diff --git "a/deduped/dedup_0487.jsonl" "b/deduped/dedup_0487.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0487.jsonl"
@@ -0,0 +1,39 @@
+{"text": "N-(2-hydroxyacetophenone) glycinate (CuNG) has been synthesized, which was initially found to be a potential resistance modifying agent and later found to be an immunomodulator in mice model in different doses. The objective of the present work was to decipher the effect of CuNG on reactive oxygen species (ROS) generation and antioxidant enzymes in normal and doxorubicin-resistant Ehrlich ascites carcinoma (EAC/Dox)-bearing Swiss albino mice.In search of a suitable GSH-depleting agent, a novel copper complex viz., copper The effect of CuNG has been studied on ROS generation, multidrug resistance-associated protein1 (MRP1) expression and on activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx).CuNG increased ROS generation and reduced MRP1 expression in EAC/Dox cells while only temporarily depleted glutathione (GSH) within 2 h in heart, kidney, liver and lung of EAC/Dox bearing mice, which were restored within 24 h. The level of liver Cu was observed to be inversely proportional to the level of GSH. Moreover, CuNG modulated SOD, CAT and GPx in different organs and thereby reduced oxidative stress. Thus nontoxic dose of CuNG may be utilized to reduce MRP1 expression and thus sensitize EAC/Dox cells to standard chemotherapy. Moreover, CuNG modulated SOD, CAT and and GPx activities to reduce oxidative stress in some vital organs of EAC/Dox bearing mice. CuNG treatment also helped to recover liver and renal function in EAC/Dox bearing mice.Based on our studies, we conclude that CuNG may be a promising candidate to sensitize drug resistant cancers in the clinic. Oxidative stress is linked to carcinogenesis as well as to sensitivity or resistance of cancer cells to anticancer drugs . The invIt has been reported that the depletion of GSH by different pharmacological agent modulates resistance to anticancer drugs ,13,14. SN-(2-hydroxyacetophenone) glycinate (CuNG) . Untreated control group received i.p. injection of 1 ml vehicle  DMSO in normal saline) only. In EAC/Dox bearing mice, CuNG was administered 7 days after inoculation with EAC/Dox. Previous work from our laboratory had showed that at a dose of 10 mg/kg body weight CuNG had no toxicity . Animals6 cell homogenate in 0.1 ml PBS was mixed with 2.4 ml EDTA (0.02 M), 2 ml deionized water and 0.5 ml 50% TCA and centrifuged at 500 \u00d7 g for 15 min at 4\u00b0C. 2 ml of supernatant was mixed with 2 ml 0.4 M Tris buffer (pH 8.9). 50 \u03bcl 5,5'-dithio bis (2-nitrobenzoic acid) [DTNB] (0.01 M) was added to the mixture. Within 2\u20133 min of addition of DTNB, optical density (OD) was measured at 412 nm. Protein was measured by using the Bradford Method .k' = (2.303/t) log [a/(a-x)] .For serum collection, mice were anesthetized and their chests were cleaned with ethanol. Blood was obtained via closed cardiac puncture by means of a 22-guage hypodermic needle . Blood fet al [Liver homogenate was prepared following the method of Hafemann et al . To 100 For bile collection, mice were anesthetized; chests were cleaned with ethanol and opened. Whole gall bladder was removed and total bile of gall bladder was dissolved in 100 \u03bcl double distilled water. To 100 \u03bcl bile solution 3.9 ml of nitric acid solution (2.5%) was added and vortexed for 5 min. To avoid co-precipitation each sample was centrifuged at 500 \u00d7 g at 37\u00b0C. Cu was measured in the clear supernatant by AAS.l urine was added to 3.9 ml of nitric acid solution (2.5%) and vortexed for 2 min. To avoid co precipitation each sample was centrifuged at 500 \u00d7 g at 37\u00b0C. Cu was measured in the clear supernatant by AAS.Mice were fed with excess amount of water with the help of feeding needle and then urine was collected at different time intervals like 4 h, 24 h and 48 h after CuNG injection i.p. 100 \u03bcl; at 24 h and 48 h only 50 \u03bcl PF was collected. 50 \u03bcl PF was added to 1.95 ml of nitric acid solution (2.5%) and vortexed for 2 min. To avoid co precipitation each sample was centrifuged at 500 \u00d7 g at 37\u00b0C. Cu was measured in the clear supernatant by AAS.Mice were anesthetized and peritoneal fluid was collected at different time intervals like 4 h, 24 h and 48 h after CuNG injection i.p. The maximum amount of peritoneal fluid collected at 4 h was 500 \u03bc6 EAC cells from EAC/S bearing or EAC/Dox bearing (untreated or CuNG treated) mice or 10 mg of tissue  in 1 ml of Hank's balanced salt solution (HBSS) were taken and NBT assay for ROS was performed according to Beauchamp and Fridovich [630 was measured. OD values were compared with a standard curve constructed with NBT and ROS generation was expressed as \u03bcM NBT equivalent/2 \u00d7 106 cells or \u03bcM NBT equivalent/10 mg tissue.2 \u00d7 10ridovich  with minFor the determination of surface MRP1 expression, EAC/Dox cells were harvested from tumor-bearing mice and incubated in presence of anti-MRP1 polyclonal antibody following appropriate blocking. Cells were then washed and incubated with anti-rabbit IgG-FITC conjugated secondary antibody. Following washing, cells were fixed with paraformaldehyde and surface MRP1 expression was determined on FACS, fluorescence detector equipped with 488 nm argon laser light source and 623 nm band pass filter  using CellQuest software (Becton Dickinson). Appropriate isotype control was taken in all cases. A total of 10000 events were acquired and analysis of flow cytometric data was performed using ModFit software. A histogram of FITC-fluorescence (x-axis) versus counts (y-axis) has been displayed.For the assessment of surface MRP1 expression, EAC/Dox cells were incubated in presence of anti-MRP1 polyclonal antibody following appropriate blocking. Cells were then washed and incubated with anti-rabbit IgG-FITC conjugated secondary antibody. Following washing, cells were fixed with paraformaldehyde and surface MRP1 expression was visualized using a confocal microscope .Each experiment was performed 3 to 5 times and results are expressed as mean \u00b1 SD or Student's t-test for significance was performed and p < 0.01 was considered significant. Flow cytometric and fluorescence microscopic data show representative data of at least three independent experiments.2O2 (which was non-toxic concentration as manifested by >98% viability) could also reduce surface MRP1 expression of these cells  and Cytochrome c reduction (data not shown). This prompted us to investigate whether CuNG treatment could inhibit MRP1 expression. It was observed that in vivo CuNG treatment also decreased surface expression of MRP1 in EAC/Dox cells within 3 days .Since we have shown earlier that CuNG is a good resistance modifier  and as cays Fig. . InteresSince increased ROS generation in different vital organs like heart, lung, liver and kidney may be toxic for these organs, we determined whether CuNG treatment also modulated ROS generation in these vital organs.As shown in Fig. Since CuNG treatment in vivo modulated the ROS generation in vital organs, we studied the status of antioxidant enzymes related to phase II detoxification in these organs.The activity of SOD decreased in heart (~35%), kidney (~5%) liver (~50%) and lung (~20%)  was observed to decrease by ~15% within 24 h following in vivo CuNG treatment (data not shown). Although the catalase activity remained more or less unchanged, the GPx activity also increased to some extent in tumor cells following CuNG treatment of EAC/Dox bearing mice (data not shown).As GSH is important for scavenging ROS and maintaining a reducing environment with in the cell, and since CuNG depletes GSH in EAC/Dox cells, we have studied whether CuNG treatment also lowers the GSH levels in heart, lung, liver and kidney. GSH levels were low in these organs of EAC/Dox bearing mice compared to that in their normal counterparts. Although CuNG treatment depleted GSH in all the organs tested by 2 h, the levels were restored by 24 h post treatment Fig. , indicatSince CuNG treatment increased ROS generation in liver of EAC/Dox bearing mice, we tested different parameters of liver and renal function to decipher whether there was any apparent hepatic or renal toxicity following treatment with CuNG.As shown in Table Accumulation of excess copper is known to be toxic. Therefore, we were interested to know whether copper was excreted or not following CuNG treatment.After CuNG injection, released copper was measured in bile, urine and in peritoneal fluid by AAS. Each mouse was injected 180 \u03bcl solution of CuNG (1 mg/ml) i.p. that is equivalent to 36.82 \u03bcg of Cu. Very high amount of copper was released through urine (26.39 \u00b1 1.6 \u03bcg) within 24 h. The amount of copper excreted in bile was lower than that of the urine  could reduce surface MRP1 expression of the EAC/Dox cells. Moreover, CuNG could modulate SOD, CAT and GPx to reduce oxidative stress in heart and lung. CuNG treatment of EAC/Dox bearing mice also restored SGPT and SGOT levels to almost normal values and thereby rescued them from liver failure. Thus CuNG is not only a resistance modifier but it also possesses tissue protective activity.Thus, we conclude that besides reversing resistance toward dox by depletion of GSH , CuNG coThe author(s) declare that they have no competing interests.AM designed and performed some major biochemical experiments, did the confocal microscopy and drafted the manuscript; JMB participated in designing and performing some major biochemical experiments, did the flowcytometry and also participated in drafting the manuscript; SM, SC, GSP and PD performed biochemical experiments; SP performed all the hepatic and renal function tests; PM maintained the cell lines; TE advised and designed some biochemical experiments and participated in drafting the manuscript; all experiments were performed in the laboratories of SR and SKC under their guidance. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "P< 0.0005\u20130.0045), suggesting that the unresponsiveness of cancer cells to CTLs observed in these patients was mainly due to loss of MUC1 expression or modulation of its antigenicity. A breast cancer cell line, NZK-1, established from one of the cytotoxicity-negative patients, did not express MUC1 and was resistant to killing by CTLs, while control breast cancer cell lines expressing MUC-1 were readily killed by CTLs. Transfection of NZK-1 cells with MUC1 cDNA induced significant lysis by autologous T-lymphocytes. These results supported the importance of MUC1 mucin in autologous anti-tumour immunity, but suggested that the major escape mechanism of tumour cells from autologous T-lymphocytes is the loss and/or modulation of MUC1 antigenicity on tumour cells, which would limit the effectiveness of possible immunotherapy designed to target the MUC1 mucin. \u00a9 2001 Cancer Research Campaign http://www.bjcancer.comMUC1 mucin is known to serve as a target molecule in the killing of breast cancer cells by cytotoxic T-lymphocytes (CTLs). We searched for a possible mechanism allowing tumour cells to escape from autologous CTLs. When the killing of breast cancer cells by autologous lymphocytes was examined in 26 patients with breast cancer, significant tumour cell lysis was observed in 8 patients, whereas virtually no autologous tumour cell lysis was detected in as many as 18 patients. In the patients who showed negligible tumour cell lysis, the autologous tumour cells expressed MUC1-related antigenic epitopes much more weakly than the tumour cells in the patients who exhibited strong cytotoxicity (significant statistically at"}
+{"text": "The method was linear over the range of 1-20 \u03bcg/mL of cetirizine dihydrochloride (r2 > 0.999) and the within-day and between-day precision values were less than 1.5%. The results showed that cetirizine dihydrochloride was unstable in 2 M HCl and 0.5% H2O2. The kinetics of the acidic degradation showed a pseudo-first-order reaction in the temperature range of 70-90\u00b0C. In addition, the kinetics of hydrogen peroxide mediated degradation was pseudo-first-order in the temperature range of 50-80\u00b0C. A stability indicating High-Performance Liquid Chromatography (HPLC) method was validated and used to study the degradation of cetirizine dihydrochloride in acidic and oxidative conditions. The separation was carried out on a Symmetry C Cetirizine dihydrochloride is a potent and non-sedating antihistamine belongs to the piperazine class of second generation of antihistamines. Cetirizine dihydrochloride is used for symptomatic treatment of allergic conditions including seasonal rhinitis and chronic urticaria -2-[2-[4-(4-chlorophenyl) phenylmethyl] piperazin-1-yl] ethoxy] acetic acid dihydrochloride , is a noLiterature survey showed several reported High-Performance Liquid Chromatography (HPLC) -9, capilet al. , India . All the HPLC grade solvents and analytical grade chemicals were purchased from Merck . HPLC grade water was obtained by a Milli-Q purification system .InstrumentationA Waters HPLC system consisted of an isocratic pump (Model 515), an autosampler (Model 710 plus) and a variable UV-vis detector (Model 480) was employed. The HPLC data were processed by using a multi-channel Chrom and Spec software for chromatography, version 1.5 x.Chromatographic conditionset al.  and a mixture of KH2PO4 50 mM and acetonitrile  at a flow rate of 1 mL/min were used. The mobile phase was prepared daily and degassed by filtration through a 0.45 \u03bcm Teflon membrane filter  and sonication for 10 min. The wavelength for UV-detection was 230 nm and all determinations were performed at ambient temperature.Chromatographic Conditions was partly based on the method reported by Zaater et al. . A SymmeStandard solution/mL. The stock standard solution was kept at 4\u00b0C protected from light. Standard solutions for calibration curve  were prepared daily by appropriate dilution of stock standard solution with mobile phase to reach the desired concentration.Stock standard solution of cetirizine dihydrochloride was prepared by dissolving an accurately weighed portion of drug in water to reach a concentration of 5000 \u03bcgSystem suitabilitySystem suitability parameters of the HPLC method were assessed by six replicate injections of a solution of cetirizine dihydrochloride (10 \u03bcg/mL in mobile phase) to the HPLC system. The coefficient of variations for the peak areas and retention times were calculated.LinearitySix series of cetirizine dihydrochloride solutions in mobile phase at the concentrations of 1, 2, 5, 10, 15 and 20 \u03bcg/mL were prepared and injected to the HPLC system. The calibration curves were constructed by plotting the measured peak areas of each concentration against the corresponding concentration and the statistical analysis was performed.Precision and accuracyCetirizine dihydrochloride solutions at three different concentration levels within the calibration range  was injected to the HPLC system in triplicate. The concentration of each solution was measured using a calibration curve in the range of 1-20 \u03bcg/mL. The within-day precision and accuracy was calculated. The same method was performed during three separate days to find out the between-day precision and accuracy.StabilityThe stability of cetirizine dihydrochloride stock solution was checked after storing at 4\u00b0C for 1 week.Application of the methodTwenty cetirizine dihydrochloride tablets were weighed and ground into fine powder using a glass mortar and pestle. An accurately weighed portion of powder equivalent to 10 mg cetirizine was transferred to a 100 mL volumetric flask and 50 mL of mobile phase was added. After 15 min sonication the volumetric flask was adjusted to the volume with the same solvent. The solution was injected to the HPLC system after filtration through a 0.45 \u03bcm polypropylene syringe filter  and ten times dilution. The drug concentration was determined in comparison with the same concentration of a standard solution of cetirizine dihydrochloride.RecoveryTo find out the relative recovery of cetirizine from dosage forms, an accurately weighed amount of tablet powder equal to 50% of one tablet was spiked with cetirizine dihydrochloride standard solution in a 100 mL volumetric flask. The same procedure for determination of drug dosage form was performed. The peak area of the triplicate injections was compared by a standard solution of cetirizine dihydrochloride with the same concentration level and the relative recovery was calculated.Kinetic investigation of cetirizine degradationFor acidic degradation, 1 mL of stock standard solution of cetirizine dihydrochloride (5000 \u03bcg/mL) was transferred into a 10 mL volumetric flask and 2 M HCl was added to volume. The flask was placed in a dry air oven  at four different temperatures . At specified time intervals, 500 \u03bcL of the solution was transferred to a 10 mL volumetric flask and after neutralization with sodium hydroxide, adjusted to the volume by mobile phase. The resulting solution was injected to the HPLC system and the peak area of cetirizine was compared with a freshly prepared standard solution. The percentage of remained cetirizine was calculated and plotted against time. Each experiment was repeated three times at each temperature.For basic degradation, the same experiment was performed using 5 M NaOH and for neutralization, a solution of hydrochloric acid was used.Oxidative degradation was also performed using the same procedure by using 0.5% hydrogen peroxide at four different temperatures .Chromatographic conditions18 column and a mixture of KH2PO4 50 mM and acetonitrile , good peak shape without tailing and interferences from degradation products in acidic or oxidative conditions, was observed  with CV < 1.5% was found to be 1 \u03bcg/mL. The limit of detection (LOD) based on S/N ratio of 3 was found to be 0.2 \u03bcg/mL.The HPLC method was linear over the concentration range of 1-20 \u03bcg/mL of cetirizine dihydrochloride. According to the data shown in Precision and accuracyThe results of the precision and accuracy of the method at three different concentration levels are demonstrated in Relative recoveryThe mean recovery of cetirizine dihydrochloride calculated by standard addition method to tablet powder was about 99% and no interfering peaks from excipients were observed.Solution stabilityThe stock standard solution of cetirizine dihydrochloride in water was stable over a period of one weak at 4\u00b0C with a recovery of about 99.5%.Analysis of pharmaceutical productThe cetirizine tablets were determined by using the proposed method. The results showed good agreement with the labeled amount (10.04 \u00b1 0.06 mg per tablet).Degradation studies2O2 at 80\u00b0C according to the reported method of Jaber et al. . In fact, a very small loss of peak area was observed after long exposure to 5 M NaOH at 90\u00b0C up to 48 h.Kinetics of degradation in acidic conditionThe degradation of cetirizine dihydrochloride was investigated in acidic condition using 2M hydrochloric acid. The drug was found to degrade in this condition at different temperatures with a same pattern . A regult = log C0 - kt / 2.303log C0 is the initial percent of cetirizine (100%), k is the apparent first order rate constant with a negative sign and t is the time. Good correlation coefficient for all plots in different temperatures was observed (CV > 0.99). The values for the apparent first order rate constants and the half-lives are presented in Here, Ct is the percent remained cetirizine peak area, CBased on the Arrhenius relationship in the temperature range of 70-90\u00b0C , the folK=Ae_Eact/RTHere, k is the apparent first order rate constant. A is the pre-exponential factor, Eact is the activation energy and T is the temperature.No significant degradation was observed at lower temperatures. So, the kinetics of degradation could not be monitored in these temperatures.Kinetics of degradation in oxidative condition2O2 medium. Using 0.5% H2O2 the degradation reaction could be followed at four different temperatures . Degradation pattern was similar in all conditions and a few small new peaks were detected in the chromatogram (The degradation of cetirizine dihydrochloride was too fast in 1% Hmatogram .The results for degradation of cetirizine dihydrochloride in oxidative condition at four different temperatures were also shown in"}
+{"text": "Many studies indicate rural location as a separate risk for dying from injuries. For decades, Finnmark, the northernmost and most rural county in Norway, has topped the injury mortality statistics in Norway. The present study is an exploration of the impact of rurality, using a point-by-point comparison to another Norwegian county.We identified all fatalities following injury occurring in Finnmark between 2000 and 2004, and in Hordaland, a mixed rural/urban county in western Norway between 2003 and 2004 using data from the Norwegian Cause of Death Registry. Intoxications and low-energy trauma in patients aged over 64 years were excluded. To assess the effect of a rural locale, Hordaland was divided into a rural and an urban group for comparison. In addition, data from Statistics Norway were analysed.Finnmark reported 207 deaths and Hordaland 217 deaths. Finnmark had an injury death rate of 33.1 per 100,000 inhabitants. Urban Hordaland had 18.8 deaths per 100,000 and rural Hordaland 23.7 deaths per 100,000. In Finnmark, more victims were male and were younger than in the other areas. Finnmark and rural Hordaland both had more fatal traffic accidents than urban Hordaland, but fewer non-fatal traffic accidents.This study illustrates the disadvantages of the most rural trauma victims and suggests an urban-rural continuum. Rural victims seem to be younger, die mainly at the site of injury, and from road traffic accident injuries. In addition to injury prevention, the extent and possible impact of lay people\u2019s first aid response should be explored. Injury is a leading cause of death worldwide, accounting for 16% of the global burden of disease .It is well established that rural areas have higher injury-related mortality rates than urban areas -5, with Finnmark lies at the very north end of the Scandinavian Peninsula, in Norway. Covering an area roughly the size of Denmark, today it is home to a mere 73,694 people . For decWe have previously described injuries in Finnmark and investigated their changes over time, and Finnmark seemed to follow a typical rural injury pattern ,12. HoweThe aim of this study was to explore the impact of different degrees of rurality on the epidemiology of trauma. This was achieved through a point-by-point comparison of Finnmark to another Norwegian county based on a thorough analysis of a two-year patient material. To extend the material and reduce the risk of random variations, we also analysed registry data for a ten-year period from Statistics Norway.All deaths from external causes (ICD-10 V01\u2013Y98) occurring in Finnmark County during the five-year period from 1 January 2000 through 31 December 2004, and occurring in Hordaland County in the two-year period from 1 January 2003 through 31 December 2004 were obtained from the Norwegian Cause of Death Registry. The Cause of Death Registry routinely records all deaths in Norway and codes the deaths in accordance to the ICD-10 system based on the information from the death certificate and autopsy reports, thus ensuring that the coding is performed uniformly. We also included those injury cases that occurred in Finnmark or Hordaland where the patient succumbed after being transferred to a hospital outside of the county.We excluded deaths from isolated, simple fractures after a fall at ground level that occurred in persons aged over 64 years, and those from poisonings. Victims of simultaneous trauma and intoxication were included. The criteria used were the same as for our previous studies of Finnmark, and were originally chosen to ensure comparability to similar studies ,12.Information concerning cause of injury, time and place of death, and demographic data was obtained from ambulance and hospital records and/or police and autopsy reports (where available), and were recorded in a standard form.Death was defined as the point in time where the patient became lifeless and no attempt at resuscitation was made or such attempts were terminated. As such, death did not require a physician to declare the patient dead. Time from injury to death was the time that elapsed from the injury up to this point. Place of death was set as the place this occurred as stated in the patient\u2019s records.Health statistics regarding the major causes of death were obtained from Statistics Norway for the period from 1 January 2001 through 31 December 2009. These data were not collected specifically for the study, but the decision to access them was made prior to the collection of the primary data. In figures and tables where Statistics Norway is the source, this is stated clearly in the legends.To investigate rural/urban differences, we divided our material from Hordaland County into two categories; injuries that occurred inside the municipality of Bergen (urban), and injuries that occurred outside of Bergen .2), which were all served by the University Hospital of Bergen. The rural Hordaland subgroup had 206,237 inhabitants (density 14/km2), which were served by three local hospitals; Odda, Voss, and Stord, as well as the University Hospital of Bergen. Finnmark had 76,629 inhabitants at the beginning of the study period and 73,210 at its end (density 1.5/km2). Finnmark is served by two local hospitals, Hammerfest, and Kirkenes, as well as the University Hospital of Troms\u00f8, which is located outside the county. Except for the differences in area and population density, the trauma systems in Finnmark and Hordaland are otherwise rather similar; there are similar requirements for level of education in the EMS and response times. Both counties have helicopter service available as part of EMS.At the beginning of the study period, the urban Hordaland subgroup had 235,423 inhabitants  was used for continuous data. For categorical data and rates, a chi-square test or Fisher\u2019s exact test was used. Comparison of groups was two-tailed with statistical significance chosen at p\u2009<\u20090.05.Approval for the study was given by the Norwegian Directorate for Health and Social Affairs (07/4817), the Norwegian Data Inspectorate (07/01595-3/clu), the Privacy Ombudsman for Research (17430/2/LT), the Norwegian Director of Public Prosecutions (Ra 07-526 IFO/mw 639.2), and the Regional Committee for Medical and Health Research Ethics (200702984-3/IAY/400).The process of inclusion and exclusion is presented in Figure\u2009The division of Hordaland into rural and urban groups was done according to the information found in the patients\u2019 journals. Therefore, we could not calculate the mortality rate for the groups based on the cases included, but had to use the mortality rate based upon the cases found. We found 89 deaths in urban Hordaland and 98 deaths in rural Hordaland during the study period. Finnmark had an autopsy rate of 34% (n\u2009=\u200948) and Hordaland had a rate of 80% n\u2009=\u2009173). The mortality rates, age, and gender distribution are given in Table\u200973. The mThe mortality rate was significantly higher in Finnmark compared with the two other areas . No significant difference in rates was observed between urban and rural Hordaland (p\u2009=\u20090.124). The fatality victims in Finnmark were younger aged than those in the other areas , but there was no difference in age within Hordaland (p\u2009=\u20090.072). There were no statistically significant differences in gender distribution (p\u2009=\u20090.493) between the groups.The time from injury until death could be established for 81 (66%) cases in Finnmark and 86 (97%) and 95 (97%) cases in urban and rural Hordaland, respectively Figure\u2009. There wThe place of death is shown in Table\u2009The distribution of the cause of injury within each area is given in Figure\u2009There was no difference between rural Hordaland and Finnmark except for deaths from snowmobile accidents (p\u2009=\u20090.001) and machinery (p\u2009=\u20090.049); rural Hordaland had none.In rural Hordaland, 7 of 98 accidents occurred at work, and there was no difference (p\u2009=\u20090.415) in these numbers compared to Finnmark (11 of 122) when adjusted for employment rate. Compared to urban Hordaland (0 of 89), both of the rural areas had a higher share of accidents occurring at work .From 2001 through 2009, Statistics Norway provided the number of suicides, falls, and road traffic accidents with personal injury. Finnmark had a higher suicide rate (p\u2009<\u20090.01) than the other areas at 14.6 deaths per 100,000 inhabitants per year compared with 10.5 deaths per 100,000 inhabitants per year in urban and 8.9 deaths per 100,000 inhabitants per year in rural Hordaland . Road traffic accidents are displayed in Figure\u2009This study shows that inhabitants of the most rural and remote study area in Norway, Finnmark County, have a significantly increased risk of dying from injuries compared with Norwegians in less rural and urban areas. The findings indicate a gradient from urban to rural areas where rurality in itself increases risk of death when injuries occur. Rural victims tend to be younger and succumb at the scene of the accident. A major finding is the fact that the prevalence of non-fatal RTAs seem to be lower in the most rural area, indicating that the risk of dying from an RTA is considerably increased.Suicide was the greatest cause of death in all areas. There was a significant difference between Finnmark and the other areas in the data from Statistics Norway. This category did not follow an urban-rural gradient, which is in line with higher suicide rates being reported in rural communities ,14,15, wRoad traffic accidents comprised the second largest cause of death. The data we obtained from Statistics Norway indicated that there are more injuries in urban Hordaland, but more deaths in rural Hordaland and Finnmark. The discrepancy between fatality and injury rates may be due to differences in accident severity, disadvantages in rural trauma care, or both. Although urban areas may have higher injury rates due to higher traffic density, they may also have lower accident severity as a result of lower speeds. Conversely, rural accidents may be more severe owing to higher speeds, but possibly also to more head-on collision, older, less crash-secure cars; and different attitudes towards seatbelt use ,17. DisaThe inclusive trauma system, encompassing prevention, legislation, and health care, has been shown to reduce mortality ,24. The Finnmark differed from both urban and rural Hordaland in deaths from machinery and snowmobile accidents. In Norway, snowmobiles are least used in the western part, and most commonly used in the northern counties. Snowmobile accident is the fourth largest cause of death in Finnmark and could explain some of the differences in total death rates among the counties.Further research should try to establish the survivability of the rural injuries. Such an analysis was not performed in this study owing to the low autopsy rate in Finnmark. The local police determine what cases are sent for autopsy and the selection is therefore unlikely to be representative. Likewise, cause of death and preventability would be of interest in future studies.This study has several limitations. First, the observation period was short, especially in Hordaland with only two years. With a short observation period, there is the risk of hitting peaks or troughs of fluctuating trends, thereby obtaining misleading results. Dividing Hordaland into rural and urban subgroups was necessary to explore the issue of rural character, but it also meant reducing the number in each group when comparing subgroups such as place or mode of accident. The difference in autopsy rates, 80% in Hordaland and a mere 34% in Finnmark, is also a concern, although the endpoints of this study are rather robust despite the lack of autopsy.This study illustrates the disadvantages of the most rural trauma victims, and suggests an urban-rural continuum. In addition to injury prevention and the implementation of a customised trauma system, the extent and possible impact of lay people\u2019s first response should be explored.The Regional Committee for Medical and Health Research Ethics of Northern Norway approved the study (ref. 200702984-3/IAY/400 and 2010/1703-4) and exempted the authors from obtaining consent from the next-of-kin of the victims of traumatic death studied in this paper.None of the authors have any conflicts of interest to declare.HKB participated in developing the design, carried out the data collection for Finnmark, performed the statistical analysis, and drafted the manuscript. ISH carried out the data collection for Hordaland, and revised the manuscript. ABB carried out the data registration for Hordaland, and revised the manuscript. IM facilitated and supervised the data registration for Hordaland, and revised the manuscript. PKL facilitated and supervised the data registration for Hordaland, and revised the manuscript. TW conceived of the study, developed the design, supervised the registration of data in Finnmark and analysis and interpretation of data, and helped draft the manuscript. All authors read and approved the final manuscript."}
+{"text": "The cytokine interleukin-22 (IL-22), which is produced by T cells and natural killer cells, is associated with tumorigenesis and tumor progression in cancers. However, the role of IL-22 in bladder cancer has not been investigated.IL-22 gene were determined with fluorogenic 5' exonuclease assays.A prospective hospital-based case-control study comprising 210 patients with pathologically proven bladder cancer and 210 age- and gender-matched healthy controls was conducted. The genotypes of 3 common polymorphisms  of the IL-22 -429 TT genotype  and -429 T allele  than the healthy controls. These findings were still significant after a Bonferroni correction. When stratifying according to the stage of bladder cancer, we found that patients with superficial bladder cancer had a significantly lower frequency of the IL-22 -429 TT genotype . When stratifying according to the grade and histological type of bladder cancer, we found no statistical association. The IL-22 +1046 T/A and IL-22 +1995 A/C gene polymorphisms were not associated with the risk of bladder cancer.Patients with bladder cancer had a significantly higher frequency of the IL-22 -429 C/T gene polymorphism is associated with bladder cancer risk. Additional studies are required to confirm this finding.To the authors' knowledge, this is the first report documenting that the  Bladder cancer is the most common cancer of the urinary tract and is the fourth most commonly diagnosed malignancy in men in the United States. It is estimated that 74,000 new cases of bladder cancer are expected to occur in the United States in 2015 IL-10 family or IL-10 superfamily, a class of potent mediators of cellular inflammatory responses IL-22 gene is located on the long arm of chromosome 12, on 12q15, approximately 52 and 99 kbp upstream from the IL-26 and interferon loci, respectively and has the same transcriptional orientation as these two adjoining genes IL-22 gene Interleukin-22 (IL-22) is a member of the IL-22 gene polymorphisms  and the risk of bladder cancer in a Chinese population.However, the role of IL-22 in bladder cancer has not been investigated. The aim of this study was to investigate the association between A prospective hospital-based case-control study of 210 patients with pathologically proven bladder cancer and 210 age- and gender-matched healthy controls was conducted in the Department of Urology of the YongChuan Hospital of ChongQing Medical University. The healthy control subjects were randomly selected when they attended a clinic for a routine examination. All the bladder cancer cases were staged according to the TNM staging system of the Union Internationale Contre le Cancer. Bladder tumors were graded using the World Health Organization (WHO) classification. All the individuals were interviewed by trained nurse-interviewers using a structured questionnaire that asked for information regarding the patients' gender, age, smoking status and occupational and other exposure histories. All parts of the study were approved by the Institutional Ethical Committee of the ChongQing Medical University and informed consent according to the Declaration of Helsinki was obtained from all the participants or their families/surrogates.IL-22 gene were determined with fluorogenic 5' exonuclease assays . The primer and probe sequences for the 5'-exonuclease assays of the IL-22 polymorphisms are listed in 2O and 2 \u00b5l of DNA. The reactions were overlaid with 15 \u00b5l of mineral oil. The cycling parameters were as follows: 10 min at 94\u00b0C for primary denaturation, followed by 40 cycles of 20 s at 92\u00b0C and 1 min at 60\u00b0C. Fluorescence was measured in a Lambda Fluoro 320 Plus plate reader .DNA was extracted from peripheral blood lymphocytes using a commercially available Qiagen kit . The genotypes of 3 common polymorphisms  of the t test, while those between categorical variables were evaluated using Pearson's x2 test. A multivariate logistic regression analysis was used to calculate crude and adjusted odds ratios (OR) and 95% confidence intervals (CI) for the association between each IL-22 polymorphism and bladder cancer risk. Statistical significance was set at a nominal p-value <0.05 for all comparisons. SAS version 9.1  was used for all the statistical tests.The data were presented as the means\u00b1standard deviation (SD) or as percentages for categorical variables. Differences between continuous variables were assessed using Student's p=0.01) was associated with bladder cancer  and -429 T allele  than the healthy control subjects  (IL-22 +1046 T/A and IL-22 +1995 A/C gene polymorphisms were not associated with the risk of bladder cancer (The genotype frequencies were in agreement with the Hardy-Weinberg equilibrium. The patients with bladder cancer had a significantly higher frequency of the subjects . The fin p=0.04) . When st p=0.04) . The IL-r cancer .IL-22 gene and the risk of bladder cancer in a Chinese population. This prospective hospital-based case-control study revealed that the IL-22 -429 C/T gene polymorphism is associated with bladder cancer risk. To the best of our knowledge, this is the first\u00a0report in the literature that evaluated the association between IL-22 gene polymorphisms and the risk of bladder cancer.In this study, we investigated the association between three common polymorphisms  of the NQO1 Pro187Ser; PSCA rs2294008 (C>T); XRCC1 Arg399Gln ; MMP-2 -1306 C/T; MMP-9 -1562 C/T; XPD Lys751Gln; ERCC2 Arg156Arg; Asp312Asn; Lys751Gln; CCND1 G870A (which may modulate the risk of bladder cancer in conjunction with tobacco smoking); XPC A499V (in Caucasian populations); CYP1A1 polymorphisms ; MDM2 SNP309T>G (among Caucasians) There is accumulating evidence that genetics plays a key role in the susceptibility to and clinicopathologic characteristics of bladder cancer. Nine meta-analyses, each of which analyzed between four and twenty-four studies, have provided evidence that the following polymorphisms are associated with increased bladder cancer risk: IL-22 -429 TT genotype and T allele as risk factors for bladder cancer are still unclear. IL-22 may play a role in controlling tumor growth and tumor progression by inhibiting signaling pathways that promote tumor cell proliferation, such as ERK1/2 and AKT phosphorylation IL-22 -429 C/T gene polymorphism has been associated with the risks for various cancers. Genetic polymorphisms and plasma levels of IL-22 contribute to the development of non-small cell lung cancer IL-22 -429 C/T gene polymorphism might be associated with the risk and multifocality of papillary thyroid cancer The mechanisms of action for the Several limitations to this study should be mentioned. First, these results should be interpreted with caution because the study subjects were Chinese; therefore, the study does not permit extrapolation of the results to different ethnic populations. Second, this is a hospital-based case-control study. Therefore, a selection bias could not be avoided and the subjects may not be representative of the general population. Third, the sample size of our study was relatively small and may not have had adequate statistical power in detecting significant differences. Finally, we did not evaluate the relationships of the 3 common polymorphisms  to the plasma levels of IL-22, which may potentially reflect the disease state of patients. Therefore, the association of the IL-22 polymorphisms with plasma levels of IL-22 should be further investigated.IL-22 -429 C/T gene polymorphism is associated with bladder cancer risk. Additional studies are required to confirm this finding.In conclusion, to the authors' knowledge, this is the first report documenting that the"}
