diff --git "a/deduped/dedup_0758.jsonl" "b/deduped/dedup_0758.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0758.jsonl"
@@ -0,0 +1,42 @@
+{"text": "Anopheline LF vectors. Six of the communities studied were located within an onchocerciasis treatment zone, and five were located outside of that zone. Communities inside the treatment zone had been offered ivermectin treatment for two-five years, with a mean coverage of 81% of the eligible population (range 58\u201395%). We found 4.9% of mosquitoes were infected with any larval stage of W. bancrofti in the head or thorax in 362 dissections in the untreated villages compared to 4.7% infected in 549 dissections in the ivermectin treated villages . We concluded that ivermectin annual therapy for onchocerciasis has not interrupted transmission of Wuchereria bancrofti (the causative agent of LF in Nigeria).There has long been interest in determining if mass ivermectin administration for onchocerciasis has 'unknowingly' interrupted lymphatic filariasis (LF) transmission where the endemicity of the two diseases' overlaps. We studied 11 communities in central Nigeria entomologically for LF by performing mosquito dissections on  Simulium black flies, and LF by Anopheline mosquitoes in rural Africa. Merck and Co. donates ivermectin (Mectizan\u00ae) to global control programmes for both these parasitic diseases, although annual ivermectin in combination with albendazole (donated by GlaxoSmithKline) is recommended by WHO for the treatment of LF in Africa, because of the presumed synergy [Ivermectin is an effective microfilaricidal oral medication that is being distributed in mass drug administration programmes for two filarial diseases, onchocerciasis  and lymp synergy ,5, altho synergy .Anopheline entomological sampling for LF in and outside of onchocerciasis programme zones.Of the two initiatives, the oldest is that for onchocerciasis and ivermectin has been distributed in annual ivermectin monotherapy (150 micrograms/kg) programmes in Africa for over 16 years . We had Anopheles gambiae sl and An. funestus in randomly selected households in 11 villages, 5 of which were outside of the onchocerciasis ivermectin treatment zone, and 6 were inside the treatment zone. Treatment coverage for those six ivermectin treatment villages during the years 1995\u20131999 ranged from 58\u201395% of the eligible population  and the highest antigenemia rate (58%). However, no statistically significant entomological differences could be demonstrated between the villages in treated and untreated zones : 4.9% of mosquitoes were infected in 362 dissections in the untreated villages compared to 4.7% infected in 549 dissections in the ivermectin treated villages .In contrast LF antigenemia Table  was lessWe conclude therefore, that ivermectin monotherapy for onchocerciasis has not been sufficient to interrupt transmission of LF in central Nigeria. Among treated villages, mosquito infection rates in treated and untreated areas were statistically equivalent, and antigenemia rates in treated villages were unacceptably high . Mosquito infection rates were indeed highest in the two villages (Lankan and Mungkohot) with the longest treatment history (5 years) with adequate coverage. Our conclusion is in support of the findings of Kyelem et al.,  who, worThe author(s) declare that they have no competing interests.Drs. Richards, Eigege, Jinadu, and Miri and Professor Oneyka were involved in the design, supervision, analysis and preparation of the manuscript. Mr. Pam and Mr. Kal supervised the fieldwork and performed the dissections, under the field supervision of Professor Oneyka. Ms Lenhart played a major role in data analysis."}
+{"text": "Using a bacterial fusion protein, a deleted colorectal carcinoma (DCC)-specific monoclonal antibody (MAb) 127-22 was established. Although MAb 127-22 reacted with almost all normal tissues, it did not react or only weakly reacted with many cancer cell lines, including colonic cancer lines, in flow cytometry. In Western immunoblots, the MAb reacted with a single 190-kDa molecule in a myeloma line Ara-10 extract. This component was scarcely detected in colonic cancer cell lines. Immunoblots of samples from 25 pairs of colonic cancers and adjacent normal tissues and from five adenoma tissues revealed that all normal colonic and adenoma tissues significantly expressed the DCC protein, whereas colonic cancer tissues showed poor expression. These results indicate not only deletion of and lowered mRNA expression of the DCC gene, but also marked reduction of DCC protein occurred in colonic cancer tissues. In addition, colonic cancer patients with liver metastasis expressed significantly lower levels of DCC than those without, suggesting the prognostic value of DCC expression."}
+{"text": "ApoER2 is a member of the low density-lipoprotein receptor (LDL-R) family. As a receptor for reelin, ApoER2 participates in neuronal migration during development as well as synaptic plasticity and survival in the adult brain. A previous yeast two-hybrid screen showed that ApoER2 is a binding partner of sorting nexin 17 (SNX17) - a cytosolic adaptor protein that regulates the trafficking of several membrane proteins in the endosomal pathway, including LRP1, P-selectin and integrins. However, no further studies have been performed to investigate the role of SNX17 in ApoER2 trafficking and function. In this study, we present evidence based on GST pull-down and inmunoprecipitation assays that the cytoplasmic NPxY endocytosis motif of ApoER2 interacts with the FERM domain of SNX17. SNX17 stimulates ApoER2 recycling in different cell lines including neurons without affecting its endocytic rate and also facilitates the transport of ApoER2 from the early endosomes to the recycling endosomes. The reduction of SNX17 was associated with accumulation of an ApoER2 carboxy-terminal fragment (CTF). In addition, in SNX17 knockdown cells, constitutive ApoER2 degradation was not modified, whereas reelin-induced ApoER2 degradation was increased, implying that SNX17 is a regulator of the receptor's half-life. Finally, in SNX17 silenced hippocampal and cortical neurons, we underscored a positive role of this endosomal protein in the development of the dendritic tree and reelin signaling. Overall, these results establish the role of SNX17 in ApoER2 trafficking and function and aid in identifying new links between endocytic trafficking and receptor signaling. ApoER2 is a member of the LDL-R family that is expressed in neurons, platelets, ovaries, epididymis, placenta and brain ApoER2 is constitutively internalized, and this process can also be induced by its ligand, reelin. Therefore, its cell surface expression is dependent on its clathrin-mediated internalization Similarly to APP, ApoER2 is proteolytically processed by secretases In this report, we present evidence showing that the ApoER2-SNX17 interaction depends on the cytoplasmic NPxY endocytosis/signaling motif of the receptor. SNX17 knock down (KD) was associated with an inhibition of ApoER2 recycling by inducing its retention in the Rab5-positive early endosomal compartment, and delaying its trafficking to the Rab11-positive recycling compartment. In SNX17 knockdown cells, there was an accumulation of ApoER2-CTF and the reelin induced receptor degradation was increased. These results relate the endocytic/recycling route of ApoER2 with the receptor half-life, which is regulated by reelin. Finally, the neuronal function of ApoER2 was found to be altered in SNX17 knockdown hippocampal and cortical neurons. We observed a significant decrease in the response to reelin in this system. This decrease was reflected by a partial but significant inhibition in dendritic outgrowth as well asa decrease in the signaling pathway, which was indicated by the altered phosphorylation levels of Dab1, AKT, GSK3\u03b2 and the ApoER2-specific target n-cofilin. These results highlight the importance of the SNX17-regulated link between ApoER2 trafficking and its signaling properties.DMEM, L-glutamine, penicillin-streptomycin, and trypsin were purchased from Gibco . Fetal bovine serum (FBS) was purchased from Hyclone . Individual protease inhibitors, puromycin, cycloheximide (CHX), and all chemical reagents were purchased from Sigma-Aldrich. The polyclonal anti-SNX17 antibody was raised against a 14-amino-acid peptide corresponding to the carboxyl-terminal region of SNX17 protein as previously described HEK 293 and HeLa cells were maintained in DMEM with 10% fetal bovine serum (FBS) (Sigma) and L-glutamine (Invitrogen). Parental N2a were grown in DMEM with 7.5% FBS. All media were supplemented with 100 U penicillin, 1 U streptomycin, and 5 \u03bcg/mL plasmocin. HA-ApoER2- and HA-ApoER2-NPxA-expressing N2a cells The protocols to obtain neurons from rat embryos were carried out with approval from the Bioethical Board for animal studies at the Facultad de Ciencias Biol\u00f3gicas and according to the Guide for the Care and Use of Laboratory Animals of CONICYT. Hippocampal and cortical neurons were cultured as described For lentivirus production, HEK 293T cells were transfected with empty pLKO.1 or the appropriate shRNA-containing pLKO.1 construct together with the pCMVR8.91 and pCMV-VSV-G packaging systems as described previously To infect neurons, virus supernatants from transfected HEK293 cells were collected in Optimem. The supernatant was concentrated and purified by ultrafiltration using Amicon Ultra 100K (Millipore). The resultant viral particles were stored at -80\u00b0C. Virus titer was calculated by dilution limit and resistance to puromycin colony formation.Escherichia coli (BL21) and lysed with PBS, 1% Triton X-100, 10 mM EDTA, and 1X complete protease inhibitor mixture. The proteins were purified and then sequentially dialyzed against PBS, 250 mM NaCl, 50 mM Tris\u2013HCl (pH 8.0), and 5.0 mM Tris\u2013HCl (pH 8.0). HEK293 cells were transfected with the HA tagged- ApoER2 expressing plasmids or plasmids for myc-SNX17 constructs using the calcium phosphate method. Cell extracts were prepared by lysing the cells with HUNT buffer . The cell extracts were incubated with GST fusion proteins and bound to glutathione agarose beads for 3 h at 4\u00b0C. The beads were washed three times in HUNT buffer, boiled in 2X sample buffer, and separated by SDS-PAGE. The presence of SNX17 or ApoER2 was determined by western blot analysis using the appropriate anti-myc or anti-HA monoclonal antibody.GST-fusion proteins were prepared as described previously FACS analyses of surface and total ApoER2 was performed as previously described 4 cells were plated in 12-well dishes. Twenty-four hours later, the cells were incubated with 1 \u03bcg/mL anti-HA antibody labeled with Alexa 488 in binding buffer  for 1 h at 4\u00b0C. Cells were shifted to 37\u00b0C during the indicated time period to allow for receptor internalization; the cells were incubated with PBS-EDTA and washed with PFN. The remaining antibody on the surface was removed by an acid wash by incubating the cells with stripping buffer  for 5 min. As a control for the total surface-bound antibody, cells without the acid wash were analyzed. All conditions were analyzed by FACS. The endocytic rate was calculated by subtracting the value of the cells exposed to the acid wash at time 0 (A0) from each time point, and dividing by A0.Endocytosis analysis by FACS was conducted as previously described 4 cells were plated in 12-well plates. The day after plating, the cells were incubated with 1 \u03bcg/mL anti-HA antibody labeled with Alexa 488 in binding buffer  for 30 min at 37\u00b0C to allow for receptor internalization and trafficking. Cells were washed twice with binding buffer, and the recycled receptors were chased at the surface with a quenching anti-Alexa 488 antibody at the indicated times. As a control for the fluorescence remaining for each time point, cells were incubated in binding buffer during the chase time . Cells were analyzed by cell cytometry and the percentage of the initial fluorescence remaining at each time point was calculated as the difference between time 0 and each chased time point. Every time point (including time 0) was normalized to the non-chased value. The percentage of recycling efficiency was calculated by subtracting the percentage of internal fluorescence from 100.Determination of ApoER2 recycling by FACS was performed as described previously All FACS data analyses were conducted using the Weasel program and analyzed using GraphPad 4.6 N2a cell clones were plated in 100-mm plates (four plates for each condition), and 24 h later the cells were lysed mechanically using a glass dounce homogenizer. The post-nuclear supernatant (PNS) was prepared by centrifugation for 15 min at 1500 g. The PNS was adjusted to 40.2% sucrose and loaded in the bottom of a Tst 60.4 tube. Then, 1.5 mL of 35% sucrose solution and 1 mL of 25% of sucrose solution were added sequentially, followed by homogenization buffer  to fill the rest of the tube. The samples were centrifuged for 1 h at 34,000 rpm using a Tst 60.4 rotor. Early and recycling endosomes were collected in the 25%/35% interface and late endosomes in the top 25%. Fractions were precipitated by the methanol/chloroform method as previously described Subcellular fractionation was performed as previously described http://rsb.info.nih.gov/ij/plugins/track/jacop.htlm). For each individual condition (n\u200a=\u200a10 cells per condition), a statistical analysis of the correlation of the fluorescence signal of green and red pixels in the dual-channel image was performed using Pearson's and Mander's coefficients and the Van Steensel's approach. The amount of total fluorescent signal in the red channel that overlapped with the total fluorescent signal in the green channel was shown in the graphic.HeLa cells stably expressing pLKO or shRNA against SNX17 were transfected with HA-ApoER2, RAP and GFP-Rab5, GFP-Rab7, or GFP-Rab11 using the Lipofectamine protocol; 48 h later, the cells were incubated with anti-HA antibody for 2 h at 4\u00b0C. After that, the cells were incubated at 37\u00b0C for the corresponding time to allow for internalization. The cells were washed twice with PBS, and the remaining surface antibody was removed by acid wash by incubating the cells in stripping buffer  for 5 min. Cells were washed twice with PBS, fixed with 4% paraformaldehyde for 20 min, and permeabilized with 0.1% Triton X-100 in PBS. Intracellular localization of the receptor was detected with goat anti-mouse Alexa-594 antibody, and confocal microscopy was performed using a laser scanning LSM 510 Zeiss microscope and a 63 X oil immersion lens . The images were deconvolved using the nearest neighbor algorithm of Methamorph version 6.0r1 software (Molecular Devices). Colocalization was quantified using the JACoP plugin of the ImageJ software  using the Lipofectamine method. Forty-eight hours later, the cells were fixed with 4% PFA and 4% sucrose for 20 min at 37\u00b0C. For cell surface staining, the cells were incubated for 30 min with a mouse anti-HA antibody and a rabbit anti-ApoER2 tail antibody that recognizes the intracellular tail (to identify non-specific permeabilization), and the surface attached antibodies were fixed with 4% PFA and 4% sucrose. Next, cells were washed, permeabilized, and incubated with a chicken anti-HA antibody to identify the intracellularApoER2. The cells were incubated with secondary antibodies, and stained cells were observed and analyzed with an inverted LSM 510 Zeiss microscope with a 63 X oil immersion lens. Individual cell images (n\u200a=\u200a10 for each condition) were acquired with identical settings for laser power, photomultiplier gain, offset, and a fixed pinhole size. The images were analyzed using ImageJ software. A threshold for each channel was selected to avoid background, and the integrated fluorescence intensity was calculated. Total fluorescence was calculated by adding the fluorescence of the permeabilized and non-permeabilized channels.Surface/total analysis was performed as described previously 6 mouse dissociated cortical neurons were infected with lentivirus expressing shRNA for SNX17 or control (pLKO) at DIV 4 with a MOI (multiplicity of infection) of 1. Three days after infection, the cells were lysed as described above.The ApoER2-expressing cells lines, SNX17 knockdown cells, or controls were lysed in 1% Triton X-100 in PBS containing protease inhibitors, and the proteins in the lysates were resolved in Tris/Tricine gels and analyzed by western blot using an antibody that recognizes the cytoplasmic tail of ApoER2 in vitro using an APP-CTF-derived intramolecularly quenched fluorescent peptide  according to the manufacturer's instructions and as described The \u03b3-secretase activity was assayed Recombinant mouse reelin was obtained from HEK 293 cells stably expressing the full-length protein. Cells were cultured to produce reelin-conditioned medium exactly as described 5 cells per well). Two days after transfection, the cells were washed with depletion medium and incubated with 150 \u03bcCi of [35S]Met/Cys per well for 90 min, followed by chasing in medium without [35S]Met/Cys and a 10-fold excess concentration of cold Met and Cys for different times. After each time point, cells were lysed in 1% Triton X-100 in PBS and incubated with anti-HA at 4\u00b0C for 4 h. The immune complexes were recovered with protein A-agarose beads. Immunoprecipitated proteins were released from the beads by boiling in Laemmli sample buffer under reducing conditions and were analyzed by SDS-PAGE and autoradiography.The effects of SNX17 silencing on the ApoER2 half-life under non-stimulated conditions were determined by the detection of mature and immature ApoER2 by western blot of cell lysates from silenced and control N2a cells and by pulse-chase experiments. These experiments were performed in HEK 293 clones transfected with HA-ApoER2 and RAP. Cells were trypsinized and plated in 6-well plates  were resolved in Tris/Tricine gels and analyzed by western blot.5 mouse dissociated cortical neurons were transfected at DIV 4 with a GFP expression plasmid and the corresponding shRNA plasmid (0.3 \u03bcg each) using Lipofectamine 2000. After 3 days, cells were treated with reelin for 20 min at 37\u00b0C. The cells were fixed with 4% PFA and 4% sucrose for 20 min and processed for immunofluorescence using anti-\u03b2III-tubulin antibody (1\u22362000 dilution) and anti-phospho- Dab1 (1\u2236250) or anti-phospho- cofilin (1\u2236500). The cells were then stained with the appropriate secondary antibodies, and images of individual cells (n\u200a=\u200a10 for each condition) were captured with an inverted LSM 510 Zeiss microscope with a 63 X oil immersion lens. The images were analyzed using ImageJ software. The thresholds for each channel were selected to avoid background, and the integrated fluorescence intensity of the soma was calculated. All data were analyzed with GraphPad Prism 4 software using Student's t-test, and displayed as the mean +/- SEM.For measurement of Dab1 and cofilin phosphorylation in response to reelin, 1\u00d7106 mouse dissociated cortical neurons were infected at DIV 4 with a MOI (multiplicity of infection) of 1. Three days after infection, the cells were incubated with concentrated recombinant reelin for 20 min at 37\u00b0C and were lysed in 1% Triton X-100 in PBS containing protease and phosphatase inhibitors, okadaic acid, sodium fluoride, \u03b2-glycerol phosphate, and sodium orthovanadate. Dab1 was immunoprecipitated by incubating the cell lysate with protein A-sepharose pre-bound to Dab1 antibody for 4 h at 4\u00b0C. The beads were washed three times with PBS, boiled in 2X sample buffer, separated by SDS-PAGE, and total and phosphorylated Dab1 were analyzed by western blot. The presence of SNX17, total and phosphorylated AKT and GSK3\u03b2 were determined in the lysates. The effect of reelin on the dendritic outgrowth was determined in dissociated hippocampal neurons. Briefly, 1\u00d7105 mouse neurons were transfected with a GFP expression plasmid and the corresponding shRNA plasmids (0.3 \u03bcg each) after attachment at DIV 0, using Lipofectamine 2000. The cells were treated with recombinant reelin from DIV 2 to DIV 4, with the reelin being replenished every 24 h. At DIV 5, cells were fixed with 4% PFA and 4% sucrose for 20 min and processed for immunofluorescence with anti-\u03b2III-tubulin antibody to identify neurons. Individual cell images of \u03b2III-tubulin and GFP-positive cells (n\u200a=\u200a20 for each condition) were captured with an LSM 510 Zeiss inverted microscope with a 63 X oil immersion lens. The images were analyzed using ImageJ software; stacks were reconstructed as one image, and the GFP channel images were analyzed with the ImageJ Sholl analysis plugin using a 10-\u03bcm radius increase. Number and length quantitation was performed by making tracings using the Neuron J plugin The activation of different targets of the reelin signaling pathway was determined by western blot, as previously described All data were analyzed with GraphPad Prism 4 software using Student's t-test, and the data are expressed as the mean +/\u2212 SE.SNX17 is a multidomain adaptor protein containing a PX domain, an atypical FERM domain containing three subdomains or modules , and a carboxy-terminal region Because SNX17 has been associated with different steps of the endocytic pathway Figure S1 A). This effect was dependent on the simultaneous presence of the PX domain and FERM domains of SNX17, because neither the expression of the SNX17 truncated form 2\u2013250 that lacks FERM F3 subdomain, nor the 105\u2013470 that lacks the PX domain but has the complete FERM domain, were able to recover the cell surface levels of ApoER2 .To address whether SNX17 has an active role in the endocytic behavior of ApoER2, we silenced SNX17 in HEK 293 cells using a lentivirus system expressing shRNA against human SNX17 and also generated a control cell line by infecting the cells with a control lentivirus , again indicating that SNX17 does not participate in the internalization rate or the arrival of the receptor to the early endosome compartment. In agreement with the subcellular fractionation results, we did not observe a major difference in the colocalization of ApoER2 with the late endosome marker GFP-Rab7 in the silenced cells compared with the control cells  and Rab11 (recycling endosome marker). SNX17 knockdown HeLa cells were transfected with HA-ApoER2 and GFP-Rab5, GFP-Rab11 or GFP-Rab7 (to identify late endosomes). ApoER2 was labeled at the cell surface with anti-HA antibody for 2 h at 4\u00b0C, followed by incubation of the cells for 40 min at 37\u00b0C to allow for its internalization and endosomal distribution. The antibodies remaining at the cell surface were removed by an acid wash. The cells were fixed and analyzed by confocal microscopy to determine the percentage of receptor colocalization with the different Rabs. As shown in Figure S1 D).Several lines of evidence relate ApoER2 trafficking with its susceptibility to proteolytic processing by the \u03b1-secretases of the ADAM family and by the \u03b3-secretase complex Figure S3), this result suggests that the lack of CTF processing could be due to altered localizations of the substrate (accumulated in early endosome) respect of the enzymatic complex.The accumulation of the ApoER2 CTF in SNX17 knockdown cells suggests at least two different scenarios. The first is an increase in the first proteolytic step by \u03b1-secretase (shedding), and the second is a decrease in the second proteolytic step by the \u03b3-secretase complex. To gain insight into the underlying mechanism of ApoER2 CTF accumulation upon SNX17 knockdown, we incubated SNX17 knockdown and control N2a cells with DAPT, a \u03b3-secretase inhibitor, and analyzed the ApoER2 CTF level by western blot. As shown (To verify the role of SNX17 under conditions in which ApoER2 is degraded in the lysosome Methods S1). The neurons transfected with SNX17 shRNA showed a visible reduction in SNX17 expression . To analyze the effect of SNX17 on ApoER2 cell surface levels, cortical neurons were co-transfected with plasmids for HA-ApoER2 and SNX17 shRNA. The intracellular and cell surface levels of ApoER2 were evaluated with different anti-HA antibodies (mouse and chicken). As is shown in Our previous observations in cells lines and the known neuronal role of ApoER2 led us to analyze the effect of SNX17 knockdown in the trafficking and function of ApoER2 in primary cultured neurons. Initially, we tested the ability of the available shRNA to knock down SNX17 and visualize this reduction by indirect inmunofluorescence. Mouse cortical neurons at DIV 5 were cotransfected with a plasmid encoding GFP and either a plasmid containing shRNA against SNX17 or pLKO as a control. Two days later, the neurons were fixed, and SNX17 expression was determined . In SNX17 knockdown neurons, the number of primary dendrites was not changed, but a reduced number of secondary dendrites were observed under basal and reelin stimulation conditions while shorter primary and secondary dendrites were observed when the neurons were stimulated with reelin.The neuronal function of ApoER2 was previously shown to be associated with the signaling pathway triggered upon reelin binding. Therefore, we tested whether a reduction in the level of the receptor at the cell surface, which was observed under the SNX17 knockdown condition, affects this signaling pathway. Long-term treatment with reelin stimulates dendritic development in a lipoprotein receptor-dependent and adaptor protein Dab1 phosphorylation-dependent manner Moreover, we analyzed the requirement of SNX17 for the reelin signaling pathway after a short-term stimulation of cortical neurons. Silenced and control cortical neurons were incubated with conditioned medium containing reelin for 20 min. Knockdown neurons exhibited a considerable decrease in the activation of downstream reelin effectors, specifically the phosphorylation levels of the adaptor protein Dab1 as analyzed by immunofluorescence Figure 9In this paper, we uncovered an important role of SNX17 in ApoER2 trafficking and function. SNX17, by interacting with the ApoER2 cytoplasmic domain, facilitates receptor exit from a Rab5 to a Rab11 endosomal compartment and its recycling to the cell surface. These mechanisms influence ApoER2 cell surface levels and the reelin-induced signaling properties. In addition, we found that SNX17 participates in the reelin-induced receptor degradation pathway and regulates the processing of the carboxy-terminal fragment of ApoER2.in vitro interaction but was required for the function of SNX17 in the regulation of ApoER2 cell surface expression. Both the PX domain and the FERM domain, through binding to the cargo, are required for the recruitment of SNX17 to the endosomal membrane We first determined that the region responsible for the interaction with ApoER2 corresponded to amino acids 105 to 470 of SNX17, which were translated to to the F1, F2 and F3 subdomains of the SNX17 FERM domain and the C-terminal region In addition, we determined that the multifunctional NPxY motif of ApoER2 is responsible for the interaction with SNX17.This falls in agreement with previous reports showing the interaction of SNX17 with the NPxY motif of LRP1, LDL-R, APP SNX17 is an adaptor protein that is localized in the early endosome compartment SNX17 has been related to different steps in endocytic trafficking, including increasing endocytosis, recycling, and/or affecting degradation of membrane proteins that bind to it The knockdown of SNX17 resulted in significant retention of ApoER2 in the early endosomes after endocytosis, suggesting a role for SNX17 in the exit of ApoER2 from the early endosomal compartment. Accordingly, it has been shown that SNX17 localizes in the tubular domain of the early endosome, which is related to the recycling pathway The role of SNX17 in ApoER2 recycling is dependent on the specific interaction with the receptor and is not caused by a general effect on the endosomal compartment because SNX17 knockdown did not affect the recycling of megalin/LRP2 In addition to Dab1, a number of adaptors proteins, including Dab2, Fe65, and X11\u03b1/Mint, bind to the ApoER2 cytoplasmic domain and regulate its trafficking and signaling Signaling receptors can be degraded or recycled to the surface after binding of their ligands To specifically evaluate the role of SNX17 in the reelin signaling pathway, SNX17 was silenced in hippocampal and cortical neurons. Reelin has essential roles in neuronal development, in the regulation of synaptic function and in neuronal survival Finally, we also determined that SNX17 alters the most common effect induced by long-term reelin treatment, which is the increase in the dendritic arborization Until now, we have centered the discussion of the neuronal roles of SNX17 and the consequences of its decrease on its effect on reelin signaling receptors, especially ApoER2. However, it is important to note that other signaling pathways could be regulated by SNX17, considering its other receptor partners. The lipoprotein receptor LRP1 has neuronal functions and has been shown to be involved in transmitter-dependent post-synaptic responses caused by its interaction with the post-synaptic proteins PSD-95 and NMDA In summary, our results show that SNX17, by interacting with the NPxY domain of ApoER2, facilitates its trafficking from early endosomes to recycling endosomes and to the plasma membrane. As the receptor CTF is, in principle, also able to interact with SNX17 this could explain the effect of SNX17 silencing in CTF accumulation. Interestingly, the role of SNX17 in receptor half-life would be dependent on the endocytosis \u201cmode\u201d of ApoER2, protecting the receptor from degradation when the receptor is engaged in reelin internalization. Therefore, the presence of SNX17 would be necessary for an optimal ApoER2/reelin-mediated signaling activation in neurons and may function, by positively regulating the cell surface level of the receptor.Figure S1A) Levels of SNX17 from one representative experiment corresponding to B,C) In addition to the role of the full length SNX17, the ability to recover the phenotype was determined for different deletion constructs, SNX17-2-250 corresponding to a deletion of the F3 subdomain (that does not bind ApoER2 in GST pull down assay) and the SNX17 105\u2013470, lacking the PX domain (that binds to ApoER2 in the GST-pull down assay) (D) Levels of SNX17 from one representative experiment corresponding to Expression levels of endogenous and transfected myc-SNX17 in control and SNX17 silenced cells. In order to recover the cell surface expression of ApoER2 reduced by silencing SNX17, control (pLKO) or SNX17 knockdown HEK293 cells were co-transfected with ApoER2 and either with pCDNA3 , or myc-SNX17 (+) from mouse. To detect the expression levels of SNX17, the cells were lysed and the presence of the adaptor protein was visualized by western blot with a rabbit polyclonal anti SNX17 antibody. (n assay) ; the pre(TIF)Click here for additional data file.Figure S2SNX17 knockdown does not alter ApoER2 arrival to the early endosome. HeLa pLKO and SNX17 silenced clones were transfected with HA-ApoER2, RAP, and GFP-Rab5. Cells were incubated with anti-HA antibody for 1 h at 4\u00b0C and then shifted to 37\u00b0C for 10 min to allow for receptor internalization. After this period of time, the antibody remaining at the surface was removed by acid wash. Cells were washed, permeabilized, and incubated with Alexa 594-conjugated goat anti-mouse IgG. Images were captured by confocal microscopy, and Mander's colocalization index and Pearson's coefficient were calculated in 10 cells for each condition. Bars, 10 \u03bcm.(TIF)Click here for additional data file.Figure S3The activity of \u03b3-secretase is not modified in cells with reduced levels of SNX17. Control (pLKO) or SNX17 knockdown N2a cells expressing ApoER2 were lysed in CHAPSO buffer. Measurement of \u03b3-secretase activity was performed using a fluorogenic substrate assay, which is based on the secretase-dependent cleavage of a -secretase-specific substrate conjugated with a fluorescent molecule.(TIF)Click here for additional data file.Figure S4SNX17 knockdown in neurons. Mouse dissociated cortical neurons were transfected at DIV 5 with GFP and the corresponding shRNA plasmid. After 48 h, cells were fixed and analyzed by immunofluorescence using an anti-SNX17 antibody. The figure shows that when cells are positive for GFP, they are also negative for SNX17 in the neurons transfected with SNX17 shRNA.(TIF)Click here for additional data file.Figure S5SNX17 knockdown alters the number and length of dendrites induced by reelin. Mouse dissociated hippocampal neurons were transfected with GFP expression plasmid and the corresponding shRNA, plasmid. After three days, the neurons were treated with reelin for 3 days, fixed, and analyzed by immunofluorescence. Images were captured by confocal microscopy. Quantitative analysis of the length and number of primary and secondary dendrites was performed by making individual tracings and using the Neuron J plugin. The lengths of primary and secondary neurites were significantly reduced upon reelin treatment in SNX17 knockdown neurons, whereas only secondary neurites were reduced in number in the silenced neurons. *p<0.05; **p<0.01.(TIF)Click here for additional data file.Methods S15 mouse dissociated cortical neurons were transfected at DIV 4 with GFP and the corresponding shRNA plasmid (0.3 \u03bcg each) using Lipofectamine 2000. After 3 days, the cells were fixed with 4% PFA and 4% sucrose for 20 min and processed for immunofluorescence with a rabbit anti-SNX17 (1\u2236250). Later cells were stained with an Alexa 555-conjugated anti-rabbit antibody. Images of individual cells were captured with an inverted LSM 510 Zeiss microscope with a 63 X oil immersion lens, and images were analyzed using ImageJ software.SNX17 silencing in neurons. A total of 1\u00d710(DOCX)Click here for additional data file."}
+{"text": "Mus spretus mice are highly resistant to several types of cancer compared to Mus musculus mice. To determine whether differences in microRNA (miRNA) expression account for some of the differences in observed skin cancer susceptibility between the strains, we performed miRNA expression profiling of skin RNA for over 300 miRNAs. Five miRNAs, miR-1, miR-124a-3, miR-133a, miR-134, miR-206, were differentially expressed by array and/or qPCR. miR-1 was previously shown to have tumor suppressing abilities in multiple tumor types. We found miR-1 expression to be lower in mouse cutaneous squamous cell carcinomas (cSCCs) compared to normal skin. Based on the literature and our expression data, we performed detailed studies on predicted miR-1 targets and evaluated the effect of miR-1 expression on two murine cSCC cell lines, A5 and B9. Following transfection of miR-1, we found decreased mRNA expression of three validated miR-1 targets, Met, Twf1 and Ets1 and one novel target Bag4. Decreased expression of Ets1 was confirmed by Western analysis and by 3\u2019 reporter luciferase assays containing wildtype and mutated Ets1 3\u2019UTR. We evaluated the effect of miR-1 on multiple tumor phenotypes including apoptosis, proliferation, cell cycle and migration. In A5 cells, expression of miR-1 led to decreased proliferation compared to a control miR. miR-1 expression also led to increased apoptosis at later time points (72 and 96 h) and to a decrease in cells in S-phase. In summary, we identified five miRNAs with differential expression between cancer resistant and cancer susceptible mice and found that miR-1, a candidate tumor suppressor, has targets with defined roles in tumorigenesis. Mus Spretus mice are resistant to several cancer types including skin, colon, lung and thymic lymphoma (M. Spretus has been used for quantitative trait locus (QTL) mapping for cancer susceptibility loci (lymphoma . Due to ity loci . To dateity loci .MicroRNAs (miRNAs) are short RNAs of 20-22 nucleotides with well-documented roles in gene regulation . They biM. spretus (SPRET/EiJ) mice and skin cancer susceptible M. musculus (FVB/NJ) mice could be considered as candidates for cancer susceptibility. To identify miRNAs which may play a role in differences in cancer susceptibility between SPRET/EiJ and FVB/NJ, we performed expression profiling on normal skin samples from these strains of mice. Five differentially expressed miRNAs with described roles in tumorigenesis were identified and validated. Based on our observations and reports in the literature supporting miR-1 as having tumor suppressor function in a variety of cancer types (miR-1 acts as a tumor suppressor in cutaneous squamous cell carcinoma (cSCC). Here, we describe the effects of expressing miR-1 in cSCC cells and the identification of Ets1, as a miR-1 target in the mouse.Because of the strong correlation between miRNA expression and tumorigenesis, we hypothesized that miRNAs showing differential expression between skin cancer resistant er types , we hypoAnimal studies were approved by the Ohio State University (OSU) and University of California, San Francisco Institutional Animal Care and Use Committees. The OSU IACUC determined that the research performed at OSU was exempt from IACUC review as pre-existing or commercially available animal specimens were used for this study. Fresh frozen skin samples from three FVB/NJ and three SPRET/EiJ female mice aged 4\u20135 weeks were obtained through the Jackson Laboratory surgical service. RNA was isolated from the skin using standard Trizol extractions . We isolated RNA a second time from two of the skin samples to generate a replicate control for the microarrays. Samples were DNAase treated. RNA was quantitated using Nanodrop . RNA was isolated from eleven cSCCs from chemically treated C57Bl6/FVB F1 mice using standard Trizol methods. RNA samples were DNAase treated.t-statistic was employed for this study  validation of candidate miRNAs. qPCR was performed using Applied Biosystems TaqMan probes to validate expression of the six candidate miRNAs . Probes were specific to either mature  or precursor  miRNAs concordant with the array results. Reverse transcription for mature miRNAs was performed using Applied Biosystem\u2019s High Capacity cDNA Reverse Transcription reagents according to manufacturer\u2019s protocol in 7.5 \u00b5l reactions . Three independent skin RNA samples were used for each strain from samples not used on the original arrays. qPCR of miR-1 levels from eleven primary mouse cSCCs was conducted as for normal skin. For miRNA quantification, real-time PCR was performed using Applied Biosystem TaqMan Assays per manufacturer\u2019s recommended conditions. All samples were done in triplicate. qPCR runs included no template and no-reverse transcriptase controls. Expression was normalized to expression levels for sno202 RNA for mature miRNAs or to L19 for pri-miRNAs. qPCR was conducted using Applied Biosystems 7900HT instrument. Cycle threshold (CT) values were averaged across triplicates and delta CT values were calculated between each test miRNA and control. The fold expression of SPRET/EiJ miRNA relative to FVB/NJ was calculated. Standard deviations of fold differences of the percentage of reference gene expression were made by comparisons between independent RNA samples of each of the test samples. Student\u2019s t-test was used to calculate p-values for the qPCR. A nonparametric Mann-Whitney U test was performed to test for differences between miR-1 expression in tumors versus SPRET/EiJ and FVB normal skin.qPCR of predicted mRNA targets. To measure expression of predicted targets, mRNA expression was measured at 48 and 72 h post miR-1 or scrambled precursor miR negative control transfection in A5 cells and at 48, 72 and 96 h post-transfection in B9 cells using SYBR green quantitative real-time PCR. Reverse transcription of mRNA was performed using a Bio-Rad iScript cDNA synthesis kit according to manufacturer\u2019s recommended conditions. Primers were designed using Integrated DNA Technologies. Target gene expression was measured using Bio-Rad SYBR Green Supermix in 10 \u00b5l reactions according to manufacturer\u2019s protocol. qPCR of each sample was performed in triplicate and was used to measure Ets1, Met, Bag4, Twf1, Sp1, Taok1, Zfp148 and Trp53 target gene expression. The following primer sets were used. Ets1: Forward: 5\u2019 TGTATGAGTGGAGCAGCACTGTGT 3\u2019, Reverse: 5\u2019 AGGTAGGGTCTCCATTAACCT 3\u2019, Met: Forward: 5\u2019 AACGGGTATTGGGAAGACCCTGAA 3\u2019, Reverse: 5\u2019 ATCCCGTCTAACAGGAAGAAGGCT 3\u2019, Bag4: Forward: 5\u2019 ACTCCACGGAAGTTCCAA ACACCT 3\u2019, Reverse: 5\u2019 TTCCAGGGTTCTGTGAAGCAGGAT 3\u2019, Twf1: Forward 5\u2019 TTCCAGGCTTTGGAGAAGGTGAGT 3\u2019, Reverse: 5\u2019 AGTCTCCTTCGTGGGAATGCTTGT 3\u2019, Sp1: Forward 5\u2019 TGCGGCAAAGTATATGGCAAGACC 3\u2019, Reverse 5\u2019 ACTCCTCATGAAACGCTTAGGGCA 3\u2019, Taok1: Forward 5\u2019 GAACCAGGCCAAGTGAAACTTGCT 3\u2019, Reverse 5\u2019 AAAGGAGGCTTCCTCTCGGCTAAT 3\u2019, Zfp148: Forward 5\u2019 GCACTGCAATGCTGCCTTTAGAAC 3\u2019, Reverse 5\u2019 TTTCGCCGGTATGGATCTTCTCGT 3\u2019, Trp53: Forward 5\u2019 ACAAGAAGTCACAGCACATGACGG 3\u2019, Reverse 5\u2019 TTCCTTCCACCCGGATAAGATGCT 3\u2019, and L19: Forward: 5\u2019 ATTCCCGGGCTCGTTGCCGGAAAA 3\u2019, Reverse: 5\u2019 ATTGGCAGTACCCTTCCTCTTCCCTA 3\u2019. Candidate targets were normalized to L19 expression and fold difference relative to the scrambled control at 48 h post-transfection were calculated. Standard deviations of fold differences of the percentage of reference gene expression were made by comparisons between independent RNA samples. Experiments included no template and no reverse transcriptase controls for each gene. Student\u2019s t-test was used to calculate p-values.qPCR confirmation of transfections. RNA was isolated from a duplicate well for each mock, scrambled control or miR-1 transfected experiment to confirm increased miR-1 expression in the miR-1 transfected cells. qPCR for miR-1 expression was conducted as described above.www.microRNA.org (www.targetscan.org were searched for predicted mRNA targets for miR-1 in both mouse and human. Targets for miR-1 were prioritized for further study by the number of predicted binding sites per 3\u2019UTR (>1 site), strength of binding score, and predicted binding of the miRNA in both human and mouse. A literature scan was also performed to identify targets which had previously been validated experimentally.Target prediction programs, oRNA.org  and www.2. Transient transfections were performed using Invitrogen Lipofectamine 2000 according to manufacturer\u2019s protocol . Mock and negative control (scrambled pre-miR) transfections were carried out for all experiments when cells were at 40\u201350% confluency. Scrambled pre-miR (AM17110) negative control and miR-1 (AM17150) precursor were purchased from Ambion .A5 and B9, mouse cutaneous spindle and cSCC cell lines respectively, and C5N, a non-tumorigenic mouse keratinocyte cell line, were used for these studies . Cell liProtein from whole cell extracts was extracted 24, 48, 72 and 96 h post-transfection via solubilization of A5 and B9 cells using RIPA buffer  containing a protease inhibitor (Roche). For each sample, 30 \u00b5g of protein were run on a 10% polyacrylamide gel in a Bio-Rad mini-gel system at 150 V (12 V/cm) for \u223c1.5 h. Proteins were transferred to nitrocellulose membrane for 70 min at 90 V (7 V/cm). Following transfer, membranes were blocked in 5% milk in TBST  and were incubated with primary antibody overnight. Antibodies and dilutions were as follows: Ets1, 1:1000 dilution (antibody a gift from Michael Ostrowski) and \u03b1-tubulin, 1:100 dilution . Incubation with secondary antibodies was for 2 h. Secondary antibodies and dilutions were as follows: Anti-mouse HRP-Linked, 1:10000 dilution , Anti-Rabbit HRP-Linked Antibody, 1:1000 dilution, . Enhanced chemiluminescent reagent  was applied in a 1:1 ratio.Cloning. Cloning of Ets1 3\u2019UTR was performed using In-Fusion Advantage PCR Cloning Kit according to manufacturer\u2019s protocol . Full length Ets1 plasmid with 3\u2019UTR provided by Dr. Michael Ostrowski was used as a template for PCR. A 1,278 base pair product was generated containing the predicted three miR-1 binding sites and was cloned into a pGL3 Control Luciferase vector . Primers used for cloning were as follows: Ets1 3\u2019 UTR In-Fusion Forward: 5\u2019-tgtaatactagtccgAGAAGAGAGGCAATTGGCTGAGGT-3\u2019, Ets1 3\u2019 UTR In- Fusion Reverse: 5\u2019-gtctgctcgaagcggACTGAGGCAGTATTCCTGATAGAG-3\u2019. Clones were sequence verified. Site-directed mutagenesis was carried out to mutate two base pairs in each of the three miR-1 binding sites in the Ets1 3\u2019UTR using QuikChange Lightning Multi Site-Directed Mutagenesis kit according to the manufacturer\u2019s protocol . Primers used for site-direct mutagenesis are as follows:Ets1 3\u2019 UTR SDM 1 Forward: 5\u2019-gttgatggctgactcccactctcccttgaagactctgaat-3\u2019,Ets1 3\u2019 UTR SDM-1 Reverse: 5\u2019-attcagagtcttcaagggagagtgggagtcagccatcaac-3\u2019,Ets1 3\u2019 UTR SDM-2 Forward: 5\u2019-ccacaaggaagcaaaggccaaactctccagctatatattttgatctta-3\u2019 ,Ets1 3\u2019 UTR SDM-2 Reverse: 5\u2019-taagatcaaaatatatagctggagagtttggcctttgcttccttgtgg-3\u2019,Ets1 3\u2019 UTR SDM-3 Forward: 5\u2019-acctgttgaactcttacgtactctccaaagacgtttcaaggaac-3\u2019,Ets1 3\u2019 UTR SDM-3 Reverse: 5\u2019-gttccttgaaacgtctttggagagtacgtaagagttcaacaggt-3\u2019.Clones were sequenced verified.Transfections and luciferase assays. C5N and A5 cells were plated in triplicate into a 12-well dish at 24 h prior to transfection. At 70% confluency, 0.10 \u00b5g Luc-Ets1 3\u2019UTR and Luc-Ets1 3\u2019UTR-mutated were each co-transfected with 10 pmol of a scrambled control miR or miR-1 into each well. 0.10 \u00b5g of a PRL-TK vector  was also transfected into each well to normalize the firefly luciferase values. All experiments included mock and pGL3-Control empty vector controls. A5 and C5N cell lysates were prepared using M-PER  and 30 \u00b5g of each sample were used for analysis. Firefly and renilla luciferase measurements were acquired 24 h post-transfection using a Veristas Microplate Luminometer.miR-1, scrambled miR control or mock transfected, A5 and B9 cells were trypsinized and 2000 cells (A5) or 3000 cells (B9) were plated in quadruplicate in a 96-well plate. Proliferation was measured at 24, 48, 72 and 96 h post-transfection using a MTT -2,5-diphenyltetrazolium bromide) cell proliferation kit . Experiments were carried out according to manufacturer\u2019s protocol. RNA and protein were isolated at each solubilization step. Optimal absorbance of the formazan product was measured at a wavelength of 550 nm and a reference wavelength of 690 nm was used. For each sample, absorbance was normalized to the reference wavelength as well as a blank control, which contained media only.At 24 h post-transfection with miR-1, scrambled miR control or mock transfected. Cells were trypsinized and counted 48, 72 and 96 h post-transfection. Two million cells were fixed in 70% ethanol. Cell cycle analysis was evaluated by DNA content. Cells were incubated with a propidium iodide solution  for 15 min at 37 \u00b0C. Data was acquired on a BD FACS Calibur instrument. ModFit software was used for analysis. Experiments were done in triplicate.A5 and B9 cells were transfected with miR-1 or scrambled miR control were trypsinized and counted at 48, 72 and 96 h post-transfection. The FITC Annexin V Apoptosis Detection Kit I was used to evaluate cell death according to manufacturer\u2019s protocol . Unstained, FITC Annexin only, and propidium iodide only conditions were used as controls. Data was acquired on a BD FACS Calibur instrument. Cell Quest Pro for was used for data analysis. Experiments were done in triplicate.A5 and B9 cells transfected with 5 cells/mL in ibidi cell culture inserts according to the manufacturer\u2019s protocol  at approximately 48, 72 and 96 h post-transfection. Transfections of A5 and B9 cells included mock transfection, scrambled miR control (AM17110) or miR-1 precursor (AM17150) as described above. Eight hours after plating, cell inserts were removed. Images were taken at 5X magnification using AxioVision 4.8 software on an Axiovert 25 microscope at 0 h and every 5\u20138 h until gaps closed. Images were assessed visually by two independent researchers for differences in rate of gap closure.A5 and B9 cells were plated at a density of 7 \u00d7 10miR-1, miR-133a, miR-124a-3, miR-134, miR-206, and miR-9-1) showed a significant difference in average expression and had a 2.0 fold or greater difference across one or more probe sets. All of these showed higher expression in SPRET/EiJ  or precursor  miRNAs and were chosen for evaluation based on the specific probe sets (mature versus precursor) that showed differences by microarray .To validate the expression differences of the six miRNAs showing differential expression between SPRET/EiJ and FVB/NJ by microarray, we performed qPCR using Applied Biosystems TaqMan probes on samples from mice not used in the initial array studies. Probes were specific to either mature  compared to median miR-1 expression in FVB/NJ (22% of control sno-202) and SPRET/EiJ (110% of control sno-202). The difference in expression was significant between the tumors and SPRET/EiJ . Based on the expression data in the primary tumors and the strain specific differences in expression, we chose miR-1 as a strong candidate miRNA to evaluate further for a role in cSCC.We hypothesized that miRNAs expressed at higher levels in SPRET/EiJ mice relative to FVB/NJ mice would behave similarly to tumor suppressor genes and exhibit reduced expression in tumors. We chose  by qPCR . In addienotypes . From thmiR-1, miR-133a, miR-124a-3, miR-134, and miR-206, we searched the literature to identify targets of these miRNAs that had been detected by expression arrays in tumors and had been further validated by other methods. We also identified genes predicted to be targets in microRNA databases www.microRNA.org . Our positive control, Twf1, showed decreased expression in miR-1 transfected B9 cells at 48, 72 and 96 h . In B9 miR-1 transfected cells Met showed significantly decreased expression only at 48 h , and Ets1 showed significantly decreased expression at 48 and 72 h post-transfection compared to scramble miR control transfected cells . Bag4 mRNA expression was significantly reduced in B9 cells transfected with miR-1 at all three time points , but it only showed significant down-regulation of mRNA at 72 h in A5 cells transfected with miR-1 compared to scrambled control cells . The remaining targets did not show statistically significant differences in expression between control and miR-1 A5 transfected cells (data not shown).We chose seven putative Ets1 had not been confirmed as a target of miR-1 in the mouse, and since several studies support a role of Ets1 in cSCC and cancer phenotypes such as metastasis, apoptosis and proliferation, we decided to further evaluate murine Ets1 as a miR-1 target . A modest, but significant decrease in proliferation was observed at the 72 h time point in the B9 cSCC cell line, but there was no difference in proliferation at 96 h .There are several published studies showing pression . Based obilities . To detemiR-1 has been shown to induce apoptosis in multiple cancer cell lines including maxillary sinus SCC, head and neck SCC, and renal cell carcinoma  and a statistically significant increase in apoptosis at 72 h . There were no differences in apoptosis at 96 h , miR-1 transfected B9 cells at 48 and 96 h , miR-1 transfected A5 cells at all time points, but this was only significant at 48 h post-transfection ; miR-1 transfected cells for both A5 and B9 for some time points , miR-1 may have an extremely modest effect on cell cycle progression resulting in fewer cells in S phase.Ectopic expression of ll lines . We evalanalysis . We obsee points , but themiR-1 in migration. In addition, Ets1 has a well-documented role in enhancement of migration  in combination with a reduced number of cells in S phase. We also observed decreased mRNA expression of previously described human miR-1 targets, Met, Twf1, and Ets1, in the mouse which establishes that miR-1 targets these mRNAs in more than one species. Furthermore, we show that Bag4, a novel miR-1 target, is significantly down-regulated in the B9 cell line.Exploitation of genetic differences between cancer resistant and cancer susceptible mice has led to the identification of candidate genes important in tumorigenesis, but little has been explored regarding the differences in miRNA expression profiles in these mice. Here, we describe our discovery of five miRNAs showing higher expression in skin cancer resistant mice compared to skin cancer susceptible mice. In more detailed analyses of one miRNA, miR-1, miR-133a, and miR-206 are all part of a group of myo-miRs, miRNAs whose expression is enriched in skeletal and cardiac muscle  and from published studies  that have roles in tumorigenesis, it is likely that miR-1\u2019s ability to reduce the expression of many tumor promoting genes could have a global influence on the suppression of tumor development  Met, (B) Ets1, (C) Twf1 and (D) Bag4 were assessed by qPCR. B9 cells transfected with a scrambled control miR (SC) are shown in black and B9 cells transfected with miR-1 are shown in gray. Cells were harvested at 48, 72 and 96 h post-transfection. Expression is plotted as a fold difference in expression compared to the 48 h SC transfected cells. Expression was normalized to control gene L19. Difference in expression was measured by student\u2019s T-test. Error bars represent standard deviation. *, p-value < 0.01, **, p-value < 0.001, NS, not significantmRNA expression of predicted targets of Click here for additional data file.10.7717/peerj.68/supp-2Figure S2miR-1. (B) Western blot analysis of Ets1 expression 24, 48 or 96 h after transient transfection of B9 with SC or miR-1. Gapdh was used as a loading control.(A) Western blot analysis of Ets1 expression 24, 48 and 72 h after transient transfection of A5 with scrambled control miR (SC) or Click here for additional data file.10.7717/peerj.68/supp-3Figure S3miR-1 or scrambled control miR transfected cells (SC) was measured at 48, 72 and 96 h by AnnexinV and PI staining measured by FACS analysis. Shown is a representative sample at 72 h post-transfection for the A5 (A) SC and (B) miR-1 transfected cells and for the B9 (C) SC and (D) miR-1 transfected cells. The gating of the cells and the percentage of apoptotic cells staining positive for AnnexinV, propridium iodine or both (upper right quadrant) are shown.Apoptosis in Click here for additional data file.10.7717/peerj.68/supp-4Figure S4miR-1 transfected cells were measured for A5 cells at (A) 48 h, (B), 72 h and (C) 96 h and for B9 cells at (D) 48 h, (E) 72 h, and (F) 96 h by staining with propidium iodide and sorting via flow cytometry. The percentage of gated cells for G0-G1, S and G2-M phases are indicated.Cell cycle parameters for scrambled control miRNA (SC) and Click here for additional data file.10.7717/peerj.68/supp-5Figure S5miR-1 and SC transfected B9 cells are shown for 0, 8, 11, and 13 h after removal of insert at approximately (A) 48 h (B) 72 h, (C) or 96 h after transfection. Representative experiments for each time point are shown.Cell motility for Click here for additional data file.10.7717/peerj.68/supp-6Table S1miRNA array data for three FVB/NJ, three SPRET/EiJ samples and one replicate RNA sample (FVB-A or \u2013B and SPRET-A or B) per strain.Click here for additional data file.10.7717/peerj.68/supp-7Table S2Genes predicted to be targets of the validated five miRNAs.Click here for additional data file."}
+{"text": "MicroRNA-210 (miR-210), the master hypoxamir, plays pleiotropic roles in certain cancers; however, its role in the development of human colorectal cancer remains unclear. Herein, we report that miR-210 is frequently up-regulated in colorectal cancer tissues, with high miR-210 expression significantly correlating with large tumor size, lymph node metastasis, advanced clinical stage and poor prognosis. Functionally, miR-210 overexpression promotes the migration and invasion of colorectal cancer cells. Furthermore, miR-210 can be induced by hypoxia and mediates the hypoxia-induced metastasis of colorectal cancer cells. In addition, vacuole membrane protein 1 (VMP1) is identified as the direct and functional target of miR-210. Thus, miR-210 is a useful biomarker for hypoxic tumor cells and a prognostic factor that plays an essential role in colorectal cancer metastasis. Colorectal cancer (CRC) remains the third most common malignancy worldwide and accounts for the fifth leading cause of cancer-related death in China Hypoxia, or low oxygen tension, is a common feature of solid tumor microenvironment. Hypoxic tumors tend to be more aggressive, more likely to metastasize, more resistant to conventional therapies, and are associated with a poor prognosis MicroRNAs  are a novel class of endogenous, small, non-coding RNA oligonucleotides that regulate gene expression by targeting the 3\u2032 untranslated region (3\u2032-UTR) of the corresponding mRNA In the current study, we focused on miR-210, the hypoxia-induced miRNA, and examined its expression in human CRC tissues, analyzed its correlation with clinicopathological characteristics and prognosis, and then uncovered the role of miR-210 in hypoxia-induced metastasis during colorectal cancer progression.Tissue samples, including tumor tissues and adjacent non-cancerous tissues, were obtained from 193 CRC patients at the time of surgery at the Department of General Surgery, Qilu Hospital of Shandong University, Jinan, China, from June 2003 to February 2008. None of the patients had ever received any chemotherapy, radiotherapy, or surgery. All the tissues were immediately placed in liquid nitrogen and frozen at \u221280\u00b0C until RNA extraction. This study was approved by the Ethical Committee of Qilu Hospital, Shandong University, and written informed consent was obtained from each patient.The clinicopathological data, including sex, age, tumor location, tumor stage, tumor size, local invasion, histological differentiation and lymph node metastasis were collected retrospectively. The duration of follow-up was calculated from the date of surgery to death or last follow-up, and we completed the follow-up in April 2012. The patients were excluded from analysis of clinicopathological characteristics and prognosis if they had incomplete medical records or inadequate follow-up.2 incubator. To induce hypoxia, the cells were exposed to a steady flow of a low-oxygen gas mixture  in a humidified incubation chamber .CRC cell lines  and HEK (human embryonic kidney) 293T cell line were purchased from the Type Culture Collection of the Chinese Academy of Sciences , and the HCT116 cell line was purchased from Shanghai Institute of Biochemistry and Cell Biology (China). All the cell lines were cultured in Dulbecco's modified Eagle's medium  containing 10% fetal bovine serum  at 37\u00b0C in a 5% CO\u2212\u0394\u0394CT relative quantification method with \u03b2-actin as a housekeeping control. The primers for \u03b2-actin , HIF-1\u03b1  and VMP1  were purchased from BioSune, Shanghai, China. For miRNA expression, cDNA was synthesized using gene-specific primers  and the M-MLV RT kit  in a 20-\u03bcl reaction volume. The RT reaction reagents contained 1 \u03bcg RNA template, 1 \u03bcl 10 mM dNTP mix, 2 \u03bcl 0.1 M DTT, 4 \u03bcl 5\u00d7 first-strand buffer, and 1 \u03bcL 40 U/\u03bcl RNase inhibitor. The volume was adjusted with RNA-free H2O. The reverse-transcription reaction was performed in triplicate to remove any outliers. MiRNA expression was assessed using qRT-PCR and an ABI PRISM 7500 Sequence Detection System . The fold changes in miRNA expression were determined using the 2\u2212\u0394\u0394CT method; the expression was normalized to the U6 small nuclear RNA (U6) expression level. In addition, the relative expression of miRNA, HIF1\u03b1 and VMP1 in HT-29 cells severed as calibrator in each run and was set at the value of 1.Total RNA was extracted using TRIzol reagent  according to the manufacturer's protocol. All of the manipulations of the RNA were carried out under RNase-free conditions. RNA concentration was measured using a BioPhotometer plus  at 260 nm, and the isolated RNA was stored at \u221280\u00b0C until use. For the analysis of HIF1\u03b1 and VMP1mRNA expression, total RNA (1 \u03bcg) was reverse transcribed into cDNA using the SuperScript kit , and qRT-PCR analyses were performed using SYBR Green  and an ABI PRISM 7500 Sequence Detection System . The fold changes in HIF1\u03b1 and VMP1 mRNA expression were quantified using the 24 cells/well in 24-well plates or at 1.5\u00d7105 cells/well in 6-well plates and were cultured approximately 24 h before transfection. After the cells reached 50% confluence, transient transfection of miRNA mimics/inhibitor  and/or plasmid were carried out using Lipofectamine 2000  following the manufacturer's instructions. For each experiment, the transfection efficiencies were evaluated by qRT-PCR at 24 h after transfection.CRC cells were plated at a density of 5\u00d7104 cells) or SW480 (1\u00d7105 cells) cells were resuspended in a medium containing 1% FBS and placed in the top chamber of each insert. An aliquot of medium containing 10% FBS (500 \u03bcl) was added to the lower chambers. After incubation for 24 h at 37\u00b0C, the cells adhering to the lower membrane were stained with 0.1% crystal violet, imaged (200\u00d7), and counted using an IX81 inverted microscope .Transwell chambers   coated with or without Matrigel  were used to perform the migration and invasion assays. At 24 h post-transfection, the HT-29  containing wild type (WT)-VMP1 3\u2032-UTR sequences or mutant (MUT)-VMP1 3\u2032-UTR sequences. HEK293T cells were transiently cotransfected with miR-210 mimics/miR-negative control and WT-VMP1 3\u2032-UTR vector/MUT VMP1 3\u2032-UTR vector. Luciferase activities were measured using the Dual-Luciferase assay kit  according to manufacturer's instructions 48 h after transfection.Total protein of cultured cells was extracted by RIPA buffer containing PMSF. BCA protein assay kit  was used to determine the concentration. Proteins was separated via SDS-PAGE and transferred onto PVDF membranes. After blocking, the membrane was incubated with mouse anti-VMP1 polyclonal antibody  or anti-\u03b2-actin mouse monoclonal antibody , followed by incubation with HRP-conjugated secondary antibodies . Signals were determined by a chemiluminescence detection kit .U-test, Student's t-test, or a Kruskal-Wallis test, as appropriate. The correlation between miR-210 and HIF1\u03b1 (or VMP1) was determined by Pearson's correlation analysis. The Kaplan-Meier method was used to estimate survival, and the survival differences between the subgroups were examined using the log-rank test. A Cox regression model  was applied for the univariate analysis and multivariate analysis of prognostic factors. Differences were considered statistically significant only when P<0.05.The SPSS  software package, version 18.0 , was used to analyze all the data. We first used the Kolmogorov-Smirnov test to determine the distribution of the data in each group. The data are presented as the mean \u00b1 standard deviation (SD) or median (interquartile range) when the values were normally or abnormally distributed, respectively. Statistical differences between the groups were tested using the Mann-Whitney -ct. The level of U6 did not show any significant differences between tumor and corresponding non-cancerous samples   . The resP<0.001, . In addiP\u200a=\u200a0.014), local invasion (P\u200a=\u200a0.047), positive regional lymph node metastasis (P\u200a=\u200a0.001), and TNM stage (P\u200a=\u200a0.005). However, there were no significant associations between miR-210 expression and the patient's gender, age, tumor location, or histology grade . The detailed results of the statistical tests between miR-210 expression and the clinicopathological characteristics are listed in We further summarized the association of miR-210 expression levels with various clinicopathological characteristics in CRC tissues and found that miR-210 expression was significantly correlated with large tumor size  and other four parameters . In the multivariate analysis, the Cox proportional hazards model involving the five significant prognostic factors identified miR-210 expression as an independent prognostic factor for patients with CRC (P\u200a=\u200a0.008). The statistical values of miR-210 expression and the other clinicopathological parameters derived from the Cox proportional hazards regression model are listed in A total of 50 patients died during the follow-up period, and the cumulative 5-year overall survival rate was 56.9%. Using the median of the miR-210 expression levels as a cutoff, we divided the 116 CRC patients into two groups: a high miR-210 expression group and a low miR-210 expression group. We then used the Kaplan-Meier survival curve analysis to assess the prognostic value of miR-210 in colorectal cancer. The results showed that the patients with high miR-210 expression had a significantly poorer prognosis than those with low miR-210 expression P<0.001, . To evalWe examined the expression level of miR-210 in a panel of CRC cell lines, including HCT-116, HT-29, SW620 and SW480. The results showed that the level of miR-210 was highest in HT-29 cells compared with the other three cell lines, and its level was lowest in SW480 cells . Based oTo measure the biological properties of miR-210 in CRC cells, we transiently modulated the miR-210 expression level by transfection with miR-210 mimics or inhibitor. As shown in Because we demonstrated miR-210 could increase the migration and invasion potential of CRC cells, we hypothesized that miR-210 could also mediate the hypoxia-induced migration and invasion of CRC cells. To confirm this hypothesis, we performed transwell assays to examine the migration and invasion potential of CRC cells under hypoxic conditions and found that the migration and invasion ability of these CRC cells were significantly increased compared to cells under normoxic conditions. Moreover, transfection with the miR-210 inhibitor dramatically diminished the migration and invasion ability of the hypoxic CRC cells, whereas transfection with the miR-210 mimics further enhanced the migration and invasion ability of the CRC cells . The aboP<0.01; TargetScan identifies that 3\u2032-UTR of VMP1 contains predicted binding site for miR-210 . LuciferTo determine whether VMP1 is involved in the miR-210 induced metastasis of CRC cells, we performed rescue assays. As shown in Hypoxia is a prevalent characteristic feature of most solid tumors, and the robust hypoxia-induced miRNA, miR-210 is currently regarded as the \u201cmaster miRNA\u201d of the hypoxia response The dysregulated expression of miR-210 has been irrefutably demonstrated in different human malignancies. Cai et al. showed that miR-210 expression was significantly higher in pediatric osteosarcoma patients and was significantly associated with aggressive clinicopathological features and a poor prognosis With regard to survival, univariate and multivariate analyses were performed to explore the potential prognostic value of miR-210 in CRC. The results of the univariate analysis showed that patients with higher miR-210 levels had a poorer prognosis than those with a lower miR-210 level. Furthermore, the results of the multivariate analysis of the Cox proportional hazards regression model showed that miR-210 was an independent prognostic factor for overall patient survival after surgery. These results are in agreement with the studies reported by Camps et al. in breast cancer The functional exploration of miR-210 indicated that miR-210 plays key roles in many cellular processes involved in physiological and malignant conditions. MiR-210 may be involved in erythropoiesis and can also promote adipogenesis In the present study, we found that the overexpression of miR-210 markedly promoted the migration and invasion of CRC cells. Our data imply that miR-210 acts as an oncogenic miRNA in human colorectal cancer to promote metastasis, which is consistent with the findings of earlier studies We found that miR-210 upregulation was correlated with aggressive tumor progression in CRC and that it could be used in the prognostic screening of patients with this malignancy. Moreover, we found that the \u201cmaster\u201d microRNA in hypoxia control, miR-210, is frequently up-regulated in CRC cells and is involved in hypoxia-induced CRC metastasis. These results add to the accumulating evidence that miR-210 plays a critical role in promoting cancer development and may assist in the development of new therapeutic regimens against hypoxic tumors.Figure S1Evaluation of the reference gene U6 variations between tumor tissues and corresponding non-cancerous tissues. There are no differences in U6 expression between the two groups (P\u200a=\u200a0.34).(TIF)Click here for additional data file.Figure S2MiR-21 relative expression level in CRC tissues (CRC) and adjacent non-tumorous tissues (NT). The miR-21 level was significantly higher in CRC tissues than in adjacent non-tumorous tissues, and its expression was normalized to the level of U6 small nuclear RNA (U6) expression in each sample.(TIF)Click here for additional data file."}
+{"text": "The role of miRNAs in acquired endocrine-resistant breast cancer is not fully understood. One hallmark of tumor progression is epithelial-to-mesenchymal transition (EMT), characterized by a loss of cell adhesion resulting from reduced E-cadherin and increased cell mobility. miR-200 family members regulate EMT by suppressing expression of transcriptional repressors ZEB1/2. Previously we reported that the expression of miR-200a, miR-200b, and miR-200c was lower in LY2 endocrine-resistant, mesenchymal breast cancer cells compared to parental, endocrine sensitive, epithelial MCF-7 breast cancer cells. Here we investigated the regulation of miR-200 family members and their role in endocrine-sensitivity in breast cancer cells.miR-200 family expression was progressively reduced in a breast cancer cell line model of advancing endocrine/tamoxifen (TAM) resistance. Concomitant with miR-200 decrease, there was an increase in ZEB1 mRNA expression. Overexpression of miR-200b or miR-200c in LY2 cells altered cell morphology to a more epithelial appearance and inhibited cell migration. Further, miR-200b and miR-200c overexpression sensitized LY2 cells to growth inhibition by estrogen receptor (ER) antagonists TAM and fulvestrant. Knockdown of ZEB1 in LY2 cells recapitulated the effect of miR-200b and miR-200c overexpression resulting in inhibition of LY2 cell proliferation by TAM and fulvestrant, but not the aromatase inhibitor exemestane. Demethylating agent 5-aza-2\u2032-deoxycytidine (5-aza-dC) in combination with histone deacetylase inhibitor trichostatin A (TSA) increased miR-200b and miR-200c in LY2 cells. Concomitant with the increase in miR-200b and miR-200c, ZEB1 expression was decreased and cells appeared more epithelial in morphology and were sensitized to TAM and fulvestrant inhibition. Likewise, knockdown of ZEB1 increased antiestrogen sensitivity of LY2 cells resulting in inhibition of cell proliferation.Our data indicate that reduced miRNA-200b and miR-200c expression contributes to endocrine resistance in breast cancer cells and that the reduced expression of these miR-200 family members in endocrine-resistant cells can be reversed by 5-aza-dC+TSA. While most patients with estrogen receptor \u03b1 (ER\u03b1)-positive tumors initially benefit from endocrine therapies, The miR-200 family of miRNAs are transcribed from two chromosomal locations: miR-200b, miR-200a, and miR-429 are located on chromosome 1p36; while miR-200c and miR-141 are located on chromosome 12p13 2) and 4-hydroxytamoxifen (4-OHT), an active TAM metabolite, in a panel of ER\u03b1-positive breast cancer cell lines derived from MCF-7 endocrine-sensitive cells representing a cellular model of progression towards endocrine/TAM-resistance. We report that transient overexpression of miR-200b and miR-200c in LY2 cells sensitized the cells to inhibition by antiestrogens TAM and fulvestrant . Further, overexpression of miR-200b and miR-200c also altered morphology of cells from a mesenchymal to an epithelial phenotype and reduced ZEB1/2 mRNA expression. Knockdown of ZEB1 increased sensitivity of LY2 cells to TAM and fulvestrant. Our results indicate a role for loss of miR-200 family members and increased ZEB1 in conferring resistance to antiestrogens in breast cancer. We suggest that in addition to being a biomarker for EMT, reduced miR-200 expression may serve as a prognostic marker in acquired endocrine resistance.Here we examined the expression of miR-200a, miR-200b, and miR-200c and their regulation by estradiol  and maintained in IMEM supplemented with 5% fetal bovine serum and 1% penicillin/streptomycin  2, 4-OHT, and exemestane (aromatase inhibitor) were purchased from Sigma-Aldrich . ICI 182,780 (fulvestrant) was from Tocris . Cells were treated with ethanol , 10 nM E2, or 100 nM 4-OHT, or other concentrations, for 6 h, as indicated. Where indicated, LY2 cells were treated with 2.5 \u00b5M 5-aza-2\u2032-deoxycytidine (Sigma-Aldrich) alone or in combination with 100 ng/\u00b5l Trichostatin A  for 72 h, with TSA added 16 h prior to RNA isolation Ei.e., relative to EtOH-treated (control).miRNA-enriched total RNA was extracted from MCF-7 and LY2 cells using the miRNA isolation kit . The quality and quantity of the isolated RNA was analyzed using a NanoDrop spectrophotometer and Agilent Bioanalyzer. cDNA was synthesized using the miRCURY LNA\u2122 first strand cDNA synthesis kit (Exiqon) and qPCR was performed using the miRCURY LNA\u2122 SYBR Green master mix (Exiqon) using the miRNA primer sets for miR-200a, miR-200b, or miR-200c (Exiqon). SNORD38B and 5SRNA were used for normalization of miRNA expression. Analysis and fold change was determined using the comparative threshold cycle (Ct) method. The change in miRNA expression was calculated as fold-change, ZEB1 was performed using SYBR green in the ABI PRISM 7900 SDS 2.1 (Life Technologies) using relative quantification. The sequence of the primers for ZEB1, ZEB2, E-cadherin, Vimentin and TGF-\u00df are described in \u2212\u0394\u0394CT and data are relative to EtOH-treated cells.For mRNA expression, the High Capacity cDNA Reverse Transcription kit  was used to reverse transcribe total RNA using random hexamers. qPCR for TMs, Ambion, Austin, TX) or microRNA precursors  for miR-200b or miR-200c using Lipofectamine RNAiMAX reagent (Invitrogen). Negative controls were mirVana\u2122 miRNA inhibitor, Negative Control #1; or Pre-miR\u2122 negative control (Ambion). After 1, 5, or 11 d, RNA was isolated (as described above) to confirm knockdown or overexpression of miR-200b or miR-200c. For ZEB1 knockdown studies, LY2 cells were transfected with Silencer\u00ae select siRNA against ZEB1  or a negative control, Silencer\u00ae Negative Control #1 siRNA (Ambion) for 48 h prior to RNA isolation.MCF-7 or LY2 cells were transfected with either miRNA inhibitors  for 6 days. 20 \u00b5l of Cell Titer 96R Aqueous One solution  was added to the wells and absorbance was read at 490 nm using a spectrophotometer (Spectromax M12). Each treatment was performed in quadruplicate within each experiment and experiments were repeated three times for statistical evaluation.MCF-7 or LY2 cells were grown in 96 well plates. Following transfection with anti-miRs or pre-miRs, or controls as above, respectively for 24 h or 5 days, cells were treated with vehicle control EtOH, 10 nM E2. Cell proliferation was determined by measuring BrdU incorporation using an ELISA kit from Roche Applied Science  according to the manufacturer\u2019s instructions. Each treatment/transfection was performed in quadruplicate. Absorbance readings in EtOH treated cells were used as control to evaluate relative BrdU incorporation as an index of cell proliferation.LY2 cells were grown in 96 well plates. The cells were seeded at a density of 2000 cells/well in 96 well plates and were incubated \u223c16 h (overnight) in growth medium prior to transfection with negative control siRNA (Invitrogen cat no. 4390843) or two different clones of Stealth siRNA for ZEB1  using Lipofectamine (Invitrogen). 24 h after transfection, the cells were treated with 100 nM or 1 \u00b5M 4-OHT or fulvestrant; or with 100 nM exemestane in phenol red-free IMEM +5% DCC-stripped serum. Cells were incubated for 48 h at 37C\u00b0 and 5% COWhole cell lysates were prepared and western blots were performed as described in Antibodies were purchased as follows: E-cadherin , vimentin and N-cadherin , Slug/SNAI2 , and \u00df-actin (Sigma-Aldrich). The ZEB1 antibody was a kind gift from Dr. Douglas S. Darling (University of Louisville School of Dentistry). Chemiluminescent bands on the PVDF membranes were visualized on a Kodak Image Station 4000R Pro using Carestream Molecular Imaging software .LY2 cells were untransfected or transfected with a negative control, pre-miR-200b, or pre-miR-200c for 48 h (see above). Images were captured using a digital microscope  at a magnification of 20\u00d7 and 400 \u00b5m scale.LY2 cells were plated in six-well plates in phenol red-free IMEM +5% DCC-FBS for 24 h. Cells were transfected with a negative control or with pre-miR-200b or pre-miR-200c (see above) for 24 h. Cells were wounded by scratching with a p200 pipette tip and then washed with medium to remove displaced cells. Images were captured at 20X magnification using an EVOS microscope and NIH Image J software was used to analyze the percent of wound area at each time point. Values were averaged from four separate readings at each time point. Chi square test was performed using Excel.Statistical evaluations were performed using GraphPad PRISM. Student\u2019s t-test was used to compare control and treatment values. P-values indicate statistical significance.i.e., LCC1, LCC2 and LCC9 cells that were derived from the parental MCF-7 cell line by propagation first as a xenograft in ovariectomized, athymic nude mice (LCC1), and then in long-term culture with tamoxifen (LCC2) or fulvestrant (LCC9) Microarray analysis of miRNA expression revealed low expression of miR-200a, miR-200b, and miR-200c in LY2 endocrine-resistant breast cancer cells compared to MCF-7 endocrine-sensitive breast cancer cells 2 and 4-OHT on miR-200 expression was examined by qPCR in the cell lines described above  expression. Overexpression of miR-200b reduced ZEB2 expression while overexpression of miR-200c reduced vimentin (VIM) expression  cells such as MDA-MB-231 and BT549 LY2 cells overexpressing miR-200b or miR-200c displayed a change in morphology from a spindle-shaped or mesenchymal phenotype to a \u2018cobblestone\u2019 or epithelial phenotype . Cells ee.g., DNA methylation and histone deacetylation. CpG island methylation of miR-200c/miR-141 promoter was reported in breast and prostate cancer cells Decreased miR-200 family expression in LY2 cells could be due to epigenetic changes in the promoter, Endocrine resistance is accompanied by loss of cell-cell adhesion and EMT due to EGFR-mediated phosphorylation and activation of the \u03b2-catenin pathway i.e., it suppresses EMT while it promotes metastatic colonization after cells have invaded a distant site. Further, miR-200 had pro-metastatic activity in a mouse model of breast cancer metastasis by targeting Sec23a, a suppressor of metastasis Although miR-200 is considered a tumor suppressor miRNA, there are some reports of its role as an oncogene or oncomiR. For example, miR-200 family expression is a marker of poor prognosis and chemoresistance in ovarian cancer Our results reveal novel roles for miR-200b and miR-200c in conferring antiestrogen sensitivity to endocrine-resistant breast cancer cells , 10 nM E2, or 100 nM 4-OHT for 6 h. Values are the mean \u00b1 SEM of 3\u20134 experiments and are expressed as fold relative to EtOH-treated cells. *p<0.05 versus EtOH treated for each cell line.(TIF)Click here for additional data file.Figure S2Overexpression of miR-200b or miR-200c 11d after transfection of LY2 cells. LY2 cells were transfected either with pre-miR-200a, pre-miR-200b or pre-miR-200c. RNA was harvested at 11 days and qPCR performed to confirm overexpression of miR-200b or miR-200c. Values are the mean \u00b1 SEM of triplicate determinations.(TIF)Click here for additional data file.Figure S3Knockdown of ZEB1 in LY2 cells. LY2 cells were transfected with siControl or 2 different clones of siZEB1 or were not transfected (Not TF). 48 h after transfection, RNA was harvested and qPCR for ZEB1 and GAPDH was performed. Values are the average of triplicate determinations \u00b1 SEM.(TIF)Click here for additional data file.Figure S4Knockdown of miR-200b or miR-200c in MCF-7 cells. MCF-7 cells were transfected with a negative control, anti-miR-200b, or anti-miR-200c and RNA was harvested 1 or 5 d after transfection. CT values for miR-200b and miR-200c in the cells transfected as indicated for 1 or 5 d. Values are the mean \u00b1 SEM of 3 determinations.(TIF)Click here for additional data file.Figure S5Overexpression of miR-200 in transfected cells. LY2 cells were transfected with negative control, pre-miR-200a, pre-miR-200b, or pre-miR-200c. RNA was harvested at 5 (A) or 7 (B) days after transfection. qPCR performed to confirm overexpression of miR-200a, miR-200b or miR-200c. Values are the mean \u00b1 SEM of 3 experiments.(TIF)Click here for additional data file.Figure S6Overexpression of miR-200 family after 3d of transfection. LY2 cells were transfected with pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. RNA was harvested at 3 days and qPCR was used to confirm overexpression of miR-200. Values are the mean \u00b1 SEM of 3 determinations.(TIF)Click here for additional data file.Figure S7Overexpression of miR-200 family changes LY2 cell morphology from a mesenchymal to an epithelial appearance. LY2 cells were transfected with control Pre-miR miRNA negative control #1 (Ambion), pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. A\u2013D. Images of LY2 cells captured using a light microscope .(TIF)Click here for additional data file."}
