diff --git "a/deduped/dedup_0078.jsonl" "b/deduped/dedup_0078.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0078.jsonl"
@@ -0,0 +1,42 @@
+{"text": "Pseudendoclonium (Ulvophyceae), in particular, is characterized by an atypical quadripartite architecture that deviates from the ancestral type by a large inverted repeat (IR) featuring an inverted rRNA operon and a small single-copy (SSC) region containing 14 genes normally found in the large single-copy (LSC) region. To gain insights into the nature of the events that led to the reorganization of the chloroplast genome in the Ulvophyceae, we have determined the complete cpDNA sequence of Oltmannsiellopsis viridis, a representative of a distinct, early diverging lineage.The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. The basal position of the Prasinophyceae has been well documented, but the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae is currently debated. The four complete chloroplast DNA (cpDNA) sequences presently available for representatives of these classes have revealed extensive variability in overall structure, gene content, intron composition and gene order. The chloroplast genome of Oltmannsiellopsis differs considerably from Pseudendoclonium and other chlorophyte cpDNAs in intron content and gene order, but shares close similarities with its ulvophyte homologue at the levels of quadripartite architecture, gene content and gene density. Oltmannsiellopsis cpDNA encodes 105 genes, contains five group I introns, and features many short dispersed repeats. As in Pseudendoclonium cpDNA, the rRNA genes in the IR are transcribed toward the single copy region featuring the genes typically found in the ancestral LSC region, and the opposite single copy region harbours genes characteristic of both the ancestral SSC and LSC regions. The 52 genes that were transferred from the ancestral LSC to SSC region include 12 of those observed in Pseudendoclonium cpDNA. Surprisingly, the overall gene organization of Oltmannsiellopsis cpDNA more closely resembles that of Chlorella (Trebouxiophyceae) cpDNA.The 151,933 bp IR-containing genome of Oltmannsiellopsis and Pseudendoclonium contained a minimum of 108 genes, carried only a few group I introns, and featured a distinctive quadripartite architecture. Numerous changes were experienced by the chloroplast genome in the lineages leading to Oltmannsiellopsis and Pseudendoclonium. Our comparative analyses of chlorophyte cpDNAs support the notion that the Ulvophyceae is sister to the Chlorophyceae.The chloroplast genome of the last common ancestor of  Mesostigma viride  with those of the four chlorophyte cpDNAs completely sequenced thus far, i.e. the genomes of Nephroselmis [GenBank:NC_000927], Chlorella [GenBank:NC_001865], Pseudendoclonium [GenBank:AY835431] and Chlamydomonas [GenBank:NC_005353]. At 59.5%, the overall A+T content of Oltmannsiellopsis cpDNA is similar to that of Nephroselmis cpDNA but is significantly lower than those of the three previously sequenced UTC genomes. The Oltmannsiellopsis genome maps as a circular molecule of 151,933 bp . A total of five introns, all of which belong to the group I family, were identified in Oltmannsiellopsis cpDNA.Table Oltmannsiellopsis cpDNA is intermediate between those of Chlorella and Chlamydomonas cpDNAs  and trnR(ccg). Relative to Chlorella cpDNA, the genomes of Oltmannsiellopsis, Pseudendoclonium and Chlamydomonas are missing a set of five genes, i.e. cysA, cyst, and three tRNA genes (trnL(gag), trnS(gga) and trnT(ggu))  and trnR(ccg)) is uniquely shared by Oltmannsiellopsis and Chlamydomonas cpDNAs, whereas no specific gene loss is shared by Pseudendoclonium and Chlamydomonas cpDNAs. Both Oltmannsiellopsis and Pseudendoclonium cpDNAs have retained the trnR(ccu) gene, which is absent from all other completely sequenced chlorophyte cpDNAs.The gene content of As Table . Althougre Table . OltmannOltmannsiellopsis cpDNA are expanded relative to their Mesostigma counterparts .K medium  under 12K medium . SequencE value threshold of 1 \u00d7 10-4. Homologous introns inserted at identical positions within the same gene were identified by manual screening of the GOBASE database [Genes and ORFs were identified as described previously . Homologdatabase .Repeated sequences were mapped with PipMaker , identiftrans-spliced psaA gene were coded as distinct fragments .The GRIMM web server  was usedcpDNA, chloroplast DNA; IR, inverted repeat; LSC, large single copy; ORF, open reading frame; rRNA, ribosomal rRNA; SDR, short dispersed repeat; SSC, small single copy; UTC, Ulvophyceae/Trebouxiophyceae/Chlorophyceae.JFP participated in the conception of this study, carried out the genome sequencing, performed all sequence analyses, annotated the genome, generated the figures, and drafted the manuscript. CL and MT conceived the study, contributed to the interpretation of the data, and helped to prepare the manuscript. All authors read and approved the final manuscript."}
+{"text": "Mesostigma viride  and land plant chloroplast genome sequences revealed that this genome experienced many gene losses, intron insertions and gene rearrangements during the evolution of charophyceans. On the other hand, the chloroplast genome of Chaetosphaeridium globosum  is highly similar to its land plant counterparts in terms of gene content, intron composition and gene order, indicating that most of the features characteristic of land plant chloroplast DNA (cpDNA) were acquired from charophycean green algae. To gain further insight into when the highly conservative pattern displayed by land plant cpDNAs originated in the Streptophyta, we have determined the cpDNA sequences of the distantly related zygnematalean algae Staurastrum punctulatum and Zygnema circumcarinatum.The Streptophyta comprise all land plants and six monophyletic groups of charophycean green algae. Phylogenetic analyses of four genes from three cellular compartments support the following branching order for these algal lineages: Mesostigmatales, Chlorokybales, Klebsormidiales, Zygnematales, Coleochaetales and Charales, with the last lineage being sister to land plants. Comparative analyses of the Staurastrum and 165,372 bp Zygnema cpDNAs encode 121 and 125 genes, respectively. Although both cpDNAs lack an rRNA-encoding inverted repeat (IR), they are substantially larger than Chaetosphaeridium and land plant cpDNAs. This increased size is explained by the expansion of intergenic spacers and introns. The Staurastrum and Zygnema genomes differ extensively from one another and from their streptophyte counterparts at the level of gene order, with the Staurastrum genome more closely resembling its land plant counterparts than does Zygnema cpDNA. Many intergenic regions in Zygnema cpDNA harbor tandem repeats. The introns in both Staurastrum (8 introns) and Zygnema (13 introns) cpDNAs represent subsets of those found in land plant cpDNAs. They represent 16 distinct insertion sites, only five of which are shared by the two zygnematalean genomes. Three of these insertions sites have not been identified in Chaetosphaeridium cpDNA.The 157,089 bp The chloroplast genome experienced substantial changes in overall structure, gene order, and intron content during the evolution of the Zygnematales. Most of the features considered earlier as typical of land plant cpDNAs probably originated before the emergence of the Zygnematales and Coleochaetales. Mesostigma viride, belong to the sister lineage Chlorophyta  and 165,372-bp Zygnema [GenBank:AY958086] cpDNAs map as circular molecules containing 121 and 125 genes, respectively  gene, the sequences of which differ at two positions. Note that the matK gene was not included in the total number of genes calculated for Zygnema cpDNA, because this gene occurs as an intron ORF in all other streptophytes where it has been identified. Aside from the absence of the IR, the most prominent differences displayed by the two zygnematalean cpDNAs relative to their counterparts in Chaetosphaeridium [Marchantia polymorpha [cis-spliced group II introns  are theStaurastrum, Zygnema, Chaetosphaeridium and Marchantia cpDNAs. The two zygnematalean cpDNAs share 120 genes, 116 of which are present in both Chaetosphaeridium and Marchantia cpDNAs. Five genes in Zygnema cpDNA are missing from Staurastrum cpDNA; they encode the tRNAPro(GGG), tRNASer(CGA), ribosomal protein L5, and the proteins CysA and CysT that are involved in sulfate transport. Although there is no functional trnS(cga) in Staurastrum cpDNA, a trnS(cga) pseudogene was identified in this genome. A standard acceptor stem could not be modelled from the RNA sequence derived from this pseudogene; the 5' region of this sequence diverges considerably from homologous tRNA sequences in other streptophytes and cannot base pair with the 3' region. Staurastrum exhibits only one chloroplast gene (rpl22) that is missing from Zygnema. To our knowledge, this is the first time that the loss of rpl22 together with that of rpl32  has been reported in the Streptophyta. As in land plant cpDNAs, but in contrast to Chaetosphaeridium cpDNA, no tufA-like sequence was detected in the two zygnematalean cpDNAs. It appears that only the chlI, odpB and ycf62 genes were specifically lost just before or concurrently with the emergence of land plants  in Marchantia cpDNA and that of 13 genes delimited by rps12b and atpI were likely present in the common ancestor of Staurastrum and Zygnema. Only four gene clusters are shared specifically between zygnematalean and Marchantia cpDNAs: rps4-trnS(gga)-ycf3 -trnMe(cau)-ndhC-ndhK-ndhJ (cluster 15), trnH(gug)-ftsH-trnD(guc) (in Staurastrum only), and trnE(uuc)-cysA-trnT(ggu) (in Zygnema only).Of the two zygnematalean cpDNAs, that showing the most similar gene arrangement with its NA Table . In bothum Table . Staurasa cpDNAs  reveals Staurastrum cpDNA compared to its Zygnema homologue at the gene organizational level is also evident when one examines the genomic region in which each gene locus would be expected to map if the IR had been retained , two cis-spliced group II introns in rpl16 and trnG(ucc), and one trans-spliced group II intron in rps12. Only three group II introns in Staurastrum and/or Zygnema cpDNAs  have no homologues in Chaetosphaeridium cpDNA. Evidence for a charophycean green algal origin of land plant group II introns is lacking for only the clpP intron at site 363. The Staurastrum trans-spliced rps12 intron resembles its Chaetosphaeridium homologue in exhibiting a large ORF in domain IV. The putative protein of 404 amino acids encoded by the Staurastrum ORF is related to reverse transcriptases, whereas the smaller protein (247 amino acids) specified by the Chaetosphaeridium ORF lacks similarity with such proteins.As in NAs Fig. . Both zyChaetosphaeridium and land plant counterparts, the cis-spliced group II intron in Staurastrum trnK(uuu) encodes the maturase MatK. As mentioned earlier, a freestanding matK gene was identified in Zygnema cpDNA even though an intron is absent from trnK(uuu) in this charophycean green alga. Close inspection of the regions immediately flanking the Zygnema matK gene for the presence of sequences conserved in domains V and VI of group II introns failed to reveal any evidence that this gene had once been an integral part of a group II intron. The Zygnema matK is most probably a functional gene because its predicted protein features the vast majority of the conserved amino acids that the trnK intron-encoded MatK of Staurastrum shares with its Chaetosphaeridium, Chara, Nitella and land plant homologues  that are in direct orientation, no dispersed repeats larger than 30 bp were detected in Staurastrum cpDNA.Only two loci of the Staurastrum and Zygnema cpDNAs bear high similarity in primary sequence and gene content to their Chaetosphaeridium and land plant counterparts, they differ substantially from one another and from the latter genomes in overall structure, gene order and intron content. From our comparative analysis of streptophyte cpDNAs, we infer that the chloroplast genome of the last common ancestor of Staurastrum and Zygnema probably lacked a large IR encoding the rRNA genes, had a low gene density, and more closely resembled Chaetosphaeridium and land plant cpDNAs at the gene organizational and intron levels than do Zygnema and Staurastrum cpDNAs. At least 16 of the 22 intron positions commonly found in land plant cpDNAs, including three sites that have not been identified in Chaetosphaeridium, were probably present in the common ancestor of Staurastrum and Zygnema.Although Staurastrum and Zygnema cpDNAs, it is not surprising that these genomes are considerably rearranged relative to their coleochaetalean and land plants counterparts that have retained the quadripartite structure. All green plant cpDNAs that have lost the IR tend to be highly scrambled in gene order [Zygnema than in the repeat-poor genome of Staurastrum. As in the cpDNAs of the nonphotosynthetic, parasitic flowering plant Epifagus virginiana [Oenothera [Zygnema cpDNA consist essentially of tandem repeats that probably arose by replication slippage.Considering the absence of an rDNA-encoding IR region in both ne order ,27. It hne order . In agrene order , we idenrginiana  and the enothera , the repStaurastrum and Zygnema cpDNAs. This hypothesis is more parsimonious than the alternative scenario involving two independent losses, and is consistent with previous evidence that the cpDNA of Spirogyra (a distant relative of Zygnema) has no IR [Staurastrum and Zygnema cpDNAs share 11 rearrangement breakpoints within ancestral gene clusters. Given the close connection between IR loss and gene rearrangements, several of these shared breakpoints might have appeared following the loss of the IR in the lineage leading to the last common ancestor of Staurastrum and Zygnema. Considering that this ancestor occupies a basal position in the tree describing the relationships among zygnematalean green algae [A single event of IR loss likely accounts for the absence of a quadripartite structure from both as no IR . It is aen algae ,22, thenStaurastrum and Zygnema cpDNAs is unexpected. The two zygnematalean cpDNAs share only five of the 16 intron insertion sites they exhibit in total.Staurastrum cpDNA lacks seven of the 13 introns that are present in Zygnema cpDNA, whereas the latter cpDNA lacks five of the eight introns found in the former genome. The intron distributions in these cpDNAs are best explained by assuming that all 16 insertion sites were populated with introns in the common ancestor of Staurastrum and Zygnema and that subsequently, several introns were specifically lost in each of the lineages leading to these green algae. Obviously, we cannot exclude the possibility that chloroplast introns occupying common insertion sites were lost independently in the Staurastrum and Zygnema lineages; thus, the predicted number of introns in the common ancestor of these algae may represent a minimal estimate. Given that intron losses are thought to result from insertions, through homologous recombination, of intron-less cDNA copies generated by reverse transcription [Staurastrum trans-spliced rps12 intron specifies a reverse transcriptase and is the only known streptophyte chloroplast intron encoding such an activity.As introns appear to be generally stable in land plant cpDNAs , the impcription , the frematK is free-standing in Zygnema cpDNA together with the absence of the trnK(uuu) intron in which it usually resides strongly suggests that its putative maturase product is essential for the splicing of group II introns other than the trnK(uuu) intron. Circumstantial evidence that MatK functions in splicing of multiple introns has previously been reported for land plant chloroplasts. The matK gene is located within the group II intron of trnK(uuu) in all photosynthetic land plants, but occurs as a free-standing gene in Epifagus cpDNA [In vivo splicing analyses of the complete set of chloroplast group II introns in land plant mutants lacking chloroplast ribosomes disclosed specific splicing defects involving mainly group IIA introns , thus implying that cpDNA-encoded protein(s) act as splicing factors [trnK(uuu) intron-specific maturase to a more versatile maturase that assists the splicing of most or all group IIA introns of land plants [Our finding that us cpDNA . In vivo factors -35. It hd plants -35.Staurastrum and Zygnema chloroplast genomes have revealed that many of the features considered earlier as typical of land plant cpDNAs originated before the emergence of the Coleochaetales and Zygnematales. While the chloroplast genome appears to have remained relatively stable in the coleochaetalean lineage, it has lost the IR and has undergone many changes in gene order and intron content during the evolution of the Zygnematales.Our structural analyses of the Staurastrum punctulatum de Br\u00e9bisson (SAG 679-1) and Zygnema circumcarinatum Czurda (SAG 698-1a) were obtained by isopycnic centrifugation of total cellular DNAs in CsCl-bisbenzimide gradients [E. coli Klenow fragment and T7 DNA polymerase and cloned into the SmaI site of Bluescript II KS+ or into ligation-ready pSMART-HCKan . After filter hybridization of the clones with the original DNA used for cloning as a probe, DNA templates from positive clones were prepared with the QIAprep 96 Miniprep kit .Chloroplast DNA fractions from radients . A randoChaetosphaeridium and Marchantia IRs were excluded in these gene order analyses. Pairwise comparisons of genome sequences were carried out using PipMaker [Nucleotide sequences were determined with the PRISM BigDye terminator cycle sequencing ready reaction kit , the PRISM dGTP BigDye terminator ready reaction kit (Applied Biosystems), and the DYEnamic ET terminator cycle sequencing kit  on ABI model 373 or 377 DNA sequencers (Applied Biosystems), using T3 and T7 primers as well as oligonucleotides complementary to internal regions of the plasmid DNA inserts. Genomic regions not represented in the clones analyzed were sequenced from PCR-amplified fragments. Sequences were assembled using SEQUENCHER 4.1.1  and analyzed using the Genetics Computer Group  software (version 10.3) package. Protein-coding and rRNA genes were identified by BLAST searches . RepeatePipMaker .cpDNA, chloroplast DNA; IR, inverted repeat; ORF, open reading frame; rRNA, ribosomal RNA.Staurastrum and Zygnema chloroplast genomes. CO and CL participated in the assembly of the genome sequences. CL performed all sequence analyses and generated the figures. All authors read and approved the final manuscript.MT conceived and designed the study, contributed to the analysis and interpretation of the data and wrote the manuscript. CO carried out the sequencing of the"}
+{"text": "Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage.The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ considerably in gene content.The 161,452 bp IR-containing genome of Scenedesmus and Chlamydomonas.Our results underscore the remarkable plasticity of the chlorophycean chloroplast genome. Owing to this plasticity, only a sketchy portrait could be drawn for the chloroplast genome of the last common ancestor of  Mesostigma viride at the base of the Streptophyta and Chlorophyta .An A+T rich fraction containing cpDNA was isolated and sequenced as described in Pombert et al. . SequencGene content was determined by Blast homology searches  against trans-spliced psaA gene were coded as distinct fragments .The GRIMM web server  was usedcpDNA, chloroplast DNA; CW, clockwise; DO, directly opposed; IR, inverted repeat; LSC, large single copy; SDR, short dispersed repeat; SSC, small single copy; UTC, Ulvophyceae/Trebouxiophyceae/Chlorophyceae.JCC participated in the conception of this study, carried out part of the genome sequencing, performed all sequence analyses, annotated the genome, generated the tables and figures, and drafted the manuscript. CO participated in the sequencing and contributed to the assembly of the genome sequence. CL and MT conceived and supervised the study, contributed to the interpretation of the data and prepared the manuscript. All authors read and approved the final manuscript."}
+{"text": "Nephroselmis olivacea, the degree of remodelling sustained by the two ulvophyte cpDNAs completely sequenced to date is intermediate relative to those observed for chlorophycean and trebouxiophyte cpDNAs. Chlorella vulgaris  is currently the only photosynthetic trebouxiophyte whose complete cpDNA sequence has been reported. To gain insights into the evolutionary trends of the chloroplast genome in the Trebouxiophyceae, we sequenced cpDNA from the filamentous alga Leptosira terrestris .In the Chlorophyta \u2013 the green algal phylum comprising the classes Prasinophyceae, Ulvophyceae, Trebouxiophyceae and Chlorophyceae \u2013 the chloroplast genome displays a highly variable architecture. While chlorophycean chloroplast DNAs (cpDNAs) deviate considerably from the ancestral pattern described for the prasinophyte Leptosira chloroplast genome resembles the 150,613-bp Chlorella genome in lacking a large inverted repeat (IR) but differs greatly in gene order. Six of the conserved genes present in Chlorella cpDNA are missing from the Leptosira gene repertoire. The 106 conserved genes, four introns and 11 free standing open reading frames (ORFs) account for 48.3% of the genome sequence. This is the lowest gene density yet observed among chlorophyte cpDNAs. Contrary to the situation in Chlorella but similar to that in the chlorophycean Scenedesmus obliquus, the gene distribution is highly biased over the two DNA strands in Leptosira. Nine genes, compared to only three in Chlorella, have significantly expanded coding regions relative to their homologues in ancestral-type green algal cpDNAs. As observed in chlorophycean genomes, the rpoB gene is fragmented into two ORFs. Short repeats account for 5.1% of the Leptosira genome sequence and are present mainly in intergenic regions.The 195,081-bp Leptosira cpDNA and its chlorophycean counterparts suggest that the same evolutionary forces shaped the IR-lacking chloroplast genomes in these two algal lineages.Our results highlight the great plasticity of the chloroplast genome in the Trebouxiophyceae and indicate that the IR was lost on at least two separate occasions. The intriguing similarities of the derived features exhibited by  All chloroplasts of photosynthetic eukaryotes inherited from their cyanobacterial ancestors a reduced genome that encodes part of the genes essential for their biogenesis. The chloroplast genome has been studied in various algal lineages, particularly in the green algal/land plant lineage (Viridiplantae) for which the number of complete chloroplast DNA (cpDNA) sequences available in public databases increases steadily. Comparative analyses of the latter genome sequences highlight distinct evolutionary trends in the Streptophyta and the Chlorophyta. In the Streptophyta, the division comprising the green algae from the class Charophyceae and all land plants, the chloroplast genome shows remarkable conservation in overall structure, gene content, gene order and intron content ,2. In coOltmannsiellopsis viridis . Although the latter three genes are missing, the set of 28 tRNA species encoded by Leptosira cpDNA is sufficient to read all codons present in this genome. The trnL(gag) and trnT(ggu) genes are also missing in the two ulvophyte and three chlorophycean green algal chloroplast genomes sequenced so far and chlI is absent from all three chlorophycean genomes: however, the ccsA and ycf12 genes have been retained in all these genomes. Aside from Leptosira, the trnS(gga) gene has been lost from all UTC algal cpDNAs previously investigated, except Chlorella and Stigeoclonium.The chloroplast gene repertoire of Leptosira cpDNA have expanded coding regions relative to their Nephroselmis and streptophyte homologues. Nine genes in the Leptosira genome are more than 50% larger than their Mesostigma counterparts  compared to only three in Chlorella cpDNA   downstream of rrs and the relocalization of this gene 62 kb away from the remaining portion of the operon.Unlike its s Figure . Howevers Figure . LeptositrnV(uac)-trnL(caa) and rpl20-rps18, are shared specifically between Leptosira and Chlorella cpDNAs. The rpl20-rps18 gene pair is also conserved in the ulvophytes Oltmannsiellopsis and Pseudendoclonium.Only two derived gene clusters, Leptosira and other green algal cpDNAs, we also estimated the minimal number of gene permutations that would be required to convert the gene order of a given genome to that of another genome. More specifically, we examined the orders of the 86 genes common to the cpDNAs of Leptosira, Chlorella, Nephroselmis, Oltmannsiellopsis, Pseudendoclonium, Stigeoclonium, Scenedesmus and Chlamydomonas using GRIMM .x medium  under 12x medium . SequencLeptosira and Chlorella cpDNAs were produced to search for the presence of shared repeated elements = 30 bp with up to 10% mismatches using the -d -p -l 30 -e 3 -seedlength 10 -q -v options of V match [Genes were identified by BLAST searches  against  V match . The res V match .psaA and rbcL genes, the two exons of the trans-spliced psaC and petD genes, as well as the rpoBa and rpoBb genes, were coded as distinct fragments .The GRIMM web server  was usedJCdC participated in the conception of this study, carried out part of the genome sequencing, performed all sequence analyses, annotated the genome, generated the tables and figures and drafted the manuscript. CO participated in the sequencing and contributed to the assembly of the genome sequence. CL and MT conceived and supervised the study, contributed to the interpretation of the data and prepared the manuscript. All authors read and approved the final manuscript."}
+{"text": "The possible emergence of resistance to the only available drug for schistosomiasis spurs drug discovery that has been recently incentivized by the availability of improved transcriptome and genome sequence information. Transient RNAi has emerged as a straightforward and important technique to interrogate that information through decreased or loss of gene function and identify potential drug targets. To date, RNAi studies in schistosome stages infecting humans have focused on single (or up to 3) genes of interest. Therefore, in the context of standardizing larger RNAi screens, data are limited on the extent of possible off-targeting effects, gene-to-gene variability in RNAi efficiency and the operational capabilities and limits of RNAi.in vitro the sensitivity and selectivity of RNAi using double-stranded (ds)RNA (approximately 500 bp) designed to target 11 Schistosoma mansoni genes that are expressed in different tissues; the gut, tegument and otherwise. Among the genes investigated were 5 that had been previously predicted to be essential for parasite survival. We employed mechanically transformed schistosomula that are relevant to parasitism in humans, amenable to screen automation and easier to obtain in greater numbers than adult parasites. The operational parameters investigated included defined culture media for optimal parasite maintenance, transfection strategy, time- and dose- dependency of RNAi, and dosing limits. Of 7 defined culture media tested, Basch Medium 169 was optimal for parasite maintenance. RNAi was best achieved by co-incubating parasites and dsRNA (standardized to 30 \u00b5g/ml for 6 days); electroporation provided no added benefit. RNAi, including interference of more than one transcript, was selective to the gene target(s) within the pools of transcripts representative of each tissue. Concentrations of dsRNA above 90 \u00b5g/ml were directly toxic. RNAi efficiency was transcript-dependent (from 40 to >75% knockdown relative to controls) and this may have contributed to the lack of obvious phenotypes observed, even after prolonged incubations of 3 weeks. Within minutes of their mechanical preparation from cercariae, schistosomula accumulated fluorescent macromolecules in the gut indicating that the gut is an important route through which RNAi is expedited in the developing parasite.We investigated S. mansoni newly transformed schistosomula yet the sensitivity of individual gene targets varies. These findings and the operational parameters defined will facilitate larger RNAi screens.Transient RNAi operates gene-selectively in  Schistosoma mansoni, one of a number of schistosome species causing schistosomiasis. In consideration of large-scale screens to identify candidate drug targets, we examined the selectivity and sensitivity (the degree of suppression) of RNAi for 11 genes produced in different tissues of the parasite: the gut, tegument (surface) and otherwise. We used the schistosomulum stage prepared from infective cercariae larvae which are accessible in large numbers and adaptable to automated screening platforms. We found that RNAi suppresses transcripts selectively, however, the sensitivity of suppression varies (40%\u2013>75%). No obvious changes in the parasite occurred post-RNAi, including after targeting the mRNA of genes that had been computationally predicted to be essential for survival. Additionally, we defined operational parameters to facilitate large-scale RNAi, including choice of culture medium, transfection strategy to deliver dsRNA, dose- and time-dependency, and dosing limits. Finally, using fluorescent probes, we show that the developing gut allows rapid entrance of dsRNA into the parasite to initiate RNAi.RNA interference (RNAi) is a technique to selectively suppress mRNA of individual genes and, consequently, their cognate proteins. RNAi using double-stranded (ds) RNA has been used to interrogate the function of mainly single genes in the flatworm,  Schistosoma haematobium is associated with an increased risk of bladder cancer Schistosomiasis is one of a number of \u2018neglected tropical diseases\u2019 (NTDs) associated with extreme poverty in the world's \u2018bottom billion\u2019 people Because treatment and control of schistosomiasis has come to rely on a single drug, praziquantel PZQ; , concernin silico and experimental data to suggest that the necessary RNAi molecular machinery is present Key initial tasks for drug development are the identification and validation of gene products for which modulation by chemical and/or genetic means translates to impaired cell/organism survival. For schistosomes, comprehensive transcriptome Schistosoma mansoni that parasitizes the snail vector To date, RNAi studies with schistosomes relevant to infection in humans have focused on single  at UCSF.S. mansoni is maintained in the laboratory using the intermediate snail host, Biomphalaria glabrata and the Golden Syrian hamster, Mesocricetus auratus,  as the definitive host A Puerto Rican isolate of 2 and 37\u00b0C. Media tested were: Basch Medium 169; DMEM ; F-12 (CCFAB002); Liebovitz's L-15 Medium without NaHCO3 (CCFDY003); M199 with Earle's Salts (CCFAX001); RPMI 1640 (containing 2mM glutamine (CCFAE001) and supplemented with 10 mM HEPES), and Schneider's Drosophila Medium (INVZR512). Phenotypic alterations in translucency, shape and motility To compare the effects of different defined culture media on parasite vitality, 200\u2013300 schistosomula were incubated in 96-well flat-bottom plates (Corning) containing 200 \u00b5L medium, 5% FBS and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin for up to 7 days at 5% COS. mansoni proteases; cathepsin B1 (using a dsRNA targeting both isoforms - CB1.1 (AJ506157) and CB1.2, (AJ506158), cathepsin C  and cathepsin D  S. mansoni in a recent comparative genomics analysis Schistosoma taxid ID of 6181). Sequence areas displaying homology  with other Schistosoma genes were avoided in order to decrease the risk of off-targeting.We selected 11 genes encoding diverse proteins and putatively expressed in different tissues  in order to assess any variability in the ability to suppress gene transcription. For gut genes, we chose 3 well-characterized in vitro cultivated S. mansoni schistosomula cDNA using gene-specific primers for the targeted genes (in vitro using the T7 RiboMAX express RNAi system (Promega) and the resulting single-stranded RNA pooled to generate dsRNA that was then treated with RNase A and DNase. The manufacturer's instructions were applied apart from scaling the reverse transcription reaction to 100 \u00b5l and allowing it to proceed overnight at 37\u00b0C with a final hour at 42\u00b0C. The dsRNA was precipitated using 1 volume of 10% 3 M sodium acetate (pH 5.2) in 100% isopropanol, and pelleted at 12 000 g for 15 min at 4\u00b0C. The pellet was washed in 70% ethanol, air-dried and resuspended in water. The concentration of dsRNA was measured in an ND-1000 Spectrophotometer (Nanodrop Technologies) and adjusted to 3.0 mg/ml. The size and integrity of the resulting dsRNA was confirmed by electrophoresis in 1% agarose gels and stored at \u221280\u00b0C until use.PCR products of approximately 500 bp in size were amplified from cDNA prepared from 6 day-old ed genes . The expDiscosoma sp. fluorescent protein, mCherry (Label IT Nucleic Acid Labeling Reagent (Mirus) according to the manufacturer's instructions. Labeling efficiency was monitored using an ND-1000 Spectrophotometer.For synthesis of Cy5-labeled dsRNA to CC, CB1 and the 2. To isolate for the effect of electroporation on RNAi efficiency, the following additional incubations were set up. Groups of 400 schistosomula were transferred to 4 mm electroporation cuvets (Bio-Rad Laboratories) in Basch Incomplete Medium 169. DsRNA (30 \u00b5g) was then added  in Incomplete Medium 169 to give a final volume of 100 \u00b5l. Electroporation was carried at 125 V for 20 ms Schistosomula were divided into groups of approximately 400 and incubated in 24-well plates containing 1 ml Complete Medium 169 (plus 5% FBS) and dsRNA (30 \u00b5g unless otherwise stated) targeting either schistosome transcripts or mCherry that was employed as a schistosome-unspecific control. Incubations were continued for 6 days at 37\u00b0C and 5% CO18 reverse primer according to the manufacturer's protocol. The resulting cDNA was purified using a DNA Clean & Concentrator-5 (Zymo Research Corporation) and stored in water at \u221280\u00b0C.After 6 days of cultivation, schistosomula were collected, washed 3 times in 1.5 ml PBS and resuspended in 50 \u00b5l of Trizol reagent (Invitrogen). Samples were flash frozen in liquid nitrogen and stored at \u221280\u00b0C. During thawing, samples were homogenized with Kontes disposable pellet pestles and microtubes (VWR). Sample volumes were adjusted to 500 \u00b5l with Trizol reagent and the temperature adjusted to 65\u00b0C for 5 min to improve tissue lysis. To separate nucleoprotein complexes, samples were further incubated at room temperature for 15\u201320 minutes. Steps to continue the isolation of total RNA with Trizol were performed up until phase separation in chloroform. At this point, the aqueous phase was transferred to a new 1.5 ml microfuge tube containing an equal volume of 75% ethanol. RNA was further purified using the RNeasy Mini Kit (Qiagen) according to the supplied instructions. The concentration of RNA was determined using an ND-1000 Spectrophotometer. Single-stranded cDNA was synthesized from total RNA using SuperScript III reverse transcriptase (Invitrogen) and an oligo d(T)http://frodo.wi.mit.edu/, T) values arising were plotted as a function of the dilution of cDNA 2 coefficients of \u22650.98 indicated high reproducibility for the triplicate reactions. Primer sets were also checked for their dissociation (melting) curves using the appropriate setting of the MxPro QPCR software package (see below). Only those primers displaying optimal efficiencies and generating single dissociation peaks  Primers were designed using the Primer 3 software . Using the MxPro QPCR Software version 4.01 (Stratagene), the 2\u2212\u0394\u0394CT method Quantitative RT-PCR was carried out in an MX 3005P Real-Time PCR cycler  using the LightCycler 480 SYBR Green I Master mix (Roche Diagnostics). g and 4\u00b0C for 5 min, supernatants were collected. An aliquot (2 \u00b5g protein) was incubated for 1 h at 37\u00b0C with 1 \u00b5M bodipy-labeled FY01 in 50 mM sodium acetate pH 5.5 containing 2.5 mM DTT, 1 mM EDTA and 1 \u00b5M each of the respective aspartic and cathepsin B (cysteine protease) inhibitors, pepstatin A and CA-074  red fluorescent protein, mCherry E. coli (Invitrogen). Bacteria that had been transformed with the mCherry open reading frame as part of a pUC18 plasmid backbone were grown overnight at 37\u00b0C in 500 ml LB medium containing 100 \u00b5g/ml of ampicillin and 20 mM glucose. After centrifugation at 3 000 g for 10 min, bacteria were incubated for 4 h in fresh LB medium containing 1 mM IPTG  and harvested by centrifugation for 10 min at 4 000 g. The pellet was re-suspended in 50 ml 100 mM phosphate buffer, pH 8.0, and sonicated using a Branson Sonifier 250 adjusted to a 60% duty cycle and an output control of 6. The material was centrifuged at 10 000 g for 15 min and the supernatant, containing recombinant mCherry, was collected. Heat denaturation in a water bath at 80\u00b0C for 40 min followed by centrifugation at 10 000 g for 15 min was employed to separate bacterial proteins from the heat-stable mCherry protein in the supernatant. The supernatant was decanted and concentrated over an Amicon Ultra-50 10K (Millipore) filter to a final volume of 5 ml. The sample was size fractionated over a Superdex 200 column  pre-equilibrated with 100 mM phosphate buffer, pH 8.0. Eluted fractions containing visible red mCherry protein (4 mg/ml) were pooled and stored at \u221220\u00b0C.The mushroom anemone . For mCherry protein, fluorescence was visualized without washing using an Axiovert 40CFL inverted microscope. Bright field images of parasites in the presence of erythrocytes were acquired using an Axiovert 40C inverted microscope.Prior to RNAi experiments with newly transformed schistosomula, we wished to evaluate the effects of different defined culture media (containing 100 U/ml penicillin and 100 \u00b5g/ml streptomycin and 5% FBS) on parasite vitality and viability. These effects were visually determined as phenotypic alterations in parasite motility, shape and translucence In spite of the mandatory DNase treatment used to remove PCR-derived DNA from dsRNA preparations, the possibility existed that residual DNA would nevertheless serve as template for qPCR should the qPCR primers be designed to amplify within the sequence used to synthesize dsRNA Direct toxicity to schistosomula by dsRNA was evident as greater proportions of parasites that displayed abnormal phenotypes Transcripts for the gut-associated proteins CB1, CC and CD are sensitive to RNAi and are robustly suppressed by >75%  or CC-(nAs exemplified by CB1 and CD (Confirmation of RNAi at the protein level was sought for CC . A 6-dayRobust and selective single and double knockdowns (>75%) were also possible for the tegument transcript targets CB2, annexin and Sm29 using 30 \u00b5g/ml dsRNA per transcript , selective single and double  knockdowns were generated with 30 \u00b5g/ml dsRNA per transcript . Howeverin silico-predicted essential genes, this was also the case after 3 week co-incubations and whether or not the culture medium and dsRNA were exchanged weekly (not shown). For CB1 and CD, the same was also true in the presence of washed erythrocytes and was independent of whether single or double RNAi was employed (not shown).No striking or obvious phenotypes were observed upon RNAi of any of the 11 gene transcripts over the 6-day incubation period. For the 3 gut-associated and 5 Electroporation has been employed as part of a protocol to deliver nucleic acids to both adult schistosomes and schistosomula e.g., Co-incubation of dsRNA with schistosomula or electroporation in the presence or absence of dsRNA followed by co-incubation of dsRNA with parasites led to robust transcript suppression (>75%) for each the tissue-representative targets examined, namely CB1 (gut), CB2 (tegument) and MetAP  and, therefore, cannot facilitate RNAi in younger schistosomula in silico and experimental evidence of the RNAi phenomenon) are now in place to facilitate the implementation of larger scale RNAi-based screening campaigns.Large-scale RNA-dependent gene silencing is an informative reverse genetic platform to interrogate decreased or loss of gene function at the protein, pathway, cell and organism levels. RNAi can also aid the identification of drug targets for the treatment of a variety of disease states In advance, we investigated the sensitivity and selectivity of RNAi for a set of 11 genes, which contained representatives from different tissue types \u2013 gut, tegument and otherwise. We employed long (approximately 500 bp) dsRNA rather than siRNA as the former can be produced at scales sufficient for performing multiple experiments and based on the assumption that the variety of siRNAs generated from the parent dsRNA would provide for as much silencing potential as possible. We focused on mechanically transformed schistosomula that are both relevant to parasitism in humans and, compared to adult parasites, available in greater numbers for automated high throughput screening S. mansoni schistosomula as mortality remained at approximately 10% out to 4 weeks of incubation. Indeed, consistent with the earlier report The question of which culture medium to use for optimal maintenance of schistosomula has not been directly evaluated since the pioneering culture work of Cheever and Weller, and Clegg in the 1950s and 60s S. mansoni mother sporocysts S. mansoniKey concerns in any large scale screening campaign are the occurrence and extent of off-targeting. The possibility of such phenomena operating in schistosomes has been raised in a recent report involving RNAi of 32 genes expressed in For both the gut and tegument genes studied, knockdown efficiency, including after double-targeting, was at least 75%. For the gut proteases, CC and CB1, transcript knockdown was mirrored by a substantial decrease or loss of translation product as determined biochemically with a specific substrate and active site-directed probe for CC, and a monospecific anti-serum to CB1. The robust suppression of CB1 and CD recorded here is consistent with previous studies using schistosomula in silico to be essential The robust RNAi of gut and tegument targets contrasts with the more variable efficiencies recorded for the 5 gene targets considered to be more generally distributed in the parasite and that had been predicted S. mansoni mother sporocysts in silico as being essential to S. mansoniSuch gene-to-gene variability in sensitivity to RNAi is likely inherent when, under a standardized set of conditions such as those under investigation here, not all gene transcripts will respond to the same degree. Variable gene responses to RNAi have also been recently described for The finding that co-incubation of newly transformed parasites and dsRNA, without the need for electroporation , is sufficient to induce robust RNAi focused our attention on the parasite gut in dsRNA uptake. By 90 min post-production from cercariae we could observe a concentration of fluorescent macromolecules above background in the gut that was indicative of rapid and active ingestion of exogenous material by the parasite. This gut activity during transformation from the cercarial state is consistent with electron microscopy studies demonstrating rearrangements of the esophageal environment The data reported herein that newly transformed schistosomula are amenable to RNAi is promising in view of previous reports observing less efficient or inconsistent suppression (of CB1) in parasites <7days old Figure S1The influence of qPCR primer positioning on the amplification of residual PCR product carried over from dsRNA synthesis. There is no amplification of residual PCR product (Panel A) when primer pairs (Primer set A) are positioned upstream from that part of the open reading frame of SmCB2 used to synthesize dsRNA (Panel B). In contrast, Primer set B (positioned within the sequence used to generate dsRNA) amplifies residual PCR product in a concentration-dependent manner that would negatively impact the apparent efficiency of RNAi as measured by qRT-PCR. Each sample was tested in duplicate and representative data from two experiments are shown.(0.35 MB TIF)Click here for additional data file.Table S1List of primer sequences employed for dsRNA synthesis (the T7 DNA polymerase binding motif is shown in bold characters) and quantitative real-time (qRT)-PCR.(0.03 MB XLS)Click here for additional data file.Video S1S. mansoni schistosomula upon incubation in Basch Medium 169. Parasites were maintained for 7 days in medium containing 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software. Note that parasites in this medium appear most uniform in translucency, shape and motion with the least background mortality.Phenotypic responses of (3.66 MB MOV)Click here for additional data file.Video S2S. mansoni schistosomula upon incubation in DMEM (high glucose) medium. Parasites were maintained for 7 days in medium containing 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software.Phenotypic responses of (3.53 MB MOV)Click here for additional data file.Video S3S. mansoni schistosomula upon incubation in F-12 medium. Parasites were maintained for 7 days in medium containing 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software.Phenotypic responses of (3.47 MB MOV)Click here for additional data file.Video S4S. mansoni schistosomula upon incubation in Liebowitz's medium. Parasites were maintained for 7 days in medium containing 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software.Phenotypic responses of (3.44 MB MOV)Click here for additional data file.Video S5S. mansoni schistosomula upon incubation in M199 medium with Earle's Salts. Parasites were maintained for 7 days in medium containing 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software.Phenotypic responses of (4.30 MB MOV)Click here for additional data file.Video S6S. mansoni schistosomula upon incubation in RPMI 1640 medium. Parasites were maintained for 7 days in medium containing 10 mM HEPES, 2 mM glutamine, 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software.Phenotypic responses of (2.81 MB MOV)Click here for additional data file.Video S7S. mansoni schistosomula upon incubation in Schneider's medium. Parasites were maintained for 7 days in medium containing 5% FBS, and 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. Time-lapse recordings were captured with a Zeiss Axiovert 40 C inverted microscope (10\u00d7 magnification) connected to a Zeiss AxioCam MRc digital camera that was under the control of AxioVision 40 version 4.5.0.0 software.Phenotypic responses of (2.63 MB MOV)Click here for additional data file."}
+{"text": "The structures of briaranes 1 and 2 were established by spectroscopic methods and by comparison of the spectroscopic data with those of known briarane analogues. Briarenolide F was proven to be the first 6-hydroperoxybriarane derivative and this compound displayed a significant inhibitory effect on the generation of superoxide anion by human neutrophils.  Two new briarane diterpenoids, briarenolides, F ( Briareum have been proven to be the most important source of briarane-type compounds , wh, wh1H\u20131Htrans to the C-15 methyl group, and these two groups are assigned as \u03b1- and \u03b2-oriented in most briarane derivatives  and andtransly found ,32,38 anly found ,40,41,422) was isolated as a white powder whose HRESIMS showed a molecular ion at m/z 397.1989 implying that 2 had the molecular formula C22H30O5 . The IR spectrum revealed absorptions for hydroxy (3397 cm\u22121) and ester carbonyl (1757 and 1734 cm\u22121) groups. The 1H NMR data , three vinyl methyls , a quaternary methyl , two olefinic protons  and an oxymethine signal . The 13C NMR and DEPT spectra of 2  and two trisubstituted  carbon-carbon double bonds, a hemiketal carbon , an acetate carbonyl , an \u03b1,\u03b2-unsaturated-\u03b3-lactone carbonyl , a tetrasubstituted carbon atom bearing a carbon substituent  and an oxymethine .Briarenolide G  and by the HMBC correlations between H2-2/C-14, H2-9/C-11 and H3-20/C-10, -11, -12. The ring junction C-15 methyl group was positioned at C-1 from the HMBC correlations between H3-15/C-1, -2, -10, -14. In addition, the acetate ester at C-14 was established by a correlation between H-14 (\u03b4H 4.78) and the acetate carbonyl observed in the HMBC spectrum of 2. The presence of a hydroxy group at C-7 was deduced from the HMBC correlations between the hydroxy proton  and C-6, C-7, and C-8. The C-7 hydroxy group was concluded to be a part of hemiketal constellation on the basis of a characteristic carbon signal at \u03b4C 106.7 . These data, together with the HMBC correlations between H3-18/C-8, -17, -19, were used to establish the molecular framework of 2. From the ent of 2 , it was red ring . The vin2  and that H-10 lies on the opposite side, \u03b1-face. The NOESY spectrum showed correlations between H-6/H3-16 and H-12/H3-20, revealing the Z geometry of the C-5/6 and C-11/12 double bonds in 2. Due to the absence of NOESY correlations for the C-7 hydroxy group, the configuration at that chiral center could not be determined by this method. By comparison of the 13C NMR chemical shifts of C-6 (\u03b4C 124.6), C-7 (\u03b4C 106.7) and C-8 (\u03b4C 160.8) for 2 with those of an unnamed known 7\u03b2-hydroxybriarane analogue 4 , which was obtained from a Caribbean octocoral Briareum polyanthes 25D +32 ; IR (neat) \u03bdmax 3498, 1789, 1743 cm\u20131; 1H  and 13C  NMR data, see m/z 591 [M + Na]+; HRESIMS: m/z 591.2420 .Briarenolide F (2): white powder; mp 78\u201380 \u00b0C; [\u03b1]25D \u221297 ; IR (neat) \u03bdmax 3397, 1757, 1734 cm\u20131; 1H  and 13C  NMR data, see m/z 397 [M + Na]+; HRESIMS: m/z 397.1989 . Briarenolide G  [Briareum spp. distributed in the tropical and subtropical Indo-Pacific Ocean. In the past 35 years, over 500 briarane analogues have been obtained and the number is still increasing based on their structural complexity and interesting bioactivities. It is worth noting that only three hydroperoxybriarane analogues have been isolated to date [1) is the first 6-hydroperoxybriarane. 7-Hydroxybriarane derivatives are also rarely found [2) was the first 7-hydroxybriarane derivative isolated from the octocorals collected off the waters of Taiwan. The study material Briareum sp. has begun to be transplanted in tanks for the extraction of natural products in order to establish a stable supply of bioactive material.Briarane-type natural products  were found in various marine organisms, particularly with the octocorals belonging to the genus areidae) ,5,6,7. I to date ,32,38 anly found ,50,51,52"}
+{"text": "Bos taurus) and nine groups of badgers  living in the surrounding woods. The distances at which loggers detected each other were found to decrease over time, potentially related to diminishing battery power that may be a function of temperature. Loggers were highly accurate in recording the identification of contacted conspecifics, but less reliable at determining contact duration. There was a tendency for extended interactions to be recorded as a series of shorter contacts. We show how data can be manipulated to correct this discrepancy and accurately reflect observed interaction patterns by combining records between any two loggers that occur within a 1 to 2 minute amalgamation window, and then removing any remaining 1 second records. We make universally applicable recommendations for the effective use of proximity loggers, to improve the validity of data arising from future studies.Knowledge of the way in which animals interact through social networks can help to address questions surrounding the ecological and evolutionary consequences of social organisation, and to understand and manage the spread of infectious diseases. Automated proximity loggers are increasingly being used to record interactions between animals, but the accuracy and reliability of the collected data remain largely un-assessed. Here we use laboratory and observational field data to assess the performance of these devices fitted to a herd of 32 beef cattle ( Interactions between animals influence a broad array of social processes Trichosurus vulpeculaProcyon lotorMeles melesSarcophilus harrisiiOryctolagus cuniculusOne increasingly popular method is the use of proximity detectors . These remote-sensing devices are attached to animals via collars, harnesses or ear tags, or in some cases they may be glued directly on to the animal e.g. seals and hedgehogs. They transmit a unique signal and automatically record frequency and duration of contacts when tagged animals come within a pre-set distance of one another. Proximity loggers have been used in a small number of focussed animal studies; however, they have the potential to address a broader range of behavioural, ecological and evolutionary questions. Proximity logging devices have been employed in several studies of wild and domestic animals including contact networks in captive brushtail possums Despite enthusiastic adoption of this novel technology, the accuracy and reliability of data collected by proximity loggers are often unmeasured but see . ProximiThe performance of proximity loggers in recording interspecies contacts has yet to be validated. It is important that the data collected by proximity loggers are closely examined and calibrated against simultaneous observations before conclusions are drawn. Also, as the technology improves, it is likely that proximity loggers will become smaller and less expensive, and so will become more widely adopted in studies of the social behaviours of wild animals. It is important that unified methods for data collection, filtering and analyses are tested, refined and adopted. The aim of this research was to perform a validation study using data collected in both the laboratory and the field to validate the information gathered by proximity loggers attached via collars to cattle and badgers, and on static base stations in the field. Investigating contact patterns in this system is of particular contemporary interest because of the role of the badger in the perpetuation of bovine tuberculosis (bTB) in cattle herds in the UK and Ireland 2 region of Cotswold limestone escarpment consisting of a wooded valley with areas of pasture grazed by a herd of approximately 35 Welsh Black cattle. The site also contains an intensively studied population of 200\u2013300 wild badgers belonging to 24 different social groups with a mean size of 10. This badger population has been the subject of long-term ecological and epidemiological research and their territorial organisation and the methods employed for their capture are well described This study was undertaken over 18 months from April 2009 to September 2010 at Woodchester Park, Gloucestershire, UK . This is a 7 kmn \u200a=\u200a77), cattle collars (n \u200a=\u200a32), and static base stations (n \u200a=\u200a19). All were manufactured by Sirtrack Tracking Solutions , and differed in packaging but operated in the same manner using the same hardware  transmitter, see below). Proximity data-logging collars consist of an Ultra High Frequency (UHF) transceiver that broadcasts a unique ID code, whilst simultaneously 'listening' for those of others. When two or more units come within a pre-determined, user-defined distance , a contact is initiated until one or both of the receiving loggers fails to detect the signal within a user-defined separation time. Collars were set to have a separation time of 10 seconds, meaning that a single continuous encounter would be recorded until the receiving logger(s) failed to detect the transmitting logger\u2019s signal for a period longer than 10 seconds. At this time, each receiving unit logs the date, starting time and the duration of the interaction with the other unit(s). Interaction data stored in the loggers were periodically downloaded onto a laptop computer using the supplied interface and software.Three configurations of the same proximity logger were used in this study: badger collars (same setting] and (ii) each collar individually set to a collar-specific UHF setting that resulted in the same detection distance as the rest of the collars [individual setting]. For the same setting study, the detection range of 16 badger proximity loggers was set at UHF 37, which in the trial of randomly paired collars conducted over a range of distances was found to equate to a contact initiation distance of 0.77\u00b10.27 m (mean \u00b1 s.d.) and a contact termination distance of 0.93\u00b10.36 m  that resulted in a contact initiation distance of 0.64\u00b10.04 m and a termination distance of 0.87\u00b10.11 m (Mycobacterium bovis (the causative agent of bTB) 77 badgers from nine social groups were fitted with proximity loggers on adjustable leather collars whilst under anaesthesia . These c3\u00b10.36 m . For the7\u00b10.11 m . These ssame setting badger collars), which in the laboratory trial between pairs of cattle collars was found to equate to a contact initiation distance of 1.70\u00b10.12 m and a contact termination distance of 1.92\u00b10.14 m (n \u200a=\u200a32 collars: M. bovis between wildlife and cattle 32 cattle were fitted with proximity loggers on adjustable collars made from synthetic belting . CollarsM. bovis in badger faeces and urine same setting method), which in a trial with base stations placed in tubes in the ground was found to equate to a contact initiation distance of 0.55\u00b10.13 m (Nineteen static base stations were submerged in plastic tubes next to badger latrines located on the pasture grazed by the cattle . Badger 5\u00b10.13 m . This re5\u00b10.13 m  which mapers comms). Cattle collars were held by a person rather than being attached to saline-filled bottles. Collars were positioned at 0 cm, 10 cm and 100 cm above ground level, representing static, badger and cattle collar positioning respectively. The badger collars, cattle collars and static base stations were randomly allocated into same-type pairs and placed 3 m apart on the ground next to an extended tape measure. Within each pair, one logger was moved towards the other in 1 cm increments every 20 seconds until the illuminated LED indicated the two loggers had established a contact. The LED was turned off when deployed on the free-ranging animals so as not to disrupt normal behaviours. This separation distance was recorded, being the contact initiation distance for the first logger. The distance between the pair of loggers was further reduced until the second logger detected the first. The loggers were then gradually moved apart until a long LED pulse indicated one logger had lost contact with the other (this was recorded as the contact termination distance for first logger). The distance was further increased until the second logger lost contact with the first (the contact termination distance for the second logger).To ascertain the distance over which proximity loggers recorded interactions at different UHF settings, loggers were subjected to a laboratory-based trial. Badger collars were attached to 2-litre plastic bottles filled with saline to mimic UHF wave absorption that would occur when worn by the animal  with those recorded prior to deployment, for all types of logger. In addition, at the end of the 17 months, two cattle collars that had not been deployed (but were the same age as those that had been on cattle in the field) were tested to determine their contact initiation and termination distances so that findings could be related to battery charge. Changes in initiation and termination distances were tested against the frequency and duration of contacts recorded by the collars.A previously identified limitation of the proximity logger technology is the tendency for a continuous contact to be recorded as a series of multiple shorter contacts In previous studies, proximity loggers interacting at the edge of their detection range have been shown to often record very short contacts , thought to be due to weak signal strength same setting or individual setting UHF settings, and therefore determine the necessity of setting each collar individually, we compared the frequency and duration of reciprocal records between five pairs of loggers in each of the three possible UHF setting combinations  collected in the field during one calendar month (June 2010). For each pairing, a linear regression was performed on the log-transformed values for collar 1 against collar 2, for both frequency (number) and duration of contacts. The residual values were then compared using a one-way ANOVA to determine whether they varied significantly between the three different pairings in frequency and duration of shared contacts. This analysis was conducted three times using the statistical software R To determine the accuracy of proximity loggers at correctly recording identification codes of other loggers, the databases of all recorded interactions for all three types of device were examined. To determine if the reliability of data varied between badger proximity loggers set using To validate the data collected by the cattle proximity loggers, focal observations of interactions between collared cattle were conducted in the field by an observer over two days in June 2010. Twelve randomly-selected cattle were each observed for 30 minutes from a distance of approximately 20 m. Cattle were considered to be interacting with each other if they were within one head\u2019s width of the other animal: this ensured that they were within the mean contact initiation distance to which the cattle collars were set (1.7 m). All interactions were recorded during each 30 minute focal period, noting the identification of the partner (read from ear tag number using binoculars), the start and end time of the contact, and the type of interaction . Observational data were compared to those recorded by the collars to determine the accuracy of the loggers in recording number of contacts, duration of contacts and contacted logger identification. Paired t-tests were used to test for differences between observed and recorded data.Of the 77 badger collars fitted: 28 (36%) were retrieved by re-trapping the badgers; 25 (33%) were retrieved by locating the dropped collar in the field using radio-telemetry (in the majority of cases this was due to a snapped collar); seven (9%) were lost ; six (8%) had fallen off underground and could not be retrieved; and 11 (14%) were still fitted on badgers at the time of writing. Of the 32 cattle collars that were deployed at the start of the study, 29 loggers (91%) were recovered undamaged  and three loggers were lost (collars fell off but were not found). Of the 19 base stations used in the study, 11 (58%) were recovered and eight went missing (presumed to have been dug up and removed by badgers).1, 60\u200a=\u200a1.17, P \u200a=\u200a0.30) or by the duration  of contacts that they had recorded during deployment in the field.All three types of logger showed a reduction in their detection range over time . The larCattle and badger collars were tested against each other at different heights to mimic interspecific contacts. The detection distances were found to have a wider range than for the same collars detecting intraspecific contacts . Howeverth percentile gap duration was 129 s. See below for field validation of broken contacts.In none of the laboratory trials of 25 pairs of badger collars was the contact recorded as a continuous 2-hour interaction, but rather always as a series of multiple broken contacts. Intra-collar variation was found to be minimal, and across all 50 collars, the median gap duration between the end of one recorded contact and the initiation of the next was 54 s , and the 951,14\u200a=\u200a155.0, P<0.001, r2\u200a=\u200a0.92); amalgamation of those less than 1 minute apart ; and amalgamation and removal of any remaining 1 second contacts   under the three treatments: no amalgamation ; amalgamation ; amalgamation and 1 s removal .There was a high level of agreement in the durations of the contacts recorded by one collar and the reciprocal interacting collar under all three treatment scenarios: no amalgamation of contacts (F\u200a=\u200a0.80) . There w1,14\u200a=\u200a9.00, P \u200a=\u200a0.01, r2\u200a=\u200a0.41); amalgamation of those less than 1 minute apart ; and amalgamation and removal of any remaining 1 second contacts . A one-way ANOVA showed that there was a significant difference between the three pairing combinations  under two of the three treatments: no amalgamation ; amalgamation ; amalgamation and 1 s removal . A Tukey\u2019s post-hoc test showed that this difference was driven by collars set using the individual-setting method, which recorded a greater number of contacts than the collars set using the same setting method when paired together  or erroneous records unrelated to any interaction. Badger collars recorded 308,318 contacts of which only three (0.001%) were deemed to be erroneous, with the ID of the individual contacted being a number that had not been deployed. The base stations recorded 5275 records, none of which had an obviously erroneous identification code. Taken together, these data suggest the identification error rate for all types of logger combined to be approximately 0.03%.Of the 179 interactions observed during the six hours of focal observations, 129  were recorded by the proximity loggers . The medth percentile for gap duration was 51 s. Thus on 95% of occasions, the maximum interval between logger records for interactions which were recorded as multiple shorter records was less than 51 s.The cattle proximity loggers split 27 of the 179 records (15%) of observed interactions into multiple shorter records. The observed duration of the shortest interaction that was recorded by the loggers as multiple shorter records was 15 s (recorded as two 1-second interactions separated by a gap of 13 s), and all interactions lasting 14 s or less were recorded as single whole records. The longest interaction recorded as one complete record was 87 s. The longest interaction recorded as a split record was 313 s (recorded as four shorter interactions separated by three gaps). The median gap duration for split records was 20 s . Of the interactions recorded as split records, the 95th percentile for gap duration between pairs of cattle collars) of each other and involved the same two animals. First, observed records from all 12 loggers in the validation study were compared with proximity logger records without combining records less than 51 s apart and without filtering out 1 second contacts. The recorded dataset was significantly different to the observed contacts in the same time period . Second, observed records were compared with proximity logger records without combining records less than 51 s apart but this time filtering out all 1 second contacts. The recorded dataset was still significantly different to the observed contacts in the same time period . Third, observed records were compared with proximity logger records where dyadic records had been combined if they occurred less than 51 s apart, without filtering out 1 second contacts. The edited dataset was again significantly different to the observed contacts in the same time period . Finally, observed records were compared with proximity logger records in which dyadic records had been combined if they occurred less than 51 s apart, and then 1 second contacts were removed from the dataset. This time there was not a significant difference between the edited dataset and the observed contacts in the same time period .Of the 1,290,632 interactions recorded by the cattle collars, and the 308,318 interactions recorded by badger collars, over 58% (755 946 records), and 51% (151 076 records) respectively, were of 1 second duration. We investigated what effect omitting these records from the cattle proximity logger dataset had on that dataset\u2019s similarity with the records from the cattle observational study. We did this both for dyadic interactions \u2018as recorded\u2019, and for combined dyadic records if they occurred within 51 s  pre-deployment setting of proximity devices and ii) preparing derived data for analysis. In doing so we aim to improve the validity of data arising from the use of proximity loggers in future studies of animal contact networks, whilst at the same time recognising that there will always be limitations to the technology, for example due to the physics of UHF waves with which they operate.The recording of erroneous data does not appear to be a significant problem with the latest generation of proximity logger, and can be considered to have a negligible impact on the data recorded. Based on the very small number of erroneous identification codes recorded, the proximity loggers appear to be extremely accurate in recording the identification of contacted collars. However, we were unable to determine what proportion of interactions recorded by the loggers as genuine identification numbers may in fact have been false. If a logger identification number existed then it was taken to be a true record. It was not possible to determine the \u2018false record\u2019 rate in the observational study as this would have required more accurate determination of separation distances than was achieved here.pers comm). The proximity loggers fitted to the badgers are likely to have been exposed to warmer temperatures than the cattle loggers due to the sett environment and the closer fitting of collars to the badgers\u2019 necks. The reduction in detection distance was very pronounced for the badger collars where a decline of almost 50% in detection range was observed over eight months, although there was no further decrease after 12 months of deployment when a critical battery threshold may have been exceeded. Also, it was not found to be influenced by the frequency or the duration of contacts that the collars had recorded. It therefore appears that longer range interactions are less likely to be recorded by the loggers over time, but that this decrease in detection distance levels off after eight months. A possible practical solution would be to periodically re-measure the detection ranges of the loggers and recalibrate as necessary. However, this could be difficult if a large number of loggers have been deployed and is likely to be highly impractical for loggers fitted to elusive wild animals that are not amenable to frequent recapture. An alternative solution would be to apply a correction factor to the data pre-analysis to account for the decrease in detection of longer range interactions over time and avoid biases in the interpretation of the data. Indeed, one general limitation of the technology at present is the requirement for animals to be recaptured in order to download the data stored in the internal memory. However, there is not a time limit for this and data can still be retrieved after the battery has run out , although that situation was not encountered in this study.The detection distance of all types of proximity logger reduced with time for those collars that had been deployed in the field, but not for the couple that had been kept in the laboratory with the battery turned off. Thus, rather than this being a feature intrinsic to the technology, it is more likely related to diminishing battery power. This in turn may be a function of temperature: at temperatures above and below 25\u00b0C, the voltage of lithium thionyl chloride batteries \u2013 as used in these proximity loggers \u2013 sags under load  using proximity logger collars versus direct observation were quantified in a recent study where it was estimated that approximately 9% of contacts went unrecorded Overall, the proximity loggers recorded a reasonable majority of the observed interactions although there was marked variation between individual loggers. The impact of missed interactions is likely to be very low because the modal duration of non-recorded interactions was 1 second, and all contacts of this duration were later filtered out of the dataset to improve reliability after combining \u201cbroken contacts\u201d. Some interactions that were not recorded by the loggers were observed to be very close contacts \u2013 it was not just the longer-range interactions that were missed. The probabilities of detecting intraspecific contacts among white-tailed deer  possibly due to weak signal strength individual setting], or using the same coefficient for all collars [same setting]) suggests that it is not necessary to individually measure and set each collar to a particular UHF coefficient. An interesting result from this analysis is that interacting collars have a high level of agreement in the duration of the contacts that they record, but less of an agreement  in the number of contacts that they record, suggesting that the length of the contact recorded may be a more accurate parameter to use in further analyses than the frequency of contacts recorded. It would be useful to investigate the influence of proximity logger separation time on data subsequently collected by loggers, since it may be expected that the longer separation times would result in fewer recorded interactions but those that were recorded would likely be of longer duration. We did not investigate this in the present study.The similar performance of the two methods for setting badger collar initiation distances .When manipulating the data collected by automated proximity loggers, contacts recorded within 1\u20132 minutes of each other should be amalgamated if they involve the same pair of loggers. This will give a more accurate reflection of longer duration interactions, and can be easily automated, for example with a script in the statistical programme R  loggers, 150% for medium-sized highly mobile animal  collars, and 175% for static base stations. These budgets should be taken as a guide rather than being prescriptive because rates of collar loss are likely to differ amongst species and users.In conclusion, this study indicates that proximity loggers are highly accurate at recording the identification of contacted loggers but less reliable at consistently determining the true frequency and duration of contacts. Our investigations of these limitations in proximity logger performance have allowed us to quantify these sources of potential error and to suggest approaches for their mitigation. We hope that the five recommendations made here will be of use to the expanding number of researchers using proximity loggers to determine contact patterns of animals and provide an evidence base on which data collected from these devices may be corrected to more accurately reflect the \u2018true-life\u2019 pattern of animal interactions.Document S1A guide to the use of the two Functions for which the R code is provided.(DOC)Click here for additional data file.R Functions S1R Code for the two Functions that can be used to filter and construct association matrices from data collected by proximity loggers.(R)Click here for additional data file."}