+{"text": "IL-22) is a member of the IL-10 family of anti-inflammatory cytokines that mediates epithelial immunity. IL-22 expression was found to be increased in patients with ulcerative colitis (UC). Whether genetic polymorphisms of IL-22 also influence UC risk is still unknown. The purpose of this study was to investigate the association between the IL-22 gene polymorphisms  and the risk of UC in Chinese Han patients.Interleukin-22 (IL-22 gene were determined by fluorogenic 5\u2032 exonuclease assays (TaqMan).This hospital-based case\u2013control study comprised 180 patients with UC and 180 age- and gender-matched controls. Genotypes of 3 common polymorphisms of the IL-22 \u2212429 TT genotype  and \u2212429\u00a0T allele  than controls. The findings are still emphatic by the Bonferroni correction. The IL-22\u2009+1046\u00a0T/A and IL-22\u2009+1995 A/C gene polymorphisms were not associated with a risk of UC. When stratifying by clinical type, location and disease severity of UC, no significant differences were found in any groups.Patients with UC had a significantly higher frequency of IL-22 \u2212429 C/T gene polymorphisms with UC risk. Additional well-designed large studies were required for the validation of our results.This is the first study to provide evidence for an association of http://www.diagnosticpathology.diagnomx.eu/vs/13000_2014_183The virtual slide(s) for this article can be found here:  Ulcerative colitis (UC), as the most common form of inflammatory bowel disease (IBD), is a form of colitis that includes characteristic ulcers, or open sores . UlceratIL-22) is a member of the IL-10 family of anti-inflammatory cytokines that mediates epithelial immunity [IL-22 is synthesized by different cell types including T- and NK-cells, and has been reported to mediate the crosstalk between inflammatory cells and keratinocytes [IL-22 expression was induced in several human inflammatory conditions, including IBD [IL-22 expression was found to be increased in patients with UC [IL-22 gene [Interleukin-22  and the risk of UC in Chinese Han patients.Whether genetic polymorphisms of This hospital-based case\u2013control study comprised 180 patients with UC and 180 age- and gender-matched controls during the years 2009 to 2014. Diagnosis of UC was based on clinical, radiological, endoscopic and histological examinations . To confIL-22 gene were determined by fluorogenic 5\u2032 exonuclease assays (TaqMan). Primer and probe sequences for 5\u2032-exonuclease assays for IL-22 polymorphisms were listed in Table\u00a02O and 2\u00a0\u03bcl DNA. Reactions were overlaid with 15\u00a0\u03bcl of mineral oil. Cycling parameters were: 10\u00a0min at 94\u00b0C for primary denaturation, followed by 40\u00a0cycles of 20\u00a0s at 92\u00b0C and 1\u00a0min at 60\u00b0C. Fluorescence was measured in a lambda Fluoro 320 Plus plate reader .Whole blood (3\u20136\u00a0ml) was obtained by venepuncture using standard EDTA collection tubes. DNA was extracted using the QIAGEN Gentra Puregene blood kit . Genotypes of 3 common polymorphisms of the t-test and presented as mean\u2009\u00b1\u2009standard deviation (SD). Categorical variables are presented as percentages and were compared by chi-squared test. Odds ratio (OR) and 95% confidence intervals (CI) were determined by logistic regression analysis. For a new work, we also use the Bonferroni correction for total number of independent comparisons. The Hardy-Weinberg equilibrium was tested for goodness-of-fit chi-square test with one degree of freedom to compare the observed genotype frequencies among the subjects with the expected genotype frequencies. The P-value less than 0.05 was considered statistically significant.STATA program version 11.0  was used for statistical analyses. Continuous variables were analysed by Demographic and clinical characteristics of study participants were showed in Table\u00a0IL-22 \u2212429 TT genotype  and \u2212429\u00a0T allele  than controls  [IL-20 polymorphisms (rs2981573 and rs2232360) might have an important role in the development of UC (P\u2009=\u20090.017) in the Mexican population [IL-10 \u2212819 CC was a candidate genotype for both IBS (P\u2009=\u20090.047) and UC (P\u2009=\u20090.007) in Japanese [EED) gene might be associated with the susceptibility to UC (P\u2009=\u20090.018) by the change of the EED expression level [PTPN2 polymorphism (rs2542151) was associated with increased UC risk [VDR) polymorphisms were associated with increased UC risk [MIF) gene \u2212173\u00a0G/C polymorphism contributed to the susceptibility of UC [IL-10R polymorphisms were associated with very-early-onset ulcerative colitis (P\u2009=\u20090.0002) [XRCC1 Arg399Gln and APE1 Asp148Glu significantly increased the rate of apoptosis and risk of UC (P\u2009=\u20090.0007) [IL-1 RN and IL-1B polymorphisms were associated with the genetic susceptibility to develop UC and might be associated with the presence of steroid-dependence in UC patients (P\u2009=\u20090.019) [IL-19 polymorphisms (rs2243188 and rs2243193) might have a protective role in the development of UC  in Mexican individuals [Recently, many studies have identified many SNPs associated with UC. A case\u2013control study in 139 and 176 patients with UC and controls found that polymorphisms in ty to UC . A case\u2013=\u20090.002) . A case\u2013Japanese . A case\u2013on level . A meta- UC risk . A meta-ty of UC . A case\u2013\u20090.0002) . A case\u2013=\u20090.019) . A case\u2013ividuals .IL-22 expression was involved in several human inflammatory conditions and autoimmune diseases. A study included 631 HCV patients found that IL-22 polymorphisms were involved in the progression of persistent hepatitis C virus infection [IL-22 receptor alpha-1 gene were associated with severe chronic rhinosinusitis (P\u2009=\u20090.0014) [IL-22 receptor alpha-1 was associated with the development of childhood IgA nephropathy (P\u2009=\u20090.002) [IL-22 deficiency may contribute to the pathogenesis of certain chronic disorders as postulated in this paper for acne inversa [IL-22 might also play important roles in the pathogenesis of chronic obstructive pulmonary disease (P<\u20090.01) [IL-22 and IL-23 in patients with peri-implantitis (P<\u20090.05) [IL-22 was associated with disease activity in Behcet\u2019s disease [IL-22 has been reported to be involved in systemic sclerosis lesions [IL-22 might be involved in the pathogenesis of allergic asthma in human and the level of IL-22 might have some relationship with the severity of the disease (P<\u20090.05) [nfection . A case\u2013\u20090.0014) . A case\u2013 inversa . A studyP<\u20090.01) . A case\u2013P<\u20090.05) . A study disease . IL-22 h lesions . A studyP<\u20090.05) .IL-22 gene polymorphisms  and the risk of UC. Secondly, our investigation was not based on genome wide screening, but UC was induced by multiple genes and environmental factors, which were not explored in the present study. Thirdly, the participants in our research are only from Han Chinese ethnic group. It would be interesting to conduct similar studies in different populations for comparison. Finally, this is a hospital based case control study, so the selection bias cannot be avoidable and the subjects may not be representative of the general population.Our results should be taken with caution for some limitations. First of all, the numbers of subjects included in this study were small, and may not have been sufficient to reveal the associations between the IL-22 \u2212429 C/T gene polymorphisms with UC risk. To the best of our knowledge this is the first study to provide evidence about the role of IL-22 polymorphisms in the development of UC. Additional well-designed large-scale multicenter studies were required for the validation of our results.In conclusion, this study provides evidence for an association of"}
+{"text": "M = 25.03, SD = 7.62). In the first stage of the validation process, statistical procedures in Mplus were used to evaluate the measurement model. Multigroup exploratory structural equation modeling supported the hypothesized 6-factor measurement model for males and females separately and for the combined sample. Analysis of the scale scores using SPSS provided further support for the construct validity of the ITAMS with hypothesized relationships observed between ITAMS scores and measures of depression and affect. The development and validation of the ITAMS opens the way for mood-related research and sport or exercise interventions requiring mood assessments, in an Italian-language context.The current study presents initial validation statistics for the Italian Mood Scale (ITAMS), a culturally- and linguistically-validated Italian version of the Brunel Mood Scale (BRUMS: Terry and Lane,  Researchers have studied affective constructs such as emotion and mood in the context of sport and exercise domains for many decades . A wide range of activities were represented, with the most common being football, track and field, swimming, wrestling, and volleyball.Participants were 950 individuals residing in Italy who regularly engaged in recreational and/or competitive physical activities  to 4 (extremely/moltissimo) rating \u201chow you feel right now/come lei si sente in questo preciso momento\u201d for each mood descriptor. Total scores were computed for each of the six subscales, where higher scores represented stronger endorsement of each mood dimension.The ITAMS is an Italian-language version of the Brunel Mood Scale  was distributed via sport-specific social network groups and to college-aged students at four Italian higher education institutions using internal social networks. A four-phase follow-up procedure was implemented, sending reminder emails on the same networks at 3-week intervals  procedures were used to test model fit. These procedures have been advocated in cases where construct-relevant multidimensionality due to item fallibility or construct overlap makes it difficult to satisfy the independent cluster models restriction that underpins confirmatory factor analysis  and the Tucker-Lewis Index (TLI), both of which require values above 0.90 and 0.95 for acceptable and excellent fit, respectively; and the root mean square error of approximation (RMSEA), which requires values less than 0.05 and 0.08, for close fit and reasonable fit, respectively  and Active (Item 20) being the exceptions, were positively skewed. Mplus offers a solution to this problem that involves treating the items as ordered categorical (polytomous), rather than continuous variables. That option was pursued here.p < 0.001, CFI = 0.98, TLI = 0.97, RMSEA = 0.05 . The standardized factor loadings are shown in Table Model solutions were estimated using diagonal weighted least squares with a mean-and-variance adjusted test statistic, operationalized as the WLSMV estimator in Mplus. The ESEM analyses were conducted using target rotation, which is appropriate when the expected factor structure is known, as in the present study Browne, . Given e\u03c7472 = 509Nervoso in Italian to indicate anger as well as nervousness. Item 13 (Anxious) had a loading above 1.00 on its target factor (Tension), which is a legitimate value when using oblique rotation because the loadings are regression coefficients, not correlations  model maintains equality of thresholds and factor loadings across groups, fixes the scale factor to one and the factor mean to zero in the first group and frees both parameters in the second group. In the second model, thresholds and factor loadings are free across groups, scale factors are one in both groups, and factor means are zero in both groups Muth\u00e9n, . In the Following the successful fitting of the measurement models, the SPSS package was used to compute descriptive statistics and reliabilities for all scales Table . ReliabiThe mean for the NA scale was close to the 16.00 reported by Crawford and Henry  for a sap < 0.01 level, so we considered these findings in terms of small (0.10 to 0.29), medium (0.30 to 0.49), and large (>0.50) effects .Correlations among the ITAMS subscales were as hypothesized. Using the Fisher r-to-z transformation to test for differences between the coefficients obtained here and those obtained by Terry et al. , the onlThe three measures at the bottom of Table The last variable in Table A table of normative data for the ITAMS, based on the present sample, was generated using the recommendations of Thomas and Nelson  and is pWe assessed the validity and internal consistency of the ITAMS by replicating the BRUMS validation process used by Terry et al. , 2003a. The measurement model of the ITAMS was confirmed via a multigroup analysis that confirmed factorial invariance across males and females. Fit statistics were very strong in the male, female, and combined samples. Although small gender differences in factor means were identified, they were not of sufficient magnitude to create model misfit, confirming that males and females conceptualize the mood construct similarly. Despite this conceptual consistency, there were differences in mood responses based on the gender and age of participants. Female athletes reported higher levels of fatigue, tension, depression (on the DASS-21), and lower levels of vigor and positive affect than their male counterparts. These results align with previous work by Terry et al. , 2012 anDespite the demonstrated psychometric strength of the ITAMS, further exploration of its psychometric characteristics is necessary. First, although the ITAMS measurement model was supported, no analysis of its predictive validity was included in our study. Therefore, investigation of the relationship between mood and performance in Italian contexts is warranted to evaluate the predictive validity of the ITAMS. Second, test-retest reliability was not addressed in our study and hence further investigation is required to establish how well the ITAMS performs over multiple assessments. Given this lack of information about the psychometric consistency of the ITAMS over time, it is prudent to caution researchers and applied practitioners about drawing definitive conclusions from multiple assessments using the ITAMS until additional psychometric scrutiny has been completed. Third, due to the wide range of applications for mood scales, further investigation of the psychometric characteristics of the ITAMS among other populations of interest  and in other situational contexts  would be advantageous. Such research efforts can be informative in assessing the need for group-specific tables of normative data or whether the preliminary norms from the present study are equally relevant beyond the world of sport and exercise.The ITAMS has a wide range of potential applications from both research and applied perspectives. From a research perspective, development of the ITAMS provides those researching in an Italian-language context with a mechanism for testing the central tenets of Lane and Terry's  conceptuOther worthwhile lines of research include evaluating the efficacy of the ITAMS as part of medical screening protocols (Galambos et al., From an applied perspective, the multiple uses for mood profiling in elite sport proposed by Terry  are equaAQ, PT, and GF: contributed equally to the development and completion of the manuscript. AQ and PT: co-led the project and the manuscript development. GF: led the statistical analysis and contributed to the manuscript development.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Bile salts have potent detergent properties and damaging effects on cell membranes, leading to liver injury. However, the molecular mechanisms for the protection of hepatocytes against bile salts are not fully understood. In this study, we demonstrated that the cytotoxicity of nine human major bile salts to HepG2 cells and primary human hepatocytes was prevented by phosphatidylcholine (PC). In contrast, cholesterol had no direct cytotoxic effects but suppressed the cytoprotective effects of PC. PC reduced the cell-association of bile salt, which was reversed by cholesterol. Light scattering measurements and gel filtration chromatography revealed that cholesterol within bile salt/PC dispersions decreased mixed micelles but increased vesicles, bile salt simple micelles and monomers. These results suggest that cholesterol attenuates the cytoprotective effects of PC against bile salts by facilitating the formation of bile salt simple micelles and monomers. Therefore, biliary PC and cholesterol may play different roles in the pathogenesis of bile salt-induced liver injury. In humans, sodium cholate (NaC), sodium deoxycholate (NaDC) and sodium chenodeoxycholate (NaCDC) are major unconjugated bile salts and exclusively conjugated with taurine or glycine in the liver1. The proportions of sodium taurocholate (NaTC), sodium glycocholate (NaGC), sodium taurodeoxycholate (NaTDC), sodium glycodeoxycholate (NaGDC), sodium taurochenodeoxycholate (NaTCDC) and sodium glycochenodeoxycholate (NaGCDC) are 13, 25, 6, 15, 14 and 25% of total bile salts in the human gall bladder, respectively2. The bile salt concentration exceeds 5\u2009mM in the lumina of bile canaliculi3. Bile salts monomers self-associate spontaneously to form simple micelles above their critical micelle concentrations (CMC)4. Bile salts have potent detergent properties and deleterious effects upon cell membranes. In bile, the predominant phospholipid is phosphatidylcholine (PC), and cholesterol is unesterified7. Bile salts are associated with phospholipids and cholesterol in mixed micelles or vesicles, which strongly attenuates the toxicity of bile salts on biliary epithelial cells9. Bile salt monomers and simple micelles coexist in dynamic equilibrium with mixed micelles and vesicles, and are responsible for the damaging effects on cell membranes11.The biliary lipids consist of a mixture of bile salts, phospholipids and cholesterol. Bile salts serve multiple physiological functions, including generation of bile flow, cholesterol homeostasis, absorption of lipids and vitamins, and antimicrobial defense13. In the presence of bile salt monomers, ABCB4 mediates the efflux of phospholipids, preferentially PC, into the canalicular lumen15. The ABCG5/ABCG8 heterodimer is the main transporter for the secretion of biliary cholesterol17.ABC transporters expressed on the hepatocyte canalicular membranes are involved in the biliary lipid secretion. ABCB11 participates in most of the bile salt transport from hepatocytes into bile21. The bile salt-induced cell injury is attributed to increased membrane fluidity and permeability after membrane lipid solubilization. The damaging effects of bile salts depend on their degree of hydrophobicity22. Previously, we have shown that the expression of phosphatidylethanolamine N-methyltransferase in LLC-PK1 cells leads to increased resistance against conjugated bile salts, presumably due to the modifications of phospholipid composition and structure in the apical membranes22. Phospholipids, but not cholesterol, provide cytoprotection against bile salt-induced death of Caco-2 cells18. However, the roles of phospholipids and cholesterol in the protection against bile salt toxicity on hepatocytes have not been systematically studied, and the underlying mechanism remains poorly understood. In the present study, using the nine major bile salts in humans, we examined the effects of PC and cholesterol on the bile salt toxicity to hepatocytes and on the cell association of bile salts. To elucidate the molecular mechanisms of protection, we also assessed the formation of vesicles, mixed micelles, simple micelles and monomers in the lipid dispersions containing bile salts, PC and cholesterol by light scattering measurements and gel filtration chromatography.The cytotoxic effects of bile salts have been shown for hepatocytes and enterocytes50) values of bile salts were determined by sigmoidal curve fitting of concentration-response data  values of PC for the inhibition of bile salt cytotoxicity  and organic anion-transporting polypeptide (OATP), transporters for bile salt uptake, are not expressed in HepG2 cellsity Fig.\u00a0. The amoity Fig.\u00a0. On the 11. Mixed micelle formation in the lipid dispersions was estimated by measuring light scattering intensity. Vesicles are large particles causing strong light scattering, whereas micelles are small particles and weakly scatter light. As shown in Fig.\u00a0It has been suggested that the formation of bile salt/PC mixed micelles and vesicles inactivates the membrane lytic action of bile salts, whereas bile salt monomers and simple micelles exert damaging effects on the membrane bilayerUsing gel filtration chromatography, we also determined the distribution of bile salts between vesicles, mixed micelles, simple micelles and monomers. The lipid particles, vesicles and micelles, are separated based on their sizes by gel filtration chromatography. Figure\u00a0\u22128\u2009M28. The simple micelles are small (~3\u2009nm in diameter) and solubilize very small quantities of biliary cholesterol6. For example, NaDC or NaTC micelles solubilize cholesterol at a molar ratio of approximately 1/20 or 1/100, respectively29. At low phospholipid/bile salt ratios (<1/4), phospholipid molecules are intercalated in mixed micelles5. Mixed micelles are quasispherical (4\u20138\u2009nm in diameter)6. The cholesterol solubilizing capacity of mixed micelles  is higher than that of simple bile salt micelles5. Vesicles are spherical structures (40\u2013100\u2009nm in diameter) and poor in bile salts 6. Multilamellar vesicles (>500\u2009nm in diameter) may be derived from fusion of unilamellar vesicles6. Both unilamellar and multilamellar vesicles are seen in human bile6. Some bile salt molecules are intercalated among phospholipid molecules in the bilayer structures and have an influence on the shape of vesicles5. Compared with mixed micelles, vesicles are much more efficient cholesterol carriers requiring only 1 phospholipid molecule to solubilize 1 cholesterol molecule5. Thus, mixed micelles are inefficient cholesterol solubilizers. Biliary cholesterol solubilization is dependent not only on the concentration of cholesterol itself but also on the phospholipid/bile salt ratio. Meanwhile, the dissolution rate of vesicles by various bile salts is dependent on the cholesterol/phospholipid ratio30. Vesicles with a low cholesterol/phospholipid ratio are rapidly dissolved, whereas an increase in the cholesterol/phospholipid ratio makes them more resistant to the solubilizing action of bile salts. Noteworthy, the inclusion of cholesterol in PC vesicles reduces the binding affinity of taurine-conjugated bile salts31. Mello-Vieira et al. have recently demonstrated that the fluorescent-labeled deoxycholic acid partitions with higher affinity to the liquid disordered domains than to the cholesterol-enriched ordered domains on lipid vesicles, and that the unlabeled bile acids have a superficial location upon interaction with the lipid membranes32. In the present study, we prepared lipid dispersions containing bile salts, PC and cholesterol. According to the equilibrium bile salt/PC/cholesterol ternary phase diagram constructed by Wang and Carrey33, bile salt/PC and bile salt/PC/cholesterol (PC/cholesterol\u2009=\u20095/1) lipid dispersions used in our experiments may be located in the one-phase micellar zone or the two-phase zone containing micelles and vesicles, in which there are no cholesterol crystals. By light scattering measurements and gel filtration chromatography, we demonstrated that cholesterol suppressed the formation of mixed micelles but facilitated that of simple micelles and monomers, and that PC and cholesterol were similarly distributed between vesicles and mixed micelles , sphingosine-1-phosphate receptor 2 (S1PR2) and \u03b15\u03b21 integrinsIn conclusion, PC protects hepatocytes from the cytotoxicity of bile salts by decreasing the cell-association of bile salts. In contrast, cholesterol reverses the protective effects of PC against bile salt cytotoxicity, which can be accounted for by increased formation of bile salt simple micelles and monomers. Therefore, biliary PC and cholesterol may differently regulate the progression of liver injury induced by bile salts.Streptomyces sp. was purchased from Asahi Kasei Pharma . Recombinant cholesterol oxidase from Nocardia sp. and peroxidase from horseradish roots was obtained from Oriental Yeast . N-Ethyl-N-(2-hydroxy-3-sulfopropyl)-3,5-dimethoxyaniline sodium salt (DAOS) was purchased from Dojindo Laboratories . All other chemicals used were of the highest reagent grade available.NaC and NaDC were obtained from Wako Pure Chemical Industries . NaTC, NaGC, NaTDC, egg yolk PC, cholesterol and 4-aminoantipyrine were purchased from Nacalai Tesque . NaGDC, NaCDC, NaTCDC and NaGCDC were purchased from Sigma-Aldrich . Glycerophospholipid-specific phospholipase D from 24. The thin films of egg yolk PC and cholesterol obtained by evaporating the lipid chloroform solution were hydrated with phenol red-free Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) containing 0.02% bovine serum albumin (BSA), and were subsequently ultrasonicated  for 1\u2009min on ice. Then, bile salts were added to the lipid dispersions.Egg yolk PC is similar to PC in human bile2) at 37\u2009\u00b0C in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS). HepG2 cells were subcultured in 24-well plates at a density of 4.0\u2009\u00d7\u2009104 cells or in 6-well plates at a density of 1.0\u2009\u00d7\u2009106 cells and incubated for 48\u2009h.HepG2 cells, a human hepatoma cell line, were purchased from Riken BioResource Center . HepG2 cells were grown in a humidified incubator (5% CO5 cells in a humidified incubator (5% CO2) at 37\u2009\u00b0C and incubated for 48\u2009h.The cryopreserved primary human hepatocytes isolated from two Caucasians (82-year-old man and 51-year-old woman) were purchased from KaLy-Cell . KaLy-Cell has the ability by the French Ministry of Research to prepare and store products from human origin for research purposes and to export human samples. The hepatocytes were thawed in KLC-Thawing Medium (KaLy-Cell), washed and resuspended in KLC-Seeding Medium (KaLy-Cell). The hepatocytes were seeded in 48-well plates coated with type I collagen at a density of 1.0\u2009\u00d7\u20091057. %LDH release\u2009=\u2009LDH activity in media/\u2009\u00d7\u2009100%. The plots of LDH release induced by bile salts were fitted to a sigmoidal curve.After incubation for 48\u2009h, HepG2 cells in 24-well plates or primary human hepatocytes in 48-well plates were washed with phenol red-free DMEM containing 0.02% BSA. The cells were incubated for 30\u2009min with phenol red-free DMEM containing 0.02% BSA in the absence or presence of various concentrations of bile salts, PC and cholesterol. The cells were then dissolved in 1% Triton X-100. Cytotoxicity of bile salts was estimated by measuring the LDH activity in the media and total cells using a CytoTox-ONE homogeneous membrane integrity assay kit 2, 1.1\u2009mM CaCl2, 6.1\u2009mM D-glucose and 10\u2009mM HEPES; pH 7.4), dissolved in 1% Triton X-100 and sonicated. The amount of bile salts was measured using an enzymatic assay kit . The protein content was determined using a BCA protein assay kit . The amount of cell-associated bile salts was calculated by subtracting that of endogenous bile salts in HepG2 cells.After incubation for 48\u2009h, HepG2 cells in 6-well plates were washed with phenol red-free DMEM containing 0.02% BSA. The cells were incubated for 30\u2009min with phenol red-free DMEM containing 0.02% BSA and 0.5\u2009mM bile salts in the absence or presence of various concentrations of PC and cholesterol. The cells were chilled on ice, washed twice with cold HEPES buffer  at 37\u2009\u00b0C using excitation and emission wavelengths of 400\u2009nm.Light scattering measurements were performed as previously describedThe lipid dispersions (500\u2009\u00b5l) were loaded on a Superose 6 Increase 10/300\u2009GL column  and eluted at 37\u2009\u00b0C with HEPES buffer  at a rate of 1.5\u2009ml/min using a BioLogic DuoFlow system . Fractions (1.0\u2009ml each) were collected, and the amount of bile salts in each fraction was determined using an enzymatic assay kit . The amounts of PC and cholesterol in each fraction were measured by enzymatic assays.60. The enzymatic measurement of PC was performed using a one-reagent system. Briefly, Reagent C contained 4 units/ml glycerophospholipid-specific phospholipase D, 4 units/ml choline oxidase, 5 units/ml peroxidase, 1\u2009mM 4-aminoantipyrine, 1\u2009mM DAOS, 0.2% Triton X-100, 1.1\u2009mM CaCl2, 50\u2009mM NaCl and 50\u2009mM Tris-HCl (pH 7.4). Sample (10\u2009\u00b5l) was added to 200\u2009\u00b5l of Reagent C, and incubated at 37\u2009\u00b0C for 20\u2009min. Absorption was measured at 595\u2009nm using a microplate reader .The amounts of PC and cholesterol were quantified by enzymatic methods as previously describedThe enzymatic measurement of cholesterol was performed using a one-reagent system. Briefly, Reagent CH contained 1 unit/ml cholesterol oxidase, 2.5 units/ml peroxidase, 1\u2009mM 4-aminoantipyrine, 1\u2009mM DAOS, 0.2% Triton X-100, 50\u2009mM NaCl and 50\u2009mM Tris-HCl (pH 7.4). Sample (10\u2009\u00b5l) was added to 90\u2009\u00b5l of Reagent CH and incubated at room temperature for 30\u2009min. Absorption was measured at 595\u2009nm using a Tecan Infinite M200 microplate reader.t-test. Multiple comparisons were performed using the Bonferroni test following ANOVA. Differences were considered significant at P\u2009<\u20090.05.The statistical significance of differences between mean values was determined using the unpaired Student\u2019s Supplementary Tables"}
