stable droplets in living cells. By studying molecular transport in chromocenters and by following their response to forced activation, we found that chromocenters resemble collapsed chromatin globules. Their global compaction, accessibility, and size was independent of HP1. Depending on the presence of transcriptional activators,\u00a0they toggled between two digital chromatin compaction states.\u00a0These two states might represent the fundamental compaction modes of chromatin that control long-range chromatin contacts and accessibility to nucleoplasmic factors.It is currently unclear how HP1 drives heterochromatin compartmentalization in living cells and which of the functional consequences above arise from it. To address this question, here we assessed key biophysical properties of chromocenters and the associated heterochromatin proteins in mouse fibroblasts. We compared the capacity of HP1 to form droplets Drosophila HP1a and human HP1\u03b1 can form liquid droplets in\u00a0vitro, which for human HP1\u03b1 is promoted by phosphorylation, addition of DNA, or removal of salt  lacked H3K9me3 and HP1\u03b1 enrichment at chromocenters, as shown previously , whereas WT cells showed an additional component reflecting larger structures  as a control  bound to the adjacent tetO array as a reference  analysis of HP1\u03b1 at the lacO array  and in chromocenters (\u03c4r\u00a0= 111\u00a0\u00b1 8\u00a0ns) (r\u00a0= 74\u00a0\u00b1 7\u00a0ns), which might reflect a reduced size of the rotating HP1 species because of decreased HP1 dimerization or lack of nuclear binding partners. As a reference, we conducted Pol-FCS measurements with purified GFP-HP1 at a concentration of \u223c50\u00a0nM; i.e., below the concentration for dimerization or self-association, in glycerol-water mixtures with different viscosities  . In the cosities G. As expcosities , demonstAnother hallmark feature of liquid droplets is concentration buffering . It refeSuv39h\u00a0dn and WT cells reacted similarly to dCas9-VPR and dCas9-GFP  Chromocenters lack preferential internal mixing and have the same viscosity as\u00a0the surrounding euchromatin, indicating that both\u00a0types of chromatin are percolated by the same nucleoplasmic liquid and are accessible to factors dissolved in it. (3)\u00a0Partial exclusion of GFP from chromocenters is independent of\u00a0HP1. Thus, access to chromocenters by an inert tracer protein\u00a0is not regulated by HP1 but likely by the tracer\u2019s ability to penetrate the denser chromocenter structure. (4) The HP1\u03b1 level in chromocenters, but not the size of chromocenters, follows the total cellular HP1\u03b1 level, indicating that heterochromatin spreading is not directly linked to the HP1\u03b1 concentration as would be expected for liquid droplets. However, it is conceivable that spreading of the repressive heterochromatin state  is linked\u00a0to HP1 by other means because HP1 is a central heterochromatin protein with many interaction partners and functions. (5) Compaction of chromocenters is sensitive to the presence of a strong activator but not to HP1. Upon forced activation, heterochromatin compaction shows a switch-like transition, and chromocenters abruptly decompact, indicating that compaction is digital, as expected for the formation of a collapsed polymer globule.In this study, we assessed key biophysical properties of mouse pericentric heterochromatin that are relevant for understanding chromatin compartmentalization and its consequences for the accessibility, spreading, and maintenance of heterochromatin. To this end, we combined complementary techniques, some of which involved fluorescently tagged HP1. Several crucial features of endogenous HP1\u03b1 are preserved for GFP-HP1\u03b1; e.g., its ability to bind to chromocenters, to undergo protein-protein interactions via its chromo- and chromoshadow domain , to formin\u00a0vitro , and to in\u00a0vitro . To addrin\u00a0vitro , employein\u00a0vitro , and comin\u00a0vitro . CombiniTaken together, we report that the global compaction, accessibility, and size of chromocenters is largely independent of HP1.\u00a0This result is in line with a number of earlier studies showing that compact chromocenters and other heterochromatin domains can form and be maintained without HP1 binding e.g., . We findOur work presented here sheds light on the biophysical basis\u00a0of chromatin compartmentalization and the consequences\u00a0arising from it. We anticipate that it will help dissect the contributions of protein self-association, liquid phase separation, and polymer collapse to the structure and function of chromatin subcompartments in different systems to uncover the general rules governing chromatin partitioning across cell types and species.fabian.erdel@ibcg.biotoul.fr). All unique/stable reagents generated in this study are available from the corresponding authors with a completed Material Transfer Agreement.The Lead Contact for this study is Fabian Erdel  and assessed their authenticity by analyzing RNA-seq data generated with them as compared to\u00a0published datasets.Cells were grown in GIBCO DMEM (Thermo Fisher Scientific) supplemented with 10% fetal calf serum (PAA), 2\u00a0mM L-glutamine, 1% penicillin/streptomycin (PAA) and 1 g/l glucose for U2OS or 4.5 g/l glucose for iMEF and 3T3 cells. Cells were cultured at 37\u00b0C and 5% CO2-HP1\u03b1 was constructed by inserting RGG-GFP-RGG from Addgene plasmid #124939 upstream of the coding sequence of HP1. The plasmid encoding for HP1\u03b1 and ZsGreen (separated by an IRES) was constructed by inserting the coding sequence of HP1\u03b1 into the cloning site of pTRE3G-ZsGreen1 (Clontech). The resulting pTRE3G-ZsGreen1-HP1\u03b1 plasmid was cotransfeced with pCMV-Tet3G (Clontech) to induce expression. For dCas9-GFP (\u201cdCas9-mock\u201d), the dCas9 open reading frame derived from Addgene plasmid #60910 was cloned into a pEGFP-N1 backbone (Clontech). For dCas9-GFP-VPR, the coding sequence for VPR from Addgene plasmid #63798 was inserted\u00a0downstream of the coding sequence for dCas9-GFP. The plasmid encoding for different single guide RNAs (sgRNAs) was derived from Addgene #61424. Inserted sgRNA targeting regions were: 5-\u2019GGGCAAGAAAACTGAAAATCA-3\u2032 (mSat) and 5\u2032-GTTCGCTCACAATTCCACATG-3\u2032 .For purification of recombinant mouse HP1, the coding sequences for mouse HP1\u03b1 and GFP-HP1\u03b1 were cloned into pET16  and pET28 , respectively. The H2B-GFP plasmid was cloned based on the histone constructs described previously . The conE.\u00a0coli Rosetta cells. Cells were grown in LB medium supplemented with 1\u00a0mM IPTG at 18\u00b0C overnight. Subsequently, cells were pelleted and resuspended in lysis buffer . Cleared cell lysates were incubated with 5\u00a0mL Ni-NTA resin (Macherey-Nagel) per 400\u00a0mL of bacterial culture and were allowed to bind for 2h at 4\u00b0C. The resin was centrifuged, washed and eluted with elution buffer . Eluates were dialyzed into storage buffer without glycerol . For the images in -1 cm-1 for HP1\u03b1 and \u03b5\u00a0= 76,634 M-1 cm-1 for GFP-HP1\u03b1 .Mouse HP1\u03b1 and GFP-HP1\u03b1 carrying an N-terminal His-tag were expressed in Droplet formation was evaluated by mixing HP1 solutions with a 33\u00a0mg/ml solution of salmon sperm DNA (Sigma) in storage buffer\u00a0and measuring the turbidity at a wavelength of 600\u00a0nm with a microplate reader (Thermo Fisher Scientific). For the images in For Western Blotting in For immunostaining, cells were seeded onto coverslips  and fixed with 4% paraformaldehyde for 12\u00a0minutes, permeabilized with 0.2% Triton X-100 in PBS for 12\u00a0minutes, and blocked with 5% BSA/0.1% Triton X-100 in PBS for 30\u00a0minutes (for STED) or 10% goat serum in PBS . Cells were labeled with 1:100 diluted primary antibodies and with secondary antibodies conjugated with Abberior StarRed (for STED) or Alexa488/Alexa568  in blocking buffer for one hour. After 3 washes with PBS, DNA was stained with DAPI  and coverslips were rinsed with water , dehydrated in 100% ethanol and mounted with Mowiol (for STED) or Prolong Diamond .tetO sites (iMEF cells were transfected with Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer\u2019s protocol, U2OS cells were transfected with Effectene (QIAGEN) or Xtreme Gene 9 (Roche) according to the manufacturers\u2019 protocols. For recruitment of TetR-PHR-YFP-HP1 to tO sites E, cells tO sites A\u20137C, iMEtO sites D\u20137I, celConfocal imaging experiments in Optodroplets in Fluorescence recovery after photobleaching (FRAP) experiments were conducted using a Leica TCS SP5 II confocal microscope equipped with a 63x oil immersion objective. All half-chromocenter and half-nucleolus FRAP experiments were conducted with a line frequency of 400\u00a0Hz, an image size of 512\u00a0\u00d7 64 pixels, a pixel size of 60\u00a0nm, no line/frame averaging, and one bleach frame with all Argon laser lines at full laser power . The left half of chromocenters/nucleoli was bleached in all experiments to avoid potential differences due to an altered scan direction.Conventional fluorescence correlation spectroscopy (FCS) experiments to determine protein concentrations in optodroplet assays\u00a0D were coPolarization-sensitive fluorescence correlation spectroscopy (Pol-FCS) experiments D\u20136H wereTo test the repressive potential of HP1 at the reporter array E, cells t(c) readsa is the turbidity for infinite HP1 concentration (upper plateau), csat is the apparent half-saturation concentration, and n is the Hill coefficient.Turbidity values of HP1-DNA mixtures in x- and y-direction to calculate the following correlation functionI is the intensity at pixel , a1 and a2 are the relative contributions from the two components, \u03bb1 and \u03bb2 represent the correlation lengths that correspond to the radii of the objects, and n1 and n2 describe the \u201cfuzziness\u201d of each component. Large values for n reflect equally sized objects with sharp boundaries and small values for n reflect broader distributions of object sizes and/or less distinct boundaries. Curves for\u00a0wild-type cells had to be fitted with two components while curves for Suv39h\u00a0dn cells could be fitted well without the second component . The values reported in 1). Fit parameters are listed in Image correlation spectroscopy analysis was conducted in R  using th2-HP1 and the phosphomimetic HP1 variants. For RGG2-HP1, cells with very low expression levels were used for the analysis, as cells with intermediate and high expression levels tended to contain many aggregates. To remove the contribution of noise to the CV of the respective RGG2-HP1 images, the latter were smoothed before the analysis . The resulting curves were fitted with the following equation, which describes a two-step dissociation process that produces the short lag phase observed in the decay curves for early time points:A is the abundance of optodroplets, A0 is the initial abundance, and k is the decay rate. The lifetime \u03c4 reported in k, which is the time at which the abundance has dropped to A0/2. An additional plateau was added to the equation for proteins forming long-lived droplets (FUSN-HP1 and RGG2-HP1).The abundance of optodroplets in The FRAP curves in To fit the FRAP data in h and the (effective) diffusion time \u03c4D. The inverse of the barrier height h can be interpreted as the effective thickness l of the\u00a0boundary, i.e., diffusion across the boundary is equivalent to unobstructed diffusion over the distance l. In p\u00a0= R/l between radius R and effective boundary thickness l is reported. It resembles a permeability with p\u00a0= 0 for an impermeable boundary and p\u00a0= \u221e for the absence of any boundary.To fit the normalized curves, a confined diffusion model was used, which assumes (effective) unobstructed diffusion within the structure of interest and a barrier at the boundary of the structure. Effective diffusion implicitly takes into account potential contributions from transient binding interactions that occur within the structure . The twoh at the boundary of a circular domain with radius n, and n vanish, whereas summands with odd n have the same absolute value but a different sign for cB and cNB N is the particle number, \u03c4R, \u03c4T, \u03c4D1 and \u03c4D2 are the rotational correlation time, triplet time, translational diffusion time for the fast\u00a0and for the slow component, respectively, fR, fT and f1 are the contributions from rotation, triplet and fast translational diffusion, f1\u00a0= 1). Correlation curves for translational diffusion of GFP-HP1 have been fitted previously with the translational part\u00a0of this function, with the slow component representing motion of HP1-bound chromatin (For Pol-FCS, cross-correlation functions of detectors measuring the same polarization contain contributions from rotational and translational diffusion, whereas cross-correlation functions of detectors measuring crossed polarizations lack the rotational contribution. The curves in hromatin . The addth and 60th percentile, and analyzed the DAPI and H3K27ac signals in each group of cells.The dose-response relationships for HP1 overexpression and dCas9-VPR recruitment in This study did not generate datasets or code."}
+{"text": "Previous studies have found that LPS and FRA1 play opposite roles in cervical cancer. In addition, LPS functions by regulating the expression of FRA1 in many disease models, but there is currently no study of their relationship in the energy metabolism of tumor cells. This study, therefore, investigates the effects of LPS on FRA1-mediated glucose metabolism and the possible mechanisms it may have in cervical cancer cells. We constructed FRA1 stable overexpressing/ empty vector cervical cancer cell lines, where glucose consumption, the level of lactic acid production and the expression of energy metabolism related molecules were detected under the stimulation of LPS. At the same time, the changes in proliferation ability of cervical cancer cells were detected. We discovered that LPS promotes glucose consumption, lactic acid production, pentose phosphate bypass, and inhibits aerobic oxidation, by inhibiting the expression of FRA1; and that LPS promotes the growth of cervical cancer cells. Our results indicate that LPS affects the proliferation and glucose metabolism of cervical cancer cells through the FRA1/MDM2/p53 pathway. According to the latest global cancer statistics MYC can up-regulate the level of lactate dehydrogenase A (LDHA), leading to an increase in lactic acid (LA) production. It can also promote the transcription of glucose transporter 1 (GLUT1), hexokinase 2, phosphor-fructose kinase, and increase cell glucose uptake and pyruvate production. K-RAS can increase the expression of GLUT1 as well as the uptake of glucose, enhance glycolysis and lactic acid production, and affect the occurrence and development of tumors Sustained rapid proliferation and abnormal energy metabolism are prominent features of tumor cells; features that potentially indicate the direction of cancer therapy FOS related antigen-1 (FRA1) is a member of the FOS family  Lipopolysaccharide (LPS) is an important component of the cell wall of gram-negative bacteria. Previous studies on LPS mainly focused on inflammatory response, but in recent years, more and more studies have found that LPS can regulate the proliferation and invasion ability of tumor cells, including breast cancer Previous studies have shown a relationship between LPS and FRA1. For example, in acute lung injuries, LPS promotes FRA1 expression in alveolar macrophages The human cervical cancer cell lines Caski and Hela were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) , penicillin (100 U/ml) and streptomycin (100 \u03bcg/ml) at 37\u02daC and 95% humidity in the presence of 5% CO2.The LV5-FRA1 lentivirus was purchased from Suzhou GenePharma . The plasmid was cut with NotI/BamHI and ligated by T4 DNA ligase with gene encoding FRA1. The fusion sequence was verified through DNA sequencing. The empty LV5 vector was used as a negative control. To establish the stable FRA1-overexpressing Caski and Hela cell lines, LV5-FRA1 or an empty LV5-vector (10ul) was added into Caski and Hela cells at a density of 50-60%, together with the polybrene transfection reagent (1ul). After 48 hours, screening was performed using puromycin. Transduction efficiency was measured using qRT-PCR and western blotting experiments.LPS (50 ug/ml) was added to Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells for 24h at 37 \u02daC. The total RNA was extracted from cultured cells using the TRIzol reagent. RNA was reverse transcribed into complementary DNA (cDNA) using a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit . The qRT-PCR technique was performed using a ChamQTM SYBR\u00ae qPCR Master Mix kit . The primer sequences used for qRT-PCR were as follows: FRA1 forward (CGAAGGCCTTGTGAACAGAT) and reverse (CTTCTGCTTCTGCAGCTCCT); GAPDH forward (CGACCACTTTGTCAAGCTCA) and reverse (ACTGAGTGTGGCAGGGACTC).LPS (50 ug/ml) was added to Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells for 24h at 37 \u02daC. Cells were lysed with RIPA lysate buffer containing 1% protease inhibitor. The protein concentration was measured using the BCA protein quantitative kit . Equivalent quantities (30-50 \u03bcg) of protein were separated in 10% SDS\u2011PAGE gels and electroblotted onto PVDF membranes . The membranes were blocked using Tris-buffered saline containing 5% non-fat milk. After that, the primary antibody was incubated overnight at 4 \u00b0C. The primary antibodies used in this study were as follows: FRA1, SCO2, COX2, G6PD (ImmunoWay Biotechnology Co); LDHA, MDM2, p53 ; GLUT1 (Abcam). After three washes, the secondary antibody (Goat Anti-Rabbit Ig(H+L) HRP or Goat Anti-Mouse Ig(H+L) HRP, Affinity, USA) was incubated at 37 \u00b0 C for 1h. After another three washes, the expression of protein was detected with a LuminataTM Forte Western HRP Substrate luminescence solution . Then \u03b2-actin  was used as a loading control. The quantification of band intensity was performed by using Image J .3 cell/well) for 24h at 37 \u02daC. Subsequently, 20ul CCK-8 was added to the cells for 2h at 37\u02daC in 5% CO2. The SoftMax Pro 6.4 microplate reader  was used for detecting the absorbance at 450 nm. The above steps were repeated at the same time every day.LPS (50 ug/ml) was added to Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells (1 x103 cell/well) for 12 days at 37 \u02daC, until visible clones grow in the 6-well plate. After washing 3 times with PBS, cells were fixed with 4% paraformaldehyde for 30 minutes, and then stained with 0.1% crystal violet solution. After washing the background with PBS and leaving plates to dry, pictures were then taken with a camera. Image J was used to quantify the number of clones.LPS (50 ug/ml) was added to Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells  was added to the cells for 24h at 37\u00b0C. The extracellular medium was collected and the glucose levels in the culture medium were measured according to the protocol as defined in the commercial Glucose Assay Kit . The absorbance at 505 nm of the Glucose level was measured using a SoftMax Pro 6.4 microplate reader .Fresh culture medium was replaced when the density of Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells in the 6-well plate reached 50-60%, and LPS (50 ug/ml) was added to the cells for 24h at 37\u00b0C. The cell supernatant was collected and the lactate levels in the cells were measured according to the protocol as defined in the Lactic Acid Assay Kit . The absorbance at 530 nm of lactate levels were measured using a SoftMax Pro 6.4 microplate reader .Fresh culture medium was replaced when the density of Caski-FRA1/Caski- empty vector and Hela-FRA1/Hela-empty vector cells in the 6-well plate reached 50-60%, and LPS (50 ug/ml) was added to the cells for 24h at 37\u00b0C. Whole cell lysates were collected and the ATP levels in the cells were measured according to the protocol as defined in the Enhanced ATP Content Detection Kit . The ATP levels were measured using a SoftMax Pro 6.4 microplate reader . Cell concentration was measured to normalize the level of ATP.Fresh culture medium was replaced when the density of Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells in the 6-well plate reached 50-60%, and LPS (50 ug/ml) was added to the cells for 24h at 37\u00b0C. Whole cell lysates were collected and the G6PD levels in the cells were measured according to the protocol as defined in the G6PD Activity Assay Kit . The absorbance (340 nm) at 0s and 300s at 37\u2103 were measured using a SoftMax Pro 6.4 microplate reader . Cell concentration was measured to normalize the level of G6PD.P<0.05 was considered statistically significant.The data were processed using the GraphPad Prism software V7.0 such that each data point was translated into its mean + standard deviation values from three independent repetitions of the experiment. The student's t-test was used to analyze the statistical comparisons between two groups. FOSL1 mRNA at different time points after adding LPS (50ug/ml). The results show that LPS has no significant effect on FRA1 in the early stage, but after 12 hours FRA1 was significantly down-regulated and the results were statistically different. This indicates that LPS can affect the FRA1 expression level of cervical cancer cells in a time depended manner  and corresponding blank control cell lines (Caski-empty vector/Hela-empty vector) through lentiviral infection. The Caski-FRA1/Caski-empty vector and Hela-FRA1/Hela-empty vector cells were treated with LPS for 24 hours. The results of qRT-PCR and western blotting tests show that LPS can indeed down-regulate the expression level of FRA1 in cervical cancer cells  and Cytochrome C oxidase subunit II (COX2) are important substances involved in aerobic oxidation. We examined the expression levels of them in four groups of cells. The results show that FRA1 promoted their expression, but after the addition of LPS, this pro-expression was significantly down-regulated . Therefore, we directly measured the content of the glycolytic product LA and the expression of SCO2 and COX2, which are closely related to OXPHOS. It was found that LA production in FRA1-overexpressing cells is less than that in the corresponding empty vector cells, but that LA production increased after adding LPS. Meanwhile, the expression levels of SCO2 and COX2 show an opposite trend. In addition, we also tested the GLUT1 and LDHA expression and found that LPS can negatively regulate FRA1-induced down-regulation of them, which accords with the glucose consumption and the level of the LA generated. Moreover, we directly measured the ATP content in eight groups of cervical cancer cells. The results show less ATP in the FRA1-overexpressiing groups. To our surprise, after adding LPS, the ATP content did not rise correspondingly as expected, but even became less. By reviewing the data, we learned that although glucose produces less ATP through glycolysis than OXPHOS, tumor cells can increase the speed of glycolysis by up-regulating the glucose transporter, and increase the speed of ATP production to meet energy requirements One of the most important processes of the Warburg effect is the enhancement of the PPP bypass. A large amount of glucose is decomposed into 5-phosphate ribose and NADPH by PPP, providing precursors for intracellular synthesis of nucleic acids and fatty acids We also used CCK-8 and colony formation assays to detect directly the proliferation of cervical cancer cells. The results show that FRA1 can inhibit the growth of cervical cancer cells, while LPS decreases FRA1-induced inhibition. This result is consistent with the results of previous research Our previous study In conclusion, our study explores the role of LPS and FRA1 in cervical cancer cells from the perspective of glucose metabolism. The results indicate that LPS affects glucose metabolism in cervical cancer cells through the FRA1/MDM2/p53 pathway, thus affecting the proliferation of cervical cancer. This work indicates the potential for using FRA1 in therapies for cervical cancer, as well as providing theoretical support for the development of therapies targeting energy metabolism in cervical cancer cells."}
+{"text": "It is difficult to identify pancreatic ductal adenocarcinoma (PDAC) and mass-forming chronic pancreatitis (MFCP) lesions through conventional CT or MR examination. As an innovative image analysis method, radiomics may possess potential clinical value in identifying PDAC and MFCP. To develop and validate radiomics models derived from multiparametric MRI to distinguish pancreatic ductal adenocarcinoma (PDAC) and mass-forming chronic pancreatitis (MFCP) lesions.This retrospective study included 119 patients from two independent institutions. Patients from one institution were used as the training cohort (51 patients with PDAC and 13 patients with MFCP), and patients from the other institution were used as the testing cohort (45 patients with PDAC and 10 patients with MFCP). All the patients had pathologically confirmed results, and preoperative MRI was performed. Four feature sets were extracted from T1-weighted imaging (T1WI), T2-weighted imaging (T2WI), and the artery (A) and portal (P) phases of dynamic contrast-enhanced MRI, and the corresponding radiomics models were established. Several clinical characteristics were used to discriminate PDAC and MFCP lesions, and clinical model was established. The results of radiologists\u2019 evaluation were compared with pathology and radiomics models. Univariate analysis and the least absolute shrinkage and selection operator algorithm were performed for feature selection, and a support vector machine was used for classification. The receiver operating characteristic (ROC) curve was applied to assess the model discrimination.The areas under the ROC curves (AUCs) for the T1WI, T2WI, A and, P and clinical models were 0.893, 0.911, 0.958, 0.997 and 0.516 in the primary cohort, and 0.882, 0.902, 0.920, 0.962 and 0.649 in the validation cohort, respectively. All radiomics models performed better than clinical model and radiologists\u2019 evaluation both in the training and testing cohorts by comparing the AUC of various models, all P<0.050. Good calibration was achieved.The radiomics models based on multiparametric MRI have the potential ability to classify PDAC and MFCP lesions. Pancreatic ductal adenocarcinoma (PDAC) is a malignancy with an overall 5-year survival rate of less than 10% and is a third-leading cause of death among cancers . HoweverRadiomics can noninvasively extract a large number of features invisible to the naked eye from traditional pictures and translate them into high-dimensional data through machine learning methods . Based oThe aim of our study was to develop and validate radiomics models that extract features from multiparametric MRI and clinical features to differentiate PDAC lesions from MFCP lesions.Our study was conducted at two institutions in SiChuan province. Ethical approval to perform this retrospective study was obtained from each Institutional Review Board (IRB), and informed consent was waived. Patients with a pathological diagnosis of either PDAC or MFCP from March 2016 to June 2019 were identified by searching the pathology database from the two centers. MFCP is defined as chronic inflammation with focal mass formation confirmed . In totaAll patients underwent a 3.0-T MR examination . The general sequences consisted of T2-weighted imaging (T2WI), precontrast T1-weighted imaging (T1WI), and the arterial phase and portal-venous phase of dynamic contrast-enhanced MRI (DCE-MRI). For the DCE-MRI sequence, 20 mL of gadopentetate dimeglumine  was administered intravenously with a pressure injector  at 2\u20133 mL/s, followed by a 20-mL saline solution flush. The scanning times were set to 30 s and 60 s after the contrast agent was injected to obtain the arterial phase and portal-venous phase images, respectively. Detailed information on the acquisition parameters is described in Two experienced radiologists  processed all the MR images independently and were blinded to the pathological results. They calculated the size of each lesion by measuring the long and short diameters of the largest cross-section of the lesion, measured the diameter of maximal cross-section of MPD and CBD. PDAC was defined an irregular mass was hypointensity on axial T1WI, hyperintensity on axial T2WI, and unobvious enhancement during the artery, portal venous and delayed phases. MFCP was defined a clear boundary mass was hypointensity on axial T1WI, hyperintensity on axial T2WI, and gradual enhancement during the dynamic enhancement Figure 2http://bit.ly//IBEXMDAnderson), an open source software program running on MATLAB 2016b (The MathWorks Inc), the workflow of radiomic showed in Two experienced radiologists manually delineated the region of interest (ROI) based on T1WI, T2WI, the arterial phase (A) and portal-venous phase (P) on the basis of the largest size of the tumors in an axial image slice, corresponding four independent feature sets generated and radiomics models established. To eliminate the volumetric effect of the peripancreatic fat space or normal pancreas, they slightly delineated within the lesion . The proThen, we selected three group features extracted from IBEX: the intensity histogram using the common fundamental measurement value to reflect the distribution of gray pixels in the image; the gray-level co-occurrence matrix (GLCM), which it reflects the measurements of the texture image by pixels with the same gray level and is mainly used for linear texture analysis; and the gray-level run-length matrix (GLRLM), which reflects the comprehensive information about the change in gray levels in terms of the step size and direction, and reflects the arrangement rules about different pixels. In total, 410 radiomics features were identified in each independent feature set , and an ICC score greater than 0.75 indicates a good agreement . Not allDimensionality reduction methods were applied to the training group to avoid dimensional disasters and reduce deviations from the radiomics features. First, independent samples t-test or Mann-Whiney U tests were performed to identify features in each feature set that were significantly different between PDAC lesions and MFCP lesions. To reduce the risk of type I error, a false discovery rate (FDR) was applied to correct the P values. Then, the least absolute shrinkage and selection operator (LASSO) algorithm was performed for dimensionality reduction and feature selection before classification . One staRadiomics features of each feature subset were selected by the above procedure, and a support vector machine (SVM) with a Gaussian kernel was applied to establish a nonlinear radiomics model. The kernel\u2019s parameter size  and the regularization parameters ) were optimized, and 10-fold cross-validation of the SVM kernel function was performed to select the best-performing models. Four radiomics models were established. An independent clinical model was established using classical imaging and clinical factors, for example, the size of lesion, the diameter of the largest cross section of the MPD and CBD, the status of CA19-9 followed the same tuning procedure described in the development of radiomics models. The performance of the four radiomics and clinical models was calculated by the area under the receiver operating characteristic (ROC) curve (AUC) and other evaluation metrics, such as the sensitivity, and specificity. The radiomics and clinical models were also assessed in the testing cohort. DeLong test was implemented to compare the AUC of four radiomics models, clinical model and radiologists\u2019 evaluation both in the training and testing cohort.https://www.r-project.org/). The LASSO regression, SVM model and ROC curve analyses were performed by means of the \u201cggplot2\u201d, \u201ce1071\u201d and \u201cpROC\u201d packages, respectively. In all tests of differences, a P-value less than 0.050 was considered a statistical significant.Regarding the clinical data, continuous variables, including the age of the patient and size of the lesion were assessed with independent samples t-test or Mann-Whiney U tests based on their distributions. Categorical variables, including the sex of the patient, the result of CA19-9 and the location of the lesion, were assessed with Pearson chi-square test or Fisher exact test. To assess the radiologist\u2019s evaluation and pathological results, Pearson Chi-square was performed. These data were analyzed by Statistical Package for the Social Sciences . The dimensionality reduction and model building processes of the radiomics features, including the intensity histogram, GLCM and GLRLM of each model, were implemented in R . Radiologists had better accuracy (80.7%), positive predictive value (92.7%) and sensitivity (84.8%) in identifying PDAC and MFCP, however, the specificity (50%) and negative predictive value (30.4%) were poor. The composition of PDAC was higher than that of MFCP in the training and testing cohorts, but no statistically significant differences existed between the two cohorts . The baseline characteristics of the two cohorts are recorded in In total, 119 patients from two independent institutions were included in the study. When comparing the results between radiologists\u2019 evaluation and pathology, no significant difference was existed , 0.943 (range: 0.269 to 0.994), 0.961 (range: 0.505 to 0.999), 0.955 (range: 0.199 to 0.999) for the T1WI, T2WI, A and P feature subsets, respectively. For the intraobserver agreement, the mean values were 0.934 (range: 0.442 to 0.999), 0.943 (range: 0.269 to 0.994), 0.940 (range: 0.378 to 0.999), 0.955 (range: 0.199 to 0.999) for the T1WI, T2WI, A and P feature subsets, respectively. Ultimately, the number of excluded features in the T1WI, T2WI, A, and P feature subsets were 27, 21, 11 and 13, respectively, and the remaining features were analyzed in the next section.The number of selected features of each separate subset after univariate analysis and LASSO algorithm implementation are shown in via the DeLong test, no significant differences existed between pairs of models . Interestingly, the performance of radiomics models were superior to clinical model and radiologists\u2019 evaluation (P<0.050). The ROC curves of five models and radiologists\u2019 evaluation in the primary and validation models are shown in The four radiomics models achieved good performance in the training and testing cohorts based on SVM modeling. The AUC of T1WI model, T2WI model, A model and P model were 0.893 [95% confidence interval (CI): 0.780-1], 0.911 (95%CI: 0.823-0.999), 0.958 (95%CI: 0.889-1), 0.997(95%CI: 0.990-1) in the training cohorts, The AUC of T1WI model, T2WI model, A model and P model were 0.882 (95% CI: 0.792-0.972), 0.902 (95%CI: 0.809-0.995), 0.920 (95%CI: 0.821-1), 0.962 (95%CI: 0.907-1) in the testing cohorts. The AUC of clinical model were 0.516 and 0.649 in the training and testing cohorts. The detailed results were shown in In our study, we compared the radiologists\u2019 evaluation and pathological results of PDAC and MFCP, there was no significant difference (P=0.076). Radiologists had a potential ability to assess the lesions. However, the specificity and negative predication value was poor. It may lead to overtreatment of MFCP, which was consistent with previous study . We consSome clinical and imaging characteristics were included in this study. Only the serum CA19-9 level was significantly different between patients with PDAC and MFCP in the training cohort, there was no significant difference in the validation cohort. this may be related with the small number of patients in the validation cohort. It indicates that CA19-9 may be regarded as a serum biomarker to identified PDAC from MFCP, however, serum CA19-9 had a high false negative rate. Ren et al.  demonstrIn our study, all the A model, P model, T1WI model and T2WI model achieved good performance in the training and testing cohorts, The reason for these findings may be associated with the fact that fat-suppressed T1WI, T2WI and dynamic contrast-enhanced MRI had a good diagnostic effect in detecting pancreatic cancer, and the tumor-pancreas contrast was best 40-70 s after injection of the contrast agent , 33.Previous studies have developed several methods for discriminating PDAC from MFCP lesions. Previous studies applied perfusion CT to distinguish PDAC from MFCP lesions, and some perfusion parameters, such as blood flow and blood volume , 7, coulRadiomics is noninvasive, inexpensive and robust. The high-dimensional imaging features of radiomics provide more detailed information on tumors that are difficult to detect with the naked eye. Our radiomics models achieved good performance; in the training cohorts, the AUC, sensitivity, and specificity performed well in the T1WI, T2WI, A and P models. The discriminative performance of the radiomics model was also remarkable in the validation cohorts.Some limitations exist in our research. Firstly, the sample size was small. In addition, the composition of the PDAC and MFCP samples are very different; however, there was no difference in the composition ratio between the training and testing cohorts. Multicenter and large-scale study would need to be performed. Last, we performed a two-dimensional analysis of the area of interest for the largest section of the lesion rather than a three-dimensional analysis of the entire lesion volume. This approach is less labor intensive but less sensitive to intratumor variations. however, previous study  identifiIn conclusion, our results show that radiomic models based on multiparametric MRI have the potential to distinguish PDAC lesions from MFCP lesions. This method needs to be validated in a larger sample size for better clinical application.The original contributions presented in the study are included in the article/The studies involving human participants were reviewed and approved by Ethics Committee of Affiliated Hospital of North Sichuan Medical College and Deyang People\u2019s Hospital. The ethics committee waived the requirement of written informed consent for participation.X-MZ designed the research study. TZ, JZ, T-WC, and YC conducted the study and collected the data. S-YZ, PL, and JLW analyzed the data. YD and BM performed the segmentation of image, processing data, and writing paper. All authors contributed to the article and approved the submitted version.The Major frontier program of applied basic research in Sichuan province, No. 2018JY0012.