+{"text": "The worldwide prevalence of obesity has reached pandemic proportions, and with it have come other associated metabolic diseases, such as insulin resistance and type 2 diabetes (T2D). Intensive research has identified the frequent coexistence of obesity with a state of inflammation in metabolic tissues such as adipose tissue and liver . MultiplIn general, a majority of cellular double-stranded RNA (dsRNA)-binding proteins, such as dsRNAdependent protein kinase (PKR) and retinoic acid-inducible gene-I (RIG-I)-like receptor family, have been known to exclusively recognize exogenous dsRNA and induce inflammatory responses . HoweverPKR, a pathogen-sensing protein, is activated by excess nutrients and its aberrant activity plays a key role in the induction of inflammatory responses, insulin resistance, and abnormal glucose metabolism in obesity . In addiob/ob mice (a leptin-deficient obese mouse model) resulted in improved glucose tolerance, accompanied by significant reduction of JNK activity and eIF2\u03b1 phosphorylation [More recently, we have identified TRBP, a trans-activation response (TAR) element-binding protein, as a physiologically-crucial component involved in obesity-induced PKR activation and metabolic dysfunction . TRBP isrylation . These fOur study suggests that metabolic inflammation results, at least in part, from deranged dsRNA processing/signaling, which adversely regulates systemic glucose metabolism in obesity. Given that TRBP is a dsRNAbinding protein involved in multiple cellular events, TRBP may be the signaling node that senses metabolic stress levels through the recognition of dsRNA networks, and links to miRNA outputs and PKR-mediated inflammatory signaling networks under the stress conditions. Identifying the molecular basis by which changes of endogenous dsRNA dynamics trigger chronic inflammation would pave the way for developing novel therapeutic strategies for not only obesity-induced metabolic diseases but also other chronic inflammatory diseases."}
+{"text": "Highly loaded polymer/clay nanocomposites with layered structures are emerging as robust fire retardant surface coatings. However, time-intensive sequential deposition processes, e.g. layer-by-layer strategies, hinders obtaining large coating thicknesses and complicates an implementation into existing technologies. Here, we demonstrate a single-step, water-borne approach to prepare thick, self-assembling, hybrid fire barrier coatings of sodium carboxymethyl cellulose (CMC)/montmorillonite (MTM) with well-defined, bioinspired brick-wall nanostructure, and showcase their application on textile. The coating thickness on the textile is tailored using different concentrations of CMC/MTM (1\u20135\u2009wt%) in the coating bath. While lower concentrations impart conformal coatings of fibers, thicker continuous coatings are obtained on the textile surface from highest concentration. Comprehensive fire barrier and fire retardancy tests elucidate the increasing fire barrier and retardancy properties with increasing coating thickness. The materials are free of halogen and heavy metal atoms, and are sourced from sustainable and partly even renewable building blocks. We further introduce an amphiphobic surface modification on the coating to impart oil and water repellency, as well as self-cleaning features. Hence, our study presents a generic, environmentally friendly, scalable, and one-pot coating approach that can be introduced into existing technologies to prepare bioinspired, thick, fire barrier nanocomposite coatings on diverse surfaces. Fire remains one of the largest reasons for non-natural fatalities and causes dramatic loss of property and gross national product in the range of billion euros every year. Cotton, a natural textile fiber, is extensively used in everyday products, such as clothing, furniture, and industrial products. Yet, cotton exhibits a low limiting oxygen index, ease of ignition, and high flammability245689101214151617181920212224252629313233Interesting progress towards nanostructured, fire-resistant coatings has been reported for ultrathin coatings based on step-wise, layer-by-layer (LbL) deposition of different polymers and nanoclay223637383940414344454647Here, we show a one-pot, single-step self-assembly approach to prepare thick, bioinspired, layered, hybrid brick-wall coatings with well-defined nanostructure on cotton textiles, as formed through self-assembly of tailored mixtures of sodium carboxymethyl cellulose (CMC) and montmorillonite (MTM) nanoclay at high fractions of the inorganic component. The coating thickness on the textile can be tailored using different CMC/MTM concentrations in the coating bath. We study the fire barrier and fire retardancy properties as a function of coating thickness by themogravimetric analysis (TGA), fire break-through test, vertical flame test (VFT), thermal imaging using forward looking infrared (FLIR) camera, and cone calorimetry. In addition, we modify the surface of the fire-retardant coating to impart amphiphobic and self-cleaning features. Hence, this study demonstrates a scalable process, that can be introduced into existing coating technologies to provide bioinspired, multifunctional, fire barrier nanocomposite coatings on textile, using benign water-based room temperature processing.60MTM40-x%, where the subscripts denote the weight fractions of both components and \u2018x%\u2019 denotes the concentration of the coating dispersion in wt%. Reasonably, we can expect that the coating thickness (weight/area) depends on the concentration of the coating dispersions and that a morphological transition may occur starting from coating of individual fibers at low concentration/viscosity to the presence of a fully coated film at high concentration/viscosity. For comparison, we also prepare a nacre-mimetic nanocomposite film by solution casting of a CMC/MTM dispersion in a petri dish. This allows characterizing the nanocomposite structure in a straightforward manner and serves as a comparison to structures created on textiles. The structural characterizations of the nanocomposite film, as well as, CMC60MTM40-1%, and CMC60MTM40-5% coated fabrics are displayed in q*) in the range of 1.7\u20132.3\u2009nm\u22121, corresponding to gallery spacing in the range of 3.7\u20132.7\u2009nm. Although the diffractogram of the coated fabric does not present very sharp peaks due to the undulated surface of the textile, it still clearly shows a hump , where only a conformal coating of the fibers exists . Formati38522 and air atmosphere from 25 to 850\u2009\u00b0C at 10\u2009\u00b0C/min as shown in The thermal and thermo-oxidative stability of the coated fabrics and control are examined by thermogravimetric analysis (TGA) in both N2 and air, respectively. The initial minute weight loss at ca. 110\u2009\u00b0C is due to the removal of moisture. The major weight loss occurs between 280 to 400\u2009\u00b0C in both atmospheres resulting from the decomposition and dehydration of the cellulose leading to thermally stable residues. The second weight loss between 400 to 530\u2009\u00b0C in air corresponds to the further oxidation of the char to produce CO and CO260MTM40-coated fabrics undergo slower degradation with increasing the slurry concentration as seen from the smaller and wider peak in the DTGA plots when going from CMC60MTM40-1% to CMC60MTM40-5% (3\u2009\u00b7\u2009mm\u00b7m\u22122\u2009\u00b7\u2009day\u22121\u00b7atm\u22121 at 50%RH and 0.115\u2009cm3\u2009\u00b7\u2009mm\u00b7m\u22122\u00b7day\u22121\u00b7atm\u22121 at 80%RH)542 increases with increasing slurry concentrations  using a fire break-through test. All samples were fixed in a circular holder with ca. 7\u2009cm diameter and then exposed to a high temperature torch at nearly 90\u00b0 angle. 60MTM40-5% chars into a shape-persistent, solid barrier, which completely restricts the fire from breaking through  on specimens with dimensions of 160\u2009mm\u2009\u00d7\u200912.5\u2009mm (L\u2009\u00d7\u2009W) in analogy to EN ISO 11925-2. The flame was kept at the bottom of the sample and ignited for 5\u2009s. A forward looking infrared camera (FLIR) allows monitoring the spatiotemporal temperature profiles and standard video monitors the general behavior. 60MTM40-1% still allows flame propagation and complete burning, yet it shows a significant amount of coherent char with some slits at the end. The behavior of CMC60MTM40-1.75% and CMC60MTM40-2.5% is different. Those are not consumed completely, but burn up to half of the sample height. The flame reaches a maximum height of ca. 85 and 80\u2009mm in 8 and 7\u2009s after ignition for CMC60MTM40-1.75% and CMC60MTM40-2.5%, respectively, leaving behind a broken solid char due to the presence of higher coating thickness. Although they self-extinguish right after removal of the direct flame, a glowing frontier persists, which propagates very slowly within the burning height , and therefore, the temperature profiles at 100, 120 and 150\u2009mm are essentially flat against time, except for the initial 5\u201315\u2009s, where some hot gases from the flame and the sample pass the markings. At 10\u2009mm, both samples show the initial burning process initiated by the exposure to the direct flame. At 50\u2009mm, interestingly, two maxima can be identified , due to the comparably thin coating.The temperature profiles of the control in entified . The fir2 , total heat release (THR), and total smoke release (TSR). Furthermore, the heat profiles are more extended in the time axis for increasing coating thickness. This demonstrates that all CMC60MTM40-coated fabrics exhibit significantly higher fire-retardancy as compared to the control60MTM40-5% reduces the pkHRR and THR to 37% and, 44%, respectively, compared to the control. This improved fire-retardancy for CMC60MTM40-5% stems from the thicker MTM- containing nanocomposite coating, which also leads to largely increased protective char formation on the coated textile surface  and flammability of the coated fabrics and the control using cone calorimetry under a constant heat flux of 50\u2009kW/m2 58. Altho surface  in accor60MTM40 coatings on textiles retain a similar weave structure as in the control  and performed a straightforward surface modification with trichlorosilane (67686970We choose a fabric coated from intermediate slurry concentration (CMCl)silane , which bAt the same time, the modification also provides protection against non-polar liquids such as salad oil, a clear advantage of using fluorinated coatings over only hydrophobic coatings . The sna30646773We demonstrated a single step, large-scale, self-assembly approach to prepare thick, bioinspired, well-defined, hybrid brick-walls as fire-retardant coatings on textiles. The coating weight/thickness is tuned by changing the slurry concentrations, and the morphology can be changed from a conformal fiber coating (low concentration) to a micrometer-thick continuous coating (high concentration) on the textile. Hence, this process makes a stark difference to polymer/nanoclay multilayers formed by LbL, which could provide only conformal and ultrathin coatings (<1\u2009\u03bcm) on fibers in alternating deposition from dilute suspensions384344455260MTM40-5% the best fire barrier coated fabric. It not only withstands long-term high temperature direct flame exposure, but also prevents the penetration of flame through it by forming a shape persistent solid char during fire break-through test. It exhibits notably lower temperature build-up during VFT, and significantly decreased pkHRR (37%), THR (44%), and TSR (53%) compared to the control as seen from cone calorimetry, suggesting the generation of fewer flammable volatiles, and smoke, respectively. Furthermore, the SEM images of the post-burn chars of all coated fabrics in VFT showed that the fabric weave structure is well maintained even for CMC60MTM40-1%. CMC60MTM40-5% exhibits an intumescent effect and forms a thick and expanded foam-like char with lot of bubbles on its surface due to gas evolution. This nanoporous char provides good heat insulation to the underlying materials and improves fire retardancy.The fire barrier properties of the coated fabrics increase with increasing slurry concentration, making CMCIn terms of functional benefits, we imparted amphiphobic and self-cleaning features by a simple surface modification with a fluorosilane. This furnishes a water- and oil-resistant surface based on water-borne CMC/MTM coatings, imparts self-cleaning, and thereby increases the usefulness for applications in harsher conditions.Importantly, the presented strategy opens a generic platform towards sustainable, high-performance and non-flammable thick nanocomposite coatings. As a major advantage, these fire-retardant coatings are devoid of any halogen atoms or heavy metals, often required in present day fire-barrier materials, and processed from water using sustainable building blocks. We expect that this continuous roll-to-roll coating process can be scaled to large quantities and implemented into existing coating technology. While we showcased the applicability on textiles, we believe it to be applicable on diverse substrates, and that further tuning of type of polymer system will allow an optimization of the properties and increased intumescent behavior. Further studies on these systems are currently under way.w\u2009=\u200990\u2009kg/mol, Aldrich), Na-Cloisite , Trichlorosilane , MilliQ water, and pure cotton textile  were used for all experiments.Sodium carboxymethyl cellulose  from a roll through the coating bath at 10\u2009mm/min for each slurry concentration. Afterwards, the fabrics were dried at ambient conditions. We use the following nomenclature for the coating compositions. Textile coated with CMC/MTM\u2009=\u200960/40 w/w at various concentrations are abbreviated as CMC60MTM40-x%, where x\u2009=\u20091, 1.75, 2.5 or 5\u2009wt%.CMC and MTM were added as premixed (60/40 w/w) powder into a IKA HKD-T-0.6 high-performance kneader with two wide-bladed kneading elements containing the appropriate amount of water to reach a total concentration of ca. 8\u2009wt%. After homogenization for 12\u2009h, the slurry was diluted to different concentrations , and degassed. Then a custom-made continuous coating machine was used to guide the cotton textile silane in heptane, and left for 15\u2009min. Afterwards, the coated textile was rinsed with heptane and water few times and dried.A CMCField emission-scanning electron microscopy (SEM) was performed on a Hitachi S-4800 field emission microscope using 1.5\u2009kV acceleration voltage.Thermogravimetric analysis (TGA) was done using a NETZSCH TG 209\u2009C instrument in both air and N2 atmosphere from 25 to 850\u2009\u00b0C at a heating rate of 10\u2009\u00b0C/min.Wide-angle x-ray diffraction (WAXD) was performed using an Empyrean setup from PANalytical using the Bragg Brentano parallel-beam geometry. An Empyrean Cu x-ray tube LFF HR (line source of 12\u2009\u00d7\u20090.04\u2009mm2) provided CuK\u03b1\u03b1 radiation with \u03bb\u2009=\u20091.542\u2009\u00c5 at 40\u2009kV voltage and 40\u2009mA current.Fire break-through tests were performed on the coated fabrics and the uncoated control using a Soudogaz\u00ae X 2000 PZ gas torch with maximum flame temperature of ca. 1750\u2009\u00b0C. All samples were conditioned for 1\u20132 days at 23\u2009\u00b1\u20092\u2009\u00b0C and 50\u2009\u00b1\u20095% relative humidity (RH) prior to test. Then samples were cut into circular shape having ca. 7\u2009cm in diameter and fixed in a circular metal holder keeping a 130\u2009mm distance between the samples and the origin of the flame. The samples were exposed to the direct flame at an angle close to 90\u00b0 and the fire break-through process was monitored using a video camera.Bench-scale vertical flame tests (VFT) were performed on the coated fabrics and the uncoated control with dimensions of 160\u2009mm\u2009\u00d7\u200912.5\u2009mm (L\u2009\u00d7\u2009W) in analogy to EN ISO 11925-2. The samples were conditioned for 1\u20132 days in normal climate at 23\u2009\u00b1\u20092\u2009\u00b0C temperature and 50\u2009\u00b1\u20095% RH prior to test. A yellow flame was kept at the bottom of the sample for 5\u2009s. The burning was monitored using a forward looking infrared camera A655sc camera (FLIR) in the temperature range of 20\u2013660\u2009\u00b0C, and standard video.Cone calorimeter experiments were conducted on a FTT cone calorimeter at 50\u2009kW/m2 heat flux, with an exhaust flow of 24\u2009L/s, according to ISO 5660, on sample dimensions of 100\u2009mm\u2009\u00d7\u2009100\u2009mm (L\u2009\u00d7\u2009W) conditioned for 24\u2009h at 23\u2009\u00b0C and 50% RH prior to test. The heat release rate was determined by the measurement of the oxygen consumption derived from the oxygen concentration and the flow rate in the combustion product stream. Parameters such as time to ignition (TTI), peak heat release rate (pkHRR), total heat release (THR), and total smoke release (TSR) were evaluated.How to cite this article: Das, P. et al. Large-scale, thick, self-assembled, nacre-mimetic brick-walls as fire barrier coatings on textiles. Sci. Rep.7, 39910; doi: 10.1038/srep39910 (2017).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."}
+{"text": "The objective of the study was to investigate the association between splenectomy and acute pancreatitis.We conducted a case-control study using the database of the Taiwan National Health Insurance Program. We included 7666 subjects aged 20\u201384 years with first-time acute pancreatitis during the period of 1998\u20132011 as cases and 30 664 randomly selected subjects without acute pancreatitis as controls. Both cases and controls were matched for sex, age, and index year of acute pancreatitis diagnosis. The association of acute pancreatitis with splenectomy was examined using a multivariable unconditional logistic regression model and reported as an odds ratio and its 95% confidence interval (CI).After adjustment for covariables, the adjusted odds ratio of acute pancreatitis was 2.90 for subjects with splenectomy  compared with subjects without splenectomy.Splenectomy is associated with acute pancreatitis. Further studies are necessary to clarify the underlying mechanism. Specifically, the spleen protects against infections mediated by innate and adaptive immunity.7\u201310; however, 9% to 36.6% of acute pancreatitis patients remained idiopathic in different studies.8,11Acute pancreatitis is a serious disease due to its high morbidity and mortality worldwide. To date, many risk factors associated with acute pancreatitis have been well established, including alcoholism, biliary stones, cardiovascular disease, diabetes mellitus, hepatitis B infection, hepatitis C infection, and hypertriglyceridemiaTo date, no systematic study has investigated the association between splenectomy and acute pancreatitis. Whether splenectomy has a positive or negative effect on risk of acute pancreatitis is unknown. As mentioned above, we rationally hypothesize that the pancreas might be easily infected by offending microorganisms involved in overwhelming post-splenectomy infections, which might subsequently lead to pancreatic inflammation. A better understanding of the relationship between splenectomy and acute pancreatitis may support interventions such as pneumococcal vaccination in persons with splenectomy. Therefore, we conducted a case-control study using the nationwide database of the Taiwan National Health Insurance Program to investigate this issue.12 The details of the program have been thoroughly addressed in previous studies.13\u201315 This study was approved by the Ethics Review Board of China Medical University and Hospital in Taiwan (CMUH-104-REC2-115).This was a nationwide case-control study using the database of the Taiwan National Health Insurance Program. Briefly, this insurance program began in March 1, 1995, and covers about 99% of the 23 million persons living in Taiwan.We selected subjects aged 20\u201384 years with first-time acute pancreatitis during the period of 1998\u20132011 as the case group according to the International Classification of Diseases 9th Revision (ICD-9 code 577.0). To increase statistical power, for each case of acute pancreatitis, four subjects without acute pancreatitis were randomly selected from the same database as the control group. Both groups were matched for sex, age (within 5 years), and index year of acute pancreatitis diagnosis. The index date for each case was defined as the date of acute pancreatitis diagnosis. The index date for control subjects was a randomly assigned day and month with the same index year of the corresponding case. To diminish biased results, subjects undergoing splenectomy within 1 month of acute pancreatitis diagnosis were excluded from the study. Subjects with prior diagnosis of chronic pancreatitis (ICD-9 code 577.1) or pancreatic cancer (ICD-9 code 157) before the date of acute pancreatitis diagnosis were also excluded from the study.16 was not recorded in this database. Therefore, chronic obstructive pulmonary disease was used as an alternative variable. Measures related to socioeconomic status, such as income, education, and occupation, were not recorded in this database and could not be included in the study. On the basis of ICD-9 codes, the diagnosis accuracy of included comorbidities has been reviewed in previous high-quality studies.17\u201320 Few patients having acute pancreatitis and/or the comorbidities studied would be expected to never go to the hospital for treatment. In order to avoid subjects who were coded by mistake or diagnosed inaccurately and to enhance the diagnosis validity, acute pancreatitis and comorbidities were identified with at least two consensus diagnoses in ambulatory care and/or during hospitalization.Comorbidities diagnosed before the date of acute pancreatitis diagnosis that were potentially associated with acute pancreatitis were included in the study as follows: splenectomy (ICD-9 procedure code 41.5); alcohol-related disease ; biliary stone (ICD-9 code 574); cardiovascular disease, including coronary artery disease, heart failure, cerebrovascular disease, and peripheral atherosclerosis ; chronic kidney disease (ICD-9 codes 585\u2013586 and 588.8\u2013588.9); chronic obstructive pulmonary disease ; diabetes mellitus (ICD-9 code 250); hepatitis B ; hepatitis C ; hypercalcemia (ICD-9 code 275.42); hyperparathyroidism (ICD-9 code 252.0); and hypertriglyceridemia (ICD-9 code 272.1). Smoking, which has been found to be associated with acute pancreatitis,t-test for continuous variables were used to compare the differences between the case group and the control group for distributions of demographic factors and comorbidities. All variables were first examined in a univariable unconditional logistic regression model. Those found to be significant in the univariable unconditional logistic regression model were then included in the multivariable unconditional logistic regression model, and odds ratios (ORs) and 95% confidence intervals (CIs) for the association of acute pancreatitis with splenectomy and other comorbidities were calculated. The probability value <0.05 was considered statistically significant .The Chi-square test and fisher-exact test for categorical variables and P < 0.001 for all). The mean (standard deviation) ages were 50.4 (15.8) years in the case group and 50.0 (16.0) years in the control group .Table Table Table 21 To diminish biased results, we excluded patients who underwent splenectomy within 1 month of acute pancreatitis diagnosis to ensure that splenectomy truly preceded the onset of acute pancreatitis.In this case-control study, we noticed that splenectomy was associated with increased odds of acute pancreatitis (adjusted OR 2.9). A review by Sinwar found that the duration between splenectomy and onset of overwhelming post-splenectomy infection could range from less than 1 week to more than 20 years.Biliary stone and alcoholism are the two most common causes of acute pancreatitis. We found that alcohol-related disease and biliary stone are strongly related to acute pancreatitis (adjusted OR 14.8 for alcohol-related disease and OR 12.5 for biliary stone; Table 1,2 After splenectomy, the impaired immune functions place subjects at high risk for overwhelming postsplenectomy infections.1\u20136 Therefore, the pancreas might be easily infected by the offending microorganisms, subsequently leading to pancreatic inflammation. Splenectomy has also been found to be associated with an increased risk of type 2 diabetes mellitus,22 and patients with type 2 diabetes mellitus are at an elevated risk of acute pancreatitis.10 Whether splenectomy causes acute pancreatitis cannot be determined in an observational study. However, we think that there could be a link between splenectomy, type 2 diabetes mellitus, and acute pancreatitis.The pathogenetic mechanism linking splenectomy and acute pancreatitis cannot be determined in our observational study, and we did not identify other studies that can be compared with ours. To date, there is little evidence to support the association of splenectomy and acute pancreatitis. We reviewed the relevant literature to explain the biological plausibility of our findings. As we know, the spleen protects humans against infections mediated by innate and adaptive immunity.There are some limitations inherent to this database. First, results of analysis of the database should be interpreted cautiously because the database did not have enough information on the etiologies of acute pancreatitis and splenectomy. In this study, only about 25% of acute pancreatitis patients had either alcohol-related disease or biliary stone Table , so the The main strength of our study is that this is the first original holistic study on the association between splenectomy and acute pancreatitis. Although the underlying mechanism linking splenectomy and acute pancreatitis cannot be completely determined, our findings are clinically important.We conclude that splenectomy is associated with acute pancreatitis. Further studies to investigate the underlying mechanism are needed."}
+{"text": "Endoscopic ultrasound (EUS) guided fine-needle aspiration (FNA) is the method of choice for sampling pancreatic lesions. This study compares the diagnostic accuracy and safety of FNB using a novel core needle to FNA in solid pancreatic lesions. A retrospective review of patients in whom EUS FNA or FNB was performed for solid pancreatic lesions was conducted. Diagnostic performance was calculated based upon a dual classification system: classification 1, only malignant pathology considered a true positive, versus classification 2, atypical, suspicious, and malignant pathology considered a true positive.p > 0.05). Using classification 2, sensitivity was 97% versus 94.0%, specificity 100% versus 100%, and diagnostic accuracy 98.0% versus 94.0% for FNB versus FNA, respectively . FNB required significantly fewer needle passes (median = 2) compared to FNA . Adverse events occurred in two (4.5%) FNB patients compared with none in the FNA group (p > 0.05). 43 patients underwent FNB compared with 51 FNA. Using classification 1, sensitivity was 74.0% versus 80.0%, specificity 100% versus 100%, and diagnostic accuracy 77.0% versus 80.0% for FNB versus FNA, respectively (all  FNA and FNB have comparable sensitivity and diagnostic accuracy. FNB required fewer passes. Endoscopic ultrasound (EUS) guided fine-needle aspiration (FNA) is the method of choice for evaluating and sampling solid pancreatic lesions \u20133. EUS cThere is uncertainty relating to the optimal needle gauge, number of needle passes, presence of an on-site pathologist, and more recently whether the ability to procure core samples using fine-needle biopsy (FNB) is advantageous , 8\u201311. SThe recently developed SharkCore\u2122 FNB needle is designed with six cutting edge surfaces and an opposing bevel to trap core tissue which preserves architecture and limits tissue fracturing in addition to including a passively activated safety sheath to prevent needle stick injuries. A recently published pilot study demonstrated comparable diagnostic performance compared to FNA .The aim of this study was to compare the sensitivity, specificity, and safety of SharkCore FNB to conventional FNA in evaluating solid pancreatic masses.A retrospective review was performed on consecutive patients who underwent index EUS guided FNB of solid pancreatic lesions by two experienced endosonographers at St. Paul's Hospital, Vancouver, BC, using the Covidien SharkCore platform  using 19\u2009G, 22\u2009G, or 25\u2009G needles. When the study was conceived 50 FNB had been performed on solid pancreatic lesions (November 2014 to July 2015). Thus a similar number of consecutive patients undergoing FNA using a 22\u2009G or 25\u2009G needle  of solid pancreatic lesions were taken for comparison (from October 2013 to October 2014). There was no on-site pathologist present for either cohort. The number of needle passes and needle throws was not standardized and was at the discretion of the endosonographer. Assessment of an adequate specimen was also at the discretion of the endosonographer generally using a crude visual assessment of the material expressed from the needle.Patients were excluded when there was a predominantly cystic component to the mass or if adequate follow-up was not available: either surgical pathology or six months' clinical follow-up. The study was approved by the University of British Columbia Ethics Board.Electronic medical records were interrogated and demographic data recorded. The size of the lesion was documented based on the largest dimension reported in millimeters. The location of the lesion was categorized as falling within the head, uncinate, genu, body, or tail of pancreas. Technical failures, number of needle passes, and needle gauge were recorded.Classification 1: nondiagnostic, benign, atypical, and suspicious are considered negative for malignancy. Only the designation \u201cmalignant,\u201d that is, class 5, is considered a true positive.Classification 2: nondiagnostic and benign are negative for malignancy. Atypical and suspicious are also considered positive for malignancy.The pathological diagnosis by EUS was categorized as nondiagnostic, benign, atypical, suspicious, or malignant . Diagnostic accuracy, positive predictive value, negative predictive value, sensitivity, and specificity were calculated using a dual classification system employed in a meta-analysis of EUS FNA by Hewitt et al. 2012 [ Diagnostic accuracy was compared to gold standard surgical pathology, subsequent EUS FNA/FNB, or six-month clinicoradiological follow-up. It was computed as the ratio between the sum of true positive and true negative values divided by the total number of lesions. Neuroendocrine tumors which have a range of malignant potential were all regarded as a \u201cpositive\u201d diagnosis and grouped with adenocarcinoma and lymphoma for the purposes of the analysis. Adverse events, as determined by interrogating electronic medical records, were also recorded and compared.p value of \u22640.05 was considered statistically significant.Statistical analysis was performed using the chi-square test, Fisher's exact test, or Wilcoxon rank sum test as appropriate using SAS 9.4 and R 3.2.0. A Patients ranged from 33 to 88 years of age (median = 66 years of age for both groups). There were 22 (43.1%) versus 25 (58.1%) males in the FNA and FNB groups, respectively. Demographic data of the study population is reported in p > 0.05) between the two groups. Lesion characteristics are shown in p = 0.018) in that there were more neuroendocrine tumors (NET) in the FNA group and more inflammatory lesions and lymphomas in the FNB group.There was no difference in location, size, or pathological class .The diagnostic performance of FNA and FNB is presented in Using the less stringent classification 2 see , the senp < 0.001). In the FNA group five (9.8%) patients required a repeat EUS compared to eight (18.6%) in the FNB group (p = 0.218). Two adverse events were reported  in the FNB group compared to none in the FNA group p > 0.05. No technical failures were reported in either group.In the FNB group, 35 (81%) lesions were sampled using a 25\u2009G needle, six (14%) lesions were sampled using 22\u2009G, and one (2%) lesion was sampled using 19\u2009G (needle gauge not reported in one case). Technical outcomes are reported in p = 1.00).In the FNA group four (7.8%) specimens were paucicellular/inadequate, three of which required repeat EUS versus three (7.0%) specimens in the FNB group of which two required repeat EUS  were neuroendocrine tumors. For FNB, seven of ten false negatives (using classification I) were pancreatic adenocarcinoma and none were eventually proven to be neuroendocrine tumors. The number of cases is too small to draw strong conclusions but this may indicate that FNB is advantageous in neuroendocrine tumors which have a spectrum of malignant potential and where a core specimen may be more important.Although we retrospectively applied two classifications to the data, it is interesting to observe how cases were managed in reality. In the FNB group, eight patients (18.2%) required a second EUS . This compares to five (9%) in the FNA group (three pancreatic adenocarcinomas and two neuroendocrine tumors). This trend is not statistically significant.It is perhaps intuitive that, for a needle designed to obtain a core, the trade-off for obtaining more tissue comes at the expense of more adverse events. The only adverse events that occurred in the study population  were in the FNB group although this was not statistically significant. To date, studies using other FNB needles have reported a similar safety profile to FNA  and manyThis study was retrospective and so has inherent limitations. Other limitations are that tissue sampling was not standardized in terms of number of passes, number of needle throws, and use of suction or \u201cslow-pull\u201d technique. Secondly the FNA group differs significantly from the FNB group in terms of the final diagnosis; however the majority of lesions were pancreatic adenocarcinoma and neuroendocrine tumors for both groups and this is unlikely to have had a material effect on diagnostic performance. Thirdly pathological specimens were not always reported in a strict categorical format. Finally, the FNB cohort dates from when the SharkCore needle was introduced, whereas the FNA cohort represents data taken at a time when both endosonographers were very familiar with that needle. There is inevitably a learning curve with new equipment and it is possible that, with more experience and familiarity, performance could improve slightly for FNB. Lastly, the sample size reported here is relatively small.In summary, the study found FNA and FNB to have comparable diagnostic accuracy and safety, with FNB requiring fewer passes. A prospective, randomized trial is warranted to establish whether FNB has an advantage over FNA."}
+{"text": "Background and Aim: Endoscopic ultrasound (EUS)-guided fine needle biopsy (FNB) and fine needle aspiration (FNA) are established methods in tissue acquisition. A new fork-tip FNB needle has been used to obtain core tissue samples. We compared the performance of the FNB using fork-tip needles with that of the FNA using conventional needles in patients who had solid neoplastic lesions within and around the upper gastrointestinal (GI) tract.Methods: In this retrospective single-center study, patients who underwent EUS examinations for solid neoplastic lesions between October 2013 and February 2017 were included. The procedures were performed in the absence of an on-site cytologist. The main objectives were to compare the diagnostic yield and average number of passes of FNB using fork-tip needles versus those of FNA using conventional needles.Results: EUS/FNA and EUS/FNB were performed on 181 solid neoplastic lesions primarily in the pancreas and GI tract walls. There was no significant difference in patient's age, gender, tumor location, or tumor size. The mean number of needle passes was significantly lower in the fork-tip needle group than in the conventional needle group . There was a trend toward higher sensitivity (89.9% vs. 81%) using the fork-tip needles than when using the conventional needles (p\u2009=\u20090.119). No significant difference in rates of adverse events between two groups was found.Conclusions: Our study demonstrates that, compared with FNA using conventional needles, FNB using fork-tip needles required significantly fewer needle passes while achieving a relatively higher diagnostic yield due to its superior capacity in tissue acquisition from solid neoplastic lesions in and around GI tract walls without on-site cytological assessment. EUS-guided fine needle aspiration (FNA) has been described for sampling the pancreas, bile duct, liver, adrenal gland, lymph nodes, and subepithelial lesions within the wall of the GI tract. The average sensitivity and specificity of EUS-FNA for solid pancreatic neoplasms is 85% and 96%, respectively.15 but many community medical centers may not have expert cytopathologists available.1Although much progress has been made to improve EUS-FNA tissue sampling, limitations of the technique include inadequate preservation of tissue architecture and insufficient material to perform immunohistochemistry, which are vital for the diagnosis of lymphomas, neuroendocrine tumors, mesenchymal tumors, and autoimmune pancreaticobiliary diseases. In addition, ROSE has been shown to decrease the number of needle passes,17 More recently, the development of a fork-tip needle, the SharkCore needle , has been demonstrated to require the same or fewer number of passes to achieve a diagnosis while providing significantly more histological yield.18\u201320 Fewer needle passes using EUS-FNB could lead to decreased procedure time, adverse events, and cost, while providing the benefit of increased histological yield.Core needles for EUS-guided fine needle biopsy (FNB) could theoretically bypass the shortcomings of traditional EUS-FNA. Initial core needles did demonstrate significantly improved diagnostic yield compared with its FNA counterparts.Although the initial studies involving the SharkCore needle are quite promising, it remains unclear whether its performance can be replicated in the community setting without ROSE. The aim of our retrospective study is to compare the outcomes of standard needles versus those of fork-tip (SharkCore) needles in solid neoplastic lesions.This is a retrospective single-center study of consecutive outpatients and inpatients who underwent EUS examinations from October 2013 to February 2017. All procedures were performed in the endoscopy unit of Kaiser Permanente Fontana Medical Center, a tertiary care hospital that is part of a large integrated health organization. The study was approved by the local institutional review board. Informed consent was obtained for all patients before the procedures.Two endosonographers (Z.S. and M.Y.C.) performed the EUS examinations using a linear-array echoendoscope  with patients under conscious sedation or general anesthesia. EUS procedures were reviewed in the electronic health record. Patients who had cystic lesions or procedures without FNA/FNB were excluded.Both FNA using conventional needles  and FNB using the fork-tip needles  were performed with standard techniques. Suction with a syringe and capillary technique and fanning method were used. The average number of to-and-fro strokes on each pass was 15 to 18 times. Smears were made on the slide and preserved in 100% alcohol. The remainder of tissue samples was preserved in formalin for cell blocks. The target lesion was visualized with EUS. Color Doppler was used to determine an avascular path. Because our cytologists were located in a different facility, ROSE was not available for our procedures.21\u201324 When using FNB with the fork-tip needles, we aimed to obtain similar quantity of tissue samples that was the FNB end-point. At conclusion of the procedures, slides and cell block were sent to the Southern California Permanente Medical Group Regional Reference Laboratory in Los Angeles where they were reviewed by experienced cytopathologists. Presence of definitive neoplastic cells was reported as a positive result. Others, such as suspicious for malignancy, atypical cells, or scant cellularity, were considered negative results. Patients with negative results on the first EUS examination were scheduled for repeat EUS/FNA or FNB or subsequent surgical biopsies until definitive diagnosis was established.When using FNA with conventional needles, we adopted seven passes, if feasible, as suggested by previous studies.t-tests and chi-square tests where appropriate. All reported p values are two sided.All analyses were conducted using SAS version 9.4 . Descriptive analyses were performed on patient demographic and clinical characteristics. Statistical tests were conducted using p\u2009>\u20090.05)  .In the conventional needle group, one patient had two simultaneous lesions who underwent FNA, resulting in a total of 42 lesions. In the fork-tip needle group, 10 patients had two simultaneous lesions who underwent FNB, resulting in a total of 139 lesions. Based on their locations, they were classified as pancreatic lesions, subepithelial lesions in GI tract, and others. In the conventional needle group, there were 32 pancreatic lesions (76.2%), 8 subepithelial lesions in GI tract (19%), and two other lesions . In fork-tip needle group, there were 111 pancreatic lesions (80.4%), 25 subepithelial lesions in GI tract (18.1%), and two other lesions  .p\u2009>\u20090.05). In conventional needle group, the pancreatic lesions included 20 ductal adenocarcinomas (47.6%), 11 neuroendocrine tumors (26.2%), and 1 other lesion . In fork-tip needle group, there were 87 ductal adenocarcinomas (63%), 17 neuroendocrine tumors (12%), and 7 other lesions .There was no significant difference between two groups in terms of their tumor location (p\u2009=\u20090.119). The average number of passes using conventional needles was 5.9\u2009\u00b1\u20092.09 compared with 3.8\u2009\u00b1\u20091.28 using fork-tip needles (p\u2009<\u20090.0001)  .p\u2009=\u20090.54). The average number of passes using 25G FNA needle was 5.5\u2009\u00b1\u20091.73 compared with 3.4\u2009\u00b1\u20091.19 using 25G fork-tip FNB needle (p\u2009<\u20090.0001) (Thirty-four solid lesions underwent EUS/FNA using a 25G FNA needle. The sensitivity of using 25G FNA needle was 82.4% compared with 87.2% using 25G fork-tip FNB needle (\u20090.0001) .p\u2009=\u20091).Minor bleeding was the only observed adverse event in both conventional needle group and fork-tip needle group. In the FNA group using conventional needles, there was one patient who had self-limited minor bleeding. In the FNB group using fork-tip needles, four patients were found to have minor bleeding that did not require any intervention. There was no significant difference between these two groups  versus regular needles (5.9 passes).25 to compare fork-tip needles with conventional needles, 15 studies and a total of 1024 patients were included. FNB using different core needles was found to have fewer passes than FNA using regular needles. In another recent study by El Chafic et al.,26 conventional needles were compared with fork-tip needles on sampling of GI stromal tumors. Fewer needle passes were required using fork-tip needles than using conventional needles.These findings were consistent with some recent studies. In a meta-analysis by Khan et al.This reduction of the number of needle passes has an important impact on our practice of EUS/FNA and EUS/FNB. With fewer number of passes, it clearly shortened the procedural time and lessened cost of the examination. In addition, fewer needle passes could potentially decrease the risks of the procedures, such as bleeding, infection, pancreatitis, and perforation. More importantly, the reduction of number of needle passes using fork-tip needles did not compromise on diagnostic yield.In our study, fork-tip needles achieved relatively higher sensitivity, 89.9% versus 81%, compared with conventional needles. Given the small sample size of the FNA group using conventional needles, it was not surprising to find no statistically significant difference between the diagnostic yields of these two groups. The explanation for the small sample size of the conventional needle group was its suboptimal performance. The tedious process of obtaining high number of passes and suboptimal diagnostic yield using conventional needles prompted us to seek alternative needles. Once realizing the improved performance of the fork-tip needles, we continued to use them on solid neoplastic lesions.27 when comparing them with a core needle from another manufacturer. In this study, the fork-tip needles were found to provide substantially higher sensitivity and accuracy in sampling solid pancreatic masses.In fact, a better sensitivity and accuracy using the fork-tip needles were shown in a study by Nayar et al.15 However, most of EUS/FNA and FNA/FNB procedures across the country are performed without the on-site cytologist. Therefore, the optimal number of total passes in this setting is largely unknown.Second, all EUS/FNA and EUS/FNB procedures included in this study were carried out without an on-site cytologist. The value of on-site cytology assessment has much been discussed. Some studies showed the on-site cytologist can reduce the number of passes.28 showed that seven passes without an on-site cytologist was not inferior to the presence of an on-site cytologist. It was noted that the procedural time in obtaining seven passes can be longer than when fewer passes were made. In our study, by using fork-tip needles, we demonstrated a steady trend of reducing the number of passes while still maintaining a high diagnostic yield in the absence of an on-site cytologist.A recent study by Lee et al.It is worth mentioning that a large variety of tumor locations and types were sampled. These lesions were not only located in the pancreas but also in and around the walls of the GI tract. From the aspects of cytopathology, as illustrated in our study, pancreatic ductal adenocarcinoma neuroendocrine tumors of the pancreas and smooth muscle GI tract tumors  were the most commonly diagnosed neoplasms, whereas rare and often difficult to diagnose lesions, such as B cell lymphoma and metastatic lesions in the pancreas, were also included. These findings are considered to be valuable to endosonographers who search for a reliable and efficient needle in tissue acquisition during EUS examination, especially without on-site cytological assessment.It was noted that significant amount of visible microcores of the tissue samples was obtained using fork-tip needles. There has also been a trend to obtain more preserved tissue samples on cytological assessment by certified cytologists. These findings should become more relevant when attempting to make diagnoses of difficult lesions, such as metastatic tumors or lymphomas, which require well-preserved tissue architecture and sufficient quantity for immunohistochemical staining. As a result, during all our EUS/FNB procedures, we have been using the presence of visible cores to serve an additional indication that adequate tissue has been obtained. Further study is planned with the aim to quantitate the visible cores of tissues to determine the optimal number of passes using fork-tip needles.Finally, there used to be concerns about the safety of EUS core needles. Many recent studies have shown that rates of adverse events remained acceptably low using fork-tip needles. Our study showed that self-limited minor bleeding was the only observed complication with 25G and 22G fork-tip needles, with no significant difference compared with conventional needles.27 Therefore, this study suggested that it is safe to use fork-tip needles on solid neoplastic lesions in pancreas and GI tract.In our practice, pancreatitis and abdominal pain were seen in small number of patients who underwent EUS/FNB for other indications, such as cystic lesions in pancreas. No incidence of pancreatitis or other adverse events was observed in these patients likely because the targets were solid lesions. Our adverse event rates were comparable with other recent studies.There are limitations to our study in large part due to its retrospective design. It was a serial design, FNA needle group followed by FNB needle group. It was not a randomized study. We tried to minimize selection bias by the inclusion of consecutive patients. In addition, this study was conducted at a single center, which may limit its generalizability. However, it should be noted that two certified endosonographers performed the procedures independently. Moreover, it reflects the realistic aspects of EUS/FNA and EUS/FNB, in the setting where an on-site cytologist is not available.One more limitation could be the nonblind design of cytologists to the method of tissue acquisition. It was noted that all FNA or FNB specimens were randomly assigned to three different certified cytologists. All cytologists were not notified the switch from conventional needles to fork-tip needles before the conclusion of this study. Another potential limitation was lack of final surgical pathology to determine the true accuracy of EUS results. To address this issue, we used strict criteria, presence of definitive neoplastic cells, for the positive results. All others, including suspicious for malignancy and atypical cells, were considered negative results. Lastly the sample size of conventional needle group was relatively small.Therefore, a randomized prospective study in multiple centers with a larger sample size is needed to further confirm the performance of fork-tip EUS needles.Our study demonstrated that fewer needle passes were required to achieve adequate specimens using the new fork-tip FNB needles than the conventional FNA needles when sampling solid neoplastic lesions of the pancreas, GI tract, and extraluminal areas. Moreover, there appeared to be a trend toward higher diagnostic yield using fork-tip needles than using conventional needles."}
+{"text": "The key objective of scanning probe microscopy (SPM) techniques is the optimal representation of the nanoscale surface structure and functionality inferred from the dynamics of the cantilever. This is particularly pertinent today, as the SPM community has seen a rapidly growing trend towards simultaneous capture of multiple imaging channels and complex modes of operation involving high-dimensional information-rich datasets, bringing forward the challenges of visualization and analysis, particularly for cases where the underlying dynamic model is poorly understood. To meet this challenge, we present a data-driven approach, Graph-Bootstrapping, based on low-dimensional manifold learning of the full SPM spectra and demonstrate its successes for high-veracity mechanical mapping on a mixed polymer thin film and resolving irregular hydration structure of calcite at atomic resolution. Using the proposed methodology, we can efficiently reveal and hierarchically represent salient material features with rich local details, further enabling denoising, classification, and high-resolution functional imaging. Scanning probe microscopy methods can generate high-dimensional data sets that correspond to a low-dimensional sample. Here, Li et al. develop a graphical bootstrapping method to quantitatively visualize large-scale high-dimensional datasets. Since the late 1980s, a variety of SPM methods sensitive to magnetic3, electrostatic8, mechanical11, and piezoelectric15 properties of surfaces have been realized, followed by the development of a number of spectroscopic modes that provided insight into kinetics and thermodynamics of single-molecule reactions19 and mechanisms of bias-induced phase transitions24 on a single defect level.After the first demonstration of atomic force microscopy (AFM) by Binnig and Rohrer25 and Proksch26. The next step was the development of the band excitation (BE) method by Jesse and Kalinin31, which enabled quantitative measurements of conservative and dissipative interactions on the nanoscale. Since then, an increasing number of multifrequency SPM techniques including, amongst many others, bi-/tri-modal SPM33 and intermodulation techniques35 as well as multidimensional approaches such as three-dimensional force mapping AFM38 (3D-AFM), holography39, and time-resolved42 techniques have been realized. Finally, the general acquisition (G)-Mode45 approach has recently been developed to enable full capture of the information stream from the photodetector, potentially reaching the information limit of SPM.Despite this progress, for over 20 years, the progress in SPM methods was associated preponderantly with the development of low noise and controlled environment platforms, as well as functionalized probes. At the same time, the basic principles of signal processing and visualization involved in SPM imaging remained the same, namely the use of the single frequency heterodyne detection methods in lock-in and phase-locked loop detection, and plotting-associated amplitude/phase or frequency maps. Considerable progress in SPM instrumentation was achieved in the early 2000s, with the introduction of dual frequency methods by Garcia35, BE31, and G-Mode45 generate large, often complex, datasets, necessitating approaches for visualizing and converting the data to materials specific information. In prior BE work, we have primarily used functional fitting of the data in the Fourier domain31, relying on a prior based on simple harmonic oscillator physics (SHO model) of the tip\u2013surface interactions. This approach by definition ignores the materials behaviors associated with deviations from SHO models, for example, nonlinearities that lead to dynamic stiffening or softening of the tip\u2013surface junction and hence require more complex dynamic models. The introduction of such models, in turn, can lead to significant issues such as spurious growth in the number of free parameters, expansive analysis times, potential overfitting, etc. Meanwhile, the linear unmixing methods based on principal component analysis46 show only limited usefulness, since the BE signal is non-linear with respect to the local mechanical properties.However, multifrequency/multidimensional techniques such as intermodulation SPM47  function of these parameters, precluding the use of the linear unmixing methods for the analysis. However, we argue that the intrinsic low dimensionality of the physics suggests the presence of the low-dimensional manifold can be derived from the high-dimensional response space of SPM measurements. Figure\u00a0Here, we propose and implement an approach based on low-dimensional embedding of high-dimensional data via a combination of graph analytics and hierarchical clustering, illustrated for BE-SPM and 3D-AFM but generally applicable to other data-rich SPM modalities. We note that fundamental physics of the tip\u2013surface interactions is intrinsically low-dimensional and is determined by a relatively small number of materials parameters. The transfer function of the cantilever is a non-linearUnlike single frequency techniques, which excite/detect the tip\u2013sample interaction within a single frequency bin, BE detection utilizes a non-sinusoidal excitation signal having finite amplitudes over a selected frequency space. Practically, this is achieved using a digitally synthesized signal having a defined band of frequencies (in the Fourier domain), which are subsequently inverse fast Fourier transformed (iFFT) to generate a signal in the time domain, used to modulate the tip\u2013sample interaction. Further, the band of frequencies is typically chosen to be positioned (in the Fourier domain) across one or many contact resonance (CR) peaks, allowing further insight into the cantilever dynamics than accessible in single frequency techniques.\u03c90, amplitude at the CR, A0, and quality factor, Q, which can be deconvoluted and stored as images as given by Eqs. ::\u03c90, ampl\u03c90) and dissipative (\u0394Q) contributions of the tip\u2013sample interaction to be decoupled. In terms of mechanical property measurements, this enables separating the influence of elastic (conservative) and viscous (dissipative) material behavior. This makes BE-SPM (sometimes referred to as CR-SPM) a promising route for mapping local mechanical properties of materials.In this way, knowledge of the full CR behavior in BE allows both conservative  of the material. Whereas peak shape (Q) behavior is reflective of energy dissipation in the tip\u2013surface junction, such that a lower relative Q value is indicative of a more viscous/compliant material. In summary, the results in Fig.\u00a048 of these samples.Figure\u00a0This analysis based on the simple model of harmonic oscillator is extremely useful; however, as previously discussed, the reliance on a SHO type model precludes the investigation of subtle but important materials non-linearities . Hence, further progress requires comprehensive data-driven approaches to visualize the data and elucidate underlying physics, ultimately yielding higher veracity functional imaging.50. Despite successful applications in numerous areas, network analytics usually require existing graph databases, which are constructed by manually labeling instances over a long time. However, of interest here is the emerging class of SPM techniques involving significantly increasing levels of data capture, which often lack prior physical understanding of the tip\u2013sample interactions and their relationship to particular material functionalities. Therefore, to gain insights into the behavior of both global and local relationships within high-dimensional measurements, we first construct the nearest neighborhood graph51. The complexity of constructing an exact nearest neighbor graph is O(n2p), which is too expensive for high-dimensional datasets {X1, X2, \u2026\u2026, Xn} where Xi\u2009\u2208\u2009Rp, especially for SPM datasets in which depending on the detection mode  p can reach to 104. Recently, Tang et al.52 proposed LargeVis, a very efficient algorithm to build approximate nearest neighbor graph based on random projection tree53 and neighbor-exploring54 techniques. The weights of edges are calculated in a similar way to the distributed stochastic neighbor embedding (t-SNE)55 method, by converting the Euclidean distances between neighbors into conditional probabilities that represent similarities. Furthermore, LargeVis layouts the nearest neighbor graph in low-dimensional manifold space following a principled probability model solved via asynchronous stochastic gradient descent56.Over the past 2 decades, networks have become an invaluable tool for extracting insights from large-scale complex systems in many branches of sciencep\u2009~\u2009104), we found LargeVis projection on the low-dimension manifold space tends to be few bulk modules, which can usually distill most salient parts of the material. However, it is difficult to further explore local details in those modules. At the same time, the low-dimensional (2D/3D) coordinates calculated by LargeVis preserve all relationships between measurements. To explore intrinsic structures and present them in a clearer way, we propose reconstructing the graph based on the LargeVis low-dimensional manifold coordinates and subsequently recalculating the manifold layout positions based on the reconstructed graph, following the same principled probability model. We refer to this method as Graph-Bootstrapping.For SPM datasets, especially for high-dimensional detection mode  method. For clustering, we use K-means and hierarchical density estimates method (HDBSCAN57), which is explained in detail in subsequent sections.Traditionally, manifold embeddings are used for visualization purposes only, that is, to overlay known labels on the manifold points. Here, we expand this approach by learning manifold from high-dimensional measurements and subsequently clustering on the manifold to provide a natural way of visualizing and denoising the data, as well elucidating the relevant physics. This task however brings two main challenges. First, the manifold layout should consist of distinguishable groups which when accessible will enable straightforward clustering to be performed. Second, the clustering algorithm should be robust enough to cover irregular manifold layouts. Figure\u00a0K-means works correctly on t-SNE and Graph-Bootstrapping manifolds, given the right tuning parameter, K, the number of clusters. However, the number of clusters is usually an unknown parameter, which in the case of SPM imaging is related to material properties that we would like to estimate. Thus, the manifold learning and clustering should share conjugate hyperparameters that are based on the local structure (such as nearest neighbors), which is the underlying logic behind the Graph-Bootstrapping presented herein.From Fig.\u00a0p\u2009=\u200915,159) is prohibitive, yet Graph-Bootstrapping took 20\u2009min to process 4GB of broadband BE-SPM measurements on a single workstation . Figure\u00a0Graph-Bootstrapping is firstly applied for analysis of the BE and broadband BE-SPM measurements of the polymer mixture. Graph-Bootstrapping reveals domain differentiation despite the fact that the algorithm is purely statistical in nature and does not require any prior information regarding the material and any differentiating structures. It is also an efficient approach. SHO fittings for a high-dimensional broadband excitation \u2009=\u2009max{corek(a), corek(b), d}, where d is the original metric distance between points a and b, corek(x) is the core distance of a point x to cover its k nearest neighbors. Supplementary Fig.\u00a0k. HDBSCAN mostly yields two clusters with a few outliers of three clusters based on LargeVis manifolds , varies as a power of k:\u03b1 is called the exponent of the power law that exists in vast branches of natural sciences, computer sciences, economics, and social sciences67. To get the fitting of power law distribution, we used the software developed by Alstott et al.68. We first normalized the cluster numbers and calculated the log\u2013log plot of probability density function of the empirical data as well as fitted power law , the cluster number tends to be stable as k increases.Compared to LargeVis, the total number of clusters based on the Graph-Bootstrapping manifold decreases continuously as mentclass2pt{minimmentclass2pt{minimk values. Supplementary Fig.\u00a0k\u2009\u2248\u20093\u03c4, 2\u03c4, \u03c4. Clusters with lower STDs are more stable numerically. On one hand, the newly raised clusters could reveal subtler physical factors that affect materials at higher spatial resolution; on the other hand, the newly raised clusters could be essentially of the same material property, but are divided by SPM measurements noises. Supplementary Fig.\u00a0k decreases seem to be randomly located when k is below 2\u03c4 .To establish the quality of clustering, corresponding to the number of distinct surface functionalities, we calculated the (cumsum) standard deviations (STD) of SPM measurements within each cluster at different Based on above analysis, we can directly denoise the data, visualize it, and extract underlying physics parameters based on the manifold clusters in Supplementary Fig.\u00a0In Fig.\u00a069 to resolve point defects in the hydration structure of calcite (10.4). For each  surface position, excitation frequencies extracted at different z piezodisplacements (corresponding to various hydration layers) are inputted to the Graph-Bootstrapping.To further demonstrate the broad capability of Graph-Bootstrapping, we applied it to the 3D-AFM dataset that has been recently investigated by S\u00f6ngen et al.69. Second, Graph-Bootstrapping also elucidated the irregular flattening of the cluster_0 curve between the fourth and fifth hydration layer as well as its large shifts of local maxima and local minima between the second and fourth hydration layer. We can assure this irregularity by comparing surface label sites and similarity loading .Mechanical measurements were performed on thin-film polymer blend samples consisting of PCL inclusions embedded in a PS matrix. Samples were prepared by spin coating in 2:1 ratio as described in previous work by Kocun et al.\u03c90\u2009=\u2009~210\u2009kHz) and a bandwidth ~100\u2009kHz using a sampling rate of 4\u2009MHz leading to a data capture of ~20 bins per band. In addition, broadband excitation/detection was implemented, using a center frequency of ~500\u2009kHz and bandwidth of ~490\u2009kHz allowing a larger number of resonance peaks to be captured simultaneously.All measurements on polymer sample were performed using a commercial AFM system , which was equipped with a laser for photothermal excitation (Bluedrive module) and used for mechanical perturbation of the AFM tip\u2013sample interaction. CR-AFM measurements were performed in contact mode where the tip was held in constant force (~65\u2009nN) with the surface using static deflection feedback. BE-AFM imaging was operated at normal AFM imaging speeds (1\u2009Hz), and the AFM system was coupled with data acquisition and arbitrary waveform generators , which were controlled using custom Matlab code (MathWorks). Measurements used a gold-coated NSC36 (Micromasch) cantilever with a calibrated spring constant of 0.89\u2009N/m and free air resonance frequency of 44.7\u2009kHz. The BE excitation center frequency, which was used to excite the photothermal laser position on the AFM cantilever, was chosen to approximately match the CR frequency (69 and we refer the reader to this text for additional details.3D-AFM measurements on calcite were performed by S\u00f6ngen et al.The Graph-Bootstrapping codes used in this study can be made available from the corresponding authors upon request.The data that support the findings of this study are available from the corresponding authors upon request.Supplementary InformationPeer Review File"}