+{"text": "In smart parking environments, how to choose suitable parking facilities with various attributes to satisfy certain criteria is an important decision issue. Based on the multiple attributes decision making (MADM) theory, this study proposed a smart parking guidance algorithm by considering three representative decision factors  and various preferences of drivers. In this paper, the expected number of vacant parking spaces is regarded as an important attribute to reflect the difficulty degree of finding available parking spaces, and a queueing theory-based theoretical method was proposed to estimate this expected number for candidate parking facilities with different capacities, arrival rates, and service rates. The effectiveness of the MADM-based parking guidance algorithm was investigated and compared with a blind search-based approach in comprehensive scenarios with various distributions of parking facilities, traffic intensities, and user preferences. Experimental results show that the proposed MADM-based algorithm is effective to choose suitable parking resources to satisfy users\u2019 preferences. Furthermore, it has also been observed that this newly proposed Markov Chain-based availability attribute is more effective to represent the availability of parking spaces than the arrival rate-based availability attribute proposed in existing research. Based on various sensing and communications technologies, it becomes possible to build up so-called smart parking guidance systems to monitor and collect the real time status of parking spaces in controlled areas, and then to direct drivers to available parking resources \u20138. Such By regarding the status of the parking facilities as attributes and drivers\u2019 preferences as weights, the problem to choose the most suitable parking facility can be viewed as a multiple attributes decision making (MADM) problem. Up to now, some MADM-based parking guidance algorithms with various attributes, weighting factors, and objectives have already been proposed and investigated \u201312. BesiIn existing research, the availability of parking resources is often defined as some kind of probabilities of estimated numbers of vacant parking spaces as in , some ocMany methods have already been proposed to predict the availability of parking resources based on queueing models \u201318, neurIn this study, the root cause of why these seemly reasonable availability results as in  and 13]13] are nTo verify the effectiveness of the expected number of vacant parking spaces as an important attribute in MADM-based parking guidance algorithms, this paper proposes a framework to implement such an MADM-based algorithm by considering three typical attributes of candidate parking facilities, including the estimated round-trip walking distance, the parking fee, and the availability degree of vacant parking spaces. By assigning different weights to those attributes, six typical parking preferences  were made for the MADM-based algorithm.c, it is modeled as an M/M/c/c queueing system, and the dynamical change of the number of vacant parking spaces is modeled as a Markov chain. In this way, the transition probability of finding k vacant parking spaces in a future time interval can be calculated in closed form. Then, the expected number of vacant parking spaces is defined as the sum of the products of every possible number of vacant spaces and its corresponding transition probability. This new Markov Chain-based availability definition is different from the arrival rate-based availability definition proposed in [Especially, to predict the expected number of vacant parking spaces, based on queueing theory, for any parking facility with capacity posed in . Based oFor drivers without any information of parking facilities, blind search is an intuitive approach to find available parking spaces by cruising on roads blindly until some vacant parking spaces appear. In this study, an enhanced self-avoiding blind search (SABS) approach was adopted as the baseline parking approach.A simulation platform was built up to investigate the effectiveness of the SABS approach and the MADM-based algorithm in comprehensive scenarios with various distributions of parking facilities, traffic intensities, and user preferences. Their performance was measured and compared in terms of average parking failure rate, average walking distance, average driving distance, and average parking fee.Experimental results show that every preference with the Markov Chain-based availability attribute can always choose the appropriate parking facility to satisfy the emphasized assignment, indicating that the proposed parking guidance framework and the MADM-based algorithm are effective to help drivers with various preferences find proper parking resources. Furthermore, it has also been proved that the Markov Chain-based availability attribute is more effective to represent the availability of parking spaces than the arrival rate-based attribute proposed in .To summarize, the main novel contributions of this paper are:Identify and define the expected number of vacant parking spaces as the core attribute to reflect the difficulty of finding available parking spaces, and proposed a queueing-theory based method to estimate the expected number of vacant spaces;Proposed an MADM-based parking guidance algorithm for choosing one appropriate parking facility among a group of candidates, by considering three representative decision factors and various preferences of drivers.Investigated the effectiveness of the MADM-based algorithm against the baseline SABS algorithm in comprehensive scenarios with various distributions of parking facilities, traffic intensities, and user preferences. Both the Markov Chain-based availability attribute and the arrival rate-based availability attribute were considered for availability-related preferences.The remainder of this paper is structured as follows: the Section on Related Work conducts a brief analysis of existing research on smart parking guidance systems; Section MADM-based Parking Guidance Framework presents the framework to implement such an MADM-based parking guidance system. Then, the MADM-based Parking Guidance Algorithm Section and the Self-avoiding Blind Search Algorithm(SABS) Section present the details of the MADM-based algorithm and the SABS strategy individually. In Section Simulations and Results, simulations for six typical preferences of the MADM-based algorithm were carried out and their effectiveness has been proved and compared with the SABS strategy with regards to the average parking failure rate, the average walking distance, and the average parking cost. The reason why those methods adopted in existing research are not effective to reflect the availability degree of vacant parking spaces is discussed in the Discussion section. Finally, we summarized the work of this paper in the Conclusion section.In smart parking guidance systems, many factors, including the availability of parking spaces, parking price, driving distance to the guided parking facility, walking distance from the guided parking facility to the destination, etc., can be considered in selecting parking facilities , 21, 22.M/G/c/c system, and the blocking probability that all parking spaces are occupied is presented, then the parking lot\u2019s capacity and its blocking probability can be disseminated to help drivers choose parking facilities. In [M/M/m/m model is used to predict the probability pij that the number of vehicles parking on the parking lot is j  at t time units in the future, given that its present state is i. In [pij. In our paper, a parking facility is modeled as an M/M/c/c queueing system, which is identical to the adopted M/M/m/m model in [c, instead of m, and then, the expected number of vacant parking spaces is calculated and used as the availability attribute of the MADM-based algorithm.From the perspective of the methods for estimating the availability of parking spaces, the queueing models and solutions in \u201318 are cties. In , a parkiis i. In  was usedmodel in , 18 exce\u201cthe preferences used in the assignment do not have much effect on the parking failure rate\u201d. This conclusion pronounces the availability attribute adopted in [Based on those predicting methods, estimation results of the availability of parking spaces can be derived and used by parking guidance algorithms. In existing research, the availability of parking resources is often defined as some kind of probabilities of estimated numbers of vacant parking spaces as in , some ocopted in  is not eA second example, in , the higc, it is modeled as an M/M/c/c queueing system, and the dynamical change of the number of vacant parking spaces is modeled as a Markov chain. Then, the expected number of vacant parking spaces is calculated as the sum of the products of every possible number of vacant spaces and its corresponding transition probability. The effectiveness of this newly defined attribute, along with the MADM-based parking guidance algorithm, was investigated and proved via simulations.In our paper, the root cause why those availability definitions in existing research are not effective in MADM-based algorithms is identified, and the expected number of vacant parking spaces is regarded as an important attribute for the proposed MADM-based algorithm. Based on queueing theory, for any parking facility with capacity sensed parking facilities network are equipped with various sensing and communication devices to monitor and disseminate the status of the facilities. Many sensing devices, such as video and image signal processors, microwave radar, ultrasonic sensors, and radio-frequency identification (RFID) readers, can be used to monitor the status of parking spaces. The sensors within the same parking facilities can be connected to a local server, which will relay the status information to remote PRIC and PNDC via wired or wireless communication links. PRIC and PNDC could be a remote cloud server running by public administrators or commercial service providers. In [ders. In , variousParking Resource Information Center (PRIC). Users may access PRIC online to get the distributions and attributes of the parking facilities within given areas.Then, for every parking facility, its attributes, ranging from its GPS location, parking fee rate, the maximum amount of parking facilities, the number of occupied spaces, to the arrival and leaving process of the vehicles, are transferred to the Parking Navigation Decision Center (PNDC) or by using distributed in-vehicle or portable navigation devices. The core difference between the two implementations lies on which entity is responsible for making the navigation decision. For the centralized structure, before arriving the destination, users\u2019 navigation device will send parking requests to PNDC, and the latter will access the information of the parking facilities stored in PRIC and choose suitable spaces for the users according to certain criteria, such as the distance from the destination, parking fee, or the availability of parking spaces. For example, in Furthermore, such information stored in PRIC can also be used to generate real time parking navigation for users in moving vehicles. This can be implemented by using the centralized The smart parking navigation problem can be regarded as how to choose appropriate parking facilities for the drivers according to some criteria, and then guide them from their current location to the chosen park facilities. On condition that the locations of the vehicles and the parking facilities are known, assume the shortest path routing algorithm can be used to guide the drivers from one location to others. So, in this paper, we mainly focus on the problem of choosing appropriate parking facility. In reality, this problem is about how to select some parking resources to satisfy certain criteria among a limited number of candidates with various attributes . This is a typical multiple attributes decision-making (MADM) problem. Ps, the driving destination is Pd, and there are n(> 0) parking facilities, identified as P1, P2, \u2026, and Pn individually, that are available for the user. Such a parking environment can be modeled as a directed or undirected graph, in which current location, the destination, and the parking facilities are nodes, and the roads that directly connect some pairs of nodes are edges. If all paths are open for two-way traffic, the graph is undirected; otherwise, the edges corresponding to those one-way paths are directed. For parking facility Pi(1 \u2264 i \u2264 n), assume its properties can be expressed by such parameters as its GPS coordination , parking fee rate fi, capacity Ci, the number of occupied spaces ni, the arrival rate \u03bbi and the service rate \u03bci.For a user, assume her/his current location is n candidate parking facilities P = {P1, P2, \u2026, Pn}, and for Pi(1 \u2264 i \u2264 n), there are m attributes. The MADM decision matrix D and its normalized matrix aij denotes the jth attribute of Pi, and aij. The normalization of the values is performed according to two situations as follows:aj respectively.Assume there are wj can be used to denote the percentage of importance of the jth attribute. Provided the decision matrix and associated weights are known, define the utility of Pi as:Simple Additive Weighting (SAW) is an effective method to calculate the overall utility of a candidate parking facility, which is determined by the weighted sum of all the attribute values. With given attribute values, there are many ways to determine the weights. Assume drivers may have different preferences about these attributes. To reflect such preference, weight In this paper, three key attributes are taken into account:ai1: estimated round-trip walking distance from Pi to the destination of the driver;ai2: estimated parking fee, = fi \u00d7 (tp + ai1), where tp is the estimated stay time of the driver at the destination. By adding ai1 to tp, we get the total parking time.ai3: estimated availability degree of vacant parking spaces at Pi when the vehicle arrives.ai1 and ai2 should be normalized by ai3 should be normalized by According to the normalization process defined in Eqs  and 2),,2), ai1 Pi, its attributes ai1, ai2, and ai3 can be easily estimated by taking into account its physical distances from Pd, walk speed, the parking fee rate, and the estimated parking duration. However, it is a challenge to estimate the availability of vacant parking spaces in each parking facility. In the following section, a queueing model is proposed for estimating the availability of parking spaces.For each t0 when a user sends request to PNDC or PRIC for parking guidance information, assume PNDC or PRIC can collect the real time status of every parking facility Pi, including the capacity ci, the number of vacant spaces ni, and the number of occupied spaces ci \u2212 ni. Furthermore, assume the arrival and the leaving of vehicles in Pi follow Poisson distributions with parameters \u03bbi and \u03bci respectively, we can model the dynamic behavior of every parking facility Pi as an M/M/c/c queueing problem in Kendall\u2019s notation [M mean the arrival and leaving of vehicles follow Poisson distribution, the first c means the number of parking spaces, and the second c means the capacity of the queue. If there is no vacant space available, assume users are not allowed to stay and circulate in the parking facility to wait for the leaving of parked vehicles.At time notation , where tM/M/c/c queueing model with parameters \u03bbi and \u03bci, providing the state x(t) be the number of vacant stalls in the facility at time t(> 0), and the driving duration from current location to the parking facility is \u03c4(> 0), the problem to estimate available spaces at t + \u03c4 can be expressed as a continuous time discrete state Markov process  is si; at time t + \u03c4, the probability of finding sj vacant spaces is the transition probability psisj. For simplicity, assume the process is time homogeneous, i.e., its transition probability is independent to the start time t, we have psisj = psisj(\u03c4).For the  process : at timeM/M/c/c queueing model [Q is the one-step transition probability matrix that can be expressed as:According to the results of ng model , 18, 24,\u03c0si be the vector of length c + 1 to represent the initial probability distribution of the states at t, in which the value at the kth position is the probability for state k \u2212 1. At time t, since the number of vacant spaces is si, only the si + 1 entry of \u03c0(t) is 1, and all the other entries are 0. The probability distribution of state sj at time t + \u03c4 can be expressed as:Let \u03c0sj(\u03c4), the value in its jth entry represents the probability of finding sj \u2212 1 vacant stalls at time t + \u03c4, and the entry with the maximum probability indicates the most possible number of vacant parking spaces. The value in the first entry is the probability of finding zero vacant parking space, which can be defined as the blocking probability \u03c00(\u03c4). So, the probability of finding at least one vacant parking space isFor the solution of \u03c0sj>0(\u03c4) can be used to describe the availability degree of parking facilities. However, for a group of candidate parking facilities with various capacity, initial status, or \u03c4, this probability can not represent the difficulty degree of finding vacant spaces in each facility, just as what happens in [\u03c0sj(\u03c4) of two parking facilities P1 and P2 with capacity 5 are listed in P1, the expected number of vacant parking spaces is 1.9; but for P2, the expected number is as high as 3.1. Obviously, for current vehicle, it will be more difficult to find a vacant parking space in P1 than in P2. So, in this paper, for parking facility Pi with capacity c and initial status si, the expected number of vacant parking spaces is defined as the availability attribute  to describe the availability degree of vacant parking spaces.Intuitively, ppens in . For exaBased on above analyses, we can estimate the utilities of candidate parking facilities by using blind search-based parking guidance strategy is used as the baseline parking strategy.The effectiveness of this definition adopted here to describe the availability degree of parking resources will be investigated via comprehensive simulations in Section Simulations and Results. For the comparison of the effectiveness of the proposed availability definition, the arrival rate-based availability definition proposed in  is also j is defined as:Tij is the estimated time for a guided vehicle to drive from current location to the target parking facility, MTBAj the mean time between car arrivals of parking facility j, and fj the number of currently vacant parking spaces.In , the degRij is assumed to indicate that \u201cit is more likely to find the free parking facility when a driver arrives at parking facility j since fewer cars are expected to come compared to the number of free parking facilities\u201d. When this definition is used as the availability attribute in the MADM-based parking guidance algorithm, it is normalized by using The lower value of To distinguish the availability definition proposed in  and the blind search strategy has also been considered in this paper. In this strategy, we assume the locations and the status of the parking facilities are not available for the vehicles, thus the drivers who want to park have to circulate blindly in the streets until an available parking space is found.For the comparison of the proposed MADM-based parking guidance algorithm, another In , it is aIn mathematics, many random walk strategies can be adopted by the drivers to find parking facilities. A self-avoiding random walk is a sequence of moves on a lattice that does not visit the same point more than once. It is reported in  that selDifferent from the original self-avoiding random walk strategy in complex networks in  that triSimulations were carried out to evaluate the effectiveness of the proposed MADM-based parking guidance algorithm, as well as the arrival rate-based availability definition proposed in  and the To support the simulation of different parking environments, \u03b1 of parking facilities is defined as the ratio of the number of parking facilities to the number of blocks. For each parking facility, assume there is only one entrance/exit randomly located on the perimeter of the block, the location of which is regarded as that of the parking facility.Assume there is at most one parking facility in one block. The density \u03bc. In [\u03bc\u22121 is 51 minutes. Therefore, in our simulations, 51 minutes is regarded as a standardized time unit to express all time-related parameters, i.e., one time unit in simulation corresponds to 51 minutes in reality. For parking facility Pi with capacity ci and service rate \u03bci, its traffic intensity \u03c1i(= \u03bbi/ci\u03bci) is defined to reflect the degree of occupancy. As the value of \u03c1i increases, the occupancy degree will be higher, and it will be more difficult to find vacant spaces. On condition that the values of \u03c1i, \u03bci, and ci are known, the value of arrival rate \u03bbi(= ci\u03bci\u03c1i) can be figured out, which is used to control the arrival of vehicles that want to park in parking facility Pi. According to the values of \u03bbi and \u03bci, a group of vehicles can be generated for parking facility Pi.For each parking facility, the time duration that vehicles will stay in the parking facility is determined by the service rate \u03bc. In , it is r\u03b2 and 1 \u2212 \u03b2 individually. For those vehicles without navigation devices, they will arrive at their specified parking facilities at given time points. At that moment, if the specified parking facility is full, the vehicle will be rejected immediately. Otherwise, it will be allocated with a vacant space and allowed to stay for a given duration specified by its service time. For those vehicles with navigation devices, assume their destinations are randomly distributed along the streets. The drivers will require parking guidance when they move close to their destination, then such requirements will be processed locally by the navigation devices or be transferred to PNDC to process remotely. No matter how the requirements are processed, target parking facilities will finally be selected for the drivers according to their preferences. When a guided vehicle arrives at a parking facility, if the parking facility is not full, the vehicle will be allocated with a vacant space and allowed to stay for a given time interval specified by its service time. Otherwise, it will be rejected. In such case, the driver will require another parking guidance until he/she finally finds out an available parking space.Among all the vehicles, assume the proportions of vehicles equipped with and without navigation devices are ai1), the parking fee (ai2), and the availability degree of vacant parking spaces (ai3), were taken into account in this paper. By assigning different weights to those attributes, different parking preferences can be made. Similar to the user preferences used in , in thisIn existing navigation software, drivers usually can access some static information of surrounding parking facilities, e.g., locations and parking fee rates. In To evaluate the effectiveness of the base SABS algorithm and the MADM-based parking guidance algorithm with various preferences on guided vehicles, following measures were considered:Average failure rate: when a driver arrives at a full parking facility, he/she will be rejected. This measure is defined as the total number of rejections happened to guided vehicles divided by the total number of guided vehicles.Average driving distance: this measure indicates the average driving distance for guided vehicles to find available parking space from where the drivers firstly send out their parking requirements. It is calculated as the sum of all driving distances of guided vehicles divided by the number of guided vehicles. The less value of this measure also means shorter driving time, less fuel consumption, and less pollution emission in the process of finding available parking spaces.Average walking distance: this metric is used to evaluate how far it is for drivers to walk from their destinations to selected parking facilities. Assume every driver always knows how to find the shortest walk path from the selected parking facilities to his or her destination, and always follows such shortest walk path. The average walking distance is calculated as the sum of round-trip walk distances of all guided drivers divided by the number of them. Usually, drivers prefer shorter walking distance to reduce walking time.Average parking fee: this metric is used to evaluate the average amount of money paid for each parking. For each guided vehicle, its parking fee is calculated as the product of the parking fee rate of the selected parking facility and the duration that the vehicle will stay. The average parking fee is the total amount of parking fee paid by guided drivers divided by the number of them.To investigate the performances of the base SABS algorithm and the MADM-based algorithm with various user preferences and parking scenarios, we have developed an event-driven simulation platform in Matlab to model the attributes and behaviors of the components in the smart parking guidance environment illustrated in \u03c1i), arrival rate (\u03bbi), service rate (\u03bci), and smart vehicle ratio (\u03b2) will also be known. According to such values, vehicles with and without navigation devices will be generated.Before running simulations, we need to initialize the simulation environment by generating concrete parking facilities and vehicles. This is implemented as follows: at first, set the values of the parameters listed in At the beginning stage, assume the parking facilities are not empty, i.e., there are some vehicles that have already been parked in these parking facilities with known service times. For each parking facility, the number of parked vehicles at the beginning of the simulation is set randomly according to its steady state probability. The process to calculate the steady state probability is presented in Section Appendix.After initialization, we can run the simulation by modeling the activities of drivers and vehicles according to the ascending order of their arrival time points. In this process, different strategies and user preferences may be applied for the vehicles to find available parking spaces. The behaviors of each vehicle are recorded for further analysis. When all the vehicles generated have already been processed, the simulator will stop, and we can find out the results of the performance metrics.To investigate the performance of parking strategies in various parking environments statistically, for each set of simulation parameters and preferences, 10 rounds of simulations were carried out and their average results were used to reflect the performance of the strategies in specified parking environment, as illustrated in following subsections. In each round of simulation, the number of vehicles equipped with parking guidance devices was 1500, and the average resulting values of those vehicles were regarded as those of current round of simulation, with a 95% confidence level.Figs When the arrival rate-based attribute is adopted, the results of the three traffic settings are shown in the AR-Low traffic row, the AR-Medium traffic row, and the AR-High traffic row correspondingly;When the Markov Chain-based attribute is adopted, the results of the three traffic settings are correspondingly shown in the MC-Low traffic row, the MC-Medium traffic row, and the MC-High traffic row.Notably, in Figs At first, we will analyze and compare the results of the SABS algorithm and the MADM-based algorithm with the Markov Chain-based availability attribute proposed in this paper. Then, analyze and compare the influence of the Markov Chain-based attribute and the arrival rate-based attribute on the results of the MADM-based algorithm.When the traffic is very low, in most cases, any parking facility can have enough vacant parking spaces for incoming vehicles. For example, in simulations, when the average traffic intensities of the parking facilities are uniformly distributed in 0.1 to 0.7, with the expectation of 0.4, it was found that the average fail rates of the seven categories are almost the same 0%, and their results of other performance metrics, such as average walking distance and average parking fee, are very close to their results when the average traffic intensity is 0.7. So, in When the average traffic intensity of the parking facilities increases, for incoming vehicles, it generally becomes more and more difficult to find available parking spaces. This tendency is clearly shown in For the SABS algorithm, since the drivers always search for available parking facilities blindly, all the parking facilities can be regarded as having equal chances of being chosen by the drivers. For every row of results in For Pref-I where the locations of the parking facilities are known and the walking distance is considered as an important decision factor, on condition that the locations of all the parking facilities and all the vehicles are uniformly distributed in the simulation area, just like SABS, all the parking facilities can also be regarded as having equal chances of being chosen by the drivers. This can explain why, in each row of Besides the locations of the parking facilities considered in Pref-I, when parking fee is further considered in Pref-II, those low-cost parking facilities near the destinations of the drivers will be chosen. This will lead to higher competition of available parking spaces and higher average parking failure rate. So, in all the simulations for no matter low, medium, or high traffic parking environments, Pref-II always shows the highest average parking fail rates.When the weight of parking fee decreases and the availability of vacant parking spaces is considered as in Pref-III, drivers may avoid those low-cost but fully-occupied nearby parking facilities. To some extent, this will relieve the competition of available parking spaces and result in a lower parking failure rate. As shown in Compared with SABS, Pref-I, and Pref-II that do not consider the availability of vacant parking spaces, not only Pref-III, other three preferences  that consider the availability attribute of parking spaces can also produce lower parking failure rate.ai1  is 0.6 and the weights of other two attributes are 0.2, in Pref-IV, the weight of ai2  increases from 0.2 to 0.6, and that of ai1 decreases from 0.6 to 0.2. This is equivalent to encourage drivers to expand their geological scope to find available parking spaces with lower parking fee. In this way, those cheaper parking spaces will be chosen by more drivers and lead to higher parking failure rate. So, in Different from Pref-III in which the weight of Now, turn to Pref-V, whose weight of the availability attribute is 0.6. As can be seen in At last, by assigning the same weight for all the three attributes, Pref-VI emphasizes on these attributes equally. Compared with Pref-V, this is equivalent to dilute the importance of the availability to the other attributes, leading to higher parking failure rate. So, in all simulations, the average parking failure rate results of Pref-VI are always higher than those of Pref-V. On the other hand, compared with SABS and other preferences except for Pref-V, Pref-VI is very effective to relieve the competition of parking resources by weighting all attributes equally. This can explain why in After above analysis of the results of SABS and the six preferences one by one, now let\u2019s investigate the effectiveness of the Markov Chain-based and the arrival rate-based availability attribute in the four availability-aware preferences . Intuitively, compared with SABS, Pref-I, and Pref-II, for the same parking environment, since the availability attribute of parking spaces is considered in the four preferences, the drivers should gain more chances to find vacant parking spaces, and the average parking failure rate results of these four preferences should be lower than those of SABS, Pref-I, and Pref-II. This rule is validated in the rows of MC-Low traffic, MC-Medium traffic, and MC-High traffic in On the other hand, for the four availability-aware preferences, in a given parking environment, as the weight of the availability attribute increases, the drivers are more likely to choose those parking facilities with more available parking spaces, and the average parking failure rate results should decrease. This new rule is also validated in the rows of MC-Low traffic, MC-Medium traffic, and MC-High traffic in However, in the rows of AR-Low traffic, AR-Medium traffic, and AR-High traffic, where the arrival rate-based availability attribute is used for the four preferences, even though they can bring out lower parking failure rate results in some cases, they cannot guarantee to produce lower results in all cases. Take Pref-IV as an example, when the traffic intensity is medium, the result of Pref-IV in the AR-Medium traffic row is 11.23%, which is higher than the result 10.14% of SABS and 10.71% of Pref-I. When the traffic intensity increases to high, the performance of Pref-IV becomes worse: in the AR-High traffic row, the average parking failure rate result of Pref-IV increases to 27.36%, which is higher than the result 25.95% of SABS and 5.93% of Pref-I, and is very close to the result 27.47% of Pref-II, which is the highest result in all simulations.Furthermore, as shown in By comparing the results of the four preferences as above, it can be concluded that: compared with SABS, Pref-I, and Pref-II, when the Markov Chain-based availability attribute proposed in this paper is applied to the four availability-aware preferences for making parking guidance, the drivers will always have higher chances of finding available vacant parking spaces. Furthermore, as the weight of the availability attribute increases, the average parking failure rate will decrease.\u201cthe preferences used in the assignment do not have much effect on the parking failure rate\u201d. This conclusion pronounces the arrival rate-based availability attribute proposed in [Nevertheless, if the arrival rate-based availability attribute is applied, it may not be as effective as expected in many cases. Just as what is concluded by the authors in , it seemposed in  is not eWhen the arrival rate-based availability attribute proposed in  are applBesides aforementioned driver-centric performance metrics, for every parking strategy or preference, the utilization of the parking facilities may also be concerned. For a given parking environment with specified parking facilities and vehicles, the average utilization of the facilities is inversely related to the average parking failure rate of the vehicles: a higher (lower) average parking failure rate means fewer (more) vehicles are accepted to park, leading to a lower (higher) utilization of the parking facility. So, based on above average parking failure rate results of SABS and all the preferences, the relative average utilization of the facilities can be inferred. For example, since Pref-V has the lowest parking failure rate of the vehicles, it will lead to the highest average utilization of the facilities. Generally speaking, for parking preferences considering the availability of vacant parking spaces, their average parking failure rate results are lower, thus leading to higher utilization of the parking facilities.Considering that the arrival-rate based availability attribute is not as effective as the Markov Chain-based one to find available parking spaces, in following sections, when the average walking (driving) distance and the average parking fee are considered, we mainly focus on the results of the preferences with the Markov Chain-based availability attribute.In simulations, the driving distance of a guided vehicle is defined as the length of the route from where the vehicle firstly sends out the parking requirement to the location of the parking facilities where the vehicle is accepted, and the walking distance is defined as the round trip length of the shortest path between the destination of the vehicle and the location of the parking facility where the vehicle is accepted. On condition that the locations of the parking facilities and the destinations of the drivers are known before parking, the drivers are assumed to choose the shortest driving or walking paths.When the Markov Chain-based availability attribute is used, the results of the average driving distance and the average round trip walking distance of SABS and the six preferences are shown in Figs As can be seen in both figures, as the traffic intensity increases from low, medium to high, the average driving or walking distance of the strategies increase, in that as the traffic intensity increases, the parking failure rate of the vehicles increases, and the drivers have to try more times to find available parking facilities, and this will result in longer driving paths. On the other hand, as the traffic intensity increases, those parking facilities close to the destinations tend to be occupied more likely, and the drivers have to choose those farther ones. This will lead to longer average walking distance.For SABS, since the locations of parking facilities are not known for drivers, and they always search for parking facilities blindly and choose the first one they meet, the walking distance between the location of the chosen facility to the destination is out of consideration. As can be seen, SABS\u2019 average driving distance results are much longer than those of the six preferences, where the locations of the parking facilities are known and the shortest paths are always chosen. On the other hand, for SABS, when a driver arrives at his/her target parking facility, the locations of the facility is known, and the driver is assumed to choose the shortest path to walk to his/her destination. So, for SABS, its average walking distance results in w1 in At the opposite extreme, for Pref-I, it is assumed that the locations of parking facilities are known and the weight of the walking distance attribute w1 in  is as hiw1 = 1), Pref-III (w1 = 0.6), Pref-II (w1 = 0.5), Pref-VI (w1 = 1/3), Pref-IV (w1 = 0.2), and Pref-V (w1 = 0.2). In each row of For the six preferences from Pref-I to Pref-VI, in given parking environments, as the weight of the walking distance attribute is considered, their average walking distance results are always shorter than those of SABS. On the other hand, as the weight of the walking distance attribute decreases, their average walking distance results of the six preferences will increase. When the six preferences are sorted in a descending order of the weight of the walking distance attribute, the sorting result is Pref-I  are more effective to reduce parking failure rate. Furthermore, it has been found that, in given parking environments, for every one of these four availability aware-preferences, compared with the arrival rate-based attribute, when the Markov Chain-based attribute is used, the preference will has lower average parking failure rate results, meaning that the Markov Chain-based attribute is more effective to represent the availability of parking spaces than the arrival rate based one proposed in .In , it was j is defined as Tij is the estimated time for driving from current location to the target parking facility, MTBAj the mean time between car arrivals of parking facility j, and fj the number of currently vacant parking spaces. Compared with the queueing model adopted in our paper to represent the dynamical arriving and leaving process of vehicles in parking facilities, the model adopted in [Tij, only the expected number of newly arriving vehicles in this period  is considered. Actually, in this period, currently parked vehicles may also leave, and those parking spaces occupied by those leaving vehicles will be available for incoming vehicles.Why preference VI in  is not aopted in  is less Rij is assumed to indicate that \u201cit is more likely to find the free parking facility when a driver arrives at parking facility j since fewer cars are expected to come compared to the number of free parking facilities\u201d. Unfortunately, for a driver about to arrive at parking facility j after Tij, the absolute number of possibly vacant parking spaces, rather than the ratio of the expected number of newly arriving vehicles to the number of currently vacant parking spaces as defined in Rij, will determine the degree of difficulty to find available parking spaces. For example, assume there are two parking facilities j1 and j2, and currently, their numbers of vacant parking spaces are 5 and 20 individually. Within Tij, assume the numbers of newly arrived vehicles  for them are 2 and 8 individually. Then, according to the definition of Rij, their corresponding degrees of availability are 0.4(= 2/5) and 0.4(= 8/20). Since these two parking facilities have the same degree of availability, according to the definition of Rij, it seems that the driver should have the same failure rate to find one vacant parking space for the vehicle. However, this is far from the fact: the driver surely has more chances to find available parking space in parking facility j2 than in j1, in that the number of possibly vacant spaces in j2 is 12(= 20 \u2212 8), and that of j1 is 3(= 5 \u2212 2).Furthermore, in , the lowIn our paper, we proposed new methods to represent the availability of vacant parking spaces, which can remedy the problems found in the availability definition adopted in : on one This study has introduced an MADM-based smart parking guidance algorithm by considering three representative decision factors and various preferences of drivers in parking environments. The decision factors include the walking distance between a facility and the destination of a driver, estimated parking cost, and the availability degree of vacant parking spaces, and the preferences emphasize on one or more factors by assigning different weights for them.Besides walking distance and parking cost, the availability degree of vacant parking spaces is one determinant factor for choosing parking facilities, especially when the traffic intensity is very high and the probability of finding vacant parking spaces is small. In this study, to quantity the availability degree of vacant parking spaces in a parking facility, the facility is modeled as an M/M/c/c queueing system, and the probability of finding a given number vacant parking spaces in a future time interval is modeled as a Markov chain. In this way, on condition that the capacity of the facility, current number of vacant or occupied parking spaces, the arriving rate, the service rate, and the expected driving duration to the facility are known, the probability of finding any given number of vacant parking spaces in the facility is quantified. On the basis, the availability degree of this facility is defined as the expected number of vacant parking spaces.To evaluate the performance of the proposed parking guidance algorithm, experiments were carried out in simulated parking environments. For the MADM-based algorithm, both the Markov Chain-based availability attribute and the arrival rate-based availability attribute proposed in  were conExperimental results show that every preference with the Markov Chain-based availability attribute can always choose the appropriate parking facility to satisfy the emphasized assignment, indicating that the proposed parking guidance framework and the MADM-based algorithm are effective to help drivers with various preferences find proper parking resources. Furthermore, it has also been observed that the Markov Chain-based attribute is more effective to represent the availability of parking spaces than the arrival rate-based attribute proposed in .So far as the authors know, compared with existing parking guidance algorithms that considered the availability of vacant parking spaces but proved to be not so effective, up to now, the proposed algorithm in this study is the only one that was proved to be effective. The algorithm itself, especially the methods to model and estimate the number of vacant parking spaces in a given time period, can be imported into real parking guidance systems or other parking guidance algorithms.Pi, i = 1, 2, \u2026, n, with capacity ci, arrival rate \u03bbi, and service rate \u03bci, the steady state probability of finding k occupied parking spaces can be obtained as below [For parking facility as below :pk= in Matlab. To handle this problem in simulation, once the value of pk is returned as NaN, another alternative method is used to estimate the number of initially parked vehicles in parking facility Pi. Assume the traffic intensity of Pi is \u03c1i, define \u03c1i1 = max, and \u03c1i2 = max, let the number of initially parked vehicles be fix), where fix is used to round a variable to the nearest integer towards zero, and U is used to generate a random variable uniformly distributed within \u03c1i1 and \u03c1i2.In Formula S1 File(RAR)Click here for additional data file."}