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The present study has shown that HBoV is common in children and adults in the MENA region. This systematic review highlights the need for more data on the role of coinfection of HBoV and other viruses, for instance, SARS-CoV-2 in children with acute bronchiolitis.The emergence of the COVID-19 pandemic highlighted the importance of studying newly emerging viruses that cause respiratory illnesses. Human bocavirus (HBoV) is one of the relatively newly discovered viruses that has been detected worldwide and causes respiratory and gastrointestinal infections, mainly in pediatric patients. However, little is known about the pathogenicity and evolution of HBoV. This systematic review was initiated to clarify the prevalence and circulating genotypes of HBoV in both respiratory and stool samples from patients of all age groups in the Middle East and North Africa (MENA) from 2005 to February 2021. We performed an electronic search through Science Direct, Scopus, PubMed, Mendeley and Cochrane Library databases. We included all studies reporting the detection rate of HBoV in the MENA region. Data were extracted, and the quality of the included articles was assessed. We included articles containing data on HBoV only or with other respiratory or gastrointestinal viral infections. Review articles, case studies, and animal and environmental studies were excluded. The final number of articles included in this study was 65 articles. The results showed that the HBoV prevalence in children was the lowest in Iran (0%) and the highest in Egypt (56.8%). In adults, the lowest and the highest prevalence were reported in Iran, with values of 0% and 6.6%, respectively. Regarding the respiratory cases, our findings revealed no significant difference between HBoV prevalence among the tested categories ( Human bocavirus (HBoV) is a parvovirus reported for the first time in 2005 . Since tParvoviridae, subfamily Parvovirinae and genus Bocavirus. There are four genotypes that belong to the Bocavirus genus. The first genotype was named HBoV1, and was predominantly reported in respiratory samples [HBoV is a small non-enveloped single-stranded DNA virus with a genome size of 5300 nucleotides. The name Bocavirus was derived after the phylogenetic analysis of the HBoV genome, which showed a close relation to bovine parvovirus (BPV1) and minute virus of canines (MVC). HBoV belongs to the family  samples . The oth samples .https://istizada.com/mena-region/, accessed on 16 January 2021)  . Only 14This systematic literature review involves all published journal articles and preprints that reported HBoV prevalence and genotypes in the Middle East and North Africa (MENA) region between 2005 and February 2021. Five databases were searched  by using (\u201cboca*\u201d OR \u201cbocavirus\u201d OR \u201cboca virus\u201d) AND  AND  as a search strategy. The eligible articles were screened for both the titles and abstracts. The studies involved in this systematic review were selected based on the following criteria: (1) the published articles contain data on HBoV only or with other respiratory or gastrointestinal viral infections from 2005 to February 2021, (2) the studied population in the article is patients residing in, or having acquired infection from, the MENA region. Review articles, case studies, and animal and environmental studies were excluded.Following the research strategy, a total of 265 articles were identified as follows: 117 articles from PubMed, 73 from Mendeley, 60 from Scopus, eight from Science Direct and seven articles from Cochran. The number of records after deduplication was 175, 88 articles were excluded due to their titles, 11 articles were excluded due to their abstracts and 12 articles were excluded after full-text article screening. The final number of articles included in this study was 65 articles .The data collection sheet was designed to extract data from the selected articles at a 95% confidence interval. The prevalence data were extracted and arranged according to the country and year of sample collection and were reported as percentages. Data of respiratory records were compared by Fisher\u2019s exact test, and p-values were calculated in IBM SPSS statistics version 28 by using the Chi-square test to identify associations.The summary of individual study parameters was prepared using Microsoft Excel. A mean percentage prevalence was taken if more than one prevalence study was reported from the same country. Prevalence charts were produced for both respiratory and gastrointestinal samples.In total, 142,748 patients were reported in sixty-five studies, and 5622 (3.94%) were positive for infection. All those studies reported the prevalence of HBoV in the MENA from 2005 to February 2021 . A mean p-value = 0.998).This systematic review reports the prevalence of HBoV in the MENA region among different tested categories including various age groups , COVID-19 cases, pilgrims, health care providers, blood donors and patients with colorectal cancer. Concerning the respiratory cases, our findings revealed no significant differences between HBoV prevalence values among the tested categories . Samples from the upper , middle  and lower respiratory tract  were examined for patients with respiratory tract infection. Stool was the specimen of choice for patients with gastroenteritis. Surgically excised specimens were used to screen human bocavirus in colorectal cancer patients. Whole blood samples from blood donors were screened for HBoV to investigate the possibility of parenteral transmission.In the MENA Region, several reports studied the prevalence of HBoV among hospitalized children and adults suffering respiratory tract infections and whether HBoV was the causal agent ,41. At tThe results showed that the prevalence of HBoV varied from one country to another. The HBoV prevalence, in cases of respiratory tract infection in children, ranged from 0% in Iran to 56.8% in Egypt ,30. In aAbdel-Moneim et al. (2016) used newly developed primers to increase the sensitivity of the PCR test for HBoV detection. Using these novel primers, the prevalence of HBoV was 56.8%, which significantly differs from previous and further studies conducted in Egypt, which found prevalence values of 22%, 10% and 18.2% respectively ,13,17. AIn Egypt, Abdel-Moneim et al. (2016) studied the presence of HBoV in colorectal cancer patients and found that among one hundred and one patients, twenty-four of them (23.8%) were positive for HBoV . MoreoveSeveral studies have reported the spreading of HBoV among pilgrims during Hajj and Umrah, as mass gathering aids in the transmission of respiratory diseases. The studies concluded that raising awareness among pilgrims of the importance of following public health precautions, such as wearing masks and undergoing vaccination, significantly reduces the transmission of respiratory pathogens ,60,70.Currently, four genotypes have been identified worldwide . In the MENA Region, HBoV1 is the most prominent reported genotype and is mainly associated with respiratory diseases ,28. HoweHBoV is detected more frequently with other viruses in the respiratory and gastrointestinal tract . HBoV coHowever, there is a conflict regarding the role of HBoV in cases of co-infection. Some studies reported no differences in clinical severity between patients hospitalized with a single infection (sole virus) and those with viral co-infection ,47. OtheThis systematic review provides a clear summary of the existing knowledge about the prevalence of HBoV infection in the MENA region. The data presented show that HBoV infection is common in children admitted to hospitals and should be screened for as a part of the standard diagnostic panels. This systematic review also highlights the importance of studying the presence of this virus alone or in association with other viruses and stresses the need for further research on the pathogenicity and genomic variation of HBoV."}
+{"text": "Finally, DeepNull improves upon linear modeling for phenotypic prediction (+23% on average).Genome-wide association studies (GWASs) examine the association between genotype and phenotype while adjusting for a set of covariates. Although the covariates may have non-linear or interactive effects, due to the challenge of specifying the model, GWAS often neglect such terms. Here we introduce DeepNull, a method that identifies and adjusts for non-linear and interactive covariate effects using a deep neural network. In analyses of simulated and real data, we demonstrate that DeepNull maintains tight control of the type I error while increasing statistical power by up to 20% in the presence of non-linear and interactive effects. Moreover, in the absence of such effects, DeepNull incurs no loss of power. When applied to 10 phenotypes from the UK Biobank ( GWAS often assume a linear phenotype-covariate relationship which may not hold in practice. Here the authors present DeepNull, in which they apply deep learning to identify and adjust for complex non-linear relationships, improving phenotypic prediction and GWAS power. These associations have expanded our knowledge of biological mechanisms7 and improved our ability to predict phenotypic risk8.Genome-wide association studies (GWASs) aim to detect genetic variants or single-nucleotide polymorphisms (SNPs) that are associated with complex traits and diseases. Over the past decade, GWASs have successfully identified thousands of variants associated with various and diverse phenotypes9. In GWAS, a potential confounder is genetic ancestry: two ancestral groups may differ with respect to minor allele frequency (MAF) at common SNPs and, for unrelated reasons, in their phenotypic means. Failure to adjust for ancestry will lead to spurious associations between the phenotype and the SNPs whose MAFs differ across ancestries, inflating the type I error of the association test. To reduce confounding due to population substructure, or the presence of genetically related subgroups within the cohort, multiple genetic PCs are commonly included as covariates during association testing11.In most GWAS, the association strength between genotype and phenotype is assessed while adjusting for a set of covariates, such as age, sex, and principal components (PCs) of the genetic relatedness matrix. Covariates are included in GWAS for two main reasons: to increase precision and to reduce confounding. In the linear model setting, adjustment for a covariate will improve precision if the distribution of the phenotype differs across levels of the covariate. For example, when performing GWAS on height, males and females have different means. Adjusting for sex reduces residual variation, and thereby increases power to detect an association between height and the candidate SNPs. Note, however, that omitting sex from the association test is entirely valid. In contrast, omitting a confounder will result in a biased test of association. By definition, a confounder is a common cause of the exposure (i.e. genotype) and the outcome (i.e. phenotype)14. Shrine et al.12 included age2 as a covariate when studying chronic obstructive pulmonary disease; Chen et al.13 included squared body mass index (BMI2) when studying obstructive sleep apnea; and Kosmicki et al.14 included an age by sex interaction (age\u2009\u00d7\u2009sex) when studying COVID-19 disease outcomes. Although these recent works have recognized the potential importance of modeling non-linear covariate effects, no systematic approach has been described for detecting the appropriate non-linear functions to adjust for in GWAS. The difficulty stems from the exponential number of possible interactions that can arise from a finite set of covariates , and the infinite number of possible transformations of any given continuous covariate . Lastly, the optimal number of covariate interactions is not known a priori and requires evaluating different possibilities  for straightforward integration into existing GWAS association platforms.In this work, we address the issue of model misspecification in GWAS; specifically, misspecification of the relationship between the phenotype and covariates. DeepNull uses a flexible deep neural network (DNN) to learn this potentially complex and non-linear relationship, then adjusts for the network\u2019s expectation of the phenotype (based on covariates only) during association testing. Although simpler models (e.g. a second-order interaction model) may suffice in particular cases, the DNN architecture is sufficiently expressive to capture the broad range of phenotype-covariate relationships that researchers might encounter in practice. Moreover, no loss of power is observed when the relationship between the phenotype and covariates is in fact linear. Using simulated data, we show that DeepNull markedly improves association power and phenotypic prediction in the presence of non-linear covariate effects, and retains equivalent performance in the absence of non-linear effects. We then demonstrate improvements in association power and phenotype prediction across 10 phenotypes from the UK Biobank (UKB)17, the DNN can capture complex non-linear relationships between the phenotype and covariates. When performing genetic association testing, the DNN\u2019s prediction of the phenotype for each individual is included as a single additional covariate within the association model. Adjusting for the DNN\u2019s prediction in the association model is equivalent to regressing it out from both phenotype and genotype. By flexibly modeling the association between phenotype and non-genetic covariates, DeepNull reduces the residual variation, and thereby increases the statistical power . Due to its ability to approximate any continuous mappingn individuals genotyped at m SNPs. Let n\u2009\u00d7\u20091 phenotype vector, where yi is the phenotypic value of the ith individual; let G\u2009=\u2009[gij] denote the n\u2009\u00d7\u2009m sample by SNP genotype matrix, where gij is the minor allele count for the ith individual at the jth variant. Let G, in which columns have been centered and scaled to have mean zero and unit variance. Furthermore, let h be a (possibly non-linear) function that predicts the phenotype from non-genetic covariates; we learn h using a DNN trained with cross-validation on the sample. The DeepNull association model is as follows:Consider a quantitative phenotype ascertained for a sample of \u03b2j is the effect sizes for the jth variant on the phenotype; n\u2009\u00d7\u2009(p\u2009+\u2009g) covariate matrix that includes p non-genetic covariates (e.g. age and sex) and g adjustments for genetic confounding (e.g. genetic PCs); \u03b3 is the (p\u2009+\u2009g)\u2009\u00d7\u20091 vector of association coefficients for all covariates. Compared with the standard GWAS association model, the DeepNull association model differs only by the inclusion of a single additional term H(X)\u03b3h: X is the n\u2009\u00d7\u2009p subset of h row-wise to X; and \u03b3h is the scalar association coefficient for the DNN\u2019s prediction of the phenotype based on non-genetic covariates.Here 15. Standardized age, sex, and genotyping_array served as true covariates for 10,000 randomly sampled individuals (\u201cMethods\u201d). First, we considered a linear effect for covariates on phenotypes (f(x)\u2009=\u2009\u03b3x). We simulated 100 phenotypes for each of six different genetic architectures with varying amounts of phenotypic variance explained by the genetic data (i) ii) iii) iv) v) vi) 18 (\u201cMethods\u201d). Statistical power and expected \u03c72 statistics for the causal chromosome (chr22) were similar for DeepNull and Baseline  than baseline, and higher expected \u03c72 statistics at causal variants (2\u201320% relative improvement) across all genetic architectures  in Eq. (x). Again, both DeepNull and Baseline are only given age, sex, and genotyping_array as known covariates. In all cases, DeepNull outperforms Baseline both in terms of statistical power (3%\u20139% relative improvement) and expected \u03c72 statistics (13%\u201322% relative improvement), while both methods control the type I error  and its power increases as the sample size increases , alanine aminotransferase (ALT), aspartate aminotransferase (AST), apolipoprotein B (ApoB), calcium, glaucoma referral probability (GRP), LDL cholesterol (LDL), phosphate, sex hormone-binding globulin (SHBG), and triglycerides (TG), each of which has evidence of potentially non-linear relationships between covariates and the phenotype . Thus, for GRP only, several additional covariates were included in the association model: VCDRvisit, refractive-error, and image-gradability. To train DeepNull\u2019s DNN, we used VCDRvisit, age, sex, and genotyping_array to predict GRP. We then performed GWAS for GRP using age, sex, genotyping_array, the top 15 PCs, VCDRvisit, refractive-error, and image-gradability as covariates.GRP differs from the other phenotypes considered in that it was derived from color retinal fundus images, using the model presented in Alipanahi et al.21 to determine whether there was evidence of inflation due to confounding. In no case did the S-LDSC intercept differ significantly from 1, providing no evidence of inflation due to confounding in our analysis  (8.60 Baseline vs. 8.38 DeepNull). However, when focusing on the subset related to lipid metabolism, DeepNull detected more gene sets (65 Baseline vs. 72 DeepNull) and did so at a higher level of significance : 13.88 Baseline vs. 14.34 DeepNull). For ApoB, DeepNull detected fewer gene sets overall (983 Baseline vs. 946 DeepNull), but at a higher level of significance : 7.65 Baseline vs. 7.81 DeepNull). The gene sets detected by DeepNull related to lipid metabolism and neurological conditions, including Alzheimer\u2019s disease.DeepNull detects more genome-wide significant hits (i.e. independent lead variants) and loci  than Baseline for all phenotypes examined Table\u00a0. For exaOverall, the average percentage improvement with DeepNull, taken across phenotypes, was 6.29% for significant hits and 7.86% for loci Table\u00a0. The ave2, age\u2009\u00d7\u2009sex, age\u2009\u00d7\u2009genotyping_array, and sex\u2009\u00d7\u2009genotyping_array. Although the additional second-order interaction covariates consistently improve over the Baseline model results, DeepNull detects as many or more significant loci than Second-order Baseline for nine of the 10 phenotypes  non-linear model. The first model, which we call \u201cBaseline+ReLU\", featurizes age into five additional covariates by applying the ReLU function at different thresholds . We observed that while Baseline+ReLU generally identified more significant hits and loci than Baseline, DeepNull consistently outperformed both baseline methods  and a polygenic risk score (PRS) defined using GWAS association results. Covariate interactions or higher order terms are occasionally included, but typically in an ad hoc fashion. DeepNull provides a way to easily include potential covariate interactions or higher order terms. The Baseline model includes a PRS computed using PLINK  across the ten phenotypes analyzed . The second-order Baseline model produces similar R2 to DeepNull for many of the phenotypes, but DeepNull increases phenotype prediction of GRP by 11.81%  of yi based on xi but omits xi from the association model, emulating the exclusion of covariates provided to DeepNull from the association model as shown in Eq. (h(xi) and a linear correction for xi, emulating the application of  were introduced to perform GWASs that include related individuals, who are not statistically independent33. An orthogonal modeling-based approach is to remap or transform the phenotype to make the distribution of phenotypic residuals more nearly normal38. While normality of the phenotypic residuals is not necessary for valid association testing, standard association tests are most powerful when the residuals are in fact normally distributed. The final class of methods increases power by leveraging external data on the prior biological plausibility of the variants under study. Highly conserved variants, variants in exons, and protein-coding variants all have higher prior probability of being causal than variants in intergenic regions. A series of methods have been developed that incorporate functional data to detect biologically important variants and up-weight their association statistics or reduce their significance thresholds44. By focusing on capturing non-linear covariate effects, DeepNull constitutes a distinct approach to improving statistical power of GWAS, one which can be used in combination with any or all of the approaches discussed above.Increasing the statistical power of GWAS is an area of active research that aims to uncover the many variants, each with individually small effect sizes, that collectively explain substantial variation in complex traits and diseases. Multiple complementary approaches have been proposed for increasing statistical power. The most fundamental is to increase the sample sizeG\u2009\u00d7\u2009X) or genotype-genotype (G\u2009\u00d7\u2009G) interactions. This limitation is shared by standard GWAS and can only be overcome by employing different statistical models that explicitly capture these interactions during association testing. Third, DeepNull\u2019s DNN is not easily interpretable compared to less expressive models such as the Baseline model. For improving GWAS power, this is not a major limitation as the parameter of interest is the coefficient describing the relationship between genotype and phenotype. By estimating this coefficient within a linear model that incorporates DeepNull\u2019s prediction of phenotype, we obtain a more precise estimate of the genetic effect. For more interpretable phenotypic prediction, possibly at the expense of some prediction accuracy, it may be beneficial to use an alternative non-linear model such as spline regression, generalized additive models45, symbolic regression46, or neural additive model47. Alternatively, the trained DeepNull model can be interrogated with a variety of methods51, although we note that DNN interpretability is still an active and evolving area of research. Lastly, DeepNull is a proof of concept. For some phenotypes, a simpler model such as the Second-order Baseline model may suffice to capture the phenotype-covariate relationship. For others, an alternative non-linear model such as a GBDT may perform similarly to DeepNull\u2019s DNN; for the 10 example UKB phenotypes presented here, a GBDT implemented in XGBoost provided similar performance. Although XGBoost and DNN performed similarly for these phenotypes, the added flexibility of DNNs may prove advantageous for other phenotypes or sets of covariates. For example, DNNs can handle complex inputs such as image and text that XGBoost typically cannot. Importantly, we observed in all cases that DeepNull performed as well or better than current standard practice, and the underlying DNN is sufficiently expressive to capture many of the phenotype-covariate relationships likely to be encountered in practice.We note several limitations of our work. First, while training the DeepNull model, we assume individuals (e.g. samples) are independent. Although this is a general assumption among machine learning methods and optimization frameworks, this is not necessarily true in the presence of related individuals. Thus, we believe that an ML optimizer that can incorporate sample relatedness may improve the prediction accuracy of DeepNull\u2019s DNN. Importantly, although DeepNull makes the independence assumption during training, this does not mean that type I error is not controlled. Our analyses used BOLT-LMM to perform the association testing, which does correctly account for the relatedness between individuals. Second, DeepNull does not attempt to model possible genotype-covariate . The resulting phenotypic predictions can readily be included among the input data to commonly-used GWAS models, including PLINK and BOLT-LMM. The improved performance of DeepNull, combined with its ease of use, suggest that it or similar approaches to modeling non-linear covariate effects should become a standard component of performing phenotypic prediction and association testing.Notation: We use bold capital letters to indicate matrices, non-bold capital letters to indicate vectors, and non-bold lowercase letters to indicate scalars.n individuals genotyped at m SNPs. Let n\u2009\u00d7\u20091 phenotype vector, where yi is the phenotypic value of the ith individual, and G\u2009=\u2009[gij] the n\u2009\u00d7\u2009m sample by SNP genotypes matrix, where gij is the minor allele count for the ith individual at the jth variant. Since human genomes are diploid, each variant has 3 possible minor allele counts: gij\u2009\u2208\u2009{0,\u20091,\u20092}. G, i.e. the empirical mean and variance of We consider GWAS of a quantitative trait for a sample of \u03b2 is the m\u2009\u00d7\u20091 vector of effect sizes for each variant on the phenotype, X\u2009=\u2009[xik] is the n\u2009\u00d7\u2009q covariate matrix, including covariates such as age and sex, and \u03b3 is the q\u2009\u00d7\u20091 vector of association coefficients for the covariates. Let X indicate covariates not directly derived from genotypic data (\"non-genetic covariates\"). For genotypes gij\u2009\u2208\u2009{0,\u20091,\u20092} the assumptions of linearity and additivity are not restrictive. On the other hand, a typical GWAS also assumes that the covariates are linearly associated with the phenotype. This is a far more restrictive assumption if any of the covariates are continuous. n\u2009\u00d7\u20091 residual vector that models the environmental effects and measurement noise.A typical GWAS assumes the effect of each variant on the phenotype is linear and additive. Thus, we have the following generative model:52.To perform a GWAS, each variant is individually tested for association with the phenotype. For example, the jth variant is tested for association using the following model:n in Eq. . Confoun53. Define X. Multiplying Eq.  into a learning problem, where we predict ui using yi and Xi\u22c5 as targets and input features, respectively. In other words, we train a model h using the covariates Xi\u22c5 and the phenotype yi by minimizingWe convert the estimation of h . The resulting model is inspired by residual networks57 and consists of two components. One component , without early stopping, batch normalization, or dropout. Kernel initializers were set to default (glorot_uniform) and bias initializers were set to default (zeros).In an equation form, the DeepNull model error in  using thjth variant and the phenotype:After training DeepNull, we use the following model to test for association between the h to each row of X. Compared to the standard GWAS association model in Eq. (H(X)\u03b3h, where h(Xi.) is the DNN\u2019s prediction of the phenotype, based on non-genetic covariates only, and \u03b3h is a scalar association coefficient. As in the model shown in Eq.  in GWAS.The vectorized form of the above association test isl in Eq. , the Deen in Eq. , \\documek partitions. For each selected partition, we train a DeepNull model using data from k\u2009\u2212\u20092 of the other partitions and use the remaining partition for validation and model selection. The model that performs best on the validation partition is then used to predict all individuals in the selected partition. The partitioning scheme ensures that each partition is used as the validation/selection partition exactly once.To avoid overfitting, DeepNull should be trained and run on distinct sets of individuals. However, to maximize the GWAS\u2019s statistical power, all individuals in the cohort should receive DeepNull predictions. To satisfy both of these criteria, we split the cohort by individual into Xk. is the value of the k-th covariate for all individuals, \u03b3k is the effect size, and f(\u2009\u22c5\u2009) is an arbitrary function from f(x)\u2009=\u2009x or exponential function j\u2009=\u20091,\u2009\u22ef\u2009,\u2009m, the variant effect sizes \u03b2j are drawn independently from a normal distribution with mean zero and variance equal to m is the number of causal variants: \u03b5 is drawn from another independent normal distribution with mean 0 and variance f(\u2009\u22c5\u2009) is the identity function f(x)\u2009=\u2009x, our simulation framework is similar to previous works32.We simulate data using the model33 applied to chromosomes chr1, chr2, and chr22. BOLT-LMM is a linear mixed model that incorporates a Bayesian spike-and-slab prior for the random effects attributed to variants other than that being tested. The prior allows for a non-infinitesimal genetic architecture, in which a mixture of both small and large effect variants influence the phenotype. Specifically, the BOLT-LMM association statistic arises from Eq.  were causal. Association testing was performed using BOLT-LMMfrom Eq.  with the\u03b1 (e.g. \u03b1 = 0.05). For null SNPs, the expected \u03c72 statistic is 1. Methods that effectively control type I error are compared with respect to their power for correctly rejecting the null hypothesis61, and their expected \u03c72 statistics33. Power is defined as the probability of correctly detecting that a variant with a non-zero effect size is causal61. Additionally, the expected \u03c72 statistic of an association method is a proxy for its prediction accuracy33.In our setting, chr1 and chr2 are utilized to compute the type I error of the association test, which is the proportion of non-causal variants erroneously associated with the phenotype at a given significance threshold 19. Briefly, the medioid of the top 15 genetic PC values of all individuals with self-reported \u201cBritish\" ancestry was computed, then the distance from each individual in UKB to the British medioid was computed and all individuals within a distance of 40 were retained. The threshold of 40 was selected based on the 99th percentile of distances of individuals who self-identify as British or Irish.All GWASs were performed in a subset of UKB individuals of European genetic ancestry, identified as in Alipanahi et al.33 (Code Availability) with covariates specific to each experiment. GWAS \u201chits\" were defined as genome-wide significant (i.e. P \u2264 5\u2009\u00d7\u200910\u22128) lead variants that are independent at an R2 threshold of 0.1. Hits were identified using the\u2009\u2212\u2009\u2212\u2009clump command in PLINK (Code Availability). The linkage disequilibrium (LD) calculation was based on a reference panel of 10,000 randomly sampled unrelated subjects of European ancestry from the UKB. The span of each hit was defined based on the set of reference panel variants in LD with the hit at R2\u22650.1. GWAS \u201cloci\" were defined by merging hits within 250 Kbp.Association testing was performed via BOLT-LMMG1 and G2 for shared and unique hits was performed by examining overlap of the hit spans; a given hit H1 from G1 is classified as shared if the span of any hit from G2 overlaps it, otherwise it is classified as unique.Comparison of two GWAS results Comparison of our GWAS with the GWAS catalog (Code Availability) was performed analogously to comparing two GWAS. We used We can learn the non-linear relationship between the phenotype and covariates by fitting sex-specific spline regression models to predict the desired phenotype using a set of covariates. For each sex, we learn an independent spline regression model based on the other non-genetic covariates. We utilized the python scikit-learn package (Code Availability) to perform spline fitting.62. The optimization objective was to minimize root mean squared error for the totalprotein phenotype in UKB. The dataset was randomly split into train (80%) and test (20%) folds. The optimal parameters identified, and used for all 10 UKB phenotypes, were the following: max_depth = 3, eta = 0.3190, alpha = 0.6577, and lambda = 2.We can also learn the non-linear relationship between the phenotype and covariates by fitting gradient boosted decision trees. XGBoost (Code Availability) is one existing implementation of gradient boosted decision trees. We utilized XGBoost to learn the non-linear relationship. The optimal XGBoost hyperparameters were selected by performing black-box hyperparameter optimization with Google VizierFurther information on research design is available in the\u00a0Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Data 1Supplementary Data 2Supplementary Data 3Reporting Summary"}