+{"text": "Dogs and cats are a common member of the family in homes across the US. No population-based data exist on the frequency of pets getting lost from the home and lost pets can be a source of human and animal suffering. Our primary objective was to determine the percentage of owned dogs and cats that were lost, and of these, what percentages of pets were recovered. We examined the recovery success for dogs compared to cats and the methods used as well as the relationship between lost or found pets and pet and owner demographics. While 15% of dog and cat owners lost their pets, dogs had higher recovery rates (93%) than cats (75%) as well as being returned using different search methods.A cross-sectional national random digit dial telephone interview was conducted between September and November 2010. There were 1,015 households that had owned a dog or cat within the past five years. Of these 817 households owned dogs and 506 owned cats. Fourteen percent of dogs : 11\u201316%) and 15% (95% CI: 12\u201318%) of cats were lost in the past five years. No owner demographic variables were associated with losing a pet. Ninety three percent (95% CI: 86\u201397%) of dogs and 75% (95% CI: 64\u201385%) of cats were recovered. For dogs, searching the neighborhood and returning on their own were the most common methods of finding the dog; 14% were found through an identification tag. For cats, returning on their own was most common. Dogs were more likely than cats to be lost more than once. Cats were less likely than dogs to have any type of identification. Knowledge of the successful methods of finding dogs and cats can provide invaluable help for owners of lost pets. Since 25% of lost cats were not found, other methods of reuniting cats and their owners are needed. Collars and ID tags or humane trapping could be valuable approaches.  Dogs and cats continue to be a common component of the family in homes across the United States as well as in many other countries with 86.4 million cats and 78.2 million dogs owned in the US . Given tIn many US shelters, more than half of the total intake may be stray animals, typically defined as a pet not relinquished to a shelter by the owner or brought in as part of a legal seizure . With thTwo publications identified participants by searching newspaper advertisements and contacting animal control facilities to study the reunion of dogs and cats with their owners ,7. Thesevs. cats and the methods used as well as examine basic pet and respondent demographic variables for their associations with lost and found pets. To our knowledge, there are no national or international studies investigating lost pets. A national study focusing on the frequency that owners loose their pets as well as a preliminary description of the experiences of those pet owners could help to drive additional programs and practice regarding search methods. The primary objectives of the current project were to calculate a population-based estimate of the percentage of owned dogs and cats that were lost from the home in a five year period. The secondary objectives were to estimate the percentage of lost pets subsequently recovered by their owners for dogs A professional survey research company  was hired to conduct a national random digit dialing (RDD) telephone survey using land-lines to identify households who had owned and lost a dog or cat in the past five years. Five years was chosen as the interval as it was a reasonable time frame for recent memory of a lost pet. Only English-speaking respondents in homes with land-lines were eligible. If answering machines were reached, a message was left to call and interviewers were available from 9 AM until 9:30 PM EST. The telephone survey was conducted from September through November 2010. The national RDD sample was supplied by Genesys Survey Sampling . The study was considered exempt from human subjects review by University of Illinois Institutional Review Board guidelines.The initial questionnaire was developed by the authors and reviewed by a number of individuals familiar with the field of animal sheltering. An initial pilot study of 25 interviews was conducted and final revisions to the survey were made. The goal for the total number of lost pets was 400 in order to obtain a 95% confidence interval of not more than \u00b15% for the estimates of percentage of dogs or cats lost assuming 50:50 lost dogs: lost cats. Based on a 50% pet ownership rate nationally and our estimate of pets being lost of 30%, a household sample size of 2,666 calculated and the budget established accordingly using standard statistical software . The questionnaire consisted of initial screening questions to identify qualified participants for the survey. The interviewer first asked the household respondent whether the household had owned a dog or cat in the past five years. If the household had not owned a dog or cat within the last five years, the survey was terminated. If the household had owned a dog or cat, the interviewer asked to speak with someone with knowledge about the pets in the household. This respondent was then asked about the number of dogs and cats owned and one dog/cat was selected to participate . Additional questions about the chosen pet were the pet\u2019s sex, if the chosen pet was spayed or neutered and a question to determine if that pet had ever been lost in the past five years. This included pets no longer in the household. The exact wording for the question about whether a pet was lost was: \u201cThe next series of questions have to do with whether your pet has ever become lost. Examples of this include: your pet ran away from home, your pet was gone longer than expected, your pet didn\u2019t come home when he/she usually does, your pet escaped from the yard or house.\u201d If no dog/cat was lost, the survey was terminated at this point. Households could have up to one lost dog and one lost cat included in the survey. If a dog/cat was lost, the interviewer asked a series of questions about the chosen dog/cat. Questions included the number of times lost, and for the most recent time the pet was lost, the types of identification (ID) worn and/or implanted, if the pet was found, if so, how and if the pet was not found what search methods were used by the owner. Additional demographic questions were also asked for respondent\u2019s education level, income level and gender. The interview was conducted with an adult 18 years or older knowledgeable about the pet.All telephone interviews were conducted by the survey research company\u2019s trained personnel who used a standard computer-assisted telephone interviewing software program (CATI Software). All interviewers were regularly monitored by supervisors. During the calling phase, at least six attempts at different times of the day and on different days were made before the participant was classified as a non-responder. vs. cat responses, the chi-square test was used, except that the Fisher exact test was used when the expected value for any cell was <5. The number of dog and cat owning households by state from a national representative panel were ranked and averaged [Response rate was calculated using the American Association of Public Opinion Research guidelines . Proportaveraged . That raP \u2264 0.25 in univariable analyses were subsequently included in multivariable logistic regression analyses. Variables with the greatest P-values were sequentially removed from the multivariable model using backwards, stepwise manual elimination until the p-values of all remaining variables were P \u2264 0.05. Meaningful interactions between the main effect variables in the model (those that could have a plausible explanation) were tested for inclusion in a similar manner. The goodness of fit of the final model was tested with the Hosmer-Lemeshow goodness-of-fit test. For all analyses including Hosmer-Lemeshow, values of P \u2264 0.05 were considered significant. Standard statistical software was used .Univariable logistic regression was used to identify factors potentially associated with whether a dog or cat had ever been lost; separate analyses were performed for responses for dogs and cats. Demographic variables evaluated were the pet\u2019s sex and neuter status and the owner\u2019s education, income and gender. Education was collapsed from nine categories into four. Income was collapsed from ten categories to four . All varP \u2264 0.05 was considered statistically significant for all analyses. For comparisons of demographic variables  and whether or not the lost pet was reunited with the owner, the chi-square test was used, except that the Fisher exact test was used when the expected value for any cell was <5 with cats and dogs analyzed separately. Owner education and income were collapsed as above. Relationships between pet demographic variables and human demographic variables were also tested. Due to the small sample size, no additional multivariable analyses were attempted. P < 0.001 for the proportion of dogs vs. cats). Male dogs were significantly less likely to be sterilized than female dogs (P = 0.002) while there was no significant difference between the percentage of male and female cats that were sterilized. Data about the frequency of pets getting lost, type of ID worn during the most recent episode and the methods used to find pets are in P = 0.7) [There were 6,996 calls made of which only 4,029 were households. There were 434 (11%) messages left on the answering machine with no person reached, 331 (8%) refusals to participate, 326 (8%) households contacted but no interview performed for various reasons, 257 (7%) households where eligibility could not be determined and 94 (2%) where a language other than English was spoken. There were 2,587 households successfully contacted between 13 September 2010 and 23 November 2010. The response rate was 64%  among households called. While our original target was 2,666, that target was based on an estimate of the pet owners we would be able to reach in comparison to the total calls we made. The actual percentage was lower than our estimate. Of these households, 1,015  had owned a dog or cat in the past five years. Sixty five percent of respondents (62\u201368%) were female. Eight hundred and seventeen households owned dogs and 506 owned cats, among them 308 owned both dogs and cats. One respondent did not provide information beyond owning a pet, for a total of 1,014 households with pet data. The median number of owned dogs during this time was one . The median number of owned cats was two . Fifty one percent of dogs and 48% of cats were male. Eighty percent of dogs (77\u201383%) and 88% of cats (85\u201391%) were spayed or neutered  or for the dog\u2019s sex . However, neuter status of cats was significantly associated with owner education (P = 0.004) and income (P = 0.006) but not owner gender (P = 0.9). Dog neuter status was similarly associated with owner education (P < 0.001) and income (P < 0.001) but not owner gender (P = 0.1). In all cases, higher education or income respondents were more likely to have their cats or dogs neutered and lower education or income respondents were more likely to have intact pets.There were no significant variables in the multivariable logistic regression models examining whether the pet was lost or not and the demographic variables . HoweverThe definition of lost pets used in this study deliberately was designed to be broad so that owners of pets would include any time they were concerned about the absence of the pet from the home. This does mean that the responses for a lost pet were based on the owner\u2019s concern and belief that the pet was lost and not an objective definition. Likely, a number of pets whose owners believed them lost would not have been considered lost by other owners. No time period was included because the normal activities of some pets would include being out roaming loose for variable periods of time. All owners considered the pets reported here to be lost in that they were gone when they would not normally be absent from the home or yard. We do not know what length of time was used by each owner to determine whether the pet was lost. This likely varies by species and whether the pet was normally allowed to roam freely or not. We sought a comprehensive definition that would apply to different situations depending on how pets were normally kept. Both dogs and cats were reported as being lost at a similar percentage, 14% (11\u201316%) and 15% (12\u201318), respectively. Of the animals lost, the majority were recovered, with dogs reunited with their owners 93% (86\u201397%) of the time and cats, 75% (63\u201384%). Dogs were more likely than cats to be lost more than once. Cats were less likely than dogs to have any type of ID or even a collar. The relatively high prevalence of ID overall in this study may be due to the question referring to the most recent time the pet became lost; it is plausible that previous experience with a lost pet might encourage owners to provide ID. However, this could also be due to owners whose pets have ID being more concerned about their pets getting lost or considering their pets lost sooner.We did not ask pet owners if their cats were indoor/outdoor or if their dogs were allowed to roam the neighborhood or were in backyards. These factors may influence the likelihood a pet was lost, or perceived as lost. The specific circumstances under which the pet was considered to be lost would also be useful. This is an area of future research that should be explored. vs. 50% and 15% vs. 30%). This resulted in fewer than 200 lost pets included in the survey. This seriously limited our ability to analyze less common responses including the role of identification tags in getting lost pets reunited with their owners. Unfortunately, both our estimated pet ownership percentage and estimate of lost dogs and cats within the past 5 years were lower than expected  would have been needed. While we did not have a large enough sample size for adequate power, the small differences for the demographic variables between pets that were lost and those that were not for both dogs and cats make the demographic variables examined less likely to be of practical importance in predicting which pets get lost. This implies that more complex variables relating to pet environments and owner lifestyles will need to be studied to better understand why pets get lost. The interviewer asked to speak with a respondent who was knowledgeable about the pets in the household. This was the person who then provided the owner demographic data. While we hoped to have identified the owner by doing this, in some cases we may have obtained human demographic data on another person in the household. We did find that lost neutered pets, lost pets belonging to respondents with more education, and lost cats belonging to respondents with higher income were more likely to be reunited with their owners. This could be due to different behaviors of neutered pets or to different behaviors by owners of neutered pets. Since households with higher owner education and income levels were more likely to have neutered pets, these results could be due to some complex inter-relationships, which we were not able to study further due to our limited samples size. This does suggest future avenues for investigation evaluating other pet-keeping and health variables and their associations with human lifestyle and demographic variables.With a similar percentage of cats and dogs lost, the lower use of ID and low return due to ID in cats compared to dogs, suggests that additional efforts are needed to reunite cats and their owners. In the present study, ID tags were responsible for 15% (9\u201323%) of dogs getting home; fewer cats were wearing ID and only one cat owner 0.04\u201310%) reported that the tag was the primary way the cat was returned home. Two thirds of the lost cats who were not found did not have any identification, making it very difficult if people found these cats to locate the owners. Recent studies on ID tag use found that the most common reason for not tagging cats was because the cat was indoor-only followed by the cat was uncomfortable wearing a collar % reporte. Refutinet al. conducted in an Ohio study where 66% of the cats that were recovered by owners returned home on their own [vs. three days for dog owners. The search methods for finding these pets varied significantly. Dogs were most likely to be recovered by searching the neighborhood while the majority of cats were reunited with their owners 59%, 45\u201372%) by returning on their own. This finding is similar to findings reported by Lord 2% by retOf the 110 dogs and 74 cats that had been reported as becoming lost, only nine (seven dogs and two cats) were found at animal control or through law enforcement. Of the cat owners who did not recover their cats (18 out of 74), only four searched at the shelter. Since the majority of cat owners that lose and do not recover their cat did not search at the animal shelter, there is likely an opportunity to increase messaging regarding this option as a search method for cat owners. Using these data to make some estimates regarding the numbers of lost pets in the US, we extrapolated based on the APPA 201 pet estimates [Animal shelter staff and veterinarians can provide a valuable service by making available information on how owners of lost pets can best find their pets. They could also help owners find their pets by instituting matching of reported lost pet records with reported found pet records. Veterinarians might offer microchip and identification tag clinics for community pet owners and be sure their own clientele\u2019s pets have microchips, collars and personalized identification. Veterinary clinics and animal shelters could have a list of resources and options for advertising for lost pets; some local papers will publish a lost pet ad free and many shelters have lost and found sections. Local veterinary associations could support advertisements for lost pets. Our distribution of respondents by state was similar to the US pet owning population . HoweverSocial desirability bias   might haOverall, our results indicate that about 14% of dogs and 15% of cats owned in the US became lost at least once during a five-year period. Seven percent of dogs and 25% of cats were never reunited with their owners. These data are the first to provide pet owners, veterinarians and animal welfare professionals with factual information about the frequency of pets becoming lost from the home. Among pets that were reunited with their owners, dogs were found most commonly by actively searching the neighborhood while cats most commonly came home on their own. Since 25% of lost cats were not found, other methods of reuniting cats and their owners are needed. It is possible that collars and ID tags or humane trapping could be valuable and more work is needed to determine this. Veterinarians and animal welfare professional can play a key role in helping pet owners if their dogs or cats become lost by guiding owners to use active methods to find lost pets, particularly within the owners\u2019 neighborhoods. Overall, our results indicate that about 14% of dogs and 15% of cats owned in the US became lost at least once during a five-year period. Seven percent of dogs and 25% of cats were never reunited with their owners. These data are the first to provide pet owners, veterinarians and animal welfare professionals with factual information about the frequency of pets becoming lost from the home. Among pets that were reunited with their owners, dogs were found most commonly by actively searching the neighborhood while cats most commonly came home on their own. Since 25% of lost cats were not found, other methods of reuniting cats and their owners are needed. It is possible that collars and ID tags or humane trapping could be valuable and more work is needed to determine this. Veterinarians and animal welfare professional can play a key role in helping pet owners if their dogs or cats become lost by guiding owners to use active methods to find lost pets, particularly within the owners\u2019 neighborhoods."}
+{"text": "Background. Failure among pet owners to neuter their pets results in increased straying and overpopulation problems. Variations in neutering levels can be explained by cultural differences, differences in economic status in rural and urban locations, and owner perceptions about their pet. There are also differences between male and female pet owners. There is no research pertaining to Irish pet owner attitudes towards neutering their pets. This paper identified the perceptions of a sample of Irish cat and dog owners that influenced their decisions on pet neutering.Methods. This study was conducted using social science  methods, including an interview-administered survey questionnaire and focus group discussions. Data was coded and managed using Nvivo 8 qualitative data analysis software.Results. Focus groups were conducted with 43 pet (cats and dogs) owners. Two major categories relating to the decision to neuter were identified: (1) enabling perceptions in the decision to neuter , and (2) disabling perceptions in the decision to neuter .Discussion. Pet owner sense of responsibility and control are two central issues to the decision to neuter their pets. Understanding how pet owners feel about topics such as pet neutering, can help improve initiatives aimed at emphasising the responsibility of population control of cats and dogs. Companion animal overpopulation causes significant costs to humans and governments every year . EvidencThere are marked differences in neutering rates across the globe. These differences can be explained by variations in cultural differences and attitudes towards neutering, and differences in economic status in rural and urban locations . DifferePerceptions owners have about their pet are also important. Owners are more likely to neuter their pet if they consider it a companion rather than a working animal . IncreasThere are differences in neutering levels between cats and dogs, with cat owners more likely to neuter than dog owners . ReferriThere is no research pertaining to the opinions and perspectives of Irish pet owners towards pet neutering. This reflects the wider lack of research on pet ownership and pet care. Given the lack of information on pet owner perspectives on neutering in Ireland, the aim of this study is to identify the self-reported perceptions of a sample of Irish cat and dog owners that influenced their decisions on pet neutering.This study was conducted using social science  methods and reported using the EQUATOR network reporting guidelines: consolidated criteria for reporting qualitative research (COREQ) . QualitaResearch ethical approval was granted by the University College Dublin (UCD) Human Research Ethics Committee. Participants were required to sign a written form of consent. For the methodology, qualitative research methods\u2014focus groups\u2014were used. Focus groups allowed participants to openly discuss their feelings on neutering, and to indicate their own decisions around neutering their pets.Pet owners were recruited through six different private veterinary practices . The practices selected were a convenience sample to ensure compliance and each of these practices agreed to participation in the study. Participants were recruited by the practices, where fliers and posters were put in place and the staff was asked to highlight the research project, to encourage participants to volunteer. Participants were offered a voucher to the value of \u20ac 50 for the practice where they were recruited from. Seven focus groups were conducted with 43 participants in total; three to nine participants in each group.A survey was administered prior to the commencement of the focus groups, to collect information on pet owner profile  and pet profile information (type and number of pets in participating households). An interview topic guide was used to direct all of the focus groups. Questions guided the focus groups to explore reasons for pet ownership and pet choice; views and decisions on pet neutering; feeding and weight control; and pet exercise:\u2022Why do you have a pet?\u2022Why did you choose that type of pet?\u2022What are your views on neutering dogs and cats?\u2022What influenced your decision to have your pet neutered or not?\u2022What are your views on pet diets, both homemade and commercial?\u2022What factors influence the weight of your pet?\u2022How do you feel about exercising your pet?All focus groups were audio-recorded and transcribed. The coding and the analysis process were assisted using Nvivo 8  qualitative data analysis software.Focus group data were grouped together using codes and themes in accordance with the technique described by 1.Enabling perceptions in the decision to neutera.Controlling unwanted pet behaviourb.Positive perceptions regarding pet health and welfare outcomesc.Perceived owner responsibilityd.Pet functione.The influence of veterinary advice2.Disabling perceptions in the decision to neutera.Perceived financial cost of neuteringb.Perceived adequacy of existing controlsc.Negative perceptions regarding pet health and welfare outcomesForty three participants took part in the study. Of these, 81.4% (35) neutered at least one of their pets. For one of the focus groups, three participants did not turn up leaving only three participants available for the focus group; however this did not impact on the quality of the data collected from this focus group. Though sample sizes are small; more owners had neutered cats than dogs, relative to the sample size. Eight pet owners neutered some of their pets, and the same number did not neuter their pets. For pet owners, that neutered their pets, neutering provided a means of controlling pet behaviour and reducing the propensity for unwanted and undesired behaviours for the pet owner. Animal behaviours that were identified as unfavourable included fighting between pets, and straying. Neutering reduces the attraction of other cats and dogs to the pet owners\u2019 home, and prevents unwanted pets.It\u2019s a case of health issues and trying to keep the cats out of fights\u2026. I think if they\u2019re not neutered, they want to be out more. Especially at night and that\u2019s putting them at risk from the traffic\u2019\u2018My dog is neutered\u2026 he\u2019s a cocker spaniel and they have a reputation for being hyper. Neutering will calm him down. I don\u2019t know what happens when dogs go into heat but I do know that the males go mad so I just thought it would be safer, as we walk him [with]out the lead. I\u2019d be petrified if he ran off. I wouldn\u2019t know what to do, so I would agree with neutering\u2019.\u2018I think with cats, you want them there, and a neutered cat stays around the house, they don\u2019t wander\u2019.\u2018One tabby was neutered when I got it and I decided to neuter the others because they would mark their territory and probably fight more. So they are all neutered.\u2019\u2018Much discussion was had on the health consequences of neutering for pets. Pet owners referred to the beliefs of others, and their own:People said he\u2019d [pet dog] be sluggish, he\u2019d be lethargic, and he\u2019ll put on weight. I never saw any change. He was a young happy dog. There are these myths going around that [neutering] will change your dog\u2019s character. I\u2019ve never seen that\u2019.\u2018Pet owners, in favour of neutering, regard neutering as an effective way of ensuring good animal health for their pets. In addition to controlling the pet\u2019s behaviour and reducing the propensity for unwanted pet behaviours, neutering pets was seen as a way of reducing the risk of the spread of disease, infections, and harm caused by fighting (and mating) between animals. For these reasons, neutering was seen as a way of prolonging the life span of the pet.With the cats, it\u2019s a case of health issues, to avoid the risk of Feline AIDS. They can pick up so much if they\u2019re out and fighting\u2019.\u2018A male cat, I had him neutered because I didn\u2019t want him to catch feline AIDS\u2019\u2018It will prevent them [cat] having infection or uterine cancer\u2026 or mammary cancer\u2019.\u2018Both cat and dog owners refer to neutering as increasing the life span of the pet.If you have the dog neutered, the bitch neutered, it can extend her life because they don\u2019t have to go through the ordeal of giving birth, pups. That can actually add another year or two to the bitch\u2019s life span, so that\u2019s why I got my present dog neutered\u2019.\u2018Neutering prolongs the males\u2019 [cat] life. They\u2019re not fighting and spreading disease\u2019.\u2018They are pets, it can increase their lifespan because of cancer and diseases, I wanted them [dogs] to live a couple of years longer, it may be selfish, they may have had some great experiences, but I\u2019ll hang onto them as long as possible\u2019.\u2018Owner sense of responsibility was apparent in the statements of pet owners who are in favour of neutering. Owners felt a responsibility to reduce unwanted pregnancies, and prevent over-population of unwanted cats and dogs.A dog yes, you don\u2019t want to be responsible for your pet creating a litter of pups or kittens\u2019.\u2018Every time you hear figures, how many pets\u2014dogs and cats\u2014that have to be put down every year, because they can\u2019t be kept, the shelters are all overrun with them. It\u2019s just the thought of it going on, is just horrible\u2019.\u2018I don\u2019t want the responsibility of having kittens or having to find homes. So it is the responsible thing to do\u2019.\u2018Neutering is more responsible and there are too many puppies around. I have cats and I let them outside. I would hate to have it on my conscience that they were the cause of some other cat having a litter\u2019.\u2018Pet owner comments reflect an emotional perspective on the problem of overpopulation, and not wanting to deal with the implications of finding homes for unwanted kittens and pups, or the implications at an emotional level for the owner.Keeping a pet  for breeding purposes was identified as a reason for deciding not to neuter.should be neutered unless there is a good reason for breeding from them\u2019.\u2018[Dogs] I had my cat neutered and I can see no point not to, unless you particularly want to breed from the animal for some reason\u2019.\u2018Only one pet owner indicated that they were breeding from their pet dog, and therefore, decided against neutering. There was no reference made to other functional related reasons for owning a pet, e.g., working animal, companionship, etc.Only four pet owners referred specifically to the role of veterinary advice in informing their decision to neuter. There was general consensus among the groups that neutering would be complied with if medically required. Two of these pet owners noted they were not in favour of neutering, but complied with medical advice. There were mixed opinions on this decision, with reference being made to a loss of perceived control over the decision:So the advice was that medically I should do it [neuter the pet dog], so I did it and I didn\u2019t really think about the rights and wrongs of it at all really\u2019.\u2018The vet would make the decision for us; she did say the female was quite small to have pups\u2019.\u2018My decision ended up having to be taken from me\u2026 the real decision was that she then got a false pregnancy and the vet said to me this can be a precursor of cancer type of thing and really I\u2019d be better off doing it\u2019.\u2018The influence of media featured very little in the focus groups, but pet owners made reference to information on the number of injured, unhealthy and euthanized cats and dogs.Financial cost was identified as a barrier to improving the prevalence of neutering of pet cats and dogs. This barrier was identified by five participants; though all five had their pet neutered. Instead, concern was raised that the financial costs of neutering would prevent others from neutering their pets.I think the cost in Ireland is extremely high\u2026. I had my two dogs done at the same time eight years ago and it was about \u20ac 350 to get them neutered by the vet\u2019.\u2018For the two [cats]\u2026 that was my bill when I went to pick them up. That\u2019s an awful lot of money\u2026there are people who genuinely can\u2019t afford it\u2026\u2019\u2018There was an overwhelming perception among those who did not have their pets neutered that adequate control measures were in place, or that neutering was not necessary because the pet was always indoors, or within sight of the owner. These measures include keeping the pet inside a controlled environment, such as the owners\u2019 house.The dog we have at the moment is not neutered. It depends on the dog and the environment which it lives, whether you have a garden, whether other people are home during the day, whether the dog is taken out on the lead only\u2019.\u2018When we got the dog, she was not neutered simply because she was always under control and there was no one living near us. So all of us made sure she was tied, up in her pen\u2019.\u2018No, he\u2019s [pet dog] not neutered. He\u2019s around us all the time. He\u2019s under strict control around the house\u2019.\u2018One pet which is completely indoors\u2014She\u2019s a total house dog. Someone\u2019s always with her if she\u2019s outside, there\u2019s no need for her to be neutered\u2019.\u2018get too fat and lazy and it\u2019s not hard to lock up a bitch for a month twice a year. I have dogs and bitches at home and I can cope with it\u2026. if you\u2019ve a bitch in heat, you lock her up. I don\u2019t agree [with] neutering\u2019.\u2018[Neutered dogs] Specific reference was made to dogs; dogs were perceived as easier to control than cats.I didn\u2019t neuter the dog but he was never loose outside. There was never any chance he was going to get himself into trouble, because he was either inside with us or outside with one of us, but I did neuter both of the cats. I did that because I didn\u2019t want the male to get himself in to trouble in other peoples gardens\u2019.\u2018I can understand with cats [the need to neuter] because they\u2019re out wandering and stuff, but with a dog and you know where they are all the time.\u2019\u2018In this instance, the cats and a male dog are neutered. However, the decision was made not to neuter the female dog:All my cats are neutered and only one male is neutered\u2026cats get diseases when they\u2019re out and around whereas the dogs are more home birds\u2019.\u2018As with the decision to neuter, concerns pertaining to animal health were also influential in the decision not to neuter. These concerns reflect pet owners\u2019 belief regarding the consequences and outcomes of neutering.When you get them [cats] neutered, they are inclined to put on a lot of weight, and they lose their shape\u2019.\u2018It is nice to leave them [pets] and not play around with them too much\u2026 just leave them as their natural self\u2019.\u2018Statements point to the belief that neutering is unnatural for the pet. Among some owners of neutered bitches, concern was expressed about the invasiveness of the procedure, how sick it had made their pet, and contributed to weight gain. Given this experience, these owners expressed reluctance to neuter future pets.In this study, the majority of the participant group had neutered all of their pets (62.8%).Self-reported perceptions were organised into those that were (i) enabling  and (ii) disabling . All pet owners in favour of neutering had neutered their pets. A minority of those against neutering also had their pets neutered, in compliance with medical advice. Enabling perceptions that supported the decision to neuter included: a desire to control unwanted behaviours (such as straying and fighting); concerns over animal health; a perceived sense of owner responsibility; pet function; and because of veterinary advice. Disabling perceptions that influenced the decision not to neuter included: the perceived financial cost of neutering; the adequacy of existing controls; and concerns over animal health. It is hoped that, in addition to encouraging further research for an Irish context, the results in this paper will contribute to a better understanding of pet owner behaviour, and contribute to informing veterinary advice and support for adequate pet care.The health benefits of neutering for pets included decreased risk of some cancers, and increased longevity . In thisThe importance of normative beliefs and perceived ability are important in explaining the relationship between responsibility and behaviour among pet owners . Recent Overcrowded animal centre in urgent appeal for \u2018responsible\u2019 owners after rise in abandoned pet\u2019  which presents information on neutering, and clarification around neutering myths. Another example\u2014the Dogs Trust launched the \u201cit\u2019s nicer to neuter\u201d campaign  issued an information leaflet \u2018campaign , in an ecampaign . The procampaign .In this sample there was an over representation of female owners. There is evidence in the research that shows differences in belief and attitudes between male and female pet owners, with male owners expressing concern over a change to the pet\u2019s personality as a result of neutering . It may While the sample size is not powered to conduct statistical hypothesis testing, as it is not appropriate in a qualitative setting, rather information was collected until saturation of the data was reached. In qualitative research; sampling is conducted to select the most appropriate participants, in this case pet owners , therefo10.7717/peerj.1196/supp-1Supplemental Information 1Click here for additional data file."}
+{"text": "Accumulating evidence implicates Zika virus (ZIKV) in pathogenesis of microcephaly in newborns and Guillain-Barr\u00e9 syndrome in adults. However, it remains unclear which viral proteins are responsible for these effects and what are the underlying mechanisms of their pathogenic activity. A recent paper by Drs. Zhao and Gallo, and their colleagues at University of Maryland in Baltimore used fission yeast for genome-wide analysis of ZIKV proteins. They demonstrated cytopathogenic activity for seven ZIKV proteins, anaC, C, prM, M, E, NS2B and NS4A. This activity was shown to be dependent on oxidative stress, and for NS4A they demonstrated involvement of the TOR stress-response pathway. Taken together, the findings presented in this paper provide the basis for further mechanistic studies that potentially can identify therapeutic means to treat neuro and immune complications of ZIKV infection. Aedes mosquitoes, which transmit the virus, inhabit [The outbreak of Zika virus (ZIKV), a flavivirus initially identified in mid-twentieth century in Uganda, has now reached USA and has spread to other countries in North and South America where  inhabit . The sca inhabit  and the  inhabit , 4. This inhabit  makes anStudy with primary human brain samples demonstrated that ZIKV infects neural stem cells, astrocytes, oligodendrocyte precursor cells, and microglia, whereas mature neurons were much less susceptible to infection . These fResults reported in the paper by Li et al. are provocative and raise new important questions. Is pathogenic activity of other ZIKV proteins also mediated by TOR? Is it mediated by TOR activation or inhibition? Is this mechanism relevant to human cells, and in particular to neural stem cells which are susceptible to ZIKV infection? What are the molecular mechanisms linking NS4A, and possibly other ZIKV proteins, to the TOR pathway? What is the connection between induction of ROS by ZIKV proteins and the effects on TOR? Some of these questions have been addressed in another report published almost at the same time as the paper by Li et al. . In that"}
+{"text": "In the present study, we compared cryoim-mDCs with DCs matured from fresh immature DCs (fmDCs) in the aspects of phenotypes, in vivo homing capacities as well as the anti-viral therapeutic effects to further clarify the effect of cryopreservation on DC-based cytotherapy. The results showed that cryopreservation impaired the homing ability of DCs which was associated with the reduced expression of CCR7 and disturbed cytoskeleton arrangement. Moreover, the antigen-specific CD8+ T cell response induced by cryoim-mDCs was much weaker than that induced by fmDCs in both the spleen and liver draining lymph nodes, which provided reduced protection from viral invasions. In conclusion, cryopreservation is a good method to keep the viability of immature DCs, however, the in vivo homing capacity and anti-viral therapeutic effect of DCs matured from frozen immature DCs were hindered to some extent.Cryopreservation is critical in reducing redundant operations and also in quality control in dendritic cell (DC) therapy. Full maturation and efficient homing of DCs to T cell-region constitute a crucial aspect of DC immunotherapy; however, the  Immature DCs (imDCs) effectively capture and process antigen but limitedly express allostimulatory molecules , whereas mature DCs (mDCs) can be generated from imDCs by stimulations from toll-like receptors (TLRs) and have a higher expression of costimulatory molecules as well as an elevated ability to home to lymph nodes (LNs)As the most potent professional antigen-presenting cells (APCs), dendritic cells (DCs) bridge the gap between the innate and adoptive immune responses and are the only ones capable of priming na\u00efve T cellsin vitro and in vivo has been documented in many disease models. In these experiments, imDCs were usually isolated in vitro and loaded with tumor or viral antigens and matured by adjuvants to become mDCs, and these antigen-bearing mDCs were then injected into syngeneic animals as anti-cancer or anti-viral vaccines35The capability of mDCs to generate antitumor or anti-viral immune response both in vitro or in vivo, however, some conclusions are controversial101112Enormous animal studies and clinical trials have proved repetitive administration of DCs is important to achieve clinically relevant T cell responsesin vivo homing capacities as well as the anti-viral therapeutic effects to clarify the effect of cryopreservation on DC-based immunotherapy. The evaluation of their homing capacities was carried out by bioluminescence imaging method (BLI). As an emerging in vivo cell tracing method, BLI has the advantages of high specificity and sensitivity and most importantly, it can visualize cells\u2019 dynamic migrating process by successive imaging14in vivo, and the correlation analysis between DC homing and the elicited therapeutic effects would greatly attribute to the optimization of DC vaccine\u2019s preparation and then to minimize the adverse influences of the freezing-thawing process.In the present work, we focused our study on the comparison between mature DCs derived from fresh imDCs (fmDCs) with that from the cryopreserved imDCs (cryoim-mDCs) in the aspects of phenotypes, There were four types of DCs involved in this study, that is, fresh immature (fimDCs), cryopreserved immature DCs (cryoimDCs), fmDCs, and cryoim-mDCs. The relationship among them was described in detail in DCs\u2009=\u2009a/(a\u2009+\u2009b\u2009+\u2009c) and PDCs\u2009=\u2009b/(a\u2009+\u2009b\u2009+\u2009c), respectively. The result showed that the homing percentage of fmDCs to PLNs at 72\u2009h was 0.465\u2009\u00b1\u20090.042, which was more than 3-fold higher than that of cryoim-mDCs (0.136\u2009\u00b1\u20090.057). In addition, the ILN-homing cell percentage of fmDCs at 24, 48 and 72\u2009h was also significantly higher than that of cryoim-mDCs. We also examined the in vivo homing ability of fimDCs and cryoimDCs  antibody to recognize the OVA antigen presented on the surface of DCs. Data showed that both fmDCs and cryoim-mDCs could be detected with presented antigens on cell surface, but the antigen-positive cell percentage of cryoim-mDCs was slightly lower than that of fmDCs  bearing the genes for Fluc and OVAin vitro as well as the trafficking and functional properties in vivo11in vivo functional properties of frozen immature DC as well as its mature counterpart are very limited, and some in vitro findings are controversial. Lewalle et al.\u03b3). In contrast, John et al.To date, several studies have reported the effect of cryopreservation on antigen-loaded or unloaded matured DCs with results showing that the freezing and thawing process does not interfere with their phenotype in vivo trafficking and therapeutic effects of frozen imDC-derived DC vaccines. We found that more than 90% imDCs could be recovered after the freezing-thawing process without changes of phenotype markers, which were in consistent with the previous findings15In this study, the freshly generated imDCs were cryopreserved, revived and matured following the most widely used procedure, with the objective to explore the viability, phenotype, i.v. injected DC homingIn DC-based cell therapy, the delivery routes of DCs play an important role in stimulation of specific T cells and potential immune response. Most commonly DC-based vaccines are injected subcutaneously, intravenously or intradermally. The subcutaneous or intradermal injection is expected to deliver DCs to local LNs. In our study, the most widely used footpad model was employed to examine DC homing capacity to local LNs, with results showing that more than 40% fmDCs could home to LNs, which was about 3-fold more than that of cryoim-mDCs. Different from the way of subcutaneous injection, intravenously injected DCs routinely distribute in a wide range of tissues. The BLI analysis showed that both the fmDCs and cryoim-mDCs accumulated in lungs at 4\u2009h post cell injection, which was in consistent with previous results that the intravenously transferred DCs tended to distributing in lungs at an early time post cell injection, mainly due to mechanical trapping in pulmonary capillaries rather than active adhesion\u03b1 and IL-1\u03b2 in the cultural supernatant of fimDCs was significantly higher than that in the culture of cryoimDCs, suggesting the maturation stimuli fmDCs got was more intense than cryoim-mDCs did. Another indispensable factor for the motility of DCs is the dynamics of the cytoskeleton, which can be viewed as \u201cmotors\u201d for the chemotaxis of DCs. DCs that failed to regulate F-actin localization and polarity show defects in migration toward chemotactic factorsOur research showed that the migration of cryoim-mDCs to lymphoid tissues, by either subcutaneous or intravenous way of delivery, was significantly lower than that of fmDCs. The term \u201cmigration\u201d as discussed here, encompasses several strictly regulated discrete events that invoke numerous context-specific cellular and molecular mechanisms. DCs express specific adhesion molecules and maturation-dependent chemoattractant receptors that allow them to respond to a variety of ligands, which control their trafficking. DCs utilize specific chemokine receptor-ligand pathways, such as CCR1-CCL13, CCR2-CCL2, and CXCR1-CXCL8 to navigate within non-lymphoid peripheral tissues21ex vivo at the higher ratio of \u201cDCs: T cells\u201d (1:5). However, when they were co-incubated in a lower ratio (1:20), T cell activation ability of DCs was positively related to their antigen presentation efficiency, suggesting the high radio of \u201cDCs: T cells\u201d co-culture may cover up the influence exerted by the antigen presentation efficiency of DCs on T cell induction. The observation that cryopreservation didn\u2019t affect T cell activation of DCs at high incubation ratio (1:5) in vitro was, however, different from the findings of Silveira et al.et al.vs. human) may also be one of the possible reasons for the differences.Although the antigen presentation ability of cryoim-mDCs was lower than fmDCs, we didn\u2019t find obvious differences between them in either promoting T cell proliferation or activation in vivo antigen-specific CD8+ T cell responses induced by DCs were detected by OVA-specific tetramers. That we choose to detect T cells in LLNs and the spleen is based on the finding that the i.v. injected DCs mainly accumulated in these two lymphoid organs. Distinct differences were observed between fmDCs and cryoim-mDCs in initiating the in vivo antigen-specific T cell responses in both the spleens and LLNs. We speculate the significantly lower T cell-activation ability of cryoim-mDCs was highly associated with the limited homing cells in these two lymphoid organs. In addition, the relatively lower antigen-presentation of cryoim-mDCs might also be one of the major factors resulting in the weak T cell induction especially at the lower \u201cDCs: T cells\u201d ratio caused by the hindered homing ability of cryoim-mDCs. Our data showed that the anti-viral effect of cryoim-mDCs was significantly lower than that of fmDCs, providing confirming evidence to the widely accepted concept that the homing ability is critically important for DC vaccines to mediate the therapeutic effects.The in vivo migration and distribution pattern with a novel finding that the homing ability of cryoim-mDCs, administrated by either subcutaneous or intravenous way, was significantly lower than that of fmDCs. In addition, we also found that the homing ability of DCs was directly correlated with the intensity of in vivo T cell responses induced, which was the main reason for the reduced therapeutic effect of cryoim-mDC vaccines.In conclusion, we focused our study on investigating the effects of freezing-thawing process on DC vaccines\u2019 Male wild-type C57BL/6 mice, 5\u20136 weeks of age were obtained from the Academy of Military Medicine Science animal center. L2G85 (FVB) mice expressing Firefly luciferase (Fluc) were backcrossed into C57BL/6 mice and used at stage N7 (L2G85.C57BL/6).All experiments were subjected to review and approval of the Animal Care and Use Committee of Academy of Military Medical Sciences (approve number: IACUC of AMMS-09-2015-003). Mice were housed and handled in accordance with the guidelines of the National Institutes of Health.\u03b1 were purchased from Peprotech Asia . Lipopolysaccharide (LPS) was purchased from Sigma Aldrich . D-luciferin was purchased from Promega Corporation . The following antibodies were used for FACS analysis: fluorescein isothiocyanate (FITC)-conjugated anti-CD86, FITC-conjugated anti-I-A[b], FITC-conjugated anti-H-2Kb, Phycoerythrin (PE)-conjugated anti-CCR7, PE-conjugated anti-mouse CD40, PE-conjugated anti-CD11c and FITC conjugated anti-CD11c were purchased from BD PharMingen . PE-conjugated anti-H-2Kb (SIINFEKL) was purchased from BioLegend . PE-conjugated anti-CCR1, PE-conjugated anti-CCR2, PE-conjugated anti-CXCR1 and PE-conjugated anti-CCR7 were purchased from R&D Systems . All the isotype control antibodies were purchased from the same company as the detecting antibodies.RPMI 1640 was purchased from Life Technologies Corporation , containing 4.5\u2009g/L D-Glucose, L-Glutamine and 110\u2009mg/L Sodium Pyruvate. GM-CSF, IL-4 and TNF-6\u2009cells/mL in 6-well plates in RPMI1640 medium supplemented with 10% FBS, 10\u2009ng/mL recombinant murine GM-CSF and 5\u2009ng/mL recombinant murine IL-4, before that the erythrocyte in the cell suspensions were depleted using RBC Lysis Buffer (Cwbio). Old medium was replaced by 2\u2009mL fresh medium with GM-CSF and IL-4 at day 3 and 5. The loosely adherent clusters were used on day 7 as imDCs. mDCs can be generated from imDCs by incubated with LPS (1\u2009\u03bcg/mL) for 48\u2009h.After euthanasia, 5\u20136 week old L2G85.C57BL/6 mice were sacrificed to collect the femurs by cutting tibia below the knee joints and the pelvic bone close to the hip joint. Muscles adhere to the bone were removed carefully, and the femurs were placed into a dish containing cold RPMI 1640 with 10% FBS. Bone marrow mononuclear cell were extruded by flushing with a syringe filled with medium, following gentle dispersion by pipet. Then, the cell suspensions were cultured at a density of 2\u2009\u00d7\u2009107\u2009cells/mL in 90% FBS supplement with 10% dimethyil-sulfoxide (DMSO), then they were aliquoted into cryovials  and put into the freezing container at \u221270\u2009\u00b0C for 24\u2009h, finally, they were transferred into liquid nitrogen tank for one month. Cryopreserved DCs were rapidly thawed in 37\u2009\u00b0C water bath and then diluted by adding 10 volumes of growth medium and centrifuged at 1200\u2009rpm for 5\u2009min before finally be resuspended in growth media.DCs were cryopreserved with a common method for cell cryopreservation using a Cryo 1\u2009\u00b0C freezing container filled with isopropyl alcohol, which can achieve a 1\u2009\u00b0C/min cooling rate at \u221270\u2009\u00b0C for 12\u201314\u2009h . DCs for cryopreservation were resuspended at a cell concentration of 5\u2009\u00d7\u2009107\u2009cells/mL. APC-anti-CD11c combined with one of the phenotypeing antibodies  were added to cell suspension at a concentration of 1.0\u2009\u03bcg per million cells in 100\u2009\u03bcL volume, and then stained half an hour at 4\u2009\u00b0C protecting from light. After staining, cells were washed two times with cold PBS and then re-suspended in 4% paraformaldehyde. The double-labeled samples were subjected to FACS analysis in an 8-color FACS Calibur . The apoptosis detection kit  was used for the viability analysis. fimDCs and cryoimDCs were washed twice with cold PBS and then re-suspended in 1\u2009\u00d7\u2009Binding Buffer at a concentration of 1\u2009\u00d7\u2009106\u2009cells/mL. Add 5\u2009\u03bcL of FITC Annexin V (0.2\u2009mg/ml) and 5\u2009\u03bcL PI (50\u2009\u03bcg/mL) per 100\u2009\u03bcL cell suspension. Gently vortex the cells and incubate for 15\u2009min at RT (25\u2009\u00b0C) in the dark. After that, 400\u2009\u03bcL 1\u00d7 Binding Buffer was added to the incubation system and then the labeled cells were analyzed by FACS Calibur within 1\u2009hour. Total cell populations in FACS analysis were determined by light scatter properties with the purpose to include most of cells and excluded the debris; the population of DCs was defined by CD11c positive population; and the positive population was gated by appropriate isotype controls. Data were collected for 10000 cells and analyzed using Flow Jo 7.6.1 software.For phenotyping, the four types of DCs  were washed twice with cold PBS and then re-suspended in Cell Stain Buffer (BioLegend) at a density of 1\u2009\u00d7\u2009106\u2009fmDCs or cryoim-mDCs cells ready for detection were adhered on a poly-L-lysine-coated microscope slide at 37\u2009\u00b0C for 0.5\u2009h, fixed with 4% paraformaldehyde  for 1\u2009h, and permeabilized with 0.1% Triton X-100  in PBS for 2\u2009min at room temperature. For F-actin staining, permeabilized cells were labeled with 300\u2009\u03bcL FITC-conjugated phalloidin (50\u2009\u03bcg/mL) for 1\u2009h at room temperature, followed by washing. For \u03b2-tublin staining, permeabilized DCs were stained with 300\u2009\u03bcL anti-\u03b2-tublin (10\u2009\u03bcg/mL) at 4\u2009\u00b0C overnight, followed by washing and the addition of 300\u2009\u03bcL Cy3-Goat Anti-Mouse IgG (2\u2009\u03bcg/mL) for 2\u2009h at room temperature. For vimentin staining, permeabilized DCs were stained with 300\u2009\u03bcL anti-vimentin (1\u2009\u03bcg/mL) at 4\u2009\u00b0C overnight, followed by washing and the addition of 300\u2009\u03bcL 488-Alex-Goat Anti-Rabbit IgG (10\u2009\u03bcg/mL) for 2\u2009h at room temperature. After washing, all coverslips were mounted using mounting medium with DAPI and viewed on a confocal laser-scanning microscopy . Triton X-100, phalloidin and DAPI were purchased from Sigma Aldrich . The antibodies of anti-\u03b2-tublin and anti-vimentin and the corresponding secondary antibody were purchased from Abcam (UK Cambridge).1\u2009\u00d7\u200910\u03bcm polycarbonate membrane  using CCL19 as the chemoattractant. DCs were seeded (5\u2009\u00d7\u2009104 cells in 100\u2009\u03bcL of RPMI 1640) in the upper chamber in 24-well cell culture plates and the lower chamber contained 500\u2009\u03bcL of RPMI 1640 with or without CCL19 . Each condition was set up in three repeats. The plates were incubated for 4\u2009h at 37\u2009\u00b0C in 5% CO2. The cells remaining in the upper chamber were removed and the migrated cells were harvested by washing the bottom side of the inserts and the wells 3 times. The total migrated cells were counted by use of Cell Counter  and the results were expressed as the mean number of migrating cells\u2009\u00b1\u2009standard deviation (SD).Chemotaxis of fmDCs or cryoim-mDCs was assessed by their migration through an 8\u2009\u22121). The acquisition of image data and measurement of signal intensity were obtained through region of interest analysis on an IVIS Spectrum system  with Living Image software (Xenogen). For the examination of DC homing to local LNs, a total of 1\u2009\u00d7\u2009106 Fluc+ DCs were injected subcutaneously into the hind leg footpad that was pretreated with 30\u2009ng TNF-\u03b1 24\u2009h before cell injection. For DC distribution analysis, 3\u2009\u00d7\u2009106 Fluc+ DCs were intravenously injected into C57BL/6J mice and imaged at 4, 24, 48 and 72\u2009h after cell injection. For DC tissue bio-distribution analysis, mice were injected intraperitoneally with D-luciferin and euthanized 10\u2009min later. Tissues were dissected and arranged on a cell culture plate or black paper, covered with D-luciferin (3\u2009mg/mL), and imaged for 1\u2009min to obtain photographs.We performed imaging 5\u2009min after intraperitoneal injection of D-luciferin (150\u2009mg kg\u03bcg/mL) for 48\u2009h, then, they were stained with anti-H-2Kb (SIINFEKL)-PE for 15\u2009min at 4\u2009\u00b0C. The reaction was stopped by washing twice with PBS and the cells were analyzed by flow cytometer.Cells were harvested by centrifugation at 200\u2009g for 15\u2009min after being pulsed with 8-mer peptides derived from chicken ovalbumin (OVA)-sequence SIINFEKL were intravenously administered in DC-treated mice. The mice were euthanized three days after the last vaccination, and LLNs and spleen were separated. Cell suspensions were then stained by antibodies against CD8\u03b1 and H-2kb tetramer-SIINFEKL  and then subjected to FACS analysis to distinguish OVAp-specific CD8+ T cells.For the detection of 257-264 SIINFEKL and Fluc were generated by the AdEasy system. Mice were challenged with AdFLGO at a dose of 1\u2009\u00d7\u2009109 PFU/mouse via tail vein injection five days after the last vaccination. The Fluc activity of the mice was monitored by BLI three days after the virus invasion.Recombinant adenovirus (AdFLO) expressing fusion proteins of the H2-Kb-binding peptide epitope OVAP value of less than 0.05. Computer software  was used to perform the statistical analysis.Data are presented as mean\u2009\u00b1\u2009SD. Student\u2019s t-test, one-way one-way ANOVA and Mann-Whitney U test were used for statistical analysis. Significance was accepted at a How to cite this article: Zhou, Q. et al. Mature dendritic cell derived from cryopreserved immature dendritic cell shows impaired homing ability and reduced anti-viral therapeutic effects. Sci. Rep.6, 39071; doi: 10.1038/srep39071 (2016).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."}
+{"text": "Atm and Xrp1 genes identified in this screen.Cell competition, the conditional loss of viable genotypes only when surrounded by other cells, is a phenomenon observed in certain genetic mosaic conditions. We conducted a chemical mutagenesis and screen to recover new mutations that affect cell competition between wild-type and RpS3 heterozygous cells. Mutations were identified by whole-genome sequencing, making use of software tools that greatly facilitate the distinction between newly induced mutations and other sources of apparent sequence polymorphism, thereby reducing false-positive and false-negative identification rates. In addition, we utilized iPLEX MassARRAY for genotyping recombinant chromosomes. These approaches permitted the mapping of a new mutation affecting cell competition when only a single allele existed, with a phenotype assessed only in genetic mosaics, without the benefit of complementation with existing mutations, deletions, or duplications. These techniques expand the utility of chemical mutagenesis and whole-genome sequencing for mutant identification. We discuss mutations in the  Drosophila remain important for the discovery of gene functions and to the genetic characterization of biological processes  flies, clones of Rp/+ cells are not generally recovered in tissues derived from otherwise wild-type imaginal discs, since they are eliminated by competitive apoptosis  pipeline for the identification of novel mutations from whole-genome sequences that automatically excludes strain differences between the reference genome and the FRT genetic background that is essential for mosaic generation. To permit mapping of a single mutation without recourse to complementation tests, we employ iPLEX MassARRAY genotyping. The iPLEX MassARRAY uses matrix-assisted laser desorption ionization time of flight (MALDI-TOF) mass spectrometry to detect sequence variants. Mass spectrometry is sufficiently quantitative that allele frequencies can be estimated from pools of recombinants, greatly facilitating mapping and reducing its expense  insertion on the X chromosome  were fed with 15 mM EMS in sucrose solution as described  to generate mosaic eyes  to screen for cell competition inhibiting mutants in the F2 generation as in Male flies from an isogenized stock  was used to remove duplicate reads. Local realignment, the recalibration of base quality values, and the adjustment of per-base alignment qualities were performed by components from the GATK pipeline .Library construction for whole-genome sequencing was performed according to the manufacturer\u2019s protocol . Whole-genome resequencing was performed on Illumina HiSequation 2000 platform with paired-end 2 \u00d7 100 reads (Illumina). Adapter or low quality bases were trimmed from sequence reads. Then the cleared sequences were aligned to the reference genome dm3 using the BWA . The MarThree mutant strains were exceptional in showing much higher frequencies of sequence differences. In each case there was a single large hypervariable region on chromosome 3R, within which apparent mutations occurred at much higher rate than normal (one mutation per 323 bp). These hypervariable regions were distinct but each partially overlapped another. This suggests that these three mutant chromosomes each contained sequences derived from a common progenitor that differs substantially from both the FRT82B chromosome and the reference genome sequence. We are unsure when these sequences entered our FRT82B strain, but sequences from these three anomalous regions have been excluded from our sequence analysis results.Primers of 20\u201322 bp length and annealing temperature of 57\u201363\u00b0 were designed for 500\u2013700 bp PCR products. NCBI/Primer-BLAST was used to optimize primer design and minimize off-target sites. QIAquick PCR Purification Kit (Qiagen) was used to purify PCR products for Sanger sequencing.Tb1. Recombinant offspring containing Tb1 and FRT82B were selected by Geneticin (G418) resistance. Single recombinant males were bred with the y w eyFLP; FRT82B P{w+, arm-LacZ} P{w+, tub-Gal80} RpS3/TM3, Ser1 tester strain and the offspring scored as phenotypically either mutant (cell competition defective) or nonmutant (cell competition manifested).The M2-73 chromosome was allowed to recombine with an isogenized chromosome marked with http://agenabio.com/assay-design-suite-20-software) using the default settings. The PCR primers were pooled to a final concentration of 500 nM. The extend oligonucleotides were ranked according to mass and divided into three groups. The lowest mass group was rehydrated to 88 \u03bcM, the middle group to 110 \u03bcM, and the highest mass group to 165 \u03bcM. A 50 \u03bcl aliquot from each of the extend oligonucleotides was pooled to make an unextended extend primer (UEP) pool. The PCR primer pool was used to amplify 10 ng of DNA in a 5 \u03bcl volume reaction with 1 U of FastStart Taq Polymerase  and 4 mM magnesium chloride. The tubes were cycled 45 times with an annealing temperature of 56\u00b0. After PCR, shrimp alkaline phosphatase (SAP) was used to dephosphorylate any remaining dNTPs to render them unusable for future polymerase reactions. A total of 0.5 U of SAP and buffer  was added to the PCR tubes and incubated for 40 min at 37\u00b0, followed by 5 min at 85\u00b0. Single base extension reactions were performed on the PCR reactions with the iPLEX Gold Kit (Agena Bioscience) and 0.8 \u03bcl of the custom UEP pool. The kit contains mass modified terminator nucleotides that increase the mass difference between extended UEPs, allowing for greater accuracy in genotyping. The mass difference with unmodified terminator nucleotides ranges from 9 to 40 kDa, depending on the two nucleotides compared. With the mass modified terminator nucleotides the mass difference increases to 16\u201380 kDa. The single base extension reactions were cycled with a nested PCR protocol that used five cycles of annealing and extension nested with a denaturation step in a cycle that was repeated 40 times for a total of 200 annealing and extension steps. The goal was to extend nearly all of the UEPs. Following single base extension, the reactions were diluted with 16 \u03bcl of water and deionized with 6 mg of resin. After deionizing for 20 min the reactions were dispensed onto SpectroChip Arrays with a Nanodispenser (Agena Bioscience). The speed of dispensation was optimized to deliver an average of 18 nl of each reaction to a matrix pad on the SpectroChip. An Agena Bioscience Compact Mass Array Spectrometer was used to perform MALDI-TOF mass spectrometry according to the iPLEX Gold Application Guide 95A  FRT82B homozygous cells. We hypothesized that mutations that diminished cell competition (or mitotic recombination) would lead to increased representation of unrecombined, pigmented, Plac92/+RpS3 cells in this assay . One group of eight samples was then resequenced in a further lane platform, which doubled the read depth for these samples.Sequencing was performed on an Illumina HiSeq2000 sequencing platform, as two groups of eight sequences, each with multiplexed 100 bp paired-end reads in a single lane platform (see Drosophila melanogaster genome version dm3 (+BDGP Release 5)  . However, there was an effect of read depth on recovery of noncoding mutations  gene, a locus important in DNA repair  . These were distributed across 3R at 1.6\u20132.6 Mb intervals. Ideally, the peaks for wild-type and mutant products from heterozygous DNA should be equal. We found nine loci where wild-type and mutant signals were within 10% of one another, one locus where only the wild-type allele was detected, and another that yielded 80% wild-type product . Such deviations from equality can occur if either chromosome differs from the reference sequence used to guide primer design, so that the primers do not amplify each genotype equally.We first analyzed amplified DNA from FRT82B M2-73/FRT82B P{w+, Tb1 strain. The dominant marker Tb1 maps distal on chromosome 3R, distant from FRT82B. Recombinant FRT82B Tb1 strains were assessed in mosaics for presence of the M2-73 phenotype, and DNA extracted from a pool of 50 independent recombinants exhibiting the M2-73 phenotype and 50 independent recombinants exhibiting the control phenotype. Allele frequencies were determined for each pool by iPLEX MassARRAY. It is expected that the mutant allele should be present in all the recombinants exhibiting the mutant phenotype, and none of the recombinants lacking the phenotype , and the pool of phenotypically mutant recombinants exhibited only M2-73 alleles from the proximal end of 3R to 17,720,801 bp . This indicates the causative mutation mapped to the interval 17,720,801\u201319,588,401 bp .Genetic recombinants were obtained after breeding FRT82B M2-73 with an isogenized Xrp1 gene , which predicted a nonsense mutation in the open reading frame  increased little with greater read depth, suggesting that the easily sequenced (or easily assembled) genome regions have already been adequately covered. Haelterman et al. reported similar conclusions .i.e., mutations that were not detected by whole-genome sequencing. When the estimated false-positive rate is subtracted, we estimate that on average 22.4 novel 3R coding mutations would be confirmed among samples at 23\u00d7 coverage, and 21.2 among samples at 50\u00d7 coverage. The failure of increased coverage to identify more mutations is consistent with a low false-negative rate. We also notice that the mutation frequency in our study was one mutation per 94.0\u2013124.6 kb (corresponding to 8.0\u201310.6 mutations per Mb), which is as high or higher than in previous studies, even though we employed a lower mutagen concentration (We do not have a direct estimate of the false-negative rate, ntration . This suThe data in Rp/+ cells from mosaic eye discs and identified two of these loci, Atm and Xrp1. These loci were identified following whole-genome sequencing through distinct approaches. Multiple Atm mutants identified a lethal complementation group, so it was evident that the locus in common between the strains was likely responsible, as was confirmed by replicating the phenotype with a pre-existing allele. Such approaches often permit the identification of mutants after whole-genome sequencing (We have isolated 13 mutants that reduce the elimination of Atm appear to select for Rp/+ cells in the mosaic eyes by eliminating Atm\u2212/\u2212 cells through a mechanism independent of cell competition. Elevated cell death in Atm mutant cells occurs due to chromosome segregation defects including telomere fusion and anaphase bridges (Atm mutation to pass this filter: Atm homozygous mutant clones are only lost after 72 hr of growth in wing imaginal discs. Because the F1 generation screened Atm homozygous clones in a non-Minute background, in which larval growth is completed \u223c2 d earlier than in the Minute background where the effect of cell competition is assessed, the F1 generation may not provide a sufficiently stringent assay to identify mutations that affect noncompetitive growth but exhibit significant perdurance effects.Mutations in  bridges , perduraXrp1, by contrast, remains a candidate to affect cell competition. Xrp1 encodes a DNA-binding bZIP protein whose expression is induced in response to irradiation and other stresses (Xrp1 is not required for cell or organismal viability (Xrp1 in cell competition in more detail elsewhere.A mutation in Identification of newly-induced point mutations following genetic screens can be a bottleneck, especially when multiple alleles are not obtained or when complementation analyses with pre-existing mutant, deficiency or duplication collections are inconvenient. We present evidence that whole-genome sequencing and variant mapping methods are adequate to identify even single alleles of nonessential genes."}