+{"text": "IUCrJ (2019), 6, 447\u2013453] elucidate the structural differences between single metal and intermetallic multiply twinned decahedral nanoparticles on the example of AuCu particles and correlate the catalytic properties with their structure at the atomic level.Control over the chemical composition and atomic ordering in bimetallic nanoparticles has driven the recent rapid progress in electrocatalysis. Liang & Yu [ For example, gold and copper nanoparticles are active catalysts for the electrochemical reduction of carbon dioxide (Hori x1\u2212Cux (x = 0.5) crystallizes with the same face-centered-cubic (f.c.c.) structure of gold or copper, whereas the intermetallic compound AuCu does not exhibit an f.c.c. structure. The chemical composition of the surface is the decisive parameter for a catalyst and ordering transformation in AuCu nanoparticles has been recently reported to have a strong influence on both the activity and selectivity during electrochemical CO2 reduction . The authors compare their experimental findings to previously reported Au and FePt nanoparticles (Li Another shining point of the current work is the visualization of surface segregation at the atomic level by quantitative STEM analysis. The authors could prove a three-atomic layer-thick gold shell in the intermetallic multiply twinned AuCu nanoparticle with the help of aberration correction. The comparison of the simulated and experimental image showed different atomic distribution in the bimetallic nanoparticle. The detailed STEM study of Liang and Yu sheds light on the structural understanding of bimetallic nanoparticle catalysts exhibiting multiply twinned structures. This enables the accurate correlation of the catalytic properties of such nanoparticles with their structure at the atomic level."}
+{"text": "LPL and ND1 genes. Urinary cell-free mtDNA levels were significantly higher in patients with DGF (P\u2009<\u20090.001) and cases of deceased donor transplantation (P\u2009<\u20090.001). The subjects with acute rejection showed higher urinary mtDNA levels than those without abnormalities (P\u2009=\u20090.043). In addition, allograft functions at 9- and 12-month post-transplantation were significantly different between tertile groups of mtDNA independent of the presence of DGF or acute rejection, showing significantly better graft outcome in the lowest tertile group. Urinary cell-free mtDNA levels during the early post-transplant period are significantly associated with DGF, acute rejection in graft biopsy, and short-term post-transplant renal function.Recent studies indicate that urinary mitochondrial DNA (mtDNA) is predictive of ischemic AKI and is related to delayed graft function (DGF) in renal transplantation. Nevertheless, the clinical implications and prognostic value of urinary mtDNA in kidney transplantation remain undetermined. Here, we aimed to evaluate the associations between cell-free mtDNA and clinical parameters, including pathological findings in allograft biopsy and post-transplant renal function. A total of 85 renal transplant recipients were enrolled, and blood and urine samples were collected at a median of 17 days after transplantation. Cell-free nuclear and mtDNA levels were measured by quantitative polymerase chain reaction for  The pathophysiology of IRI includes excessive generation of reactive oxygen species (ROS) and inflammatory responses, resulting in tissue damage and cell death5. During these processes, innate immunity is triggered by the endogenous damage-associated molecular patterns (DAMPs)6, and the activation of toll-like receptor (TLR) and related signaling pathways has been reported in previous studies8.Over the past decades, kidney transplantation has become the treatment of choice for end-stage renal disease, due to improvements in graft outcome. However, there are still significant obstacles preventing further increase in graft survival, such as delayed graft function (DGF) and allograft rejection, which is a major challenge for clinicians. In particular, during the early post-transplant period, the allograft is adversely affected by profound ischemia-reperfusion injury (IRI), which is inevitable but critically affects subsequent graft outcome. IRI is a major risk factor for DGF and is associated with chronic allograft dysfunction and acute rejection (AR)14. Of these mitochondrial DAMPs, cell-free mitochondrial DNA (mtDNA) has been reported to be a predictive biomarker of the progression of acute kidney injury (AKI)16. Transplantation studies have demonstrated that increased extracellular mtDNA is associated with elevated levels of inflammatory cytokines, early organ dysfunction in liver transplantation17, and DGF in kidney transplantation18. These findings suggest that mtDNA could be one of the important DAMPs in organ transplantation. Nevertheless, to date, there is limited research investigating the clinical implications of cell-free mtDNA in kidney transplantation. Moreover, it is uncertain whether the detected mtDNA is merely a consequence of mitochondrial damage from IRI or a causative factor for subsequent graft dysfunction, impacting as DAMP. In the present study, we evaluated the clinical implication of cell-free mtDNA during the early post-transplant period on histological and clinical parameters and examined the association between cell-free mtDNA levels and short-term graft outcome in kidney transplantation.In recent years, mitochondrial DAMPs have received considerable attention as an important mediator of tissue injury in various inflammatory conditions, including trauma, sepsis, cancer, hemodialysis, and transplantation2, and tertile 3 group had a lower eGFR than tertile 1 and 2 groups. Ten patients experienced DGF and those in higher tertiles were more likely to experience DGF. Corticosteroids and tacrolimus were administered as initial immunosuppressive therapy in all subjects. There were no significant differences in sex, age, donor category, and dialysis duration between the groups.Baseline characteristics of the included patients are presented in Table\u00a019. The urinary cell-free mtDNA level was negatively correlated with eGFR and positively correlated with urine NGAL level at the time of sample collection . These findings suggest that urinary mtDNA sensitively reflects the effects of IRI.As shown in Table\u00a0Based on histological findings of the biopsy performed approximately 17 days after transplantation, patients were divided into 4 groups: no abnormalities, AR, acute tubular necrosis (ATN), and other injury. In our study, there were two cases of acute T cell-mediated rejection (Banff category 4) and 6 cases of acute antibody-mediated rejection (Banff category 2). Additionally, 4 cases revealed borderline changes (Banff category 3) in graft biopsy, but were treated with intravenous corticosteroid pulse therapy with strong clinical suspicion of rejection. These 12 patients were classified into the AR group. The other injury group included calcineurin inhibitor toxicity as well as nonspecific pathological findings, such as mesangial hypercellularity. The AR and ATN groups showed lower eGFR levels at baseline than those observed in the other groups Table\u00a0. The AR P\u2009=\u20090.043) and in the other injury, although the latter was not statistically significant, as determined by post-hoc analysis. All other markers, including urinary nDNA, plasma nDNA and mtDNA, and urinary NGAL levels, showed no difference between the groups ; at 12 months, eGFR was 73.9\u2009\u00b1\u200918.5\u2009mL/min/1.73\u2009m2 in tertile 1, 59.8\u2009\u00b1\u200918.1\u2009mL/min/1.73\u2009m2 in tertile 2, and 59.1\u2009\u00b1\u200918.6\u2009mL/min/1.73\u2009m2 in tertile 3. Consistent with this finding, a mixed-effect regression model for eGFR adjusted for sex, age, time after transplantation, baseline graft function, and the presence of acute rejection or DGF showed significant interactions of urinary mtDNA tertiles with time  inflammasome, and the simulator of interferon genes signaling36. MtDNA can directly activate the NLRP337, and the inhibition of mtDNA release suppresses inflammasome formation38, suggesting a positive feedback between mtDNA and NLRP3 inflammasome. Tsuji et al. demonstrated that mtDNA stimulated cytokine production and renal mitochondrial injury via the TLR9 pathway39. Likewise, the association between urinary mtDNA and allograft functions at 9- and 12-month post-transplantation could be explained in part by these mechanisms, although the elucidation of detailed mechanistic pathway requires further investigation. Nevertheless, our results provide insights into the role of urinary cell-free mtDNA in renal allograft outcome.In the present study, cell-free mtDNA was measured approximately 2 weeks after transplantation, a period in which grafts mildly affected by IRI could achieve stable function. Although plasma mtDNA rapidly decreases to baseline with a short half-life40. Accordingly, our findings, along with those of a recent study of urinary mtDNA on DGF18, indicate that urinary mtDNA could be a sensitive indicator for IRI. Second, immunologic injury such as acute rejection also increased the urinary mtDNA level, suggesting that ongoing injury other than IRI can elevate the urinary mtDNA level. Specifically, tubulointerstitial inflammation involved in the process of acute rejection might contribute to the mitochondrial damage. The proximal tubule, which is a major target in ischemic AKI, are very rich in mitochondria required for the generation of ATP27, which supports these findings and our correlations between urinary mtDNA levels and NGAL, a known renal tubular injury marker. However, despite the association with DGF, the urinary mtDNA level in ATN group was not elevated and ATN grades according to the tertiles were not different. Because most of the enrolled subjects underwent early protocol biopsy rather than indicated biopsy, the ATN group included many subclinical patients with good graft function; of all 26 ATN subjects, the majority (62%) had mild ATN. Furthermore, some of the patients may have recovered histologically from post-transplant ATN at the time of biopsy.There are several other considerations about the findings of urinary mtDNA during early post-transplant period. First, deceased donor transplantation, DGF, and even SGF are significantly associated with increased urinary mtDNA release, but not with plasma mtDNA, and more strongly than urinary nDNA. It has been shown that, compared with nDNA, mtDNA is more vulnerable to oxidative stress caused by ROS in IRI due to a lack of repair mechanism and the absence of histone protectionOur results indicated relatively weak correlations between urinary mtDNA and eGFR at baseline. However, mtDNA levels were well correlated with post-transplant renal recovery time. Further, when examined over time, allograft functions at 9 and 12 months post-transplant were significantly different between the tertile groups of mtDNA independent of the presence of DGF or acute rejection, showing significantly better graft outcome in the lowest tertile group. These results revealed the association of mtDNA with short or intermediate-term graft outcome and indicated that mtDNA levels may provide prognostic information. Further, mtDNA can serve as a surrogate markers of mitochondria dysfunction and offer the possibility of its application as a therapeutic target for renal allograft injury. Given that few studies have addressed the impact of mtDNA on graft prognosis beyond the immediate post-transplant period, our study can contribute towards understanding the clinical relevance of cell-free mtDNA.Our study has several limitations. The total number of subjects was small. In particular, a small number of patients with acute rejection was included and analyzed together with borderline changes. It was difficult to evaluate robust graft outcomes such as graft failure due to the small sample size and a short follow-up period. Moreover, our study lacks data on changes in urinary mtDNA levels during the follow-up period. To evaluate the differences in prognosis according to cell-free mtDNA levels, serial measurements would be helpful. Nevertheless, our results clearly showed that urinary cell-free mtDNA level is associated with graft injury early after transplantation and seems to be predictive of subsequent graft function, although further confirmatory studies are warranted.In conclusion, urinary cell-free mtDNA levels during the early post-transplant period are significantly associated with the presence of DGF, acute rejection in graft biopsy, and short-term post-transplant graft function.41. Follow-up information on graft status was collected every 3 months for the first year after transplantation. The recipients\u2019 data including age, sex, laboratory findings, and donor information were collected from electronic medical records. The Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation was used to calculate estimated glomerular filtration rate (eGFR) of the patients42. DGF was defined as needing dialysis within 7 days of transplantation. Slow graft function (SGF) and immediate graft function (IGF) were defined as reductions in serum creatinine of <20% or >20% within the first 24\u2009h post-transplant, respectively43. Additionally, we defined renal recovery time as the period from the time of transplantation until serum creatinine levels reached their nadir and were stable for more than 7 days. All studied transplant recipients and organ donors provided written informed consent prior to participation in the study. No organs or tissues were procured from prisoners, and all of them was obtained from patients who received kidney transplantation at Kyung Hee University Hospital at Gangdong. The study was conducted in accordance with the Declaration of Helsinki, and the sample collection and application for research purpose were approved by the local institutional review board  and were registered with the Clinical Research Information Service (KCT0001010).We enrolled a total of 85 renal transplant recipients who underwent kidney transplantation and had been followed up for >3 months at Kyung Hee University Hospital at Gangdong from January 2012 to February 2015. All except one patient had graft biopsy performed approximately 2\u20133 weeks after transplantation. Blood (n\u2009=\u200978) and urine (n\u2009=\u200985) samples were collected early in the morning of graft biopsy. Patients with missing urine samples or active infection were excluded. Foley catheters were removed on postoperative day 5 according to the center\u2019s protocol. All enrolled subjects were categorized on the basis of urinary mtDNA levels into tertile 1 (4.78\u20136.03 copies/mg Cr), tertile 2 (6.03\u20136.64 copies/mg Cr), and tertile 3 (6.64\u20138.22 copies/mg Cr). Post-transplant renal function according to the tertiles was evaluated during the follow-up period of 12 months. We also examined the association of urinary mtDNA levels with clinical information and pathological findingsg for 30\u2009min and at 2000 g for 20\u2009min, respectively, and plasma and urine supernatant samples were isolated and stored at -80\u2009\u00b0C until cell-free DNA (cfDNA) measurement. Cell-free DNA was extracted from 200\u2009\u00b5L of plasma and 400\u2009\u00b5L of urine supernatant using a QIAamp DNeasy Blood and Tissue kit . Cell-free nuclear and mitochondrial DNA concentrations were measured by quantitative real-time polymerase chain reaction (RT-PCR) targeting the human lipoprotein lipase (LPL) gene and human NADH1 dehydrogenase subunit 1 (ND1) gene, respectively, using a StepOnePlus real-time PCR system . The sequences of the ND1 primers were as follows: forward 5\u2032-ATACCCATGGCCAACCTCCT-3\u2032, reverse 5\u2032-GGGCCTTTGCGTAGTTGTAT-3\u2032; and the sequences of the LPL primers were as follows: forward 5\u2032-CGAGTCGTCTTTCTCCTGATGAT-3\u2032, reverse 5\u2032-TTCTGGATTCCAATGCTTCGA-3\u2032. Standard DNA fragments for ND1 and LPL were synthesized by Integrated DNA Technologies  for absolute quantification. Urinary neutrophil gelatinase-associated lipocalin (NGAL) was measured using a Human Lipocalin-2/NGAL Quantikine ELISA kit , according to the manufacturer\u2019s protocol. Urine creatinine concentration was measured using the Creatinine Parameter Assay kit (R&D Systems) and urinary cell-free nDNA and mtDNA copy numbers and NGAL levels were corrected for measured urine creatinine.Approximately 10\u2009mL of blood samples drawn in heparinized tubes and 50\u2009ml of urine samples were collected from the participants. Each blood and urine sample was centrifuged at 850\u200941. Based on the pathologists\u2019 reports, histological diagnosis was classified into four categories  to determine the association with the cell-free mtDNA level. ATN was diagnosed based on histological findings such as epithelial swelling with lucent cytoplasm, loss of brush border, and epithelial flattening44 and scored according to the extent of lesion 45.All biopsy specimens were examined by experienced renal pathologists blinded to patients\u2019 clinical information. Renal allograft pathological features were described and graded as per the Banff 2013 classification2 test or Fisher-exact for categorical variables, depending on the normality of the distribution. The correlation of cell-free nDNA and mtDNA levels with eGFR or urinary NGAL was assessed using Spearman correlation test. The comparisons according to the early graft function and donor status were carried out using the Mann\u2013Whitney U test and Kruskal\u2013Wallis test. Linear mixed effects modeling was also performed to examine the longitudinal change of graft function with lme4 package (version 1.1\u201320) in R. Differences with P-values less than 0.05 were considered statistically significant.All statistical analyses were performed using the R software . DNA copy numbers were logarithmically transformed before analysis. Comparisons of baseline characteristics across tertiles were made using ANOVA or Kruskal\u2013Wallis test for continuous variables and \u03c7Supplementary Figures and table"}
+{"text": "Achillea millefolium, Solidago Canadensis, and Daucus carota plants from these two sites. Culture- dependent and independent analyses revealed class Gammaproteobacteria predominated in all the plants regardless of the presence of petroleum hydrocarbon, with Pantoea spp. as largely dominant. It was interesting to note a >50% taxonomic overlap (genus level) of 16s rRNA high throughput amplicon sequences with cultivable endophytes. PERMANOVA analysis of TRFLP fragments revealed significant structural differences between endophytic bacterial communities from hydrocarbon-contaminated and non-contaminated soils\u2014however, there was no marked difference in their functional capabilities. Pantoea spp. demonstrated plant beneficial characteristics, such as P solubilization, indole-3-acetic acid production and presence of 1-aminocyclopropane-1-carboxylate deaminase. Our findings reveal that functional capabilities of bacterial isolates being examined were not influenced by the presence of contamination; and that the stem endosphere supports ubiquitous BEs that were consistent throughout plant hosts and sites.Bacterial endophytes (BEs) are non-pathogenic residents of healthy plant tissues that can confer benefits to plants. Many Bacterial endophytes have been shown to contribute to plant growth and health, alleviation of plant stress and to in-planta contaminant-degradation. This study examined the endophytic bacterial communities of plants growing abundantly in a heavily hydrocarbon contaminated site, and compared them to those found in the same species at a non-contaminated. We used culture- dependent and independent methods to characterize the community structure, hydrocarbon degrading capabilities, and plant growth promoting traits of cultivable endophytes isolated from  Plants form associations with a multitude of structurally and functionally diverse beneficial microorganisms that can provide them with selective advantages. Among these beneficial associates are bacterial endophytes (BEs) - non-pathogenic bacteria that reside within the living tissues of plants without conferring them harm. Many BEs have been reported to support growth, improve plant health and alleviate stress  deaminase that decreases ethylene production Glick, . Some BEOil Springs, Ontario, Canada , sits above a naturally occurring near surface oil deposit. Oil has been seeping to the surface and forming gum patches since human recorded history in the area. Hand-dug wells and pumps were established as the 1850's and the pumps still produce oil to this day. During pump services, oil frequently spills onto the nearby soils leading to total petroleum hydrocarbon concentrations in the spill areas from 45,000\u2013300,000 ppm. Despite the known toxicity of petroleum hydrocarbon, several common plant species grow abundantly in these soils.Plants naturally produce alkanes, aromatic hydrocarbons and other compounds that share structural similarities with many organic pollutants; and some of these compounds are intermediates of degradation pathways that are produced during catabolism of organic contaminants. Bacteria that are in intimate association with plants are known to consume plant exudates, and are deemed capable in degrading organic contaminants. Hence, the role of plant bacterial partners in remediating soils contaminated by organic compounds has been well documented  toxicity. We predicted that (1) these plants harbor high numbers of endophytic bacteria that are able to mineralize PHC and (2) these plants harbor high numbers of endophytic bacteria with plant growth promoting capabilities. To this end we compared the endophytic bacterial populations found in herbaceous species thriving at Oil Springs to those found in the same species growing at a control, uncontaminated site.The hydrocarbon contaminated site is a natural oil seep field located at Oilsprings, Ontario . Soils have silty clay loam soil texture, with pH of 6.8\u20137.3, and extractable total P and total N were 21 mg/L and 0.44% dry soil, respectively. The non-hydrocarbon contaminated site is located around 80 km away at Komoka, Ontario , which is an uncontaminated meadow with undetectable levels of PHCs. The soil was silty loam soil, a pH of 7.7 and extractable total P and total N of 5.3 mg/L and 0.20% dry soil, respectively.Achillea millefolium, Solidago canadensis, and Daucus carota , of the same size and maturity, were sampled. These plants were chosen as these were seen growing at both the hydrocarbon and non-hydrocarbon contaminated sites. All plants were immediately placed in Ziploc bags and into a 4\u00b0C cooler box for transport to the lab.Three pumping wells with recurring spillage were randomly chosen as sampling locations across a 650-acre oil field; whereas in non-contaminated site, three random sampling locations were chosen across a 500 m transect line. Three plant species belonging to\u2014MH470404 - MH470471.In each replicate, 15\u201320 g of stem tissues were surface- sterilized using a series of washes . To test the efficacy of sterilization, an aliquot of the last wash was plated onto agar plates and sterilized stem samples were imprinted onto both Reasoner's 2A (R2A) and Tryptic Soy Agar (TSA) media. The sterilized stems were then macerated in a sterilized Waring blender vessel at 2,0000 rpm using sterile 60 ml 50 mM Tris-HCl and heterotrophic bacteria were isolated by plating 100 \u03bcL on R2A and TSA plates. The media plates were incubated at 28\u00b0C for a period of 1\u20134 weeks. Individual bacterial colonies were isolated and grown into pure culture. Lysates were made from pure colonies by boiling 2 loopfuls of 1 \u03bcL sterile disposable loops in 100 \u03bcL sterile distilled water for 7 min. One microliter of lysate was used as template in a PCR reaction using 16SrRNA primers 27F (5\u2032-AGAGTTTGATYMTGGCTCAG-3\u2032) and 1492R . These methods are detailed elsewhere , using primers alkBwf 5\u2032-AAYAC NGCNCAYGARCTNGGVCAYAA-3\u2032 and alkBwr 5\u2032-GCRTGRT GRTCHGARTGNCGYTG-3\u2032 that targets groups belonging to acdS) was assayed following Blaha et al. (All isolates were assessed for production of indole-3-acetic acid (IAA), solubilization of inorganic phosphate and the presence of the 1-aminocyclopropane-1-carboxylate deaminase gene. IAA production by bacterial isolates both in the presence and absence of L-tryptophan (L-TRP) was measured following the method described by Gordon and Weber . The phoa et al. .Total community DNA was extracted from plant macerates using FastDNA SPIN Kits  following manufacturer's instructions with modifications . Community structure and taxonomic diversity were examined using Terminal Restriction Fragment Length Polymorphism (TRFLP) of PCR-amplified 16S rRNA gene fragments. The genomic DNA was initially amplified with universal bacterial primers 27F (5\u2032-AGAGTTTGATYMTGGCTCAG-3\u2032) and 1492R (5\u2032-TACCTTGTTACGACTT-3\u2032) using conditions as above. The resultant amplicons were digested with restriction enzymes PvuII and MscI (NEB Canada) to minimize amplification of chloroplasts and mitochondria  was performed at Molecular Research LP  on an illumina MiSeq following the manufacturer's guidelines. The 16s rRNA gene V4 hypervariable region was amplified using the PCR primers 515/806 with barcode on the forward primer. PCR reactions were prepared using the HotStarTaq Plus Master Mix Kit  under the following conditions: 94\u00b0C for 3 min, followed by 28 cycles of 94\u00b0C for 30 s, 53\u00b0C for 40 s and 72\u00b0C for 1 min, after which a final elongation step at 72\u00b0C for 5 min was performed. 16s sequence data were trimmed, denoised, and chimera depleted with default parameters using Qiime pipeline v.1.8  based on Bray Curtis dissimilarities was used for the ordination of TRFLP dataset. Permutational ANOVA was then carried out using the function Adonis in the vegan package  were used to compare total culturable heterotrophic bacteria and phylotype richness of each plant species, thereafter, a Daucus carota (wild carrot), Achillea millefolium (yarrow) and Solidago canadensis (goldenrod). Community characterizations were done using culture- dependent and independent means. Phenotypic characterization assays were done on the culturable fraction of endophytic bacterial strains.Endophytic bacterial communities were isolated from the stem endosphere of Pantoea and Pseudomonas spp. dominated the culturable flora of the wild carrot plants from both sites. Stenotrophomonas spp. were recovered in yarrow plants from both sites, whereas, both Pseudomonas and Stenotrophomonas were recovered from goldenrods at both sites. Pantoea spp., having been retrieved from all the plants regardless of contamination seemed to be ubiquitous. Phylogenetic structure of the 16s rRNA revealed grouping of cultivable bacterial endophytes regardless of plants host species and contamination . There was also a significant interaction effects of plant species and location .We examined the endophytic community assemblages using nonmetric multidimensional scaling of TRFLP fragments as shown in Figure Solidago- 16 Daucus- 14 Achillea- 24 and 45 (Solidago- 16 Daucus- 15 Achillea- 14) from HC contaminated and non-HC contaminated sites, respectively, were assayed for their hydrocarbon degradation capabilities, production of indole acetic acid, P solubilization, presence of hydrocarbon degrading and ACC deaminase genes.A total of 99 isolates, of which 54 isolates  of culture-independent and cultivable endophytic bacterial community structure. As shown in Figures Pantoea species.Phosphate is an essential plant nutrient with low bioavailability in soil which is unavailable to the plants. It is well known that improved nutrient uptake of plants is mediated by plant-associated microorganisms. In this study case, the majority of the P solubilizing bacteria were Pantoea spp., Pseudomonas spp. and Stenotrophomonas showed evidence of IAA production. Other bacteria are well known for their production of ACC deaminase. This enzyme is highly influential in the plant environment because it hinders the production of ethylene. Under stressful conditions, production of ethylene is induced; this induction then inhibits plant growth. BEs are known to hinder ethylene biosynthesis through the expression of the enzyme ACC (1-aminocyclopropane-1-carboxylate) deaminase encoded by the acds gene that converts the ethylene precursor ACC to \u03b1-ketobutyrate and ammonia \u2014a plant growth hormone, is synthesized by a large number of plant associated bacteria (Long et al., a Glick, . In thisMicrobacterium foliorum 122 and Plantibacter flavus 251, bacterial endophytes that are common among the plants in this study, revealed that there were no known genes for classical toluene and naphthalene metabolism despite the fact that both these strains demonstrated utilization of toluene and naphthalene substrates (Lumactud et al., We expected to find functional differences between the bacterial endophytes isolated from HC and non-HC contaminated sites. However, there was no marked difference on functional capabilities of stem bacterial endophytes isolated from either contaminated or non-contaminated site. Particularly unexpected was virtual absence of known alkane hydroxylase and catechol 2,3-dioxygenase genes in the strain collection. Genomic analyses of In summary we found very few differences in adaptive traits in the endophytes of Oil Springs and the control site Komoka. The stem as a habitat may have protected the bacterial endophytes from the stress that is occurring outside the plants, which is likely one of the reasons why there was no marked difference of functional capabilities between contaminated and non-contaminated sites. The selective pressure for the endophytes is more determined by the plant interior than by the exterior contaminants.RL conceptualized the project, performed field and laboratory work, analyzed data, wrote the manuscript with supervision and editing by RF.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Col10a1 gene. It is involved in the process of endochondral ossification in ray-finned fishes and tetrapods (Osteichthyes), but until now unknown in cartilaginous fishes (Chondrichthyes). We show that holocephalans and elasmobranchs have respectively five and six tandemly duplicated Col10a1 gene copies that display conserved genomic synteny with osteichthyan Col10a1 genes. All Col10a1 genes in the catshark Scyliorhinus canicula are expressed in ameloblasts and/or odontoblasts of teeth and scales, during the stages of extracellular matrix protein secretion and mineralization. Only one duplicate is expressed in the endoskeletal  mineralizing tissues. We also show that the expression of type X collagen is present in teeth of two osteichthyans, the zebrafish Danio rerio and the western clawed frog Xenopus tropicalis, indicating an ancestral jawed vertebrate involvement of type X collagen in odontode formation. Our findings push the origin of Col10a1 gene prior to the divergence of osteichthyans and chondrichthyans, and demonstrate its ancestral association with mineralization of both the odontode skeleton and the endoskeleton.In order to characterize the molecular bases of mineralizing cell evolution, we targeted type X collagen, a nonfibrillar network forming collagen encoded by the  Col10a1 is not limited to cartilage mineralization as it is expressed by osteoblasts in the amphibian Xenopus tropicalis  have lost perichondral bone and all large dermal bones . ChondriScyliorhinus canicula, whale shark Rhincodon typus, thornback ray Raja clavata, little skate Leucoraja erinacea, thorny skate Amblyraja radiata) and holocephalans . We conclude that these type X collagen genes arose from a series of local tandem duplications that occurred prior to the divergence of the holocephalan and elasmobranch lineages, in the time period when the unique hard-tissue repertoire of chondrichthyans evolved. The major expression site of these type X collagen genes in the cartilaginous fishes is in the teeth and scales of the odontode skeleton, whereas only one gene duplicate is also expressed in vertebral mineralizing tissues of the endoskeleton. We further show that a type X collagen expression site is retained in teeth of two osteichthyans, the zebrafish D. rerio and the western clawed frog X. tropicalis. Our results indicate an ancestral shared involvement of Col10a1 genes in the formation of a mineralized odontode skeleton, in addition to its role in endoskeletal mineralization, as early as the last common ancestor of all jawed vertebrates.Here, we report the identification of several type X collagen genes in both clades of cartilaginous fishes, elasmobranchs  to screen transcriptomic data of other chondrichthyan species led to the identification of six similar coding sequences in the catshark S. canicula and thornback ray Ra. clavata, as well as a single Col8a1 and Col8a2 sequence. In the transcriptome of little skate L. erinacea we have identified partial gene transcript sequences LSb2-ctg50203 for Col10a1.1; LSb2-ctg2668069 for Col10a1.2; LSb2-ctg41083 for Col10a1.4; LSb2-ctg68055 for Col10a1.5; LSb2-ctg688724 for Col10a1.6; LSb2-ctg44808 for Col8a1; and LSb2-ctg1616013 for Col8a2.We searched the whole elephant shark genome assembly and identified five Col10a1 copies on two other genomic loci  spreading over 100\u2009kb on the genomic locus NW_018064585.1, to which four of the catshark cDNAs could be aligned in tandem  online. mic loci . TogetheCol10a1 gene (Ensembl ENSG00000123500) is located in the 103\u2009kb long intron 6 of the 5\u2032-nucleotidase domain containing 1 gene . These two genes are located on the opposite strands and a Fyn related Src family tyrosine kinase gene (Frk ENSG00000111816) has the same orientation as Col10a1 but located 40\u2009kb away from the 5\u2032 end of the Nt5dc1 gene  and 20 (col10a1b), the first one located 14\u2009kb upstream of one copy of Frk (fyna ENSDARG00000011370), the latter is located in the intron 6 of nt5dc1 (ENSDARG00000006797) and 20\u2009kb upstream of another copy of Frk (fynrk ENSDARG00000027807).The human genomic locus of the dc1 gene . Conserv genomes . In the Nt5dc1 in the elephant shark C. milii to undergo the Genscan analysis that led to the identification of five consecutive Col10a1 genes . In the whale shark R. typus, strong similarity was detected in several predicted transcripts: LOC109931113; LOC109919892 located 30\u2009kb upstream of a Frk gene (Gene ID: 109919891); LOC109914588 which is a composite predicted transcript including four consecutive Col10a1 sequences, and is located in the intron 6 of Nt5dc1 : exons of all six tandem gene copies of Col10a1 could be identified along a 400\u2009kb long portion of the scaffold 000143F in synteny with Frk and Nt5dc1 genes . The fif Nt5dc1  online. tionship : Col10a1ol10a1.8 .Protein domain predictions showed that the elephant shark and catshark Col10a1 duplicates share typical domain architecture and organization with osteichthyan Col10a1 proteins . MissingCol10a1 gene expression values as Transcripts Per Million (TPM). In lower jaws all six tandem duplicates were expressed, with values above 10 detected for Col10a1.1, Col10a1.2, Col10a1.4, and Col10a1.6 in catshark and ray, as well as for Col10a1.3 in catshark  and mesenchyme (odontoblasts) at the secretory stage of developing tooth buds  of the zebrafish larvae (col10a1b was detected only in teeth at days 4 and 6 (col10a1a and col10a1b in the mesenchyme of the older tooth (with deposited matrix) and the expression of col10a1b in the epithelium of a less developed tooth bud  and epithelium (ameloblasts)  G\u2013I.Col10a1 gene duplicates in holocephalans (elephant shark), and six Col10a1 gene duplicates in elasmobranchs . This is a first reported characterization of the Col10a1 gene orthologues outside of the osteichthyan group, which supports the origin of Col10a1 before the divergence of osteichthyans and chondrichthyans  ameloblasts  with expression in mesenchymal cells of developing teeth and scales in the catshark. Interestingly, patterns in the mesenchymal compartment showed variation\u2014pulp of the