+{"text": "Escherichia coli, Staphylococcus aureus, and Streptococcus agalactiae are important pathogenic bacteria responsible for different infectious diseases in several animal species. In the present study, a whole blood culture with S. aureus, E. coli, or S. agalactiae and flow cytometry were used to investigate, whether stimulation with different bacterial species induces different immunomodulation patterns in camel leukocytes. The expression of different cell surface myeloid markers and cell adhesion molecules on monocytes and neutrophils was investigated. In addition, the capacity of monocytes and neutrophils to produce reactive oxygen species (ROS) was analyzed.Recent studies have reported pathogen-species-specific modulating effects on the innate immune system. highMHCIIhigh monocyte subset with a reduced fraction of CD14highMHCIIlow monocytes. For the CD14lowMHCIIhigh monocytes, however, only stimulation with S. aureus or S. agalactiae increased their fractions in blood. Although all bacterial species elicited the upregulation of cell surface MHC class\u00a0II molecules on granulocytes, the increase was, however, highest on cells stimulated with S. aureus. The expression levels of the two adhesion molecules, CD11a and CD18, on neutrophils and monocytes were differently affected by bacterial stimulation. Functionally, E. coli failed to stimulate ROS production in monocytes, while induced a strong ROS production response in granulocytes. S. agalactiae elicited a week ROS production in granulocytes when compared to the other two pathogens.Stimulation with either of the bacterial species resulted in the expansion of the camel CD14coli, S. aureus, or S. agalactiae suggests pathogen-species-specific modulating effects of the bacterial pathogens on the camel innate myeloid cells.The different responsiveness of monocytes and granulocytes toward different bacterial species indicates different host-pathogen interaction mechanisms for the two cell populations. In addition, the phenotypic and functional differences between cells stimulated with E.  Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), and Streptococcus agalactiae  are major causative agents of different infectious diseases in the dromedary camel including metritis, mastitis, and neonatal infections [E. coli results mostly in severe acute inflammatory disease with clinical signs [S. aureus and S. agalactiae are mainly responsible for mild subclinical infections of the udder [E. coli ) and gram-positive bacteria  differ in their pathogenesis mechanisms. While gram-negative bacteria release the endotoxin lipopolysaccharide (LPS) [S. aureus or E. coli on some innate immune functions of the liver have been comparatively investigated [E. coli significantly downregulated key components of the complement system, S. aureus inhibited the cell signaling via integrin, Fc\u03b3R and Rho GTPases in the liver [S. aureus and E. coli infections, animals with E. coli infection showed significantly greater serum levels of the cytokines interleukin (IL)-1\u03b1, IL-1\u03b2, IL-6, monocyte chemotactic protein (MCP)-1, and macrophage inflammatory protein (MIP)-1\u03b1 than S. aureus-infected mice [ Pathogen-species-specific modulatory effects on the innate immune system have been described in several species and for different pathogens \u20139. Eschefections , 10. Forfections , 12. In al signs , whereashe udder , 5, 14. de (LPS) , 15, grade (LPS) . In a restigated . Both bahe liver . In a moted mice .Monocytes and neutrophils are innate cell populations with key roles during the immune response to bacterial infections \u201320. The highMHCIIlow), monocyte subset Mo-II (CD14highMHCIIhigh), and monocyte subset Mo-III (CD14lowMHCIIhigh) [Based on the surface expression of the lipopolysaccharide (LPS) co-receptor CD14 and the major histocompatibility complex (MHC) class II molecules, camel monocytes have been recently classified into monocyte subset Mo-I (CD14CIIhigh) . SeveralCIIhigh) .In addition to their essential role as first responders during the innate immune response , 19, incStudies on the pathogen-species-specific effect of bacterial pathogens on the innate immune system of camels are limited. The aim of the present study was, therefore, to analyze changes in phenotype and function of camel leukocytes in a whole blood culture with different bacterial species.Camelus dromedarius) aged between 8 and 10\u00a0years with comparable body condition scores. All animals were fed on hay and barley in addition to a mineral supplement. Water was available ad libitum. Blood was obtained by venipuncture of the external jugular vein (vena jugularis externa) into vacutainer tubes containing EDTA . The animals were only used for blood collection. Collected blood samples were stimulated ex vivo. Blood samples were collected from six apparently healthy camels housed at the Camel Research Center, King Faisal University, Al-Ahsa, Saudi Arabia. The studied animals included male (to exclude the effect of reproductive physiology like pregnancy or parturition) dromedary camels . Whole blood (1\u00a0ml) was diluted with 0.9\u00a0ml medium  in sterile 12\u2009\u00d7\u200975\u00a0mm glass tubes . Live bacterial suspension  was added to the diluted blood and the mixture was then incubated for 6\u00a0h at 37\u00a0C. A negative control tube containing 1\u00a0ml blood and 1\u00a0ml medium without bacteria was also included. After incubation, the tubes were then put into icy water (to enhance the detachment of stimulated adherent cells from plastic) and immediately centrifuged at 4\u00a0\u00b0C for 10\u00a0min at 1000xg. After removing the supernatant, the cell pellet was suspended in PBS.Whole blood stimulation was performed according to a previously established method . The bac6 cells/ml in MIF buffer  and NaN3 (0.1\u00a0g/L)).Separation of whole camel leukocytes was done after hypotonic lysis of blood erythrocytes . For leuCell viability of blood leukocytes was measured using the dye exclusion assay . StimulaMonoclonal antibodies used in this study are listed in Table\u00a05) were incubated with unlabeled primary monoclonal antibodies (mAbs) specific for the cell markers CD14 and MHCII or with directly labeled monoclonal antibodies to the cell adhesion molecules CD11a and CD18 [The expression of different myeloid markers and cell adhesion molecules was analyzed using membrane immunofluorescence and flow cytometry . Separatand CD18 . After i6/well) were incubated for 20\u00a0min  with the ROS-sensitive dye dihydrorhodamine (DHR)-123, . After incubation, cells were washed with MIF buffer, and the percentage of ROS-positive cells and the relative amount of generated ROS was determined by flow cytometry  after acquisition of 100 000 events\u00a0 . StimulaStatistical analysis was carried out using the software Prism (GraphPad software version 5). Results are expressed as mean\u2009\u00b1\u2009S.E. of the mean (SEM). Differences between means were tested with one-factorial analysis of variance (ANOVA). Results were considered statistically significant at a p-value of less than 0.05.coli induced the lowest percentage of viable cells among neutrophils (92\u2009% \u00b1 1.6) and monocytes (93\u2009% \u00b1 1.4). However for all leukocyte populations, no significant changes (p\u2009>\u20090.05) were found in the fraction of viable cells after bacterial stimulation  among unstimulated cells (cells in medium control) was 99\u2009% \u00b1 0.3 for lymphocytes, 97\u2009% \u00b1 0.6 for monocytes, and 96\u2009% \u00b1 0.6 for neutrophils. In comparison to stimulation with other bacteria, stimulation with E. s 92\u2009% \u00b1 .6 and moaureus (39.1\u2009% \u00b1 2.9) or E. coli (47.8\u2009% \u00b1 6.0) resulted in a significantly (p\u2009<\u20090.05) higher percentage of ROS-positive granulocytes in comparison to stimulation with S. agalactiae (21.1\u2009% \u00b1 4.1). In addition, the increase in the amount of ROS produced by granulocytes (fold increase relative to medium control) was significantly higher after stimulation with S. aureus (4.9 fold\u2009\u00b1\u20090.6) or E. coli (4.3 fold\u2009\u00b1\u20090.6) than S. agalactiae (2.6\u2009\u00b1\u20090.4). In monocytes, only stimulation with S. aureus or S. agalactiae induced a significant (p\u2009<\u20090.05) increase in the percentage of ROS-positive cells . For lymphocytes, none of the bacterial species induced significant changes (p\u2009>\u20090.05) in the percentage of ROS-positive cells or the MFI of DHR-123  rise in the percentage of ROS-positive granulocytes Fig.\u00a0\u00a0A and thp\u2009>\u20090.05) by bacterial stimulation  reduced after stimulation with S. aureus or E. coli  of CD11a expression on monocytes  expression of CD18 after stimulation , the CD14highMHCIIhigh inflammatory monocytes  and the CD14lowMHCIIhigh monocyte subset   decrease in fraction of Mo-I  with a significant 3 to 5 fold expansion (p\u2009<\u20090.05) of inflammatory Mo-II  in comparison to unstimulated control  after stimulation with S. aureus  and S. agalactiae  in comparison to unstimulated control  blood granulocytes as measured by increased forward scatter (FSC) values . In addition, stimulation with either of the bacterial species elicited the upregulation (p\u2009<\u20090.05) of cell surface MHC-II molecules on granulocytes  in comparison to unstimulated blood (MFI 399\u2009\u00b1\u200961).Bacterial stimulation of whole blood activated significantly , Staphylococcus aureus (S. aureus), and Streptococcus agalactiae  are responsible for several infectious diseases in the dromedary camel [E. coli, S. aureus, or S. agalactiae, on the phenotype and function of camel leukocytes. The whole-blood culture used in the current study has been widely proven as an effective stimulation method, preserving the microenvironment of interaction between the pathogen and immune cells as it presents in vivo [Pathogen-species-specific effects on several components of the innate and adaptive immune responses have been described for several species , 9. Eschry camel , 10. The in vivo , 34.E. coli- or S. aureus-caused clinical endometritis [high MHC-IIhigh monocytes was observed in several bacterial infectious diseases [S. aureus or S. agalactiae but not with E. coli elicited an increase in the number of M-III monocytes. Whether this effect is unique to gram-positive bacteria, still to be investigated.Monocytes and neutrophils are innate immune cells with key roles during the immune response to bacterial infections .In a recmetritis . In humadiseases , 37. ThiAccording to recent reports, granulocytes can acquire the function of antigen-presenting cells and contribute to adaptive immune responses by activating T cells in an MHC class II-dependent manner . The stiE. coli, in contrast to S. aureus and S. agalactiae, failed to stimulate ROS production in camel monocytes. This seems different from cattle, where stimulation with E. coli elicited ROS generation in blood monocytes [E.coli-induced infections [S. agalactiae compared to stimulation with S. aureus or E. coli. This is also the case for the stimulation-induced change in CD11a expression on granulocytes, being only induced after stimulation with S. aureus or E. coli. The biological significance of the change in adhesion molecules expression on stimulated cells and its impact on cell migration and the innate immune response needs to be analyzed in functional studies.The generation of ROS is a key antimicrobial function of phagocytes that serves the effective killing of bacteria . In the onocytes . It is afections . For graS. aureus and S. agalactiae, two gram-positive bacteria, indicates the existence of further mechanisms for the pathogen-species specific modulatory effects on the immune system.Several reports have shown that the differences in the immune response to different bacterial species may correspond to the variation in the cell surface receptors stimulated by different bacterial pathogen-associated molecular patterns (PAMPs) . AccordiE. coli, S. aureus, or S. agalactiae argues for pathogen-species-specific effects of the bacterial pathogens on the camel innate myeloid cells, monocytes and neutrophils. Further work is needed to understand the mechanisms involved in the heterogenic response of innate immune cells toward different bacterial species.The different responsiveness of monocytes and granulocytes toward different bacterial species indicates different host-pathogen interaction mechanisms for the two innate cell populations in the dromedary camel. Whether this is due to different sets of pattern recognition receptors on camel monocytes and granulocytes, still to be investigated. In addition, the phenotypic and functional differences between cells stimulated with"}
+{"text": "Clostridium, has been largely overlooked in bioactive compound discovery. As Clostridium spp. thrive in extreme environments with their metabolic mechanisms adapted to the harsh conditions, they are likely to synthesize molecules with unknown structures, properties, and functions. Therefore, their potential to synthesize small molecules with biological activities should be of great interest in the search for novel antimicrobial compounds. The current study focused on investigating the antimicrobial potential of four soil Clostridium isolates, FS01, FS2.2 FS03, and FS04, using a genome-led approach, validated by culture-based methods.Soil bacteria are a major source of specialized metabolites including antimicrobial compounds. Yet, one of the most diverse genera of bacteria ubiquitously present in soil, Clostridium isolates showed varying levels of antimicrobial activity against indicator microorganism; all four isolates significantly inhibited the growth of Pseudomonas aeruginosa. FS01, FS2.2, and FS04 were active against Bacillus mycoides and FS03 reduced the growth of Bacillus cereus. Phylogenetic analysis together with DNA-DNA hybridization (dDDH), average nucleotide identity (ANI), and functional genome distribution (FGD) analyses confirmed that FS01, FS2.2, and FS04 belong to the species Paraclostridium bifermentans, Clostridium cadaveris, and Clostridium senegalense respectively, while FS03 may represent a novel species of the genus Clostridium. Bioinformatics analysis using antiSMASH 5.0 predicted the presence of eight biosynthetic gene clusters (BGCs) encoding for the synthesis of ribosomally synthesized post-translationally modified peptides (RiPPs) and non-ribosomal peptides (NRPs) in four genomes. All predicted BGCs showed no similarity with any known BGCs suggesting novelty of the molecules from those predicted gene clusters. In addition, the analysis of genomes for putative virulence factors revealed the presence of four putative Clostridium toxin related genes in FS01 and FS2.2 genomes. No genes associated with the main Clostridium toxins were identified in the FS03 and FS04 genomes.Conditioned/spent media from all four Clostridium spp. isolated from farm soil indicated their potential to produce novel secondary metabolites. This study serves as a basis for the identification and characterization of potent antimicrobials from these soil Clostridium spp. and expands the current knowledge base, encouraging future research into bioactive compound production in members of the genus Clostridium.The presence of BGCs encoding for uncharacterized RiPPs and NRPSs in the genomes of antagonistic The online version contains supplementary material available at 10.1186/s12864-021-08005-2. Antimicrobials are widely used in medicine, food, and agriculture to kill or inhibit the growth of harmful microorganisms \u20133. AntibClostridium species, which are metabolically diverse and play an important role in natural processes such as degradation of waste, fixation of carbon dioxide, and fermentation of organic matters, have not been thoroughly investigated for their antimicrobial production [Clostridium species. Their metabolic diversity suggests they are of interest in exploring the potential for novel secondary metabolites possessing antimicrobial properties.In the past few decades, bacteria have been considered to be the most promising source of antimicrobials . Soil isoduction . This mioduction . Perhapsin silico strategies for the prediction of potential gene clusters, involved in the synthesis of bioactive compounds, has permitted a new understanding of the antimicrobial potential of various microorganisms from different environments. Genome sequencing and rapidly developing bioinformatics tools/methods provide opportunities to assess the biosynthetic potential of microorganisms prior to any biological testing or chemical analysis. Genome mining for the existence of biosynthetic pathways that allow microorganisms to synthesise secondary metabolites including antimicrobials has therefore become part of the emerging efforts to renew antimicrobial discovery. The genes responsible for the synthesis of secondary metabolites in bacteria are often organized as biosynthetic gene clusters (BGCs). These gene clusters usually consist of genes responsible for biosynthesis of precursors, assembly and modification of compound scaffolds, and genes required for regulation, export, and resistance [In recent years, the development of sistance . BGCs arsistance .Several computational tools including antiSMASH , ARTS 1, BAGEL 3Clostridium isolates [Clostridium spp. for the synthesis of secondary metabolites belonging to antimicrobial compound groups and provided genome and culture-based evidence for their antimicrobial potential. Two isolates (FS01 and FS03) were sequenced in the current study and the other two isolates (FS2.2 and FS04) were previously sequenced [Clostridium isolates and the genome-based study revealed the presence of putative secondary metabolite gene clusters defining the biosynthetic capability of four soil Clostridium spp. to produce secondary metabolites, with potential antimicrobial properties.Our previous study revealed the antimicrobial potential of Farm 4 soil conditioned medium originating from FS01, FS2.2, FS03, and FS04 isolates . In the equenced , 21. CulClostridium isolates from soil for antimicrobial activity, conditioned media of all four Clostridium isolates were prepared after growing in cooked meat glucose starch medium (CMGS) as monocultures and tested for growth inhibition of Bacillus mycoides ATCC6462, Bacillus cereus NZRM5, and Pseudomonas aeruginosa ATCC25668. These bacteria were selected based on their adverse impact on food safety and quality, and human health. B. cereus has been reported to cause two types of food poisoning: diarrhoeal and emetic [B. mycoides is mainly associated with food spoilage and their food poisoning potential appears to be low [P. aeruginosa is a known opportunistic pathogen and a major cause of hospital acquired infections. Its control has become challenging due to resistance to multiple antimicrobial drugs [P. aeruginosa has also been identified as a spoilage bacterium in dairy products [B. mycoides and P. aeruginosa, but not B. cereus in comparison to untreated controls (P\u2009<\u20090.05). Similarly, FS2.2CM was active against B. mycoides and P. aeruginosa. Among all four isolates, the strongest and broadest antimicrobial activity was reported from FS03CM showing significant growth inhibition against all three test microorganisms compared to untreated controls (P\u2009<\u20090.05). FS04CM demonstrated the least activity by inhibiting only the growth of P. aeruginosa , Clostridium cadaveris (100\u2009%), Terrisporobacter glycolicus (95.6\u2009%), and Clostridium senegalense (98.2\u2009%) respectively. In the current study, whole genome sequences of these four soil Clostridium isolates were used to further confirm the taxonomic assignment and the functional relationships between the isolates and closely related microorganisms.A preliminary identification of four soil isolates was carried out using PCR based 16\u00a0S rRNA gene sequence analysis as described previously . This inParaclostridium bifermentans and Paraclostridium benzolyticum; FS2.2 was closely related to Clostridium cadaveris; FS03 was closely related to Terrisporobacter glycolicus, and FS04 was closely related to Clostridium senegalence  and average nucleotide identity (ANI) have been identified as important criteria in microbial species delineation [Clostridium isolates and their closest neighbours are shown in Table\u00a0Paraclostridium bifermentans (formerly known as Clostridium bifermentans), FS2.2 and Clostridium cadaveris, FS04 and Clostridium senegalense were over the recommended species boundary cut-off values of 70\u2009% dDDH and 95\u2009% ANI, respectively [Terrisporobacter glycolicus ATCC 638, and FS03 and Terrisporobacter glycolicus DSM 1288 were below species cut-off values. Therefore, FS03 does not belong to the species T. glycolicus (formerly known as Clostridium glycolicum) even though it is the closest relative according to 16\u00a0S rRNA based phylogenetic analysis. These results indicate that FS03 may represent a novel species of the genus Terrisporobacter.Genome-based methods including ineation , 32. Theineation . Digitalectively , 34. TheClostridium spp. was conducted by computing the functional genome distribution (FGD). FGD analysis computes the overall levels of microbial genome similarities by comparing amino acid sequences predicted from each bacterial open reading frames (ORFeomes) [Paraclostridium bifermentans, Clostridium cadaveris, and Clostridium senegalence respectively  . The FGDely Fig.\u00a0. FS03 shBacteria exhibiting antagonistic activity against other harmful microorganisms are often considered for developing probiotics. When considering bacteria to be used as probiotic, their pathogenicity is of the utmost important. An array of animal and microbiological assays is available to demonstrate the safety of potential probiotic strains. Nowadays, the evaluation of genome sequences has become a vital part of a thorough safety evaluation , 37.Clostridium includes important human and animal pathogens and some of the members produce exotoxins responsible for diseases such as those causing botulism, tetanus, and gas gangrene. Clostridium perfringens and Clostridium botulinum are two main toxin producers causing foodborne illnesses [Clostridium isolates shown to possess antimicrobial properties were evaluated for the presence of virulence genes using their whole genome sequences.The genus llnesses . In the Clostridium genomes was investigated using VFanalyzer. VFanalyzer is a virulence factor data base (VFDB) integrated automatic pipeline, which can identify known or potential virulence factors in complete or draft genomes of bacteria [Clostridium toxin related genes; plc , colA (kappa-toxin), and pfoA (perfringolysin O) in the FS01 genome and one putative toxin related gene; nagH (Mu-toxin) in the FS2.2 genome. FS03 and FS04 genomes were not found to harbour putative genes for the main Clostridium toxins including alpha-clostripain (cloSI), alpha-toxin (pIc), beta2 toxin (cpb2), Botulinum neurotoxin (atx), C. novyi alpha-toxin (tcnA), C. perfringens enterotoxin (cpe), Clostridium difficile toxin , enterotoxin , kappa-toxin (colA), mu-toxin , perfringolysin O (pfoA), sialidase , tetanus toxin (tetX), toxin A (toxA), and toxin B (toxB). Based on these results, FS03 and FS04 isolates could be more suitable for developing probiotics as genes for virulence factors were absent. However, the expression of plc, colA, and pfoA toxin genes detected in FS01 isolate, are usually regulated by the VirS/VirR two component regulatory system [VirS and VirR) were not found in FS01 genome. However, further assessments are required to confirm their safety to be used as probiotics.The presence of putative virulence genes in all four bacteria . The VFay system  and geneClostridium spp. have started to gain attention as potent antimicrobial producers with the advent of computational genomics [Clostridium species [Clostridium isolates demonstrated antimicrobial activity against significant food and human associated bacteria and were further investigated for their genetic potential to produce various secondary metabolites, using their assembled whole genome sequences and antiSMASH 5.0 genome mining pipeline.In recent years, strict anaerobes such as genomics . Recent  species \u201343. In tClostridium genomes  enzyme encoded by the relevant biosynthetic gene cluster [Clostridium and were not associated with any known sactipeptides.The most abundant BGC type annotated in the genomes of the four bacterial isolates was sactipeptide Fig.\u00a0. Sactipesubtilis . Since tium spp. . It is p cluster . antiSMA cluster . The antParaclostridium bifermentans strains and Paeniclostridium sordellii strains harbour 100\u2009% identical gene clusters to the predicted FS01 sactipeptide gene cluster in this study  origin have been significant bioactive compounds possessing antimicrobial, antifungal, anti-tumour properties, and can be used as immunosuppressants . NRPs arClostridium isolates in the present study predicted the presence of two putative NRPS gene clusters in the genomes of FS2.2 and FS04. These two gene clusters and their domain organization were found to be different to each other  signature genes for identification of core genes of a biosynthetic pathway. This implies a limitation of these tools not being able to identify novel pathways and enzymes. To improve the BGC detection, antiSMASH has implemented the \u2018ClusterFinder\u2019 algorithm to identify BGCs that are not detected by the rule-based genome mining. This technique still has some bias towards currently known pathways as BGC detection has been trained using source data from known pathways . The asstes used . Some ofbacteria . DespiteClostridium isolates, that showed antimicrobial activities against bacteria associated with human health, food quality and safety, predicting their genetic potential to produce novel secondary metabolites. This knowledge serves as a basis for future investigations to identify and characterize potent antimicrobials from Clostridium isolates and also expands the current knowledgebase on the potential of the genus Clostridium to produce bioactive compounds.BGCs encoding for uncharacterized RiPPs and NRPSs were identified from four soil Clostridium spp. by PCR based 16\u00a0S rRNA gene sequence analysis [Clostridium isolates were revived on sheep blood agar (SBA) plates following incubation at 35\u00a0\u00b0C overnight under anaerobic conditions. Each isolate grown on SBA plates was then used to inoculate either cooked meat glucose starch medium or tryptic soy broth (TSB). Bacillus mycoides ATCC 6462, Bacillus cereus NZRM 5, and Pseudomonas aeruginosa ATCC 25,668 were obtained from Environmental Science and Research (ESR), New Zealand. They were grown in tryptic soy broth (TSB) and incubated at 35 oC overnight for growth inhibition assays.All four bacterial isolates  used in this study were previously isolated from soil collected from bovine dairy farms  and identified as analysis . Frozen Clostridium enriched conditioned media were prepared from all four individual isolates following a previously described method with some modifications [Clostridium isolate grown on SBA plates was used to inoculate cooked meat glucose starch medium (45 mL) supplemented with yeast extract (0.0005\u2009%), hemin (0.1\u2009%), and vitamin K (1\u2009%) and incubated in a 35 oC anaerobic chamber  for 48\u00a0h. After the incubation, enriched media were centrifuged at 10,000 \u00d7 g for 40\u00a0min at 4 oC and supernatants were filter-sterilized using 0.22\u00a0\u03bcm polyvinylidene fluoride syringe filters . Sterile conditioned media were aliquoted and stored frozen at -20 oC until use. Conditioned media prepared from FS01, FS2.2, FS03, and FS04 isolates were denoted as FS01CM, FS2.2CM, FS03CM, and FS04CM respectively.ications . Briefly7 CFU/mL cell density and 50 \u00b5L were mixed with CMGS broth (50 \u00b5L) and conditioned medium (100 \u00b5L) in a 96-well flat bottom microtiter plate  and covered with a sealing membrane . Bacterial growth of the test cultures in each well was assessed by incubating the plate in a microplate spectrometer at 35 oC and measuring the optical density (OD) at 595 nm for 24\u00a0h. Nisin (45 \u00b5M)  and Butterfield\u2019s diluent were used as the positive control and untreated control respectively. Corresponding blanks  were used for background correction.Microplate turbidimetric growth inhibition assays were conducted according to a method described previously . BrieflyP\u2009<\u20090.05 were considered statistically significant.All experiments were performed in triplicate and data were presented in mean\u2009\u00b1\u2009standard deviation. The area under the experimental growth curve (AUC), which represents the overall bacterial growth under given growth conditions was calculated using the R package \u2018growthcurver\u2019 . Single oC for 30\u00a0min. Following the incubation, 100 \u00b5L of 20\u2009% (w/v) sarkosyl (sodium lauroyl sarcosinate)  and 15 \u00b5L of RNase A   were added and incubated at 37 oC for another 30\u00a0min. Then, 7.5 \u00b5L of proteinase K (10\u00a0mg/mL)  were added and incubated at 37 oC for 30\u00a0min. The lysate extraction was carried out three times with 600 \u00b5L of phenol/chloroform/isoamyl alcohol (25:24:1) )  and centrifuged at 20,000 \u00d7 g for 20\u00a0min. The DNA was precipitated using 50 \u00b5L of 3\u00a0M sodium acetate (pH 5.2)  and three volumes of ice-cold absolute ethanol at -20 oC for overnight, followed by a washing step with 750 \u00b5L of 70\u2009% ethanol and centrifugation at 17,000 \u00d7 g for 5\u00a0min. After removing supernatants, genomic DNA pellets were air-dried for about 15\u00a0min and re-suspended in 100 \u00b5L of sterile DNase and RNase free water. All samples were stored at 4 oC overnight, they were separated by 0.8\u2009% gel electrophoresis, and visualized by Gel Doc XR system . DNA quality and quantity were assessed using Qubit 4 fluorometer  and NanoDrop 1000 spectrophotometer .Genomic DNA from pure cultures grown in TSB was extracted by using a phenol-chloroform extraction method as described earlier  with minClostridium isolates was sequenced using Illumina MiSeq version 3 sequencing platform at the Massey University Genome Services, New Zealand. DNA library preparation was performed with the Celero PCR workflow with an enzymatic fragmentation DNA-seq library preparation kit . Quality and quantity assessments of DNA libraries were carried out as a quality control check before sequencing. The resulting reads were quality trimmed, filtered, and de novo assembled with the A5-miseq assembler  under the default settings [High quality genomic DNA extracted from four settings .C. cadaveris strains from the NCBI database  were submitted to the TYGS webserver. TYGS extracted available 16\u00a0S rRNA gene sequences from query genomes using RNAmmer [d5 [A 16\u00a0S rRNA gene sequence based phylogenetic tree was constructed using the Type (Strain) Genome Server (TYGS) webserver . Briefly RNAmmer  and thenmmer [d5 .Clostridium genome and their closest neighbours were computed using Genome-to-Genome Distance Calculator (GGDC version 2.1) in TYGS analysis tool with default parameters [Clostridium genome and their closest neighbours were calculated using the ANI calculator developed by Kostas lab with default parameters (http://enve-omics.ce.gatech.edu/ani/). ANI values were calculated as the mean identity of BLASTN matches [The digital DNA:DNA hybridization (dDDH) values of each of the rameters , 64. The matches .Clostridium isolates and their closest neighbours identified from TYGS phylogenetic analysis. All the genomes required for the analysis except the four Clostridium isolates were downloaded in FASTA format from NCBI database. They were concatenated using a universal spacer-stop-spacer sequence and automatically annotated using GAMOLA 2 software package [Functional genome distribution (FGD) analysis investigates the genomic differences between bacteria and interprets the genetic diversity . FGD ana package . FGD ana package .Clostridium isolates [Biosynthetic gene clusters encoding for secondary metabolites were predicted and annotated using the web server version of antiSMASH 5.0  with defisolates .Additional file 1."}
+{"text": "Moreover, several current studies are focusing on improving their conversion efficiency. This study proposes a method to process micro- and nanostructures onto the surface of CIGS/ITO bilayer films to broaden the field of solar cell application. The bilayer films exhibited optical characteristics different from those of a single-film during processing. Field intensities at different layer positions of the CIGS/ITO bilayer films were analyzed, and different structures were fabricated by varying a set of parameters. Ripples were obtained using a pulse energy of 0.15 \u03bcJ and scanning speeds in the range of 0.1\u20131 mm/s, but after increasing speed to 3\u20135 mm/s, ripple structures were produced that had a large period of several microns and spatial porous nanostructures. This pattern exhibited low reflectivity. Optimal structures were obtained at a scanning speed of 3.5 mm/s a pulse energy of 0.15 \u03bcJ, and a reflectivity lower than 5%. Large areas characterized by micron-sized ripple structures and accompanied by nanoscale porous structures presented high optical performance and efficiency, which can be used to broaden the application of thin film-based solar cells.CuSe Curreficiency ,4, so re5 cm\u22121 and an absorption thickness of 1\u20132 \u03bcm [CIGS films are direct band-gap semiconductors having an absorption coefficient of up to 10f 1\u20132 \u03bcm ,7,8,9. Df 1\u20132 \u03bcm ,12,13,14f 1\u20132 \u03bcm . Howeverf 1\u20132 \u03bcm , laser sf 1\u20132 \u03bcm , two-beaf 1\u20132 \u03bcm , and othf 1\u20132 \u03bcm ,20,21), f 1\u20132 \u03bcm ,23, but As the study of a single-layer film in our previous research ,25 showeBased on this, a method of using an ultrafast laser to modify the surface morphology of CIGS/ITO bilayer thin films is proposed, and the interaction between the laser and the different properties of the thin films  is studied. Bilayer films exhibit different optical characteristics compared to single-layer films  because 2) measured 1.3. The laser pulse energy was adjusted by using a combination of a half-wave plate and a linear polarizer. The sample was fixed onto a motorized xyz stage  to ensure a precise positioning of the sample. The overlap of the pulses that were irradiated onto the sample surface was tuned via a mechanical shutter and by controlling the scanning speed of the laser. The schematic diagram of the fabrication of the periodic structures is shown in A CIGS film of 1.5 \u03bcm thickness was sputtered onto a series of glass substrates via magnetron sputtering at room temperature . Then, an additional ITO thin film of 50 nm was sputtered onto the CIGS film surface. Form this, an Nd:YLF femtosecond laser system  with a pulse regenerative amplification of 800 nm wavelength and a repetition rate of 1 kHz was used. The laser system, which has a maximum power of 5 W, delivered pulses of 120 fs duration from a rectangular beam of 9 \u03bcm \u00d7 13 mm via a plano-convex round cylindrical lens having a 75 mm focal length. The energy density distribution of the laser beam was Gaussian, and the beam quality factor (MCompared with single-layer films, bilayer films exhibit a special field intensity distribution under laser irradiation. The morphology and field intensity at different layer positions are shown in All the morphology of the surface structures can be affected by a variation in laser pulse irradiation . A low pIn order to investigate the influence of different parameters on the surface structures of the CIGS/ITO bilayer film, different morphologies were fabricated using a laser pulse energy of 0.15 \u03bcJ and a variable scanning speed. The results are shown in The flocculent deposition decreased upon increasing the scanning speed, and disappears at a speed of 1 mm/s. Uniform periodic ripples were fabricated and the ITO thin film remained intact. The ripples were not perfectly straight and the period measured about 700 nm . SeveralThe optimal areas with ripples accompanied by porous structures were successfully fabricated using a scanning speed of 3.5 mm/s and a pulse energy of 0.15 \u03bcJ b. The coThis study proposed a novel method for processing CIGS/ITO bilayer films by using a rectangular spot irradiated by a femtosecond laser. Bilayer films exhibited different optical characteristics than found in a single-film layer. Field intensities at different layer positions of the CIGS/ITO bilayer films were very different, which showed an obvious periodic distribution in the upper part of the CIGS film and a fragment distribution besides a periodic distribution in the lower part of the ITO film. The optics were reflected at the interface and later interfered with the CIGS/ITO bilayer films. Different structures were successfully fabricated by adjusting a set of parameters. High-frequency laser-induced periodic spatial structures were fabricated onto ITO thin film with a higher spot overlap rate and with a low scanning speed of 0.01 mm/s and a pulse energy of 0.1 \u03bcJ. By fixing the pulse energy at 0.15 \u03bcJ and varying the scanning speed in the 0.1\u20131 mm/s range, ripples were obtained. For a larger scanning speed in the 3\u20135 mm/s range, large periodic structures accompanied by spatial porous structures were were obtained at a scanning speed of 3.5 mm/s and a pulse energy of 0.15 \u03bcJ, which had a reflectivity lower than 5%. Large areas characterized by ripples and porous structures with a high optical performance and efficiency were successfully fabricated, which can improve the field of application of thin-film-based solar cells."}