+{"text": "N = 50\u201378). Lifestyle was assessed using questionnaires and weight was measured at baseline, 3 and 6 months after randomization. BMI, blood pressure, body composition, pulse wave velocity, glycemic parameters and lipid profile were assessed 3\u20138 years after randomization. Decreases in savory and sweet snack intake were associated with lower HOMA-IR 3\u20138 years later, but these associations disappeared after adjustment for current lifestyle. No other associations between changes in lifestyle or body weight during the first six months after randomization with cardiovascular health 3\u20138 years later were observed. In conclusion, reductions in snack intake were associated with reduced insulin resistance 3\u20138 years later, but adjustment for current lifestyle reduced these associations. This indicates that changing lifestyle is an important first step, but maintaining this change is needed for improving cardiometabolic health in the long-term.The degree to which individuals change their lifestyle in response to interventions differs and this variation could affect cardiometabolic health. We examined if changes in dietary intake, physical activity and weight of obese infertile women during the first six months of the LIFEstyle trial were associated with cardiometabolic health 3\u20138 years later ( It is therefore that primary prevention of CVDs focuses, among others, on improving these lifestyle factors and reducing body weight [Unhealthy diet, physical inactivity and a BMI over 25 kg/my weight . Observay weight  lowered Randomized controlled trials (RCTs) showed that improving lifestyle and reducing body weight improved cardiometabolic health ,5. HowevThe LIFEstyle RCT enrolled obese infertile women, and allocated them to a six-month diet and physical activity intervention or to prompt infertility treatment ,10,11. WWe hypothesized that women who increased their intake of vegetables and fruit, decreased their intake of sugary drinks and snacks, became more physically active and lost more weight during the first six months after randomization had a better cardiometabolic health 3\u20138 years after randomization compared to women who did not show these improvements in lifestyle and weight. We therefore examined if the change in dietary intake, physical activity and body weight of obese infertile women, combining the intervention and control group, over the first six months of a preconception lifestyle intervention study was associated with their cardiometabolic health 3\u20138 years after the start of the study.2 were randomized into a six-month structured lifestyle intervention (intervention group) or infertility care as usual (control group). The lifestyle intervention focused on eating a healthy diet according to the Dutch Dietary Guidelines 2006 [The study population comprises all women who participated in the follow-up of the LIFEstyle study. The LIFEstyle study was a multicenter randomized controlled trial (RCT), conducted between 2009 and 2014 in the Netherlands ,11. In tnes 2006 , includiN = 111; At 3\u20138 years after randomization, 574 women were eligible to participate in the follow-up study of the LIFEstyle RCT . During The study was conducted in accordance with the Declaration of Helsinki and all procedures were approved by the Medical Ethics Committee of the University Medical Centre Groningen, the Netherlands (METc 2008/284). Written informed consent was obtained from all participants at the start of the LIFEstyle study as well as the start of the follow-up.In order to calculate change in lifestyle and body weight over the first six months of the study, we used dietary intake, physical activity and body weight measures collected at baseline, 3 and 6 months after randomization in the lifestyle intervention study. Dietary intake was examined using a 33-item food frequency questionnaire (FFQ) consisting of two parts. The first part was based on the standardized questionnaire on food consumption used for the Public Health Monitor in the Netherlands , asking Physical activity was examined using the validated Short QUestionnaire to ASsess Health-enhancing physical activity (SQUASH) questionnaire . This quBody weight (kg) was measured during hospital visits at baseline, 3 months and 6 months after randomization by trained research nurses that were not involved in the lifestyle intervention coaching.Cardiometabolic health 3\u20138 years after randomization was examined in a mobile research vehicle by two researchers, using a standardized research protocol. Women were asked not to eat or drink from 90 min onwards before the mobile research vehicle arrived at their home. They were additionally asked not to drink caffeine containing beverages or to smoke from 12 h onwards before the physical examination. Height and current weight were measured to calculate current BMI. Height was measured to the nearest 0.1 cm using a wall stadiometer  on bare feet, with heels flat on the ground at an angle of 90 degrees, head in Frankfort horizontal position and heels, back and shoulders straight against the wall. Current weight was measured in underwear to the nearest 0.1 kg using a digital weighting scale , while the participant was standing still and looking straight ahead. All measurements were done twice, and in case of >0.5 cm difference in height and >0.5 kg difference in weight, a third measurement was performed. After sitting quietly for 5 min, blood pressure was measured three times at heart level, at the non-dominant arm, using an automatic measurement device  with appropriate cuff size. The three measurements were done using a 30 s time interval and women were not allowed to talk in between, move, cross their legs or tense their arm muscles. Body composition was measured twice by bio-electrical impedance  after lying quietly for 5 min. On beforehand participants were asked to take of any jewelry, belts, piercings, etc. which could affect the BIA measurements. After cleaning the skin with alcohol, electrode strips were attached at the dorsal side of the left hand and foot with at least 3\u20135 cm in between the two electrodes. Women were instructed not to talk in between the measurements and attention was paid that arms and legs did not touch other parts of the body. A third measurement was performed in case the impedance or resistance differed >5\u03a9. Fat mass and fat free mass were calculated using equation of Kyle and colleagues . ImmediaApart from the physical examinations, a trained nurse visited the participants at home to draw a venous blood sample after an overnight fast. All venous blood samples were analyzed at the biochemical laboratory of the Amsterdam UMC. We examined metabolic health by fasting serum concentrations of glucose  and insulin , triglycerides , total cholesterol  and high density (HDL-C) lipoprotein cholesterol . Low density (LDL-C) lipoprotein cholesterol was calculated using the following formula;  \u2212 (high density lipoprotein cholesterol) \u2212 0.45 \u00d7 (triglycerides). Furthermore, insulin resistance (HOMA-IR) was calculated as fasting insulin concentration in \u03bcU/mL multiplied by fasting glucose concentration in mmol/L divided by 22.5. We additionally examined if metabolic syndrome was present or not. If present, participant met at least three of the following criteria determined by the American Heart Association: glucose \u2265 5.6 mmol/L, HDL-C < 1.3 mmol/L, triglycerides \u2265 1.7 mmol/L, waist circumference \u2265 88 cm or blood pressure \u2265 130/85 mmHg .We used linear regression models to study the association between the change in dietary intake, physical activity, and weight during the first six months after randomization and cardiometabolic health 3\u20138 years later. Results are displayed as betas (\u03b2) and 95% confidence intervals (C.I.). For metabolic syndrome, logistic regression was used and results are displayed as odds ratios (OR) and 95% C.I. We recalculated the intake of vegetables and fruits into 10 g/day dividing the change by ten. Our regression models therefore display the effect on cardiometabolic health per 10 g change of vegetable intake and fruit intake per day.N = 5). This means that a higher change score for vegetable intake, fruit intake, and MVPA is healthier, while a higher change score for sugary drink intake, savory and sweet snack intake, and weight change (higher means weight gain instead of weight loss) is unhealthier. In our regression models, the change in vegetable intake, fruit intake and MVPA was calculated by subtracting the baseline measurement from the last known measurement. The change in sugary drinks, savory and sweet snack intake and body weight was calculated by subtracting the last known measurement from the baseline measurement. An increase in change score in our regression models is favorable, reflecting an increase in vegetable intake, fruit intake and MVPA, and a decrease in sugary drink intake, savory and sweet snack intake and body weight.For the descriptive statistics the change in lifestyle and body weight over time was calculated by subtracting the baseline measurement from the last know measurement at preferably 6 months or otherwise 3 months after randomization . In mostAll crude regression models were corrected for baseline cardiometabolic health, depending on the outcome variable , with exception of fat mass, fat free mass, and PWV as these outcomes were not measured at baseline. We therefore corrected fat mass and fat free mass models for baseline BMI , and PWVp-values <0.05 were considered statistically significant.Statistical analyses were performed using the software Statistical Package for the Social Sciences (SPSS) version 24 for Windows . Of the 577 women randomly allocated to the intervention and control group during the trial, 574 women were eligible to participate in the physical examinations at 3\u20138 years after the intervention . Of thesN = 111) and non-participants (N = 463) of the follow-up study (N = 111), with exception of ethnicity and the change in sweet snack intake , most of them were Caucasian (94.6%), had an intermediate vocational education (49.1%) and were obese at 3\u20138 years after the intervention (mean BMI = 35.5 kg/m2 (SD = 5.3); k intake . Particip = 0.049). This association disappeared after adjustment for smoking, current savory snack intake and current MVPA ; p = 0.33). Changes in savory snack intake were not associated with women\u2019s BMI, blood pressure, body composition, PWV or other metabolic outcomes at follow-up. Furthermore, a decrease in sweet snacks intake during the first six months after randomization was associated with a lower HOMA-IR at follow-up ; p = 0.003). Also this association disappeared after adjustment for smoking, current sweet snack intake and current MVPA ; p = 0.84).We did not observe the hypothesized associations between increases in vegetable intake, fruit intake and MVPA during the first six months of the LIFEstyle study with a more favorable BMI, blood pressure, body composition, PWV and metabolic health 3\u20138 years later . FurtherDietary intake, physical activity and weight change during the first six months after randomization were not associated with having metabolic syndrome at follow-up .Adding randomization arm into the model (intervention or control group) and time between randomization and follow-up (years) did not change effect estimates. Additionally, effect estimates hardly changed when we excluded women in early pregnancy from our study sample (results not shown).A decrease in savory and sweet snacks during the first six months after randomization was associated with lower insulin resistance 3\u20138 years later. However, these associations became non-significant after adjustment for current lifestyle. No other associations between changes in lifestyle or body weight during the first six months after randomization with cardiovascular health 3\u20138 years later were observed.A reason why we did not observe statistically significant associations between changes in lifestyle and body weight during the first six months after randomization with cardiovascular health 3\u20138 years later might be the low number of participants included in the follow-up study, and therefore we had low power to observe the hypothesized associations. Furthermore, it might be that there was not enough individual variation in the changes in lifestyle and body weight to find any associations with cardiovascular health at follow-up, which could be explained by the fact that women allocated to the control group participated to a larger extent in our follow-up study than women allocated to the intervention group.p = 0.06) and more MVPA (p = 0.09) had a higher fat free mass are in accordance with physiological mechanisms. Muscular activity stimulates the development and maintenance of lean muscle mass [p = 0.06). This is in line with findings in other studies and may relate to links between lower visceral fat mass and higher HDL-cholesterol [There were multiple associations pointing towards our hypothesis that healthy changes in lifestyle are associated with more favorable cardiovascular health. Our findings that women with a higher intake of fruit (cle mass  and the cle mass . Furtherlesterol .p = 0.06), which is not in line with our hypothesis and unexpected, assuming that a lower intake of sugary drinks causes a lower BMI, which is associated with improved HDL-cholesterol [However, we also observed that women who decreased their sugary drink intake tended to have a lower HDL-cholesterol  about cardiometabolic health at the start of the intervention and at 3\u20138 years after randomization, and were able to take into account women\u2019s baseline cardiometabolic health. There are also limitations that should be mentioned. Dietary intake as well as physical activity was measured using self-reported questionnaires. Obese women tend to under-report unhealthy behavior and over-report healthy behavior , and womTo conclude, decreases in savory and sweet snack intake were associated with reduced insulin resistance 3\u20138 years later, but after adjustment for current lifestyle these associations disappeared. No other associations between changes in lifestyle or body weight during the first six months after randomization with cardiovascular health 3\u20138 years later were observed. Changing lifestyle is an important first step, but maintaining this change is needed to improve cardiometabolic health in the long-term."}
+{"text": "Tuberculosis awareness is crucial to the success of control and prevention of tuberculosis. However, the knowledge and perceptions of tuberculosis patients in rural Kenya is not well documented. The study sought to explore the knowledge and perceptions of TB patients in West Pokot County Kenya.This was a qualitative descriptive study conducted between January-March 2016. A total of 61 pulmonary tuberculosis patients took part in the study which comprised 6 focus group discussion and 15 in-depth interviews. Thematic analysis was used to analyse the data.Participants perceived TB as a serious contagious disease that is hard to diagnose and treat. They attributed tuberculosis to smoking, drinking alcohol, dust, cold air, witchcraft, trauma to the chest, contact with livestock and genetic factors. They believed that TB was transmitted through casual contact with TB patients and sharing of utensils.The study showed a lot of misperceptions among tuberculosis patients. The tuberculosis program should heighten patient education to improve patient knowledge and put more effort to dispel misinformation about the cause and mode of transmission of the disease. Tuberculosis(TB) is a major global health concern . It is tStudy setting: This was a facility-based study carried out in four hospitals offering TB services in West Pokot County, Kenya. The County is located in the Rift Valley and lies within Longitudes 34\u00ba 47\u00b4 and 35\u00ba 49\u00b4 East and Latitude 10\u00ba 10\u00b4 and 30\u00ba 40\u00b4 North. The County has a population of 512,690 people (2009 census) and an area of 9,169.4 km2. It is less developed with poor infrastructure and the inhabitants are mainly Pokots. Approximately 80% of the County is arid or semiarid and 60% of the inhabitants are nomadic pastoralists while the rest of the population are agro-pastoralists [oralists . There aoralists . The maioralists .Study design: This was a qualitative descriptive study conducted between January-March 2016 using focus group discussion (FGDs) and in-depth interviews (IDIs).Participant recruitment and sampling: The study participants composed of 61 pulmonary tuberculosis patients receiving treatment from four health facilities in West Pokot County. Only confirmed adult TB cases on treatment were included in the study. The mentally ill and patients who had not completed two weeks of treatment were excluded from the study due to the infectious nature of the disease. With the guidance of the nurses at the TB clinics, participants who met the inclusion criteria were purposively selected and briefed about the study and were booked for the interviews during their appointment dates.In-depth interviews: In-depth interviews were the primary method used to collect data on patient knowledge and perceptions. The interviews were done at the TB clinics and lasted for 45-60 minutes. A semi-structured interview guide was used to collect the information. The interviews were conducted in Kiswahili language at the TB clinic and were tape recorded and later transcribed verbatim [verbatim . The converbatim  was usedFocus group discussion: We conducted six FGDs  each comprised of 6-10 participants. Compared to individual interviews, group interaction allows participants to agree and disagree thereby stimulating richer responses which aid in revealing the respondent's real perceptions on the subject of interest [interest . Gatheriinterest . The coninterest . Data saData processing and analysis: The FGDs and IDIs were transcribed by the researcher. Transcripts were analysed with the aid of the N-vivo (version 11). Data collection and data analysis were done concurrently. Thematic analysis was done by reading through the transcript multiple times and identifying, coding and categorizing meaningful patterns into themes and sub-themes.Ethical considerations: The research proposal was approved by Moi University College of Health Sciences/Moi Teaching and Referral Hospital Institutional Research and Ethics Committee . Participants were all briefed on the study and each respondent asked to sign an informed consent form without coercion. Participants allowed the audio recording during data collection and were assured of confidentiality and anonymity for any information given.Socio-demographic characteristics of the participants: A total of 61 participants were enrolled in the study. The median age of the participants was 38 (range 27-61 years). A total of 29(47.5 %) were females while 32(52.5%) were males. Out of the 61 participants, 46(75%) participated in the FGD while 15(25%) participated in the in-depth interviews. About 27(44%) of the participants had no formal education while 21(35%) and 13(21%) had attained primary and secondary education respectively. Majority 34(56%) were pastoralist while 11(18%) and 10(17%) indicated business and formal employment as their main source of income. The rest (9%) indicated they had no source of income.Knowledge and perceptions of TB: Tuberculosis was commonly referred to as \"TB\" by the study participants. When asked the local name for the disease, the participants reported that among the Pokot community, TB was known as Semewo takat meaning disease of the chest. The findings revealed that TB patients had different perceptions about TB. There were five themes namely: curable disease, serious illness hard to diagnose and treat, contagious disease, a disease caused by a germ, and misconceptions. The misconception theme had 2 sub-themes.Curable disease: The data revealed that patients correctly perceived TB as a curable disease. They were also cognisant to the fact that for one to be cured of TB they needed to adhere to treatment for a long period of time. The fact that the patients were aware of efficacious drugs against TB made it less stressful for the patients to learn that they were suffering from TB. Two participants had this to say; \"\u2026TB is curable but one has to be persistent and take drugs for a very long time\u2026\" . \"I wasn't scared at all because TB is a disease that is treatable as well as curable.\" . Patient's previous experiences were key in shaping their perceptions about TB. One patient expressed how devastated he was to learn that he had TB which according to him was a fatal disease. He believed that TB can be fatal particularly if one does not seek and adhere to the doctor's instruction. His experience of having witnessed a patient die of TB in his village made him worried about his illness. However, he found relief after the nurse explained that TB was curable and showed him evidence of people who had been treated and cured of TB. This implies the importance of patient education by the health workers in creating awareness on facts about tuberculosis. This was illustrated by a male patient in his response to the question, how did you feel after being told you were suffering from TB? \"When they told me I had TB I got scared that I might die and leave my children without a caregiver\u2026but the nurse reassured me that it is a treatable disease and that I will get cured when I take the drugs well. I was scared because I used to have a neighbour who had TB, he was told to stop taking alcohol and smoking but he continued until he died. I was encouraged by the doctor who gave me an example of 5 people who had TB and yet they recovered\u2026this gave me hope\" .\"The problem with TB is that you have to take treatment for a very long time and sometimes you give up. Personally I swallowed the drugs until I felt I had recovered. I swallowed for one and half month and I felt I had Improve and so I stopped the medications\" . \"Even me I swallowed the drugs for some time until I had Improved and so I stopped the treatment. But after one and a half years I had severe cough and came back here\u2026\" .The participants alluded to the fact that for one to be cured of TB they needed to adhere to treatment for a long period of time. Majority of the participants viewed this as a major challenge in dealing with the disease. However, some of the patients indicated having abandoned treatment prematurely after their health had improved. This only resulted to more suffering as the disease recurred and patient forced to restart a full treatment regimen. This may be attributed to lack of knowledge about TB treatment among some of the TB patients in West Pokot County. This was alluded to by the participants in their narratives. Contagious disease: Majority of the participants perceived TB as a contagious disease that can easily spread from one person to the other. Some of them correctly indicated that TB is an airborne disease and emphasised the need to observe cough etiquette to prevent transmission. However most of the participants held a lot of misperceptions on TB transmission. This is illustrated below in the misconceptions theme. Some of the participants had this to say; \"I have heard that TB is transmitted to another person through coughing. The doctors here tell us to cover our mouth when we are coughing so that we don't pass the disease to the other people\" . \"TB can be transmitted through air when you cough or sharing utensils.\" .A serious disease hard to diagnose and treat: Most patients thought that TB was a severe disease that mainly affect the chest and has an insidious onset which makes it hard to diagnose. Majority were concerned about the frustration one has to go through before getting the correct diagnosis and treatment. Due to the onset of symptoms which mimic other respiratory tract infections, patients were often treated with different medications without improvement. This was illustrated by the following sentiments; \"\u2026with TB life is complicated, some of us have gone to so many hospitals before being told the problem is TB\" . \"TB is a bad disease it hides in the body and it is not easy to know that you are suffering from TB. Because it starts just like a common cold with a cough\u2026\" . The participants perceived TB as a source of great suffering to the patient. Several participants agonised how difficult it was to go through the experience of having TB. They recounted how TB caused them a lot of pain and discomfort which left them very weak and unable to lead a comfortable life. Some of the participants had this to say; \"When you have TB you suffer a lot and you experience a lot of chest pains and you also cough a lot. It is a bad disease that sucks the body making you lose weight\u2026 It makes someone to vomit a lot and loss appetite and this makes you very weak\" . \"TB is a serious disease that makes you lose weight, \"inakunyonya kama kupe\" (it sucks you like a tick) it sucks you until you become very weak and everyone can notice you are unhealthy\" . The participants were cognizant to the fact that TB is fatal without treatment. They termed TB as \"a very bad disease\" which require medical attention. According to the participants, if one has TB they should seek the right treatment from what they referred to as \"big hospitals\" meaning the County or Sub-county hospitals. \u201cWhen one has that disease he should go to the hospital because it is a very bad disease\" . \"TB is a bad disease that can finish you and the best thing is to look for treatment in a big hospital like this one so that your problem is discovered early and cured\" .TB is caused by germ: One of the probing questions on knowledge about TB in both narrative guide and focus group discussion guide was \"What causes TB\"? The data from both the narrative and the focus group discussions showed that participants had different explanations as to what causes TB. Only 2 participants in the focus group discussion indicated that TB is caused by germ or bacteria. The rest of the participants held a lot of misconceptions about the cause of TB as discussed below in the misconceptions theme.Misconceptions about TB: The participants had a lot of false beliefs and myths concerning the cause and transmission of tuberculosis.Notions on the cause of TB: The participants indicated that TB was a hereditary disease. According to them, this was the explanation for having more than one person from the same family suffer from TB. Although most of them termed TB as a contagious disease they did not attribute transmission to be the reason why members of the same family could suffer from tuberculosis. To some of the patients, having a member of the family suffer from TB was expected since this was an inherited disease. This was demonstrated by some of the participants who had this to say; \"TB is hereditary. It is a family disease like in my case most of the members have been treated for TB. It runs in our family. Even when they told me I had the disease I was not surprised\" \u2026 if someone from your family has suffered from TB, then automatically someone else in the family will have to suffer from TB. That is, they say that there some families/clan who have had this disease from olden days and it will continue like that even in future generations\" . Similarly, the participants perceived smoking and drinking alcohol as the cause of TB. The participants particular those who had the habit of drinking alcohol and smoking cigarettes found this as the only explanation as to why they acquired TB. \"TB is caused by drinking alcohol and smoking cigarettes. If you look keenly you will find those who take a lot of illicit brews get TB. I used to take alcohol and that's how I got the disease but now I have stopped\" . The mistaken beliefs on the cause of TB affect the control and preventive measures the community may advocate for. According to the participants since drinking alcohol and smoking was a major cause of TB, one of the measures to reduce the burden of TB in the county was that the government should ban the consumption of illicit brew and cigarette smoking. This was illustrated by the following participant; \"TB is caused by drinking and cigarettes smoking. To reduce this problem the government should ban smoking and stop consumption of all illicit brews\" . The participants attributed dusty environment and the dry weather predominant in West Pokot as the cause of the increased cases of TB in the area. According to them, TB mainly affect people who are exposed to dust due to the nature of their jobs. Some of the participants had this to say; \"It affects those people who smoke and those who work in dusty places. This place is dry and thus why we have a lot of TB\" . \"TB is a lot in this region because of the dry weather and a lot of dust\" .\"TB is caused by dust and cold air\" . For some of participants TB is a zoonotic disease that spread from the goats to humans. The participants were mainly pastoralists and believed that their interaction with the domestic animals was a source of TB. Due to animal theft, communities in the region often share room with their goats and sheep. To some of the participants this was one of the cause of tuberculosis. \u2026also the practice of rearing goats where some people sleep in the same room with the goats may be causing the many cases of TB\" . \"TB is disease that affects the chest mainly and it is brought by the close contact with goats. Living in the same room with goats can bring the infection to the humans\" .For others TB was as result of trauma to the chest. Some of the participants associated their illness to be as result of trauma that they had suffered at some point before the TB symptoms set in. Several patients recounted that their chest problems started after some injury to the chest which was later diagnosed as tuberculosis. A participant had this to say; \"One can get TB when you suffer from Trauma. My problem with TB started when I fell from a tree and hurt my ribs. After sometime I started coughing and thus how my problem all started\" . Worse still, for other participants TB was as a result of bad omen, curse or witchcraft. One of the key questions in the FGD guide was \"What are some of the traditional explanations to the causes of TB\"\" In response to this question a minority of the participants indicated that TB was not viewed as an infectious disease. To them TB was a curse or a bad omen that can befall anyone. \"\u2026people say TB comes as a result of curse or a bad omen which can affect anyone\u2026some think that it is witchcraft\"\" .Other participants felt TB was as result of both cold air and dust as indicated by one of the male respondent; Patients' notions on TB transmission: When asked whether TB is transmissible, the participants correctly perceived TB as contagious, however majority had false notions on how TB spread from one person to the other. This is of concern since it is likely to affect the preventive and control measures adopted by the community. Participants believed that TB was transmitted through sharing of utensils. They noted that they all had their utensils set aside from the rest of the family to avoid transmitting the illness. \"The disease can be transmitted through sharing utensils. That is why it is always good to have your own cup spoon plate even cooking pots \u2026I don't know of any other route.  \"If you have TB you are supposed to have your cup, plate, spoon cooking pot and even beddings isolated from the rest in the family.\" You must not share with the others . For others TB was transmitted through casual contact with an infected person. In order to prevent transmission they advised that an infected person should avoid associating with the rest of the family including having their own utensils and house. This often led to acts of isolation as described by some of the participants. \"When one has TB she should not shake hands with the healthy people until one completes the treatment\" . \"TB is also transmitted when you eat and drink with a person who has TB. People with TB should have their own utensils and should not share house with the rest of the family\" .The study showed that, though the participants correctly perceived TB as a contagious disease that is curable they did not know the cause and the mode of transmission of tuberculosis. Participants attributed the cause of TB to genetic factors, drinking alcohol and smoking, cold air, trauma, dusty environment as well as bad omens while sharing of utensils and casual contact were seen as the main routes of transmitting TB. This is despite the fact that these were patients who were already on treatment and ought to have received TB education at the health facility. The lack of TB knowledge is of great concern as it leads to wrong opinions on control and prevention of TB thereby making it difficult to reduce the burden of TB. The current study revealed there were false beliefs and opinion about the cause of TB in the study area. The findings are consistent with those of a study done in rural Uganda where witchcraft, hereditary factors, heavy labour, sharing of utensils and smoking were documented as the causes of TB . SimilarSimilarly, the participants attributed casual contact such as greetings, eating together and sharing utensils with an infected person as a mode of TB transmission. As means of preventing TB, nearly all the participants reported the need for TB patients to have their own utensils which shouldn't be shared with the rest of the family. The findings of the current study are consistent with those of a recent study done among pastoralist communities in Ethiopia that showed significant knowledge gaps about the cause, signs and symptoms, mode of transmission, prevention, and treatment of TB among the community members . While pThe study showed incorrect knowledge about TB among TB patients. Although the participants correctly perceived TB as a contagious disease they did not understand the correct cause and mode of transmission. There is a need to improve patient knowledge and awareness of TB. The current study is limited in that we only focused on patients and not the healthcare workers and the kind of patient education given at the TB clinics. Further studies to look into the kind of patient education given and its effectiveness in improving patients TB knowledge are recommended.Previous studies have focused on community knowledge of tuberculosis and shown poor knowledge among study participants;Community members often have incorrect knowledge about the cause transmission and treatment of tuberculosis.The current study focuses on TB knowledge and perceptions among Tuberculosis patients who are already on treatment. The patients have been in contact with health workers and should have received TB education as required by the TB program;The study shows the patients still exhibit TB knowledge gaps and recommend a need to heighten TB education by the TB program."}
+{"text": "A facile and convenient synthesis of bis(2-(1H-benzo[d]imidazol-2(3H)-ylidene)-3-oxopropanenitrile), bis((3-amino-5-(methylthio)-1H-pyrazol-4-yl)methanone) and bis derivatives incorporating a thieno- thiophene moiety  Treatment of 3,3'-bis(3-oxopropanenitrile) (2)  with sodrile) 4, . Its IR own in 1  with an 3 with hydrazine hydrate gave 3,4-dimethylthienothiophene-2,5-diyl-bis-(3-amino-5-(methylthio)-1H-pyrazol-4-yl)methanone  in refluxing xylene afforded 2-({5-[-2-cyano-3-(dimethylamino)-2-propenoyl]-3,4-dimethylthienothiophen-2-yl}carbonyl)-3-(dimethylamino)-2-propenenitrile (9) -3,4-dimethylthienothiophen-2-yl}carbonyl)-3--2-propenenitrile (3). To a stirred solution of sodium hydride  in dimethylsulfoxide (20 mL), compound 2  was added. The resulting mixture was stirred for 30 min, and then carbon disulfide  was added. After 2 h of stirring, methyl iodide  was added and the stirring was continued for additional 4 h. The resulting reaction mixture was then poured over crushed ice and the solid product was filtered off, washed with water, dried and finally recrystallised from ethanol to afford bis(methylthio)methylene derivative 3 in 60% yield, mp 170 \u00b0C; IR (KBr) \u03bd max: 1,698 (C=O), 2,210 (C\u2261N), 2,985  cm\u22121. 1H-NMR (DMSO-d6): \u03b4 2.23 , 2.53 . Anal. Calcd for C20H18N2O2S6(510.76): C, 47.03; H, 3.55; N, 5.48. Found: C, 47.13; H, 3.48; N, 5.40%.3,3'-bis(2-(1H-benzo[d]imidazol-2(3H)-ylidene)-3-oxo-propanenitrile) (4) Method A.o-Phenylenediamine  was added to a solution of bis(methylthio)methylene derivative 3  in ethanol (20 mL). The mixture was refluxed for 3 h and then allowed to cool. The solid formed was filtered off, washed with ethanol and recrystallised from DMF/water to afford compound 4 in 72% yield, mp < 320 \u00b0C; IR (KBr) \u03bd max: 1,670 (C=O), 2,195 (C\u2261N), 3,214 and 3,177 (NH) cm\u22121; 1H-NMR (DMSO-d6): \u03b4 2.49 , 7.28\u20137.32 , 7.56\u20137.59 , 13.1 ; 13C-NMR (DMSO-d6): \u03b4 8.3 (2CH3), 111.0 (2=C-C), 115.3 (2CN), 117.6, 118.9, 142.2, 156.0 (benzimidazole ArC), 130.4, 131.8, 138.8, 140.1, (thienothiophene ArC), 185.9 (2C=O). Anal. Calcd for C28H18N6O2S2 (534.61): C, 62.91; H, 3.39; N, 15.72. Found: C, 62.81; H, 3.32; N, 15.67%.Method B. To a mixture of diethyl 3,4-dimethylthienothiophene-2,5-dicarboxylate  and 2-(1H-benzo[d]imidazol-2-yl)acetonitrile  in dry benzene (25 mL) and dimethylformamide (1 mL) was added sodium hydride . The reaction mixture was refluxed for 4 h, then allowed to cool. The solid that precipitated was collected by filtration, washed with ether and dried. The solid product was dissolved in water and the resulting solution was neutralised to pH 7 with concentrated hydrochloric acid. The precipitated solid was collected by filtration, washed with water and dried. Recrystallisation of the crude product from DMF/water gave a product (60% yield) identical in all respects  with that obtained by method A.Synthesis of bis((3-amino-5-(methylthio)-1H-pyrazol-4-yl)methanone) (8). To a solution of compound 3  in EtOH (20 mL), hydrazine hydrate  was added and the reaction mixture was refluxed for 4 h, and then left to cool. The solid product so formed was filtered off, washed with EtOH and dried. Recrystallization from DMF/ EtOH afforded 8 in 55% yield; mp 302 \u00b0C; IR (KBr) \u03bd max: 3,427, 3,214 and 3,177 , 1,675 (C=O) cm\u22121; 1H-NMR (DMSO-d6): \u03b4 2.49 , 2.89 , 5.5 , 7.95 ; 13C-NMR (DMSO-d6): \u03b4 8.3 (2CH3), 11.7 (2CH3-SH), 87.8, 115.3, 142.2, (pyrazole ArC), 130.4, 131.8, 136.3, 140.1, (thienothiophene ArC), 185.9 (2C=O). Anal. Calcd for C18H18N6O2S4(478.63): C, 45.17; H, 3.79; N, 17.56. Found: C, 45.27; H, 3.86; N, 17.51%Synthesis of 4,4'-bis (12). To a mixture of compound 9  and thiourea  in ethanol (30 mL), a few drops of piperidine was added and the reaction mixture was refluxed for 8 h, then left to cool to room temperature. The precipitated product was filtered off, washed with EtOH, dried and finally recrystallized from DMF to afford compound 12 in 78% yield; mp. 318 \u00b0C; IR (KBr) 3,200 (NH), 2,210 (C\u2261N), cm\u22121; 1H-NMR (DMSO-d6): \u03b4 2.49 , 6.37 , 11.62 . Anal. Calcd. for C18H10N6S4(438.57): C, 49.29; H, 2.30; N, 19.16. Found: C, 49.20; H, 2.22; N, 19.106%.Synthesis of 4,4'-bis(5-benzoyl-2-(phenylamino)- thiophene- 3-carbonitrile) (17). To a stirred solution of potassium hydroxide  in DMF (20 mL) was added compound 2 . After stirring for 30 min, phenyl isothiocyanate  was added to the resulting mixture. Stirring was continued for 6 h, and then 2-bromo-1-phenylethanone  was added portionwise over a period of 30 min. After the addition was complete, the reaction mixture was stirred for additional 12 h, during which the 2-bromo-1-phenylethanone went into solution and a yellow product precipitated. The solid product was filtered off, washed with EtOH and dried, Recrystallization from EtOH/DMF afforded 17 in 86% yield, mp < 320 \u00b0C; IR (KBr) \u03bd max: 3,277 (NH), 2,212 (C\u2261N), 1618 (C=O) cm\u22121; 1H-NMR (DMSO-d6): \u03b4 2.07 , 7.09\u20137.53 , 10.6 ; 13C-NMR(DMSO-d6): \u03b4 8.3 (2CH3), 115.3 (2CN), 116.3, 117.6, 118.9, 125.3, 126.6, 127.9, 129.1, 136.7 (ArC\u2019s), 130.4, 131.8, 138.8, 140.1 (thienothiophene ArC), 111.0, 133.3, 145.8, 156.0 (thiophene ArC), 187.9 (2C=O). MS m/z (%) 774 , 773 , 351 (80.6%), 212 (16.2%), 63(30.3%). Anal. Calcd for C44H28N4O2S4 (772.98): C, 68.37; H, 3.65; N, 7.25. Found: C, 68.31; H, 3.69; N, 7.20%.In summary, the reactivity of diethyl 3,4-dimethylthienothiophene-2,5-dicarboxylate (1) as a versatile and readily accessible building block for the synthesis of new bis-heterocycles incorporating thienothiophene moieties of potential biological and pharmaceutical importance was investigated."}
+{"text": "Sirtuins 1 and 2 (SIRT1/2) are two NAD-dependent deacetylases with major roles in inflammation. In addition to deacetylating histones and other proteins, SIRT1/2-mediated regulation is coupled with other epigenetic enzymes. Here, we investigate the links between SIRT1/2 activity and DNA methylation in macrophage differentiation due to their relevance in myeloid cells. SIRT1/2 display drastic upregulation during macrophage differentiation and their inhibition impacts the expression of many inflammation-related genes. In this context, SIRT1/2 inhibition abrogates DNA methylation gains, but does not affect demethylation. Inhibition of hypermethylation occurs at many inflammatory loci, which results in more drastic upregulation of their expression upon macrophage polarization following bacterial lipopolysaccharide (LPS) challenge. SIRT1/2-mediated gains of methylation concur with decreases in activating histone marks, and their inhibition revert these histone marks to resemble an open chromatin. Remarkably, specific inhibition of DNA methyltransferases is sufficient to upregulate inflammatory genes that are maintained in a silent state by SIRT1/2. Both SIRT1 and SIRT2 directly interact with DNMT3B, and their binding to proinflammatory genes is lost upon exposure to LPS or through pharmacological inhibition of their activity. In all, we describe a novel role for SIRT1/2 to restrict premature activation of proinflammatory genes. Macrophages (MACs) are required to respond to a wide range of environmental stimuli which specify their functions. Historically classified as both pro-inflammatory and anti-inflammatory, MACs provide versatile and dynamic responses as part of the innate immune system. In order to acquire the corresponding phenotypes of each cell type, MACs undergo very specific changes in gene expression that are mediated by the complex interplay between signalling, transcriptional and epigenetic machineries. Deregulation of these processes results in abnormal MAC function which ultimately forms the basis for many immune diseases.in vivo treatment with SIRT1-specific inhibitor EX-527 resulted in increased atherosclerotic lesion size through increased intraplaque macrophage infiltration and impaired autophagy  or IL-4/IL-10 respectively. The plasticity of these MACs render them responsive to further polarization depending on the environmental stimuli encountered, hence they are coined as M0 MACs. Despite the relevance of sirtuins and DNA methylation in myeloid differentiation and function, their interplay has not been explored in this context until now. In the present study, we observed a rapid upregulation of SIRT1/2 proteins upon the addition of M-CSF to MOs to stimulate MAC differentiation, prior to further polarization. We studied the effects of SIRT1/2 inhibition on global gene expression, DNA methylation and changes in various histone marks during macrophage differentiation and activation. In brief, we report a novel role for SIRT1/2 in the sequential and hierarchical deposition of DNA methylation, involving a direct interaction with DNMT3B, and the inhibition of active histone H3 modifications in pro-inflammatory genes to prevent their premature activation during differentiation and prior to the encounter with bacterial antigens.In humans, MACs arise from circulating or resident monocytes (MOs) which are largely present in the blood, spleen and bone marrow. MAC differentiation can be achieved E. coli O111:B4, Sigma-Aldrich, Darmstadt, Germany) were added at day 5 of differentiation for 18 hrs. To inhibit SIRT1, SIRT2 and in combination, 70 \u03bcM of EX-527 , 4 \u03bcM of AGK2 (Sigma-Aldrich) and 50 \u03bcM of Cambinol  were added, respectively, to MOs at day 0 in the presence of M-CSF. Cytokines and inhibitors were refreshed every two days until the end of the experiment. Corresponding volumes of DMSO were used as control.Buffy coats used in the study were obtained from anonymous donors via the Catalan Blood and Tissue Bank . All donors signed an informed consent form prior to donation, and all donations were in accordance with the guidelines of the World Medical Association (WMA) Declaration of Helsinki. Peripheral blood mononuclear cells (PBMCs) were extracted by layering buffy coats on Lymphocytes Isolation Solution  and centrifuged at 800 g for 30 min in the absence of braking. After collection, PBMCs were washed with phosphate-buffered saline (PBS) and MOs were purified using CD14 MicroBeads  following the manufacturers\u2019 instructions. Following cell separation, CD14+ MOs were attached to plates by incubation with serum-free medium and then cultured in \u03b1-minimal essential medium  containing 10% fetal bovine serum, 1% Penicillin Streptomycin  and supplemented with 25 ng/ml human M-CSF  for MAC differentiation. For MAC activation, 10 ng/ml of LPS , CD86-APC (Miltenyi Biotec), CD83-APC (Miltenyi Biotec) and CD80-PE (Miltenyi Biotec) for 20 min on ice protected from light. Cells were washed twice with staining buffer and fixed with PBS containing 4% paraformaldehyde . 8000 events were acquired using Gallios Flow Cytometer  and analyzed using the Kaluza software (Backman Coulter).Cells were detached mechanically using cell scrapers and resuspended in staining buffer (PBS containing 2 mM of EDTA and 4% FBS), followed by incubation with human FcR Blocking Reagent (Miltenyi Biotec). Cells were counted and 1 \u00d7 10\u00ae RSC simplyRNA Cells Kit  and reverse transcription was performed using Transcriptor First Strand cDNA Synthesis Kit  all according to manufacturers\u2019 instructions. LightCycler\u00ae 480 SYBR Green I Master mix (Roche) and forward and reverse primers (sequences annotated in \u00ae 480 II System (Roche) and results were analyzed using the corresponding LightCycler\u00ae 480 Software (Roche). Relative quantification of target genes was calculated by the standard double delta Ct method, and all genes were normalized against the housekeeping gene ribosomal protein L38 (RPL38). All statistical tests were performed using \u0394Ct values in which statistical significance was defined as P < 0.05 by paired Student's\u00a0t-test.Total RNA was isolated utilizing MaxwellProtein expression was visualized by western blotting, in which electrophoresis and transfer were performed as previously described . Membran\u00ae Instruments, Vermont, USA).Released cytokines IL-10 and IL-1\u03b2 were detected using ELISA kits provided by BioLegend and Invitrogen , respectively, according to manufacturers\u2019 instructions. Absorbance was measured at 450 nm using PowerWave\u2122 XS microplate reader ] with corresponding units of Benzonase (Sigma) and incubated at 4\u00b0C for 4 h. 50 \u03bcl of supernatant was saved as input and diluted with 2\u00d7 Laemmli sample buffer . Supernatant was first incubated with PureProteome\u2122\u00a0Protein A/G Mix Magnetic Beads (Millipore) for 1 h to remove background signal. Samples then incubated overnight at 4\u00b0C with corresponding antibodies against DNMT1 , DNMT3A , DNMT3B , SIRT1 , and SIRT2  according to the specifications of each antibody. Negative controls were incubated with rabbit  and mouse  IgGs. Subsequently, samples were incubated with magnetic beads at 4\u00b0C for 2 h, and beads were then washed three times with lysis buffer. For sample elution, 100 \u03bcl of 1\u00d7\u00a0Laemmli sample buffer was added to beads. Samples and inputs were denatured at 95\u00b0C in the presence of 1% \u03b2-mercaptoethanol. Whole-cell extracts and IP samples were visualized by western blotting, as described above.For RNA knockdown experiments, we transfected isolated monocytes with SIRT1 Silencer\u00ae pre-designed siRNA , and ON-TARGETplus SMARTpool siRNAs against SIRT2 (L-004826-00), DNMT3A (L-006672-01) and DNMT3B (L-006395-00), with non-targeting siRNA as control, all provided by Dharmacon . Transfections were carried in MAC differentiation media using Lipofectamine 3000 Reagent  according to manufacturer's instructions. Media containing siRNA and Lipofectamine were removed after 6\u20138 h following transfections, and this was repeated every 48 h in M-CSF differentiation media for 5 days, in which MACs were subsequently stimulated with LPS for 18 h. Transfection efficiencies were examined by western blotting.\u00ae Assay Design Software 2.0  and sequences are listed in \u00ae Q24 System (QIAGEN).Total DNA was extracted by the proteinase K protocol. Briefly, cells were lysed using lysis buffer  in the presence of Proteinase K (Roche), and nucleic acids and lipids were separated by repeated centrifugation. DNA was precipitated using isopropanol and washed with 75% ethanol. 300 \u03bcg of isolated DNA were bisulfite (BS)-converted using EZ DNA Methylation-Gold\u2122 Kit  according to manufacturers\u2019 instructions. BS-converted DNA (\u223c20 ng) was used as template for further pyrosequencing. Primers for PCR amplification and sequencing were designed using the PyroMarkhttps://www.bioconductor.org) and CRAN (https://cran.r-project.org) repository packages. Firstly, background correction was performed using Robust Microarray Analysis (RMA) normalization provided by oligo package. Each probe was then annotated using clariomshumantranscriptcluster.db package, and the average expression level was calculated if more than one probe was mapped to the same gene. Downstream statistical analyses were performed using an eBayes-moderated paired t-test provided by limma package to obtain log2 fold change (log2FC), P-value and adjusted P-value  between sample groups. Genes that displayed statistically significant tests  were considered differentially expressed. Heatmaps were generated using calculated z-scores.The quality of extracted total RNA was first analyzed by the 2100 Bioanalyzer System , and 100 ng of excellent quality RNA (RNA Integrity number of > 9) was then hybridized on Human Clariom S\u2122\u00a0Assay arrays (Thermo Fisher) carried out at/by the High Technology Unit (UAT), at Vall d\u2019Hebron Research Institute (VHIR) following manufacturers\u2019 instructions. Downstream data normalization and analysis were performed using statistical analysis language R in combination with Bioconductor  between sample groups by an eBayes-moderated paired t-test. P-value of < 0.01 and FDR of < 0.05 was considered statistically significant.500 ng of BS-converted DNA were hybridized on Infinium MethylationEPIC BeadChip array  following manufacturers\u2019 instructions. This array covers over 850 000 (850K) CpG methylation sites per sample at single-nucleotide resolution, covering 99% of RefSeq genes. Probe fluorescence was detected by BeadArray Reader , and image processing and intensity data extraction were performed as previously described . For dowhttp://great.stanford.edu/public/html)  and annotated genes in the Clariom S array were used as background. The Functional Annotation tool was used and GO terms with P-value < 0.01 was considered significantly enriched.Gene ontology (GO) analysis of DNA methylation was carried out using GREAT online tool (ic/html)  by applyP-value < 0.01 defines a motif as significantly enriched.Motif enrichment analyses were performed using HOMER motif discovery software  and anal2FC of Cambinol-treated versus untreated M-CSF MACs, and a Normalized Enrichment Score (NES) was calculated for each hallmark as described in the original article  software. Genes were ranked by expression log article .http://dcc.blueprint-epigenome.eu/). More than three independent datasets were downloaded for each histone mark and ChIP-seq peaks were consolidated, filtering the peaks with a q-value < 0.01 and a fold change \u22652 and using the MSPC program  upregulation and downregulation of 303 and 533 genes respectively Figure . More spAltogether, SIRT1/2 inhibition during macrophage differentiation resulted in the acquisition of a more pro-inflammatory signature, suggesting a role for these deacetylases in the silencing of inflammatory genes prior to MAC polarization.TM7SF4, ACP5 and ADAM12, and displayed enrichment in motifs of the bZIP family of TFs, in concordance to a previous study  during MAC differentiation, and surprisingly, inhibition of SIRT1/2 in turn inhibited almost all CpG methylation gains, which suggested that SIRT1/2 activity is required for MAC-associated DNA hypermethylation . Co. CoTM7SFn Figure , bottom.n Figure . Furthern Figure . GO anal3 Figure  and\u00a0E. T3 Figure .de novo DNA methylation , in the hypermethylated CpG cluster. We observed that there was a significant enrichment in DNase I hypersensitivity in MOs which decreased in MACs, coupled with significant enrichment of H3K4me1 in both cell types . To evaet\u00a0al. . Surpriset\u00a0al. \u2013E, it ismulation , displaymulation , indicatde novo DNA methylation during MO-to-MAC differentiation. It is likely that acquisition of DNA methylation is accompanied by additional histone modifications. Hence, we analyzed the enrichment of histone marks H3K9/14ac, H3K4me3, H3K4me1, H3K36me3, H3K27me3 and H3K27ac, as well as DNase I hypersensitive sites, all obtained from the Blueprint database, in MOs and MACs within a window of 4000 bp centring around hyper- and hypomethylated CpGs  . Firstlyn Figure . Other ge Figure . Interese Figure , suggeste Figure , howeverSLC1A2, TNFAIP3 and ADORA2A loci upon MO-to-MAC differentiation, in which the complex appeared to dissociate following LPS stimulation. Second, we observed that their binding was abrogated upon inhibition with cambinol both before and after LPS stimulation (Figure To better understand the relationship between SIRT1/2 and the DNA methylation machinery in MACs in relation to the control of proinflammatory genes, we then performed co-immunoprecipitation experiments to assess the potential interaction between SIRT1/2 with DNMTs. Immunoprecipitation, performed using M-CSF MACs differentiated from MOs for 5 days, showed that both SIRT1 and SIRT2 co-immunoprecipitated with DNMT3B, but not DNMT1 and DNMT3A Figure . Interesn Figure . Finallyn Figure . We wereTNFAIP3, JAK3, RUNX3\u00a0and ADORA2A. Conversely, SIRT2 knockdown did not appear to have an effect on DNA methylation, except in the case of JAK3 (Figure \u0394SIRT1 MACs correlated with an aberrant upregulation of the same genes following LPS stimulation, albeit some did not reach statistical significance (Figure Utilizing specific pharmacological inhibitors targeting SIRT1 and SIRT2, we observed that inhibition of SIRT1 may have a stronger effect on gene expression than SIRT2 . Thus in3 Figure . Knockdo3 Figure . Moreovee Figure . Similarde novo DNA methylation through direct DNMT3B interaction, linked to H3K4me3 demethylation and H3K27ac deacetylation, to prevent premature activation of pro-inflammatory genes during MAC differentiation and prior to encounter with bacterial antigens.\u00a0In this study, we report a novel role for SIRT1/2 in macrophage differentiation, in which these deacetylases act as a key element in establishing the hierarchy of epigenetic modifications involving acquisition of et\u00a0al. to exert anti-inflammatory effects in RA macrophages through the inhibition of NF-\u03baB signalling, and SIRT1 Tg-mice displayed reduced M1 polarization (Our initial observation showed that both SIRT1 and SIRT2 undergo a drastic upregulation concomitant with MAC differentiation, and that the effects of SIRT1/2 inhibition during this process impact the expression levels of many genes related to the immune properties of these cells, with a particular effect on proinflammatory genes mediating their aberrant upregulation. These observations support a major role of SIRT1/2 in maintaining a repressed status for these genes, most likely through the direction interaction with DNMTs, which is in concordance to what has been observed in other studies. Notably, SIRT1 has been previously described by Park rization . Individde novo DNA methyltransferases with unmethylated H3K4 histone peptide leading to the catalytic activation of DNMT3A (Interestingly, the analysis of DNA methylation changes in relation to inhibition and downregulation of SIRT1/2 shows that only gains of DNA methylation are affected, in contrast to DNA demethylation, which is identical to those without SIRT1/2 inhibition. Remarkably, the group of genes that gain methylation during macrophage differentiation, almost all of which are affected by SIRT1/2 inhibition, associate with additional epigenetic features including a decrease in H3K27ac and H3K4me3 and an increase in H3K4me1. These observations indicate that these three histone marks are linked to the observed gains of DNA methylation. Different studies have established links between DNA methylation and histone modifications. First, the presence of DNA methylation has originally been described to prevent methylation of H3K4 . Second,f DNMT3A ,48. Thisf DNMT3A . Taken tf DNMT3A , and conf DNMT3A . Finallyf DNMT3A , howeverf DNMT3A . Our finet\u00a0al. showed that SIRT1 recruitment to induced double-strand breaks was dependent on DNMT1, and that DNMT1, DNMT3B and SIRT1 form part of a large multi-protein complex following oxidative DNA damage (et\u00a0al. where SIRT1 was observed to directly deacetylate MLL1 and modulate H3K4 tri-methylation along the circadian cycle (The dynamics between SIRT1/2 and DNMTs has been partly elucidated by our results, in which we have observed a direct interaction between SIRT1/2 and DNMT3B, which in turn interacts with DNMT3A. Other studies had previously linked SIRT1 activity with DNMTs. For instance, O\u2019Hagan A damage . We obseA damage . Additioan cycle . Since Het\u00a0al., as the authors show that, by utilizing different statistical strategies that include statistical inference of differentially methylated regions and additional normalization techniques, promoter DNA methylation indeed correlate negatively with gene expression (et\u00a0al. show that a previous demethylation step, together with histone modifications, is required for correct upregulation of inflammatory genes during dendritic cell activation (The hierarchy of DNA methylation, histone modifications and gene expression has been proven to be extremely complex, in which contradictory literature has described DNA methylation as both a cause and a consequence of changes in gene expression. While it is generally accepted that DNA methylation results in gene repression, however, recent studies have provided conflicting evidence in their relationship. One study involving 62 unrelated individuals concluded that DNA methylation contributes to only 8% of inter-individual gene expression variation . Similarpression . Neverthtivation . Contrastivation . In thisIn conclusion, our work directly identifies SIRT1/2, through direct interaction with DNMTs, as essential factors in the establishment of gains of methylation, as well as additional epigenetic modifications that prevent premature expression of proinflammatory genes during differentiation to MACs and prior to their encounter to bacterial antigens.Expression and methylation array data for this publication have been deposited in the NCBI Gene Expression Omnibus and are accessible through GEO Series accession numbers GSE131115 and GSE131177.gkz1127_Supplemental_FileClick here for additional data file."}
+{"text": "Recently, the influence of leader\u2019s personality traits on employee behavior has become an emerging research area. Leaders play a crucial role in any organization because team members look up to them for policy and behavioral guidelines. Based on the social exchange theory, this study is focused on the relationship of employee-perceived leader narcissism and employee voice behavior. Through the analysis of 239 questionnaires, we find that leader narcissism has a significant influence on the motivation of leadership impression management. The narcissistic leader uses impression management that is more likely to have self- serving purpose rather than pro-social motivation. This motivation impacts leader-member exchange (LMX) quality which influences employee voice behavior. This study has significant theoretical and practical implications as it is the first study that empirically verifies the stated relationship in this under-researched area. Employee voice behavior is defined as promoted behavior that employee intends to adopt for the purpose of improving an organization\u2019s standard procedures and performance, as well as facing challenges and making innovative suggestions with colleagues or leaders spontaneously ,2,3. StuHowever, although some scholars have discussed the relationship between leaders\u2019 personality traits and employee voice behavior, most of these researches focus on the positive side of leadership behaviors and characteristics, such as transformational leadership, charismatic leadership, and leader openness, etc. ,7,8. RecImpression management refers to a series of interactive behaviors that allow individuals to gain and maintain positive images that others hold of them. By consciously or unconsciously employing these behaviors, individuals are able to \u201cconform to social norms, avoid blame or gain credit, maintain or enhance their self-concept, and strategically wield power and social influence\u201d . ResearcIn organizations, leaders and their followers will develop and maintain a certain type of exchange relationships over time which is known as leader-member exchange (LMX) . ScholarIn this present study, we explore the relationship between leader narcissism and employee voice behavior by using impression management and social exchange theory to reveal the mechanism. This research contributes to the existing literature in the following aspects: First, leader narcissism and employee voice behavior evolve in two relatively separate research fields. Although some scholars tested the relationship between leader narcissism and employee voice behavior , there iThe concept \u201cnarcissism\u201d comes from the word \u201cnarcissus\u201d, which represents three meanings: (1) inflated self-concept; (2) Interpersonal exploitation; (3) Inordinate need for tribute from others . NarcissNarcissism has existed in team leaders which happen to be a common personality trait. Numerous CEOs  have been identified as narcissists, such as Jack Welch, Steve Jobs, etc. Maccoby lists that narcissistic individuals have two strengths: they are visionaries which can influence and inspire a lot of followers . As visiIn previous studies, there are few empirical pieces of evidence that have examined the relationship between leader narcissism and employee voice behavior directly, but there is some evidence that indicates the indirect effect of leader narcissism on employee voice behavior. For instance, Campbell and his colleague consider that because narcissistic individuals are overconfident, they love to get praise from others, but are unwilling to accept criticism . Other sHypothesis\u00a01.leader narcissism negatively relates to employee voice behaviorImpression management is defined as an individual\u2019s behavioral modification to maintain the desired perception of themselves in the minds of others ,30. IndiHypothesis\u00a02.Leader narcissism has a positive relationship with self-serving impression management behaviorHypothesis\u00a03.Leader narcissism has a negative relationship with pro-social impression management behaviorThe leader-member exchange quality (LMX) indicates the relationship between leader and employee is different from the organizational background and the forms of interpersonal relationships . LMX basIn order to build up a good leader-member exchange relationship, and better governing organization member and management, the leader often does impression management. However, although leader can use impression management to create some \u201cgood images\u201d in the eyes of others, the motives perceived by employees behind those images determine employees\u2019 psychological and behavior reaction . SpecifiHypothesis\u00a04.leaders\u2019 self-serving impression management is negatively related to LMXHypothesis\u00a05.Leaders\u2019 pro-social impression management is positively related to LMXAlthough studies in the existing literature have examined the direct relationship between LMX quality and employee voice behavior, indirect effect results have shown the quality of LMX could promote employee voice behavior effectively. For example, some scholars posit that LMX quality helps to improve employees\u2019 affective organizational commitment . MoreoveHypothesis\u00a06.LMX quality is positively related to employee voice behaviorThe research in leader-member exchange (LMX) usually relied on two theories to explain how LMX varies and develops, that is the role and social exchange theories. People consider low LMX quality relationships are more about economic exchanges and employment contract while considering high LMX quality relationships are beyond the formal work contract, it is more about mutual recognition and support  which will motivate follower to gain a higher ability and performance level. Masterson and her colleagues suggest that social exchange theory is closely connected with procedural and interactional justice perceptions in an organization . One comAccording to above mentioned, narcissistic leaders will present self-interest image more easily which will be considered as self-serving conduct by followers. In this situation, followers may sense more injustice feelings within the dyad relationship, and hence feel bad about the leader-member exchange quality. Narcissistic leaders are more likely to focus on themselves so that there is a lack of social nature in the interaction between leader and follower. The follower may feel less trusted, supported or even respected. As we can infer from the aforementioned, low level of LMX is significantly related to the low level of employee commit and proactive behavior such as organizational citizenship and voice behavior.Thus, from social exchange theory and the integrative perspective of social exchange theory and justice feeling, we suggest that leader impression management and LMX will mediate the relationship between leader narcissism and follower voice behavior.We collected data from employees from two state-owned manufacturing company groups (a photoelectric communication enterprise and a machinery processing enterprises) and two private company groups  in China, these company groups all have a nationwide business. The headquarters of these four company groups are located in central China. We sent out all surveys in sealed envelopes to the HR department supervisors of each company groups who have a long-term, high-quality relationship with participants and us, they helped us gather the survey forms according to our instructions. Finally, 300 employees and 73 supervisors completed a supervisor-subordinate paired survey so that some systemic errors such as common method variance can be reduced. and all scales were proceeded with the translate-translate back method by two professors who have published relevant research papers in English to make sure the items can be clearly understood by Chinese workers . In the We adapted well-developed measurement scales and went through the \u201ctranslate-translate back\u201d procedure. To further check the reliability and validity of every measurement scale, we had run KMO & Bartlett\u2019s test and computed Pattern Matrix, as well as Cronbach\u2019s alpha for the reliability coefficients.We adopted a six-item scale from Hochwarter & Thompson . EmployeWe adopted Gardner and Cleavenger\u2019s Leader Impression Management Questionnaire (LIMQ) to measure leader impression management . FifteenPro-social impression management was measured using two indicators: a six-item scale measuring Exemplification  and a nine-item scale measuring Ingratiation . The Cronbach\u2019s alpha = 0.886.Self-serving impression management was measured using two indicators: a five-item scale measuring Intimidation  and a five-item scale measuring Self-Promotion . Items were rated on a five-point frequency scale . The Cronbach\u2019s alpha = 0.892. KMO & Bartlett\u2019s test is 0.916 (p < 0.001) for the pro-social dimension and 0.877 (p < 0.001) for self-serving dimension. Pattern Matrix shows that all items both in pro-social measurement and self-serving measurement are loaded on 2 factors which are consisted of our design.A seven items Likert-type scale was adapted from Graen & Uhl-Bien\u2019s study to measure LMX . ExampleWe adapted Van Dyne and LePine\u2019s six-item scale to measure employee\u2019s general voice behavior . Items wWe used SPSS 25  and Amos 20  to process and analyze our data. Specifically, we adapted a standard procedure to test if our hypothesized model is the best fit for structural equation modeling analysis on Amos. As we have five variables in our hypothesized model (five-factor model), we also test four-factor model by combining two measures in to one construct , as well as three (combining three variables into one), two (combining four variables in to one) and one factor model .Hypotheses 1 and 2 propose that perceived leader narcissism is positively related to leaders\u2019 self-serving impression management and, negatively related to leaders\u2019 pro-social impression management. As shown in According to Anderson & Gerbing\u2019s suggestions, we have also examined four alternative models to justify the hypothesized model . In the Prior studies have identified that the narcissistic leader has a significant impact on the leader\u2019s relationship with the team ,51. TherIn this study, we focus on a social exchange perspective within the relationship between employee perception of leader narcissism, leader impression management, and employee voice behavior. In the empirical test, we examined the chain mediating effect of leader impression management and LMX had on the relationship between leader narcissism and employee voice behavior. The results show that employee perception of leader narcissism is negatively related to their perception of leader pro-social behavior and positively related to self-serving behavior. And these two impression management behavior will have a different impact on leader-member exchange quality which will then positively influence employee voice behavior. In our data analysis, the results indicate that leader narcissism is more related to self-serving conduct perception, which will negatively affect the employee voice behavior through the mediating effect of LMX quality. The result has shown that narcissistic leader reduces pro-social impression management behavior, but increases self-serving impression management behavior, thus lower the quality of LMX which result in less employee voice behavior. The results especially the main effect of leader narcissism reduce employee voice behavior is consistent with Liu and his colleagues\u2019 study . This reThis study has several practical implications: First, this study empirically proved that leader narcissism has an inhibitory effect on employee voice behavior. To promote organizational development and improvement, the team leader should show humility, such as how to objectively view the value of employees and avoid the negative effect of narcissism that brings to the organization. Second, this research has shown the impact of leadership style on employee behavior and the intrinsic motivation of attribution of leaders\u2019 impression management. When leader behavior is attributed to pro-social motivation, it enhances the relationship of LMX quality; In contrast, when leader behavior is attributed to self-serving motivation, it damages the relationship of LMX quality. Therefore, the leader should not only carry on impression management but also should pay more attention to the attribution management of behavior and motivation. For example, as a team leader, he or she should do some pro-social behavior to build a better image and enhance member exchange relationship, such as helping employees to solve problems, helping employees for career development, listening to employees from their perspective, etc. Moreover, this study has also found employee voice behavior not only depends on the potential risk they may feel but also the reciprocity and emotional relationship of leader and employee. This suggests that employee has both a rational side and the emotional side. For the development of the organization, leaders should create an atmosphere to encourage employees to speak up, and they should also consider the effect of intrinsic motivation of employee voice behavior. It\u2019s better for the leaders to talk with employees sentimentally and rationally.Although this study makes a certain theoretical contribution and has practical implications, our research also has several limitations that need to be explored in future research. First, although this study used leader-employee dyadic data to avoid the common method bias problem, it used a cross-sectional design. Because we did not test the longitudinal study, thus the result has not shown the causality, especially the effect of leader humility on employee voice behavior. Hence, future studies may consider longitudinal design or experiment study to test its further relations. Second, this paper may not take some of the boundary factors into consideration about the effect of leader narcissism and employee voice behavior, such as other personality traits, or organization culture, etc. Different employees may react differently towards what leader narcissism may bring out of them; under a different organizational culture, the effect of leader narcissism on employee voice behavior may also be different. Future studies need to take the personality traits of employees and organizational culture into account, testing the variation of leader narcissism on employee voice behavior under different circumstances. Finally, this study has not controlled the key mechanism mentioned, which are the effect and risk that impact on employee voice behavior in past literature. Due to the lack of specific scales, this paper distinguishes from the theory and logic, the future study may consider developing a relative scale to differentiate various mechanism of the impact on employee voice behavior.The purpose of this paper was to examine the role of leader impression management and its influence on leader-member exchange quality as well as employee voice behavior. We found that leader narcissism is negatively related to leader pro-social impression management but positively related to leader self-serving impression management. And the correlation between leader narcissism and self-serving impression management is more significant than that of leader pro-social impression management. The results show that narcissistic leaders will reduce employees\u2019 general voice behavior through self-serving conduct perception and reduced LMX quality. This finding answered the question of how a leader\u2019s narcissism influences LMX quality as well as employee voice behavior, revealing this mechanism from the perspective of impression management."}