tooth and scale for Col10a1.6 versus extensive expression in the root region for Col10a1.3 and Col10a1.4. Nevertheless, these are difficult to interpret, as the dynamics of odontoblasts and adjacent cell type differentiation have not been studied in detail in chondrichthyan fishes. Still, the expression of Col10a1.5 seems to be concentrated to the secretory odontoblasts indicating the involvement in the production of dentin matrix.On the other hand we describe four of the duplicated genes  together with bone matrix proteins . StrikinCol10a1 expression data only in catshark would have suggested that an ancestral type X collagen gene had been recruited to the odontode skeleton in the chondrichthyan lineage. However, a previous study reported Col10a1 expression in zebrafish teeth  and cartilaginous fishes, most probably inherited from the last common ancestor of all jawed vertebrates  was strongly expressed during endoskeletal mineralization in the catshark. Expression was detected in standard chondrocytes going through globular mineralization, in \u201cfibrocyte-like chondrocytes\u201d of the fibrous vertebral body and in \u201costeocyte-like\u201d cells that surround the neural arches. We did not detect expression of Col10a1.4 or any other Col10a1 duplicate in the Meckel\u2019s cartilage, which is not mineralized yet, although the initiation of mineralization is set up at that developmental stage  and did not require further approval by an ethics committee. Embryos were raised in seawater tanks at 18\u2009\u00b0C and euthanized by overdose of MS-222 (Sigma) at selected stages .Embryos of the lesser spotted catshark A section of the abdomen including the vertebral column was dissected into RNAlater from one catshark embryo at stage 32 (3.5-month old). The sample was homogenized in liquid nitrogen and total RNA extracted with RNeasy fibrous tissue Mini kit (Qiagen). Total RNA quality and quantity were determined using Bioanalyzer 2100 and Qubit 3.0. The library was prepared from 360\u2009ng total RNA using the TruSeq stranded mRNA library preparation kit, from which the Poly(A)+ mRNA fraction was isolated using poly-T oligo-attached magnetic beads, then chemically fragmented, and finally reverse transcribed to generate cDNAs that are ligated to adapters. These products were purified and amplified with PCR to generate the indexed final double stranded cDNA library. The quality of the library was evaluated in TapeStation 4200, High Sensitivity assay; the quantity of the library was analyzed by real-time PCR in LightCycler 480 (Roche). Three hundred and sixty nanograms of the cDNA library was sequenced by paired-end sequencing (100\u2009\u00d7\u20092) in Illumina HiSeq 2500 sequencer.Transcriptome sequencing data were deposited into NCBI SRA database under accession number SRR8753342.Sequenced reads of catshark vertebral column as well as publicly available reads of catshark (SRR5179116 and SRR5179117) and thornback ray (SRR5114772) lower jaw transcriptomes  were assCol10a1), Collagen 8a1 (Col8a1), and Collagen 8a2 (Col8a2) sequences for human, mouse, and zebrafish were collected from GenBank. Elephant shark whole genome assembly GCA_000165045.2 Callorhinchus_milii-6.1.3  Transcriptomic Contigs-Build 2 of Skatebase (http://mbb.univ-montp2.fr/MBB//index.php). Nucleotide sequence data reported are available in the Third Party Annotation Section of the DDBJ/ENA/GenBank databases under the accession numbers TPA: BK010855-BK010872. Catshark Col10a1 cDNA sequences were used to search for similar sequences in a whale shark genome (R. typus) using BLASTN (GCA_001642345.2 ASM164234v2 [A. radiata draft genome using BLAST (data accessed with permission from Vertebrate Genome Project https://vgp.github.io/genomeark/Amblyraja_radiata/).Collagen 10a1 (ii-6.1.3  was down Genscan  and Augu Genscan . Predictkatebase  and agai164234v2 ). Thornbhttps://metacpan.org/pod/HmmCleaner.pl). Final alignments used for subsequent phylogenetic reconstruction are available in Predicted CDS and protein sequences for all identified collagen type X and type VIII genes from elephant shark, catshark, little skate, thornback ray, and whale shark together with sequences from osteichthyan species were used for phylogenetic tree reconstruction  online. Col8a1 clade , Fw GAATGGTGCACTTCTGTTGC and Rev CACGATATCCTGCAACACCT for Sc-Col10a1.2 (Sc-Col10A), Fw TGTGGTTGGTAAACCAGGTC and Rev ACCGGGAAAACCTAATGGAC for Sc-Col10a1.3 (Sc-Col10C), Fw TCTGTGACTCTGGTCTATGG and Rev CCAGTTGCTCCTGCCTGTC for Sc-Col10a1.4 (Sc-Col10B), Fw CAACTATGATTCATCAAAAGG and Rev CAATTCAAGACGACACTTGCG for Sc-Col10a1.5 (Sc-Col10D), Fw GGATACAATGCTGCACGTCA and Rev ATAGCCATTTGTGCCTGCAG for Sc-Col10a1.6 (Sc-Col10E), Fw AAGGCCCATCTGGTTTACCT and Rev CTGTTCGGATGGAAGTTGCA for Sc-Col8a1, Fw GCTAGCCTTCATGTAGATGG and Rev CCTTAGGTAGAACATTGCTCA for Sc-Col8a2. Probes were designed on regions that include coding sequences. In order to test for potential cross-hybridization, we aligned the riboprobe sequences and calculated the identity matrix: the maximal values were 0.595 between Col10a1.2 and Col10a1.4, 0.571 between Col10a1.4 and Col10a1.6, and 0.562 between Col10a1.2 and Col10a1.6 . Inserts were amplified using primers present in the vector backbone, and PCR products were used as a template to synthesize antisense DIG riboprobes in a 3\u2009\u00b5l reaction containing 100\u2013200\u2009ng PCR product and using the DIG RNA labeling mix (Roche) and T7 or SP6 RNA polymerase (Promega) following manufacturer\u2019s instructions. DIG-labelled riboprobes were purified on MicroSpin G50 column .Whole embryos from stage 33 were fixed for 48\u2009h in 4% PFA in 1\u00d7 PBS at 4\u2009\u00b0C and then transferred in 100% ethanol at \u221220\u2009\u00b0C for storage. Catshark in situ hybridizations were performed on 14\u2009\u00b5m thick cryosections  and stored at \u221220\u2009\u00b0C. In situ hybridization on sections was performed as described previously  with strcol10a1a Fw CCTGGAGCCAAAGGAGAGTT; Rev TATCGGCAGCAAAGACACCA; and zebrafish col10a1b Fw TTCATCTCCTGGGAAGCCTG; Rev TTCACCTCTGCTACCTGGTG gene sequences. Zebrafish cDNA was synthesized with SuperScript III First-Strand Synthesis Kit (ThermoFisher) and oligo dT primers using RNA isolated from zebrafish embryos at 5\u2009days post fertilization (dpf) as a template. Fragments were PCR amplified and cloned from zebrafish cDNA into TOPO pCR II TOPO vector and antisense RNA probes were synthesized with either SP6 or T7 RNA polymerase and digoxigenin labeling mix (Roche). In situ hybridization on zebrafish whole-mount larvae was done as previously described (Primers were designed for zebrafish escribed . Whole-mX. tropicalis stage NF60 tadpoles were performed using previously reported Col10a1 probe and previously described protocol (In situ hybridization on paraffin sections of protocol .Molecular Biology and Evolution online.msz145_Supplementary_DataClick here for additional data file."}
+{"text": "There is paucity of evidence for the role of health service delivery to the malaria decline in Uganda We developed a methodology to quantify health facility readiness and assessed its role on severe malaria outcomes among lower-level facilities (HCIIIs and HCIIs) in the country. Malaria data was extracted from the Health Management Information System (HMIS). General service and malaria-specific readiness indicators were obtained from the 2013 Uganda service delivery indicator survey. Multiple correspondence analysis (MCA) was used to construct a composite facility readiness score based on multiple factorial axes. Geostatistical models assessed the effect of facility readiness on malaria deaths and severe cases. Malaria readiness was achieved in one-quarter of the facilities. The composite readiness score explained 48% and 46% of the variation in the original indicators compared to 23% and 27%, explained by the first axis alone for HCIIIs and HCIIs, respectively. Mortality rate was 64%  and 68%  lower in the medium and high compared to low readiness groups, respectively. A composite readiness index is more informative and consistent than the one based on the first MCA factorial axis. In Uganda, higher facility readiness is associated with a reduced risk of severe malaria outcomes. Nevertheless, the disease remains a major public health problem and accounts for over 210 million cases and 420,000 deaths annually, affecting mainly the sub-Saharan Africa2.The global malaria burden has declined in the last decade with the incidence of cases and malaria-related deaths reducing by 18% and 48%, respectively during 2000\u201320153. Malaria burden has also reduced in the last few years with malaria incidence declining by over 75% between 2000 and 20153. Although the contribution of control interventions towards malaria decline in Uganda has been investigated4, there is a paucity of evidence for the role health system strengthening has had on this success. This may be attributed mainly to the lack of direct measurements of health systems strengthening5, and partly to the weak routine data collection systems in developing countries6. The rollout of the District Health Information System version 2 (DHIS2) in Uganda has facilitated electronic reporting of routinely collected health facility data and has led to improvements in data quality7.In Uganda, malaria is a major leading cause of hospitalization and death, responsible for 30\u201350% of all health facility outpatient visits, 15\u201320% hospital admissions, and over 20% of hospital deaths8. Service delivery is primarily concerned with immediate outputs of a national health system9. The proxy measure for service delivery is health facility readiness defined in terms of general service and service-specific readiness indicators5 estimated from health facility surveys.Health system strengthening can be measured indirectly using proxies of its six building blocks, that is, governance, health workforce, health financing, health technologies, health information and service delivery10. Service-specific readiness, on the other hand, refers to the capability of health facilities to provide a service of minimum acceptable standards, and is measured by the availability of the following tracer items necessary for the provision of a particular service; trained staff, service delivery guidelines, equipment, diagnostic capacity, medicines and commodities10.General service readiness refers to the overall capacity of health facilities to provide health services and is measured by the availability of tracer items in five domains, namely; basic amenities, basic equipment, standard precautions for infection prevention, diagnostic capacity and essential medicines11. USDI provides a set of metrics for benchmarking service delivery performance in health and education and assesses the quality of basic health services and of services related to primary education. It adopted health facility assessment tools used in service provision assessments designed by the World Health Organization (WHO)12. A high number of health facility readiness indicators, corresponding to tracer items can be generated from these surveys, each measuring a different attribute of readiness but no single indicator is sufficient to summarize all aspects of facility readiness. Therefore, a need arises to develop a single index of readiness that represents the vast array of readiness indicators characterizing health system functioning and its effect on health outcomes.Although measurements of facility readiness is crucial for health planning and decision making, the implementation of nationally representative facility surveys in Uganda has suffered from lack of funds. The most recent survey namely, the Uganda Service Delivery Indicator (USDI) was conducted in 2013 and it was supported by the World Bank14, Ghana15, Haiti16, Tanzania17, Brazil18, Malawi and Nepal19, Kenya, Namibia and Rwanda20 to assess the effects of health facility readiness on health outcomes. In most of these studies the score was developed using Principal Component Analysis (PCA) designed for summarizing continuous variables21, despite the fact that the data collected from the facility assessments surveys are mainly binary in nature. Multiple correspondence analysis (MCA) is the most appropriate technique for this type of categorical data23. A few studies that have employed MCA to construct a facility readiness score used the first factorial axis to represent overall facility readiness25. However, the use of this single-axis score is unlikely to fulfill the Global First Axis Ordering Consistency (FAOC-G) property26 which means that the score monotonically increases/decreases for all indicators. The FAOC-G property ensures that the absence of any readiness indicator from a facility will contribute to a lower readiness score than its presence. Failure of the FAOC-G will result to inconsistent and meaningless readiness score. Asselin (2009)26 proposed a composite index based on more than one MCA axis to remedy the construction of inconsistent poverty scores. To our knowledge, composite MCA scores have not been used in constructing indices measuring health systems-related performance. More so, construction of readiness scores in the above studies did not preselect indicators that were most relevant for the outcome(s) of interest. Variable selection formulated in a geostatistical modeling framework has been shown to identify covariates that explain most variation in the outcome27. It is expected that a readiness score obtained from indicators most relevant for the health outcome would be more informative.Facility readiness scores and categorical indices derived from score quantiles have been developed in assessment surveys conducted in several countries including NigeriaIn this study, we linked the USDI survey of 2013 with data on severe malaria (deaths and severe cases) data reported in the Health Management Information System (HMIS) to assess the effects of facility readiness on severe malaria outcomes. A composite readiness score was created by exploiting more than one factorial axis of the MCA of the most relevant general service and malaria specific readiness indicators identified through geostatistical variable selection. Results from this study provide methodology on constructing facility readiness indices and provide information to the Ministry of Health (MoH) and other stakeholders on the overall readiness of lower level health facilities in Uganda to deliver malaria services, and the role of this effect on the risk of severe malaria outcomes.28. The remaining 5% of the country comprises of unstable and epidemic-prone transmission areas situated in highlands of the south-western, and areas around the mountains Rwenzori in the mid-western region and Elgon in mid-eastern. Plasmodium falciparum is the dominant parasite species and the most dangerous with the highest case-fatality rate. The primary vector is Anopheles gambiae s.l. which breeds in temporary stagnant water, while An. funestus is the second most important vector and breeds mainly in permanent water bodies.Uganda is located in the SSA region and ranks among the top 15 countries that contribute to 90% of the global malaria burden. Malaria transmission is stable and perennial in 95% of the country, but the entire population is at risk29. Hospitals are further classified into district, regional referral, national referral serving district, region and country-level populations. The HCI is the lowest level and first point of contact. It is headed by village health teams (VHT)/community medicine distributors who are largely volunteers, targeting smaller populations of 1000 people.The health system in Uganda is decentralized with the Ministry of Health responsible for policy formulation, quality assurance, resource mobilization, capacity development, technical support, and provision of nationally coordinated services such as epidemic control, coordination of health research and monitoring and evaluation of overall sector performance. Health care services are delivered through a tiered structure of facilities consisting of hospitals and Health Centers (HC) IV, HCIII, HCII and HCI at district, Health Sub-District (HSD), sub-county, parish and village levels, respectivelyData on severe malaria outcomes was extracted from the Health Management Information System (HMIS) for the period January\u2013December 2013. Two severe malaria outcomes were defined, namely, the cumulative number i) of malaria deaths and ii) of severe malaria cases leading to hospitalization during 2013. Both outcomes were considered for the analyses of HCIII data, but only the latter for HCIIs due to the limited scope as diagnosed severe cases are referred to HCIIIs and other higher level facilities.10. In particular, we created (i) general service readiness indicators for the five domains  and (ii) malaria-specific indicators. Readiness indicators were defined as binary variables, taking the value \u20181\u2019 if the tracer item was available at the facility and \u20180\u2019 otherwise. Availability and functionality of items were confirmed through direct observation by the interviewer prior to data recording in the questionnaire. Furthermore, domain readiness indicators for each of the five domains of the general service readiness and for the domain of malaria services were defined as availability of all tracer items that belong to a particular domain. A facility was assigned 1 if all tracer items constituting a domain were found at the facility and 0 otherwise.Data from the USDI survey were used to construct readiness indicators following standard definitionsBayesian geostatistical negative binomial models using stochastic search variable selection were fitted to the severe malaria outcomes to select the most important facility readiness indicators. For each readiness indicator, a Bernoulli variable was introduced with Bernoulli probability corresponding to the inclusion of the indicator in the model (details are provided in the Appendix). Spatial correlation was taken into account by assuming a Gaussian process on health facility locational random effects. The models were fitted separately on severe malaria and malaria mortality for HCIII facilities and on severe malaria for HCII facilities.K readiness indicators, XK, two binary variables were created, k is absent from facility i (i.e. XK = 0) and 0 otherwise. Similarly, k is present in facility i (i.e. XK = 1) and 0 otherwise. A readiness score i, based on the ath factorial axis of MCA was defined by jk indicates the value of XK and the weights ath factorial axis corresponding to a\u2009=\u20091. Following the approach proposed by Asselin (2009), we defined the composite readiness score Fi by L is the number of factorial axes used in the composite score and ath factorial axis and 0 otherwise, that is, k\u2009=\u2009a and XK indicator depends on a discrimination measure calculated for each indicator and axis, measuring the contribution of the indicator to the total variance explained by the axis. To improve interpretation of the score we translated the weights so that the absence category (jk\u2009=\u20090) of the XK indicator received a zero weight and the presence one (jk\u2009=\u20091) received a strictly positive weight representing the gain in the readiness increase measured by the axis a when a facility i acquires the kth tracer. Therefore, the Fi is replaced by MCA was applied to the most important A separate composite score was derived for each health facility level due to differences in mandate and service scope across levels. A readiness index was created from the readiness score as a categorical variable with three levels for both HCIIIs and HCIIs based on the tertiles of the distribution of the composite score.Descriptive statistics, that is, frequencies, proportions and chi-square tests were used to summarize and compare readiness indicators and the index by facility level and other health facility characteristics. Geostatistical Bayesian negative binomial models were fitted separately by facility level to assess the effect of health facility readiness on the severe malaria outcomes. The models were adjusted for facility location , management authority (government/private) and distance to district headquarters.30 and Bayesian models were fitted in OpenBUGS31 using Markov Chain Monte Carlo (MCMC) simulation. Parameters were summarized by their posterior medians and 95% Bayesian Credible intervals (BCIs). Modeling details are provided in the Appendix.Descriptive analysis and MCA were conducted in STATAA total of 250 health facilities participated in the health facility assessment survey but only 207 (82.8%) reported in the HMIS consistent and complete data on severe malaria outcomes during January\u2013December 2013. Six out of the 207 were higher level facilities  and were excluded due to insufficient sample size. The characteristics of the 201 facilities included in the analysis are presented in Table\u00a0General service and malaria specific readiness indicators for HCIIIs and HCIIs are presented in Table\u00a0Results show that basic amenities readiness was achieved in only three HCIII facilities and none in HCII. Access to adequate sanitation and availability of emergency transport were the most and least available tracer items in this domain. Urban-based facilities had a significantly higher basic amenities readiness compared to rural facilities   achieved basic equipment readiness. This readiness was significantly higher in HCIIIs, urban-located, private managed and in Central region facilities but did not differ by the proximity of a facility to district headquarters  and urban facilities .Diagnostic capacity readiness was met in only one-fifth of facilities. This readiness was more than five times higher in HCIIIs compared to HCIIs, two times more in urban than rural facilities. Diagnostics readiness was higher in private-managed facilities and highest in the Northern region but did not differ by the distance to district headquarters  and 30%  lower in the medium and high groups that the low one, respectively. The incidence of severe cases was twice as high among distant HCIIs compared to those near to the district headquarters, however, the distance effect was not important for HCIIIs. Geographical variation in severe malaria cases was higher in HCIIs than in HCIIIs.We repeated the analysis of the relation between facility readiness and severe malaria outcomes using a composite readiness score constructed from all indicators to assess the impact of our approach on the estimated facility readiness effects. Results showed that the composite score constructed from all indicators suggested that the relation between readiness with severe malaria (for HCIIs) and with malaria deaths (for HCIIIs) were not statistically important  property obtaining scores which are likely inconsistent not capable of describing all facets of readiness in the population of interest.Our findings suggest that the composite readiness score constructed from multiple factorial axes explains a higher proportion of the variation in the original data for both HCIIIs and HCIIs and therefore it is more informative than the one derived from the first axis. These findings are in agreement with results reported in economics literature in which the concept of composite score was first developed to evaluate poverty reduction programsMore so, the score based on the subset of indicators identified through variable selection contained more information and had an important effect on the risk of severe outcomes compared to the index created from all indicators. The probable explanation to this finding is that variable selection helps to weed out indicators from the index construction that have little or negligible relation to the health outcome of interest and hence resulting into a meaningful measure. Our study is the first to apply an objective procedure that selects the most important facility readiness indicators and a malaria-related facility readiness index.35.Facility readiness is unevenly distributed across regions in Uganda with the northern regions having the least readiness compared to the central and southern located regions. These regional differences between the north and south may be explained by the recent war in the north that affected the health infrastructure and the availability and access of health services in this region38.Indicators contributing the most weight to the composite index were those with a high coverage. These results are in agreement with findings from other studies39.The readiness indicators that explained most variation in severe malaria outcomes differed between HCIIIs and HCIIs. This could be attributed to the different mandates of facilities at different levels owing to variations in service scope, staffing levels, infrastructure and equipment39.The readiness score had a nearly normal distribution for HCIIIs and a right-skewed distribution for HCIIs. This is an indication of higher heterogeneity in readiness of HCIIs compared to HCIIIs and can be explained by the HCIIs\u2019 limited capacity to provide quality basic healthcare services as a result of low staffing levels, high drug stock-outs, insufficient infrastructure, poor coordination and limited supervision unlike in HCIIIs or higher level facilities29. However, generally malaria-specific readiness was higher in HCIIIs, urban-located privately-managed facilities, and in facilities located nearer district headquarters. This is because HCIIIs receive more Primary Health Care (PHC) funding, have better infrastructure, more qualified personnel and are subject to more supervision from both technical and political teams at district and health sub-district level compared to HCIIs29.Readiness of lower level facilities to provide malaria services was low despite the high availability of the domain-specific tracer items. Absence of microscopy diagnostic testing is the main reason for this shortcoming. The inadequate malaria readiness at the lower level facilities which serve a big proportion of the rural population may explain why the disease remains the leading cause of mortality in the country40. Urban facilities have also higher malaria readiness most likely due to greater access to infrastructure including road network, national power grid and other public services, which eases transportation and delivery of commodities such as drugs, supervision, and improves staff morale boosting retention.The higher malaria readiness in privately managed facilities may be attributed to better medical equipment, well-maintained infrastructure, higher staffing levels, reduced staff absenteeism and higher supervision compared government-managed facilities41. The low sector funding affects negatively the maintenance of infrastructure, causes stock-outs of essential drugs, slows down recruitment and motivation of the health workforce29. Readiness in the basic equipment domain was high most likely due to the durable nature and low cost of the tracer items that constitute this domain compared to other domains whose items may cost higher and require substantial massive capital investment or they are consumables such as drugs that require constant replenishment.Facility readiness was very low for all general service domains with the exception of basic equipment. This can be related to inadequate government health sector funding which stands at 9.6% of the national budget and it is way below the Abuja Declaration target of 15%42. The finding also indicates that the majority of malaria cases reported in the HMIS are confirmed. Availability of glucometers for measuring blood glucose was low especially at HCIIs indicating a major setback in lieu of emerging evidence of a growing non-communicable diseases burden in Uganda43. More so, essential medicines readiness was low despite some medicines such as oral rehydration solution and zinc sulphate drugs were highly available. This result is consistent with MoH reports that highlight drug stock-outs as one of the major constraints to good service delivery in the country44.Availability of malaria RDTs was high despite of the very low diagnostic capacity readiness. This can be attributed to the country\u2019s adoption of the WHO \u2018Test and Treat\u2019 campaign where free RDTs are provided to public and private facilities by MoH with support from Roll Back Malaria (RBM) partnershipReadiness of both HCIIIs and HCIIs was associated with a decline in malaria-related mortality and severe morbidity. These results underscore the significance of health facility performance and health systems strengthening in general on health outcomes.P. falciparum transmission45 where severe malaria manifests mostly in young children with less developed immunity, but becomes less common in older children and adults as acquired immunity gives increasing protection46.A higher number of malaria deaths and severe cases was obtained among children less than 5 years. This is expected in countries with a stable and intense 42. This proportion is likely to be even higher among adults since treatment seeking is higher among children compared to adults, therefore a large proportion of severe malaria illnesses and deaths occur in people\u2019s homes without coming to the attention of a formal health service2. Our findings are generalizable only for lower level facilities in Uganda namely, HCIIIs and HCIIs, and not for HCIVs and hospitals which serve as referral centers for lower facilities. Furthermore, our estimates for general service and malaria-specific readiness indicators may be overestimated since data on the availability of training guidelines and manuals was not collected in the survey.A limitation of the study is that health facility records underestimate morbidity and mortality in developing countries because most people who fall sick don\u2019t seek health care and a number of them die at home. Results from the 2014-15 malaria indicator survey reported only 80% of children less than 5 years old who had a fever sought care and treatment from a formal health facilityThe composite readiness score created by exploiting more than one MCA factorial axis produces a more informative  and consistent health facility readiness measure that is capable of capturing all aspects of readiness unlike the index based on only the first axis. Higher facility readiness is associated with a reduced risk of severe malaria outcomes in the lower level facilities in Uganda. However, facility readiness to provide malaria treatment services is low. The biggest obstacle hindering lower level health facility readiness is the severe absence of basic amenities and stock-out of essential medicines. If the health facility readiness remains as it is now, the decline of severe malaria burden may be reversed, which will compromise the achievement of the goals of the Health Sector Strategic and Investment Plan development plan (HSSP) of 2015/16\u20132019/2020. The government should address lower level facility readiness gaps by increasing health sector funding to the levels recommended by Abuja declaration in order to achieve and sustain a substantial reduction in severe malaria burden in the country.Appendix"}
+{"text": "The isolated strains, identified by means of specific molecular tools , belonged to 45 different species. Several thermophilic species belonging to genera Thermoascus and Thermomyces were detected, which could be key during composting. Moreover, the presence of several potentially harmful fungal species, such as Aspergillus fumigatus, A. terreus, and Scedosporium apiospermum, were found during the whole process, including the final product. Results highlighted the importance of surveying the mycobiota involved in the composting process in order to: (i) find solutions to improve efficiency and (ii) reduce health risks.Composting is a complex process in which various micro-organisms, mainly fungi and bacteria, are involved. The process depends on a large number of factors  among which microbial populations play a fundamental role. The high temperatures that occur during the composting process indicate the presence of thermotolerant and thermophilic micro-organisms that are key for the optimization of the process. However, the same micro-organisms can be harmful  for workers that handle large quantities of material in the plant, and for end users, for example, in the indoor environment . Accurate knowledge of thermotolerant and thermophilic organisms present during the composting stages is required to find key organisms to improve the process and estimate potential health risks. The objective of the present work was to study thermotolerant and thermophilic mycobiota at different time points of compost maturation. Fungi were isolated at four temperatures  from compost samples collected at five different steps during a 21-day compost-maturation period in an active composting plant in Liguria . The samples were subsequently plated on three different media. Our results showed a high presence of fungi with an order of magnitude ranging from 1 \u00d7 10 Composting represents one of the most efficient methods for sustainable waste management. As already highlighted by other authors, this methodology depends on many factors, the most important being the nature, composition, sizing, and quality of the substrate ,2, envirIn the last few decades, some authors studied the microbial components of compost, mainly focusing on the bacterial components ,9,10,11,With the advent of new high-throughput sequencing technologies, nonculture-based approaches were applied to characterize microbial communities, giving a wider picture on them than classical culture-based approaches ,13,14,15In the last decade, studies investigated the fungal communities in compost, confirming that fungi are a significant part of the microbial community, in particular during the maturation phase ,21,22,23This work contributes to the knowledge of thermotolerant and thermophilic fungal communities in compost. We characterized the fungal community of compost samples taken during the ripening of the product at five different stages in a composting plant in northwestern Italy. After isolation of the strains in pure culture, they were identified at the species level using the latest taxonomic insights.w:w) by the anaerobic digestate , and green and brown waste from municipal green planting and pruning. This new mixture is composted in chambers measuring 4 m \u00d7 8 m \u00d7 2 m. Ripening time is, on average, 21 days after which the product is ready to leave the plant.Samples were collected from a compost-production plant in Liguria . The plant produces biogas through anaerobic digestion in a batch system from the organic fraction of urban solid waste (OFMSW) collected from a municipality in the area. After the anaerobic-digestion phase, a new mixture is made composed of 1:1  was analyzed, and samples were collected after 1, 7, 14, and 21 days of maturation . Given the size of the chambers, each sample consisted of 10 randomly taken composite samples of the biopile and biodigestate at various stages of maturation. Fungi were isolated by a modified plate dilution method . Each soPenicillium, calmodulin for Aspergillus, elongation factor 1-alpha, and LSU for others) according to Samson et al. [2, 1.25 \u03bcL NH 10\u00d7 PCR buffer taq, 0.98 \u03bcL 1 mM dNTPs, 0.63 \u03bcL DMSO, 0.25 \u03bcL 10 \u00b5M of each primer, 0.05 BioTaq 5 U/\u00b5L) and 1 \u03bcL of DNA template. The PCR program was: 5 min 95 \u00b0C, 30\u201335 \u00d7 , 5 min 72 \u00b0C, 10 \u00b0C for \u221e. Amplicons were bidirectionally sequenced, assembled and compared using BLAST  against sequences present in the sequence database of the National Center of Biotechnology Information  (GenBank) and sequences present in the internal database of the Westerdijk Institute.A preliminary sorting of the isolated strains was carried out on the basis of phenotypic characters. DNA barcoding of the isolated strains was carried out by amplification of the internal-transcribed-spacer (ITS) region using primer pair V9G and LS266 . Later, n et al. . In shorFungal-biodiversity level (H\u2019) was calculated for each sample with Shannon\u2019s biodiversity index ,29,30. R4 CFU g\u22121 to 3 \u00d7 105 CFU g\u22121 during a maturation period of 21 days.The heat map in Scedosporium apiospermum, Thermomyces dupontii  and Thermomyces lanuginosus. Strains of Aspergillus chevalieri, A. terreus, and Talaromyces trachyspermus were isolated in 4 of the 5 samples. They were followed by six species that were isolated in three of the five samples: Aspergillus fumigatus, Geotrichum sp., Malbranchea cinnamomea, Rasamsonia emersonii , Scedosporium aurantiacum, and Scopulariopsis brevicaulis.The isolated strains belonged to 25 genera and were identified as 45 different species. The obtained sequences were deposited in GenBank with the following accession numbers: MT316336-MT616380, MT312848-MT312857, MT420412-MT420424, and MT433447-MT433470. The heat map in Aspergillus fumigatus, A. terreus, and Scedosporium spp (in particular S. apiospermum) were found in high concentrations.Composting is a complex process based on the biodegradation of organic matter in which fungi play a key role during the ripening phase. Our data, collected in an active plant, confirmed the presence of thermotolerant and thermophilic fungi. During the maturation period, the number of CFUs increased, biodiversity rose, while mycobiota evolved from unequal distribution among species at the beginning of maturation to fairer distribution between species at maturity. Despite this evolution, we confirmed that the mycobiota were rather stable from a qualitative point of view. However, several potentially pathogenic species emerged in all phases of the cycle, and, for this reason, the periodic monitoring of the concentrations of certain species during the production cycle is necessary. For example, in our case, the opportunistic pathogenic fungal species Analyzing our data, we observed an increase in the number of CFUs during the maturation period up to 10 times in the final product compared to the digestate and the mixed product sampled after one day of maturation see . The higThermomyces, Scedosporium, and Aspergillus, while the mature sample (21D) was clearly more homogeneous. This was further confirmed by the diversity indices shown in With regard to the specific composition of the sampled populations, about 25% of the isolated strains were shared in at least 3 of the 5 samples, thus present in at least 60% of the process . The JacThermomyces dupontii was, until 2014, known under its old name, Talaromyces thermophilus [Rasamsonia emersonii and Mycothermus thermophilus, previously known as Talaromyces emersonii and Scytalidium thermophilum, respectively. The isolates were primarily identified using ITS sequencing. However, this locus lacks resolution at the species level for some genera detected in the compost, such as Aspergillus, Penicillium, Scedosporium, Scopulariopsis, and Talaromyces. In order to obtain reliable species identifications, additional genes  were generated to confirm the presence of key species in the composting process. Because information is often linked to a species, correct identification is important from a biotechnological and medical point of view. Accurately identified isolates in this study could have added value for metagenome studies where only partial ITS sequences are often used.Results concerning the isolated fungi are consistent with previously published data on compost samples ,18,19,21mophilus . Other iThermomyces dupontii , Thermomyces lanuginosus, and Thermoascus aurantiacus that degrade the woody components in the compost. However, opportunistic pathogenic species were also found in the samples. The most recurrent genus was Scedosporium. In particular, Scedosporium apiospermum was found in all samples, including the mature compost. Five other species, S. aurantiacum, S. brevicaulis, S. dehoogii, S. minutisporum, and S. prolificans, were found in decreasing numbers. Moreover, a strong presence of Aspergillus fumigatus was detected in the mature samples. The high temperatures, therefore, shaped the mycobiota during compost maturation. Only some specialized species can survive and proliferate in these particularly hostile conditions. Our results agreed with those of L\u00f3pez Gonz\u00e1lez et al. [We isolated several thermophilic fungi capable of producing enzymes such as amylase, xylanase, phytase, and chitinase, among which were z et al. . In factThis is one of few studies that analyzed mycobiota during compost-maturation phases, and is currently the only one in which species were accurately identified using ITS sequencing supplemented with secondary barcodes. Our results confirmed high biodiversity of the fungal component that tends to stabilize during the compost-maturation process. Results showed a high presence of thermophilic and thermotolerant species that, if properly managed, could improve the composting process. However, a significant presence of species potentially harmful to the health of workers and end users should also be noted."}