+{"text": "In this study, the HRM dissociation profiles of msp1 and msp2 amplicons were determined and validated against parasite isolates from malaria patients. The msp1 and msp2 profiles of both laboratory and clinical isolates were reproducibly differentiated by HRM. These rapid assays are performed in a closed-tube system, and so avoid cross-contamination while increasing throughput, which are two major advantages. The HRM assays offer significant gains in simplicity, speed and interpretation of results, and reduced analysis cost, for studies that require discrimination of parasite clones. Assay performance in large-scale studies utilizing DNA samples derived from filter-paper bloodspots should now be evaluated.Recurrent parasitaemia during follow up of clinical trials of antimalarial drug efficacy results from either recrudescence of parasites surviving treatment or from parasites newly emerging from the hepatic stage of infection. Nested PCR is used to distinguish these two possibilities and the technique is difficult to standardise. There is risk of both false positive and false negative results, leading to misclassification errors. The high-resolution melt (HRM) assay was developed with pairs of conserved primers targeting blocks of merozoite surface protein 1 and 2 ( Plasmodium falciparum is the most virulent of the six Plasmodium species that cause malaria in humans, being responsible for high mortality and morbidity, particularly in Africa. Efforts to control and eliminate malaria have been hampered by the emergence of drug resistant parasites1, but our ability to track and control resistance is also hampered by the high genetic diversity of P. falciparum. Further, to accurately estimate true drug efficacy in clinical trials of antimalarial drugs, recurrent infections seen after drug treatment need to be identified either as new infections arising from the liver or as recrudescent parasites persisting from the original infection. A PCR-correction method is generally deployed to distinguish between the two. In addition, ex vivo and in vitro studies to identify drug resistant parasites in complex infections also need to identify the constituent parasite clones in an infection or isolate in order to accurately capture the emergence of minor clones in the subsequent growth of parasites3, as is also seen in vivo4. This requires the identification of clones in paired samples, before and after treatment, and determining whether they are the same clones5.msp1,msp2) and glutamate rich protein (glurp) are amplified using sequence specific primers in a nested-PCR6. The recurrent infection is categorized by comparing the size of polymorphic repeat regions in these genes before (day 0) and after treatment (day of failure). If fragment sizes differ, the recurrent infection is categorized as a new infection, but if the post-treatment analysis produces the same fragment sizes as before treatment, these are considered recrudescent parasites, implying that treatment failure has occurred. In multi-clonal infections, minority clones constituting a small proportion of the total biomass might fall below the detection limit of the genotyping method and be missed by PCR-based detection due to competition for primers or other constituents of the reaction mix by the more abundant clones7. This was resolved by genotyping at extra time points on day 1 and day 2 post-treatment as well as at the follow-up time-point prior to the day that microscopically detected parasite recurrence occurred8. Using this approach, studies of treated malaria patients in Kenya and Tanzania showed the presence of additional malaria clones, differing from those at day 0 and day of failure resulting in re-classification of many recurrent infections as recrudescent infections in these extended analyses9. However, this approach requires significantly more effort, and current methods for determining different clones such as nested-PCR, microsatellite and DNA sequencing are labour-intensive, time-consuming and are prone to contamination. In addition, gel electrophoresis-based methods discriminate clones based on size differences alone and cannot detect sequence variation. In this study, a real-time quantitative PCR (qPCR) was developed with (HRM) method analysis, which is sensitive to both amplicon length and base composition, to identify distinct P. falciparum msp1 and msp2 genotypes.One tool commonly used to distinguish between newly emergent and recrudescent parasites is conventional nested-PCR and gel electrophoresis detection. In this genotyping method, the genes that code the surface antigen loci of merozoite surface protein 1 and 2 . To establish the specificity of the oligonucleotide primers and optimize the PCR conditions, 3D7 DNA obtained from laboratory-cultured parasites were initially used. Amplification of msp1 resulted in one minor peak and the major peak was retained in melt curve analysis but only the major one in HRM normalized graph windows. The msp2 genotyping of 3D7 DNA, however, unexpectedly produced two major melt peaks and HRM amplification curves each. It was first thought this resulted from the presence of two amplicons due to contamination. Further repeats of the msp1 and msp2 HRM analyses with a different source of DNA again gave two amplification curves for msp2, and fractionation of PCR products by gel electrophoresis confirmed that. Both msp1 and msp2 generated single band each of the predicted size. To rule out any inherent problems of the assays, we used uMELT software10 to predict the HRM curve of msp1 and msp2 gene fragment sequence of 3D7. The software correctly predicted one major and one minor curve for msp1 and two major curves for msp2 suggesting that this pattern does indicate two amplicons, but rather it is due to a bimodal melt of the double stranded DNA (dsDNA) where the base composition if not uniform throughout. The dsDNA melts in transition with regions of the amplicon that are more stable  melting later. These stable regions maintain their dsDNA configuration until the temperature is high enough to cause melting of the stable region, resulting in a bimodal melt profile even though only one amplicon is produced in the reaction.Alignments of msp1 and msp2 HRM assays, 3D7 DNA at different parasite densities (3\u20130.00003%) was amplified. The assay detected as low as 1.5 parasites per \u00b5l with GCP of 77.44% and 62.44% for msp1 and msp2, respectively, relative to a 3D7 DNA sample at 1500 parasites per \u00b5l. GCP estimates increased to 92.32% and 78.41% for msp1 and msp2 genotypes respectively when 15 parasites per \u00b5l (0.0003% parasitaemia) were used. We then chose the 3D7 DNA sample with 15 parasites per \u00b5l, which is closer to limit of detection of parasites by expert or reference laboratory microscopy, to determine the inter-assay coefficient of variation (CV). The mean\u2009\u00b1\u2009SD inter-assay CV (n\u2009=\u200935) for msp1 and msp2 was 93.15\u2009\u00b1\u20095.99 and 86.45\u2009\u00b1\u20099.47 respectively  (due to a shorter nucleotide sequence) such as 7G8, K1 and R033 in msp1 genotype were less affected by parasitaemia difference compared to the clones with higher Tm (longer nucleotide sequence) such as 3D7 and Dd2 (data not shown). The minor peak observed in 3d7 msp1 genotyping was also observed in all other laboratory isolates and was consequently excluded from HRM analysis.In an analysis of monoclonal parasite preparations, a distinct HRM amplification curve was produced for each of the five different clones  using msp1 genotype as well as the msp2 genotype for Dd2 produced two distinct HRM curves when two clones were mixed  patients, and one additional unpaired pre-treatment sample. We investigated whether the assay accurately detects the number of clones in each sample and correctly classifies before and after treatment samples as the \u201csame\u201d or \u201cdifferent\u201d infections. The HRM/melt curves generated by les Fig.\u00a0. Generalmsp1 or Dd2 for msp2 and K1 and 3D7 for both), which represent the three different HRM melt curve observed in the initial validation experiment. Any sample within 0.2\u2009\u00b0C degree of the sample with known HRM melt curve belongs to the same clone  on day 28 was negative by msp1 but showed similar HRM melt curve on msp2 though slightly different Tm was observed (84.2 on d0 and 83.8 on day 28). However, the normalized HRM curve classified the two samples as \u201cdifferent\u201d. This is consistent with the gel-based PCR, which generated different clones on d0 (K1 and RO33) and d28 (K1 and MAD20) suggesting a possible new infection  using both ter Fig.\u00a0. On the ter Fig.\u00a0. The mspmsp1 and 82% (61\u201399%) for msp2 in all samples. Samples collected after day 7  were classified as \u201cdifferent\u201d with a GCP of less than 50% relative to day 0 sample. This was in complete agreement with the gel-based PCR results  for msp1 and msp2 respectively. When Dd2 and 7G8 were artificially mixed, DNA from a 10:1 to 1000:1 mixtures at 0.3% parasitaemia generated a GCP estimate for msp1 and msp2 of >50% in comparison with a 1:1 mixture at the same parasite density  produced GCP estimates of 77.44% and 62.44% for msp1 and msp2 genotyping, parasite isolates are broadly classified into K1, MAD20 and R033, and FC and IC/3D7 sub family clones respectively. Since the Tm value for the K1 clone was found to lie in the middle of the range of values across all laboratory isolates tested, this clone was used as a calibrator and the software calculated the florescence signal of each clone relative to the signal of K1 and to generate a difference graph , 7G8 (R033). In gel-based discrimination, 3D7 and K1 are grouped together but in the HRM assay, they cluster into different groups, reflecting difference in the DNA sequence and length. Interestingly, the patient DNA samples HL1204 and HL1209, HL1205 and HL1212, and HL1210 and HL1211 clustered into 7G8/R033, Dd2 (MAD20) and 3D7 allele types respectively with GCP ranging from 42.6% to 78.2% when genotyped with msp1. When genotyped with msp2 HL1204, HL1210 and HL1211 clustered into IC/3d7 sub family clones while HL1205, HL1209 and HL1212 clustered in both IC/3D7 and FC type clones suggesting that both alleles were present in the samples. This has been previously reported for these isolates using gel electrophoresis, where the samples contained more than 3 or more clones of FC type and more than 1 or more clones of IC/3D7 type3. Using HRM, the classification of parasite clones into clusters of sub-families takes 3\u20134 hrs compared to 1\u20132 days using PCR and gel-electrophoresis methods , and has been successfully evaluated for detection of drug resistance malaria parasites12.Genotyping of the msp1 and msp2 HRM assays correctly discriminated alleles from five different single-clone laboratory isolates, those of polyclonal DNA samples derived from whole blood and DBS. The assays detected densities as low as 1.5 parasites per \u00b5l accurately, suggesting that the method is as sensitive as the nested-PCR electrophoresis method. However, the mixed clones evaluated were artificially prepared and the ability of HRM assays to precisely estimate the probability of missed alleles in natural field isolates remains to be determined. This was clear when paired patient samples were genotyped and analysed using HRM, where at least one allele was missed in two patient samples compared to the nested-PCR and gel electrophoresis method3. It is not clear whether this is due to an intrinsic sensitivity difference in detecting minor clones or the detection of false positive alleles by nested-PCR and gel electrophoresis, possibly due to amplicon contamination. HRM assays avoid contamination and risk of PCR product carry-over as the method is non-nested and uses a closed-tube readout.The msp1 and msp2 HRM genotyping identified one or more extra alleles in post-treatment samples from some of the patients. This was also observed previously when the same samples were genotyped by PCR and gel electrophoresis, suggesting that this is a general observation regardless of the PCR-based genotyping methods used13, best explained by changes in the relative abundance of the constituent circulating clones in vivo before and after treatment8. In polyclonal infections, these changes in relative abundance mean certain genotypes may remain undetected at one time point, but recur later leading to false classification. These minority clones are missed by PCR-based detection methods due to competition for primers or other constituents of the reaction mix by the more abundant clones7. In a study in Papua New Guinea, detection of minor clones decreased with an increase in multiplicity of infection, suggesting the dominance of major clones among PCR amplicons detected14. A similar study carried out in Uganda reported a higher probability of mixed infections in high transmission areas, and this affected classification of treatment outcomes15. A slow-clearing minority variant present but not detected at admission, could cause recrudescence but would be identified in the recurrent sample as a new infection, rather than recrudescence of parasite genotypes present at the time of treatment. This has recently been demonstrated in a multiplicity of infection study to detect and quantify the markers of antimalarial drug resistance16. Therefore, the failure to detect minor alleles at day 0 is likely to lead to misclassification of some infections17. The data in this study and previous reports8 demonstrate that inclusion of the additional time points day 1, day 2 and day before failure, in addition to pre-treatment and day of failure, improve specificity when determining the complexity and origins of recurrent infections.Both 6. This is particularly important in high transmission settings, where two distinct clones may generate PCR products with the same size but which differ in sequence. These will be indistinguishable by gel electrophoresis. Others have attempted to resolve this by classifying any pair of samples that contain matched and unmatched alleles as new infections18, but this can clearly lead to underestimation of recrudescence infections. WHO/MMV guideline states that, in treated malaria patients, \u201c a \u2018re-infection\u2019 [i.e. new infections] is a subsequent occurring parasitaemia in which all the alleles in parasites from the post-treatment sample are different from those in the admission sample, for one or more loci tested\u201d19. This definition seeks to minimize misclassification error and maximize accuracy of classification.One other strength of the HRM assay is that the clones are discriminated based not only on length but also sequence differences and this feature allows the HRM assay to overcome the resolution limitation observed in the gel electrophoresis-based methodsmsp1 and msp2 alleles generate more than one melting peak, due to the inherent two-phased nature their DNA melting profile. For distinguishing recrudescence from new infections, this shortcoming can be overcome as the HRM amplification curves of the samples before and after treatment are compared with each other, and any additional peak due to the inherent nature of DNA melting will be reflected in both samples. The interpretation of those melting peaks will be more challenging if the genotyping purpose is to study parasite diversity and complexity of infection, although we have shown that this can be overcome by including known comparators for both msp1 and msp2 genotyping. Measurement of the amplification signal of each clone relative to these comparators thus permits classification of allelic variants into clusters.One of the shortcomings of the HRM assays is that some of the in vitro drug sensitivity studies, particularly for polyclonal parasite isolate in which a subset of genotypes preferentially survive in vitro cultures, as this often reflect survival in in vivo therapeutic efficacy studies20. Our data warrant the large-scale evaluation of the performance of the real-time PCR and HRM approach on DNA samples derived from filter paper bloodspots collected in field studies.In addition to drug and vaccine efficacy studies, HRM genotyping can be applied in studies of parasite biology \u2013 for example, to assess parasite cloning experiments, and in monitoring the identity, integrity and clonality of propagated parasite lines, if necessary direct from cryo-preserved material. The HRM method can also be deployed as tool for 3. Eighteen paired dried blood spot (DBS) samples were available to validate the HRM on DBS field samples. For 15 children, day 0 (before treatment) and day 7 (7 days after treatment) were available. For two children, day 0 and day 14 or day 28 samples were available and for one child, day 0, 7 and 21 samples were available. The samples were collected between January and July 2014 from asymptomatic children aged 5 to 12 years attending schools near Mbita, Kenya, as part of a study on mosquito behaviour and odor profile of malaria-infected individuals. Study site, sample collection and other details of the study has already been published22. Culture adapted laboratory isolates 3D7, Dd2, 7G8, K1, R033 and D10 were obtained from the Malaria Research and Reference Reagent Repository (http://MR4.org). Parasite cultures were tightly synchronized as ring-stage trophozoites to stimulate infected peripheral blood in vivo.Parasite DNA from malaria cases treated at the Hospital for Tropical Diseases (HTD), London, UK was utilized for this study. Clinical isolates were obtained from six patients: pre-treatment and post-treatment samples were available for patients HL1204, HL1205, HL1209, HL1210 and HL1211 and only pre-treatment for patient HL1212. Details of the patient history, parasitaemia and treatment have previously been publishedmsp1 and block 3 of msp2 genes. Pairs of oligonucleotide primers for msp1 (Msp1HRM_F: TAGAAGATGCAGTATTGACAGGT and Msp1HRM_R: CAGCGTAAGATTTAGCATCTGAATC) and msp2 (Msp2HRM_F: AGCAACACATTCATAAACAATGCT) and Msp2HRM_R: TCCATGTTGTCCTGTACCTTTATTC) flanking the target regions were designed with the PCR amplicon expected to yield 346\u2009bp and 518\u2009bp respectively. The msp1 primers are conserved in the commonly used isolates K1, MAD20 and Ro33, and the msp2 primers in FC27 and 3D7/IC respectively. Amplification of DNA was performed in a 25\u2009\u00b5l reaction volume on a Rotor-gene 6000 thermal cycler . The reaction mixture contained 5\u2009\u00b5l of extracted genomic DNA, 200\u2009nM of each primer, 3\u2009mM of MgCl2, 300\u2009nM of each dNTP, 5\u2009\u00b5M SYTO 9 green florescence nucleic acid stain (Invitrogene), 1X NH4 reaction buffer  and 1 U Taq polymerase . PCR conditions were one cycle of 94\u2009\u00b0C for 2\u2009min, 40 cycles of 94\u2009\u00b0C for 15\u2009sec, 54\u2009\u00b0C for 20\u2009sec and 72\u2009\u00b0C for 40\u2009sec. To verify the specificity of the primer sets, PCR products were detected by gel electrophoresis of 10\u2009\u00b5l from each reaction on 2% agarose gels. Gel-based PCR assays targeting msp1 and msp2 genes were amplified using previously reported methods6 and clone similarity between time points was carried out using previously published approaches18. Gels were made and run in TBE buffer  and 5ul of loading buffer  were added to each sample prior to electrophoresis.New primer sets were designed to amplify block 1 of msp1 and msp2 primers was established by running gel-electrophoresis of the PCR products. The sensitivity and limit of detection of the assay was estimated using a five-fold serial dilution of 3D7 in blood starting at 3% parasitaemia. The sensitivity to detect clones in mixed infection was estimated using a mixture of Dd2 and 7G8, and Dd2 and K1 Plasmodium falciparum in culture medium at 5% haematocrite in a ratio of 1:1, 10:1, 25:1, 50:1, 100:1, 500:1 and 1000:1, and Dd2:7G8 in a ratio of 1:1, 10:1, 25:1, 50:1, 100:1, 500:1 and 1000:1 with a minimum parasitaemia of 15 parasites per \u00b5l. The reproducibility of the msp1 and msp2 HRM assays was determined by carrying out 35 replicate tests of 15 parasites per \u00b5l of 3D7 strain.The specificity of the P. falciparum clones, the PCR products were subjected to a ramping of 0.1\u2009\u00b0C s\u22121 between 75\u2009\u00b0C and 90\u2009\u00b0C. All specimens were performed in duplicate and their melting profiles were analysed using Rotor-gene 6000 software (version 1.7.87) and the HRM algorithm provided. Visual examination of the melt curves data from a panel of laboratory isolates across a gradient of different temperature ramp increments was performed to select the optimum temperature in which most laboratory isolates show distinct conventional melt curves.QPCR HRM analysis was performed in a Rotor-gene 6000 thermal cycler (Corbett Life Science). In order to determine the optimal melting temperature for differentiation of For genotype analysis, temperature-shifted and normalized amplification curves were used in in the HRM analysis. Normalization regions of 82.0\u201382.5 and 88.0\u201388.5 were used as a standard but were modified for some clinical samples depending on the melting temperature peaks observed. The threshold in the melting curve analysis was adjusted to ensure that all positive samples generate interpretable dF/dT profiles and melt peak estimates. A fixed threshold was not deployed as the florescence signal amplitude varied across samples. The Genotype Confidence Percentage (GCP) is a value attributed to each genotype/allele compared with the genotype of a calibrator, with a value of 100% indicating an exact match. For clinical samples, the pre-treatment sample (hr 0) was a calibrator.P. falciparum laboratory isolates were subjected to HRM curve analysis. The difference-curve graph was used to classify the different msp1 and msp2 clones into clusters based on florescence signal difference relative to K1 (reference strain).Melt curve analysis was used to verify the presence of multiple clones in each parasite isolate or culture. Clone similarity was signified by assigning names of known genotypes (strains) to samples with similar melting temperature to the known genotypes. PCR amplicons from five different T value, end-point florescence level and amplification efficiency. The real-time data were analysed using different modules available in the Rotor-gene software. A sample was re-analysed if its CT value was \u226530, or if it had lower amplification end point compared to the majority plots, or if amplification efficiency differ from other reactions or fell below an amplification value of 1.4 (2\u2009=\u2009100% amplification efficiency). The reproducibility of the msp1 and msp2 assays was measured by calculating the coefficient of variation (mean\u2009\u00b1\u2009standard deviation) of GCP of replicate tests.Validation of each result was assessed using Chttp://www.malariaresearch.eu/) and are freely available to researchers. All data generated or analysed during this study are included in this published article (and its Supplementary Information files).All culture-adapted parasite lines described have been deposited in the European Malaria Reagent Repository . Approval for the study was obtained from the Research Ethics Committee of the University College London Hospitals (Application number: 07/Q0505/60), and include in their manuscript a statement confirming that informed consent was obtained from all participants and/or their legal guardiansDataset 1"}
+{"text": "This paper defines a Sahlqvist fragment for relevant logic and establishes that each class of frames in the Routley-Meyer semantics which is definable by a Sahlqvist formula is also elementary, that is, it coincides with the class of structures satisfying a given first order property calculable by a Sahlqvist-van Benthem algorithm. Furthermore, we show that some classes of Routley-Meyer frames definable by a relevant formula are not elementary. Sahlqvist Correspondence Theorem is a celebrated result in modal logic ., 16.8, 1mutatis mutandis, the argument for the Sahlqvist Correspondence Theorem  can be ented in . Moreovebi-approximation semantics (which unfortunately is much more complicated than the Routley-Meyer framework). Other settings without boolean negation where Sahlqvist theorems have been obtained are positive modal logic POS must be the case. Hence, (1). So (1) and (2) are actually equivalent.Next we observe that one may assume that any unary predicate  appearing in POS, appears also in the antecedent of (1). For suppose not, that is, there a unary predicate P1,\u2026,Pn\u2200x1,\u2026,xk(Up\u2264(P1)\u2227\u2026\u2227Up\u2264(Pn)\u2227REL\u2227(DN)AT\u2227IMP \u2283\u00acNEG\u2228POS).(3)\u2003\u2200Observe that \u00acNEG \u2228POS is a positive formula.It is easy to see that (1) is equivalent to \u03c01(xi1),\u2026,\u03c0k(xik) are all the conjuncts of (DN)AT and IMP in the antecedent of (3) in which the unary predicate Pi occurs. Then if \u03c0j(xij) appears in one of the conjuncts in IMP, it must be a formula of the form \u2200yz(Rxijyz \u2227\u2203b(Ob \u2227 b \u2264 y) \u2283 Piz), in which case we define \u03c3(\u03c0j(xij)) = \u03bbu.(\u2203yz(Rxijyz \u2227\u2203b(Ob \u2227 b \u2264 y) \u2227 z \u2264 u)). On the other hand if \u03c0j(xij) appears in one of the conjuncts in (DN)AT we put \u03c3(\u03c0j(xij)) = \u03bbu.(xij \u2264 u) in case \u03c0j(xij) = Pixij and \u03c3(\u03c0j(xij)) = \u03bbu.(xij\u2217\u2217\u2264 u) in case \u03c0j(xij) = \u00ac\u00acPixij\u2217\u2217. Note that \u03c3 is a well-defined function and that for any \u03c0j(xij), if \u03c0j(xij)[w] then \u2200y(\u03c3(\u03c0j(xij)(y) \u2283 Piy)[w]. Next define \u03b4(Pi) = \u03bbu.(\u03c3(\u03c01(xi1))(u) \u2228\u2026 \u2228 \u03c3(\u03c0k(xik))(u)). Now, if (DN)AT[ww1\u2026wk] and IMP[ww1\u2026wk] then \u2200u(\u03b4(Pi)(u) \u2283 Piu)[ww1\u2026wk].Suppose Up\u2264(\u03b4(Pi)) holds for any Pi. This is so because each \u03c3(\u03c0j(xij))(u) is upward closed under \u2264, and any union of upward closed sets under \u2264 is also upward closed under \u2264. Moreover, by the reflexivity of \u2264, [\u03b4(P1)/P1\u2026\u03b4(Pn)/Pn](DN)AT and [\u03b4(P1)/P1\u2026\u03b4(Pn)/Pn]IMP will hold trivially. So, from \u03b4(P1)/P1\u2026\u03b4(Pn)/Pn]\u2200x1,\u2026,xk(Up\u2264(P1)\u2227\u2026\u2227Up\u2264(Pn)\u2227REL\u2227(DN)AT\u2227IMP \u2283\u00acNEG\u2228POS),(4)\u2003(\u00acNEG \u2228POS)).(5)\u2003\u2200Given that any unary predicate appearing in POS also appears in the antecedent of (4), (5) is a first order formula in the signature of Routley-Meyer frames, which contains R,\u2217, and O as the only non-logical symbols.At this point we should note that P1,\u2026,Pn be arbitrary and suppose further that ww1\u2026wk] and IMP[ww1\u2026wk], it must be the case that \u2200u(\u03b4(Pi)(u) \u2283 Piu)[ww1\u2026wk]. Hence, by Lemma 3, We have seen that (1) implies (5). All that is left is to show that (5) implies (1). Recall that (1) is equivalent to (3). Thus it suffices to prove that (5) implies (3). Assume (5), let The procedure in the above proof is better understood by working out some examples, which we will do next for the benefit of the reader.M is any model based on Rwyz and V on V (p) = {x : y \u2264 x} and V suffices to show that By the Sahlqvist-van Benthem algorithm, the following list of equivalences must hold: V such that By the Sahlqvist-van Benthem algorithm, x(x\u2217\u2217\u2264 x \u2227 x \u2264 x\u2217\u2217) when we consider validity with respect to all the worlds in O of the frame. This is not the same in general as \u2200x(x = x\u2217\u2217) which is the condition usually required to validate \u223c\u223c p \u2192 p. However, it is certainly the case that, using the construction from Theorem 5 . Suppose M is an arbitrary model based on Rwyz \u2203u1u2(Ru1u2y \u2227 Pu1 \u2227 Qu2) both hold, u1 \u2264 z and u2 \u2264 z, and, by the Hereditary Lemma, Pz and Qz as desired. Hence, V on V (p) = {x : u1 \u2264 x} and V (q) = {x : u2 \u2264 x} suffices to guarantee that y,z(Rxyz \u2283 x \u2264 z \u2227 y \u2264 z) by some manipulations.By the Sahlqvist-van Benthem algorithm, x,y,z(Ox \u2227 Rxyz \u2283\u2203u2u3(Ryu2u3 \u2227\u2203b(Ob \u2227 b \u2264 u2) \u2227 u3 \u2264 z)) when we consider correspondence with respect to the worlds in O of a given frame. This condition is actually equivalent to the condition \u2200x\u2203b(Ob \u2227 Rxbx) corresponding in  then, then \u2200y(Piy \u2283 \u03c3(\u03c0j(xij))(y))[w]. Next define \u03b4(Pi) = \u03bbu.(\u03c3(\u03c01(xi1))(u) \u2227\u2026 \u2227 \u03c3(\u03c0k(xik))(u)). Now, if (T)NAT[ww1\u2026wk] and IMP[ww1\u2026wk] then \u2200u(Piu \u2283 \u03b4(Pi)(u))[ww1\u2026wk]. The remainder of the proof is as before but using again the contrapositive formulation of Lemma 3 and noting that the intersection of a collection of upward closed sets under \u2264 is also upward closed under \u2264. \u25a1Finally, let p \u2192t)\u2227\u223ct \u2192\u223c p. Using our Sahlqvist-van Benthem algorithm, we obtain that the following equivalences hold: Up\u2264(P), Rwyz, \u2200u,v(Ryuv \u2227 Pu \u2283\u2203b(Ob \u2227 b \u2264 v)) and \u00ac\u2203b(Ob \u2227 b \u2264 y\u2217), it must be that \u2203u2(Ryz\u2217u2 \u2227\u00ac\u2203b(Ob \u2227 b \u2264 u2)). Thus if Pz\u2217, \u2203b(Ob \u2227 b \u2264 u2), which is a contradiction, so \u00acPz\u2217. Consequently M based on V (p) = {x : z\u2217\u2264 x}. Now, if Ryu1u2 and u1 \u2208 V (p), that is, z\u2217\u2264 u1, we that, by p3, Ryz\u2217u2, and hence, \u2203b(Ob \u2227 b \u2264 u2). This shows that Consider the dual relevant Sahlqvist implication (\ud835\udf03) defined by \u0398(\u03d5) = \ud835\udf03 \u2192 \u03d5, and applications of \u2228 where the disjuncts share no propositional variable in common.A relevant Sahlqvist formula is any formula built up from  relevant Sahlqvist implications, propositional variables, and negated propositional variables using \u2227, the operations on formulas \u0398 (for any propositional variable free relevant formula Every relevant Sahlqvist formula has a local first order correspondent onRoutley-Meyer frames.Immediate from Lemma 11, Lemma 16 and Lemma 9. The only thing the reader should note is that In this paper we have defined a fragment of relevant languages analogue to the Sahlqvist fragment of modal logic. We then went to establish that every class of Routley-Meyer frames definable by a formula in this fragment is actually elementary. This isolates a modest but remarkable collection of relevant formulas. We also showed that there are properties of Routley-Meyer frames definable by relevant formulas which are not first order axiomatizable."}
+{"text": "Protein induced by vitamin K absence II (PIVKA-II) is an abnormal prothrombin increased in gastrointestinal malignancy. We aimed to evaluate PIVKA-II in comparison to established pancreatic cancer (PC) biomarkers  and CA 242) measured in PC patients and in patients with benign pancreatic diseases.We studied 26 PC patients (Group 1) and 20 patients with benign pancreatic diseases (Group 2). PIVKA-II and CEA were measured by chemiluminescent enzyme immunoassay method (CLEIA) on LUMIPULSE G1200 , CA 19-9 and CA 242 were measured by ELSA  and EIA , respectively. Receiver operating characteristic (ROC) analysis was performed to assess biomarkers\u2019 diagnostic characteristics in both groups.vs. 31.0 (23.0 \u2013 43.0) mAU/mL (P < 0.001) for PIVKA-II, 260.0 (158.7 \u2013 272.0) vs. 45.2 (9.0 \u2013 58.0) U/mL (P = 0.034) for CA 19-9, 104.0 (30.2 \u2013 150.0) vs. 7.2 (4.8 \u2013 26.0) U/mL (P < 0.050) for CA 242, 9.4 (5.3 \u2013 37.5) vs. 4.5 (1.8 \u2013 7.0) ng/mL (P = 0.021) for CEA. Areas under the ROC curve of PIVKA-II, CA 19-9, CA 242, CEA were 0.86 (95% CI: 0.71 \u2013 1.00), 0.58 (95% CI: 0.38 \u2013 0.78), 0.73 (95% CI: 0.54 \u2013 0.92), 0.64 (95% CI: 0.44 \u2013 0.85), respectively.Median and interquartile range (IQR) in Group 1 and Group 2 were: 1749.0 (320.2 \u2013 3921.0) PIVKA-II is significantly higher in PC than in benign pancreatic diseases. PIVKA-II shows a rather good diagnostic performance compared to CA 19-9, CEA and CA242, thus its determination could help PC management. All patients were referred to the Oncologic Unit A, of the Policlinico Umberto I, Rome, Italy. Group 1 patients met the following eligible criteria: adult age (\u2265 18 years), the first occurrence of neoplastic pathology, no prior treatment with neoadjuvant therapy, absence of diabetes, no serious physical disabilities. The criteria for inclusion to Group 2 were: adult age (\u2265 18 years), absence of any present malignant tumour, no prior occurrence of neoplastic pathology, no diabetes, no serious physical disabilities, presence of a pancreatic benign disease . The study protocol was approved by the Institutional Review Board and all subjects participating in the study, patients and volunteers signed a written informed consent. At enrolment, medical history was collected for each patient, and peripheral blood samples were drawn and immediately sent to the laboratory of Tumour Markers of the Policlinico Umberto I, Rome. When diagnosis was made for every participant in the study, each serum sample was analysed for PIVKA-II, CA19-9, CEA and CA 242. Group 1 and Group 2 patients\u2019 diseases were confirmed by histopathological examination conducted in the Histopathological Unit of the Policlinico Umberto I, Rome, Italy. All Group 1 patients were subjected to postoperative histopathological diagnosis, which confirmed the presence of PC . The research was performed in compliance with the current revision of Helsinki declaration.Blood collection was performed following a standard protocol. Peripheral blood samples were obtained by venous puncture, collected in a red top Vacutainer  clotted 60 \u2013 90 minutes and centrifuged for 10 minutes at 1300xg. The serum fractions were aliquoted in 1.5 mL Eppendorf tubes  and stored at \u2013 80 \u00b0C until analysis.Prothrombin induced by vitamin K absence II and CEA serum concentrations were determined on a Lumipulse G1200 , using the LUMIPULSE G PIVKA-II kit and the LUMIPULSE G CEA kit  respectively  method . The diagnostic kit RIA ELSA-CA 19-9 CisBio is a solid-phase two-step \u201csandwich\u201d immunometric assay. The detection range was between 1.5 and 240 U/mL, with intra-assay CV of < 3.8%, inter-assay CV of < 4.0% and a cut-off value of 37 U/mL (CV < 10%) based on the 95% confidence interval according to manufacturer\u2019s specifications.CA 242 concentration in serum specimens was measured by a manual enzyme immunoassay (EIA) technique using the CanAg CA242 EIA kit . The CanAg CA242 EIA is a solid phase, non-competitive immunoassay. The detection range was between 1 and 150 U/mL, with intra-assay CV of < 3.8% and inter-assay CV of < 4.0% According to manufacturer was considered a cut-off of normality of 16 U/mL (CV < 10%) based on the 95% confidence interval.All assays were performed in duplicate and according to the manufacturers\u2019 instructions.Since sample size in our study was < 30, a non-parametric Mann Whitney U test was performed to determine the differences in accuracy of PIVKA-II, CA 19-9, CEA and CA 242 for PC versus benign pancreatic diseases  and indirectly through post-translational activation of proteins including PIVKA-II, which have thus been proposed as tumour markers for diverse types of malignancies (In the last years, many studies have provided evidences on the role of PIVKA-II as a biomarker for gastrointestinal malignancies: particularly, it has been well demonstrated in literature that PIVKA-II is biomarker of crucial importance in HCC since its serum values are linked to the cancer volume, potential of microvascular metastasization and can predict tumour recurrence (CA 19-9 is currently the most important biomarker for PC but its serum concentrations are more useful for monitoring responses to therapy rather than in early diagnosis (CA 242 on contrary had a good diagnostic performance in our population, according to its AUC. CA 242 is a serological marker increased in PC patients, its serum values have been found to have a correlation with cancer size and differentiation, lymph node and liver metastasis status and clinical staging (Carcinoembryonic antigen is the second most commonly used biomarker for PC detection despite its pathological values are found only in 30-60% of PC patients, data confirmed also in our population (Because of the insufficient individual sensitivity or specificity of already established PC biomarkers, our study is part of the constant ongoing effort to identify additional serological biomarkers for the timely detection of PC. Recent studies have been focusing on the discovery of new biomarkers that would facilitate PC identification but to our knowledge, this pilot study is the first to explore the role of PIVKA-II as a biomarker for PC. However, our results are in line with a reported case of a PIVKA-II producing PC ("}
+{"text": "Natural killer (NK) cells are an emerging new tool for cancer immunotherapy. To develop NK cell therapeutics from peripheral blood mononuclear cells (PBMCs) of healthy donors, substantial expansion of primary NK cells is necessary because of the very low number of these cells in peripheral blood. In this study, we aimed to investigate the effect of various cytokine alone or combinations, in expanded NK cells and to analyze the synergetic effect of cytokine combinations.Human NK cells were isolated from healthy donor PBMC. Purified NK cells were stimulated with single cytokines or combinations of IL-2, IL-15, IL-18, and IL-27. The expanded NK cells were characterized by flow cytometry, cytotoxicity assay, calcein AM assay and Western blot.We investigated the synergistic effects of each cytokine, namely, IL-2, IL-15, IL-18, and IL-27, on human NK cells isolated from PBMCs of healthy donors and cultured for 21\u2009days. We identified that IL-15/IL-18/IL-27-mediated activation of NK cells most potently increased NK cell proliferation, cytotoxicity, and IFN-\u0263 secretion compared with the activation observed with other treatments, including IL-2, IL-15, and IL-15/IL-18. Additionally, the expression of DNAM-1, NKG2D, CD69, and natural cytotoxicity receptors  increased on day 21 compared to that on day 0, demonstrating the activation of NK cells. In vitro, expanded NK cells were highly cytotoxic against cancer cells, displaying increased perforin and granzyme B accumulation.Taken together, these results indicated that IL-27 can synergize on NK cell expansion and activation with IL-15 and IL-18. In addition, we described an improved culture method for ex vivo expansion of human NK cells with IL-15/IL-18/IL-27 stimulation and characterized the response of NK cells to this stimulation.The online version of this article (10.1186/s40425-019-0652-7) contains supplementary material, which is available to authorized users. They 6+ cells  and modu6+ cells . NK cell6+ cells . In cont6+ cells . Therefodim and CD56bright [dimCD16bright  and is commonly described as the most cytotoxic subset, whereas CD56brightCD16dim/\u2212 NK cells  are abundant cytokine producers [Human NK cells may be divided into two subsets, CD5656bright . In periroducers , 12. HowIn general, NK cells are well known for their ability to be maintained alive in long-term culture as well as for their ability to be activated when treated with different types of cytokines , 14. TheIn this study, we investigated the ability of each cytokine and their combination on expansion and activation of primary NK cells. We presented data showing that IL-15, IL-18, and IL-27 potently enhance NK cell cytotoxicity and increase the absolute number of CD3-CD56+ NK cells in long-term culture (21\u2009days). Our results suggest that synergistic interactions between IL-15, IL-18, and IL-27 play a crucial role in CD3-CD56+ NK cell functions by improving NK cell cytotoxicity activity, which increases perforin granule accumulation and IFN-\u03b3 production. We further characterized the phenotypic and functional consequences of CD3-CD56+ NK cells being stimulated with IL-15, IL-18, and IL-27.n\u00a0=\u200926; female n\u00a0=\u200912, male n\u00a0=\u200914). This research protocol was reviewed and approved by the institutional review board of CHA Bundang Medical Center, CHA University (permit number: CHAMC 2017\u201301\u2013001). PBMCs were isolated from whole blood by a density gradient with Ficoll-Paque Plus  followed by purification using an NK cell isolation kit . Cells were activated in CellGenix\u00ae GMP Stem Cell Growth Medium  supplemented with 10% human serum  and the cytokines IL-2 (10 or 100\u2009ng/ml), IL-15 (10\u2009ng/ml), IL-27 (10\u2009ng/ml)  and IL-18 (10\u2009ng/ml)  under standard culture conditions  for 21\u2009days (long-term culture). Fresh culture medium containing cytokines and 10% human serum was added to the flask every 2 to 3\u2009days for 21\u2009days. The initial seeding density of NK cells was a median of 1\u2009\u00d7\u2009106 (range: 0.8\u20131.3\u2009\u00d7\u2009106) NK cells in 6-well plates . After 7\u2009days, the cells were transferred into T25 flasks, T75 flasks, and T175 flasks  with additional media containing cytokines for 21\u2009days.Primary NK cells were purified (>\u200995% pure) from peripheral blood mononuclear cells (PBMCs) of healthy human volunteers . Cells were stained with May-Gr\u00fcwald-Giemsa solutions. Images were analyzed using an ICC50 HD Camera System from Leica (Leica Microsystems).2 incubator. NK-92, the human NK cell line, was purchased from the ATCC and cultured in Alpha MEM devoid of ribonucleosides and or deoxyribonucleosides, 12.5% FBS, 10,000\u2009U/mL Pen/Strep , 2\u2009mM\u2009L-glutamine , 0.2\u2009mM inositol , 0.02\u2009mM folic acid , 0.1\u2009mM 2-mercaptoethanol , and 100\u2013200\u2009U/ml recombinant IL-2 .The human tumor cell line K562  and A2780 (human ovarian cancer cell line) were obtained from the ATCC. Cells were cultured in RPMI 1640 medium  supplemented with 10% heat-inactivated FBS, 200\u2009mM\u2009L-glutamine and 10,000\u2009U/mL Pen/Strep  at 37\u2009\u00b0C in a 5% CODay 21-expanded NK cells as well as freshly isolated PBMCs and NK-92 cells, were analyzed for phenotypic markers by flow cytometry. Cells were stained in Fluorescence-activated cell sorting (FACS) buffer on ice for 30\u2009min with mixed antibodies. The following fluorescently labeled antibodies were purchased from BD Pharmingen\u2122: anti-human CD3 (HIT3a), CD56 (B159), CD16 (3G8), CD314 , CD335 , CD336 , CD337 , CD96 (6F9), CD226 , CD19 (HIB19), CD14 (M5E2), KIR2DL1/CD158a (HP-3EA), KIR2DL2/3/CD158b (CH-L), and KIR3DL1/CD158e1 (DX9). The antibodies for human NKG2A/CD159a (#131411), KIR2DL4/CD159d (#181703), KIR3DL2/CD159k (#539304), and KIR3DL3/CD158z (#1136B) were purchased from R&D systems. The antibodies for human CD69 (CH/4) were purchased from Invitrogen, and antibodies for human KIR2DL5A/CD158f (UP-R1) were purchased from Origene. After washing with FACS buffer, cells were analyzed on a FACS Calibur machine (BD Biosciences). Data analysis was carried out using the FlowJo software program .t-test.At each time point , 500\u2009\u03bcl of cell supernatants were collected and frozen at \u2212\u200980\u2009\u00b0C. Cytokine analysis was performed according to the manufacturer\u2019s instructions using a Human IFN-\u0263 Quantikine ELISA Kit . Absorbance was read at 450/540\u2009nm using a SpectraMax L Microplate Reader . Concentration was calculated using the standard provided with the kits. Means and standard deviations of concentrations in triplicate samples were compared by 2. K562 tumor targets  and primary NK cells  stimulated with IL-15/IL-18/IL-27 for 21\u2009days were seeded together in a cell culture slide  at different E:T ratios  in duplicate. Cells were cocultured at 37\u2009\u00b0C for 4\u2009h. After 4\u2009h, live imaging of NK cell cytotoxicity on tumor targets was performed using a Zeiss LSM 510 microscope . The cytotoxicity % was calculated by the equation: cytotoxicity %\u2009=\u2009(dead target cell count / dead + live target cell count) \u00d7\u2009100.Calcein  is a fluorescent dye that can be used to determine cell viability in eukaryotic cells . K562 target cells were used to demonstrate the NK cell-mediated cytotoxicity detection method using calcein AM. Target cells were stained by incubating them in 5\u2009\u03bcM calcein AM staining media (1\u2009mg/ ml stock) in complete RPMI media for 30\u2009min at 37\u2009\u00b0C in 5% CO4 cells/ml) was added to a slide funnel and fixed in a cold methanol-acetone solution for 5\u2009min. The slides were washed three times with PBS and then blocked with blocking solution  for 1\u2009h. The cells were then washed with PBS and permeabilized in 0.1% Triton\u00ae X-100 (in PBS) for 20\u2009min. Protein was detected using anti-perforin  and anti-granzyme B  antibodies for 24\u2009h at 4\u2009\u00b0C, followed by several washes in PBS. Incubation was repeated with an appropriate fluorescein isothiocyanate and Texas Red-conjugated secondary antibody , and cell nuclei were stained with 4,6-diamidino-2-phenylindole. Coverslips were mounted onto slides with Vectashield Mounting Medium  and examined using a Zeiss LSM 510 confocal microscope .Cells were washed with cold PBS, and 200\u2009\u03bcl of the cell suspension . Before\u00a0isolation of total protein, NK cells were gently removed\u00a0 by washing\u00a0with 1\u00a0X cold PBS.\u00a0 For Western blotting, anti-caspase-3, anti-caspase-8, and anti-caspase-9 antibodies from Cell Signaling; anti-perforin (CB5.4) and anti-granzyme B antibodies from Abcam; and anti-\u03b2 actin antibodies from Santa Cruz Biotechnology were used. Secondary antibodies and ECL reagents were obtained from GE Healthcare. Signals were visualized by a G: BOX-CHEMI-XT4 Gel Documentation System.4 cells per well in 96-well plates . Then, 1.0\u2009\u00d7\u2009106 expanded NK cells and NK-92 cells were resuspended in SCGM complete medium, and four serial dilutions (2-fold) were performed. Aliquots from each NK cell serial dilution containing 5.0\u2009\u00d7\u2009105, 2.5\u2009\u00d7\u2009105, 12.5\u2009\u00d7\u2009105 and 6.25\u2009\u00d7\u2009104 cells were added per well in a 96-well plate in duplicate. After 4\u2009h of incubation, 50\u2009\u03bcl of CytoTox Glo\u2122 Cytotoxicity Assay reagent was added to all wells. This assay used a luminogenic peptide substrate to detect dead cells by selectively measuring \u2018dead-cell protease activity.\u2019 The luminescent signal that reflects cytotoxicity was measured using a SpectraMax L Microplate Reader . Cytotoxicity was calculated by dividing the luminescent dead-cell signal by the total cell luminescence value.The cytotoxicity of NK cells was determined using a CytoTox Glo\u2122 Cytotoxicity Assay  according to the manufacturer\u2019s instructions. Briefly, K562 cells were seeded at a density of 5.0\u2009\u00d7\u200910P values of less than 0.05 were considered statistically significant. The results are expressed as the mean\u2009\u00b1\u2009SD and were obtained from two or three independent experiments.A two-tailed paired t-test was performed to analyze data using GraphPad Prism 5.0 software  as indicated in the figure legends. Statistical analysis was performed using a t-test adjusted with Benjamini and Hochberg procedure, and the ANOVA test adjusted with Bonferroni posttests. n\u00a0=\u200912, mean\u2009\u00b1\u2009SD); the range was 20\u201340\u2009years. Fourteen donors were males with a mean age of 35.07\u2009\u00b1\u20095.313\u2009years ; the range was 20\u201349\u2009years . Twenty-six healthy adult donors enrolled in the study. Twelve donors were females with a mean age of 33.25\u2009\u00b1\u20095.429\u2009years , including 9.34% (range: 5.374\u201313.931%) CD3-CD56dim NK cells , including 12.62% (range: 6.786\u201323.137%) CD3-CD56dim NK cells. Our data show that the NK cell populations did not significantly differ between the age groups of males and females. After purification of NK cells, we obtained 93.68\u2009\u00b1\u20094.30% CD3-CD56dim NK cells. On day 21, NK cells stimulated with single cytokines or a combination were composed of highly enriched CD3\u2009\u2212\u2009CD56dim (96.34\u2009\u00b1\u20092.41%) or CD56dim CD16+ (93.10\u2009\u00b1\u20093.38%) NK cells\u00a0.To improve the ex vivo proliferation of human NK cells, we optimized the culture medium using different types of cytokines, such as IL-2, IL-15, IL-18, IL-27, and cytokine combinations. To test this approach, we purified CD3-CD56Purified NK cells were cultured with IL-2, IL-15 or cytokine combinations, such as IL-15/IL-18, IL-15/IL-27, IL-18/IL-27, and IL-15/IL-18/IL-27, for 7\u2009days for short-term, 14\u2009days for mid-term, and 21\u2009days for long-term cultures  or IL-18/IL-27. After 7\u2009days of culture, the proliferation of NK cells was markedly decreased with IL-18 or IL-27 only treatment. The total cell number at day 14 was ~\u200950% of that on day 0. In particular, the growth stopped in two samples with IL-18-only or IL-27-only cultures on day 14, and the cell number subsequently decreased. Additionally, NK cell clusters gradually decreased after 7\u2009days. We obtained similar results with a combination of IL-18 and IL-27. In NK cells, IL-18 or IL-27 has usually been described as a costimulatory cytokine that functions synergistically with IL-15 .6 (range: 23.6\u201341.9\u2009\u00d7\u2009106) viable NK cells  family, such as NKp44, NKp30, NKp46, DNAM-1, and CD69  and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expression. The expression levels of PD-1 and CTLA-4 did not significantly change after 21\u2009days of culture, similar to NKG2A  , which were more abundant than those of resting NK cells (upper panel). Using Western blots, we then compared the expression levels of these proteins in NK cells incubated with IL-2hi, IL-2low, IL-15, IL-15/IL-18, IL-15/27 or IL-15/IL-18/IL-27  and fluorescence images (upper panel) at each E: T ratio for the target cells. The number of brightly fluorescent live target cells gradually decreased with increasing number of expanded NK cells (E: T ratio), while all of the control target cells  were brightly fluorescent. At an E: T ratio of 5:1, nearly total lysis of K562 cells was observed. To derive live cell counts, the fluorescence intensity of the target cells was assessed at different E: T ratios so that target cells with lower fluorescence signals, such as those lacking calcein release and apoptotic bodies, were excluded from the live (bright) cell counts . Table S2. Percentage of NK cells receptor positive cells in CD3-CD56+ primary NK cells from healthy donors (n = 9). Table S3. Percentage of NK cells receptor positive cells in CD3-CD56+ NK cells from healthy donors (n = 3). (DOCX 37 kb)Additional file 2:Figure S1. Gating strategy for flow cytometry. Figure S2. Gating strategy to identify NK subsets. Figure S3. NK cytotoxicity against ovarian cancer cells. Figure S4. Detection of NK cell surface receptor expression in NK cell lines, NK-92, and NK-92MI. Figure S5. Western blotting analysis for perforin and granzyme B. Figure S6. Overview of human cytokine-mediated NK cell responses. (DOCX 1791 kb)"}
+{"text": "Transduction with BaEV-LVs encoding for CAR-CD22 resulted in robust CAR-expression on 38.3 \u00b1 23.8% (mean \u00b1 SD) of NKAES cells, leading to specific killing of NK-resistant pre-B-ALL-RS4;11 cell line. Using a larger vector encoding a dual CD19/CD22-CAR, we were able to transduce and re-expand dual-CAR-expressing NKAES, even with lower viral titer. These dual-CAR-NK efficiently killed both CD19KO- and CD22KO-RS4;11 cells. Our results suggest that BaEV-LVs may efficiently enable NK-cell biological studies and translation of NK-cell-based immunotherapy to the clinic.NK-cell resistance to transduction is a major technical hurdle for developing NK-cell immunotherapy. By using Baboon envelope pseudotyped lentiviral vectors (BaEV-LVs) encoding eGFP, we obtained a transduction rate of 23.0 \u00b1 6.6% (mean \u00b1 SD) in freshly-isolated human NK-cells (FI-NK) and 83.4 \u00b1 10.1% (mean \u00b1 SD) in NK-cells obtained from the NK-cell Activation and Expansion System (NKAES), with a sustained transgene expression for at least 21 days. BaEV-LVs outperformed Vesicular Stomatitis Virus type-G (VSV-G)-, RD114- and Measles Virus (MV)- pseudotyped LVs ( The relative resistance of NK cells to transduction hampers the study of NK-cell biology and the development of NK cell-based immunotherapy. VSV-G-LVs, classically used to generate chimeric antigen receptor (CAR)-T cells , do not KO were generated using purified Cas9 protein and two gRNA targeting CD19 or CD22 (Integrated DNA Technologies). CD19KO and/or CD22KO cells were FACS-sorted based on loss of surface marker expression. Cells were cultured in DMEM (Wisent) or RPMI1640 supplemented with 10% FCS and penicillin/streptomycin (Gibco). Media were supplemented with 100 UI/mL IL-2  for NK-cell cultures.Blood samples were obtained from healthy volunteers after informed consent (IRB-approved protocol #CER-3527). NK-cells were enriched from PBMC using a CD56-positive selection kit . NK cells were expanded using the Amplification and Expansion System (NKAES) with irradiated K562mbIL21 or K562mbIL15 feeder cells as described , 9. AlteFigure 3A). The pMD2.G (VSV-G) was a gift from Didier Trono  and pLTR-RD114A . The Measles virus (MV-LV) and BaEVRLess envelope plasmids were used as previously described (An UCOE sequence  was addeR-RD114A  (RD114) NKAES were transduced after 1 week of expansion. One day before transduction, a 12-well plate was coated with RetroNectin (Takara). The following day, concentrated vectors at indicated multiplicity of infection (MOI), were added to coated plates for 4 h at 37\u00b0C. Then NK cells were seeded in these wells in IL-2-supplemented medium and protamine sulfate  (8 ug/mL). The plates were then centrifuged at 1,000 g for 1 h and incubated at 37\u00b0C overnight. The next day, IL-2-supplemented medium was added to each well. Transduction was assessed on day 3 or day 5 after transduction for NKAES and freshly isolated NK-cells (FI-NK), respectively.\u2212 CD56(-APC)+ CD3(-PE)\u2212 cells (Biolegend). For NK-cell receptor detection, samples were stained with DAPI, CD56-BV711, CD16-BV786, NKp30-AF647, NKp44-PE, NKp46-BV421 (Biolegend), NKG2D-APC (BD Biosciences), and NKG2A-PE (Miltenyi Biotec). CD3-BV650 and CD19-APC-Cy7 (Biolegend) markers were used as a gating exclusion strategy for the NK cell staining. Receptor expression was assessed on DAPI\u2212 CD56(-BV711)+ CD3(-BV650)\u2212 cells. To detect CAR-expression, cells were incubated with 2 \u03bcl Siglec2(CD22)-Fc chimera  for 30 min at 4\u00b0C, washed and stained with anti-Fc-PE (Jackson Immune).All samples were stained with anti-CD56-APC, anti-CD3-FITC (Biolegend) and 7AAD (BD Biosciences). Transgene expression was detected by flow cytometry on 7AADCytotoxicity was assessed 24 h after cell contact by flow cytometry. Targets cells were loaded with PKH26 dye (Sigma-Aldrich) according to the manufacturer's directives and seeded in 96 well round bottom plates. Effector cells were then added at different effector:target ratios and medium alone was added to control wells. Before acquisition, 7AAD was added to each well to discriminate dead cells. The cytotoxicity was calculated as: Cytotoxicity (%) = [1-live targets (sample)/live targets (control)] \u00d7 100%.GSE128696, #GSE129044). For the FI-NK vs. IL-21-NKAES/IL-15-NKAES comparisons, extraction of total RNA was done using the RNeasy mini kit (Qiagen) and Total RNA Purification Plus Kit (Norgen Biotek), respectively. The quality of RNA was verified with 2100 Bioanalyzer (Agilent) prior to preparation of sequencing libraries with the TruSeq RNA Sample Prep v2 Kit. Quality of libraries was verified via Agilent 4200 Tapestation using a High Sensitivity D1000 ScreenTape Assay kit. For the IL-15 NKAES analysis, approximately 60\u201380 million paired-end 150 bp sequence reads per library were generated, whereas for the IL-21 NKAES analysis, 30 million single-end 101 bp sequence reads per library were generated, both using Illumina HiSeq4000 platform. Kallisto, an RNA quantification program based on pseudoalignment was used to obtain read count estimates per gene . Statistical significance was determined by one-way or 2-way ANOVA with multiple testing and Bonferoni correction or using simple multiple Blood samples were obtained from healthy volunteers after informed and written consent. The study was approved by the institutional ethical board of the CHU Sainte-Justine (approved protocol #CER-3527).p < 0.0001, and 23.0% vs. 10.4%, 2.1 and 7.8% for FI-NK, p < 0.0001, respectively). The mean fluorescence intensity (MFI) of GFP after transduction in NK cells was similar for BAEV, VSV-G and RD114 and significantly lower for MV-LV in NKAES (p = 0.06). Transduced FI-NK could be easily amplified after transduction (not shown). High transduction rates were also observed after NK-cell expansion on K562-mbIL15-41BBL feeder cells (We first transduced NK cells expanded using the Amplification and Expansion System (NKAES) and freshly isolated NK-cells (FI-NK) with an eGFP-encoding LV and observed that in both cases, BaEV-LVs outperformed VSV-G-, MV-, and RD114- LVs  or non-transduced (GFP-) . There wp < 0.05). Although the percentage of dead cells in culture was low for all conditions . Together these results suggest that BaEV-LV transduction did not affect viability nor NK-cell proliferation.The number of recovered living cells in both NKAES and FI-NK was preserved after transduction with BaEV-LVs  althoughnditions , it was We then assessed whether NK-cell cytotoxic function was preserved after BaEV-LV transduction and confirmed that the cytotoxicity of eGFP-transduced NKAES cells against K562 cells was equivalent to non-transduced NKAES .RNAseq analyses of both FI-NK and NKAES showed that ASCT1 and ASCT2 mRNAs were detected at significantly higher frequency in both IL-15- and IL-21-NKAES than in FI-NK , which m8 CAR-expressing cells from 5 \u00d7 105 transduced cells after an expansion of 14 days (not shown). Since transgene size affects transduction efficacy .The datasets generated for this study have been deposited in GEO database of NCBI . The participants  provided their written informed consent to participate in this study.AC, WL, PB, SN, HR, SS, MG, and CT-L performed the experiments. AC, WL, PB, and KB wrote the manuscript. NC and DL generated the RNAseq data on IL-21 expanded NKAES cells and participated in the redaction of the manuscript. JS and LB generated the RNAseq data on IL-15 expanded NKAES cells and participated in the redaction of the manuscript. RD recruited participants and collected samples. EH generated the hypotheses, conceptualized the study, and wrote the manuscript. EV provided BaEVTRless encoding plasmid, discussed results, and wrote the manuscript. All authors reviewed and approved the manuscript.EV has a patent EP2761010 licensed to Lentigen/Miltenyi Inc. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Caldicellulosiruptor bescii and expressed in Escherichia coli. The purified recombinant CbGI (rCbGI) showed neutral and thermophilic properties. It had optimal activities at pH\u20097.0 and 80\u00b0C and retained stability at 85\u00b0C. In comparison with other reported GIs, rCbGI exhibited higher substrate affinity (Km = 42.61\u2009mM) and greater conversion efficiency (up to 57.3% with 3M D-glucose as the substrate). The high catalytic efficiency and affinity of this CbGI is much valuable for the cost-effective production of HFCS.Glucose isomerase (GI) that catalyzes the conversion of D-glucose to D-fructose is one of the most important industrial enzymes for the production of high-fructose corn syrup (HFCS). In this study, a novel GI (CbGI) was cloned from  Glucose isomerase (GI), also known as xylose isomerase, catalyzes the reversible isomerization of D-xylose and D-glucose to D-xylulose and D-fructose, respectively. In the food industry, GI is widely used in the industrial production of high-fructose corn syrup (HFCS) , which iThermobifida fusca WSH03-11 produced in Escherichia coli had the maximum conversion rate of 45% (w/v) at pH\u20097.5 and 70\u00b0C [Thermus oshimai (ToGI) has an optimum temperature of 95\u00b0C and at a maximum conversion rate of 52.16% at 85\u00b0C [It has been reported that a thermodynamic equilibrium exists between the isomerization reactions of glucose and fructose. Along with the increase of reaction temperature, the conversion rate of glucose to fructose also gradually increases. Thus, thermostable GI is more favorable for the one-step production of HFCS-55. If this thermostable GI can convert high concentrations of glucose to fructose at a higher rate, it would be remarkable for industrial purposes . So far,and 70\u00b0C , while tCaldicoprobacter has been reported with good properties for HFCS-55 production [Caldicoprobacter bescii DSM 6725. The gene was cloned and expressed in E. coli BL21 (DE3). The enzyme showed the highest conversion rate of 57.3% with 3M D-glucose. Thus, it has great application potentials in the industrial production of HFCS-55.The thermostable GI from the genus of oduction . In ordeC. bescii DSM 6725 was purchased from the Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH  and grown in DSMZ 516 medium. The Fast Pfu DNA polymerase and E. coli strains BL21 (DE3) and Trans1 were obtained from TransGen . The E. coli cells were cultivated in Luria-Bertani medium  supplemented with 100\u2009\u03bcg/mL kanamycin. The plasmids pEASY-T3 and pET-30a were used for cloning, sequencing, and expression, respectively. The substrate D-glucose from Sigma-Aldrich was used for the enzyme activity assay. Fructose and other chemicals were of analytical grade and commercially available.The strain C. bescii DSM 6725 genome sequence is now available (https://www.ncbi.nlm.nih.gov/genome/1747?genome_assembly_id=300706) and is known to encode for several functionally uncharacterized genes. An open reading frame (ORF), consisting of 1317\u2009bp, coding for a putative xylose isomerase (GenBank accession number: ACM59729), was not characterized. Its nucleotide and amino acid sequences were analyzed by using the blastn, blastx, and blastp programs (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The protein molecular weight and isoelectric point (pI) were performed using the Vector NTI Advance 11.5 software (Invitrogen). The genomic DNA of C. bescii DSM 6725 was extracted by using a TIANamp Genomic DNA Kit . Overlap PCR was used to construct the expression plasmid pET-CbGI. With the genomic DNA and expression vector pET-30a (+) as the templates, the CbGI-encoding gene and linear pET-30a were amplified by PCR with the specific primers containing overlapping fragments and C-terminal His6-encoding sequence presented in E. coli Trans1 competent cells for sequencing. Transformants were selected on LB plates containing 100\u2009\u03bcg/mL ampicillin. The purpose gene CbGI ligated to pET-30a (+) expression vector with encoding C-terminal six-His sequence by overlapping methods.The E. coli BL21 cells harboring recombinant expression plasmid pET-CbGI were grown at 37\u00b0C in 300\u2009mL LB medium containing 100\u2009\u03bcg/mL kanamycin to an OD600 of 0.5-0.6. The CbGI expression was then induced by 1\u2009mM of isopropyl-\u03b2-D-1-thiogalactopyranoside (IPTG) at 30\u00b0C for 5\u2009h. The E. coli cells were harvested by centrifugation  and suspended in 10\u2009mL of buffer . After cell disruption by sonication, the crude enzyme was collected by centrifugation  and mixed with histidine protein purification beads  at 4\u00b0C for 2\u2009h. A gradient of imidazole solution (40-300\u2009mM) was applied to elute the recombinant protein. The eluates showing GI activities were pooled, dialyzed to remove the imidazole, and stored at 4\u00b0C. The protein concentration was determined by using the BCA protein assay kit (TransGen), with bovine serum albumin as the standard.For CbGI production, the 2+, 50\u2009mM of D-glucose, and 0.05\u2009mL of properly diluted purified CbGI in 50\u2009mM of McIlvaine buffer (pH\u20097.0). The reactions were conducted at 80\u00b0C for 30\u2009min and stopped by cooling in ice water. The amount of D-fructose produced was then determined by measuring the absorbance at 560\u2009nm following the cysteine-carbazole-sulphuric acid method [\u03bcmol of D-fructose per min under the assay conditions.The GI activity was determined by measuring the amount of D-fructose. Unless otherwise stated, the standard reaction systems (1\u2009mL) contained 0.5\u2009mM of Co2HP04-NaH2PO4 buffer (pH\u20097.0) at temperatures ranging from 60\u00b0C to 95\u00b0C for 30\u2009min. To estimate the pH stability, the enzyme was preincubated at 37\u00b0C for 1\u2009h in buffers described above (pH\u20092.0\u201312.0), and the residual enzyme activities were then measured at standard conditions (80\u00b0C and pH\u20097.0 for 30\u2009min). The thermal stability of CbGI was determined by measuring the residual enzyme activities under standard conditions after preincubation at various temperatures for 15\u2009min, 30\u2009min, and 60\u2009min, respectively. All experiments were in triplicate.The optimal pH for CbGI activity was determined in 50\u2009Mm McIlvaine buffer (pH\u20093.0 to 8.0), Tris-HCl (pH\u20097.0 to 9.0), and glycine-NaOH (pH\u20099.0 to 12.0) at 80\u00b0C in for 30\u2009min. The optimal temperature for CbGI activity was determined by performing the activity assays in NaKm, Vmax, kcat, and kcat/Km) of CbGI, the reaction systems (1\u2009mL) performed using glucose at various concentrations from 10, 20, 40, 60, 80, and 100\u2009mM at pH\u20097.0 and 80\u00b0C for 30\u2009min. The reactions were terminated by cooling in ice water, and the amounts of D-fructose produced were measured by the HPLC chromatographic method using the column HPX-87C (250 \u00d7 4\u2009mm) . The mobile phase, temperature and the flow rate were water, 50\u00b0C and 0.5\u2009ml\u2009min\u22121, respectively. The experiment was carried out three times and each included triplicate. The kinetic parameters Km and Vmax were calculated from the Lineweaver-Burk plots.To determine the kinetic parameters  at a final concentration of 10\u2009mM.The effects of metal ions and chemical reagents on the CbGI activity were determined by measuring the enzyme activities under standard conditions in the presence of various metal ions and chemicals  containing 1\u2009M D-glucose, 50\u2009mM phosphates buffer (pH\u20097.0), 0.5\u2009mM CoFor potential industrial applications, the temperature effect on the conversion efficiency of CbGI was determined by measuring the fructose yields as described above after incubations at 70\u00b0C and 80\u00b0C for various durations with 2\u2009M D-glucose as the substrate. The conversion rate of CbGI was estimated by increasing the concentrations of D-glucose from 0.1\u2009M to 3\u2009M at 80\u00b0C. The amounts of D-fructose produced were determined the HPLC chromatographic method as described above. The measurements were carried out in three independent experiments, and each experiment included triplicate.Caldicellulosiruptor . It exhibited the highest identity of 84% with the GI derived from Thermoanaerobacter ethanolicus CCSD1 (accession number: AKM94132.1), which has been characterized [Thermoanaerobacterium thermosulfurigenes (1A0C_A) in the PDB database.The ORF of CbGI contained 1317\u2009bp, which coded for a polypeptide of 438 amino acid residues. The comparison of the CbGI amino acid sequence with other sequence proteins using Blast P showed a similarity of about >95% with many putative xylose isomerases from the genus of E. coli, the CbGI was successfully ligated into the pET-30a (+) vector by overlapping PCR. After IPTG induction and cell disruption, significant GI activity was detected in the crude enzyme. Following a single step of Ni2+ chelate affinity chromatography, the recombinant CbGI was purified to be on electrophoretic homogeneity presented in For expression in T. saccharolyticum [Actinoplanes missouriensis CICIM B0118(A) [Streptomyces griseus [Caldicoprobacter algeriensis was 90\u00b0C [Thermobifida fusca WSH03-11 is expressed in E. coli with an optimum temperature of 80\u00b0C [T. thermosulfurigenes (65\u00b0C) [T. ethanolicus CCSD1 (TEGI), which had an optimum temperature of 90\u00b0C [T. neapolitana 5068 GI with optimum temperature of between 95 and 100\u00b0C [Thermus oshimai is as high as 95\u00b0C [The optimum pH for CbGI activity was determined to be pH\u20097.0 presented in olyticum , ActinopB0118(A) , and Str griseus . Howeverwas 90\u00b0C , GI from of 80\u00b0C . The opts 65\u00b0C) . In rece of 90\u00b0C , and T. nd 100\u00b0C . Also, b as 95\u00b0C , 16. Alt5\u00b0C . In  as 95\u00b0C . The stuKm, Vmax, and kcat/Km values of CbGI were determined to be 42.61\u2009mM, 8.22\u2009U/mg, and 9.69/s/mM, respectively. In comparison to other reported counterparts, CbGI had a lower Km and a higher kcat/Km value. It indicated that CbGI has superior substrate affinity and higher catalytic efficiency.The kinetic parameters were calculated using the Lineweaver-Burk plots. The 2+, Mg2+, or Mn2+ can activate the enzymatic activity of GIs [2+ was added at the final concentration of 0.5\u2009mM. Although Mg2+ and Co2+ are essential for GI activity, they play different roles: Mg2+ is superior to Co2+ as an activator, while Co2+ plays a role in stabilizing the enzyme [S. olivaceoviridis E-86 significantly increased enzyme activity when Mg2+ was added [T. strain B6A requires Mg2+ and Co2+ [S. sp. SK GI mutant G219D is converted from Co2+ dependent to Mn2+ dependent [2+ presented in + and \u03b2-mercaptoethanol had no effect on the enzyme activity (less than 10%). Other metal ions and chemicals including Cr3+, Ni2+, Mn2+, Ca2+, SDS, and EDTA strongly inhibited the CbGI activity by 50% and more.It has been reported that divalent cations like Coy of GIs . For CbGe enzyme . Such GIas added . The gluand Co2+ , and S. ependent . Therefo2+. Since no difference was detected in the conversion rates (data not shown), 60\u2009U of CbGI was used for the following conversion efficiency assays.To assess the conversion efficiency of CbGI, 30\u2009U, 60\u2009U, or 90\u2009U of CbGI was added into the 3\u2009mL reaction systems containing 1\u2009M of D-glucose and 5\u2009mM CoC. algeriensis at 85\u00b0C for 3\u2009h [T. naphthophila RKU-10 [To investigate the conversion efficiency of CbGI at different temperatures, the reactions were conducted at pH\u20097.0 and 70\u00b0C or 80\u00b0C, respectively, with 2\u2009M of glucose as the substrate. The results showed that the conversion rates of CbGI at 70\u00b0C and 80\u00b0C were similar presented in  for 3\u2009h , which 5a RKU-10 .w/v = 54%) presented in T. oshimai strain had a conversion of 52.16% < 55% at a substrate concentration of 400\u2009g/L [Thermobifida fusca WSH03-11 has a maximum conversion of 53% at a 45% (mass-to-volume) glucose concentration [Streptomyces sp. has a conversion rate of 55% at a low glucose concentration (mass-to-volume ratio of 30%) [T. ethanolicus have a conversion rate of 53.8% and 55.4% at 10% glucose concentration, respectively [Thermus oshimai increased first and then decreased [The time course of D-glucose conversion into D-fructose by CbGI was determined at 80\u00b0C and pH\u20097.0 with 0.1-3\u2009M D-glucose as the substrate. The results showed that the conversion rate of CbGI increased along with the increased concentration of D-glucose. The maximum conversion rate, 57.3%, was observed at 4\u2009h when 3\u2009M D-glucose was used as the substrate ( of 30%) . The wilecreased . This inC. bescii was characterized. The CbGI was neutral and thermophilic, with excellent thermal and pH stability. Moreover, the enzyme had high-glucose conversion rate of 57.3% with 3\u2009M glucose as the substrate. CbGI is favorable for industrial one-step production of HFCS-55 at a cost-effective way.In this study, the gene cloning and expression of a novel GI from"}
+{"text": "Arabidopsis thaliana by overexpressing high affinity copper transporters COPT1 and COPT3 (OECOPT). A genome-wide analysis conducted on OECOPT1 plants, highlighted that iron homeostasis gene expression was affected under both copper deficiency and excess. Among the altered genes were those encoding the iron uptake machinery and their transcriptional regulators. Subsequently, OECOPT seedlings contained less iron and were more sensitive than controls to iron deficiency. The deregulation of copper (I) uptake hindered the transcriptional activation of the subgroup Ib of basic helix-loop-helix (bHLH-Ib) factors under copper deficiency. Oppositely, copper excess inhibited the expression of the master regulator FIT but activated bHLH-Ib expression in OECOPT plants, in both cases leading to the lack of an adequate iron uptake response. As copper increased in the media, iron (III) was accumulated in roots, and the ratio iron (III)/iron (II) was increased in OECOPT plants. Thus, iron (III) overloading in OECOPT roots inhibited local iron deficiency responses, aimed to metal uptake from soil, leading to a general lower iron content in the OECOPT seedlings. These results emphasized the importance of appropriate spatiotemporal copper uptake for iron homeostasis under non-optimal copper supply. The understanding of the role of copper uptake in iron metabolism could be applied for increasing crops resistance to iron deficiency.The present work describes the effects on iron homeostasis when copper transport was deregulated in  Changes in the bioavailability of both metals throughout the evolution of the atmosphere led to a decrease and increase in the Fe and Cu bioavailability, respectively, allowing their substitution as cofactors in different proteins to perform similar functions  superoxide dismutase (SOD) is replaced by its Fe counterpart when Cu is scarce (Copper (Cu) and iron (Fe) are transition metals with redox properties that form coordination complexes with organic molecules, acting as essential cofactors in numerous proteins, including components of the respiratory and photosynthetic electron transport chains . Howeverunctions . For inss scarce . Metallos scarce .Arabidopsis uses strategy I that is based on the reduction of Fe3+ to Fe2+ by the reductase FRO2 present in the root plasma membrane , which regulates this balance through ROS control , a group of conserved plant peptides induced under Fe deficiency in vascular tissues . Moreove control . Among tand FER3 . ILR3 anand FER3 . BTS is and FER3 . BTS andand FER3 .2+ in the soil, although under metal deficiency it is introduced in the root cells as Cu+ by high affinity Ctr transporters, denoted COPT (COPPER TRANSPORTERS) in plants  lead to increased Cu uptake, oxidative stress, and phenotypes related to altered circadian rhythms  and of the transgenic lines OECOPT1 and OECOPT3 were surface-sterilized and stratified for 2 days at 4\u00b0C and were germinated in \u00bd MS medium (Sigma) plates including 1% sucrose (4 (\u00bd MS + 10 Cu) for the microarray analysis. Seedlings were grown as previously described (\u22122 of cool-white fluorescent light) at 23\u00b0C/16\u00b0C temperature cycle.Seeds of  sucrose  (\u00bd MS) oescribed  for 7 da3BO3, 36.6 \u03bcM MnSO4 H2O, 15 \u03bcM ZnSO4 7H2O, 0.57 \u03bcM NaMoO4 2H2O, 0.25 mM KI, and 0.05 \u03bcM CoCl2 6H2O. Finally, 0.05% MES, 1% sucrose, and 0.8% phytoagar was added, and the pH was adjusted to 5.7\u20135.8 with diluted KOH. The Cu concentration in the Cu deficiency (0 \u03bcM CuSO4) media including commercial phytoagar (Duchefa Biochemie) measured by ICP-MS is <0.008 \u03bcM Cu. To study the effects that the different Cu and Fe content have in plants, 50 \u03bcM Fe-citrate and 1 \u03bcM CuSO4 5H2O were added to the medium for Cu and Fe sufficiency conditions. Moreover, seedlings were grown in Cu deficiency (0 \u03bcM CuSO4) and Cu excess (10 \u03bcM CuSO4). On the other hand, Fe-sufficient and slight or severe Fe deficiency medium was supplemented with 50, 10 and 0 \u03bcM Fe-citrate, respectively. Other metal concentrations and treatments were used for specific experiments as indicated in the Supplementary Figure Legends.In order to obtain \u00bd MS medium with the indicated concentrations of either Cu or Fe, the solution was prepared by adding macronutrients (Sigma) and micronutrients consisted in a mix of 50 \u03bcM Hhttp://rsb.info.nih.gov./ij). Values represent the arithmetic mean \u00b1 standard deviation (SD) of three biological replicates (n = 3).The chlorophyll content in seedlings and leaves was determined by the trichlorometric method . Root le535 was measured in a spectrophotometer  and 100 \u03bcM Fe III-EDTA was added to the seedlings and incubated at 30\u00b0C with stirring 225 rpm in the dark. After 30\u00a0min, the solution was collected and absorbance Aotometer . Values 3+ detection by Perl\u2019s staining, four to five seedlings of 11-day-old were vacuum infiltrated with equal volumes of 4% (v/v) HCl and 4% (w/v) K- ferrocyanide (Perl\u00b4s stain solution for 15\u00a0min) and incubated at room temperature for 30\u00a0min  microscope equipped with (Leyca MC170HD) camera and (LAS V4.10) software.For root Fer 30\u00a0min . One repOECOPT1 line were grown in the 12\u00a0h neutral photoperiod and three biological replicates were obtained for the (\u00bd MS) treatment and four biological replicates were used as 10 \u03bcM CuSO4, (\u00bd MS + 10 Cu) samples. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen) and aRNA was amplified using the MessageAmp\u2122 II aRNA Amplification kit (Ambion). Long oligonucleotide microarrays were provided by Dr. David Galbraith . The hybridization and analysis were performed as described elsewhere (2) were obtained using the GenePix Pro 6.0 microarray-analysis software  and normalized with the GenePix Pro 6.0 and Acuity 4.0 software . Differential genes were identified with significance analysis of microarray (SAM) (2 \u2264|1|). Biological processes were identified with the Gene Ontology (GO) annotation (http://genecodis.dacya.ucm.es/) (Seven-day-old seedlings of the WT and the lsewhere . The expay (SAM)  with falnotation , performucm.es/)  program ucm.es/) Table 1.ucm.es/)  and are Arabidopsis RNA was isolated using the RNeasy Plant Mini Kit (Qiagen), was quantified by UV spectrophotometry and its integrity was visually assessed on ethidium bromide-stained agarose gels. After treatment with Dnase I Amp Grade (Invitrogen), cDNA was generated by retro-transcriptase SSII (Invitrogen) as previously described  of three biological replicates (n = 3).Total escribed . Real-ti2 consumption, 14\u201316 roots of 10-day-old seedlings, grown in different conditions, were used. The roots were cut with a scalpel and resuspended in 1.5\u00a0ml of \u00bd MS liquid medium, as it is described above but without sucrose. The roots were transferred to an airtight chamber and the measurement of O2 consumption for a minimum of 5\u00a0min was performed using a Clark type electrode (Oxyview system). The rate of decrease of O2, referenced to fresh weight (F.W.) of the roots (nmol O2/OD600 \u00d7 F.W.) was taken as an index of respiratory capacity. Values represent the arithmetic mean \u00b1 standard deviation (SD) of three biological replicates (n = 3).To study OCu and Fe contents were determined by ICP-MS as described previously  at the SFor the determination of the content of ABA, indol-3-acetic acid (IAA), and JA, 8-day-old seedlings were lyophilized, processed and analyzed by UHPLC (ultra-high-pressure liquid chromatography) Q-Exactive (ThermoFisher Scientific) as described previously  in the pp-value <0.05)  test for a non-parametric measurements using the InfoStat software, version 2010 (http://www.infostat.com.ar)  . For the.com.ar) .Arabidopsis, we performed a comparative transcriptomic analysis of 7-day-old wild-type (WT) and a previously generated COPT1 overexpressing (OECOPT1) line . From the global analysis of gene expression, a total of 583 differentially expressed genes were identified with a log2 ratio of \u2265|1| in the OECOPT1 versus WT  line , grown uersus WT SII. TheOECOPT1 seedlings indicated that several the Biological Processes categories were overrepresented, including those linked to photosynthesis, photomorphogenesis, transport of metals such as Fe, Zn, manganese, cadmium, and phosphate, oxidative stress and responses to abscisic acid (ABA) and cold stress   compared to 160 genes (142 induced and 18 repressed), respectively. The analysis of the gene ontology (GO) of differentially regulated genes between WT and OECOPT1 is the altered expression of Fe-related genes  or excess (\u00bd MS + 10 Cu). In contrast, the genes encoding FRO reductases showed a different behavior; expression of FRO2 was induced but that for FRO3 was repressed in OECOPT1 seedlings only in Cu excess. In order to further assess the effects of Cu on their expression, seedlings were grown on hand-made \u00bd MS medium with three different CuSO4 concentrations, including Cu deficiency (0 \u03bcM CuSO4), sufficiency (1 \u03bcM CuSO4), and mild Cu excess (10 \u03bcM CuSO4). Furthermore, in addition to OECOPT1, plants overexpressing the COPT3 transporter (OECOPT3)  was lower than in WT under both Cu deficiency and excess. Since genes encoding reductases FRO2 and FRO3 displayed distinct regulation in OECOPT1 seedlings   were alsOECOPT1 and OECOPT3 seedlings were previously shown to incorporate more Cu, both under metal deficiency and excess in the growth medium  that encode ferritins  transcription factors was also analyzed  transcription factors. IRL3 and bHLH115 were repressed in OECOPT3 , jasmonic acid (JA), and indol acetic acid (IAA) contents were determined  and slight Fe deficiency (10 \u03bcM FeSO4)  or repressed (UPB1), suggesting that maybe there are certain similarities or common steps in signal transduction between the responses to Cu excess and Fe deficiency, leading to the induction of these transcriptional factors.The expression of the Fe homeostasis regulators OECOPT1 (OECOPT1 seedlings were photosynthesis-associated nuclear genes (PhANG) and genes related to photomorphogenesis, and oxidative stress , sufficiency (1 \u03bcM CuSO4) and excess CuSO4 (10 \u03bcM CuSO4) , aimed to restore electron flow in a non-phosphorylating bypass  and AOX2 (+2.08), were also induced under Cu excess in OECOPT (LOW SULPHUR UPREGULATED1 (LSU1) has been shown to prevent chloroplastic ROS production by interacting with FSD2  and a decrease in hydrogen peroxide (H2O2).Since the respiratory electron transport chain is one of the most metal requiring processes, Og bypass , was incith FSD2 . LSU1 wa2.