+{"text": "Skeletonema dominated the spring bloom and was found to be the key taxa in explaining these changes in abundance and phenology. Extensive summer blooms of the coccolithophore Emiliania huxleyi, which has been characteristic for the inner Oslofjorden, has also gradually decreased during the last decades, along with reducing eutrophication. Dinoflagellates have not had the same reduction in abundance as the other groups. Despite an increasing proportion of dinoflagellates compared with other taxa, there are no clear indications of increased occurrence of toxic algal blooms in inner Oslofjorden. However, the introduction of new \u201ctoxin-producing\u201d species may cause concern.Changes in phytoplankton abundance and biomass during the period 1933\u20132020 were examined by statistical modeling using data from the Inner Oslofjorden phytoplankton database. The phytoplankton abundances increased with eutrophication from 1930s to 1970s, but with the implementation of sewage cleaning measures and a resulting reduction in nutrient releases, the phytoplankton abundance has since then decreased significantly. The onset of the seasonal blooms has started progressively later during the last 15\u00a0years, especially the spring bloom. The delayed spring bloom co-occurred with increasing temperature in winter and spring. The diatom biomass decreased more than that of dinoflagellates and other microeukaryotes. The diatom genus  Phytoplankton are the major primary producers in the oceans and produce most (ca. 98%) of the organic matter available for subsequent trophic levels of marine food webs  from the 1980s to 2018 as a result of improved wastewater treatment in the inner Oslofjorden .We also aimed to understand how reduced nutrient levels and increased SST have impacted phytoplankton composition and abundance. The analyses were based on a newly compiled dataset , embraciWe addressed the following questions:Has the seasonal pattern of phytoplankton concentrations and taxonomic composition changed over time in the inner Oslofjorden?Have the phytoplankton taxa that dominate the blooms changed during the last century?Has the occurrence of harmful algae changed over time?How did changes in nutrients, salinity and temperature coincide with the seasonal and interannual changes in phytoplankton?2. The connection to the more open outer Oslofjorden and Skagerrak in the south is through the narrow sound of Dr\u00f8baksundet, where the sill is only 19.5-m deep. Northwards of the Dr\u00f8bak sill, more sills divide the fjord into several basins, such as Vestfjorden, B\u00e6rumsbassenget, Bekkelagsbassenget and Bunnefjorden. This bathymetry is a constraint to efficient deep-water renewal 2. The co renewal .SST and salinity varies strongly through the year in inner Oslofjorden. The stratification is mainly influenced by freshwater outflow from the rivers Glomma and Drammenselva in outer Oslofjorden, and by brackish water from the Baltic current, creating a surface layer which is much less saline than the deep Atlantic water. The horizontal water exchange in Oslofjorden takes place through estuarine circulation where low-saline surface water is flowing outwards and an underlaying high-salinity counter-current is flowing inwards the fjord . During The limited water exchange makes the fjord vulnerable to pollution, especially from nutrients and organic matter that may lead to high phytoplankton concentrations in surface waters and high levels of oxygen consumption in the deep-water .Rivers, waterways and land runoff are significant contributors of bioavailable phosphate in the fjord, but the contribution from sewage plants and especially overflow runoff is also substantial. A major part of the total flux of organic substances is from sewage plants .https://doi.org/10.15468/gugesq, \u22121) following Menden-Deuer and Lessard (a (chl a). Chemical analyses of water samples and measurements of salinity, temperature by CTD (Conductivity Temperature Depth) were described in The data source for the analyses in this study is the Inner Oslofjorden phytoplankton database, which is a compilation of phytoplankton cell counts and co-occurring environmental data when available, from research and monitoring programs from 1896 to 2020 ( Lessard . The envPhytoplankton taxa were aggregated into three groups: diatoms (Diatom), dinoflagellates (Dino) and \u201cother microeukaryotes\u201d (Other). The group termed \u201cother microeukaryotes\u201d is taxonomically diverse and is dominated by unidentified phototrophic and heterotrophic flagellates and monads less than 5\u00a0\u03bcm in diameter.Analysis of the whole time-series, from 1933 to 2020, included all 15 stations , but froFrom 1933 to 1993, only abundance data were available, but from 1994 and onwards, also biomass was calculated. The most comprehensive sampling started in 2006. For the taxonomic analysis, the names in the species list were updated to the current and valid taxonomy according to World Register of Marine Species  and AlgaA Generalized Additive Model GAM;  was usedSkeletonema spp., Chaetoceros spp., Pseudo-nitzchia spp. and Prorocentrum spp. Data were analyzed on ln-scale to homogenize the variance , logDiatom\u2009=\u2009ln[\u03bcg C/L diatoms], logDino\u2009=\u2009ln[\u03bcg C/L dinoflagellates] and logOther\u2009=\u2009ln[\u03bcg C/L other microeukaryotes]. Later, we used similar analysis for biomass of selected dominant taxa; Model M1  and \u03b5 is an independent and normal distributed error term. The number of knots was fixed to compare the seasonal curves of different phytoplankton taxa in a standardized way.Here, subscript Model M2 .Here, Model M3 .Here, We first fitted models M1, M2 and M3 to data on logTotA, logTotC, logDiatom, logDino logOther for the most consistently sampled period, 2006\u20132020. By comparing the explanatory power of these models, we determined how much of the variation in the data is explainable through seasonality alone (M1), through interannual trends combined with a fixed seasonal pattern (M2) and through interannual trends combined with a seasonal pattern that varies gradually between years (M3). To visualize the results of model M3 , we predicted the seasonal variation for 3 years representing the beginning, middle and end of the analyzed period . Note that short-term changes are smoothed by the model and that the model predictions for these 3 years can be interpreted as averages over several years. Model M2 was used to visualize changes over years for abundance and biomass of the three selected groups  for longer periods, specifically for 1933\u20132020 for abundance and 1994\u20132020 for biomass (limited by data availability). Model M2 was used rather than M3 due to insufficient data to reliably estimate possible changes in seasonal pattern for most of these response variables. It was thereby assumed that the seasonal pattern was constant and only abundance levels changed between years. However, to show the seasonal distribution of data, we also showed the results from model M3 as a two-dimensional contour plot of model predictions as function of year and day-of-year as . Model MTo investigate seasonal and interannual trends in possible drivers of changes in phytoplankton biomass and abundance, we analyzed environmental variables logN\u2009=\u2009ln[\u03bcM total nitrogen], logP\u2009=\u2009ln[\u03bcM total phosphorus], logSi\u2009=\u2009ln[\u03bcM Silicate]), S and SST  by model M3  and Distance-based redundancy analysis (dbRDA) on Hellinger-transformed data were then performed using the \u201cadonis\u201d and \u201cdbrda\u201d functions in the R \u201cvegan\u201d package  functions of D, logPc is logP centred by subtracting the mean and logNc and logSic are logN and logSi, respectively, centred by subtracting the mean. The function k(Dt) describes the seasonal departures from a mean level when variations caused by nutrients are accounted for. The functions m(Dt), n(Dt) and o(Dt) give the season-dependent coefficients for, respectively, the associations of logPc, logNc and logSic with logX. These three functions thereby show how the interannual correlations between, respectively, logX and logP, logX and logN and logX and logSi change through the season. After initial analysis logSi was only used in analyzing variation in logDiatom. By analyzing the response and the nutrient variables on ln-scales, we assume linear relationships between proportional changes in nutrients and phytoplankton. A coefficient value of 1 implies that phytoplankton abundance or biomass scales proportionally with the nutrient; a coefficient value of 0 implies no relationship; while a coefficient value between 0 and 1 implies a nonlinear relationship on the original scale, with the largest changes in phytoplankton occurring when nutrient concentrations vary between low values. Coefficient values larger than 1 suggest a convex relationship that is difficult to interpret biologically. Note that this model describes statistical associations and that the model formulation does not represent a mechanistic explanation of the dynamics. The signs and magnitudes of the associations nonetheless throw light on the dynamics. We anticipate that nutrient-phytoplankton associations are negative when the nutrients are plentiful but potentially reduced by the phytoplankton, and positive when the nutrients are low and limiting phytoplankton growth.Here, Similarly, we investigated how variation in temperature and salinity was associated with variation in biomass of the different phytoplankton groups model M5, Eq. , Eq. 5. functions of D, SSTc and Sc are SST and S, respectively, centred by subtracting the mean. The function k(Dt) gives the seasonal trend predicted for SSTc\u2009=\u20090 and Sc\u2009=\u20090, similar to the description of M4 above. The purpose of model M5 was to assess to which degree climate factors could explain the interannual trends in phytoplankton. Note that this model shows statistical associations that may reflect a number of direct and indirect mechanisms. For example, temperature and salinity may be indicators of water column stratification and water mass origin, which in turn influence light and nutrient availability for the phytoplankton. In addition, temperature and salinity can affect phytoplankton growth directly, as well as the activity of the competitors and predators of the different phytoplankton groups.Here, R2). The AIC estimates the relative amount of information lost by a given model: the less information a model loses (i.e. lower AIC), the higher is the quality of that model. The GCV is a measure of leave-one-sample-out prediction error (P\u2009<\u20090.05) positive autocorrelation would violate the assumption of independently distributed residuals and could lead to narrow confidence bands. No serious deviations from model assumptions were found (results not shown).Alternative models  for describing seasonal and interannual variation in phytoplankton variables  for 2006\u20132020 were compared based on the Akaike\u2019s Information Criterion AIC; , the genon error . Models on error . To asse4) were similar with high concentrations during winter and lowest during summer , total nitrogen (N) and silicate (Si(OH)g summer . Spring g summer . Note thg summer . Nitrogeg summer , but theg summer . Phosphog summer .SST was 0\u00b0C in winter and around 3\u20134\u00b0C during spring blooms . TemperaThe analyses of total phytoplankton biomass during 1994\u20132020 and total phytoplankton abundance during 1933\u20132020 show that biomass has decreased since the start of the measurements in the 1990s and abundance has decreased since the 1970s , Fig. S2Figs 5a and b and Figs 6a and b and Phytoplankton biomass and abundance in the inner Oslofjorden showed clear seasonality S2. The sP\u2009<\u20090.05 for the year-term in model M2) for total biomass  for 2006\u20132020 shows that the most complex model, M3, performed best for all taxonomic groups  to one (April) which coincided with the first peak of Chaetoceros . Pseudo-nitzschia spp. commonly reached blooming levels   , while Co August . High abAlexandrium spp., Pseudo-nitzchia spp., Protoceratium reticulatum, Dinophysis acuminata, Dinophysis norvegica and Dinophysis acuta) when they occured, often exceeded the risk limits defined by the Norwegian Food Safety Authority .RDA showed that the physical\u2013chemical parameters associated differently with the class and genera studied . For theclotella . PERMANOgellates , and allThe interannual correlations between phosphorus and the biomass of all phytoplankton groups were positive both during spring and autumn . A signiFigs 2c and a concentration during the same period  was nitrogen-limited during summer and autumn. The same study also suggested that the continuous reduction in nitrogen was the main controlling factor of the decreasing trend in chlorophyll a. Although the nitrogen reduction is no longer significant  was found in high abundance in all seasonal blooms. It typically dominated blooms in spring when freshwater discharge establishes strong salinity stratification. It was also found in autumn blooms. This pattern is found as well in other studies from North-Eastern Europe  is located inside the sill of Oslofjorden, with geographically reduced possibilities for water exchange with the Skagerrak. However, the phenology, including spring blooms and dominant phytoplankton taxa, are highly similar to the rest of Northern Europe  that may affect fish, shellfish and other organisms, was first recorded in 2009. The previous year it was observed by the monitoring programme in the outer Oslofjorden (Generally, the inner Oslofjorden has had very few severe toxic algae events, and only one recorded incident led to human death in 1901 (Pseudo-nitzschia increased in abundance from the 1960s to 2010 and since then only slightly decreased. Pseudo-nitzschia-species did not show a significant correlation with any of the environmental variables that were analyzed. Therefore, our results indicate no increased risk of blooms of toxic species in inner Oslofjorden. There is, however, a continued risk that additional harmful species may become established due to increasing SST.The potential toxic diatom genus Except for the spring blooms, there was a high degree of variation of individual species blooms, which suggests that selection of bloom-species occurs as a result of being in the right place at the right time at suitable inoculum levels .The phytoplankton assemblages in the inner Oslofjorden have shown a striking resilience both in their major properties characterized by distinct seasonal patterns directing to some biological and functional stability. Still the trends that have been recorded for temperature, and the significant changes in the timing of the blooms signify environmental changes.Skeletonema, which have been dominating the spring blooms, is also found to be the key taxa in explaining the changes in phenology of these blooms.The change in the spring blooms was more correlated to temperature than the other two seasonal blooms. A. pseudogonyalax is of concern.While the summer blooms of coccolithophores and diatoms found before the 1970s have been significantly reduced in abundance coinciding with reductions in the supply of nutrients, the abundance of dinoflagellates have not had the same reduction as the other groups. We suggest that this group is not as affected by the reduction in nutrient supply as the other phytoplankton groups due to different strategies of nutrient utilization and storage. Despite the greater abundance of dinoflagellates relative to other groups, there was no clear indication of an increased risk of toxic algal blooms in inner Oslofjorden; however, the introduction of new species such as The changes in phytoplankton phenology impact the energy available for grazers such as copepods and other zooplankton and thus affect the higher trophic levels of the food web. Delayed phytoplankton spring blooms have been found to be negatively associated with the survival of fish larvae (Supplementary_figure_1_fbac055Click here for additional data file.Supplementary_figure_2_fbac055Click here for additional data file.Supplementary_figure_3_fbac055Click here for additional data file.Supplementary_figure_4_fbac055Click here for additional data file.Supplementary_figure_5_fbac055Click here for additional data file.Supplementary_table_1_fbac055Click here for additional data file.Supplementary_table_2_fbac055Click here for additional data file."}
+{"text": "In the presence of a catalytic amount of TfOH, alkyl- and chloro-substituted acetophenones produced a series of terphenyls through a tandem reaction which merged six steps into a one-pot procedure. Moreover, the corresponding ester products were obtained when using other substituted acetophenones as the starting materials under the same reaction conditions.Reported here is a novel cyclocondensation of aryl methyl ketones and triethyl orthoformate for the simple synthesis of  m-terphenyl derivatives starting from aryl methyl ketones and triethyl orthoformate. This is a tandem reaction which merged six steps into one-pot procedure.A facile metal-free and solvent-free benzannulation was developed for the construction of  Generally, when using trialkyl orthoformates for acetalization of carbonyl compounds in the presence of a catalytic amount of Lewis or Br\u00f8nsted acid, both ketones and aldehydes could be transformed to their corresponding acetals 6 with excellent yields.11 With the aid of microwave and a catalytic amount of boron trifluoride, three equivalents of aryl ketones condensed with one equivalent of triethyl orthoformate to afford the product 7 in moderate yields.12 Herein, we surprisingly found that an abnormal tandem cyclocondensation took place under strong acid and an elevated temperature conditions to furnish m-terphenyls 3 as its main product.Through an extensive literature research, we found that diverse compounds have been reported as the main product for the reaction of aryl ketones and triethyl orthoformate in the presence of acid under only slightly different conditions . Open-chm-terphenyls, acetophenone (1a) and triethyl orthoformate (2) were selected as model substrates (3COOH) as catalyst, the reaction proceeded smoothly at 50 \u00b0C to furnish a moderate yield of 1,3-diphenylbenzene (3a) (Entry 3). A lower temperature would dramatically reduce the yield of 3a and benefit the formation of carboxonium ions (4 or 5) (Entries 1 and 2), while the self-condensation of 1a would be accelerate to generate the byproduct 1,3,5-triphenylbenzen (8a) at a higher temperature,13 thus finally decreased the yield of the desired product (Entry 4). The choice of acids was of considerable importance in this cyclocondensation reaction. In fact, there was a low or no yield of 3a when inorganic acids or weak organic acids were employed (Entries 5\u20137), and an excess amount of the acid was necessary to guarantee the formation of the desired product (Entries 3 and 8\u201310). While using strong organic acids, the cyclocondensation reaction with only one equivalent of the acid could produce 3a in moderate yields (Entries 11\u201312). We believed that large amount of acid would result in the formation of carboxonium ions as byproducts. Therefore catalytic amount of a stronger organic acid was tested. We found that trifluoromethanesulfonic acid  led to much cleaner reaction, and finally gave the best yields (Entries 13\u201317). Surprisingly, we found that the best molar ratio between acetophenone and orthoformate is 1\u2009:\u20094 which is contradicted with what is dictated by the reaction equation. When reducing the amount of triethyl orthoformate, the yield of 3a was dramatically decreased (Entries 18\u201319). Moreover, the reactions with different solvents were also examined (Entries 20\u201323), and yet both the reaction cleanness and the yields were not better than those obtained without any solvent.In order to develop an efficient approach to bstrates . When wepara- or meta-position on the phenyl ring methanone or -4\u2032-yl(phenyl)methanone intermediate, which undergoes decomposition by nucleophiles to generate the final product 3a and the byproduct 9a.On the basis of our results and the related literatures, a tentative mechanism for the reaction between acetophenone (1a) and triethyl orthoformate under strong acidic conditions is proposed in m-terphenyls from simple starting materials without any metal catalysts and solvents.In summary, a cascade cyclocondensation reaction merged six steps into one-pot procedure has been disclosed. This reaction demonstrates a new protocol for the synthesis of 1H and 13C) were recorded on 600 MHz spectrometers with tetramethylsilane (TMS) as an internal standard. The splitting patterns are designated as singlet (s), doublet (d), triplet (t), quartet (q), dd (doublet of doublets); m (multiplets), and etc. All first-order splitting patterns were assigned on the basis of the appearance of the multiplet. Splitting patterns that could not be easily interpreted are designated as multiplet (m) or broad (br). High resolution mass spectral analysis (HRMS) was performed on ESI-QTOP mass spectrometer. Purification was done by column chromatography and preparative TLC using silica gel. TLC analyses were performed on commercial glass plates bearing a 0.25 mm layer of silica gel GF254. Visualization was performed using a UV lamp or chemical stains like KMnO4 and I2. Commercially available materials were used as received.Nuclear magnetic resonance spectra (To a 25 mL two necked flask under nitrogen atmosphere at 50 \u00b0C was added triethyl orthoformate (4.0 mmol) and acetophenones (1.0 mmol). After stirring for 0.5 hour, trifluoromethanesulfonic acid (0.1 mmol) was added into the mixture. After completion of the reaction (monitored by TLC), it was quenched with a saturated sodium carbonate (10 mL), extracted with dichloromethane (3 \u00d7 10 mL) and dried with anhydrous sodium sulphate. The organic mixture was concentrated under reduced pressure, and separated by silica-gel column chromatography using ethyl acetate\u2013hexane as eluent in increasing polarity to yield the desired product.1H NMR  \u03b4 7.83 , 7.71\u20137.63 , 7.60 , 7.53 , 7.48 , 7.39 ; 13C NMR  \u03b4 141.82, 141.22, 129.23, 128.84, 127.44, 127.30, 126.20, 126.17.The title compound was obtained as white solid, 81% yield, mp: 83\u201384 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.78 , 7.59\u20137.52 , 7.52\u20137.46 , 7.28 , 2.42 ; 13C NMR  \u03b4 141.64, 138.36, 137.15, 129.50, 129.09, 127.09, 125.77, 125.68, 21.12.The title compound was obtained as white solid, 73% yield, mp: 125\u2013126 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.82 , 7.59 , 7.55\u20137.45 , 7.38 , 7.22 , 2.47 ; 13C NMR  \u03b4 141.82, 141.21, 138.36, 129.05, 128.69, 128.11, 128.05, 126.16, 126.04, 124.36, 21.55.The title compound was obtained as colorless oil, 84% yield, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.82 , 7.59 , 7.54\u20137.48 , 7.33 , 2.83\u20132.63 , 1.32 ; 13C NMR  \u03b4 143.55, 141.71, 138.67, 129.12, 128.36, 127.21, 125.90, 125.75, 28.58, 15.64.The title compound was obtained as colorless crystal, 75% yield, mp: 86\u201387 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.82 , 7.58 , 7.55\u20137.43 , 7.29 , 2.67 , 1.72 , 1.01 ; 13C NMR  \u03b4 141.96, 141.66, 138.61, 129.06, 128.90, 127.06, 125.84, 125.68, 37.71, 24.58, 13.90.The title compound was obtained as white solid, 82% yield, mp: 71\u201372 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.79 , 7.58 , 7.56\u20137.52 , 7.48 , 7.33 , 2.97 , 1.31 ; 13C NMR  \u03b4 148.16, 141.71, 138.84, 129.12, 127.23, 126.94, 125.95, 125.79, 33.88, 24.09; HRMS (ESI) calcd for C18H13 (M + H)+: 229.1012, found: 229.1010.The title compound was obtained as white solid, 69% yield, mp: 99\u2013100 \u00b0C. 1H NMR  \u03b4 7.81 , 7.62\u20137.53 , 7.52\u20137.44 , 7.29 , 2.68 , 1.74\u20131.61 , 1.42 , 0.97 ; 13C NMR  \u03b4 142.21, 141.70, 138.60, 129.10, 128.89, 127.11, 125.87, 125.71, 35.35, 33.70, 22.46, 14.02.The title compound was obtained as yellowish solid, 78% yield, mp: 47\u201348 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.83 , 7.58 , 7.55\u20137.44 , 7.33\u20137.18 , 2.55 , 1.94 , 0.97 ; 13C NMR  \u03b4 141.68, 141.00, 138.63, 129.60, 129.11, 126.95, 125.86, 125.70, 45.14, 30.31, 22.47; HRMS (ESI) calcd for C26H31 (M + H)+: 343.2420, found: 343.2425.The title compound was obtained as white solid, 79% yield, mp: 67\u201368 \u00b0C. 1H NMR  \u03b4 7.81 , 7.61\u20137.53 , 7.49 , 7.29 , 2.78\u20132.55 , 1.75\u20131.64 , 1.47\u20131.32 , 0.93 ; 13C NMR  \u03b4 142.25, 141.69, 138.60, 129.10, 128.88, 127.11, 125.87, 125.71, 35.64, 31.61, 31.24, 22.61, 14.09.The title compound was obtained as white solid, 75% yield, mp: 56\u201357 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.78 , 7.56\u20137.51 , 7.50\u20137.46 , 7.44 , 7.40 , 7.24 , 2.36 , 2.33 ; 13C NMR  \u03b4 141.73, 138.91, 136.93, 135.79, 130.07, 128.99, 128.53, 125.82, 125.63, 124.60, 19.94, 19.45; HRMS (ESI) calcd for C22H23 (M + H)+: 287.1794, found: 287.1791.The title compound was obtained as yellowish oil, 71% yield, mp: 57\u201358 \u00b0C. 1H NMR  \u03b4 7.71 , 7.59\u20137.49 , 7.47\u20137.40 ; HRMS (ESI) calcd for C18H13Cl2 (M + H)+: 299.0389, found: 299.0388.The title compound was obtained as white solid, 68% yield, mp: 112\u2013113 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.73 , 7.63 , 7.57 , 7.53 , 7.40 , 7.38\u20137.33 ; 13C NMR  \u03b4 142.77, 140.58, 134.78, 130.10, 129.50, 127.57, 127.39, 126.65, 126.01, 125.42.The title compound was obtained as yellowish oil, 74% yield, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 8.15 , 8.08 , 7.96 , 7.91 , 7.86 , 7.76 , 7.62 , 7.58\u20137.48 ; 13C NMR  \u03b4 141.80, 138.50, 133.69, 132.71, 129.38, 128.51, 128.23, 127.67, 126.64, 126.48, 126.36, 126.02, 125.97, 125.65.The title compound was obtained as white solid, 67% yield, mp: 144\u2013145 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.72 , 7.63\u20137.54 , 7.54\u20137.40 , 7.05\u20136.96 , 3.87 ; 13C NMR  \u03b4 159.21, 141.32, 133.81, 129.11, 128.26, 125.33, 125.15, 114.22, 55.36.The title compound was obtained as white solid, 23% yield, mp: 193\u2013194 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 8.01 , 7.55 , 7.45 , 3.44\u20133.31 , 3.26 ; 13C NMR  \u03b4 199.49, 136.81, 133.21, 128.63, 128.21, 42.39, 27.66.The title compound was obtained as white solid, mp: 139\u2013140 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 7.80 , 7.72 , 7.49 , 7.40 ; 13C NMR  \u03b4 142.35, 141.16, 128.85, 127.55, 127.36, 125.18.The title compound was obtained as white solid, mp: 170\u2013171 \u00b0C, and the analytical data are consistent with those in the literature. 1H NMR  \u03b4 8.00 , 6.91 , 4.35 , 3.86 , 1.38 ; 13C NMR  \u03b4 166.43, 163.25, 131.55, 122.97, 113.55, 60.66, 55.43, 14.40.The title compound was obtained as colorless oil, 46% yield, and the analytical data are consistent with those in the literature. There are no conflicts to declare.RA-010-D0RA00578A-s001"}
+{"text": "Aquaporins are membrane channels that allow for the movement of water and solutes in cells. They have been reported to play crucial roles in mammalian early development and cryopreservation processes. However, there are few studies focused on the characterization of aquaporins in cumulus oocyte and embryo complexes of cattle. Moreover, no studies have been carried out on Brahman, Holstein, Gir and Romosinuano, important bovine breeds in milk and meat production. Therefore, the objective of this study was to evaluate their presence, transcript level and possible functions in the cumulus oocyte complex of the Brahman, Holstein, Gir and Romosinuano breeds and in embryos from five bovine crosses. Aquaporins 1\u201312 were found in both cumulus oocyte complexes and embryos, and we found possible parental effects on the expression of aquaporins 6 and 12b in cumulus oocyte complexes and aquaporins 4, 8 and 9 in embryos. This allows one to evidence possible functions in the early development of the Brahman, Holstein, Gir and Romosinuano bovine breeds.AQPs) are proteins with various functions related to proper cell function and early development in mammals. The aim of this study was to evaluate the presence of AQPs and determine their mRNA levels in the cumulus oocyte complex (COC) of four bovine breeds and in blastocysts of five bovine crosses. Grade I, II and III COCs were collected by ovum pick up from non-lactating heifers of the Brahaman, Holstein, Gir and Romosinuano breeds. Embryos were produced in vitro up to the blastocyst stage of the bovine \u2640Gir \u00d7 \u2642Holstein, \u2640Holstein \u00d7 \u2642Gir, \u2640Brahman \u00d7 \u2642Holstein, \u2640Holstein \u00d7 \u2642Brahman, and \u2640Romosinuano \u00d7 \u2642Holstein crosses. mRNA expression of AQP1-AQP12b was estimated in COC and embryos by real-time-PCR. The presence of the twelve AQPs in the COCs and bovine embryos was established. Additionally, significant differences were determined in the expression of AQP6 and AQP12b in COCs, as well as in transcripts levels of AQP4, AQP8 and AQP9 from bovine embryos. Gene expression of AQPs in COCs and bovine embryos is consistent with the previously described biological functions. This is the first report of AQPs in COC of Gir, Brahman, Holstein and Romosinuano and embryos of five crossbreeds between Bos indicus and B. taurus.Aquaporins ( AQPs) are a family of conserved integral transmembrane proteins considered fundamental for the correct function of cells such as water transport , cell adhesion, cell migration, cell proliferation and cell differentiation [AQPs may be involved in inflammatory processes, as regulators of the host\u2019s innate defense at the cell membrane level [Aquaporins  and the polarized distribution of Na/KATPase [AQPs has been studied during the cryopreservation process where cells dehydrate and rehydrate [ systems . In the /KATPase ,9,10. Inehydrate ,12.Bos taurus taurus or Bos taurus indicus genetic groups [B. indicus breeds, one finds Gir and Brahman livestock. The first is the main dairy cattle in tropical and subtropical regions [B. taurus bovines, Holstein represents a widespread breed for dairy farming [Differences have been shown regarding gene expression patterns related to reproductive features such as oocyte quality, oocyte recovery, blastocyst production and pregnancy rates, depending on whether the donors belong to c groups ,14. Amon regions , and the regions . For B.  farming , while R farming .AQP, determine its mRNA levels in cumulus oocyte complexes (COC) of Brahman, Gir, Romosinuano, Holstein breeds and \u2640Brahman \u00d7 \u2642Holstein, \u2640Gir \u00d7 \u2642Holstein, \u2640Holstein \u00d7 \u2642Gir, \u2640Romosinuano \u00d7 \u2642Holstein and \u2640Holstein \u00d7 \u2642Brahman embryos, and determine the genetic influence of breeds on expression patterns.Due to this, the objective of this study was to evaluate the presence of n = 15 each) was taken by Ovum pick up (OPU) from nulliparous and non-lactating heifers aged between 48 to 96 months, belonging to the Brahman (n = 3), Gir (n = 3), Romosinuano (n = 3) and Holstein (n = 3) breeds, in Monteria\u2013C\u00f3rdoba, with an average temperature of 29 \u00b0C and relative humidity between 70% and 85%.Bovine COC pool  connected to a sterile 50 mL puncture tube through a Teflon hose. The OPU kit is completed with a vacuum pump calibrated at 50\u201353 mm Hg (20 mL/min). The follicular fluid obtained from the punctures was deposited in the puncture tube with the collection medium . The tubes were kept at 39 \u00b0C in a constant-temperature water bath. After aspiration, the COCs were classified according to Rodrigues et al.  in three2, and 95% humidity in the incubator.COCs were washed four times in TALP-Hepes medium and once in in vitro maturation medium TCM199 supplemented with follicle-stimulating hormone and fetal bovine serum. About ten oocytes were then transferred in microdroplets of 50 \u00b5L of TCM199, for a period of 24 h at 38.5 \u00b0C, 5% COg for 30 min, and the pellet was resuspended in TALPFert medium. This medium was incubated for 18 hours at 38.5 \u00b0C, 5% CO2, and 95% humidity.Previously matured oocytes were washed four times in TALP-Hepes medium and transferred to TALPFert medium. Straws of 0.25 mL of semen were thawed in a water bath at 37 \u00b0C for 35 s, exposed to gradients of Percoll 45/90 in TALP-Sperm, then centrifuged at 500\u00d7 2, 5% O2, N2 balance and 95% humidity. Three embryo pools (n= 10 each one) were obtained for each \u2640Gir \u00d7 \u2642Holstein, \u2640Holstein \u00d7 \u2642Gir, \u2640Brahman \u00d7 \u2642Holstein, \u2640Holstein \u00d7 \u2642Brahman, and \u2640Romosinuano \u00d7 \u2642Holstein cross.Zygotes were washed four times in Talp-Hepes medium, and then the embryos were transferred to 50 \u00b5L of culture medium SOF-BE1, where they remained in the blastocyst stage at 38.5 \u00b0C, 5% COTM Reverse Transcription System kit , and cDNA quality was determined through Endpoint PCR and agarose gel electrophoresis.Total RNA extraction was carried out from COC and embryo pools, using the RNA-solv reagent kit , following the manufacturer\u2019s instructions with modifications , and RNAAQP primer sets designed in Geneious Prime software  with modifications at annealing temperature for each set of primers .RT-PCR amplification from cDNA was carried out using GoTaq\u00ae Flexi DNA polymerase  and software , followi primers . Amplicon = 324) were run in duplicate with Luna\u00ae Universal qPCR Master Mix  following the manufacturer\u2019s instructions, in a QuantStudio 3 Real-Time PCR System  by Fast ramp program. Each primer product was validated by melt-curve analysis and gel electrophoresis imaging to ensure amplification from genomic DNA was not present. Relative gene expression was calculated using the 2\u2212\u2206\u2206Ct method [actb was set as a normalization gene [qPCR assays . In the case of parametric data, an ANOVA test using Tukey\u2019s test as AQP6 mRNA expression was higher in Romosinuano compared to Brahman (p = 0.010) and Holstein (p = 0.004); likewise, Gir has a higher expression than Brahman (p = 0.004) and Holstein (p = 0.002) (AQP12b mRNA level was higher in Gir compared to Holstein (p = 0.039), but this AQP was expressed similarly between Romosinuano, Brahman and Gir, and Romosinuano, Brahman and Holstein  . In addiHolstein . MoreoveAQPs in the COCs, it is possible to see in AQPs (with the exception of AQP5) compared to the COCs of the other species, where the mRNA levels of AQP2, AQP3, AQP7, AQP8, AQP10, AQP11 and AQP12b are higher in Gir and Brahman (B. indicus species), respectively, in contrast to those obtained by Romosinuano and Holstein, and the AQP1, AQP4, AQP6 and AQP9 transcripts have a higher expression in Gir and Romosinuano, respectively, unlike Brahman and Holstein.On the other hand, despite the fact that no significant differences were determined in the expression of all the AQP4 and AQP9 in the blastocysts is influenced by the parental effect of Romosinuano as an oocyte donor breed, since the expression of these AQPs is similar in the crosses between \u2640Gir \u00d7 \u2642Holstein and \u2640Holstein \u00d7 \u2642Gir and between \u2640Brahman \u00d7 \u2642Holstein and \u2640Holstein \u00d7 \u2642Brahman, but differs between \u2640Gir \u00d7 \u2642Holstein and \u2640Romosinuano \u00d7 \u2642Holstein , with the mRNA level being lower in the latter. The expression of p = 0.0015), \u2640Gir \u00d7 \u2642Holstein (p = 0.0016), \u2640Holstein \u00d7 \u2642Gir (p = 0.0011) and \u2640Romosinuano \u00d7 \u2642Brahman (p < 0.0001), but is similar to \u2640Gir \u00d7 \u2642Holstein (p > 0.9999), \u2640Holstein \u00d7 \u2642Gir (p = 0.9986) and \u2640Romosinuano \u00d7 \u2642Brahman (p = 0.1818) when Holstein is the sire (\u2640Brahman \u00d7 \u2642Holstein).Moreover, AQP8 transcripts are related by the parental effect of Brahman as sire, since its expression differs in \u2640Holstein \u00d7 \u2642Brahman compared to \u2640Brahman \u00d7 \u2642Holstein , and a downward trend in the expression of all AQPs (except for AQP3) when Romosinuano is the oocyte donor breed (\u2640Romosinuano \u00d7 \u2642Holstein).On the other hand, in the expression of AQPs. Therefore, we propose the importance of AQP1, AQP10 and AQP11 in the regulation of the flow of water, CO2, NH3 and glycerol through the cell membranes of the COCs of the Brahman, Holstein, Gir and Romosinuano breeds [AQPs in the COCs of the Brahman, Holstein, Gir and Romosinuano breeds, and several studies have found the expression of AQP1, AQP3, AQP4, AQP5, AQP7 and AQP9 in bovine oocytes [In accordance with Jin et al. , bovine o breeds ,22,23,24 oocytes ,26,27,28AQP3 expression in the COC of B. indicus and B. taurus may play a role in water movement and cytoplasmic maturity in immature oocytes [AQP7 in bovine oocytes [Moreover,  oocytes , influen oocytes ,29. On t oocytes ,30; thus oocytes ,30. AQP1, AQP3, AQP4, AQP5, AQP7 and AQP9 in theca cells as GC of bovine ovarian follicles [AQPs\u2019 expression in COCs of B. indicus and B. taurus. AQP1, AQP5, AQP7 and AQP9 may play a key role in the formation of the antrum in the Gir, Brahman, Holstein and Romosinuano breeds, since the transport of water and glycerol has been reported during the formation of the antrum mediated by AQP1, AQP7 and AQP9 [AQP3, AQP4, and AQP5 in antral follicular fluid flow [AQP4 and AQP7 [COCs are formed by undifferentiated granulosa cells (GC), and previous studies have characterized the presence of ollicles ,31,32, tand AQP7 ,34. B. indicus and B. taurus [AQPs. The significant differences in the expression of AQP6 and AQP12b may be related to the genetic diversity provided by migration, natural selection and geographical separation [AQP2, AQP3, AQP7, AQP10, and AQP12b in Gir and Brahman may be due to their high adaptive capacity to harsh environments, given their tolerance to heat, and to both internal and external parasites, in comparison to Holstein and Romosinuano breeds [On the other hand, exposure to high temperatures affects folliculogenesis . In this. taurus ,37 may eparation . In addio breeds ,40.AQPs\u2019 gene expression in the COC of Gir, Brahman, Romosinuano and Holstein, and of AQP2, AQP6, AQP10 and AQP12b in bovine COC. To the authors\u2019 knowledge, this study is the first report of AQP3, AQP7, AQP9 and AQP11 has been reported in bovine embryos by qPCR [AQPs, except for AQP10 [AQPs\u2019 expression in blastocysts of these breed crosses may be a heat-protection measure during embryonic development.In agreement with our study, the presence of  by qPCR ,41, and or AQP10 ,44,45,46AQP1, AQP2, AQP8 and AQP9 in the embryonic development of the five bovine crosses evaluated could be the homeostasis of the maternal-fetal fluid [AQPs have been reported in the fetal membrane, blastocysts and trophectoderm of different mammals, respectively [AQP8 and AQP9 could play a role in the preservation of cytoplasmic osmolarity during glycerol consumption in embryonic cells [AQP9 and AQP10 may be involved in the movement of other solutes, such as urea, purines and pyrimidines, during the embryo development of theses bovine crosses [The function of al fluid , since tectively ,49,50,51ic cells . Moreove crosses ,8.AQP3 mRNA expression of the different embryo crosses between B. indicus and B. taurus breeds. Therefore, the presence of AQP3 in these blastocysts could be related to fundamental developmental processes, such as the movement of water through the trophectoderm [AQP7 [According to Wohlres\u2013Viana et al. , no signectoderm ,53 and trm [AQP7 ,54. AQP4 and AQP5 have been found, as in this study, in B. indicus blastocysts and in 8-cell blastomeres and the blastocoel cavity of mice [B. indicus and B. taurus could be related to water transport, given their high solute selectivity [AQP5 is phosphorylated in the blastocyst stage, leading to its displacement to the cytoplasmic membrane in embryos in vivo [AQP6 may be involved in water transport and blastocoel formation of the bovine crosses given its high permeability to nitrate [On the other hand,  of mice ,55,56,57ectivity ,59. In a in vivo ,59. Like nitrate .AQPs in the COCs of Gir, Brahman, Holstein and Romosinuano and in embryos of five crosses between B. indicus and B. taurus. Expression of the AQP mRNA level in COC and bovine embryos is consistent with previously described biological functions in other mammals. Our findings provide the basis for identifying key roles for AQPs in COCs and bovine embryonic development; however, further studies are required to characterize and elucidate their functions, as well as their possible use in cryopreservation.This is the first report on the twelve"}