+{"text": "The role of the lateral size-reduction in the x- and y-directions in improving LED performance is separately identified through experimental and modeling investigations. The narrowed dimension in the x-direction is found to cause and dominate the alleviated current crowding phenomenon, while the size-reduction in the y-direction has a minor influence on that. The size-reduction in the y-orientation induces an increased ratio of perimeter-to-area in miniaturized LED devices, which leads to improved thermal dissipation and light extraction through the sidewalls. The grown and fabricated LED devices with varied dimensions further support this explanation. Then the effect of size-reduction on the LED performance is summarized. Moreover, three-micro-walls LED architecture is proposed and demonstrated to further promote light extraction and reduce the generation of the Joule heat. The findings in this work provide instructive guidelines and insights on device miniaturization, especially for micro-LED devices.The recent technological trends toward miniaturization in lighting and display devices are accelerating the requirement for high-performance and small-scale GaN-based light-emitting diodes (LEDs). In this work, the effect of mesa size-reduction in the InGaN/GaN LEDs is systematically investigated in two lateral dimensions ( Owing to advantages in reliability, long lifetime, vivid colors, and energy efficiency, InGaN/GaN multiple quantum well (MQW) light-emitting diodes (LEDs) are regarded as a promising candidate to replace conventional lighting devices and have been extensively applied in various areas, such as automotive, backlight sources, display screens, electronic equipment, communicating applications, and general lighting . In ordeDespite extensive reports on the effect of size-reduction in the GaN-based LEDs, no conclusive remarks can be drawn. Therefore, a systematical study with complementary theoretical simulation and experimental investigation is strongly required to resolve the discrepancy and uncover the underlying physics. Furthermore, most of the previous works focus on studying the influence of the total size or shape of the lateral mesa on the LED performance without analyzing the individual influence of size-reduction in one certain dimension. Thus, in this work, the size-reduction effect on the performance of InGaN/GaN LEDs is systematically analyzed with both experimental and numerical investigations. The influence of the size-reduction of the lateral mesa in two directions on the performance of the LED chip is separately identified. Then the effect of size-reduction on the GaN-based LEDs is concluded, which offers instructive guidelines in device miniaturization. Finally, a three-micro-walls LED architecture is proposed and demonstrated with the aim of improving the light extraction efficiency and reducing the thermal heat generated.18\u00a0cm\u22123, in which SiH4 was adopted as the dopant source. Then, eight pairs of In0.15Ga0.85N/GaN MQWs with 3-nm thick QW and 12-nm thick QB were grown. In addition, a 20-nm thick p-doped Al0.15Ga0.85N electron blocking layer (EBL) was grown to suppress the excess electron overflow into the p-GaN region. Then a 200-nm thick Mg-doped GaN with a doping concentration of 3 \u00d7 1017\u00a0cm\u22123 was grown as the hole source layer. The p-type conductivity of the EBL and the hole source layer was realized by Mg doping where Cp2Mg was used as the Mg precursor. Subsequent to the epitaxial growth, the LED wafers were fabricated into flip-chip LED devices using standard fabrication processes. The mesa area was shaped using reactive ion etching (RIE) for LED devices of different sizes. Ni/Ag (5\u00a0nm/5\u00a0nm) metal layers were deposited as the current spreading layer using e-beam evaporation, and Ti/Au  metal layers were deposited as p- and n-electrode contact. A schematic diagram of the device structure is shown in The InGaN/GaN MQW LEDs studied in this work were grown on c-plane patterned sapphire substrates by metal-organic chemical vapor deposition (MOCVD) system. The sapphire substrate used is the two-inch patterned-sapphire substrate that has periodic cone patterns with a diameter of 2.4\u00a0\u03bcm, a height of 1.5 \u03bcm, and a pitch of 3\u00a0\u03bcm. The epitaxial growth was initiated on a 30-nm thick low-temperature GaN nucleation layer followed by a 4\u00a0\u00b5m unintentionally doped n-type GaN (u-GaN) layer. Subsequently, a 2-\u03bcm thick Si-doped GaN layer was grown with a doping concentration of 5 \u00d7 106/s and 40% of the polarization charges were assumed such that 60% of the theoretical polarization charges were released because of the crystal strain relaxation by generating dislocations. The other parameters used in the simulation can be found elsewhere  simulator, which self-consistently solves the Schr\u00f6dinger equation, continuity equation, and Poisson equation with proper boundary conditions. In the simulations, the Auger recombination coefficient was set to 1 \u00d7 1,042\u2009mlsewhere .x- and y-directions. In order to identify the individual influence on the LED performance, the effect of size-reduction in these two lateral orientations is separately investigated with the x-direction as the beginning. As we can see from the equivalent circuit shown in Ii is current corresponding to each path where i = 1, 2, \u2026, k\u22121, and k, in which k is infinity, xi denotes its corresponding length, V is the bias voltage applied to the LED, R1 denotes the resistance along the vertical direction from the p-contact layer to the active region, L is the mesa size in the x-direction, W is the lateral length from the edge of n-contact to the edge of the p-GaN layer, and R0 is the resistance per unit length of the n-GaN layer in the lateral direction along x. Then the average current for all current paths is obtained, as shown below:x-direction, which means the current becomes more uniform in the lateral direction and thus the current crowding effect is alleviated. As the p-GaN layer is entirely covered by the p-contact metal, the reduction of the mesa size in the y-direction has a minor contribution in alleviating the current crowding effect. Therefore, the alleviated current crowding as a consequence of the narrowing in the mesa size mainly originates from the uniform current spreading in the lateral x-direction. It is worth noting that if the finger shape or other types of electrode pattern is adopted in the p-contact metal layer, the electrode distribution along the lateral directions (both x- and y-directions) will further affect the current spreading performance. In that case, the current spreading is subjected to the coupling effect of size-reduction in the x-direction and electrode patterns  vs. voltage (V) as shown in In order to further support the above conclusion that the size-reduction in the 2, which demonstrates that the electron concentration in EBL and the p-GaN region is reduced when the mesa dimension decreases from 180 to 45\u00a0\u03bcm. The reduction of the electron concentration in the p-doped region indicates the effective suppression of the electron leakage. These results suggest that with a narrowed mesa dimension in the x-direction, the current crowding phenomenon is alleviated and the electrons will spread more homogeneously.Moreover, owing to the improved current spreading, the electron overflow into the p-GaN layer is suppressed. The simulated electron concentration near the p-GaN layer is depicted in x-orientation leads to alleviated current crowding thus improved performance is obtained, while the reduction in the y-direction makes a minor contribution to the current spreading performance. However, the diminished dimension in the y-direction increases the ratio of perimeter-to-area. The increased ratio of perimeter-to-area in the smaller LEDs leads to improved heat dissipation and reduced self-heating, hence the temperature in the LED device is decreased  for InGaN/GaN LEDs as following:C(x) is the alleviated current crowding effect  is the improvement achieved by the increased perimeter-to-area ratio, including improved thermal dissipation and light extraction  is the reduced self-heating and improved heat distribution  is the enhancement owing to the strain relaxation  is the possible negative effect due to the increased nonradiative recombination , which has a refractive index of 1.47. For the proposed LEDs with three-micro-walls geometry, the wall spacing is designed to be varied as 11, 22, and 33\u00a0\u03bcm, and the corresponding fabricated LED devices are presented in In order to further improve the light extraction in the smaller InGaN/GaN LEDs, we design a three-micro-walls LED architecture by incorporating three micro-LEDs into a device. The schematic diagram of the proposed LED structure is shown in 2 in the gap. Meanwhile, the proposed architecture with the wall spacing of 33\u00a0\u03bcm has the best performance because more light escapes from the sidewall with a larger gap between the micro-walls. More importantly, there is less thermal heat generation for the LED device with wider wall spacing due to the reduced series resistance when current horizontally passes the n-GaN layer. Jheat) generated in the LED can be expressed as:R1 is the total resistance from top contact layer to active region in the vertical direction, R0 denotes the resistance of n-GaN layer, I is current, p denotes the resistivity of n-GaN layer, l is the lateral distance from n-electrode to mesa edge, and S is the cross-sectional area of the n-GaN layer perpendicular to the direction of l. According to R0 increases due to the enlarged area S. Hence, the total heat generation in the LED device is reduced, which contributes to improved LED performance. It is worth noting that with a larger gap, the thermal heat dissipation is improved accordingly. Thus, the proposed LED architecture has superior performance due to improved light extraction, less thermal heat generation, and better heat dissipation.As the three-micro-walls LED device is three times the size of the single-wall LED, the optical power of the former is divided by three for comparison. The experimentally measured optical output power of the devices is shown in x- and y-directions is identified separately. The physical mechanism of performance enhancement by mesa size-reduction is revealed by using a model of current paths, which suggests that the current crowding effect is alleviated when the lateral mesa size is narrowed in the x-direction. The calculated results indicate that the LED devices with narrowed dimensions in the x-direction have reduced electron leakage and a better current-voltage characteristic under the same current density, which is attributed to the effectively improved current spreading. Backed by the experiments, the decrease of the mesa size in the y-direction is found to improve the LED performance, which is owing to a higher ratio of perimeter-to-area, better thermal dissipation, and improved light extraction. Then the effect of size-reduction on the LED performance is concluded. Finally, a new LED architecture with three-micro-walls is proposed and demonstrated. The proposed three-micro-walls LEDs are observed to have improved optical performance compared to the controlled group and with the increase of wall spacing, the improvement becomes conspicuous, which is owing to the increased light extraction and less Joule heat generation resulting from the reduced series resistance when current horizontally passes the n-GaN layer.The InGaN/GaN LEDs with different mesa dimensions are investigated both experimentally and numerically to explore the size-reduction effect on the LED performance. The individual role of the size-reduction in the lateral The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding authors.All authors have made a substantial, direct, and intellectual contribution to the work and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Checkpoint blockade immunotherapy has had a significant impact on the survival of a subset of patients with advanced cancers. It has been particularly effective in immunogenic cancer types that present large numbers of somatic mutations in their genomes. To date, all conventional immunotherapies have failed to produce significant clinical benefits for patients diagnosed with pancreatic cancer, probably due to its poor immunogenic properties, including low numbers of neoantigens and highly immune-suppressive microenvironments.Herein, we discuss advances that have recently been made in cancer immunotherapy and the potential of this field to deliver effective treatment options for pancreatic cancer patients. Preclinical investigations, combining different types of therapies, highlight possibilities to enhance anti-tumor immunity and to generate meaningful clinical responses in pancreatic cancer patients. Results from completed and ongoing (pre)clinical trials are discussed. Pancreatic ductal adenocarcinoma (PDAC) is the most common form of pancreatic cancer and the seventh leading cause of cancer deaths in developed countries, with forecasts indicating a further escalation of mortality rates in the coming decade , 2. The The recent breakthrough of cancer immunotherapy has had a huge impact on the outcome of patients affected by therapy-recalcitrant cancer types such as advanced melanoma and non-small cell lung cancer (NSCLC) \u201312. TargImmunotherapy, however, may still hold potential to be used in a tailored manner for PDAC patients. Novel omics-technologies are providing more profound insights into the tumorigenic and immunologic mechanisms at play in PDAC and, as such, may support rationale-based approaches , 26. In PDAC combines a unique set of (intrinsic/extrinsic) features that makes it particularly challenging to tackle with immunotherapeutic approaches. In Fig. KRAS gene are ubiquitous as they are present in over 90% of PDACs, while\u00a0also inactivation of the TP53 gene occurs frequently. Tumor suppressor genes such as SMAD4 and CDKN2A are also often mutated, albeit at lower frequencies [BRCA1- and BRCA2-deficient tumors could also be susceptible to checkpoint blockade immunotherapy due to the widespread propagation of DNA damage in these tumors [BRCA genes have also been described in PDAC patients, but whether they confer sensitivity to checkpoint blockade immunotherapy remains to be demonstrated [A number of studies has focused on dissecting the various components that underlie the complex biology of PDAC. Firstly, comprehensive genomic analyses have mapped the mutational and transcriptional landscape of PDACs. Activating mutations in the quencies , 30. Furquencies . Tumors quencies . Mismatcquencies , 33. DNAquencies . Of notee tumors , 35. Hernstrated . Beyond nstrated . Other wnstrated , 39.In recent years, the comprehensive characterization of immune cell populations that infiltrate tumor microenvironments has been essential to understand cancer immunity as well as to devise new immunotherapeutic strategies. Cytotoxic T cells play a central role in cancer immunity and immunotherapy. Their accumulation in tumor tissues is generally associated with a better patient prognosis and a better response to checkpoint blockade immunotherapies , 40, 41.Lastly, the large stromal compartment in PDAC consists of both cellular and non-cellular components that play pivotal roles in malignant cell growth and, possibly, in hampering drug delivery and immune cell infiltration , 66. CroIn summary, the development of immunotherapies that are efficient for PDAC patients should account for the idiosyncrasies of this disease and consider aspects from cancer genetics, immune cell composition and the role that the stromal compartment plays in this disease., see Table To date, targeting CTLA-4 and the PD-1/PD-L1 axis with immune checkpoint blockers (ICB) has, with the exception of patients diagnosed with mismatch repair-deficient tumors, failed to make an impact in PDAC clinical data, radiotherapy causes damage to both cancer cells and stromal cells and can trigger conversion of the tumor microenvironment from a \u201ccold\u201d to a \u201chot\u201d immunological state \u201391. In sCancer vaccines have successfully been introduced as therapeutic measures for prostate cancer, cervical cancer and premalignant vulvar intraepithelial neoplasia \u201398. In PThe most extensively clinically tested cancer vaccine in PDAC is GVAX, a heterologous whole-cell vaccine composed of two irradiated allogeneic PDAC cell lines modified to secrete GM-CSF . The ratAntigen-targeted vaccination employs another strategy aimed at stimulating an immune response specifically directed against one or multiple cancer antigens. Neoantigens are considered to be truly tumor-specific, as they arise from somatic mutations in cancer cells . SeveralKRAS, TP53, SMAD4 and CDKN2A, with KRAS mutations occurring in over 90% of PDAC patients, thereby constituting an attractive target for neoantigen-based vaccines [KRAS mutant protein with a single- or poly-peptide vaccine in combination with GM-CSF has been shown to induce antigen-specific T cell responses in a phase I/II clinical trial, but it remained unclear whether those T cells actually recognized and killed tumor cells [KRAS peptide vaccine with poly-ICLC adjuvant in combination with nivolumab and ipilimumab after adjuvant standard of care treatment (NCT04117087).Antigens derived from mutations in driver genes are optimal targets for therapeutic vaccination. Mutations at driver genes are more likely to be clonal and they are often shared between patients, albeit that the number of mutations targeting driver genes is generally much lower\u00a0than those targeting passenger genes in any given tumor . Common vaccines . Targetior cells . Long-teor cells . BuildinOther clinical trials with peptide-based vaccines using tumor-associated antigens have yielded mixed results. Tumor-associated antigens are not derived from mutations, but can be highly expressed in PDAC cells. A peptide cocktail vaccine, OCV-C01, containing peptides from the vascular endothelial growth factor receptor (VEGFR) 1 and VEGFR 2 proteins, both associated with neovascularization, and a kinesin-family protein (KIF20A)-derived peptide, combined with chemotherapy was tested in an adjuvant setting. This peptide cocktail vaccine showed no benefit in 1-year survival, overall survival or progression-free survival rates, but did improve disease-free survival in per-protocol analysis and led to the generation of antigen-specific cytotoxic T-cell responses in PDAC patients , 119. HuIn conclusion, PDAC cancer vaccination strategies have shown mixed clinical results. Although most cancer vaccines tested induced vaccine-specific T cell responses, it remains to be determined how often the targeted antigens are actually being presented by tumor cells, particularly in the context of the generation of cytotoxic T cell responses. If those antigens are indeed presented, vaccination approaches could be important complements to immune checkpoint blockade therapies.et al, performed a phase I clinical trial and treated six PDAC patients with HF10. After treatment three patients were stable, one was in regression and two showed disease progression [In recent years, there has been a renewed interest in oncolytic viral (OV) therapy as an anti-cancer treatment modality. This approach makes use of replication-competent viruses, which replicate within the host, and preferentially target and lyse tumor cells, thereby potentially inducing robust and long lasting immunity . Moreovegression . A more gression . Other ogression \u2013134. To gression \u2013138. DesAdoptive T cell therapy (ACT) involves the administration of autologous immune cells that can be enriched for tumor specificity, to cancer patients . To achi+ malignancies, including one PDAC patient, using anti-CEA CAR T cell therapy provoked significant respiratory toxicities, resulting in premature closure of the study [Chimeric antigen receptor (CAR) T cell therapy is an adoptive T cell strategy that makes use of T cells genetically engineered to express chimeric antigen receptors (CARs). CARs are composed of an extracellular, antigen-binding domain  and an intracellular TCR-signaling domain. Compared to T-cell receptor therapy, CAR T cells are not HLA-restricted and can potentially be engineered to recognize any target expressed on the surface of tumor cells . In B cehe study . On the he study . Local ahe study . To augmhe study . Intereshe study , 154. A During the process of T cell priming, the presence of CD40 ligand (CD154), expressed by helper T cells, is essential for competent activation of dendritic cells and subsequent antigen presentation and provision of co-stimulatory signals to cytotoxic T cells . CD40 agAn avenue worth pursuing to improve the success of immunotherapy in PDAC patients is the breaking down of the stromal desmoplastic barrier and the targeting of cancer-associated fibroblasts. High desmoplasia with low vascular perfusion potentially impedes the delivery of drugs as well as immune cell infiltration. Furthermore, it contributes to a hypoxic environment which, in turn, promotes the accumulation of immunosuppressive cells and aggressive features of tumor cells . SeveralFocal adhesion kinase (FAK), a non-receptor protein tyrosine kinase, is a mechano-sensor that is crucial for crosstalk between different components of the extracellular matrix and is expressed by almost all tissues and cell types , 161. InTGFB1, TGFB2 and TGFB3, represents a family of cytokines\u00a0that are ubiquitously expressed during tumorigenesis and have pleiotropic effects [Transforming growth factor \u03b2, with its different isoforms,  effects , 165. In effects . A precl effects . Subsequ effects . A phase effects .Connective tissue growth factor (CTGF/CCN2) is a member of the CCN family of proteins and is involved in extracellular matrix production, desmoplasia, tumor cell proliferation, adhesion, migration, angiogenesis and metastasis . CTGF isHyaluronic acid (HA) is another potential target within the pancreatic cancer stroma. Hyaluronic acid is a hydrophilic glycosaminoglycan whose production leads to increased interstitial tumor pressure, thereby limiting the access of potentially effective circulating anticancer drugs via reduced tumor perfusion . In a reImmunotherapy for advanced PDAC desperately needs a breakthrough. To maximize success rates of immunotherapy in an\u00a0era of personalized medicine, molecular and immune profiling should be the starting points of treatment selection. Recent classifications of PDAC on the basis of molecular subtypes related to immunogenicity could aid in immunotherapeutic treatment selection, although its clinical implementation still needs to be validated . EmerginIn short, the successful use of immunotherapy in PDAC patients remains an uphill battle. The research field should make optimal use of system-wide approaches integrating the different idiosyncrasies of the PDAC tumor microenvironment. Once immunotherapy is apt for PDAC patients, we believe that combinatorial treatment strategies will herald a new spark of light at the end of a long tunnel."}
+{"text": "A Local Authority v JB [2021] UKSC 52 brought these problems to the fore, as the Supreme Court was at last confronted with the differences between the definition and use of the term \u2018capacity\u2019 by the civil and criminal law on sexual capacity. We suggest that the decision made by the Supreme Court in JB has left open terrain which ought to be used to reframe, or perhaps even replace, the concept of \u2018capacity\u2019 within the criminal law on sexual capacity.1The term \u2018capacity\u2019 has come to assume a variety of meanings in the law of England and Wales, and the failure of statutes and judges to specify its meaning and application across the civil and criminal law leads to problems. Nowhere is this perhaps clearer than in the law relating to sexual capacity. This paper begins with an overview of two streams of law on sexual capacity in the civil and criminal law. The first stream traces through the criminal law provisions of the  The first is legal capacity, i.e., classification as an actor before the law.A Local Authority v JB [2021] UKSC 52 (\u2018JB\u2019), in which the problem of the misaligned development of the criminal and civil law was brought to the fore. We suggest that the Supreme Court has provided the opportunity, in effect, to start again, and we set out some modest proposals for how we might do so. We focus on the criminal field, not least because we suggest that the problem is both more acute and less recognised.3Perhaps illustrating that (as so often) Lewis Carroll was making a serious point, the failure of statutes and judges to follow Humpty Dumpty\u2019s approach in choosing what they want the word \u2018capacity\u2019 to mean leads to problems. Nowhere is this perhaps clearer than in the context of sexual capacity in England & Wales. Two (apparently) overlapping statutes and streams of case law address different aspects of the question of whether valid consent to sexual activity can be or has been given. Both use the word \u2018capacity.\u2019 And neither is using it to mean the same thing. In this article, we trace how the criminal law and the civil law have conceptualised the concept of sexual capacity, and how the statutory formulation of those concepts have fared before the courts. Looking back at how these conceptions were developed and applied, and the different policy concerns that have been in play, gives us an opportunity to clarify the conceptual positions, to tease out whether the policy concerns are justified, and also to ask whether and how the law could move forward. We then turn to an analysis of the Supreme Court decision in the case of We make two preliminary points. The first is as to the scope of our discussion, which is primarily addressed to the position involving sexual activity between two people, one, or both, of whom may have impaired decision-making capacity. A person with impaired decision-making capacity could be either the initiator of such activity or (for want of a better word), the recipient of such activity; in reality, it might well be that for many purposes, most of the time, it is irrelevant which. One of the problems (it might be thought) with how the law has evolved, in both the civil, but in particular the criminal, sphere, is that it starts to be necessary to look closely at what role the person is playing, and through the rear view mirror of the criminal law to decide which one is the perpetrator and which is the victim. Such an approach, and such language, may be necessary, but it does not mean either that the language always feels right, or (perhaps more pertinently) that the underlying position feels right.4The second is that, whilst our focus is on England & Wales, we suggest that the issues that we discuss are of broader relevance. This is particularly so given the intense focus on the concepts of legal and mental capacity in consequence of the requirement contained in Article 12(2) of the UN Convention on the Rights of Persons with Disabilities (\u2018UNCRPD\u2019) for States to recognise the right of disabled people to enjoy legal capacity on an equal basis with others.25 By the early 20th century, the legislature had become involved, deeming an entire class of individuals \u2013 those (in effect) with severe learning disabilities - simply legally incapable of giving consent to any sexual activity, such that any sexual activity with such a person was an offence.6Questions of whether and how the law should treat the legal ability of those with cognitive impairments to give consent to sexual activity troubled the criminal courts erratically from the middle of the 19th century. The meaning of \u201cconsent\u201d in the sexual context was not, as a general rule, the focus of statute; rather it was left to the common law. As vividly described by Ralph must be a matter for personal choice by the individual, so that if he or she is incapable of making the decision, no-one may make it for them. The common law test of capacity to consent to sexual intercourse in general follows the usual form, that the person concerned must be capable of understanding what is proposed and its implications and exercising choice.7] should not be included in any criminal test. As the Law Commission noted at paragraph 4.60:he criminal law is concerned with whether or not a valid consent has been given. If A, who is unable to retain much information, decides to consent, on the basis of so much of the relevant information as he or she is capable of remembering, why should A be deemed incapable to make that decision if, when making it, he or she understood (for example) with whom sexual intercourse would take place, and wanted this to occur? In the substitute decision-making structure designed for the civil law, there are good reasons why, in the interests of that person\u2019s financial, property, domestic and other affairs, he or she should have the benefit of a substitute decision-maker\u2019s assistance. In the criminal law, however, rather than being of benefit to A, by providing a substitute decision-maker, the effect of such a requirement may be harmful to A, by denying him or her the autonomy to give consent to something about which he or she may properly be recognised as having sufficient information and understanding to make a choice 11[t]The Law Commission identified that the structure and language of the definition that it had proposed in the civil sphere did not easily translate into the criminal sphere and could be simplified to reflect \u201cthat a person should be regarded as being unable to make a decision on whether to consent to an act if (a) he or she is unable to understand (i) the nature and reasonably foreseeable consequences of the act, and (ii) the implications of the act and its reasonably foreseeable consequences; or (b) being able so to understand, he or she is nonetheless unable to make such a decision.\u201d For these purposes, \u201c\u2018mental disability\u2019 should mean a disability or disorder of the mind or brain, whether permanent or temporary, which results in an impairment or disturbance of mental functioning.\u201d  as well as the right to choose to engage in sexual activity (a positive aspect). The difficulty is that a person\u2019s mental disability may render them unable to refuse that attention as effectively as those without such disability. In cases such as those with severe learning disabilities, this risk is likely to continue throughout their lifetime. This vulnerability may be a result of:(a)an inability to remove themselves from the risk;(b)an inability to conceptualise or verbalise the abuse;(c)lack of sex education, without which they may not have sufficient knowledge or understanding about sex and sexual relationships to make an informed choice; or(d)low self-esteem, which results in a lack of belief that they have the right to refuse sex or a particular sexual partner.4.70 If this negative aspect of sexual autonomy is to have any real meaning for those to whom these factors are material, the criminal law needs to provide protection for them. The positive aspect of sexual autonomy  may be met by specific provision in the substantive criminal law [\u2026].Further, the Law Commission returned to the dilemma of how to secure the autonomy of those with \u201cmental disabilities\u201d to engage in sexual activity in non-exploitative relationships, identified in its 1991 work, but not further addressed in its work leading towards the draft Mental Incapacity Bill. The Law Commission identified that:provision in the substantive criminal law of exemptions which recognise that, in certain circumstances, no offence would be committed despite a lack of capacity to consent. Such exemption might relate to apparently consensual sexual activity that takes place between two people, each with want of capacity, in non-exploitative circumstances; or where only one party to such activity lacks capacity, and this occurs in non-exploitative circumstances\u201d  Home Office Review of sex offence, offences  .\u201dThe How these provisions have been interpreted by the courts is dealt with in section four, below. Before we get there, however, and to remain true to the chronology, we need to note the parallel statutory developments in the shape of the passage of the 312 Many other areas of the law retain their own tests for deciding whether the person has the requisite mental capacity to take a step with legal effect, examples including making a will (Banks [1870]),13 entering into a contract (Boughton [1873]), or making a gift (Re Beaney [1978]).The 14 Indeed, with one exception, the Who Decides? Making Decisions on behalf of Mentally Incapacitated Adults\u201d (1997) noted but did not expressly address the Law Commission recommendations  consent to marriage; (b) consent to have sexual relations [\u2026].\u201d Clause 26 was not expressly considered by the Joint Committee convened to conduct pre-legislative scrutiny on the draft Bill, and the provisions of clause 26 then made their way (in slightly modified form) into s.27, which provides in material part as follows:(1)Nothing in this Act permits a decision on any of the following matters to be made on behalf of a person\u2014(a)consenting to marriage or a civil partnership,(b)consenting to have sexual relations,[\u2026]The  adults\u201d , provideRe M (An Adult)  [2015] Fam 61 considered that s.27 made plain that \u201cwhere a court finds that a person lacks capacity to consent to sexual relations, then the court does not have any jurisdiction to give consents on that person\u2019s behalf to any specific sexual encounter ; an observation endorsed by Lord Stephens in JB. In similar vein, and at first instance, Hayden J observed in London Borough of Tower Hamlets v NB [2019] COPLR 398 at paragraph 34 that \u201c[t]he unambiguous effect of [s.27] is to strip the Court of any power to sanction a sexual relationship between P and another individual, in all circumstances, where it is established that capacity to consent to a sexual relationship does not exist. This is self-evidently necessary for a variety of ethical, moral and legal reasons.\u201d In Re AA  [2021] COPLR 14, Keehan J was required to consider the question of whether a young man had capacity to make decisions regarding auto-erotic asphyxiation (AEA). This appears to have been treated separately to the question of whether he had capacity to consent to sexual relations . Keehan J concluded that there was reason to believe that the man did not have capacity to make decisions in respect of engaging in AEA, but accepted \u201cthe agreed position of the parties that no best interest decisions fall to be made because it would be contrary to s.27(1)(b) or, at least, the philosophy of this provision for the court to make a decision in respect of AEA on AA\u2019s behalf.