\u2212 and H2O2 controls the transition between root cell proliferation and differentiation  and 1,4-ditiothreitol (DTT)  were stained with the Perl\u00b4s blue to detect the presence of Fe3+. The intensity of stained roots indicated that Fe3+ increased as Cu rise in the media from 0 to 10 \u03bcM Cu in all seedlings\u00b4 genotypes. Moreover, OECOPT seedlings were more intensely stained than WT in all the conditions  under Cu excess in the OECOPT plants is in agreement with their induction under sulfur deficiency and by Fe deficiency and Cu excess  was first characterized in a screening for Cu conditional phenotypes in Chlamydomonas where Cu scarcity in plastocyanin is counteracted by a heme-containing cytochrome (Arabidopsis. Moreover, the GUN4 porphyrin-binding protein enhances Mg-chelatase activity (UPB1 in OECOPT plants under Cu deficiency could emphasize the requirement of spatially appropriate Cu uptake at the root tip, where normally COPT1 is expressed (In order to address how Cu influenced the signaling pathways involved in the Fe deficiency response, the expression of sing BTS , and mayeedlings SIV. Moseedlings . Multipltochrome , althougactivity  and its activity . On the activity . These ractivity . In thisxpressed , to avoixpressed .3+ in the root. Despite low Fe in the shoot, the presence of high Fe3+/Fe2+ ratio in the root prevented local responses to Fe deficiency (Taken together, these results indicated that high Cu renders increased Feficiency Figure 8The datasets generated for this study can be found in the: The microarray raw data were deposited in the NCBI\u2019s Gene Expression Omnibus and are accessible through GEO Series accession number GSE143857.OECOPT1 global analysis. AP-G and AA-B performed the physiological and molecular experiments in mutant plants. All authors contributed to the article and approved the submitted version.LP and SP conceived the idea and wrote the manuscript. MP-A and FV-S performed the This work was supported by grant BIO2017-87828-C2-1-P from the Spanish Ministry of Economy and Competitiveness, and by FEDER funds from the European Union.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Peripheral nerve reflexes enable organ systems to maintain long-term physiological homeostasis while responding to rapidly changing environmental conditions. Electrical nerve stimulation is commonly used to activate these reflexes and modulate organ function, giving rise to an emerging class of therapeutics called bioelectronic medicines. Dogma maintains that immune cell migration to and from organs is mediated by inflammatory signals . However, nerve reflexes that regulate immune function have only recently been elucidated, and stimulation of these reflexes for therapeutic effect has not been fully investigated.We utilized both electrical and ultrasound-based nerve stimulation to activate nerve pathways projecting to specific lymph nodes. Tissue and cell analysis of the stimulated lymph node, distal lymph nodes and immune organs is then utilized to measure the stimulation-induced changes in neurotransmitter/neuropeptide concentrations and immune cellularity in each of these sites.In this report, we demonstrate that activation of nerves and stimulated release of neurotransmitters within a local lymph node results in transient retention of immune cells (e.g. lymphocytes and neutrophils) at that location. Furthermore, such stimulation results in transient changes in neurotransmitter concentrations at distal organs of the immune system, spleen and liver, and mobilization of immune cells into the circulation. This report will enable future studies in which stimulation of these long-range nerve connections between lymphatic and immune organs can be applied for clinical purpose, including therapeutic modulation of cellularity during vaccination, active allergic response, or active auto-immune disease. In recent years, several nerve reflexes have been described that modulate the function of the immune system. These include the vagus nerve-mediated anti-inflammatory reflex, that alters cytokine release from macrophages  approximately 5\u2009mm apart. The needles were insulated by covering the surfaces with epoxy (Kwik-cast) leaving approximately 5\u2009mm of electrode tips exposed as a conducting surface. One electrode was connected to the positive terminal of the stimulator and the other electrode connected to the negative terminal of the stimulator.  with an internal source resistance of 50\u2009\u03a9, programmed to output a waveform of 10\u2009V, 7\u2009V, 5\u2009V, 2\u2009V or 0.5\u2009V with a pulse length of 50\u2009msec at a repetition rate of 30\u2009kHz, 200\u2009Hz, 20\u2009Hz or 0.5\u2009Hz. The waveform was adjusted with a voltage offset to balance the net voltage-time between the positive (pulse) cycle and the negative (off) cycle. The current source stimulator consisted of a custom voltage to current circuit  system has been shown previously  were housed at 25\u2009\u00b0C on a 12-h light/dark cycle and acclimatized for 1\u2009week, with handling, before experiments were conducted to minimize potential confounding measures due to stress response. Water and regular rodent chow were available ad libitum. Experiments were performed under protocols approved by the Institutional Animal Care and Use Committee of GE Global Research.Prior to stimulation the rat was anesthetized with 1\u20132% isoflurane and laid prone on a water circulating heating pad. Methylene blue (0.5\u2009mg/kg of a 1% dye solution) was injected into the foot pad of the rat to trace the lymphatic and highlight the popliteal lymph node prior to surgical exposure and nerve stimulation. To gain access to both the sciatic nerve and visualize the popliteal fossa, a S-shaped incision was made through the bicep femoris exposing the popliteal fossa and sciatic nerve. The surgical area is irrigated in sterile saline to prevent damage from excessive drying of the tissue during the experiment. A stainless steel electrode, described above, were placed along the sciatic nerve nearest to the sacral plexus region of the spine. Following electrode placement, a pulse is applied for 3\u2009min. Following stimulation, the area is irrigated once more with sterile saline and the surgical flap replaced and sutured closed. The animal is then maintained under anesthesia for the duration of the study designated incubation period.2 for ablation/cavitation).The region above the designated point for U/S stimulus was shaved with a disposable razor and animal clippers prior to stimulation. A Vivid E9 Diagnostic imaging ultrasound system was used to identify the region of interest as described above. The area was marked with a permanent marker for later identification. Ultrasound stimulation was applied using a the HIFU system. The U/S probe was placed at the designated area of interest identified by the diagnostic ultrasound probe. An U/S stimulus was then applied with total duration of a single stimulus not surpassing a single 1\u2009min pulse. At no point was the energy allowed to reach levels associated with thermal damage and ablation/cavitation (35\u2009W/cmRodents were anesthetized with 2\u20134% isoflurane prior to IP administration of an LD75 dose of LPS (10\u2009mg/kg). Following injection, animal were then allowed to incubate under lower anesthesia (1.5\u20132% isoflurane). Throughout the study, the level of anesthesia is monitored through assessment of either deep pain recognition  to confirm deep anesthesia or corneal response during the incubation period. During incubation period, low level anesthesia was maintained to reduce discomfort associated with LPS induced inflammation, which may trigger changes in stress response altering blood chemistries; however, isoflurane was maintained at superficial levels to prevent reduced cardiac output and hypothermia induced by isoflurane.Escherichia coli, 0111: B4; Sigma\u2013Aldrich) was used to produce a significant state of inflammation in naive adult Sprague\u2013Dawley rats prior to neuroimmune stimulation. LPS was administered to animals (10\u2009mg/kg), which corresponds to an approximate LD75 dose.After incubation (1\u2009h), the animal was euthanized and tissue, blood samples are collected as described below. Endotoxin (lipopolysaccharide (LPS) from Animals were anesthetized with 2\u20134% isoflurane and depth of anesthesia confirmed through assessment of deep pain recognition as described above. For lidocaine injection into the sciatic nerve, the rat was manually restrained in a lateral recumbent position with the hindlimb to be injected held at a right angle with the longitudinal axis of the trunk. A single fine tipped insulin syringe was then used to administer a 1% dose of lidocaine  or isotonic saline to the sciatic nerve located caudal to the greater trochanter. This method of sciatic nerve block has been assessed in the literature  and reaction tested by corneal reflex and toe pinch. Following confirmation of complete anesthesia, the animal is laid in a dorsal recumbent position and a V-cut made through both the skin and abdominal wall, caudal to the last rib. Internal organs are then moved, and a needle inserted through the diaphragm into the vena cava and blood drawn out for a total volume of 5-9\u2009mL to confirm exsanguination. Freshly collected blood was used in cell-counting studies immediately following collection. The remainder of the collected blood was stored in EDTA collection tubes and stores in -20C. Following exsanguination, organs  were rapidly removed and homogenized in a solution of phosphate-buffered saline (PBS), containing phosphatase  and protease (1-\u03bcL to 20\u2009mg of tissue as per Roche Diagnostics) inhibitors. A targeted final concentration of 0.2-g tissue per mL PBS solution was applied in all samples. Lymphatic fluid samples were filtered through a 70um cell strainer (Corning) prior to cell counting. Samples were stored at \u2212\u200980\u2009\u00b0C following cell counting.2PO4, set to pH\u20093 (with phosphoric acid). The solution was then buffered with 100-mg/L EDTA and 200-mg/L 1-octane-sulfonic acid. Final concentration of mobile phase mixture was set to 5:95, A:B. A flow rate of 1\u2009mL/min was used to improve overall peak resolution while the column was held to a consistent 20\u2009\u00b0C to minimize pressure compaction of the column resulting from the viscosity of the utilized mobile phase. The UV detector was maintained at a 254-nm wavelength, which is known to capture the absorption for catecholamines including norepinephrine, epinephrine, and dopamine.Tissue homogenates were initially homogenized with 0.1-M perchloric acid and centrifuged for 15\u2009min, after which the supernatant was separated, and the sample injected into the HPLC. Catecholamines norepinephrine and epinephrine were analyzed by HPLC with inline ultraviolet detector. The test column used in this analysis was a Supelco Discovery C18 . A biphasic mobile phase comprised of [A] acetonitrile: [B] 50\u2009=\u2009mM KHFor ultrasound stimulation, animals were anesthetized with 2\u20134% isoflurane and laid on a water circulating warming pad to prevent hyperthermia during the procedure. Prior to neuromodulation, the area above the anatomical area of interest was shaved with a disposable razor and animal hair clippers. After targeting (as described above), the ultrasound stimulus was applied for a duration of 1\u2009min. The LPS was then administered immediately following the first ultrasound stimulus (as described above). A second 1-min ultrasound stimulus was then applied following the LPS administration for a total duration of 2\u2009min. The animal was then allowed to incubate under anesthesia, and blood samples were taken as described above. After incubation, the animal was euthanized, and tissue and blood samples were taken as described above.Prior to euthanization, rodents were deeply anesthetized, and a single incision was made through the abdominal wall and the superior mesenteric lymph duct located through identification of anatomical landmarks  and completely exposed. Following isolation of the lymph duct, a small hole was made with fine tip IRIS scissors and a cannula inserted into the lymph duct.Cell counting was performed on a Hemavet 950 analyzer (Drew Scientific). A 200uL aliquot of lymphatic fluid or tissue homogenate was mixed on a rotary mixer immediately following collection for a minimum of 10\u2009min at RT. Analysis of the sample occurred within no more than 1\u2009h post collection. No cell count analysis was performed on previously frozen samples. Hematological assessment of each sample including white blood cell, neutrophil and lymphocytes were performed in accordance with instrument supplier documentation and normalized to the weight of the collected tissue sample.n\u00a0=\u20095 for each study. However, experimental variability, suspected to originate from animal-to-animal variation resulted in the increase in group size in several studies, as indicated in the corresponding figure legends. All data were expressed as means\u2009\u00b1\u2009SE. Statistical analysis was performed using a Student\u2019s t-test and Mann-Whitney post hoc or one-way analysis of variance (ANOVA) with a Tukey\u2019s post hoc analysis. Statistical significance is indicated as a * (for P\u00a0<\u20090.05), ** (for P\u00a0<\u20090.005) and *** (for P\u00a0<\u20090.0005).Animal group sizes for each experiment were estimated using a desired power of 0.9 based on prior studies accounting for a minimum group size of Figure Figure Local lidocaine application at the nerve prior to stimulation resulted in attenuation of all stimulation-associated neurotransmitter changes Fig. c, and coWe tested whether focused, noninvasive stimulation of neural tissue directly within and around the popliteal LN also results in changes in WBC counts. After delivery of ultrasound neurostimulation  using a peripheral ultrasound neuromodulation device previously described  and distal lymph tissue Huston, . For exaHerein we provide evidence that lymph nodes and other immune tissues may be interconnected by long range nerve pathways and/or reflexes, allowing communication for coordinated activity. We show that upon stimulation of the nerves entering a local lymph node (i.e. both efferent and afferent neurons from that site) there are concurrent changes in neurotransmitter signaling and immune cell trafficking in both the local lymph node and distal immune sites. Interestingly, this signaling to distal immune tissue is site dependent on tissue location  and appears targeted to specific organs (e.g. liver and spleen). In addition, the changes in immune cell trafficking at different sites (i.e. liver versus spleen) were coincident with different neurotransmitter signals, suggesting that the neuroimmune system is hard-wired to interact with different immune cell sub-types at different locations or based on different sensory inputs.Norepinephrine and epinephrine function as both neurotransmitters and neurohormones  were performed above the stimulation electrodes; therefore, the nerve path between the stimulation site and the targeted proximal popliteal lymph node remained intact. This may allow for local efferent, but not afferent signaling within the resected nerve. In addition, resection was confined to the sciatic nerve, leaving other possible afferent pathways intact (such as the descending cutaneous nerve), which may account for the differences between the lidocaine Figs.\u00a0 and 2 anUnder normal physiological conditions sympathetic-immune cell signaling is thought be involved with activation of the inflammatory response to foreign antigens  and neuropeptide (neuropeptide Y (NPY), Substance P, and vasoactive intestinal peptide (VIP)) concentrations at the directly stimulated popliteal lymph node after stimulation with different stimulation frequencies . N\u00a0=\u20095, One way ANOVA with multiple comparison analysis *\u2009=\u00a0p\u00a0\u2264\u20090.05, **\u2009=\u00a0p\u00a0\u2264\u20090.005,***\u2009=\u00a0p\u00a0\u2264\u20090.0005. Figure S2. Additional measures of neurotransmitter  and neuropeptide (neuropeptide Y (NPY), Substance P, and vasoactive intestinal peptide (VIP)) concentrations at the directly stimulated popliteal lymph node after stimulation with different intensities . N\u00a0=\u20095. One way ANOVA with multiple comparison analysis *\u2009=\u00a0p\u00a0\u2264\u20090.05, **\u2009=\u00a0p\u00a0\u2264\u20090.005,***\u2009=\u00a0p\u00a0\u2264\u20090.0005. Figure S3. Additional data comparing the concentration of neutrophils and lymphocytes within the directly stimulated lymph node, contralateral lymph node, distal axillary lymph node and distal immune tissue  with stimulation following sciatic nerve resection (SN resection) directly above the site of electrical stimulation  or without (CTRL) stimulation and with stimulation following lidocaine injection). Electrical stimulation parameters: 0.5\u2009mA, 20\u2009Hz, pulse length 50\u2009msec. Figure S4. An image of the bipolar electrodes created from electroacupuncture needles that were insulated using biocompatible epoxy  up to the metal/stimulating tips. Figure S5. A schematic diagram of the custom voltage to current circuit built (within the current source stimulator system). The circuit was driven by an analog output from a data acquisition and analysis system (MP150 Biopac Systems), and the custum circuit provides a current output of approximately 1\u2009mA per 1\u2009V input (including output current and voltage monitoring). Figure S6. An example biphasic pulse from the system (S5) that was used during stimulation experiments; the pulse was constructed with a positive output (0.2\u2009ms), no output (0.2\u2009ms), then a negative output (0.2\u2009ms), followed by a period of no output which was adjustable to change the effectively stimulation frequency. For example, a 49.4\u2009ms pause would provide a total stimulation frequency of 20\u2009Hz. Figure S7. Example output from impedance tests of the electrodes built for the experiment . The average electrode impedance ranged from 1200 to 1600\u2009\u03a9."}
+{"text": "Introduction: Different implant\u2013abutment connections have been developed to reduce mechanical and biological failure. The most frequent complications are loss of preload, screw loosening, abutment or implant fracture, deformations at the different interfaces, and bacterial microleakage. Aim: To review the evidence indicating whether the implant\u2013abutment connection type is significant regarding the following issues: (1) maintenance of the preload in static and dynamic in vitro studies; (2) assessment of possible deformations at the implant\u2013abutment interfaces, after repeated application of the tightening torque; (3) evaluation of the sealing capability of different implant connections against microleakage. Materials and Methods: In June 2020, an electronic literature search was performed in Medline, EBSCO host, and PubMed databases. The search was focused on the ability of different implant connections to maintain preload, resist deformation after tightening and retightening, and prevent microleakage. The related titles and abstracts available in English were screened, and the articles that fulfilled the inclusion criteria were selected for full-text reading. Results: The literature search conducted for this review initially resulted in 68 articles, among which 19 articles and 1 systematic review fulfilled the criteria for inclusion. The studies were divided according to the three proposed objectives, with some studies falling into more than one category . Conclusions: Conical abutment appears to result in fewer mechanical complications, such as screw loosening or fractures, and higher torque preservation. After SEM evaluation, damage was observed in the threads of the abutment screws, before and after loading in internal and external connections. Internal hexagon implants and predominantly internal conical (Morse taper) implants showed less microleakage in dynamic loading conditions. We suggest further studies to guarantee excellence in methodological quality. In recent years, geometries of implant connections have been developed with different mechanical, biological, and esthetic characteristics. Two basic geometries are available: internal and external connections. External connections usually have an external hexagon on the implant platform, whereas internal connections can be divided into internal hexagons, internal octagons, and Morse taper connections . The ossThe external hexagon was the first connection system adopted in modern implantology by Branemark , based oInternal connections have been introduced with a Morse cone of different degrees of inclination, depending on the commercial brand , to loweAs described previously, the different implant\u2013abutment connection designs have very different characteristics, which can affect mechanical stability. The failure of an implant is related to two problems: biological and mechanical factors. Biological causes essentially relate to periimplantitis, which affects the soft and hard tissues around the implants, whereas mechanical causes involve prosthetic components, namely, overload of the prothesis\u2013implant\u2013pillar complex, implant fracture, abutment fracture, loosening of the screws, and fracture of the superstructure  ,18.Abutment screw stability can be affected by preload, the effect of settling, and screw geometry ,19,20. PAnother important phenomenon experienced by the screw joint is the settling effect. This occurs because neither the interior torque nor the screw is perfectly fabricated and without irregularity; therefore, these rough areas are smoothed, causing a loss of 2\u201310% of the initial preload . Torque The stability and integrity of the abutment\u2013implant connection, by means of a screw, are fallible from the moment the prosthetic elements are attached. This fallibility depends on the applied preload, wear of the components, and function. It is necessary to evaluate and quantify, with in vitro studies, the loss of torque before and after loading and the integrity of the system structures in the different connections. The current work aims to review the existing literature to evaluate, according to the type of connection, the maintenance of the preload, the assessment of possible deformations at the different interfaces after repeated application of the tightening torque, and the sealing capability of different implant connections against microleakage.The following analysis was performed according to the guidelines and the principles of an integrative review. The review is focused on the guiding question, \u201cis the implant\u2013abutment connection design important in the mechanical behavior of dental implants?\u201d. Dental literature in Medline, EBSCO Host, and PubMed databases was searched from January 2004 to June 2020. The literature search was limited to journals available in English. The keywords were free-text words and included a combination of the following: implant abutment connections; preload; tightening torque; cyclic loading; implant abutment deformation; misfit; microleakage. Manual and electronic searches were performed to select the relevant articles.The screening of the articles was conducted, as shown in the flow chart of All studies meeting the criteria were obtained, screened independently, and analyzed according to the stages of an integrative review process. The literature search initially resulted in a total of 68 articles, of which 27 were selected after an evaluation of their titles and abstracts. Full articles were analyzed, and 19 in-vitro studies and 1 systematic review were considered eligible for the review .Several mechanisms can cause screw loosening and loss of preload. One is the embedment relaxation of mating thread surfaces . Ten perThe relationship between applied torque and preload depends on several factors, including screw geometry, material properties, surface texture, degree of lubrication, rate of tightening, and integrity of the joint . Cyclic Monitoring of screw torque provides a clearer understanding of the role of the screw and the significance of implant connection design on the maintenance of preload. Several studies have been conducted to resolve this issue. In-vitro static studies have been developed to evaluate torque maintenance in implant\u2013abutment interfaces without the application of any external dynamic forces. In contrast, studies with cyclic loading have been carried out to simulate clinical situations in which implants and prostheses are subject to multiple dynamic/occlusal forces. Torque application studies have been conducted with single and multiple tightening. (a) Maintenance of preload after single tighteningStatic mechanical behavior after one tightening was evaluated in two studies: Jorge et al. 2013 and Al-Otaibi et al. 2018 ,44. A to(b) Maintenance of the preload after multiple tighteningFive studies , Ferreira et al. (2012), Bernardes et al. (2014), Al-Otaibi et al. (2017), Kim et al. (2020)) 11, Ferre,36,42,47In these studies, the RTV of the abutment screw was measured after multiple tightening with a digital torque meter , Al-Oitabi et al. (2017), Kim et al. (2020)), an analogic torque gauge ), and a screw tightening machine ). The number of implants present in the studies varied from 4 to 50.(c) Maintenance of the preload after single tightening and the application of cyclical load6 cycles , 1 \u00d7 105 cycles , 5 \u00d7 106 , 0.5 \u00d7 106 , and 2000 cycles of loading in the study of Tsuge et al. The RTV of the abutment screw was measured after loading (postloading). For this purpose, some of these studies used a torque gauge  and others used a digital torque meter . The loss of preload was investigated in Tsuruta et al. using a torque wrench made by the manufacturer. In the study of Gil et al., no mention is made of the instrument used to evaluate the loss of preload. The number of samples evaluated in all studies varied from 30 to 120. The studies by Khraisat et al. and Butignon et al. were conducted only on external connection implant systems, and Xia et al. only focused on implants with internal connections.Nine studies , Piermatti et al. (2006), Tsuge et al. (2009), Butignon et al. (2013), Jorge et al. (2013), Shin et al. (2014), Gil et al. (2014), Xia et al. (2014), Tsuruta et al. (2018)) ,40,41,43The remaining studies tested specimens with either external or internal implant\u2013abutment connections . Screws were tightened to manufacturers\u2019 recommendations, varying from 20 to 35 Ncm, with the exception of the study of Xia et al., in which implant\u2013abutment assemblies were randomly assigned to three tightening groups .(d) Maintenance of the preload after multiple tightening and the application of cyclical load6 cycles between 10 and 200 N. The effect of repeated screw joint closing and opening, after cyclic loading with a chewing simulator , was evaluated by Arshad et al. [Cashman et al. (2011)  comparedd et al.  in 30 imScanning electron microscopy (SEM) is useful to evaluate prosthetic abutment screw surfaces for better interpretation of the effects of tightening/untightening procedures on the surface texture and the plastic deformation of these components.SEM examination was conducted in seven studies to evaluate the surface changes of the abutment screw thread and the implant hexagon corner after loading.Two of the studies evaluated the surface changes in the abutment screw and implant connection using SEM, before and after loading  ,45, and The presence of gaps at the implant\u2013abutment junction is one of the main factors that contribute to peri-implant inflammation. The gap acts as a microbial colonization site, which may result in loss of supporting bone. Differences in the connection design appear to influence the bacterial leakage at the implant\u2013abutment interface . As the In the systematic review of Mishra et al., (2017) , 30 artiStreptococcus sanguinis and incubated at 37 \u00b0C and in 10% CO2 for 72 h. Detorque values were recorded. The bacterial penetration was assessed, and SEM micrographs of the external hexagon abutment showed no bacterial cells.Ricomini Filho et al., (2010)  evaluateGil et al. (2014)  evaluateIn 2019, He et al.  develope(a) Maintenance of preload after single tighteningThe results of Jorge et al. and Al-Otaib et al. ,44 corroInvestigation of the effect of different maintenance times of torque application and screw loosening was the aim of the study of Al Otaibi et al.  in inter(b) Maintenance of the preload after multiple tighteningBecause the retorque value measured after screw loosening is an indirect measurement of the remaining preload, the aim of these studies was to evaluate the torque maintenance of the retention screws\u2019 abutment, in different connections, after repeated tightening/loosening cycles of the screws. The torque loss, after multiple tightening, demonstrates that part of the insertion torque used to generate the preload is lost even when no external force is applied to the system. In general, RTVs were found to be lower than tightening torque values. This reduction can be attributed to the phenomenon of the settling effect ,57,58. TClinically, the current results indicate that the retention screws should be retightened after 3 min of insertion before masticatory loading occurs. In addition, a careful follow-up of the implant-supported prosthesis should be performed because simulated masticatory loading induces screw loosening .In the study of Al-Otaibi , removalIn conflict with these studies, Cashman et al.  found noThe results of Rocha Bernardes et al.  did not (c) Maintenance of the preload after tightening and the application of cyclical loadCyclic loading forces during physiological function that do not exceed the maximum strength of an implant\u2013abutment connection may loosen the implant\u2013abutment connection gradually or make it fail due to fatigue. The reason for fatigue failure is either a lack of force-fitting or form-closure of the connection design. The critical reason for the loosening of the implant\u2013abutment connection is the loss of preload at the abutment screw and the resulting unscrewing or fatigue failure of the screw material. RTV has been used as a measurement of preload in numerous studies to evaluate interface stability following fatigue tests . The tor6), different fatigue machines, and the number of samples evaluated (from 30 to 120). Some studies compared the different implant designs available, and others included only one kind of connection system.Study results relating to the maintenance of preload after multiple tightening and application of cyclical load have presented diversity that may be explained by the range of the applied load (from 10 to 1450 N), number of loading cycles  Maintenance of the preload after multiple tightening and the application of cyclical loadIn the studies of Cashman et al. and Arshad et al. ,45, the The results of the study of Arshad et al. indicate that the RTV was considerably lower than the insertion torque in the conical hexagon connection. These results corroborate previous studies, which reported that all screw types display some decay in preload with repeated tightening. The result depends on screw material, intrinsic metallurgic properties of the raw material, and the manufacturing process. These factors could explain the variations observed by Arshad et al. in the torque values between samples of the same group. Previous studies have shown that not only screws from different manufacturers but also screws from different lots of the same manufacturer could lead to different maximum preload torque before fracture ,62. ClinCashman et al., did not determine a significant loss of RTV postfatigue loading despite similar test parameters. The purpose of the study of Cashman et al. was to compare the abutment fatigue resistance to a simulated function in a specific brand control abutment relative to a third-party-compatible abutment. The differences in chemical composition, manufacturing, and surface treatment indicate a need for independent verification of functional compatibility. Different abutment manufacturers result in a difference in RTV postfatigue loading. The control abutment demonstrated a greater RTV than the third-party-manufactured component.Scanning electron microscopy (SEM) was carried out to determine the characteristics of the interface microgap, compare thread geometry, and evaluate surface characteristics between systems.6 cycles  and 2000 cycles . In the study of Khraisat et al., mild burnishing and scuffing of the abutment screw thread surfaces were observed, after tightening, in control specimens that were not loaded. Marked burnishing was observed at the hexagon corners on the compression sides.SEM examination was conducted by Khraisat et al.  and Tsuge et al.  ,35. ThesIn the study of Tsuge et al., damage was observed on the threads of the abutment screws and the screw surfaces  on the upper and lower flanks, which was probably due to screw tightening. However, no abnormal wear or damage due to micromovement or bending caused by cyclic loading was observed on the abutment screws in any of the samples.6 cycles of loading to compare thread geometry and evaluate surface characteristics in internal connections. Differences in surface finish were visualized in postfatigue cycling, such as ductile delamination and rough surfaces in the profiles of the threads. Visual differences at the macro/microscopic level were also apparent in the thread geometry, with third-party abutments demonstrating considerably greater variation in geometrical architecture than control specimens.SEM was also carried out in the study of Cashman et al.  after 5 6) of implant\u2013abutment assemblies with internal connections and different tightening torque values was investigated. Under-tightened implant\u2013abutment assemblies (24 Ncm) failed to survive fatigue tests (crack propagation), whereas implant assemblies in the recommended and over-tightened torque groups  had intact implant\u2013abutment interfaces, as proven by SEM.In the study of Xia et al. , the dyn6), was evaluated by Arshad et al. [The surface topography of one screw in each group, before and after cyclic loading  in internal hexagon and internal octagon connections.A single study contradicts all of these findings: Murmura et al.  used SEMIn the systematic review of Mishra et al. (2017) , a maximEscherichia coli suspension. They found that in the DAT connection group, 7 of 10 total implants showed no bacterial infiltration at 96 h. This new internal conical design should reduce bacterial infiltration by constructing a physically tight connection with a high level of precision in the submicrometer range. Additional studies are necessary to better understand the stability of this new type of internal connection over a longer period, with different bacteria and subject to the mastication function.In vitro investigations showed that a major portion of conical connection systems presents a microgap under static forces smaller than 10 \u03bcm , demonstThis review found that different studies have been performed using a variety of approaches, thus often making the studies difficult to compare. As a result, it is difficult to draw conclusions about which abutment system behavior is optimal.Maintenance of the preload: Internal connections have a higher preload value than that of the external hexagon design. The conical configuration can spread the load along the fixture and the surrounding bone more homogeneously than both the external hexagon and traditional internal connections. Assessment of possible deformations at different interfaces after repeated application of tightening torque: Damage was observed in the threads of the abutment screws, before and after loading, in external and internal implant\u2013abutment connections.Evaluation of the sealing capability of different implant connections against microleakage: All connections presented some microgaps and bacterial microleakage. However, the performance of the conical connection systems appeared to be superior to that of other systems.Considering the proposed objectives, we can draw the following conclusions:Further in-vivo prospective studies are needed to build evidence of the best-performing connection over the long-term while bearing in mind the other factors that can affect clinical results."}
+{"text": "Hip osteoarthritis patients exhibit changes in kinematics and kinetics that affect joint loading. Monitoring this load can provide valuable information to clinicians. For example, a patient's joint loading measured across different activities can be used to determine the amount of exercise that the patient needs to complete each day. Unfortunately, current methods for measuring joint loading require a lab environment which most clinicians do not have access to. This study explores employing machine learning to construct a model that can estimate joint loading based on sensor data obtained solely from a mobile phone. In order to learn such a model, we collected a dataset from 10 patients with hip osteoarthritis who performed multiple repetitions of nine different exercises. During each repetition, we simultaneously recorded 3D motion capture data, ground reaction force data, and the inertial measurement unit data from a mobile phone attached to the patient's hip. The 3D motion and ground reaction force data were used to compute the ground truth joint loading using musculoskeletal modeling. Our goal is to estimate the ground truth loading value using only the data captured by the sensors of the mobile phone. We propose a machine learning pipeline for learning such a model based on the recordings of a phone's accelerometer and gyroscope. When evaluated for an unseen patient, the proposed pipeline achieves a mean absolute error of 29% for the left hip and 36% for the right hip. While our approach is a step in the direction of using a minimal number of sensors to estimate joint loading outside the lab, developing a tool that is accurate enough to be applicable in a clinical context still remains an open challenge. It may be necessary to use sensors at more than one location in order to obtain better estimates. Hip osteoarthritis (OA) patients exhibit changes in kinematics and kinetics that affect the contact forces of the hip and knee joints during walking and daily activities. It is believed that these changes are important in the progression of OA Felson,  and thatBecause of these drawbacks, clinicians could greatly benefit from a mobile system that is able to provide accurate joint loading estimates based on cheaper sensors. Ideally, such a system would be based on inexpensive, wearable sensors that the patients can easily use at the clinician's practice or even at home. Inertial measurement unit (IMU) sensors and electromyography (EMG) sensors are ideal candidates for this purpose as they are relatively cheap and have been applied successfully in a wide range of human movement analysis tasks .For this study, 20 patients with unilateral end-stage hip osteoarthritis were recruited from a local hospital . They were included based on the following criteria: aged between 55 and 75 years; unilateral hip osteoarthritis; awaiting joint replacement surgery; Body Mass Index \u226430kg\u00b7mEach patient performed multiple repetitions of nine types of exercises. Walk: level walking at a self-selected speed, one repetition corresponds to one stride;Ascend stairs and descend stairs: at a self selected speed, without hand-held support on a standardized 4-step staircase, one repetition corresponds to one stride;Sit down and stand up: the height of the chair was standardized to participants knee height;Forward lunge and side lunge: step length standardized at 70% leg length;Stand on one leg (approx. 2 s) and squat on one leg: hands fixed at the side.We measure the patients' hip and knee contact force to define the ground truth joint loading that we aim to estimate. While contact forces can be measured directly using instrument prostheses, we instead use a combination of experimental data and musculoskeletal modeling  and three ground reaction force plates embedded in the floor . Each participant was equipped with 38 reflective markers on bony landmarks conforming to the full-body plug-in walk model (Oxford Metrics). The single markers on the body segments were substituted by rigid three marker clusters. The marker trajectories and ground reaction force data were used as input in a standard musculoskeletal modeling workflow applied in OpenSim 3.3  sensors since they are easy to use outside the lab. IMU sensors are often used in human motion analysis for this reason  and 3D angular velocity , both with a sampling rate of 50 Hzx), proximal-distal (y) and lateral-medial (z) direction of the person's left leg.In this study, we use the IMU sensors from a mobile phone . During the whole exercise protocol, the phone continuously recorded the 3D acceleration , ax(t1), \u2026, ax(tn)] where ti is the ith time stamp of an exercise repetition.Since the signals change over time, each signal is represented as a time series, i.e., a sequence of values. For example, the Whereas the optoelectronic cameras and the ground reaction force plates were connected to the computer that was used for measuring the joint contact forces, the mobile phone sensor recordings were collected directly on the phone. Since the computer and the mobile phone recorded the data independently, their recordings were not synchronized through a single clock. In order to link to correct parts of the sensor data to the joint contact forces, both systems' time stamps have to be aligned. This can be done by incrementing the time stamps of the phone by the lag between the two clocks, i.e., the difference between the computer's clock time and the phone's clock time.Pl:l+nCF, CF) for each lag l\u2208, which corresponds to the lags l for which all time stamps of the contact force data CF are between the start and end of the phone data P. Unfortunately, the exact lag was unknown at the time of data collection. Finding this lag manually would require to check for each possible lag whether the joint contact force signal is aligned with the phone's signals and select the lag that results in the best alignment. Additionally, since the lags vary across the different collection sessions due to drift in the phone's clock time, this would have to be repeated for each subject. Therefore, we align the signals automatically using an approach based on the cross-correlation coefficient between the signals. Specifically, we compute the cross-correlation for each possible lag, i.e., xcorr for each target.feature extraction block converts the raw phone signals into a format that is suitable for learning a model. This format consists of features that summarize the phone signals, e.g., by extracting the mean of the ax signal. Each feature summarizes the data of one exercise repetition, i.e., one window of data. The process of defining a set of relevant features is called feature construction. Section 2.6.1 describes this process in more detail. Next, the normalization block normalizes the feature values in order to make the predictions more robust. Section 2.6.2 lists several normalization procedures. Finally, the model block turns the  feature values into a prediction for the left/right hip/knee joint impulse. Since the relation between phone-based features and joint impulse is unknown from a biomechanics perspective, we use machine learning to automatically learn a model from a dataset labeled with ground-truth joint impulses. Sections 2.6.3 and 2.6.4 describe the learning settings and methods for training these models.The pipeline consists of three building blocks. First, the The input of the pipeline consists of the measurements collected by the phone's sensors. However, the high dimensionality of the raw phone signals prevents using these signals directly for training a model. Therefore, we follow a feature-based approach Fulcher,  and convWe use the TSFuse Python package with the minimal feature extraction settings to generate a feature representation. This package extracts a set of statistical features  from both the original signals and additional signals derived from these signals. To derive new signals, TSFuse combines multiple signals using different transformations . We refer to De Brabandere et al.  for the Since this construction method uses the target data to remove irrelevant features, the feature construction method was repeated for each cross-validation fold (see section 2.7). In our experiments, TSFuse constructed the same 63 features in each fold. Normalizing the feature values may be required from a machine learning and biomechanics perspective. From a machine learning perspective, standardizing the feature values to a similar range is necessary for certain types of models, including the regularized linear model of our pipeline (section 2.6.4). From a biomechanics perspective, other studies using accelerometer data have shown that individual differences  may influence the signals and thus affect the feature values as well  the original joint impulses relative to subject's body weight, and (2) the standardized impulses using the mean and standard deviation over the complete training set. We do not consider standardizing based on each subject's joint impulses since that would require ground truth joint loading measurements for the test data, which is understandable as the model does not have these when applied to an unseen subject.Since some exercises have completely different movements, the joint impulse can not be modeled in the same way for each exercise. The model could detect the exercise type itself by training the model using the complete dataset. However, given the small dataset size, we simplify the learning task by training multiple models, each focusing on only one or a few similar exercises. Specifically, we consider the following two learning settings:One exercise (OE)This setting splits the data per exercise type and evaluates models for each exercise type separately.Similar exercises (SE)This setting splits the dataset in groups of similar exercises: walk, ascend stairs and descend stairs; sit down and stand up; forward lunge and side lunge; and stand on one leg and squat on one leg.Grouping multiple exercises in the SE setting increases the number of training examples compared to the OE setting, which may help selecting relevant features and setting good parameters for the model. We hypothesize that the SE setting yields more accurate models as a result of the increased training set size. To evaluate this hypothesis, section 3.4 compares both settings.1-norm of the weights in the cost function. Given the small dataset of this study, this method is suitable as it is able to select relevant features from a large number of features (p) when the number of training examples (n) is small (n\u226ap). In our experiments, we use the Lasso implementation of scikit-learn  by Tibshirani . This meWe compare the linear regression models to a na\u00efve baseline model which predicts the average joint impulse of all exercise repetitions in the training data. As the baseline requires no learning, achieving a lower prediction error is a minimal requirement for the linear model to do better than the current best approach for monitoring the joint loading of patients. This approach uses the population average as a \u201cjoint loading profile\u201d for monitoring an individual patient. The na\u00efve baseline estimates the population average from a specific group of subjects, in this case a sample of hip OA patients.unseen patient, and (2) applying the model to a seen patient, i.e., a patient for whom some labeled data is already available. The first scenario is relevant when a doctor without lab access applies the model to one of his patients. Since this patient's movement patterns may be different compared to the patients for whom the model was trained, we hypothesize that the second scenario may improve the predictions by including labeled data of the patient in the training data. To evaluate these scenarios, we employ the following cross-validation procedures:We evaluate the pipeline's performance on unseen  data with respect to two scenarios: (1) applying the model to an Leave-one-subject-out cross-validationunseen patient. In each fold, we hold out all data of a single patient and train the model using all other patients' data. The error averaged over all folds corresponds to the prediction error that a doctor without lab access can expect.This cross-validation procedure evaluates how accurate the pipeline works for an Leave-one-exercise-type-out cross-validationseen patient. This procedure splits the data based on the exercise type. In each fold, the test data consists of all repetitions of one exercise type performed by one subject. The training data consists of all other exercises performed by the same subject as well as all data of the other subjects. Note that we do not consider leave-one-repetition-out cross-validation: since all trials of each exercise were performed consecutively, the dependency between trials may be too strong and result in overly optimistic errors.This cross-validation procedure evaluates how accurate the pipeline works for a \u0177i w.r.t. the ground truth joint impulses yi over all exercise repetitions i. This metric represents the average relative deviation from the actual joint impulses over all exercise repetitions performed by a patient. The MAE% is defined as follows:For both cross-validation schemes, we evaluate the models by reporting the relative mean absolute error (MAE%) of the estimated joint impulses This section evaluates the proposed joint impulse prediction pipeline. We evaluate the pipeline using both cross-validation procedures in section 3.1 (leave-one-subject-out) and section 3.2 (leave-one-exercise-type-out). For the pipeline's building blocks, we use dataset-level standardization for the feature values and train the models using the SE setting. Our comparison in sections 3.3 and 3.4 shows that this normalization procedure and learning setting were found to be optimal choices for our dataset.In section 2.6.2, we hypothesized that normalization procedures can improve the error of the models by scaling features to a similar range and removing inter-individual differences. In section 2.6.3, we hypothesized that the SE setting yields more accurate results as this setting increases the number of training examples by combining multiple exercises. To evaluate this hypothesis, The goal of this study was to explore the possibility of using a minimal number of sensors for predicting joint loading in hip OA patients. We proposed a machine learning pipeline that requires only the IMU data collected from a mobile phone. In this section, we discuss our choices for the different building blocks of this pipeline. We then discuss the differences in the obtained errors with respect to the joints and exercise types. Finally, we discuss the accuracy vs. ease-of-use trade-off of our approach and suggest future directions with respect to this trade-off.feature extraction block, we used an automated approach  can be used for other types of exercises and for other types of sensors as input.The proposed machine learning pipeline required making several decisions for the different building blocks. For the The results of x1, \u2026, x10] is significantly different from  where xi is subject i's MAE% of the baseline for the left hip/knee and yi is subject i's MAE% of the baseline for the right hip/knee. The resulting p-values are 0.3694 (for the hip) and 0.4458 (for the knee) meaning that the difference between left and right was not significant. Most likely, the difference is due to the small sample size (only 10 subjects) and does not hold in general.Similar to the difference between the hip and knee, there are also different errors for the left and right side. Interestingly, this difference does not only hold for the linear models, but also for the baselines, which suggests that there may be a larger variability in the joint impulses for the right side compared to the left side. One possible reason could be the side of the hip that was affected. However, this is unlikely as the right hip was affected for 6 patients and the left hip for 4 patients. To evaluate whether the difference between left and right is significant, we performed a two-sided paired t-test for the overall MAE% of the baseline. That is, we tested whether [The errors of the linear model are different for the different exercise types, which suggests that predicting joint impulses is easier for some exercises compared to others. Given that there are large differences in the movements between exercises, the differences in the joint impulse prediction errors can depend on the relation between the data collected by the phone and the contact force at each point in time. model block were trained using L1-regularization (lasso), which select a small number of features out of the 63 generated features. Since the selected features are different for each fold, it is hard to visualize which features are used in the models given the large number of models . Instead, we run stability selection , attach 38 reflective markers to the patient and analyze the collected data in order to calculate the joint contact forces from the collected measurements.Our model only requires attaching a mobile phone to the patient's left hipHowever, given the results of this work, we recognize that using a mobile phone may be an easy solution, but unfortunately, one that is not accurate enough for valid clinical use. A better compromise between accuracy and ease-of-use would be to use a combination of IMU sensors at more than one location. This would allow having a better view of the patient's movements. Still, the number of sensors should be kept to a minimum in order to keep the tool practical. More research is needed to evaluate which locations are most suitable.Even though the results are far from perfect, we argue that our phone-based model is a step in the right direction in estimating joint loading in a clinical setting using a very limited amount of sensors. Especially the results for predicting the joint impulse during level walking are interesting, where distinct reduction in mean absolute error from the baseline can be seen (MAE% from 43.9 to 16.8%). When monitoring a patient during daily life, this result is promising as walking is one of the most commonly performed daily activities and might be responsible for the majority of the joint loading during a day. The improvement over the baseline indicates that clinicians are able to obtain more accurate estimates of a patient's joint load compared to using a population average. In the future, a \u201chip OA\u201d profile using population averages could shift to a \u201cpersonal\u201d profile using a more individualized estimate of joint loading. This in turn could help clinicians align a person's exercise prescription to their individual loading profile based on more accurate methods which could improve their rehabilitation. Given that joint contact forces are believed to be important in the initiation and progression of OA Felson, , this miThis work presented a machine learning pipeline to estimate the hip and knee joint impulse based on a mobile phone. In terms of the mean absolute error, we found that the proposed pipeline is able to slightly outperform a population average baseline for the hip , but not for the knee. Our approach has two key advantages over existing methods for predicting joint loading. First, the proposed pipeline only requires a mobile phone as input. Second, we trained and evaluated the pipeline using data of patients instead of healthy subjects, which is relevant with respect to the setting in which the proposed pipeline is applicable, i.e., monitoring patients.However, even though our phone-based model is a step in the direction of estimating joint contact forces using a minimal number of sensors, the current approach still has several limitations that need to be addressed in future work. First, the overall error of our approach should be reduced further in order to be applicable in a clinical context. One possibility is to use multiple sensors, but still only a few such that the model remains easy to use. Related work by Wesseling et al.  has showThe datasets generated for this study are available on request to the corresponding author.The studies involving human participants were reviewed and approved by Ethics Committee Research UZ/KU Leuven. The patients/participants provided their written informed consent to participate in this study.AD, JE, AT, IJ, BV, and JD conceived, designed and coordinated the study. JE collected the data. AD and JD developed the machine learning pipeline. AD and JE analyzed the data and initially drafted the manuscript. AT, IJ, BV, and JD provided useful suggestions in the preparation of the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The physicochemical properties of the fibers and sorbents were characterized using scanning electron microscopy (SEM), differential scanning calorimetry (DSC), Fourier transform infrared spectroscopy (FTIR) and inductively coupled plasma optical emission spectroscopy (ICP-OES). The mechanical properties of the fibers were also evaluated. The results of this work showed that the tested fibrous scaffolds have melting temperatures suitable for wound dressings design (58\u201360 \u00b0C). In addition, they demonstrated to be stable even after seven days in physiological solution, showing no macroscopic damage due to PVP release at the microscopic scale. Pelletized sorbents with the higher particle size demonstrated to have the best water uptake capabilities. Both, fibers and sorbents showed antimicrobial activity against Gram-negative bacteria Pseudomona aeruginosa and Escherichia coli, Gram-positive Staphylococcus aureus and the fungus Candida albicans. The best physicochemical properties were obtained with a scaffold produced with a PCL/PVP ratio of 85:15, this polymeric scaffold demonstrated the most antimicrobial activity without affecting the cell viability of human fibroblast. Pelletized Ag/Si-Al2O3-3 sorbent possessed the best water uptake capability and the higher antimicrobial activity, over time between all the sorbents tested. The combination of PCL/PVP 85:15 microfibers with the chosen Ag/Si-Al2O3-3 sorbent will be used in the following work for creation of wound dressings possessing exudate retention, biocompatibility and antimicrobial activity.Skin burns and ulcers are considered hard-to-heal wounds due to their high infection risk. For this reason, designing new options for wound dressings is a growing need. The objective of this work is to investigate the properties of poly (\u03b5-caprolactone)/poly (vinyl-pyrrolidone) (PCL/PVP) microfibers produced via electrospinning along with sorbents loaded with Argovit\u2122 silver nanoparticles (Ag-Si/Al Appropriate wound management is critical for a suitable healing process; rapid wound closure is desired and is usually achieved using wound dressings. No wound dressings that is ideal for all wound types exists but all of them must fulfill a series of minimal requirements such as: rapid healing, prevention of infection and affordable cost for the patient . Despite2 of exudate per day, while venous leg ulcers exudate production ranges between 4000 and 12,000 g/m2/day  \u00d7 100, where AT is the absorbance of treated cells, and AC is the absorbance of control cells. Experiments were performed independently in a threefold manner with internal triplicates.For cell viability determination, disks of 0.3 cm3 and 1 mL of 40% HF, with consecutive dilution in boric acid with total volume 43 mL. All samples were dried at 120 \u00b0C for three hours before the acid digestion.Sample elemental analysis was performed using an inductive coupled plasma optical emission spectrometer (ICP-OES) Varian Vista-MPX simultaneous CCD. Typically, 125 mg of each sample was digested in the mixture of 2 mL of 63% HNOwet\u2212Wdry) to the initial value Wdry, as described in Equation (1).In order to determine the water absorption capability of the pelletized or powdered sorbents, a series of gravimetric tests were carried out. The pelletized samples were fabricated by compressing 100 mg of each powdered sample using a commercial pellet press. Phosphate buffer solution (PBS) at 37 \u00b0C was used as a wetting agent to emulate the physiological conditions. The tests were carried out following previously reported methods for determining water absorption in pelletized and powdered samples ,40,41 adPelletized pre-weighed dry samples were placed into tissue culture well plates containing 1 mL of PBS at 37 \u00b0C. The plates were sealed and placed in an incubator at 37 \u00b0C for 2 h. After this time, the samples were taken out of the incubator, removed from the wells and placed onto lint-free absorbent paper towels for 3 s to remove excess liquid; the samples were then weighted. Fluid absorption was determined using Equation (1).p < 0.01) was performed to compare statistically significant differences between water absorption of the samples.Then, 1 g of each dry sample was placed in a purpose-designed centrifuge basket to measure the fluid absorption of powdered samples, and the total dry weight was registered. The basket was then submerged in a 50-mL beaker containing 10 mL of PBS at 37 \u00b0C. The beakers were sealed and placed in an incubator at 37 \u00b0C for 2 h. After this time, the baskets containing the samples were removed from the incubator, padded dry on the outside and immediately placed in a centrifuge at 1500 rpm for 30 s to remove excess liquid from the surface of the grains. After this process, the baskets containing the samples were weighted. Fluid absorption was determined using equation 1. ANOVA test , Escherichia coli (ATCC 25922) and Pseudomona aeruginosa (ATCC 15442) were cultured in a previously sterilized Muller-Hinton medium at 35 \u00b0C for 24 h. After that, bacterial strain population was standardized at 0.5 McFarland scale compared with the standard tube (0.132 abs at 620 nm) with saline solution. Once cell cultures were ready, 150 \u03bcL of the clean medium was added to each well-containing the fibers disks of 0.3 cm2 or 10 mg/mL of the sorbents. Then, 50 \u03bcL of each inoculum with a clean medium was added . As a negative control, 150 \u03bcL of the clean medium was placed with 50 \u03bcL of each strain, without fibers; as a positive control, gentamicin 10 mg/mL was used. All exposed bacterial cells to fibers and sorbents were incubated at 35 \u00b0C for 24, 48 and 72 h. As fibers do not dissolve, samples were removed and placed in a new well with the help of sterile forceps, and then washed with 200 \u03bcL of the clean medium. Fibers were discarded, and the solution was measured in a Microplate reader (Thermo Scientific) at 620 nm.Fiber samples of 0.3 cmCandida albicans (ATCC 90028) were subcultured to DIFCO\u2122 Sabouraud Dextrose Agar , at 35 \u00b0C (\u00b12 \u00b0C). Colonies were picked with a sterile bacteriological loop and suspended in 3 mL of sterile saline solution 0.145 mol/L. The resulting suspension was vortexed for 15 s, and the cell density was adjusted visually to obtain an equivalent transmittance of 0.5 McFarland Standard at a 530 nm wavelength. This procedure provided a standard suspension containing 1 \u00d7 106 to 5 \u00d7 106 cells/mL. As previously described, 150 \u03bcL of the clean medium was added to each well-containing fiber disks of 0.3 cm2 or 10 mg/mL of the sorbents. All fungal cells exposed to fibers and sorbents were incubated for 24, 48 and 72 h at 35 \u00b0C. Fluconazole at 10 mg/mL was used as a positive control and fungal cell suspension as a negative control. All antimicrobials experiments were done by triplicate.In the case of the antifungal assay, p < 0.05.The experiments were done in a threefold independent manner with internal triplicates. The results were expressed as mean \u00b1 standard deviation of three independent experiments. Data was evaluated by one way analysis of variance (one-way ANOVA), followed by Tukey\u2019s post-hoc test, using Graph Pad Prism version 6.0c software. The results were considered statistically significant when It is important to mention that the showed SEM images were chosen to observe the morphology and rugosity of the fibers . CompletPCL fiber scaffolds presented an average diameter of 2.09 \u00b1 0.78 \u00b5m, while PVP fibers possessed diameters of 1.11 \u00b1 0.37 \u00b5m, in the case of PCL/PVP fibers; PCL/PVP 95:5 fibers showed a fiber diameter of 39.39 \u00b1 27.63 \u00b5m and PCL/PVP 85:15 fibers of 64.94 \u00b1 9.28 \u00b5m, respectively.It is important to note, that the high thickness of PCL/PVP 85:15 fibers (~65 \u00b5m) is due to the presence of long bulbs on the fibers, this measurement was taken from the bulbs average diameter, on the contrary, fibers were measured in the parts where no bulbs were present giving diameters of 0.76 \u00b1 0.11 \u00b5m .PCL/PVP fibers demonstrated a higher diameter than their pure polymeric counterparts, and as the amount of PVP was increased, the water absorption of the fibers increased. This can be attributed to the ability of PVP to absorb up to 40% of its weight at ambient conditions . On the other hand, PVP-fibers smooth appearance was associated with the small diameter obtained on the fibers. On the other hand, higher amounts of PVP on PCL/PVP fibers resulted in a significant increase in the diameter of the fibers, compared with pure PCL. \u22121 (b) and C-O at 1175 cm\u22121 (c) for PCL and C=O (e) and C-N (d) vibration frequencies of PVP at 1662 and 1423 cm\u22121, respectively. Incorporation of PVP into PCL fibers can be easily monitored by the progressive intensity increase of bands at 1662  and 1423 cm\u22121  as the amount of PVP increases, without intensity decrease of bands corresponding to the vibration frequency of C=O (b) and C-O (c) groups of PCL. Dotted lines in All samples were analyzed by FTIR spectroscopy to obtain evidence of PVP incorporation into the PCL fibers. \u22121, which form the polymer backbone. Finally, other characteristic signals that demonstrate no alteration of the polymers structures corresponding to the C-H alkanes group (a) were observed at 2939 cmA fundamental parameter in a wound dressing scaffold is the thermal stability of the polymeric fibers; it has been reported that burn injuries can reach temperatures up to 41 \u00b0C ,44,45,46As expected, PCL and PCL/PVP fibers showed no evident macroscopic degradation after seven days of observation. On the contrary, PVP fibers were dissolved almost immediately, only 14 s, after being placed on the Petri dish with a saturated physiological solution . SEM imaSeveral mechanical characteristics should be fulfilled for a material to be used as a wound dressing, such as durability, stress resistance, flexibility, pliability and elasticity. In addition, it should be easy to apply and remove without causing any trauma during dressings changes . Therefo\u22124 m, with the exception of PCL samples which were ~1 \u00d7 10\u22124 m thinner after the electrospinning of 3 mL solution. Even when the size of the fibers has an effect on the final thickness of the mat, the adjustment of the mat thickness can be adjusting by increasing the volume (higher than 3 mL) [PCL, PVP and PCL/PVP electrospun fibers were tested using five replicates. Results are reported in an 3 mL) .In the case of the ultimate tensile strength, PCL demonstrated to be more resistant to plastic deformation and ultimate load than PVP . BetweenMoreover, elongation at break expresses the capability of the fibrous mat to resist changes of shape without crack formation . PCL/PVPAll samples presented values of Young\u2019s module that are less than 1 MPa. The PCL/PVP 95:5 mats demonstrated to have the most elasticity (~107 \u00b1 4% elongation at break), and PVP fibers the least elasticity (~21 \u00b1 8% elongation at break) .Finally, One of the great challenges of fibers for biomedical applications is the cytotoxic effect that they can exert on healthy cells. The proliferation of HFF-1 cultures demonstrated that PCL fibers promoted proliferation by 177 \u00b1 22%, and PVP fibers showed a proliferation of 136 \u00b1 35% compared with negative control (DMEM: cell suspension in media). Despite these results, the standard deviations of these samples are high and no significant difference exist when compared to normal growth. Furthermore, the combination of PCL/PVP does not favor the proliferation as considerably as the pure polymeric fibers but not decrease the cell viability compared to the negative control. In the case of PCL/PVP 85:15, the proliferation percentage is 108 \u00b1 23%. Meanwhile, PCL/PVP 95:5 fibers showed lower viability with 69 \u00b1 28% . The obs2O3 sorbents (1\u20134) show the best absorption capability. Been a sorbent a substance which has the property of collecting molecules of another substance by sorption, and are commonly used as materials for blood purification and hemodialysis [The water absorption test was performed to determine which of the Ag-Si/Aldialysis ,57,58,592O3 sorbents presented on 2O3-2 (0.003% Ag), the content of Ag in samples is related to its antimicrobial activity [2O3 samples using the method of low-temperature (77 K) nitrogen vapor sorption  using generally accepted methods [spec), volume and pore size were calculated from experimental sorption isotherms using the classical Brunauer-Emmett-Teller (BET) method for the range of relative vapor pressures of nitrogen sorbate 0.08\u20130.25. The preferred pore size in sorbents is 10\u2013100 nm. Samples Ag-Si/Al2O3-3 and Ag-Si/Al2O3-4 contain a larger number of thin pores , which provide a higher sorption activity of these samples with respect to water. With respect to the bulk density of the Ag-Si/Al2O3 sorbents, it has been reported that higher bulk density lowers the ability to absorb water, therefore the sorbent Ag-Si/Al2O3-3 with less bulk density (0.7 g/cm3) is expected to have best water uptake from all samples [Physicochemical properties of the Ag-Si/Alactivity ,15,16. Iactivity , being aactivity , the soractivity  studied  methods . Before  samples .As the particle size of the sorbents increased, the total number of pores and the specific surface also increased, regardless of the percentage of silver added. 2O3-2 sorbent had the lowest water uptake capability (19.8%), while sorbent Ag-Si/Al2O3-4 absorbed the most amount of water (37.3%) in the compressed pellets study. In the case of the powdered sorbents, as illustrated in The specific surface and the total number of pores of the sorbents play an essential role in water uptake. 2O3-3 and Ag-Si/Al2O3-4 in form of pellets or powder possess a better water uptake, that can be attributed to their properties such as: particle size, specific surface and the number of pores (p < 0.01), neither pelletized or powdered sorbents showed any significant difference of water absorption.In this study, it can be observed that sorbents Ag-Si/Alof pores . Ag amou2O3-3 and Ag-Si/Al2O3-4 are the best candidates for the composite dressings fabrication.Compressed pellets are better for a wound dressings application due to the dimensions required in some types of injures. This work shows that pelletizing the samples has no significant effect on water uptake. Therefore, sorbent Ag-Si/AlPseudomona aeruginosa and Escherichia coli and Gram-positive bacteria Staphylococcus aureus were chosen to evaluate the antimicrobial activity of the fibers and sorbents. The results showed that both sorbents and fibers produced a decrease in the bacterial population. Fibers presented selective antimicrobial activity depending on their constitution. All samples (fibers and sorbents) showed significant differences in growth at 24 and 48 h, and there was no significant difference at 72 h. On the other hand, the microbial growth of the four-evaluated species presented a statistically different growth after 24, 48 and 72 h of incubation. At 24, 48 and 72 h, the fibrous scaffolds did not cause microbial growth with significant differences  between 53 and 54 \u00b0C [PCL/PVP scaffolding was firstly studied to improve the low biodegradation rate of pure PCL scaffolds. Kim and co-workers tested different PCL/PVP ratios showing that effectively, upper concentrations of PVP cause faster degradation of PCL/PVP scaffold. As the PVP amount increases, the faster it may be released from the scaffold. PCL/PVP 50:50 ratio scaffold released 97% of the PVP within the first two hours. In addition, they found that average fiber diameters are within the range 1.27\u20131.88 \u00b5m and melting temperatures  or PVP (1.11 \u00b1 0.37 \u00b5m). Average diameters obtained with PCL/PVP 95:5 and 85:15 were 39.39 \u00b1 27.63 \u00b5m and 64.94 \u00b1 9.28 \u00b5m, respectively. The melting temperatures of PCL and PCL/PVP 95:5 and 85:15 fibers are 61.3, 59 and 58.3 \u00b0C. The melting point of fiber studied in the present work is 4\u20135 \u00b0C above those found by Kim.Differences found between fiber-scaffolds in this work and those obtained by Kim could be associated with the electrospinning conditions. The electrospinning conditions used by Kim to produce PCL/PVP scaffolds with 90:10 and 80:20 w/w ratios, voltage 10 kV, the working distance of 10 cm and flow rate of 0.75 mL/h. Meanwhile, the optimized conditions to produce all scaffolds in this work were a concentration of 13%, voltage 20 kV, flow rate of 1 mL/h and the working distance of 20 cm. Furthermore, it is essential to note that PVP type of molecular weight could also contribute to the differences. Kim used a PVP with a molecular weight of 360 kDa while we used a 40 kDa one. An essential factor to consider in the fabrication of polymeric scaffolds is their thermal stability. Dini et al. , pointedThe thermal stability is not the only consideration to produce dressings scaffolds. Low-degradation kinetics of PCL in vivo  make an A prerequisite to use of electrospun nanofibrous scaffolds in biomedical applications is their adequate mechanical properties ,79. The \u22121), determined by macro-tensile testing (Instron), is 190 \u00b1 6 MPa. The differences between Young\u2019s modulus of PCL fiber scaffolds and the extruded films may originate due to the porosity of fiber scaffolds, interactions between fibers  and fiber orientation [In this study, Young\u00b4s modulus values of PCL samples were less than (0.32 MPa) compared to literature, where the same fibers presented value 3.8 \u00b1 0.8 MPa. In the case of the average value of strain at break, samples in this work presented a value of 95 \u00b1 16% lower than the reported PCL fibers (170 \u00b1 10%) . These dentation .In the case of PVP electrospun fibers reported in the literature, the % of elongation at break is 9.10 \u00b1 0.2%, and the ultimate tensile strength is 2.30 \u00b1 0.2 MPa . In caseThe Young\u2019s modulus measured for the fiber scaffolds remains relevant for their use as wound dressings, as it predicts the mechanical response of the non-woven scaffold in contact with adjacent tissues. Finally, the mechanical properties of single nanofibers within the scaffolds are also crucial in the understanding of the cells behavior when they will be attached to the fiber as they are developing new tissue .Nevertheless, since Young\u2019s modulus of the human skin fluctuates between 0.42 MPa and 0.85 MPa , in the PCL and PVP have been reported to be biocompatible polymers and have been used in tissue engineering and drug delivery systems ,84,85. TIn order to establish the cytocompatibility of polymeric scaffolds with HFF-1 fibroblast cells, the cellular viability was determined after 24 h exposure to the polymeric scaffolds. As mentioned before, PCL have been reported as a low bioactive polymer . DespiteThe results of this work showed that PVP added to PCL reduces growth promotion but not interfere with cell proliferation. The PCL/PVP 85:15 scaffold exemplifies the above . Pseudomona aeruginosa and Escherichia coli, and one Gram-positive bacteria Staphylococcus aureus were chosen to test antibacterial bioactivity of the PCL/PVP fibers and sorbents. These bacterial strains were used because they can cause skin infection with severe damage, such as the case of Pseudomona aeruginosa [Escherichia coli can be isolated from surgical and traumatic wounds, foot ulcers and decubitus [Staphylococcus aureus are related with skin and soft tissue infections in ambulatory care [Candida albicans was chosen because diverse fungal species commonly colonize the human skin. Some Candida species, especially C. albicans, do not only reside on the skin surface as commensals but also cause infections by growing into the colonized tissue [One of the most important contributions of this work is the identification of the antimicrobial properties of the PCL/PVP 85:15 scaffold. Two Gram-negative bacteria such as ruginosa ,91, Eschecubitus  and Stapory care . For antd tissue ,95.S. aureus and E. coli  with 16.66% drop of activity after 24 h of contact and with S. aureus (ATCC6538) with 13.33% drop of activity after 24 h of contact [E. coli and S. aureus [Despite the fact that PCL and PVP are polymers with no antimicrobial properties, our results showed that pure PCL in the form of fibers show slight antimicrobial activity for  E. coli ; similar contact . Finally. aureus .P. aeruginosa and S. aureus, and moderate activity for E. coli and C. albicans. The improvement of antimicrobial activity for PCL/PVP 85:15 scaffold compared with pure PCL fibers could be associated with the prolonged release of PVP. As observed in tumor cells, PVP could interfere with SOD and other antioxidant enzymes of bacterial and fungus to produce growth inhibition [On the other hand, PCL/PVP 85:15 scaffold showed an important antimicrobial activity for hibition ,98. The Candida albicans ATCC 10231, Bacillus subtilis ATCC 6633 and Bacillus cereus ATCC 11778. In other study, pure PVP films shows bioactivity against E. coli and S. aureus. Reducing about ~61% of S. aureus growth and ~50% of E. coli growth when PVP is used as coated film on plastic and glass [In the case of the reduction of microbial growth due to the pure PVP fibers presence is confirmed by Adomavi\u010di\u016bt\u0117 et al. . It was nd glass .S. aureus [S. aureus, P. mirabilis, MRSA and P. aeruginosa [P. aeruginosa proliferates rapidly, this bacterium secretes extracellular polymeric substances (EPS) after 6 h been exposed to PCL scaffolds, indicating that the first hours after inoculation are critical for inhibiting biofilm formation [C. albicans  were evaluated. These components are non-toxic, flexible, with the ability to avoid infection thanks to the Argovit\u2122 included in the sorbent and can absorb and retain water.This work evaluated the physicochemical properties, cytocompatibility and antimicrobial activity of polymer scaffold and sorbents that will be part of the wound treating dressings. The PCL/PVP 85:15 fibrous scaffolds obtained by electrospinning possessed adequate mechanical properties, melting temperature and decomposition rate in physiological solution and may be used for dressings production. This scaffold produces no modification on cellular viability of HFF-1 fibroblast after 24 h of exposure compared with the negative control that demonstrates its cytocompatibility in wound healing. In addition, the PCL/PVP 85:15 scaffold showed antimicrobial activity against Gram-positive, Gram-negative bacteria and fungus cultures. All these features combined with the good water uptake of sorbent Ag-Si/Al"}