+{"text": "Orang Asli population in Malaysia.The national government policies and Jabatan Kemajuan Orang Asli (JAKOA) have to put more effort to improve the quality of life for Orang Asli communities. Over the years, under the government-sanctioned relocation programme, many Orang Asli groups were moved to a more developed and urban area. They were given proper facility, healthcare service to ensure the improvement of overall well-being. While undernutrition among the Orang Asli remains a major health issue, evidence has shown that overweight and obesity in this population are increasing. This observation might be attributed to an urbanised lifestyle that often leads to unhealthy dietary patterns, leading to an increased prevalence of obesity, chronic diseases, food insecurity and unhealthy diet intake. The nutritional transition should be capture for a better understanding of Orang Asli nutritional status. This review assessed the nutritional status and its related key factors among  Indigenous people can be defined as a minority ethnic group of people sharing common characteristics and maintenance within the ancestral territories of cultural, social, economic and political entities . To dateAccording to the Malaysia government, the Aboriginal Peoples Act 1954 ACT 134) had implemented to recognise this community. Since 1957, government and non-governmental organisations (NGOs) have embarked on numerous development projects to promote the quality of life of the communities of Orang Asli, such as educational, financial, healthcare, resettlement, housing opportunities and many other initiatives. Despite the planned development, this population still remains socioeconomic marginalised and negative health aspects because they live in forest areas and still follow traditional lifestyles that are strongly influenced by the environment and cultural traditions of ancestral origin. This resulted in high mortality among the Orang Asli population that has limited access to modern medical facilities. The existence of a high prevalence of health problems like undernutrition, infectious diseases  and chronic disease is a strong sign of significant shortcomings in Orang Asli social and public health policies. Other culprits resulted in a poor quality of life, including genetic vulnerability, socioeconomic disadvantages, resource alienation and political injustice , 2016\u20132025, highlighted \u2018the second Sustainable Development Goals (SDGs) that are zero hunger to end hunger, achieve food security and improve nutrition to tackle the high prevalence and effects of malnutrition collectively\u2019 , normal weight (18.5 kg/m2\u201324.9 kg/m2), overweight (25.0 kg/m2\u201329.9 kg/m2) and obese (\u2265 30.0 kg/m2). BMI greater than or equal to 30.0 kg/m2 is considered to be caused of abnormal or excessive adiposity. Five studies were included in this review for analysis (n = 138) showed that the mean BMI of Orang Asli adults in Lembah Belum, Gerik in Perak state were reported to be 20.8 \u00b1 4.1 kg/m2, with mean BMI values for male and female as 20.5 \u00b1 2.9 kg/m2 and 21.0 \u00b1 4.77 kg/m2, respectively, and there was no significant difference reported between male and female (n = 57) has reported that the mean BMI was 21.83 \u00b1 3.4 kg/m2 for men and 21.31 \u00b1 4.05 kg/m2 for women from Che Wong tribe in the Krau Wildlife Reserve in Pahang State. Among the male respondents, 13.8%, 72.4% and 10.3% of them were underweight, normal and overweight, respectively, while for female, 25.0%, 46.4% and 28.6% of them were underweight, normal and overweight, respectively (Body mass index (BMI) is the most popular method for nutritional assessment whereby it captured the bodily composition in relation to weight and height status. According to World Health Organization (WHO) , BMI defanalysis , 10\u201313. n = 138), the data showed that the mean BMI was 25.7 \u00b1 4.61 kg/m2 for Orang Asli in Cameron Highlands. According to the BMI categorisation, most of them were normal/healthy (37.7%), followed by obese (34.8%), overweight (25.4%) and underweight (2.2%). Another study (n = 351) by Chang  had significantly higher mean BMI than males (29.1 \u00b1 3.08 kg/m2). More than 40% of the respondents were obese and 54.7% were overweight (n = 58) conducted in 2018 showed that the mean BMI of respondents from Temiar Orang Asli Community in Kuala Betis, Gua Musang in Kelantan State was 25.2 \u00b1 5.3 kg/m2 where there was no significant difference between men and women. According to the WHO  show that 2% of respondents had low levels of body fat, 29% of them had normal (mean = 24.52 \u00b1 4.65%) and 69% of them had a high (mean = 28.65 \u00b1 4.99%) and very high (mean = 37.37 \u00b1 6.87%) body fat. Overall, these findings indicate that most respondents were deemed overweight or obese  is also an important health indicator that helps to screen for potential health risks associated with overweight and obesity. WC is measured at the end of several consecutive natural breaths, the midpoint between the top of the iliac crest and the lower margin of the last palpable rib in the midaxillary line is determined at the level parallel to the floor . The datn = 57) conducted in 2010 indicated that the mean WC was 74.4 \u00b1 6.09 cm and 73.92 \u00b1 6.80 cm for males and females, respectively (n = 138) showed that the mean of WC for respondents were 79.2 \u00b1 12.53 cm, where 26.8% of the respondents had central obesity according to the waist-hip ratio, while 13% of them had central obesity according to the WC. Another study (n = 58) indicated that the mean of the normal WC was 73.46 \u00b1 11.27 and 96.51 \u00b1 7.20 for the at-risk category, where 16% of respondents exhibited central obesity . A total of 82.8% of the households reported some household food insecurity with child hunger (28.1%), individual food insecurity (32.8%) and household food insecurity (20.3%) (n = 92) from Gombak in Selangor State, about 88% of the household were food insecure, with 48.9% of them reporting household food insecure, 21.7% individual food insecure and 17.4% child hunger. In a study on Mah Meri women (n = 222), 82.9% of households reported that they experienced food insecurity, with 29.3% subjects experiencing household food insecure, followed by 23.4% subjects experiencing individual food security, and lastly, 30.2% of the subjects were in the child hunger category that experienced the most severe level of food insecurity  . The stu (20.3%) . In anot.3% . Theunger 28.%, indiviFood insecurity is closely related to poor nutritional status, including malnutrition and malnourishment, which can be defined as experiencing a poor or inadequate diet that leads to malnutrition. Five research were included in this topic , 19\u201320. n = 222), household food insecurity (28.5 \u00b1 5.8) was significantly correlated with a higher mean BMI than individual food insecure (26.7 \u00b1 7.3) and child hunger (25.8 \u00b1 4.6) after controlling for age (P < 0.025) (n = 92) stated that the BMI and WC were found no statistically significant difference between the food secure and food-insecure groups (2) and individual food insecurity (27.82 kg/m2), the mean BMI was slightly higher relative to child hunger (24.85 kg/m2). Among all, 2.2% of household food insecurity and 25% of child hunger were found experiencing underweight, whereas, in terms of at-risk WC, more women under the food secure category (72.7%) were a higher risk compared with women in household food insecure (66.7%), individual food insecurity (60%) and child hunger (50%) (Based on a study on Mah Meri women (< 0.025) . This ine groups . This ster (50%) .n = 64). The food secure group had higher percentages of normal weight-for-age and height-for-age children compared to the food insecurity group. Among children in household food insecure, 46.2% of them were significantly underweight, 30.8% were significantly stunted and 7.7% were significantly wasted , the study had reported that intakes of macronutrients and micronutrients seemed to be decreased as food security worsened  was 1087.6 \u00b1 692.7 kcal, 877.0 \u00b1 323.5 kcal and 955.4 \u00b1 409.0 kcal, respectively, on the differences in women\u2019s energy and nutrients intakes by food security status, mean calorie intakes among respondents in household food insecurity, individual food insecurity, and child hunger (n = 222). The research indicated the women from the child hunger group were significantly correlated with higher mean sodium (P < 0.001) and fat (P < 0.05) nutrient score compared with other groups. A higher Malaysian HEI score indicating lower consumption of sodium and fat. Women from child hunger showed to experience severe food insecurity, causing them to reduce the frequency of meal intake and daily expenditure on basic food to provide their children\u2019s needs, thus resulting in low consumption of sodium and fat. However, during food insecurity, consumption of available food in the household such as fried rice, soy sauce, and salted fish anchovies resulted in the higher intake of fat and sodium observed among women from household food insecure (Another study (d hunger . In housd hunger . The higd hunger . Researcn = 222) indicated that respondents of the individual food-insecure and child-hunger groups had lower Malaysia HEI scores; specifically, for grains and cereals with a mean score of 8.0 \u00b1 1.7% comparing with 8.9 \u00b1 1.4% in the secure group as well as meat, poultry and egg consumption with a mean score of 4.0 \u00b1 3.3% comparing with 6.0 \u00b1 3.6% in the secure group (n = 64) conducted by Zalilah and Tham  decreased as household food insecurity worsened. The prevalence of children with poor diet quality index from the individual insecure group (81.0%) is higher than that of the household food insecure (53.8%). The low availability of food supply for consumption are the key factors that restrict the food variety and hence the quality of diet (n = 222) indicated a strong correlation between food security status and Malaysian HEI  suggested that as the household income, per capita income and food expenditure decreased (P < 0.001), the food insecurity worsened significantly. Women from the child hunger group were shown to have a significantly higher number of children (3.1 \u00b1 1.7) and a larger household size (5.2 \u00b1 1.7) than that in the food-secure group (number of children: 2.6 \u00b1 2.1 and household size: 4.6 \u00b1 2.6) (n = 92) suggested that difference in school years, number of children, monthly income and household size were identified to have significant difference between food security status (n = 64) on the prevalence of household food security among the Temuan community, based on household income and per capita income, improved household food security as household income and per capita income increased . The study provides evidence on the barriers to obtain an adequate amount of traditional and modern food , coping strategies were classified into three categories which are food-related coping strategy, non-food related strategy and other related coping strategies. Among food-related strategies, most of the women adopted the coping strategies of consuming whatever food is available around the house (66.3%) and using less expensive food (64.1%). For non-food-related coping strategies, many of them adopted the strategy of being thrifty in using money (82.6%) and planning for expenses (82.6%). They also implemented other related coping strategies, such as catching or fishing fish from rivers (22.8%) and depending on forest sources for food (26.1%), which are known as the traditional seeking food practices (n = 61) was performed to assess the types of coping strategies adopted and the associated severity level for food insecurity among women from three ethnic groups  during the period of food insecurity. A total of 29 strategies covering both traditional food searching and modern economy practices were identified and further categorised into two themes: food consumption and financial management coping strategies. Among the food consumption coping strategies, \u2018searching for food from food for surroundings\u2019 (95.1%) under the sub-themes diversification of food sources was the most common food consumption coping strategy, followed by request or borrow food (86.9%) under the same sub-themes, and then eat the less preferred meal (83.6%) under the sub-theme dietary change. Less preferred food consumption represented an inability to be satisfied with the food, particularly where it was a food that had been persistently eaten and that the participants would become bored with eating. Besides, decrease in the number of people  and rationing  are also adopted as food consumption coping strategies . Techniques including buying groceries from local grocery shops or food outlets, seeking edible plants (e.g. fern shoot and tubers) in the jungle, fishing at nearby lakes and rivers and hunting for animals in the forest were identified. As Jahai lives along the rivers and thus, fish is their primary food source. Besides, some of the Jahai households also receiving support from NGOs and engage in farming activities to sustain the household food sources  showed a total of 17 food restrictions were reported by participants and were separated into four groups: i) aquatic animal-fish; ii) animals; iii) plants and iv) processed foods. These food restrictions imposed on women during pregnancy are believed to maintain harmony with natural and spiritual forces and prevent any misfortune or calamity. Fear of complications during labour and childbirth, sawan or convulsions affecting the baby  and twin pregnancy were the key reasons causing the practice of these food taboos. These food taboos practised might lead to an insufficient and imbalanced diet. Most of the traditional avoidance and dietary restrictions have been passed on to Temiar communities for generation and are still prevalent (n = 28) was conducted to establish an understanding of food preparation techniques practised by Jahai sub-tribe. The main cooking methods, including roasting and grilling, frying, simmering and boiling. Cooking oil and water have been the principal cooking medium among Jahai subtribe. Understanding the frequent use of such food preparation methods is important because methods of food preparation have been shown to affect the nutritional quality of food. Nonetheless, the effect of food preparation methods and the food taboos on the nutritional status of the Orang Asli population are important subjects to be explored in future studies (n = 191), reported that the lifestyle changes which unhealthy food habits and low physical activities adopted were observed among Orang Asli due to modernisation and urbanisation. In summary, unhealthy food habits in relation to food taboos, traditional food cooking methods and sedentary lifestyle are affecting the nutritional status among Orang Asli.The food habits and lifestyle practised by the individual are crucial among the Orang Asli population as there is a link between health, nutrition and lifestyle. Adequate and healthy nutrition practices may reduce the risk of becoming sick and less vulnerable to diseases. However, modernisation and urbanisation have brought about a change in Orang Asli food habits and lifestyles that lead to the new age of disease . A totalrevalent . Another studies . Aziz etGiardia duodenalis among aboriginal primary school children and its adverse effects on child growth in Pahang (n = 374) showed that a total of 22.2% of children were found to be positive for Giardia infection. There was a high prevalence of Giardia infection in children < 10 years old of age compared to those > 10 years old of age (27.4% versus 16.0%), but there was no statistically significant difference (P = 0.141). When compared between males (24.6%) and females (20.0%), there is also no statistically significant difference being found. With regards to the nutritional status, the mean weight and height of children among those infected with Giardia were shown to be lower. The mean weight (22.1 kg) of the participants infected with Giardia was lower than the mean weight of the non-infected participants (24.4 kg). Even though the mean height of the participants infected with Giardia (124.9 cm) was lower than the mean weight of the non-infected participants (127.1 cm), there was a statistically significant difference. Therefore, it is suspected that parasite infections contribute to child malnutrition through the progressive reduction of chronic inflammation and nutrient deficiency in digestion and absorption. Acute diarrhoea, malabsorption of fat, vitamins and D-xylose, and lactose intolerance are stated to cause Giardia (n = 341) among Iban tribe communities showed that the overall prevalence of parasitic intestinal infections was 57.5%, generally varied from 33.3% to 100% in all age groups with soil-transmitted helminths infections (50.4%) and protozoan infections (10%). Young children (55.3%) had a higher overall prevalence of infections compared to adults (6.7%). This may be because children were not aware of personal hygiene and good cleanliness practices or were unaware of the possibility of exposure to pathogenic organisms  and deficiency of micronutrients. Among Malaysian Orang Asli, intestinal parasite infections remain a major public health issue where poor environment and sanitation, poor hygiene, unhealthy food habits, overcrowding, low educational achievement and deprivation are prevalent. There are two studies involved in the investigation of these infectious diseases among the Orang Asli population \u201326. The  Giardia . Anothern = 191). Participants from the Lanoh community showed a higher risk of diabetes, which could be due to insulin resistance, compared with other sub-tribes as the high mean level of insulin (176.95 pmol/L) hs-CRP levels (28.02 nmol/L) detected. By using Framingham Online Calculator, the cardiovascular diseases risk score was determined, where 42% of the male in inland have high Framingham risk score (FRS) (21%) and moderate (21%) FRS as compared to males in the periphery (16.7% FRS for each). A high-risk score (4.2%) of FRS was only found in inland among females. The changes in lifestyle and diet due to modernisation and urbanisation have also resulted in the consumption of fast food either inland or periphery among the Orang Asli population, which led to an increased risk of chronic diseases  conducted among the Iban tribe population in Sarawak demonstrated the prevalence of anaemia by assessing the haemoglobin level, given 36.4% of the population with a mean Hb level of 126.0 g/L. The findings also indicated that females (39.8%) are more susceptible to anaemia compared with males (32.9%). The prevalence of anaemia was age-dependent, with a high prevalence recorded for adults 18 years of age and older (55.2%), followed by school children (25.6%) and young children (25.6%). Due to their physiological changes and menstrual blood loss, particularly during reproductive age, females are more likely to be anaemic. This research also illustrated that anaemia was significantly associated with parasitic intestinal infection (P < 0.001). It may be due to the synergistic influence of the species causing blood loss due to hookworm and reduced reabsorption or iron indigestion . Males  showed better regulation of total cholesterol levels than females  concerning lipid profiles. Compared to women who stay at home and live a sedentary life, this tendency can be related to a higher level of male physical activity because they will have to earn or search for family food. Besides, the high percentage of presence of hyperinsulinemia and high hs-CRP levels were reported among all the participants. High insulin levels (> 173 nmol/L) were found in male inland  and periphery . Among the inlanders, female Bateq (50%) and Lanoh (54.55%) were reported to have a higher percentage of undergoes high hs-CRP levels (> 28.6 nmol/L) compared to other tribes. High levels of hs-CRP could be due to obesity that resulted from low physical activity and high intake of fatty foods or high calories meal, as well as a condition like injuries, illness and infections were prone to increase the level of hs-CRP and lead to determine the estimated risks falsely (Metabolic impairment, also known as a metabolic disorder, refers to the abnormal chemical reaction in the body that interferes with the process of metabolism, which causes the body to have either excess or insufficient quantities of essential substances required to remain healthy. One study that is linked to metabolic impairment among the Orang Asli population was found. Aziz et al.  conducteDouble burden of malnutrition is recognised as a public health issues among Orang Asli communities, where modifiable factors including food insecurity, coping strategies, food habits and lifestyle have been demonstrated to impact the nutritional status of the Orang Asli in Malaysia. Food security and its associated risk factors play the major role in securing the nutritional status among Orang Asli communities, in which the initiated changes in lifestyle and dietary behaviour is likely to predispose Orang Asli to have greater exposure to chronic diseases. The findings not only warrant the attention of researchers to explore the underlying risk factor and potential consequences of the co-existence of malnutrition in the aspects of cultural, social, economic and environmental in Orang Asli communities, but also urge for the needs for immediate actions. Comprehensive public health policies and initiatives involving stakeholders at multi-level aiming at nutritional improvement, food environment in terms of accessibility and affordability to quality diet, and nutritional awareness along with socioeconomic and educational empowerment, may potentially to mitigate the issues. Additional efforts should be undertaken to ensure the effectiveness of these policy actions, as well as to consider the sociocultural sensitivity, to simultaneously relieve the Orang Asli malnutrition problem."}
+{"text": "Immune checkpoint blockade (ICB) therapy has brought remarkable clinical benefits to patients with advanced non-small cell lung carcinoma (NSCLC). However, the prognosis remains largely variable.The profiles of immune-related genes for patients with NSCLC were extracted from TCGA database, ImmPort dataset, and IMGT/GENE-DB database. Coexpression modules were constructed using WGCNA and 4 modules were identified. The hub genes of the module with the highest correlations with tumor samples were identified. Then integrative bioinformatics analyses were performed to unveil the hub genes participating in tumor progression and cancer-associated immunology of NSCLC. Cox regression and Lasso regression analyses were conducted to screen prognostic signature and to develop a risk model.Functional analysis showed that immune-related hub genes were involved in the migration, activation, response, and cytokine-cytokine receptor interaction of immune cells. Most of the hub genes had a high frequency of gene amplifications. MASP1 and SEMA5A presented the highest mutation rate. The ratio of M2 macrophages and na\u00efve B cells revealed a strong negative association while the ratio of CD8 T cells and activated CD4 memory T cells showed a strong positive association. Resting mast cells predicted superior overall survival. Interactions including protein\u2013protein, lncRNA and transcription factor interactions were analyzed and 9 genes were selected by LASSO regression analysis to construct and verify a prognostic signature. Unsupervised hub genes clustering resulted in 2 distinct NSCLC subgroups. The TIDE score and the drug sensitivity of gemcitabine, cisplatin, docetaxel, erlotinib and paclitaxel were significantly different between the 2 immune-related hub gene subgroups.These findings suggested that our immune-related genes can provide clinical guidance for the diagnosis and prognosis of different immunophenotypes and facilitate the management of immunotherapy in NSCLC. Non-smaWith rapid advancement of precision medicine, the clinical benefits of checkpoint blockade therapy have rekindled the hope for better outcome of LUAD immunotherapy. Immune checkpoint inhibitors target tumor-specific antigens which are utilized by cancer cells to evade tumor-reactive immune cells. To date, immune checkpoint molecules mainly include programmed cell death protein 1 (PD-1), mucin domain-containing 3 (TIM3), lymphocyte-activation gene 3 (LAG3), and cytotoxic T-lymphocyte antigen-4 (CTLA-4). Antibodies blocking PD1/PDL1 have been approved for clinical use and have received impressive clinical responses in some patients with LUAD . UnfortuAlthough there have been some research findings regarding IRGs and LUAD prognosis, they were focused on single biomarkers and a prognostic model based on IRGs that can systematically assess the prognosis of LUAD patients is not available , 6, 13. In this study, we combined all known IRGs from multiple immunology databases and then performed weighted gene co-expression network analysis (WGCNA) to identify hub IRGs in TCGA-LUAD cases. After that, we evaluated the mutation rate of the hub IRGs and tried pathway and GO enrichment. Then, we evaluated immune cell infiltration by using CIBERSORT and merged the results with hub IRGs for correlation analysis. Next, we selected IRGs associated with the survival outcome of LUAD patients and constructed a gene prognostic model based on Lasso Cox regression. Finally, we clustered hub IRGs in an unsupervised fashion and compared the differences of immune cell infiltration as well as the sensitivity to anticancer drugs in different groups. These could be ultimately used to assist clinicians in prognostic evaluation and therapeutic selection of LUAD patients and to provide further insights into the molecular mechanism of immune-related genes in tumor immune evasion.22.1The overall analysis scheme is illustrated in 2.22 >0.85 (power = 7). Then, the one-step function was used for network construction and detection of consensus modules. Similar modules were clustered and merged in accordance with the threshold of height less than 0.25. Finally, we obtained four modules and associated molecular features with clinical information for predicting outcomes for LUAD patients. The turquoise molecular structure had the strongest association with the prognosis and was selected for further analysis.The WGCNA methodology analysis was performed according to Langfelder\u2019s instructions. We used R package WGCNA 1.69 to identify the crucial immune-related gene modules. The expression matrix was confined to only immune-related genes. The soft threshold was calculated, and the screening threshold was set as R2.3We selected the hub gene from the turquoise module based on the values of GS and MM . Functional enrichment analysis was performed using R package cluster Profiler, and the threshold sets were p-value\u2009<0.05 and q-value <0.2. We also conducted mutational analysis of hub genes, and genes with a mutation rate of more than 5% were exhibited.2.4We used the R package CIBERSORT to evaluate 22 immune cell types in each sample of the LUAD cohort. Samples with p < 0.05 were considered eligible and used for subsequent studies. Kaplan\u2013Meier survival analysis was applied first to explore the prognostic value of tumor-infiltrating immune cells. Then, Pearson\u2019s correlation test was performed to evaluate the correlation between tumor-infiltrating immune cells and the correlation between tumor-infiltrating immune cells and hub genes.2.5In brief, interaction network data were downloaded from RAID and TRRUST databases. LncRNAs, mRNAs, and TFs, which are associated with hub genes, were extracted and introduced into Cytoscape 3.71 to generate the interaction network.2.6The prognostic model was developed in the following steps. First, univariate Cox analysis was used to determine the connection between hub genes and prognosis. Genes with p-value <0.05 were selected. Then, Lasso regression was performed to remove highly correlated genes and build survival models. Patients were divided into high-risk and low-risk groups, and Kaplan\u2013Meier survival curves were plotted. Next, the area under the receiver operating characteristic curves (AUC) at different cutoff values of overall survival time was calculated to evaluate model discrimination. Finally, independent GEO LUAD dataset GSE30219 was used to further validate the prognostic value of our model.2.7http://tide.dfci.harvard.edu) and the R package \u201cpRRophetic,\u201d respectively.We also divided patients into two groups through unsupervised clustering analysis of hub genes. We first compared the survival curves between the two groups. Then, we used a heatmap to show the distribution of tumor immune cell infiltration between the two groups. Finally, we evaluated the efficacy of immunotherapy and drug sensitivity between the two subgroups by using Tumor Immune Dysfunction and Exclusion (TIDE) web application  was found to have the strongest association with the sample feature. This module was selected for further analysis Figure\u00a013.3The GS value and module membership (MM) value of genes in the turquoise module were calculated. There were 280 hub genes screened by the threshold of GS >0.3 and MM >0.5.  enrichment analysis was divided into three categories: Biological Process (BP), Cellular Component (CC), and Molecular Function (MF). The BP enrichment pathway was mainly of regulation of inflammatory response, positive regulation of response to external stimulus, and leukocyte migration. The CC enrichment pathway was mainly of the external side of the plasma membrane, tertiary granule, and secretory granule membrane. The MF enrichment pathway was mainly of cytokine binding, G protein-coupled peptide receptor activity, and cytokine receptor activity. The KEGG enrichment pathway was mainly of cytokine\u2013cytokine receptor interaction, 3.5Samples of lung adenocarcinoma  and lung squamous cell carcinoma  were selected from the cBioPortal database. Mutations were detected in 280 genes. A total of 54 genes had a mutation rate of over 5%. The mutation rate of MASP1 was the highest (22%) according to the gene mutation map, followed by SEMA5A (18%). All the mutational genes in the map were associated with NSCLC  survival curves between the two groups based on the survival data. The results revealed that the high-infiltration group of resting mast cells displayed remarkably better overall survival (OS) than those with low infiltration and the high-infiltration group of activated mast cells and neutrophil displayed remarkably worse OS than those with low infiltration Figure\u00a023.8The Pearson correlation coefficient was calculated between hub genes and infiltrated immune cells. The results suggested that almost all the genes were positively associated with resting CD4+ memory T cells and negatively correlated with T follicular helper cells and activated mast cells Figure\u00a033.9We constructed a regulatory network based on 181 TFs, 144 lncRNAs, and 424 mRNAs, which were interacting with hub genes from different databases Figure\u00a043.10We performed Lasso-penalized Cox regression analysis with cross-validation to pick out nine genes from the 15 candidates. Furthermore, among the nine genes, TRIM58, PDGFB, FPR2, and ANO6 were prognostic risk factors (HR >1), whereas TLR7, PTGDR2, NR3C2, LIFR, and ANOS1 were prognostic protective factors (HR <1). To evaluate the nine-gene prognostic signature, we calculated the risk score for each sample in TCGA according to the expression levels of nine genes weighed by their relative coefficient using the following formula: risk score = PTGDR2*(-0.140) + ANOS1*(-0.115) + LIFR*(-0.091) + TLR7*(-0.052) + FPR2*(-0.026) + NR3C2*(0.020) + PDGFB* (0.090) + TRIM58*(0.127) + ANO6*(0.176). The risk scoring section of each sample was (-0.762\u20131.910), and high-/low-risk groups were divided with the median of risk score as the cutoff , which suggested that the model had favorable efficiency. ROC curves were also applied for the prognosis of samples depending on risk scores. The AUC values of 360d, 540d, 720d, 900d, and 1080d were all above 0.6, whereas the value of 180d was 0.59 Figure\u00a05The GSE30219 dataset was selected as the validation set to further verify the prognostic predictive value of the nine-gene signature. Survival analysis of the validation dataset also showed a significant difference in OS between the high- and low-groups (p = 0.012). The AUC values of 180d, 360d, 540d, 720d, 900d, and 1080d were all above 0.6 according to ROC curves Figure\u00a063.11We employed an unsupervised clustering algorithm to classify the 1,006 samples of NSCLC patients. They were classified into two clusters, cluster1 with 474 samples and cluster2 with 532 samples. The heatmap showed that the expression of hub genes was different in the two subtypes. Survival analysis showed significant differences between the two clusters (p = 0.048)  Figure\u00a073.13An analysis of expression levels for 44 immune checkpoints between the two clusters were performed  Figure\u00a084Lung cancer is the leading cause of cancer-related deaths in the world, with an average 5-year survival rate of 21% . The immBased on the statistical analysis of the whole-genome characteristics, we found a total of 54 mutated IRGs with mutation rate >5% and most of them were amplified in the genome. It is confirmed that tumor mutational burden is associated with improved survival in patients receiving immune checkpoint inhibitors across a wide variety of cancer types. The most frequently mutated IRGs is MASP1 (22%), followed by SEMA5A (18%), which has never been reported previously in NSCLC. MASP1 is an abundant component of the lectin pathway of complement , 15. The2+-activated Cl-ion channels (IRGs have been used to predict the prognosis of NSCLC patients in previous research , 7, 17. channels . The TMEchannels . It has channels . Howeverchannels . LUSC pachannels . On the channels . Thus, tPGD2/PTGDR2 signaling was found to inhibit tumorigenesis, tumor growth, and metastasis in gastric cancer . HoweverInfiltrated immune cells in the tumor microenvironment of lung cancer play a key role in tumor progression and have been widely studied in recent years. In our research, we found that the infiltration degrees of mast cells and neutrophils were associated with prognosis of NSCLC. Mast cells are well known for their roles in allergic disorders . HoweverThe CD4+ memory T cells were constitutively presented in the microenvironment of lung cancer, which could be mobilized by IL-12 to proliferate and kill tumor cells in the xenograft . T folliIn the present study, we identified a novel and independent classification based on the IRG expression profiles. According to research, the patients in cluster2 had a better OS. Interestingly, we found that the proportion of infiltrated immune cells was remarkably different in the two subtypes, especially in resting memory T cells, macrophages M0, and macrophages M2. However, these immune cells mentioned above presented no difference in OS.The therapies for NSCLC, including chemotherapies, targeted therapies, and immunotherapy, have undergone great advancements over the past two decades. Cytotoxic therapies have demonstrated a remarkable effect on early-stage NSCLC, whereas adjuvant cytotoxic therapy with a cisplatin-based doublet is associated with improved survival in patients with resected advanced NSCLC . The staThere are still some limitations to the research. Because of retrospective data gained from public databases, the model needs to be further validated by a larger number of clinical samples. Additionally, bias of expression exists in IRGs, which has been caused by heterogeneity in NSCLC.5The IRGs and the related immune cells may be used to guide prognosis prediction and clinical decisions for NSCLC patients. These findings may be considered as therapeutic targets as well as possible playmakers in the antitumor immune response to newer targeted cancer drugs.The original contributions presented in the study are included in the article/SH, DJ, FZ, KL, KJ, JH, HS, Q-YM, and JW designed the study. SH, DJ, FZ, KL, KJ, and JH analyzed the data; SH, DJ, FZ, HS, Q-YM, and JW wrote the manuscript. All authors contributed to the article and approved the submitted version."}