\u201d . In other words, Keehan J appears to have accepted that the \u201cphilosophy\u201d of s.27(1)(b) should apply not solely to questions of giving consent on behalf of a person to sexual relations with another, but more broadly to decisions in relation to how an individual could or should obtain sexual release.Most probably because the question of the position of a person who wished to initiate sexual activity had never come into sharp legal focus before, there had prior to 2021 been very little jurisprudence about precisely what \u201cconsent\u201d means for purposes of s.27 4As both the Law Commission in the 1990s and the Home Office review of sexual offences had identified, it is quite possible for a person with cognitive impairments to be a  perpetrator of as well as a victim of unwanted sexual activity. The Review had used the concept of capacity in this context  [2014] 1 WLR 2469 expressed \u2013 obiter \u2013 concerns as to whether the public interest had been served in charging the defendant in question, who had a mild learning disability, with rape and then sexual assault on the particular facts of the case, describing the decision as \u2018astonishing,\u2019 a description conceded with hindsight by prosecuting Counsel (R v A(G), para 15).in determining whether a prosecution should be brought, in particular through the application of the public interest stage of the \u2018full code\u2019 test set out in the Code for Crown Prosecutors  which ap16 that the complainant consented for purposes of the non-consensual sexual offences created by the R v B (MA) [2013] 1 Cr. App. R. 36, unless the defendant\u2019s state of mind amounted to insanity in law \u201cbeliefs in consent arising from conditions such as delusional psychotic illness or personality disorders must be judged by objective standards of reasonableness and not by taking into account a mental disorder which induced a belief which could not reasonably arise without it (R v B (MA), para 40). However, the Court of Appeal continued:41. It does not follow that there will not be cases in which the personality or abilities of the defendant may be relevant to whether his positive belief in consent was reasonable. It may be that cases could arise in which the reasonableness of such belief depends on the reading by the defendant of subtle social signals, and in which his impaired ability to do so is relevant to the reasonableness of his belief. We do not attempt exhaustively to foresee the circumstances which might arise in which a belief might be held which is not in any sense irrational, even though most people would not have held it. Whether (for example) a particular defendant of less than ordinary intelligence or with demonstrated inability to recognise behavioural cues might be such a case, or whether his belief ought properly to be characterised as unreasonable, must await a decision on specific facts. It is possible, we think, that beliefs generated by such factors may not properly be described as irrational and might be judged by a jury not to be unreasonable on their particular facts. But once a belief could be judged reasonable only by a process which labelled a plainly irrational belief as reasonable, it is clear that it cannot be open to the jury so to determine without stepping outside the ActR v B (MA), para 41). [2014] 1 WLR 2469 was precisely such a case, which meant that the jury in the case was not required to determine the mens rea of the defendant and not required to consider whether he did, or had reason to, believe that the complainant was consenting to his sexual advances (R v A(G),para 13). In such a case, the court will have the powers of disposal available under s.5 for purposes of deciding whether the person is unfit to plead, i.e., whether they have a disability which would constitute a bar to them being tried,R v B (MA) [2013] 1 Cr. App. R. 36 left open the potential for the insanity defence to apply in the context of non-consensual sexual situations, although there is no reported case where it has been applied. Again, in such a case, the court will have the powers of disposal available under s.5 determining whether the individual should be made the subject of a special verdict that they are not guilty by reason of insanity. The Court of Appeal in 19 In criticising these proposals, Alec Buchanan has helpfully highlighted one of the key distinctions between the different functions of capacity in civil and criminal contexts:In [\u2026] non-criminal cases the context is one where 1) a choice remains to be made or acted upon, 2) the consequences of that choice are not meant to influence the court\u2019s decision and 3) the important question for the court is who shall be allowed to make the choice. In criminal cases where a mental state defence is being offered 1) the choice in question has already been made and acted upon, 2) there is no \u201cvalue neutrality\u201d because the law has already declared the act illegal and 3) the question is whether the defendant should be punished in the usual way. A concept that has contributed to the civil law of decision-making is not automatically useful in criminal law.References to a defendant having mental capacity should be included in a replacement for the insanity defence if they help us identify non-responsible defendants. I do not think that the references to capacity in the Law Commission\u2019s proposals would prevent courts from arriving at the right decisions, even in difficult cases. Rather I see the proposed wording as a missed opportunity to express the criteria for permitting a legal excuse in the simplest language possible. The Law Commission document introduces a complicated abstraction, capacity, that has been defined in several different ways in the literature on the jurisprudence of excuse and that if challenged in court will have to be defined again..It should be noted in relation to the third and fourth of these matters that the Law Commission has proposed reforms to both aspects see , drawingif a defendant with a cognitive impairment is convicted of an offence, and not diverted into the psychiatric system, their impairments would be relevant in determining his sentence: the Sentencing Council Guidelines include as a mitigating factor \u201cMental disorder or learning disability,\u201d particularly where this is linked to the commission of the offence , Step 2.20and (in one sense) separately, the fact that a person is considered to have cognitive impairments will be relevant as to whether either Sexual Risk Orders (\u2018SROs\u2019) and Sexual Harm Prevention Orders (\u2018SHPOs\u2019) under the 5\u201cdeveloped no clear principles governing whether a person had capacity to consent to sexual acts\u201d , Munby J gave his (obiter) observations as to the meaning of capacity to consent at common law, namely: \u201cthe capacity to choose, to decide whether to give or withhold consent, dependent upon the capacity to understand the nature and character of the act, crucially, the capacity to understand the sexual nature of the act.\u201dPrior to 2003, the common law had R v Cooper (Gary Anthony) [2009]1 WLR 1786, concerned with s.30 21 She also said she was \u201cfar from persuaded\u201d that Munby J\u2019s observations in Re MAB and Re MM as to the common law test were correct . However, ultimately, she did not have to resolve these doubts as she considered that the statutory test contained in s.30 In R v A(G) [2014] 1 WLR 2469. This case concerned a defendant with a moderate learning disability who had been convicted of sexually assaulting a complainant with a mild learning disability, contrary to s.30 SOA 2005. A prosecution expert had concluded that the complainant lacked capacity to consent to sexual relations pursuant to ss.2-3 22 but a jury found that he had committed the alleged assault.23 The defendant\u2019s appeal was successful. The Court of Appeal R v A(G) [2014] 1 WLR 2469 interpreted the term \u2018capacity\u2019 in s.74 by reference to ss.30-33 . Macur LJ stated:24 The  [Mental Capacity] Act. Section 74 of the 2003 Act provides the interpretation of \u201cconsent\u201d: \u201cFor the purposes of this Part, a person consents if he agrees by choice, and has the freedom and capacity to make that choice\u201d.\u2000\u2000 Quite clearly, therefore, the issue of consent involves inter alia the capacity to choose, subject to inferences that may be drawn in accordance with sections 75 and 76 of the Act. Sections 30(2)(a), 31(2)(a), 32(2)(a) and 33(2)(a) of the 2003 Act which create offences against persons with mental disorder impeding choice express a lack of capacity as follows:\u201che lacks the capacity to choose . . .  . . .\u201d25 The bracketed words reflect the provisions of sections 2(1) and 3(1) of the 2005 Act, and lead us to determine that the difference in definition of capacity in the civil and criminal jurisprudence is a difference without distinction.[24]26 However, the similarity of definition does not, in our view, dictate the same standard of proof. We observe that the adjudications of the Court of Protection will look to the future in generality; the criminal law looks retrospectively to specific acts of the past.The question of capacity for purposes of the R v A (G) below, but at this stage note that the Court of Appeal appear to made these observations without having been addressed upon any of the matters set out above.25We will return to the decision in 6JB falls outside the scope of this paper; it was conducted by Baker LJ in the Court of Appeal decision in JB  between paragraphs 24 and 75. Two overarching themes appear from those cases.26 The first is a protracted judicial disagreement about whether the relevant test was a so-called \u2018act\u2019 (or \u2018issue\u2019) specific or person-specific, resolved (prior to JB) by the Court of Appeal in In re M (An Adult)  [2014] EWCA Civ 37, [2015] Fam 61 in favour of an act-specific test. The second is a tension between seeking to set a low bar to the test to promote autonomy and securing against the risk of exploitation, as to which see, most obviously, cases such as Re TZ [2013] EWCOP 2322, [2013] COPLR 477 and Re TZ (No. 2) [2014] EWCOP 973, [2014] EWCOP 973, [2014] COPLR 159. The (perhaps crude) fudge adopted in Re TZ (No. 2), adopted subsequently in other cases, was to conclude that the person in question had capacity to consent to sexual relations, but not to make decisions about contact with others. Such a conclusion opened the way to regulating contact through the prism of best interests, and hence (in effect) to enabling only \u2018safe\u2019 sexual encounters to take place.A comprehensive review of the case-law before the case of 727 The evidence was also that JB had sought sexual activity with women who, potentially, either would not, or could not, consent.The definitional disharmonies illustrated above were finally brought to the fore by the case of JB. At the centre of this case was a 38 year-old-man, JB, who had several physical and cognitive impairments, and in whose life the local authority had significant involvement. The local authority\u2019s concern in this case was that JB would be at risk of engaging in a course of sexual activity which may not have the consent of any prospective sexual partner, in circumstances where the evidence was that his \u201cnumber one priority\u201d was \u201cto get\u201d a woman as a sexual partner.28 that he did have such capacity; the local authority appealed to the Court of Appeal which held29 that (1) the proper question was whether he had capacity to decide to engage in sexual relations; and (2) he lacked such capacity. The Official Solicitor \u2013 acting as JB\u2019s litigation friend30 \u2013 appealed on JB\u2019s behalf to the Supreme Court.The local authority therefore brought proceedings before the Court of Protection for declarations and decisions which would enable it to exercise control over JB\u2019s contact so as to prevent him having unsupervised contact with any woman. At first instance, the local authority and the Official Solicitor as JB\u2019s litigation friend reached agreement on the majority of issues relating to JB\u2019s capacity, save for the question of whether he had capacity to consent to sexual relations. Roberts J held31Before the Supreme Court, the critical question was whether, in order to have capacity to engage in sexual relations, JB needed to understand that the other person must be able to consent, and gives and maintains consent throughout, to the sexual encounter in question. Expert evidence was adduced to indicate that, by virtue of his Autistic Spectrum Disorder, JB could not understand, use, or weigh this information. The question for the Supreme Court was whether this information was legally relevant to a decision to engage in sexual relations for purposes of the capacity test contained in s.2 32The Supreme Court held, unanimously, that information about the other person\u2019s consent was legally relevant to the question of whether JB had capacity to decide to engage in sexual relations. However, as with the Court of Appeal, it declined to make a final declaration that JB lacked this capacity, but rather remitted the matter to Roberts J for her to consider the test, and any further expert evidence required to address the test, in light of its judgment.JB was upon the requirements of the capacity test under the 33A central limb of the Official Solicitor\u2019s challenge to the Court of Appeal\u2019s decision was that it had created a test with an \u201cimpermissible difference between the civil and criminal law\u201d . Lord Stephens rejected this challenge. He identified that there were differences in the application of the test for capacity which may lead to different conclusions. The first was the different standards of proof . The second was the fact that:the focus of the criminal law, in the context of sexual offences, is retrospective. It focuses upon a specific past event. Any issue relating to consent is evaluated in retrospect with respect to that singular event. So, the material time in a criminal case is the time of the alleged offence and the question becomes, for instance, \u201cDid P have capacity to consent at that time?\u201d But a court assessing capacity to engage in sexual relations under the MCA ordinarily needs to make a general, prospective evaluation which is not tied down to a particular timeJB, para 101).34, and there were \u201csound policy reasons\u201d why the civil and criminal law test for capacity should be the same. He considered that Munby J had set out the reasons of policy in In re MM (at para 89):In this context both the criminal law and the civil law serve the same important function: to protect the vulnerable from abuse and exploitation \u2026 Viewed from this perspective, X either has capacity to consent to sexual intercourse or she does not. It cannot depend upon the forensic context in which the question arises, for otherwise, it might be thought, the law would be brought into disrepute.Lord Stephens \u201cJB, para 105). However, he considered that it remained possible for the civil law to impose a more demanding test, based upon the \u201ccountervailing and overriding policy reasons\u201d of protecting others and the person themselves . Whilst he agreed with Munby J that in general terms, the criminal and civil law served the same function, he also considered that that should not concern the different purposes of the two branches of the law and the ways in which they carried out their functions, such that \u201cit may be permissible to adopt different tests of capacity in the civil and the criminal law\u201d .Lord Stephens agreed, finally, that the civil law test for consent could not impose a less demanding test of capacity than the criminal law test .Importantly, however, Lord Stephens made clear that whether the clarification of the test of capacity under the That self-direction did not prevent Lord Stephens making a number of obiter observations about whether there were any differences between civil and criminal law.R v A (G) that the difference in definition of capacity in the civil and criminal jurisprudence is a difference without distinction:For instance, in the context of the MCA, information relevant to the decision to \u201cengage in\u201d sexual relations includes the fact that the other person must have the ability to consent to the sexual activity and must in fact consent before and throughout the sexual activity. P lacks capacity if P is unable to understand that information or if he is unable to use or weigh it as part of the decision-making process. However, to my mind that aspect of capacity is irrelevant in the context of sections 30-33 SOA provided P is the complainant rather than the alleged perpetrator [\u2026]. In that criminal context P\u2019s capacity to consent would not include a sufficient understanding by him of the fact that the alleged perpetrator  must have the ability to consent to the sexual activity and must in fact consent before and throughout the sexual activity.at paragraphs 110-1, Lord Stephens disagreed with Macur LJ in JB, para 112), two different concepts:The capacity to \u201cengage in\u201d sexual relations encompasses both P as the initiator of those relations and P as the person consenting to sexual relations initiated by another. The information relevant to a decision whether to initiate sexual relations includes the fact that the other person must have the ability to consent to the sexual activity and must in fact consent before and throughout the sexual activity. That is not information relevant to an evaluation of whether P has the capacity to \u201cconsent to\u201d sexual relations initiated by another person. As the Court of Appeal stated in this case (at para 93) \u201cThe word \"consent\" implies agreeing to sexual relations proposed by someone else.\u201d The capacity to consent to sexual relations for the purposes of the criminal law is concerned with the understanding of the complainant (whom I have been referring to as P) about matters which are relevant to their autonomy, not those which are relevant to the autonomy of the alleged perpetrator. I do not consider that the criminal law requires that a complainant understands that their assailant must have the capacity to consent and in fact consents before the complainant can be considered to have capacity. I do not discern any difference in this regard between the civil and criminal law.in relation to the position of P as complainant in respect of offences outside ss.30-3 JB, para\u2019s 113-4). Lord Stephens noted the decision of the Court of Appeal in R v B (MA) [2013] as to the potential relevance of a person\u2019s inability to read subtle social signals, but made clear that he was not intending either to contradict or build upon that judgment .Lord Stephens rejected the Official Solicitor\u2019s argument that the Court of Appeal\u2019s approach (in the civil context) required more than was expected of individuals in the criminal law context when it comes to determining whether they had a reasonable belief in the consent of the other . He considered that, for purposes of the mens rea, the accused\u2019s \u201cknowledge of the complainant being unable to refuse includes the reasonably foreseeable consequences of what is being done but it does not include a requirement that the complainant should have any understanding of the fact that the alleged perpetrator  must have the ability to consent to the sexual activity and must in fact consent before and throughout the sexual activity\u201d . Again, therefore, he could not discern any difference between the civil and criminal law.Lord Stephens identified the position where the individual with cognitive impairments might be accused of an offence under ss.30-33 8JB were led to overlook how those policy reasons tracked through into statutory wording which was, intentionally, different.As a starting point, we should make clear that we respectfully agree with Lord Stephens\u2019 conclusion that there is no necessary requirement that the tests of capacity should be the same for purposes of the civil and the criminal law. Even if, in broad terms, the two concepts should march in track, this paper has traced how the JB allows stock to be taken by the criminal courts in England & Wales going forward. In so doing, we suggest that it has left the terrain open for reconsideration of the concept of \u2018capacity\u2019 within the Luckily, however, the resetting of the position by the Supreme Court in MAB [2006] about the common law test seemingly having been preserved , Lord Stephens did not address the meaning of the term \u2018capacity\u2019 for purposes of s.74 MAB [2006] in R v Cooper [2009].First, save for noting Munby J\u2019s (obiter) observation in JB [2021], para 110).Second, whilst Lord Stephens made (obiter) observations that the term \u2018capacity\u2019 in relation to the specific offences in ss.30-3 R v A (G) [2014] is, strictly, limited narrowly to the question of the relevant standard of proof, so its observations about the meaning of \u2018capacity\u2019 for purposes of s.74 and s.30-3 Cooper [2009] about the interaction between the two.35Third, the decision of the Court of Appeal in If, therefore, it is time to start again, we would respectfully suggest that the Humpty Dumpty rule should therefore apply, and those appearing before the courts and the courts themselves should take a fresh run at what they mean when they say \u2018capacity\u2019 in the More radically, we suggest that the 36 but the stakes are high. We suspect that it will be quite some time \u2013 if ever \u2013 before any jurisdiction seeking to comply with the Committee\u2019s interpretation of Article 12 takes the equivalent step in the field of sexual consent to that taken in relation to voting in England & Wales in 2006 of abolishing any linkage between cognitive impairment and legal capacity.37 But for jurisdictions seeking to address the consequences of cognitive impairment in the field of sexual capacity \u2013 which might one day include England & Wales \u2013 the CRPD undoubtedly provides a stimulus for a much more radical reframing of the terms of the debate.Even more radically, and raising our eyes above the purely domestic horizon, we note that it might be said that everything that we have set out above could be considered entirely irrelevant. Whatever components of  capacity are actually to be found in the relevant provisions of the Appendix"}
+{"text": "Varroa destructor is a parasite mite of the eastern honey bee Apis cerana, which is native to Asia. The European honey bee Apis mellifera was imported to Asia from Europe and the USA for apiculture in the 19th century. In a short period of time, V. destructor parasitized the artificially introduced honey bees. Varroa destructor was estimated to have spread around the world with A. mellifera when it was exported from Asia to locations worldwide about 50\u2009years ago. The mitochondrial DNA of the parasitic honey bee mite V. destructor was analyzed using next-generation sequencing. The complete mitochondrial genome of V. destructor was identified as a 16,476-bp circular molecule containing 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and one AT-rich control region. The heavy strand was predicted to have nine PCGs and 13 tRNA genes, whereas the light strand was predicted to contain four PCGs, nine tRNA genes, and two rRNA genes. All PCGs began with ATA as the start codon, except COIII and CytB, which had ATG as the start codon. Stop codons were of two types: TAA for eight genes and TAG for five genes. Molecular phylogenetic analysis revealed that V. destructor from Japan was genetically distant from that of France. A high base substitution rate of 2.82% was also confirmed between the complete mitochondrial DNA sequences of V. destructor from Japan and the USA, suggesting that one Varroa mite strain found in the USA is not from Japan. Varroa destructor is a parasite of the eastern honey bee Apis cerana, which is native to Asia . The specimen was stored in a freezer at \u221220\u2009\u00b0C in National Museum of Nature and Science, Japan . The adult mites were transferred immediately to 99% ethanol for subsequent mitochondrial DNA analysis. To sequence the mitochondrial DNA, we used MiSeq (Illumina). These specimens were stored at the National Museum of Nature and Science, Japan. The complete mitochondrial genome of V. destructor from the USA was used as a reference sequence to assemble the reads using Geneious R9 . The genome consisted of a 16,476-bp long closed loop, which included 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and one AT-rich control region that represents a typical mite mitochondrial genome. The average AT content of the V. destructor mitochondrial genome was 80.1%. The heavy strand was predicted to have nine PCGs and 13 tRNA genes, whereas the light strand was predicted to contain four PCGs, nine tRNA genes, and two rRNA genes. All PCGs began with ATA as the start codon, except COIII and CytB, which had ATG as the start codon. Stop codons were of two types: TAA for eight genes  and TAG for five genes . A phylogenetic analysis was performed using 13 PCGs across 14 Acari taxa (V. destructor from Japan and the USA, suggesting that one Varroa mite strain found in the USA is not from Japan.We succeeded in sequencing the entire mitochondrial genome of ari taxa . A high"}
+{"text": "Derris scandens, Boesenbergia pandurata, Citrus hystrix, and Kaempferia parviflora, with PC50 values 0.5\u20138.9 \u00b5g/mL. K. parviflora extract also inhibited PANC-1 cancer cell colony formation. Phytochemical investigation of K. parviflora extract led to the isolation of fourteen compounds, including two polyoxygenated cyclohexanes (1 and 2), eleven flavonoids (3\u201313), and \u03b2-sitosterol (14). Stereochemical assignment of compound 1 was confirmed through X-ray analysis. All isolated compounds were tested for their preferential cytotoxicity against PANC-1 cells. Among them, 5-hydroxy-7-methoxyflavone (3) displayed the most potent activity with a PC50\u2009value of\u20090.8 \u00b5M. Mechanistically, it was found to induce apoptosis in PANC-1 cell death in NDM as evident by caspase cleavage. It was also found to inhibit PANC-1 cancer cell colony formation in DMEM. Therefore, compound 3 can be considered as a potential lead compound for the anticancer drug development based on the anti-austerity strategy.Human pancreatic tumor cells have an intrinsic ability to tolerate nutrition starvation and survive in the hypovascular tumor microenvironment, the phenomenon termed as \u201causterity\u201d. Searching for an agent that inhibits such tolerance to nutrient starvation and kills the pancreatic cancer cells preferentially in nutrient-starvation is a unique anti-austerity strategy in anti-cancer drug discovery. In this strategy, plant extracts and compounds are tested against PANC-1 human pancreatic cancer cell line under the conditions of nutrient-deprived medium (NDM) and nutrient-rich medium (DMEM), to discover the compounds that show selective cytotoxicity in NDM. Screening of twenty-five Thai indigenous medicinal plant extracts for their anti-austerity activity against the PANC-1 human pancreatic cancer cell line in nutrient deprived medium (NDM) resulted in the identification of four active plants,  Pancreatic cancer is the deadliest cancer type with a five-year survival rate less than 5%. During 2019, 35,700 deaths occurred, which made pancreatic cancer occupy the third and fourth primary cause of cancer-related deaths among females and males, respectively octane-5,6-diol 6-acetate (1) octane-5,6-diol 5-acetate (2) . Fraction 1 was chromatographed by normal-phase MPLC using an n-hexane\u2013EtOAc gradient system to afford three subfractions . Subfraction 1-3 was recrystallized from EtOAc to yield 5-hydroxy-3,7-dimethoxyflavone . Fraction 2 was subjected to normal-phase MPLC with an n-hexane\u2013EtOAc gradient system to afford three subfractions . Subfraction 2-1 was further purified by normal-phase MPLC using an n-hexane/EtOAc gradient system to give 5-hydroxy-7-methoxyflavone  and \u03b2-sitosterol . Subfraction 2-2 was recrystallized from EtOAc to yield 5-hydroxy-3,7,4\u2019-methoxyflavone . Subfraction 2-3 was separated by normal-phase MPLC with an n-hexane/EtOAc gradient system to give 5-hydroxy-7,4\u2019-methoxyflavone  and 5-hydroxy-3,7,3\u2019,4\u2019-tetramethoxyflavone . Fraction 3 was rechromatographed by normal-phase MPLC using an n-hexane\u2013EtOAc gradient system yielding two subfractions . Subfraction 3-1 was separated by normal-phase MPLC with an n-hexane/EtOAc gradient system to give (\u2212)-4-benzoyloxymethyl-3,8-dioxatri-cyclooctane-5,6-diol 6-acetate , (+)-4-benzoyloxymethyl-3,8-dioxatri-cyclooctane-5,6-diol 5-acetate  and 5,7,4\u2019-trimethoxyflavonone . Fraction 4 was subjected to normal-phase MPLC with an EtOAc\u2013MeOH gradient system to afford three subfractions . Subfractions 4-1 and 4-2 were recrystallized from EtOAc to yield 3,5,7-trimethoxyflavone . Subfraction 4-3 was separated by normal-phase MPLC with an n-hexane/EtOAc gradient system to give 5,7-dimethoxyflavone  and 3,5,7,4\u2019-tetramethoxyflavone . Fraction 5 was subjected to normal-phase MPLC with an EtOAc\u2013MeOH gradient system to afford two subfractions . Subfraction 5-1 was purified by normal-phase MPLC with an EtOAc/MeOH gradient system to give 5,7,4\u2019-trimethoxyflavone  and 3,5,7,3\u2019,4\u2019-pentamethoxyflavone .Dried rhizomes of HEPES was purchased from D\u014djindo Laboratories . Fetal bovine serum was purchased from Nichirei Biosciences Inc. . Antibiotic/antimycotic solution was purchased from Sigma\u2013Aldrich. Nutrient-deprived medium was prepared according to a previously described protocol . Rabbit The PANC-1 (RBRC-RCB2095) human pancreatic cancer cell line was purchased from the Riken BRC cell bank. The cell line was maintained in standard DMEM with 10% FBS supplement, 0.1% sodium bicarbonate, and 1% antibiotic antimycotic solution.K. parviflora were determined by a procedure described previously [4 cells/100 \u03bcL/well) in DMEM were seeded in 96-well plates and incubated for 24 h. The cells were then washed twice with Dulbecco\u2019s phosphate-buffered saline (PBS) and replaced with either DMEM or nutrient-deprived medium (NDM) containing serially diluted test samples and incubated for 24 h. The medium was then replaced with 100 \u03bcL of DMEM containing 10% WST-8 cell counting kit solution. After 3 h of incubation, the absorbance was measured at 450 nm. Cell viability was calculated from the mean values for three wells using the following equation:50).Preferential cytotoxicities of the twenty-five Thai indigenous medicinal plants\u2019 extracts and the isolated compounds of eviously . In brie4 cells/well) were seeded in DMEM in a 12-well plate and incubated at 37 \u00b0C under humidified 5% CO2 for 24 h. Phosphate-buffered saline (PBS) was then used to wash the cells followed by treatment with NDM alone (the control) or NDM containing K. parviflora extract (2.5 and 5 \u03bcg/mL). Both the treated and control cells were incubated for 24 h and then treated with EB/AO reagent and images were captured using an Evos FL digital microscope (20\u00d7 objective) with phase-contrast and fluorescence modes.PANC-1 cells (5 \u00d7 102 for 24 h for cell attachment. The cells were then treated with K. parvifolia extract or 5-hydroxy-7-methoxyflavone (3) in DMEM and were allowed to grow at 37 \u00b0C under humidified 5% CO2 for 12 days. Cells were then washed with PBS, fixed with 4% formaldehyde, and stained with crystal violet for 15 min. Each experiment was performed in triplicates. Colony area was measured using the ImageJ plugin \u201cColony Area\u201d [PANC-1 cells (2000 cells/well) were plated in 12-well plates at a density of in DMEM (2 mL/well) and incubated at 37 \u00b0C under humidified 5% COWestern blot analysis was carried out by a procedure described previously . In briet-test using GraphPad Prism.Data are presented as means \u00b1 SD; the statistical significance was calculated by student\u2019s Derris scandens, Boesenbergia pandurata, Citrus hystrix, and Kaempferia parviflora, with PC50 values 0.5\u20138.9 \u00b5g/mL. K. parviflora extract was found to inhibit colony formation, and this was subjected to phytochemical investigation, that resulted in the isolation of fourteen compounds (1\u221214). The absolute configuration of 1 was achieved by X-ray crystallography. Among the isolated compounds, 5-hydroxy-7-methoxyflavone (3) was identified as a potential anti-austerity agent. Compound 3 was found to induce apoptosis in PANC-1 cell death in NDM, as well as inhibit PANC-1 cancer cell colony formation in DMEM. Therefore, 5-hydroxy-7-methoxyflavone (3) is a promising lead structure for the anticancer drug development based on the anti-austerity strategy.Screening of twenty-five Thai indigenous medicinal plants extracts for anti-austerity activity against the PANC-1 human pancreatic cancer cell line in NDM resulted in the identification of four active plants,"}