+{"text": "Cancer is one of the leading causes of death globally. The development of drug resistance is the main contributor to cancer-related mortality. Cancer cells exploit multiple mechanisms to reduce the therapeutic effects of anticancer drugs, thereby causing chemotherapy failure. Natural products are accessible, inexpensive, and less toxic sources of chemotherapeutic agents. Additionally, they have multiple mechanisms of action to inhibit various targets involved in the development of drug resistance. In this review, we have summarized the basic research and clinical applications of natural products as possible inhibitors for drug resistance in cancer. The molecular targets and the mechanisms of action of each natural product are also explained. Diverse drug resistance biomarkers were sensitive to natural products. P-glycoprotein and breast cancer resistance protein can be targeted by a large number of natural products. On the other hand, protein kinase C and topoisomerases were less sensitive to most of the studied natural products. The studies discussed in this review will provide a solid ground for scientists to explore the possible use of natural products in combination anticancer therapies to overcome drug resistance by targeting multiple drug resistance mechanisms. Cancer is the second most common cause of death after cardiovascular diseases. Statistics from the USA showed that the number of people diagnosed with cancer was 1.7 million in 2017 with 0.6 million deaths . In someNowadays, one of the most prominent challenges for cancer treatment is drug resistance as malignant cells persuade different mechanisms  to deviaOne of the primary mechanisms for chemotherapy resistance is drug efflux, which is defined as drug transportation from the intracellular milieu using energy-dependent pumps ,13. HighSophisticated transmembrane transporters direct drug efflux, mainly the ATP-binding cassette (ABC) family . In humaABCB1, also known as MDR1 or P-glycoprotein (P-gp), is one of the well-characterized transporters associated with drug resistance for several types of tumors such as leukemia and colorectal, kidney, and lung multiple myeloma ,19,20. FABCC1 overexpression, also known as a multidrug resistance-associated protein-1 (MRP1), plays a crucial role in the failure of chemotherapy in a number of malignant tumors, including prostate, breast, and lung cancers ,23,24,25ABCG2 is recognized as a primary breast cancer-efflux transporter known as breast cancer resistance protein (BCRP) ,30. ABCGFurthermore, overexpression of ABCC2 and ABCC3 has a pivotal effect on the resistance of multiple cytotoxic drugs such as methotrexate, cisplatin, doxorubicin, and etoposide ,34. ThesDrug detoxification is considered one of the prominent mechanisms to confront chemotherapy treatment. This process involves two main pathways. The first pathway (Phase I) is mediated by cytochrome P450 enzymes (CYP450), which encompasse hydrolysis and oxidation-reduction reactions ,38. The One major drug-resistance conjugation pathway is glutathionylation, which is mediated by the GSH-GST system . GST, a Unfortunately, several chemotherapeutic drugs are substrates for detoxification processes. Therefore, focusing on the machinery of this area may help in overcoming the resistance problem.Inhibition of cell death is a fundamental hallmark of cancer. Anticancer medications mainly target this mechanism by inducing programmed cell death, also called apoptosis . ConsequThe disparity between the pro and anti-apoptotic molecules also plays a role in inducing resistance against anticancer therapy . Hence, Numerous chemotherapeutic drugs target DNA damage of the cancerous cells as the main mechanism of action, such as platinum-based drugs, alkylating agents, and anthracyclines . However6-methylguanine DNA methyltransferase (MGMT) repair enzyme, as glioblastoma patients with increased levels of MGMT showed poor treatment outcomes and higher mortality rates compared with the patients with reduced expression levels -4-hydroxy-3-methoxycinnamate (EHHM), is acquired from Livistona chinensis. It has been reported that autophagy enhances cell longevity in HCC cells administered EHHM; EHHM could therefore be a potentially efficacious strategy for treatment of this tumor .When berberine is used in combination with lung cancer radiotherapy, in addition to inducing autophagy cell death in vitro and in vivo, it has also been shown to induce autophagy and apoptotic cell death in different hepatocellular carcinoma cells . As evidOne of the major bioactive components in green tea is Epigallocatechin-3-gallate (EGCG) ,508,509.Curcuma longa L., Curcuma zedoaria (Christm) Rose., Curcuma amada Roxb., and Curcuma petiolate [2/M arrest and autophagy [Curcumin is the major bioactive component extracted from etiolate ,358,477.etiolate ,520,521.utophagy .Antioxidant N-acetyl-L-cysteine (NAC) blocked the curcumin-induced molecular effects, suggesting that curcumin-induced ROS implicated in autophagosome development . NAC alsThe curcumin-induced autophagy was shown to be ROS-dependent . CurcumiThe survival rate against thioacetamide-induced HCC was observed to be increased by curcumin . The comCurcumin is the most extensively studied natural compound for the prevention and treatment of cancer . HoweverSome of the Chinese medicinal herbs induce autophagy ,366,473.Terpenoids are the largest class of natural compounds exhibiting multiple antitumor properties, especially due to their selectivity toward tumor and cancer stem cells (CSC) ,535,536.Triptolide is a diterpenoid from the roots of Tripterygium wilfordii and was found to inhibit the proliferation of 60 US National Cancer Institute cancer cell lines ,544. FurOridonin, a diterpenoid extracted from Rabdosia rubescent, promoted autophagy in L929 cells through p38 MAPK and nuclear factor kappa B (NF-kB) pathways ,553,554.Celastrol induced autophagy in human gastric cancer AGS and YCC-2 cells . MoreoveSulforaphane is found in cruciferous vegetables, such as broccoli, cabbage, cauliflower, and hoary weed . SulforaRecently, a novel alkaloid called Monanchocidin A (MonA) was isolated from the marine sponge Monanchora pulchra . MonA exCannabinoids promote autophagy-dependent apoptosis in melanoma cells . TreatmeSeriniquinone, isolated from a marine bacterium of the genus Serinicoccus, demonstrated potent anti-proliferative activity toward melanoma cell lines by activation of autophagocytosis, while targeting small protein, dermcidin . OblongiPlant lectins have been considered as possible antitumor drugs because of their ability to induce autophagic cell death ,579,580.Thymoquinone exposure resulted in caspase-independent, autophagic cell death in human LoVo colon cancer cells . HonokioJujuboside B is a saponin from the Zizyphus jujuba var. spinosa seeds. Jujuboside B induced autophagy and apoptosis in human AGS and HCT-116 gastric adenocarcinoma cells in vitro and efficiently inhibited cancer growth in a nude mouse xenograft model bearing HCT-116 cells in vivo . MoreoveA polymethoxy flavonoid, nobiletin has been shown to inhibit cellular replication in human SKOV3/TAX cells through apoptosis and autophagic flux suppression. Comparatively, via Akt signalling, the disturbed autophagic process activated nobiletin-induced apoptosis in this cell line. These data provided evidence to suggest that in human ovarian tumor cells, nobiletin can surmount multi-drug resistance by inhibiting autophagic disruption via Akt modulation . EGFR anNevertheless, T790M mutation, which increases TKIs resistance generated by EGFR, has transpired to be a key difficulty in tumor therapy. An admixture of wogonin and icotinib was noted to surmount icotinib resistance arising via T709M . An elevDerived from Sophoraflavescens Aiton, matrine is a major quinolizindine alkaloid . The serMixing autophagy interventions with molecular targeted treatment is thought to offer a positive therapeutic approach to HCC . Data am2, oroxylin A, resveratrol, and kaempferols. mTOR signalling pathway phosphorylation may be suppressed by myricetin. Autophagy could be instigated by galangin via the TGF-p receptor/Smad. Safeguarding autophagy linked with the negative modulation of CD147 and ER stress could be provoked by baicalein. Wogonin, in combination with sorafenib, WZ35, and tangeretin has anti-HCC effects mediated through autophagy inhibition.Polyphenols have a distinct capacity to inhibit cell replication and to initiate apoptosis or autophagy in HCC; this ability has drawn attention to their possible use for targeted treatments. In brief, polyphenols, e.g., apigenin, oroxylin A, and resveratrol, may act as inhibitors for the PI3K/Akt/mTOR signalling mechanism. LC3 II evolution, and thus autophagy inducement, is contributed to by luteolin, isoorientin, quercetin, kaempferols, curcumin, adriamycin (doxorubicin) with curcumin, EGCG, EHHM, delphinidin, EF25-(GSH)Multiple biological properties of the naturally occurring polyphenols in the diet encompass antitumor and autophagy-enhancing influences. Research has demonstrated that polyphenolics enact their anti-HCC activities through interference with the autophagic process, e.g., activation of Beclin-1, Atg5, Atg7, Atg9, Atg12, LC3-II, and SQSTM1, together with the modulation of PI3K/Akt/mTOR, PTEN, P38/PPAR-a, JNK/Bcl-2, ER stress, p62, p53-dependent, TGF-p receptor/Smad signaling, and YAP. These data suggest that they are possible agents with multiple modes of action against HCC, which is a catastrophic pathology.Key factors to take into account with pharmaceutical agents sanctioned by the FDA, e.g., sorafenib, are their adverse event and strength profiles, as these indicate potentially serious unwanted side effects, such as liver toxicity, inflammation, bleeding, fistulas, rashes, high blood pressure, ischemia, and wound reparation issues. Similarly, outcome data on HCC therapies in individuals with advanced cirrhosis are not accessible. Thus, a preferable option would be to couple autophagy-modulating hepatoprotective polyphenolic compounds, with favorable safety statistics, with anti-HCC agents sanctioned by the FDA in order to offer new treatment approaches encompassing autophagy modulation. Furthermore, the development of de novo therapies for HCC should include such polyphenols in their research.The development of resistance to pharmaceutical agents decreases their therapeutic impact. As autophagy contributes to cancer advancement, influencing this process using naturally arising substances is a potentially encouraging approach to combat multidrug resistance in malignant cells. However, the lack of testing in in vivo models, therapeutic protocols, and evaluations of phytochemical toxicity weakens the published data from single studies and makes it challenging to predict the effectiveness of substances derived from plants in the therapy of specific forms of neoplasia.Oncosis is described by cell lysis and rapid cell and organelle swelling, in addition to membrane permeability. Oncosis is associated with intercellular events involving swelling of the mitochondria, depletion of adenosine triphosphate (ATP), failure of calcium ion homeostasis, activation of certain proteases , disruption of lysosome, and finally rupture of the plasma membrane ,593.In addition to chemotherapy, radiation, genetic, or immune therapeutic strategies as well as combinatorial approaches, natural antitumor products with promising safety and efficacy are setting an important stage for the new anticancer treatments ,594,595 Artemisia annua L. (sweet wormwood), has been used as one of the well-known traditional Chinese medicines for many years in the treatment of fevers and chills [Artemisinin, which was extracted and separated from d chills . In pancd chills . The ford chills ,598,599.d chills .The exact mechanism of action of artemisinin is still controversial, and the target of action has not been completely revealed. Current research shows that artemisinin uses multi-approaches and multi-links to influence the tumor progression. Both apoptotic and non-apoptotic cell death are involved in the anticancer activity of artemisinin. Furthermore, artemisinin affects cancer metabolism and immunosuppression. However, the related literature is still limited, and more in-depth research into these aspects is required.One of the most recent forms of non-apoptotic cell death is methuosis. The name of methuosis, which is derived from the Greek \u2018methuo\u2019 and means \u2018to drink to intoxication\u2018, was chosen because the most prominent characteristic in cells undergoing this phenotype of death is the accumulation of large fluid-filled cytoplasmic vacuoles that originate from macropinosomes ,602,603.Macropinocytosis is defined as a non-selective liquid-phase endocytic pathway for the extracellular substances\u2019 uptake . MacropiRecently, the relationship between tumors and macropinocytosis has attracted more attention as it might has a great research value for tumor survival and treatment . AccordiFirstly, it is not clearly confirmed whether methuosis represents a recent unique phenotype of controlling cell death or whether it is just a subtype of oncosis or necrosis ,613. AddAdditionally, macropinocytosis can both enhance cancer survival and has detrimental effects on cancers ,624,625.The understanding of molecular pathways involved in non-apoptotic cell death induced by natural anticancer drugs would assist in exploiting novel molecular targets of plant-derived compounds necessary to advance safer and effective anticancer therapeutics allowing to circumvent cancer drug resistance ,631,632.Although most antitumors reduce the size of tumors significantly , they faThe ability of natural products and their derivatives to prevent, inhibit, and reverse the progression of cancer has been clinically studied. Surveys indicate that approximately 80% of cancer patients use natural products in combination with classic anticancer drugs . This shMore and more evidence has shown that natural compounds are highly specific to tumor cells and have minimal adverse effects on normal neighboring cells; therefore, they bring great hopes for future anticancer therapies ,633. It The principal objectives for combination therapies encompassing prolongation of survival rates and enhancing life quality include mitigating the cytotoxic adverse event profiles of pharmaceutical agents and simultaneously diminishing tumor resistance and unwanted drug effects.Natural compounds such as flavonoids, sesquiterpenes, alkaloids, diterpenoids, and saponins, in addition to polyphenolic compounds, to overcome drug resistance ,668 are Although sufficient data were available from clinical trials conducted on animals to prove the efficacy of resveratrol with respect to tumor therapy, few in vitro clinical studies have been conducted in human cells. Thus, there is a dearth of results relating to human trials that assess the effectiveness of resveratrol in cancer resistance treatment. The data exhibited unpredictable outcomes with respect to the use of resveratrol because the majority of these clinical trials used different doses and routes of administration with a small sample size of patients .Resveratrol can efficiently exhibit its antitumor effects in combination with other chemotherapeutic agents in addition of having an excellent safety profile. A number of important challenges need to be considered before bringing resveratrol to the bedside owing to its rapid metabolism giving rise to limited bioavailability in humans .The role of melatonin in cancer treatment and prevention has been widely studied, and numerous experimental studies proved the antitumor effect of melatonin against many types of cancers. The combination of conventional anticancer therapies with melatonin showed promising results through reinforcing the therapeutic effects of these therapies . OverallIt has been proposed that melatonin\u2019s benefit in mitigating the toxic effects of chemotherapy and its association with aberrant mitochondrial function should be explored using double-blind, placebo-controlled trials. It can be expected that a plethora of information will emerge over the next ten years relating to the way in which melatonin exerts a positive effect in conjunction with chemotherapeutic agents . The devIt is well established that therapy for individuals presenting with glioblastomas is complex; curative surgery is nearly impossible, and the majority of tumors exhibit a high recurrence rate despite treatment with radiation and chemotherapy . Thus, sLissoni et al. published a study investigating treatment with an admixture of melatonin and aloe vera . The purThe data relating to the utilization of melatonin as an adjunct to chemotherapy are encouraging, both in terms of augmenting the effectiveness of therapy and mitigating adverse event profiles ,675. HowTraditional Chinese Medicine (TCM) uses a combinatorial method of two or more agents to achieve a synergistic effect . TCM hasCurcumin is a common term used for a mixture of curcuminoids that are purified from the Indian spice turmeric powder, mainly comprised of curcumin (curcumin I), demethoxycurcumin (curcumin II), and bisdemothoxycurcumin (curcumin III) . CurcumiCurcuminoids are known to have many biological activities, including anti-inflammatory ,687, antClinically, poor bioavailability is the one major problem with using curcumin. The levels of curcumin in plasma and tissues remain low after oral consumption, reported to be in the range of nanomolars and picomolars, respectively . CurcumiClinical trials offer the opportunity to verify and to identify the impact, side effects, and pharmacokinetics of therapeutic agents. Since curcumin\u2019s bioavailability is low, many curcumin formulations have been manufactured and have undergone testing in clinical trials ,695,704.More importantly, both phase I and II clinical studies with curcumin have been carried out and showed some encouraging results. Despite its poor bioavailability, phase I studies indicated that curcumin is well tolerated  and provAmong all natural product modulators, the most well-studied and well-known are flavonoids, which include flavonols, flavones, isoflavones, flavanols, flavanolols, flavanones, and chalcones . TypicalArtemisinin possesses some advantages, including less susceptibility to resistance, that makes it worthy of development as a novel anticancer agent. In Pubmed, there are only three studies in the last three years. Some previous clinical studies before 2019 have been comprehensively reviewed by Efferth and Zhang et al. ,722. DesSanctioned by the State FDA of China, the compound Kushen Injection (CKI) has been utilized as an adjunctive therapy to Western antitumor medication for various forms of malignancy . It compPolyphenolic natural products, such as Ellagic Acid and Schisandrins, represent a chemically unique class of molecules as potential anticancer agents to overcome multidrug resistance in cancer . HoweverEpigallocatechin gallate (EGCG) is one of the major bioactive components in green tea. EGCG enhances the effect of cisplatin and oxaliplatin-induced resistance of cancer cells and exerts synergistic effects with anticancer agents. In addition to cisplatin and oxaliplatin, these agents include temozolomide, doxorubicin, resveratrol, vardenafil, erlotinib, and curcumin ,727,728.In order to appraise the acceptability, pharmacokinetics, and effectiveness of EGCG in humans for tumor therapy, clinical studies are in progress. A phase I clinical trial evaluating therapy for radiation dermatitis in patients with breast neoplasia studied concurrent radiotherapy and EGCG solution. The highest dose of 660 pM of EGCG was without significant side effects , and theGambogic acid (GA) is one of the main compounds derived from the gambogic resin exuded from a plant of the genus Garcinia . It has 2. Patients taking GA on days 1\u20135 within a two-week cycle showed a higher rate of disease control, with only grade I and II adverse reactions. A phase IIb clinical trial with a larger sample size of participants would be required to better investigate the safety and efficacy of GA.To asses the safety and effectiveness of GA in patients with advanced malignant tumors, different doses have been compared in a phase IIa clinical trial . GA is sA major limitation in all of the clinical studies has been the identification of appropriate pharmacodynamic biomarkers evaluating changes in autophagy.Autophagosomal configurations can act as scaffolds to initiate apoptosis  and necrContemporary clinical trial designs frequently permit specimen gathering from malignancies, together with serum pre and post therapy. These may assist in the generation of improved bioindicators to act as pharmacodynamic markers for the effectiveness of autophagy inhibitors and to enhance patient selection for this therapy type. If enhanced clinical trials are added to in-depth molecular and cellular appraisal in order to comprehend the pathways underpinning the setting-reliant influence of autophagy on malignancy, a more logical foundation to inform judgements about when and in which trajectory autophagy could be influenced during tumor treatment could be developed. As changes in autophagy are inevitable during malignancy and such alterations will impact cancer progression, turning a blind eye to the issue is a poor choice. It is preferable to comprehend the biology and then use that information in effectively designed clinical studies.The final objective of laboratory tests is to attain clinical usage. In clinical trials, subjects are typically split into two cohorts, i.e., controls administered traditional chemotherapy and the intervention arm who are additionally given natural products. The impact of Fritillariae thunbergia was evaluated in 90 individuals with acute leukemia ; compareInhibitors or modulators derived from natural resources are occasionally termed \u2018fourth-generation inhibitors\u2019. Such substances offer a spectrum of de novo chemical scaffolds that are apposite for the creation of new agents. It can be anticipated that scientists appreciate the role of screening for novel natural compounds that exhibit these properties, as they are more likely to have a positive outcome than many existing products. There is an enormous range of resources that could be used; biologically active constituents are currently derived from vegetation, fungi, and even sea life, following which they are purified and studied in depth. An advantage is that these natural substances are typically of minimal toxicity and produce few side effects.Individuals with solid tumors  and dissAlthough uncertainty remains, clinical modulation of autophagy in oncology is currently in progress  with mosChemical biology methods and cell culture-based approaches are powerful but have limitations that can unintentionally introduce confusion or uncertainty conclusion. Consideration of these limitations may help avoid common pitfalls and, in the fullness of time, lead to useful reinterpretation of existing data. Thus, additional future studies using in vivo systems and better clinical trials for the clinical management of resistance to drug-induced tumor cell death are needed to determine the clinical effectiveness and safety of these natural compounds.While many natural products used for cancer are associated with minimal or no risk, this is not true for all such therapies. Potential toxicities include direct toxicity of natural products, indirect effects of natural products due to interactions with other medications, and also the risk to the patient who uses natural products to avoid or delay established, effective treatment in the management of cancer disease ,749.There are some potential side effects associated with commonly used natural products and other types of CAM ,751. ForMany natural products are pharmacologically active, raising concerns about potential interactions with conventional therapy, both cytotoxic agents, and other medical therapies ,754,755.Although not a direct \u201ctoxic\u201d effect, the use of natural products may result in a significant delay in instituting conventional treatment that is of documented benefit for a specific condition . As non-In a previous report, 258 patients diagnosed with nonmetastatic breast, prostate, lung, and colorectal cancer in the National Cancer Database between 2004 and 2013 who underwent alternative medicine treatment as the sole therapy  and who also did not receive conventional cancer treatment were compared with a matched cohort of 1032 patients who received conventional cancer therapy . PatientThe use of autophagy-related kinase inhibitors/activators may lead to unwanted and uncontrolled side effects, despite their potential therapeutic benefits in animal models. Considering the protective properties of autophagy on neurons, it is reasonable to enhance the brain specificity of autophagy-related therapies for neurodegenerative conditions. Different delivery approaches and photodynamic chemotherapy are proposed to attain the goal of organ specificity. Additionally, as known for the common kinase drugs, these autophagy-related kinase inhibitors/activators share the complications of target selectivity and resistance .The lack of cancer cells\u2019 killing selectivity of thapsigargin prevent its direct use as an anticancer agent. To transport thapsigargin directly to cancer sites, some prodrugs have been developed. For example, G115 and G202 are prodrugs created by a conjugation of thapsigargin to substrates of proteolytic enzymes that are available only in tumor cells. Additionally, JQ-FT is an antileukemic prodrug established by a conjugation of a thapsigargin derivative and folic acid. These prodrugs represent an efficient way to overcome thapsigargin cytotoxicity and provide targeted cancer therapy .Natural products are emerging as a promising source for effective anticancer agents. The numerous sources of these products cause high diversity in targets and mechanisms of action. Such diversity has encouraged scientists to consider natural products as therapies for drug resistance in cancer. Some natural products showed high potential to target drug resistance mechanisms in cancer and caused tumor regression. Many of these natural compounds were successfully considered as therapies in preclinical and clinical studies. However, the use of natural product as a standard therapy to treat drug resistance is still limited. Further studies are needed to explore the potential of natural products in combination therapies to overcome drug resistance. Future studies can focus on studying the possible synergistic effect of natural product combinations to target multiple biomarkers in drug resistance. Studies can also consider using natural products as adjuvant treatments to augment conventional anticancer therapies."}
+{"text": "The Barail sandstone in the Surma Basin is a medium- to coarse-grained pinkish-colored rock exposed near the northeastern margin of Bangladesh. In this study, we evaluated the reservoir quality of the Barail sandstone based on its petrophysical and petrographic characteristics. Petrophysical analyses of outcropped samples showed that sandstones are made up of 16.48% porosity and 132.48 mD permeability. Sandstone density ranges from 1.94\u00a0g/cm3 to 2.37\u00a0g/cm3, with a mean value of 2.12\u00a0g/cm3, shown as moderately compacted sandstone. Integrated data such as bulk density, porosity, permeability, Rock Quality Index (RQI), Normalized Porosity Index (NPI), Flow Zone Indicator (FZI), compressive strength, etc. with their relationships indicate that Barail sandstone owing characters to become a good petroleum reservoir. The rock samples consisted mainly of quartz with an insignificant amount of rock fragments and plagioclase feldspar and are categorized as sub-arkose to sub-litharenite. The rock samples also contains lithic  of granitic and gneissic fabric and some volcanic product like aguite, albite, andesine, garnet, spinel and ulvo-spinel indicating the source of nearby orogeny. The euhedral to subhedral shape of the quartz grain in a porphyritic texture, moderately sorted with a smaller amount of clay minerals indicating the moderately mature rock type. The iron oxide border around the quartz grain also indicates that the Barail sandstone was deposited under dry climatic condition. Petrophysical analysis involves the investigation of physical and chemical properties and their interaction with fluids . The Bokabil Formation is sand-dominated thick channel deposits with finely interlaced shale and siltstone with porosity ranging from 10 to 20%  locations within exposed sections , Shahjalal University of Science and Technology (SUST). The cylindrical samples (about 3.7\u00a0cm\u2009\u00d7\u20096.5\u00a0cm) were prepared from collected samples from the field with help of core plug. The samples were cleaned and then dried at a temperature of 90\u00a0\u00b0C overnight to avoid deformation and alteration of clay by heating.\u03c3b) of rock samples was measured using direct methods for geometric shapes , where the bulk volume (Vb and dry weight of the core samples (Wd) were measured using a precision caliper (0.1\u00a0mm precision) and an electronic balance (0.1\u00a0mg precision).The bulk density (\u03c3b) was calculated as:The measured rock bulk density (\u03c3g) was determined by the product of the porosity measurement using the equation below.Vg is the volume of rock grains, which can be calculated according to the following equationVp is the volume of the pores.TPI-219 Helium porosimeter (Core test system Inc.) was used to determine the porosity. The porosity of the rock (Bilham and England) uses the two helium matrix-cup porosimeters for the estimation of grain volume, which follows Archie's law for determining bulk volume. Grain density , reservoir quality index (RQI) and normalized porosity index (NPI) values , NPI is the ratio of pore volume to grain volume and RQI and FZI are in microns.RQI and NPI are used to determine FZI, which is a unique and useful value to quantify the flow character of a reservoir and one that offers a relationship between petrophysical characteristics at small-scale, such as core plugs, and large scale, such as wellbore level  using triaxial  setup at the Geotechnical Engineering Lab, PME, SUST at a vertical speed of 0.2\u00a0mm/m. Fig.\u00a0.Fig. 3SaThe specimens were examined with different types of microscopes. Thin sections were prepared and examined by an optical polarized transmitted light microscope device (Olympus BX51 TF Japan and OMAX-BMQB333V173 BDKC180L3) connected with a digital camera under 10X up to 40X magnification. X-ray diffraction (XRD) was carried out in the materials laboratory of the Department of Physics, SUST, for selected rock samples (six samples). XRD analyses for six samples were carried out using Rigaku Ultima-IV and were performed with Cu-K\u03b2 radiation operating at 9\u00a0kV with D/teX Ultra 250 detector of a scan rate of 0.01\u00b0 2\u03b8 per second with scan range 15\u201380\u00b0. Mineral grains in sandstone and rocks fragments were identified using the WPPF software which uses Crystallographic Open Database (COD) as a baseline database. The COD could fully identify \u201csmall molecules/small to 180 medium unit cells\u201d crystal configurations. Thin sections were prepared for all samples but selective samples were analyzed based on their quality  and facies 2 (sub-litharenite).Barail Sandstone has porosity ranges from 10.29 (for sample 8) to 23.79 (for sample 17) with an average value of 16.48 . The density\u2013porosity ratios in these diagrams are linear and controlled by the following equations.The bulk density and porosity relationships for the samples studied are illustrated in Fig.\u00a0For facies 1For facies 2r\u2009=\u20090.58 and 0.68 for Facie1 and 2, respectively). These relationships can be derived from linear equations;The permeability and bulk density relation is illustrated in Fig.\u00a0For facies 1For facies 2r\u2009=\u20090.74 and 0.60 for facie1 and 2, respectively), while some data points are scattered. Exponential regression equations representing such relationships for facies 1 and facies 2.Permeability and porosity cross-plot Fig.\u00a0c shows dFor facies 1For facies 2Figure\u00a0r\u2009=\u20090.35 and 0.09 for facie1 and 2, respectively), while certain data points are dispersed. However, the equations that represent these relationships are:The reservoir quality index (RQI) values of the Barail sandstone samples are directly related to the porosity Fig.\u00a0d. The poFor facies 1For facies 2r\u2009=\u20090.81 and 0.56 for facies 1 and facies 2, respectively). This means that the reservoir exhibits the high value of heterogeneity. The following equations may be used to represent the relationships:The RQI values of Barail sandstone samples are directly related to the permeability shown in Fig.\u00a0For facies 1For facies 2From the above relationship, we observed that the reservoir quality index RQI is not mainly dependent on permeability. However, rock strength and bulk density have a linear correlation.r\u2009=\u20090.67 and 0.69 for facies 1 and 2, respectively) between them as compressive strength increases with increases of bulk density  among the rock fragments. Certain dark-colored minerals are found in rock samples Figs.\u00a0\u20137. Quartdark-colored minerals, are also notable in some samples Fig.\u00a0a\u2013d. SurfIntegration of porosity and permeability with RQI, NPI and FZI used to reservoir quality analysis is popular to quantify the reservoir rocks. However, core plug measurement is still well accepted for porosity and permeability measurement rather than geophysical observation. Porosity and permeability measured in the present study are 16.48% and 132.48 mD Table b; porosiThe Barail sandstone formation exposed within the Dauki Fault area, and these sediments are believed to be deposited early in the collision of the Indian and Burmese submarine plates and granitoids have been deposited in the active continental margin  and insignificant amount of feldspar (5%) and rock fragments (7%). Based on volumetric analysis, the sandstones are categorized as sub-arkose to sub-litharenite types. XRD analyses support the thin section analyses and also identified rock fragments within the samples. Feldspars are alkali, but plagioclase feldspar also observed in some thin sections. Rock samples contain gneissic lithic material of continental felsic rocks and also contain volcanic product such as augite, spinel and ulvo-spinel. Iron oxide rim around quartz grains indicates that samples experienced moderate degree of chemical weathering under arid climatic condition. Moreover, Barail sandstone with moderate maturity exhibits that these rocks have better reservoir quality."}
+{"text": "KMT2A gene (NM_001197104.2). In this article, we discuss a 5-year-old boy who has mild intellectual disability (ID), hypotonia, HC, hypertrichosis on the back, dysmorphic facies, psychomotor retardation, and growth delay. Trio-based whole-exome sequencing (trio-WES) was carried out on this patient and his parents, confirming the variants with Sanger sequencing. Trio-WES showed a de novo mutation of the KMT2A gene . On the basis of the clinical features and the results of the WES, WSS was diagnosed. Therefore, medical professionals should consider a diagnosis of WSS if patients have growth retardation and development delay as well as hirsutism, particularly HC.Wiedemann\u2013Steiner syndrome (WSS) is a rare genetic disorder. Patients with WSS have characteristics of growth retardation, facial dysmorphism, hypertrichosis cubiti (HC), and neurodevelopmental delays. WSS is in an autosomal dominant inherited pattern caused by a mutation of the  Wiedemann\u2013Steiner syndrome (WSS) (OMIM: #605130) is an autosomal dominant genetic disease. It was first described by Wiedemann et al. in 1989 . PatientKMT2A gene  (NM_001197104.2), which was found in 2012 by Jones et al. [KMT2A gene (NM_001197104.2) is located on chr11q23.3 and encodes a histone methyltransferase (HMT) enzyme. This enzyme regulates the gene expression profile in early embryonic development and hematopoiesis [KMT2A have been reported in the Leiden Open Variation Database (https://databases.lovd.nl/shared/genes/KMT2A) accessed on 5 July 2021 [http://www.hgmd.cf.ac.uk/ac/gene.php?gene=KMT2A) accessed on 5 July 2021, 163 variants have been documented. More patients have been diagnosed with WSS using whole-exome sequencing (WES).WSS is caused by the mutation of the opoiesis . To date NM_00119104.2, whuly 2021 ,14. In tKMT2A gene.Until now, the complete WSS phenotype has not been fully understood. In this article, we discuss a 5-year-old Taiwanese boy with the clinical features of WSS using trio-based WES (trio-WES) to identify a de novo missense pathogenic variation of the Z score = \u22120.55), a body length of 48 cm , and a head circumference of 35 cm . The patient\u2019s parents were non-consanguineous, and they were phenotypically normal. The boy was referred to our genetic clinic due to mild ID and growth delay. At our clinic, the patient\u2019s weight, and height were 16.6 kg , 104.9 cm , respectively. Physical examination showed dysmorphic facies and thick hair  accessed on 5 July 2021, ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) accessed on 5 July 2021, the Genome Aggregation Database (http://gnomad.broadinstitute.org/) accessed on 5 July 2021, the Exome Aggregation Consortium (http://exac.broadinstitute.org/) accessed on 5 July 2021, the 1000 Genomes Project (http://browser.1000genomes.org) accessed on 5 July 2021, and HGMD (http://www.hgmd.cf.ac.uk/) accessed on 5 July 2021. We confirmed the identified variants via Sanger sequencing and interpreted the variants using the guidelines of the American College of Medical Genetics and Genomics (ACMG) [We collected peripheral blood from the patient and his parents for genomic DNA at the age of 5 years. Trio-WES was carried out by the National Health Research Institutes . They used the Illumina HiSeq Xten system. The trimmed reads were mapped to the reference human genome (hg19). We identified the variants using the following databases: the Single Nucleotide Polymorphism Database (s (ACMG) .KMT2A gene , which we confirmed via Sanger sequencing . His symptoms, which are compatible with WSS, include mild ID; growth delay; dysmorphic facies and thick hair; and hypertrichosis on the back, arms, and lower limbs but not on the abdomen.According to a previous study with a cohort of 33 French WSS cases , the resKMT2A gene. It is an important gene expression regulator in early development. HMT regulates multiple Wnt-related and Hox-related genes in histone H3 lysine 4 methylation [HMT is encoded by the hylation . Due to hylation , distinchylation .Patients with language delay and ID require special education classes with regular speech and occupational therapies. If symptoms of hypotonia are noted, patients should have carnitine supplementation . For patients with cardiac anomalies, surgical treatment should be considered. Because of growth retardation, children with WSS should have their pituitary function investigated. If biochemical evidence of growth hormone deficiency is noted, a pituitary magnetic resonance imaging scan should be considered, and patients should receive recombinant human growth hormone treatment. All these treatments can help patients with WSS survive with a better quality of life. WES, a powerful tool used to identify disease-causing variants, allows the relationship between genotype and phenotype to become clearer. Shashi et al.  stated tIn summary, we discussed a 5-year-old Taiwanese boy who was diagnosed with WSS via clinical features and trio-WES. He is the first patient with WSS presented in Taiwan. WSS is a rare genetic disorder that combines with sporadic syndrome and phenotypic heterogeneity. Therefore, our findings can be valuable in genetic diagnosis and mutation-based screening."}
+{"text": "Previous studies have shown that prophylactic cranial irradiation (PCI) can improve the survival of patients with limited-stage small cell lung cancer (LS-SCLC). PCI is recommended for patients who respond well to chemoradiotherapy. However, whether PCI could be extrapolated to the LS-SCLC patients in the modern era of MRI is unknown. This study aimed to explore the value of PCI in patients with LS-SCLC in the era of brain MRI.This study included 306 patients with LS-SCLC at the Cancer Hospital of China Medical University. All patients received brain MRI at diagnosis and after radiochemotherapy to exclude brain metastases. A propensity score matching was performed to reduce the influence of potential confounders. Overall survival (OS), progression-free survival (PFS), and recurrence failure types were compared between PCI and non-PCI groups.p = 0.128) or PFS  benefits. During follow-up, 30 patients (20.0%) developed brain metastases, including 13 patients (17.3%) in the PCI group and 17 patients (22.7%) in the non-PCI group. Regarding death as a competitive risk, patients who received PCI had a lower cumulative incidence of brain metastasis than those who did not .Among the 306 eligible patients, 81 underwent PCI, and 225 did not. After propensity score matching, there was no statistical difference in baseline data between the two groups, with 75 patients in each group. PCI did not achieve OS (median OS: 35 vs. 28 months, When brain MRI was performed at diagnosis and pre-PCI, PCI could reduce the cumulative rate of brain metastases, but it did not achieve survival benefits for LS-SCLC patients. Small cell lung cancer (SCLC) is a neuroendocrine tumor closely related to smoking, of which about 1/3 are limited-stage SCLC (LS-SCLC) at diagnosis. After initial treatment, SCLC patients have a high propensity for relapse and metastases. Dissemination to the brain is a preferential pattern of relapse and metastasizing for patients with SCLC, and 50%\u201360% of SCLC patients will have brain metastases within 2 years after diagnosis  reduces the rate of brain metastases and significantly improves 3-year overall survival (OS) (15.3% vs. 20.7%) . HoweverWe retrospectively reviewed LS-SCLC patients treated within our institution between January 2012 and January 2018. The inclusion criteria were as follows: pathologically diagnosed as SCLC; brain MRI was performed at diagnosis and after radiochemotherapy to exclude brain metastases; had any thoracic response  to concurrent/sequential chemoradiotherapy. The exclusion criteria were as follows: combining with other malignant tumors, chemotherapy cycles \u22642, disease progression during chemoradiotherapy, and incomplete follow-up information. In brain MRI monitoring of intracranial status, regardless of whether PCI is performed, all patients were monitored by brain MRI every 3 months for 2 years, every 6 months for 3 years, and annually after 4 years. The study was approved by the Institutional Review Board of Cancer Hospital of China Medical University.2 d1 or 25 mg/m2 d1\u20133 + etoposide, 100 mg/m2 d1\u20133; carboplatin, area under the curve (AUC) = 5\u20136 d1 + etoposide, 100 mg/m2 d1\u20133), with chemotherapy cycles \u22653.The chemotherapy regimen was mainly platinum-based chemotherapy and etoposide . In the supine position, a spiral CT  simulation scan was performed from the cricothyroid membrane through the second lumbar vertebra with 3\u20135 mm of slice thickness. The obtained scan images have been uploaded to the Pinnacle workstation. The delineation of the target area refers to the imaging data before and after chemotherapy: gross tumor volume (GTV) included clinical and imaging visible tumor lesions (primary lesions and involved lymph nodes) based on contrast-enhanced CT scan; clinical target volume (CTV) was the 5-mm expansion of GTV and the complete involved lymphatic zone, which should be adjusted appropriately according to the adjacent anatomical structure. CTV is expanded 5\u00a0mm in a 3D direction to form planning target volume (PTV). Thoracic radiotherapy was given as 50\u201366 Gy in 25\u201333 daily fractions, 5 fractions/week. When thoracic radiotherapy reaches 4\u20135 weeks, lung CT should be re-examined to compare the changes in the lesions before and after radiotherapy. If the tumor shrinks significantly, repositioning, delineating the target area, and performing reduced field irradiation based on the patient\u2019s condition.PCI was recommended for LS-SCLC patients exhibiting any thoracic response  to concurrent/sequential chemoradiotherapy within 1 month. CTV for PCI was the whole brain, and CTV expanded 3\u00a0mm was PTV. PCI was given as 25 Gy in 10 daily fractions  through the whole brain opposed lateral fields using 6\u201310 MV. The dose of radiosensitive organs at risk (OARs) was evaluated.p < 0.05 was considered statistically significant. R statistical software version 4.1.0  and SPSS 17.0 software  were used.The clinical characteristics of the categorical variables were tested by the chi-square test or Fisher\u2019s exact test for independence, and Student\u2019s t-test tested the continuous variables. A propensity score match analysis was performed for patients with/without PCI. The Kaplan\u2013Meier method was used to estimate the median OS (mOS) and progression-free survival (PFS), and the log-rank test was used for comparison between groups. The Cox proportional hazards regression model estimated the significant covariates. Brain failure risk (BFR) was modeled by the Fine and Gray subdistribution hazard method; deaths from any cause were considered a competing event. All tests were two-sided, and After exclusions, 306 patients were enrolled in our analysis. There were 206 (67.3%) male and 100 (33.3%) female patients. Of 306, 233 (76.1%) patients were clinical stage III before initial treatment. Treatment decisions were based on the results of the second cranial MRI, and finally, 81 patients received PCI (p = 0.015), patients receiving sequential chemoradiotherapy , and patients with PR or SD efficacy  were all higher than those in the PCI group. After propensity score matching, there was no significant difference in baseline data between the two groups of 75 patients per group , the mOS from LS-SCLC diagnosis was 31 months , with 3- and 5-year survival rates of 37.3% and 21.9%, respectively. The mOS was 35 and 28 months in the two groups , the median PFS (mPFS) from LS-SCLC diagnosis was 13 months , with 3- and 5-year survival rates of 16.5% and 12.3%, respectively. The mPFS was 15 and 10 months in the two groups  patients, of which 52 (69.3%) patients and 51 (68.0%) patients were in the PCI group and non-PCI group, respectively. Patients with intracranial progression only, extracranial progression only, and intracranial combined with extracranial progression were respectively 4 (5.3%) cases, 39 (52.0%) cases, and 9 (12.0%) cases in the PCI group and 6 (8.0%) cases, 34 (45.3%) cases, and 11 (14.7%) cases in the non-PCI group (p = 0.001). Regarding death as a competitive risk, patients who received PCI had a lower cumulative incidence of brain metastasis than those who did not  developed brain metastasis: 13 in the PCI group (17.3\u00a0%) and 17 in the non-PCI group (22.7\u00a0%). The median time for the central nervous system (CNS) failure was 18 and 9 months in the two groups (p = 0.037), TNM staging (p < 0.001), and efficacy of initial chemoradiotherapy (p = 0.020) were remarkable prognostic indicators associated with OS. Multivariate Cox regression analysis demonstrated that TNM staging  was independently associated with OS. Additionally, age (p = 0.032), TNM staging (p = 0.001), and efficacy of initial chemoradiotherapy (p = 0.025) were also significant prognostic indicators associated with PFS in the univariate analysis. Multivariate Cox regression analysis demonstrated that age  and TNM staging  were independently associated with PFS. However, PCI had nothing to do with the improvement of OS  and PFS . Similarly, a retrospective study analyzed 297 LS-SCLC patients who underwent baseline brain MRI and restaging brain MRI and/or CT to exclude brain metastases. Among them, 209 patients received PCI, and PCI did not improve the OS of LS-SCLC patients  (p < 0.0001) but did not achieve survival benefits .At present, gadolinium-enhanced MRI is used for the diagnosis of brain metastases from SCLC, which is a more sensitive diagnostic imaging technique than CT for identifying brain metastases (MRI vs. CT: 24% vs. 10%) ( = 0.32) . All patp = 0.002) and self-reported cognitive functioning at 6 months   . In a Ja 0.0001) . In orde 0.0001) , 17. Rec 0.0001) .p = 0.256) and the cumulative incidence of brain metastasis (p = 0.313) between the PCI and non-PCI groups  and 45 (60.0%) experienced extracranial progression in the PCI and non-PCI groups, respectively. The CONVERT study showed that 449 (82%) LS-SCLC patients received PCI after completing chemoradiotherapy, of which 173 (39%) had extracranial progression , 24. PatIt should be pointed out that the present study has limitations. First, this is a single-center retrospective study with patient heterogeneity and selection bias, although we attempted to reduce the influence of potential confounders through propensity score matching. Second, due to the limitations of the institutional database, we were unable to collect detailed information on patients\u2019 cognitive function after PCI. Moreover, we did not further analyze the data regarding the specific salvage therapy strategies after brain metastases, which may affect survival. Further clinical trials may be warranted to confirm our results and determine the most suitable patients for PCI in the era of brain MRI.This retrospective study showed that when brain MRI was performed at the time of diagnosis and pre-PCI to exclude brain metastases, PCI could reduce the cumulative rate of brain metastases, but it did not achieve survival benefits for LS-SCLC patients. Therefore, in the contemporary era of brain MRI, prospective studies are warranted to confirm the value of PCI.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.This study was a retrospective study based on data obtained for clinical purposes. We have consulted extensively with the Ethics Committee of the Cancer Hospital of China Medical University, and they believe that our study does not require ethical approval. The Ethics Committee of Cancer Hospital of China Medical University gives up the ethical approval.CQ and HY designed the research. CQ and HL performed the data acquisition. CQ and WL performed the statistical analysis. CQ, LZ, XS, and FW drafted the manuscript. All authors reviewed and approved the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "N-acyl-alkylene (3) and bis-N-thiourea-alkylene (5) \u2014as potential multifunctional agents for the treatment of Alzheimer\u2019s disease (AD). All compounds exhibited high inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) with selectivity for BChE. These new agents displayed negligible carboxylesterase inhibition, suggesting a probable lack of untoward drug\u2013drug interactions arising from hydrolytic biotransformation. Compounds 3 with bis-N-acyl-alkylene spacers were more potent inhibitors of both cholinesterases compared to compounds 5 and the parent amiridine. The lead compounds 3a\u2013c exhibited an IC50(AChE) = 2.9\u20131.4 \u00b5M, IC50(BChE) = 0.13\u20130.067 \u00b5M, and 14\u201318% propidium displacement at 20 \u03bcM. Kinetic studies of compounds 3a and 5d indicated mixed-type reversible inhibition. Molecular docking revealed favorable poses in both catalytic and peripheral AChE sites. Propidium displacement from the peripheral site by the hybrids suggests their potential to hinder AChE-assisted A\u03b242 aggregation. Conjugates 3 had no effect on A\u03b242 self-aggregation, whereas compounds 5c\u2013e  showed mild (13\u201317%) inhibition. The greatest difference between conjugates 3 and 5 was their antioxidant activity. Bis-amiridines 3 with N-acylalkylene spacers were nearly inactive in ABTS and FRAP tests, whereas compounds 5 with thiourea in the spacers demonstrated high antioxidant activity, especially in the ABTS test (TEAC = 1.2\u20132.1), in agreement with their significantly lower HOMO-LUMO gap values. Calculated ADMET parameters for all conjugates predicted favorable blood\u2013brain barrier permeability and intestinal absorption, as well as a low propensity for cardiac toxicity. Thus, it was possible to obtain amiridine derivatives whose potencies against AChE and BChE equaled (5) or exceeded (3) that of the parent compound, amiridine. Overall, based on their expanded and balanced pharmacological profiles, conjugates 5c\u2013e appear promising for future optimization and development as multitarget anti-AD agents.Using two ways of functionalizing amiridine\u2014acylation with chloroacetic acid chloride and reaction with thiophosgene\u2014we have synthesized new homobivalent bis-amiridines joined by two different spacers\u2014bis- Alzheimer\u2019s disease (AD) consists of pronounced degenerative changes in the aging brain, including widespread synaptic dysfunction and neuronal loss, leading to profound deficits in memory and cognition . At presTo date, the main successes have been the characterization of the pathogenic features of AD. These include neuronopathy (particularly of cholinergic neurons), synaptic dysfunction and loss leading to impaired neurotransmitter systems, mitochondrial dysfunction leading to oxidative stress, and the accumulation of misfolded or otherwise aberrant proteins such as tau and \u03b2-amyloid ,4,5.Among other processes that are important for cognitive functioning, cholinergic signaling undergoes a steady decline in AD, marked by a progressive decrease in the levels of the neurotransmitter, acetylcholine (ACh). A straightforward way to increase ACh concentrations is to suppress ACh degradation by inhibiting acetylcholinesterase (AChE) with anticholinesterase drugs. Those in current therapeutic use include rivastigmine (Exelon), galantamine (Reminyl), and donepezil (Aricept) ,7.Normally, brain ACh predominantly undergoes hydrolysis 80%) by AChE, and hydrolysis by butyrylcholinesterase (BChE) is supplementary. However, as AD progresses, AChE activity declines and BChE activity increases 0% by ACh,10. RecoA pathognomonic feature of AD is the deposition of \u03b2-amyloid peptide (A\u03b2) plaques in the brain . This prWe now know that AChE can mediate functions that have a bearing on AD pathogenesis, namely, its peripheral anionic site (PAS) can bring about the aggregation of A\u03b2 ,25,26. TAn important contributor to the initiation and continuation of neurodegenerative processes is oxidative stress, which occurs when the capacity of cellular antioxidant systems is insufficient to overcome the creation of reactive oxygen species (ROS) ,39. OxidThere is considerable interest in the discovery and development of multi-target-directed ligands (MTDLs), also known as multifunctional molecules or multitarget drugs or agents ,40,49,50The design of multitarget agents is a rational approach that typically involves splicing two distinct pharmacophores separated by a spacer into a single molecule. Alternatively, two identical pharmacophores could be used to produce homobivalent ligands or homodimers. As a starting point, individual pharmacophores should be used that are known to exert an action on a given target ,57,58. TA receptor, and an inhibitor of the nitric oxide synthase signaling pathway bisbisbisbisbisquinoline (4). Brown solid; Yield 22%, m.p. 103\u2013105 \u00b0C. 1H NMR (CDCl3) \u03b4: 1.75\u20132.03 , 2.12\u20132.51 , 2.80 , 3.10 , 3.21\u20133.36 , 3.10 . 13C NMR (CDCl3): 21.40, 24.17, 25.16, 27.18, 31.27, 32.46, 35.42, 129.60, 135.98, 141.28, 144.48 (C=S), 156.96, 163.57. Anal. Calcd. For C13H14N2S: C, 67.79; H, 6.13; N, 12.16. Found: C, 67.54; H, 6.013; N, 12.26.4 (2.1 mmol) in chloroform (10 mL). The reaction mixture was stirred at room temperature for 1 h. The reaction mixture was evaporated, and 10 mL of ether was added. The formed precipitate was collected on filter, washed with ether and dried. Yield 60\u201383%.1,\u03c9-Diaminoalkane (1 mmol) in chloroform (10 mL) was added dropwise to a stirred solution of isothiocyanatoamiridine 2,2\u2032-Ethane-1,2-diylbis[N-(thiourea)] (5a). White solid; Yield 78%, m.p. > 200 \u00b0C. 1H NMR (CD3OD) \u03b4: 1.62\u20131.98 , 2.02\u20132.25 , 2.53\u20132.71 , 2.75\u20133.05 , 3.60\u20133.85 . 13C NMR (CDCl3 +CD3OD): 22.62, 22.84, 23.21, 24.48, 29.93, 32.27, 34.14, 45.24, 127.16, 132.69, 140.20, 156.96, 164.25, 181.03 (C=S). Anal. Calcd. for C28H36N6S2: C, 64.58; H, 6.97; N, 16.14. Found: C, 64.88; H, 6.92; N, 16.03.2,2\u2032-Propane-1,2-diylbis[N-(thiourea)] (5b). White solid; Yield 82%, m.p. 188\u2013190 \u00b0C. 1H NMR (CDCl3) \u03b4: 1.40\u20131.95 , 1.97\u20132.21 , 2.53\u20132.71 , 2.75\u20133.05 , 3.60\u20133.85 , 6.62 , 7.68 . 13C NMR (CDCl3 +CD3OD): 22.57, 22.82, 23.14, 24.46, 29.34, 29.48, 32.23, 34.10, 41.36, 114.24, 119.22, 125.70, 127.27, 132.81, 140.72, 156.84, 164.03, 180.58 (C=S). Anal. Calcd. for C29H38N6S2: C, 65.13; H, 7.16; N, 15.71. Found: C, 65.16; H, 7.33; N, 15.56.2,2\u2032-Butane-1,2-diylbis[N-(thiourea)] (5c). White solid; Yield 83%, m.p. 194\u2013196 \u00b0C. 1H NMR (CDCl3 + CD3OD) \u03b4: 1.40\u20131.70 , 1.71\u20131.97 , 2.00\u20132.21 , 2.53\u20132.71 , 2.75\u20133.05 , 3.50\u20133.73 , 6.62 , 7.68 . 13C NMR (CDCl3 +CD3OD): 22.76, 22.98, 23.30, 24.61, 26.64, 29.60, 32.30, 34.20, 44.70, 127.49, 133.16, 141.69, 156.64, 163.90, 180.86 (C=S). Anal. Calcd. for C30H40N6S2: C, 65.66; H, 7.16; N, 15.31. Found: C, 65.80; H, 7.01; N, 15.59.2,2\u2032-Pentane-1,2-diylbis[N-(thiourea)] (5d). White solid; Yield 88%, m.p. 185\u2013187 \u00b0C. 1H NMR (CDCl3 + CD3OD) \u03b4: 1.21\u20131.38 , 1.55\u20131.73 , 1.75\u20131.97 , 2.02\u20132.21 , 2.59\u20132.74 , 2.75\u20133.11 , 3.40\u20133.71 . 13C NMR (CDCl3 +CD3OD): 23.43, 23.63, 23.88, 25.13, 25.24, 29.80, 30.17, 32.81, 34.67, 45.70, 128.53, 134.21, 143.30, 156.83, 164.16, 181.65 (C=S). Anal. Calcd. for C31H42N6S2: C, 66.15; H, 7.52; N, 14.93. Found: C, 66.46; H, 7.32; N, 15.08.2,2\u2032-Hexane-1,2-diylbis[N-(thiourea)] (5e). White solid; Yield 84%, m.p. 193\u2013195 \u00b0C. 1H NMR (CDCl3) \u03b4: 1.21\u20131.35 , 1.55\u20131.71 , 1.73\u20131.93 , 2.02\u20132.23 , 2.55\u20132.70 , 2.75\u20133.11 , 3.55\u20133.71 , 5.90 , 7.31 . 13C NMR (CDCl3 +CD3OD): 22.36, 22.72, 22.35, 23.04, 24.44, 26.05, 29.18, 32.70, 34.44, 44.40, 126.06, 131.19, 138.48, 157.98, 164.83, 180.30 (C=S). Anal. Calcd. for C32H44N6S2: C, 66.63; H, 7.69; N, 14.57. Found: C, 66.66; H, 7.92; N, 14.46.2,2\u2032-Heptane-1,2-diylbis[N-(thiourea)] (5f). White solid; Yield 82%, m.p. 169\u2013171 \u00b0C. 1H NMR (CDCl3) \u03b4: 1.11\u20131.40 , 1.43\u20131.67 , 1.68\u20131.95 , 2.00\u20132.25 , 2.55\u20132.73 , 2.75\u20133.15 , 3.40\u20133.71 , 5.63 , 7.67 . 13C NMR (CDCl3): 22.32, 22.69, 22.99, 24.40, 26.48, 28.53, 28.96, 29.11, 32.69, 34.41, 45.29, 126.13, 131.19, 138.52, 157.98, 164.94, 179.90 (C=S). Anal. Calcd. for C33H46N6S2: C, 67.08; H, 7.85; N, 14.22. Found: C, 66.91; H, 7.75; N, 14.40.2,2\u2032-Octane-1,2-diylbis[N-(thiourea)] (5g). White solid; Yield 88%, m.p. 190\u2013192 \u00b0C. 1H NMR (CDCl3) \u03b4: 1.13\u20131.421 , 1.43\u20131.67 , 1.68\u20131.95 , 2.02\u20132.23 , 2.53\u20132.72 , 2.75\u20133.17 , 3.43\u20133.75 , 5.72 , 7.62 . 13C NMR (CDCl3 +CD3OD): 22.51, 22.75, 23.13, 24.41, 26.31, 29.37, 32.17, 34.07, 44.42, 126.98, 132.52, 140.70, 156.82, 164.04, 180.39 (C=S). Anal. Calcd. for C34H48N6S2: C, 67.51; H, 8.00; N, 13.89. Found: C, 67.67; H, 8.18; N, 14.05.v/v) was employed as the solvent; the concentration used did not alter the activities of the enzymes (data not shown). Initially, we used a single concentration of 20 \u00b5M for all compounds. Subsequently, IC50 values (\u00b5M) were determined for the most active compounds against AChE, BChE, and CES : human erythrocyte AChE, equine serum BChE, porcine liver CES, acetylthiocholine iodide (ATCh), butyrylthiocholine iodide (BTCh), 5,5\u2032-dithio-bis-(2-nitrobenzoic acid) (DTNB), 4-nitrophenol acetate (4-NPA), tacrine, and BNPP. We measured the activity of AChE and BChE according to the colorimetric Ellman procedure (\u03bb = 412 nm), as described in detail in . CES act and CES .Ki) and noncompetitive component (\u03b1Ki).We assessed the mechanisms of AChE and BChE inhibition by performing a thorough analysis of enzyme kinetics. After a 5 min incubation at 25 \u00b0C (for temperature equilibration) with three increasing concentrations of inhibitor and six decreasing substrate concentrations, the residual enzyme activity was measured as described above for enzymatic assays. Linear regression of 1/V versus 1/[S] double-reciprocal (Lineweaver-Burk) plots was used to determine the inhibition constants for the competitive component . We selected this source of AChE for consistency with our other reports and because of the purity, specific activity, and lower cost compared to human AChE. Moreover, a 3D alignment of EeAChE (PDB: 1C2O) and human AChE (PDB: 4EY7) using the MUSTANG procedure  = 500 \u03bcM), then it was aliquoted and stored at \u221220 \u00b0C.A total of 1 mg of lyophilized HFIP-pretreated A\u03b242 self-aggregation and amyloid fibril inhibition studies by the tested compounds, aliquots of 500 \u03bcM A\u03b242 stock solution were diluted in 215 mM Na-phosphate buffer pH = 8.0 to a final concentration of 50 \u03bcM A\u03b242. Then, the samples were incubated for 24 h at 37 \u00b0C without stirring in the absence  or presence of the test compounds. Myricetin and propidium iodide were used as references (positive controls). All compounds were used at a concentration of 100 \u00b5M. To quantify A\u03b242 fibril formation, after incubation, 5 \u03bcM ThT in 50 mM glycine-NaOH buffer pH 8.5 was added to the solutions to a final concentration of 4 \u03bcM ThT and the fluorescence was measured at 440 nm (excitation) and 485 nm (emission). Analyses were performed with a FLUOStar Optima microplate reader . The blanks consisted of 215 mM Na-phosphate buffer, pH = 8.0, 10% (v/v) DMSO or test compounds, respectively. Each assay was run in triplicate. Results are presented as mean \u00b1 SEM calculated using GraphPad Prism version 6.05 for Windows .For the measurement of A\u03b242 self-aggregation by the test compounds was calculated using the following equation:i and IFo are the fluorescence intensities obtained for A\u03b242 in the presence and in the absence of inhibitor, respectively, after subtracting the fluorescence of respective blanks.The inhibition (%) of A\u03b2\u2022+) decolorization assay [Radical scavenging activity of the compounds was assessed using the ABTS radical cation . The reduction in absorbance was measured spectrophotometrically at 734 nm using xMark UV/VIS microplate spectrophotometer . Ethanol blanks were run in each assay. Values were obtained from three replicates of each sample and three independent experiments. Standard antioxidant Trolox was used as a reference compound. Trolox equivalent antioxidant capacity (TEAC) values were determined as the ratio between the slopes obtained from the linear correlation of the ABTS radical absorbance with the concentrations of tested compounds and Trolox. For the test compounds, we also determined the IC50 values .The reaction was monitored for 1 h with an interval of 1\u201310 min. Data are given for 1 h of incubation of compounds with ABTSFRAP3 (Sigma-Aldrich) in distilled water and 25 mL of 0.3 M acetate buffer (pH 3.6). Aliquots of 10 \u00b5L of the tested compound  dissolved in DMSO (0.5 mM) were placed in quadruplicate. Absorbance was measured at the wavelength of 593 nm after 60-min incubation at 37 \u00b0C. In each case, Trolox was used as a reference compound to obtain the standard curve and value was calculated with respect to the activity of Trolox and expressed as Trolox equivalents (TE)\u2014the values calculated as the ratio of the concentrations of Trolox and the test compound, resulting in the same effect on ferric reducing activity.The ferric reducing antioxidant power (FRAP) assay proposed by Benzie and Strain ,107 was http://www.eyesopen.com [https://www.msg.chem.iastate.edu/gamess/ accessed on 20 January 2022), and structures with the lowest energies were used for pKa estimations and molecular docking simulations. Estimations of pKa values were performed using the Calculator Plugins of Marvin 21.14.0, ChemAxon (http://www.chemaxon.com accessed on 20 January 2022). For molecular docking, the optimized structures of the ligands were used with partial atomic charges derived from QM results according to the L\u00f6wdin scheme [Conformers of the inhibitors were generated using OMEGA 4.0.0.4: OpenEye Scientific Software, Santa Fe, NM. open.com  (accesseopen.com  softwaren scheme . Frontiehttps://autodock.scripps.edu/download-autodock4/ accessed on 20 Jan 2022). The grid box for docking included the entire active site gorge of AChE (22.5 \u00c5 \u00d7 22.5 \u00c5 \u00d7 22.5 \u00c5 grid box dimensions) and BChE (15 \u00c5 \u00d7 20.25 \u00c5 \u00d7 18 \u00c5 grid box dimensions) with a grid spacing of 0.375 \u00c5. The main Lamarckian Genetic Algorithm (LGA) [6 evaluations, 27 \u00d7 104 generations, and a population size of 3000. Figures were prepared with PyMOL (www.pymol.org accessed on 20 January 2022).X-ray structures of human AChE co-crystallized with donepezil (PDB: 4EY7)  and an ohm (LGA)  parameteow) and aqueous solubility (pS) were estimated by the ALogPS 3.0 neural network model implemented in the OCHEM platform [iK and inhibitory activity pIC50) [Lipophilicity   were esty pIC50) . This sey pIC50)  were caly pIC50) .50 values were determined using Origin 6.1 for Windows, OriginLab .All tests were performed at least in triplicate in three independent experiments. Results are presented as mean \u00b1 SEM calculated using GraphPad Prism version 6.05 for Windows . Plots, linear regressions, and ICN-acyl-alkylene (3) and bis-N-thiourea-alkylene (5).In summary, we developed two ways to functionalize the amiridine molecule: by acylation with chloroacetic acid chloride and by reaction with thiophosgene. The reaction of obtained intermediates, amiridine chloroacetamide and amiridine isothiocyanate, with 1,\u03c9-diaminoalkanes allowed us to prepare bis-amiridines joined by two different spacers: bis-3 and 5 as potential anti-AD agents allowed us to draw several conclusions regarding the influence of the spacer structure, as noted below.Our comparative studies of the pharmacological profiles of the new homobivalent ligands of series All compounds exhibited high inhibitory activity against both AChE and BChE with selectivity toward the latter enzyme. We also observed mixed-type reversible inhibition of both cholinesterases. All compounds very weakly inhibited CES, which suggests the probable absence of undesirable drug\u2013drug interactions arising from this potential source of hydrolytic biotransformation.3 with bis-N-acyl-alkylene spacers were more active inhibitors of both cholinesterases compared to compounds 5 with bis-thiourea-alkylene spacers. While the most active compounds 5 (5c\u2013e) had anti-AChE and anti-BChE activity comparable or equal to amiridine, the most active compounds 3 (3a\u2013d) exceeded both anti-AChE and anti-BChE activity of the parent compound. Compound 3c was found to have a very high inhibitory activity against BChE, comparable to tacrine. Thus, for the first time, it was possible to obtain amiridine derivatives with inhibitory potencies against AChE and BChE that equaled or exceeded that of the parent compound, amiridine.Compounds 3a\u2013c, with N-acyl-alkylene spacers of length n = 2, 3, 4, more effectively displaced propidium from the AChE PAS than the parent compound amiridine and the lead compounds 5c\u2013e with bis-thiourea-alkylene spacers.The lead compounds 3  may result in the improved displacement of propidium iodide from the PAS by these compounds. These results, along with those from kinetics and propidium iodide displacement experiments, indicate that the conjugates 3 and 5 are dual-site binding AChE inhibitors that have the potential to block the AChE-induced aggregation of \u03b2-amyloid, which would be an ameliorating, disease-modifying effect.Molecular docking explained the observed structure-inhibitory activity relationships. It also indicated binding of the conjugates to both principal sites in AChE, including the possibility of binding to the PAS, where the better binding affinity of compounds 3 containing bis-N-acyl-alkylene spacers have no effect on A\u03b242 self-aggregation, this activity of the conjugates 5 depends on the length of the alkylene spacer. Only the compounds 5c\u2013e  showed a pronounced inhibition of A\u03b242 self-aggregation. Although the effect was rather weak compared to the reference compounds Myricetin and propidium iodide, it exceeded the anti-aggregation activity of the parent compound amiridine.Whereas the conjugates 3 and 5 is their antioxidant activity. Bis-amiridines 3 with N-acylalkylene spacers were almost inactive in the ABTS and FRAP tests, while compounds 5 with thiourea in the spacer demonstrated high antioxidant activity, especially in the ABTS test (TEAC = 1.2\u20132.1). This result is in agreement with the lower HOMO-LUMO gap values calculated for compounds 5.The most substantial difference between conjugates Our calculated ADMET profiles predicted good blood\u2013brain barrier permeability, good intestinal absorption, and low cardiac toxicity risk for all compounds. Moreover, our predicted ADMET, physicochemical, and PAINS properties were acceptable for potential lead compounds at this phase of drug discovery.3 with bis-N-acyl-alkylene spacers were more potent inhibitors of cholinesterases and AChE-induced aggregation of \u03b2-amyloid. The use of a thiourea-containing spacer results in bis-amiridines 5 with an expanded and more balanced pharmacological profile. Compounds 5c\u20135e have emerged as the most interesting, as they displayed the properties of multitarget drug candidates for AD therapy. Not only do they have the potential to alleviate symptoms of AD, also showed an ability to act as antioxidants and to exert other potentially disease-modifying effects. Thus, we believe that these agents are worthy of further optimization and development as AD therapeutics.Thus, the proposed approaches to amiridine molecule functionalization allowed us to obtain potent inhibitors of AChE and BChE with different pharmacological profiles, depending on spacer type, as potential multifunctional agents for the treatment of AD. Conjugates"}