+{"text": "Despite the crucial role of the liver as the central regulator of iron homeostasis, no studies have directly tested the modulation of liver gene and protein expression patterns during iron deficiency instauration and recovery with fermented milks. Fermented goat milk consumption improves the key proteins of intestinal iron metabolism during iron deficiency recovery, enhancing the digestive and metabolic utilization of iron. The aim of this study was to assess the influence of fermented goat or cow milk consumption on liver iron homeostasis during iron-deficiency anemia recovery with normal or iron-overload diets. Analysis included iron status biomarkers, gene and protein expression in hepatocytes. In general, fermented goat milk consumption either with normal or high iron content up-regulated liver DMT1, FPN1 and FTL1 gene expression and DMT1 and FPN1 protein expression. However, HAMP mRNA expression was lower in all groups of animals fed fermented goat milk. Additionally, hepcidin protein expression decreased in control and anemic animals fed fermented goat milk with normal iron content. In conclusion, fermented goat milk potentiates the up-regulation of key genes coding for proteins involved in iron metabolism, such as DMT1, and FPN1, FTL1 and down-regulation of HAMP, playing a key role in enhanced iron repletion during anemia recovery, inducing a physiological adaptation of the liver key genes and proteins coordinated with the fluctuation of the cellular iron levels, favoring whole-body iron homeostasis. Fe2+ is then transported across the apical membrane of enterocytes by the divalent metal transporter 1 (DMT1). This protein transports some divalent cations including ferrous iron. Iron crosses the basolateral membrane of intestinal enterocytes by the action of ferroportin, an iron exporter, entering into systemic circulation. After that, iron can be stored in the liver joined to ferritin, which is an iron storage protein. The mechanisms regulating systemic iron homeostasis are largely centered on the liver and involve two molecules, hepcidin and ferroportin, that work together to regulate the flow of iron from cells into the systemic circulation [Iron deficiency anemia (IDA) is a highly prevalent pathology and a medical condition in the clinical practice, affecting more than two billion people worldwide. This public health problem has a negative impact on the lives of infants and fertile women worldwide . Daily, Due to the key role of iron in many physiological cell functions, including replication, ATP, DNA synthesis and the heme group in hemoglobin , and as The liver is one of the most functionally and metabolically active organs in the body. In addition to roles in detoxification, digestion, protein synthesis, gluconeogenesis, and fat metabolism, the liver also plays a significant role in iron homeostasis. It is responsible for approximately 8% of plasma iron turnover and it is the major site for iron storage, acting also as the key regulator of iron homeostasis . The livOn the other hand, it has been previously reported that fermented goat milk consumption improves the key proteins of intestinal iron metabolism during IDA recovery, enhancing the digestive and metabolic utilization of iron . HoweverOne hundred male Wistar rats aged 3 weeks and weighing about 34.56 \u00b1 6.35 g, purchased from the University of Granada Laboratory Animal Service , were included in this study. The animals were maintained under standard animal housing conditions with a 12-hour light/dark cycle (lights on at 9:00 A.M.), temperature (23 \u00b1 2 \u00b0C) and humidity (60 \u00b1 5%). All animal experiments were carried out in accordance with Directive 2010/63/EU on the protection of animals used for scientific purposes.n = 50) [n = 50) for 40 days [In the pre-experimental period (PEP), 100 rats were randomly divided into two groups; a control group received the AIN-93G diet  in goat or cow milk, and then the samples were incubated at 37 \u00b0C for approximately 24 h. Subsequently, fermented milk samples were dehydrated by a smooth industrial process to obtain products with a moisture content ranging between 2.5% and 4.5%. Sufficient amounts of fermented dehydrated cow or goat milk were utilized in the experimental diets to provide 20% of protein and 10% of fat. The constituents and nutrient compositions of the experimental diets are presented in Diets were prepared with fermented cow or fermented goat milk. Hematological parameters were measured at the end of PEP and EP using a fully automated hematology analyzer .Transferrin saturation, serum iron and TIBC were determined using Sigma Diagnostics Iron and TIBC reagents . Serum ferritin was measured by the Elisa method using a standard kit (rat ferritin ELISA Kit) supplied by Biovendor GmbH, Heidelberg (Germany). Hepcidin-25 was determined using a DRG ELISA Kit . The HSI was determined by the use of the following equation:v/v  until the total elimination of organic matter. Finally, the samples were diluted with Milli Q  ultrapure water. Iron analysis was undertaken using a PerkinElmer Optima 8300 inductively coupled plasma-optical emission spectrometer (ICP-OES)  with a segmented-array charge-coupled device (SCD) detector. Multi-elemental Atasol calibration solution  was used to calibrate the apparatus. For the calibration curve, diluted standards were prepared from concentrated standard solutions. After each series of 5 samples, an internal standard solution of 10 mg/L was used. The acceptable result was assessed as 10%. Three replicates of each sample were analyzed.Prior to iron analysis, liver fractions were mineralized by wet digestion in a sand bath  using nitric acid followed by a mixture of HNO3:HClO4, 1:4 Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were measured by standard colorimetric and enzymatic methods using a BS-200 Chemistry Analyzer . From liver samples, total RNA was extracted with TRIsure lysis reagent  following the manufacturer\u2019s instructions. The RNA quantity and purity were measured using a spectrophotometer  at 260/280 nm. Reverse transcription was performed on 1 \u00b5g of total RNA in a 20 \u00b5L reaction to synthesize complementary DNA (cDNA), using an iScript cDNA Synthesis kit (Bio-Rad). Quantitative real-time PCR was performed in a total reaction volume of 20 \u00b5L using the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) and SYBR Green detection using Sso Avdvanced Universal SYBR Green Supermix (Bio-Rad). Primer sequences of divalent metal transporter 1 (DMT1), ferroportin 1 (FPN1), ferritin (FTL1) and hepcidin antimicrobial peptide (HAMP) for quantitative real-time PCR are shown in Liver samples were mechanically homogenized in tissue protein extraction reagent (T-PER)  supplemented with a protease inhibitor cocktail  under ice-cold conditions. On 4%\u201320% Criterion TGX (Tris-Glycine extended) gels , 12 \u00b5g of total protein was separated in a vertical electrophoresis tank  at 250\u2009V for 20 min. Separated proteins were transferred onto a polyvinylidene difluoride membrane (Bio-Rad) by wet transfer for 60 min at 120 V. Thereafter, the membranes were blocked with 5% dry milk in Tris-buffered saline (TBS) plus Tween-20 (TTBS) (Bio-Rad) solution for 1 hour at room temperature. After three washes in TBS, membranes were incubated with rabbit anti-DMT1 polyclonal, dilution 1:400 , rabbit anti-SLC40A1 polyclonal antibody (FPN1), dilution 1:800, hepcidin polyclonal antibody, dilution 1:500, and mouse anti-\u03b2-actin monoclonal, dilution 1:1000  as primary antibodies, in 5% dry milk in TTBS overnight at 4 \u00b0C with shaking. \u03b2-actin was used as the loading control. Then, the membranes were washed 3 times in TTBS and incubated for 1 h at room temperature with the appropriate secondary conjugated antibody Immun-Star Goat Anti-Rabbit (GAR)-HRP; Bio-Rad Laboratories; 1:40,000 amd ImmunStar Goat Anti-Mouse (GAM)-HRP; 1:80,000 in TTBS. Immunoblots were detected with a chemiluminescence Luminata forte western HRP Substrate  and visualized with chemiluminescence using ImageQuant LAS 4000 . All results were analyzed with Image J software.t-test. Following a significant F-test (p <0.05), individual means were tested by pairwise comparison with Tukey\u2019s multiple comparison test when main effects and interactions were significant. Two-way analysis of variance (ANOVA) was used to determine the effect of the type of diet supplied to the animals, anemia, and iron content in the diet. Statistical significance was set at p < 0.05 for all comparisons.Data are presented as mean \u00b1 standard error of the mean (SEM) and statistical analyses were performed using SPSS 26.0 . Differences between groups  were tested for statistical significance with Student\u2019s p < 0.001); however, liver weight remained unchanged, and, as a consequence, HSI was higher in anemic group (p < 0.05). Transaminases were significantly higher in the anemic group (p < 0.001)  .p < 0.001) compared to animals fed fermented-cow-milk-based diets. Body weight was significantly lower in anemic animals fed both fermented milks with normal Fe content (p < 0.01). Body weight was lower a with high Fe content diet than with a normal Fe content diet in animals fed with fermented-cow-milk-based diets in both groups (control and anemic) (p < 0.05). HSI was higher in both groups of animals (control and anemic) fed fermented-goat-milk-based diets, either with normal Fe or high Fe, compared to animals fed fermented-cow-milk-based diets (p < 0.001). Liver iron content was increased in animals fed with fermented goat milk compared to animals fed with fermented cow milk with normal Fe content diets (p < 0.01). In contrast, liver iron content was lower in animals fed fermented goat milk compared to fermented cows\u2019 milk with high Fe content (p < 0.01). Liver iron content was lower in anemic animals compared to the control group, irrespective of the iron content in both types of fermented milks (p < 0.01). As expected, dietary high Fe content increased the liver content of this mineral in control and anemic animals fed fermented cow milk (p < 0.001), this increase being lower in the animals fed fermented goat milk (p < 0.05). AST and ALT were lower in rats fed with fermented-goat-milk-based diets compared to rats fed with fermented-cow-milk-based diets in all experimental conditions (p < 0.01). High Fe content did not affect the transaminases when supplying both milk-based diets  and in control groups fed with a normal Fe diet, and previously induced anemia reduced DMT1 expression in the animals fed fermented goat milk with normal Fe content (p < 0.05) (p < 0.001). Induced anemia increased liver DMT1 protein expression in animals fed both fermented milk with normal Fe content (p < 0.001). High Fe content increased DMT1 protein expression in all groups of animals fed fermented goat or cow milk (p < 0.001), except in control animals fed fermented goat milk, which showed a decrease (p < 0.05) (Fermented goat milk up-regulated liver DMT1 gene expression in control and anemic rate fed with high Fe content ( < 0.05) A. Simila < 0.05) B.p < 0.001) or high Fe content (p < 0.01) (p < 0.001). Anemia decreased FPN1 protein expression in animals fed fermented goat milk with normal Fe (p < 0.01) and increased in animals fed both fermented milks with high Fe content (p < 0.001). High Fe content increased liver FPN1 protein expression in all groups of animals fed fermented goat or cow milk (p < 0.001), except control animals fed fermented goat milk, which showed a decrease (p < 0.001)  C. Protei< 0.001) D.p < 0.05) and also in control and anemic animals fed fermented goat milk with high Fe content (p < 0.001). Anemia increased HAMP mRNa expression in animals fed fermented cow milk with high Fe content (p < 0.01). High Fe content increased HAMP gene expression in anemic animals fed both fermented milks (p < 0.001) and in control groups fed a fermented cow milk diet (p < 0.01) (p < 0.001). Anemia decreased hepcidin protein expression in animals fed fermented cow milk with normal Fe content (p < 0.001) and increased in animals fed fermented goat milk with normal Fe content (p < 0.05); however, with high Fe content, anemia increased hepcidin protein expression in the animals fed both fermented milks (p < 0.001). High Fe content increased hepcidin protein expression in all groups of animals fed fermented cow or goat milk (p < 0.01) but decreased in control animals fed fermented cow milk (p < 0.001)  E. Hepcid< 0.001) F.p < 0.01). Anemia up-regulated liver mRNA FTL1 expression in animals fed fermented cow milk with high Fe content (p < 0.01). High Fe content up-regulated FTL1 mRNA expression in the anemic groups fed both fermented milks (p < 0.001) and in the control group fed fermented cow milk (p < 0.01)  . Anemia reduced body weight in the PEP, due to the impairment of hematological parameters and the depletion of the hepatic iron levels. These negatively affect the weight gain of animals during the growing period, since the hypoxia induced by the lack of iron limits ATP production and decreases levels of thyroid hormones and ghrelin, inducing cachexia and leading to reductions of lean mass . In a prDuring the EP, body weight was statistically lower in the animals fed fermented goat milk. This finding can be explained because, as previously reported , fermentLiver iron homeostasis is tightly regulated to maximize the iron supply when anemia is established and to promote storage when iron status is adequate. Intracellular iron content is regulated by the relative rate of cellular import, via DMT1, versus export, via FPN1 .Fermented goat milk improves iron metabolism, because, as previously reported , it incrAfter supplying the fermented-milk-based diets, iron repletion was more efficient with fermented goat milk, a fact that is corroborated by the recovery of hematological parameters and the liver iron content recorded in the current study. This fact can be explained due to the beneficial increase in the liver DMT1 iron-transport gene and protein expression, enhancing iron metabolism and storage compared with fermented cow milk. DMT1 is localized both to the plasma membrane and in the cytosol of hepatocytes . In addiHepcidin is a key indicator of iron status and metabolism. This hormone regulates iron levels and location in response to nutritional status. High hepcidin levels block intestinal iron absorption and macrophage recycling, causing anemia. Low hepcidin levels favor bone marrow iron supply for hemoglobin synthesis and erythropohiesis. Multiple factors regulate the expression of hepcidin in the liver. As expected, low serum hepcidin levels were recorded in the PEP due to the increased expression of key duodenal proteins involved in iron absorption , favorinIn addition, we have previously reported that fermented goat milk consumption decreased pro-inflammatory cytokines and increased anti-inflammatory cytokines , due to Although, in physiological conditions, hepatocytes have a high capacity for iron storage, the liver is also the main organ affected by the oxidative stress caused by Fe-overload toxicity due to its high propensity to induce reactive oxygen species (ROS) . As mentFTL1 is the intracellular iron storage protein that stores and releases iron in a controlled way, and its expression greatly increases when cellular iron concentrations rise, providing the cell with an enormous ability to sequester iron. When intracellular iron content is low, iron-responsive element-binding protein 2 (IRP2) represses FTL1, mRNA translation, while intracellular iron accumulation promotes IRP2 degradation and allows FTL1 mRNA translation . As prevFermented goat milk consumption potentiates the up-regulation of key genes and proteins involved in iron metabolism, such as DMT1 and FPN1, and downregulates liver hepcidin, enhancing and improving iron repletion during anemia recovery. In addition, taking into account the better iron storage in the liver during anemia recovery, the reduction in the iron accumulation during Fe overload, and the improvement of the hematological parameters, fermented goat milk consumption induces a hepatic physiological adaptation of the key genes and proteins that regulate the fluctuation of the cellular iron levels, favoring whole-body iron homeostasis."}
+{"text": "Collective forces of tumor spheroids in three-dimensional biopolymer networks. Published 30, April 2020We have identified errors in the Material and Methods section of the manuscript \u2013 under the heading \u201cPrimary breast cancer spheroid and tumoroid embedding\u201d. These errors were unintentional and have been rectified. See below.Original text:FluoSphere polystyrene beads  are carefully suspended, without forming bubbles, in 1.2 mg/ml collagen solution at a concentration of 2x108 beads/ml. 650 \u00b5l of this mixture is poured into one well of a 6-well plate [\u2026]\u201c650 \u00b5l of the 1.2 mg/ml collagen/bead mixture. [\u2026]\u201dOnce the spheroids/tumoroids have settled to the base of the tube, excess media is aspirated away and spheroids/tumoroids are resuspended in Corrected text:Silica beads  are carefully suspended, without forming bubbles, in 1.2 mg/ml collagen solution at a concentration of 2x108 beads/ml. 1300 \u00b5l of this mixture is poured into one well of a 6-well plate [\u2026]\u201c1300 \u00b5l of the 1.2 mg/ml collagen/bead mixture. [\u2026]\u201dOnce the spheroids/tumoroids have settled to the base of the tube, excess media is aspirated away and spheroids/tumoroids are resuspended in The article has been corrected accordingly."}
+{"text": "Thromboelastography (TEG) rapidly provides a comprehensive assessment of the entire coagulation process and is helpful as a guide for correcting consumptive coagulopathy in sepsis-induced DIC. This study aimed to investigate the role of TEG in the prediction of DIC in patients with septic shock. (2) Methods: TEG was conducted prospectively in 1294 patients with septic shock at the emergency department (ED) between January 2016 and December 2019. After exclusion of 405 patients with \u201cdo not attempt resuscitation\u201d orders, those refusing enrollment, and those developing septic shock after ED presentation, 889 patients were included. DIC was defined as an International Society on Thrombosis and Hemostasis score \u2265 5 points within 24 h. (3) Results: Of the 889 patients with septic shock , 158 (17.8%) developed DIC. TEG values, except lysis after 30 min, were significantly different between the DIC and non-DIC groups. Among the TEG values, the maximal amplitude (MA) had the highest discriminating power for DIC, with an area under the curve of 0.814. An MA < 60 indicated DIC with 79% sensitivity, 73% specificity, and 94% negative predictive value. Based on multivariable analysis, MA < 60 was an independent predictor of DIC ). (4) Conclusions: In patients with septic shock, the MA value in TEG could be a valuable tool for early prediction of DIC. Coagulation abnormality is an important and common complication in patients with sepsis. This dysregulation of the hemostatic system may lead to disseminated intravascular coagulation (DIC) and result in microvascular thrombosis, hypoperfusion, major organ dysfunction, and ultimately death ,2. SepsiThromboelastography (TEG) is a point-of-care test that quickly measures the rate (reaction time (R), clot formation speed (K), and alpha angle), strength (maximum amplitude (MA)), and stability (lysis after 30 min (LY30)) of clot formation . TEG corThis retrospective analysis of a prospective data registry was performed at an urban academic adult emergency department in a tertiary referral center with an annual census of more than 110,000 patients in Seoul, South Korea. Beginning in January 2010, all consecutive adult patients (aged \u226518 years) with septic shock that were diagnosed in the emergency department and treated with protocol-driven resuscitation bundle therapy were enrolled with their data prospectively collected in our institution\u2019s Septic Shock Registry . It was Septic shock was defined as refractory hypotension  requiring vasopressors despite adequate fluid therapy or a blood lactate concentration of at least 4 mmol/L with suspected or confirmed infection, according to previous definition . The sepDemographic and clinical characteristics, including age, sex, past medical history, source of infection, and clinical outcome , were retrieved from electronic medical records of registry-enrolled patients. Blood samples were obtained within 15 min of ED presentation. Data on white blood cell counts, hemoglobin levels, blood urea nitrogen levels, creatinine levels, albumin levels, and initial lactate levels were collected. The Sequential Organ Failure Assessment (SOFA) score was calculated in the ED on initial recognition of septic shock . The AcuTEG was performed at the time of septic shock recognition. Whole blood (approximately 4 mL) was collected in vials containing citrate, by an assigned nurse. TEG was initiated with a computerized coagulation analyzer , which measured the physical properties of the clot and recorded kinetic changes. The recorded variables included R , K , alpha angle , MA , and LY30 . Subsequently, the coagulation index (CI) was calculated with the following formula: (CI = 0.1227 (R) + 0.0092 (K) + 0.1655 (MA) \u2212 0.0241 (\u03b1) \u2212 5.0220) . The nort-test or the Wilcoxon rank-sum test for continuous variables and the chi-square test or the Fisher\u2019s exact test for categorical variables. TEG analysis involved calculating the area under the receiver operating characteristic (ROC) curve (AUC). We determined the cutoffs for TEG values which represent an AUC more than 0.750, including K, MA, and CI, using ROC-based methods (the Youden index). To identify risk factors for the DIC, we included variables with an entry-level significance of p < 0.05 in the univariate analysis. After we confirmed multicollinearity with linear regression, multivariate analysis was performed by using the process of backward stepwise regression. The results of multivariate logistic regression analysis are reported as odds ratios (OR) and 95% confidence intervals (CI). In addition, standard statistical methods were used to calculate sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and positive and negative likelihood ratios . All statistics were performed by using SPSS software . A p-value of < 0.05 was considered statistically significant.Continuous variables with normal distributions are represented as the mean \u00b1 standard deviation, and those with skewed distribution are represented as the median and interquartile range. Categorical variables were presented as numbers and percentages. Variables were compared to identify differences between the DIC group and non-DIC group, using Student\u2019s Using registry data, we analyzed 1294 patients with septic shock who had undergone TEG at admission. We excluded 231 patients with \u201cdo not attempt resuscitation\u201d orders, 100 patients who refused to enroll in the study, and 74 patients who developed septic shock after 6 h of ED presentation. Of the 889 enrolled patients, 158 (17.8%) patients with septic shock were diagnosed with overt DIC with an ISTH score of \u2265 5 .p = 0.031). The DIC group had significantly lower levels of hemoglobin and albumin than the non-DIC group. The initial lactate levels were significantly higher in the DIC group than in the non-DIC group. Compared with the non-DIC group, the DIC group had significantly higher initial SOFA and APACHE II scores. The overall 28-day mortality was 17.5%; it was higher in the DIC group than in the non-DIC group .p = 0.000).The sensitivities, specificities, PPVs, NPVs, PLRs, and NLRs of the TEG values are shown in The candidate risk factors associated with DIC included the following: age, initial lactate level, SOFA score, APACHE II score, K > 2.0 min, MA < 60 mm, and CI < 1.8 . In multIn this study, TEG profiles demonstrated significant differences among patients with septic shock in the DIC and non-DIC groups. Among the TEG values, MA < 60 was an independent factor associated with an increased risk for DIC ), with a sensitivity of 79%, specificity of 73%, and NPV of 94%.DIC is defined as the systemic intravascular activation of coagulation arising from different causes . AlthougThe manifestations of coagulopathy in sepsis vary from normal to hypercoagulability, hyperfibrinolysis, and hypocoagulability ,29. In tIn our study, there was no difference in LY30 between the groups and mainly within the normal range (0~8%). Panigada et al. reported that impairment of fibrinolysis is associated with worse outcomes in sepsis . As our p = 0.000), which is similar to the results of a previous study reporting that 32.5% patients with sepsis and overt DIC died [Sepsis-associated DIC is more frequently associated with organ dysfunction than with bleeding, which is a frequent complication of DIC with hematologic disorder . In thisDIC died .Recently, efforts have been initiated to discover potential therapeutic targets to modulate pathophysiological pathways, such as coagulation systems, that may lead to organ dysfunction. Accordingly, studies have been conducted that incorporate several interventions to treat coagulopathy in patients with sepsis, including administration of anticoagulant supplements such as antithrombin ,35, actiThis study has several limitations. First, it did not necessarily reflect the general population because it was a single-center study, although it included a large sample of patients. Second, there were large numbers of patients excluded due to a do not resuscitate (DNR) order. As DNR is generally made in patients with critical illness with severe comorbidity, it could lessen the severity of the population. Third, studies have shown that TEG has a relatively broad reference range, and therefore, it might best be used to monitor changes within individuals ,42. If TEarly diagnosis of coagulopathy and initiation of treatment is crucial for patients with sepsis. Considering that TEG results are rapidly available at bedsides, MA < 60 could be a valuable tool for DIC prediction in patients with septic shock."}
+{"text": "A total of 279 non-redundant statistically significant differentially abundant proteins were identified by the combination of three proteomic approaches in MM BMIF, while in the case of serum 116 such differentially abundant proteins were identified. The biological context of these dysregulated proteins was deciphered using various bioinformatic tools. Verification experiments were performed in a fresh independent cohort of samples using immunoblotting and mass spectrometry based SRM assays. Thorough data evaluation led to the identification of a panel of five proteins viz., haptoglobin, kininogen 1, transferrin, and apolipoprotein A1 along with albumin that was validated using ELISA in a larger cohort of serum samples. This panel of proteins could serve as a useful tool in the diagnosis and understanding of the pathophysiology of MM in the future.Multiple myeloma (MM) is a plasma cell-associated cancer and exists as the second most common hematological malignancy worldwide. Although researchers have been working on MM, a comprehensive quantitative Bone Marrow Interstitial Fluid (BMIF) and serum proteomic analysis from the same patients\u2019 samples is not yet reported. The present study involves the investigation of alterations in the BMIF and serum proteome of MM patients compared to controls using multipronged quantitative proteomic approaches  MM is c as well , 8.Interestingly, there is no clinically relevant protein marker yet available for MM diagnosis . The curin silico tools. Furthermore, a selected panel of statistically significant proteins was verified for their differential abundance by immunoblotting as well as MS-based SRM assays. Moreover, potential candidate proteins were also validated in a fresh independent cohort of serum samples using Enzyme-linked immunosorbent assay (ELISA), as it is a minimal invasive fluid that could easily be used for the diagnostics applications. The significance of this study remains in the fact that the proteins which are observed in the BMIF and also reflected in the serum with similar expression profile are proposed as a potential candidate biomarker panel for MM diagnosis. Though BMIF serves as proximal fluid and an excellent source of information on disease pathophysiology, it is an extremely invasive sampling procedure, which puts a lot of stress on the suspected patients of MM. Therefore, the panel of protein markers which are present both in BMIF and serum with a similar expression profile could serve as an excellent alternative and complementary markers with high specificity and accuracy. To the best of our knowledge, this is the first comprehensive proteomics study involving MM clinical bone marrow interstitial fluid and serum samples which utilizes multipronged proteomic approaches.To identify the suitable biomarker for MM, the choice of biospecimen for proteomic investigation is very important. Being a proximal biofluid for the hematological malignancies, bone marrow interstitial fluid (BMIF) could serve as a potential source for identifying diagnostic, prognostic and therapeutic markers for various blood cancers including MM . On the The Institutional Ethics Committee of Armed Forces Medical College, Pune and National Centre for Cell Science, Pune approved this study. A total of 156 volunteers  were recruited for the study. Due to the unavailability of bone marrow interstitial fluid from healthy controls, we included the non-hematological malignancy samples in this study as BMIF control samples as these samples are devoid of any hematological malignancies. All the volunteers were informed about the study and written informed consent was obtained from each of them before clinical sample collection. The bone marrow aspirate and peripheral blood samples were simultaneously collected from the same study cohort. Freshly diagnosed naive MM patients without any other malignancy, diabetes and hypertension were recruited for this study. Similarly, controls without any ailments such as diabetes or hypertension were recruited for this study. The average age of the MM subjects recruited for this study was 63.95 years and that of healthy volunteers and non-hematological malignancy patients was 57.54 and 56.2 years, respectively Table S1The bone marrow aspirate and blood samples were incubated for 30\u00a0min at room temperature and then centrifuged at 3,000 rpm for 10\u00a0min at 10\u00b0C to separate the BMIF and serum respectively. The BMIF and serum samples were transferred in sterile cryovials, labeled and stored at \u221280\u00b0C freezer until further experiments. BMIF and serum samples were depleted for most abundant proteins such as albumin and IgG by using affinity chromatography based spin trap format depletion kit and desalted using a 2D clean-up kit  as per instructions provided by the manufacturer. BMIF and serum protein pellets, thus obtained, were dissolved in rehydration buffer  and the protein estimation was performed by a 2D Quant kit .The 2D-DIGE experiments were performed as per the protocol reported previously by Rapole and co-authors . Brieflyhttp://www.matrixscience.com) was used for the data analysis by keeping the taxonomy as Homo sapiens, database as SwissProt, enzyme as trypsin, oxidation of methionine as variable and carbamidomethylation of cysteine as a fixed modification. The MS mass tolerance was set as 75 ppm and MS/MS as 0.4 Da.Differentially expressed protein spots identified in 2D-DIGE were excised automatically through Ettan spot picker  from the preparative gel and subjected to in-gel digestion of the proteins as reported earlier . BrieflyHundred microgram protein from MM BMIF and serum  and respective controls  were subjected to in-solution digestion using trypsin. The four plex iTRAQ labeling of digested peptides was performed as per the manufacturer\u2019s protocol . Briefly, iTRAQ reagents dissolved in ethanol were added to the respective protein sample i.e., 114-controls, 115-MM samples, 116-MM samples and 117-controls and incubated at RT for 1\u00a0h. The labeled samples were pooled and concentrated using SpeedVac . Labeled peptide sample was fractionated by SCX chromatography  using a Shimadzu HPLC. The fractionated peptide samples were again concentrated under vacuum and desalted using C18 ZipTips  before performing the LC-MS/MS analysis. The desalted peptide samples were separated and analyzed through Eksigent MicroLC 200 System  which was coupled to a Triple TOF 5600 high-resolution mass spectrometer . The peptides were separated using a linear gradient of 7\u201335% ACN for 60\u00a0min for peptide elution from the analytical column with a flow rate of 8 \u03bcl/min. The column temperature was set as 40\u00b0C, and the autosampler temperature was kept as 4\u00b0C. The mass spectrometric analysis was executed with m/z ranging from 100\u20133,200, MS scan rate of six spectra, MS/MS scan rate of three spectra, with top 15 peaks for MS/MS analysis. The protein identification and quantitation were performed by ProteinPilot software  through the SwissProt database with 1% FDR and one missed cleavage as input parameters.The label-free SWATH-MS analysis was performed on BMIF and serum samples (12 MM and 12 controls), which were depleted for Albumin and IgG. An equal amount of BMIF and serum proteins were subjected to trypsin digestion, and the peptides were analyzed using a Triple TOF 5600 mass spectrometer  equipped with Eksigent Nano 2D Ultra 2D plus  having an Eksigent Nano LC 3C18 CL reverse phase column  along with NanoLC Trap Chrom XP C-18-CL  column. Data dependent analysis (DDA) was performed for the individual samples to generate high quality spectral ion libraries for SWATH-MS analysis, by operating the mass spectrometer with specific parameters as mentioned elsewhere . Technichttp://david.abcc.ncifcrf.gov/home.jsp), Protein Analysis Through Evolutionary Relationships  analysis and Ingenuity Pathway Analysis (IPA). DAVID analysis was performed by selecting functional annotation, Uniprot accession as identifier ID and extracted the biological functions. Similarly, PANTHER analysis was performed by keeping the Homo sapiens as a selected organism. Functional classification viewed in graphic charts for select analysis and exported the molecular function, biological process, cellular component, protein class and pathways. Likewise, in silico bioinformatics analysis was performed by Ingenuity Pathway Analysis (IPA) software  to identify the Canonical pathways, upstream regulators and toxicology functions.Proteins that were significantly differentially expressed  were interpreted using Database for Annotation, Visualization and Integrated Discovery . An appropriate secondary antibody conjugated with horseradish peroxidase enzyme (HRP)  was employed to detect the respective primary antibody. After treating with a chemiluminescent substrate, the blots were visualized by ImageQuant LAS 4000 instrument .Western blot analyses of BMIF and serum samples  were performed as described previously . Brieflyvia in silico approach on SKYLINE 3.1 software, cross-referred from SRM Atlas, MRM based public libraries and literature . Transitions for each of the proteins to be verified through the SRM experiments were established terature , 35, 36.In the validation phase, we used a separate cohort of 72 volunteers  to perform ELISA based validation in serum samples. All the ELISA experiments were performed according to the manufacturer\u2019s instructions. We validated a panel of five proteins with the Human Haptoglobin Quantikine ELISA kit , Human Kininogen DuoSet ELISA kit , Human Apolipoprotein A-I Quantikine ELISA Kit , Human sTfR Quantikine IVD ELISA Kit (1 Kit) , Human Serum Albumin DuoSet ELISA, 15 Plate (1 KIT) . The optical density of the each sample was determined by using an EPOCH 2 microplate reader  set to 450 nm and 570 nm. Optical imperfections correction was done by subtracting the readings of 570 nm from 450 nm readings. Further quantitative analysis was performed using GraphPad Prism software.To identify the MM induced differentially expressed proteins in MM BMIF and serum samples, the multipronged quantitative proteomic approaches were employed to maximize the proteomic coverage. The proteins identified in both the biomatrices with similar differential regulation and statistical significance were projected as potential candidate biomarkers. The results obtained from the experiments are discussed henceforth.p-value \u22640.05 (student\u2019s t-test) with \u22651.5 fold change for up-regulation and \u22640.67 as fold change for down-regulation. Out of these differentially expressed protein spots, 96 protein spots were up-regulated and 90 protein spots showed down-regulation as compared to control. A total of 112 protein spots were identified through the 4800 MALDI-TOF/TOF MS (Sciex), and 31 proteins were found to be non-redundant. Of these 31 non-redundant proteins, 19 proteins were found to be up-regulated, while 12 proteins showed decreased expression in MM as compared to control. The list of differentially expressed BMIF proteins identified using 2D-DIGE is mentioned in Decyder software revealed 1,450\u20131,600 protein spots which emerged as differentially expressed proteins in MM BMIF as compared to control. Biological variations of the gels were compared against a master gel through the BVA module to obtain statistically significant protein spots. Finally, 186 protein spots showed the statistical significance of p-value \u22640.05 and fold change \u22651.5/\u22640.67. Out of these differentially expressed protein spots, 90 protein spots were up-regulated and 63 protein spots showed down-regulation. A total of 96 proteins were identified through the MALDI-TOF/TOF MS, and 29 proteins were found to be non-redundant. Of these non-redundant proteins, 18 proteins were up-regulated and 11 proteins were down-regulated in MM as compared to control. The list of differentially expressed serum proteins identified using 2D-DIGE is mentioned in Similarly, serum 2D-DIGE analysis revealed approximately 1,200\u20131,300 protein spots out of which 153 protein spots showed differential regulation in MM with criteria of statistical significance of A total of 719 proteins were identified in BMIF using iTRAQ and out of these 183 proteins were found as differentially expressed with criteria of fold change \u22651.5/\u22640.67. A total of 91 proteins showed up-regulation and 92 proteins showed down-regulation in MM BMIF as compared to the control samples. The complete list of significant differentially regulated BMIF proteins identified using iTRAQ methodology is provided in In serum, a total of 650 proteins were identified using iTRAQ and out of these, 68 proteins were found as differentially expressed based on the fold change criteria of \u22651.5/\u22640.67. Among differentially expressed proteins, 30 proteins were up-regulated and 38 showed down-regulation in MM patients as compared to healthy controls. The complete list of significant differentially regulated serum proteins identified using iTRAQ methodology is provided in Identification of BMIF and Serum Proteome Alterations in MM Using 2D-DIGE and Identification of BMIF and Serum Proteome Alterations in MM Using iTRAQ. Multivariate statistical analysis such as OPLS-DA for BMIF SWATH-MS data revealed good discrimination between the control and the MM groups . ELISA based validation experiments were performed for proteins MM is the second most common hematological malignancy associated with plasma cell deformation and ultimately leads to bone marrow resorption. Currently, MM diagnosis primarily depends on the protein markers like serum albumin and B2M which are lesser specific at the early stages of this disease. Therefore, finding the novel and sensitive diagnostic and therapeutic markers for MM has a tremendous potential to improve patient survival. BMIF is the proximal biofluid for hematological malignancies and could serve as a potential source for identifying diagnostic, prognostic and therapeutic markers for MM. But unfortunately, bone marrow aspiration is an invasive and tedious procedure that puts patients through considerable anxiety and stress. Hence, to overcome this problem, for the first time, we identified and verified a set of differentially abundant proteins in MM BMIF and serum samples using multipronged quantitative proteomic approaches. Further, we selected a set of common proteins that showed a similar pattern of differential abundance in both MM BMIF as well as serum. Finally, we validated a panel of potential candidate biomarkers in a large cohort of serum samples that is associated with MM.via its down-regulation, which is also evident from a similar expression pattern found in our study.The bioinformatics analysis of the significant differentially abundant proteins found to be involved in many biological processes, some of which are elaborated henceforth in context to the proteins identified in this study. Platelet degranulation has been reported as a major biological process being altered in various cancers due to differentially expressed proteins , 38. In viz., Ig kappa chain C region, Ig mu chain C region, Ig alpha-1 chain C region and Ig heavy chain V-III region involved in these pathways depicted an up-regulated expression pattern in both biological fluids. BCR signaling plays a key role in the maintenance and development of B cells. The pathways altered downstream of BCR signaling would lead to the proliferation and survival of the B cells. The differentially expressed proteins associated with the BCR signaling pathway found in our study were positively modulated, which could lead to proliferative signals leading to the development of MM as explained by Choi & Kipps  signaling pathway, as observed in this study, could play an important role in MM development and progression. Interestingly, differentially expressed proteins  & Kipps . Various & Kipps \u201344.Complement activation is an important cause for inflammation and a series of experiments have proved that it could lead to tumor progression . ComplemPrevious studies have reported that higher levels of intracellular cholesterol positively affect cancer cell proliferation and migration , 48. TheSome of the acute phase proteins have been related to distinct cancers and also linked to their malignancy stages. Acute-phase proteins like alpha-1-acid glycoprotein 1, inter alpha- trypsin, serum amyloid A protein, alpha-1-antitrypsin, serum amyloid A-4 protein, C-reactive protein (CRP) showed up-regulation in this study. Previously, few reports demonstrated CRP levels to be elevated in squamous cell carcinoma of the esophagus and in adenocarcinoma and revealed that an increase in CRP levels correlated with tumor growth and metastasis \u201351. IlhaDuring the tumor progression, various innate immunity components are activated to minimize the inflammation caused by cancer , 55. TheCancer-associated pathways such as integrin signaling pathway, inflammation mediated by chemokine and cytokine signaling pathway, Wnt signaling pathway and FAS signaling pathway appeared to be altered in both MM BMIF as well as serum. The integrin signaling pathway plays an important role in cancer growth, metastasis, and therapy resistance in the tumor cells as well as in stromal cells. Integrins involve in the interaction of cells with their local environment and translate the external chemical response into a concerted intracellular response . Chemokiviz., the western blotting and the mass spectrometry based SRM assay to verify the proteins differentially regulated in the discovery phase. A panel of 15 Proteins viz., kininogen 1, alpha-1-antitrypsin, vitronectin, gelsolin, transferrin, ceruloplasmin, haptoglobin, apolipoprotein A-IV, alpha-1-acid glycoprotein 1, beta-2-glycoprotein, plasminogen, serum amyloid p-component, complement C3, apolipoprotein A1, and fibrinogen alpha chain were verified in MM BMIF. Similarly, a panel of 14 proteins viz. haptoglobin, kininogen 1, alpha-1-antitrypsin, zinc-2-alpha glycoprotein, gelsolin, apolipoprotein A1, transferrin, ceruloplasmin, plasminogen, serum amyloid A1, complement C3, vitamin D binding protein, serum amyloid P component and alpha-1-antichymotrypsin were verified in an external cohort of serum samples. Finally, we validated a panel of five of the verified proteins such as haptoglobin, kininogen 1, transferrin and apolipoprotein A1 along with known MM biomarker, albumin in a large cohort of serum samples using ELISA. This panel of proteins could be useful in the diagnosis and understanding of the pathophysiology of MM. The relevance of each protein in the potential biosignature panel of MM identified in this study is discussed henceforth.Further, we performed the verification experiments using two approaches viz., 2D-DIGE, iTRAQ, SWATH in MM BMIF and serum samples suggesting a potential candidate for MM. Overall, the MM serum and BMIF haptoglobin expression profiles were in good agreement with previous reports.Haptoglobin is an acute phase alpha glycoprotein comprised of two alpha and two beta subunits and tasked with hemoglobin clearance upon erythrocyte lysis. Haptoglobin is also known to carry out several other functions including antioxidant, anti-inflammatory and immune response regulation . MoreoveAlternate splicing of kininogen 1 transcript produces high molecular weight kininogen (HMWK) and low molecular weight kininogen (LMWK). The HMWK is involved in blood coagulation as well as the proteolytic release of bradykinin peptide . BradykiTransferrin is an iron transport protein present in blood serum. The total concentration of blood transferrin usually shown as a total iron-binding capacity of serum (TIBC). Lower TIBC leads to hemolytic anemia in which red blood cells destroyed very early stages . InteresApolipoprotein A-1 is a multifunctional component of high-density lipoprotein (HDL) involved in inflammation and immune response regulation apart from cholesterol trafficking. Recently, many studies have observed that apolipoprotein A-1 levels are altered upon cancer development and indicated that it could serve as a useful marker for diagnosis, prognosis as well as risk stratification of cancer patients . It\u2019s beAlbumin is a globular protein synthesized in the liver and performs the primary function of regulating the oncotic pressure of blood apart from acting as a carrier protein for various hormones, vitamins, and enzymes. Albumin constitutes over 60% of total blood plasma protein and its differential abundance levels have been intrinsically associated with several ailments. Importantly, in one of the study, hypoalbuminemia, a condition of reduced albumin levels have been detected as a marker of the advanced stage as well as higher cancer burden in MM patients . AuthorsMM is a disease that is primarily diagnosed in the advanced stages where the medical interventions for the treatment are very limited. Early diagnosis of MM can be crucial as the chances of better disease management by the clinicians can increase the overall survival expectancy of the MM patients. Protein-based makers of MM can comply with finding the biosignature which could be developed as early predictor of this disease. Our study design was to identify a biosignature panel of proteins from the BMIF and serum samples of MM patients and cross-verified its abundance in an independent cohort of serum samples of MM patients as the serum is an easily obtained diagnostic biofluid. Using multipronged proteomic approaches, we identified 279 and 116 non-redundant differentially expressed proteins in MM BMIF and serum respectively. A verification phase of experiments in an external cohort of BMIF and serum samples confirmed a set of 15 and 14 proteins respectively. Finally, a combined panel of four common proteins namely haptoglobin, kininogen 1, transferrin and apolipoprotein A1 along with albumin (an established biomarker for MM) were validated in a fresh cohort of serum samples and could be better and minimally invasive diagnostic, prognostic markers for MM. However, validation in a larger cohort of MM patients can further help to investigate the practical potentiality of these proteins as early diagnostic and prognostic markers. We believe that this panel of proteins could help in future MM disease management and thereby improving the survival expectancy of MM patients.via the PRIDE partner repository (The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: Proteome Xchange Consortium pository  having iThe studies involving human participants were reviewed and approved by Armed Forces Medical College, Pune and National Centre for Cell Science, Pune. The patients/participants provided their written informed consent to participate in this study.Conceived the study: VC, TC, SR. Designed the study: VC, KT, TC, SS, VS, MS, SR. Performed the experiments: VC, FR. Compiled the data: VC, RT, KT, FR, DM, SR. Analyzed the proteomics data and performed the statistical and bioinformatics analysis: VC, RT, KT, FR, DM, SR. Drafted the manuscript: VC, RT, KT, TC, SS, FR, DM, MS, SR. Provided clinical samples: TC, SS, VS. Provided chemicals and reagents: SR. All authors contributed to the article and approved the submitted version.This research was supported by NCCS intramural funding and the Department of Biotechnology, Govt. of India, India (grant no. BT/PR10855/BRB/10/1330/2014).Authors FR and DM are employed by Sciex, Gurgaon, India.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "However, due to some limitation of 68Ga-PSMA-11 the development of alternative tracers is of high interest. In this study, we aimed to investigate the value of 18F-PSMA-1007 in identifying non-metastatic high-risk PCa.Clinical management decisions on prostate cancer (PCa) are often based on a determination of risk. 18F-PSMA-1007 PET/CT were retrospectively analyzed. According to the European Association of Urology guidelines on PCa, patients were classified into intermediate-risk (IR) group or high-risk (HR) group. The maximum standardized uptake values (SUVmax) of the primary prostate tumor were measured on PET/CT images. The diagnostic performance of PET/CT for IR and HR PCa was calculated, and the relationship between the SUVmax of primary prostate tumor, prostate-specific antigen (PSA) level and Gleason score (GS) was analyzed.A total of 101 patients with primary non-metastatic PCa who underwent r\u2009=\u20090.561, r\u2009=\u20090.496, P\u2009<\u20090.001, respectively). Tumors with GS 6 and 7a showed significantly lower 18F-PSMA-1007 uptake compared to patients with GS 8 and 9 (P\u2009<\u20090.01). SUVmax in patients of HR was significantly higher than those of IR . In receiver operating characteristic curve analysis, the optimal cutoff value of the SUVmax for identifying high-risk PCa was set as 9.05 .Of all 101 patients, 49 patients were classified into IR group and 52 patients were classified into HR group. There was a significant positive correlation between PSA level/GS and SUVmax (18F-PSMA-1007 PET/CT showed the powerful diagnosis efficacy for high-risk PCa, which can be used as an objective imaging reference index for clinical reference. PCa is one of the most common tumors in men worldwide . PatientPSMA is a membrane-bound enzyme with high expression in prostate cancer cells and low expression in benign prostatic tissue . Over th68Ga-PSMA-11 is a widely used tracer for PET imaging applications in the detection of PCa. Nevertheless,\u00a0the disadvantage of 68Ga-PSMA PET/CT is that it has more bladder activity,\u00a0as\u00a0tracer\u00a0accumulation in the urinary\u00a0tract may influence\u00a0the uptake evaluation of the prostate bed [18F-PSMA-1007, can eliminate this kind of disadvantage because of its hepatobiliary excretion owing to its moderate lipophilic characteristics. It has been used as a promising new PET tracer in the management of PCa [18F-PSMA-1007 has longer half-life and higher physical spatial resolution than 68Ga-PSMA PET/CT, because 18F is cyclotron-produced with the larger activity amount [18F-PSMA-1007 has been reported that the intensity of tracer accumulation in the primary tumors of PCa patients correlated to GS and PSA level, and it is promising for accurate local staging of PCa [68Ga-PSMA-11 in local recurrence or metastasis [18F-PSMA-1007 PET/CT for high-risk PCa.Currently, tate bed . Recentlt of PCa , 14. Fury amount . In prevg of PCa , 15, 16.tastasis . However18F-PSMA-1007 PET/CT noninvasive imaging diagnostic strategies to identify the high-risk of PCa and tried to establish an objective imaging reference index.Thus, we intended to measure the intensity of tracer uptake in the primary prostate tumor and evaluate the value of 18F-PSMA-1007 PET/CT imaging at our institution between March 2019 and August 2020. The inclusion criteria were: (1) all patients who underwent 18F-PSMA-1007 PET/CT imaging need complete clinical data; (2) all patients need to have radical prostatectomy (RP) histopathology. The exclusion criteria were: (1) the time interval between the measurements of PSA values/RP and 18F-PSMA-1007 PET/CT was more than 4\u00a0weeks (2) metastatic lesions were found on PET images or RP histopathology; (3) patients referred to treatment or patients with previous history of other cancer . 18F-PSMA-1007 was prepared in a GE TracerLab FN synthesizer according to the one-step procedure described previously [eviously . The rad18F-PSMA-1007 images were acquired from a body PET/CT scanner  and were performed approximately 120\u00a0min after IV injection of 4.0\u00a0MBq/kg 18F-PSMA-1007 . For attenuation correction, a low-dose unenhanced CT scan was performed from the skull base to the middle of the thigh, with the following parameters: tube voltage of 140 Kvp, tube current of 110\u00a0mA, detector collimation of 64\u2009\u00d7\u20090.625\u00a0mm, pitch of 0.829, a tube rotation speed of 0.5\u00a0s, section thickness of 5\u00a0mm and reconstruction thickness of 2.5\u00a0mm, and was followed by the PET scan that matched the CT section thickness. A three-dimensional mode was used to obtain PET images with the following parameters: field of view, 576\u00a0mm; matrix of 144\u2009\u00d7\u2009144; slice thickness and interval, 5\u00a0mm. The emission scan time for each bed position was 1.5\u00a0min and the overlap between two adjacent bed positions was 50%.18F-PSMA PET/CT images were analyzed using a dedicated workstation , which allowed the review of PET, CT and fused imaging data in axial, coronal and sagittal slices. PET imaging was interpreted independently by 2 experienced nuclear medicine physicians both of whom have more than 10\u00a0years of clinical experience and blind of all relevant clinical statistics. Any disagreement was resolved by consensus.All max of the primary tumors were acquired from the most intense uptake area in prostate gland. Areas in the whole body having uptake above the background activity were defined as metastatic. Typical pitfalls such as PSMA uptake in sacral and coeliac ganglia or in the stellate ganglia were frequently observed but were not considered pathological [SUVological . This inological \u201324.max of the primary tumor were described descriptively (nonparametric Spearman correlation coefficients). The differences between different subgroups were evaluated by using the Mann\u2013Whitney U test and Kruskal\u2013Wallis test. ROC curve analysis was used to determine the optimal cutoff value of the SUVmax for identifying high-risk PCa. For all statistical parameters, P values of less than 0.05 were considered statistically significant.Data analyses were performed with SPSS version 23.0 software . Associations between GS, PSA value, and SUVThe clinical characteristics of the enrolled 101 patients with GS 6\u20139 are summarized in Table P\u2009<\u20090.001; Table r\u2009=\u20090.496, P\u2009<\u20090.001). Combining GS and tumor-related tracer uptake, lower median SUVmax value was found in the subgroups GS 6 (SUVmax: 5.35) and GS 7a (SUVmax: 8.70) than in GS 7b (SUVmax: 11.60), GS 8 (SUVmax: 18.08) and GS 9 (SUVmax: 19.00). The result of Kruskal\u2013Wallis test showed that the differences in SUVmax value between tumors with GS 6/7a and those with GS 8/9 were statistically significant . Figures\u00a0r\u2009=\u20090.561, P\u2009<\u20090.001).There was a statistically significant difference in median SUVmax between patients of HR and those of IR . The AUC of the SUVmax of the primary tumor was 0.829, which can efficaciously identify non-metastatic high-risk patients with PCa. Therefore, we believe pathologists and clinicians may reduce missed diagnoses if they refer to PET images and results. Apart from that, PSMA-PET/CT may better screen out the patients of high risk, especially when the patients are unable to receive aspiration biopsy or the histology results of biopsy are not satisfactory.A timely and accurate diagnosis of high-risk PCa is front and center for the clinician. The commonly used risk classifications for the PCa are based on clinical stage, Gleason score by biopsy and PSA level before treatment. However, it is not absolutely reliable to evaluate the accuracy of GS in patients who have undergone 12-core random, transrectal ultrasound-guided (TRUS) biopsy. In the clinical work, it may also encounter the patients who refuse biopsy for a variety of reasons. Another problem with the scheme is the inherent inaccuracy in determining T stage , 23. Kesg of PCa . In our P\u2009<\u20090.01). There were no statistical differences in SUVmax value between tumors with 7b and those with GS 8/9, which was different from the result of previous studies on 68Ga-PSMA [P\u2009>\u20090.05). This finding was consistent with previous studies on 68Ga-PSMA [The biological characteristics of PCa tissues vary greatly between different GS, which is an important indicator for the treatment and prognosis evaluation of PCa . Thus, w8Ga-PSMA , 24. Rea8Ga-PSMA ; thus, t8Ga-PSMA , 24, whi18F-PSMA-1007 uptake. The further researches about metastatic lesions or the impact of 18F-PSMA 1007 on the choice of treatment will be conducted in the further.The present study has some limitations that should not be neglected. Firstly, the retrospective nature of the analysis is the major limitation of our study, and further validation is required by multicenter studies with more patients. Secondly, the data of patients with GS 10 are lack in this study. Hence, the transferability of our data has yet to be assessed. Finally, we only focused on intra-prostatic 18F-PSMA-1007 was a great potential tracer for PCa PET/CT imaging. The intensity of tumor-related tracer uptake on 18F-PSMA-1007 PET/CT correlates with the PSA level and GS in primary PCa. Furthermore, 18F-PSMA-1007 PET/CT showed powerful diagnostic performance for risk stratification of primary PCa, which can be used as a reference index for identifying high-risk PCa.In conclusion,"}
+{"text": "High detection efficacy was reported in biochemical recurrence (BCR) of prostate cancer after radical prostatectomy. Thus, we evaluated the preliminary diagnostic utility of [18F]PSMA-1007 PET in patients with prostate cancer, focusing on the BCR which is not detected on conventional imaging.18F]PSMA-1007 (259\u2009\u00b1\u200937\u00a0MBq). PSMA-PET images were evaluated for lesion detection as well as its relation to PSA values and location.We enrolled a total of 28 patients (age 51\u201379\u00a0years) with BCR of prostate cancer. BCR was defined as a continuous increase in PSA after radical prostatectomy or radiation therapy without any apparent recurrent lesions on conventional diagnostic imaging (CT and bone scintigraphy). PSMA-PET scanning was performed approximately 60\u00a0min after intravenous injection of PSMA-1007 PET. This suggested the significant advantage of having minimal physiological urine excretion.Abnormal uptake, which was suspected to be recurrence or metastasis, was detected in 92.9% (26/28) of patients with BCR. The SUVmax was 8.4\u2009\u00b1\u20096.4 in local recurrence, 11.5\u2009\u00b1\u200911.8 in pelvic lymph nodes (LN), and 4.1\u2009\u00b1\u20091.6 in bone metastasis. The detection rates were 66.7% in the PSA group-1 (0.1\u20130.5\u00a0ng/mL), 85.7% in the PSA group-2 (0.5\u20131.0\u00a0ng/mL), and 100% in the PSA group-3 (above 1.0\u00a0ng/mL). Among the PET-positive BCR patients  UMIN000037697. Express68\u00a0Ga]Ga-PSMA-11 PET has been mainly used for PET imaging targeting PSMA and was recently approved by the FDA as the 1st PSMA PET probe. Meanwhile, the 18F-labeled PSMA ligand, [18F]PSMA-1007, has the advantages of the abundant availability of 18F and higher synthetic yield. It also showed favorable biodistribution in humans, with minimal excretion in the urine [18F]PSMA-1007 PET [18F]PSMA-1007 PET in patients with prostate cancer, focusing on the BCR, as an interim report.PSMA-1007 solution was synthesized using MPS200 (Sumitomo Heavy Industries) according to a previous study [18F]PSMA-1007 (259\u2009\u00b1\u200937\u00a0MBq). PET/CT images were acquired using Discovery 710  in 3-D mode  with 2\u00a0min per bed position. PET images were reconstructed using an ordered subset expectation maximization (OSEM) algorithm with three iterations per eight subsets, and Gauss-filtered to a transaxial resolution of 4\u00a0mm at full-width at half-maximum (FWHM). Attenuation correction was performed using the unenhanced low-dose CT data (tube current 100\u00a0mA). The CT-scans were reconstructed to a slice thickness of 3.75\u00a0mm with an increment of 3.27\u00a0mm. CT and BS were performed according to the institutional standard protocol as routine clinical practice.1FPSMA-100us study . After an\u2009=\u20095) or clinical course . In other cases without sufficient evidence (n\u2009=\u20096), apparent abnormal uptakes were judged as positive in potentially recurrent or metastatic regions. The impact on patient management was also evaluated after PSMA-PET in patients with BCR.PSMA-PET images were analyzed for detection of lesions, as well as their relation to PSA values and location in patients with BCR. All PET images were interpreted by two physicians with board certifications. When there were differences in the interpretation of a result, it was judged by the senior nuclear medicine physician who has enough knowledge about PSMA-PET imaging. Detection rate was defined as the image-based positive finding which was suspected recurrence on PSMA-PET. True positivity was defined based on the histopathological confirmation (n\u2009=\u200926), local recurrence was detected in 57.7% (15/26), pelvic LN in 42.3% (11/26), and bone metastasis in 15.4% (4/26)  of the patients with BCR. The SUVmax was 8.4\u2009\u00b1\u20096.4 in local recurrence, 11.5\u2009\u00b1\u200911.8 in pelvic lymph nodes (LN), and 4.1\u2009\u00b1\u20091.6 in bone metastasis  of BCR patients, who were suspected of local recurrence, focal uptake was detected adjacent to the bladder on [18F]PSMA-1007 PET. This suggested its significant advantage of less physiological urine excretion . However, caution is advised when interpreting bone uptake of [findings . In addifindings .18F]PSMA-1007 PET showed a high detection rate in recurrent and metastatic lesions. In patients with BCR, its high detection led to proper treatment strategies, such as salvage radiation therapy or surgical removal of recurrent lymph nodes.["}
+{"text": "This study aimed to evaluate the efficacy of 68Ga-PSMA-11 PET/CT as a triage tool for prostate biopsy (PSMA-TB) and compare with transrectal ultrasound-guided biopsy (TRUS-GB) for the diagnosis of clinically significant prostate cancer (csPCa).n\u2009=\u200925), whilst patients with negative PSMA-PET underwent systematic TRUS-GB (n\u2009=\u200935). All patients in the TRUS group underwent TRUS-GB directly (n\u2009=\u200960).This single-centre study randomly allocated 120 patients with elevated serum prostate-specific antigen (PSA) levels (>\u20094\u00a0ng/ml) to PSMA-PET or TRUS group. Patients with PSMA-avid lesions (SUVmax \u2265\u20098.0) underwent PSMA-TB via a single-puncture percutaneous transgluteal approach  vs 2/35 (5.7%), P\u2009<\u20090.01). PSMA-TB detected significantly more PCa and csPCa than TRUS-GB in the TRUS controls  vs 19/60 (31.6%), P\u2009<\u20090.01; csPCa, 20/25 (80.0%) vs 15/60 (25.0%), P\u2009<\u20090.01). PSMA-PET detected significantly more cases of csPCa amongst patients with PSA 4.0\u201320.0\u00a0ng/ml than TRUS . No haematuria, urinary retention or pelvic infection was observed after PSMA-TB compare with TRUS-GB.PCa and csPCa were detected in 26/60 (43.3%) and 24/60 (40.0%) patients in the PSMA-PET group and 19/60 (31.6%) and 15/60 (25.0%) in the TRUS group, respectively. In the PSMA-PET group, the detection rate of PCa and csPCa were significantly higher in PSMA-PET-positive than negative patients  vs 3/35 (8.6%), 68Ga-PSMA-11 PET/CT is a feasible imaging technique that may serve as a triage tool for prostate biopsy, and may improve the detection rate of csPCa compared with TRUS-GB, especially in patients with serum PSA 4.0\u201320.0\u00a0ng/ml. Systematic transrectal ultrasound-guided biopsy (TRUS-GB) is currently the main technique for the diagnosis of prostate cancer (PCa). However, this random, non-targeted approach increases the detection of low-risk disease, whilst about 18% clinically significant cancers (csPCa) are missed . Multi-p68Ga and 18F-fluoride have been well-explored and successfully translated for the clinical diagnosis of PCa in the last decade [68Ga-PSMA positron emission tomography/computed tomography (PET/CT) is a valuable method for detecting biochemical recurrence and malignant lymph nodes [68Ga-PSMA PET/CT also showed high sensitivity for identifying nodal and/or distant metastases compared with TRUS, and was thus a useful tool for tumour staging [68Ga-PSMA PET/CT had higher sensitivity for the detection of lymphadenopathy and visceral metastasis compared with mpMRI, and described the clinical characteristics of intra-prostatic primary lesions including tumour size, shape, and location [Prostate-specific membrane antigen (PSMA) is highly expressed in most primary and metastatic castration resistant PCa , 8, whict decade , 10. 68Gph nodes . A recen staging . Moreove staging . However staging , 15. We location \u201319.68Ga-PSMA PET/CT has shown to be more sensitive for the detection of primary prostatic lesions and regional lymphadenopathy compared with TRUS and MRI [68Ga-PSMA PET/CT could serve as a triage tool for prostate biopsy. This study aimed to investigate the feasibility of 68Ga-PSMA PET/CT-targeted biopsy (PSMA-TB) for detecting PCa, especially csPCa.The ideal prostate biopsy strategy would improve detection rate of csPCa and minimize the detection of indolent disease, thus avoiding the over-treatment of patients with PCa.  and MRI , 18. We n\u2009=\u200960) underwent 68Ga-PSMA-11 PET/CT. PSMA-TB was subsequently performed if PSMA PET/CT was highly suggestive of PCa, and systematic TRUS-GB was performed if PSMA PET/CT was negative. For patients with multiple intra-prostatic PSMA-avid lesions, the lesion with the highest uptake was selected as the puncture target. If PSMA-TB were negative, systematic TRUS-GB plus two cores of suspicious-lesion biopsies were performed within 2\u00a0days. All patients in the TRUS group (n\u2009=\u200960) underwent direct systematic TRUS-GB. Clinically significant PCa was defined as any Gleason score \u2265\u20097 (3\u2009+\u20094) and a lesion diameter >\u20090.5\u00a0cm3, or T3/T4 clinical stage. The CONSORT diagram for this study is shown in Fig.\u00a0This study was approved by the Nanjing First Hospital, and all patients signed an informed consent. A total of 120 patients with elevated serum prostate-specific antigen (PSA) levels (>\u20094.0\u00a0ng/ml) were consecutively enrolled and randomized into PSMA-PET and TRUS groups. Each patient was assigned a random computer-generated number, and patients with odd numbers were assigned to the PSMA-PET group and patients with even numbers to the TRUS group. All patients in the PSMA-PET group . 68Ga-PSMA-11 was radiolabelled using an automated module (ITM). All products were prepared using good manufacturing practice and were non-pyrogenic and sterile. Radiochemical purity and stability were determined by analytical reverse phase high-performance liquid chromatography. The radiochemical purity of all products administered to patients for imaging was >\u200999%. PET/CT was performed  45\u201360\u00a0min after injection of 111\u2013185\u2009\u00d7\u2009106\u00a0MBq 68Ga-PSMA-11 (3\u20135\u00a0mCi). CT images were used for attenuation correction and accurate localization. PET imaging was acquired immediately after CT scanning (matrix 256) with a 15.5\u00a0cm field of view, with 3\u00a0min acquisition for each bed position. Pelvic imaging in the prone position was specifically acquired for prostate TB. Reconstruction was conducted using an ordered subset expectation maximization algorithm with four iterations/eight subsets, and Gauss-filtered to an in-plane spatial resolution of 3\u00a0mm at full-width at half-maximum. PET/CT fusion was performed using a uMI 780 workstation. All lesions were displayed in three planes , and the region of interest (ROI) was delineated from the PET/CT fusion image.The precursor PSMA-HBED  was obtained from ABX advanced biochemical compounds GmbH (Germany). volume of each lesion was calculated using the equation: lesion volume\u2009=\u20091/2\u2009\u00d7\u2009A\u2009\u00d7\u2009B2 (mm3) where A and B represent the long and short diameters of the lesion, respectively. For multiple positive lesions, the lesion with the highest SUVmax, which may present with the highest aggressiveness, was selected as the puncture target. Patients with lower uptake in the primary prostatic lesion (SUVmax <\u20098.0) underwent systematic TRUS-GB.Images were examined by one radiologist and one nuclear medicine physician who were blinded to the clinical characteristics and pathology. Visual and semi-quantitative analyses were used to detect the primary lesion and lymph node metastasis. Region of interest (ROI) was drawn around the primary prostatic lesion with 40% maximal standardized uptake values (SUVmax) cut-off in the 1\u00a0h postinjection fusion image, SUVmax of the prostatic primary lesions and metastasis were acquired from the ROI. In this study, lesions with abnormal focal uptake in the prostate gland, tracer activity higher than the surrounding background and a SUVmax higher than the cut-off value of 8.0 were defined as intra-prostatic primary lesions, and suspected with csPCa based on our previous data and other clinical studies , 20. ConAll patients signed consent for this novel targeted biopsy procedure. Enemas and prophylactic antibiotics were not required. Aspirin and other anticoagulants were withdrawn for 7\u00a0days prior to the procedure. Pelvic CT was performed in the prone position, and the optimal cognitive fusion of PET and CT images was conducted. Once the index lesion in the prostate was determined, the puncture path, angle and depth were pre-simulated on the CT image. Metal palisade labelling was used to locate the puncture point on the patient\u2019s buttock, and a single-puncture percutaneous transgluteal approach was implemented with 1% lidocaine for local anaesthesia. Under CT guidance, an Argon Angiotech 17G biopsy trocar  was introduced through the gluteus maximus, the ischial anal fossa, and the anal elevator muscle and positioned cognitively at the target point Fig.\u00a0. Two to Patients underwent a standard systematic TRUS-GB protocol. Briefly, oral ciprofloxacin was routinely administered for 3\u00a0days, and an enema was performed 1\u00a0h before the procedure. Patients were placed in the left lateral position and local anaesthesia was applied to the anus. Systematic prostate biopsy was performed using an 18G needle  under B ultrasound guidance . A total of 12 core aspirations were performed in four sagittal planes of the medial line of the prostate lobe on both sides and the lateral side of the peripheral belt.Biopsy specimens and the tumour cell ratio of the whole tissue sample were analysed by a pathologist with 5\u00a0years\u2019 experience in urinary pathology. Histopathology positive biopsy specimens were compared with gross tissue histopathology in patients who underwent radical prostatectomy. The final pathology for each patient was confirmed as follows: (1) gross tissue histopathology after radical prostatectomy; (2) biopsy histopathology if patients did not undergo radical prostatectomy; and (3) biopsy specimen histopathology of TRUS-GB plus two core suspicious lesions if patients were negative for PSMA-TB.t tests. Continuous variables with a non-normal distribution were presented as median (interquartile range) and analysed by Mann\u2013Whitney U tests. \u03c72 or Fisher\u2019s exact tests were used to compare the differences between categorical variables. A P value <\u20090.05 was considered statistically significant.Statistical analysis was performed using SPSS, version 24.0 . The normality of the data was tested by Kolmogorov\u2013Smirnov analysis. Continuous variables with a normal distribution were presented as mean  and analysed by Student\u2019s The clinical data are shown in Table 2\u2009=\u20091.74, P\u2009>\u20090.05) and csPCa .The overall detection rates of PCa and csPCa were 37.5% (45/120) and 32.5% (39/120), respectively. PSMA-PET detected 43.3% (26/60) PCa and 40.0% (24/60) of csPCa, whilst TRUS detected 31.6% (19/60) PCa and 25.0% (15/60) of csPCa. There was no significant difference in detection rates for PCa  , 23 were true positive, of whom 21 were diagnosed by a single needle puncture (including two patients with negative TRUS-GB prior to this study). Two patients were initially negative on PSMA-TB but confirmed by supplementary TRUS-GB, and two patients who received both PSMA-TB and TRUS-GB followed by transurethral resection of the prostate gland were true negative, with a final diagnosis confirmed as benign disease. In the PSMA-PET group, the detection rates of PCa and csPCa were significantly higher in PSMA-PET-positive compared with PSMA-PET-negative patients  and csPCa in 15/60 (25.0%)  TRUS control patients. In one patient with previous abdomino-perineal resection due to rectal cancer , PCa (Gleason 4\u2009+\u20093) was finally confirmed by this novel puncture technique  and csPCa in 20/25 (80.0%) patients with PSMA-avid lesions, whereas TRUS-GB detected PCa in 19/60 (31.6%) . However, no significant difference existed in csPCa detection between PSMA-PET and TRUS in patients with PSA >\u200920.0\u00a0ng/ml   than that of TRUS group   . There was no significant differences in lesion size between patients with higher Gleason scores (\u2265\u20097) and lower Gleason scores (<\u20097)  Table .Table 4SCompared with systematic TRUS-GB, the needle did not pass via the rectum for PSMA-TB and no bowel preparation, including preoperative enema and pre-antibiotics, was therefore needed. The total time for PSMA-TB was thus only 20\u201330\u00a0min, and no postoperative antibiotics were administered during and after puncture. PSMA-TB was well-tolerated, with only one patient experiencing a few episodes of haematuria after the TB. However, haematuria occurred in 10 patients, urine retention in three patients and rectal infection in one patient after TRUS-GB.68Ga-PSMA-11 PET/CT has been well-documented for the early detection of biochemical recurrence of PCa, even in patients with low PSA levels [68Ga-PSMA uptake correlated with higher Gleason score and higher aggressiveness [68Ga-PSMA PET is of great value for detecting index lesions and high-risk disease, with significant impact on the clinical management of PCa [68Ga-PSMA PET as a triage tool for prostate biopsy.A levels . Recent siveness . 68Ga-PSt of PCa , 22. TRUt of PCa , 24. A rt of PCa . Howevert of PCa , 27, incIn this pilot study, we compared the difference in detection rates of PCa between PSMA-TB and TRUS-GB and developed a novel transgluteal PSMA-TB technique, which was easy to perform in the prone position. The needle was inserted transgluteally rather than transrectally, thus avoiding complications such as rectal bleeding and infection. Except for one patient who experienced a few episodes of haematuria, there were no other complications during or after the puncture procedure. This novel approach allows the puncture needle to be adjusted in real-time by CT guidance to ensure that it is located close to the inside of the anal levator muscle, thereby avoiding damage to the pudendal vasculature and pudendal nerves. We obtained two to four biopsy specimens with only one entry site using the co-axial needle technique. Biopsy histopathology confirmed the feasibility of this novel PSMA-TB. The proportion of cancer tissues in the whole tissue sample was >\u200950% in 16 patients and <\u200950% in five cases. The Gleason score in three patients was underestimated by PSMA-TB and adjusted after radical prostatectomy.For patients with multiple intra-prostatic lesions, the lesion with the highest SUVmax was referred to as the index lesion and selected as the puncture target. The size and position of the lesions are also important parameters, and large lesions are easier to biopsy. In this study, SUVmax cut-off value of 8.0 was determined as the csPCa threshold. Amongst 23 cases of PCa, 22 were finally confirmed as csPCa (SUVmax 8.73\u201340.69), and the detection rate of csPCa was 88.0%, with a sensitivity and specificity of 91.7% and 94.1%, respectively. Fendler et al.  reported68Ga-PSMA PET/CT has great merits for the detection of csPCa compared with TRUS and biopsy, whilst PSMA-TB is a novel technique with higher detection rate for csPCa but fewer adverse events, and might thus be an option for patients with PSMA-avid lesions. A single-puncture percutaneous transgluteal approach was shown to be feasible, well-tolerated and easy to perform.The efficiency of PSMA-TB was further evaluated in patients with different levels of serum PSA. For patients with PSA 4.0\u201320.0\u00a0ng/ml, the detection rate of csPCa was significantly higher in the PSMA-PET (27.02%) compared with the TRUS group (8.82%), whilst the efficacies of the two procedures were comparable in patients with PSA >\u200920.0\u00a0ng/ml. These findings suggest that PSMA-TB might be a better option in patients with low PSA levels (<\u200920.0\u00a0ng/ml), leading to an improved detection rate of csPCa. However, PSMA-TB had a better detection rate for PCa and fewer adverse events in patients with serum PSA >\u200920.0\u00a0ng/ml or large PSMA-avid index lesions. Urinary retention, pelvic infection and lower limb pain or numbness are common side effects of TRUS-TB. However, PSMA-TB was associated with fewer adverse effects in this study, and patients therefore preferred PSMA-TB to TRUS-TB. PSMA-TB thus demonstrated good clinical potential compared with TRUS-GB. In summary, 68Ga-PSMA PET/CT as a triage tool for the diagnosis of PCa. However, this study had some limitations, first, mpMRI was not routinely used and the diagnostic efficacy was not compared with MRI-guided biopsy for economic reasons. Second, patients with elevated serum PSA were randomly enrolled in the study, including some with benign prostatic disease, which decreased the sensitivity of 68Ga-PSMA PET/CT. Third, biopsy was performed using a single-puncture technique, which might have underestimated the tumour burden. Due to variable heterogeneity of PCa, multiple internal prostatic lesions are usually observed, and selection of the PSMA-avid lesion as the target might miss low-PSMA-expressing lesions. Tumours with negative or mild PSMA expression, which is not an indication for PSMA-TB, might be missed by PSMA-PET [The current single-centre study evaluated the feasibility of PSMA-PET .68Ga-PSMA PET/CT may serve as a triage tool for prostate biopsy, and PSMA-TB has higher sensitivity for the detection of csPCa than TRUS-GB. A novel percutaneous transgluteal approach involving a single puncture might improve the detection rate of csPCa. This minimally invasive targeted biopsy technique has great potential for the precise diagnosis of PCa.In conclusion,"}
+{"text": "Hypertension is a primary risk factor for cardiovascular disease (CVD). Tianma Gouteng decoction (TGD), originating from Zabingzhengzhixinyi, has been used for thousands of years in China to treat hypertension, giddiness, and migraine. This updated meta-analysis aimed at assessing the efficacy and safety of TGD combined with nifedipine in the treatment of primary hypertension.  Related research published prior to September 1, 2019, was found in electronic databases without language limitations. Fourteen studies were selected and analyzed for specified criteria, including the quality of the studies. All outcomes were recorded exhaustive. Data management and analysis were performed using RevMan 5.3 software. I2\u2009=\u200922%, RR\u2009=\u20091.17, and 95% CI: 1.12 to 1.22). Traditional Chinese medicine (TCM) symptoms of patients were obviously improved in the experimental group than in the control group . Traditional Chinese medicine (TCM) symptoms of patients were obviously improved in the experimental group than in the control group . Traditional Chinese medicine (TCM) symptoms of patients were obviously improved in the experimental group than in the control group . Traditional Chinese medicine (TCM) symptoms of patients were obviously improved in the experimental group than in the control group . Traditional Chinese medicine (TCM) symptoms of patients were obviously improved in the experimental group than in the control group (P < 0.00001) when two studies (shicaihong 2017 and xiaoyugao 2017) were removed. And the results of DBP showed no heterogeneity . Traditional Chinese medicine (TCM) symptoms of patients were obviously improved in the experimental group than in the control group (P < 0.00001) when two studies (shicaihong 2017 and xiaoyugao 2017) were removed. And the results of DBP showed no heterogeneity  patients were enrolled. The total efficacy rate was improved significantly for the combination of nifedipine with TGD compared to nifedipine treatment alone ( The combination of TGD and nifedipine has a better effect in the treatment of hypertension, including blood pressure lowering and patients' TCMs improving. However, our findings must be handled with care because of the small sample size and low quality of clinic trials cited. Other rigorous and large-scale RCTs are in need to confirm these results. Hypertension is an important risk factor for cardiovascular disease (CVD) worldwide, and it is also a major risk factor for stroke and coronary heart disease (CHD) in China , 2. As aUncaria rhynchophylla (Miq.) Jacks., Gastrodia elata Bl., Scutellaria baicalensis Georgi, Eucommia ulmoides Oliv, Radix cyathulae, Loranthus parasiticus, abalone shell , Gardenia, Leonurus japonicus, Caulis polygoni multiflori, and Poria cocos, all of which are standard in the Chinese Pharmacopoeia 2015 edition [Combination therapy, which is considered to be beneficial for enhancing the antihypertensive effect without increasing AEs , is the  edition .Several meta-analyses \u201312 have We searched CNKI, PubMed, VIP, EMBASE, Wanfang, Cochrane Library, and CBM. To conduct a comprehensive search, studies published prior to September 1, 2019, were investigated without language limitations. The search terms used were as follows: \u201cTianma Gouteng decoction\u201d and \u201chypertension\u201d or \u201cnifedipine\u201d and \u201chypertension.\u201d All corresponding articles were downloaded into Endnote software  for further investigation.The inclusion criteria were designed according to the suggestions of doctors, as follows: patients diagnosed as having primary hypertension by meeting the criteria of Guide to Prevention and Treatment of Hypertension 2010, Guiding Principles for Clinical Research of New Drugs in Traditional Chinese Medicine, Chinese Medicine Dialectical Diagnosis Efficacy Standard, Chinese Medicine Diagnosis and Treatment of Heart Disease Efficacy Standards and Norms, or Guide to Prevention and Treatment of Hypertension in China. Studies were presented as randomized control trials (RCTs). The intervention used for patients was TGD combined with nifedipine in the experimental group and only nifedipine in the control group. The measurement of the outcome of each article must have contained a total antihypertensive efficacy. The following indices in the articles must contain at least one of the following: blood pressure, TCMs, serum creatinine, adverse events, and blood urea nitrogen.The following criteria were utilized to exclude conditions: (1) nonrandomized controlled trials; (2) secondary hypertension; (3) hypertension and other illnesses; (4) patients received drugs other than TGD and nifedipine in RCTs; and (5) studies such as reviews, animal experiments, and case report that were considered to be irrelevant to the theme.Patients that had systolic blood pressure (SBP) greater than or equal to 140\u2009mmHg and/or diastolic blood pressure (DBP) greater than or equal to 90\u2009mmHg were diagnosed with hypertension in the included studies. To measure the diagnostic efficacy of antihypertension treatment, the total efficiency is equal to significant effect and effective summation. Treatments were considered significantly effective when DBP returned to normal levels and reduced by at least 10\u2009mmHg, or DBP did not return to normal levels, but the reduction was at least by 20\u2009mmHg. The treatment was considered effective when DBP returned to normal levels and decreased by less than 10\u2009mmHg, when DBP did not return to normal levels, but the reduction was by 10\u2009mmHg\u223c19\u2009mmHg, or there was a reduction in systolic blood pressure of at least 30\u2009mmHg. Treatment was considered invalid when DBP and SBP did not change significantly or even got worse.TCM symptoms of hypertension criteria were as follows: (1) significant effect: obvious improvement in clinical symptoms, (2) effective: clinical symptoms slightly improved, and (3) invalid: symptoms and signs have no significant changes or even worse.In order to assess the risk of bias, three authors  independently evaluated the study validity according to the Cochrane Handbook for Systematic Reviews of Interventions .Random sequence generation (selection bias)Allocation concealment (selection bias)Blinding of participants and personnel (performance bias)Blinding of outcome assessment (detection bias)Incomplete outcome data (attrition bias)Selective reporting (reporting bias) and other biasesSix criteria assessing bias and quality were evaluated according to whether the articles described the following:Three levels were used to assess each checklist item. \u201cLow risk\u201d of bias suggested that the program was sufficient. \u201cHigh risk\u201d of bias indicated that the description of methods or treatment program was not sufficient enough or was abnormal. \u201cUnclear risk\u201d of bias indicated that there were no descriptions of methods or the treatment program. Any objections among the evaluators  were determined through conversation with a fourth author (Yulin Liang).Information from the articles selected in this study included authors, year of publication, number of primary hypertension cases in the experiment and control groups, gender and age of patients, treatment period, random method, interventions, and evaluation standard, and the evaluation indexes were independently extracted by the three authors . This information is provided and arranged in Tables I2 tests and Q statistics. If the data had low heterogeneity (P \u2265 0.1 and I2\u2009\u2264\u200950%), a fixed-effects model was applied. If the data had high heterogeneity (P < 0.1 or I2\u2009>\u200950%), a random-effects model was applied. Latent issue bias was shown by funnel plots. Index measures, such as antihypertensive efficacy and TCMs, were thought to have dichotomous variables and evaluated by risk ratio (RR) with 95% confidence intervals (CIs). Continuous variables (such as BP) were rated by the mean difference (MD) with 95% confidence intervals. The significance of RR or MD was analyzed by a z-test, and P < 0.05 was considered to be indicative of statistical significance. The potential publication bias was assessed by constructing funnel plots.A Cochrane collaboration meta-analysis review methodology was applied in this study, with Review Manager 5.3 (Cochrane Collaboration) used to perform statistical analysis. The heterogeneity of the studies was determined by Studies took place between 2012 and 2017 ; all werAll trials were RCTs of participants according to Cochrane risk of bias estimation. The appropriate generation of random distribution sequence was depicted in six , 24\u201326 aP < 0.00001; P=0.22, \u03c72\u2009=\u200915.40, and I2\u2009=\u200922%).Effectiveness was defined as an improvement of symptoms. Fourteen articles , 23\u201329 r\u03c72\u2009=\u200910.65, I2\u2009=\u200944%, and P=0.10); therefore, a fixed-effects model was performed for a meta-analysis, which showed that TGD combined with nifedipine can significantly improve TCMs . TGD combined with nifedipine is preferable to nifedipine in reducing DBP of patients. Due to the large heterogeneity, sensitivity analysis was performed by removing 2 studies and recalculated the combined estimate on remaining studies. And the results of DBP showed no heterogeneity  and the random-effects model was performed for this analysis. The MD and 95% CI . Hypertension in patients is also accompanied by dizziness, headache, tinnitus, and insomnia [P < 0.00001). The BP level also reduced in the experimental group more than the control group . Only two studies reported AEs of TGD combined with nifedipine.In clinical studies, total efficiency is a measure for judging the antihypertensive efficacy of drugs. As the results of this meta-analysis showed, the total effective rate for the treatment of hypertension in the experimental group was 90.93% (652/717), which was higher than the control group (77.79% (557/716)). Compared with the control group, the experimental group showed better in antihypertension effect  when two studies (shicaihong 2017 and xiaoyugao 2017) were removed. And the results of DBP showed no heterogeneity  when two studies (panzhixiong 2019 and shicaihong 2017) were removed. We made a detailed analysis of the included literature and found that there were significant differences in the sex ratio of patients in the experimental group in the shicaihong 2017 and xiaoyugao 2017 studies. Study publications provided only limited descriptions of study design, allocation concealment, and baseline data, and there are a few indicators of measurement. All of the RCTs included in this review showed a mostly unclear risk of bias in more than one \u201crisk of bias\u201d domains. These reasons may lead to poor heterogeneity in the research process, as well as funnel diagram asymmetry. It is suggested that international standards should be used in clinical research to improve the quality of methodology and strengthen the quality of research and optimization methodology. At the same time, the details such as the generation of random sequence, the concealment of distribution, and the implementation of random allocation should be clarified in the research report. In addition, it should also develop in the direction of international cooperation, multicenter, large sample, complex random grouping, and so on. In addition, there are limitations to this research, such as the low quality of eligible trials, the lack of strict methodologies, and the employment of sole race rather than a more varied population sample. It is necessary to examine the results using other rigorous and large-scale RCTs.However, substantial heterogeneity was detected between included studies when we studied SBP and DBP outcomes. First, a sensitivity analysis was conducted, in which 1 study at a time was removed and the individual study would not have a significant impact on the results. Second, we conducted a sensitivity analysis by removing 2 studies and recalculated the combined estimate on remaining studies. The results of SBP showed a small heterogeneity (According to the results and conclusions of the article, we can see that the combination of TGD and nifedipine has a better effect in the treatment of hypertension, so we suggest that we can adopt the method of combination of traditional Chinese and Western medicine according to the patient's condition. However, our findings must be handled with care because of the small sample size and low quality of clinic trials cited. Other rigorous and large-scale RCTs are in need to confirm these results."}