+{"text": "Blood and urine samples and all the kidney remnants were collected for analysis. Additionally, THP-1 cells were used to explore the mechanism through which SM attenuates renal inflammation. Compared with the sham group, the 5/6 Nx ApoE\u2013/\u2013 mice exhibited a significant increase in the macrophage infiltration of the kidneys (nephritis), upregulation of IL-1\u03b2, generation of reactive oxygen species, reduced creatinine clearance, and renal fibrosis. However, the administration of SM significantly alleviated these effects. SM suppressed the H2O2-induced secretion of IL-1\u03b2 from the THP-1 cells via the heme oxygenase-1-induced inhibition of the IKK\u03b1-NF-\u03baB pathway. SM attenuated renal inflammation and arrested macrophage accumulation by inhibiting IKK\u03b1, revealing a novel mechanism of the therapeutic effects of SM on renal injury and offering a potential approach to CKD treatment.Chronic nephritis leads to irreversible renal fibrosis, ultimately leading to chronic kidney disease (CKD) and death. Macrophage infiltration and interleukin 1\u03b2 (IL-1\u03b2) upregulation are involved in inflammation-mediated renal fibrosis and CKD. Sesamol (SM), which is extracted from sesame seeds, has antioxidant and anti-inflammatory properties. We aimed to explore whether SM mitigates macrophage-mediated renal inflammation and its underlying mechanisms. ApoE Chronic nephritis leads to an irreversible reduction in the glomerular filtration rate and renal fibrosis, ultimately leading to chronic kidney disease (CKD) and end-stage renal disease (ESRD). The infiltration of the glomerular and interstitial macrophages is a hallmark of CKD that plays a crucial role in renal injury . After kThe NF-\u03baB signaling pathway is highly activated in inflammatory diseases. It is accompanied by the recruitment of inflammatory cells and the production of proinflammatory cytokines, such as IL-1, IL-6, IL-8, and tumor necrosis factor-alpha (TNF-\u03b1) . The I\u03baB2O2), a major endogenous ROS, is a destructive molecule that is widely used to mimic ROS in in vitro studies [Reactive oxygen species (ROS) are critical mediators of the activation of proinflammatory signaling pathways . Therefo studies .Heme oxygenase-1 (HO-1) is a cellular defense mechanism activated by oxidative stress and other stimuli. It also has antioxidant and anti-inflammatory properties. Unilateral ureteral obstruction caused more severe fibrosis in HO-1 knockout mice. Furthermore, macrophage infiltration was increased in HO-1-deficient mice, as measured by the expression of F4/80 . HO-1 isSesamum indicum) seeds and sesame oil and is continuously decomposed by sesaline and other substances during thermal processing. SM has a potent antioxidant capacity [\u2013/\u2013 nephrectomy mice [Sesamol (SM), 3,4-methylenedioxyphenol, is a lignan compound and an important aromatic component of sesame oil . SM is pcapacity , as wellcapacity ,27. SM romy mice .In this study, we investigated the protective effects of SM on a 5/6 nephrectomized (5/6 Nx) mice model. In particular, we examined the influences of SM on macrophage infiltration and inflammatory mediators. Our study provides a novel mechanism of the action of SM in the prevention and treatment of renal fibrosis.\u22121 penicillin and streptomycin and 10% fetal bovine serum . Sesamol SM , dimethyl sulfoxide (DMSO), phorbol 12-myristate 13-acetate (PMA), and H2O2 solution were purchased from Sigma . IKK\u03b1 siRNA (si-IKK\u03b1) and control siRNA (si-Ctl) were procured from Santa Cruz Biotechnology .The Tohoku Hospital Pediatrics-1 (THP-1) cell line was purchased from the American Type Culture Collection . THP-1 cells, a human leukemia monocytic cell line, were maintained in RPMI-1640 medium  supplemented with 25 U mL\u2013/\u2013 mice  aged 10\u201312 weeks (weighing 21\u201323 g) underwent 5/6 nephrectomy (5/6 Nx), the complete removal of the right kidney, and the infarction of approximately 2/3rd of the left kidney by ligating part of the renal artery branch. Female mice were used owing to their small glomerular sieving structure [\u2013/\u2013 mice, as a dyslipidemia animal model, that underwent 5/6Nx easily accumulated a greater number of immune cells in the kidneys, making them ideal for studying kidney inflammation. Throughout the study, the mice were fed on a regular diet. The mice received SM (25 or 50 mg/kg) via oral gavage thrice per week for eight weeks after 5/6 Nx surgery. All the mice were euthanized by isoflurane  inhalation.All the mouse experiments were approved by the Institutional Animal Care and Use Committee of China Medical University and performed in accordance with the National Institutes of Health Laboratory Animal Care and Use Guidelines . Female ApoEtructure , which iWe separated the plasma from the whole blood and then removed the platelets from the plasma by centrifugation . The test paper and plasma (150 \u03bcL) were then placed in an automatic clinical chemistry analyzer  according to the manufacturer\u2019s instructions.The kidney tissues were embedded in paraffin and sliced into 3 \u00b5m-thick sections. The slides were stained with hematoxylin and eosin , antibodies, or Masson\u2019s trichrome stain (Sigma). Images were captured using a DM750 microscope  and analyzed using the ImageJ software .4 THP-1 cells were inoculated on 96-well plates for the cell viability assessment. PMA was added for 48 h to render the cells adherent, after which the medium was changed to a fresh medium for 24 h. The cells were treated with H2O2 (0\u201330 \u00b5M) or SM (0\u201320 \u00b5M) for 24 h. Subsequently, the cells were incubated with 10% WST-1 reagent (Abcam) in a fresh medium at 37 \u00b0C for 4 h. The absorbance of each sample at 440 nm was measured using a microplate reader . The percentage of each sample was calculated after normalizing all the data to those of the corresponding controls.For this assay, 1 \u00d7 104) were inoculated on 96-well plates, and PMA was added to render cells adherent for 48 h, after which the medium was changed to fresh medium for 24 h. The THP-1 cells were treated with H2O2 (0\u201330 \u00b5M) for 24 h. Subsequently, the supernatant was removed, and the cells were washed with phosphate-buffered saline (PBS). The 2\u2032,7\u2032-dichlorofluorescein diacetate (DCFH-DA) ROS-specific stain was then added, and the cells were incubated in the dark at 37 \u00b0C for 30 min. The cells were then washed twice with PBS. The intracellular levels of ROS were determined using an Infinite M1000 microtiter plate reader (TECAN) .The intracellular levels of ROS were determined using a cellular ROS/superoxide detection assay kit (Abcam) according to the manufacturer\u2019s instructions. The cells  alone, or H2O2 after an SM (2 \u00b5M for 1 h) pretreatment. To obtain protein extracts, the cells were lysed and homogenized in RIPA lysis buffer in the presence of protease inhibitors . After centrifugation, the protein concentration was determined using a BSA protein assay kit . For the immunoblot assays, 20 \u00b5g of cell lysate was loaded onto 12% SDS-PAGE gel per well and separated by electrophoresis. The separated proteins were transferred to Hybond-PVDF membranes . The membranes were blocked with blocking buffer for 1 h at 25 \u00b0C, incubated overnight at 4 \u00b0C with primary antibodies (1:1000), and finally incubated with appropriate secondary antibodies (1:5000). The primary antibodies used included anti-p-IKK\u03b1  and anti-IKK\u03b1  , anti-p-NF-\u043aB  and anti-p-I\u043aB\u03b1  , anti-HO-1 , and anti-\u03b2-actin . \u03b2-actin was used as the loading control. The protein expression was evaluated using an ECL reagent . Images were obtained using quantitative video densitometry .THP-1 cells were seeded on six-well plates at a density of 1 \u00d7 106\u2009cells per well and stimulated with PMA for 48 h. The medium was replaced with fresh medium supplemented with 20% FBS without antibiotics. The control and IKK\u03b1-siRNA  were prepared at a final concentration of 10 nM, following the manufacturer\u2019s instructions. The control and IKK\u03b1-siRNA and the siRNA transfection reagent  were mixed for 10 min and then transfected into the cells for 12 h. H2O2 was then added to stimulate the cells.The cells were inoculated on six-well plates at approximately 5 \u00d7 106 cells/well on 6-well plates and treated with different stimuli. For the in vivo experiments, the murine renal tissues were homogenized. All the samples were collected and frozen with NucleoZOL  at \u221280 \u00b0C, and total RNA was isolated and extracted by centrifugation according to the manufacturer\u2019s instructions. The iScript cDNA Synthesis Kit  was used to synthesize the cDNA. Finally, the Q SYBR Green Supermix (Bio-Rad) was used for the real-time PCR. The primers used are listed in THP-1 cells were seeded at a density of 1 \u00d7 10https://www.rcsb.org/) for the first step of the docking simulation. The docking of IKK\u03b1 and HO-1 with the protein catalytic sites was evaluated using BIOVIA Discovery Studio .The crystal structures of IKK\u03b1  were obtained from the Protein Data Bank  was assessed by one-way ANOVA for multiple groups and Student\u2019s t-test using the GraphPad Prism 5 software .The results are presented as the mean \u00b1 standard error of the mean (SEM) for each repeated experiment. Statistical significance (\u2212/\u2212 mice and established a CKD mouse model (p < 0.01). We observed that SM reduced inflammation, with a decrease in the number of nucleated cells. The representative optical microscopy images showed glomerular lipidosis, which was characterized by dilated glomerular capillary loops containing foam cells and cholesterol accumulation in the 5/6 Nx group (p < 0.001). Furthermore, we observed that the mice in the SM group exhibited an enhanced reduction in the Masson\u2019s trichrome-stained positive area compared with that of the 5/6 Nx mice (We performed 5/6 nephrectomy (5/6 Nx) on the ApoEse model A. In addse model B. After se model C\u2013E. We oNx group F. In addNx group F. Masson Nx mice G. These p < 0.001). In contrast, the number of macrophages was significantly reduced in the kidneys of the mice to which SM was administered compared with that of the mice that received 5/6 Nx alone (p < 0.05). This showed that SM resulted in a lowered infiltration of macrophages in the kidneys. Moreover, we tested the ability of P-IKK\u03b1 to induce the infiltration of macrophages into inflamed tissues. We observed that the expression of IKK\u03b1 was significantly increased in the 5/6 Nx group compared with that in the sham group (p < 0.001). However, it was decreased in the 5/6 Nx group treated with SM. In addition, we also calculated the expression level of IL-1\u03b2. We observed that IL-1\u03b2 expression was increased in the 5/6 Nx group, whereas it was reduced in the SM-treated group  macrophages in the kidneys and quantified the number of infiltrating F4/80+ macrophages. We observed that 5/6 Nx led to strong F4/80+ macrophage infiltration in the kidneys (ed group C.p < 0.01). Notably, SM ameliorated the increase in the levels of renal MDA in the 5/6 Nx ApoE\u2212/\u2212 mice (p < 0.01). In contrast, the levels of GPx were increased in the SM group , an indicator of lipid peroxidation, to confirm the observed levels of ROS . We foun\u2212/\u2212 mice D. MoreovSM group E. These \u2212/\u2212 mice. After euthanasia, the whole blood was separated to obtain plasma, and we performed biochemical analyses (p < 0.05). Furthermore, we detected a downward trend in the high-density lipoprotein cholesterol (HDL-C) levels (p < 0.05) in the 5/6 Nx mice compared with that of the sham mice. However, SM reduced the levels of blood triglyceride, total cholesterol, and LDL-C (p < 0.05) and increased those of HDL-C (p < 0.05) in the 5/6 Nx mice. We further noticed that the blood glucose level was significantly decreased in the high-dose SM-treated group (p < 0.05). In addition, compared with the sham group, the 5/6 Nx group exhibited increased levels of plasma MDA (p < 0.05). In contrast, the levels of plasma MDA in the SM groups were lower than those in the 5/6 Nx group. These results implied that uncontrolled levels of blood lipids result in high levels of ROS during the progression of chronic renal disease that can be conversely blocked by SM.Abnormal levels of blood lipids and lipid peroxidation have been shown to play a significant role in the progression of inflammation-mediated CKD . Therefoanalyses A\u2013E. We o) levels C. In con2O2. The THP-1 cells were differentiated into macrophages using 25 ng/mL PMA for two days and fresh medium for one day. The WST-1 assay was conducted to examine the viability of the H2O2-injured THP-1 cells. The data showed that H2O2 reduced the THP-1 cells\u2019 activity in a concentration-dependent manner, and the half maximal inhibitory concentration of H2O2 was about 5 \u03bcM (p < 0.01). Next, we observed that H2O2 induced the release of intracellular ROS in the THP-1 cells (p < 0.05). In addition, we demonstrated that the ROS induced the expression of IL-1\u03b2 in the H2O2-primed THP-1 cells in a concentration-dependent manner (p < 0.05). After confirming the dosage of H2O2, we used a dose of 5 \u00b5M H2O2 for the following experiments. Next, we assessed the role of IKK\u03b1 in the ROS-induced secretion of IL-1\u03b2 in the macrophages. We administered the siRNA-targeting scrambled sequence or IKK\u03b1 (siIKK\u03b1) to the cells for 12 h and then stimulated them with H2O2 for another 24 h. We added BMS345541 (an IKK\u03b1 and IKK\u03b2 inhibitor) 1 h prior to H2O2, which served as a positive control. We noticed that the stimulation of the THP-1 cells with H2O2 increased the expression of IL-1\u03b2, whereas the knockdown of IKK\u03b1 by siIKK\u03b1 or its pharmacological inhibition by BMS345541 decreased the expression of IL-1\u03b2 in the THP-1 cells (p < 0.05). In contrast, siCtrl blockade did not affect the H2O2-stimulated THP-1 cells. These findings indicated that IKK\u03b1 plays a pivotal role in the expression of IL-1\u03b2 in THP-1 cells. We also observed that the THP-1 cells exhibited the phosphorylation of IKK\u03b1, I\u043aB\u03b1, and NF-\u043aB (p65) upon their stimulation with H2O2 (p < 0.05). We observed that most of the remaining THP-1 cells after siIKK\u03b1 blockade had a lower expression of IL-1\u03b2, suggesting that reduced cellular inflammatory events were associated with IKK\u03b1 blockade. Therefore, the inhibition of IKK\u03b1 might represent a promising anti-inflammatory treatment strategy.To verify whether ROS directly influence the macrophages, we treated phorbol-myristate-acetate (PMA)-induced THP-1 cells with Hith H2O2 E. Notabl2O2-stimulated THP-1 cells. We administered SM for 1 h and then stimulated the cells with H2O2 for the following 24 h. We did not observe any SM-induced cytotoxicity at a concentration of 20 \u03bcM in the WST-1 assay (p < 0.05). In addition, the expression of IL-1\u03b2 was significantly inhibited by SM compared with that in the H2O2-treated THP-1 cells (p < 0.01). We also observed higher phosphorylation levels of IKK\u03b1, I\u043aB\u03b1, and p65 in the H2O2-treated THP-1 cells. In contrast to the H2O2 treatment, the administration of SM reduced the phosphorylation of IKK\u03b1, resulting in lower levels of p-I\u043aB\u03b1 and P-p65 (p < 0.01). Moreover, when the macrophages were exposed to H2O2, they displayed a significant inflammatory response, as evidenced by their expression of IL-1\u03b2. In particular, we found that the expression of IL-1\u03b2 was substantially reduced in the presence of SM (p < 0.05). In contrast, SnPP  abolished the anti-inflammatory effect of SM on the H2O2-induced THP-1 cells. To test whether HO-1 has the potential to inhibit IKK\u03b1-mediated inflammation, we performed molecular docking simulations to predict the activation and binding affinities of HO-1 in IKK\u03b1 inhibition  to the renal tissues, leading to the increased formation of foam cells and increased production of ROS, which cause inflammation and fibrosis in the kidneys, resulting in CKD. However, SM was shown to arrest this process via an increase in the levels of HO-1, which led to the inhibition of IKK\u03b1 in the macrophages  in mice mimics renal failure after the loss of kidney function in humans, exacerbates renal injury through inflammation and oxidative stress, and has been widely used in CKD research . In thisrophages .\u2212/\u2212 mice, and this infiltration was ameliorated by SM.Inflammation is closely related to renal disease and can be defined as a complex network of interactions between renal parenchymal cells and resident immune cells, including macrophages, dendritic cells, circulating monocytes, lymphocytes, and neutrophils. The kidney harbors various resident immune cells that play crucial roles in maintaining tissue homeostasis. These cells produce inflammatory mediators that initiate kidney disease and concomitantly trigger a regulatory response to curb inflammation, repair damaged tissue, and restore homeostasis. Inflammation plays a vital role in the progression of chronic renal failure. Excessive inflammation activates the white blood cells, leading to the production of cytokines related to splenomegaly. The inflammatory responses in each group of mice were compared by calculating the size of the spleen (data not shown). In this study, we observed that nucleated cells infiltrated the kidneys of the 5/6 Nx ApoE\u2212/\u2212 5/6 Nx mice.Renal fibrosis is the final critical common pathway in the progression of renal diseases. Renal fibrosis has been associated with inflammatory cell infiltration, tubular atrophy, and the loss of peritubular or glomerular capillaries, during which a sustained inflammatory process might result in substantial tissue damage, eventually leading to fibrogenesis ,12. Ther\u2212/\u2212 mice. This situation was improved after the oral administration of SM. Moreover, we assessed the levels of MDA to analyze the production and levels of ROS. The levels of ROS were increased in the ApoE\u2212/\u2212 mice with 5/6 Nx, which presented higher levels of triglycerides, total cholesterol, and LDL-c in the plasma and a higher inflammatory response in the kidneys. Regarding the reduction in glomerular lipid deposition in the 5/6 Nx mice after the SM treatment, we found that SM protected the tissue against ROS damage and improved glomerular damage attributed to ROS as the main inflammatory factor. Lipids promote the recruitment of immune cells, such as macrophages, neutrophils, and bone-marrow-derived dendritic cells, to the tissues. In patients with kidney disease, the inflammatory response was caused by an increase in the levels of triglyceride-rich lipoproteins, and patients on hemodialysis had significantly lower inflammation and levels of lipoprotein variables than patients with CKD [CKD is associated with dyslipidemia, including high levels of triglycerides, low levels of HDL cholesterol, and an altered lipoprotein composition . Increaswith CKD . These f2O2, which increased the expression of IL-1\u03b2, promoted inflammation. Conversely, this effect was inhibited by incubating the THP-1 cells with siIKK\u03b1 or BMS345541 (an IKK inhibitor). Furthermore, considering that the inhibition of IKK\u03b1 by siIKK\u03b1 might affect the transcription and translation of IKK\u03b2, we examined the protein expression of IKK\u03b2 and found that it was not affected. In addition, we also found that p-IKK\u03b1 and the total IKK\u03b1 were both elevated in the H2O2-induced cells. Another article also found similar results [2O2 induced the expression of IL-1\u03b2 in the THP-1 cells via the IKK\u03b1/NF-\u043aB signaling.Macrophages, which are monocyte-derived phagocytic cells, are located in peripheral tissues and act as important mediators of inflammation and immune modulation . They ar results . These rAs mentioned previously, research on the benefits of exploiting drug mechanisms in kidney disease is still lacking. In this study, we found that SM diminished the expression of IL-1\u03b2 by inducing the expression of HO-1 and inhibiting the IKK\u03b1 pathway. Furthermore, we confirmed the inhibitory effect of HO-1 on the IKK pathway by assessing the protein-binding site. In addition, although we did not explore fibrosis-related proteins, the findings of Masson\u2019s trichrome staining were consistent with some studies reporting a synergistic role of IL-1\u03b2 in renal fibrosis. Therefore, we concluded that sesame oil and nutritional supplements containing SM might be used to reduce the burden on the kidney function. In view of its safety, low price, and wide availability, SM can serve as a potential therapeutic agent for the treatment of kidney disease. However, more studies are required to determine the efficacy and safety of SM for patients with CKD.\u2212/\u2212 mice that underwent 5/6 Nx and did not receive the SM treatment accumulated a greater number of immune cells in the kidneys, indicating the formation and transportation of an increased number of foam cells in the blood, thus promoting glomerular lipid deposition. Foam cells are encountered in common glomerular diseases, such as focal and segmental glomerulosclerosis and diabetic nephropathy, but their pathogenic significance remains unknown. Extrapolating from studies on atherosclerosis, we can observe that therapeutics targeting the production of mitochondrial ROS or modulating cholesterol and lipoprotein uptake or their egress from these cells might prove beneficial for the treatment of kidney diseases in which foam cells are present. Secondly, different macrophages reflect different physiological roles in kidney disease. Thus, further understanding of the influences of specific subpopulations of macrophages will be helpful for the development of treatment strategies for kidney diseases. Furthermore, several studies have analyzed specific markers of each immune cell, which is a more accurate measurement method. However, this was another limitation of our study. Therefore, in future studies, the immune system should be thoroughly investigated to clarify the role of each component in kidney diseases. Thirdly, HO-2 is a factor affecting macrophage polarization and phagocytic activity in inflammation. Namely, HO-2 deficiency impairs HO-1 expression and inducibility in the macrophages [This study had some limitations. Inflammation and lipids play significant roles in the progression of CKD. Macrophages take up lipids and readily form foam cells. The ApoErophages . In otherophages . Howeverrophages . Thus, oIn summary, our results highlighted that IKK\u03b1 is a central regulator of the macrophages during inflammation in CKD. In addition, we demonstrated that SM treatment increased the levels of HO-1 and inhibited the ROS-induced IKK\u03b1 signaling in the macrophages during inflammation in vitro and in vivo and, thus, might be beneficial for patients with CKD."}
+{"text": "A data commons is a cloud-based data platform with a governance structure that allows a community to manage, analyze and share its data. Data commons provide a research community with the ability to manage and analyze large datasets using the elastic scalability provided by cloud computing and to share data securely and compliantly, and, in this way, accelerate the pace of research. Over the past decade, a number of data commons have been developed and we discuss some of the lessons learned from this effort. In this article, we discuss the role of software platforms called data commons in supporting the fourth paradigm of science and some lessons learned from ten years of experience developing and operating data commons.Since the end of the 16th century, experimental science has been\u00a0driven by conducting experiments, collecting data, and analyzing it. With the development of low cost sensors, high throughput instruments, and inexpensive storage to hold the data they produce, a new paradigm for scientific discovery has emerged. The The Tragedy of the Commons2 that focused attention on problems arising when a shared finite resource is used by a community. The governance structure is critical. About forty years later in 2009, Elenor Ostrom received the Nobel prize in Economic Sciences3 for her work about the governance of the commons4.As we will describe below, a data commons is a shared resource to support a scientific community. Some of the challenges with shared resources were identified in 1968 when Joseph Hardin published an article in Science called the commons as a natural, cultural or digital resource accessible to all members of a community, or more broadly of a society. Importantly, a commons is held through a partnership, a not-for-profit, or other entity, for the benefit of a community, but not owned privately for commercial gain4.Following Ostrom, we define a data commons as a software platform that co-locates: 1) data, 2) cloud-based computing infrastructure, and 3) software applications, tools and services to create a governed resource for managing, analyzing, and sharing data with a community5. Briefly, a data commons is a cloud-based software platform with a governance structure that allows a community to manage, analyze and share its data. We discuss some of the differences between data commons and data repositories towards the end of the paper.For the purposes here, we view a data mesh is a collection of data commons, cloud-based computational resources, and other cloud-based resources that interoperate using a common set of core software services and a hybrid governance model.A related concept is a data mesh . A 6, the NHLBI BioData Catalyst data platform , the NHGRI Genomic Data Science Analysis, Visualization and Informatics Lab-space (AnVIL)7, the NIH Common Fund Data Ecosystem8, the All of Us Research Hub9, the Australian Research Data Commons10, the Elixir Data Platform11, the BloodPAC Data Commons12, the NIBIB Medical Imaging and Data Resource Center (MIDRC)13, the Veterans Precision Oncology Data Commons14, and the NIH Kids First Data Resource (https://kidsfirstdrc.org/).Examples of data commons and similar platforms include: the NCI Genomic Data Commons (GDC)The functionality is compelling. Modern cloud computing provides elastic, on-demand, pay-as-you-go computing that can be used to provide compelling functionality in a data commons and accelerate research over the data in the commons. In particular, although there is a learning curve, cloud computing can manage large data , provide large scale compute, and provide specialized scalable services for querying and analyzing data. More generally, data commons can make important data and its interactive exploration more widely available to the scientific community, including to less technically sophisticated users. The most important reason for building a data commons is that the functionality provided by a data commons is compelling.To speed the pace of research discoveries. By having the commons curate and processes the data once for a particular research community, it enables individual researchers and research groups to proceed more quickly to analyzing data to investigate particular hypotheses, since each group doesn\u2019t have to curate the data, process the data with a uniform set of pipelines, and quality check the results. This work can be done once by the commons.To create network effects. Another reason to build data commons is be part of a larger data ecosystem or data mesh containing multiple commons, computing platforms, and knowledgebases in order to take advantage of network effects as more commons are built and more users access data from the resources in the mesh. As an example, a commons in a data mesh can participate in federated machine learning with other commons and data resources via its APIs, while adhering to its governance, security and privacy policies.To host data that is too large to be managed easily by research groups. As the size of the data grows, it becomes more and more difficult for each research group to develop and operate their own computing infrastructure. A data commons is often used to manage the large experimental data and process it to produce derived datasets that are easier to analyze by individual scientists and research groups.To reduce cost. Funds for science are always limited and tough choices must be made. By investing in a centralized commons, the cost for managing, curating and processing data to produce data products for a research community can be done once centrally to reduce the overall costs of a research program or initiative. In practice, with very large datasets, the cost of funding each research group to build their own data platform can be so high that the only practical way to distribute the data to the research community is through a centralized data commons.7.Although, it can be more expensive to store data in the cloud than on premise, as the size of the data increases, as the number of different groups using the data increases, and as the percent of the data needed by research groups increases, having a single copy of the data in the cloud is less expensive for the sponsor than separately funding each research group to manage the data separately. Another consideration affecting costs are any egress charges when transferring data out of public clouds. For large datasets that are downloaded by a large number of users, these can be expensive. For this reason, it can be useful to provide copies of large datasets in private clouds where the egress charges may be much less. This is done, for example, in the AnVIL data platform for selected datasetsTo protect sensitive data. Sometimes data commons are built because research data is so sensitive that it must be protected within an\u00a0enclave for it to be safely shared. Examples include the All of Us Research Hub9 and the Veterans Precision Oncology Data Commons14. For example, the data may be in a commons and not available to researchers directly but only through specific integrated software applications (software as a service) that are designed to protect the confidentiality of the data or through virtual desktop infrastructure which restricts the ability to download or otherwise access the data.There are several main reasons research projects build data commons.15, have made petabytes of curated, harmonized data availability to a research community and \u201cdemocratized access to cancer genomics data,\u201d which until the launch of the GDC in 2016 was available only to the largest research organizations that had the resources and expertise to analyze petabyte scale data. With the GDC and its open APIs16, researchers could access the GDC\u2019s data products in cloud computing environments or on their own local resources for further analysis or integrative studies.As an example, data commons, such as the NCI Genomic Data Commons17 has made developing data commons and data meshes much easier. Today, cloud computing is the key technology that has enabled the current generation of data commons.The emergence and adoption of cloud computing over the past decade18, the amount of well-curated, harmonized data is often not noted. This creates a \u201cdata gap\u201d that impedes research. Data commons are designed in part to close this gap and allow research communities to create curated, harmonized data sets to accelerate their research.Although the large and increasing amount of data being generated in biology, medicine and healthcare is well documented15. As reported in6, the GDC contains over 2.9 PB of curated, harmonized cancer genomics data from over 60 projects (as of February 2021). Each month over 50,000 unique researchers use the system and over 1.5 PB of data are accessed6. As a rough measure of its popularity, the membership of the American Association of Cancer Research is about 50,000.One of the more popular data commons is the NCI Genomic Data Commons15. In contrast, it is typical to bring together cancer genomics data from different projects that are analyzed by different groups using different pipelines, which can make subsequent integrative analysis much more challenging and problematic. The GDC has a user interface that enables interactive graphical exploration of the data, with the ability to download publication quality graphics.The data from the different projects is curated with respect to a single data model and each month on average over 25,000 bioinformatics pipelines are run over the data to create a harmonized set of data products that are analyzed with a common set of bioinformatics pipelinesPerhaps the most important reason for its popularity is that the GDC makes it easy for researchers to access its data and make new research discoveries with much less effort than if they were to analyze the raw data themselves, as it usually required with a traditional data repository.The GDC lists over 100 high impact publications that have been written using the data products it makes available to the cancer genomics research community.Although there are a few data repositories that serve the general scientific community that have proved successful, in general data commons that target a specific user community have proven to be the most successful. The first lesson is to build a data commons for a specific research community that is struggling to answer specific research challenges with data. As a consequence, a data commons is a partnership between the data scientists developing and supporting the commons and the disciplinary scientists with the research challenges.Successful commons curate and harmonize the data and produce data products of broad interest to the community. It\u2019s time consuming, expensive, and labor intensive to curate and harmonize data, by much of the value of data commons is centralizing this work so that it can be done once instead of many times by each group that needs the data. These days, it is very easy to think of a data commons as a platform containing data, not spend the time curating or harmonizing it, and then be surprised that the data in the commons is not used more widely used and its impact is not as high as expected.Despite the importance of a study, few scientists will try to replicate previously published studies. Instead, data is usually accessed if it can lead to a new high impact paper. For this reason, data commons play two different but related roles. First, they preserve data for reproducible science. This is a small fraction of the data access, but plays a critical role in reproducible science. Second, data commons make data available for new high value science.A useful rule of thumb is that every barrier to data access cuts down access by a factor of 10. Common barriers that reduce use of a commons include: registration vs no-registration; open access vs controlled access; click through agreements vs signing of data usage agreements and approval by data access committees; license restrictions on the use of the data vs no license restrictions.The largest costs of developing and operating a data commons are: i) the costs of data curation and data harmonization; and, ii) the costs of developing easy to use, interactive front ends for exploring and analyzing the data.The most successful commons have open APIs, enabling the community to build utilities, libraries, and tools make the data usable and accessible.The policies, procedures and controls required for security, compliance, and regulatory support are expensive and time consuming to develop and to operate and, in almost all cases, are underfunded.19. This might lead one to advocate saving operational costs by only hosting the more popular datasets. On the other hand, over the long term, interesting, and sometimes, quite interesting, new science may result from further use and analysis of the less popular datasets.Some datasets in a commons tend to be very frequently downloaded, with others much less frequently downloaded, and with the distribution following a Zipfian or other power law distributionData commons, at least as we have defined them here, are designed to support a particular research community. In contrast, a data mesh  is a hybrid architecture, consisting of some common services that enable a collection of independently managed and governed data platforms to interoperate.It is tempting when building a data platform or data commons to take the attitude that everyone should contribute data to your platform, but there is not a good reason, and only risk, if you enable your data to leave your system. As an alternative, if data access needs to be restricted, consider developing trust relationships with other data platforms and sharing data and interoperating with them.traditional data repositories in several ways. First data commons have FAIR APIs20 for discovering and accessing the data they manage (versus user interfaces for downloading data) and have integrated tools for exploring and analyzing data. Of course, more recent data repositories are increasingly being built with FAIR APIs. Also, data commons curate the data submitted to them and in some cases harmonize it by analyzing it with a common set of analysis tools.Data commons differ from 21, we define as a \u201cweb-based enterprise information systems that provide scientists with customized and easy access to community-specific data collections, computational tools and collaborative services on e-Infrastructures.\u201d Historically, a science gateway was a web-based portal that brought together data, computational and other resources for a scientific community. These days, science gateways tend to be cloud-based with FAIR APIs. See Fig.\u00a0A related concept is a science gateway or virtual research environment, which following the definition in23, tend to integrate a wider variety data and computational resources and serve a much broader range of scientific communities.Science and data clouds, such as the European Open Science CloudLarge datasets are now prevalent throughout almost all areas of scientific research and cloud computing is increasingly being used to manage and analyze the resulting data. A data commons is a cloud-based computing resource with a governance structure that allows a community to manage, analyze and share its data.Data commons have emerged in part to address the data gap\u2009\u2013\u2009the gap between the large amount of data available and the small amount of data that can be easily used to formulate new hypotheses, to make new discoveries, and to build machine learning and AI models.Despite, the availability of raw generated data and large scale cloud computing infrastructure, science remainsdata limited, since the available data needs to be carefully curated and harmonized before it is useful. Commons support this important activity so that research questions can be more efficiently tackled by a research community.This point is worth emphasizing. 24 that enable data meshes (data ecosystems) consisting of multiple data commons, cloud-based computing platforms, knowledgebases, and other resources to interoperate. The hope is that making data also available through interoperating with data meshes will further accelerate the pace of research.Looking towards the future, a core set of microservices are emerging"}