+{"text": "Mustela erminea) is invasive in New Zealand and has a serious impact on native biota. Trapping is the most common technique used to control stoats, but efforts to eradicate them or to improve control efficiency will require a range of different techniques. We examined the use of mustelid body odours as lures to attract stoats to traps or monitoring devices. Stoats were attracted to stoat urine, scats, and bedding, and to ferret (M. furo) bedding in captive and field trials. The use of odour lures may be particularly useful when the usual food-based lures are ineffective.The stoat (Mustela erminea) rely on effective lures for trapping and detection devices, such as cameras. Long-life semiochemical lures have the potential for targeting stoats in situations where food-based lures are of limited success. The attractiveness of body odours of captive stoats was tested in a series of captive animal and extensive field trials to investigate their potential as trapping and monitoring lures. Stoats approached and spent significantly more time sniffing stoat urine and scats and bedding from oestrous female stoats than a non-treatment control. The bedding odours were attractive in both the breeding and the non-breeding season. Stoats also spent significantly more time sniffing oestrous stoat bedding than female ferret bedding, but the ferret odour also produced a significant response by stoats. In the field trials, there were no significant differences between the number of stoats caught with food lures (long-life rabbit or hen eggs) compared with oestrous female or male stoat bedding lures. These results indicate the potential of both stoat bedding odour and the scent of another mustelid species as stoat trapping lures that likely act as a general odour attractant rather than a specific chemical signal of oestrus.Eradication and control methods to limit damage caused to native biota in New Zealand by the stoat ( It seems likely that no single technique will bring about these eradications\u2014a \u2018toolbox\u2019 of methods will be required, and research is therefore under way on a wide variety of fronts [The stoat wildlife ,2,3,4. Iwildlife ,9,10,11.wildlife ,13. In 2f fronts .Current control techniques for stoats in New Zealand rely mainly on networks of kill traps . These mOryctolagus cuniculus L.) meat are the current standard lures, and long-life rabbit formulations are available . However, food-based lures are not always effective at attracting stoats to traps and bait stations [Food-based lures have long been considered the \u2018best practice\u2019 for stoat trapping. Hen eggs and rabbit , use olfaction early in life to imprint on prey species [Fertile female stoats pose the greatest threat to predator-free areas, potentially carrying blastocysts in the uterus year-round and these pregnant females are considered to be the most difficult to catch . A limit species . Egg bai species , and Cla species  observed species  summaris species .Neovison vison Schreber) [Mustela putorius) and marten (M. foina) glandular secretions also increased the probability of detecting mustelids at camera-trap monitoring sites compared with no attractant [One approach to overcoming the limitations of food-based lures is to exploit natural odours used by the target species for communication. Stoats have a solitary lifestyle, defending intrasexual territories in the non-breeding season, and searching out mates in the breeding season ,45,46. Tchreber) ,55,56. Ctractant . Urine, faeces and other body odours are also potential sources of semiochemicals for mustelids . MusteliStoats should therefore be expected to respond positively to the scents from glands of both male and female conspecifics and to approach the scent of larger predators as well as prey species. One source of a range of these potential lure compounds is the bedding materials found in dens of free-living or captive animals. The current study reports on a series of captive animal trials to assess the relative attractiveness to stoats of mustelid bedding material odours, supplemented by field trials to test their attractiveness relative to both rabbit- and egg-based lures.The captive animal trials were conducted at the Johnstone Memorial Laboratory facilities of Lincoln University, Canterbury, New Zealand. Wild-caught stoats were housed individually in outdoor pens (3 m \u00d7 1.8 m \u00d7 2 m high) that contained foliage, wood and tunnels, with a nest box containing Dacron  bedding material. The stoats were fed rabbit meat, hen eggs or 1-day-old chicks daily, and water was also available. Female stoats were not mated, so they remained in oestrus over spring and summer (September\u2013February). Ferrets used as donors for odour test materials were housed in similar pens. A series of trials was conducted on the captive animals between November 2013 and February 2017. In the first trial, 4 female and 4 male stoats were presented the urine and scats of an oestrous female stoat in November and December. In Trial 2, bedding odours of an oestrous female stoat were presented (a) to 5 female and 6 male stoats during the breeding season (November\u2013February) and (b) to 3 females and 5 males in the non-breeding season (March\u2013June). Different stoats were used in the two seasons. In Trial 3, 8 female and 6 male stoats were given the choice of bedding odours from an oestrous female stoat and those from a female ferret . The stoats were tested individually in an outdoor pen (3 m \u00d7 6.1 m \u00d7 2.05 m in height). Bedding samples were collected from the donor animals\u2019 cages and stored in zip-lock bags at room temperature until use. Single samples from individual donors were used in these pen trials. The control for all the trials was unscented Dacron. On the day of the trial, each sample was placed in a metal mesh tea ball. The researcher handling the lure materials wore different disposable gloves for each lure sample to guard against cross-contamination, and to minimize human scent, to which stoats produce agonistic responses . The tesThe test animal was live-trapped from its home pen two nights before the trial and released into the pen. It was thus given two days/nights to explore the pen before the lures were introduced. Each trial was run over one 24 h period. After the trial, the stoat was returned to its home pen. The pen was water-blasted between trials. Lincoln University Animal Ethics Committee approved these trials under applications 501, 535 and 630. Rattus rattus and R. norvegicus are likely to inhabit coastal forest [Stoat bedding lure was tested as part of a restoration project in Abel Tasman National Park. The bedding odour samples were prepared at the Lincoln captive animal facility and couriered to the field site. A trap line along the coastal section of the park was alternately lured with either oestrous female stoat bedding lure  or a dried rabbit meat block formulation  once a month between April and August 2014 (4 checks). Treatments were not rotated amongst the sites. In total, there were 66 stations treated with stoat bedding and 66 containing dried rabbit. Because most of the captured animals were well decayed by the time the traps were cleared, only species and not the sex of the captures was recorded; nor were rats identified to species but both l forest . A field trial to compare the trapping success of oestrus stoat bedding and dried rabbit lures was conducted over two years in Nelson Lakes National Park as part of the Rotoiti Nature Recovery Project . Nine trThe lures were placed at the back of DOC200 and DOC250 single-set trap boxes. The treatments were alternated along the trap lines or between pairs of the same type of trap. The lines were checked, and the lures were refreshed monthly. Treatment position remained the same for the first year (August 2016\u2013June 2017) and then reversed for the second year of the trial. Captured animals were recorded only by species. The Coromandel Kiwi Project team ran a 2-stage trial between August 2016 and March 2019 using their network of DOC200 traps in wooden tunnels in and around Coromandel township. Eleven trap lines were used, with tunnels spaced at 150\u2013200 m intervals. In Stage 1 (6 months), half the traps were lured with male stoat bedding odour on a Dacron square (provided from Lincoln University) inside a paper tea filter bag plus either dried rabbit or a single hen egg. The alternate traps contained either the dried rabbit or hen egg lure, depending on the monthly lure regime and varied among lines. In Stage 2 (2 years), the male stoat bedding lure was tested on its own against either dried rabbit or a hen egg. There were 78 bedding lure treatment trap sites and 85 food-lured trap sites. Treatments were not rotated amongst the sites. Each trap was checked monthly as above by volunteers and with occasional additional opportunistic checks when a member of the public reported that a tunnel contained a capture. p-value method, performed on the log scale.The video recordings for the captive trials were mostly reviewed by co-authors T.S., T.A. and M.S., who did not know which treatment was which. The total amount of time each stoat spent touching the lure dispensers over a 24 h period was recorded. The results were analysed using GLMM with a negative binomial link function to avoid overdispersion. Fixed effects in the model were lure type and sex of the test animal with test animal ID as a random effect. Where significant differences were detected, pairwise comparisons of means were undertaken using the Tukey-adjusted Comparisons of catch rates of animals trapped in the field on different lure types were analysed using a 2-sample test for equality of proportions without continuity correction given the large sample sizes. Analysis was performed using trap site nights with a double set  recorded as a two for each night deployed in the field (Abel Tasman) and a single set trap recorded as one for each night (Rotoiti and Coromandel). All data analysis was conducted using the statistical package R (version 4.0.2) using packages lme4 (version 1.1\u201327.1) and emmeans (version 1.6.2-1). The stoats would respond to the odour stations by approaching the stake, typically sniffing at the base and then standing on their back legs to sniff directly with the nose touching the lure dispenser.2 = 10.98; p < 0.001) in the amount of time stoats spent investigating the urine and scats odours (13.85 \u00b1 3.0 s) compared with the blank control (6.33 \u00b1 1.5 s). The difference between males and females was close to being significant . The response times ranged from 1 to 54 s for the oestrous lure compared with 1 to 19 s for the control.In this trial run in spring and early summer (breeding season), there was a significant difference , with male stoats responding more than female stoats to the oestrous lure. Both male and female stoats spent significantly more time interacting with the treatment than with the control (both p \u2264 0.001). The response of male stoats to oestrous bedding odours tested in the breeding season ranged from 37 to 271 s and for female stoats 11 to 243 s. 2 = 32.01; p < 0.001), with male stoats responding more than female stoats to the oestrous lure (p \u2264 0.001). The response of male stoats to oestrous bedding odours tested in the non-breeding season ranged from 61 to 444 s and for females from 39 to 230 s.In the non-breeding season, there was still a significant interaction between lure type and sex . This time female stoats responded significantly more than male stoats to both the oestrous stoat and the ferret lure  or the control (p < 0.001), and significantly more to ferret bedding than the control (p < 0.001). Male stoats responded significantly more to stoat bedding than either ferret bedding (p < 0.001) or the control (p < 0.001), and significantly more to ferret bedding than the control (p < 0.001). All the contrasts were significant. Female stoats responded significantly more to stoat bedding than either ferret bedding .2 = 2.58, df = 1, p = 0.11). Two of the stoats caught with dried rabbit were caught at the same site during the same monthly trapping period. Significantly more rats were caught on dried rabbit than the oestrous bedding lure  The numbers of stoats and rats caught during the Abel Tasman trial are summarised in 2 = 0.16, df = 1, p = 0.69). In the second stage, testing the bedding lure on its own versus the dried rabbit lure, again there was no significant difference in the number of stoats caught .The captures recorded during the trial at Nelson Lakes are summarised in 2 = 0.27, df = 1, p = 0.61). However, stoat bedding lure on its own in Stage 2 was significantly less attractive to rats than the dried rabbit lure .The addition of stoat bedding odour to the traps did not significantly affect capture rates of rats in Stage 1 . The number of stoats caught on egg lure in Stage 1 also did not vary significantly with the male stoat bedding lure or without it . In Stage 2, again there was no significant difference between the number of stoats caught on the male stoat bedding lure or dried rabbit , nor between the male stoat bedding lure and egg . The trial results of male stoat bedding lure against dried rabbit and egg lures in Coromandel are summarised in Mustela nivalis vulgaris Erxleben) were caught in Stage 1 and 22 in Stage 2  but significantly increased the number of rats caught on the egg lure . When presented on its own in Stage 2, the stoat lure caught significantly fewer rats than the dried rabbit lure  but significantly outperformed the egg lure .Rats were caught on the male stoat bedding lure both when presented in Stage 1 together with the rabbit or egg lure and on their own in Stage 2 . The addIn both captive and field trials, the results described here have repeatedly demonstrated the potential for bedding odours as lures for stoats. The trials on captive animals showed that both male and female stoats would spend time investigating the scent of conspecifics, in both the breeding season and the non-breeding season. Because the female scent used was always from animals in oestrus, it is possible that the male stoats were responding to an oestrous signal, even during the non-breeding season. This would explain the higher responsiveness of the males compared with the females. However, that the female stoats also responded to the female bedding odours and that male bedding odours were effective in the Coromandel field trial indicate that the stoats were more likely responding to a general mustelid scent. The attractiveness of the bedding lure to the female stoats, although not as high as to the males, is a positive result for the control of the traditionally hard to trap females. The captive stoats also responded to the bedding odour of a female ferret, as was found by Garvey et al. .The field trial results indicate that bedding lures can be as effective as a dried rabbit lure or hen egg for attracting stoats to kill traps. This supports the findings of Garvey et al. , who shoOur results indicate that bedding lures also have the potential to be used in combination with a food odour. The combination of lures is not likely to provide conflicting messages\u2014stoats use body rubbing to scent mark food caches , and ferFelis catus) were caught on the stoat bedding lures in the field trials. These responses support the results of trials by Garvey et al. [Mustelid bedding odours also have potential as multi-species mustelid lures. This is supported by (a) the positive responses of the captive female stoats to the ferret bedding odours, and (b) the fact that both weasels and ferrets  and/or where the density of conspecifics is low, and survivors are seeking mating opportunities."}
+{"text": "Little is known about the impact of low muscle mass (MM) assessed by calf circumference (CC), arm circumference (AC), arm muscle circumference (AMC), and corrected arm muscle circumference (CAMC)\u2014on mortality risk later in life. We aimed to investigate the impact of low MM assessed by CC, AC, AMC and, CAMC on all-cause, cardiovascular, and cancer mortality risk.Data came from 418 older adults who participated in a 10-year follow-up prospective cohort study. Low MM was defined as a CC < 33 cm for women and < 34 cm for men and by the lowest tertile of AC, AMC, and CAMC stratified by sex. The log rank test, Kaplan-Meier curves, and Cox regression were used.There were 147 deaths: 49 related to CVD and 22 to cancer. A small CC , AMC  and CAMC  were associated with all-cause mortality. A small CAMC was a protective factor for CVD mortality . In the Kaplan-Meier analysis, older adults with LMM presented low all-cause mortality survival, with AC (p < 0.05), AMC (p < 0.005), CAMC (p < 0.002), and CC (p < 0.001). Cancer mortality was associated with low CAMC (p < 0.020).Low MM assessed by anthropometric measures  increased the all-cause mortality risk. A small CAMC decreased the CVD mortality. The number of older adults is increasing rapidly globally, and by 2050 one in six individuals worldwide will be aged 65 and over . AdvanciProspective studies showed that typical health conditions in older adults such as functional disability, limited mobility, morbidity, and low physical performance have a significant impact on their mortality risk \u20139. The hMM can be measured by different methods such as dual x-ray absorptiometry, bioelectrical impedance, ultrasound, computed tomography (CT), and magnetic resonance imaging (MRI) ,19. HoweSmall AC and CC have been previously associated with a lower survival rate in older institutionalized adults . HoweverThe study was conducted in the city of Goi\u00e2nia, capital of the state of Goi\u00e1s, Midwestern Brazil. The procedures used in the Goi\u00e2nia Older Adult Project cohort that started in 2008, were described in detail in previous publications \u201333. The The participants were followed-up from baseline in 2008 until the date of the last interview held in 2018/2019.Mortality information was obtained from the Brazilian Mortality Information System from the baseline in 2008 to March 2019. All deaths were confirmed in home visits. The basic cause of death was coded using the World Health Organization International Classification of Diseases, Tenth Revision (ICD-10) . CVD morMM was measured by the following anthropometric measurements: arm circumference (AC), arm muscle circumference (AMC), corrected arm muscle circumference (CAMC), and calf circumference (CC).2 on the contact surface and an accuracy of 1 mm, with a 0\u201365 mm ruler. The measurement was taken on the back of the arm and midway between the point of the acromion and olecranon process while the arm was hanging relaxed. Three measurements were taken successively, and the average of three measurement was used [et al. [AC was measured at the intermediate point between the lateral projection of the scapular acromion process and the lower margin of the ulna olecranon with the person in an upright position . The TSFwas used . CAMC wa [et al.  to deter [et al. .2 for men and < 23.2 cm2 for women), and CAMC (< 20.1 cm2 for men and < 20.0 cm2 for women). For CC, a previously validated cut-off point was used for this same study population, with dual energy x-ray absorptiometry (DXA) data as the reference, with low MM values for CC being < 34 cm for men and < 33 cm for women [Low MM was defined using the lowest tertile stratified by sex for AC (< 29.1 cm for men and 29.2 cm for women), AMC  sociodemographic characteristics ; (ii) health conditions, number of comorbidities and history of diseases previously diagnosed by physicians (diabetes and hypertension); (iii) lifestyle .Weight (in kilograms) and height (in meters) were measured according to standard procedures . Weight The anthropometric measurements were described according to the three mortality risk groups. The differences between the groups were evaluated using the Student\u2019s t, Chi-square, or Fisher\u2019s exact test.The three outcomes, all-cause, CVD, and cancer mortality, were analysed according to the occurrence of low MM in 2008, measured by the following anthropometric variables: AC, AMC, CAMC, and CC, using three Cox regression models for adjustment, as follows: Model 1: sociodemographic variables; Model 2: Model 1 + lifestyle; Model 3: Model 1 + Model 2 + DM, hypertension, number of chronic diseases and biochemical markers .The survival curves were plotted using the Kaplan-Meier\u2019s method. The log rank test was used to compare the survival curves of older adults with low MM and adequate MM. For all statistical analyses, significance was determined at p <0.05 level. All analyses were performed using STATA 12.0 software. In cases of loss to follow-up, survival time was censored on October 10, 2018.2, female (66%), white skin colour (46.4%), four years of education (41.2%), social class C (61%), living with a partner (45.2%), former smoker (43.3%), sedentary (35.2%), and not consuming fruits and vegetables on a daily basis (72.3%). The prevalence of diabetes was 23% and that of hypertension was 60% (The sample characterization was as follows: mean age 70.69 \u00b1 7 years (60 to 98 years), mean BMI = 26.97 \u00b1 5.12 kg/m was 60% . The basDuring the ten-years follow-up, 147 (35.2%) deaths occurred. Of these, 49 (33.3%) died of CVD and 22 (14.9%) of cancer. The all-cause mortality rates were statistically different for low MM values evaluated by CC (p < 0.000), AC (p < 0.027), AMC (p < 0.004), and CAMC (p < 0.002) and the cancer mortality rates were statistically different considering CAMC (p < 0.0036) .In the Cox regression analysis, low MM measured by CC , AMC , and CAMC  significantly increased all-cause mortality risk in the ten-year follow-up. Low MM measured by CAMC increased cancer mortality  .In the adjusted Cox regression analysis, all-cause mortality risk was significantly associated with the three low MM anthropometric measurements i.e. CC , AMC , and CAMC  . A smallFor all-cause mortality, the log rank test showed that participants with low MM measured by all anthropometric measurements  had shorter survival times compared to participants with adequate MM .The survival curves for CVD in participants with low and normal MM measured by AC (p = 0.546), AMC (p = 0.231), CAMC (p = 0.364), and CC (p = 0.366) showed no significant differences. With regards to cancer mortality risk, a small CAMC (p < 0.020) reduced survival. Small AC (p = 0.122), AMC (p = 0.625), and CC (p = 0.231) did not change cancer survival.To the best of our knowledge, this study was the first to analyse the impact of low muscle mass measured by various anthropometric measures on all-cause, CVD, and cancer mortality risk in community-dwelling older adults from a Latin American community. This study used four anthropometric measurements to evaluate muscle mass and our findings showed that having a small AC, AMC, CAMC, and CC increased significantly the all-cause mortality risk after 10 years of follow-up. In addition, older adults with a small CAMC had a shorter survival time for cancer and lower risk of death from CVD.This study showed that the lowest AMC and CAMC tertiles and small CC increased the risk of death. The results from the survival curves analyses showed that individuals with low muscle mass measured by AC, AMC, CAMC, and CC have lower survival rates after a ten-year follow-up. These results corroborate previous studies \u201353 in ol2 in men and \u2264 21.6 cm2 in women increased the risk of death after an eight-year follow-up. Data from a cohort with a six-month follow-up showed that the risk of death has been reduced by up to 5% for each unit of increased CAMC [Interestingly, in a community-dwelling sample aged 70 and older, a European study  showed tsed CAMC .Decreased anthropometric measurements may indicate low muscle mass, being associated with worse health conditions and a higher likelihood of death ,55. TherThe most used sophisticated methods to assess body composition, such as dual x-ray absorptiometry and bioelectrical impedance, despite having a good precision in the measurement of body compartments, are not routinely used in clinical practice, due to the need for trained personnel, high costs and time spent for their performance ,19. AnthPrevious findings on the association between anthropometric measures and cause-specific mortality in older adults living in the community are limited ,51. FurtThe findings of the present study showed that a small CAMC reduces the risk of CVD mortality by 54%. Most previous investigations on the impact of low muscle mass on CVD mortality used only AMC measurement ,50,56. OData from the Bangladesh Health Effects of Arsenic Longitudinal Study (HEALS) cohort, which followed 1,975 individuals aged 18 and older  for 8 yeSince the CAMC calculation involves triceps skinfold (DCT) and AC with bone mass correction, the decrease in CAMC probably reflects a gain in subcutaneous fat mass. The associations of each body fat deposit in the risk of CVD vary, since the upper and lower parts of the body contain divergent fat deposits with different biological functions .Regional differences in the severity of adipose inflammation, storage and renewal of lipids, release of adipokines and endocrine effects are among the mechanisms potentially responsible for the aforementioned proposed associations \u201358.Even for similar types of fat, subcutaneous adipose tissue in the arm was considered less susceptible to unregulated release of free fatty acids compared to abdominal subcutaneous adipose tissue . A studyOn the other hand, CAMC is considered a surrogate marker to indicate the muscle mass used to determine a muscle tissue reserve, reflecting the sarcopenia that is associated with mortality in the older adults . The mecIn the present study, the ten-year survival was lower in individuals with low muscle mass compared to those with normal muscle mass using CAMC. To date, there are no studies on the association between CAMC and the risk of death from cancer in older adults living in the community. A study evaluating cancer mortality in obese and non-obese people in the US used AC to measure muscle mass and reported no association between AC and cancer mortality risk .The relationship between low muscle mass and cancer mortality later in life also remains uncertain. A greater understanding of the underlying mechanisms of muscle loss is needed. However, it is known that maintaining muscle mass can improve the metabolism and increase energy reserves, increasing, consequently, the chances of older adults coping with disease . TherefoThis study demonstrates that anthropometric measures such as CC, AMC and CAMC used as indicators of low muscle mass can predict mortality in community-dwelling older adults. Knowing that CC is more affected by edema than AC  and consOverall, there are no consistent results between anthropometric measurements and the risk of death from specific causes. It should be noted that most of the studies were conducted on young adults in European countries.The most important limitation of this study include the lack of muscle strength measurement and tests that evaluate muscle function . It is recognized that strength is better than mass in predicting adverse outcomes, particularly mortality . AnotherThese results have relevant implications for clinical practice in gerontology and geriatrics, as well as for planning public health actions. The measurement of these anthropometric measures should be incorporated into health care practices for older adults, as they are more practical and cheaper than other methods to measure muscle mass and, consequently, helping the development of mortality prevention measures. Anthropometric evaluations are effective as the first step in screening older patients to identify those most at risk of death and to target interventions to prevent loss of muscle mass. The early detection of low muscle mass can reduce disability and, in turn, increase the survival rate later in life. In additional, future studies should investigate the relationship of these anthropometric measurements by CVD type and primary site of cancer.Low muscle mass evaluated by the anthropometric measurements i.e. AC, AMC, CAMC and CC increased the all-cause mortality risk in older community-dwelling adults but not for cancer and CVD mortality. Except for a small CAMC, which increased the risk of cancer mortality and reduced the risk of CVD mortality.S1 File(XLSX)Click here for additional data file.S2 File(DOCX)Click here for additional data file."}
+{"text": "BackgroundThe European Association of Urology (EAU) recommends that the operative steps and documentation necessary for successful and appropriate management of bladder cancer include identifying factors necessary to assign disease risk stratification, clinical stage, adequacy of resection and the presence of complications and immediate intravesical chemotherapy administration.AimTo assess and improve the adequacy of current transurethral resection of bladder tumour (TURBT) documentation at a district general hospital in the UK against the EAU 2022 guidelines.MethodsOperative notes over a one-year period were assessed for the inclusion of key steps to achieve a comprehensive TURBT as outlined by EAU guidelines. Outcomes included documentation on the details of the operative findings and intervention as well as the perioperative assessment. A standardised template for TURBT procedures was created and surgical staff received training on its usage. The audit was subsequently repeated after six months to assess for improvements.ResultsTURBT documentation of 78 cases in the first cycle was compared to 37 cases from the second cycle. Significant improvements in the documentation of tumour size , tumour description , depth of resection , administration of chemotherapy  and assessment for perforation  were demonstrated. Improvements in pre-operative and post-operative examination rates under anaesthesia also achieved statistical significance . There was an increase in the documentation of completeness of resection but this did not achieve statistical significance .ConclusionThe operative note template led to the improvement in the documentation, improving the risk stratification of bladder cancer in patients\u00a0undergoing TURBT. The use of procedure-specific operative note templates should be adopted for all commonly performed procedures to improve the completeness of documentation. The purpose of an operation note is to facilitate the continuity of care as well as provide a medico-legal record of a patient\u2019s care . The RoyBladder tumours are typically managed using a multimodal approach to intervention . TransurThomas et al.  first reThis quality improvement project was designed to assess procedure-specific operative note details after recognition of deficiencies at two local uro-oncology MDT meetings. The study aimed to assess how the current practice of operative note documentation measured against the recommendations from the European Association of Urology (EAU) Guidelines.This study was based on the practice of one Urology department operating across two District General Hospitals, serving a population of 530,000 .A list of patients who potentially underwent TURBT was constructed through collaboration with the local bladder cancer patient tracker, uro-oncology specialty nurses and hospital coders for CPT code  and bladder cancer ICD-10 code (C67). The notes of all patients were reviewed by two independent reviewers and patients were included in the study if they had a TURBT procedure between January 2019 and January 2020. This included patients who were having their first TURBT as well as any subsequent redo TURBT procedures.The operation note of each included patient was assessed for the inclusion of the recommended necessary operative steps to achieve a comprehensive TURBT. These steps were based on the EAU guidelines and included documentation on the 1) Details of the operative findings , 2) Details of the operative intervention  and 3) Details of the perioperative assessment . The date of the procedure and name as well as the career grade of the surgeon writing each operative note were also collected.The data from the first cycle was presented to the department and senior Urology staff (registrar and consultants) noting the deficiencies. A standardised TURBT Operative Note Documentation Template was created to include all the fields necessary for a standard TURBT documentation note, as well as the standard required fields as directed by the RCS  was used for data analysis. Descriptive statistics were used to compute the frequencies and percentages. The Fischer\u2019s exact test was used to compute the significant changes in the frequencies. All the tests were two-sided and a p-value < 0.05 was considered statistically significant.A total of 103 patients were included in the original compiled list of patients who potentially had a TURBT procedure. Twenty-five patients were excluded due to one or more of the following reasons: refusal of operative management, operative management deemed inappropriate, inaccessible documentation or procedure cancellations. Seventy-eight patients were found to have had TURBT between January 2019 and January 2020 and were included in the first cycle of the audit. The second cycle included a further 37 patients who underwent TURBT between May and October 2020.The average age of patients included in the first cycle was 72 range 41-90) whereas the cohort included in the second cycle was marginally younger with an average age of 67 (range 31-89). Overall, both cycles had a similar sex distribution with the first cycle being 76% male vs 78% in the second cycle. A greater proportion of the notes in the second cycle were written by Consultants as opposed to Registrars (see Table -90 whereThere were significant improvements in the rate of documentation of key operative steps in the second cycle when compared to the first. Documentation of the number of tumours remained perfect (100%) across both cycles with the majority of cases reported to only have one tumour in both cycles (Cycle 1: 67% vs Cycle 2: 70%)  and tumour description  were observed. The most commonly reported tumour size across both cycles was 1-2 cm  (see Table This study assessed the completeness of operative notes for an important, common procedure in\u00a0general urological practice. The contents of operative notes are of significance due to their implications for post-operative care and potential medico-legal proceedings. There is an added layer of importance for cancer procedures as these cases typically require an extensive multidisciplinary approach in the perioperative phase. There is also a risk of disease recurrence at a point far removed in time from the index operation, in which case accurate and complete historical documentation may prove to be invaluable through altering future management.The RCS stipulates that surgeons must keep \u201caccurate, comprehensive, legible and contemporaneous records\u201d . Their \u2018The use of EMRs provides prompts for clinical actions and automated measures of quality outcomes . EMR facEMRs have an operation note template that meets the criteria defined by the RCS for an operative note and can be customized. The adapted template remained familiar to the users and provided prompts for procedure-specific data points as outlined by the EAU guidelines. The study template was readily accessible to surgeons when writing their operative notes only requiring one extra click from their normal practice. This ease of access and familiarity made this method of intervention more suitable than alternatives such as the use of memory aids in orthopaedic and ENT\u00a0theatres as reported by Mustafa et al. \u00a0and ShayCoughlan et al.  reportedSenior surgical staff in this study also moved on to create templates for other commonly performed procedures such as Flexible Cystoscopy, Transurethral Resection of the Prostate, Ureteroscopy and Laser Lithotripsy/Ureteric Stent insertion after receiving training on the usage and integration of the study template. Most EMRs have templating features and as such the effect demonstrated in this study should be easily transferable across hospitals with EMRs. The discussion on the contents of a comprehensive operative note prompted by this study resulted in improved compliance in other operations. Singh et al.  demonstrTwo studies have previously reported methods of improving the completeness of TURBT documentation. Anderson et al.  designedLimitations of this study included the small sample size in the re-audit period. This reduction in completed procedures was largely due to the disruption of services during the coronavirus pandemic. Another potential for bias in this study is the significant increase\u00a0in the proportion of operative notes being completed by consultants in the second cycle. This may have contributed to the improvement in operative note documentation reported across cycles.The results of this study showed improvement in the documentation of most of the key steps of the TURBT procedure. Even though electronic record-keeping is not available to all hospitals, some of the beneficial effects on completeness of documentation should be translatable to any practice by simply making printed custom operative note templates available for common core procedures.In recent years there has been a move towards the use of electronic templates for operative documentation which has shown great improvements in documentation, legibility and completeness as defined by RCS standards. Future development should focus on a move towards speciality and procedure-specific documentation to take into account the importance and variability of speciality and procedure-specific details. This seems feasible in the future given the National Health Service's goal to become completely digital over the coming few years."}
+{"text": "Methods. Human peripheral blood mononuclear cell-derived osteoclasts were cultured on bone slices with serum from treatment-na\u00efve RA patients and healthy controls and with synovial fluid samples acquired from RA and OA patients. The concentrations of 29 different cytokines and related proteins, including RANKL and OPG, were analyzed in the fluids tested.  Rheumatoid arthritis (RA) and osteoarthritis (OA) are common joint diseases associated with changes in local, as well as systemic bone structure and osteoclast function. We investigated how the different soluble inflammatory stimuli in these diseases can affect osteoclastogenesis and bone resorption  RA serum and synovial fluid increased both osteoclastogenesis and bone resorption. Osteoclastogenesis and activity increased more in the cultures containing OA than RA synovial fluid. The osteoclasts cultured in different culture media exhibited different phenotypes, especially the cells cultured with OA synovial fluid were generally larger and had more nuclei. A general increase in proinflammatory cytokines in RA synovial fluid and serum was found. Surprisingly, OA synovial fluid showed lower levels of osteoclastogenesis inhibiting cytokines, such as IL-4 and IL-10, than RA synovial fluid, which at least partly explains more pronounced osteoclastogenesis. No significant difference was found in RANKL or OPG levels.  The proinflammatory stimulus in OA and RA drives the monocyte differentiation towards inflammatory osteoclastogenesis and altered osteoclast phenotype. Rheumatoid arthritis (RA) is a chronic autoimmune inflammatory joint disease that targets mainly the synovial tissue, but the exact disease etiology and pathogenesis are unknown . The synBesides RA, osteoarthritis (OA) is another even more common joint-decaying disease, which also results in changes in local bone turnover. OA is a disease of the whole joint associated with mechanical wear of the joint surfaces and involvement of the surrounding tissue, subchondral bone, cartilage, and synovium. OA includes a component of low-grade inflammation (reviewed in ) and alsLocal changes seen in a RA and OA patient knees are shown in in vivo, osteoclastogenesis is induced from mononuclear osteoclast precursors by the macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor kappa-B ligand (RANKL) [in vitro by stimulating peripheral blood-derived mononuclear cells with RANKL and M-CSF [\u03b1 increase and osteoprotegerin (OPG) decreases it [in vivo is a complex, balanced process that is influenced by multiple cytokines and this environment is not easily reproducible in in vitro osteoclastogenesis assays.The key players contributing to bone changes in both RA and OA are osteoclasts, which are generally described as multinucleated tartrate-resistant acid phosphatase, TRAcP, staining positive giant cells capable of resorbing bone  in suita (RANKL) \u201313. Ostend M-CSF , and it eases it \u201313. Sponeases it , 3. ThisThe size of the osteoclasts has been associated with their activity and larger osteoclasts are more often involved in pathological bone resorption \u201317. In Rin vitro. Human serum from novel untreated RA patients and synovial fluid (SF) from patients undergoing knee prosthesis operation, as well as human peripheral blood-derived mononuclear cells, were used to produce a controllable osteoclastogenesis model and bone resorption activity model. These approaches allowed us to better understand the pathophysiology of local and systemic bone loss in RA and OA at the cellular level and to detect possible key cytokines that could partially explain the different clinical features of the diseases.Our aim was to create a model to study the complexity of the local and systemic inflammatory stimulus on osteoclastogenesis RA serum, that was used in the osteoclast cultures, was collected from six untreated RA patients at the time of initial diagnosis. At this time point, the patients did not show signs for advanced knee osteoarthritis, and they were not undergoing knee surgery. There is no systematic radiographic data of the possible lower grade KL classification changes in knee or other joints. The RA patients were diagnosed according to the ACR/EULAR 2010 criteria for RA by a rheumatologist, and they were seropositive . Healthy control serum was collected from nine healthy volunteers.Synovial fluid was acquired from ten RA and OA patients undergoing total knee replacement operations. These patients were all different from those, from whom we could collect serum samples, as described above. All patients in this group had advanced osteoarthritis at least in their knee joints, and the mean Kellgren-Lawrence score for the operated knees was three in both RA and OA groups. All RA patients were seropositive . RA patients, who the synovial fluids were collected, were treated with various different RA medications that had been changed numerously over the years. Patient data is shown in Due to low volume of synovial fluid available and the known high variation of cytokines in synovial fluid, the blindly selected synovial fluid samples were pooled to create a standardized disease environment.Peripheral blood mononuclear cells were isolated from whole blood of a healthy volunteer male donor using the Ficoll-Paque density gradient centrifugation method  according to the manufacturer's instructions. Blood samples were collected into heparin-coated tubes to prevent coagulation. After acquisition, the fresh blood samples were diluted 1\u2009:\u20091 in PBS and layered on top of the Ficoll-Paque solution and centrifuged 400\u2009g, at room temperature for 35\u2009min without brake. Buffy coat was collected and twice suspended to 50\u2009ml PBS and centrifuged 170\u2009g for 10\u2009min to remove platelets. After separation, the mononuclear cell fraction was collected and used immediately for cell culture. The cells were not frozen during the procedure.No additional trauma was caused during sample acquisition. The patients gave a written informed consent for the use of their samples. The protocol followed the Helsinki Declaration principles in full, and the Northern Ostrobothnia Hospital District Ethical Committee gave an approval for the study and tissue collection.\u03bcg/ml streptomycin with 20% concentration of tested serum, and additional RANKL 20\u2009ng/ml, M-CSF 10\u2009ng/ml, and heparin 5000\u2009IU/ml 0.20\u2009ml/ml. Three RA and three healthy control sera  were used for these experiments. Fetal bovine serum (FBS) was used as a reference serum, and negative control cells were cultured with FBS without added RANKL and M-CSF. The cells were cultured for 14 days, with half of the medium replaced every 3-4 days. The cells were fixed with PFA.Peripheral blood mononuclear cells were cultured on top of bovine bone slices in 96-well plates  and differentiated into osteoclasts in alpha-MEM including 100 iU/ml penicillin and 100\u2009\u03bcm thin 6\u2009mm round slices and stored in 70% ethanol. Before use, they were rinsed thoroughly in PBS. The 6\u2009mm round slices fit 96-well plate dishes' wells precisely to provide a good baseplate for cell cultures and cells can be fixed directly on them.The bone slices were cut from long bovine bones' cortical areas using a diamond saw into 100\u2009Peripheral blood mononuclear cells were cultured and differentiated into osteoclasts with the same protocol as for the RA serum test , but this time, the serum was replaced with the pooled RA or OA synovial fluid. The pooled synovial fluid was added to the cell culture media as 20% concentration with the addition of 10% healthy human serum. As a control, a culture with 10% healthy human serum was conducted at the same time. The mononuclear cells for the synovial fluid and serum assay were collected from the same donor, but at different times to keep the amount of donated blood in minimum safe levels. In this study, synovial fluid from osteoarthritis (OA) patients was used as a control due to ethical and volume limitations for acquiring synovial fluid from healthy individuals. Healthy control knees have been suggested to contain 6.7 \u00b1 2.3\u2009ml\u2009SF , but on\u03b3, IP-10, MCP-1, MIP-1-alpha, MIP-1-beta, platelet-derived growth factor (PDGF-BB), RANTES, TNF-\u03b1, and VEGF were analyzed using the Bio-Rad Bio-Plex Pro\u2122 Human Cytokine 27-plex assay, Luminex MagPix Instrument and Luminex xPotent Software from the synovial fluids (10 RA and OA), and serums . Three samples from each group were used for osteoclast culture assays. The serum samples were diluted two-fold and the synovial fluid samples four-fold. All samples were tested in duplicate.Twenty-seven different cytokine and related protein concentrations ), IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 (p70), IL-13, IL-15, IL-17, eotaxin, basic fibroblast growth factor (FGF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSf), IFN-Synovial fluids were tested also for RANKL and OPG concentrations using an Invitrogen\u2122 eBioscience\u2122 ProcartaPlex Human RANKL Simplex Kit and a TNFRSF11B Human ProcartaPlex\u2122 Simplex Kit for OPG. The test was done to avoid confounding by RANKL and OPG, by showing that in the cell cultures the RANKL concentration used is supraphysiological and the RANKL already present in the samples does not affect osteoclast differentiation in the experiment.The fixed cells were stained with a TRAP kit (Sigma-Aldrich) and Hoechst nuclei stain. TRAP positive cells with two or more nuclei were counted as osteoclasts. The osteoclast number in the serum assay was counted using a light microscope from the whole 6\u2009mm diameter bone slice. For the synovial fluid assay, the number of osteoclasts was counted from five random locations on the bone slice under 20x magnification. The number of osteoclasts between the two assays is not directly comparable even though they are from the same donor, since the cells have been extracted from the blood at different time points and different biological factors like cytokine levels in the blood could affect the outcome. This was done to limit the volume of donated blood at a single time to a minimum. Stromal cell number, intensity of TRAP staining, and number of nuclei within osteoclasts were quantified blindly and individually by two researchers under a light microscope from each bone slice. The intensity of TRAP stain and the presence of stromal cells were quantified on a 0-3 nominal scale. Since osteoclast size has been associated with their activity, the average number of nuclei in an osteoclast, which also represents the cell size, was counted on a scale of 0, 2-3 , 4-7 (medium), or >8 (large). Additionally, the cells were visualized using a Zeiss LSM 780 confocal microscope.2) from each sector was captured and analyzed with 20x magnification. The area and volume of resorption were measured from each captured area. The average depths of the three deepest pits in the area were measured independently.To visualize and confirm resorption pits on the bone slices before laser microscopy, the cells were brushed off from the slices using a small plastic-tipped brush, and the pits were stained with horseradish peroxidase-conjugated WGA-lectin antibody and DAB stain. The area and volume of resorption pits on a bone slice were measured using an Olympus LEXT OLS4100 laser microscope and software. A bone slice was divided into five sectors and a random area , IL-1ra (70-fold), IL-17 (59-fold), IP-10 (49-fold), IL-1b (39-fold), MIP-1a (31-fold), MIP-1b (27-fold), IFN gamma (20-fold), IL-2 and IL-9 (15-fold), GM-CSf (13-fold), IL-6 (11-fold), PDGF-BB and IL-4 (11-fold), IL-7 (10-fold), IL-10 and TNF-alpha (9-fold), and other cytokines 5-fold or less .\u03c1 = \u22120.894, p = 0.041); and in synovial fluid samples, we found positive correlation between TNF-alpha , IL-4 , IL-10 , G-CSF , IL-17 , and RF that could indicate either RF interference in the analyses or RF relation to the disease activity. Due to the possible RF interference, these should be interpreted with caution.Since it has been suggested that RF has a confounding effect in multiplexing immunological cytokine analyses , we testAltogether, the cytokines were roughly ten times more concentrated in the synovial fluids, when compared to the serums. In supplementary file \u03c1 = 0.497, p = 0.042) in all analyzed SF samples  and the volume (10368 \u00b1 10695\u2009\u03bcm3 vs. 6048 \u00b1 10157\u2009\u03bcm3) of resorption compared to healthy control serum (p < 0.05). The increase in resorption was in the same proportion as the increase in osteoclast number between the serums. No significant change was found in the average depth of the deepest pits between RA and Ctrl serum, The volume of resorption from the serum experiment is shown in \u03bcm2, volume: 115703 \u00b1 52299\u2009\u03bcm3) and OA  synovial fluids increased resorption of the bone slices, when compared to healthy control human serum  (p < 0.05). OA synovial fluid increased the area and volume of resorption, but the change in the average depth of the deepest pits between RA and OA was within measurement accuracy (p < 0.05). The increases in resorption were in the same proportion as the changes in osteoclast numbers. A single osteoclast's resorption capacity was the same between different groups.The volume of resorption from the synovial fluid experiment is shown in accuracy . The synin vitro the effect of inflammatory factors present in RA serum and RA and OA synovial fluids on osteoclastogenesis and bone resorption by osteoclasts. The main finding emerging from our experiments was that, when compared to healthy controls, the inflammatory stimulus present in novel untreated RA patients' serum significantly increases the general osteoclastogenesis and bone resorption. A similar effect is seen in real life contributing to the secondary osteoporosis in RA patients [The aim of this study was to investigate patients , 22. Sinpatients , the eropatients . It is upatients . Our datPrevious studies have examined the increased proinflammatory cytokine profile in RA and OA synovial fluid and serum, and increased cytokine levels have been found to correlate with disease severity \u201327. Our RANKL is considered the main factor of osteoclast differentiation . To veri\u03b1, IL-1, IL-6, IL-7, IL-8, IL-15, and IL-17 [\u03b1, IL-6, IL-7, and IL-17 were also increased in RA serum compared to healthy controls. Along with the above cytokines, various other disease-related molecules and proteins such as CRP, VEGF, IL-11, IL-23, and IL-34 in RA are also known to increase osteoclastogenesis independently of RANKL [Cytokines associated with increased osteoclastogenesis include TNF-nd IL-17  that werof RANKL , 31. Oth\u03b3, IL-4, and IL-10 in RA synovial fluid samples compared to OA. Even though these results should be interpreted with caution due to low number of samples and shown RF interference in IL-4 and IL-10 measurements, these have all been shown to decrease osteoclastogenesis under some conditions [\u03b1, IL-3, IL-27, and IL-33 in RA patient samples [We could see the pro-osteoclastogenic effect of RA serum in the osteoclast cultures as increased number of osteoclasts , number nditions . IL-4, Inditions ; thus, t samples \u201339. TogeWe found evidence of morphological differences of osteoclasts that were generated under RA and OA synovial fluids and believe that this change in the phenotypes of these cells is due to inflammatory osteoclastogenesis . The ostAs limitations of our study, we acknowledge, that both RA and OA are very variable diseases, and we see this variation in cytokine levels between the patients. Even though our experiments were performed on cells from a single donor, we would expect the results to be similar with slight variations if cells from a different healthy donor were used. However, we must be careful in the interpretation of this data. Especially, cells derived from RA or OA patients could give a different response due to the priming in inflammatory milieu or genetic factors. The donor used in this study does not have any rheumatic disease or osteoarthritis. In further studies, also different donors for osteoclast precursors should be considered. However, this study shows an example of how the local RA or OA inflammatory environment can change the behavior of healthy individual's cells.Our study would have benefitted from treatment-na\u00efve OA controls for RA serum samples and healthy SF controls for the end-stage RA knees at time of a prosthesis operation. This was governed by the availability of patient material for OA and due to ethical reasons for the healthy controls. OA diagnosis is mostly done in primary healthcare, which data we do not have access to, years before needing treatment in specialized healthcare. Also determining what would classify as a treatment-na\u00efve OA patient would be extremely hard as the patients seek medical help at very different stages of the disease, as the symptoms do not often correlate with the radiological findings, and the first line of treatment is nonsteroidal anti-inflammatory medication, which can be bought over the counter in pharmacies. The OA patients going through operative treatment are a less heterogenous selected group. The low sample volumes forced us to pool synovial fluid samples for the cell cultures, which we also consider as a limitation of our study.in vitro. RA serum and synovial fluid both increased osteoclast differentiation and bone resorption capacity, when compared to healthy serum. Osteoclast differentiation and bone resorption increased even more in the presence of OA synovial fluid that could be due to lower levels of monocyte differentiation regulating cytokines. These data help us to better understand these diseases and remind us how complex the inflammatory processes are. Further studies of inflammatory osteoclastogenesis are required to obtain an understanding for optimal therapeutic interventions.In this preliminary study, we showed how local and systemic inflammatory cytokines in RA have a direct effect on the differentiation and bone resorption ability of osteoclasts"}
+{"text": "Risk assessment in communities or regions typically relies on the determination of hazard scenarios and an evaluation of their impact on local systems and structures. One of the challenges of risk assessment for infrastructure operators is how to identify the most critical scenarios that are likely to represent unacceptable risks to such assets in a given time frame. This study develops a novel approach for prioritizing hazards for the risk assessment of infrastructure. Central to the proposed methodology is an expert elicitation technique termed paired comparison which is based on a formal mathematical technique for quantifying the range and variance in the judgements of a group of stakeholders. The methodology is applied here to identify and rank natural and operational hazard scenarios that could cause serious disruption or have disastrous effects to the infrastructure in the transnational \u00d8resund region over a period of 5 years. The application highlighted substantial divergences of views among the stakeholders on identifying a single \u2018most critical\u2019 natural or operational hazard scenario. Despite these differences, it was possible to flag up certain cases as critical among the natural hazard scenarios, and others among the operational hazards. Infrastructure assets and systems may be exposed to a plethora of hazard scenarios, such as natural hazard events , operational accident  or market/economy hazard , which can affect an infrastructure system or interconnected systems. Ideally, the vulnerability of infrastructure assets and the resulting impact should be evaluated against a wide range of plausible scenarios. However, in practice, time constraints, limited resources, and multiple unknown  elicitation; a formalized process to determine a rational consensus among subject-matter experts on the uncertainties associated with problems where sufficient empirical or historical data are not available to characterize uncertainties statistically. It draws on the expertize of stakeholders and thus is particularly suited to complex systems, which are difficult to model, and for assessing the relative risks of unusual or exceptional events for which empirical observations are scarce this information can be as an input for risk and resilience assessment processes as well as to support the construction of risk and resilience management strategies. This has the added advantage of characterizing stakeholders risk perception and deviating from similar approaches  can be understood as stochastic variables often with very little support for their frequencies as a result of a paucity of statistical data for the systems and scenarios being studied. A simpler approach is taken in the literature where values to the two dimensions of risk are provided subjectively by assigning a value based on a scale, e.g.  in the presentation of any specific findings. This encourages each participant to provide their own considered judgement without fear of criticism. It should also be mentioned that the adopted elicitation technique aims to perform a comparative assessment and for this reason, it lacks the empirical control when the aim is to quantify numerical uncertainty associated with a specific scenario. Thus, the participants are not assessed based on how well they are able to quantify uncertainties, per se  and givThe main steps in the proposed methodology are illustrated in Fig.\u00a0Prior to the elicitation, a number of stakeholders whose role is to help compile the list of scenarios, as well as rank them, must be identified. Suitable stakeholders could either be those who are familiar with the operation of a particular infrastructure, those who rely on its service, or operators of infrastructure in a region with experience in risk assessment. With the facilitator and stakeholders identified, the elicitation takes place. In what follows, a detailed description of each step is provided.The success of the elicitation depends on a well-designed questionnaire. To ensure its quality, a well-attended workshop with stakeholders is necessary to mitigate the potential of unknown, ignored or excluded scenarios and also to ensure that the questionnaire adopts terminology that is familiar to the stakeholders and is unambiguous in meaning for the specific assessment.The elicitation questionnaire proposed has five main parts. The first part introduces the potential participants to the main objectives of the elicitation and describes why their insight is needed. In the next two parts, general professional information from the participants are requested, and a consent form can be found with information confirming that the study complies with any relevant ethics and data protection requirements. A clear assurance is also given that the participants\u2019 responses will remain anonymous. The fourth part contains the main elicitation and includes a concise description of the problem, the main components of the examined infrastructure, the definition of the consequence levels and the list of the predefined scenarios. Moreover, the paired comparison technique is explained with clear and detailed instructions provided on the role of the participants. The fifth part invites the participants to provide their feedback on the elicitation and raise any concerns regarding the questionnaire. In what follows the material found in the fourth,  part of the questionnaire is presented in detail.Infrastructure systems are complex, often spatially distributed, networks. As a first step, information is collected with the aim of gaining an in-depth understanding of the region being studied, including interaction between different infrastructure systems. To do this, a list of the major components of the various systems and/or networks and their main characteristics is constructed. The focus is on characteristics  which are deemed important for the assessment of their vulnerability to different hazards. Finally, information regarding the functioning of the infrastructure is necessary to understand the importance of the services it provides at local, national and international level.A list of possible hazard scenarios that can affect the infrastructure is compiled. To assist the elicitation facilitator to compile these hazard scenarios, the methodology proposes the construction of scenarios for a given hazard class. In Fig.\u00a0The selected hazard scenarios are mainly based on knowledge of past events that have affected the region, the specific infrastructure system or similar systems in other locations. The incorporation of scenarios adopted in the literature for the risk assessment of the examined type of infrastructure is also recommended. However, it is important not to concentrate only on past events that have caused large or disastrous consequences, but to include \u201cnear-miss\u201d events that might be repeated at greater intensity in the future with catastrophic consequences, and to consider \u201ccounterfactual\u201d events Woo , 2013 whDiscrete levels of consequence also need to be determined to aid the comparison of different hazards and across different infrastructure systems. Table Having determined the list of hazard scenarios and the definition of the consequence levels, the elicitation process can take place, during which the participants are invited to provide their \u2018contingent evaluations\u2019  (Cooke and Misiewicz R\u201d indicating that the incident on the Row (Hazard Event 1) better meets the relevant criterion than the incident (Hazard Event 2) in the column; or a \u201cC\u201d if they think that the incident in the Column better meets the criterion. In a case where the expert\u2019s opinion is that the two incidents are equally likely to meet the criterion then an equals sign (\u201c=\u201d) should be put in the box  measures how closely the experts\u2019 option rankings determined by the patterns of individual pairwise choices correspond to one another among the group of participants. For one particular set of pairwise comparisons, and on their own, these two metrics are only roughly indicative of the levels of agreement and concordance that exist. The metrics can be more informative, and potentially diagnostic, if the whole topic being addressed covers a number of different issues or factors for which expert pairwise choices are elicited; then, agreement and concordance scores can quantify the relative evidential strengths of each component of the pairwise elicitation, as contributions toward characterizing the make-up of the problem overall.With regard to the group of participants, their level of agreement as a group is examined in three different ways. Firstly, a chi-square test is conducted by the software to test the null hypothesis that the preferences expressed by the respondents, as a group, are random. For instance, from this test, a Having analyzed the results, a feedback workshop with the participants is held to discuss the findings. The participants are invited to express their opinions on whether they agree or disagree with the findings and, if critical, provide justifications for their disagreements. The facilitator should be prepared for the extreme case of a majority of the participants expressing major disagreement with the outcomes. In this case, the questionnaire could be revised and sent to the participants for the process to be repeated.Reporting the findings is the final step of the proposed methodology. The report should contain the aggregated data and if desired dependent on the context can be structured to ensure the anonymity of the participants and their organizations.The case study presented in this paper is intended to demonstrate the application of this method to the infrastructure generally in the \u00d8resund region, without specific reference or consideration to any infrastructure asset or sector. The general nature of this case study was explained to the participants at the outset. What follows is a brief description and a summary of the most significant infrastructure geographically co-located in the region, as well as of the region itself.The \u00d8resund region covers the region of Sk\u00e5ne on the Swedish side of the \u00d8resund strait, the capital region of Denmark and Zealand region  on the Danish side. With a total population of nearly 4 million people, the region is an excellent example of European cross-border collaboration and interdependency, building on the metropolitan area around Copenhagen and Southern Sweden, with the cities of Malm\u00f6, Lund and Helsingborg.The most obvious infrastructure connecting the region is the \u00d8resund fixed link, a four-lane motorway and rail (two tracks) bridge/tunnel across the \u00d8resund between Copenhagen and Malm\u00f6, with associated motorway and railway connections. Denmark and Sweden\u2019s transport infrastructures are interconnected with the \u00d8resund road and rail link, which is used daily by over 10,000 commuters. The \u00d8resund road and rail crossing comprises an 8\u00a0km long bridge spanning between a 4\u00a0km long artificial island in the middle of the sound and mainland Sweden and the 4\u00a0km long Drogden immersed tube tunnel between the artificial island and Copenhagen in Denmark. As well as linking two large communities by road and rail, allowing commuters to live on one side and work in the other, the crossing  is the primary road and rail link between Scandinavia and mainland Europe and has reduced the crossing time to a 15\u00a0min car or train journey. Train traffic via the \u00d8resund Bridge is reliant on the electricity infrastructure of both Denmark and Sweden. At the time that this study was undertaken, the bridge also carried the main fiber optic data connection to Finland.Other transport infrastructure in the region includes the Copenhagen airport, which is the sixth largest air transportation hub in Europe used daily by over 10,000 travelers, 4000 of whom travel for business; the ferry between Helsing\u00f8r and Helsingborg; the navigational routes in the strait; several ports ; Copenhagen Metro and Malm\u00f6 city tunnel; connected highways ; and the \u00d8resund railway line.In this case study, the most critical natural and operational hazard scenarios for the infrastructure in the \u00d8resund region are identified using the proposed risk-prioritization framework. In what follows, a brief account of past natural events and operational accidents that have affected the \u00d8resund region is presented, together with the results obtained by applying the proposed methodology developed. It should be mentioned that in the present case study, the stakeholders consulted were individuals or representatives of organizations who have a specific expertize and familiarity with the infrastructure of the \u00d8resund region in general but did not represent any of the owners or operators of the infrastructure, as such the application presented is only exemplary. The authors were the facilitators. The goal of the study is to prioritize the hazardous scenarios for the region such that they could provide input to the regional risk assessment or to the risk assessment undertaken by the operators of the infrastructure in the region. This study also allows for an assessment of the level of agreement among the stakeholders, which captures the complexity of the problem as well as the extent of any lack of data or divergence of judgements. As in any hazard identification study or risk assessment, it is acknowledged that the selection of a sample of hazard scenarios can usually only represent a fraction of the range of scenarios that could occur. However, this does not reduce the value of the prioritized list of hazardous scenarios that can be obtained by applying the methodology.A questionnaire containing three tables with the generic form of Table In the following, a detailed discussion of the results depicted in Tables No major disaster has hit the \u00d8resund region in the recent past. Nonetheless, several natural hazard classes have caused various levels of disruption to the operations of the region\u2019s infrastructure.Both Copenhagen and Malm\u00f6 are low-lying coastal cities. Their location increases their vulnerability to flooding. In 2010 and 2014, heavy torrential rains caused flooding and closures of roads in Malm\u00f6 and other parts of the Sk\u00e5ne region  are not random. With respect to the coefficients of agreement and concordance, these values (see Table With regard to the consistency of the group of participants, it is observed in Table Figure\u00a0In Fig.\u00a0Figure\u00a0In particular, the scenarios of extremely high winds, snowstorm and off-site lightning causing a power outage are the three scenarios which are considered both more likely to occur in the next 5\u00a0years and more likely to cause Disaster. It should be noted that storm surge also ranked very high in the likelihood to cause Disaster, although it ranked 7th in its likelihood to occur in the next 5\u00a0years. A notable outcome of the elicitation is the scenario of the solar storm which appears to be more likely to cause Disaster than to cause Emergency. For this scenario, the large radius of the ellipse in the y-direction regarding its likelihood to cause Disaster can also be noted. This means that the participants are not in agreement regarding its ranking order. Despite this, the solar storm scenario can also be flagged as potentially critical given that its rank score could be as high as the snowstorm or the off-site lightning.In contrast to the complex picture of the disaster-level, the plot of rank scores of likelihoods of Emergency against the scenario likelihoods to occur in the next 5\u00a0years shows less significant off-diagonal deviations. In particular, the three meteorological scenarios, namely extreme high winds, snowstorm and lightning, are identified as the hazards most likely to occur and cause an Emergency in the region. This said, the degree of dispersion in the exact ranking order of each of the three scenarios is sizeable and identifying a single dominant hazard scenario on this basis is, therefore, difficult.The transport infrastructure in the \u00d8resund region could also be disrupted by operational hazard scenarios. News reports over the recent years showed that since its opening 17\u00a0years ago, the \u00d8resund link had to be closed on multiple occasions due to road accidents. Notably, on the 15th February 2017, the link was closed after at least 10 cars were involved in an accident which injured 14 people (The local In Table The 10 hazard scenarios are ranked using the UNIBALANCE (Macutkiewicz and Cooke The consistency of the responses of each individual participant and the degree of agreement within the group of participants are assessed first. Individually, the eight individual stakeholders appear to have provided consistent and non-random pairwise preferences for all three likelihoods.p value (see Table p values indicate that the group-wide ranking order is incoherent for the likelihoods of Disaster and Emergency. In line with this, the low values of the coefficients of agreement and concordance for the likelihood of Disaster and Emergency also suggest a large degree of dissimilarity among the participants\u2019 patterns of pairwise preferences, as well as in the collective ranking order of the different scenarios.Unlike the relatively clear picture in the natural hazards scenarios, the ranking of the operational scenarios is associated with high degree of disagreement among the participants. This is reflected in group ranking metrics. In particular, the approximately zero The high degree of disagreement among the participants regarding the rank order of the scenarios is clearly highlighted by the large and overlapping ellipses around each rank score for the majority of scenarios in both direction in Fig.\u00a0In our results, there are two outliers with significantly lower probabilities of Occurrence in both plots: 1\u2014Pandemic, and 3\u2014Aircraft collision with tower pylons; both markers rank quite high on the Disaster and Emergency scales, but the elongated ellipses indicate significant uncertainties associated with the rank scores of both. Similarly, the airside accident scores the highest mean score in Table  but is aThe high degree of disagreement regarding the ranking order of the scenarios highlights the difficulty in prioritizing operational hazard scenarios. This is perhaps unsurprising given the diverse types of infrastructure considered and more discussion is required to address the reasons behind this disagreement. Despite this difficulty, it can be argued that in assessing the risk of the Oresund region, the scenarios of pandemic and aircraft collision are highlighted as worthy of attention for the Disaster case and for the Emergency the airside accident should be added to the aforementioned scenarios. Interestingly, the recent coronavirus pandemic which broke 4\u00a0years after the elicitation vindicated the stakeholders for flagging the pandemic scenario as an event least likely to occur than its alternatives but likely to have a severe impact in the region short term.A methodology is proposed for identifying the most critical natural or operational hazard scenarios in respect of disaster risk or emergency risk for different facilities, systems and assets comprising an infrastructure system. The novelty of the proposed methodology is the use of a structured expert elicitation procedure to obtain quantitative relative risk rankings. The proposed procedure, termed paired comparison, allows for the quantification of the degree of agreement or dissimilarity among the stakeholders in judging the rank order of the scenarios and consequences. The critical scenarios identified and the process of elicitation, which comprises stakeholder workshops, is found to foster discussion among relevant but diverse stakeholders toward improved cross-sectoral emergency and disaster planning. The methodology allows characterizing the stakeholders perception which enables prioritizing scenarios as well as identifying need for further knowledge development. The latter is particularly relevant when scenarios cluster and have large uncertainty. Overall, this characterization is in itself a key element to foster risk communication and to take stakeholder\u2019s views into account in structuring risk management and resilience plans.The proposed methodology was applied to identify critical hazard scenarios for the \u00d8resund region. The methodology was successful in engaging with stakeholders and identifying critical scenarios taking into account their degree of disagreement. Overall, the participants found it easier to reach a consensus in the rank order of the natural hazard scenarios and struggled to reach a consensus in the ranking of the operational ones. With regard to the natural hazard scenarios, the participants highlighted as critical mostly meteorological scenarios. In particular, the relatively frequent events such as extremely high winds, snowstorm and off-site lightning were identified as critical for both the Disaster and Emergency risks. With regard to Disaster risk, the participants also identified storm surge as critical and the solar storm scenario was also flagged as potentially critical. With regard to the operational hazard scenarios, despite significant disagreements among participants, the scenarios of pandemic and aircraft collision were highlighted as potentially critical for both levels of consequences. In particular for the case of Emergency, the airside accident was also flagged as potentially critical by the participants.The disagreement among participants noted in the application is in many respects not surprising if there were unambiguous dominant hazard scenarios or individual risks, then an expert elicitation would not be needed. What the present methodology offers, for the transnational \u00d8resund region, is a set of objective comparative rankings of natural and operational hazard scenarios and associated likelihoods of emergencies or disasters in the next five years, against which response planning and other priorities can be set, basic similarities in effect scale and impact magnitudes notwithstanding. It is believed that this process of paired evaluation, stakeholder engagement, workshops, discussion and feedback provide a means for resilience to be discussed and to raise awareness in stakeholders of potential risks."}