+{"text": "A dysregulated host immune response significantly contributes to morbidity and mortality in tuberculous meningitis (TBM). Effective host directed therapies (HDTs) are critical to improve survival and clinical outcomes. Currently only one HDT, dexamethasone, is proven to improve mortality. However, there is no evidence dexamethasone reduces morbidity, how it reduces mortality is uncertain, and it has no proven benefit in HIV co-infected individuals. Further research on these aspects of its use, as well as alternative HDTs such as aspirin, thalidomide and other immunomodulatory drugs is needed. Based on new knowledge from pathogenesis studies, repurposed therapeutics which act upon small molecule drug targets may also have a role in TBM. Here we review existing literature investigating HDTs in TBM, and propose new rationale for the use of novel and repurposed drugs. We also discuss host variable responses and evidence to support a personalised approach to HDTs in TBM. Mycobacterium tuberculosis (M.tb) and managing host inflammatory response. Antimicrobial drug therapy for TBM has been adapted from that used for pulmonary tuberculosis (TB); four drugsare given initially, with subsequent tapering to two or three drugs  for continuation of therapy up to one year. Yet the host immune response may be dysregulated, and contributes to the poor outcomes associated with TBM. Host directed therapies (HDT) seek to control this host response and reduce death and neurological injury. Clinical outcomes in tuberculous meningitis (TBM) depend upon both killingM.tb within the central nervous system. In fact, corticosteroids are the only widely used host directed therapy in TBM with any proven benefit in both adults and children. In adults, in particular, questions around their clinical use remain including whether they have a role in improving outcomes in HIV-associated TBM and the mechanisms by which they improve survival. Clinical trials to assess the efficacy of other HDTs including aspirin and thalidomide have been conducted, however there is not yet conclusive evidence to suggest when, with whom and at what dose they may be effective. New knowledge from studies uncovering mechanisms of inflammation and brain injury may also allow for a directed approach to modulating the host response. Similarly studies aiming to contribute knowledge of factors at play which influence variability in the host may lead us away from a \u2018one size fits all\u2019 therapeutic approach.The discovery and assessment of new therapeutics in TBM has been a neglected area; this includes the development of bespoke antitubercular drug regimens which account for differing ability of drugs to penetrate the central nervous system, and the design of HDTs which counter dysregulated immune responses toWe review the evidence on currently used HDTs in TBM and suggest potential therapeutics based on pathogenesis studies and drawing from knowledge and experience in other forms of tuberculosis and neuroinflammatory conditions. We will review work which has contributed to our understanding of variation in host response and discuss how this knowledge might be harnessed to design a personalised approach to the use of HDT in TBM.. The mechanism through which corticosteroids confer clinical benefit is unclear, although reduction in intracerebral inflammation seems most likely. Glucocorticoids bind to and activate the glucocorticoid receptor of macrophages and other cells, interfering with inflammatory mediator transcription and expression. Additional indirect genomic effects of inhibition of pro-inflammatory transcription factors such as activator protein-1, and non-genomic mechanisms further mediate glucocorticoid anti-inflammatory effects.Adjunctive corticosteroids reduce mortality from TBM, at least in the short termM.tb induces activation of the microglial NLRP3 inflammasome, a multimolecular immune complex of receptors and sensors that mediates innate immune responses and induces inflammation via pro-inflammatory caspases and cytokines; a process inhibited by dexamethasone. In TBM, pro-inflammatory cerebrospinal fluid (CSF) cytokine concentrations are acutely elevated, although therapeutically reducing these concentrations may not be clinically beneficial. In a study of 16 individuals with TBM in India, concentrations of tumor necrosis factor (TNF)-\u03b1, interleukin (IL)-1\u03b2, IL-6, IL-8, IL-10 were elevated in TBM vs. controls , and declined during TB treatment, yet cytokine concentrations were not related to disease severity, brain magnetic resonance imaging (MRI) abnormalities or clinical outcome. In a paediatric study (n=30), CSF TNF-\u03b1, IL-1\u03b2, and interferon (IFN)-gamma concentrations were elevated in acute TBM, but again did not correlate with disease severity, nor were they influenced by corticosteroid administration. However in a large study of clinical and intracerebral inflammatory phenotype and 9-month survival in adults with TBM from Vietnam, multiple pro-inflammatory and anti-inflammatory CSF cytokines were significantly reduced in HIV uninfected individuals who died vs. in HIV uninfected who survived. This effect  was not seen in HIV co-infection. Murine studies suggest. In a representative subset of this study, dexamethasone did not significantly alter tested CSF cytokines  over time vs. placebo. CSF concentrations of IL-6, IL-8, and IL-10 fell slowly after commencement of anti-TB chemotherapy, and TNF-\u03b1 fell rapidly, all irrespective of dexamethasone treatment. In a subgroup of HIV uninfected adults (n=37), dexamethasone significantly reduced CSF matrix metalloproteinase-9 (MMP-9) in follow up samples taken after a median 5 days of treatment. CSF cytokine concentration measurement is frequently used as a proxy for measurement for intracerebral inflammation. Further work is required to determine whether the protective effect of dexamethasone correlates with a measurable reduction in intracerebral inflammation.In 545 Vietnamese individuals >14 years recruited to a randomized placebo-controlled trial of dexamethasone for TBM, dexamethasone was associated with a reduced risk of death . Corticosteroid use in TBM is commonplace, dexamethasone is commonly used as it is affordable and widely available although the optimal corticosteroid preparation, dose, and route of administration are unknown. Issues with prolonged intravenous therapy, access to intravenous therapy, and pill burden for oral therapy, all require consideration when designing clinical trials of new corticosteroid regimens. Whether beneficial therapeutic effects extend to HIV co-infected individuals is uncertain. In a HIV-positive subgroup (n=98) from a randomized trial of adjunctive corticosteroids for TBM in Vietnamese adults, dexamethasone was associated with a non-significant trend towards improved survival. Subsequently, a study of adults with HIV-associated TBM showed global increase in pro-inflammatory cytokine concentrations, running counter to theory that immunosuppressed HIV co-infected individuals have lower intracerebral inflammation. A multicentre randomized controlled trial of adjunctive corticosteroids for HIV co-infected adults with TBM is currently underway in Vietnam and Indonesia (NCT03092817).International guidelines recommend adjunctive corticosteroids for TBM management. TBM-IRIS is a common and often severe complication of starting anti-retroviral therapy (ART) in TBM, and is associated with high CSF neutrophil counts and a positiveM. tuberculosis culture at presentation. Interestingly, a CSF inflammatory process, specifically high neutrophils and high TNF-\u03b1 in combination with low IFN-gamma, predicted later TBM-IRIS in a study of 34 individual with TBM in South Africa. Inflammasome activation appears to be involved in the development of TBM-IRIS, with matrix metalloproteinase (MMP)-9 a possible mediator of brain tissue damage. Whilst corticosteroids during the first 4 weeks after initiation of ART reduced TB-associated IRIS in HIV co-infected individuals in a trial in South Africa, individuals with TBM were excluded. There are no randomized trials of corticosteroid therapy for TBM-IRIS, nor for paradoxical neurological reactions in HIV uninfected individuals.Corticosteroids are frequently used to treat common neuro-complications of TBM; paradoxical reactions, and the immune reconstitution inflammatory syndrome (IRIS). Paradoxical neuro-inflammatory reactions, which occur despite appropriate anti-TB chemotherapy, may reflect host response to dead and dying bacteria. Unlike in adults, improvement in disability, albeit moderate, is described. Dosage and duration however is debated and in randomized trials dosage has varied between 1mg/kg and 4mg/kg daily, for 3-4 weeks. One trial compared three dosage regimens; 2 mg/kg/day over 4 weeks vs 4 mg/k/day over 1 week and 2 mg/k/day for the next 3 weeks vs 4 mg/kg/day over 4 weeks. In each group the initial 4 weeks was following by 4 weeks of tapering. There was no difference in mortality between groups, however prolonged periods of higher dose prednisolone were associated with new onset optic neuropathy and hydrocephalus. These findings highlight the delicate balance between moderating host immunity, and avoiding the occurrence of adverse events. Further studies are needed to identify ideal dosage regimen, as well as explore host variability in response to corticosteroids in childhood TBM.In childhood TBM, benefit from corticosteroids has been demonstrated in a number of studies, and stroke was associated with a two-fold increase in mortality in a recent meta-analysis. The inflammatory state occurring in TBM contributes to the pathogenesis of stroke. A prospective study of 146 TBM patients demonstrated an acute phase inflammatory response with significantly elevated cytokines  in blood and CSF. A hypercoagulable state was reflected by elevated protein C, factor VII, plasminogen activator inhibitor-1 and anticardiolipin antibodies, as well as decreased protein S in a case series of 16 children. Bleeding times were also markedly shorter and platelet counts remained markedly raised in this subgroup. Hypercoagulability has been shown to occur in adults with pulmonary tuberculosis, and may also contribute to pathogenesis of stroke in TBM. Local intra- and extra-vascular factors contributes to TBM pathogenesis, most significantly in the form of cerebral vasculitis secondary to inflammatory infiltrates; initially believed to be directly due to tubercle bacilli implantation, now known to correlate with the inflammatory exudate in the basal cisterns and subarachnoid space. The significance of intravascular thrombosis is still unclear. While thrombosis might be common in the context of vasculitis, autopsies on TBM patients failed to demonstrate frequent arterial thrombosis. Significant platelet dysfunction has also been demonstrated in TBM, manifesting as increased mean platelet volumes, platelet distribution width and platelet-large cell ratio. These parameters are significantly associated with infarcts and suggests the use of antiplatelet agents in TBM. Local intra- and extra-vascular factors contribute to TBM pathogenesis in the form of vasculitis due to bacilli infiltration. In an effort to reduce mortality and long-term neurological disability in TBM, aspirin is increasingly being studied due to its anti-inflammatory and inhibitory effects on platelet and thrombus production. In murine models, low dose aspirin (3 mg/kg) showed a systemic decrease in serum cytokines  and late stage T cell responses inM.tb infection. Aspirin also enhances T helper cell 1 responses for eliminating bacilli from lungs. Aspirin contributes to the resolution of inflammation by generating 15-epi-lipoxims, resolvins and protectins, recognized for their anti-inflammatory as well as pro-resolving characteristics It is also well described how the drug inhibits pro-inflammatory prostanoid production via acetylation of COX.Cerebral infarction occurs in 25\u201371% of TBM cases. A randomised controlled trial of TBM involving children in South Africa (n=146) could not establish improved neurological/cognitive outcomes or survival with ASA at doses of 75 mg (low dose) or 100 mg/kg/day (high dose). However, the developmental outcome of children on high dose ASA was similar to the placebo and low dose ASA groups, despite being younger of age and having higher baseline severity. This finding warrants further investigation of high-dose ASA in childhood TBM. A study of 120 Vietnamese adults with TBM demonstrated a reduction in death and new infarcts with the addition of 81 mg/day aspirin (8 of 36 or 22.2%) and 1000 mg/day aspirin (6 of 38 or 15.8%), versus placebo (11 of 38 or 28.9%). Aspirin was associated with dose-dependent inhibition of thromboxane A2 and upregulation of pro-resolving protectins in the CSF. Another retrospective study by Misraet al. in India failed to validate clinical benefit, showing an insignificant reduction in deaths with the addition of 150 mg aspirin as compared to standard anti-TB therapy. However, 25% (11 of 135) of patients randomized to the aspirin arm had a complete recovery at 3 months versus 17.1% (7 of 135) in the standard treatment arm. In the three adult trials, corticosteroids were administered alone or in conjunction with aspirin with no adverse event signal found. None of these trials observed an increase in adverse events, but safety concerns with increasing doses of aspirin persist. Whilst these studies of adjunctive aspirin described varying results regarding morbidity and mortality, they paved the way for further large randomised controlled trials. The above described trials utilized a daily aspirin regimen duration or primary outcome measured at two to three months. A recent study utilized MRI to quantify baseline and follow up brain lesions in TB meningitis and found that 60% (n=48) of participants had the presence of acute infacts at enrolment, with only one new infact at follow up 2 months later. This correlates to the acute phase in which most complications of TB meningitis occur and the window where meningeal inflammation and vasculitis needs to be treated. Phase 2 (NCT03927313) and 3 (NCT04145258) trials are currently underway to validate aspirin as a host-directed therapy. Given the insufficient evidence base, aspirin is not routinely used in most individuals with TBM.To date, three randomized controlled trials have investigated the role of aspirin in adult and paediatric TBM. In 118 adult TBM patients in India, aspirin resulted in absolute risk reduction of stroke in 19.1% and significant reduction in mortality compared to placebo (10 of 118 (21.7%) versus 23 of 118 (43.4%), p=0.02). In addition, thalidomide does not inhibit TNF-\u03b1 produced by stimulated T-cells. The therapeutic effect of thalidomide therefore appears to be dose dependant since differing TNF-\u03b1 concentrations will result in opposing physiological consequences. Thalidomide has a wide range of biological effects, due to its ability to interfere with the immune system, and depending on the cell type or pathway of activation. The inhibition of TNF-\u03b1, which is produced primarily by macrophages and monocytes, accounts for most of the immunological effects of the drug. TNF-\u03b1 performs a delicate balancing act during host response to mycobacterium tuberculosis infection, whereby on the one hand it is mandatory for keeping infection under control, but on the other hand, if produced at too high levels it induces a hyperinflammatory state resulting in severe tissue damage. The potential of thalidomide to activate T-cells, resulting in elevated production of IL2, IFN and TNF-\u03b1, may potentially interfere with its anti-inflammatory properties as well as in children with UK Medical Research Council (MRC) grade 2 TBM in a dose-escalating pilot study. However, a double-blind, randomized trial of high dose thalidomide treatment (24mg/kg/day for 1 month) in children with grade 2 and 3 TBM was discontinued due to side effects  and deaths in the thalidomide arm.Thalidomide has been shown to reduce CSF TNF-\u03b1 experimentally in rabbits and blindness-related to optochiasmatic arachnoiditis. Adverse drug effects have been less of an issue in these situations. The life-threatening nature of these TBM sequelae as well as the anatomical location of the lesions, which precluded surgery, disqualified them from being included in trials. Nonetheless, the clinical improvements noted have been substantial.  noted in both the pilot and randomized trials have led to more targeted studies, albeit at a much reduced dosage (\u22645 mg/kg/day). Additionally, adjunctive thalidomide has been shown to be particularly effective in observational studies involving tuberculous brain abscessesantial. .. Regression is associated with fibrosis, mineralization  and eventually disappearance, usually with no residual structural abnormalities. T2-black granulomas may however persist for years in asymptomatic children. In most cases, cure is achieved after less than 3 months of adjunctive thalidomide therapy. When used, the duration of adjunctive thalidomide therapy should be guided by subsequent clinical and radiological responses. In TBM clinical improvement of mass lesions generally precedes radiological improvement due to a reduction in peri-lesional inflammation. Serial MRI T2-weighted studies have shown that evolution of the lesions from early stage \u201cT2 bright\u201d abscesses with oedema to \u201cT2 black\u201d represents a marker of cureIt is the authors experience that adjunctive thalidomide warrants consideration in the following TBM-related conditions: corticosteroid-unresponsive optochiasmatic arachnoiditis resulting in visual impairment and/or optic disc pallor; enlarging TB abscess despite corticosteroid therapy (TB-IRIS); large TB abscess/tuberculomas in critical brain regions (i.e. brainstem) that is not amenable to surgical drainage and not responding to corticosteroids; large dural-based TB abscess resulting in epilepsia partialis.TNF-\u03b1 has been shown to exert deleterious effects on capillaries already sensitized by exposure to mycobacterial products. The endarteritis, coupled with raised intracranial pressure because of edema and obstructive hydrocephalus, often leads to cerebral ischaemia/infarction. The value of low-dose adjunctive thalidomide in modifying the progressive endarteritis is yet to be explored. \u03b1. However, like in other neuroinflammatory conditions where cytokines such as IFN-\u03b3 have opposing roles, inhibition of these cytokines may not necessarily lead to improved outcomes and therefore caution must be exercised in exploring the potential drugs which inhibit these pro-inflammatory cytokines as candidate HDTs.Modulation of cytokines known to contribute to pathology is a potential strategy to support host defenses or control deleterious inflammation in TBM. In TBM a number of pro-inflammatory cytokines are thought to play a role in pathogenesis, including IL-2, IL-6, IL-1\u03b2, IFN-\u03b3 and TNF-, they may also be responsible for latent TB reactivation and dissemination to the CNS in those where the drug is used to treat autoimmune conditions. Anakinra is a human interleukin-1 receptor antagonist that blocks the biological activity of natural IL-1 and may also have a role in TBM. Anakinra demonstrated efficacy in one case of life-threatening protracted paradoxical inflammation in CNS TB where high dose corticosteroids failed. Other immunomodulatory agents of interest include canakinumab and tocilizumab, human monoclonal antibodies inhibiting IL-1 and IL-6 respectively. In TBM, vasculitis occurs due to the proximity of the progressive exudative meningitis to the basal subarachnoid cistern and the circle of Willis. Cyclophosphamide, an alkylating cytotoxic drug is an effective drug in the treatment of primary cerebral vasculitis. Two case reports have described clinical improvement with the use of cyclophosphamide in TBM associated cerebral vasculitis; however, its role as an effective treatment in this context needs further investigation particularly due to concerns over its potential adverse activity as a potent immunosuppressive drug.There are accumulating data on the role of the anti-TNF-\u03b1 monoclonal antibodies infliximab and adalimumab and the soluble TNF-\u03b1 receptor etanercept in TBM treatment. Although these agents are described as options for treating refractory paradoxical reactions involving the CNSAlthough host directed therapies are in use, they are limited in either efficacy or availability. Therefore the quest for more effective therapeutics remains ongoing. Here we discuss potential therapies which target pathways highlighted in recent pathogenesis studies, or draw on insights from other forms of TB or inflammatory conditions with shared mechanisms of pathogenesis .in vitro studies have demonstrated that statins enhance anti-inflammatory and inhibit pro-inflammatory functions in microglial cells and inhibit mechanisms involved in neurodegeneration. Anti-inflammatory properties may be due to modulation of isoprenylation with downstream effects on inhibitory and stimulatory transcription pathways, or via allosteric inhibition of leucocyte function antigen (LFA)-1 integrin which is involved in the transmigration of activated T cells through the blood brain barrier. Neuroprotective effects may be due to modulation of excitotoxicity, vascular function, angiogenesis, and/or reduced oxidative damage through nitric oxide stimulas. Importantly, some studies have shown increased neuronal death with higher concentrations of statins.HMG-CoA reductase inhibitors (\u2018statins\u2019) are ubiquitously used in prevention and treatment of cardiovascular disease, but are also known to have immunomodulatory, anti\u2010inflammatory and anti\u2010oxidative properties. Several. Patients with secondary progressive MS benefited from statin therapy with a phase 3 trial underway (NCT03387670). In a mouse model of traumatic brain injury, atorvastatin led to profound attenuation of T cell, neutrophil and natural killer cell invasion into the CNS, and reduction in production of pro-inflammatory cytokines (IFN-y and IL-6) and chemokines (CCL5 and CXCL10). In a double-blind randomised trial involving 36 patients with traumatic brain injury, rosuvastatin given for 10 days in the acute phase of injury significantly reduced TNF-\u03b1 which correlated with a reduction in disability scores. Other conditions where the role of statins has been explored include Alzheimer\u2019s disease, and Parkinson\u2019s disease. Further, statins may be associated with reduced risk of tuberculosis. In a TB murine model, adjunctive simvastatin shortened time to culture clearance by 1 month, enhanced bacterial killing, and decreased culture-positive relapse and enhance bacterial killing. Clinical trials  will investigate the efficacy of statins in pulmonary tuberculosis. Given their potential use as an adjunctive TB therapy, their lipophilic properties allowing good penetration to the CNS, as well as their potential as an anti-inflammatory and neuroprotective agent, statins may have a role as a HDT in TBM; trials to explore this hypothesis are needed.The potential of statins to effect CNS inflammation and neurodegeneration in other conditions are of interest given the shared mechanistic pathways in TBM. For example, animal models of multiple sclerosis (MS) show that statins skew immune responses towards an anti-inflammatory T-helper cell 2 response, inhibiting pro-inflammatory cytokines IL-2, IL-12 and IFN-\u03b3. This mechanism is thought to contribute to brain injury and cell death in other neurological conditions such as stroke, epilepsy, traumatic brain injury, Alzheimer\u2019s and Huntington\u2019s disease. Therapeutics which aim to reduce glutamate excitotoxicity either by i) modulating the downstream effects of glutamate via NMDA receptor binding or ii) reducing extracellular glutamate (e.g. glutamate \u2018grabbing\u2019) may have a role in the treatment of TBM. In acute stroke, a similar approach was taken however although animal studies were promising, randomised trials in humans assessing efficacy of NMDA antagonists largely failed. Therapeutics have been designed to reduce glutamate induced excitotoxicity by lowering blood glutamate concentration thus leading to a larger natural glutamate gradient between the brain and blood thereby facilitating the efflux of extracellular brain glutamate into the blood. In an animal study riboflavin (vitamin B2), selected for its ability to interact with Glutamate-Oxaloacetate transaminase (GOT) to significantly reduced blood glutamate levels compared to placebo  . Further. A delicate balance in eicosanoid levels is crucial forM.tb control and regulating the production of pro-inflammatory cytokines.Eicosanoids are arachidonic acid derived lipid mediators that trigger pro-and anti-inflammatory responses and include prostaglandins, resolvins, lipoxins, and leukotrienes which serve as signalling molecules, modulating inflammation and cell death in TB. New generation NSAIDs with more selective inhibition of COX2 may have more favourable safety profiles. Phase 1 trials to assess the safety and bactericidal activity of celecoxib and etoricoxib in healthy volunteers with a view to developing these agents as HDTs for drug sensitive TB are currently underway . Although trials to further investigate the role of aspirin in TBM are underway, future research should consider the potential contribution of newer more selective COX2 inhibitors in TBM.Non-steroidal inflammatory drugs (NSAIDs), which exert their effects by inhibiting cyclooxygenase (COX) activity may lead to reduction of excessive inflammation in TBM. As discussed, aspirin, a non-selective COX inhibitor has been investigated in three trials in TBM with variable outcomes , PDE-4 (roflumilast) and PDE-5 (sildenafil) have all increased bacterial clearance and reduced pro-inflammatory cytokines which contributed to a reduction in neutrophil infiltration and lung pathology. The role of phosphodiesterase inhibitors has not been studied in TBM but the properties above make them intriguing candidates for adjunctive therapy in TBM.Phosphodiesterase inhibitors (PDE-i) are small-molecule inhibitors that reduce inflammation by increasing intracellular cyclic adenosine monophosphate and cyclic guanine monophosphate . Phospho. The U.S. National Institutes of Health HIV guidelines recommend starting ART within 2 weeks of anti-TB chemotherapy for HIV-TB co-infected patients with CD4 cell counts <50 cells/ \u00b5L and within 8 weeks for CD4 counts >50 cells/\u00b5L. In TBM there are unique considerations given the infection surrounds crucial structures  with a very limited ability to expand within the skull and spinal canal should excess inflammation occur. Inflammation occurring following the initiation of HIV therapy is known as immune reconstitution inflammatory syndrome (IRIS), which in the context of TBM is associated is frequent (up to 40%) and associated with high mortality (30%).Although not an HDT per se, the decision as to when antiretroviral therapy is started must consider the potential immunopathogenic complications as well as the benefit in preventing further opportunistic infection. Guidelines vary slightly regarding the timing of initiation of ART relative to initiation of anti-TB chemotherapy in those co-infected with TB and HIV. The 2010 World Health Organisation (WHO) ART guidelines recommend initiating ART within 8 weeks of anti-TB chemotherapy in all HIV-TB co-infected patients regardless of CD4 count. This approach hopes to strike a balance between the beneficial effects of ART  and the potential harms of TB-IRIS.In a randomised trial of testing immediate HIV therapy initiation (at time of initiating TB treatment) vs delayed (after 2 months) in TBM, immediate therapy was associated with significantly more grade 4 adverse events (n=102) than delayed HIV therapy . This trial informed current consensus that ART initiation should be delayed by between 4-8 weeks after starting TBM therapyM.tb in TBM is vital; although excessive inflammation leads to neurological damage. Polymorphisms in genes involved in immune response or signaling pathways can influence host inflammatory response, or susceptibility to TBM.Host immune response toLTA4H) gene influenced the balance of pro and anti-inflammatory eicosanoids in response toM tuberculosis infection. LTA4H catalyzes the final step in pro-inflammatory leukotriene B4 (LTB4) synthesis, with LTB4 effects usually balanced by anti-inflammatory lipoxin A4 (LXA4), the two together ensuring an appropriate response toM. tuberculosis without excessive tissue damage. A single nucleotide polymorphism (SNP) (rs17525495) in the promoter region of theLAT4H gene alters gene expression, and LTB4 LXA4 balance; low (CC) and high (TT) inflammatory states result fromLTA4H allele homozygosity whereas an intermediate (CT) inflammatory state results from allele heterozygosity. Both TT and CC inflammatory states were associated with increased death in a retrospective study of adults with TBM. In this retrospective study adjunctive dexamethasone was associated with improved survival in the high inflammatory TT group, with the effect of dexamethasone unclear in the CC and CT groups. In a subsequent study of 764 Vietnamese adults, ten CSF cytokines were measured of: TNF-\u03b1, IFN-\u03b3, IL-1\u03b2, IL-2, IL4, IL-5, IL-6, IL-10, IL-12, IL-13. In HIV-uninfected adults with TBM, pro-inflammatory IL-1\u03b2, IL-2, and IL-6 (but not TNF-\u03b1) were significantly associated withLTA4H genotype; low concentrations in CC genotype, intermediate concentrations in CT genotype, and high concentrations in TT genotype. In HIV co-infected individuals with TBM,LTA4H genotype did not appear to influence survival, response to dexamethasone, or CSF cytokine profile. AdditionallyLTA4H genotype did not influence survival in a study of HIV-uninfected Indonesian adults with TBM, all of whom received corticosteroids. ALTA4H genotype stratified approach to adjunctive corticosteroid therapy in TBM is now being assessed in an ongoing randomized placebo-controlledLTA4H genotype stratified non-inferiority trial of HIV uninfected adults with TBM in Vietnam (NCT03100786). If benefits of adjunctive corticosteroids as a host directed therapy are shown to be limited to one or moreLTA4H genotypes, this paves the way for personalized corticosteroid therapy in TBM. Such benefit related toLTA4H genotype may lead to innovation and development of affordable point of care tests, to enable implementation ofLTA4H genotype testing into patient management. A previous study in the zebrafish model showed that the leukotriene A4 hydrolase  in CD43, a surface glycoprotein, has been associated with more severe presentation, and decreased survival, in TBM. Why SNPs in CD43 affectM tuberculosis susceptibility is uncertain, but CD43 has a role in regulating proinflammatory cytokines, and theoretically anti-inflammatory therapies may be beneficial in such patients., evidence that patients with a dysregulated host immune response benefit from more, or different, host directed therapies is lacking.Where variable host responses toHost directed therapies are an evolving area of TBM research. We know that the inflammatory response in TBM contributes to poor outcomes. Further, we know that dexamethasone reduces death from TBM. What is unknown is how the drug works, who might benefit most from dexamethasone or whether other therapies should be given in addition to dexamethasone or in place of it in some scenarios. There may also be scenarios where dexamethasone is harmful. Important questions regarding the exact role of thalidomide and aspirin also remain. While in the case of the former, a narrow context in which the drug might be useful is becoming clearer, in the latter the optimal and safe dose of aspirin considering its antiplatelet and anti-inflammatory properties, is uncertain. Although the use of immunomodulatory therapies have been reported sporadically, often where corticosteroid treatments have failed, no clinical trials have been conducted to systematically assess their safety profile and efficacy.. In TBM we must work towards establishing similar repositories through international collaboration. However, the relatively low global incidence of the disease, and the challenging environments in which TBM most commonly occurs will make this a lengthy endeavour.Drug discovery depends on accurately identifying molecular targets which play crucial roles in disease biology, and which are amenable to modulation via biologics or small molecule drug therapeutics. In diseases with high global incidences such diabetes or hypertension, large scale data repositories are beginning to provide genetic insights to inform drug discovery and therefore change the direction of and speed at which novel and repurposed therapeutics become available, further research is required to establish whether a more refined or alternative model could better recapitulate human disease. Genomic research to identify variation in host response will allow further refinement of therapeutic approaches based on factors at the individual patient and population level. While studies of LTA4H genotype have led the way in this area of TBM research, focus must now widen to include other pathways that are likely to vary between hosts. As we move forward with host-directed therapies for TBM we must remain cognisant of the characteristics of the hosts whose responses we are attempting to change. Whether these changes are obvious (e.g. HIV infection) or more opaque (e.g. unknown genetic polymorphisms) they must be considered with trial design so that we can understand as fully as possible, the role of these therapies in improving outcomes in TBM.In the near future, we can focus on better understanding of key pathogenic processes underpinning inflammation and brain injury. For example, further understanding of the role and interaction of glutamate and tryptophan in brain injury may uncover targets for which existing drugs can be repurposed and novel therapeutics developed. The rational design of animal models to help inform which of these might deserve clinical trials in TBM is also key; although the rabbit model of TBM has been in use since the early 1900s I have no additional comments for this submission.Is the review written in accessible language?YesAre all factual statements correct and adequately supported by citations?PartlyAre the conclusions drawn appropriate in the context of the current research literature?YesIs the topic of the review discussed comprehensively in the context of the current literature?YesReviewer Expertise:NAI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. This review is well-written with complete focus on the potential host directed therapies for TB meningitis. The manuscript contains a detailed literature review  on the use of corticosteroids, aspirin, thalidomide, statins, and other molecules, against TB meningitis.\u00a0 Recommendations: Introducing a paragraph about tuberculosis incidence and epidemiology at the beginning of the manuscript, followed by sections on the prevalence of TB meningitis, and then pathogenesis of TB meningitis, will further enhance the strength of the manuscript.specific comments within the text of the manuscript. The reviewer has providedIs the review written in accessible language?YesAre all factual statements correct and adequately supported by citations?YesAre the conclusions drawn appropriate in the context of the current research literature?YesIs the topic of the review discussed comprehensively in the context of the current literature?YesReviewer Expertise:Tuberculosis, HIV and DiabetesI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Dear Reviewer 2,\u00a0 Many thanks for your thorough review of the manuscript and your suggestion to add a section on TBM epidemiology and pathogenesis. We agree that these are important areas, however since this manuscript forms a collection of published papers in a TBM supplement, many of which covered TBM epidemiology and pathogenesis in detail, the authors felt that this manuscript should maintain a narrow focus on the subject area, and therefore felt chapters on TBM epidemiology/pathogenesis was beyond the scope of the article. General comments: This review regarding the host directed therapy (HDT) for TBM is globally well written and includes adequate references on this topic to date. It could be better balanced. In the introduction, the authors could include a short chapter about TBM epidemiology.Systematic review:Title I do not agree to consider aspirin, thalidomide and immunomodulatory therapies (anti-TNF and anti-Il1 antibodies) as \u201cexisting \u201c HDT in TBM. To date, only one HDT has been proven to reduce mortality, namely dexamethasone and the other one are promising approaches but have not been assessed in clinical trials yet. So I would consider as Existing HDT the only dexamethasone and \u201cPromising\u201d HDT the other ones. The title \u201cpotential future HDT\u2026\u201d should be replaced by Potential \u201cpathways\u201d for HDT since some of the activators/inhibitors cited in this chapter are new components never evaluated in RCTs.Chapter Dexamethasone: The authors should describe what kind of controls were evaluated in a study of 16 individuals in India. The authors write about cerebral inflammation but it is a proxy to consider CSF cytokines as a maker of cerebral inflammation. The authors should comment on this point. The issue of dexamethasone dosage (and of rifampicin induction) and of the use of other corticosteroids should be detailed in this chapter described since dexa is the only HDT validated in the guidelines.Chapter Aspirin: The chapter is well written. In addition to the comprehensive antiagregant effect of aspirin, can the author explain how they expect an additional antiinflammatory effect to high dose dexamethasone? \u00a0The duration of the treatment should be discussed.Chapter Thalidomide: Data on thalidomide are very few and mainly observed in children. The authors should be cautious regarding their experience with adjunctive thalidomide in TBM regarding the lack of date. Thalidomide is an old anti-inflammatory drug used in inflammatory diseases and progressively removed from guidelines because of its toxicity. Again, it seems difficult to consider thalidomide as a \u201cpromising\u201d drug for TBM since new biological agents are far more efficient on proinflammatory cytokines. The authors should not suggest using thalidomide at a large scale in TBM/TB brain abscess.Chapter Immunomodulatory HDT: This chapter is quite short regarding the perspective given by anti-TNF in a severe form of TBM/CNS TB. The choice of the type of anti-TNF, as well as the duration of treatment and the risk associated to this medication, could be discussed. To my mind, anti-TNF therapies may represent one of the best approaches to reduce mortality and morbidity of TBM/TB Abssess in HIV and non HIV people and in children. The main issues are the toxicity of these drugs in the environment where TBM occurs and the availability of these drugs in poor income countries. These points have to be discussed in this review. In table 2, the authors should add the following references about adalimumab:Adalimumab treatment may replace or enhance the activity of steroids in steroid-refractory tuberculous meningitis. \u00a0Lee HS, Lee Y, Lee SO, Choi SH, Kim YS, Woo JH, Kim SH. J Infect Chemother. 2012 Aug;18(4):555-7Adalimumab for Corticosteroid and Infliximab-Resistant Immune Reconstitution Inflammatory Syndrome in the Setting of TB/HIV Coinfection. \u00a0Lwin N, Boyle M, Davis JS. Open Forum Infect Dis. 2018 Jan 30;5(2):ofy027ART: It is not really fair to consider ART as HDT\u2026 even if it is obvious that ART has a significant impact on immunological status. HIV coinfection raises other issues in the management of TBM and I would consider separating this chapter from HDT.Chapter Future pathways\u2026: Chapter Statin therapy It is not well balanced to have a chapter statin with no data on TBM longer than the chapter on biological agents, even if the background is interesting. I would summarize the impact of statin on multiple sclerosis, \u00a0brain injury, etc since it is quite far from TBM to focus on the potential interest of statins on TB and immune response. FIGURE 2: Not really helpful in the present form. I would perform a central plot with increased neuronal survival, immune modulation, axon plasticity myelination that are the goal of treatment; and to describe around the central plot the different pathways to reach this target. \u00a0Chapter Host response: The discussion regarding the LTA4H gene and the response to dexamethasone is an important point of pharmacogenetic. The authors should discuss if this strategy is affordable in every setting.Is the review written in accessible language?YesAre all factual statements correct and adequately supported by citations?PartlyAre the conclusions drawn appropriate in the context of the current research literature?YesIs the topic of the review discussed comprehensively in the context of the current literature?YesReviewer Expertise:HIV Infection ; TBMI confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Dear reviewer 1, Many thanks for your thorough review of the manuscript and your suggestions. We have addressed each in turn in the responses below.General comments: This review regarding the host directed therapy (HDT) for TBM is globally well written and includes adequate references on this topic to date. It could be better balanced. In the introduction, the authors could include a short chapter about TBM epidemiology. We agree that this is an important area, however since this manuscript forms a collection of published papers in a TBM supplement, many of which covered TBM epidemiology in detail, the authors felt that this manuscript should maintain a narrow focus on the subject area, and therefore felt a chapter on TBM epidemiology was beyond the scope of the article.Paragraph sub-headings: I do not agree to consider aspirin, thalidomide and immunomodulatory therapies (anti-TNF and anti-Il1 antibodies) as \u201cexisting \u201c HDT in TBM. To date, only one HDT has been proven to reduce mortality, namely dexamethasone and the other one are promising approaches but have not been assessed in clinical trials yet. So I would consider as Existing HDT the only dexamethasone and \u201cPromising\u201d HDT the other ones. The title \u201cpotential future HDT\u2026\u201d should be replaced by Potential \u201cpathways\u201d for HDT since some of the activators/inhibitors cited in this chapter are new components never evaluated in RCTs. We have changed the sub-headings as suggested.Chapter Dexamethasone: The authors should describe what kind of controls were evaluated in a study of 16 individuals in India. This has been added to this section. The authors write about cerebral inflammation but it is a proxy to consider CSF cytokines as a maker of cerebral inflammation. The authors should comment on this point. A comment has been added to this section as per suggestion . The issue of dexamethasone dosage (and of rifampicin induction) and of the use of other corticosteroids should be detailed in this chapter described since dexa is the only HDT validated in the guidelines. We agree this issue is important and have commented on this in the text pointing out to readers that although \u201cCorticosteroid use in TBM is commonplace, dexamethasone is commonly used as it is affordable and widely available although the optimal corticosteroid preparation, dose, and route of administration are unknown.\u201d We have added text to further clarify this point in a sentence following this.Chapter Aspirin: The chapter is well written. In addition to the comprehensive antiagregant effect of aspirin, can the author explain how they expect an additional anti-inflammatory effect to high dose dexamethasone?\u00a0 The duration of the treatment should be discussed. Many thanks. These suggestions have been added to this section.Chapter Thalidomide: Data on thalidomide are very few and mainly observed in children. The authors should be cautious regarding their experience with adjunctive thalidomide in TBM regarding the lack of date. Thalidomide is an old anti-inflammatory drug used in inflammatory diseases and progressively removed from guidelines because of its toxicity. Again, it seems difficult to consider thalidomide as a \u201cpromising\u201d drug for TBM since new biological agents are far more efficient on proinflammatory cytokines. The authors should not suggest using thalidomide at a large scale in TBM/TB brain abscess. Many thanks for your comments on this. We feel differently that the use of thalidomide is supported by now numerous published studies, the most recent being the largest cohort of adult or pediatric patients treated with adjunctive thalidomide for CNS TB\u2013related complications. In this study (reference below), published this year in Clinical Infectious Diseases, thalidomide appeared to be safe, well tolerated and clinically efficacious. Although we appreciate that further RCT generated evidence is required to warrant its use widescale, it is the opinion of the authors on the manuscript that this is indeed a \u2018promising\u2019 HDT that warrants discussion and further explanation.Clinical Infectious Diseases, Volume 72, Issue 5, 1 March 2021, Pages e136\u2013e145 Ronald van Toorn, Regan S Solomons, James A Seddon, Johan F Schoeman. Thalidomide Use for Complicated Central Nervous System Tuberculosis in Children: Insights From an Observational Cohort.Chapter Immunomodulatory HDT: This chapter is quite short regarding the perspective given by anti-TNF in a severe form of TBM/CNS TB. The choice of the type of anti-TNF, as well as the duration of treatment and the risk associated to this medication, could be discussed. To my mind, anti-TNF therapies may represent one of the best approaches to reduce mortality and morbidity of TBM/TB Abssess in HIV and non HIV people and in children. The main issues are the toxicity of these drugs in the environment where TBM occurs and the availability of these drugs in poor income countries. These points have to be discussed in this review. In table 2, the authors should add the following references about adalimumab: Adalimumab treatment may replace or enhance the activity of steroids in steroid-refractory tuberculous meningitis.\u00a0 Lee HS, Lee Y, Lee SO, Choi SH, Kim YS, Woo JH, Kim SH. J Infect Chemother. 2012 Aug;18(4):555-7 Adalimumab for Corticosteroid and Infliximab-Resistant Immune Reconstitution Inflammatory Syndrome in the Setting of TB/HIV Coinfection.\u00a0 Lwin N, Boyle M, Davis JS. Open Forum Infect Dis. 2018 Jan 30;5(2):ofy027 Many thanks for these comments. These references have been added as suggested.ART: It is not really fair to consider ART as HDT\u2026 even if it is obvious that ART has a significant impact on immunological status. HIV coinfection raises other issues in the management of TBM and I would consider separating this chapter from HDT. Many thanks for these comments. As per your suggestion we have separated this section as a distinct sub-chapter within the manuscript.Chapter Future Pathways: Chapter Statin therapy - It is not well balanced to have a chapter statin with no data on TBM longer than the chapter on biological agents, even if the background is interesting. I would summarize the impact of statin on multiple sclerosis,\u00a0 brain injury, etc since it is quite far from TBM to focus on the potential interest of statins on TB and immune response. Thank you for these comments, we have shortened this paragraph as suggested. FIGURE 2: Not really helpful in the present form. I would perform a central plot with increased neuronal survival, immune modulation, axon plasticity myelination that are the goal of treatment; and to describe around the central plot the different pathways to reach this target.\u00a0 Many thanks for your thoughts on this. We agreed with these and attempted to modify the figure as you suggested. However, on review, given that the effect of manipulation of these pathways has not yet been explored in this context we did not want to develop a figure which may be misleading given the early stages of research in this area. We have rather simplified the diagram as a reference figure for readers as they read this section, allowing them to visualise the pathways being discussed. \u00a0Chapter Host response: The discussion regarding the LTA4H gene and the response to dexamethasone is an important point of pharmacogenetic. The authors should discuss if this strategy is affordable in every setting. Many thanks, we agree this is an important issue; we have added a comment on this to the section."}
+{"text": "Twenty-eight states have provided nursing homes (NHs) with immunity from legal liability related to COVID-19. This study places these provisions in the context of prior actions protecting NHs from legal action and explores factors influencing the adoption of such immunity provisions across states. It uses cross-sectional data to examine patterns of policy adoption and to assess states\u2019 likelihood of adopting immunity provisions using multivariate methods. Variables of interest include information on state political, socioeconomic, programmatic, and COVID-19-related characteristics as well as data on campaign contributions and lobbying activity at the state level. Factors significantly related to NH immunity provision adoption included measures of state fiscal health (unemployment), ideology (percent legislators Democrat), governing capacity (unified government), and NH characteristics . Population density and Medicaid as a percentage of state general fund expenditures proved significant as well. Against these complex influences, organizations lobbying on behalf of NH residents and their families have found themselves ineffectual in creating avenues for accountability. Results indicate that enforcing accountability for NH deaths during the COVID-19 pandemic is a complex process, constrained by available policy tools and made more complicated by factors external to the NH environment that contributed to high death rates. Historically, the NH industry has been successful in avoiding consequences for poor quality care, a pattern that has persisted in that NHs have generally been successful in avoiding liability for negligence during the COVID-19 pandemic."}
+{"text": "ROC curve analysis revealed that the AUC of bump-calcaneus ratio was larger than that of bump height. The optimal threshold was 4 mm or higher for bump height and 7.5% or higher for bump-calcaneus ratio. The intra- and inter- observer ICCs were, respectively, 0.965 and 0.898 for bump height and 0.930 and 0.889 for bump-calcaneus ratio. Conclusions: This study proposes two novel radiographic parameters to identify operatively treated Haglund\u2019s deformity, namely bump height and bump-calcaneus ratio. They are easy to measure and intuitive. Both of them are effective diagnostic parameters for Haglund\u2019s deformity. Furthermore, bump-calcaneus ratio is more reliable diagnostic parameter than bump height.Background: Haglund\u2019s deformity, which is characterized by a bony prominence of the posterosuperior aspect of the calcaneus, causes posterior heel pain. To date, there is no standard radiographic parameter to diagnose symptomatic Haglund\u2019s deformity. Herein, we proposed novel radiographic measurements to distinguish between patients with and without symptomatic Haglund\u2019s deformity. Methods: We retrospectively evaluated ankle radiographs of 43 patients who underwent surgery for symptomatic Haglund\u2019s deformity (Haglund group) and 41 healthy individuals (control group) free of heel complaints. Fowler\u2013Phillip angle (FPA), Heneghan\u2013Pavlov parallel pitch lines (PPL), Haglund\u2019s deformity height, bump height, and bump-calcaneus ratio were measured and compared between the groups. Furthermore, the reliability and cut-off value of each parameter were validated via ICC and ROC curve analysis, respectively. Results: The bump height ( Haglund\u2019s deformity, also known as \u201cpump bump,\u201d is one of the common causes of heel pain. It was first described by Patrick Haglund in 1928 . IncreasAt present, the etiology of Haglund\u2019s deformity is not well understood and may be related to tightness of the Achilles tendon, talipes cavus, heredity and calcaneal morphology or position. Haglund\u2019s deformity usually occurs in middle-aged women and is usually bilateral. It is mainly manifested by swelling and pain in the posterior heels. Conservative treatments, including anti-inflammatory drugs, physiotherapy, orthosis, and adjustment of insole height, constitute the first-line treatment; however, their success rate is low . In geneMany studies have proposed various X-ray measurement methods to objectively diagnose and define Haglund\u2019s deformity since its first description in 1928 ,11. ConvThis study aimed to validate two new radiographic measurements for the diagnosis of symptomatic Haglund\u2019s deformity and verify their cut-off values and reliability. We hypothesized that our new radiographic measurements would show significant differences between patients with and without operatively treated Haglund\u2019s deformity. The results of this study could provide clinicians with an objective measurement for the diagnosis of Haglund\u2019s deformity and help to establish a consensus among various specialties concerning this issue.We retrospectively evaluated the lateral view of ankle radiographs of 43 patients who underwent surgeries for Haglund\u2019s deformity (Haglund group) from August 2011 to December 2020 and enrolled the other 41 relatively healthy individuals without posterior heel pain as the control group. The radiographic measurements for Haglund\u2019s deformity were performed in a total of 84 heels. This study was approved by the Institutional Review Board (IRB) of our institution .The Haglund group consisted of 22 males and 21 females with an average age of 56 \u00b1 13.5 years . The clinical diagnostic criteria for Haglund\u2019s deformity included palpable calcaneal hump with posterior heel pain and local swelling in the prominence of the posterior calcaneus. After conservative treatment failed, all patients received MRI to exclude any other pathogenesis or tumor over the posterior heel  and undeThe control group consisted of 19 males and 22 females with an average age of 55 \u00b1 10.8 years . According to their medical records, they had no posterior heel pain, and most of them sustained ankle sprain. Exclusion criteria were the same in both the groups: individual with less than 18 years of age, infection in the foot and ankle, inflammatory disease, any previous ankle or foot surgeries, or incomplete medical records.To quantify the bone anomalies potentially implicated in posterior heel pain, we used the standard radiologic criteria, and all radiographic parameters were measured on the lateral view radiograph of the ankle using the software built in picture archiving and communications system (PACS) with ultraquery . To decrease the possible variation of ankle radiography by foot malpositioning, the standardized radiographic procedure was followed. The patient was requested to be in a lateral recumbent position on the table and an image receptor was placed vertically beneath the upright ankle with foot in dorsiflexion. The lateral aspect of the knee and ankle joint should closely contact with the table resulting in the tibia lying parallel to the table. The x-ray beam was directed horizontally, centered at the bony prominence of the medial malleolus of the distal tibia. The position of distal fibula, distal tibia and talar domes were checked to evaluate the quality of radiographs. The distal fibula should be superimposed by the posterior portion of the distal tibia and the superior articular surface of the talus should be clearly identified.An FPA is the angle between the tangent line to the rear edge of the greater tuberosity of the calcaneal and the line connecting the anterior tubercle and medial tuberosity of the calcaneal a. The noHeneghan\u2013Pavlov PPL is the baseline formed by the line connecting the anterior tubercle and medial tuberosity of the calcaneus and a parallel superior line passing through the superior aspect of the talar articulation b. If PPLHaglund\u2019s deformity height (BA1\u00af) c was obt1\u00af/BC1\u00af) c.This study put forward two novel measurement methods for the diagnosis of Haglund\u2019s deformity, namely bump height and bump-calcaneus ratio. Firstly, the baseline tangent to the anterior tubercle and medial tuberosity of the calcaneus was drawn. The baseline was moved upward parallelly until it touched the superior edge of the calcaneus, which was considered the reference line for bump height different to that in Haglund\u2019s deformity height. Then, the reference line was moved upward parallelly again until it reached the superior edge of the bump and the intersection point was considered as the vertex of the bump (point B). The vertical distance between the vertex of the bump and the reference line was measured as bump height (s (BC2\u00af) d.In order to assess interobserver reliability, two orthopedic surgeons blindly carried out all measurements using the above-mentioned methods. Additionally, the first author and another orthopedic surgeon conducted the same radiographic measurements. In order to evaluate intraobserver reliability, two observers conducted two identical measurements at an interval of seven days. Each measurement was carried out independently by two observers; it was confirmed that the measurements by two observers would not interfere with each other.p < 0.050. The post hoc power of the two new target parameters was calculated using G*Power 3.1.9.7  with the setting of \u03b1 = 0.05.Continuous data including patients\u2019 age are presented as means and standard deviations. The normality of continuous data was checked using the Kolmogorov\u2014Smirnov test. The Mann\u2013Whitney U test was performed to examine intergroup differences in age. Descriptive data, such as patients\u2019 gender and surgical site, are presented as frequencies and percentages. The chi-square analysis and Fisher\u2019s exact test were conducted to compare categorical data between the two groups. The area under the curve (AUC) and optimal cut-off value were calculated from the receiver operating characteristic (ROC) curve. The intraclass correlation coefficient (ICC) and kappa index were used to validate the intraobserver and interobserver reliability of each parameter. All statistical analyses were performed using SPSS version 22.0 . The level of statistical significance was set at A total of 84 patients, including 40 males and 44 females, with an average age of 54 years were enrolled in this study. Total 50 right feet and 34 left feet were studied. Among these 84 patients, 43 patients in the Haglund group had symptomatic Haglund\u2019s deformity and underwent surgery in our hospital, whereas 41 patients in the control group had no posterior heel pain. There was no statistically significant difference in age, gender, and laterality between the control and Haglund groups .p = 0.543). No one in our cohort had an FPA greater than 75\u00b0, previously reported cut-off value of FPA. There were 19 cases (67.44%) in the Haglund group and 29 cases (46.34%) in the control group with positive PPLs; there was no statistically significant difference between the two groups (p = 0.083)  .p = 0.202). There was also no statistically significant difference in Haglund\u2019s height ratio between the Haglund and control groups   .p < 0.001). The bump-calcaneus ratio in the Haglund group was significantly higher than that in the control group   .According to ROC curve analysis , the AUCFurther ROC curve analysis revealed that the optimal cut-off value of bump height was 4 mm. In the Haglund group, 74.42% (32 of 43) patients had a bump height of 4 mm or more; in the control group, 75.61% (31 of 41) patients had a bump height of less than 4 mm. The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) of bump height were 74.4%, 75.6%, 76.2%, and 73.8%, respectively .The optimal cut-off value of bump-calcaneus ratio was 7.5%. In the Haglund group, 83.7% (36 of 43) patients had a bump-calcaneus ratio of greater than 7.5%; in the control group, 70.7% (28 of 41) patients had a bump calcaneus ratio of less than 7.5%. The sensitivity, specificity, PPV, and NPV of bump-calcaneus ratio were 83.7%, 68.3%, 73.5%, and 80.0%, respectively .Bump height and bump-calcaneal ratio showed almost a perfect intraobserver agreement (ICC > 0.9) and substantial interobserver agreement (kappa index > 0.8). However, other radiographic parameters showed poor to fair interobserver agreement .This study put forward two novel and highly reproducible measurement methods for the diagnosis of operatively treated Haglund\u2019s deformity, namely bump height and bump-calcaneus ratio. They are also the first continuous variables measured based on the bump height in Haglund\u2019s deformity. Furthermore, considering the influences of body sizes on calcaneal height, we also proposed using the bump-calcaneus ratio. Our results revealed that previous X-ray measurements including FPA, PPL, Haglund\u2019s deformity height, and Haglund\u2019s height ratio could not effectively diagnose symptomatic Haglund\u2019s deformity, whereas bump height and bump-calcaneus ratio showed statistically significant differences between Haglund and non-Haglund groups. Among all the radiographic parameters measured in this study, bump-calcaneus ratio had the highest AUC and quite high reproducibility and accuracy. The intra and interobserver reliability of bump-calcaneus ratio were also excellent, and the sensitivity, specificity, and accuracy of bump-calcaneus ratio were 83.7%, 68.3%, and 76.2%, respectively. The statistical power of the two new target parameters was calculated and reached 0.99.X-ray measurement methods that are frequently used for the diagnosis of Haglund\u2019s deformity include FPA and PPLs; however, they have poor sensitivity and specificity for the diagnosis of Haglund\u2019s deformity. In 1945, FPA was first put forth by Fowler et al. ,12. In aTo the best of our knowledge, scarce radiographic measurement methods with good sensitivity and specificity have been reported for diagnosing symptomatic Haglund\u2019s deformity. Bulstra et al. proposed the calcaneal pitch angle (CPA), defined as the angle between the ground and plantar surface of the calcaneus, could effectively distinguish the Haglund\u2019s group and control group. However, based on their subgroup analysis, the significant difference of CPA was mainly found between female patients but not males in the two group. The gender-specific radiographic parameter may limit its clinical application . FurtherHaglund\u2019s deformity is characterized by a bony prominence of the posterior-superior aspect of the calcaneus. In 2012, Kang et al. used Haglund\u2019s deformity height to verify the relationship between Haglund\u2019s deformity and insertional Achilles tendinitis . They shTherefore, we measured bump height using the connecting line between the anterior tubercle and medial tuberosity on the inferior margin of the calcaneus instead, which is used as the baseline for both FPA measurement and the Heneghan\u2013Pavlov PPLs test. Next, we took into account the effect of body size on calcaneal height. The bump height was divided by the measured calcaneal height BC2\u00af, in d to yielThe existing measurement methods of Haglund\u2019s deformity mostly focus on the changes in calcaneal shape; among them, only PPL, a categorical variable, is related to the bump. The connecting line between the anterior tubercle and medial tuberosity of the calcaneal, which is a well-known feature used in measuring PPL, was used as the baseline for calculating bump height in this study. Next, the bump-calcaneus ratio was calculated by dividing bump height by calcaneus height. Our newly proposed measurements take into account the characteristics of Haglund\u2019s deformity, including bony prominence of the calcaneus and the difference in calcaneus height as per individual body size.To date, the commonly used measurement methods of Haglund\u2019s deformity cannot determine whether a patient requires operative treatment. All patients in the Haglund group underwent operation after conservative treatment failed. In this study, the new measurement methods based on the lateral view of the ankle revealed that 74.4% of the patients showed symptomatic Haglund\u2019s deformity with a bump height of 4 mm or higher, whereas about 83.7% of the patients showed a bump-calcaneus ratio of 7.5% or larger. At present, the main operative management of Haglund\u2019s deformity is a retrocalcaneal decompression for bump removal or a closing wedge calcaneal osteotomy for changing calcaneus shape ,19,20,21This study has some limitations, including small sample size and retrospective design, which might lead to selection or undetectable bias. In addition, this study was conducted at a single institution and the control group in our cohort consisted of relatively healthy patients. In the future, multi-center prospective controlled studies including completely healthy patients as the control group are required to verify the accuracy of our measurement methods.In this study, we proposed two novel radiographic parameters for the diagnosis of operatively treated Haglund\u2019s deformity, namely bump height and bump-calcaneus ratio. They can both effectively diagnose symptomatic Haglund\u2019s deformity and show good reliability. The cut-off values of bump height and bump-calcaneus ratio are 4 mm and 7.5%, respectively. Our proposed measurements herein may provide clinicians with a guidance for the diagnosis of Haglund\u2019s deformity and for the extent of bump removal during retrocalcaneal decompression."}
+{"text": "Cognitive impairment is frequently reported among anti-phospholipid syndrome (APS) patients as well as anti-phospholipid antibody (aPL) carriers, but it is less studied than other manifestations of this condition. Moreover, the exact prevalence of cognitive impairment in these patients has not been accurately determined, mainly due to inconsistency in the tools used to identify impairment, small sample sizes, and variability in the anti-phospholipid antibodies measured and positivity cutoffs. The notion of a direct pathogenic effect is supported by the observation that the higher the number of aPLs present and the higher the load of the specific antibody, the greater the risk of cognitive impairment. There is some evidence to suggest that besides the thrombotic process, inflammation-related pathways play a role in the pathogenesis of cognitive impairment in APS. The cornerstone treatments of APS are anti-coagulant and anti-thrombotic medications. These treatments have shown some favorable effects in reversing cognitive impairment, but solid evidence for the efficacy and safety of these treatments in the context of cognitive impairment is still lacking. In this article, we review the current knowledge regarding the epidemiology, pathophysiology, clinical associations, and treatment of cognitive impairment associated with APS and aPL positivity. Anti-phospholipid syndrome (APS) is an acquired systemic disorder associated with the presence of anti-phospholipid antibodies (aPLs). The classic aPLs include anti-cardiolipin antibodies (aCL), lupus anticoagulant (LA), and the more recently described anti-\u03b22 glycoprotein I antibodies (a\u03b22GPI) . The priNeurologic involvement in APS is prevalent and responsible for significant morbidity and mortality . APS mayTo date, most studies examining cognitive impairment in aPL carriers and in APS have included a small sample size and varied considerably in terms of cognitive impairment detection methods, the particular aspects of cognition evaluated, and the specific antibody type  and the laboratory cutoffs used to define positivity . This coIn this review, we summarize the available data regarding the possible associations between cognitive decline associated with aPL and APS. We discuss the epidemiology, pathophysiology, clinical manifestations, and recommendations for management, with an emphasis on the European League Against Rheumatism (EULAR)\u2019s recommendations for the treatment of APS. Dementia is characterized by a decline in cognition from the previous level of function that interferes with daily function and independence. It usually involves one or more cognitive domains . Cognitive impairment is a clinical state between normal cognition and dementia . SeveralCognitive impairment is reported in aPL-positive individuals with a frequency that ranges between 19% to 40% ,11. A syA correlation between cognitive impairment and high levels of aPL was similarly reported in primary and secondary APS ,18,19. HAmong primary APS patients, the frequency of cognitive impairment ranges between 42 and 80%, compared to the 7\u201375% range observed in patients with secondary APS ,27,28,29Two recent systematic literature reviews reported that the prevalence of cognitive impairment among aPL carriers, primary APS, and secondary APS, when considered together as a group, ranges between 15 and 42% ,37.In a very recent study by Sevim et al., the APS ACTION registry, which aimed to describe the baseline characteristics of about 800 patients with aPL positivity, cognitive impairment was reported in 85 (11%) patients . In the The pathogenesis of cognitive impairment in APS has not been fully elucidated. Historically, cognitive impairment in APS was mainly attributed to aPL antibody-related microvascular thrombosis resulting from hypercoagulability, with venous and/or arterial thrombosis. The pro-thrombotic effects of aPL through endothelial dysfunction, the activation of platelets, complement, and the coagulation cascade, are well known ,5. AntovTo explain the possible non-thrombotic contribution of aPL to brain injury, investigators assessed animal models. In a murine model of APS, mice developed neurological and behavioral disorders, including hyperactivity, memory impairment, and aggression, without any evidence of thrombosis ,41. FurtThese findings suggest that autoimmune mechanisms may underlie, at least partially, the cognitive impairment observed in patients with aPLs. Thus, cognitive impairment in these patients may actually be a result of the combined effects of hypercoagulability, blood\u2013brain barrier disruption, the activation of pro-inflammatory mechanisms as a result of the direct binding of aPL to brain tissue, and genetic predisposition .A recent study by Rosa et al. examined the association between brain-derived neurotrophic factor (BDNF), a neuroprotective mediator, and cognitive impairment in primary APS, with lower levels of BDNF associated with cognitive impairment in these patients .Cognitive function is a composite of various domains, including perception, motor skills and construction, attention and concentration, memory , executive functioning, processing speed, and language/verbal skills. A variety of tools and questionnaires have been developed to assess different aspects of cognition. Each test was developed and tested in different groups of patients and thus has a specific reliability, validity, sensitivity, specificity, and positive predictive value, which together determine the usefulness of each test and the clinical scenario for which it is best suited . IncorpoMultiple cognitive functions are impaired in aPL carriers . The maiA wide range of cognitive functions are impaired in primary APS . The maiSLE is a systemic disease affecting various tissues, including brain tissue, causing neuropsychiatric symptoms and cognitive impairment ,50. KozoThe main cognitive functions impaired in patients with secondary APS (mainly SLE-associated) are related to executive functions, complex attention, verbal memory and verbal fluency, as well as visuospatial domain . TektoniLong-term anticoagulation with oral warfarin is a cornerstone treatment in APS patients presenting with thrombotic lesions and neurologic manifestations, including cognitive impairment . Hughes The European League Against Rheumatism (EULAR)\u2019s recommendations for the management of anti-phospholipid syndrome in adults recommend the use of low-dose aspirin for primary prevention  in aPL carriers with high-risk aPL profiles , without addressing cognitive impairment specifically . InteresTo date, no clinical studies have directly examined the effect of hydroxychloroquine (HCQ) on cognitive impairment in APS. HCQ is an anchor therapy in SLE, and many studies have shown favorable effects on damage accrual and survival in SLE patients ,60,61,62Ceccarelli et al., in their cohort study, evaluated changes in SLE-related cognitive impairment over 10 years. They found that cognitive impairment improved in the majority of patients, but the use of HCQ, or immunosuppressants, was not associated with a change in cognitive impairment over time . AnotherSome case reports have demonstrated the successful treatment of aPL-associated cognitive dysfunction or neurological manifestations with mycophenolate mofetil and immunoglobulins, but properly designed prospective studies are needed to confirm their efficacy .In summary, while cognitive impairment in APS is less studied than other manifestations of the syndrome, this type of neurologic involvement seems to be relatively common among APS patients, as well as aPL antibody carriers. The exact prevalence is unclear, mainly due to inconsistency in the tools used to identify impairment in these studies. The higher the number of the aPLs and the higher the load of the specific antibody, the greater the risk of cognitive impairment. Some evidence suggests that besides the thrombotic process, inflammatory injury plays a role in the pathogenesis of cognitive impairment in APS. The cornerstone in the treatment of APS is anti-coagulant and anti-thrombotic modalities. These treatments showed some favorable effects in reversing cognitive impairment (when there is another accepted indication for treatment), but solid evidence for the efficacy and safety of these treatments in the context of cognitive impairment is, unfortunately, still lacking.Several questions remain unanswered in the context of cognitive impairment in aPL carries and patients with APS. First, can low aspirin prevent cognitive impairment in aPL carriers? This question may be best answered by comparing patients treated with aspirin with untreated patients by following them prospectively for the occurrence of cognitive decline. Second, are anti-coagulant and anti-thrombotic therapies effective in the management of cognitive impairment in patients with APS? Third, is there a place for immunosuppressive therapy in treating cognitive impairment in patients with APS? Fourth, is there any effect of the cumulative duration of aPL positivity on the severity of cognition defects in APS and aPL-carriers? These are only some, but very challenging, questions that need to be addressed in the coming years."}