+{"text": "The cerebellum plays a major role in balance, motor control and sensorimotor integration, but also in cognition, language, and emotional regulation. Several neuropsychiatric disorders such as attention deficit-hyperactivity disorder (ADHD), autism spectrum disorder (ASD), as well as neurological diseases such as spinocerebellar ataxia type 3 (SCA3) are associated with differences in cerebellar function. Morphological abnormalities in different cerebellar subregions produce distinct behavioral symptoms related to the functional disruption of specific cerebro-cerebellar circuits. The specific contribution of the cerebellum to typical development may therefore involve the optimization of the structure and function of cerebro-cerebellar circuits underlying skill acquisition in multiple domains. Here, we review cerebellar structural and functional differences between healthy and patients with ADHD, ASD, and SCA3, and explore how disruption of cerebellar networks affects the neurocognitive functions in these conditions. We discuss how cerebellar computations contribute to performance on cognitive and motor tasks and how cerebellar signals are interfaced with signals from other brain regions during normal and dysfunctional behavior. We conclude that the cerebellum plays a role in many cognitive functions. Still, more clinical studies with the support of neuroimaging are needed to clarify the cerebellum\u2019s role in normal and dysfunctional behavior and cognitive functioning. MoreoveHere, we review literature on the anatomy and physiology of the cerebellum, and the neurocognitive functions of three conditions that have been linked to cerebellar function: SCA3, ADHD, and ASD. SCA3 is a neurological disease where cerebellar degeneration is clearly and robustly demonstrated, ADHD and ASD are neuropsychiatric disorders that have been associated with cerebellar abnormalities, but the extent of cerebellar involvement is not as pronounced as in the case of SCA3 . We seleWe attempt to link these findings to contemporary theories and models of the cerebellum, and we discuss how symptoms may arise from interactions between the cerebellum and other brain parts that influence cognitive functions. We then discuss potential clinical implications from knowledge about the cerebellum\u2019s involvement in cognitive functions. A cerebellar-dependent neuropsychological test battery could be a valuable tool in the diagnostic process when data from medical examinations such as biomarkers and neuroimaging data are missing or are unclear. This could lead to an improved understanding of the neurocognitive functions of these patient groups, and, ultimately, better treatment.We performed a literature search in two electronic databases: PubMed and Embase. Through these searches, we identified articles supplying information on the neurocognitive profile, neurocognitive functions, and cerebellar functions of patients with three specific diagnoses ADHD, ASD, and SCA3.Original articles and chapters reporting relevant studies on humans and animals were included. We used terms such as \u201cADHD,\u201d \u201cASD,\u201d and \u201cSCA3\u201d coupled with terms related to the cerebellum, cerebellar functions and to neurocognitive domains and neurocognitive profiles, such as \u201ccognition,\u201d \u201cintelligence,\u201d \u201cvisual perception/construction,\u201d \u201cprocessing speed,\u201d \u201csensorimotor integration,\u201d \u201cexecutive function,\u201d and \u201cmemory.\u201dvia corticopontine projections  contains 80,2% of all neurons in the human brain as well as 19% of all the non-neural cells in the brain . The antjections . The posjections . The cerjections .via oligosynaptic loops  nucleus projects mainly to the brainstem and spinal cord; the interposed (comprising the emboliform and globose) nucleus targets mainly the midbrain and the thalamus; and the lateral (dentate) nucleus projects mainly to the thalamus. Some neurons in the cerebellar nuclei project directly to the red nucleus, which then projects to other nuclei that control muscles. This is how the cerebellum can elicit blink responses even in the absence of the cortex  shows cerebellar activation during many cognitive, affectional, and social tasks in healthy participants, although there is significant inter-participant variability in the pattern of topographical activation on a specific task . A meta-Neuroimaging studies have shown that explicit motor timing activates the cerebellum, the supplementary motor area, basal ganglia, right-inferior frontal, and parietal cortices . Timing Ataxia derives from Greek and means \u201clack of order.\u201d SCA is a rare inherited , progressive, neurodegenerative, and heterogeneous disease mainly affecting the cerebellum. SCA is the used nomenclature for Spinocerebellar Ataxia from type 1 to type 48 for autosomal dominant cerebellar ataxia a . SCA3 isDue to the effects on the cerebellum, CCAS is present in SCA3 . HoweverSCA3 influences the brain stem, cerebellum, and pyramidal tracts . HoweverThe cerebellum has enduring subcortical and cortical connectivity, resulting in non-motor symptoms that are often neglected during clinical assessments in many neurodegenerative conditions, especially if clinical ataxia is not present . More thAlthough previously thought to primarily impact motor functions, numerous studies that we review below highlight that SCA3 also significantly impacts multiple cognitive domains.Previous studies show that SCA3 patients exhibit deficits on the Hayling Sentence Completion Test and the Stroop Color-Word Test\u2013designed to assess inhibitory ability . Feng etContrasting results emerged for this cognitive domain. Given that the cerebellum is also involved in language, it is perhaps unsurprising that SCA is associated with language problems . One stuBesides, contrasting test results emerge for semantic verbal fluency with and without impairment . AccordiTo some extent, impairment in executive functions may mediate the language deficits seen in patients with SCA. For example, patients may have trouble with word retrieval that implicates the cerebellum and its connections with the cerebrum . FundamePatients with SCA also exhibit memory problems. Several studies show that SCA3 patients have deficits with immediate auditory recall and delayed auditory recall . A singlSCA3 patients did not show any visual recall impairment measured with the Rey-Osterrieth Complex Figure test, a non-process-pure test that can measure more cognitive functions . Mainly,The results on sequence learning impairment are coherent with the present opinion on dysregulated striatal-cortical and cerebellar-cerebral networks in SCA3 . ParietaIn contrast to the cognitive domains discussed so far, where there are evident deficits, at least in some sub-domains, the evidence for deficits in visuospatial perception and ability is relatively weak. Visual perception has been measured in SCA3 patients with the Incomplete Letters subtest of the Visual Object and Space Perception Battery. Results showed performances within the normal range . No impaTheory of Mind is impaired in SCA3 patients . HoweverSeveral studies have investigated the impact of SCA3 on general intelligence, with contradictory results. A recent review by In conclusion, multiple studies on SCA3 patients with cerebellar damage have shown impairments in various cognitive domains, particularly in executive functions, and secondary effects in other areas. The neurocognitive functions are illustrated in Previous results showed a link between activity in the cerebro-ponto-cerebello-thalamo-cortical loop and executive functions in SCAs . This isExecutive dysfunctions also affect verbal functions like semantic and phonemic fluency as well as fluency while switching between categories . These aWhile social cognition is not well-studied in patients with SCA, some findings suggest that the Theory of Mind may be affected. Psychiatric conditions such as anxiety and depression, common among SCA3 patients, may also harm cognition. Language and cultural differences may also confound psychological studies, including those we have reviewed here. The severity of ataxia, the duration of the disease, and visual, articulatory, or upper limb motor difficulties can also influence cognition and hence the performance on neuropsychological assessments. However, because of the small sample sizes of previous studies, different confounders, and different neuropsychological methods that have been used, the neurocognitive profile of SCA3 needs to be better characterized and needs to be investigated further.ADHD is a neuropsychiatric disorder present in approximately 5% of all children and in approximately 2.5% of the adult population . It is eAdults with ADHD show emotional dysregulation and executive function deficits . While aThe brain of patients with ADHD has been the subject of extensive research. One of the most robust findings is the abnormal structure and function of the cerebellum in patients diagnosed with ADHD. Abnormal cerebellar development has been implicated in ADHD . FunctioHowever, the brain changes associated with ADHD extend beyond the cerebellum. Structural brain imaging studies have revealed that patients with ADHD display smaller brain volumes in multiple regions, including the cerebellum, dorsolateral prefrontal cortex, caudate, pallidum, and corpus callosum . MoreoveThis evidence of ADHD being linked to cerebellar abnormalities is further supported by studies revealing that children with ADHD perform poorly on tasks that demand cerebellar involvement. Children with ADHD exhibit abnormal tapping responses and abnormal synchronized oscillatory mechanisms . ChildreIncreased cerebro-cerebellar functional connectivity in the superior temporal gyrus within the somatomotor network could underlie impairments in cognitive control and somatic motor function in ADHD. Furthermore, increasing cerebro-cerebellar functional connectivity in older participants with ADHD suggests that enhanced cerebellar involvement may compensate for dysfunctions of the cerebral cortex in ADHD . MoreoveIn summary, abnormal cerebellar development, morphological differences of the cerebellum and cerebellar connectivity, and results from behavioral studies where the cerebellum is involved prove that this structure of the brain is clearly involved with ADHD.In the following section, we analyze studies that examine the neurocognitive functions of patients with ADHD. The research indicates that patients with ADHD experience deficits across all cognitive domains, although the specific subdomains affected differ from those observed in the other disorders reviewed.Studies have shown differences in neurocognitive function between patients with ADHD and controls, as evidenced by results from the 3-dimensional computerized Tower of London Test. This test measures both planning latencies and accuracy and has demonstrated that patients with ADHD exhibit impairments in both areas. This trend of impairment is thought to stem from difficulties in inhibiting responses when faced with problem-solving tasks, resulting in decreased planning activity . The worResults showed that patients with ADHD exhibit impaired inhibition compared to healthy controls, as reported in various studies . HoweverAnother fMRI study by Patients with ADHD exhibit difficulties with processing speed, distractibility, and selective attention, leading to an increased number of omission errors compared to healthy controls on tests such as the Vigilance and Sustained Attention Test and Selective Attention Test, two subtests of the Vienna Test System . SimilarThe results of verbal fluency tests in patients with ADHD are inconsistent. While some studies have found no difference between healthy controls and ADHD patients using the Resensburg Word Fluency Test , others Children with ADHD showed slower speed response than typically developed children on a naming test . FurtherThe contribution of the cerebellum, together with other brain areas are necessary for language processing. Verbal fluency and lexical retrieval tasks are associated with cerebellar activation. For example, the contralateral cerebellar hemisphere, together with Broca\u2019s area, was actively involved in the production of semantically related verbs in response to visually presented nouns. This is an example how these actions are due to non-motor cognitive processes subserving semantic word association . FurtherADHD patients have shown lower scores in delayed recall of verbal memory compared to healthy controls as tested by the Verbal Learning and Memory Test . LikewisA meta-analysis investigating the presence of procedural sequence learning found that ADHD patients do not exhibit significant deficits and that procedural sequence learning appears to be intact in ADHD . HoweverThe cerebellum also contributes to memory functions, for example, Visuospatial ability, tested with the Rey-Osterrieth Complex Figure test, did not show significant differences between healthy controls and ADHD patients . SchreibSocial cognition is still poorly explored in patients with ADHD, in particular regarding adults . ContrasCerebellum plays a fundamental role in identifying sequences in movements that are important to understand the intentions of others. For example, mirroring, attribute mental states in others, mentalizing, and making predictions regarding social behavior . InteresIntelligence is not impaired in patients with ADHD. Researchers who used the Cattell\u2019s Culture Fair Intelligence Test found no difference between healthy controls and adult ADHD patients . LikewisAdults with ADHD exhibit clear impairments in multiple cognitive domains that impact their daily functioning. The cognitive heterogeneity among adults with ADHD may be due to variations in comorbid disorders, medication status, and mood disorders within the ADHD group .An overview of the neurocognitive functions and how they are affected in ADHD according to this review are illustrated in Several deficits were identified under the attention cognitive domain and processing speed as well ias verbal fluency tasks . Visual The results of social cognition studies in patients with ADHD are contradictory, and the presence of undiagnosed comorbid ASD could be a confounding factor that negatively impacts their social cognition abilities .Mental rigidity, a common feature in patients with ADHD and ASD, could also be contributing to the varying results. The presence of disinhibition, difficulties with planning, and lack of motivation, as well as other dysexecutive symptoms characteristic of frontal lobe syndrome, have been reported among patients diagnosed with ADHD. These symptoms can impact other cognitive domains, and self-report questionnaires have shown high scores for executive dysfunction, indicating deficits in neuropsychological assessments .When it comes to ADHD, the presence of undiagnosed comorbidities and other psychiatric disorders can significantly impact the results of neurocognitive assessments. Additionally, the consumption of psychotropic substances and multiple medications by some ADHD patients can greatly impact their cognitive and executive function performance . For insCollectively, the evidence from behavioral and neuroimaging studies, indicates that ADHD is associated with cerebellar abnormalities and that these cerebellar abnormalities impact cognitive functions. This suggests that the symptoms associated with ADHD are partly due to changes in cerebellar function. However, it is also clear that ADHD is a disorder that affects multiple brain regions, and more research is required to determine the precise nature of the relationship between these deficits and the extent to which they are due to cerebellar dysfunction or problems with the interplay between various brain regions, including the cerebellum. Identifying the specific contribution of cerebellar impairment in the context of ADHD is crucial to advance our understanding of this disorder and inform the development of effective interventions to improve cognitive and motor functions.Autism spectrum disorder is characterized by difficulties with social interaction, communication, limited interests, and repetitive and restrictive behavior . These pThe most common suggested causes of ASD are metabolic and physiological disorders, immunological dysfunction, oxidative stress, and mitochondrial dysfunction . AlteredAutism spectrum disorder has many comorbidities, including morphological abnormalities like macrocephaly, cerebral palsy, physiological impairments like gastrointestinal, sleep problems, psychiatric disorders like anxiety, ADHD, obsessive-compulsive disorder, tic disorders, Tourette syndrome, epilepsy, and Rett syndrome . PatientExecutive dysfunction can contribute to the symptoms associated with ASD . The prePost-mortem and structural MRI studies have highlighted that the frontal lobes, amygdala and cerebellum are abnormal in ASD . StructuIn addition to these morphological differences, there are many studies showing that the performance of patients with ASD differs from controls on tasks related to the cerebellum. For example, performance on eyeblink conditioning, a simple form of learning that is dependent on the cerebellum, differs between patients with ASD and controls . Eye-traTaken together, ample evidence shows cerebellar impairment in patients and mouse models with ASD. Cerebellar abnormalities cause disruption of functions related to the cerebellum, but they may also negatively affect the ability to interpret external stimuli and organize internal processes. This doesn\u2019t mean that the fundamental cause of ASD is to be found within the cerebellum, but rather that whatever neural alterations lead to ASD, the cerebellum likely plays an important role.Neuropsychological studies demonstrated deficits in working memory and other executive dysfunctions for patients affected by ASD compared to healthy controls . ResultsThere is growing evidence that the changes in executive functions observed in ASD patients are linked to changes in the connectivity between the cerebellum and the cerebrum . For exaPatients with ASD scored significantly lower than healthy controls on the Purdue Pegboard Test, a psychomotor test of manual dexterity and bimanual coordination also used to measure executive functions and attention . ASD patEvident abnormalities were previously identified in the domain of the verbal functions. Difficulties with social interaction, verbal and non-verbal communication, and imaginative activities consistently occurred together with language difficulties . Adults In a recent study In a previous study there were no significant performance differences between healthy controls and ASD patients on the Embedded Figures Test that measure local/global perceptual style, central coherence and perception ability . AccordiSocial cognition seems to be one of the most impaired cognitive domains for patients affected by ASD. Many studies demonstrated a strong impairment with social cognition in ASD patients, where, respectively, the theory of mind, emotion processing and social orientation were deficient . PatientSocial, cognitive, and adaptive skill deficits characterize intellectual disabilities, which are present in this neuropsychiatric and neurodevelopmental disorder . The norThe neurocognitive functions in ASD are summarized in This review highlights differences in neurocognitive functions, illustrated in These three conditions are all associated with clear cerebellar abnormalities, which may in turn affect cognitive functions, directly or indirectly. Although progress has been made in identifying cognitive difficulties, further research is needed to fully understand the disorders and their effects on other cognitive functions. Currently, many of the cognitive difficulties are not sufficiently acknowledged, resulting in limited recognition and understanding in society. A key goal of future research should be to determine if these cognitive deficits are directly caused by the disorders, by other comorbid conditions, or a combination of both.Other conditions such as low or high intelligence quotient, epilepsy, tics, depression, anxiety, eating disorders, obsessive-compulsive disorder, and burnout syndrome can impact the performance of patients with SCA3, ADHD, and ASD on neuropsychological assessments. The presence of these conditions can be confounding factors that clinicians must take into account when interpreting test results and associated cognitive functions. Other problems with earlier studies include small sample sizes, poor neurocognitive task selection, cultural differences and patient heterogeneity; which may also contribute to the variations in performances revealed in this review.There are several reasons why it is important to assess neurocognitive function in ADHD, ASD, and SCA3. First, identifying cognitive deficits that arise during the early stages of these conditions could help prevent or alleviate further cognitive impairments. Second, understanding the cognitive challenges facing these patients can help caregivers as well as the patients themselves to facilitate their daily routines. Third, the identification of cognitive deficits can be a starting point for personalized work and educational rehabilitation programs. Failure to detect cognitive impairments, on the other hand, can have severe effects. Cognitive deficits can trigger high levels of psychosocial stress at school or work which can lead to depression, anxiety, and ultimately self-harm, violence, and increased risk of suicide.Neuropsychological assessments can contribute to the discrimination between many disorders and diseases, for example, Alzheimer\u2019s disease, frontotemporal dementia, and post-traumatic stress syndrome. However, for ADHD, SCA3, and ASD there are few neuropsychological assessments used in clinical practice. The neurocognitive functions have not been extensively evaluated and clarified in SCA3. Future studies need to clarify how the damage to the cerebellum affects cognitive functions with the support of neuroimaging, how cerebellar damage in SCA3 affects the neurocognitive domains, and if it is possible to detect a mild cognitive impairment which often leads to cognitive diseases or dementia .For ADHD the Integrated Visual and Auditory continuous performance test is commonly used by researchers and clinicians . This teHowever, for neuropsychiatric disorders like ADHD and ASD neuroimaging results have been less clear, perhaps because of the heterogeneity of these disorders . ADHD anFuture studies are needed to further explain the role of the cerebellum in both normal and pathological behavior, mood regulation, impulse control and how it contributes to executive cognitive functioning. Further, new clinical studies investigating the cognitive profiles of ADHD, ASD, and SCA3, are necessary to gain insight into the nuances of the disorders which in turn can improve the differential diagnosis and the potential to identify sub-cognitive phenotypes of patients with ADHD and ASD, which in turn may help us develop better treatments and strategies. Non-pharmacological strategies could also help the large group of patients with neuropsychiatric symptoms who do not fulfill all the diagnostics criteria to obtain a formal ADHD or ASD diagnosis. Given that most of the studies on ASD have focused on children or adolescents, further studies are needed to clarify the cognitive functions of adults with ADHD and ASD.To fully understand how the cerebellum works we must study how it contributes to different psychological functions and neurocognitive domains. Considering the rich cerebro-cerebellar connections, we should expect that changes in the cerebellum can affect cognitive functions such as verbal functions, cognitive flexibility, impulse control, task initiation, efficiency, self-monitoring, planning, and prioritizing. The findings from neuroimaging and neuropsychology reviewed here show cogent evidence that the human cerebellum plays a pivotal role in many cognitive functions. Accordingly, ADHD, ASD, and SCA3\u2013three conditions associated with abnormalities in cerebellar morphology\u2013all affect various cognitive functions, although more research is needed to uncover the causal relationships involved. Future clinical studies on these patient groups and other patients in which the cerebellum is affected can help us uncover the cerebellum\u2019s role in cognition and lead to an improved understanding of the difficulties facing patients with cerebellar alterations.MC: wrote the first draft, conception, disposition, and organization of the work. SV: reviewed and critiqued the parts inherent to cognition, neurocognitive impairments, and neuropsychology. PG: reviewed and critiqued the parts inherent to ADHD and ASD. SG: reviewed and critiqued the parts inherent to ataxia and SCA3. AR: wrote the final draft, supervised the main work, conception, financing, and organization of the work. All authors contributed to the article and approved the submitted version."}
+{"text": "This study explores the potential of using physical infrastructure as a \u201csocial sensor\u201d for identifying marginalized communities. Prior work tends to explore biases in infrastructure as a retrospective \u201csocial autopsy\u201d. Instead, our study aims to create an introspective \u201csocial biopsy\u201d, using existing infrastructure gaps to inform how future\u00a0policy and investment can address existing inequities more sharply and proactively. Specifically, this work explores the possibility of using U.S. county-level broadband penetration rates as a social sensor to predict rates of unemployment amidst the COVID-19 pandemic. The result is a 2\u2009\u00d7\u20092 typology of where broadband as a social sensor is sharper (or coarser), as well as prone to error . We further explore combining broadband with other forms of physical infrastructure  to\u00a0create a sensor \u201carray\u201d to further enhance detection. Overall, this work proposes an \u201cinfrastructure-as-sensor\u201d approach to better detect social vulnerability during times of crises in hopes of enhancing resilience through providing services more quickly and precisely to those who most need it. Particular configurations of infrastructure, ranging from clusters of buildings and bridges down to a single building and bridge site, are shown to impact mobility, decision-making, response time, well-being, and even entrepreneurship5. Such an approach is precise enough to detect behavior amidst crises as global as a pandemic6, and as local as an active shooter situation7. Moreover, a series of scaffolding technologies have now been shown to enhance data acquisition, communication, and coordination around such systems. These range from sensors measuring floor vibrations induced by an individual9 all the way to sensors used for social media tracking10 and digital twins12, as well as augmented and virtual reality operating across these individual and systems-level scales17.While the built environment has long been known to impact human behavior19 find that not everyone equally benefits from infrastructure or the technologies that support it; infrastructure linkages to local communities are often skewed and biased25. However to borrow from a medical analogy used in this space, prior studies tend to evaluate infrastructure systems, and the calamities which impact such systems, as a retrospective post-mortem \u201csocial autopsy\u201d26.Our study aims to take the conceptual terrain from this important body of work and expand it to address issues of equity. Seminal work undergirding this areasocial sensor of such bias and inequity. In other words instead of just analyzing how infrastructure was skewed by past bias, we treat current infrastructure asymmetries as characterizing the present impacts of said bias . In taking a social sensor approach, this study seeks to transcend the prevailing approach of documenting biases in existing infrastructure in order\u00a0to start crafting more real-time solutions to alleviate such challenges.Our study asks can we transform such analyses into a \u201csocial biopsy\u201d , allowing for a more immediate and introspective sampling of infrastructure gaps to identify and alleviate bias in real-time? We see a possibility for doing so by treating infrastructure as a 11 which focuses on developing sensing mechanisms that are sensitive to an individual\u2019s activity, thereby identifying human behavior and mobility at ever more precise and granular resolutions. However, scaling this latter human-as-sensors approach is computationally, capital, and environmentally intensive28. Currently, prevailing solutions are algorithmic in nature, whereby the approach is either creating more parsimonious algorithms that require less computational resources28, or optimizations that help increase savings by leveraging differences across a set of infrastructure assets29. Moreover, these approaches (1) rely primarily on propriety data which is challenging to make reproducible or available for government use, let alone do so in a way that is adequately sensitive to privacy issues; and (2) largely propose and evaluate possible sensors rather than provide guidelines for sensor choice and deployment.Treating infrastructure as a social sensor complements the prevailing human-as-sensors approach1 and sociology26 to inform infrastructure sensor choice for these purposes. Furthermore, our approach relies only on public data, ensuring that the methods and outcomes of such research can be reproducible as well as be\u00a0pragmatically integrated and deployed by government agencies in decision making processes. Overall while most prior sensing approaches rely on private data or indirect capture of inequity 32, our approach sees what is feasible with more publicly available, and therefore more easily and cheaply accessible, data on infrastructure networks closer to the physical enablers and barriers of bias and inequity.Our \u201cinfrastructure-as-sensor\u201d method proposes an alternative synergistic approach. In identifying those infrastructure configurations that lead to the most bias and inequity, we can better identify where to deploy more granular human-as-sensor approaches in ways that can realize greater benefits at less cost. In this manner, infrastructure-informed targeting could help further minimize costs by bringing into greater focus those areas that are most likely suffering from infrastructure-driven bias for which human-as-sensors approaches could more efficiently and effectively be deployed to better track and mitigate. Our approach uses thinking in urban studies40. Therefore, we keep the study\u2019s focus on whether infrastructure is a useful social sensor of marginalized groups, especially those sensitive to the linkages between broadband and unemployment. Second, we find that economic vulnerability is best captured through unemployment rather than other commonly used metrics such as wages. As Fig. 41. The second finds that broadband adoption and availability may be associated with employment in rural America during March and April of 202042. However, this work does not cover the entire United States, uses a limited set of broadband measures, and does not use empirical methods which allow for analyzing the change in unemployment before vs. during COVID-19.To explore the feasibility of our proposed infrastructure-as-sensor approach, we explore the asymmetries in broadband deployment and how that impacted unemployment amidst COVID-19. We chose this setting for several reasons. First, there is already an extensive literature that documents the impacts of broadband penetration and availability on unemployment .Second, COVID-19 is a useful multidimensional shock. COVID-19 led to stay-at-home mandates implemented by all states, which required individuals to work from home if they were performing non-essential work : Populations that depend on broadband for work , or who\u00a0historically lack broadband access  will\u00a0exhibit greater rates of unemployment from COVID-19 due to broadband access.Hypothesis 2 : Populations with less reliance on broadband for their employment  will\u00a0exhibit lower rates of unemployment from COVID-19 due to broadband access.As informed by prior theoryBoundary Condition 1 (sensor slippage): Dimensions that are further away from what the sensor measures  will exhibit weaker signaling effects.Boundary Condition 2 (sensor array): Triangulating across multiple sensors will improve targeting along the most key dimensions and to the most critical locations.As with any sensor, we expect\u00a0there will be some\u00a0slippage and error\u00a0in the accuracy of this sensor. Thus, we also explore the following two boundary conditions:We now proceed to present the main results and how different groups are (or are not) impacted by broadband access amidst the COVID-19 stay-at-home mandates. To empirically analyze boundary condition 1, we split cases into three subsets: (1) those that directly depend on broadband for work; (2) those that indirectly measure broadband access; and (3) those that do not directly depend on broadband. The intuition is that our social sensor will exhibit the strongest signals for cases in set (1) and the weakest for cases in set (3). To empirically analyze boundary condition 2, we then conduct a proof-of-concept supplementary analysis of how one could scale from broadband as a single senor measuring high-speed Internet access to an \u201carray\u201d of sensors that incorporate the built environment to see if we can more holistically and precisely capture such vulnerabilities. This includes buildings, bridges, and WiFi-enabled libraries. We conclude with a summary of the findings and discuss the implications and possible uses for this infrastructure-as-sensor approach.44. Broadband access can be\u00a0measured in terms of several different metrics including a)\u00a0actual speed (measured by Microsoft (MSFT), Ookla and MLab), b)\u00a0advertised availability (measured by\u00a0the FCC), and c)\u00a0adoption (measured by the American Community Survey (ACS)). Therefore, our operating definition of broadband access is the degree to which an individual can access high-speed internet as measured either in terms of self-reported access, advertised speed, and/or actual speed tests. For the purposes of this study,\u00a0\u201cadequate\u201d either means 50% or more of the population has 25 Mbps upload and 3 Mbps download in terms of advertised or actual speed, or 50% of the population or more report access to broadband. This definition aligns with those of other well-regarded sources45. We discuss the differences in these broadband metrics further in the Methods section and in SI Appendices Before discussing the results, we must first define empirically our key variable, namely what we mean by broadband access. We start with the definition used by the Federal Communications Commission (FCC) which\u00a0states that broadband is \u201chigh-speed internet access that is always on and faster than the traditional dial-up access\u201d. They define\u00a0adequate broadband access for an individual as at least 25 Mbps upload speed and 3 Mbps download speed46  does not have adequate broadband access, and in turn, is most negatively impacted by stay-at-home mandates implemented during the COVID pandemic. This is done by subsetting to specific populations known to have lower access levels or industries known to need broadband access more to work productively. If these gaps are consequential, we assert that unemployment will be higher for those counties where lack of access is indeed concentrated to particular groups or industries, hence the formulation of our aforementioned hypotheses.To reiterate our hypotheses, broadband should sharpen as a social sensor for groups whose lack of broadband access makes them less resilient to the COVID-19 stay-at-home mandates, while broadband as a social sensor should coarsen for groups and locations where such access should be inconsequential in their ability to manage the pandemic. Several groupings lend support to our hypotheses. While we report the summary of our results in Fig. The first subset focuses on regulatory-based mechanisms resulting from the stay-at-home orders which mandated that some groups work in-person based on their role in the local economy. In this scenario, we expect to see a greater impact on unemployment in those counties that have below median numbers of essential industry designated (EID) workers, because these workers were more reliant on having broadband access to both comply with stay-at-home mandates and to maintain their employment. For counties with above the median EID workers, when all else is equal, the base case finds that treated counties experience an increase in unemployment rate of 1.04% compared to control counties after the onset of COVID-19. For counties below the median number of EID workers, when all else is equal, the base case finds that the unemployment rate difference is 1.55% for treated counties when compared to control counties after the onset of COVID-19. We see in this gap that the sensor behaves as we expect; lower levels of essential workers sharpen the sensor and identify a larger gap in unemployment, while higher levels serve to coarsen the sensor.51. Here we expect that for counties that have on average higher numbers of people that are able to work from home prior to the pandemic, the impact of the forced work-from-home mandates during the COVID pandemic would have less of an impact as these occupations already allowed them to pivot to working from home (WFH) more easily. We find this to be the case. For counties with above the median numbers of people employed in industries that could easily work from home, when all else is equal, the base case finds that treated counties experience an increase in unemployment rate of 0.96% compared to control counties after the onset of COVID-19. For counties below the median numbers of people employed in industries that could easily work from home, the base case finds that the unemployment rate difference is 1.29% for treated counties when compared to control counties after the onset of COVID-19. Here we see the effect that people working in occupations and industries better suited to working online experienced lower rates of unemployment as a result of the work-from-home mandates.To further solidify this mechanism, we also look at occupations that, by the nature of the