+{"text": "The role of long non-coding RNA (lncRNA) in human tumors has gradually received increasing attention in recent years. Particularly, the different functions of lncRNAs in different subcellular localizations have been widely investigated. The upregulation of lncRNA small nucleolar RNA host gene 17 (SNHG17) has been observed in various human tumors. Growing evidence has proved that SNHG17 plays a tumor-promoting role in tumorigenesis and development. This paper describes the molecular mechanisms by which SNHG17 contributes to tumor formation and development. The different functions of SNHG17 in various subcellular localizations are also emphasized: its function in the cytoplasm as a competing endogenous RNA (ceRNA), its action in the nucleus as a transcriptional coactivator, and its function through the polycomb repressive complex 2 (PRC2)-dependent epigenetic modifications that regulate transcriptional processes. Finally, the correlation between SNHG17 and human tumors is summarized. Its potential as a novel prognostic and diagnostic biomarker for cancer is explored especially. The diversity of cancers increases the complexity of treatment. Hanahan and Weinberg first summarized and classified the functional capabilities acquired by cancer cells that facilitate cell survival, proliferation, and dissemination into six cancer hallmarks in 2000, which include the following: 1) sustaining proliferative signaling, (2) evading growth suppressors, 3) enabling replicative immortality, (4) activating invasion and metastasis, (5) inducing/accessing vasculature, and (6) resisting cell death  have been found to regulate genomic expression through transcriptional and post-transcriptional levels . The funSNHG is the small nucleolar host gene and belongs to lncRNA. Several SNHG family members, such as SNHG1 , 8, SNHGThis paper discusses the correlation between SNHG17 and tumors by describing the molecular mechanisms by which SNHG17 contributes to the formation of cellular hallmark capabilities and the enabling characteristics. The paper also focuses on its different functions in various subcellular localizations and finally discusses the potential of SNHG17 as a new prognostic and diagnostic biomarker for cancer.The data samples of the differentially expressed genes of LUAD after SNHG17 knockdown were downloaded from GSE131543. The immune-related genes were acquired from the ImmPort database.http://metascape.org/). Terms with p-value cutoff of 0.01, min overlap of 3, and min enrichment of 1.5 were considered. The top 20 enriched terms are displayed in GO analyze was performed using Metascape (ssGSEA was applied to explore the infiltration degrees of immune cell types in LUAD of the TCGA database using the GSVAR package in R (version 1.34.0). The estimated package was used to generate ImmuneScore, StromalScore, and ESTIMATEScore. R language version 3.6.3 loaded with ggplot2 package (version 3.3.3) was used to demonstrate the correlation between SNHG17 and PD-L1. All the correlation between SNHG17 and others were studied using Spearman correlation analysis.SNHG17 is associated with increased cell proliferation capacity in various types of cancers. The mechanisms that promote the formation of this phenotype include the activation of cyclin-dependent kinases (CDKs), phosphoinositide-3 kinase/protein kinase B (PI3K/Akt) and Wnt/\u03b2-catenin signaling pathway, and the inhibition of cyclin-dependent kinase inhibitor (CKI) Figure\u00a01), first identified the relevance between SNHG17 and tumor cell proliferation in colorectal cancer, and revealed that SNHG17 epigenetically targets p57 by binding to enhancers on zeste homolog 2 (EZH2). As a well-known CKI, p57 plays a vital role in regulating the cell cycle. Briefly, the cell cycle regulatory machinery comprises three major types of proteins: cyclin, CDK, and CKI. The binding of cyclin with CDK promotes cell cycle progression, and CKI hinders this effect by inhibiting the cyclin-CDK complex. The tumor suppressor-like properties of CKI have been reported in recent years . As a considerably method for intracellular protein degradation, the UPS is one of the essential mechanisms controlling the levels of MYC protein . A recenPI3K/AKT signaling, one of the critical intracellular pathways, is also involved in the mechanism of how SNHG17 enables tumor cells to obtain the capacity of sustained proliferation. STAT3 and transforming growth factor-\u03b2 (TGF-\u03b2) are located upstream of SNHG17, which contribute to activate the PI3K/AKT signaling pathway by increasing SNHG17 levels , 29. In CTNNB1 gene, which encodes \u03b2-catenin by targeting miR-506-3p  facilitates this upstream regulation of SNHG17  and regulatory cell death (RCD). Apoptosis has been widely investigated as the first identified regulatory cell death in tumors; some non-apoptotic regulatory cell deaths, such as autophagic cell death, pyroptosis, and ferroptosis, are also currently gaining attention. Cancer cells can resist cell death through multiple pathways, which is also one of the hallmark capabilities. Interestingly, the upregulation of SNHG17 is associated with increased drug resistance in astrocytoma and prostate cancer , 40. FurMultiple innate tumor suppressive mechanisms exist in mammals to ensure that cells have normal levels of proliferation, and these mechanisms are activated when cells show aberrant proliferation, leading to apoptosis or senescence . Thus, rIn addition, IGF binding protein 3 (IGFBP3) may act as a bridge linking SNHG17 to p53-dependent apoptosis in colorectal cancer . IGFBP3 Autophagy plays a role in the maintenance of normal cellular homeostasis-like apoptosis. Interestingly, as with TGF-\u03b2, cellular autophagy plays a dual role in tumor progression, inhibiting early tumor formation and promoting late tumor progression \u201352. IncrSNHG17 was screened as an effective autophagy-related lncRNA signature closely associated with prognosis in ovarian cancer and renal clear cell carcinoma , 57. IntFerroptosis is an iron-dependent oxidative cell death , and thiConcerning the studies on the relationship between SNHG17 and tumors, the most significant relationship is the promotion of tumor proliferation, invasion, and metastasis. Several studies have shown that the high-level expression of SNHG7 correlates with lymph node metastasis, distant metastasis, and tumor invasion depth in various tumors , 44, 46.SNHG17 can have different functions in various subcellular localizations. The best-known capability of SNHG17 lies in its function as ceRNA in the cytoplasm. In esophageal squamous and hepatocellular carcinomas, SNHG17 can promote EMT by targeting miR-338-3p/SOX4 and miR-3180-3p/regulatory factor X-box 1 (RFX1) axes, respectively , 63.via sponge miR-144 , recently demonstrated that SNHG17 is involved in TGF-\u03b21-mediated EMT in esophageal squamous cell carcinoma. Mechanistically, SNHG17 acts in the nucleus by recruiting the transcription factor c-Jun to the c-Myc promoter region, which increases the transcriptional activity of the c-Myc promoter. Furthermore, SNHG17 promotes the expression of the EMT-associated transcription factor Twist1 via c-Myc  belong to the family of extracellular proteases and promote tumor progression through tumor microenvironment (TME) regulation. MMPs are not only known as a marker of EMT but also induce EMT. Exosomes can act as tools for cancer cells to regulate the TME and promote proliferation and invasion. As the lncRNA released from tumor-derived exosome, SNHG17 is crucial in promoting tumor migration by increasing MMP2 levels through sponge miR-2861 .via the Wnt/\u03b2-catenin signaling pathway in vivo experiments  deserves consideration. Telomeres, which protect the ends of the chromosome, are closely associated with the capability of tumor cells to proliferate indefinitely. Consequently, telomerase, specifically expressed in most tumors, plays an important role and prevents telomere shortening. Telomerase is an attractive target for tumor therapy. Its catalytic core includes telomerase reverse transcriptase and telomerase RNA. SNHG17-related protein PES1 can promote tumor progression in multiple ways. As a key component of telomerase composition, PES1 promotes telomerase assembly by facilitating the direct interaction between telomerase reverse transcriptase and telomerase RNA. The increased expression of PES1 can also lead to enhanced telomerase activity and affect telomere length maintenance , 84.Hanahan and Weinberg 2011) introduced immune destruction avoidance as another hallmark capability  and intersected them with immune-related genes downloaded from the ImmPort database , recently raised the possibility of cancer-derived exosomes as an emerging enabling characteristic. Interestingly, SNHG17 can be released by cancer-associated fibroblast as exosomal lncRNA in osteosarcoma to promote tumor proliferation, migration, and apoptosis resistance .We are grateful for the help of Heilongjiang Human Resources and Social Security Bureau.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "This paper proposes a muffler with simple geometry to effectively reduce low-frequency noise in ductwork systems. A muffler named infinity tube with an expansion chamber (ITEC) is developed from the infinity tube (IT). Theoretical and numerical analyses of wave propagation in the ITEC have been conducted in this paper. The transfer matrix method is adopted to predict transmission loss theoretically. The theoretical results are validated by the finite element method simulation. The comparison of the transmission loss between the IT and ITEC illustrates that the ITEC has an advantage in low-frequency noise reduction. The transmission loss results of the ITEC are compared with the Helmholtz resonator system to assess the potential for industrial application. Finally, the geometric parameters of the proposed ITEC on its noise attenuation performance have been analyzed. The proposed ITEC can effectively reduce low-frequency noise, and it is suitable for ductwork systems in constrained spaces. The ductwork system is of vital importance to modern buildings . It is aThe Herschel-Quincke tube (hereafter HQ) consists of two pipes parallelly mounted along with arbitrary length and cross-section area ,11. StewLato et al.  developeIn this paper, the transfer matrix method (TMM) is adopted to predict the noise attenuation ability of the ITEC. TMM and the statement of pressure equality and conservation of volumetric flow are performed to solve the transmission loss of the ITEC analytically. The finite element method (FEM) simulation of the ITEC has been conducted to validate the theoretical prediction results. Then, the transmission loss results of the ITEC are compared with infinity tubes and other silencers to examine the noise attenuation performance. The most frequently used reactive silencer in industry, the Helmholtz resonator, is chosen for comparison. Finally, the effects of the geometric parameter of the proposed ITEC on the noise attenuation performance are investigated.p is the acoustic pressure, c0 = 343 m/s represents the sound speed in the air, and t is the time. Assuming that the wave is harmonic in time, the sound pressure and particle velocity could be solved as:3 represents the air density, Considering only that the plane wave exists inside a duct system, the sound wave propagation along the X-direction would be governed by the classical acoustic wave equation as:ECL is the length from point C to point D. Sound pressure The transfer matrix method (TMM) has been widely used to evaluate the noise attenuation performance of the mufflers. The transfer matrix of a circular duct of uniform cross-sectional area and length, e.g., from point C to point D in By ignoring the time-harmonic terms, Equations (5) and (6) could be re-arranged to a matrix form:L inside a uniform cross-section duct. Then, the transfer matrix CDT of Equation (4) could be obtained by inverting Equation (7):Equation (7) could be used to determine the sound pressure and particle velocity transmitted through length ECS is the area of duct CD, and NS is the area of neck AB.TMM could also solve the transfer matrix at conjunction points. According to the statement of pressure equality and conservation of volumetric flow, the transfer matrix from point B to point C in TT represents the transfer matrix for the side-branch tube of the ITEC, and ABT to EFT represents the transfer matrix of each cascaded subsystem. The transfer matrix from ABT to EFT could be easily obtained by referring to Equations (8) and (9).By calculating the product of the transfer matrix in each subsystem, the sound pressure and particle velocity between points A and F in L and R of the main duct is required. The continuous conditions of pressure equilibrium and conservation of volume velocity at the junction position yield:The sound transmission characteristics inside the side-branch tube are pre-requisites to acquiring the sound pressure and particle velocity of the whole duct system. This indicates that the transfer matrix between points Re-arranging Equation (11), we can obtain:The relationship between L and R:Equation (13) along with Equations (12) and (11) could be solved to determine the transfer matrix between points Finally, the transmission loss of the whole duct system could be expressed as:The finite element method (FEM) simulations are performed by commercial software COMSOL Multiphysics to validate the accuracy of the transmission loss results of the analytical model. The parameters of the ITEC model in this validation case are listed in MS represents the cross-section area of the main duct, S2 denotes the cross-section area of IT, and L2 represents the length of IT. In ECS has the same value as NS, the ITEC would become an infinity tube. Therefore, the analytical model of the ITEC could also be used to predict the transmission loss of IT. In this case, matrices BCT and DET in Equation (10) turn into identity matrices, which indicates that Equation (10) becomes:The analytical model could also be used to predict the transmission loss of the infinity tube. According to Lato et al. , for an TT in Equation (17), the transmission loss of the infinity tube could be deduced. In the following research, the analytical model based on Equation (15) is used to calculate the transmission loss of IT and then is compared with the results from Equation (16).Using the expression of L2 = 1.15 m and various S2M/S ratios. At the same time, ITs with the same geometries are used to examine the transmission loss by Equation (15). As shown in S2M/S = 1/4 case in A comparison of the transmission loss between the IT and ITEC is carried out to examine the noise attenuation ability of the ITEC. The parameters of the ITEC are the same as the geometric model of The Helmholtz resonator is widely used as a muffler for ductwork systems in industry . To furtNL = 95.91 mm and N =S 1418.6 mm2. The cavity volume of parallel HRs is the same as half of the chamber volume of curved HRs, which is easy to obtain from In this study, the parameters of curved HRs are the same as the ITEC in ECL + 2NL) is fixed (1150 mm), while the neck and expansion chamber lengths have different values. The length values are shown in In this section, ITECs with different geometric parameters are analyzed to discuss the influence of geometrics on noise attenuation performance. (1)Under the lower-frequency domain, length ratios have little influence on resonance frequency and attenuation bandwidth. ITECs with a higher length ratio would slightly decrease transmission loss peaks and have slightly narrower attenuation bands.(2)Under the moderate frequency domain, the length ratio significantly influences transmission loss performance. ITECs with higher length ratios have a higher resonance frequency and narrower attenuation bands. Compared with the low-frequency condition, ITECs have significantly narrower attenuation bands under the moderate frequency domain, which indicates that ITECs with higher length ratios are not suitable for medium-frequency noise attenuation.(3)Length ratio has a significant influence on transmission loss under the higher-frequency domain. With the length ratio changing from 1/10 to 1/4, the transmission loss peak has increased by nearly 100 Hz. In addition, ITECs with a length ratio equal to 1/4 have a significantly wider bandwidth than the other length ratios, which indicates that the increase in neck length of the ITECs would be good for high-frequency noise attenuation.N/SECS ratios correspond to three different expansion chamber radii and a fixed neck radius. The transmission loss results are shown in N/SECS = 1/4 has the lowest peak frequency and widest noise attenuation bandwidth under the lower-frequency domain. On the contrary, the lower cross-section area ratio would be better for high-frequency noise attenuation. The ITEC with N/SECS = 1/1.44 has the highest peak frequency and widest noise attenuation band under the higher-frequency domain.Furthermore, the influence of the cross-section area ratio is investigated. As listed in L = ECL + 2nL= 1.15 m); ECL and nL are also scaled down simultaneously, whereas the radii of the neck and expansion chamber have remained unchanged. As shown in L would lead to a more significant error than the FEM results, which is due to the fact that the neck length of 0.6 L is very short. According to Ingard [nL case. Both TMM and FEM results show that the ITECs with shorter lengths would have a broader noise attenuation band. Meanwhile, the transmission loss peaks tend to shift to the higher-frequency domain. Therefore, the ITECs with shorter lengths would have better noise attenuation performance but are not suitable for low-frequency noise reduction. The transmission loss peak (TLmax) and the resonance frequency (0f) of ITECs with different geometric parameters are summarized in In o Ingard , an end TLmax. It can be seen that changing the length ratio leads to a change of 19 dB in the TLmax in higher-frequency domain and a change of 11.8 dB in the TLmax in moderate frequency domain. Changing the cross-section area ratio has a change of 12.1 dB in higher-frequency domain. Changing the total length has a change of 7.8 dB in lower-frequency domain. Therefore, adjusting the length ratio and the cross-section area ratio are beneficial for improving the higher- and medium-frequency noise attenuation ability, and adjusting the total length is useful for improving the lower-frequency noise attenuation ability. 0.f Changing the total length has more of a significant impact on the resonance frequency than changing the length ratio and the cross-section area ratio. The 0f under three peaks has an increase of 98, 302, and 254 Hz. This indicates that adjusting the total length is an effective way to control the frequency of noise reduction.This paper conducts a thorough theoretical and numerical investigation of an innovative noise attenuation device, the ITEC. The conclusions are summarized as follows:A closed-form equation for the transmission loss of the ITEC device has been derived. The analytical model is compared with the FEM model to validate the accuracy of the transmission loss results. In addition, the analytical model is used to predict the transmission loss of the IT device. Transmission loss results indicate that IT could be regarded as a particular case of the ITEC.The transmission loss results of the ITEC are compared with those of IT, which shows that the ITEC is more suitable for reducing low-frequency noise than IT devices. The transmission loss results of the ITEC are compared with those of curved HRs and parallel HRs systems. The results show that the ITEC has the same transmission loss results as those of curved HRs system, which indicates that the sharable sidewall does not affect the noise attenuation characteristics of the ITEC device. The ITEC has 14 and 64 Hz resonance frequency reduction than parallel HRs, which indicates that the ITEC is more suitable for reducing low-frequency noise. In addition, the geometry of the ITEC shows that it has an advantage in a constrained space, which indicates that the ITEC would have potential in ductwork systems.A parametric study is conducted to investigate the influence of geometric parameters on the noise attenuation performance of the ITEC. Transmission loss results of the ITECs with different length ratios, cross-section area ratios, and total length are conducted by TMM and FEM. The transmission loss results could provide guidance on choosing the geometric parameters of the ITECs to reduce duct noise."}
+{"text": "This study explored the ideal period for wearing masks to prevent the physiological and psychological problems associated with long-term face mask use during respiratory infections by healthcare workers. Breathing simulators, surgical masks (SM) and medical respirators (PM) were prepared for two to eight hours. Changes in the comfort of masks  and protection  were assessed. The results demonstrated that the masks offered efficient liquid-particle filtering even after eight hours of use. However, the number of bacterial colonies using PM and SM grew significantly after two and four hours, respectively. Concerning comfort, the inspiratory resistance of masks rose dramatically after two hours, whereas the moisture permeability declined considerably after four hours. In addition, skin temperature had a significant increase within two hours, which may result in facial discomfort. When conditions permitted, the hospital staff was instructed to replace their masks every two hours. This century witnessed the emergence of four fatal infectious respiratory diseases: SARS, swine flu, MERS, and coronavirus disease 2019 (COVID-19). Since the year 2020, COVID-19 has rapidly spread around the world ,4. The pWith the onset of the COVID-19 pandemic, the selection process to wear procedure masks on various occasions has become more evident, and numerous experts have presented suitable recommendations for their use ,11,12,132 and O2 [However, based on interviews and studies, medical experts are unsure about the exact period of mask use. According to studies, masks  could be worn for 8 h without a substantial reduction in bacterial filtration, breathability function  and part2 and O2 . The acc2 and O2 . Itching2 and O2 ,24,25. A2 and O2 . The pot2 and O2 . Even he2 and O2 . Until rTherefore, the purpose of this study was to determine the optimum time for healthcare workers to wear different masks, by means of assessing the overall changes in protection and comfort of the masks after various wear times. Following the study, two types of masks\u2014surgical masks (SM) and medical respirators (PM)\u2014 that were frequently used by medical staff were chosen. A breathing simulator was utilised by simulating the frequency, temperature, and humidity of human breathing. Starting with the safety and comfort of the masks, this study evaluated the relationship between safety performance  and comfort performance  over time of wear. The finding demonstrated the optimal time to wear a mask, which would help healthcare personnel use them properly, reduce their psychological stress, and lessen the health hazards associated with inappropriate wear.Surgical masks (SM) and medical respirators (PM) worn by medical staff nowadays were chosen as research subjects. Filtration efficiencyAccording to the standard GB 19083, the filtration efficiency of non-oily particles in masks was tested after varying simulated wearing times. With a flow rate of 85 L/min, the Automated Filter Tester 8130  was utilised. The particle size of sodium chloride was 0.3 \u03bcm. A specialized mask mold was used to ensure that sodium chloride particles pass only through the mask\u2019s surface without escaping through the edges. After three repetitions of each test, the average result was determined.Synthetic blood resistance of mask surfaceThe masks that underwent different wearing times were evaluated for anti-synthetic blood penetration in compliance with YY/T 0691 and YY 0469. The JYF-247X Medical Face Mask Synthetic Blood Penetration Tester  was used to simulate 16 kPa of blood pressure in humans. The injection speed was set at 550 cm/s. When injecting, a volume was sprayed at the central part of the mask and after 10 min, its back was checked for signs of penetration.Total bacterial colony countDifferent individuals wore SM and PM in a laboratory at constant temperature and with relative humidity for various periods. In accordance with GB 15979, they were tested for bacterial contamination. Samples were taken from nose and mouth masks and diluted 1:20 with saline. After thorough mixing, the aforementioned salt samples precipitated spontaneously. Supernatants were collected for colony counting; 1 mL of sample solution was applied to each Petri dish, followed by 15\u201320 mL of nutrient agar medium. After mixing and hardening, plates were inverted and incubated for 48 h at 37 \u00b0C. Infrared imaging of facial skin temperatureAn Infrared Thermal Imager T630sc  was utilised to record thermal images of a head model wearing a SM or a PM to simulate normal breathing for a predetermined time duration. The FLIR ReserchIR Max software (version 4.40.9.30) could calculate the average temperature of a specific spot or region on the face in response to fluctuating skin temperature during different wearing periods.Respiratory system resistanceAs required under GB2626, the breathing resistance of masks was evaluated after simulated wearing for different periods. As the automatic equipment for breathing resistance tests, the JYF-246T  was chosen and its gas flow rate was set at 85 L/min. During testing, the gaps between the face and the mask were sealed with adhesive tape to prevent any edge leakage. Following five repetitions of each test, the mean result was determined.Moisture permeabilityThe moisture permeability of masks that underwent different wearing duration was measured in accordance with the standard GB/T 12704. A temperature of 38 \u00b0C, relative humidity of 90%, and gas flow rate at 0.5 m/s were applied to the Water Vapour Permeability Tester FX 3180 . Random samples were taken from the same region of multiple masks to avoid contacting the desiccant. The average value was taken as the result following the three repetitions of each test.p < 0.05. Using IBM SPSS Statistics 25, statistical analysis was carried out. Hypotheses were tested using ANOVA and multiple comparisons. A significant difference was indicated by Filtration effectiveness varied with wear time for the two types of masks, as seen in Spunbond + Meltblown + Spunbond (SMS) constructions for surgical masks consisted of a spunbond nonwoven outer layer, a meltblown nonwoven middle layer and a spunbond nonwoven inner layer . To formThe preparation of synthetic blood conformed to the YY 0469 standards. It contained sodium carboxymethyl cellulose, Tween-20, sodium chloride, methylisothiazolinone, red dye amaranth, and distilled water. Its surface tension and viscosity were comparable to those of blood, as its hue resembled it. The surface morphology of masks before and after a blood spray is displayed in p < 0.001) with continued use, whereas SM experienced a significant increase beginning at 4 h. After varying periods of use, the overall number of bacterial colonies with SM was considerably less than with PM. During the first four hours of use of both masks, bacterial colonies increased steadily before erupting. With continuity in respiration, the relative humidity within the mask increased. The temperature inside the mask was comparable to that of the human body. Consistent with the findings of earlier investigations ,39, bactp < 0.001 for SM and p < 0.05 for PM.2 levels, and decreased O2 levels, resulting in hypercapnia or hypoxaemia, which can lead to headaches [As the duration of mask wear increased, a considerable quantity of moisture gathered inside the mask, slowly creating droplets and making it damp. Some pores were clogged by water vapour, which decreased the air exchange efficiency and gradually raised breathing resistance. The minute ventilation required for strenuous total-body activity was 10 to 15 times higher than typical . When theadaches . Likewiseadaches , which wp < 0.001) between conditions of wearing one or not doing it. There was no substantial change in temperature after six hours. After using one for two hours, the surface temperature of both types increased significantly by 4.9 \u00b0C. After eight-hour use, the temperature of SM was 31.2 \u00b0C, a rise of 5.7 \u00b0C, while that of PM was 31.8 \u00b0C, a rise of 6.2 \u00b0C.While breathing, thermal infrared images, lateral views, of SM and PM were captured see . From a Due to the particularly good liquid barrier characteristics of the mask, inhaled water vapour at the surface of the head mould cannot exit smoothly, resulting in the formation of a considerable amount of moisture on both the face and mask. The human face contains highly concentrated temperature sensors , making According to the experimental data, the moisture permeability of SM was better than that of PM. With the extension of time, it showed a downward trend. There was no significant difference in moisture permeability during four hours of mask-wearing. After six hours of breathing simulation, it decreased significantly, as shown in Water vapour passes through the fabric in three broad ways : water mThe optimal wear time for each indicator specific to both types of masks is summarised in Combining the safety and comfort of masks, it is advised that healthcare workers replace their masks every two hours, not more than four hours if conditions allow. Even though surgical masks are more comfortable than medical respirators, employees are encouraged to wear respirators in COVID-19 risk situations due to their weak protective properties and poor fit to the human face.This study was conducted in a controlled laboratory environment where the temperature and humidity were kept at 20.0 \u00b1 2.0 \u00b0C and 65.0 \u00b1 4.0% to assure constant test conditions for wearing a mask and to minimise errors; thus, it may not fully reflect real-world situations. Extremes in outdoor temperature and humidity, as well as the actual labour intensity faced by medical staff, can significantly affect mask samples and reduce their effective life."}
+{"text": "Are 25-year intensity-based physical activity trajectories associated with nonalcoholic fatty liver disease (NAFLD) in midlife?In 2833 Black and White participants in the Coronary Artery Risk Development in Young Adults cohort study, those in a high decreasing vigorous-intensity physical activity (VPA) trajectory had a 41% lower risk of NAFLD than those following a low stable VPA over 25 years. No associations were found between moderate-intensity physical activity trajectories and NAFLD.These findings suggest the importance of sustained VPA from early adulthood to midlife for lower NAFLD risk, and the importance of equitable prevention programs that promote lifelong participation in vigorous-intensity activities. This cohort study investigates intensity-based physical activity (PA) trajectories from young to middle adulthood and examines the associations between PA trajectories and nonalcoholic fatty liver disease prevalence in midlife. Physical activity (PA) is recommended for preventing and treating nonalcoholic fatty liver disease (NAFLD). Yet, how long-term patterns of intensity-based physical activity, including moderate-intensity PA (MPA) and vigorous-intensity PA (VPA), might affect the prevalence of NAFLD in middle age remains unclear.To identify distinct intensity-based PA trajectories from young to middle adulthood and examine the associations between PA trajectories and NAFLD prevalence in midlife.This population-based cohort of 2833 participants used the Coronary Artery Risk Development in Young Adults study data. The setting included field clinics in Birmingham, Alabama; Chicago, Illinois; Minneapolis, Minnesota; and Oakland, California. Data analysis was completed in March 2023.PA was self-reported at 8 examinations over 25 years (1985-1986 to 2010-2011) and separately scored for MPA and VPA.NAFLD was defined as liver attenuation values less than 51 Hounsfield units after exclusion of other causes of liver fat, measured using computed tomography in year 25 (2010-2011).Among a total of 2833 participants included in the sample, 1379 (48.7%) self-identified as Black, 1454 (51.3%) as White, 1206 (42.6%) as male, and 1627 (57.4%) as female from baseline (1985-1986)  to year 25 (2010-2011) . Three MPA trajectories were identified: very low stable (1514 participants [53.4%]), low increasing (1096 [38.7%]), and moderate increasing (223 [7.9%]); and 3 VPA trajectories: low stable (1649 [58.2%]), moderate decreasing (1015 [35.8%]), and high decreasing (169 [6.0%]). After adjustment for covariates , participants in the moderate decreasing  and the high decreasing  VPA trajectories had a lower risk of NAFLD in middle age, relative to participants in the low stable VPA trajectory. Adjustments for baseline body mass index and waist circumference attenuated these estimates, but the results remained statistically significant. The adjusted RRs across the MPA trajectories were close to null and not statistically significant.This cohort study of Black and White participants found a reduced risk of NAFLD in middle age for individuals with higher levels of VPA throughout young to middle adulthood compared with those with lower VPA levels. These results suggest the need for promoting sustainable and equitable prevention programs focused on VPA over the life course to aid in lowering NAFLD risk. In the United States, the prevalence of NAFLD among adults is approximately 31%,8 Moreover, different forms of PA  seem to have a beneficial effect on NAFLD.8 However, little is known about how long-term patterns of different forms of PA  might affect NAFLD prevalence in middle age. By identifying patterns of PA over time, the delivery of programs aimed at modifying lifestyle risk factors can be tailored to patients at greater risk for NAFLD.Systematic reviews of randomized and nonrandomized clinical trials investigating the effects of PA on NAFLD indicated that PA resulted in significant therapeutic benefits on NAFLD, including a reduction in intrahepatic lipids independently of weight loss.In this study, we aimed to (1) identify distinct PA trajectories from young to middle adulthood over 25 years and (2) examine the associations between intensity-based PA trajectories and NAFLD prevalence in middle age (ages 43-55 years) in a racially diverse population of adults. We hypothesized that multiple PA trajectory patterns exist within the Coronary Artery Risk Development in Young Adults (CARDIA) population and that, when considering a specific PA intensity , participants in a trajectory of higher levels of PA over time would be associated with a lower likelihood of NAFLD in middle age compared with those in a trajectory of lower levels of PA.9 Briefly, in 1985 to 1986, 5115 self-identified Black and White men and women aged 18 to 30 years (year 0: Y0) were recruited from 4 US urban sites: Birmingham, Alabama; Chicago, Illinois; Minneapolis, Minnesota; and Oakland, California. Participants have been followed up for more than 35 years with in-person examinations and detailed collection of sociodemographic and clinical data at Y0, Y2 (1987-1988), Y5 (1990-1991), Y7 (1992-1993), Y10 (1995-1996), Y15 (2000-2001), Y20 (2005-2006), Y25 (2010-2011), Y30 (2015-2016), and Y35 (2020-22). Retention rates have been high among survivors throughout the 30 years of completed follow-up.10 All study protocols were approved by the institutional review boards at all study sites, and all participants provided informed consent at each examination. This study followed the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) reporting guideline for cohort studies.The CARDIA study is an ongoing prospective observational cohort designed to investigate risk factors for cardiovascular disease. The CARDIA study design, sampling strategy, and methods have been described elsewhere.A total of 3181 participants had liver attenuation measured at Y25. Of those with liver attenuation data, we excluded a total of 331 participants as follows: those with self-reported cirrhosis or viral hepatitis (n\u2009=\u200953); risk factors for chronic liver disease  or causes of secondary hepatic steatosis , HIV (n\u2009=\u200927); and medications known to cause hepatic steatosis  (n\u2009=\u200948). After these exclusions, the resulting sample with liver attenuation data was 2850. An additional 17 exclusions were made for participants who did not have at least 3 PA measures during follow-up. The final analytic sample size was 2833 participants.11 Participants were asked for their frequency of habitual activity during the past 12 months in 13 categories (8 vigorous intensity and 5 moderate intensity) of recreational sports, leisure, and occupational activities. Using a computer-based algorithm, total PA scores were calculated based on frequency (number of months), intensity score of the activity , and a weighting factor to correspond to the duration of each activity (2-5 hours per week).11 PA scores were expressed in exercise units (EU), with separate scores for moderate-intensity PA (MPA) and vigorous-intensity PA (VPA). Total PA scores were the sum of scores for all activities. A total of 300 EU is approximately equivalent to 150 minutes of MPA or 75 minutes of VPA per week, as recommended by the 2018 Physical Activity Guidelines for Americans.13 The CARDIA PA questionnaire has validity and reliability comparable with other PA questionnaires.14 We included PA data collected at 8 examinations  over 25 years.Participants reported PA at each examination using the interviewer-administered CARDIA PA questionnaire.15 Quality control and imaging analyses were performed at a core reading facility . Liver attenuation (LA) measured in Hounsfield units (HU) was used as the CT diagnostic criteria for hepatic steatosis. In this study, any NAFLD was defined as LA of less than 51 HU (primary outcome) and moderate-to-severe NAFLD (>30% steatosis) as LA less than or equal to 40 HU (exploratory outcome) after exclusion of other causes of liver fat.16 An LA cutoff of less than 51 HU approximates a liver-to-spleen ratio less than 1.0 and indicates at least mild steatosis is present. CT slices of the upper abdomen were performed to measure LA. The mean of 9 measurements in the right lobe of the liver on 3 distinct CT slices was used to determine mean LA values. In this cohort, the quantitative measurement of LA relied on a workflow within the National Institutes of Health\u2019s Center for Information Technology Medical Image Processing, Analysis, and Visualization application.15 Trained readers avoided measuring regions, including large hepatic vessels and focal hepatic lesions.18 On a randomly selected sample of 156 participants, the interclass correlation coefficient between different readers was high for LA (0.975).15Noncontrast computed tomography (CT) measured liver fat at Y25. Scans of the abdomen were performed using multidetector CT scanners as previously described.19 with a censored normal distribution was used to identify PA trajectory groups from early to middle adulthood (n\u2009=\u20092833). GBTM is a specialized application of finite mixture modeling. It provides a flexible approach for identifying distinctive clusters of individuals following similar developmental trajectories within a given population.19 To identify the best-fitting trajectories, we used the bayesian information criterion , proportion of participants in each trajectory , mean posterior probability of group membership (near 1.0) 21 Models estimated risk ratios (RR) and 95% CI.21 This approach was chosen over conventional methods for binary outcomes (logistic regressions) because the prevalence of NAFLD exceeded 10%, thus estimates were reported using RR instead of odds ratios.22 Clinically important covariates were chosen a priori for inclusion in multivariable models given their potential confounding roles. Models were sequentially adjusted for baseline sex assigned at birth , self-reported race (Black or White according to CARDIA\u2019s study design), study center, and Y25 age, years of education, and lifestyle risk factors . Body mass index  and waist circumference measured at baseline were separately added to the fully adjusted model . Because we hypothesized that BMI and waist circumference measured at Y25 were on the causal pathway between PA trajectories and NAFLD, these variables were not included as covariates. We also explored whether race and sex were effect modifiers. All covariates had less than 1% missing data, except for diet quality score (21% missing). We verified linearity assumptions for continuous covariates through visual inspection, quadratic terms, and quartile categorization. Two-sided P\u2009<\u2009.05 was considered statistically significant. All analyses were performed in Stata 17.0 MP (StataCorp) from January to March 2023.Descriptive statistics summarized Y0 and Y25 sample\u2019s characteristics by PA trajectory groups. Categorical variables were presented as frequency (percentage), whereas continuous variables were presented as mean (SD). The associations between the PA trajectory groups and NAFLD were examined using modified Poisson regression with robust SEs.Among a total of 2833 participants included in the sample, 1379 (48.7%) self-identified as Black, 1454 (51.3%) as White, 1206 (42.6%) as male, and 1627 (57.4%) as female from baseline (1985-1986)  to Y25 (2010-2011) . Three distinct MPA and VPA trajectories from young to middle adulthood were identified . In FiguThe associations between MPA and VPA trajectories and Y25 NAFLD at LA less than 51 are presented in After adjustment for demographics with model 1  and to better understand the association between PA patterns and NAFLD risk, including the optimal duration  of PA for reducing NAFLD risk.36 While the optimal duration and intensity of PA should be tailored to each patient\u2019s preferences and physical abilities, the guidance document emphasizes encouraging patients to exercise as much as possible.36 Our findings offer supporting evidence that higher PA intensities sustained over the life course may reduce the risk of NAFLD. That is, meeting  or exceeding by twice as much  the current VPA guidelines were associated with a lower risk of NAFLD in middle age.The American Association for the Study of Liver Diseases recommends that to prevent or improve NAFLD, patients should engage in 150 minutes of MPA at least 5 times per week or increase their activity level by more than 60 minutes per week.37 such as lower socioeconomic status and access to safe places to be physically active ,39 and engage in advocacy work aimed at achieving equitable access to care and treatments for all patients. Given known socioeconomic, racial, and ethnic disparities in NAFLD prevalence,40 clinicians and researchers need to approach the prevention and treatment of NAFLD with a health equity lens,41 recognizing the root causes  and the social determinants of health that contribute to these disparities.42 Treatment interventions must be feasible and accessible to all patients, particularly for those who are disproportionately affected by these disparities.To best assist patients with NAFLD, clinicians must consider the complex interplay of individual factors and structural and social determinants of health that may affect patients\u2019 ability to make lifestyle changes,40 Future trials and population-based cohort studies should include proper representation of the populations that are most affected by NAFLD to help develop future guidelines that support equitable access to prevention and treatment of NAFLD for all patients.41 Third, our findings are unable to differentiate incident from prevalent NAFLD, as only a single assessment of NAFLD was evaluated. While it is unknown whether participants had NAFLD at baseline, CARDIA began in 1985 to 1986 before the rapid rise in obesity and diabetes prevalence when participants were at a mean age of 25 years, thus with a likely low overall prevalence of NAFLD at baseline. Additionally, we acknowledge the recent nomenclature shift from NAFLD to metabolic dysfunction\u2013associated steatotic liver disease (MASLD).43 Although we used NAFLD criteria in our study, we believe that most of our participants would meet criteria for MASLD.45Our findings should be interpreted in light of the study\u2019s limitations. First, PA was assessed using a self-reported questionnaire, which is prone to measurement error  and social desirability bias. Second, because the CARDIA cohort recruited only Black and White participants, our results might not be generalizable to other racial and ethnic groups and populations with different sociodemographic characteristics, particularly those with the highest prevalence of NAFLD, such as Hispanic populations and those with low socioeconomic status.This cohort study\u2019s results suggest that individuals who met or exceeded the current 2018 Physical Activity Guidelines for Americans  from young to middle adulthood had a lower risk of NAFLD in middle age compared with those who engaged in less than the current recommendations. Targeted delivery of equitable prevention programs aimed at modifying lifestyle risk factors over the life course, particularly facilitating VPA, may be important to reduce NAFLD risk in midlife."}
+{"text": "In human lung cancer, high ERO1A expression is associated with a higher risk of recurrence following neoadjuvant immunotherapy. Mechanistically, ERO1A ablation impairs the balance between IRE1\u03b1 and PERK signaling activities and induces lethal unfolded protein responses in tumor cells undergoing endoplasmic reticulum stress, thereby enhancing anti-tumor immunity via immunogenic cell death. These findings reveal how tumor ERO1A induces immunosuppression, highlighting its potential as a therapeutic target for cancer immunotherapy.Immunophenotyping of the tumor microenvironment (TME) is essential for enhancing immunotherapy efficacy. However, strategies for characterizing the TME exhibit significant heterogeneity. Here, we show that endoplasmic reticular oxidoreductase-1\u03b1 (ERO1A) mediates an immune-suppressive TME and attenuates the response to PD-1 blockade. Ablation of ERO1A in tumor cells substantially incites anti-tumor T\u00a0cell immunity and promotes the efficacy of aPD-1 in therapeutic models. Single-cell RNA-sequencing analyses confirm that ERO1A correlates with immunosuppression and dysfunction of CD8  \u2022ERO1A induces immunosuppression and resistance to PD-1 blockade\u2022ERO1A impairs the balance between IRE1\u03b1 and PERK signaling activities\u2022Ablation of tumor ERO1A enhances anti-tumor immunity via immunogenic cell death\u2022ERO1A is a potential target for therapeutic strategies in cancer immunotherapy Liu et\u00a0al. reveal that ERO1A mediates an immune-suppressive TME and attenuates the response to PD-1 blockade by impairing the balance between IRE1\u03b1 and PERK signaling activities and induces lethal unfolded protein responses. They find that targeting ERO1A can incite anti-tumor immunity and enhance aPD-1 efficacy in therapeutic models. Immune checkpoint inhibitors (ICIs) have shifted the paradigm of cancer treatment; however, many patients have experienced low or no clinical response after immunotherapeutic interventions.,+ T\u00a0cell infiltration) respond to ICIs, whereas \u201ccold\u201d tumors (immune desert/exclusive with low CD8+ T\u00a0cell infiltration) require co-treatment to improve the anti-tumor efficacy.,It has recently been proposed that tumors act as an ecosystem, where the host extensively interacts with the tumor microenvironment (TME), the distal metastatic environment, and its internal environment.,in situ, coordinated by the activation of inositol-requiring enzyme-1\u03b1 (IRE1\u03b1) and PRKR-like ER kinase (PERK), facilitates tumor growth and drug resistance and governs multiple pro-tumoral attributes by reprogramming the function of immune infiltrates.,,The hostile TME conditions, including hypoxia, nutrient deprivation, exposure to therapeutic agents, and immune responses, perturb the protein-folding capacity of the endoplasmic reticulum (ER), thereby provoking ER stress in cells.,,During ER stress, the expression of endoplasmic reticular oxidoreductase-1\u03b1 (ERO1A) increases, contributing to tumor cell survival.Here, we investigate the crosstalk between ERO1A activation and TME remodeling in solid tumors. Disruption of ERO1A impairs the balance between IRE1\u03b1 and PERK signaling activities and triggers lethal UPR in ER-stressed tumor cells, thereby promoting host anti-tumor immunity via ICD. Furthermore, a high expression level of ERO1A is associated with higher recurrence risk after neoadjuvant immunotherapy in patients with lung cancer. Our study highlights the potential of ERO1A as a therapeutic target in cancer immunotherapy.KO) cell lines, including MC-38, LLC, and B16 tumors, were introduced using CRISPR-Cas9-based genetic ablation of the Ero1a  cell lines transfected with Scramble single-guide RNAs  or depleted CD8+ cells in immunocompetent mice via antibody-based approaches  cells but not regulatory T\u00a0cells (Tregs), macrophages, or MDSCs (KO tumors had a higher abundance of tumor-infiltrating lymphocytes (TILs) in the tumor core region than control tumors  analyses and immunofluorescence (IF) staining of MC-38 tumors were performed after two rounds of aPD-1 treatment. Compared with Ero1aor MDSCs A\u2013S2D. Ful tumors J. After NK cells E and S2Fterparts G and S2Hl tumors I and S2Jwere not K. Taken + T, B, and NK cells, whereas it was positively correlated with CD4+ T\u00a0cells  analyses were performed using Ero1areatment A. Each creatment B\u2013S5D. A ectively B and S5Exp cells A and S6Bcontrols B. We nexterparts C and 2D,ectively E and S6C+ T\u00a0cells in Ero1aKO tumors, we next examined the proliferation and cytotoxic function of CD8+ T\u00a0cells in therapeutic models. A revival trajectory of CD8+ T\u00a0cells by RNA velocity analysis was calculated from the Mki67+ Tex cells, followed by the Il2ra+ Texp and Tnfrsf9+ Texp cells, to the Gzmf+ Tem, Ifng+ Tm, Ifit1+ Tcm, and CD28+ Tm cells  exhibited significantly higher anti-tumor capacity in Ero1aKO tumors compared with WT counterparts -related genes, which were identified as mediators of the immunogenic characteristics of ICD,Hmgb1, Calr, and Anxa1, were significantly overexpressed in Ero1aKO tumor cells compared with WT controls, suggesting the intracellular danger signaling pathways that govern ICD in Ero1aKO tumors , those previously injected with Ero1aKO MC-38 tumors showed substantially reduced tumor growth upon rechallenge with Ero1aWT MC-38 tumors , which promotes protein folding in the ER  overnight in the presence or absence of Kira6. Inhibition of IRE1\u03b1 with Kira6 significantly decreased the proportion of cells incorporating EdU in Ero1aWT cells pre-treated with tunicamycin  who received neoadjuvant aPD-1 treatment were collected from the NCC cohort. Immunohistochemistry (IHC) staining distinguished 15 patients with low ERO1A expression (IHC \u2212/+) and 22 patients with high ERO1A expression  had a partial response (PR), and 2 (13%) had stable disease (SD). In contrast, 4 (18%) of 22 patients in the ERO1Ahigh group achieved PR, 14 (64%) had SD, and 4 (18%) had disease progression (PD). Although the pathological response rate \u226590% was higher in the ERO1Alow group (7 of 15) compared with the ERO1Ahigh group (6 of 22), the difference between the pathological response rate and ERO1A expression was not statistically significant  in the ERO1Ahigh group  and melanoma (ENA: PRJEB23709). Using progression-free survival (PFS) as the endpoint, it was observed that low ERO1A mRNA expression was associated with better PFS in both cohorts  has been proposed for tumor immune phenotyping and includes the infiltration, activity, and fate of anti-tumor effector immunocytes.,,,There is growing evidence that intrinsic ER stress responses in tumors promote malignant progression by altering immune cell functions, which co-exist in the TME.,Immunotherapies and checkpoint inhibitors have revolutionized the field of cancer treatment yet are effective in only a fraction of patients with solid tumors.in\u00a0vivo experiments. However, considering the impact of tumor site on the heterogeneity of the TME, orthotopic tumor models would be more optimal for recapitulating TME features. Furthermore, we identified SPP1 as the specific signaling pathway involved in the intercellular crosstalk between tumor cells and CD8+ T\u00a0cells associated with Ero1aWT tumors; however, the rigid cell-to-cell interactions within the ERO1A-associated TME remodeling require more functional studies.Our study provides a method of converting non-responsive cold tumors into hot ones. Whether this or a similar tactic could be applied to other solid tumors, especially in the case of immunophenotyping, is an interesting question for future studies. The therapeutic models employed in this study utilized subcutaneous tumor models for zlhuxi@163.com).Further information and requests regarding this manuscript should be directed to and will be fulfilled by the lead contact Jie Wang . All patients were research-consented for providing archival formalin-fixed and paraffin-embedded (FFPE) tissue blocks and radiological images. Inclusion criteria for the cohort includes patients pathologically confirmed with resectable lung cancer and received primary lung cancer surgical resection after two cycles of neoadjuvant immunotherapy at National Cancer Center between 2018 and 2022. All patients were treatment-na\u00efve before receiving neoadjuvant treatment and were with three representative tissue blocks each.H&E and IHC staining were performed in the Histopathology Department and Translational Lung Cancer Research Laboratory of National Cancer Center. Sections of 4-5\u00a0\u03bcm thickness were cut from FFPE tissue blocks for H&E and IHC staining. Slides were scanned using the Aperio Pathology Imaging System (Leica) and were viewed with ImageScope (Leica) which allows for 20\u00d7 magnification of image captures. Slides were assessed for tumor region and pathological response by pathologists in National Cancer Center. Slides were scored as -\\+\\++\\+++ by two pathologists independently, and any discrepancies were resolved through discussions with the other pathologist. Slides with -/+ expression levels were characterized as ERO1A low expressors (15 patients) while\u00a0++/+++ expression levels were characterized as ERO1A high expressors (22 patients). The slides were also evaluated by IHC Profiler using ImageJ to independently confirm the manual scoring. Clinical response was evaluated after two cycles of neoadjuvant immunotherapy based on radiologic images by oncologists.in\u00a0vivo experiments. About 5\u00a0\u00d7\u00a0105 tumor cells were suspended with 100\u00a0\u03bcL PBS and then subcutaneously injected into the right flank of mice. Tumor volumes were measured every 2\u00a0days via vernier caliper and calculated with 0.5\u00a0\u00d7\u00a0length\u00a0\u00d7\u00a0width2. The diameter of each single tumor was\u00a0<\u00a02.0\u00a0cm. Tumors were collected, washed, and weighted on the indicated days, and used for FCM, IHC, WB, and RNA-sequencing. For secondary-tumor challenge, C57BL/6 mice were first injected with PBS, Ero1aWT, or Ero1aKO cells. Tumor cells were subcutaneously injected into the right flank of mice at a dose of 1\u00a0\u00d7\u00a0105 cells, and further challenged the mice with 5\u00a0\u00d7\u00a0105 Ero1aWT cells on the left flank after 10\u00a0days. From day 10, tumor size was measured every 2\u00a0days, and survival rate was determined every day by tumor length\u00a0>\u00a02.0\u00a0cm or animal death. For CD8+ depletion, CD8 antibody (5\u00a0mg/kg per mouse) or the isotype control antibody  was injected intraperitoneally for 4 consecutive days starting from day 1 after tumor transplantation, and every 5\u00a0days thereafter.C57BL/6 and BALB/cA-nu mice were purchased from the Jackson Laboratory and bred in the specific pathogen-free animal facility at National Cancer Canter, Cancer Hospital. All animal experiments were approved by the Animal Care and Use Committee of National Cancer Center. 7-week-old female mice were selected at random and used for subsequent WT or Ero1aKO tumors were subcutaneously transplanted into C57BL/6 mice. Mice were left for 10\u00a0days for tumor development and then allocated into 2 groups for isotype or aPD-1 treatment. For in\u00a0vivo immunotherapy, 200\u00a0\u03bcg of anti-PD-1 antibody  was injected intraperitoneally per mouse when xenograft tumor reached a palpable size, and every 3\u00a0days thereafter. Mice were sacrificed and analyzed after 6 cycles of treatment. In terms of Kira6 treatment, 10\u00a0mg/kg of Kira6  was daily given through intraperitoneal injection for 14\u00a0days.For MC-38 therapeutic models, MC-38 Ero1a2 in RPMI-1640  supplemented with 10% fetal bovine serum  and 1% Penicillin-Streptomycin . Cell lines were routinely tested for Mycoplasma by PCR.MC-38 , LLC , and B16-F10  were cultured at 37\u00b0C with 5% COSlides with 4\u20135\u00a0\u03bcm tissue sections were baked at 60\u00b0C, deparaffinized with xylene and rehydrated through a graded series of ethanol solutions . Tissue slides were then treated with microwave to induce epitope retrieval by boiling slides in critic acid solution for 15\u00a0min. Protein blocking was performed using blocking buffer  for 20\u00a0min at room temperature. Primary antibodies for anti-ERO1L , anti-IRE1\u03b1 , anti-PanCK , anti-CD4 , anti-CD8 , and anti-CD68  were used. The slides were then incubated with secondary antibodies  for 30\u00a0min at room temperature. Each slide was evaluated by 3 pathologists. For mIHC analysis of human samples, heat-induced epitope retrieval was performed to remove all the antibodies including primary and secondary antibodies after each cycle of staining. Multiplex immunofluorescence staining was performed using the AlphaTSA\u00ae Multiplex IHC Kit . Slides were counterstained for nuclei with DAPI  for 10\u00a0min and mounted in mounting medium. Images were scanned and captured using ZEISS AXIOSCAN 7.WT tumor cells. HEK293T cells were transfected with lentiviral and helper vectors via Lipofectamine 2000 . Supernatant containing lentivirus was collected after 48h and used to infect tumor cells. Single clones were picked and expanded following puromycin  selection. T7E1  was performed for mutation validation. The HEK 293T cells  were routinely tested for Mycoplasma by PCR. sgRNAs sequences are as follows: sgEro1a1 ; sgEro1a2 ; sgEro1a3 . The mouse ERO1A cDNA (NM-015774.3) was used to generate full length ERO1A. Mouse ERO1A expression plasmids were used to rescue Ero1a expression in Ero1aKO tumors. cDNA expression validation was performed by qPCR and WB assays.ERO1A was knocked out by CRISPR/Cas9 genome editing in mouse tumor cell lines, including MC-38, LLC, and B16-F10. Three sgRNAs were cloned into the lentiviral vector FV034. A CRISPR/Cas9 vector with non-targeting sgRNA (sgScramble) was used to establish corresponding control Ero1ain\u00a0vitro Kira6 treatment, MC-38 cells were first treated with 0.3\u00a0\u03bcg/mL Tunicamycin  to induce ER stress. After 12\u00a0h culturing, ER-stressed MC-38 cells were then treated 0.6\u00a0\u03bcM Kira6. The viability of cells was quantified using Cell Count Kit-8 (CCK-8) after treated for 24 or 48\u00a0h and calculated by normalizing to DMSO group . Cell death was measured through CytoTox 96\u00ae non-radioactive cytotoxicity assay  according to the manufacturer\u2019s instructions. Culture medium was collected and LDH release was measured at indicated time points.For MC-38, LLC, or B16-F10 cells were seeded densely in a 6-well plate and cultured to confluence. Further, a 200-\u03bcL sterile tip was used to scratch a wound line across the monolayer cells. The detached cells were then washed away with phosphate-buffered saline. Cells were cultured in RPMI-1640 and photographed at 0- and 24-hour post-wounding. Images were captured using a phase-contrast microscope (OLYMPUS). Each assay was replicated thrice.5 (invasion) or 105 (migration) MC-38, LLC, or B16-F10 tumor cells were seeded in the upper chamber with 200\u00a0\u03bcL of serum-free RPMI-1640. Then 700\u00a0\u03bcL of medium containing 10% FBS was added in the lower chamber. Cells on the upper membrane were carefully removed with a cotton swab after incubation for 24 h, and the invaded cells that had traversed the membrane were identified by crystal violet staining and photographed. Invaded cells were counted manually and confirmed by using ImageJ software (NIH).Migration assay was performed with a 24-well transwell chamber without Matrigel  coated in the upper chamber, while invasion assay was performed with its upper chamber coated with Matrigel. A total of 2\u00a0\u00d7\u00a010+ T\u00a0cells were then isolated with CD8+ negative selection kit  according to the manufacturer\u2019s instructions. The isolated T\u00a0cells were stimulated with anti-CD3  and anti-CD28  antibodies for 24\u00a0h in the presence of IL-2 , and the function of CD8+ T\u00a0cells was measured by quantifying the release of IFN-\u03b3 , TNF-\u03b1 , and GzmB  by enzyme linked immunosorbent assay assays.Lymphocytes were first collected from C57BL/6 naive mouse spleen and CD8+ T\u00a0cells, about 1\u00a0\u00d7\u00a0106 MC-38 cells were dissociated and first stained with 1mL CFDA-SE  according to the manufacturer\u2019s instructions. The labelled MC-38 cells (1\u00a0\u00d7\u00a0105) were then co-cultured with T\u00a0cells (5\u00a0\u00d7\u00a0106) for 24 h. To measure cell death in MC-38 cells, samples were collected and then stained with propidium iodide  and analyzed by LSR II (BD Biosciences) using FlowJo V10.9 software. CFDA-SE and PI dual-positive cells were determined as dead MC-38 cells.To further assess the cytotoxicity of CD8Cell or tissue lysates were extracted in RIPA buffer  Protein concentration was evaluated by bicinchoninic acid (BCA) Protein Assay Kit  and then analyzed by SDS\u2013PAGE gel electrophoresis and blotting onto PVDF membranes. Primary antibodies used included: anti-ERO1L , anti-IRE1\u03b1 , anti-pIRE1\u03b1 , anti-XBP1s , anti-PERK , anti-pPERK , anti-eIF2\u03b1 , anti-peIF2\u03b1 , anti-ATF4 , anti-ATF6\u03b1 , anti-CHOP , and anti-\u03b2-Actin. Primary antibodies were applied in 5% non-fatty milk or primary antibody dilution  in TBST and incubated overnight at 4\u00b0C, followed by HRP-conjugated secondary antibodies incubation at room temperature for 2 h. Secondary antibodies used included: Goat anti-Rabbit HRP-conjugated IgG , Rabbit anti-Mouse HRP-conjugated IgG . Images were collected by Amersham Imager 600 .To quantify the abundance of TILs in tumor samples, fresh tumor lysates were stained with conjugated antibodies and isotype controls. Antibodies used for FCM are listed in the Total RNA was isolated from T\u00a0cells using TRIzol reagent . Reverse transcription was performed using M-MLV Reverse Transcriptase  under the manufacturer\u2019s instructions. RT-qPCR reactions were performed using PowerUp\u2122 SYBR\u2122 Green master mix  in QuantStudio\u2122 5 .+ T\u00a0cells for 24 h, the supernatant was collected and filtered to prepare the samples to be tested. Protein concentrations were measured in the supernatant using the BCA methods. ELISA was performed through mouse-IFN-\u03b3, -TNF-\u03b1, and -GzmB ELISA Kits according to the manufacturer\u2019s instructions. Binding signals were detected at 450\u00a0nm using a 96-well plate reader (Thermo Fisher Scientific).To assess the function of T\u00a0cells, the release of IFN-\u03b3, TNF-\u03b1, and GzmB were analyzed by ELISA. After co-culturing of tumor cells with activated CD8To profile the cytokines and chemokines in tumor samples, the 17-Plex ProcartaPlex\u2122 immunoassay  was performed under the manufacturer\u2019s instructions. Fresh tumor tissues were weighted and prepared for extraction of suspension proteins. Tumor tissues were then subjected to homogenization with 1\u00a0mm glad beads of 60\u00a0s in ProcartaPlex\u2122 Cell Lysis Buffer  in the FastPrep-24 5G benchtop reciprocating homogenizer . Protein concentration was measured in the tumor lysates using the BCA methods. Values were normalized based on protein concentration.SeuratThe scRNA library of samples was prepared and constructed by using Chromium Single Cell 3\u2032 Reagent kits followed by the manufacturer\u2019s protocol (10X Genomics). The Illumina NovaSeq 6000 platform was used to sequence the libraries of scRNA samples with pair-end 150 base pairs. The CellRanger (v 5.0.1) was used to align the clean reads with mm10. The ComplexHeatmap. The density of distribution of scRNA was performed by stat_density_2d function with the parameters of geom\u00a0= \"tile\", aes (fill\u00a0= ..density..), contour\u00a0= FALSE. The significantly up-regulated genes in the specific sample and/or subpopulation were identified by FindMarkers and FindAllMarkers. The clusterProfiler was used to annotate the top markers of each subpopulation with the KEGG database. The gene set enrichment analysis was also performed by the GSEA function implemented in clusterProfiler. The slingshot was used to estimate the development trajectory and order the single-cell data. The differentialGeneTest implemented in monocle2 was used to identify the dynamics expressing genes among the development trajectories. The genes whose q-value\u00a0<\u00a01\u00a0\u00d7\u00a010-10 were retained for analysis. The genSmoothCurves was used to downsample and smooth the expression data for accelerating the visualization and gene module cluster among the development trajectories. The ggplot2 was used to display the expression patterns of gene modules.The harmony was used to remove the batch effects between samples. The dimension reducing of tsne, phate and umap were calculated based on 20 harmony components. The phate module was implemented by the package of reticulate and s2a. The cell types were identified by classical molecular markers and visualized by iTALKCellChatfilterCommunication was used to filter the interaction of ligands and receptors with the parameter of min.cells\u00a0= 10. The SPP1 signaling interaction was annotated and generated in CellChatDB.mouse. The ggpubr was used to generate bar plots and box plots for displaying the expression pattern of gene expression and gene set signatures with p value calculation. The statistical significance was denoted as \u2217p\u00a0<\u00a00.05, \u2217\u2217p\u00a0<\u00a00.01, and \u2217\u2217\u2217p\u00a0<\u00a00.001.The Two-tailed Student\u2019s t-tests were used to determine mean differences between two groups. Two-sided Chi-square tests were conducted to compare the difference in rate between two groups. Two-way ANOVA was used to compare differences among multiple groups. Survival curves were analyzed by log-rank analysis. Statistical analyses were performed using GraphPad Prism . Data are presented as mean\u00a0\u00b1 s.e.m or mean\u00a0\u00b1 SDs. Statistical significance was determined as indicated in the figure legends. P values of less than 0.05 were considered significant; \u2217p\u00a0<\u00a00.05, \u2217\u2217p\u00a0<\u00a00.01, and \u2217\u2217\u2217p\u00a0<\u00a00.001."}