+{"text": "Saponaria officinalis extracts were used as both reducing and capping agents in the green nanochemistry synthesis of ZnO. Inorganic zinc oxide nanopowders were successfully prepared by a modified hydrothermal method and plant extract-mediated method. The influence of microwave irradiation was studied in both cases. The size, composition, crystallinity and morphology of inorganic nanoparticles (NPs) were investigated using dynamic light scattering (DLS), powder X-ray diffraction (XRD), SEM-EDX microscopy. Tunings of the nanochemistry reaction conditions , ZnO NPs with various shapes were obtained, from quasi-spherical to flower-like. The optical properties and photocatalytic activity (degradation of methylene blue as model compound) were also investigated. ZnO nanopowders\u2019 antibacterial activity was tested against Gram-positive and Gram-negative bacterial strains to evidence the influence of the vegetal extract-mediated synthesis on the biological activity.In the present work, the properties of ZnO nanoparticles obtained using an eco-friendly synthesis (biomediated methods in microwave irradiation) were studied.  In recent years zinc oxide nanoparticles (ZnO NPs) have gained more interest in the scientific community due to their desirable properties and applications in different areas. Its properties include radiation absorption, thermodynamical stability, high photostability, high electrochemical coupling coefficient, low toxicity, biocompatibility, and biodegradability . These pZinc oxide nanoparticles vary in shapes and sizes due to multiple types of syntheses described in the literature. Certain parameters, such as temperature, pH or reaction time, can greatly impact ZnO NP morphologies. Therefore, selecting an appropriate synthesis procedure is an important factor. Some synthesis methods include hydrolysis in polyol media, chemical precipitation, template method, solvothermal and hydrothermal methods, microwave heating, thermal oxidation processes, sol\u2013gel, biosynthesis, electrochemical deposition, mechanical milling, sonochemical routes and laser ablation . The new2, WO3, ZnO, Nb2O5, and Fe2O3) in various processes of decontamination and disinfection  2\u2212 complexes. When the concentration was above their critical solubility, part of those complex ions turn in ZnO nuclei, while the other part exhibited preferential adsorption on the surface of the nuclei, promoting the growth rate along the c-axis direction and formation of anisotropic hexagonal prism-like particles [In t 140 \u00b0C . The rolarticles .In The presence of synthetic surfactants in the reaction media was the most common way to promote the formation of 3D hierarchical structures, such as flower-like aggregated. Cetyltrimethylammonium bromide (CTABr), due to the amphiphilic chemical structure that allows micellization and surface adsorption, plays an interesting role in the fabrication of various ZnO nanocrystalline products. Depending on the reaction conditions in the presence of CTABr as a structuring agent, other various morphologies of ZnO nanopowders had been reported, from irregular to plates, bipyramids, cabbage-like or stars . The conHigher concentrations of CTABr, such as 0.3 M, resulted in the destruction of aggregated; only plated or rods could be obtained.In the synthesis proposed in the present work, the moderate concentration of CTABr was used, together with the effect of fast and concentrated heating process under microwave irradiation, and the morphology of the ZnO nanoparticles obtained was clearly well-defined 3D hierarchical rose structures. In + and Zn(OH)42\u2212 were responsible for the faster reaction rate, while the formation of micelles and lamellar liquid crystal phased at high concentrations of CTABr promote the oriented attachment of ZnO nuclei and further development of the ZnO nanoplates. The decrease in the surface energy produced the aggregation of the nanoplates in 3D hierarchical structures resembling rose flowers [The proposed mechanism that explains the CTABr role emphasizes that the ion pairs formed due to electrostatic interaction between CTA flowers .S. officinalis extract, with flavonoids, alkaloids, glycosides, phenols, tannins, carbohydrates, etc., could act as reagents in ZnO formation and capping agent in controlling the crystal growth, thus reducing the size of the nanoparticles. One could also expect that saponin surfactants to adsorb on the ZnO nuclei, similar to CTABr behavior, and flower-like 3D aggregates could be obtained.The complex composition of In Saponaria officinalis extract were saponins, steroids, terpenoids, flavonoids, alkaloids, glycosides, phenols, tannins, carbohydrates. The root extract was considered to contained approximately 20% saponins, with various chemical structures, the four representative types being Pentacyclic Oleanane, Ursane and Lupane, as well as Tetracyclic one. All saponins in the S. officinalis were natural surfactants with good surface-active properties, but they do not exhibit the self-assembling properties, do not aggregate in micellar structures, such as synthetic surfactants do [From previously reported studies, the most abundant components of tants do .S. officinalis could not produce the modification of the shape of ZnO nanoparticles in plates. The effect is only as a capping agent since the diameter of rods was reduced, and the size of the 3D aggregate was also decreased compared to flower-like particles formed in the samples without surfactant and with CTABr.Thus, the presence of the surfactants from The plant extract, despite its complex composition with phytochemicals containing many reactive groups, was not able to act as an efficient, reducing agent to produce the formation of a large number of crystalline ZnO nanoparticles. The product obtained in the absence of NaOH, with solely plant extract, under microwave irradiation shows an amorphous mass of agglomerated particles with small size, with irregular shape. Rarely, some star-like aggregated with size in the 1\u20132 \u00b5m range formed by the connection of nanorods could be observed d2.S. officinalis extract due to the presence of residual plant extract that remained trapped into the reaction product.The EDX spectra a3\u2013d3 of The composition of ZnO products obtained in various conditions of reaction was also investigated using XPS. Their spectra are presented in 2\u2212 bonded in the ZnO lattice was assigned for the O1s at 530.5 eV, the OH groups and water molecules adsorbed on the surface were detected at 531.8 eV and 533.1 eV, respectively. A small fraction of organic oxygen was attributed for O1s located at 532.2 eV. For sample ZnO_4, prepared only in the presence of plant extract, the high-resolution spectrum of O1s reveals only two oxygen species attributed to organic oxygen located at 532.2 eV and water molecules adsorbed on the surface were detected at 533 eV. Zinc 2p high-resolution spectra  Zn 2p 3/2 = 1021.5 eV and 1044.3 eV for Zn2p 1/2. Both signals were present in the spectra recorded for samples ZnO_1, ZnO_2, and ZnO_3 synthesized using NaOH as a reducing agent, without capping agent or in the presence of CTABr or plant extract. For the sample ZnO_4, prepared only with S. officinalis extract, the spectrum was very noisy, and no distinct signal could be evidenced due to the very small content of ZnO nanoparticles formed in this sample. Zn LM2 high-resolution spectrum confirmed the presence of Zn2+ oxidation state-specific for ZnO at 498 eV.In the deconvoluted high-resolution spectrum of the O1s singlet a\u2013d, four spectra e\u2013h reveaFurther analysis of the size and surface potential of the ZnO products obtained in various conditions was performed by dynamic light scattering . The resThe ZnO flower-like particles obtained from the Zn nitrate hydrate/NaOH mixture showed an average size of 3D architectures of 1244 nm as measured as intensity mode, with a rather high polydispersity index (PdI) of 0.363, due to the presence of an additional population of large aggregated in the range of 5500 nm.S. officinalis extract possesses the smallest 3D flower-like architectures, with an average diameter of 863 nm and monomodal distribution. The sample was rather monodispersed with a PdI of 0.285. The ZnO_4 sample, prepared only with the plant extract addition, showed the presence of small particles around 40 nm as a major population and another population of higher particles of 244 nm, with a high polydispersity . The small grains tend to form larger aggregated, which corresponded to the aspect of the sample observed in the SEM images.As expected, the presence of the surfactant CTABr acting as a capping and stabilizing agent reduced the dimension of the ZnO flower-like structures. The average value of the size was 1068 nm, and the sample exhibit a monomodal distribution and high monodispersity . The ZnO nanopowder ZnO_3 prepared in the presence of NaOH and Nitrogen adsorption\u2212desorption measurements were performed to investigate the textural properties of ZnO particles by estimating the surface area and total pore volume after sample calcination at 600 \u00b0C, according to the procedure described above. The resulted for the samples ZnO_1 prepared in an alkaline media without capping agent, ZnO_2 with CTABr and ZnO_3 with plant extract as capping agents are summarized in 2/g and 3.257 m2/g with 0.0116 cm3/g and 0.0094 cm3/g total pore volume. The obtained results indicate the presence of very few pores, probably formed by sintering of the inorganic ZnO network during the calcination process. A small number of slit-like pores could form in this way. The difference in the BET surface was mainly due to the sizes of ZnO crystallites and of the flower-like architectures. However, for sample ZnO_2 (with a rose-like morphology) was recorded a higher specific surface area (8355 m2/g) compared to samples ZnO_1 and ZnO_2, but a smaller value for total pore volume, 0.0036 cm3/g, respectively. The different sizes and morphology of the ZnO nanosheets that form the rose-like aggregated were responsible for the modification of textural properties.For the analyzed samples, all textural parameters were much lower than those usually recorded for mesoporous samples. Thus, the BET surface area of ZnO_1 and ZnO_3 samples, both with chrysanthemum-like morphology of 3D aggregated, was determined to be 2.292 mAlthough the specific surfaces of the studied ZnO particles were high at the macro-level (see SEM images), both samples show very low surface areas, which could be generated by the presence of mesopores. Considering the crystalline nature of the ZnO flower-like consisting of hexagonal prism nanorods, the measured values of BET-specific surfaces and total pore volumes were in the expected range.In The photoluminescence of the synthesized ZnO NPs was measured at room temperature, and the spectra are shown in No distinct signals were present in the visible region 500\u2013600 nm, usually emission related to surface defects. However, the spectra were very broad due to the transition between the single-charged oxygen vacancies .The photocatalytic activity of the phytosynthesized ZnO was evaluated by the degradation of methylene blue (MB) as a model organic pollutant under visible light. For irradiation, a 250 W medium-pressure Hg irradiation lamp was used, with emission in the 404.5\u2013407.8, 435.8, 546.1 and 570\u2013577 nm range. For the photodegradation, 1.5 mg ZnO was added into a beaker containing 15 mL of MB dye solution (5 mg/L). MB solution with the appropriate amount of catalyst was stirred for 30 min in the dark to achieve the adsorption equilibrium of MB onto the semiconductor surface. Degradation of MB was monitored by a recording of Vis spectra at several irradiation times. MB displays blue color in water and absorbs in the visible region at 612 and 664 nm. t).The degradation efficiency was calculated from Equation (9) described in As compared with the reference, where the degradation efficiency is 75%, all other samples showed a lower activity as photocatalysts .When exposed to visible light, ZnO_1 samples exhibited the highest activity among the synthesized samples. About 42% of MB was degraded after 40 min irradiation by ZnO_1. The other samples showed to be less active, with degradation degrees of 33% for ZnO_2, 21% for ZnO_3 and only 15% for ZnO_4. The value obtained for ZnO_4 was slightly greater than those obtained for simple photolysis of MB, 13%.A = f(t), the pseudo-first-order constants were estimated from the linear regression of the equation:Since it was reported that the photocatalytic degradation of MB by ZnO nanoparticles follows a pseudo-first-order kinetic, from the kinetic curves The results are presented in For all ZnO samples, the reaction followed apparent first-order kinetics. The values of pseudo-first-order rate constants decrease in the following order: ZnO_1, ZnO_2, ZnO_3 and ZnO_4.appk experimentally determined from Equation (10) described in The half-life time of the reaction was one of the most useful parameters to evaluate the behavior of catalysts; the half-life time could be calculated from the pseudo-first-order constant \u22121 and t1/2 = 20 min). The values of rate constants and corresponding half-life times for ZnO samples are presented in The rate constants were smaller for all catalysts as compared with the reference ZnO  compared with the other synthesized ZnOs. Samples ZnO_2 and ZnO_3 were less active, while sample ZnO_4 shows no catalytic efficiency on MB photodegradation, the rate constant being equal to the one obtained for simple photolysis of MB. For the sample ZnO_4, prepared only with S. officinalis extract as a capping agent could be used as catalysts for MB degradation under visible light, with lower efficiency than the nanoparticles capped with the synthetic surfactant, but with better biocompatibility and low toxicity for the environment.However, these data show that samples ZnO_3 obtained from green synthesis with E. coli ATCC 25922 and P. aeruginosa ATCC 27853 strains, compared with Gram-positive bacteria represented by S. aureus ATCC 25923 strain and yeast strain C. albicans ATCC 10231 , , . S. offiE. coli ATCC 25922, the MIC values were in the range of 1.25 \u00b5g/mL and 10 \u00b5g/mL, with the lowest value for ZnO_1 sample (1.25 \u00b5g/mL), while P. aeruginosa ATCC 27853 strain expressed MIC values between 0.625 \u00b5g/mL and 5 \u00b5g/mL, with the lowest value for ZnO_4 nanopowder (0.625 \u00b5g/mL).For S. aureus ATCC 25923, the MIC values were in the range of 1.25 \u00b5g/mL and 20 \u00b5g/mL, and for C. albicans ATCC 10230, the MIC values were between 2.5 \u00b5g/mL and 20 \u00b5g/mL. For both strains, the most active sample was the ZnO_1 containing chrysanthemum nanoflowers without a capping agent, expressing the lowest MIC value. The sample ZnO_2 prepared with CTABr as a capping and structuring agent had the highest MIC values, 10 \u00b5g/mL for E. coli, 5 \u00b5g/mL for P. aeruginosa and 20 \u00b5g/mL for S. aureus and C. albicans, respectively. Thus, at a similar size, the rose aspect of the flower-like aggregate proved to be less effective in the inhibition of the microbial growth, despite the presence of some traces of CTABr adsorbed on the ZnO nanoparticle surface.For S. officinalis extract was intermediate between the performances of nude ZnO chrysanthemum nanoflowers, and the ones of CTABr capped nanoflowers. The MIC values were 5 \u00b5g/mL for E. coli and for P. aeruginosa and 10 \u00b5g/mL for S. aureus and C. albicans, respectively.The antimicrobial efficiency of the ZnO_3 sample containing nanoflowers prepared with S. officinalis extract act reagent was due mainly to the presence of the solid particles of extract and could not be related to the ZnO nanoparticles in the sample.The MIC values recorded from the product obtained using only 3)2\u00b76H2O) (purity 98%), sodium hydroxide (NaOH) , and cetyltrimethylammonium bromide (CTABr)  were all Aldrich reagents purchased from Sigma-Aldrich  and used as received, without any additional purification. Ethanol 96% was purchased from ChimReactiv SRL . Bidistilled water was produced using a laboratory ultrapure water purification system .Zinc nitrate-6-hydrate . Shredded roots of Saponaria officinalis L. underwent extraction in a Soxhlet apparatus for 1 h at 80 \u00b0C using 10 mL of solvent (ethanol\u2013water in the mass ratio 1:1) per gram of vegetal material. The plant extract obtained was further filtered through a syringe filter Minisart\u00ae 0.8 \u00b5m  and stored in brown glass vials at refrigerator until was used in experiments, no more than a week.The extraction procedure from the roots of the bstances . Saponar3)2\u00b76H2O) and different co-reactants through 5 different procedures. For the synthesis of sample ZnO_1, 1.2 g of Zn(NO3)2\u00b76H2O were dissolved in 32 mL of deionized water (S1) under vigorous stirring. Then, a solution of 1.6 g of sodium hydroxide (NaOH) dissolved in 16 mL of deionized water was added (S2). The mixture was stirred for 5 min at room temperature until a milky aspect was obtained. Subsequently, the suspension was added to the microwave reactor Monowave 200 . The conditions for preparing sample ZnO_2 were the same as for specimen ZnO_1, except that a solution, which consisted of 2.4 g of cetyltrimethylammonium bromide (CTABr) dissolved into 32 mL of deionized water (S3) was added over the first two solutions (S1 + S2). For the synthesis of ZnO ZnO_3, 16 mL of alcoholic extract of Saponaria Officinalis and 16 mL of deionized water were added over S1 + S2. Sample ZnO_4 was prepared by adding 16 mL of alcoholic extract of Saponaria officinalis and 16 mL of deionized water over S1. Each of the obtained mixtures was transferred into a microwave vial, rapidly heated at 150 \u00b0C and maintained at this temperature for 5 min without any stirring. After cooling, the obtained ZnO nanostructures were washed with deionized water several times and dried at 90 \u00b0C for 2 h to form powder products.Zinc oxide nanoflowers were fabricated via microwave heating from an aqueous solution of zinc nitrate-6-hydrate  with an X\u2019Pert Pro MPD diffractometer from Panalytical using Cu K\u03b1 radiation (\u03bb = 1.5406 \u00c5) set to work in Bragg\u2013Brentano geometry with 2\u03b8 = (20\u201380)\u00b0, a speed of 2 sec/step and 0.02\u00b0 step, whereas in the extract analysis 2\u03b8 = (0\u201380)\u00b0. Diffuse reflectance electronic spectra were recorded at room temperature with a Jasco UV-vis-NIR V670 spectrometer  in the 200\u20131500 nm range, using Spectralon as reference.Photoluminescence spectra were recorded on the dry samples, on a modular device with OceanInsight XDH spectrometer coupled to a LED source with 365 nm emission and optical fiber in reflection mode .Dynamic light scattering (DLS) and laser Doppler velocimetry (LDV) techniques were used to determine the average particle size, particle size distribution and, respectively, Zeta potential . Before measurements, the samples were dispersed in distilled water, using a concentration of 1 mg/5 mL and then ultrasonicated for ~3 min in an ultrasonic bath.ZnO particle\u2019s morphology was investigated through scanning electron microscopy (SEM) images , without covering the samples and using a large field detector (LFD), high vacuum (HV) working mode and 30 kV accelerating voltage. The specimens for SEM investigations were cast on aluminum stubs, using the same aqueous dispersions that were prepared for the DLS and LDV measurements (1 mg/5 mL). For analyzing the elemental composition and structure of the synthesized ZnO samples, an energy-dispersive X-ray microanalysis system (EDX)  was used.The nitrogen adsorption\u2013desorption isotherms were recorded at 196 \u00b0C, using a NOVA 2200e automated gas sorption instrument . Prior to measurements, samples were calcinated using the following heating program: 10 min from 30 \u00b0C to 100 \u00b0C; 30 min at 100 \u00b0C; 30 min from 100 \u00b0C to 250 \u00b0C; 30 min at 250 \u00b0C; 1 h from 250 \u00b0C to 500 \u00b0C; 2 h at 500 \u00b0C; 30 min from 500 \u00b0C to 650 \u00b0C; 1 h at 650 \u00b0C; cooling to room temperature and then were degassed under vacuum at 300 \u00b0C for ~16 h. The Brunauer\u2013Emmett\u2013Teller-specific surface areas of samples were calculated from adsorption data at a relative pressure range of 0.08\u20130.3. The total pore volumes were evaluated from the adsorbed amount of nitrogen at a relative pressure of 0.986.The chemical composition of the samples was determined by XPS. All measurements were performed with ESCALAB Xi+  equipped with a multichannel hemispherical electron analyzer  working with Al K\u03b1 radiation (h\u03bd = 1486.2 eV).\u22128 Torr to remove the chemisorbed water from their surfaces. The surface chemical compositions and oxidation states were estimated from the XPS spectra by calculating the integral of each peak after subtraction of the \u201cS-shaped\u201d Shirley-type background using the appropriate experimental sensitivity factors using Avantage software (version 5.978).As energy reference was used C 1 s, which has 284.8 eV. XPS data were recorded on slightly pressed power materials that had been outgassed in the pre-chamber of the setup at room temperature at a pressure of <2 \u00d7 10The XPS spectrum was analyzed using the NIST X-ray photoelectron spectroscopy database.The photocatalytic activity of the ZnO nanoparticles was tested by the photodegradation of methylene blue (MB) in an aqueous solution under visible light radiation. For irradiation, a 250 W medium-pressure Hg irradiation lamp was used, with emission in the 404.5\u2013407.8, 435.8, 546.1 and 570\u2013577 nm range.The experimental design was optimized using commercially available ZnO spherical nanoparticles, according to a procedure developed in our laboratory. MB stock solution (200 ppm) was prepared in bidistilled water. For investigation of the initial catalyst loading on the degradation, the concentration of MB in the reactor was 4 ppm and the catalyst in the range 0\u2013300 ppm, while for investigation of initial dye concentration on the degradation, the concentration of MB was ranging between 1.7 and 5.3 ppm with a constant catalyst concentration of 100 ppm.MB solution with the appropriate amount of catalyst was stirred for 30 min in the dark to achieve the adsorption equilibrium of MB onto the semiconductor surface. The photocatalytic activity of ZnO particles for the degradation of MB was examined using Vis spectroscopy. MB displays blue color in water and absorbs in the visible region at 612 and 664 nm.t).The degradation efficiency was calculated as:appk experimentally determined as follows:The half-life time of the reaction is one of the most useful parameters to evaluate the reaction rate for first-order kinetics; the half-life time can be calculated from the pseudo-first-order constant The half-life times showed a significant decrease from almost 300 min (5 h) in the absence of ZnO to 4 min in the presence of 300 ppm ZnO. In the case of MB variation, the half-life times decrease from 27 min to 11 min when the initial concentration of MB increases from 1.7 ppm to 5.3 ppm.For the optimum conditions obtained for ZnO, the synthesized nanoparticles were tested as photocatalysts for MB degradation. The initial concentration of dye was 4 ppm MB, and the loading of catalyst was 100 ppm. The solutions were irradiated for a minimum of 40 min until the absorbance of MB decreased up to 75%.Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Pseudomonas aeruginosa 5399 clinical strain, Escherichia coli ATCC 25922 and Candida albicans ATCC 10231. To perform the experiment, two successive passages were made on an appropriate nutrient-agar medium, followed by incubation at 37 \u00b0C, for 24 h. All the microbial strains are included in the microbial collection of the University of Bucharest, Faculty of Biology, Microbiology Department.For the antimicrobial assays, the following standard microbial strains were used: 8 CFU/mL, using the 0.5 McFarland standard. Petri dishes with Mueller\u2013Hinton agar (MHA), respectively Sabouraud agar (SDA), were seeded with microbial inocula. An amount of 10 \u00b5L solution of each sample was spotted on the sterile paper disc with 6 mm diameters, previously arranged on the medium surface. The plates were left at room temperature to ensure the equal diffusion of the compound in the medium and then incubated at 37 \u00b0C for 24 h. The antimicrobial activity was evaluated by measuring the diameters of the inhibition zones.The qualitative screening of the antimicrobial properties was performed by an adapted spot diffusion method, according to Clinical Laboratory Standard Institute  standards, to evaluate the inhibitory efficiency of tested compounds. The microbial inocula were prepared from 18 h cultures and adjusted to a density of 1.5 \u00d7 107 CFU/mL were added to each well. The MIC values were spectrophotometrically established (absorbance reading at 600 nm using BioTek Synergy -HTX ELISA multimode reader). Each experiment was performed in triplicate and repeated on at least three separate occasions.For MIC (minimum inhibitory concentration) testing, a broth microdilution method for the prepared working solutions was performed, according to with CLSI procedure. Binary dilutions of each tested compound were performed in broth medium, starting with 20 \u00b5g/mL concentration calculated for ZnO NPs, in a range between 20 \u00b5g/mL and 0.0390625 \u00b5g/mL. Further, 15 \u03bcL of microbial suspension adjusted to 1.5 \u00d7 10For biological tests, significant differences between the means of triplicate experiments and the control were determined by using one-way ANOVA statistical analysis. All data are presented as mean values \u00b1 the standard deviations (SD).Saponaria officinalis extract compared to CTABr as structuring, and capping agents were also investigated. The plant extract could serve as a capping and structuring agent but is not efficient in transforming zinc precursor in ZnO nanoparticles at an acceptable rate without further thermal processing. The ZnO nanopowders were obtained as 3D hierarchical architectures with morphologies like a chrysanthemum or rose aspect. The crystallinity, composition and size of the nanoparticles were investigated by XRD, UV-vis and DLS. The photocatalytic effect of as-synthesized flower-like ZnO nanoparticles was evaluated from the MB degradation under UV irradiation. The ZnO nanopowders exhibit good degradation activities in an aqueous solution of MB, according to their size and morphology. The highest photocatalytic performance after 40 min of exposure to light (42%) was exhibited by ZnO nanoflowers synthesized without capping agent, while the addition of CTABr or S. officinalis extracts results in a decrease of degradation efficiency to 33% and 21%, respectively.A simple microwave-assisted hydrothermal synthesis of ZnO nanopowders was studied to investigate the possibility of designing a green alternative to solvothermal or hydrothermal long-term, energy-consuming autoclave methods. The influence of the phytochemicals from E. coli, P. aeruginosa, S. aureus and C. albicans. The minimum inhibitory concentrations of ZnO nanoflowers with plant extract were found in the range 10\u201320 \u00b5g/mL, larger than the values for the ZnO flowers without capping agents, but smaller compared to the ones of CTABr capped ZnO nanoparticles, respectively.Antibacterial activity was tested against commonly used strains S. officinalis extract as a capping agent is proposed as a low-cost, time and energy-efficient, environmentally friendly approach. The ZnO nanoflowers\u2019 antibacterial and photocatalytic activities suggest that they can be used as industrial processes of dye removal and as an affordable non-toxic product in other applications based on antibacterial activity.In summary, a novel microwave-assisted green synthesis method using"}
+{"text": "This pilot study included thirty-seven male college students with obesity aged 18\u201322 years : n = 18; control group (CG): n = 19). The EG conducted 40% VO2max cycling combined with BFRT activities and the CG conducted 40% VO2max cycling without BFRT two times per week for 12 weeks. Our results showed that in EG, there were significant differences in weight, thigh skinfold thickness (TS), waist circumference, abdominal skinfold thickness, fat mass, body fat percentage, body mass index and glucose (GLU), total cholesterol (TC), triglyceride, low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels before and after the experiment . After the experiment, TS, GLU, TC, HDL-C, and LDL-C in EG were significantly different than those of the CG . Together, our results demonstrate that cycling at 40% VO2max combined with BFRT may improve body composition and blood lipid profile of male college students with obesity. Our findings have important implications for those who cannot perform moderate- and high-intensity exercises.Blood flow restriction training (BFRT) is a new method for promoting muscle growth and improving muscle function, even with relatively low-intensity exercise. BFRT on patients with obesity has not been extensively studied. This study aimed to analyze the effects of cycling at 40% of maximum oxygen uptake (VO Blood flow restriction training (BFRT) is a complementary exercise that is based on using a specific compression device combined with general exercise. It induces muscle ischemia in the distal limbs through pressure and is a new method for promoting muscle growth and improving muscle function, even with relatively low-intensity exercise . This meThe research conducted by Abe 2006  , SakurabPrevious studies have shown that BFRT can activate the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway in the muscles of male individuals and stimulate protein synthesis . Using mThe main mechanism underlying BFRT may be an increase in metabolic stress, including hormone secretion, regulation, and the inhibition of protein synthesis, muscle fiber mobilization, and cell swelling. In those unable to perform high-intensity strength training, BFRT is a good alternative for strength development . More leLow-intensity training with BFRT can stimulate muscle growth and improve muscle mass. Moreover, BFRT is not limited to a single training modality but can be performed combined with aerobic cycling or walking ,22. Due Although BFRT has attracted attention worldwide, it was mainly studied and used among people without training experience, undergoing recovery, or high-level athletes. The effects of BFRT on patients with obesity have not been extensively studied. Thus, due to its characteristics of low intensity, high efficiency, simplicity, and low risk of injury, we hypothesized that BFRT is suitable for people with obesity who cannot perform high-intensity exercise. Low-intensity BFRT should positively affect fat loss, body composition, and exercise ability in people with obesity. Therefore, we investigated the influence of low-intensity BFRT on muscle and fat in people with obesity by studying patients with obesity undergoing low-intensity BFRT as an intervention.2  \u00d7 Time [pre vs. post]) to evaluate training effects for all dependent variables. A paired-sample t-test was conducted to analyze data before and after the intervention in both groups. Additionally, a t-test was used to analyze changes in the EG and CG before and after the intervention. All p > 0.05); judging by whether the studentized residual exceeds \u00b13 times the standard deviation, each group of data had no outliers. After Mauchly\u2019s test of sphericity, for the interaction term group \u00d7 time, the variance and covariance matrices of the dependent variables were equal (p > 0.05).Two-way repeated measurement analysis of variance method was used to judge the influence of different interventions on various physical indicators of the subjects over time. Through the analysis of studentized residuals and the Shapiro-Wilk test, each group of data obeys a normal distribution (p < 0.05) . In the CG, there were no significant differences in all indicators before and after the intervention  . In the rvention .p < 0.05). HDL-C increased significantly compared with the CG group (p < 0.05) . In the CG, there was also a significant difference in GLU, TC, and LDL-C levels before and after the intervention (p < 0.05)  . In the  < 0.05) .2max combined with BFRT could significantly reduce FM, % BF, BMI, and subcutaneous fat thickness in people with obesity, as well as optimize their body composition.According to the results of this study, TS, WC, AS, FM, % BF, and BMI changed significantly in the EG after the intervention compared to those before the intervention, and no change was seen among the CG. The results of this study are consistent with the results of similar studies. For example, a study by Fei  on healt2max on college students for 12 weeks. The % BF and BMI of male college students with low VO2max significantly decreased. This confirmed that cycling exercise at 40% VO2max combined with BFRT is a better choice for people with obesity (due to lower intensity) compared with aerobic exercise at approximately 55\u201385% VO2max without blood flow restriction (BFR).Zhouming  conducteConventionally, it is understood that aerobic exercise does not cause muscle hypertrophy  and evenHuman experiments have shown that cell swelling caused by BFRT not only inhibits protein catabolism but also has a positive effect on protein synthesis through protein-sparing; it also promotes lipolysis .Although there is extensive evidence that BFRT can promote muscle strength and hypertrophy, it is unclear whether cell swelling is caused by stress or the combination of the interaction of stress and low-intensity exercise. Moreover, the similarities and differences between the effects of low-intensity blood flow restriction resistance exercise and BFR aerobic exercise on the human body are also unclear. Furthermore, whether fat loss caused by low-intensity BFRT is mainly due to the protein-saving effect and promotion of fat lipolysis or excessive energy consumption due to BFR has not been fully elucidated.However, in this study, TS, WC, AS, FM, % BF, and BMI tended to significantly decrease in the EG, suggesting that BFRT can promote lipolysis.p < 0.05 and p < 0.001, respectively). After 12 weeks, there were significant differences in GLU, TC, HDL-C, and LDL-C levels in the EG compared with the levels in the CG . The effects of BFRT on TC, TG, HDL-C, LDL-C, and blood GLU levels have not been systematically reported. According to a study by Wei et al. [In this intervention, GLU, TC, TG, HDL-C, and LDL-C in the EG, showed significant differences before and after the intervention (i et al. , low-int2max intensity combined with BFRT had characteristics of aerobic exercise and a greater effect on blood lipids than cycling exercise at 40% VO2max unrestricted blood flow.According to the Resistance Exercise Training guidelines provided by the American Heart Association in 2011, Williams et al.  evaluate2max intensity combined with BFRT was used. The differences between the results of the aforementioned study and ours may be due to differences in exercise mode and intensity. In the BFRT study, there are few studies that discuss HDL-C, but all studies focusing on the effect of exercise on HDL-C seem to consistently indicate that there was an increase in HDL-C mor, no matter in humans or rats [The blood flow restriction test of Fei  used a 2 or rats . What is or rats  and stre or rats  are help or rats  found th2max intensity leads to a higher proportion of adipose tissue oxidation for energy than that at 65% VO2max intensity [2max intensity combined with BFRT, there were significant differences in all instances before and after the intervention, both in intra- and inter-group comparisons. Results have shown that cycling exercise at 40% VO2max combined with BFRT could effectively promote the lipolysis and energy consumption for obese people to participate in exercises. Simultaneously, compared with cycling exercises at 40% VO2max combined without BFRT, BFRT can promote the oxidative energy supply of adipose tissue. Combined with BMI, WT, % BF, TC, TG, and other indexes, BFRT can improve body composition and lipid metabolism and promote overall fitness by reducing fat and controlling body weight in patients with obesity.Studies have shown that cycling exercise at 40% VOntensity . HoweverRegarding the mechanism underlying the improvement of energy metabolism by BFRT, it is necessary to increase the determination of LPL and related metabolic factors, such as mitochondria, to further understand this mechanism.The participants in this research were young people. It cannot be guaranteed that the results of this experiment are equally effective for the elderly with obesity. Although studies have shown that BFRT combined with resistance exercise can effectively reduce blood pressure in the elderly , BFRT coLow-intensity aerobic exercise combined with BFRT can optimize the body composition of obese patients. Therefore, for the purpose of reducing fat, controlling weight, and improving muscle mass, it is recommended to use aerobic exercise combined with BFRT as an auxiliary exercise in the fitness process. Because BFRT can promote muscle hypertrophy, it can also be used as an auxiliary method in the stage of improving strength. In addition, because BFRT requires less intensity, it is a good choice for people who have little strength and cannot perform moderate and high-intensity exercises. BFRT can have a positive effect on the serum biomarkers of obesity, and the requirement for exercise intensity is very low. Therefore, those who have high blood lipid levels and lack exercise time can use BFRT appropriately in their daily life and work.2max combined with BFRT can improve the body composition and lipid metabolism of patients with obesity, promote overall fitness, reduce body fat, and control weight. It is important for those who cannot perform moderate- and high-intensity exercise to improve their health and exercise ability.Cycling exercise at 40% VO"}
+{"text": "In the validation phase, 58 patients with cardiovascular risk factors who were not previously prescribed aspirin were recruited. In this group, ex-vivo addition of 2.5 mg dosage equivalent of rivaroxaban significantly reduced arachidonic acid-induced platelet aggregation in the presence of aspirin. These results demonstrate the potential for low-dose rivaroxaban to overcome aspirin non-sensitivity in patients with PAD. Further studies are needed to evaluate and confirm these findings.Approximately 20% of vascular patients treated with acetyl salicylic acid  demonstrate less than expected platelet inhibition \u2013 putting them at a four-fold increased risk of adverse cardiovascular events. Low-dose rivaroxaban (2.5 mg twice daily) in combination with low-dose aspirin has been shown to reduce adverse cardiovascular and limb events when compared to aspirin alone. In this study, light transmission aggregometry was used to measure arachidonic acid-induced platelet aggregation to evaluate the potential of combining low-dose rivaroxaban and aspirin in attenuating or overcoming aspirin non-sensitivity. In the discovery phase, 83 patients with peripheral arterial disease (PAD) taking 81 mg aspirin daily were recruited from the outpatient vascular surgery clinic at St Michael's Hospital between January to September 2021. 19 (23%) were determined to be non-sensitive to aspirin. After  Aspirin non-sensitivity affects 1 in 4 patients with cardiovascular disease , 6. AspiRivaroxaban is effective for the prevention and treatment of venous thromboembolism, prevention of stroke in atrial fibrillation, and the prevention of atherothrombotic events in patients with coronary artery disease (CAD) or peripheral arterial disease (PAD) , 10. In ex vivo in patients with PAD.In this pilot study, we explored the potential for low-dose rivaroxaban to overcome aspirin non-sensitivity This study was performed in accordance with the Declaration of Helsinki and was approved by the Unity Health Toronto Research Ethics Board at St. Michael's Hospital, Toronto, Canada . All patients provided written informed consent before participating in this study.In the discovery phase, consecutive patients with PAD on 81 mg aspirin daily presenting to ambulatory vascular surgery clinics at St. Michael's Hospital between January to September 2021 were recruited. Patients' past medical history and clinical characteristics were recorded. Diagnosis of PAD was established clinically  or through utilizing the ankle brachial index (ABI) <0.9. Patients were deemed ineligible if they met one or more of the following criteria: patients taking any antithrombotic medication other than 81 mg aspirin daily; patients with history of bleeding disorders, gastrointestinal bleeding, thrombocytopenia, anemia, or leukopenia; patients who were pregnant, or patients under the age of 18.2 were considered to have renal disease  analysis was conducted as per previous protocols , 13. In gous PPP , 14. LTAgous PPP .Sensitivity to aspirin after incubation with 2.5 mg rivaroxaban was determined using LTA. Non-sensitive patients' autologous PRP samples were spiked with a final concentration of 50 ug/mL of rivaroxaban, which equates to maximum plasma concentration (cmax) after ingestion of 2.5 mg rivaroxaban as previously described by Mueck et al.  and KreuFor the validation phase, we assessed the effects of 2.5 mg rivaroxaban alone on platelet function. A new patient cohort with cardiovascular risk factors not taking aspirin was recruited. Patients were deemed ineligible if they met one or more of the following criteria: patients taking any antiplatelet drug or anticoagulant medication; patients with history of bleeding disorders, gastrointestinal bleeding, thrombocytopenia, anemia, or leukopenia; patients who were pregnant, or patients under the age of 18.Next, PRP was collected and arachidonic acid-induced platelet aggregation was measured in 4 different samples: (1) PRP; (2) PRP spiked with 2.5 \u03bcL of a rivaroxaban solution to give a final concentration of 50 ug/mL  rivaroxaban 3) PRP spiked with 2.5 \u03bcL of an aspirin solution to give a final concentration of 10 \u03bcM  aspirin; and 4) PRP spiked with both 2.5 mg equivalent rivaroxaban, and 81 mg equivalent aspirin refer to . After sAll clinical characteristics and demographics were presented as frequency and percentages, or mean and standard deviations. Normality was assessed using normality plots and the Shapiro\u2013Wilk test. Normally distributed continuous variables were presented as mean and standard deviation. Non-normally distributed data were presented as median and interquartile range (IQR). Categorical variables were presented as count and percent. The non-parametric Wilcoxon rank sum test was used to compare baseline aggregation with aggregations spike with aspirin and/or rivaroxaban. All hypothesis testing was carried out at the 5% (2-sided) significance level. Statistical analyses were conducted using GraphPad Prism, version 8.4.2.In the discovery phase, 83 patients with PAD prescribed 81 mg aspirin daily were recruited. As shown in Of the 83 patients, 19 patients (23%) had a maximal platelet aggregation \u226520% in response to arachidonic acid, despite taking 81 mg aspirin with a mean maximal platelet aggregation of 42 . These 19 patients were considered aspirin non-sensitive. Non-sensitive patients were more likely to be taking an angiotensin converting enzyme inhibitor/angiotensin II receptor blocker (ACEi/ARB) when compared to sensitive patients. There was no significant difference in any of the other characteristics measured .In this experiment, a fresh sample of PRP from the 19 patients non-sensitive to 81 mg aspirin was spiked with low-dose 2.5 mg rivaroxaban dosage equivalent . In the To further investigate the potential of rivaroxaban overcoming aspirin non-sensitivity, an independent cohort of 58 consecutive patients with vascular risk factors not taking aspirin or any other antiplatelet/anticoagulant drug were recruited in the validation phase. Mean age of this group was 56 years, 62% of patients were male, 60% were smokers, 43% having hypertension, 28% having hypercholesterolemia, and 12% having diabetes mellitus .To determine if rivaroxaban has combined effects with aspirin, platelet aggregation in response to arachidonic acid was tested in 4 different PRP samples. First, PRP from patients not taking any antiplatelet or anticoagulant was compared with PRP spiked with 2.5 mg equivalent rivaroxaban. Secondly, PRP was spiked with 81 mg aspirin dosage equivalent, and compared to PRP spiked with both aspirin and rivaroxaban. Compared to non-spiked, control PRP, rivaroxaban alone did not demonstrate a significant reduction in platelet aggregation in response to arachidonic acid . When PREx-vivo addition of low-dose 2.5 mg rivaroxaban dosage equivalent successfully overcame aspirin non-sensitivity in 58% of the initial \u201caspirin non-sensitive\u201d PAD patients. In the validation phase, rivaroxaban was able to significantly reduce platelet aggregation in combination with aspirin. We observed reduction of platelet aggregation in the presence of rivaroxaban alone, but this reduction was not statistically significant.In the discovery phase, we report that approximately 23% of patients with PAD were non-sensitive to their 81 mg aspirin. Large randomized trials have demonstrated that the combination of rivaroxaban (2.5 mg twice daily) and low-dose aspirin (81 mg once daily) compared with aspirin alone reduces major adverse cardiovascular events in patients with coronary artery disease (CAD) or PAD , 22, 23.Our data allude to combined effects between aspirin and rivaroxaban on platelet aggregation, however several studies have shown other platelet activation pathways that may be influenced by rivaroxaban. For example, Perzborn et al. reported that rivaroxaban inhibited tissue factor (TF)-induced platelet aggregation . Subsequex-vivo settings. In-vivo analysis of the reduction of platelet activity, and reversal of aspirin non-sensitivity are needed to confirm ex vivo findings, as well as to determine if this is linked to a reduction in adverse events in aspirin non-sensitive patients. Lastly, patients were questioned on compliance to daily aspirin therapy, however no testing was conducted to ensure compliance. This may lead to an increase percentage of non-sensitive patients who are actually non-compliant.This pilot study has some limitations. First, a small sample size was utilized in this study. Further research with larger samples sizes is warranted to confirm our findings. Second, our experiments were limited to ex-vivo and overcome aspirin non-sensitivity in 58% of patients previously non-sensitive to aspirin. The addition of 2.5 mg rivaroxaban twice daily, in addition to 81 mg aspirin daily, may help to reduce the increased risk of cardiovascular events in patients non-sensitive to aspirin and further large studies are needed to confirm our findings in a clinical setting.In conclusion, we were able to demonstrate that low-dose, 2.5 mg equivalent rivaroxaban was able to significantly reduce arachidonic acid-induced platelet aggregation in the presence of aspirin The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Unity Health Toronto Research Ethics Board at St. Michael's Hospital, Toronto, Canada. The patients/participants provided their written informed consent to participate in this study.MQ and HK performed study concept and design. HK, MP, SJ, ND, MS, MR, JE, CM, MA-O, RA, and MQ performed development of methodology and writing, review, revision of the paper, provided acquisition, analysis and interpretation of data, and statistical analysis. MQ provided technical and material support. All authors read and approved the final paper.This research was fully funded by the Blair Foundation.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Die Strahlentherapie (RT) bietet Patienten mit lokalisiertem Prostatakarzinom aller Risikostadien (PCa) eine effektive und sichere kurative Behandlungsoption. Da eine homogene Erh\u00f6hung der Strahlendosis durch die Belastung der umgebenden Risikoorgane (\u201eorgans at risk\u201c [OAR]) limitiert ist, bietet die fokale Dosiseskalation (FDE) auf die intraprostatische Tumormasse (GTV) eine interessante M\u00f6glichkeit, die lokale Tumorkontrolle zu erh\u00f6hen und gleichzeitig die Dosisvorgaben f\u00fcr die OAR zu respektieren. Studien, die einen Vergleich zwischen pathologischen Gro\u00dffl\u00e4chenschnitten und Schnittbildgebung durchf\u00fchrten, haben gezeigt, dass die multiparametrische Magnetresonanztomographie (mpMRT) in der Lage ist, PCa-L\u00e4sionen mit ausreichender Sensitivit\u00e4t und Spezifit\u00e4t darzustellen, und somit eine Voraussetzung der GTV-Definition zur fokalen Dosiseskalation bietet.Die Studie Focal Lesion Ablative Microboost in Prostate Cancer (FLAME) hat dieses Konzept in einer randomisierten, kontrollierten Phase-III-Studie untersucht und Patienten mit lokalisiertem, intermedi\u00e4rem oder Hochrisiko-PCa entweder mit 77\u202fGy in 35\u00a0Fraktionen oder mit zus\u00e4tzlichem fokalem Boost (auf das GTV) bis zu 95\u202fGy in 35\u00a0Fraktionen behandelt . Das GTVAufgrund der Tumorbiologie des PCa mit vergleichsweise langsamem Krankheitsverlauf hat sich zur Evaluation des Gesamt\u00fcberlebens (OS) nach Behandlung der validierte Surrogatendpunkt metastasenfreies \u00dcberleben (MFS) etabliert. Patienten mit Hochrisiko-PCa erleiden h\u00e4ufiger distante Metastasen, sodass sich die Frage stellt, ob dies auf eine bereits bei initialer Behandlung bestehende Mikrometastasierung oder auf eine unzureichende lokale Tumorkontrolle zur\u00fcckzuf\u00fchren ist. Aus diesem Grund wurde in der hier kommentierten FLAME-Studie der Effekt der fokalen Dosiseskalation auf die lokale Kontrolle  und die regionale und distante Kontrolle  untersucht.Zwischen 2009 und 2015 wurden Patienten mit intermedi\u00e4rem oder Hochrisiko-PCa in drei Zentren der Niederlande (Amsterdam und Nijmegen) und Belgiens (Leuven) eingeschlossen. Ausschlusskriterien waren u.\u202fa. Hinweise von Lymphknoten- oder Fernmetastasen, basierend auf konventionellem Staging, eine transurethrale Prostataresektion innerhalb von 3\u00a0Monaten vor der Strahlentherapie, ein International Prostate Symptom Score (IPSS) \u2265\u202f20 Punkte und eine Kontraindikation f\u00fcr eine mpMRT oder nicht sichtbare GTV in der mpMRT. Alle Patienten erhielten Goldmarker zur Positionierungskontrolle w\u00e4hrend der bildgef\u00fchrten Strahlentherapie (IGRT). Eine elektive Bestrahlung der pelvinen Lymphabflusswege wurde nicht vorgenommen. Das bRFS wurde anhand der Phoenix-Kriterien bestimmt. Da sich die klinische Praxis w\u00e4hrend der Durchf\u00fchrung der Studie \u2013\u00a0insbesondere durch die Etablierung der Positronenemissionstomographie (PET) mit Tracern gegen das prostataspezifische Membranantigen (PSMA)\u00a0\u2013 ver\u00e4ndert hatte, hing die Durchf\u00fchrung der Bildgebung von den behandelnden \u00c4rzten und den jeweiligen Zentren ab.Das Rezidivmuster wurde anhand der verwendeten bildgebenden Methoden w\u00e4hrend der Studiennachverfolgung mit deskriptiver Statistik analysiert. Es wurde zwischen Lokalrezidiven , regionalen Rezidiven  und distanten Rezidiven  unterschieden. F\u00fcr die \u00dcberlebensanalysen wurden regionale und distante Metastasen zu rdMF zusammengefasst. Unterschiede zwischen LFS und rdMFS wurden mittels Kaplan-Meier-Analysen und \u201elog-rank t\u2011test\u201c bestimmt. Unter Ber\u00fccksichtigung klinischer und pathologischer Parameter  wurden Cox-Regressionen durchgef\u00fchrt. Zudem erfolgten Korrelationen zwischen der D98\u202f% des GTV und den Rezidivendpunkten, um eine Dosis-Wirkungs-Kurve zur Vorhersage der Wahrscheinlichkeit von LF und rdMF bis zu 7\u00a0Jahre nach RT erstellen zu k\u00f6nnen.571\u00a0Patienten, davon 84\u202f% mit hohem und 16\u202f% mit intermedi\u00e4rem Risiko nach EAU-Kriterien, wurden in die FLAME-Studie eingeschlossen. 65\u202f% der Patienten erhielten eine Androgendeprivation (ADT). In die Per-Protokoll-Analyse wurden 271\u00a0Patienten im Kontrollarm und 264 im experimentellen Arm behandelt. Die Bildgebung bei den insgesamt 95\u00a0Rezidiven umfasste Knochenszintigraphie (11\u202f%), Computertomographie , Cholin-PET (13\u202f%), PSMA-PET (72\u202f%) sowie die mpMRT (26\u202f%).p\u202f=\u20090,008) und rdMFS  waren signifikant unterschiedlich in beiden Armen. Die Cox-Regression zeigte einen Vorteil f\u00fcr die fokale Dosiseskalation mit einer adjustierten Hazard Ratio (HR) von 0,33  f\u00fcr LFS und 0,56  f\u00fcr rdMFS. Die Dosis-Wirkungs-Kurven zeigten eine geringere Vorhersagekraft f\u00fcr die Entstehung von LF und rdMF mit steigender Dosis, welche bei fokalen Boost-Dosen \u2265\u202f85\u202fGy 0\u202f% f\u00fcr LF und <\u202f10\u202f% f\u00fcr rdMF gegen\u00fcber 15\u202f% nach Standarddosierung von 77\u202fGy betrug.Im Vergleich zum Standardarm traten im experimentellen Arm seltener Lokalrezidive (21\u00a0vs. 7), regionale Rezidive (22\u00a0vs. 7) und distante Rezidive auf . Im experimentellen Arm wurden seltener Therapien wegen eines Rezidivs durchgef\u00fchrt (26\u00a0vs. 40). LFS  zu profitieren scheinen. Die niedrigen Raten an regionalen Rezidiven im fokalen Dosiseskalationsarm stellen zudem den \u201ebenefit\u201c einer zus\u00e4tzlichen elektiven Bestrahlung der pelvinen Lymphabflusswege [Die Autoren dieser Studie konnten zum ersten Mal zeigen, dass sich eine fokale Dosiseskalation positiv auf die Entstehung regionaler und distanter Metastasen auswirkt. Bei der Interpretation dieser Ergebnisse muss ber\u00fccksichtigt werden, dass der hier analysierte Endpunkt rdMFS nicht mit dem als OS-Surrogatparameter validierten Endpunkt MFS gleichzusetzten ist. Dieser wurde von der Initiative lusswege  und die Dosen \u2265\u202f8\u202fGy zu prW\u00e4hrend die insgesamt beeindruckenden Ergebnisse die Grundlage f\u00fcr eine schon heute sehr gute Therapie f\u00fcr Patienten mit prim\u00e4rem lokalisiertem Hochrisiko-PCa bieten, zeigt sie erneut, dass zus\u00e4tzliche pr\u00e4diktive Marker f\u00fcr eine verbesserte Risikostratifizierung notwendig sind, um eine optimale und personalisierte Therapie zu finden. Eine M\u00f6glichkeit hierzu bietet die heutzutage auch in der Prim\u00e4rdiagnostik von Hochrisikopatienten als Standard anerkannte PSMA-PET/CT , die durZus\u00e4tzlich erm\u00f6glicht die PSMA-PET ein verbessertes intraprostatisches Staging. Aufgrund der h\u00f6heren Sensitivit\u00e4t in der Detektion der intraprostatischen Tumormasse und der weniger anspruchsvollen GTV-Definition im Vergleich zur mpMRT bietet die Implementierung der PSMA-PET zur fokalen Dosiseskalation die M\u00f6glichkeit einer besseren Tumorabdeckung und damit m\u00f6glicherweise eine weitere Verbesserung der Rate lokaler, regionaler und distanter Rezidive . Ziel zuSchlie\u00dflich haben sich in den vergangenen Jahren die moderat hypofraktionierten RT-Konzepte (MHRT) und die stereotaktische Strahlentherapie (SBRT) in der Behandlung des PCa etabliert. W\u00e4hrend f\u00fcr Patienten mit niedrigem und intermedi\u00e4rem Risiko von einer Gleichwertigkeit dieser Therapieregime mit einer konventionell fraktionierten RT ausgegangen werden kann, ist dies bei Hochrisikopatienten noch nicht abschlie\u00dfend gekl\u00e4rt. Die Ergebnisse der englischen PACE-C(NCT01584258)-Studie werden zur Beantwortung dieser Frage beitragen. Ob die Behandlung von Hochrisikopatienten auch mit diesen modernen Therapieregimen der fokalen Dosiseskalation erreicht wird, wird u.\u202fa. die HypoFocal-SBRT-Studie untersuchen, in der die fokal dosiseskalierte SBRT auf Basis der Implementierung der PSMA-PET und mpMRT analysiert wird .Eine fokale Dosiseskalation in der EBRT verbessert nicht nur die Rate biochemischer Rezidive, sondern auch lokaler, regionaler\u202f+\u2009distanter Metastasen.Es besteht eine Dosis-Wirkungs-Beziehung zwischen fokaler Boost-Dosis und dem Auftreten von lokalen, regionalen und distanten Metastasen. Wir d\u00fcrfen also davon ausgehen, dass auch Dosiseskalationen unterhalb von 95\u202fGy (\u2265\u202f85\u202fGy) mit hoher Wahrscheinlichkeit einen positiven Therapieeffekt haben.Weitere pr\u00e4diktive Marker zur Verbesserung der Risikostratifizierung sind notwendig, um Patienten zu identifizieren, die in der \u00c4ra der PSMA-PET und fokalen Dosiseskalation von einer Therapieeskalation bzw. -deeskalation profitieren d\u00fcrften.Die HypoFocal-SBRT-Studie wird die SBRT mit fokaler Dosiseskalation auf Basis der PSMA-PET und mpMRT bei intermedi\u00e4ren und Hochrisiko-PCa-Patienten analysieren.Simon K.B. Spohn und Anca-Ligia Grosu, Freiburg/Brsg."}
+{"text": "Enrichments with polyphenol mixes and crude extracts exhibited synergistic and additive effects in the SET-based DPPH assay. In the HAT-based ORAC assay, EO enrichments with crude extracts exhibited more additive effects, as well as less antagonistic effects, than enrichments with their major polyphenol mixes, revealing the significant contributions of minor compounds. EOs enriched with crude green tea and apple extracts exhibited synergistic or additive effects, whereas EOs enriched with grape seed and rosemary extracts exhibited equal antagonistic effects. Predictive models were developed to explain the variability between the observed and predicted antioxidant activities of enriched EOs.With the aim to develop essential oil (EO) multi-antioxidant systems, combinatorial interactions of selected phenol and terpene-rich EOs  enriched with individual polyphenols, crude plant extracts, and mixtures of their major polyphenols were investigated using single electron transfer (SET)-based DPPH and hydrogen atom transfer (HAT)-based ORAC assays. Polyphenols that enriched Eos the most favorably were rosmarinic acid (IC To limit the oxidative degradation of lipids during storage and distribution, the food industry has employed the use of synthetic antioxidants, which have since fallen under scrutiny. Indeed, synthetic antioxidants, such as butylated hydroxyanisole, butylated hydroxytoluene, tert-butylhydroquinone, and propyl gallate, are suspected to have carcinogenic, mutagenic, and teratogenic effects after chronic use . With inEOs are composed of volatile compounds that contribute to their antimicrobial and antioxidant properties such as phenols, allylic alcohols, and selected monoterpenes ,4. The cBlends of antioxidants can have an additive, synergistic, antagonistic, or indifferent effect ,7. In anEOs were obtained from commercial suppliers . Grape sw/w catechin, 52% w/w epicatechin), green tea , apple , and rosemary  extracts to simulate them (w/w). EOs and plant extracts were mixed to achieve the same ratio as EOs and polyphenol mixes.EOs and their enriched counterparts were prepared according to their compositions . The cheate them . All EOsThe DPPH assay was carried out according to the method reported by Brand-William et al.  with mod50 was defined as the concentration required to reduce DPPH by 50%. The IC50 was expressed as mg sample/mg DPPH.The concentrations of antioxidants were plotted against the estimated inhibition ratio. The ICR1 is the fluorescence reading at the initiation of the reaction; nR is the last measurementcompound is the slope of the linear regression analysis of the compound; mTrolox is the slope of the linear regression analysis of Trolox.The ORAC assay was carried out according to the method outlined by , with moResults are expressed as \u00b5mol Trolox Equivalents (TE)/g sample.p < 0.05) using GraphPad Prism Version 8.4.2 for Windows, GraphPad Software, San Diego, CA, USA, www.graphpad.com. All measurements were taken as triplicates and reported as mean \u00b1 standard error. The statistical analyses were carried out using the Microsoft Excel 2019 software package . The Kruskal\u2013Wallis and Dunn\u2019s multiple comparisons tests were performed to detect significant differences , was completed using R software (version 3.4). R software was also used to establish correlations between variables and responses. Design Expert\u00ae Software version 8.0.7  was used to identify the best models that fit the relationships between the composition and the antioxidant properties of essential oils and for analysis of variance (ANOVA).Antioxidant samples were clustered according to their ICp-coumaric, chlorogenic, and ferulic acids). Regardless of the interactions with EOs, the IC50 and ORAC values of the enrichments followed the structural advantages of their respective phenolic acid or flavonoid enrichment. The average antioxidant activities of the EOs were as follows according to their phenolic acid or flavonoid enrichment, respectively: rosmarinic acid > chlorogenic acid > ferulic acid > p-coumaric acid, and quercetin > epicatechin > catechin > rutin hydrate. Phenolic acids and flavonoids are hydrogen-donating radical scavengers and their efficiencies increase with increasing hydroxyl groups in their aromatic moieties and catechol groups, respectively [The addition of singular major polyphenols of plant extracts to 6 EOs improved some of the latter\u2019s antioxidant capacities but not most of the former . These mectively .p-coumaric acid\u2019s activities differed due to the methoxy substitution in the ortho position to the hydroxyl group [Ferulic acid and yl group . Quercetyl group . These tyl group . Furtheryl group , which c50 was Ceylon cinnamon (HE-CAN-04)/quercetin (0.068 mg/mg DPPH), whereas yellow sage (HE-SAU-01-02)/p-coumaric acid had the highest IC50 (1.142 mg/mg DPPH). The former\u2019s high antioxidant capacity is supported by the fact that quercetin can be found in situ in Cinnamomum species [p-coumaric acid\u2019s poor performance in the DPPH assay [Due to combinatorial effects, the EO/polyphenol pair with the lowest IC species . TherefoPH assay  due to tp-coumaric acid exhibited additive and synergistic effects, and no antagonistic effects in the DPPH assay. Rutin hydrate has exhibited synergistic effects with terpenoids, such as \u03b3-terpinene [Mixtures enriched with rutin hydrate, quercetin, and erpinene , which cp-coumaric acid (7451.0 \u00b5mol TE/g oil + polyphenol), and chlorogenic acid (4709.4 \u00b5mol TE/g oil + polyphenol). The EO/polyphenol pair with the highest ORAC value was white thyme (HE-THY-03)/ferulic acid , whereas clove (HE-CLO-01)/epicatechin (2252.4 \u00b5mol TE/g oil + polyphenol) displayed the lowest. There was no antagonism in enrichments with quercetin and catechin. Rutin hydrate enrichments exhibited the most antagonistic effects in the ORAC assay. Of the EOs, yellow sage (HE-SAU-01-02) exhibited the most antagonism when enriched with polyphenols, notably rutin hydrate (2298.5 \u00b5mol TE/g oil + polyphenol), rosmarinic acid (5772.0 \u00b5mol TE/g oil + polyphenol), The synergy between certain EOs/polyphenols could be due to the regeneration of their antioxidants, where weaker antioxidants (co-antioxidant/synergist) regenerate stronger antioxidants (primary antioxidant), and vice versa in antagonism . This sy50 of all unenriched polyphenol mixes were lower than their expected IC50, thus displaying antagonistic effects . Pimento berry (HE-PIM-01)/green tea mix showed the highest overall antioxidant capacity . This pair\u2019s synergistic effects and low IC50 value could be due to the contributions of eugenol and the EO\u2019s minor components such as methyleugenol. Since clove oil (HE-CLO-01) contains more eugenol (93.5% versus 86.4%), its lower activity confirms that other compounds are influencing pimento berry\u2019s (HE-PIM-01) activity [EOs enriched with the green tea mix  showed tactivity .50 = 0.013 mg/mg DPPH; ORAC Value = 12,720.5 \u03bcmol TE/g sample), whereas enrichments of pimento berry (HE-PIM-01)  and Ceylon cinnamon (HE-CAN-04)  showed additive/synergistic and synergistic/additive effects in the DPPH/ORAC assays, respectively. When paired with the apple mix, these EOs exhibited ORAC values more than ten times greater than the other EOs, due to synergistic interactions with their eugenol. Indeed, the ORAC values increase with the EOs\u2019 increasing eugenol contents  [EOs enriched with the apple polyphenol mix  did not 50 values, although all were synergistic. The high absolute values of the IC50 of these enrichments could be attributed to the presence of p-coumaric acid (80% of the mix), which was shown to have a poor antioxidant activity on its own  and Ceylon cinnamon (HE-CAN-04), with the grape seed extract (EX-RAI-01) greatly improved the antioxidant capacities of the EOs in both assays, in comparison to their corresponding values with the polyphenol mix. When clove EO (HE-ORI-03) was enriched with the grape seed polyphenol mix , it exhiEnrichment of all oils with the green tea extract (EX-THE-01) increased their antioxidant capacity, especially pimento berry\u2019s (HE-PIM-01) ORAC value , which showed synergistic effects. No antagonism was observed in both assays: all enrichments in the DPPH assay were synergistic, whereas those in the ORAC assay were additive, except with pimento berry (HE-PIM-01). The ORAC values of the EOs nearly doubled, suggesting that interactions with the major compounds contributed to half of the effects and that the extract\u2019s minor polyphenols contributed to the other half. Green tea is known to have a very high antioxidant activity thanks to its flavonoids, catechins, gallic acids, and the like . With an50 and ORAC values of all the EOs, except the IC50 of clove (HE-CLO-03) (0.041 mg/mg DPPH). No antagonistic effects were observed in both assays. Enrichments that once were antagonistic between EOs and the apple polyphenol mix were then additive  or synergistic  when enriched with the plant extract. Therefore, the minor components of the plant extract contribute positively to the overall antioxidant activity of the enrichments. Furthermore, all synergistic combinations included EOs with phenols  improved the IC phenols , whereas phenols . All enr50 compared to the polyphenol mix and showed synergistic effects across all enrichments, except that of pimento berry , which exhibited additive effects. In the ORAC assay, there were antagonistic effects when enriching yellow sage (HE-SAU-01-02) and oregano (HE-ORI-03) with the extract. Therefore, the antagonistic effects between yellow sage (HE-SAU-01-02) and the rosemary polyphenol mix had carried over and interactions with the minor components did not overcome the pre-existing antagonism. Additionally, the synergy that was previously present between oregano (HE-ORI-03)/rosemary mix was then lost when enriched with the crude extract. This reveals that the minor components of rosemary extract (EX-ROM-04) interact poorly with EOs lacking phenols in the ORAC assay. The enrichment of clove EO (HE-CLO-01) remained synergistic, albeit with a lower ORAC value than that with the polyphenol mix. Enrichment of pimento berry (HE-PIM-01) and Ceylon cinnamon (HE-CAN-04) remained synergistic, though enrichments with the extract resulted in lower ORAC values. This suggests that the major compounds of rosemary extract were mostly responsible for their synergistic effects. Rosemary extract (EX-ROM-04) enrichments showed the lowest overall improvement in absolute antioxidant capacity. Enriching with the extract improved the IC50 vector, indicating that they were well differentiated in the DPPH assay. The ORAC values of the latter did not vary much, hence the lack of dispersion along the ORAC vector. Therefore, to assess the contribution of each polyphenol mix and their interactions with the EOs, the DPPH assay could be considered. Oils enriched with individual polyphenols followed the ORAC vector, as their IC50 values were not dispersed enough to be differentiated between each other. Finally, though all oil/crude extract enrichments were loosely dispersed from each other, enrichments with the same extract clustered uniformly along the ORAC vector, with a few outliers (oil/green tea extract enrichments). This, therefore, suggests that these enrichments are loosely differentiated by the ORAC assay.Overall, each enrichment step behaved differently in both assays, as shown in the principal component analysis (PCA) . Unenric50 and ORAC values. There is a weak to moderate correlation between the expected and observed IC50 (R2 = 0.37). The difference between the two is more pronounced in the high IC50 value range. Additionally, the correlation is not proportional. The following model can explain 48% of the variability of observed IC50 (R2 = 0.48): 2 = 0.7). The variability was mainly due to the synergistic and antagonistic effects observed upon enrichment with plant extracts than with individual polyphenols and polyphenol mixes. The following model can explain 50% of the variability of the observed IC50 (R2 = 0.48).In contrast, there was a moderate to strong correlation between the expected and observed ORAC values  and apple (EX-POM-04) extracts, contributed positively to their activity. Such interactions are advantageous, as lower EO quantities would be necessary to increase product quality. Predictive models were developed to explain the variability in the IC50 and ORAC values. In future work, the use of additional antioxidant activity assays with different mechanisms, including reducing power, metal chelation, and others, would broaden the potential applications of the identified synergistic multi-oxidant systems.The investigation of the interactions between selected EOs enriched with polyphenols, their mixtures, and plant extracts was conducted using the DPPH and ORAC assays. No direct correlation was found between the IC"}