tasks required for the work, are more amenable to the work-from-home mandates52 and we therefore expect them to be asymmetrically impacted when resilience depends upon broadband access during the stay-at-home mandates. Given this premise, we expect to see counties with higher median percentages of Black and Hispanic populations to also have higher rates of unemployment. For counties with above median percentage of Hispanic and Black populations, the base cases respectively find an increase of 1.62% and 1.42% in the unemployment rate of treated counties over control counties after the onset of COVID-19. For those counties below the median, when all else equal, the base cases respectively find that treated counties experience a lesser unemployment rate increase of 0.69% and 0.95% over the control counties after the onset of COVID-19. The difference for counties which have higher percentages of Hispanic and Black populations suggest that marginalized groups are indeed more detrimentally impacted by COVID-mandated stay-at-home orders, likely due to their systematically lower broadband access; higher levels of Hispanic and Black populations sharpen the sensor and lower levels coarsen it.The second subset focuses on marginalization. Certain groups, specifically Black and Hispanic populations, are known to have less access to broadbandThe third group focuses on industrial composition. We first look at industrial composition as demarcated by geography and how that should impact the importance of broadband access during COVID-19. Rural and urban areas are fundamentally different in their demand and supply for broadband services. The industries which drive the economic engines in rural areas  are less dependent on broadband access. Therefore, we expect to see less impact on unemployment in rural areas when using broadband access to demarcate treatment and control groups. For urban counties and mixed urban/rural counties, when all else is equal, the base case finds an increase of 1.12% in the unemployment rate for treated counties over control counties after the onset of COVID-19. For solely rural counties, when all else is equal, the base case finds a statistically insignificant impact on unemployment after the onset of COVID-19. These findings suggest that the use of broadband as a social sensor is sharpened in urban areas, where the primary economic motors are more influenced by broadband access, and the sensor is coarsened in rural areas whose local economies are less dependent on broadband.In addition to exploring the broad economic sectors associated with urban and rural areas, we also explore how work gets done in specific sectors can also impact\u00a0social sensor\u00a0sharpening or coarsening. For instance,\u00a0the computational and analytical work in\u00a0technology sectors likely necessitate\u00a0greater reliance on broadband, so we would expect to see those counties with higher proportions of individuals employed in these sectors impacted more than individuals employed in other sectors. For counties with above median number of tech workers, when all else is held equal, the base case finds that treated counties experience an increase of 1.01% in unemployment over control counties after the onset of COVID-19. For counties below the median, when all else is equal, the base case increase in unemployment rate is insignificant for treated counties over control counties after the onset of COVID-19. This aligns with our expectations; given broadband is crucial for tech industry work, high-tech employment levels sharpen the sensor, while low-tech employment levels coarsen the sensor.53. What that means is while we find alignment with our hypotheses for the subsets we discuss above, broadband will not always coarsen and sharpen as a social sensor in anticipated ways if subsets capture multiple conflating signals beyond broadband access. In particular, we seek to characterize both type I errors  and type II errors .So far, broadband operates effectively as a social sensor when what it measures  is predominantly driving unemployment impacts for the social group of concern. However, as we know from engineering, sensors can start experiencing error when what it measures is conflated with other signals54, this may also be due to confounding aspects associated with service metrics. For instance, the service sector is strongly associated and co-located with high-tech sectors (r = 0.47), which suggests those who work in high-tech also increasingly use such services. This suggests collinearity between industry variables that is spuriously picked up by broadband. Therefore in this case, the conflating signal that is leading to error is\u00a0arguably the spatial and sectoral linkages between service sectors that are less broadband-dependent with high-tech sectors that are more broadband dependent.False positives are those subgroupings that we expected not to affect our social sensor but demonstrate an effect. For example, we anticipate no effect on employment for service workers because their reasons for unemployment are due to COVID-induced business closures and arguably not access to broadband . However, we find that for counties with above median levels of service workers, when all else is equal, the base case finds an increase in unemployment rate of 1.17% for treated counties over control counties after the onset of COVID-19. For those counties below the median, when all is equal, the base case finds an unemployment rate increase of 0.51% for treated over control counties after the onset of COVID-19. While this could mean such services are increasingly moving onlineFalse negatives are those subgroupings that we expected to sharpen (or coarsen) our social sensor but prove inconclusive. For example, we would expect that counties which have higher average income would experience a less severe impact from stay-at-home orders due to the capability of being able to purchase improved broadband speeds. However, we find that in counties with above median average incomes, when all else is equal, treated counties experience an increase in unemployment of 1.55% over control counties after the onset of COVID-19. Conversely for below median counties, when all else is equal, treated counties experience an increase in unemployment of 1.03% over control counties after the onset of COVID-19. This again is likely due to the fact that there are confounding aspects associated with income metrics such as education considerations (population with bachelor\u2019s degree or higher\u2014r = 0.49). In this case, the conflating factor is other proximate and interlinked sociodemographic characteristics that one must carefully tune and calibrate upon deployment. For instance, income may potentially be conflating sociodemographic factors that drive lack of broadband access  with those that reflect greater capabilities and skills to put it to good use .We see similar false negatives with households with children. Here, we posit due to the need for children to engage in virtual school due to stay-at-home mandates, these households would likely require the parent to stay at home to tend to their children during these times, risking their employment. However, here too we do not find this expected impact as there is little difference in the unemployment rate increases in the base cases (households with children: 1.27% unemployment rate increase for above median vs. 1.39% for below median). We do see this is more consistently the case for counties with above vs. below median levels of single parent households, but the differences between the groups overlap, suggesting they are less significant . Inevitably then, when that signal no longer dominates and/or has other conflating and competing signals, errors are likely to result. Figure arrayed, whereby multiple sensors that read different signals are linked together to mitigate weakeness in any one sensor. This reflects practices in the field of engineering to understand how sensors are developed and used to measure various parameters. One means for doing this is to have a set of redundant measures to ensure accurate readings. We see this in the field of atmospheric science. When measuring the temperature of clouds, which is a critical predictor of storm dynamics and cloud formation, both radiosondes and drone profiling are used to get the most accurate measure possible to include in the models55. We argue that this holds true for the use of infrastructure as a social sensor. We can perhaps strengthen the sensor by incorporating other, additional sensor measures highlighting the relationship between broadband internet and unemployment. Secondly, while there are some applications where a single sensor is enough to measure a given parameter, this is not always the case for more complex parameters. For example, one can get an accurate reading of temperature by only using a thermometer. However, in order to track an object\u2019s movement, a complementary array of sensors may be required, including but not limited to an accelerometer and optical tracking capabilities56. In order to understand the complex dynamics of economic metrics during times of crises, a full array of infrastructure sensors may more accurately pinpoint counties which are detrimentally impacted.How then can we help mitigate the errors from a social sensor (in this case broadband)? Perhaps as in engineering, sensors are more effective when they are 57, and many people who did not have access to broadband in their homes during COVID made use of their local public libraries to help fill the broadband gap58. For this redundant public (as opposed to private household) measure check, we created a parallel metric to our broadband metric which assessed what percent of a county\u2019s population falls within the \u201clegal service area\u201d of a public library, defined as the population that lives within the boundaries of the geographic area the library was established to serve. For an additional sensor to be a useful component in an array, there should be some orthogonality, which suggests that the additional sensor is providing information that is not being captured in the existing sensors used. In this case, there is some correlation between public libraries and broadband access, but not perfect correlation, which suggests libraries are providing additional information not captured in our core broadband sensor. We find the correlation between the metrics, when in binary form of treated vs control, to be 0.2. Using this metric, we classify counties with below 50% of their population in the legal service area of a public library (akin to our below 50% penetration of broadband at a county level) as our control group and we classify counties with above 50% of their population in the legal service area of a public library as the treatment group (akin to our above 50% penetration for broadband). We separately run the same model presented above and find that our results directionally hold with the results using broadband access as the sensor, but that the signal of the results on average across most\u00a0of the cases are smaller and less significant on average. We argue this suggests that public access to broadband helped reduce gaps seen in private access to broadband. The results from this analysis are included in Table We start by assessing how a redundant measure of broadband access, WiFi enabled public libraries, may work to strengthen the results of our study. Public libraries serve as a \u201cfirst choice, first refuge, and last resort in a range of emergency and e\u2013government circumstances\u201d59. As with libraries, building and bridge networks are adding novel information to our core broadband sensor. As a result of this, we would expect that by integrating both sets of physical infrastructure into our broadband models, this would help sharpen the (broadband) sensor. Perhaps also areas with physical connectivity enhance the expectation of digital connectivity more than areas without such connectivity.To further explore the creation of sensor arrays to detect gaps, we also selected two forms of physical infrastructure which serve to complement the upstream and downstream rollout of broadband\u2014bridges per county and new building permits per state (selected based on data availability). We selected these because they capture different dimensions as to how the built environment can influence broadband through rollout and point of access. Building networks are likely where broadband is deployed more downstream and therefore where it is accessed. Building networks\u00a0have a correlation with the broadband access metric of 0.15. Bridge networks impact urban connectivity and therefore may influence where broadband is rolled out more upstream. Bridge networks have a correlation with broadband of 0.25As shown in Fig. Overall, this suggests linking sensors into \u201carrays\u201d strengthens the signal, reduces errors, mitigates detection gaps, and helps identify the most prominent subsets for targeting. In this case, public libraries reduce the false positives and negatives from broadband alone, help prioritize which subset yields most promising gaps for targeting , and identifies more precisely where broadband signals weaken. Moreover in incorporating additional built environment features, we can detect influences on these broadband gaps based on gaps in rollout (bridges) or gaps in points of access (buildings). Clearly, we can conceive many other different sensors for such an array, so we see this as demonstrating a proof-of-concept for future work to explore more systematically other sensor arrays and outcomes, even beyond those centrally focused on broadband and unemployment. Overall in line with Boundary Condition 2, using multiple sensors in an array improves targeting to the most key variables  and to the most key locations .Our study explores the possibility of using gaps in infrastructure as a \u201csocial sensor\u201d to help us more introspectively target policy and investment towards areas whose resilience is especially fragile to disruptions and other exogenous events. We develop an \u201cinfrastructure-as-sensor\u201d approach by analyzing the impacts that broadband access has on unemployment\u00a0in the United States during the stay-at-home mandates implemented during the COVID-19 pandemic. The result is a 2 \u00d7 2 typology that explains what factors sharpen the sensor, coarsen it, and render it prone to error . We further supplement this work by demonstrating how errors and gaps in the sensor can be addressed through creating a sensor \u201carray\u201d that couples broadband with other infrastructural measurements of access  as well as with other factors that may\u00a0influence upstream rollout , or downstream points of access .28. An infrastructure-as-sensor approach can help identify the most promising subsets for targeting, and then\u00a0focusing a human-as-sensors approach on these subsets can help maximize the approach\u2019s benefits while mitigating its costs. Simply put, an infrastructure-as-sensor approach can help detect the most promising areas for which a human-as-sensor approach can bring greater granularity and value. More specifically, prior human-based social sensing approaches focus more on different individual interpretations of the surrounding social world60. Our infrastructure-based social sensing approach pioneered here focuses more on how infrastructure influences what comes to be available in one\u2019s social world well before interpretations are made.Besides the main objective of providing support more quickly to communities susceptible to disruption, we see several contributions resulting from this work. First, the infrastructure-as-sensor approach can potentially better address structural factors that hinder promising human-as-sensor interventions. Prior work from a human-as-sensors approach show how enhanced granularity can be achieved, but focuses less on how to best target the deployment of such approaches in lieu of their large computational costs61. However, sensors in social applications are often more complex whereby multiple social signals are interdependent and so measuring one may not always be sufficient to adequately characterize key behaviors and activities. Moreover, intertwined social signals may muddy the ability to measure any one signal that a sensor is intending to measure. As a practical example, consider the ambitions around smart city initiatives. The vision for smart cities is to integrate several data layers in real-time so cities can \u201cself-diagnose\u201d problems62. This requires combining different infrastructure data, each equipped to best measure different social activity. Moreover, each of these data have differing assumptions and biases as to what data most matters that could perpetuate when such approaches are scaled to a city level. One particular issue is that the algorithms used in such approaches are likely trained on data that are not necessarily representative24. In taking our infrastructure-as-sensor approach and, more importantly, using multiple sensors in an array, we see our work helping to address these issues in several ways. For instance, we find integrating social sensors in an array helps better sharpen and detect gaps and skews present in any one sensor alone. Perhaps then, these arrays could be used to penalize overfit in smart city planning models to observed priors when such gaps and skews are found increasingly present. This could be done through weighting residuals by the number of social sensors in the array present at a given location. We also find integrating sensors in an array helps further triangulate which subsets are more promising for more granular analysis (such as with a humans-as-sensor approach previously discussed). This can better ensure models are less reliant on proxies of access  that obscure and mask important gaps and skews that have significant equity implications.Second, we demonstrate the value of not just using one sensor, but a sensor array. Prior work on social sensors\u00a0focuses primarily\u00a0on the value of using\u00a0one specific\u00a0sensor but very\u00a0little work looks at the interdependencies and interplay across sensors. Sensors for engineering applications are often designed to measure one signal30 or how to use data collected about humans to understand how they interact with their physical environment, for example through the use of smart-wearables31 or by assessing point clouds which outline the coarse body shape of people in order to understand actions 32. All these approaches require the collection of large-scale sets of private data. Our approach uses infrastructure data that is publicly available and so further increases data access ease and speed. Given its basis is public data, such an approach is also arguably more scalable in ways that are more sensitive to privacy concerns.Third, we highlight that our approach provides a novel method for using publicly available data to assess existing community vulnerabilities to infrastructure service gaps, which contrasts with existing approaches that rely on extensive computing power and large-scale proprietary data. Currently, much of the work in this space is focused either on how to use human online presence and commentary to gain insight into physical world events25, but less guidance on how to inform sensor choices . With such methodological advancements, government agencies can use the insight from such analyses to assess more quickly who in the future may most immediately need broadband support before the next pandemic occurs. To explain how that could occur using this work, we provide a demonstration case . Rather infrastructure is an endogenous input that is asymmetrically distributed and whose interdependencies matter. As such, we cannot take infrastructure for-granted as an equally accessible input that all can use to create value.Overall, we hope this study motivates future work to advance the agenda that we propose around using infrastructure as a social sensor to better detect inequity and bias. If we take seriously the numerous retrospective studies that note infrastructure is more a measure of bias than equity, then we can more introspectively use such networks to detect harm in the moment, rather than ponder \u201cwhat if\u201d as structural inequalities continue to ossify.63. A key way to assess this assumption is to analyze if the trends between the control and treatment groups track similarly prior to the onset of the treatment, commonly called the parallel trend assumption64. In this case, this means treatment and control group trends, as defined by broadband penetration levels, should track similarly prior to the onset of the COVID-19 stay-at-home mandate shock. To verify this, we present a parallel trends plot, which provides a visual check on the zero condition mean of the errors assumption required for the DiD analysis, for the main analysis in Fig. The primary methodological approach used here\u00a0is difference-in-differences (DiD) regression modeling. Several critical assumptions underpin DiD models. The first assumption states that the treatment and control groups behave similarly pre-shock and that there is not an unobserved factor sorting the groups which would violate strict exogeneity, an extension of Gauss-Markov\u2019s zero-conditional mean of the error assumption65. We use the complete dataset where there is data available across all dependent and independent variables. We drop data for 8 counties due to lack of unemployment data (02063\u2014Chugach Census Area(AK), 02066\u2014Copper River Census Area (AK), 15005\u2014Kalawao County (HI)), lack of demographic data , 22059\u2014La Salle Parish (LA), 35013\u2014Dona Ana County (NM)), and lack of education data (02158\u2014Kusilvak Census Area (AK), 46102\u2014Oglala Lakota County (SD)). Where there is missing data across the splits, these counties are removed only for that analysis, as is represented in the observation counts presented in the regression tables in Appendix This analysis is run at a county-level spatial and monthly time resolution. As of the 2020 U.S. census, there are 3143 counites County H), lack o35, data from the Local Area Unemployment Statistics (LAUS) Dataset, published by Bureau of Labor Statistics (BLS), is used to construct the dependent variable. Specifically, we use the LAUS\u2019 unemployment rate data, which is measured as the ratio of unemployed people to the total civilian labor force, in a percentage form66. We download the data directly from the BLS user interface, at a monthly and county-based resolution. We then combine this data with the finalized list of counties as defined in the 2020 census. For the main models, we use the unemployment rate as a percent. Due to potential concerns of non-normality . However, the MSFT data only assesses devices using MSFT tools and Ookla and M-Lab are user defined. The MSFT data is pulled directly from Microsoft\u2019s Github account for both 2019 and 202070, while the Ookla and M-Lab data are sourced from the Indicators of Broadband Need Map in 202071, a tool managed by the United States Department of Commerce and National Telecommunications and Information Administration. One should note that the MSFT dataset does have limitations in that the speed tests are only conducted anytime a user connects to a MSFT application, which in turn does not capture a full measure of servers being used72. Moreover, we choose to ground our interpretations at a 50% penetration rate because this aligns with prior work in this area which argues that in order to achieve adequate economic impact, digital infrastructure must reach at least 50% of the population73. When we refer to \u201cbase case\u201d throughout the study, we are referring to this case (MSFT 2020 data with treatment being those counties as on or above 50% penetration rate and control being those counties with less than a 50% penetration rate). The results remain largely consistent across the various datasets and penetration rates and are presented for transparency.The first measure of broadband we consider is the speed threshold measures. For the purposes of our work, there are three primary datasets which aim to measure speed thresholds. The Microsoft dataset counts the number of devices that have connected to the internet at broadband speed per each zip code74. Further, the dataset is predicated on the highest level of advertised broadband in a census tract, rather than being a measure of what speeds are actually measured. While this data is primarily available at the census-tract level, the FCC aggregates the data to county level on an annual basis. In order to keep our dataset comparable to other analyses run with both FCC and MSFT data, we use the measures of FCC data already included with the MSFT base data70. One should note that the FCC data is the only dataset which separates out mobile data. While this is not ideal for comparability across the datasets, we feel that the results are still indicative of general directionality.The second measures broadband advertised availability. The most widely used dataset is published by FCC under the Form 477 which is available at census-block on a 6-month basis or county annually. Federal reporting mandates require that companies self-report their maximum advertised broadband level at every census tract. This is then assumed to be the level of access at that census tract. While this data is audited by a third party, the self-reported nature of this data is cause for concern75. This data was obtained from the Indicators of Broadband Need database71.The third and final measure of broadband internet assess adoption. The U.S. Census incorporates a question into the 5-year American Community Survey (ACS) which asks if a household has access to internet . This data does not assess the quality (primarily measured in speed) nor reliability (how often is the speed reported) of the internet connection. This data is available at census-tract level on an annual basis, although the data is not comparable over adjacent years due to ACS\u2019s methodological data developmentThe average number of people with access to adequate levels of broadband, at a county level, are used to define the treatment and control groups for our DiD analysis. As we noted in the main body of the manuscript, adequate access to broadband is defined as 25 Mbps download and 3 Mbps upload. Though we use a 50% penetration rate for our base case, we vary the threshold for penetration rates (from above 25% to above 75%) to ensure greater robustness in our findings. Moreover, we further ran a robustness where we only keep those counties that are consistently in the treatment (or consistently in the control) between MSFT 2019 and MSFT 2020 data to ensure our treatment is consistent and robust in its findings . We run a sensitivity analysis, as is discussed in Appendix 76.To assess sensor sharpening and coarsening as well as where broadband as a social sensor is prone to error, we use several moderating variables to subset the data. Regarding regulatory factors, we measured the number of essential industrial workers at the state level using the federal government\u2019s definition of Essential Workers77. We calculate the percent of Black/African American population by dividing the total population who is Black  by the total population . We calculate a similar metric for the percent of the population who is Latino/Hispanic by dividing the total population who is Latino/Hispanic  by the total population . We pull the average household income directly from the ACS 2019 data (B19013_001E). We calculate the number of single parent households by summing the number of single fathers (B11005_006) with the number of single mothers (B11005_007), divided by total number of households (B11005_001) in ACS 2019. Similarly, we calculate the percentage of households with children under the age of 18 by dividing the number of households with children under 18 (B11003_001) by the total number of households (B11005_001). For industry factors, we consider both geographic and industry composition.Regarding marginalization factors, we used data from the 2019 ACS and 2020 Decadal Census which we pulled via the Census API interface in R, tidycensus78. The analysis is run using subsets that separate out solely urban counties and mixed rural/urban counties from solely rural counties. This is done to capture the effect occurring in rural counties.Regarding geography, the NCHS\u2019s Urban-Rural Classification scheme for counties takes into consideration the population density at a county level and ranks the county as being solely urban, a mix of rural and urban, or only rural79 and collect the data by county from the Bureau of Labor Statistics. We also measure the number of service sector workers in a county. Here, we define the service sector using NAICS Sector codes80 Retail Sales (44\u201345) and Accommodation and Food Services (72). We collect this data directly from the Bureau of Labor Statistics (BLS) Quarterly Workforce Indicators (QWI) database. We also separate out counties with above and below median numbers of employees that work in occupations which most likely can be done from home, and therefore already arguably have adequate broadband access. Here, we used the definition provided by Dingel and Neiman and focused on the industry they identified as having the highest share of jobs that can be done completely from home, Educational Services51. This analysis assesses the potential for conducting all work-related tasks from home, which implicitly assumes adequate broadband coverage. We collect this data again directly from BLS QWI database using NAICS Sector code 61.Regarding industry, we separate out the counties with above median numbers of employees working in \u201cHigh Tech Fields\u201d as defined by the National Science Foundation in their Science and Engineering Indicators81. This is the only publicly available data we could find on building density. To assess wifi-enabled libraries, we use data from the Public Library Survey, available from the Institute of Museum and Library Services82. From the total 9245 public libraries included in the initial sample, we only kept those that had either \"External Wifi Access Before COVID-19\" or \"External Wifi Access Added During COVID-19\" and that did not have their legal service area data suppressed. This reduced the total sample to 7626. We summarized by county the unduplicated legal service area which provides an estimate of the number of people each library serves with any potential duplicate people removed. We then replicate the broadband metrics by taking the total number of people with \"access\" to a public library  and divide that by the total county population to get our percent library access for the county.Regarding additional built environment factors for creating the sensor arrays, we select three key supplemental infrastructure systems. To assess the interaction between bridges and broadband, we look at counties with above and below median number of bridges per county using data pulled directly from the National Bridge Inventory for 2020. For buildings, we look at the number of new building permits per state according to the US Census Bureau41. We include education as a regressor because by increasing the broadband coverage in an area, it is likely that individuals who have previously not been able to access other forms of online education, may be able to access additional education, which would in turn result in greater likelihood of future employment. Education may also influence one\u2019s digital literacy to use broadband connectivity for such productive purposes83. We capture the baseline of educational attainment as the number of people over the age of 25 with a Bachelors\u2019 degree and the percentage change in the population over 25 which holds a Bachelors\u2019 degree. We also include aspects of demographics as control metrics, such as the number of people who are Black and Hispanic in each county as demographics can reflect structural barriers or enablers to employment, irrespective of broadband access. These controls are included in all regressions which are run. These datasets are also used, in part, for the splits run on race. We also include population density as a way of controlling for larger cities and urban areas likely receiving \u201ctreatment\u201d of broadband access earlier. We also included year and state fixed effects. For added robustness, we also ran models that included a wider range of controls that include more granular employment levels across several prominent sectors, COVID case loads, amongst other covariates found in prior work 84. These models with such additional controls led to similar and robust results  to a comparable control group in order to understand how the treatment (in this case broadband access) impacts the dependent variables of interest. In essence, this design allows us to compare treatment group counties to highly comparable counterfactual controls to understand what impact broadband access has on unemployment.As we noted previously, we employ a DiD approach for this analysis as it allows the investigation to be structured into a quasi-experimental framework. In this approach, measurements of employment for both control and treatment groups before and after the \u201cshock\u201d of COVID are used as the dependent variables. While varied and assessed in the robustness check for correctness, the baseline analysis establish the control group as any county that has below the industry standard of 25 Mbps download and 3 Mbps upload speedBased off of this, the base regression model is presented in Eq. :1\\documeUnemployment Rate is the average monthly unemployment rate for county i at month t. Broadband is a binary variable, reflecting if the county is above or below the threshold for adequate access to broadband at the given penetration rate. DiD approaches assume treatment and control groups remain constant throughout the analysis, so this should only vary by county i and not by month t. As stated earlier, this is checked and confirmed in Appendix COVID is a binary variable for when COVID began . This impacts all counties, irrespective if they are in the treatment or not, so this impacts month t and not county i. The DiD indicator is the coefficient of the interaction between Broadband \u00d7 COVID. The remaining terms are county-level controls, which vary over space. These variables do not vary by time due to the availability of data of the timeframe analyzed. Therefore, the pre-pandemic (2019) levels for the controls were included to ensure that the pre-pandemic levels are what drove the results and not any post-movements. \u03b5 is the error term. Given the policies were initiated at the state level (see SI Appendix Broadband \u00d7 COVID) and fixed effects for time (month) and unit (state), known as a two-way fixed effect DiD model86, and find similar results. These results are available in Appendix In addition to checking different scenarios for robustness, we also conduct a check on the parallel trends assumption. Figure Inclusion of fixed effects at the state and monthly level . This emulates work done by Isley and Low which includes controls for the percentage of the population employed in NAICS 2-digit industriesControlling for COVID case load Use of the various outlined datasets of broadband access at a county level. This check has been integrated throughout the analysis given how fundamental the critiques are across the different datasets and given the discussion around what each dataset is measuring include a range of other metrics which could create confounding effects.Parametrizing what percentage of the population has access to 25 Mbps download and 3 Mbps of upload speed. This check is also incorporated throughout the paper.Assessing consistency of control and treated groups over time Perturbing when COVID-19 occurred. This includes adjusting the implementation of the shock from March to April of 2020 to show the results are directionally and statistically consistent . This check also included running falsification tests to demonstrate how shifting the shock to a different month (either September 2019 or August 2020) greatly reduces the effects to confirm the findings are due to COVID-19 rather than some other secular trend Running the regressions using Ookla and Mlab data , as they are more appropriate to deploy both within a DiD framework and with panel data88. The results from the generalized synthetic control and Bayesian approaches are both robust and consistent with the results found in the main paper. A more detailed explanation of these methods can be found in the SI Appendix We also ran several supplementary analyses to gauge robustness beyond our core DiD framework. We run a generalized synthetic controls approach89. Perhaps then, COVID-19 infection rates could drive how many take advantage of such a program. To probe into this, we separately did a placebo where we defined the treatment and control groups based on above and below median average COVID-19 cases for July 2020 (a representative month for the time frame we considered90). While we found some significance for these models, these effects greatly diminish once we incorporate the full set of controls . While we cannot think of any other shock that would have occurred at the same time as COVID, we want to consider what impact COVID itself had. For instance, the Emergency Broadband Benefit program provided households with a supplemental income of $50/month to help pay for increased broadband access Supplementary Information."
\ No newline at end of file