+{"text": "The presenting method confirmed that this can be used with the same process for 11 organisms and sediments from estuarine ecosystem in Japan as models.For the detection of microplastics (MPs) in aquatic biota using Fourier transform infrared spectroscopy (FTIR), the ability to remove organic matter (OM) in pretreatment steps is essential to increase the time efficiency of MPs measurement and method uniformity. In principle, decreasing OM can be achieved by increasing the number of pretreatment steps. However, MPs are lost in proportion to the number of transfers between each step. Therefore, we have created a \"Cylindrical MPs Fractionator\" composed of commercially available materials. This container allows for a six-step pretreatment process that is designed to increase the removal capacity of OM with only one transfer to prevent the loss of MPs.  Specifications TableThe pretreatment method for microplastics (MPs) analysis using the \"Cylindrical MPs fractionator\" is presented here. This method assumes the biological sample consists of four components: proteins, carbohydrates, fats, and carbonate minerals. First, carbonate minerals are removed by formic acid. Then, the remaining three components are decomposed by Fenton's reagent. However, since the specific gravity of the lipids is low compared to the specific gravity of Fenton's reagent, the components tend to be residual at the inner wall during the reaction. This is caused by the oxygen bubbles\u2019 upward action pushing them up the sample. Therefore, potassium hydroxide is used to saponify the remaining unreacted adipose tissue. Add Ethylenediamine-N,N,N',N'-tetraacetic Acid Disodium Salt Dihydrate-2Na (EDTA-2Na) simultaneously with potassium hydroxide to dissolve the carbonate that could not be removed with formic acid. This causes most of the biogenic material to be micronized and its breakdown products, together with iron oxide (or iron hydroxide), to form a sludge. The sludge is then settled by density separation and is removed. However, during the density separation process and filtration, some organic matter (OM) remains on the filter. Particularly, fibrous filters collect degradation products smaller than the pore size. This can result in a coating on the microplastic that prevents the infrared absorption spectrum of pure microplastic from being obtained. To further remove residues, the filter is rinsed with a formic acid solution during decompression filtration , lipids and proteins are emulsified with sodium dodecyl sulfate (SDS), and polysaccharides are removed with a NaOH/Urea/Thiourea (NaUT) solution . FinallyThe fractionator is designed to meet two specific conditions. First, the material must be highly resistant to various chemical treatments, heating, and density separations. Second, the internal structure must be cylindrical to not interfere with the particles' vertical movement. The overall view of the fractionator is shown in \u2022The fractionator main unit a: approx\u2022The cock valve unit f: approxThe original materials for this fractionator can be purchased mainly from Flonchemical Co., Ltd. A set of fractionators costs approximately US$165 . The fractionator can be cleaned and reused like regular laboratory equipment. Considering that the cock valve is used only for density separation and, therefore, not required for every fractionator, the cost for the second and subsequent sets will be less. Prices of materials are constantly changing and should be checked accordingly. Note that materials need to be purchased in unit lengths.Experimenters should wear clothing that does not contain plastic fibers  whenever possible and white lab coats with minimal skin exposure (safety considerations). Appropriate protective equipment  should be used when using hazardous reagents. Clothing should be carefully cleaned of foreign particles using adhesive tape prior to MPs extraction procedures.1)Preparation of laboratory equipment: All laboratory equipment must be washed/rinsed with distilled water immediately before use. All extraction procedures must be performed under sterile and clean conditions (using of a dust-proof clean bench is recommended).2)Record the mass of the pipe (-> A), aluminum cap (-> B), and lower plug (-> C) .3)Fill the hole in the lower plug with distilled water, transfer this to a graduated cylinder, and record the hole volume (-> D).The following steps are required before extraction:1)Preparation of carbonate minerals elimination reagent:Formic acid is used for carbonate minerals elimination. Invertebrates may have a complex junction of exoskeleton and viscera, and removal of the exoskeleton by dissection prior to pretreatment may lead to loss of viscera containing MPs. Therefore, it may be better not to remove the shell and skeleton before pretreatment. When the pretreatment is conducted with the exoskeleton, the formic acid will first remove the carbonate from the exoskeleton, allowing subsequent solutions to penetrate more easily into the interior. In the case of crustaceans, they contain calcium carbonate as part of their chitin. Carbonate minerals elimination at the beginning of the process will enhance the ability of the chitin to break down.\u03b1 and \u03b2. \u03b1 is used before the hydrogen peroxide treatment, and \u03b2 is used in the filtration. The prepared solution is filtered through a filter syringe (or reduced-pressure filtration) with a smaller mesh than the filter used in MPs collection.There are two carbonate minerals elimination regents, \u03b1 (This aqueous solution is needed to be stored in the dark at 2\u201310\u00a0\u00b0C.)>\u2022Formic acid \u2022Iron(II) sulfate heptahydrate (10\u00a0mg / mL CAS RN\u00ae: 7782\u201363\u20130)\u2022Decamethylcyclopentasiloxane <Composition of carbonate minerals elimination reagent *This is an antifoaming agent and is added to allow the hydrogen peroxide to react safely. Propylene glycol (PG) can be substituted, although less effective.\u20223-Methyl-1-butanol This is also an antifoaming agent and is added to allow hydrogen peroxide to react safely. However, D5 and PG have long-lasting antifoaming effects, and they have the property of temporarily increasing the amount of foam. To reduce this, 3M1B is added to promote defoaming due to its Marangoni effect. Depending on the experimental conditions, the defoaming effect of 3M1B does not last for several days. Therefore, it is recommended that it be used in combination with D5 or PG. Ethanol can be substituted, although it has a shorter lifespan. Test it once with adequate safety precautions, check the foam generation, and adjust the amount of defoaming agent and the temperature increase program (Step 2). This mixing should be done immediately before use.* \u03b2 (aqueous solution)>\u2022Formic acid \u2022Sodium dodecyl sulfate 2)Place the sample in the lower stopper and measure the mass.<Composition of carbonate minerals elimination reagent *Perform dissection as appropriate. Refer toto determine if dissection is necessary.3)Insert the lower plug into the pipe body.4)\u03b1 per 1\u00a0g of the sample and put the upper cap on.Add 3\u00a0mL of carbonate minerals elimination reagent 5)Wait until the bubbling is stopped.*The end of bubbling may not be due to the end of carbonate minerals elimination but rather to the complete decomposition of formic acid. Therefore, add a small amount of additional formic acid solution to confirm that carbonate minerals elimination has been completed.6)\u03b1 and go to the next step.When the carbonate minerals elimination is finished, add another 0.1\u00a0mL of carbonate minerals elimination reagent *Additional Reagent \u03b1 is added because it is necessary to move to the next step under acidic conditions.1)Prepare ice water in a 1\u20132\u00a0L beaker.2)Add 30\u00a0mL of 35% hydrogen peroxide solution (CAS RN\u00ae: 7722\u201384\u20131) per 1\u00a0g of sample.Organic decomposition is performed using Fenton's reagent. Immediately after adding the reagent, the reaction may heat up, so ice-cooling is performed. Once the reaction cools down, heat to 50\u00a0\u00b0C to accelerate the reaction. At this time, the fractionator is immersed in water to prevent it from exceeding 50\u00a0\u00b0C due to reaction heat.Add in small quantities to avoid strong reactions. Do not approach the body or look inside from above.3)Immerse the fractionator in ice water and allow it to stand for 24\u00a0hrs. (4)Agitate with a mixer.*Agitation is not mandatory, but it allows the tissues to mix uniformly with the solution, thus promoting an efficient reaction. However, be careful that the sample does not adhere to the vessel wall after stirring. If the sample adheres to the wall, open the cap on a clean bench and drop the sample into the solution using a long-tipped metal spatula. The adhesion of organic matter to the wall surface that occurs at this time will greatly affect the efficiency and accuracy of the subsequent FTIR analysis.5)Allow to stand for 24\u00a0hrs. at room temperature while immersed in room temperature water.6)Allow the external container containing the water to stand at 50\u00a0\u00b0C for 72\u00a0hrs.7)Bring to room temperature and go to the next step.*1)Make potassium hydroxide  and EDTA-2Na  mixture solution. Pay attention to the heat of dissolution.2)Take the potassium hydroxide solution with a filter syringe and add 5\u00a0mL per gram of sample while observing the sample reaction.3)Incubate at 50\u00a0\u00b0C for 1 day.4)Bring to room temperature and agitate the sample with a vortex mixer or the like.5)Go to the next step.Organic decomposition is performed using alkaline solutions. The main purpose is to decompose diatoms and saponify lipids. If the hydrogen peroxide is still active in Step 3, the reaction proceeds rapidly, so add hydrogen peroxide in small amounts while monitoring the condition of the sample. If the reaction is too strong, stop adding hydrogen peroxide and allow it to stand for several days until the hydrogen peroxide is gone.Density separation is performed using a sodium iodide solution. Mineral particles in the sample are removed in this step. The specific gravity of the internal solution is first calculated, and the final density in the solution is adjusted to 1.6 by adding a sodium iodide solution with a density of 1.8. When placing the fractionator, stand it vertically to not interfere with the vertical movement of the particles. The operation is repeated three times.*Caution! Mixing sodium iodide and hydrogen peroxide causes an explosive reaction. Use the highest possible precautions to avoid mixing the two.1)Prepare sodium iodide solutions with specific gravities of 1.8 and 1.6. Place a magnetic stirrer in a 1\u00a0L beaker and add 500\u00a0mL of distilled water. Add sodium iodide (CAS RN\u00ae: 7681\u201382\u20135) and stir until dissolved. Using a graduated measuring cylinder, measure 10\u00a0mL of the solution to determine the specific gravity. Continue until the solution reaches the desired gravity.*A minimum of 1\u00a0L of sodium iodide solution with a specific gravity of 1.6 is required.2)Filter the solution through a filter paper with a pore size smaller than the smallest particle size of the target MPs.3)Measure the weight of the fractionator with the sample. -> E4)Measure the height of the sample solution. -> h5)Estimate the specific gravity of the solution using the following formula (Refer to the pretreatment log table as necessary):where the \u03c6 is the pipe's inner diameter.6)Add 1.8 sodium iodide so that the final specific gravity becomes 1.6 by the specific gravity of the solution obtained by the following formula:7)Add 1.6 sodium iodide to bring the volume to 150\u00a0mL.8)Stand the fractionator upright and allow it to stand for at least 3\u00a0hrs.9)Fill a 1\u00a0L beaker to the 600\u00a0mL with a sodium iodide solution of specific gravity 1.6.10)Loosen the stopper at the bottom of the fractionator to the extent that the container does not leak, and close the valve at the top.11)Immerse the lower part of the fractionator in 1.6 sodium iodide and gently open the loosened lower stopper in the solution.12)Open the upper valve slightly, pour half of the sodium iodide in the fractionator into the external solution, and close the valve again.13)Close the lower part with another clean plug and open the upper valve.14)[First and second times] Add sodium iodide solution with a specific gravity of 1.6 to 150\u00a0mL.15)[Third time] Go to the Filtration without adding sodium iodide solution.Filtration is performed using a stainless-steel mesh and a PTFE filter . Use a f*There are two reasons to use more than one filter type. One is the infrared absorption spectrum. Thick samples may not transmit infrared light, and larger particles are measured by the reflection method. The second is a filter area issue. In our protocol, we set a PTFE filter in a filter holder with a funnel diameter of 4\u00a0mm for filtration to reduce the FTIR measurement time as much as possible. The presence of large MPs, even a small number, may cause sample overlap and interfere with the detection of small MPs. For this reason, the filtration in this study follows this step. This is not mandatory and can be modified to suit the experimenter's desired particle size range of MPs.1)Set the stainless-steel mesh  / PTFE filter  to Filter holder  or funnel.2)Gently pour the solution from the fractionator.3)Co-wash the fractionator and lower stopper with distilled water.When the fractionator was rinsed with distilled water in and out, particles may stick to the wall at the top. Remove the lower plug from the fractionator and rinse the fractionator from top to bottom. Also, since some residual solution may spill out when removing the lower plug, please open the lower plug above the funnel.4)Co-wash the funnel and stainless-steel mesh with distilled water.*At this time, try to drop the solution on the stainless-steel mesh at a single point so samples do not scatter. If this is difficult, the use of an additional filter holder is recommended. This minimizes the target area when photographing the microscopic FTIR measurement surface. The stainless-steel mesh should be handled flat and not bent to avoid out-of-focus photographic images.5)Remove the stainless-steel mesh and the funnel and continue vacuum filtration through the PTFE filter.6)If clogging occurs, stop the vacuum and return the solution to the fractionator.*Return as much solution as possible to the fractionator. There is a possibility that the dissolved substances will react with the carbonate minerals elimination solution B and re-coagulate.7)Add a few drops of carbonate minerals elimination reagent \u03b2 for additional carbonate minerals elimination.8)When the foaming stops, restart the vacuum, flow through the carbonate minerals elimination solution \u03b2, add the solution again, and resume filtration. Repeat 7) and 8).*Since the areal analysis of the infrared absorption spectrum depends on the measurement area, reducing the filter area as much as possible is ideal. However, if the filtered sample is too thick in an attempt to reduce the area, infrared rays will not be transmitted properly, and a clean absorption spectrum will not be obtained. Although it is not possible to make a blanket decision depending on the characteristics of the sample, you should visually check the thickness of the sample before replacing the filter or moving on to the next step. Ideally, the thickness of the sample should be such that the filtration surface is discolored but not feel the height of the samples.9)When the solution is filtered out, or the sample has reached the ideal thickness, wash the fractionator and filter holder with distilled water.**Insufficient washing will result in residual sodium iodide. Residual sodium iodide will prevent the filter from being impressed and make FTIR analysis impossible. If the solution remains, set the next filter in a different filter holder, and continue filtration. If there is only one filter holder, wait until the first filter has been processed and it is available again.10)Go to the next step.*The PTFE filter that has finished filtration is NOT removed from the filter holder.1)Take 1\u00a0mL of 1% SDS solution with a filter syringe and add it to the filter holder. Cover the filter holder with aluminum foil or the like and allow it to stand for 2\u00a0hrs. under 50\u00a0\u00b0C conditions.2)After 2\u00a0hrs., attach the filter holder to a vacuum filtration bottle and perform vacuum filtration again.The infrared absorption spectrum of lipid content is similar to polymers, and residual lipid content can greatly interfere with microplastic measurements. The light-specific gravity of the lipid can cause it to be lifted by the bubbles of hydrogen peroxide water. Thus, SDS solution is added to emulsify the lipid content.*If lipid content were present, the filtration speed would be faster than before treatment.3)Wash with distilled water and go to the next step.1)Pre-cool the sealed container supporting the filter holder to \u221220\u00a0\u00b0C beforehand.2)Prepare a NaUT solution .3)Take 1\u00a0mL of NaUT solution with a filter syringe and add it to the funnel. Cover with aluminum foil or the like and replace the filter holder with a pre-cooled airtight container, freeze at \u221220\u00a0\u00b0C.4)When the solution solidifies, remove the filter holder, and stir with a vortex mixer or the like, grasp the filter holder firmly by hand to prevent it from shifting.5)When the solution dissolves and returns to liquid, filter it under reduced pressure.6)Wash with distilled water.7)Remove the PTFE filter from the funnel and store it.This treatment is intended to specifically remove chemically stable natural polymers. It is effective for samples with high woody debris content, such as riverine debris. As well as samples with robust chitin skeletons PTFE filters curl up when dried, so the edges must be restrained. They should also be sealed to prevent contamination and sample loss (see *loss see .n\u00a0=\u00a08) in our experimental environment. As a result, we observed three polystyrene particles from one blank. Therefore, we used the mean +3 (standard deviation) and mean +10 (standard deviation) used in general chemical analysis to determine that the limit of detection (LOD)\u00a0=\u00a04 and the limit of quantification (LOQ)\u00a0=\u00a011 particles. This varies with each researcher and experimental environment, so it is recommended to check this on a case-by-case basis.We performed a blank test  to evaluate the recoverability of plastic particles through this method, and this was done according to the recommendations of Way et\u00a0al., (2022). 45\u201353\u00a0\u00b5m (30 particles/test), 90\u2013106\u00a0\u00b5m (20 particles/test), 150\u2013160\u00a0\u00b5m (20 particles/test), 180\u2013212\u00a0\u00b5m (20 particles/test), 300\u2013355\u00a0\u00b5m (15 particles/test), and 500\u2013600\u00a0\u00b5m (10 particles/test) particles were treated (section 2.2). The recovery (%) was recorded from the known number of particles added using the number of particles on the filter. The tests were carried out randomly by five experimenters. For the relationship between particle size and recovery, we created a regression curve for an asymptotic regression curve through the origin. This is shown in the following equation: results .Table 2RAccording to Way et\u00a0al. pL, the perimeter length of the approximate ellipse eL, the major axis diameter l\u03a6 (\u00b5m), and the minor axis diameter s\u03a6 (\u00b5m) of the approximate ellipse were measured. The particle diameter \u03a6, macroscopic shape index \u03b4 (0 < \u03b4 \u2264 1), and microscopic shape indices \u03b6 (0 < \u03b6 \u2264 1) of particles before and after processing were calculated We evaluated MPs destruction using shape indices difference between before and after treatment. Polyvinyl chloride (PVC), Polyamide (PA), and Polymethyl methacrylate (AC) particles were used. These are chosen because of the tendency of low chemical stability. Commercially available plastic boards  were sawed and sieved to create particles (726\u00a0\u00b1\u00a016\u00a0\u00b5m). The evaluation used these because they are generally polymers with low drug resistance. 80 particles of each plastic type were treated. After that, 50 particles of each were randomly selected and evaluated following the procedure. Microscopic images (5440 dpi) of particles were taken using a binocular stereomicroscope  coupled with a camera . Image analysis was performed using ImageJ . The perimeter length of the particle \u03b6 of AC  \u00b1 According to Olsen et\u00a0al. Caloglossa ogasawaraensis, were collected using hand nets, metal shovels, and hand picks.We collected and pretreated biota and sediments from Tokyo Bay to confirm the feasibility of this method for organisms and sediments. Samples were collected on May 12, 2021, at a tidal flat at the mouth of Tsurumi River , which flows through the Tokyo metropolitan area. A total of 10 common animals  and red The sediment samples were collected by placing a 25\u00a0cm square quadrat in the intertidal zone and carefully collected at a depth of 1\u00a0cm in a glass bottle with a metal shovel. Each sample was processed using this proposed pretreatment, and residues were collected on stainless-steel mesh and PTFE filters.Microscopic observations of the filter sample condition confirmed the good dissolution of biological tissue in all samples, and it was determined that MPs were possible to measure . At the First, the stainless-steel mesh and PTFE filter do not accurately separate particle sizes. Some particles on the PTFE filter are larger than 100\u00a0\u00b5m in diameter . PossiblSecond, the collection range of residue does not exactly equal the filter holder funnel shape. Due to the minute irregularities of the glass surface and the thickness of the filter itself, the actual collection area will be irregularly shaped. It is important to carefully observe the visible light image and add all particles to the FTIR measurement range, considering the possibility that MPs are collected beyond the circle range.This method does not remove the solution during processing. Therefore, the disadvantage is that the amount of solution is largely relative to the amount of sample and gradually adds up. In the case of our fractionator, the maximum amount of sample that can be processed is approximately 1\u00a0g. If a sample larger than 1\u00a0g is to be processed, the only way is to separate the sample into multiple fractionators. Removal of water by freeze-drying and the creation of a larger fractionator are a couple of possible solutions. However, these have not been tried at this stage and are issues to be addressed in the future.FTIR-based detection is a commonly used method in detecting MPs The main aim of this method is to realize quantitatively monitor MPs contamination throughout a given aquatic ecosystem in the same measurement condition. To do so, it was necessary to create a pretreatment method to detect MPs from various samples using the same technique to guarantee the homogeneity of MPs data. At the same time, it was necessary to improve the analysis time efficiency of microscopic FTIR for processing many samples. Thus, a pretreatment method for MPs analysis using the \"Cylindrical MPs fractionator\" is presented here. This fractionator comprises commonly available components and reduces the transfer of samples to only one time. We have confirmed that this method can fractionate MPs from a total of 11 organisms  and sediments.\u2022MPs can be extracted from fish, invertebrates, sediments, and algae in a completely identical procedure.\u2022Filter samples with high MPs content can be obtained, increasing the time efficiency of FTIR analysis.\u2022The fractionator can be easily and inexpensively made with commercially available tools, and various reagents can be used.The advantages of this method are as follows.\u2022Samples can be processed up to approximately 1\u00a0g at a time.\u2022Fluoropolymer MPs are difficult to detect.\u2022The procedure is many, uses multiple hazardous chemicals, and takes a long time.The disadvantages of this method are as follows.Hiraku Tanoiri: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Resources, Writing \u2013 original draft. Eduardo Estevan Barrientos: Writing \u2013 review & editing, Visualization. Haruka Nakano: Investigation, Validation, Writing \u2013 review & editing. Hisayuki Arakawa: Writing \u2013 review & editing, Resources, Supervision. Masashi Yokota: Validation, Writing \u2013 review & editing, Visualization, Project administration.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
+{"text": "Nowadays, Wireless Sensor Networks (WSNs) are widely used for collecting, communicating, and sharing information in various applications. Due to its limited resources in terms of computation, power, battery lifetime, and memory storage for sensor nodes, it is difficult to add confidentiality and integrity security features. It is worth noting that blockchain (BC) technology is one of the most promising technologies, because it provides security, avoids centralization, and a trusted third party. However, to apply BCs in WSNs is not an easy task because BC is typically resource-hungry for energy, computation, and memory. In this paper, the additional complication of adding BC in WSNs is compensated by an energy minimization strategy, which basically depends on minimizing the processing load of generating the blockchain hash value, and encrypting and compressing the data that travel from the cluster-heads to the base station to reduce the overall traffic, leading to reduced energy per node. A specific (dedicated) circuit is designed to implement the compression technique, generate the blockchain hash values and data encryption. The compression algorithm is based on chaotic theory. A comparison of the power consumed by a WSN using a blockchain implementation with and without the dedicated circuit, illustrates that the hardware design contributes considerably to reduce the consumption of power. When simulating both approaches, the energy consumed when replacing functions by hardware decreases up to 63%. Wireless sensor networks (WSNs) are multi-hop self-organizing network systems that consists of many low-cost wireless sensor nodes (SNs) connected through wireless communications. The purpose lies in supportively perceiving, collecting, and processing the information of predefined variables in a monitoring area and transmitting it to a base station (BS). As a significant part of the Internet of Things (IoT), WSNs play an important role in many applications, such as medical and health related-treatment, national defense, environmental monitoring, and smart homes. In most cases, the SNs are operated by a battery and cannot be recharged. Moreover, the SNs may be positioned in hard-to-reach or inaccessible environments and are anticipated to stay operating for several months or years. Therefore, mechanisms to reduce the energy consumption of these nodes and maximize the network life cycle have lately attracted the attention of many researchers .In addition, most of WSNs are defenseless against security threats and pose several security challenges . TherefoOne type of security technology is a blockchain (BC). The security of blockchain systems is vital for potential users . BCs havSecurity: Neither node nor anyone else, except transmitter and receiver can have access to data transmitted via BC.Removal of intermediaries: The peer-to-peer nature of BC requires no intermediaries.Immutability: Nothing on the BC can change, and any confirmed transaction cannot be altered.Permanence: A public BC acts as a public ledger. If the BC remains active, data will be accessible.Speed: According to  \u2190 \u03b1 x[i-1] *(1-x[i-1])\u2003\u20033: end for\u2003\u20034: for i = 0: L \u2212 1\u2003\u20035: x[i] \u2190 b* (x[i]+d)\u2003\u20036: end for\u2003\u20037: i = 0\u2003\u20038: while (i<sos)\u2003\u20039: for j = 0: L \u2212 1\u200310: i \u2190 i *x[j]\u200311: if (i< = sos)\u200312: Y\u2190 v[i]\u200313: end if\u200314: end for\u200315: end whileHere, n = 0,1,\u2026\u2026 . ., L-1.0 is initial value of chaotic logistic map.XL represents the length of the chaotic sequence,\u03b1 is a control parameter defined as a value to determine the appearance and behavior of the logistic map .d and b are constant set to the maximum required sampling interval SoS represents the length of the original signal,V is the input signal,Y represents the value of the resulting compressed data.0. By inserting these parameters into Eq \u20031: for i = 1: L-1\u2003\u20032: x[i] \u2190 \u03b1 x[i-1] *(1-x[i-1])\u2003\u20033: end for\u2003\u20034: for i = 0: L \u2212 1\u2003\u20035: x[i] \u2190 b* (x[i]+d)\u2003\u20036: end for\u2003\u20037: i = 0\u2003\u20038: while (i<sos)\u2003\u20039: for j = 0: L \u2212 1\u2003\u200310: i \u2190 i *x[j]\u200311: if (i< = sos)\u200312: id\u2190 i\u200313: end if\u200314: end for\u200315: end while\u200316: V\u2190 interp {id,Y}\u2003\u2003As stated before, in order to increase data security, the dedicated circuit will perform compressive sensing. The chaotic compressive sensing is designed to achieve simultaneous compression and encryption ,53. ThisIn addition, the circuit is also responsible for generating the hash value that represents the backbone of blockchain technology and is also regarded as the main block identifier in the block chain. This method is proposed because it is characterized of being its low complexity. Theoretical analysis indicates that the algorithm can satisfy all the hash function requirements efficiently and flexibly. This method has higher sensitivity to the original message, which means that any change in the plaintext affects the ciphertext ,55. The Algorithm 3: Generation of hash value .\u2003Input: L, \u03b1 = 4, b, d, sos, v , x [0],M (message)\u2003Output: f(x) hash value\u2003Hash generation\u20031: for i = 1: L-1\u20032: x[i] \u2190 \u03b1 x[i-1] *(1-x[i-1])\u20033: end for\u20034: Divide M into blocks\u20035: padding message M\u20036: for j = 0 to n-blocki XOR x[i]\u20037: f(x) = M\u20038: end\u20039: display f(x)Thus, when cluster-head receives compressed and encoded data from Sensor node, the designed circuit creates a chaotic sequence, computes the hash and then composes the Tx block by encrypting the data with the previous hash.Previous Algorithms 1\u20133 where coded in Verilog  languageIn this section the performance of our proposal, as well as its energy efficiency evaluation is analyzed. To do so, we will compare our proposal with other versions of WSN with blockchain without the dedicated circuit. The simulation and evaluation of the proposed method are accomplished in MATLAB version 2019b environment using the results obtained from the circuit implementation in the FPGA and software energy consumption.In this section of our work, we\u2019ll examine the effectiveness of the signal compression algorithm, which works to reduce the size of data by sampling based on a logistic map. We\u2019ll also study the signal compression ratio we obtained using this approach and the statistical analysis of the signal compression ratio. In N integer value and nonzero When N = 5, 4 and 3.In In the compressed sensor approach, linear compression approach is used to transform a signal X original data into another form Y compressed data. Resulting in compressed signals, the length of the signal time period was random between 500 and 1000 and the number of signal points was 1000.The compression ratio data has been obtained by the statistical SPSS  and the These results about compression ratio were introduced in the MATLAB environment to simulate the circuit operation together with the next ones obtained with the FPGA and software execution.After developing, synthesizing and checking the correct operation of the algorithms described in the previous sections in a FPGA, we obtained its power consumption results. The VIVADO \u00ae design suite was used for this purpose. The power consumption of the implemented dedicated circuit for compression is shown in On the other hand, the consumption power of the implemented hash generation circuit is 0.663 W as shown in the To compare with software-implemented functions, hash SHA256 generation algorithm was implemented in an ultra-low power microcontroller. A STM32L476) ST. STM32L4 MCU series Ultra-low power with performance  and operating at 24 Mhz. This is the minimum consumption in an operational stage. With this consumption per Mhz, the best results (minimum consumption) can be obtained. Additionally, results were also obtained for a more common case. An experiment was performed with the microcontroller running at 80 Mhz (its maximum frequency) and without external switched-mode power supply. This could be representative of many actual designs.In  different consumption benchmarks results are shown. As stated in that application note2 for an 80 Mhz frequency, a consumption about 120 \u03bcA/Mhz represents a real situation. As there is a linear relationship between the software function execution time and the energy, the execution time of those algorithms were computed and then the consumption of these algorithms was obtained. Thus, we will also compare the system with these functions implemented in software and the proposal with functions implemented in hardware to demonstrate the advantages of the latter. Therefore, comparing software and hardware depends on adding/eliminating the complexity of the computation time and its associated power consumption. That is, when functions are not carried out by hardware, software complexity will be higher. Additionally, to study all the possibilities, a software compression technique was also designed in the software-only version to analyze its benefits. Then, a software version of the Chaos compression technique implemented in hardware was implemented on the same microcontroller. Therefore, a comparison between software with and without compression techniques has been carried out, in addition to comparing them with the hardware design will be conducted.This section presents the results obtained with the proposal to optimize the power consumption of wireless sensor nodes. Our hardware-implemented solution will be compared to the standard implementation of a wireless sensor network (WSN) with blockchain technology for securing the system. To obtain the results, MATLAB tool will be used to configure and simulate the WSN described in section 3. It use the well-known Leach algorithm ,35 to coWe will obtain the power consumption and network lifetime for a WSN with Leach algorithm and a traditional software-implemented blockchain (i.e no data compression and hash computation obtained by software).We will compare the previous results with a WSN with Leach algorithm and a software implemented blockchain (i.e without the dedicated circuit) but with chaos compression algorithm. The compression technique (chaos) must be responsible for part of the improvements in the network lifetime. Thus, we decided to measure the benefits and drawbacks (extra consumption) of implementing the chaos compression in the software.Finally, we will obtain the results of our proposal: a WSN with Leach algorithm and a hardware implemented support (dedicated circuit) for blockchain operations.In order to obtain the energy consumption of the nodes, the next steps will be taken into account:Each sensor node reads input data and compresses data. Then it sends the data to is cluster-head.The cluster-head collects data from sensor nodes and generates a hash to form a block.The node\u2019s energy is re-calculated by subtracting the transmitter energy consumption from the initial energy, so that the new node energy is .DA is the data sensorization energy, and it is only consumed on the transmitter node, as it collects data using its input peripherals. E1 is the energy consumed by the transmitting and receiving operations and depends on factors such as the signal coding, filtering or modulation. Efs (free space) and Eamp (multi-path) fading channel models depends upon the transmission distance d. If the distance is below a threshold, the free space model is used. In other case, the multi path model is chosen.Where EIn addition, the consumption of the dedicated circuit (obtained from the FPGA implementation) to fulfill the data compression and hash computation is added. In the \u201chardware\u201d version, it is assumed that the node uses a separate hardware circuit to implement hash generation and compression, while basic utilities are performed by the microcontroller. The consumed energy at each node is then calculated as follows:new is the energy of the node after deducting the basic utilities consumption as in where EFor comparison purposes, the hardware hash computation and chaos compression have also been implemented in software, and their energy consumption have obtained as reflected in Tables The MATLAB simulation scenarios used in the research have the following assumptions:Sensor nodes were distributed in a random way in a square 100 m\u00d7100 m region.Sensor nodes were characterized by being homogeneous. They are assigned a matchless identifier number in the network, and their energy is limited.The base station is located in the center of the square with a static position.The power of the wireless transmitter could be adjusted. Several simulations were performed to analyze the performance improvement of the proposed solution compared with software approaches. This performance centers on two main parameters: Network lifetime and total energy consumption.stable period and unstable period.In this research, the definition of network lifetime can be described as the time from the start of the simulation to the time when the energy in the battery of the last node does not allow its operation (the node dies). In WSNs, the lifetime of the network can be classified into two periods, as the Stable period typically refers to the lapse of time between the start of the simulation and the time when the first node dies.Unstable period refers to the time from stable period to the end of the simulation.So, chaos compression techniques, even in software version, significantly improves the network lifetime. The benefits of compression techniques may outweigh the extra consumption of the algorithm due to the less data to transmit. However, it remains to be seen what happened if the microcontroller works at a higher frequency (and then with higher consumption).And now we are going to compare previous results with the dedicated circuit version. On the other hand, It should not be forgotten that the inclusion of blockchain techniques in WSN will provide great benefits at the cost of higher consumption. Minimizing this increase, in order to make this possibility viable, is the reason for this work. To show this concept, in Figs Leach protocol case, without blockchain, shown by the red color in Figs When using a security technology such as a blockchain, energy consumption will increase, which will make the network lifetime shorter. Software implemented blockchain without data compression is represented in brown color. Moreover, when our chaos compression proposal was used as software, there was a clear improvement in the network lifetime as shown in the blue color. This improvement increased significantly when using our proposal as hardware compared with the traditional blockchain or the proposal as software as shown in the bold blue color. They are close to the of the non-blockchain version. Thus, the use of blockchain becomes a real possibility.As it can be seen in Figs Figs Regarding the \u200fenergy variance of the nodes, it was very high in the traditional software approach, while when using the software compression, it decreased as shown in When the dedicated circuit is replaced by software to compress the data, it is also shown that the energy variance of the nodes was very high. When using the dedicated circuit, the \u200fenergy variance decreased as shown in The hardware solution enables the WSN to live longer than the traditional one. Therefore, the power variance of a WSN containing a dedicated circuit continues to rise during the rounds while the conventional network loses power.Adopting a blockchain in a WSN is not easy. It is necessary that several critical limitations  are addressed. This proposal contains a step forward in solving these main limitations for adopting blockchain technology in WSN. To overcome these problems, a dedicated circuit is designed to perform some blockchain-related functions, such as hash generation and data compression. This paper has demonstrated how the hardware implementation of these complex software functions contributes significantly to reduce the consumption of energy of the entire network and extend its the lifetime.This way, hardware signal compression is an effective method to reduce the data to transmit and, therefore, to minimize the energy requirements. Thus, transferring the software functions (hash computation) and compression techniques to a specific circuit reduce both the time and the energy requirements to compute them. The MATLAB platform was used to test the new proposed approach. In order to provide the real operation parameters to the MATLAB simulator, a Verilog implementation of the dedicated circuit was performed. From this real implementation, energy consumption was obtained. The energy consumption of the software functions performed by the dedicated circuit was also obtained by implementing them in a representative embedded microcontroller. Real energy consumption was measured in laboratory conditions and results were added to the MATLAB simulations. The main results show a reduction of up to 63%. Therefore, the feasibility of implementing blockchain in WSN with dedicated circuits has been demonstrated. This opens the door to new implementations and uses of the blockchain technology in WSN.Compared to the systems presented in the States of the Art section, our proposal offers several advantages. This way, regarding , where tOnce it is clear that a blockchain can be implemented in a WSN, in future works network performance under the threat of different attacks will be tested and the security enhancements of blockchain in such scenarios will be evaluated. Network behavior will be monitored under attacks and it will be studied how the attack will be detected by a trust mechanism based on the dedicated circuit using chaos technology as well as the proposed lightweight encryption. Additionally, we will compare our technique with blockchain implementations in other microcontroller families, mainly those working at higher frequencies. 23 Jan 2023 <div> PONE-D-22-33611 </div>  <div> New approach to improve power consumption associated with blockchain in WSNs </div>  <div> PLOS ONEDear Dr. Jabor,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.============================== </div>  <div> \u00a0 </div>  <div> Reviewers were in general agreement that the manuscript requires\u00a0a revision before to be considered for publication.ACADEMIC EDITOR: </div>  <div> In particular, they should improve the overall presentation of the manuscript, fix\u00a0English where needed, clarify\u00a0better the context and motivations of the research.Authors should carefully take into account their suggestions and comments for the acceptance.Finally, in preparing their revised version, authors should follow the guide lines reported at the following address to comply with the journal requirements:https://journals.plos.org/plosone/s/submission-guidelineshttps://journals.plos.org/plosone/s/materials-software-and-code-sharing </div>  <div> Authors also should share\u00a0their data, material, and artifacts according to ==============================plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Mar 09 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0 </div> A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Letterio GallettaAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at\u00a0https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfhttps://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-code and ensure that your code is shared in a way that follows best practice and facilitates reproducibility and reuse.2. Please note that PLOS ONE has specific guidelines on code sharing for submissions in which author-generated code underpins the findings in the manuscript. In these cases, all author-generated code must be made available without restrictions upon publication of the work. Please review our guidelines at https://www.youtube.com/watch?v=_xcclfuvtxQ3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to \u2018Update my Information\u2019 (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: 4. Please amend your authorship list in your manuscript file to include author Maytham Jabor.http://journals.plos.org/plosone/s/licenses-and-copyright.5. We note that Figures 2, 9 and 10 in your submission contain copyrighted images. All PLOS content is published under the Creative Commons Attribution License (CC BY 4.0), which means that the manuscript, images, and Supporting Information files will be freely available online, and any third party is permitted to access, download, copy, distribute, and use these materials in any way, even commercially, with proper attribution. For more information, see our copyright guidelines: We require you to either (1) present written permission from the copyright holder to publish these figures specifically under the CC BY 4.0 license, or (2) remove the figures from your submission:a. You may seek permission from the original copyright holder of Figures 2, 9 and 10 to publish the content specifically under the CC BY 4.0 license.\u00a0http://journals.plos.org/plosone/s/file?id=7c09/content-permission-form.pdf) and the following text:We recommend that you contact the original copyright holder with the Content Permission Form (http://creativecommons.org/licenses/by/4.0/). Please be aware that this license allows unrestricted use and distribution, even commercially, by third parties. Please reply and provide explicit written permission to publish XXX under a CC BY license and complete the attached form.\u201d\u201cI request permission for the open-access journal PLOS ONE to publish XXX under the Creative Commons Attribution License (CCAL) CC BY 4.0  remove the figure or ii) supply a replacement figure that complies with the CC BY 4.0 license. Please check copyright information on all replacement figures and update the figure caption with source information. If applicable, please specify in the figure caption text when a figure is similar but not identical to the original image and is therefore for illustrative purposes only.http://journals.plos.org/plosone/s/supporting-information.\u00a06. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: [Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0I Don't KnowReviewer #2:\u00a0N/A********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0NoReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0No********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The author minimised the processing load of generating the blockchain hash value, encrypting and compressing the data to reduce the overall traffic and energy to add blockchain in WSNs. In the paper, they design a dedicated circuit to implement the compression technique and generate the blockchain hash values and data encryption. The compression algorithm is based on chaotic theory. Finally, they compare the power consumed by a WSN using a blockchain implementation with and without the dedicated circuit, showing that the dedicated hardware reduces the power consumption up to 63%.SIGNIFICANCEThe idea of the paper is a significant advance in state of the art and helps researchers open new research directions.ORIGINALITYThe idea of adding blockchain technology to Wireless Sensor Networks is not new, but they innovate it using a dedicated circuit that reduces power consumption.TECHNICAL QUALITYIn the paper, the author prose a new way to use blockchain technology on Wireless Sensor Networks reducing several limitations, such as energy and memory size. To overcome these problems, they design a specific circuit. They provide a comparison of the power consumption using a blockchain implementation with and without the dedicated circuit using MATLAB. The results show that the dedicated hardware reduces power consumption by up to 63%.In my opinion, the author should better discuss their result to stress what are the advantages of using blockchain. For example, they could insert some results about the network's resilience to churn nodes.In the Introduction, the authors said that speed is one of the advantages of the blockchain. Could they explain why? Usually, the transaction speed is one of the blockchain limitations.In Section Proposed System, the authors talk about the POS consensus algorithm. Is it proof of stake? It needs to be clarified how they use it.The author should better comment on Figures 15 and 16 to stress the advantages of their model compared to the others.The Authors should share their data and codes to allow everyone to reproduce their results.SCHOLARSHIP AND QUALITY OF WRITINGThis paper is well-written and organized.The paper situates the work concerning the state of the art, citing and comparing the other papers about WSNs and blockchain.Some other comments:- [30],[31],[35] are websites and are better as footnotes.-The quality of Figures 3, 6, 7, 8, and 9 has to be increased.- The arrow size of Figure 2 should be increased.- Figure 5 is cited before Figure 4; they should be inverted.- Section Circuit design and implementation should start with an introduction and not directly with a subsection.Reviewer #2:\u00a0#SUMMARYThe manuscript applies blockchain technology (BC) to Wireless Sensor Networks (WSNs) in order to add a certain level of security , avoiding a centralization approach.A typical issue with BC is that it requires a certain amount of computation capabilities and energy that are critical in WSNs.To face this issue, the authors propose an energy minimization strategy that minimizes the processing load of the BC hash value and encrypts and compresses data that travels from the cluster heads to the base station reducing the general traffic.The main novelty of the manuscript is that the compression algorithm used to transfer information between nodes of the network is based on chaotic theory.Authors argue that compressing data using chaotic theory has at least two advantages. The first is that it can be easily implemented in hardware. The second one is that it allows the creation of low-power, cheap signals and can be added in the small areas of electronic circuits.To support their design, the authors provide a hardware implementation of their proposal in Verilog implementation and run it on an FPGA.They perform an experimental evaluation showing a reduction of 63% in energy consumption.#EVALUATIONThe topic of the paper is interesting and within the scope of the journal. The paper aims at providing an effective energy consumption associated with blockchain in Wireless Sensor Networks with the use of a dedicated circuit.We welcome the goal of the paper but we believe that the paper at the current stage is not ready for publication yet. For this reason, we suggest that the manuscript undergoes a major revision.We identify two kinds of issues that should be addressed in future submissions.The first concerns the overall presentation throughout the paper:- a clear definition of security property should be added It should be analyzed whether the level of security is increased, which security properties are provided, and the overall benefits from a security point of view.- citations of relevant concepts are missing  or a not correctly placed (i.e. the 8th source)- several sentences are too long and this affects the understanding of the concepts/ideas- certain concepts that are repeated- the use of \u201cThis way\u201d should be dramatically reduced- the use of brackets should be limited. They should not contain important concepts (i.e. \u201cthe hash of the current block\u201d in the \u201cIntroduction\u201d section)- the English should be improved - the style of the article is not coherent - the advantages of a concept  should be inserted after its definition. The exchange will increase the clarity of the paper and its basic notion.basic concepts on BC and chaotic theory could be introduced in a suitable \u201cBackground\u201d section.Below we provide a list of the issue for each section that should be addressed:- In \u201cAbstract\u201d:- it should be interesting to have a clear motivation about how this approach added confidentiality and integrity. (It could be inserted in one of the sections of the paper but at the current stage is missing.)- In \u201cIntroduction:- some ideas are unclear (such as the adoption of BC in WSNs and why it is a successful strategy in the use of chaos on hardware)- Nakamoto\u2019s paper should be cited when introducing the notion of BC certain definitions are missing. In particular, we suggest introducing the blockchain as a distributed ledger because this concept is used in the BC advantages and in the \u201cProposed system\u201d section.- In \u201cState of the art\u201d:- the illustrated existing approaches must achieve energy consumption (as the introductory sentence explains) but the 25th source is inserted even if it does not fulfill this goal. Its inclusion should be motivated.- all the sources should be classified according to some criteria that are a priori defined  and it could be useful to insert a table that summarizes them.- all the existing approaches should be compared with the researchers' one as it is done for the 28th source. If the 28th source is more relevant than the others should be motivated.- In \u201cProposed System\u201d:- the use of the figures is not effective - some sentences could be simplified - the layout associated with the data flowing into the network should be improved. Fig.3 should be inserted before the overall description of the mechanism to better understand it.- In \u201cCircuit design and implementation\u201d:- the introductory sentence that illustrates the purpose of the section is missing- the overall structure should be simplified because there are a lot of repetitions (such as the definition of the parameters should be listed once). Some basic ideas are already expressed in the \u201cIntroduction\u201d section so are redundant.- the Algorithm definition and analysis are not clear - there is a line spacing issue after Algorithm 3 and the explanation of this Algorithm could be improved.- the interpolation part should be rephrased and clarified when and why it is required to be used - In \u201cExperimentation and Results\u201d:- the acronym CS is incorrectly used. It stands for compressed sensing, not for signal compression. The use of the same acronym is misleading.- Fig. 9 and Fig. 10 could be replaced with tables showing the outcomes of the FPGA implementation to have clear evidence of the values.- the analysis of how the microcontroller works at higher frequency should be added in the \u201cFuture work\u201d section- Figures should be deployed and analyzed. In particular, Fig. 15 and Fig.16 show three different approaches, their results should be examined and the benefits (or the drawbacks) should be illustrated.- In \u201cConclusions and future work\u201d:- the definition of which type of attack will be analyzed as future work should be added********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 17 Mar 2023Dear Reviewer'sthanks for evaluating this article. Your comments have been very useful to improve our paper. The revised manuscript includes your suggestionsAttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 5 May 2023New approach to improve power consumption associated with blockchain in WSNsPONE-D-22-33611R1Dear Dr. Jabor,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Letterio GallettaAcademic EditorPLOS ONEReviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The authors have adequately addressed all my comments raised in a previous round of review, and I think this manuscript is now acceptable for publication.Reviewer #2:\u00a0The topic of the paper is interesting and within the scope of the journal. It aims at providing an effective energy consumption associated with blockchain in Wireless Sensor Networks with the use of a dedicated circuit.The authors have significantly improved the manuscript by taking into account the proposed changes. All the critical issues identified in the first revision have been addressed.The paper is complete from a stylistic and conceptual point of view at the current stage so we believe that is ready for publication.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0No********** 11 May 2023PONE-D-22-33611R1 New approach to improve power consumption associated with blockchain in WSNs Dear Dr. Jabor:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Letterio Galletta Academic EditorPLOS ONE"}
+{"text": "Physical exercise is known to improve the level of activities of daily living and physical function in people with dementia; however, symptoms of dementia often pose challenges when implementing physical therapy. This study aimed to elucidate how physiotherapists (PTs) engage with older adults with dementia to encourage exercise and participation in physical activity.In this qualitative study, four PTs working with older adults with dementia in long-term care facilities in Japan were recruited and interviewed. We used a modified grounded theory approach to assess how PTs engaged with older adults with dementia during physiotherapy sessions.Based on PT responses, five categories of engagement were identified: \u201cmake structured preparations for clients to begin physical activity,\u201d \u201clink exercise therapy to a client\u2019s daily life,\u201d \u201cdiscover changes in daily life,\u201d \u201cascertain cognitive function,\u201d and \u201caccommodate client differences.\u201d Concepts were derived under each category. The category \u201cmake structured preparations for clients to begin physical activity\u201d served as a preceding stage for PTs to engage with older adults with dementia. PTs linked exercise therapy to each client\u2019s daily life activities to encourage voluntary participation in daily physical activity. PTs ensured the performance of routine patterns of movement and modified these movement patterns per clients\u2019 differing paces.PTs provided exercise and movement training based on various degrees of client involvement and made structured preparations for clients to begin physical activity that were linked to exercise therapy. Our findings may prompt PTs to encourage older people with dementia to participate in physical therapy and benefit from exercise. Dementia is a syndrome involving more severe cognitive decline than the degree expected from the usual consequences of biological aging . The numPhysiotherapists (PTs) working in rehabilitation provide services to maintain and improve people\u2019s movements and functions . The oppOlder adults with dementia may be clinically complex, and a greater level of dementia education is needed to address this complexity . In thisIn this qualitative study, PTs providing services to older adults with dementia were interviewed. A modified grounded theory approach (M-GTA) was used to analyze the interview responses. The M-GTA was used to understand and interpret details concerning the contextuality of the detail-rich data derived from semi-structured interviews wherein the interviewees were asked to speak as freely as possible , 17. ThiThis study was conducted in accordance with the Declaration of Helsinki guidelines. All procedures were approved by the Medical Ethics Review Committee of Kanazawa University . All PTs, clients, and clients\u2019 family members, as well as the directors of the facilities where the PTs were affiliated, were provided with a verbal and written briefing on the purpose and details of this study prior to subsequently obtaining their written informed consent to participate.Two authors were PTs , one was a nurse (YT), and all were women. All members of the research team have experience with research in health science. YT has extensive experience in qualitative research about geriatric nursing and was involved in data analysis and supervision of this study.Snowball sampling  was usedClients or their family members were invited to participate in this study via PTs. Six clients who gave consent to participate were asked for their cooperation to allow a researcher (MY) to observe the clients\u2019 physiotherapy sessions. One client who visited the outpatient department could walk independently, while all other admitted clients required wheelchair assistance. The Barthel index was used to determine the ADL . One cliPhysiotherapy was administered to clients between 2 and 3 times per week on an individual basis within the facilities where the PTs worked. Each treatment session lasted from 15 to 20 minutes; however, the total interaction time, which included the time taken to walk to the physiotherapy room and time to prepare for the session, was 20 to 30 minutes per session. The objectives of the physiotherapy sessions included maintaining and improving the capacity of the older adults for ADL, maintaining and improving the ability to assume sitting and standing positions, and preventing falls. The exercise program included passive stretching, active exercises, active assisted exercise, leg presses, functional activity training, gait training, weight shifting in the sitting position, and ascending and descending stairs. Gait training was performed as assisted walking between the parallel bars, assisted walking with a walker, or independent walking based on the client\u2019s physical function.Data were collected from January to September 2017. Interviews with the PTs and observations of their physiotherapy sessions and their clients were performed at the facilities where the PTs worked.With permission from the facilities where the PTs worked, MY observed the physiotherapy sessions of the PTs and their clients while recording the sessions using a video camera. This approach was adopted to enable the authors to become informed concerning the details of the physiotherapy sessions and for the PTs to reflect on the physiotherapy sessions and to speak more freely during the interviews. Upon completion of a single physiotherapy session, MY proceeded to interview the PTs in a room within each PT\u2019s facility.For the interviews, we used a semi-structured interview guide with the following three open-ended questions: (1) \u201cPlease tell me about the client\u2019s physiotherapy program and its background,\u201d (2) \u201cIs there anything you noticed while watching the video footage of the physiotherapy session?\u201d and (3) \u201cDo you have any other thoughts concerning care for older adults with dementia?\u201d PTs were asked to speak freely according to the interview guide questions while watching the recorded video footage of their physiotherapy session with the client(s). MY asked follow-up questions or encouraged the PTs to discuss further details using probes or maintaining a short period of silence  to obtaiVerbatim records in Japanese were generated from audio records of the interviews, and then translated into English after analysis, which was performed by MY, YT, and YY using the M-GTA , 17, witThis study involved several theoretical and practical considerations. In terms of theoretical considerations, the following steps were performed to enhance credibility , 26\u201328. bold, the concept names are shown in \u201cdouble quotations,\u201d and the words of the interviewees are presented in italics.We generated 16 concepts and five categories concerning the involvement of PTs in encouraging participation in physical activity in older adults with dementia . The catmake structured preparations for clients to begin physical activity to encourage exercise/physical activity. Endeavors to make structured preparations for clients to begin physical activity through the link exercise therapy to a client\u2019s daily life entailed PTs\u2019 concentration on clients before and during the implementation of the exercise program. Three concepts of interaction, namely, discover changes in daily life, ascertain cognitive function, and accommodate client differences, served to facilitate this process There are clients who tend to experience pain even with passive exercise and are reluctant to perform them. Therefore, if a client has a range of motion in the joint that allows changing of clothes, I think it is best to endorse active exercise. They will not perform the exercise without encouragement. In many cases, they just tend to sit and stare blankly. (PT-3)The PTs observed the client to \u201cunderstand the client\u2019s condition on the day of physiotherapy,\u201d upon meeting a client, such as the client\u2019s physical condition, what the client spoke about, the level of arousal, facial expression, and movement. Based on the results, the PTs decided the timing of physiotherapy and the outline of the exercise/movement training content to be performed on that day.First, their eyes are sometimes closed; I call them to see if they will open their eyes or not. I check the extent to which the eyes open. Then, whether they maintain their eyes open. I also check to see if the client\u2019s mood is good or bad on the day. Even if they are in a good mood, they can get agitated and angry. (PT-2)PTs \u201calleviate negative memories of clients,\u201d such as pain, discomfort, and anxiety. PTs were careful not to provoke the bad memories of clients.The last thing is to ensure that you say goodbye to the clients after they reach their next destination. This is where they differ from healthy older people. Whereas a person without cognitive decline would be able to go to their next destination on their own, clients become anxious when left alone in a place. Therefore, I check by asking \u201cWhat are you going to do next?\u201d before taking them there and telling them goodbye. (PT-1)The general rule is to avoid anything that the client does not like. In particular, the client clearly knows what she wants to do, so I do not force her to move when she says, \u201cI do not want to move.\u201d (PT-2)PTs emphasized the need for clients to \u201cmaintain familiar movement patterns\u201d and understood that having an appropriate movement pattern or pace was related to maintaining movement capacity in ADL.There are many clients who maintain function through repetitive movements. (PT-3)He is receptive to familiar things but tends to have challenges with accepting new things. In general, I keep things in the same form and use the same tasks, as in a mechanical order, so that it won\u2019t burden the client. (PT-4)This category comprised concepts that showed how the PTs engaged with the clients when implementing exercise and movement training. A PT observed how a client performed exercises and movements and then \u201cprompted a client to perform movements appropriately.\u201dI first ask the client to move. I observe how he moves and assist him as needed. (PT-2)PTs also provided \u201cnon-verbal reminders to induce movements,\u201d such as incorporating group therapy and setting an environment that would encourage the performance of an intended exercise.If I want the client to maintain a sitting position as long as possible without resting on the back of the chair, I gather a few people around a table and have the clients engage in tasks. This is not done as a task or occupational therapy, but rather, it is done when I want to train the client\u2019s postural balance. However, the client is not capable of maintaining the posture through verbal instructions alone, so I shift their focus closer to their hands, which shifts their center of gravity forward. (PT-1)If a client is capable of performing more movement, I let them perform ring tossing by positioning the poles a little further away to achieve greater motion in the trunk. If I try to train the client\u2019s trunk control using exercises that require the client to be in a supine position, I do not think they could easily understand the exercise. I think it would be better if muscle strengthening could be achieved during movement. (PT-3)PTs observed clients performing exercises and movements and \u201cspecified markers for self-pacing.\u201dDuring the knee extension exercise, if I don\u2019t say anything, the client gradually alternates leg movements from side to side. The movement gradually deviates from extension movements and progresses toward stepping. I told the client to \u201ccontinue\u201d because I wanted him to continue the knee extension exercise on one side. (PT-3)PTs \u201cconvey information on how to perform movements in an actual living environment\u201d to clients and caregivers. PTs practiced the movements that clients could easily perform with their clients, based on their current physical condition, within their actual living environment. They also educated caregivers on how to perform the movements their clients were familiar with, how to care for them, and how to arrange the environment to facilitate movement.There are many people who refuse to exercise as their dementia progresses. Therefore, there are cases for which I assess whether the client can perform some movement using functional activities and observation of movement in the client\u2019s usual environment. If the client tells me, \u201cI am going to the toilet now, so I cannot do the rehabilitation (physiotherapy),\u201d I accompany them by saying, \u201cAlright, then I will go with you.\u201d I also speak with the staff for that floor after assessing the room\u2019s environment and toilet movements and identifying how the client can easily move in that environment. (PT-4)PTs \u201cprovide functional training in a simulated environment.\u201d This is a common methodology used in physiotherapy. The previously mentioned concept, \u201cconvey information on how to perform movements in an actual living environment,\u201d may be the approach that is more frequently used for older adults with dementia.There are clients who perform \u201cstanding while holding\u201d parallel bars, or if capable of doing so on their own, use THERABAND and \u201crelease one hand off the parallel bar and practice raising of clothing up and down\u201d as simulated training. (PT-4)This category comprised three concepts that emerged in relation to the PTs\u2019 discovering past, present, and future ADL of the clients, namely, \u201cidentify activities that the client is naturally good at,\u201d \u201cascertain recent lifestyle habits,\u201d and \u201cnotice changes in life function.\u201dThis client was apparently very active before dementia. He used to love driving cars, and even after he stopped driving, he used to go out by bicycle. He likes moving, and I guess he is enjoying it. He self-propels the wheelchair quite a lot. People around the facility often mention, \u201cOh, I saw Mr. O there.\u201d (PT-2)In the mornings she asks me, \u201cWho are you, again?\u201d before saying, \u201cGood morning.\u201d She comes to me and asks me, \u201cWhen is my turn for the rehab (physiotherapy)?\u201d so she recognizes that she is someone that does physiotherapy and that I am her therapist. She is just unable to remember my name. (PT-1)There was a case of a client who had difficulty controlling her toilet needs, feeling uneasy and often saying, \u201cI want to go to the toilet, I want to go!\u201d but calmed down after a balloon was inserted. She had residual urine and difficulties emptying her bladder on her own, which is why a balloon was inserted. I was worried that balloon insertion might make her even more uneasy and that she might pull out the tube, but it was completely the opposite\u2013she became very calm. (PT-4)PTs observed the body movements of clients while they performed their routine exercises and movements and \u201cassessed what the client remembers.\u201d Alternatively, they \u201cask the client what they wish to do next.\u201d The PTs would then ascertain changes in cognitive function based on the client\u2019s movements or responses.We have been doing this for a very long time, so the client himself remembers it and does it along with me. At this point, I keep the program unaltered and encourage the client to perform the same exercise to prompt the movements that he remembers. (PT-2)When I ask, \u201cWhat do you want to do?\u201d those who can answer are those capable of making their own decision, and I have to ask a follow-up question for those clients who do not know what they want to do. For these latter clients, I provide more options for them to answer the question, such as \u201cToilet? Remove your clothes? Put on your clothes? Cold? and Hot?\u201d Sometimes, a client would just continue to repeat, \u201cNo, No.\u201d (PT-1)PTs \u201cset goals through considering changes in cognitive function\u201d and supported the physical activity of clients: \u201cset individual standards for evaluating the degree of independence in ADL.\u201dIt depends on the client. There are people who, with practice, have become capable of bathing at home independently. It is an issue I consider mostly on a case-by-case basis. (PT-1)He is capable of this much movement now, but at one point, he scored 0 points on the HDS-R . Sometimes I think that movements are different. There are people who would score high points and still be incapable of going to the toilet, whereas there are those who only score 7 or 8 points but are capable of going to the toilet without assistance. (PT-3)In this study, we investigated how PTs interacted with older adults with dementia to encourage exercise and physical activity. Previous studies have reported extensive knowledge and experience acquired through interviews with PTs providing physiotherapy to older adults with dementia , 13, 14.make structured preparations for clients to begin physical activity prior to the next step, to link exercise therapy to a client\u2019s daily life, with the goal of encouraging older adults with dementia to voluntarily engage in physical activity during their daily life  link exercise therapy to a client\u2019s daily life. One of the concepts identified in the former category was \u201cmaintain familiar movement patterns.\u201d Experienced rehabilitation specialists emphasize the importance of consistency and becoming familiar with the treatment environment [linking exercise therapy to a client\u2019s daily life category, involves introducing a physical activity that the client is not accustomed to. This concept can be a disadvantage in terms of enabling a client to become familiar with the therapeutic environment. However, in making structured preparations for clients to begin physical activity, PTs do not just provide movement patterns that the client is accustomed to but also engage with the client to help acquire movements in different patterns and paces while the client prepares for exercise therapy; thus, contributing to the improvement in the client\u2019s movement capacity.Conflicting concepts were found in relation to two categories: 1) ironment , 31. Phyironment . Proceduironment . Performdiscover changes in daily life, ascertain the cognitive function of clients, and accommodate client differences were likely to provide sources of information to facilitate the process in terms of the step to link exercise therapy to a client\u2019s daily life via the step to make structured preparations for clients to begin physical activity  cannot be provided, depending on the physical and cognitive abilities of older adults with dementia, and further validation is needed.General principles are set out in the American Psychiatric Association (APA) treatment guidelines in relation to caregivers\u2019 attitudes toward patients with dementia . For exaThe interviews in this study were conducted prior to the start of the COVID-19 pandemic. We also asked the PTs about their experiences after the COVID-19 pandemic began. They responded that there had been no change in their approach and attitudes toward older adults with dementia. However, the environment is now more focused on infection prevention, and the daily lives of the clients have been affected. For example, the clients and PTs wear masks for infection control; therefore, both of them have found it challenging to communicate with each other through the use of facial expressions and nonverbal communication. Moreover, the PTs needed to observe their clients more carefully than previously. For admitted clients, opportunities for group exercise and outings have been reduced, and the range of activities has been limited due to zoning in the facility. When family visits were also limited, some clients seemed less willing to participate in physiotherapy. In some cases, when online visitation became available, the person regained their motivation. In the infection prevention response to COVID-19, PTs used the same approaches as those presented in this study while accepting that there were changes in their clients as a result of the changes in their environment.Considering applicability and transferability, the context of the study was described in our methods section, and many statements of the PTs were presented in the results section. Our findings may be useful in understanding and applying physiotherapy in the medical field. However, the study had limitations in that hospitalization involves a drastic change in the environment, and admitted patients are prone to distress associated with medical procedures. Given the significant differences between hospital-based and long-term care, our results may be poorly applicable in some aspects of medical settings. Future studies are required to confirm the applicability of our findings.The PTs in our study provided exercise and movement training by applying various degrees of involvement. PTs made structured preparations for clients to begin physical activity to link with exercise therapy. The involvement of PTs in encouraging client physical activity was observed to help guide older adults with dementia to live more independent lives. Our findings may contribute to older adults with dementia continuing to participate in physiotherapy and benefit from exercise.S1 Checklist(PDF)Click here for additional data file."
\ No newline at end of file