+{"text": "Capn4 knockout fibroblasts lacking the regulatory calpain subunit. About half of the neurons lost calcium homeostasis within two hours of a transient, 20 min glutamate receptor stimulation. These neurons had a significantly (49%) higher mean baseline cA-TAT proteolysis rate than those maintaining calcium homeostasis, suggesting that the unknown protease(s) cleaving cA-TAT may influence DCD susceptibility. Overall, the results indicate that excitotoxic glutamate triggers the activation of calpain-independent neuronal protease activity prior to the simultaneous loss of calcium homeostasis and mitochondrial bioenergetic function.Glutamate excitotoxicity contributes to many neurodegenerative diseases. Excessive glutamate receptor-mediated calcium entry causes delayed calcium deregulation (DCD) that coincides with abrupt mitochondrial depolarization. We developed cA-TAT, a live-cell protease activity reporter based on a vimentin calpain cleavage site, to test whether glutamate increases protease activity in neuronal cell bodies prior to DCD. Treatment of rat cortical neurons with excitotoxic (100 \u00b5M) glutamate increased the low baseline rate of intracellular cA-TAT proteolysis by approximately three-fold prior to DCD and by approximately seven-fold upon calcium deregulation. The glutamate-induced rate enhancement prior to DCD was suppressed by glutamate receptor antagonists, but not by calpain or proteasome inhibitors, whereas DCD-stimulated proteolysis was partly attenuated by the proteasome inhibitor MG132. Further suggesting that cA-TAT cleavage is calpain-independent, cA-TAT fluorescence was observed in immortalized  Glutamatergic signaling through calcium  channel [2+ buffering by mitochondria helps maintain tight control over intracellular Ca2+ levels, enabling Ca2+ to continue to regulate diverse processes throughout the cell following the cessation of glutamate receptor stimulation [2+ uptake capacity and other intracellular Ca2+ buffering mechanisms are exceeded. This results in loss of intracellular Ca2+ homeostasis, accompanied by nearly complete and persistent mitochondrial depolarization [Mitochondria, negatively charged organelles which produce ATP to meet cellular energy needs , take up channel ,8. This mulation . When thrization .2+ deregulation is observed in primary rodent neuronal cell cultures treated with an excitotoxic concentration of glutamate even after resting Ca2+ is restored by the addition of glutamate receptor antagonists [2+ deregulation indicates that the initial NMDA receptor-mediated Ca2+ rise triggers intracellular events leading to inevitable Ca2+ homeostasis collapse despite the cessation of Ca2+ influx. A better understanding of the intracellular signaling events that commit neurons to DCD and resultant death following transient excitotoxic glutamate receptor stimulation is important because it may lead to novel, neuron-sparing intervention strategies.Caagonists . The tim2+-dependent calpain proteases promote mitochondrial dysfunction and DCD following glutamate-mediated Ca2+ entry [2+-activated protease activity contributes to the delayed mitochondrial dysfunction and DCD remained attractive because apoptosis-inducing factor (AIF), a mitochondrial protein reported to causatively contribute to excitotoxic cell death upon nuclear translocation [Previously, we hypothesized that activation of Ca2+ entry . However2+ entry  and othe2+ entry  failed tlocation ,12, is rlocation ,14 or calocation  proteoly2+-dependent. However, unexpectedly, this increase was insensitive to inhibitors of both calpains and the proteasome. A significantly higher baseline cA-TAT proteolysis rate was observed in the fraction of neurons undergoing DCD during the time course of our experiment, raising the important possibility that the unknown protease or proteases primarily responsible for cA-TAT processing contribute to the delayed perturbations in Ca2+ and mitochondrial homeostasis.Here, we employed cA-TAT, a second-generation version of a cell-permeable, fluorogenic reporter based on a calpain cleavage sequence within a different calpain substrate, vimentin , to revi+), Fluo-4FF, Neurobasal medium, B27 supplement, and GlutaMAX were obtained from Invitrogen . Ionomycin was obtained from EMD Biosciences . Streptavidin-horseradish peroxidase (HRP) was obtained from Life Technologies-Thermo Fisher . Other reagents were obtained from Sigma-Aldrich .Cal Fluor Orange-GSGTSS-K(BHQ-2) amide (cA) and Biotin-BAla-(K-CFO560)-GSGTSS-K(BHQ-2)-BAla-GRKKRRQRRRPQ-amide (cA-TAT) were synthesized by Biosearch Technologies, Inc.  . Tetrame5 cells/well in poly-D-lysine-coated Lab-Tek 8-well chamber slides (Nunc). Fetal bovine serum  was included in the Neurobasal culture medium described below, but only during the initial plating to facilitate attachment to the chamber coverglass. Cells were subsequently maintained at 37 \u00b0C in Neurobasal medium containing B27 supplement (2%), GlutaMax (0.5 mM), penicillin (100 IU/mL), and streptomycin (100 \u00b5g/mL) for 14\u201315 days in vitro (DIV) prior to experiments, with half medium changes performed every 3\u20134 days. A low-oxygen incubator with a humidified atmosphere of 92% N2/5% CO2/3% O2 was used for culture to prevent oxidative stress due to supraphysiological O2 [2) is substantially lower that the oxygen level in the atmosphere  [2, 0.4 mM KH2PO4, 20 mM N-Tris-(hydroxymethyl)-methyl-2-amino-ethanesulfonic acid, 5 mM NaHCO3, 1.2 mM Na2SO4, and 15 mM D-glucose, pH 7.4.Primary cortical neurons were prepared from 1\u20132 pairs of E18 rat cortices obtained from BrainBits\u2122, LLC  as previously described ,16. Brie 21% O2) . ImmediaCapn4 knockout (Capn4\u2212/\u2212) MEFs and wild-type (Capn4+/+) MEF control cells were generously provided by Dr. Peter Greer  [2.Immortalized  Canada) . The celd~9.7 \u03bcM) that fluoresces intensely only in neurons displaying loss of calcium homeostasis [An LSM\u2122 5 Pascal laser scanning confocal system  was used to simultaneously image changes in intracellular protease activity and calcium level in a temperature-controlled room air enclosure at 37 \u00b0C with the fluorescent probes cA (5 \u00b5M) or cA-TAT (1 \u00b5M) and Fluo-4FF (0.5 \u03bcM), respectively. The probe cA is an internally quenched protease substrate containing a calpain cleavage site of vimentin  Figure A and cA-eostasis . The imaNeurons in eight-well Lab-Tek chambers were pre-treated with calpain inhibitor , proteasome inhibitor MG132 (20 \u00b5M), or dimethyl sulfoxide (DMSO) vehicle control for 10\u201330 min, as indicated in figure legends, and then cA or cA-TAT was loaded for 80 min prior to image acquisition. In cA-TAT imaging experiments, the extracellular protease probe was removed by replacing the imaging medium with fresh imaging medium containing Fluo-4FF and DMSO or inhibitor, but no cA-TAT. The cA protease reporters were excited at 543 nm and emitted fluorescence was collected between 560 and 615 nm, while the excitation and emission wavelengths for Fluo-4FF imaging were 488 nm and 505\u2013530 nm, respectively.2+ deregulation, neurons were loaded with Fluo-4FF, as above, but in conjunction with TMRM+ (100 nM) instead of cA-TAT. The dye-loading period for TMRM+, used together with Fluo-FF, was 2 h at 37 \u00b0C. TMRM+ was excited at 543 nm and emissions were monitored using a 560LP filter, while Fluo-4FF fluorescence was simultaneously monitored using the excitation/emission wavelengths described above. Images were acquired at four-minute intervals for the duration of each experiment, using the Multi-Time Lapse Module to acquire fluorescence time-course measurements from four independent wells in parallel.For experiments assessing the timing of mitochondrial membrane potential loss with respect to Ca+ and Fluo-4FF was detected. Regions of interest corresponding to all neuronal somas within imaged fields acquired from 2\u20134 independent wells of 1\u20132 primary neuronal preparations were selected for the quantification of fluorescence over time. All protease inhibitors were tested on \u22653 independent wells of two or more different primary neuronal preparations with similar results. However, because there were some differences in protocol , only exact replicates were combined for analysis. Rates of cA-TAT proteolysis were determined by linear regression analysis. A cell was excluded from analysis if: (1) the noise-to-signal ratio precluded either a linear fit of the baseline rate used for normalization or an ionomycin response (suggestive of poor probe loading); (2) the cell underwent lysis and lost the fluorescent indicator before any post-baseline rate could be calculated; (3) the cell spontaneously underwent Ca2+ deregulation prior to glutamate addition; and (4) the cell recovered calcium homeostasis following DCD (a rare event). These exclusion criteria are discussed further in No crosstalk between either the emissions of cA or cA-TAT and Fluo-4FF or the emissions of TMRMNeuronal lysates from cA-TAT-loaded cells were harvested in 50 \u00b5L of radioimmunoprecipitation assay (RIPA) buffer containing protease inhibitor cocktail following the acquisition of fluorescent time-courses and then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS\u2013PAGE), as previously described . Proteint-test was used to test for an effect of protease inhibitor treatment on baseline cA-TAT proteolysis rate and, also, to compare the baseline rate in cells that did or did not undergo Ca2+ deregulation in response to glutamate. We were unable to use repeated measures analysis of variance (ANOVA) to evaluate whether the acute treatments  changed the rate of cA-TAT proteolysis in individual cells because a few cells underwent lysis before the ionomycin rate could be calculated, and the repeated measures ANOVA cannot handle missing values. Therefore, the data were analyzed in GraphPad Prism by implementing the mixed-effects model using the Restricted Maximum Likelihood (REML) method, which employs a compound symmetry covariance matrix. Geisser\u2013Greenhouse correction was used. This method gives the same p-values and multiple comparisons tests as repeated measures ANOVA when there are no missing values. Given the assumption that the missing ionomycin rate values resulting from the rare lysis events (3\u20134 cells per condition) were random, i.e., unrelated to the level of protease activity, the results can be interpreted in the same way. Finally, to test for inhibitor effects on the baseline-normalized rates measured following glutamate, MK-801+NBQX, or ionomycin addition, we used a two-way ANOVA followed by \u0160\u00edd\u00e1k\u2019s multiple comparisons test. p-values < 0.05 were considered significant.Statistical analysis was performed using GraphPad Prism version 9.3 . A Welch\u2019s unequal variances TM fluorophore and BHQ-2TM quencher separated by a calpain cleavage site derived from the structural protein vimentin  could not be imaged in conjunction with cA owing to spectral overlap. Therefore, we sought to confirm that irreversible mitochondrial depolarization occurs simultaneously with Ca2+ deregulation in our cortical neuron cultures continuously exposed to excitotoxic glutamate  that results in self-quenching in the mitochondrial matrix [+ is used in \u201cquench mode,\u201d mitochondrial depolarization results in efflux of TMRM+ from the matrix and consequent dequenching of its fluorescence emission [+ fluorescence prior to the dye\u2019s subsequent escape across the plasma membrane, revealing the timing of mitochondrial depolarization with respect to DCD when used in conjunction with Fluo-4FF.We were interested in determining whether glutamate-stimulated protease activity occurs upstream of mitochondrial bioenergetic dysfunction, but the mitochondrial membrane potential-sensitive probe tetramethyl rhodamine methyl ester , l matrix . When TMemission . The res+ fluorescence over time in regions of interest corresponding to neuronal somas from 10 representative neurons within an imaged well. We saw a relatively small TMRM+ fluorescence increase in the majority of cells immediately following glutamate addition (2+ deregulation (ICD), a much larger increase in TMRM+ fluorescence was observed, followed by a rapid drop below baseline  mouse embryonic fibroblasts [Capn4\u2212/\u2212 MEFs and wild-type MEF control cells exhibited detectable intracellular red fluorescence upon baseline cA-TAT incubation and notable intracellular red fluorescence following ionomycin treatment , cells showing Ca2+ deregulation at the first time point (4 min) after glutamate addition were classified as DCD rather than considered separately as ICD. Furthermore, since so few cells maintained Ca2+ homeostasis in the presence of E64d (\u2212/\u2212Capn4 experiment that enzyme(s) other than calpain are responsible for the digestion of cA reporters in cells.The baseline cA-TAT proteolysis rate showed high variability and was not significantly altered by E64d . Therefo of E64d , we test of E64d B. As cal2+-dependent calpain proteases, the cA fluorescence accumulation in cells behaves as if it is Ca2+-dependent. This behavior includes: (1) an increased rate of fluorescence accumulation upon glutamate addition (which stimulates NMDA receptor-mediated Ca2+ entry), (2) increased fluorescence accumulation upon spontaneous DCD, and (3) direct stimulation of fluorescence accumulation rate by Ca2+ ionophore-mediated Ca2+ entry. Therefore, we asked whether the glutamate-stimulated cA-TAT accumulation rate could be acutely reversed by blocking pathways of Ca2+ entry. To accomplish this, we added MK-801 to block NMDA receptor-mediated Ca2+ influx and, at the same time, the AMPA receptor antagonist NBQX to suppress glutamate-mediated plasma membrane potential depolarization. The latter should largely antagonize Ca2+ entry through voltage-dependent Ca2+ channels, while also preventing entry through the Ca2+-permeable AMPA receptor subclass. We found that the MK-801 plus NBQX combination not only significantly inhibited the glutamate-stimulated proteolysis rate, but also significantly suppressed the cA-TAT proteolysis rate to below baseline . This is because the spontaneous electrical activity exhibited by mature cortical neurons in culture is expected to alter the basal levels of intracellular Ca2+ [Although multiple lines of evidence indicate that cA or cA-TAT proteolysis is independent of Cabaseline . These dlar Ca2+ .Capn4 for activity [Yet another challenge in identifying the cA-TAT-degrading protease(s) is the possibility of redundancy. The cA reporter was marginally susceptible to chymotrypsin in cell-free assays  and may activity ,312+ ionophore ionomycin used as a positive control to confirm cA-TAT probe loading. MG132 (20 \u00b5M) pre-incubation did not affect the baseline cA-TAT proteolysis rate  was ~50% greater in cells that underwent DCD within two hours of the start of the 20 min transient glutamate receptor stimulation compared with the neurons that were able to maintain Ca2+ homeostasis. However, there are other possibilities. MK-801+NBQX dropped the cA-TAT proteolysis rate below baseline, suggesting that the baseline cA-TAT proteolysis rate reflects the endogenous level of glutamate receptor signaling. Therefore, either energy demand or another process associated with neuronal activity may underlie the correlation between high cA fluorescence accumulation rate and DCD occurrence. Alternatively, it may be the individual neuron\u2019s ability to load cA-TAT probe and the pathways involved, rather than the ability to digest the reporter at a higher rate, that predicts DCD propensity. While the Western blot detection of biotin-conjugated cA-TAT cleavage product strongly indicates that intracellular fluorescence accumulation is due to reporter cleavage, further work is needed to understand whether the large cell-to-cell variability reflects differences in cA-TAT loading, true heterogeneity in protease activity, or some combination of the two.One hypothesis to explain this result is that the protease mediating most of the cA-TAT cleavage also promotes DCD following glutamate exposure by degrading protein substrates required for Ca\u2212/\u2212Capn4) approaches supporting calpain-independence. We did observe significant inhibition by the proteasome inhibitor MG132, but only of the DCD- or ionomycin-induced cA-TAT proteolysis enhancement, and even then the inhibition was incomplete. This result suggests that multiple proteolytic activities contributed to cA-TAT cleavage over the time course of our imaging experiments.We made initial attempts to identify the class of proteolytic activities responsible for cA-TAT digestion in cells. E64d insensitivity suggests that cA-TAT cleavage is not cysteine protease-mediated, ruling out calpains and several cathepsins, with additional pharmacological (MDL28170) and genetic  responsible for the baseline and glutamate-stimulated rates, hypothesized to contribute to delayed Ca2+-dependent, the role of Ca2+ need not be direct. Activation of the Ca2+-dependent phospholipase PLA2G4A was recently reported to cause the translocation of a soluble lysosomal protease to the cytoplasm in rat cortical neurons and to promote lysosomal permeabilization in vivo following traumatic brain injury [2+-dependent phospholipase, e.g., of a few lysosomes, whereas the larger increase upon DCD reflects more global lysosomal disruption. Future experiments with Ca2+-dependent phospholipase A2 inhibitors and lysosome-stabilizing agents could be carried out to test this hypothesis.Finally, it is important to note that although cA-TAT cleavage appears to be Can injury . Lysosomn injury ,35. Thus2+ deregulation. Higher cA-TAT proteolysis rates in neurons showing DCD suggests that an unknown protease responsible for cA-TAT reporter cleavage influences DCD susceptibility. The identity of this protease (or proteases), its endogenous substrates, and whether it indeed contributes to mitochondrial dysfunction and DCD remain to be determined.Using a novel, internally quenched fluorogenic peptide reagent, cA-TAT, this study demonstrated that excitotoxic glutamate exposure increases cortical neuron intracellular protease activity prior to delayed Ca"}
+{"text": "To explore the safety and efficiency of endometrial myomectomy (EM) and Serosal myomectomy (SM) for the removal of intramural myoma greater than 8\u00a0cm in diameter during cesarean section.Retrospective analysis and follow-up were used, and 190 cases of pregnancy complicated with uterine myoma from Jan. 2017 to May 2022 in Ningbo Women\u2019s and Children\u2019s Hospital were collected, 130 cases of caesarean myomectomy as study group, 64 cases of EM as study group A, 66 cases of SM as study group B, 33 cases with uterine fibroids removed before suturing the uterine incision as study group B1, 33 cases with uterine incision sutured followed by removal of fibroids as study group B2, 60 cases of Caesarean section alone as control group. To compare perioperative conditions between and within groups.P\u2009<\u20090.001, P\u2009<\u20090.001, P\u2009=\u20090.025, P\u2009=\u20090.011). \u2461 For type III and V fibroids, the time of myoma removal, postoperative exhaust and pre- and post-operative haemoglobin drop and intraoperative blood loss in study group A were less than those in study group B ; For type IV uterine fibroids, only postoperative exhaust time was less in Study Group A than in Study Group B . \u2462 Time of myoma removed was less in study group B1 than in study group B2 .\u2460 Operation time, postoperative exhaust time, pre- and post-operative haemoglobin drop, intraoperative blood loss were all more than those of the control group in the study group (68.65\u2009\u00b1\u200911.87 vs 56.17\u2009\u00b1\u20099.18\u00a0min, 21.04\u2009\u00b1\u20094.98 vs 17.03\u2009\u00b1\u20091.3\u00a0h, 1.27\u2009\u00b1\u20090.59 vs 1.09\u2009\u00b1\u20090.43\u00a0g/dl, 613\u2009\u00b1\u2009221 vs 532\u2009\u00b1\u2009156\u00a0ml, It is safe and feasible to remove interstitial myomas larger than 8\u00a0cm in diameter during caesarean section. EM has the advantage of shorter operation time and less intraoperative bleeding, SM, in a way that the myoma is removed before suturing the uterine incision, can shorten the myomectomy time. It can benefit the patients more. Uterine myomas are the most common benign tumours in the female reproductive organs and affect 20% to 40% of women at reproductive age . The risThe investigation was carried on 190 cases of pregnant women diagnosed for uterine fibroids greater than 8\u00a0cm in diameter during pregnancy and scheduled for cesarean section (CS) between Jan. 2017 to May 2022 at Ningbo Women and Children\u2019s Hospital were retrospectively reviewed in this study. The Institutional Review Board of Ningbo Women and Children\u2019s approved this study, and the need for informed consent was waived because of the retrospective nature of this study.Electronic medical records were reviewed to collect patient demographics, obstetrical history, operative reports, and clinical notes. The inclusion criteria were preoperative ultrasound and intraoperative diagnosed uterine fibroids of type (3\u20135) according to FIGO classification and fibroids larger than 8\u00a0cm in maximum diameter. The following patients were excluded: Patients in high risk of postpartum haemorrhage such as twins, placenta praevia, placenta implantation, placenta abruption, coagulation disorders etc. 130 women who had consented to and undergone caesarean myomectomy were assigned to the study group, while the other 60 women were assigned to the control group. The Study Group included 64 women undergone EM who were assigned to the Study GroupA, 66 women undergone SM who were assigned to the Study GroupB. Study Group B included Study Group B1 thirty-three cases who removed uterine fibroids before suturing the uterine incision and Study Group B2 thirty-three cases who sutured the uterine incision followed by myomectomy.All patients were prepared for autologous blood transfusion before the operation. Cesarean section was performed with a midline abdominal incision and spinal anesthesia. Following the delivery of the newborn and placenta, intravenous carbetocin 0.1\u00a0mg was injected. Then the uterus was delivered out of the abdominal cavity and the lower uterine was tied with a tourniquet. Study Group A and Study Group B1 removed uterine fibroids before suturing the uterine incision and Study group B2 sutured the uterine incision followed by myomectomy. Myomectomy process: The assistant squeezes the myoma towards the endometrium or serosa, then a linear incision at the most prominent part of the myoma was made by electro scalpel till fibroid surface via the myoma pseudocapsule. Surgeon then extracts the fibroid by progressive tractions, while sutuer-ligating the vessels at the basal part to provide hemosta, finally closing tumor cavity using continuous suture method with absorbable 1 Polysorb CL-905, suturing the serosal or endometrium with 2\u20130 Vicryl. Observe the amount of uterine bleeding after loosening the tourniquet. If the bleeding was heavy, medications were administered as the initial form of conservative treatment. Intrauterine injections of Carboprost-Tromethamine 250\u00a0mg and intravenous tranexamic acid 1\u00a0g are used to enhance uterine contraction. The effect is not satisfactory, thus more hemostatic measures are added. If the uterine incision is not sutured, the preferred method is to tamp down the uterine cavity with a balloon and, if necessary, ligate the ascending branches of the uterine artery; If the uterine incision has been sutured, it is best to ligate one or both ascending branches of the uterine artery. If necessary, a balloon is inflated into the uterine cavity through the vagina.The surgical outcomes that included duration of surgery, blood loss (volume method\u2009+\u2009weighing gauze), preoperative and postoperative hemoglobin values and surgical complications , intrauterine adhesion) were recorded for statistical analysis.P\u2009<\u20090.05 was considered significant.Statistics Statistical analysis was performed using SPSS 23.0 software. Data were presented as mean\u2009\u00b1\u2009SD, median  or count (percentage). Comparison between groups was determined by t test, one-way ANOVA test, Wilcoxon rank sum test or chi-square test. P\u2009>\u20090.05 for all) . There were no significant differences in the incidence of postpartum haemorrhage, transfusion, uterine artery ligation, intrauterine adhesion, 5\u00a0min Apgar score and asphyxia between the two groups (P\u2009>\u20090.05).The intraoperative and postoperative outcomes for the Study Group and control group are summarized in Table P\u2009=\u20090.036, P\u2009<\u20090.001, P\u2009=\u20090.014, P\u2009=\u20090.008) (Table P\u2009=\u20090.016). However, there were no significant differences in intraoperative blood loss and the time of myoma removal (Table The intraoperative and postoperative outcomes in the different types of fibroids are summarized in Tables\u00a0P\u2009=\u20090.033). However, there were no significant differences in intraoperative blood loss and the pre- and post-operative haemoglobin drop.Differences in the time of myomectomy according to the sequence of uterine incision suturing and myomectomy are presented in Table Myomectomy during cesarean section has its unique advantages. During pregnancy, the myometrium becomes more elastic, the psuedocapsule of the myoma increases, the boundary between the myoma and the surrounding tissue is clearer, and the myoma is easier to peel , 13. AloThe key to the safe removal of uterine myoma during cesarean section is to reduce intraoperative bleeding, which can be achieved by localizing the blood supply to the myoma or by blocking the uterine blood supply. For example, U-shaped suture ; intrathEM is indicated for myoma close to the uterine incision, and if the myoma is close to the bottom of the uterus, the difficulty of this procedure will be greatly increased. In this study, myomas near the bottom of the uterus were resected via SM. The traditional surgical procedure is to suture the uterine incision first, and then treat the uterine myoma. This is because suturing the uterine incision first to restore the integrity of the uterus reduces bleeding from the incision and promotes uterine contraction to reduce intraoperative bleeding, but problems such as penetration of the uterine cavity and difficulty in hemostasis occur when dealing with deep, large interstitial myomas. Under the premise that the tourniquet temporarily blocks the blood supply of the uterus, this study first resects the uterine myoma, and then sutures the uterine incision. It is the result of many years of practice and exploration by our team, and there is no literature report in China at present. The concept is that removing the uterine myoma through the uterine serous layer before closing the uterine incision can push the leiomyoma from the endometrial layer to the serous layer, make the uterine myoma pseudocapsule close to the serous layer, and reduce damage to the uterine myoma during myoma resection. Myomectomy guided by the uterine cavity avoids penetration of the uterine cavity, and prevents the occurrence of dead space, with more convenient and rapid resection of uterine myoma. In this study, this was also confirmed by the significantly shorter resection time of B1 myoma in the study group. Because the uterine blood supply is temporarily blocked with a tourniquet before myomectomy, to reduce bleeding from the uterine incision and the placenta dissection surface during myomectomy. And this was confirmed by the lack of significant differences in intraoperative bleeding and the difference in hemoglobin before and after surgery in study groups B1 and B2 in this study.To sum up, resection of interstitial myomas greater than 8\u00a0cm in diameter during hysterectomy is safe and feasible, and EM has the advantage of shortening the operative time and reducing intraoperative bleeding. The resection of uterine myoma through serosa, with the removal of the myoma first and then the suturing of the uterine incision, can shorten the time of myomectomy and is worth promoting. As a retrospective analysis, although the preoperative data have been controlled consistently in all groups of patients, it is still inevitable that some of the biases cannot be eliminated. The long-term recovery of hysteromyoma resection during cesarean section and the obstetric outcome of re-pregnancy need to be further studied."}
+{"text": "Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease in persons with HIV (PWH) (HIV-NAFLD). It is unknown if HIV-NAFLD is associated with impairment in health-related quality of life (HRQOL). We examined HRQOL in PWH with and without NAFLD, compared HRQOL in HIV- versus primary NAFLD, and determined factors associated with HRQOL in these groups. Prospectively enrolled 200 PWH and 474 participants with primary NAFLD completed the Rand SF-36 assessment which measures 8 domains of HRQOL. Individual domain scores were used to create composite physical and mental component summary scores. Univariate and multivariate analyses determined variables associated with HRQOL in PWH and in HIV- and primary NAFLD. In PWH, 48% had HIV-NAFLD, 10.2% had clinically significant fibrosis, 99.5% were on antiretroviral therapy, and 96.5% had HIV RNA <200 copies/ml. There was no difference in HRQOL in PWH with or without NAFLD. Diabetes, non-Hispanic ethnicity, and nadir CD4 counts were independently associated with impaired HRQOL in PWH. In HIV-NAFLD, HRQOL did not differ between participants with or without clinically significant fibrosis. Participants with HIV-NAFLD compared to those with primary NAFLD were less frequently cisgender females, White, more frequently Hispanic, had lower BMI and lower frequency of obesity and diabetes. HRQOL of individuals with HIV-NAFLD was not significantly different from those with primary NAFLD. In conclusion, in virally suppressed PWH, HRQOL is not different between participants with or without HIV-NAFLD. HRQOL is not different between HIV-NAFLD and primary NAFLD. Non-alcoholic fatty liver disease (NAFLD) is the most common liver disease in persons without human immune deficiency virus (HIV) (primary NAFLD), affecting nearly a quarter of the population in North America . PrimaryThe increasing efficacy and utilization of antiretroviral therapy (ART) has improved the longevity of persons with HIV (PWH) , 10. In In addition to its impact on morbidity and mortality, NAFLD burden extends to affect health-related quality of life (HRQOL), as evaluated by a person\u2019s perception of the physical, mental and emotional aspects of their well-being. Studies show persons with primary NAFLD have significant reduction in HRQOL compared to the general population \u201320. The In this study, we first assessed HRQOL in a well phenotyped cohort of PWH with and without HIV NAFLD. We next compared HRQOL in persons with HIV-NAFLD to that of a large cohort of well characterized adults with primary NAFLD. Finally, we sought to determine factors associated with the physical and mental components of HRQOL in PWH and in NAFLD.HIV-NAFLD cohort: Consecutive consenting PWH were prospectively enrolled from three outpatient HIV clinics at Indiana University School of Medicine, Massachusetts General Hospital and University of Texas Health Science Center between 2018 and 2022. Each participant provided a signed informed consent. The study protocol was approved by each site\u2019s Institutional Review Board (IRB). Inclusion criteria were hepatic steatosis by ultrasound , age \u2265 1Primary NAFLD cohort: Consecutive consenting patients without HIV were prospectively enrolled from the NAFLD clinic at Indiana University School of Medicine between 2017\u20132022. Indiana University IRB approved the protocol. Each participant provided a signed informed consent. NAFLD was diagnosed based on the recent American Association for the Study of Liver Diseases guidelines , which r+ T cell nadir and current count at enrollment, current and prior ART classes). Clinically significant fibrosis was defined as LSM\u2265 8.6 kPa , vital signs, medical and medicinal history, HIV and ART data , participants also completed the 36-item Short Form (SF-36) Health Survey version 1.0. SF-36 is a widely used and validated tool to evaluate the impact of disease on several physical and mental domains of health in the setting of a variety of chronic diseases, including liver diseases, primary NAFLD and HIV \u201333. SF-3Participants with HIV-NAFLD versus without HIV-NAFLD as well as participants with HIV-NAFLD with versus without clinically significant fibrosis were compared in socio-demographic, laboratory and clinical variables. Means and standard deviations for continuous variables and frequencies and percentages for categorical variables were provided for each of the four groups. Two-group comparisons were made using two-sample independent t-tests for continuous variables and Chi-square/Fishers test for categorical variables. Similar analyses were also performed for PCS and MCS. One of our primary aims was to identify factors associated with HRQOL in terms of PCS and MCS. We first assessed univariate or unadjusted association with quality of life and then we built a multivariate regression model using stepwise selection procedure.A secondary aim was to assess how HIV-NAFLD versus primary NAFLD was differentially associated with HRQOL in terms of PCS and MCS after adjustment for differences in HIV-NAFLD and primary NAFLD groups. Although we could have considered a matched case (HIV NAFLD) control (primary NAFLD) study design by matching age and sex, we could not make the two groups similar in terms of other important covariates that were significantly different between the two groups. Therefore, we used multivariate analysis to adjust for all covariates which showed significantly different distribution between the two groups. This approach provided the advantage of maximizing the number of cases and controls we could use in statistical analyses. A p-value of 0.05 or less was considered statistically significant. SAS 9.4  was the software used for the analysis.2, 73% were males, 56.5% White, and 30% Hispanic A total of 200 PWH were evaluated in this analysis. Mean (SD) age was 50 (12.1) years, BMI 29.1 (6.0) kg/m2], were more likely to be White (69.8% vs 44.2%), had larger waist circumference [105.7 (15.6) vs 97.3 (15.1) cm], higher ALT [37.4 (24.3) vs 22.8 (11.8) U/L], and higher AST [30.0 (16.8) vs 21.3 (7.9) U/L] . They also tended to have higher frequency of type 2 diabetes  and use of hypoglycemic agents . There were no differences between the two groups in age, proportion with history of acquired immunodeficiency syndrome, absolute or nadir CD4+ T cell counts, proportion with nadir CD4 <200, ART exposure, or HIV-1 RNA suppression levels PWH with HIV NAFLD, compared to PWH without HIV NAFLD, had higher mean (SD) BMI  and MCS [50.3 (12.2)] In subgroup analysis of HIV NAFLD, no significant differences were observed between those with and without clinically significant fibrosis S1 Table), NAFLD or NAFLD with clinically significant fibrosis were not associated with PCS or MCS in PWH. Older age, higher BMI, Black race, larger waist circumference, diabetes and higher triglycerides levels were associated with worse PCS. Black race, non-Hispanic ethnicity, higher triglycerides levels, insulin levels, and absolute and nadir CD4+ T cell counts were associated with worse MCS, whereas older age, higher BMI, and larger waist circumference were associated with better MCS scores.On univariate analysis (+ T cell counts (negatively) were independently associated with MCS in PWH.On multivariate analysis S2 Table). Participants with HIV-NAFLD, compared to those with primary NAFLD, were less frequently cisgender females (18.4% vs 62%), White (71.3% vs 94.3%), and more frequently of Hispanic ethnicity (29.9% vs 1.3%). They had lower BMI (SD) [30.5 (5.7) vs 35.8 (7.4) kg/m2] and lower frequency of obesity (44.8% vs 79.3%) and diabetes (17.4% vs 38%). Participants with HIV-NAFLD also had lower AST [30.2 (16.1) vs 35.0 (18.7) U/L] and lower frequency of clinically significant fibrosis (12.6% vs 45.2%) than those with primary NAFLD.There were distinct differences in the characteristics of participants with NAFLD between the two groups  vs 67.5 (28.7)], role limitations due to physical health [74.4 (38.3) vs 57.9 (43.4) vs], pain [70.8 (27.8) vs 58.1 (26.0) vs], general health [67.8 (24.1) vs 51.0 (23.1)], and better PCS [47.8 (10.2) vs 40.2 (12.0)]. Compared to primary NAFLD, participants with HIV-NAFLD reported significantly better energy and fatigue [64.5 (25.0) vs 42.5 (23.0)], with trends toward worse emotional well-being, role limitations due to emotional problems, social functioning and MCS.S3 Table), variables associated with better PCS included HIV NAFLD, male sex, \u201cOther\u201d race, Hispanic ethnicity, and higher platelet levels, whereas clinically significant fibrosis, older age, higher BMI, diabetes, and higher triglyceride and glucose levels were associated with worse PCS. After adjustment for significant covariates in the multivariate analysis In a univariate analysis (S3 Table). Of these variables, only male sex and Hispanic ethnicity were independently associated with better MCS in the multivariate analysis Factors associated with better MCS in univariate analysis were older age, male sex and Hispanic ethnicity whereas higher platelets, triglycerides, glucose and insulin levels were associated with worse MCS .With the availability of effective therapies for viral hepatitis, NAFLD has emerged as the leading cause of liver disease in PWH . HIV-NAF2 and 29.4% of participants with HIV RNA above the chosen 50 copies/ml threshold of suppression. While HRQOL in that study was lower in PWH and fatty liver  than PWH without fatty liver, fatty liver was not independently associated with HRQOL on multivariate analysis, whereas unemployment and waist circumference were. That fatty liver was not independently associated with HRQOL in that study is consistent with our findings. In a follow up study, the same group from Germany used an HIV-specific tool (MOS-HIV survey) to assess HRQOL in PWH https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 7 Dec 2022December 7, 2022Dr. Pavel StrnadAcademic EditorPLOS OneManuscript PONE-D-22-24135: \u201cNon-alcoholic Fatty Liver Disease is Not Associated with Impairment in Health-related Quality of Life in Virally Suppressed Persons with Human Immune Deficiency Virus\u201dDear Dr. Strnad,We would like to thank you and the Reviewers for your insightful and constructive comments that have helped us improve and strengthen our manuscript. Based on your comments, we have modified the manuscript. Below, we have addressed all specific comments individually and made the corresponding changes to the draft.Competing interests: Dr. Gawrieh consulting: TransMedics, Pfizer. Research grant support: Viking, Zydus, and Sonic Incytes. Dr. Corey serves on the scientific advisory board for Theratechnologies, Novo Nordisk and BMS and has received grant funding from Boehringer-Ingelheim, BMS and Novartis, Dr. Lake receives research support from Gilead Sciences and Zydus. In the past 12 months she has received research support from Pfizer, CytoDyn, and Oncoimmune, and has served as a consultant to Merck and Theratechnologies, Dr. Samala, Dr. Desai, Dr. Debroy, Ms. Sjoquist, Ms. Robison, Ms. Bhamidipalli, Dr. Saha, Dr. Zachary, and Dr. Tann have nothing to disclose , Dr. Akisik\u2026., Dr. Robbin has served as a consultant for SEED , Dr. Gupta reports consultancy/advisory fees from Gilead Sciences, Inc. and ViiV Healthcare and research support from the NIH, Indiana University School of Medicine, and ViiV HealthCare, Dr. Chung has received research grant support (to institution) from Boehringer Ingelheim, BMS, Roche, Gilead, Janssen, and GSK , Dr. Chalasani has ongoing research support from Eli Lilly, Galectin Therapeutics, Intercept, and Exact Sciences, In the past 12 months, he has received consulting fees from Abbvie, Madrigal, Nusirt, Allergan, Siemens, Genentech, Zydus, La Jolla, Axcella, Foresite Labs, and Galectin Therapeutics. This does not alter our adherence to PLOS ONE policies on sharing data and materialsWe hope you will consider our revised paper for publication in PLOS One.Sincerely,Samer Gawrieh, MD on behalf of all the authors Indiana University School of MedicineJournal CommentsJournal Requirements:1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfAuthors response: Done. We have reformatted our manuscript according to PLOS ONE's style requirements.2. Please include your full ethics statement in the \u2018Methods\u2019 section of your manuscript file. In your statement, please include the full name of the IRB or ethics committee who approved or waived your study, as well as whether or not you obtained informed written or verbal consent. If consent was waived for your study, please include this information in your statement as well.Authors response: Done. These statements are now included in the methods: \u201c Each participant provided a signed informed consent. The study protocol was approved by each site\u2019s Institutional Review Board (IRB).\u201dAND \u201cIndiana University IRB approved the protocol. Each participant provided a signed informed consent.\u201d3. Thank you for stating the following in the Competing Interests section: \"Dr. Gawrieh consulting: TransMedics, Pfizer. Research grant support: Cirius, Galmed, Viking and Zydus. Dr. Corey serves on the scientific advisory board for Theratechnologies, Novo Nordisk and BMS and has received grant funding from Boehringer-Ingelheim, BMS and Novartis, Dr. Lake receives research support from Gilead Sciences and Zydus. In the past 12 months she has received research support from Pfizer, CytoDyn, and Oncoimmune, and has served as a consultant to Merck and Theratechnologies, Dr. Samala, Dr. Desai, Dr. Debroy, Ms.Sjoquist, Ms. Robison, Ms. Bhamidipalli, Dr. Saha, Dr. Zachary, Dr. Akisik, and Dr. Tann have nothing to disclose. Dr. Robbin has served as a consultant for SEED , Dr. Gupta reports consultancy/advisory fees from Gilead Sciences, Inc. and ViiV Healthcare and research support from the NIH, Indiana University School of Medicine, and ViiV HealthCare, Dr. Chung has received research grant support (to institution) from Boehringer Ingelheim, BMS, Roche, Gilead, Janssen, and GSK , Dr. Chalasani has ongoing research support from Eli Lilly, Galectin Therapeutics, Intercept, and Exact Sciences, In the past 12 months, he has received consulting fees from Abbvie, Madrigal, Nusirt, Allergan, Siemens, Genentech, Zydus, La Jolla, Axcella, Foresite Labs, and Galectin Therapeutics.\"http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: \"\"This does not alter our adherence to PLOS ONE policies on sharing data and materials.\u201d . Thus, these data suggest that screening for high risk NAFLD with hepatic fibrosis is warranted in PWH.The same study reported on an HIV-specific tool and observed impact of significant fibrosis on QoL \u2013 this could be added in the discussion (PMID: 35996039)Authors response: Thank you for this note. We have now added the following section in the discussion to highlights this study: In a follow up study, the same group from Germany used an HIV-specific tool (MOS-HIV survey) to assess HRQOL in PWH (37). In addition to confirming the importance of metabolic factors, lower socioeconomic status and presence of significant fibrosis were also noted to negatively affect the HRQOL in PLWH. It could be mentioned that alcohol assessment (ADUIT >8) leaves room for harmful alcohol consumption if not assessed clinically.Authors response: Thank you for this comment. At your suggestion, we have now added the following paragraph to the discussion.In this study, we applied an alcohol use questionnaire, AUDIT, to survey participants for excessive and harmful drinking. While this may not be feasible in clinical practice, obtaining alcohol consumption history during clinical encounters is a feasible and alternative way to screen for harmful alcohol consumption.QoL is strongly impacted by sex with women reporting lower levels of QoL in all analysis. I could not see lower OoL in this analysis (table 2) \u2013 clearly here a male dominance and transgender aspect could be the reason for this. Then again male sex was associated with higher levels in supp. Table 3. Please comment.Authors response: We thank the Reviewer for this comment. Please allow us to clarify.When we look at HRQOL specifically in PWH, we see numerical but non-significant differences in PCS and MCS between women and men . Indeed, after adjusting for covariates, gender was not an independent factor influencing PCS or MCS in PWH . When we look at ALL patients with NAFLD (with and without HIV), data shown in supplementary Table 3  and main Table 5 , women had significantly lower PCS and MCS than men.To clarify this, we have added the following paragraph in the discussionIn PWH, we did not observe an independent association between gender and HRQOL. However, in patients with NAFLD (with and without HIV), male sex was independently associated with better HRQOL as reflected by better PCS and MCS.Please indicate when the SF-36 was completed in relation to the diagnostic test for NAFLD. At the same time? Up to 6 or 12 month ?Authors response: The SF-36 was completed the same day of the diagnostic testing for NAFLD (ultrasound and Fibroscan). We have now clarified this in the methods and added the following sentenceAt the time of enrollment (same day of the diagnostic testing for NAFLD), participants also completed the 36-item Short Form (SF-36) Health Survey version 1.0. In the literature there have been reports of TAF impacting obesity \u2013 can you provide data on the ART backbone?Authors response: Thank you for this suggestion. We have now added the detailed ART data to Table 1. The Reviewer is correct, there was a trend for PWH with NAFLD to have higher exposure to TAF. We have added the following sentence to the results to summarize additional the ART data:PWH with HIV NAFLD, compared to PWH without HIV NAFLD tended to have longer duration of HIV infection (16.6 (10.1) vs 14.0 (9.6) years, P =0.07), had more exposure to non-nucleoside reverse transcriptase inhibitors  and Tenofovir Alafenamide . Reviewer #2: -In table 1 must be added the antiretroviral drug classes that PLWH are taking and the duration of HIV infectionAuthors response: Thank you for this suggestion. We have now added these data to Table 1 and updated the results sections to reflect that by adding this paragraph:PWH with HIV NAFLD, compared to PWH without HIV NAFLD tended to have longer duration of HIV infection (16.6 (10.1) vs 14.0 (9.6) years, P =0.07), had more exposure to non-nucleoside reverse transcriptase inhibitors  and Tenofovir Alafenamide 72.4% vs 59%, P = 0.06).-nadir CD4 is significantly associated with HRQOL ; how many patients were affected by severe opportunistic infections during their clinical history?Authors response: Thank you for this suggestion. We have now added the proportion of participants with nadir CD4 <200 and history of AIDS data to table 1 and added the following paragraph to the results: There were no differences between the two groups in age, proportion with history of acquired immunodeficiency syndrome, absolute or nadir CD4+ T cell counts, proportion with nadir CD4 <200, ART exposure, or HIV-1 RNA suppression levels Table 1. -no data on therapy for diabetes are included ; it could be better to have data on the percentages of patients on therapy because these data could impact on HRQOLAuthors response: Thank you for this suggestion. All PWH who had diabetes were on hypoglycemic agents with a trend for PWH with NAFLD to be on these more than PWH without diabetes. We have now added the proportion of participants on diabetes medications to Table 1 and to the results section: PWH with HIV NAFLD, compared to PWH without HIV NAFLD, \u2026\u2026 also tended to have higher frequency of type 2 diabetes  and use of hypoglycemic agents . 14 Dec 2022Non-alcoholic Fatty Liver Disease is Not Associated with Impairment in Health-related Quality of Life in Virally Suppressed Persons with Human Immune Deficiency VirusPONE-D-22-24135R1Dear Dr. Gawrieh,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Pavel StrnadAcademic EditorPLOS ONEAdditional Editor Comments :Thank you for giving me the opportunity to handle this interesting manuscript!Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0I Don't Know********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Nothing to add - thorough analysis - in their revision, my previous comments have been addressed.Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Yes:\u00a0J\u00f6rn M. Schattenberg M.D.Reviewer #1:\u00a0Reviewer #2:\u00a0No********** 1 Feb 2023PONE-D-22-24135R1 Non-alcoholic fatty liver disease is not associated with impairment in health-related quality of life in virally suppressed persons with human immune deficiency virus Dear Dr. Gawrieh:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Pavel Strnad Academic EditorPLOS ONE"}
+{"text": "Serum amyloid A (SAA) concentrations are increased in cats with lymphoma vshealthy cats; however, the association between SAA concentrations andprognosis in cats with lymphoma is unclear. The aim of this study was toevaluate if SAA concentrations were different in cats with nasal vsnon-nasal lymphoma, if SAA concentrations are prognostic in patients treatedwith high-dose chemotherapy and if SAA concentrations are correlated withother clinicopathological variables.Cats diagnosed with intermediate- or large-cell lymphoma between 2012 and2022 with SAA concentration data available were included. Associationsbetween tumour site , stage, response to treatment andSAA concentration were evaluated using non-parametric statistics.Associations between SAA concentrations and stage with survival time wereevaluated using Cox regression analysis. Patients with nasal tumours andthose not receiving high-dose chemotherapy were excluded from the survivalanalyses.Thirty-nine cats were included. Median SAA concentrations were significantlyhigher in non-nasal compared with nasal lymphoma . SAAconcentrations did not correlate with tumour stage. Median survival time forpatients with non-nasal tumour and undergoing chemotherapy was 49 days(range 2\u20131726). Responders had a better median survival time thannon-responders , whereas SAA concentrations were not associated with survivaltime. Lower haematocrit at presentation was associated with a reduced mediansurvival time (P\u2009=\u20090.007).In the population examined, no correlation between serum concentration of SAAand prognosis in patients with lymphoma was identified, while lowhaematocrit and lack of response to treatment were both found to beassociated with survival time. SAA concentrations were elevated in patientswith non-nasal lymphoma vs patients with tumours confined to the nasalcavity. A secondary aim was to correlate SAA concentrations with other clinical andpathological variables, which were previously advocated as potential prognosticfactors in other studies, in the same cohort of patients.\u00b0C) samples obtained at the time of presentation. SAAconcentrations were measured on an Olympus AU400 or AU480 analyser using a humanimmunoturbidimetric assay previously validated for use in cats.29 Thelaboratory reference interval for SAA concentration was <0.5\u2009\u00b5g/ml and the limit blank of the assay was0.3\u2009\u00b5g/ml.The medical records of a university referral hospital were reviewed between January2012 and March 2022 for cats diagnosed with lymphoma. Patients were included if theyhad a cytological or histological (\u00b1\u2009immunohistochemistry) diagnosis ofintermediate-to-large-cell lymphoma. Patients with a diagnosis of small-cell orlarge granular-cell lymphoma were excluded from the study. SAA concentration datawere retrieved from the previous medical history or measured using archived frozen and non-responders .Response to treatment was classified as complete remission (CR) if a completedisappearance of the visible disease was noted; partial remission (PR) if the lesionwas reduced by at least 30% of its initial size but had not completely disappeared;stable disease (SD) if the disease had either reduced by less than 30% or increasedup to 20%; or progressive disease (PD) if the disease had increased by more than20%. Chemotherapy adverse events and their grade were classified according to theVeterinary Cooperative Oncology Group criteria.31 Median survival time wasmeasured from the time of diagnosis to the time of death for any cause. Patientsthat did not receive high-dose chemotherapy, patients diagnosed in 2022 (due toshort follow-up time) and patients with nasal lymphoma were excluded from theresponse-to-treatment and survival analysis. Exclusion criteria for the singlegroups analysed are summarised in Neutrophil count, haematocrit (Hct) and serum albumin at presentation were alsorecorded. Patients were excluded if they received any treatment with chemotherapy,steroids, radiation therapy or surgery before SAA measurement. Follow-up informationwas retrieved from the medical records of the hospital or by contacting thereferring veterinary surgeons. Only patients that underwent full staging, includingthoracic (thoracic radiographs or thoracic CT), abdominal  imaging and fine-needle aspiration of the spleen and liver were included whenevaluating the association between tumour stage and SAA concentrations. Based onthese findings, patients were retrospectively staged according to a previouslydescribed staging system .30 The nP value<0.05 was considered to be statistically significant.Statistical analysis was performed using commercially available statistical software. For statistical purposes, a SAA concentration below thelimit of blank of the assay (0.3\u2009g/l) was assigned an arbitrary value of 0.15\u2009mg/l.The Kruskal\u2013Wallis or Mann\u2013Whitney U-test was used to compare SAA concentrationsbetween groups (stage and site). Spearman\u2019s correlation coefficient was used toevaluate associations between continuous variables. Kaplan\u2013Meier survival curveswere constructed to calculate the median survival times of different groups, withsurvival between different groups compared using the log-rank test. Univariable Coxregression analysis was used to evaluate the association between SAA concentration,stage, site  and response to treatment (responder vsnon-responder) with overall survival time . Data are presentedas median (range), unless otherwise specified, and a During the study period, a total of 39 cats met the inclusion criteria. Domesticshorthair was the most represented breed (n\u2009=\u200931), followed by domestic longhair(n\u2009=\u20091), Tonkinese (n\u2009=\u20091), Norwegian Forest Cat (n\u2009=\u20091), British Shorthair(n\u2009=\u20091), Ragdoll (n\u2009=\u20091), Russian Blue (n\u2009=\u20091), Siamese (n\u2009=\u20091) and Birman(n\u2009=\u20091). The median age of the population was 9 years (range 3\u201317). Maleneutered cats were the most common (n\u2009=\u200928), followed by female neutered(n\u2009=\u200910) and female entire (n\u2009=\u20091). Feline immunodeficiency virus and felineleukaemia virus status was available in 24 cases, and was negative in all testedcases.Alimentary lymphoma was the most common anatomical classification (n\u2009=\u200920),followed by renal (n\u2009=\u20097), nasal (n\u2009=\u20095), mediastinal (n\u2009=\u20092), splenic (n\u2009=\u20092),CNS (n\u2009=\u20091), skin (n\u2009=\u20091) and submandibular lymph node (n\u2009=\u20091). Lymphoma wasdiagnosed in more than one site in 28 cases, of which locoregional lymph nodeswere the most common site involved (n\u2009=\u200921), followed by the liver (n\u2009=\u20097),spleen (n\u2009=\u20095), kidneys (n\u2009=\u20094), bone marrow (n\u2009=\u20092) and lungs (n\u2009=\u20091), andsuspected myocardium (n\u2009=\u20091).Diagnosis was achieved by cytology alone in 21 cases and by histology alone insix. Diagnosis was confirmed by cytology and histology in 12 cats. The lymphomawas classified as intermediate cell in seven cases and as large cell in theremaining 32. The immunophenotype was available in 11 cases, and was assessed byimmunohistochemistry in nine cases and by flow cytometry in two. Immunophenotypewas characterised as a B-cell neoplasia in five cases, T-cell neoplasia in fourcases and as showing an aberrant, suspected NK immunophenotype in two. In thefirst case, the diagnosis of an NK immunophenotype was suspected as, on flowcytometry, the majority of gated cells lacked expression of any of the testedmarkers  other than CD18. In the second case, onimmunohistochemistry, the neoplastic cells were negative for CD3 and CD79a(these were the only markers tested).Thoracic imaging was performed in 26 cases; by CT scan in five cases and bythoracic radiographs in the remaining 21. Abdominal US was performed on 32patients. Sixteen of these patients underwent US-guided fine-needle aspirationof the spleen and liver. Patients were classified as stage 1 in two cases, stage2 in three, stage 3 in two, stage 4 in six and stage 5 in three.Of the entire population examined, 32 patients received chemotherapy alone, threepatients radiation therapy alone, three were treated with palliativeprednisolone only, and one received radiation therapy and chemotherapy. Of thepatients treated with chemotherapy alone, 26 underwent a high-dose COP protocoland six received lomustine and prednisolone. One patient that received radiation therapy and chemotherapy was treated with lomustine. Themedian number of chemotherapy doses administered in patients undergoing a COPprotocol was five (range 1\u201312), while it was two (range 1\u20135) in the patientsreceiving lomustine. Lomustine  was given at 10\u2009mg/cat every4\u20135 weeks in all cases. Data regarding the treatment received are summarised inThe overall response rate for the population receiving chemotherapy alone  was 52%. The date of diseaseprogression was recorded in 23/34 cats. The median time to first progression was36 days (range 2\u2013887). Rescue protocols were used in 14 cases. Lomustine was themost common rescue agent (10 cases), followed by COP (one case), L-asparaginase(one case), and vincristine and cytarabine (one case). Radiotherapy was used inone case. The median time to second progression was 20 days (range 2\u2013481). Onlyone patient received a second rescue protocol with cytarabine and prednisoloneand was euthanased 24 days later owing to progressive disease. At the time ofwriting, 33 patients were deceased. Of these, 31 died as a result oftumour-related causes, one died after trauma on day 750 and one died from heartfailure due to a previously diagnosed restrictive cardiomyopathy at day 32.When patients with nasal lymphoma and patients that did not receive chemotherapywere excluded (n\u2009=\u200925), the median survival time was 49 days (range 2\u20131726).Median survival time for cats with nasal lymphoma was 250 days (range31\u20132422).SAA concentrations were measured at the time of diagnosis in 22/39 cases and on afrozen stored sample in the remaining 17 cases.P\u2009=\u20090.026).Median SAA concentration for the entire population was 5.3\u2009\u00b5g/ml and ranged from<0.3 to 796.7\u2009\u00b5g/ml. SAA was elevated (>0.5\u2009\u00b5g/ml) in 25 patients (64%).SAA concentrations were significantly higher in patients with non-nasal comparedwith nasal lymphoma . Median serum albumin level was 25\u2009g/l(range 17\u201338). When compared with other clinicopathological values, SAAconcentration showed a weak positive correlation with neutrophil count anda weak negative correlation with serum albumin concentration.There was no statistically significant correlation between SAA concentrationsand Hct .Median Hct was 26% (range 14\u201347%), and the median neutrophil count was10\u2009\u00d7\u200910After excluding patients that did not undergo full staging, 16 were available foranalysis. SAA concentration of cats with different stages of lymphoma are shownin After the exclusion of patients with nasal lymphoma, patients that did notreceive any treatment, and patients diagnosed in 2022, 25 patients were includedin the survival analysis. Of these, 22 were treated with a COP protocol andthree with a lomustine protocol.P <0.001). SAAconcentrations were not significantly associated with survival time . Hct also tended towards a statistically significantassociation with survival time on univariable analysis .In the univariable analysis, response to initial treatment was the only factorthat was statistically significantly associated with survival time, withresponders living significantly longer than non-responders  and response to treatment  were found to be independentlyassociated with increased survival time.In the multivariable analysis, increasing Hct , while increasing Hct  and response to treatment  remained statistically significantlyassociated with increased survival time.When the three cats treated with lomustine were excluded and only cats treatedwith COP were included in the analysis, SAA concentration was not statisticallysignificantly associated with survival time . Therefore, we do not believe that the use of frozen samples would havesignificantly confounded our data.To our knowledge, there are no published studies regarding the stability of SAA infrozen samples in cats. A recent study in dogs did not show a significant differencein SAA concentration in frozen samples after 3 and 6 months.SAA concentration does not appear to be of value as a prognostic marker in catsundergoing chemotherapy for non-nasal, intermediate-to-large-cell lymphoma. However,the SAA concentration was elevated in patients with non-nasal lymphoma vs patientswith a nasal form of the tumour. Further prospective studies with a largerpopulation are required to confirm these findings."}
+{"text": "Between January 2018 and December 2020, twenty patients (7 men and 13 women) with peripheral high-flow arteriovenous malformations who were treated primarily with arterial embolization using squid were retrospectively included. Anatomical sites being treated included the head and neck (16), extremities (2), uterus (1), and pelvis (1). Squid was used as the sole embolic agent in 15 patients, and transarterial embolization was employed in all cases except one where direct puncture embolization was used. Treatments were delivered over one or two sessions, with or without surgery. A total of 27 sessions were carried out with an interval time ranging from 6 to 36 months between sessions.  Technical success was achieved in all cases. In those patients treated with squid alone, 13 exhibited total devascularization following embolization, and a further 4 required surgical excision to achieve complete obliteration of the arteriovenous malformation. There were no major complications, cases of microcatheter entrapment, or dimethyl sulfoxide-related pain recorded. On follow-up, one patient reported persistent pain, and another patient developed a garlicky taste. All other patients reported complete resolution of symptoms following treatment.  This study demonstrates the successful use of squid in managing peripheral arteriovenous malformations with low complication rates and long-term stable results, therefore validating its efficacy when used alone or in combination with other embolic agents. Squid may be the preferred embolic agent in any interventional radiologist's armamentarium as it offers formulations with varying viscosities (squid-18 and squid-12). We conclude that squid should be considered as a first-line embolic agent in the management of peripheral arteriovenous malformations. Arteriovenous malformations (AVMs) are vascular lesions that can develop in any part of the body and are characterized by the presence of arteriovenous microfistulae through a vascular nidus. They have a congenital etiology, and the location, scale, and degree of arteriovenous shunting through the lesion determine the symptomatology and clinical features of AVMs . PeripheThe use of ethylene-vinyl alcohol (EVOH) copolymers was first reported by Akmangit et al. and paved the way for innovative embolic agents to be developed in the management of peripheral AVMs , 4. OnyxSimilarly, squid is another nonadhesive EVOH-based liquid embolic agent that is available in two versions (squid-12 and squid-18). Squid-12 has been shown to have an added advantage when utilized for embolization of AVMs due to its lower viscosity and higher distal penetration . The essIn this study, we present our treatment experience with using squid as the primary embolic agent in 20 patients who presented with peripheral AVMs.A retrospective analysis of patients who were treated for peripheral AVMs with embolization using squid alone or in conjunction with other embolic agents between January 2018 and December 2020 was conducted. 20 patients  with ages ranging from 5 to 45 years were identified and included in the study.All cases were discussed and managed by a multidisciplinary team comprising of plastic surgeons, interventional radiologists, and dermatologists. Prior to referral, patients had already undergone computerized tomography angiography (CTA), magnetic resonance imaging (MRI), or magnetic resonance angiography investigations. The patient's presenting complaint, angioarchitecture on digital subtraction angiography (DSA), and contrast-enhanced tests were used to reach a multidisciplinary consensus on whether embolization could be followed by surgery or not. All patients were counseled comprehensively about the proposed treatment and its possible side effects to ensure informed consent. The choice of embolizing material depends upon the availability and the type of AVM.Data regarding the anatomical site, clinical symptoms, history of prior treatments, number of embolization sessions needed, embolic agents used, technical outcomes of procedures, and complications was extracted for analysis in the study. Patients were followed up for an average period of 6-36 months, and outcomes were assessed using clinical examination, review of symptoms , follow-up imaging (MRI/CTA), and delayed complications.All squid embolization sessions were performed under general anaesthesia on a biplane angiography unit. In our unit, embolization is normally delivered as an adjuvant treatment with a view to reduce the size of the AVM nidus and obliterate fistulous components, facilitating definitive surgical excision and total cure in a few selected cases.Vascular access was obtained through the transfemoral route for all procedures. Treatment was preceded by diagnostic angiography to analyse the feeders in difficult cases; however, in most cases, the diagnostic and therapeutic procedure was done in the same session. A guiding catheter was used as an intervention in every procedure. The microcatheter\u2013wire assembly was navigated under roadmap guidance, commonly into the most accessible dominant feeder supplying the nidus. Once the distal position was achieved, the flow was assessed with superselective angiograms, and the microcatheter position was further refined to achieve the wedge position. All microcatheters that were used were dimethyl sulfoxide (DSMO) compatible both with detachable and nondetachable tips. All microcatheters were navigated using microwires of size 0.08. If wedging did not occur, we created a pseudowedge effect by creating a small plug of squid around the microcatheter tip to prevent reflux. Embolization was continued as long as nidal percolation occurred without the embolic material entering into the draining vein or refluxing around the microcatheter tip. When either of these occurred, the flow was redirected by briefly pausing the injection for an interval of fewer than 2 minutes and then resumed. Multiple feeders were accessed in the same or consequent procedures. Embolization was terminated if complete embolization was achieved angiographically, and significant reflux occurred around the microcatheter tip or further embolization of the AVM was deemed risky. The microcatheter was retrieved using controlled traction.Squid, a liquid embolic agent based on ethylene-vinyl alcohol, was used for embolization alone or in addition to other embolic agents. Variations of squid which were administered included squid-18 and squid-12 which exhibit high and low viscosity, respectively. To increase the embolizing force, squid was either used in conjunction with other embolizing agents  particles/Bleomycin) or alone. The squid was constantly combined with a \u201cshaker unit\u201d (time = 20 minutes) up to the point of use in order to create a fluoroscopically visible tantalum suspension. DMSO-compatible microcatheters were used for administration, with the dead space in the microcatheter being filled with DMSO before squid infusion. The squid was injected into the target vessel with a 1\u2009ml syringe for 45 seconds to replace the DMSO in the microcatheter's dead space, followed by gradual retrieval to avoid trapping. It was injected slowly (60\u201390\u2009s) to mitigate DMSO toxicity and preserve tolerability even though thromboembolism of small vessels.A total of 20 patients were taken up for embolization of peripheral AVMs between Jan 2018 and Dec 2020. Of these, 16 patients had head and neck AVMs, 2 AVMs on extremities, 1 uterine, and 1 at the pelvic location. 13 patients were female, and 7 patients were male with ages ranging from 5 to 45 years. The most common presentation was that of pulsatile swelling followed by pain, cosmetic disfigurement, and haemorrhage in descending order.Squid-12 and 18 were the sole liquid embolic agents used in 15 cases. In the other 5 cases, additional embolic agents such as PVA particles and coils were also used. Both detachable and conventional DMSO-compatible microcatheters were used in all procedures. In one case, percutaneous puncture embolization was also required. A total of 27 sessions of embolizations were performed. The average volume of squid used in each case was 2.5\u2009ml, and the average duration of injection was 25 minutes.13 AVMs were completely obliterated by sole embolization with squid, and a further 4 AVMs were almost completely obliterated with surgical excision following embolization. In 2 cases, there was partial embolization, but they refused further treatment, and in a single case, there was temporary relief followed by recurrence , as well as rapid shunting within the lesion and outflow into enlarged anterior tibial veins. A microcatheter microwire assembly, which was DMSO compatible, was navigated from the left common femoral artery to the right popliteal artery. Both ATA and PTA were engaged super selectively, and squid-12 was administered in a pulsatile fashion until no more shunting was evident, and a small amount of squid was refluxed into the proximal draining veins.Postembolization angiography revealed total obliteration of the AVM and excellent perfusion of the remainder of the foot. The patient made an uneventful recovery and was symptom-free at 1-year follow-up .A 45-year-old female with an insignificant medical history presented with a progressively increasing swelling involving the upper lip, left cheek, and ipsilateral mandible. Bruit was evident on palpation of the lesion, and CTA revealed a large facial AVM with multiple feeders arising from the left external carotid artery. Following a multidisciplinary review, an endovascular procedure was planned because of the high risk of intraoperative haemorrhage.A head and neck DSA was performed which revealed multiple feeders, including the internal maxillary artery and linguofacial trunk on the left side, draining into superficial veins. Feeding arteries were super selectively catheterized, and both squid-18 and 12 were used for embolization. Postembolization angiogram confirmed complete obliteration of the AVM, and the patient's clinical symptoms resolved completely after a month. The patient remained symptom-free at the 12-month follow-up however refused cosmetic surgery to manage the residual disfigurement .AVMs are congenital in nature, and they can occur in any anatomical location and can be surrounded by bony or soft tissue coverage . AVMs prYakes developed a new classification system for such lesions' angioarchitecture. Endovascular methods and embolic agents that can successfully ablate these AVMs are determined using the AVM Classification System. Yakes' classification contained lesions that, according to the International Society for the Study of Vascular Anomalies classification 2018, are considered arteriovenous fistulas (AVFs) rather than arteriovenous malformations (AVMs).A validated therapeutic alternative is endovascular transcatheter embolization of peripheral AVMs prior to surgical excision in selected cases. A variety of embolic agents can be utilized in this technique, and multiple sessions are often required to achieve the desired outcome .Liquid embolic agents seem to be the most appropriate for AVMs because of their capacity to form a cast that penetrates the nidus and occludes the various feeders . The safIn this report, we presented our first clinical experience with squid, a new EVOH copolymer. Squid has recently been launched in four separate formulations, i.e., 18, 18LD, 12, and 12LD. The LD (low density) models contain 30% lesser tantalum, which can aid in X-ray visualization of structures hidden behind thick embolic casts. The micronized tantalum particles in squid are smaller than those of Onyx, resulting in a more homogeneous solution. In this study, we only used the 12 and 18 formulations to resolve the target lesions. In general, squid-18 was chosen for initial plug forming in the embolized feeder, and injection was started with squid-12 because it penetrates the embolic cast more effectively than squid-18. Squid-18 behaved similarly to Onyx 18 in our view.Squid's lower tantalum concentration (30%), which may improve vascular visibility during embolization and minimize metallic artifacts during imaging follow-up, is another advantage over Onyx , 10.The squid was often infused into DMSO-compatible microcatheters, with the dead space in the microcatheter being filled with DMSO before the infusion. Using a 1\u2009ml syringe, the squid was pumped for 45 seconds to replace the DMSO in the dead space of the microcatheter and then into the target vessel, gradually retrieving the microcatheter to prevent trapping. To reduce DMSO toxicity and ensure tolerability, the squid was injected slowly over 60\u201390 seconds .Following intra-arterial injection, DMSO has been shown to cause an inflammatory response, vasospasm, and endothelial necrosis. It is worth noting that these findings are seen in studies using higher amounts and infusion speeds than what is usually used for cerebral Onyx embolization. Although DMSO metabolites are mostly excreted through the kidneys, they are also excreted through the lungs which may lead to possible pulmonary toxicity .A few other complications related to squid embolization are a slow setting time (1-3\u2009min), catheter retention, pigmentation, and high material cost. The injection is also painful, so general anaesthesia is mandatory . HoweverAnother advantage of squid is the presence of fewer beam artifacts, which helps to rule out the exact size of residual AVM in those cases where we intend to do radiosurgery after initial embolization. When compared to Onyx, the initial clinical encounter of squid reveals subjectively decreased artifacts on postembolization CT scans. On CT and flat-panel CT acquisitions, all four squid versions caused less beam hardening artifacts compared to Onyx 18. Squid LD variants generated fewer objects than their standard density counterparts .Transcatheter embolization with squid, with or without postembolization surgical excision, is a promising treatment choice for peripheral AVMs. Thanks to its slow polymerization, squid seems to have controlled embolization which allows for deep penetration in the nidus with less chance of catheter gluing due to its nonadhesive properties. There is a paucity of evidence in the current literature regarding the use of squid in the management of peripheral AVMs, and therefore, more research will be required to further characterize its safety profile in the peripheral vasculature."}
+{"text": "Mechanisticinformation for the formation of the unique low-valent tetrametalliccompound 4 was gathered by hydrogenation of the phenyl-substitutedprecursor [Ta(\u03b75-C5Me5)Ph(\u03bc-S)]2, which proceeds through a stepwise hydrogenation process,disclosing the formation of the intermediate tetranuclear hydridesulfide [Ta2(\u03b75-C5Me5)2(H)Ph(\u03bc-S)(\u03bc3-S)]2 (5). Extending our studies toward tantalum alkyl precursorscontaining functional groups susceptible to hydrogenation, such asthe allyl-and benzyl-substituted compounds [Ta(\u03b75-C5Me5)(\u03b73-C3H5)(\u03bc-S)]2 and [Ta(\u03b75-C5Me5)(CH2Ph)(\u03bc-S)]2 (2), enables alternative reaction pathways en route to theformation of 4. In the former case, the dimetallic systemundergoes selective hydrogenation of the unsaturated allyl moiety,forming the asymmetric complex [{Ta(\u03b75-C5Me5)(\u03b73-C3H5)}(\u03bc-S)2{Ta(\u03b75-C5Me5)(C3H7)}] (6) with only one propyl fragment.Species 2, in addition to the hydrogenation of one benzylfragment and concomitant toluene release, also undergoes partial hydrogenationand dearomatization of the phenyl ring on the vicinal benzyl unityto give a \u03b75-cyclohexadienyl complex [Ta2(\u03b75-C5Me5)2(\u03bc-CH2C6H6)(\u03bc-S)2] (7). The mechanistic implications of the latter hydrogenationprocess are discussed by means of DFT calculations.Hydrogenolysis ofa series of alkyl sulfido-bridged tantalum(IV)dinuclear complexes [Ta(\u03b7 5-C5Me5)R(\u03bc-S)]2, led to the isolationof the low-valent Ta(III) tetrametallic sulfur cube-type species [Ta(\u03b75-C5Me5)(\u03bc3-S)]4. Partial hydrogenolysis using phenyl, allyl, and benzyl moietiesreveals plausible reaction pathways to the cube-type species. DFTstudies confirm the low oxidation states of the synthesized compounds.Hydrogenation of a series of dimetallicalkyl/aryl/allylsulfide-bridge complexes of tantalum, [Ta(\u03b7 Remarkable examples of these reactionsreport the transformation of simple metal alkyl precursors into highlyvaluable low-valent species capable of mediating challenging transformations.In the field of small-molecule activation, Hou et al. reported howthe hydrogenolysis of a C5Me4SiMe3-ligated titanium trialkyl compound leads to the formation of a trinuclearheptahydride complex with ability to promote the C\u2013C bond cleavageof benzene,7 as well as the splitting andhydrogenation of N2.8 The sameHou also evidenced that these reactions can be extended to group 6as treatment of a chromium alkyl species supported by a C5Me4SiMe3 ligand with H2 in the presenceof N2 provides a tetranuclear diimide/dihydride complex[(Cp\u2032Cr)4(\u03bc3-NH)2(\u03bc3-H)2] (Cp\u2032 = C5Me4SiMe3), in which dinitrogen was reduced to NH2\u2013 fragments.9 Within group 5, Fryzuk11 explored the hydrogenation of [(SiNPN)TaMe3] (SiNPN = PhP(CH2SiMe2NPh)22\u2013), which resulted in the formation ofthe dinuclear tantalum hydride species [{(NPN)Ta}2(\u03bc-H)4]. Notably, the latter compound, besides mediating the fixationand functionalizing dinitrogen,12 also activates other small molecules such as CO2,13 CO,14 CS2,15 and N2H4.16 The versatility of this dimetallic system motivatedthe preparation and hydrogenation of other tantalum alkyl complexeswith modified NPN as ancillary ligands.18 Even thoughthese investigations provided new dimeric Ta species bridged by threehydride fragments, the generated products were unreactive toward smallmolecules, highlighting the major role played by the ancillary ligandin dictating the reactivity of the generated tantalum hydrides. Similarly,it is expected that modifying the fragments susceptible to hydrogenolysiswill result in new and exciting outcomes. However, a systematic studyof the hydrogenolysis of tantalum compounds bearing different reactivefragments with hydrogen has not been reported.Hydrogenolysis of early transition metalalkyl compounds is a convenientmethodology for the formation of low-valent transition metals viareductive elimination.5-C5Me5)R(\u03bc-S)]2 ,19 which possess potentially reactive M\u2013Cbonds. Building on these results, herein, we report the hydrogenolysisof the previous series of dimeric tantalum alkyl precursors, whichresults in the formation of a tetranuclear Ta(III) species. Replacementof the alkyl substituents by aryl, benzyl, and allyl fragments allowsthe isolation of different reaction intermediates, which is indicativeof the existence of multiple reaction pathways in the hydrogenationreactions toward the formation of the final tetranuclear Ta(III) product.In addition, DFT calculations provide insight into the electronicstructure of the tetranuclear Ta(III) species and the reaction mechanismof hydrogenolysis of Ta\u2013alkyl bonds in dimetallic complexes.Recent effortsin our laboratory have focused on the synthesisof dinuclear sulfido-bridged tantalum complexes containing cyclopentadienylas an ancillary ligand. This work resulted in the isolation of a seriesof bimetallic complexes of type [Ta(\u03b719 Compounds [Ta(\u03b75-C5Me5)R(\u03bc-S)]2  were prepared by thereaction of the dimetallic chloride species [Ta(\u03b75-C5Me5)Cl(\u03bc-S)]2 with thecorresponding alkylating reagent, [MgR2(thf)2]  or LinBu, at room temperaturein toluene or hexane R(\u03bc-S)]2  under analogous conditions was first investigated. In all cases, upon H2 splitting, the dimeric species lead to the formation of thetetranuclear tantalum(III) compound [Ta(\u03b75-C5Me5)(\u03bc3-S)]4 (4), arranged in a cubane-type structure, as outlined in 1H NMR only displays theformation of the corresponding alkane compound and one singlet at2.20 ppm assigned to the \u03b75-C5Me5 of the symmetrical species 4.Hydrogenolysis ofthe species [Ta \u00c5 are slightly longer than those foundfor the dinuclear precursors [Ta(\u03b75-C5Me5)R(\u03bc-S)]2  \u00c5),19 but similar to thoseobserved for the trinuclear complexes [Ta3(\u03b75-C5Me5)n3\u2013Cln3+(\u03bc3-Cl)(\u03bc-S)3(\u03bc3-S)] .19 Likewise, the intermetallic distance (Ta\u00b7\u00b7\u00b7Ta= 2.98(1) \u00c5)20 in 4 ismarginally longer than those registered for the dinuclear compounds(2.918(1)\u20132.951(1) \u00c5), but shorter than those found forthe trinuclear species (3.402(1)\u20133.545(1) \u00c5), or the cube-typederivatives [TaCl(NR)py(\u03bc3-S)]4.21The molecular structure of 4, we explored the hydrogenolysisof [Ta(\u03b75-C5Me5)Ph(\u03bc-S)]2 bearing aless basic phenyl moiety compared to previous alkyl fragments. Indeed,this process requires forcing the reaction conditions to 4 atm ofH2, 60 \u00b0C and 4 days to afford quantitatively thetetrametallic Ta(IV) hydride species [Ta2(\u03b75-C5Me5)2(H)Ph(\u03bc-S)(\u03bc3-S)]2 (5), as determined by X-raydiffraction analysis Ph] and [Ta(\u03b75-C5Me5)H] fragments linked by four bridging sulfuratoms. This molecular arrangement suggests that the formation of 5 combines the hydrogenolysis of only one phenyl group ofthe dinuclear dialkyl precursors with a dimerization process. Similarmolecular structures have been reported for the tetranuclear imidoand sulfur-bridged tantalum compounds [Ta4(\u03b75-C5H5)2(\u03bc-Cl)(NtBu)4py2(\u03bc3-S)2(\u03bc-S)2](C5H5).21 Further analysis of the molecularstructure of 5 reveals that within each dimer, one ofthe tantalum atoms exhibits a three-legged piano-stool geometry withthe cyclopentadienyl rings located on the apical positions and twosulfur atoms and one phenyl ligand occupying the basal apexes, whilethe vicinal tantalum exhibits a four-legged piano-stool with the cyclopentadienylrings located on the apical positions and three sulfur atoms and onehydride ligand occupying the basal apexes. Although the position ofthe hydride atom in the diamagnetic compound 5 was determined in thedifference Fourier map and its position refined, there is a slightuncertainty in this assignment due to the proximity of heavy tantalumand sulfur atoms that can overwhelm the small electron density ofthe H atom.Structurally, compound \u20131 in the IR spectrumand a highly upfield resonance in the 1H NMR spectrum at\u22124.98 ppm. The latter delta value compares well with the dataregistered for other tantalum terminal hydride species such as [Ta(\u03b75-C5Me5){\u03b75-C5H4(SiMe3)2}H(CNR)] .23 Supporting the idea that species 5 is an intermediate in the formation of compound 4,when a toluene solution of 5 was exposed to a dihydrogenatmosphere over a longer period of time, it led to the formation ofthe cubane compound 4 (The presence of the hydride ligand is further confirmedby theobservation of a band at 1633 cmmpound 4 3.5-C5Me5)(\u03b73-C3H5)(\u03bc-S)]2 with 7 atm of hydrogen atroom temperature for 4 days resulted in the hydrogenation of onlyone of the two allyl fragments, leading to compound [{Ta(\u03b75-C5Me5)(\u03b73-C3H5)}(\u03bc-S)2{Ta(\u03b75-C5Me5)(C3H7)}] (6) with a propyl moiety ] (NPN* =PhP(2-(N-mesityl)-5-Me-C6H3)2; BTA = bis(trimethylsilyl)acetylene) reported by Fryzuk,in which under controlled H2 pressure and short reactiontimes an alkene hydride tantalum species generated by partial hydrogenationis isolated.18A similar process can be foundfor the hydrogenolysis of the alkynebenzyl tantalum compound [(NPN*)Ta(BTA)(\u03bc-S)]2 compared to the similar bimetallic alkyl precursors.19 For instance, the Ta\u00b7\u00b7\u00b7Ta distanceof 3.033(1) \u00c5 is close to those registered for the species [Ta(\u03b75-C5Me5)R(\u03bc-S)]2  and species with the Ta\u2013Tasingle bond in the oxidation state (IV).24The solid-state structureof complex  studies 3, reveal5-C5Me5)(CH2Ph)(\u03bc-S)]2 (2), which reacts with H2 (<1 atm) at 65 \u00b0C in toluenesolution to produce the hydrogenolysis of one alkyl moiety, whilethe second one is transformed into a cyclohexadienylmethylene fragmentthrough a hydrogenation process, forming the species [Ta2(\u03b75-C5Me5)2(\u03bc-CH2C6H6)(\u03bc-S)2] (7) 2] (7) 5.7 displaystwo signals at very different chemical shifts (\u03b4 = 2.05 and1.76) due to the presence of two inequivalent pentamethylcyclopentadienylligands. The four methine protons of the cyclohexadienyl fragmentresonate as multiplets at \u03b4 5.00, 3.71, 2.99, and 2.27, whilethe two diastereotopic methylene units (cyclohexadienyl and Ta\u2013CH2C6H6) were found as AX spin systemsat \u03b4 3.49, 2.56 (2J = 11.0 Hz) andat \u03b4 0.25, 1.12 (2J = 11.0 Hz),respectively. Additionally, the 13C NMR spectrum exhibitedtwo signals for these methylene groups at \u03b4 29.2 and 65.7. Finally,we observed that compound 7 can be transformed into thetetrametallic tantalum(III) compound 4 by reaction withH2 (1 atm) at 70 \u00b0C for several days.NMR spectroscopy for the diamagneticcomplex 7, along with a selection of interatomicdistances and angles, is depicted in 2C6H6 fragment. The partialhydrogenation and dearomatization of the latter moiety are evidencedby the position of C57, which is located \u22480.55 \u00c5 abovethe plane formed by the C52\u2013C56 atoms. Although both metalcenters exhibit a three-legged piano-stool geometry, formed by a pentametylcyclopentadienylring and two sulfur atoms, the third position is differently occupiedby a methylene group in the case of Ta2, and a \u03b75-cyclohexadienyl moiety for Ta1. The bond distances from Ta1 to thecarbon atoms of the \u03b75-cyclohexadienyl fragment arein the range of 2.33(1)\u20132.51(1) \u00c5, which is similar tothe metrical parameters found for a related tantalum compound reportedby Tilley,26 in which a \u03b75-cyclohexadienyl fragment, also generated by hydrogenation of a phenylring, interacts with a vicinal Ta atom. The distance between the twometal centers (2.988(2) \u00c5) is slightly longer than those observedin the alkyl precursors [Ta(\u03b75-C5Me5)R(\u03bc-S)]2 , but still within the range for an intermetallic bonding interaction.19The solid-statestructure of one of the two crystallographic independentmolecules of 1\u20133, the tetranuclear [Ta(\u03b75-C5Me5)(\u03bc3-S)]4 (4), and [Ta2(\u03b75-C5Me5)2(H)Ph(\u03bc-S)(\u03bc3-S)]2 (5). Similarly to our previous studies on theelectronic configuration of dinuclear sulfide Ta(IV) species,27 compounds 1\u20133 display a HOMO orbital consistingof a \u03c3-bonding combination between the d orbitals of the tantalumatoms, proving a \u03c3 bond between the two Ta(IV) centers . For the cube-type structure 4, we could identify four occupied molecular orbitals (fromHOMO to HOMO \u2013 3) based on tantalum d-type orbitals, whichis a clear indication of the oxidation state III of tantalum atoms.The HOMO \u2013 3 orbital  averaged for the six Ta\u2013Ta interactions is 0.63,which is lower than that for dinuclear complex 2 (0.72).For complex 5, the frontier molecular orbitals HOMO andHOMO \u2013 1 are tantalum d-type orbitals of non-bonding and bondingnature, respectively (see 5-C5Me5)H]fragments). Delocalization of the electron pair reduces the bond orderof the Ta\u2013Ta bonding in the tetrametallic complex 5 (WBI = 0.45), with a crystallographic Ta\u2013Ta distance of 3.20\u00c5, significantly longer than those found for the previously characterizeddimetallic sulfide Ta(IV) complexes (ranging from 2.92 to 2.95 \u00c5),for which a Ta\u2013Ta \u03c3 bond was proposed.19Our initial analysis aimed toelucidate the bonding situation for the dinuclear parent compounds ters see S28. For ters see S28. For 2(\u03b75-C5Me5)2(CH2Ph)2(\u03bc-S)2] (2) with H2 to yield toluene and complex 7, [Ta2(\u03b75-C5Me5)2(\u03bc-CH2C6H6)(\u03bc-S)2]. The proposed mechanism (trans Ta(IV)-hydride Ta(IV)-benzylintermediate, (ii) trans\u2013cis isomerization bringing closer the hydride and benzyl ligands ofboth metal centers, and (iii) partial hydrogenation of the phenylring of the remaining benzyl ligand.Next, we focused our attentionon the hydrogenolysis of Ta-alkylcompounds and computationally analyzed the mechanism of the reactionof [Taechanism 6 can be 2 coordinatesthe H2 molecule to form the intermediate A  hydride complex[{Ta(\u03b75-C5Me5)(H)}(\u03bc-S)2{Ta(\u03b75-C5Me5)(CH2Ph)}] (B), in which the hydride and the benzylligands are trans to each other. The computed, overall free-energybarrier for the H2 addition (2 + H2 \u2192 B + toluene) is 21.9 kcal\u00b7mol\u20131, and the intermediate B is 2.0 kcal\u00b7mol\u20131 below the reactants. This indicates that the process is both kineticallyand thermodynamically feasible.First, one of the Ta(IV) centers of complex ediate A 6. Then,27 we also evaluated the activation of H2 by oxidationof the Ta(IV)\u2013Ta(IV) bond to yield the dihydride Ta(V) complex[Ta(\u03b75-C5Me5)(H)(CH2Ph)(\u03bc-S)]2. However, this path can be ruled outsince its computed free energy  is higher than that of the current transition state TSAB. A third alternative was explored forthe addition of H2 across the Ta\u2013S bond;30 however, it is also energetically disfavorable when compared withthe free energy of the TSAB structure.Alternatively, by analogy withour previous study on the N=Nbond cleavage by dinuclear hydride Ta(IV) complexes,B undergoes a trans-to-cis isomerizationin order to place the hydride and the benzyl ligands on the same sideof the [Ta2(\u03bc-S)2] core . For this process,two possible transition states with an electronic configuration oftriplet or singlet are possible; the former reveals a lower free-energybarrier . The isomerizationoccurs by exchanging the positions of the hydride and the pentamethylcyclopentadienylligands via a square-planar [Ta(\u03b75-C5Me5)(H)(\u03bc-S)2] transition state . We could find two MECPconnecting B with 3B and 3C with C whoseenergy values are indicative of moderate activation barriers for thespin crossover processes, 9.9 and 0.7 kcal\u00b7mol\u20131, respectively. In addition, due to the influence of heavy tantalumatoms in the structure of MECP, the spin\u2013orbit coupling isexpected to be large, favoring the transition from the singlet tothe triplet and back to the singlet surface. Alternative pathwayswere evaluated for this reaction step; nevertheless, they were discardeddue to their prohibitive energetic barriers .In the next step of the mechanism,the intermediate )2] core 6, enablion state 7. The ex3 bondof the benzyl ligand places the aromatic ring close to the hydridebound to the second tantalum center in the intermediate C\u2032, leading to the hydrogenation of the aromatic ring at the orthoposition. According to the experimental result, the computed free-energybarrier through the TSC\u20327 transition state is feasible , and the resulting final product 7 lies 12.7 kcal\u00b7mol\u20131 below the reactants.Interestingly, calculations suggest that this later hydrogenationstep is reversible with a moderate reverse free-energy barrier of20.1 kcal\u00b7mol\u20131 (from 7 to TSC7), lower than the overall free-energybarrier of the forward process, 23.9 kcal\u00b7mol\u20131 (from B to 3TSBC).Finally, the free rotationalong the Ta\u2013Csp5-C5Me5)R(\u03bc-S)]2, ledto the isolation of the low-valent Ta(III) tetrametallic sulfur cube-typespecies [Ta(\u03b75-C5Me5)(\u03bc3-S)]4. Furthermore, by judiciously selecting thefragment attached to tantalum, we have been able to isolate the intermediatespecies [Ta2(\u03b75-C5Me5)2(H)Ph(\u03bc-S)(\u03bc3-S)]2 (5), in which partial hydrogenation and dimerizationhave occurred prior to the final formation of 4. Alternatively,using allyl and benzyl moieties enables new routes toward the formationof species 4, via partial hydrogenolysis. DFT analysisprovides valuable information about the electronic configuration ofthe tetrametallic structures, confirming the oxidation state III forthe cube-type structure [Ta(\u03b75-C5Me5)(\u03bc3-S)]4, and IV for compound[Ta2(\u03b75-C5Me5)2(H)Ph(\u03bc-S)(\u03bc3-S)]2 (5). Additionally, our calculations suggest a route for theformation of the unexpected compound [Ta2(\u03b75-C5Me5)2(\u03bc-CH2C6H6)(\u03bc-S)2] (7), inwhich the hydrogenolysis of the dimetallic compound [Ta(\u03b75-C5Me5)(CH2Ph)(\u03bc-S)]2 (2) proceeds through the heterolytic H2 addition to the Ta\u2013benzyl bond, releasing toluene and generatinga Ta-hydride intermediate. Then, the reaction evolves through an isomerizationprocess that allows the Ta-hydrido group to hydrogenate the aromaticring of the benzyl ligand. Finally, based on the detected reversibilitybetween 7 and TSC7, in which the hydride shifts from the cyclohexadienyl ring to themetal, we envisage the use of these species as masked hydride tantalumcompounds. Therefore, further efforts with this species will be directedtoward analyzing the catalytic hydrogenation of unsaturated organicmolecules.Wehave shown that the hydrogenation of a series of dimetallicalkyl/aryl/allyl sulfide-bridge complexes of tantalum, 2 ,19 and theorganomagnesium reagents [MgR2(thf)2] 31 were synthesized according to publishedprocedures, and LinBu (1.6 M in hexane) was purchasedby Sigma-Aldrich and used without further purification. Hydrogen waspurchased from Linde. Microanalyses  were performedon a LECO CHNS-932 microanalyzer. Samples for IR spectroscopy wereprepared as KBr pellets and recorded on the PerkinElmer IR-FT Frontieror Bruker FT-IR-ALPHA II spectrophotometers (4000\u2013400 cm\u20131). 1H and 13C NMR spectra wereobtained by using Varian NMR System spectrometers: Unity-300 Plus,Mercury-VX, and Unity-500, and reported with reference to solventresonances. 1H\u201313C gHSQC were recordedusing the Unity-500 MHz NMR spectrometer operating at 25 \u00b0C.All manipulations were carriedout under a dry argon atmosphere using Schlenk-tube and cannula techniquesor in a conventional argon-filled glovebox. Solvents were carefullyrefluxed over the appropriate drying agents and distilled prior touse: C5-C5Me5)Cl(\u03bc-S)]2  in a 100 mL Schlenk vessel was added a hexane solution of LinBu  at 0 \u00b0C. The reaction mixturewas stirred at room temperature for 24 h and filtered through celite.The solvent was removed in vacuum to produce a green solid, which,after washing with hexane (3 \u00d7 10 mL), was identified as 1 . IR \u03bd\u0305: 2955 , 2912 , 2866 , 2850 , 1484 , 1427 , 1377, 1027 , 479 . 1H NMR : \u03b4 2.17 , 0.90\u20130.60 , \u22121.68 . 13C{1H} NMR : \u03b4 115.8 (C5Me5), 71.1 (CH2CH2CH2Me), 32.1, 30.3, 13.7 (CH2CH2CH2Me), 12.3 (C5Me5). Elemental Anal. (%) Calcd for C28H48S2Ta2 (810.71): C, 41.48; H, 5.97; S, 7.91.Found: C, 41.11; H, 5.47; S, 8.20.To a toluenesolution (40 mL) of [Ta(\u03b75-C5Me5)Cl(\u03bc-S)]2 , [Mg(CH2Ph)2(thf)2] , and toluene (40 mL). After stirring for24 h at room temperature, the reaction mixture was filtered througha medium-porosity glass frit, and the solvent was then removed invacuum to yield 2 as a green solid after washing withhexane (3 \u00d7 10 mL) . IR  \u03bd\u0305: 3053 , 3017 , 2954 , 2904 , 2851 , 1595 ,1492 , 1427 , 1376 , 1027 , 483 . 1H NMR : \u03b4 7.05, 6.79 , 6.68 , 1.98, \u22120.77. 13C{1H} NMR : \u03b4 143.4 , 130.2 , 127.7 , 123.1 , 116.6 (C5Me5), 76.5 (CH2Ph), 12.2 (C5Me5). Elemental Anal. (%) Calcd for C34H44S2Ta2 (878.74): C, 46.47;H, 5.05; S, 7.30. Found: C, 46.90; H, 4.98; S, 7.57.A 100 mL Schlenk vessel was chargedin the glovebox with [Ta(\u03b75-C5Me5)Cl(\u03bc-S)]2 , [Mg(p-MeC6H4CH2)(thf)2] ,and toluene (40 mL). After stirring for 24 h at room temperature,the reaction mixture was filtered through a medium-porosity glassfrit, and the solvent was then removed in vacuum to yield 3 as a green solid after washing with hexane (3 \u00d7 10 mL) . IR  \u03bd\u0305: 3043, 2974 , 2904 , 2852 , 1634 , 1608 , 1506 , 1453 ,1428 , 1378 , 1028 , 495 . 1H NMR : \u03b4 6.89, 6.64, 2.16, 2.01 , \u22120.75 . 13C{1H} NMR : \u03b4 140.0, 132.1 , 130.3, 128.4 , 116.5(C5Me5), 76.5 (p-MeC6H4CH2), 12.2(C5Me5). Elemental Anal. (%)Calcd for C34H44S2Ta2 (906.79):C, 47.68; H, 5.33; S, 7.07. Found: C, 48.38; H, 4.90; S, 7.22.A 100 mL Schlenk vessel was charged in the gloveboxwith [Ta(\u03b75-C5Me5)R(\u03bc-S)]2  was placed into a Carius tube (100 mL) with a Young\u2019svalve. The argon pressure was reduced and replaced with hydrogen (P = 4.0 atm). The reaction mixture was stirred at room temperaturefor 24\u201348 h . The resulting solution was filtered, and the solventwas removed under vacuum to afford 4 as a dark greensolid after washing with hexane (3 \u00d7 10 mL). . IR  \u03bd\u0305:2970 , 2951 , 2903 , 1489, 1453 , 1428 , 1374 , 1026 (s), 840 (m),548 . 1H NMR : \u03b4 2.20 . 13C{1H}NMR : \u03b4 107.2 (C5Me5), 12.8 (C5Me5). ElementalAnal. (%) Calcd for C40H60S4Ta4 (1392.96): C, 34.49; H, 4.34; S, 9.21. Found: C, 34.54; H,4.57; S, 7.44. Repeated attempts to obtain satisfactory sulfur analysisfor complex 4 were unsuccessful.Atoluene solution (30\u201340 mL) of 0.500 g of [Ta(\u03b75-C5Me5)Ph(\u03bc-S)]2  was placed into a Fisher-Porter vessel(120 mL). The argon pressure was reduced and replaced with hydrogenpressure (P = 7 atm). The reaction mixture was leftto heat at 60 \u00b0C for 4 days. The resulting solution was filtered,and the solvent was removed under vacuum to afford 5 asa dark orange solid . IR  \u03bd\u0305: 2978 , 2903 , 1633, 1490 , 1458 , 1428 , 1376 , 1261 (w), 1027 (s), 882 (m), 731 (m), 700 (m). 1HNMR : 7.10\u20136.70 , 2.20 ,1.87 , \u22124.98. \u03b4 13C{1H}NMR : \u03b4 138.6,137.4, 125.5, 123.4 (Ph), 115.4, 112.3 (C5Me5), 13.4, 12.7 (C5Me5). Elemental Anal. (%) Calcd for C52H72S4Ta4\u00b7C6H14 (1635.36):C, 42.60; H, 5.30; S, 7.84. Found: C, 42.86; H, 4.77; S, 7.26.A toluene solution (20\u201330mL) of [Ta(\u03b75-C5Me5)(\u03b73-C3H5) (\u03bc-S)]2  and 30\u201335mL of toluene. The argon pressure was reduced and replaced with hydrogenpressure (P = 7 atm). The reaction mixture was leftstirring at room temperature for 4 days. The resulting solution wasfiltered, and the solvent was removed under vacuum to afford 6 as a dark red solid after washing with hexane (3 \u00d710 mL), and the solvent was removed in vacuum . \u03bd\u0305: 2974 ,2944 , 2907 , 2858 , 1493, 1375 , 1214 , 1027 , 467 . 1H NMR : 4.56 , 1.84, 1.78 , 1.49  0.84 , \u22120.85 , not observed . \u03b4 13C{1H}NMR :\u03b4 114.7, 104.6 (C5Me5), 105.7 (CH2CHCH2), 66.8(CH2CHCH2),65.4 (CH2CH2CH3),24.9 (CH2CH2CH3),22.6 (CH2CH2CH3),12.5, 11.8 (C5Me5). ElementalAnal. (%) Calcd for C26H42S2Ta2 (780.64): C, 40.00; H, 5.42; S, 8.21. Found: C, 39.72; H,5.26; S, 8.10.A 120 mL Fisher-Portervessel was charged in the glovebox with [Ta(\u03b75-C5Me5)(CH2Ph)(\u03bc-S)]2 was placed into a Carius tube (150 mL) with a Young\u2019s valve.The argon pressure was reduced and replaced with hydrogen pressure(P < 1 atm). The reaction mixture was heated to65 \u00b0C for 48 h. The resulting solution was filtered, and thesolvent was removed under vacuum to afford 6 as a darkyellow solid . IR  \u03bd\u0305: 3068 , 3023 , 2956 , 2905 , 2851 , 1594 ,1492 , 1451 , 1428 , 1375 , 1260 (m),480 . 1H NMR : 5.00, 3.71, 2.99, 2.27 , 3.44 ,2.56 , 2.05, 1.76 , 1.12 , 0.25 . \u03b4 13C{1H}NMR : \u03b4 114.9,107.2 (C5Me5), 114.2, 95.1,81.9, 53.6 (CH2C6H6), 71.5 , 65.7 (CH2C6H6), 29.3 (CH2C6H6), 12.4, 11.9 (C5Me5). Elemental Anal. (%) Calcd for C27H38S2Ta2 (788.62): C, 41.12; H, 4.86;S, 8.13. Found: C, 41.18; H, 4.72; S, 8.00.A toluenesolution (40 mL) of [Ta and an Oxford Cryostream700 unit, while that for 6 was collected at 200 K ona Bruker D8 Venture diffractometer equipped with multilayer opticsfor monochromatization and collimator, Mo K\u03b1 radiation (\u03bb= 0.71073 \u00c5) and an Oxford Cryostream 800 unit. Crystallographicdata for all complexes is presented in Table S1 in the Supporting Information.Crystalswere obtained by slow cooling at \u221220 \u00b0Cof the corresponding toluene solutions. Single crystals were coatedwith mineral oil, mounted on Mitegen MicroMounts with the aid of amicroscope, and immediately placed in the low-temperature nitrogenstream of the diffractometer. The intensity data sets for 4 and 7 were solved by direct methods (SHELXS),32 while those of 5 and 6 were solved by applying intrinsic phasing (SHELXT)33 using the WINGX34 or Olex235 packages. All were refined by least-squaresagainst F2 (SHELXL).36 All non-hydrogen atoms were anisotropically refined, whilehydrogen atoms were placed at idealized positions and refined usinga riding model, except the terminal hydride atom in complex 5, which was localized in the difference Fourier map and isotropicallyrefined, fixing both coordinates and thermal factor in the last cyclesof refinement. Details about the absorption correction performed oneach data set are described in the Supporting Information.The structures of compounds 5 crystallized withone slightly disorderedhexane solvent molecule; although it could be apparently modeled,a better refinement was achieved by using a solvent mask in Olex235 removing the contribution of the disorderedhexane molecule to the structure factors. Also, mild RIGU restraintswere applied to the pentamethylcyclopentadienyl and phenyl carbonatoms.Complex 7, where cyclopentadienyl carbon atoms C21\u2013C25and C41\u2013C45 presented some dynamic disorder; thus, RIGU andSIMU restraints were applied.Finally, two crystallographically independent moleculeswere foundfor compound 37 withinthe density functional theory (DFT)38 frameworkusing the PBE0 functional.41 The geometries were obtainedusing a standard double-\u03be Lanl2dz42 pseudopotential with an f polarization function43 to describe tantalum and a 6-31G basis set46 for describing the rest of the atoms. To obtain the electronic energies,the basis set was extended to a triple-\u03be pseudopotential Lanl2tz(f)47 for tantalum and to the augmented 6-311++Gbasis set for the rest of the atoms.50 Toluene solvent effectswere considered in all calculations with the IEF-PCM implicit solvationmodel51 as implemented in Gaussian16.37 We also applied Grimme\u2019s GD3 dispersioncorrection.52 All the optimized minimawere located without any restriction and in the absence of imaginaryfrequencies. Transition states were characterized by a single imaginaryfrequency, whose normal mode corresponded to the expected motion.In the calculation of Gibbs free energies, we used as a referencestate 1 mol\u00b7L\u20131 in the condensed state, andfrequencies below 100 cm\u20131 were withdrawn employingthe Goodvibes code.53 The MECP betweendifferent spin states was located using the program developed by Harveyet al.54 using the EasyMECP code.55 A data set collection of the optimized structuresfor the most representative species is available in the ioChem-BDrepository56 and can be accessed via https://iochem-bd.urv.es/browse/review-collection/100/1082/7d9fa995af391b9361a9b9de.Calculations were performed usingthe Gaussian16 program package"}
+{"text": "Skeletal muscle is essential for human locomotion as well as maintaining metabolic homeostasis. Age-related reduction in skeletal muscle mass, strength, and function  is a result of pathophysiological processes that include inflammation, alteration of molecular signaling for muscle protein synthesis and degradation, changes in insulin sensitivity, as well as altered skeletal muscle satellite cell activity. Finding strategies to mitigate skeletal muscle loss with age is deemed paramount as the percentage of the population continues to shift towards having more older adults with sarcopenia. Recent research indicates omega-3 fatty acid supplementation can influence anabolic or catabolic pathways in skeletal muscle. Our brief review will provide a synopsis of some underlying mechanisms that may be attributed to omega-3 fatty acid supplementation\u2019s effects on skeletal muscle. We will approach this review by focusing on cell culture, animal , and human studies evaluating omega-3 fatty acid supplementation, with suggestions for future research. In older adults, omega-3 fatty acids may possess some potential to modify pathophysiological pathways associated with sarcopenia; however, it is highly likely that omega-3 fatty acids need to be combined with other anabolic interventions to effectively ameliorate sarcopenia. There is a great deal of interest surrounding the maintenance and improvement of skeletal muscle mass and strength using a wide variety of interventions. In younger adults, improving skeletal muscle mass and strength may be important for the performance-enhancing benefits it can bestow in athletic or recreational activities. In older adults, finding strategies to reduce the consequences of sarcopenia  is deemed paramount to reducing the morbidity and mortality associated with this condition . DelineaOmega-3 fatty acids are polyunsaturated fatty acids with a double-bond three atoms away from their methyl end. The most predominant forms of \u03c9-3 fatty acids that have been investigated for their effects on muscle include docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), and alpha-linolenic acid (ALA). These \u03c9-3 fatty acids incorporate into cellular phospholipid membranes and produce physiological effects via their ability to produce various eicosanoids  via the cyclooxygenase and lipoxygenase enzymatic pathways. Typically, the traditional Western diet is composed of excessive \u03c9-6 fatty acids , which may produce a more inflammatory environment if not balanced properly with a greater intake of \u03c9-3 fatty acids . This maThe mechanisms likely involved in the anabolic or anti-catabolic effects of \u03c9-3 fatty acid supplementation revolve around (1) inflammatory milieu modification, (2) activation of the mechanistic target of rapamycin (mTOR) pathway in skeletal muscle, (3) improved insulin sensitivity, and (4) the potential to alter skeletal muscle satellite cell activity see  8,9,10,,10,11,12Studies with cell cultures have determined how \u03c9-3 fatty acids may affect pathways associated with inflammation, insulin sensitivity, and synthesis of muscle protein. EPA and DHA have been the most predominantly utilized fatty acids for the incubation of C2C12 cells  for in vitro studies. EPA and DHA are the fatty acids that are thought to produce the greatest physiological effects. One way in which skeletal muscle-induced protein degradation may occur is through chronically elevated inflammatory milieu via TNF-\u03b1 stimulated apoptosis of myocytes . The nucMyogenic regulatory factors (MRFs) are a group of transcription factors that control myogenesis during activation, proliferation, and differentiation of satellite cells  in postnC2C12 myoblasts were incubated with lipopolysaccharide , inducing deficiency in insulin signaling, but when the myoblasts were co-incubated with EPA, there was a restoration of insulin signaling . This stThese cell culture studies have been performed under conditions that likely optimize \u03c9-3 fatty acids\u2019 effectiveness. Even though cell culture studies are important to help understand underlying mechanisms, the in vivo effects may be less pronounced given the physiological milieu of intact organisms. In the next section, we review studies of animals evaluating the effectiveness of supplementation with \u03c9-3 fatty acids.While pre-clinical animal-based study models are important for testing hypotheses and determining outcomes, currently, there is limited animal data  on supplementing with \u03c9-3 fatty acids for affecting skeletal muscle. The following section delineates the effects of supplementing with \u03c9-3 fatty acids on skeletal muscle in mostly obese mouse and rat models, models that most likely potentiate muscle atrophy. Obesity is known to produce many metabolic disturbances, which may be attenuated by \u03c9-3 intake, but does not necessarily represent a healthy condition to test the effectiveness of \u03c9-3 fatty acid supplementation on skeletal muscle .In an obese male mouse model, chia oil (which is high in ALA) was fed to animals who were also fed a diet high in fat to evaluate the effects on insulin signaling and fat and lean tissue mass . Fat masIn a rat model (13 months old), 8 weeks of supplementation with an EPA and DHA blend of \u03c9-3 fatty acids was able to increase the phosphorylation of phosphoinositide 3-kinase (PI3K) and ribosomal protein S6 kinase (p70s6k), two important upstream and downstream components, respectively, of the Akt/mTOR pathway in the longissimus dorsi but not the soleus muscle . AccordiIn summary, there are potential advantages and disadvantages to skeletal muscle in using various types of \u03c9-3 fatty acids in animal models. In the two obese mouse models explained above, high amounts of ALA were able to rescue cell signaling that may enhance outcomes for skeletal muscle anabolism ,31. HoweSeveral clinical trials in humans have evaluated EPA and DHA supplementation on skeletal muscle mass, strength, and functional ability ,42,43,44Oxylipins are a group of key mediators of the metabolism of long-chain polyunsaturated fatty acids in humans. A recent study determined the relationship between \u03c9-3, \u03c9-6, and \u03c9-9 oxylipin metabolites and markers of skeletal muscle biology  both before and after 24 weeks of supplementation with combined EPA, DHA, and docosapentaenoic acid (DPA) \u03c9-3 fatty acids . There wSome human-based studies have attempted to identify the mechanism(s) underlying the positive effect of supplementing with \u03c9-3 fatty acids on skeletal muscle mass and function. Integrated myofibrillar protein synthesis (MyoPS) remained higher in a group of healthy young females who supplemented with a combined EPA/DHA dose of 5 g/day for 4 weeks before undergoing 2 weeks of limb immobilization and then 2 weeks of recovery from the immobilization when compared to a placebo . This reMore recent studies have evaluated the effects of \u03c9-3 supplementation strategies on skeletal muscle in younger individuals as well. Relative and absolute upper body strength and relative lower body strength were enhanced following 10 weeks of resistance exercise when it was combined with an EPA and DHA supplementation protocol when compared to a placebo supplement; conversely, body composition was improved with the resistance exercise but was not different between the \u03c9-3 and placebo groups . AnotherSome population-based research has been carried out evaluating \u03c9-3 intake on strength and all-cause mortality. First, a cross-sectional study was conducted assessing \u03c9-3 fatty acid intake in a large cohort of Korean adults, demonstrating that increased \u03c9-3 intake was positively associated with hand grip strength suggesting an effect on skeletal muscle strength . Other rIn summary, some research in humans that have utilized \u03c9-3 supplementation strategies alone indicates a potential role for these fatty acids in maintaining or improving skeletal muscle outcomes in both younger and older adults. As the studies by Smith et al. ,54 pointUpcoming research in this area should focus on the underlying mechanisms whereby \u03c9-3 supplementation strategies may enhance skeletal muscle parameters in the absence of other interventions. This will provide clear information on the potential benefits (and possible drawbacks) of supplementing with \u03c9-3 fatty acids. \u03c9-3 fatty acid dosing is extremely variable between different study designs. Finding the optimal dose that could enhance skeletal muscle, particularly in aging individuals, is key to understanding the potential positive effects this nutrient could have. Also, more research in inflammatory non-communicable diseases  management by \u03c9-3 supplementation strategies will likely reveal the underlying mechanisms whereby skeletal muscle could be enhanced in these conditions. The effects of \u03c9-3 fatty acid intake alone on skeletal muscle form and function have not been fully elucidated. For now, it seems that the main mechanisms that \u03c9-3s are involved with the aiding of skeletal muscle include (1) a decrease in inflammation, (2) enhancement of muscle protein synthesis, (3) alteration in the sensitivity of insulin, and (4) improvements in muscle satellite cell activity. Future work in this area will likely identify other underlying mechanisms at work in the positive effects that these fatty acids may have in enhancing and promoting skeletal muscle."}
+{"text": "This cross-sectional survey aimed to identify aerobic bacteria, antimicrobial resistance, and multi-drug resistance profiles of bacteria isolated from different wound infections among a group of Egyptian patients.Staphylococcus aureus, especially from wound infections because of accidents (71.8%). Piperacillin, methicillin, ampicillin/sulbactam, and amoxicillin/clavulanic acid were all highly resistant to S. aureus and Coagulase-negative Staphylococci. The prevalence of methicillin-resistant S. aureus in wound infections was 89.9%. S. aureus showed superior sensitivity to vancomycin (85.3%) and linezolid (81.3%). The highest prevalence of Gram-negative isolates was for Pseudomonas aeruginosa (40%), which was highly sensitive to ciprofloxacin (79.2%) and highly resistant to levofloxacin (83.3%). Several isolates revealed a multi-drug resistance profile (52.4%). The overall MDR rate of Gram-positive and Gram-negative isolates were 50% and 54.9%, respectively.Of 120 positive samples, 170 isolates were identified. Polymicrobial infections were determined in 55% of samples. The dominant Gram-positive isolated strains were The prevalence of MRSA isolated from various wound infections and MDR is a warning issue in Upper Egypt. It should implement a health education strategy and hygiene measures to prevent the spread of wound infection-causing organisms in the community. Skin provides a good medium for pathologic bacteria to proliferate. Subsequently, the chance of a skin wound being infected is boosted, and interferes with the healing process . The oriS. aureus are resistant to penicillin, and that remains a global issue [The rate of MDR bacteria elucidates a worldwide increase as announced by the Centers for Disease Control and Prevention (CDC) . This phal issue . Despiteal issue . Normallal issue . Unfortual issue .Regardless the type of wound infection, it is important to monitor the dynamic changes in the prevalence of sensitivity profiles and MDR profiles over time. This is important in detecting a structured therapeutic strategy to prevent microbial proliferation while avoiding side effects . RegardiThe study designed as a cross-sectional design that has been carried out from November 2019 to September 2021. The wound samples were collected from the patients who attended the Department of Plastic and Reconstructive Surgery, Minia University Hospital (MUH). The hospital provides its services to a geographical area of approximately 6\u00a0million people in Upper Egypt. The hospital included 330 beds.The study included males and females aged 1 month to 60 years. Wound infection is suspected if a wound was not healing well, getting bigger, and exudation of pus or fluids. Samples were obtained from various wound types including burn wounds, surgical wounds from different anatomical sites, and abscesses. Specimens were properly labeled, indicating the source, gender, and age of patients.A total of 146 randomly selected wound swabs were collected from MUH. Wound infection is suspected when a wound is not healing properly, grows in size, or exudes pus or fluids. The specimens were collected on sterile cotton swabs and the wounds were cleaned before collection to avoid surface contamination. Swabs are transferred immediately, within 2\u00a0h to the laboratory. In the laboratory, the specimens were registered, and swabs were cultured, streaked, and incubated at 37\u00a0\u00b0C for 24\u00a0h. After incubation, plates were checked for bacterial growth. Plates with negative bacterial growth were additionally incubated for another 24\u00a0h.The hospital collects samples from different clinical sources on a daily basis from patients and sends them to the hospital\u2019s laboratories for analysis. Samples were collected from hospital laboratories without dealing with patients directly. Upon getting permission from the Head of Plastic and Reconstructive Surgery Department, Faculty of Medicine, Minia University, the collection of laboratory samples has begun.The microorganisms were identified by Gram stain, culturing, biochemical reactions, and motility testing as per standard guidelines . Culture8 CFU/mL). The inoculum was dispensed on the surface of Mueller-Hinton agar plate and ramified with a sterile metallic wire loop and the plates were allowed to dry for 3\u20135\u00a0min. Antibiotic discs were used with the following concentrations: linezolid , tetracycline , chloramphenicol , rifampin , piperacillin , amoxicillin/ clavulanic acid , ampicillin/ sulbactam , levofloxacin , gentamicin , vancomycin , cefoxitin , ciprofloxacin , cefuillin/tazobactam , cefuroxime , ceftazidime, tigecycline, cefazolin , trimethoprim-sulfamethoxazole , and imipinem . Antibiotic discs were applied on the surface of the plates at least 15\u00a0mm apart from the edges of the plates to prevent overlapping of inhibition zones. The plates were incubated at 37oC for 24\u00a0h and the diameters of zones of inhibition were measured in mm and the results are compared to those from the Clinical Laboratory Standard Institute (CLSI) . S. aureus isolates were considered MRSA when the diameter of inhibition zone of cefoxitin disc is \u2264\u200921\u00a0mm according to CLSI .Antimicrobial sensitivity was determined by the Kirby Bauer agar disc diffusion method. A small inoculum of each pure bacterial isolate was emulsified in 2 mL sterile normal saline. The turbidity of the cell suspension was adjusted to correspond to 0.5 MCfarland standard . The results were considered statistically significant when the P value was less than 0.05.Of 146 samples, bacterial growth was evident in 120 (82.2%) samples, and 26 cultures (17.8%) were clear. The majority of participants were males, representing 73.5% (n\u2009=\u200988) and the rest was females represented 26.7% (n\u2009=\u200932). The ages of the patients ranged from 1 month to 60 years, with an average of 25.28\u2009\u00b1\u200916.21. The frequencies of samples isolated from different wound infections were shown in Fig.\u00a0S. aureus (62.5%) followed by P. aeruginosa (40%), Klebsiella spp. (11.6%), CoNS (10.8%) Protues spp. (10%), and E. coli (6.67%)  samples, while mono-microbial infections were detected in 54 (45%) samples. There were 88 Gram-positive isolates (51.8%) and 82 Gram-negative isolates (48.2%). The dominant strains isolated from all types of wound infections were S. aureus and CoNS showed high resistance to piperacillin, cefoxitin, ampicillin/sulbactam, and amoxicillin/clavulanic acid. MRSA was detected in 89.9% of S. aureus isolates. The details of sensitivity and resistance profiles are mentioned in Table\u00a0S. aureus or CoNS was significant in case of rifampin, piperacillin, gentamicin, levofloxacin and ciprofloxacin (p\u2009<\u20090.05).Both P. aeruginosa was sensitive to ciprofloxacin (79.2%) and highly resistant to cefazolin (100%) and levofloxacin (83.3%). Klepsiella spp. were sensitive to gentamicin (78.6%) and highly resistant to cefazolin (100%) and ceftazidime (85%). Protius spp. was highly resistant to ampicillin/sulbactam (100%), cefazolin (100%) and ceftazidime (91.9%). Finally, E. coli showed absolute resistance against cefuroxime and cefazolin (100%) and high resistance against ampicillin/sulbactam (87.5%). In the case of levofloxacin and ciprofloxacin, the association between susceptibility or resistance to various antibiotics was significant (p\u2009<\u20090.05).Data in Table\u00a0p\u2009>\u20090.05).Gender was not significantly correlated with the antibiotic resistance profile among Gram-positive samples (67 patients) and Gram-negative samples 53 patients) (Tables\u00a0 patientsS. aureus and 15.4% for CoNS). Total MDR rate of Gram-negative isolates was 54.9% with the highest prevalence pattern of E. coli (87.5%). For other Gram-negative species, the MDR rates were as follows: P. aeruginosa (54.2%), Klebsiella spp. (50%), and Proteus spp. (41.7%). Both Proteus spp. and E. coli had significant distributions of resistance profiles across antibiotic classes (p\u2009<\u20090.05). Only 4.7% and 2.9% of all isolates showed XDR and PDR profile, respectively. XDR rate of Gram-positive isolate was 2.3% and that of Gram-negative isolates was 7.3%, while the PDR rates of Gram-positive and Gram-negative isolates were 3.4% and 2.4%, respectively.MDR, XDR, and PDR percentages of each bacteria were calculated out of the total number of isolates of each bacteria. Table\u00a0This survey assessed the prevalence of various bacterial species isolated from different wound infections among a group of patients in Upper Egypt. Of the 146 population subjects included in this survey, 120 patients elucidated positive bacterial growth with a high isolation rate of 82.2%. This was approximately similar to the finding of Mohammed et al. who reported an isolation rate of 83.9% for wound infections from inpatients and outpatients with pus and/or wound discharge in Northwest Ethiopia . Our oveThe prevalence of poly-bacterial species (55%) was higher than that of mono-bacterial species (45%). This was different from the findings of Hassan et al.  who repoOur findings revealed almost similar proportions of Gram-positive bacteria (51.8%) and Gram-negative strains 48.2%). This was in line with Ares et al.  and Bess%. This wS. aureus and P. aeruginosa were the dominant pathogens. This was consistent with the findings of Puca et al. [S. aureus represented 62.5% of all isolates and 85.2% of isolated Gram-positive strains that have been isolated from all samples of different wound infections. This was comparable to the findings of Ahmed et al. [S. aureus was identified in 61% of specimens, surgical site infections, abscesses, and burn infections were the most common sites of S. aureus isolates representing 59%, 56%, and 52%, respectively. This was to some extent in agreement with the present results. The prevalence of S. aureus was 65%, which coincided with the prevalence reported by Mulu et al. [S. aureus isolated from wound infections [S. aureus is the common skin commensal. Also, exogenous or endogenous infections could be the source of the S. aureus infection.Our findings revealed that a et al. . S. aured et al.  in a stuu et al.  among 15fections , 22, 23.CoNS accounted for 10.8% of all isolates which was comparable to a retrospective study conducted in intensive care unit of Ain Shams University Hospitals in Egypt, which reported a rate of 12.5% from different infection sites . AnotherP. aeruginosa was the second pathogen that was isolated from wound infections, with a prevalence of 40%. This prevalence was compatible with that recorded by Manikandan and Amsath [Klebsiella spp. (11.6%), Proteus spp. (10%), and E. coli (6.7%). A previous study in Egypt revealed a predominance of Klebsiella spp. followed by E. coli [E. coli among all identified Gram-negative species, followed by Proteus spp., with the least prevalence of P. aeruginosa [Among all isolates, d Amsath . Another E. coli . Anotherruginosa . The divruginosa .S. aureus was sensitive to vancomycin with a rate of 85.2%, while vancomycin-resistant S. aureus (VRSA) was detected in 14.8% of cases. This was relatively lower than that concluded in Egypt by Ghoniem et al. [Beta-lactam ring-based antibiotics had the highest resistance profile to Gram-positive strains, with a prevalence ranging from 84.6 to 98.7%. Our findings revealed a remarkable increase in the prevalence of MRSA compared to a previous survey that was conducted by Ahmed et al.  who repom et al.  who repom et al.  demonstrP. aeruginosa was the most commonly isolated Gram-negative species, with resistance rates ranging from 62.5 to 100% to the \u00df-lactam antibiotic. Similarly, P. aeruginosa had a high prevalence of levofloxacin resistance (83.3%). These findings were quite similar to Nikokar et al. [P. aeruginosa isolated from burn infections and post-surgical sites and wound infection against the cephalosporin antibiotics cefazolin (83.7%) and ceftazidime (68.8%), gentamicin (37.2%), and imipenem (23.3%). While they confirmed a high resistance rate against ciprofloxacin (66.3%), our findings supported the lowest resistance being against ciprofloxacin (16.7%).Regarding Gram-negative sensitivity, All Gram-negative isolates tested positive for absolute resistance to the cefazolin antibiotic in our study. r et al.  results Klebsiella spp. exhibited high resistance to \u00df-lactam antibiotics. This was in agreement with previous literature conducted in Bangladesh [Klebsiella spp. Antimicrobial resistance as a result of antibiotic misuse is a life threatening issue affecting both males and females of all ages without regard to certain genders or age groups [ngladesh . This wangladesh  that hige groups . The curE. coli and Pseudomonas spp., respectively, against the majority of tested antibiotics. Regarding Gram-positive isolates, the overall MDR was 50%, with a higher MDR profile for S. aureus (56%) followed by CoNS (15.4%). This was less than the findings of Melake et al. who found that the prevalence of MDR of S. aureus and CoNS isolated from burn wounds in Egypt were 73.5% and 47%, respectively.The prevalence of the MDR profile was slightly higher among the Gram-negative isolates compared to Gram-positive species. The MDR of Gram-negative rate was 54.9%, which is close to the MDR rates reported in two studies conducted in Ethiopia. The first study reported an MDR prevalence of 51% among bacteria isolated from open fracture wounds . The secThe main limitations of the current study can be summarized as follows; (1) the use of a disk-diffusion approach to detect the bacterial susceptibility, which has relative reliability, (2) the generalization of the study findings has to be interpreted with caution as possible due to heterogeneity of subjects and settings in different geographic areas; and (3) the availability of anaerobic bacteria was not accounted for in the current study due to the shortage in the culture conditions.S. aureus and P. aeruginosa were the most commonly isolated pathogens. A high rate of MRSA was revealed among S. aureus isolates. Vancomycin and linezolid were the most effective drugs against S. aureus and ciprofloxacin was the most effective one against P. aeruginosa. Several isolates elucidated MDR profile for all tested classes of antibiotics, which indicates a serious exacerbation of bacterial resistance and a difficulty finding treatment options for all infections.Within the limitations of the current findings, it can be concluded that there was a dominance of polymicrobial wound samples."}
+{"text": "The focus of this review is on the proteomic approaches applied to the study of the qualitative/quantitative changes in mitochondrial proteins that are related to impaired mitochondrial function and consequently different types of pathologies. Proteomic techniques developed in recent years have created a powerful tool for the characterization of both static and dynamic proteomes. They can detect protein\u2013protein interactions and a broad repertoire of post-translation modifications that play pivotal roles in mitochondrial regulation, maintenance and proper function. Based on accumulated proteomic data, conclusions can be derived on how to proceed in disease prevention and treatment. In addition, this article will present an overview of the recently published proteomic papers that deal with the regulatory roles of post-translational modifications of mitochondrial proteins and specifically with cardiovascular diseases connected to mitochondrial dysfunction. The mitochondrial proteome consists of proteins that are encoded by both mitochondrial DNA and nuclear DNA. Mutations in the genomes that encode these proteins lead to protein alterations and protein deficiencies. The defected proteins that modulate mitochondrial behaviors and are associated with, e.g., mitochondrial dynamics, respiration and metabolism, mitophagy and mitochondrial protein import pathways, can cause mitochondrial dysfunction. Many diseases characterized by mitochondrial dysfunction have been described, e.g., cardiovascular disease ,2, canceVarious mitochondrial activities and functions have been reported; however, for many, the underlying mechanisms at the protein level remain unclear. To be able to carry out the proper strategy for disease prevention and treatment, it is crucial to understand the cellular pathways that lead to the damage, as well as the protective processes, at the molecular level. Proteomics, as a powerful and efficient tool for identification/quantitation of the proteins, has been helping to clarify the involvement of mitochondrial proteins in various disorders ,17,18. ICardiovascular diseases such as ischemia/reperfusion (I/R) injury, heart failure, cardiomyopathy or hypertension are associated with mitochondrial dysfunction that results from a defected respiratory chain, decreased adenosine-5\u2032-triphosphate (ATP) synthesis, enhanced oxidative stress and changes in the mitochondrial structural integrity . An impaThe involvement of various mitochondrial proteins and mitochondrial dysfunction in different diseases has been reviewed ,23,24,25In this review, mitochondria and their metabolic pathways are overviewed briefly, followed by a discussion on mitochondrial proteins (mitoproteome). Mass spectrometry (MS)-based proteomic approaches for mitochondrial protein identification/quantitation are described and databases that can support the research on mitochondrial proteins are included. Furthermore, examples of proteomic studies performed over the last five years on mammals are discussed with a focus on mitochondrial dysfunction, involvement of mitochondrial proteins, regulation roles of PTMs and cardiovascular diseases.The mitochondrial structure of most eukaryotic cells contains the following compartments: the outer mitochondrial membrane (OMM), the intermembrane space (IMS) and the inner mitochondrial membrane (IMM), forming the cristae and the matrix. The number and size of mitochondria are dependent on cell type, tissue and organism; however, the size is usually in range of 0.5\u20131 \u00b5m. Muscle cells that have to fulfill large energy requirements during movement contain a large number of mitochondria. In addition, the heart muscle cells are rich in mitochondria, with a content of about 5000 per cell, as the heart muscle has high energy demands to pump blood via the circulatory system. The major task of mitochondria is production of ATP and providing energy to cells; however, \u201cmitochondria are intimately embedded in the signaling cascades and programs that operate within the cells\u201d . For exa2+) and release of proapoptotic proteins [Healthy mitochondria are essential for proper organ functionality. Mitochondria under stress conditions trigger signaling pathways to activate the cell response, and various mediators of mitochondrial communication are released, such as metabolites of the mitochondrial metabolism system ,44. Howeproteins ,42,46. Tproteins .2). Prior to FAO, long-chain acyl-CoA fatty acids from cytosol are activated by acyl-CoA synthetases and are imported inside mitochondria by the carnitine cycle [2 and NADH that subsequently enter the TCA cycle. Acyl-CoA degradation is catalyzed by different acyl-CoA chain length-specific enzymes : very long chain (VLCAD), medium-chain (MCAD) and short-chain (SCAD) acyl-CoA dehydrogenases in humans [2. NADH and FADH2, as donors of electrons, are together with O2 used in the OXPHOS system, in which electrons are transferred from electron donors to electron acceptors during a set of redox reactions. The OXPHOS system consists of five protein complexes (complexes I\u2013IV and FoF1 ATP synthase complex) that are bound to IMM. Protein complexes I\u2013IV (ETC) are respiratory chain complexes. They are NADH dehydrogenase , succinate dehydrogenase (complex II), cytochrome c oxidoreductase  and cytochrome c oxidase (complex IV). Electrons enter complex I and are transferred to complex IV, in which O2 is the final electron acceptor and H2O is produced (reduction of molecular oxygen to water). The energy from the redox reactions is used predominantly for transporting the protons from the mitochondrial matrix to IMS and an electrochemical proton gradient is created across the IMM which is used by the FoF1 ATP synthase complex to synthesize ATP through phosphorylation of adenosine diphosphate (ADP) [To provide energy to cells in the form of ATP, the cardiac mitochondria depend on metabolic pathways, specifically on three major pathways (cellular respiration), i.e., fatty acid \u03b2-oxidation (FAO), the tricarboxylic acid cycle  and the oxidative phosphorylation (OXPHOS) system. In FAO, acetyl-coenzyme A (acetyl-CoA) is produced together with the reduced form of nicotinamide adenine dinucleotide (NADH) or the reduced form of flavin adenine dinucleotide  ,49. The When insufficient molecular oxygen delivery occurs, for example, during cardiac ischemia, the reducing components of ETC that are normally re-oxidized fail to follow this process. As a result, the electron flow in the ETC decreases and this has a negative effect on both the FAO pathway and the TCA cycle progress. ATP production by the OXPHOS system is compromised and this phenomenon forces the cells to switch to anaerobic glycolysis, the alternative way to produce ATP energy.The functions of mitochondrial membrane protein complexes and their assembly into macromolecular structures (supercomplexes)  have bee1 and the Rieske iron-sulfur protein). The other subunits stabilize and regulate complex III and contribute to efficient electron transfer [A mitochondrion possesses its own maternally inherited genome  and contains mitochondrial proteins that are encoded by mtDNA; however, during evolution, the number of protein coding genes in mtDNA was substantially reduced in eukaryotic cells. In humans, 13 proteins are encoded by mtDNA. These hydrophobic proteins are core subunits of OXPHOS complexes that are inserted into IMM during their synthesis, either peripherally or integrally. They include seven subunits of complex I (chains 1\u20136 and chain 4 L of NADH-ubiquinone oxidoreductase (ND1-ND6 and ND4L)), one subunit of complex III (cytochrome b), three subunits of complex IV (subunits 1\u20133 of cytochrome c oxidase (COX1-COX3)) and two subunits of FoF1 ATP synthase complex (ATP synthase subunit a (ATP6) and ATP synthase protein 8 (ATP8)) . Howevertransfer . About 2transfer , i.e., fMitochondrial dysfunction-mediated diseases are in many instances caused by mutations in nuclear and/or mitochondrial genomes encoding the proteins that were part of the complexes during their assemblies or the proteins that participated in complex expression . MitochoEfforts have been made in the past to compile mitochondrial protein datasets, including the proteins that make up complex I for different species , proteinhttps://string-db.org (accessed on 10 January 2023)), UniProt , Pfam (protein families database), Ensembl (a genome browser for vertebrate genomes), GO (gene ontology consortium), CDD (conserved domain database for proteins), InterPro , RefSeq (Reference Sequence database), IPA  and PhosphoSitePlus . Many of these databases can be found in Database Commons\u2014a curated catalog of worldwide biological databases (https://ngdc.cncb.ac.cn/databasecommons/ (accessed on 10 January 2023)). Other sources for human mitochondrial proteins are the Human Proteome Map (http://humanproteomemap.org/ (accessed on 10 January 2023)) and the Human Proteome Atlas (http://www.proteinatlas.org/ (accessed on 10 January 2023)).Currently, biological databases  that could further support research on mitochondrial proteins and could serve as a public data repository are available. For example, these include the PRIDE , KEGG (Kyoto Encyclopedia of Genes and Genomes), STRING  followed by high-speed centrifugation to pellet and concentrate the mitochondria . Furthermore, centrifugation in density gradient  is used on crude mitochondria pellets or affinity purification is included to obtain purer mitochondria [Usually, after cell/tissue homogenization, differential centrifugation is applied to isolate mitochondria from the rest of the cellular components, the procedure of which depends on the cell/tissue types. First, centrifugation is performed at low speed to pellet the intact cells, tissue debris and nuclei  followed by mass spectrometry (MS). Despite the limitations related to 2-DE, such as the detectability of low abundance proteins and difficulty of dissolving hydrophobic membrane proteins, it is useful for the detection of protein PTMs, where the shift in the isoelectric points, as well as the protein distribution, can be visualized on the gels. In this instance, the isolation/enrichment of mitochondria from cell lysates/homogenates is crucial and can be followed, e.g., by two-dimensional fluorescence difference gel electrophoresis (DIGE)  and, if To enrich/purify the mitochondrial proteins/peptides, immunoaffinity methods are applied, for example, enrichment of acetylated and malonylated tryptic peptides from heart tissue homogenate  and enri13C6, 15N4 arginine, 13C6 lysine or 13C9 tyrosine) [MS approaches for protein/peptide identification and quantitation include tandem instruments, such as matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF/TOF) for peptide mass fingerprinting or LC-MS/MS with further peptide fragmentation in order to obtain amino acid sequences. LC-MS/MS strategies for protein quantitation are label-free techniques , chemicayrosine)  or labelyrosine) . In labeyrosine) ,82,83,84In discovery-driven proteomics, nano-liquid chromatography coupled to a tandem mass spectrometer via electrospray ionization (nLC-MS/MS) is applied. Usually, data-dependent acquisition (DDA) mode is implemented in which a survey MS scan is first performed on the sample of enzymatically digested peptides and then a fixed number of peptide precursor ions is selected and analyzed by MS/MS. The resulting spectra of MS/MS fragment product ions are searched and matched to database protein sequences.The acquisition strategy, called \u201csequential window acquisition of all theoretical fragment-ion spectra\u201d (SWATH) ,86, can Another targeted MS-based method that can selectively analyze specific proteins, protein isoforms and PTMs or can be used as an antibody-free validation tool is multiple (selected) reaction monitoring (MRM and SRM) . MRM is Regulation of protein expression and PTMs are the key events, for example, in the development and maturation of the heart, in neonatal cardiomyocyte proliferation and in maturation and differentiation. It was documented that \u201ctypical\u201d phosphoproteins are expressed across tissues, yet they display tissue-unique phosphorylation sites from various kinases that modulate protein function in order to comply with the specific needs of a particular tissue type . PTMs arOne of the PTMs that targets mitochondrial proteins is acylation. Generally, it is a reversible covalent addition of an acyl group from acyl-CoA to a lysine residue of the protein molecule. Experiments have shown that the mitochondrial proteome is highly acylated and the addition of various acyl groups to the proteins results in various PTMs, i.e., the addition of an acetyl group from acetyl-CoA results in acetylation, the addition of a succinyl group from succinyl-CoA results in succinylation, the addition of a malonyl group from malonyl-CoA results in malonylation and the addition of a glutaryl group from glutaryl-CoA results in glutarylation. Although these PTMs are under the same umbrella of structurally similar acylation, they have various effects on the protein structure, function and interaction with other proteins and are the reasons for different pathological consequences. These PTMs modify different proteins in different biological pathways ,44. ProtThe signaling pathways activated in the heart as a result of mitochondrial energy dysfunction have been investigated in mice with depleted mitochondrial phosphate carrier protein, SLC25A3 . This mi+/NAD(P)H redox state and ROS emission) compared to the control. Moreover, experiments on DKO animals subjected to TAC surgery showed that dual deletion of SIRT3 and CrAT did not worsen cardiac dysfunction and disease progression when coupled with pressure overload induced by TAC. In summary, the acetylome in the DKO model not only recapitulated but highly increased the magnitude of hyperacetylation identified in a pressure overload model of HF (TAC-MI). In DKO mice with extreme acetylation, minimal evidence of oxidative dysfunction was found compared to other conditions examined. Using TAC-induced pressure overload, DKO hearts were not more susceptible to dysfunction. Thus, based on the experiments in this study, acetylation of the cardiac mitochondrial proteins did not contribute to heart failure and although hyperacetylation of the mitochondrial proteome in the heart can lead to functional decline, it was not sufficient to cause pathological remodeling during pressure overload using TAC [It has been reported that lysine acylation of mitochondrial proteins contributed to heart failure by impairment of the respiratory function and the oxidative metabolism ,96,97. Hsing TAC .In another work, the effect of SIRT3 downregulation on the mitochondrial acetylome in vivo induced by doxorubicin treatment was examined using MS . Doxorub+ (regulator of protein acetylation) were decreased as well as the levels of nicotinamide phosphoribosyltransferase, NAMPT, the enzyme related to NAD+ synthesis. Acetyl-CoA amounts in HFD hearts were enhanced. In addition, DRP1 acetylation was up-regulated in both HFD mice and HFHC monkey hearts in the mitochondrial fraction but not in the cytosolic fraction, suggesting that acetylation was associated with DRP1 translocation from the cytosol to the mitochondria. Thus, lipid overload promoted DRP1 acetylation. The following experiments in the culture of adult cardiomyocytes showed that under lipotoxicity caused by palmitate , cytosolic NAD+ levels decreased and DRP1 alteration repeated the changes observed in HFD hearts. Palmitate caused mitochondrial fission, sensitivity to mitochondrial permeability transition pore (mPTP) opening and cardiomyocyte death. By supplementation of NAD+ into cardiomyocyte cultures (using NAD+ precursor nicotinamide ribose chloride or NAD+ precursor nicotinamide mononucleotide or overexpression of NAMPT), the increase in the DRP1 level was blocked, along with DRP1 S616 phosphorylation and DRP1 acetylation. MS-based proteomics identified DRP1 acetylation at lysine sites K75 and K642 in HFD hearts and no acetylated peptides in control CD mice hearts. Further observations of adult cardiomyocytes suggested that palmitate regulated DRP1 activity and stability by acetylation of DRP1 at the K642 site. Next, DRP1 activation was studied in terms of promoting lipid overload-induced cardiomyocyte death. Using co-immunoprecipitation, DRP1 interacted with VDAC1 , and this interaction was enhanced in HFD hearts. In summary, in HFD-fed mouse hearts, DRP1 levels were up-regulated and a HFD regulated DRP1 phosphorylation, mitochondrial translocation from cytosol, oligomerization and GTPase activity in mice hearts. Similarly, in HFHC diet-fed monkeys, lipid overload resulted in DRP1 activation and myocardial damage. It was suggested that NAD+-modulated acetylation of DRP1 regulated the DRP1 levels and activity. Furthermore, the K642 acetylation of DRP1 during lipid overload may be important for DRP1 activation, and lipid overload-induced cardiomyocyte death was mediated via DRP1 activity, DRP1 acetylation and VDAC1.The function and acetylation of a mitochondrial fission regulator, dynamin-related protein 1 (DRP1), have been investigated in a model of lipid overload-induced cardiomyocyte death and myocardium dysfunction . Here, mThe review articles that have emerged over the past five years have reported the metabolic regulation of SIRT3, SIRT4 and SIRT5 in lysine acetylation, malonylation, succinylation and glutarylation ,102; the32P protein labeling, and the experiments confirmed the existence of dynamic and extensive mitochondrial matrix phosphoproteomes in both the heart and liver.Reversible phosphorylation is another PTM that has a crucial role in mitochondrial processes and functions. Recent progress in phosphoproteomic techniques has enabled many phosphorylated sites in the mitochondrial proteins to be identified. The constantly developing methods for mitochondrial isolation and fractionation, phosphopeptide/phosphoprotein enrichment and MS-based proteomics, with efficient and accurate analysis of accumulated data, have resulted in increased knowledge of the mitochondrial phosphoproteome. The studies confirmed that the impairment of mitochondrial phosphatases resulted in the dysfunction of the mitochondrial metabolism, implying the importance of phosphoproteome regulation for mitochondria homeostasis ,104,105.p \u2264 0.05 was statistically significant, FC \u2264 0.833 or FC \u2265 1.2). Out of 3812 proteins identified, 72 proteins were differentially expressed with 12 proteins up-regulated and 60 proteins down-regulated in the MAP4 KI group compared to the WT group. Using a GO database analysis of differentially expressed proteins, the most enriched proteins were related to GTP binding, guanyl ribonucleotide binding and guanyl nucleotide binding. The pathway analysis of differentially expressed proteins identified several cardiomyopathy-related pathways with hypertrophic cardiomyopathy as one of the most enriched pathways, implying the correlation of MAP4 phosphorylation with this disease. The MS data were confirmed by Western blotting for the proteins that were involved in regulation of mitochondrial function, i.e., mitochondrial ubiquitin ligase activator of NFKB (MUL1), growth arrest and DNA damage-inducible gamma interaction protein 1 (GADD45GIP1) and NADH-ubiquinone oxidoreductase 75 kDa subunit (NDUFS1). GADD45GIP1 levels were higher, whilst MUL1 and NDUFS1 levels were significantly lower in the MAP4 KI group compared to the WT control. In summary, this work identified proteins that were differentially expressed in heart tissue as a result of MAP4 phosphorylation, and it contributed to the knowledge on molecular mechanisms of MAP4 phosphorylation-induced mitochondrial dysfunction [The potential mechanism of microtubule-associated protein 4 (MAP4) phosphorylation in cardiomyocyte mitochondrial dysfunction has been reported using cardiac proteomics . Based o13C6 lysine -containing diet which were used as spike-in heavy standards for quantification of non-labeled experiments. The samples of heart tissues were subjected to 1-DE, and each lane was cut into six to twelve pieces. Equal proportions of Lys6-labelled and non-labelled protein bands were combined, in-gel digested using Lys C and the resulting peptides were analyzed by LC-MS/MS. A total of 24,366 phosphorylated sites were mapped to 4953 identified proteins; the majority of them were single phosphorylated peptides. A total of 84.3% of phosphorylated peptides were serine phosphorylated, 15.3% were threonine phosphorylated and 0.4% were tyrosine phosphorylated. The significant fold changes  in the expression of phosphorylated sites measured at time points P2 and P20 (both related to time point P10) showed 89 and 573 phosphopeptides differently regulated, respectively. The proteins that were annotated as mitochondrial included 495 phosphorylated sites. For example, subunits of the OXPHOS system exhibited an alteration in the expression of phosphorylated sites during development, and increased phosphorylation was identified for MIC60 (MICOS component subunit) at S113, S128 and S446 sites during development from P10. Furthermore, association of protein PGC-1- and ERR-induced regulators in muscle 1 (PERM1) to the outer mitochondrial membrane was detected as well as its upregulation during heart development from P2 to P20. PERM1 was highly phosphorylated with 34 phosphorylated sites identified. It was confirmed that PERM1 phosphorylation at S347, S358, S369 and S380 was mediated by casein kinase 2 (CK2), and phosphorylation regulated the stability of PERM1. Furthermore, to calculate the rate of Lys6 incorporation into newly synthesized proteins, mice fed with a Lys6-containing diet for 1\u20134 weeks were examined by LC-MS/MS and the ratios between non-labeled and Lys6-labelled peptides in heart tissues were calculated. PERM 1 showed a faster Lys-6 incorporation (6.4 days) compared to other mitochondrial proteins such as VDAC2, cytochrome c oxidase subunit 5B (COX5B) and heat shock protein 60 (HSP60) (average of 13 days). Furthermore, the experiments on PERM1-deleted mitochondria showed that mitochondrial proteins that mediated transport of amino acids and carnitine were down-regulated and that the levels of lipids, amino acids and acylcarnitines were changed. Thus, the authors concluded that mitochondrial PERM1 was crucial for lipid and amino acid homeostasis and contributed to the regulation of energy metabolism in mitochondria.A comprehensive dataset of dynamic changes in the proteome and phosphoproteome has been compiled in mouse hearts during postnatal development using spike-in SILAC  quantifiThe aim of the next study was to identify and characterize novel phosphorylated proteins in mitochondria that could be efficient in the prevention of I/R injury . SpragueThe phosphorylated mitochondrial proteins involved in the nitric oxide (NO)/protein kinase G (PKG)/mPTP pathway were investigated in a rat cardiac ischemia model . PreviouIn addition, methods have been published that were applicable for large-scale analysis of mitochondrial phosphoproteome in various cells and tissues . They inThe selected proteomic studies published in the last five years are overviewed with a focus on two heart diseases, myocardial I/R injury and cardiomyopathy. Papers that include proteomics of isolated mitochondria as well as proteomics of whole cell lysates with mitochondrial protein identification are discussed. Although one study targeted PTM (tyrosine nitration) changes during I/R, it was included in this section.An acute myocardial infarction (AMI), commonly termed as a heart attack, is an ischemic event that creates a high danger of developing HF. In an AMI, blood flow to the heart is suddenly restricted or blocked and it prevents the heart from receiving enough oxygen. This causes a necrosis of the tissue within at-risk myocardium and the final loss of functional tissue (infarct size) delineates the future clinical outcomes. The early blood restoration after the ischemic period, i.e., reperfusion, can prevent the increase in the infarct size of the ischemic tissue; however, it can have further negative consequences such as arrhythmias, dysfunction of cardiac contractility or even cell death ,116. DurRecently, a proteomic approach has been applied to evaluate mitochondrial and cardiomyocyte injury as a result of ETC damage during cardiac I/R  . Prior t2+ or during I/R in rat hearts [2O2) and lower amounts of cytochrome c and AIF were released outside of mitochondria. In addition, quantitative proteomics of isolated mitochondria identified up-regulation of proteins \u03b1-crystallin B chain, as well as paraplegin and sarcalumenin  and the proteins related to complex III in CPNS1-deleted mice. The proteomic analysis included separation of proteins by SDS-PAGE, in-gel digestion of the bands and protein identification using a UltiMate 3000 UHPLC system  interfaced with an Orbitrap Fusion Lumos Tribrid MS  performed in DDA acquisition mode. The data were analyzed by Thermo Scientific Proteome Discoverer (PD) software V2.3 against the UniProt mouse protein database  [Calpains (CPN1 and CPN2) are the proteins of the calcium-dependent, non-lysosomal cysteine proteases family and their activities are dependent on the intracellular calcium concentration. They have been involved in mitochondrial injury and implicated in the development of, e.g., myocardial infarction (MI), after I/R. Historically, they are known to be cytosolic proteins. However, both mitochondrial calpains (mCPN1 and mCPN2) have been found in various locations in cardiac mitochondria compartments dependent on their functions in various pathological conditions ,126,127.t hearts . Recent t hearts . Both CPt hearts . In [119Although nitrotyrosine formation in reversible postischemic contractile heart dysfunction  has been evaluated previously using immunohistochemistry and Western blotting , a recenSestrin2 is an essential protein that regulates the cell response to various stresses  and it iComparative proteomics has been used to identify differentially expressed proteins in isolated rat hearts subjected to normal, I/R and diazoxide post-conditioning (D-post) . The I/R2) oxidation via the reduction of ferricytochrome c in the Q-cycle. In this cycle, complex III is involved in the pathway of electron transfer from QH2 to the Rieske iron-sulfur cluster (2Fe-2S) and to heme c1, and this is controlled by the groups of heme bL  and bH  and by two semiquinones. Complex III\u2019s catalytic mechanism contributes to ATP synthesis and generation of endogenous superoxide anion radicals (.O2\u2212). In [122 of cytochrome c1 and C125 of heme c1 in complex III of I/R samples; this was not observed in sham or ischemic heart samples; (ii) oxidative modification of complex III by cysteine sulfonation/sulfination  after I/R in contrast to sham and ischemia samples; specifically, a significant increase in cysteine sulfonation and/or sulfination of the metal binding sites of the Rieske iron-sulfur cluster (cysteine residues C217 and C236), cytochrome c1 (C140 and C220) and other subunits of complex III (hinge protein (C65), core 1  and core 2 (C191)), and (iii) specific sulfonation of C236 caused damage to the metal binding of the Rieske iron-sulfur cluster by blocking oxidation of ubiquinol and thus electron transfer from ubiquinol to heme c1 through the (2Fe-2S) cluster. Since the C236 site of the Rieske iron-sulfur cluster is located inside of the cluster and it is not accessible to oxidation , it was implied that C236 is oxidized by ROS that are generated locally under stress created by I/R. The sulfonated cysteine sites of cytochrome c1 and the hinge protein are confined in the IMS of mitochondria, and core 1 and core 2 sulfonated cysteine sites are positioned in the mitochondrial matrix compartments. This fact further supported the idea that complex III residing in the IMM released ROS to both sides of the IMM during reperfusion [1 destruction by overproduction of ROS in the post-ischemia and in the enhanced oxidative sulfonation of the Rieske iron-sulfur cluster of complex III. These events contributed to increased formation of O2\u2212, which worsened I/R injury.The molecular mechanism of oxidative injury to mitochondria complex III after cardiac ischemia has been examined recently , providiO2\u2212). In , a rat herfusion . In summRecent work has examined the mitochondrial proteome in a pre-clinical model of ischemia (90 min of left anterior descending (LAD) coronary artery balloon occlusion), ischemia-revascularization ) and isCardiomyopathy is a heart disorder in which the heart\u2019s ability to pump blood to the rest of the body becomes restricted, which can lead to arrhythmias and eventually to HF. It affects the heart muscle, which can become stiff (restrictive cardiomyopathy), enlarged (dilated cardiomyopathy) and thickened (hypertrophic cardiomyopathy) and it can cause scar tissue.293 in CLP hearts. Moreover, a considerable decrease in PDH activity  was observed in CLP hearts compared to sham, and the mitochondrial oxygen consumption rate  in CLP hearts was decreased as well. Thus, cardiac dysfunction induced by sepsis was connected to inhibition of mitochondrial PDH and to compromised pyruvate-fueled oxidative respiration in the mice myocardium. In summary, this work on the sepsis myocardium identified molecular remodeling events that showed the functional relation between PDH inactivation and pyruvate/malate-based OCR without detection of any dysfunction of ETC complexes I, II and IV [The study of mitochondrial dysfunction and the profile of the mitochondrial proteome in polymicrobial sepsis-induced cardiomyopathy has been examined recently . Septic I and IV . Figure 13CD2O) or light (CH2O) formaldehyde to distinguish between peptides originated from diabetic mice or WT mice. LC-MS/MS (Easy-nLC 1200 coupled to Orbitrap Fusion Lumos Tribrid MS (Thermo Scientific)) was used to analyze the samples. In addition to proteomic analysis, a quantitative evaluation was performed by transthoracic echocardiography and Doppler tissue imaging. They revealed that diabetic mice exhibited diastolic dysfunction and cardiac hypertrophy compared to non-diabetic mice, which confirmed the onset of diabetic cardiomyopathy. A proteomic comparative analysis identified 53 proteins differentially expressed in diabetic mice compared to WT mice, with 30 proteins down-regulated and 23 proteins up-regulated. Among them, the mitochondrial proteins that regulate mitochondrial ATP production and electron transfer in ETC were detected, for example, alpha, beta, delta and epsilon subunits of ATP synthase (ATP5) and cytochrome c1 (complex III) were up-regulated, whilst NDUFB11 and kinase COQ8A (ADCK3) were down-regulated in diabetic mice compared to WT. In order to identify the interconnectivities between proteins (protein\u2013protein interactions) as well as protein biological pathways, the proteins were submitted to the STRING and IPA databases. A STRING analysis of differentially expressed proteins showed enrichment of proteins involved in calcium ion binding (six proteins) and in the striated muscle contraction (two proteins) in WT mice. On the contrary, in diabetic mice, the major enrichment was for the proteins associated with metabolism (nine proteins), FAO (seven proteins) and ATP synthesis (four proteins), with two proteins involved in striated muscle contraction as well. An analysis by IPA indicated OXPHOS and mitochondrial dysfunction as the highest scoring networks in diabetic mice. In addition, differentially expressed proteins were engaged in biological processes such as mitochondrial dysfunction, cardiac fibrosis, cardiac hypertrophy and cardiac necrosis/cell death. Diabetic cardiomyopathy is a form of cardiovascular disease that can afflict people suffering from diabetes mellitus. It is characterized by structural abnormalities and cardiac dysfunction. It can lead to HF and usually the symptoms that otherwise mark HF are not present. Recently, the mitochondrial protein changes associated with diabetic cardiomyopathy have been studied in mice with type 2 diabetes using proteomic profiling . The lefAnother work that has studied diabetic cardiomyopathy examined the role of SIRT3 in this disease . SIRT3 rTo understand the causes and mechanisms of disease and determine the appropriate treatments, pathological models are often created. During modeling of pathological conditions related to mitochondrial dysfunction, various drugs (streptozotocin) and metabolic inhibitors  are used. Although use of these pathological models highly contributes to disease characterization, the drugs/inhibitors that are used can exhibit additional effects that can interfere with interpretation of the protein expression and activation status. In addition, these models do not fully reflect the true disease situation which can be affected by variables such as human age, exposure to therapeutic agents and environment. These facts can complicate the results and prevent scientists from coming to the correct conclusions.Furthermore, mitochondrial proteins are responsible for many cellular functions, and as protein interactions are essential for cellular activities, the proteins do not function as single units but they act as multiprotein complexes. Thus, many pathological alterations can occur because of the disturbances in protein interactions and are not necessary because of protein changes. Hence, the methods that can quantify protein\u2013protein interactions, in addition to the methods that identify the interacting protein partners, are important. In addition, mitochondrial proteins possess structural and biochemical differences and their changes in pathologies should be taken into consideration in addition to the data acquired by proteomics. Therefore, proteomics accompanied by other methods  can be more informative and can contribute to a more complete mitochondrial protein profiling. Notably, the expression status of mitochondrial proteins identified by MS-based proteomics should be always confirmed and validated by other methods.The advances in MS-based proteomics minimizes the obstacles related to risk of high false positive rates and identification of low abundance proteins. It is possible to identify and quantify thousands of proteins simultaneously over a high dynamic range and identify mitochondrial proteins from the whole cell proteome. It can be expected in the future that MS-based proteomics will be more often applied to characterization of mitochondrial proteins. Thus, mitochondrial pathways leading to both disease and protection will be described at the protein level. For example, using metabolic labeling of the mitochondrial proteins by non-canonical amino acid AHA could monitor the protein dynamics and allow for identification of newly synthesized proteins in vitro and in vivo in a short time window of a few hours after their synthesis. This could reveal the dysregulation of mitochondrial proteins at early stages of their synthesis and thus earlier recognition of the factors involved in their pathology can be possible as well as the indication of therapeutic targets.The integrated approach of combining omics technologies in mitochondrial research is a very promising future direction. For example, proteomics magnified and complemented by metabolomic results is especially fitting for investigation of mitochondrial dysfunction and metabolic changes in cardiovascular pathologies. It can show how different expression of proteins affects cellular processes. Several studies have been reported using this approach, and it can be expected that more studies will take advantages of these methods in the future.However, the major task is to transfer the knowledge obtained in the laboratory to clinical practice. This process is rather slow, although the proteins identified by proteomics as the markers for disease prevention, diagnosis and therapy have found their places in clinics for routine diagnostics. The major hurdles related to this transfer are the quality of sample collection, the complexity of biological sample preparation, instrumentation availability for protein quantity measurements and the accessibility to large patient cohorts for new biomarker validation. The progress in the research of mitochondrial dysfunction-related disorders together with the characterization of the involved mechanisms on a molecular level by highly sensitive instruments in MS-based proteomics has resulted in novel discoveries. These findings have contributed to the explanation of mitochondrial protein interactions and pathways and have indicated protein players associated with pathological conditions. By using MS instruments and developing innovative statistical methods for efficient and accurate analysis of data, investigations of the mitochondrial human proteome are possible, since a small amount of tissue from, e.g., a biopsy, can be sufficient to obtain the relevant data. However, since the mitochondrial proteome is highly dynamic and it changes in both quality and quantity in response to various physiological changes, the important task is to select the right time window and sample type which best represent these changes."
\ No newline at end of file