+{"text": "N-acetylglucosamine (NAG3) with hen egg-white lysozyme(kaWT) and its double mutant Asp48Asn/Lys116Gln (kaMT). We definedbinding anisotropy, \u03ba \u2261 (kaWT \u2013 kaMT)/(kaWT + kaMT), and determined its ionic strength dependence.Our goal was to check if this ionic strength dependence provides informationabout the orienting hydrodynamic effects in the ligand-binding process.We also computed ionic strength dependence of the binding anisotropyfrom Brownian dynamics simulations using simple models of the lysozyme\u2013NAG3 system. The results of our experiments indicate that in thecase of lysozyme and NAG3 such hydrodynamic orienting effectsare rather negligible. On the other hand, the results of our Browniandynamics simulations prove that there exist molecular systems forwhich such orienting effects are substantial. However, the ionic strengthdependence of the rate constants for the wild-type and modified systemsdo not exhibit any qualitative features that would allow us to concludethe presence of hydrodynamic orienting effects from stopped-flow experimentsalone. Nevertheless, the results of our simulations suggest the presenceof hydrodynamic orienting effects in the receptor\u2013ligand associationwhen the anisotropy of binding depends on the solvent viscosity.Using stopped-flowfluorometry, we determined rate constants forthe formation of diffusional encounter complexes of tri- N-acetylglucosamine(NAG3) to hen egg-white lysozyme (HEWL) was investigatedpreviously by several groups.5 It is an interesting case of receptor\u2013ligand associationbecause for the reaction to occur the binding partners not only mustbe brought into close proximity but they also must assume a particular,sterically allowed relative orientation. The binding site of HEWLhas a form of a deep cleft  was purchased from Toronto Research ChemicalsInc. Glycin (Art.-Nr. 3908.2), KCl (Art.-Nr. 6781.1), and NaOH (Art.-Nr.P031.1) were purchased from Carl Roth GmbH + Co. KG. HCl (CAS Number7647-01-0) was purchased from Chempur, Poland. All reagents were usedas received. All solutions were prepared with Millipore water. Lysozymeand NAG3 were dissolved in 20 mM glycine\u2013HCl (pH4.0). The solution ionic strength was established by adding an appropriateamount of KCl. The buffer without KCl added has the ionic strengthof 6.7 mM. Stock solutions of NAG3 were prepared by dissolvingthe appropriate weight of crystalline solid in the glycine bufferof given ionic strength adjusted with KCl. Concentrations requiredfor stopped-flow mixing experiments were obtained by serial dilutionof the stock solution in the same glycine buffer.Hen egg-white lysozyme (CASNumber 12650-88-3) was purchased from Sigma-Aldrich. E.\u00a0coli by using a designedand commercially ordered plasmid from GeneCust, Custom Services forResearch (https://www.genecust.com/en/). The pure sample of the lysozyme mutant was obtained by solubilizationof the inclusion bodies in buffer with 8 M urea, purification in twosteps, i.e., ion exchange and gel chromatography, and refolding ofthe purified protein. Because the maximal concentration of the mutantHEWL we were able to prepare for our stopped-flow experiments wasabout 4 \u03bcM, also for the wild-type protein the same concentrationwas used.D48N/K116Q was expressedin 37 using the Pro-Data Chirascan 4.1 (Applied Photophysics Ltd.) software.All spectroscopic measurements were performed at 20.0 \u00b0C.UV\u2013vis absorptionspectra were recorded by using the UV-2401-PC Shimadzu spectrometer.Circular dichroism (CD) spectra were collected by using the ChirascanPlus (Applied Photophysics) spectrophotometer. Simultaneously withthe CD spectra, the UV absorbance spectra were measured. For the far-UVrange (190\u2013250 nm) either a 0.1 or 1 mm cell was used. Forthe near-UV range (250\u2013340 nm) a 10 mm cell was used. CD spectraof lysozyme solutions or corresponding solvent were scanned with 0.5s integration, 0.5 nm step resolution, and 1 nm bandwidth. Six scanswere performed and averaged. Prior to spectra measurements, the CDbaseline was registered with an empty cell holder and with 3 s integration.From each recorded spectrum of HEWL solution, the corresponding smoothedbuffer spectrum was subtracted. Buffer spectra were smoothed by theSavitzky\u2013Golay method (window size 11)3 of concentrations 4, 8, 16, 32, and 64\u03bcM. The exact concentration of both variants of lysozyme ineach experiment was established by absorbance measurements, assumingthe molar extinction coefficient \u03f5280\u202fnm =37700 M\u20131 cm\u20131.38 For each pair of protein\u2013ligand concentrations usedin the stopped-flow experiments, 20 or more reaction progress curveswere averaged. The resulting set of averaged progress curves representsone separate experiment. For each ionic strength and each lysozymevariant four such experiments were done. All solutions were preparedin degassed buffer. Each series of stopped-flow experiments was doneby using freshly prepared protein samples. All measurements were performedat controlled temperature of 20.0 \u00b0C. The (averaged) reactionprogress curves were analyzed numerically by using the DynaFit program40 and assuming a two-step binding model represented by A SX20 stopped-flow system (AppliedPhotophysics) was employed for the kinetic measurements. Samples wereexcited with a light-emitting diode (295 nm wavelength). The emissionwas collected at 90\u00b0 to the excitation beam; a 320 nm cutofffilter was used (Schott WG 320). The excitation pathway was 5 mm,and the emission pathway was 1 mm. A 1:1 mixing ratio was used. Thevoltage of the photomultiplier was set to 500 V. Stopped-flow experimentsconsisted of mixing solutions of \u223c4 \u03bcM of lysozyme withsolutions of NAG41 To create the mutant structure, we changed thenames of the appropriate amino acids and atoms in the pdf file andremoved unnecessary atoms. Executing CHARMM, we added and optimizedcoordinates of lacking atoms in Asn48 and Gln116.Atomistic models of hen egg-white lysozyme andits mutant were created based on the X-ray structure with PDB ID 1HEW and by u43 The requiredelectrostatic calculations were performed by using the finite-differencePoisson\u2013Boltzmann (PB) method,44 implemented in the University of Houston Brownian Dynamics program(UHBD).34 All simulations were performed at 293 K,with a solvent dielectric constant of 78, and that for the protein2. The dielectric boundary between the protein and the solvent isdefined as a Richards probe-accessible surface45 with a 1.4 \u00c5 probe radius and an initial set of 280surface dots per atom.46 All atomic partialcharges and radii for the protein were taken from the CHARMM27 parameterset for the standard amino acids and nucleic acids.48 The titration curves and the electric dipole moments, referred tothe center of diffusion,49 of lysozymeand its mutant were computed as described elsewhere.50The electrostaticproperties of proteins are determined to a large extent by the abilityof certain amino acids to exchange protons with their environmentand the dependence of these processes on pH. The charge distributionin lysozyme and its mutant corresponding to the experimental conditionswas calculated by our computer methodology for titration of proteins,as described in full detail elsewhere.3 molecule was created based on the same crystallographicstructureas the HEWL model, 1HEW.7 Partial charges assigned to NAG3 atoms were taken from the work of Zhong et al.51 These charges were used to evaluate the nettotal charge and the permanent dipole moment of the NAG3 molecule.The atomistic modelof the NAG3 are not possibleat present; therefore, we used a substantially simplified model. Simultaneouslyour model maximizes hydrodynamic orienting effects and thus servesas a useful reference system.Simulations of diffusionalencounters including hydrodynamic receptor\u2013ligand interactionsfor realistic models of HEWL and NAGN-acetylglucosamine. The receptor is modeledby two linear arrays of five beads each, parallel to each other. Thesetwo arrays are separated by 12 \u00c5. In each array, neighboringbeads are separated by distance of 3 \u00c5. 32 Moreover, we expectthat the electrostatic and hydrodynamic orienting interactions bothpromote orientation of the ligand shown in Hydrodynamic models of the receptorwith elongated binding cleft and its elongated ligand employed inBrownian dynamics simulations were built of overlapping sphericalelements of equal radii of 2 \u00c5. In the case of the ligand, thisis a linear array of three beads, which corresponds to three subunitsof tri-e located inthe center of the corresponding bead, blue color means positive chargeof +2e, and gray color means zero charge. In thecomplex arrangement shown on the left-hand side of The beads in 53 implementedin the UHBD program,34 which was modified,as described earlier,29 to include hydrodynamic interactionsbetween associating molecules. Both interacting molecules are representedby spherical bead models, as described above. Hydrodynamic interactionsbetween beads used in modeling diffusing molecules were approximatedas pairwise additive contributions described by Rotne\u2013Pragertensors.54 We realize that usage of pairwiseadditive Rotne\u2013Prager hydrodynamic tensors to model hydrodynamicinteractions is a rather crude approximation. However, employmentof more sophisticated description of the hydrodynamic interactions56 can hardly be used in Brownian dynamics simulations in three-dimensionalCartesian space57 because it would make the timenecessary to complete the results unacceptably long. On the otherhand, even our simplified Brownian dynamics approach is useful andenables reliable interpretation of experimental data.58Simulations of moleculardiffusion and calculation of the rate constant for the diffusion-controlledencounter for bead models of the receptor and ligand are based onthe Brownian dynamics (BD) method,34To obtain diffusional encounter rate constants fromBD simulations with the UHBD program, one computes and then analyzesmany trajectories of one reactant diffusing toward its partner \u201creceptor\u201dunder the influence of electrostatic intermolecular forces and therandom forces mimicking the influence of the bombardment by the solventmolecules. The computation of the diffusional encounter rate constantsis based on the ratio of trajectories ended with the \u201creaction\u201dto the total number of trajectories.We used three reaction criteria for our receptor\u2013ligandmodel. The fulfillment of each successive reaction criterion meansthat the previous one was also fulfilled. Such an approach allowsus to follow the history of the diffusion of the ligand near the bindingsite of the receptor.xz-plane, but simultaneouslythe angle its long axis makes with the Cartesian Oy axis can be aslarge as 70\u00b0. We did not set more restrictive reaction criterionbecause it would result in substantially smaller number of reactionsin our Brownian dynamics simulations and much worse statistics.The reaction criteriaused for the second electric model of thereceptor are defined analogously, but it should be noted that chargedbeads of one array of the receptor change their charge on the oppositeone, and consequently the dipole moment of the second model of receptorhas its electric dipole moment rotated by 90\u00b0 relative the firstmodel.Supporting Information. Diffusional rate constants reportedin the present work are based on 600000 Brownian trajectories. Allsimulations were performed at 293 K at a desired ionic strength. Thesolvent viscosity was set to 1.002 cP to represent water at 293 K.As a reference, simulations that neglect the hydrodynamicinteractionsbetween receptor and ligand were also performed. Examples of inputsfor both types of simulations are shown in the e for the ionic strength0 through +10.9e for 150 mM and +11.3e for 500 mM. For the mutated HEWL these charges are +8.5e, +10.7e, and +11.1e, respectively.The values of the electric dipole moments are at these ionic strengths:107.5, 154.1, and 168.6 D for the WT and 99.1, 93.0, and 99.5 D forthe mutant. These dipole moments are computed relative to the diffusioncenter49 of the molecule. The angle betweenthe dipole moment of the wild-type and that of the mutant is 45\u00b0for zero ionic strength, 35\u00b0 for 150 mM ionic strength, and 31\u00b0for 500 mM ionic strength.The total charge of the WT HEWL at pH 4.0at 293 K changes from +9.03 has zero net charge;thus, its permanent dipole moment can be computed with position vectorsof its partial atomic charges taken relative to an arbitrary originof the Cartesian coordinate system. The calculated magnitude of theNAG3 dipole moment is 18.7 D, while the magnitude of thedipole moment of its first monomer is 5.03 D. The monomer result compareswell with values given by Zhong et al.,51 who obtained values in the range 5.1\u20135.4 D for differentconformations of the NAG monomer.NAG62 Moreover, the spectra of the wild-type lysozyme and its mutant,for both ranges, the far-UV CD and the near-UV, are very similar.That indicates that both the secondary and tertiary structures oflysozyme and its mutant are pretty much the same. Therefore, we concludethat hydrodynamically both variants of the protein might be consideredidentical; thus, for a given mutual distance of the ligand and lysozyme,and mutual orientation of the ligand and the elongated binding cleft,the hydrodynamic interactions between associating partners are verymuch the same.We registered far- and near-UV spectra4 for theProbably relevant for our discussion of the identity or lack ofidentity of the secondary and tertiary structures of the hen egg-whitelysozyme and its Asp48Asn/Lys116Gln double mutant is the observationthat the fluorescence of the mutant is clearly smaller than the fluorescenceof the wild-type lysozyme see 5.3 reaction progress curves registeredin stopped-flow experiments conducted at solution without additionof KCl (ionic strength = 6.7 mM). Each progress curve shown in thisfigure is the average progress curve obtained from at least 20 mixingsin the stopped-flow fluorometer cell.In 40 program and the reaction model represented by \u20131 s\u20131 forthe mutant and wild-type, respectively. The result obtained for thewild-type lysozyme is close to the average value obtained in our previousstudy,63 2.98 \u00b1 0.08 \u03bcM\u20131 s\u20131, at pH 3.2 and 20 \u00b0C,in the glycine\u2013HCl buffer without addition of KCl.Analysis of these twoparticular sets of progress curves with the DynaFit\u20131 s\u20131. However, because our progress curves registered for the mutantlysozyme are of worse quality than those registered for the wild-typelysozyme, the DynaFit program never indicated for them the three-stepmodel as superior and sometimes indicated the one-step binding modelas the best one. Estimations of the diffusional encounter rate constants,when we compare the wild-type and the mutated lysozyme, should bederived from the same binding model. As a compromise, we analyzedall registered progress curves with the two-step binding model shownby Accordingto the model discrimination analysis implemented in theDynaFit program, in the case of the wild-type lysozyme, the three-stepbinding model, i.e., containing one more conformational transitionstep in comparison the two-step model of N-acetylglucosamine, derivedfrom four series of independent stopped-flow experiments, as functionsof the ionic strength. It can be seen that for each ionic strengththe rate constant for the wild-type lysozyme is larger than that forthe mutated lysozyme, but except for I = 200 mM,the error ranges overlap. However, the dependence of both rate constantson the ionic strength is not very regular. It is most probably relatedto the relatively substantial standard error of our results. The resultsfor the wild-type lysozyme agree very well with the results obtainedin our previous work63 for slightly lowerpH (3.2) and twice larger concentration of the protein.The results presentedin N-acetylglucosamine toward the binding cleft or the hydrodynamicinteraction does not discriminate between ligand molecules approachingthe cleft with different orientations. Because our laboratory is notspecialized in the expression of mutated proteins, further experimentswould be rather difficult to proceed. Moreover, it is also possiblethat the experimental approach requires investigations of systemsother than protein receptors with elongated ligands. Instead, we performedBrownian dynamics simulations of the binding process.The dependence of the binding anisotropy \u03baon the solutionionic strength is shown in We performedBrownian dynamics simulations for an artificial model of the receptorwith elongated binding cleft and elongated ligand molecule, shownin As can be seen, for simulations with the hydrodynamic interactionsincluded, all three reaction criteria result in positive values ofthe binding anisotropy and its increase on going from the least restrictive(a) to the most restrictive (c) criteria. For simulations withoutthe hydrodynamic interactions included, the two less restrictive criteriagive negative values of the binding anisotropy parameter \u03ba.Thus, the number of detected reactions is larger for the receptormodel with its dipole moment perpendicular to its long axis. Apparently,the electrostatic attraction of the ligand toward the area betweenthe beads, modeling the binding site, is more effective for the mutatedmodel than for the wild-type model of the receptor. This results ina larger number of trajectories with the ligand diffusing in the vicinityof the binding site, and the two less restrictive reaction criteriaallow to classify a substantial fraction of receptor\u2013ligandarrangements as the complex formation. Only for the most restrictivereaction criterion is the value of binding anisotropy positive; thus,the fraction of the number of receptor\u2013ligand arrangements,classified as binding, for the model of mutated receptor must be significantlyreduced. This results in positive binding anisotropies in the absenceof hydrodynamic interactions.64 The number of trajectorieswas again 600000 for each ionic strength.We may conclude, based on theresults shown in 29). In that work, this relative increase in thediffusional encounter rate constant was shown to rise in the ionicstrength range from 0 to about 150 mM, reaching a plateau for thehigher values.Figure S1. We show these results in the Supporting Information because the numbers ofdetected reactions from simulations with the receptor\u2013ligandhydrodynamic interactions included are relatively small. This leadsto substantial fluctuations in the ionic strength dependence of thebinding anisotropy for the most restrictive reaction criterion. Forsimulations without hydrodynamic interactions included, no viscositydependence is visible in the whole ionic strength range.On the other hand, for simulations without receptor\u2013ligandhydrodynamic interactions included, there is no viscosity dependencein the whole investigated ionic strength range. Analogous resultsfor the most restrictive reaction criterion are shown in Tables S1\u2013S6 presentcomputed diffusional encounter rate constants for simulationswith and without receptor\u2013ligand hydrodynamic interactionstaken into account, for the wild-type and the mutated receptor model,for all reaction criteria. As can be seen, the rate constants withhydrodynamic interactions neglected are much larger than those obtainedfrom simulations with HI included, particularly for the model of mutatedreceptor. Simultaneously, it is clear from the data presented in Tables S1\u2013S3 that the smaller values ofthe diffusional encounter rate constants computed for the model ofmutated receptor, for all three reaction criteria, result from strongorientational steering by hydrodynamic interactions. These effectsovercome stronger electrostatic attraction of the ligand by the mutatedreceptor visible from the simulations without hydrodynamic interactionsincluded with the less restrictive reaction criteria. Smaller valuesof the rate constants for the model of mutated receptor in comparisonto the wild-type receptor, obtained from Brownian dynamics simulationswithout hydrodynamic interactions included for the most restrictivereaction criterion, apparently result from excluded volume effects.Forcompleteness, 32 Besides the differences in the sophisticationof the employed models for hydrodynamic effects calculations, ourbeing much more simplified, the simulation described in that workconsisted of one-dimensional translation motion and one-dimensionalrotation motion of the ligand with respect to the receptor model,whereas here the ligand has full translational and rotational freedom.The other difference is that our receptor model consists of two arraysbuilt from five beads each, whereas in the other work the receptormodel consisted of only two spherical elements. A clarification ofthese differences requires further investigations.It might be surprising that we observe in our Brownian dynamicssimulations clear effect of orientational steering by hydrodynamicinteractions, whereas such effects were not visible in another Browniandynamics simulations for the similar receptor\u2013ligand model.The results of our Brownian dynamics simulations show that it ispossible to construct simplified models of receptor\u2013ligandexhibiting strong hydrodynamic orienting effects when, in the simulation,the ligand is approaching the binding site of the receptor. So thesearch for more realistic models, which will exhibit hydrodynamicorientation steering, is not doomed to failure.N-acetylglucosamine, is not a promising receptor\u2013ligandsystem for detection hydrodynamic orienting effects accompanying theformation of the encounter complex. Actually, very small values ofthe binding anisotropies, obtained in our experiments, strongly indicatethat in the case of association of chitotriose with elongated bindingcleft of lysozyme hydrodynamic orienting interactions apparently playno role. Therefore, one has to look for more complex molecular shapesamong receptor\u2013ligand systems available for experimental kineticinvestigations, which can be modeled by relatively small number ofspherical elements.On the otherhand, the results of the experimental part of theproject show that the association of the elongated ligand with theelongated binding cleft, as in the case of lysozyme and tri-The most important conclusion from the presentwork is the following.Assume that one finds a receptor\u2013ligand system that exhibitsin experiments substantial binding anisotropy. Moreover, the accuracyof the measurements is high. Then, one needs to repeat the experimentsin a solvent of different viscosity. That allows one to see if theanisotropy has only electrostatic origins. The viscosity dependenceof the anisotropy might indicate hydrodynamic orienting contributions."}
+{"text": "Coastal waters worldwide suffer from increased eutrophication and seasonal bottom water hypoxia. Here, we assess the dynamics of iron (Fe), manganese (Mn), and phosphorus (P) in sediments of the eutrophic, brackish Gulf of Finland populated by cable bacteria. At sites where bottom waters are oxic in spring, surface enrichments of Fe and Mn oxides and high abundances of cable bacteria were observed in sediments upon sampling in early summer. At one site, Fe and P were enriched in a thin layer (~\u20093\u2009mm) just below the sediment\u2013water interface. X\u2010ray absorption near edge structure and micro X\u2010ray fluorescence analyses indicate that two\u2010thirds of the P in this layer was associated with poorly crystalline Fe oxides, with an additional contribution of Mn(II) phosphates. The Fe enriched layer was directly overlain by a Mn oxide\u2010rich surface layer (~\u20092\u2009mm). The Fe oxide layer was likely of diagenetic origin, formed through dissolution of Fe monosulfides and carbonates, potentially induced by cable bacteria in the preceding months when bottom waters were oxic. Most of the Mn oxides were likely deposited from the water column as part of a cycle of repeated deposition and remobilization. Further research is required to confirm whether cable bacteria activity in spring indeed promotes the formation of distinct layers enriched in Fe, Mn, and P minerals in Gulf of Finland sediments. The temporal variations in biogeochemical cycling in this seasonally hypoxic coastal system, potentially controlled by cable bacteria activity, have little impact on permanent sedimentary Fe, Mn, and P burial. Low bottom water O2 can lead to the release of toxic hydrogen sulfide (H2S) from sediments into the water column. The lack of O2 and the presence of H2S in bottom waters can lead to the formation of \u201cdead zones\u201d, which are defined by mass mortality of marine species , manganese (Mn), and phosphorus (P) in coastal systems  near the sediment surface by transporting electrons along their filaments over cm\u2010scale distances  and a unique pH profile surface sediment, when compared to sediments where cable bacteria are absent  over the last century resulting in enhanced primary production and an increase in the spatial extent of bottom water OThe Gulf of Finland is the most eutrophic basin of the Baltic Sea Fig.\u00a0. The abs2 conditions. From 2014 to 2016, site JML was mostly hypoxic (O2\u00a0<\u200963\u00a0\u03bcM) and only briefly became oxic (O2\u00a0>\u200963\u00a0\u03bcM) in June 2015  than GOF5 and LL3A  as a consequence of the lower O2 availability  at these sites did not indicate activity of cable bacteria at the time of sampling, as a consequence of the recent transition from oxic to hypoxic/anoxic bottom waters, and the corresponding low O2 concentrations observed near the sediment\u2013water interface  were observed at sites GOF5 and LL3A. At these latter sites, the polychaete Marenzelleria dominated  are located along a water depth gradient ranging from 60 to 85\u2009m water depth in the Gulf of Finland Fig.\u00a0; Table\u00a01015 Fig.\u00a0. In contmer Fig.\u00a0. The sedmer Fig.\u00a0. Site JMted Fig.\u00a0. Despiteted Fig.\u00a0.Pelagia. Water column depth profiles of temperature, salinity and density were obtained with an ultraclean CTD\u2010system. Dissolved O2 was measured with a Sea\u2010Bird O2 sensor attached to a CTD. Water column samples were collected using 24 ultratrace metal clean PVDF samplers of 24\u2009liters each, placed in two rows of 12 samplers mounted onto a rectangular titanium frame  were obtained using 20\u2009mL syringes and passed through 0.45\u00a0\u03bcm nylon filters. Aliquots for H2S analysis were transferred into N2 purged 8\u2009mM NaOH solutions immediately after filtration to prevent loss of H2S. Subsequently, the HPO42\u2212 and H2S concentrations were determined via the methylene and molybdate blue complex methods, respectively  were acidified as quickly as possible after sampling to pH\u00a01.8 using distilled HCl and stored at 4\u00b0C until analysis (within 1\u2009yr). This acidification can potentially lead to an underestimation of total dissolvable Fe and Mn as a consequence of precipitation of humic substances upon acidification . To ensure high accuracy of the measurements, the system was checked daily using a GEOTRACES standard or an in\u2010house reference material (acidified sea water pH\u00a01.8). For GEOTRACES SAFe D1, we obtained measurements with an average value of 0.69\u2009\u00b1\u20090.26\u2009nM . The detection limit for Al was 4.3\u00a0\u00b1\u20093.4\u00a0nM (n\u00a0=\u20095) and the value of the blank was 1.98\u2009\u00b1\u20090.41\u2009nM (n\u00a0=\u200984).Acid\u2010washed LDPE bottles  were rinsed three times with sample prior to sample collection. Unfiltered samples for total dissolvable Fe, Mn, and aluminum (Al) and filtered samples for dissolved Fe, Mn, and Al  database at the Swedish Meteorological and Hydrological Institute .Monthly time\u2010series data for bottom water O2 atmosphere (0.5\u20134\u00a0cm resolution) in a climate\u2010controlled laboratory on\u2010board ship at in situ temperature. Slices for each depth interval were split into vials for porosity and solid\u2010phase analysis and polypropylene 50\u2009mL tubes that were centrifuged at 3500\u2009rpm for 20\u2009min at in situ temperature for pore water retrieval. All sample handling took place in an inert atmosphere, hence oxidation artifacts can be excluded  and X\u2010Ray Absorption Spectroscopy  and the determination of sedimentation rates using 210Pb dating.Sediment cores (diameter 10\u00a0cm) were collected in a single cast using a multi corer . Duplicate bottom water samples were retrieved directly from the overlying water. At each site, one sediment core was sectioned immediately after core retrieval in a glovebox under a N\u03bcm nylon filters under anoxic conditions. Directly after filtration, subsamples of 0.5\u00a0mL for H2S analysis were trapped in an 8\u2009mM NaOH solution (1.5\u00a0mL). Concentrations of H2S and HPO42\u2212 were determined as described for the water column samples. Ammonium (NH4+) concentrations were determined on\u2010board ship using a QuAAtro (Bran\u2009+\u2009Luebbe) gas segmented continuous flow analyzer using the phenol\u2010hypochlorite method (Koroleff\u00a0\u03bcL Suprapur\u00ae HCl (35%) per mL sample and analyzed for dissolved Fe and Mn onshore using Inductively Coupled Plasma\u2010Optical Emission Spectroscopy . Sulfate (SO42\u2212) and chloride (Cl\u2212) concentrations were determined using ion chromatography (IC).Bottom water samples and the supernatant from the centrifuge tubes (~\u20095\u00a0mL) were passed through 0.45\u00a0Koroleff\u00a0. Samples4+, HPO42\u2212, Fe, and Mn across the sediment\u2013water interface were determined in situ, using two benthic landers, equipped with three chambers, each with a square surface area of 144\u2009cm2 and a volume of overlying water ranging from 0.9 to 2\u00a0liters. During incubation, the overlying water was stirred continuously as described in Lenstra et al.\u00a0 as described in Berner\u00a0 in closed PTFE vessels. The residual gel was dissolved in 1\u00a0M HNO3 and the Fe, Mn, S, and P contents were determined by ICP\u2010OES.For the analysis of total Fe, Mn, S, and P contents, aliquots of\u2009~\u2009125\u2009mg freeze\u2010dried sediment were digested in a mixture of HF (40%) and 2.5\u00a0mL HClOorg) and nitrogen (Norg) contents were corrected for the weight loss during decalcification.Aliquots of\u2009~\u2009300\u2009mg of freeze\u2010dried sediment were decalcified using two wash\u2010steps of 1\u00a0M HCl for 24\u2009h  and ferric Fe minerals using 1\u00a0M HCl for 4\u00a0h, [II] crystalline Fe minerals using citrate dithionite buffer (CDB) for 4\u00a0h, [III] magnetite (Fe3O4) using 0.2\u00a0M (NH4)2C2O4/0.17\u2009M C2H2O4 for 6\u00a0h, and [IV] pyrite (FeS2) extracted by concentrated HNO3 for 2\u00a0h. The sum of these four fractions is defined as total extractable Fe.Iron phases were fractionated using aliquots of\u2009~\u200980\u2009mg freeze\u2010dried sediment. A combination of two operational sequential extraction methods after Poulton and Canfield\u00a0 and Claf2; 0.5\u00a0h), [II] CDB\u2010P , [III] authigenic\u2010P associated with calcium carbonate (CaCO3)\u2009+\u2009carbonate fluorapatite\u2009+ biogenic hydroxyapatite , [IV] detrital\u2010P , and [V] organic\u2010P (ashed at 550\u00b0C for 2\u00a0h following extraction with 1\u00a0M HCl for 24\u2009h).For sedimentary P speciation, the sequential extraction procedure after Ruttenberg\u00a0 as modif0; methanol; 16\u2009h), and [III] chromium reducible sulfur  chloride in 32% HCl; 48\u2009h).Sulfide was fractionated using aliquots of\u2009~\u2009300\u2009mg freeze\u2010dried sediment following the sequential, passive distillation extraction procedure after Burton et al.\u00a0, 2008 asorg, as an indicator of bottom water salinity  S/C210Pb by direct gamma counting at 46.5\u00a0keV with a high purity germanium detector (Ortec GEM\u2010FX8530P4\u2010RB). Self\u2010absorption was measured directly and the detector efficiency was verified with a National Institute of Standards and Technology standard. Excess 210Pb was derived from the difference between the measured total 210Pb and the estimate of the supported 210Pb activity as given by 214Pb . Sedimentation rates were estimated by fitting a reaction transport model .Freeze\u2010dried sediment samples were analyzed for \u03bcm layer of alumina powder. High\u2010resolution elemental maps of Fe, Mn, P, Ca, and S (30\u00a0\u03bcm spot size) were obtained using a Desktop EDAX Orbis \u03bcXRF analyzer .At sites JML and GOF5, subcores  were embedded with epoxy resin for high\u2010resolution elemental mapping  was controlled by a Kirkpatrick\u2013Baez mirrors system. Although the cross section of the beam was very narrow, the analyzed volume in the sediment sample was relatively large. To illustrate this, the absorption length, calculated with the program Hephaestus (Ravel and Newville\u00a02) with a density of 2.2\u2009g\u2009cm\u22123 is\u2009~\u200985\u00a0\u03bcm. This implies that Fe and Mn atoms, which are located below a depth of several tenths of micrometers below the sample's surface, can still contribute to the measured fluorescence spectrum, although the signal's intensity decreases with depth.Suspended matter samples from the water column (Supplementary Information 1.4) and epoxy embedded sediment retrieved from site GOF5 were further investigated for their Fe and Mn mineralogy at the ID21 beamline  were collected within the energy range, 7.00\u20137.65\u2009keV for Fe and 6.50\u20136.90\u2009keV for Mn. The XANES spectra were corrected for the background signal and normalized using the ATHENA software package  of spectra. For this reason, the quality of Mn spectra was insufficient for EXAFS analysis and the energy range of Fe EXAFS spectra was limited. Although limited, when available, Fe EXAFS spectra for epoxy embedded sediments were used to better constrain the LCF.2 was near\u2010saturation in the upper\u2009~\u200950\u2009m of the water column. Below 50\u2009m, O2 decreased strongly from\u2009~\u2009350 to\u2009~\u20090\u00a0\u03bcM with increasing water depth. Sulfide was only observed in the lower part of the water column and bottom water at site JML, reaching concentrations up to 18\u00a0\u03bcM  or\u2009~\u20099\u00a0\u03bcM (GOF5 and LL3A) until\u2009~\u200960\u2009m. At site JML, NO3 concentrations decreased to values\u2009<\u20090.1\u00a0\u03bcM. At all sites, HPO42\u2212 increased with water depth from 0.02 up to\u2009~\u20095\u00a0\u03bcM  phosphate standard , whereas site GOF5 was characterized by a strong surface enrichment of Fe oxides , whereas FeS was depleted in the surface sediment at site GOF5 (34\u00a0\u03bcmol\u2009g\u22121). At GOF5, FeS increased with depth within the first 15\u2009cm of the sediment followed by a decrease, which coincided with a strong increase in sedimentary pyrite. Labile Fe(II) corrected for FeS exhibited strong surface enrichments at sites GOF5 and LL3A (~\u2009300\u00a0\u03bcmol\u2009g\u22121). Crystalline Fe oxides and magnetite showed no trend with sediment depth at all sites. Total extractable Fe represented\u2009~\u200940\u201370% of the total Fe pool. Total Mn was low at site JML, whereas surface enrichments in total Mn were observed at sites GOF5 and LL3A . Weight ratios of Mn/Al were always below 0.1 at all sites . The fitting results indicate an increased contribution of 6L\u2010ferrihydrite with an increase in the Fe content  phosphate (hureaulite) and rhodochrosite was the most consistent approach to reproduce all the spectra (Supplementary Information 1.17). The Mn XANES spectra retrieved from the Mn\u2010rich areas in the upper part of the surface sediment area #1\u20133; Fig.\u00a0; Fig.\u00a03.2  due to less efficient sequestration in the sediment  in the bottom waters of the Gulf of Finland  and we show here that at these latter sites, this particulate Mn is predominantly present in the form of Mn oxides  and nearly equal amounts of Mn in the water column and surface sediment , which Hermans et al.\u00a0, the sediment was highly enriched in Mn oxides Figs.\u00a0; Table\u00a0342\u2212 and low levels of \u03a3H2S. Such conditions were present in the surface sediment at site GOF5  in the top 5\u2009mm of the surface sediment was 0.048\u2009mol\u2009m\u22122  was located in zone A and 90% (0.043\u2009mol\u2009m\u22122) in zone B  of total Fe was located in zone A (0\u20132\u2009mm) and 71% (0.17\u2009mol\u2009m\u22122) in zone B  could potentially sequester 0.033\u2009mol P m\u22122.The relative contributions of the Fe and Mn oxides and Mn(II) phosphates in sequestering P in the surface sediment at site GOF5 was estimated Table\u00a0 by combim\u22122 Fig.\u00a0 of whiche B Fig.\u00a0. The tot\u00a0\u22122 Fig.\u00a0. Approxi\u22122. Approximately, 73% (0.015\u2009mol\u2009m\u22122) of total Mn was located in zone A (0\u20132\u2009mm) and about 27% (0.006\u2009mol\u2009m\u22122) in zone B  of P sequestration.The total amount of Mn in the top 5\u2009mm of the surface sediment amounted to 0.021\u2009mol\u2009mTo summarize, P sequestration in the surface sediment of GOF5 occurred in a very narrow zone of the sediment and was predominately associated with Fe oxides (68%), whereas Mn oxides and Mn(II) phosphates both played a smaller role  compared to that of site GOF5  phosphates and Mn oxides. The Fe oxides are focused within a thin layer (3\u2009mm), and are responsible for\u2009~\u200968% of the P sequestration in the surface sediment, while Mn minerals account for the remaining\u2009~\u200932%. Our results highlight that only a very narrow zone of the sediment is involved in the recycling of Fe, Mn, and P in this brackish, seasonally hypoxic coastal area. While variations in bottom water OThe authors declare that they have no conflicts of interest.Appendix S1: Supporting informationClick here for additional data file.Appendix S2: Supporting informationClick here for additional data file."}
+{"text": "In the acute-withdrawal group, all ASMs were discontinued once the patients were admitted. In the slow-taper group, the doses of ASMs were gradually reduced by 15\u201330% daily. We also evaluated the safety of the acute-withdrawal and slow-taper protocols. The mean lengths of hospital stay were 3.8 \u00b1 1.92 and 5.2 \u00b1 0.69 days in the acute-withdrawal and slow-taper groups, respectively (p < 0.005). No severe adverse events, including status epilepticus, were observed. Acute ASM withdrawal has the advantage of significantly reducing the length of hospital stay over slow tapering, without any severe adverse effects.Antiepileptic medications (ASMs) are withdrawn at the epilepsy monitoring unit to facilitate seizure recordings. The effect of rapid tapering of ASMs on the length of hospital stay has not been well documented. We compared the mean length of hospital stay between patients who underwent acute ASM withdrawal and slow dose tapering during long-term video electroencephalography (EEG) monitoring. We retrospectively investigated 57 consecutive patients admitted to the epilepsy monitoring unit regarding the mean length of hospital stay in the acute ASM withdrawal group ( Long-term video-electroencephalography (EEG) is widely applied as a useful tool to identify epileptic foci in the preoperative evaluation of intractable epilepsy and to confirm the diagnosis of episodic symptoms, including psychogenic non-epileptic seizures ,2,3. TheAdverse events, such as status epilepticus, should be avoided while ensuring the diagnostic accuracy and efficacy of video-EEG monitoring ,6,7. SomOnly a few studies have compared the duration of hospital stay between groups subjected to acute withdrawal and slow dose tapering ,11. In tn = 12) and those with no change in ASM during monitoring (n = 9), 57 patients were retrospectively investigated regarding the length of hospital stay and latency of the first seizure after the start of monitoring in the acute-ASM-withdrawal (n = 27) and slow-taper (n = 30) groups. Data regarding patient demographics and ASM doses were collected from the medical records. The patients who underwent intracranial monitoring were excluded from hospital stay analysis (n = 11). The study protocol was approved by our Institutional Research Ethics Committee .Among the 78 consecutive patients admitted for EEG monitoring at Fukuoka Sanno Hospital, Fukuoka, Japan, between October 2017 and January 2020, excluding patients diagnosed with non-epileptic seizures . All values are expressed as the mean \u00b1 standard deviation. The statistical analyses were performed using SPSS statistics version 27 . In all cases, analysis items with a p-value < 0.05 were considered statistically significant.We analyzed the difference in latency of the first seizure and the average length of hospitalization between the two groups. The chi-squared test was used to compare categorical data between the two groups . An independent sample No statistically significant differences were observed between both groups in the baseline demographics of sex, duration of epilepsy, seizure frequency, history of febrile seizures, magnetic resonance imaging findings, or epilepsy syndrome . HoweverThe mean length of hospital stay was significantly shorter in the acute-withdrawal group than in the slow-taper group . The number of generalized tonic\u2013clonic seizure was 0.5 \u00b1 1.0 (median: 0) in the acute-withdrawal group and 1.2 \u00b1 1.9 (median: 1) in the slow-taper group, which was fewer in the withdrawal group, but without statistical significance. There were no significant side effects and/or drug intolerance after the re-introduction of the ASM.In the present study, the duration of hospitalization was shorter in the acute-withdrawal group than in the slow-taper group. Shortening of hospitalization has several advantages. In the era of the COVID-19 pandemic, there is limited availability of hospital beds for the care of patients with epilepsy, hence the need to shorten the duration of hospital stay as much as possible . From anFor patients treated with ASMs with longer half-lives, such as phenobarbital and/or zonisamide, it is recommended that ASMs be discontinued before initiating video-EEG to capture seizures within a limited monitoring time . In our The most important concern in video-EEG monitoring is patient safety ,5. PreviAnother concern is that ASM withdrawal triggers non-habitual seizures and misleads the determination of seizure foci. Tapering of antiepileptic drugs increases the seizure frequency and secondary generalization but does not affect the pattern of seizure initiation or propagation . Acute wOur study had some limitations. The number of study patients was small. The allocation of patients to each withdrawal arm was not randomized. The patient\u2019s demographics were not comparable in some parameters including numbers of ASMs, which may be related to the severity of epilepsy. The difference may have influenced the latency of seizure occurrence and monitoring length in our study. Further large-scale studies are required to confirm the findings of the present study.The acute ASM withdrawal protocol may be used to shorten hospitalization for video-EEG monitoring without adversely affecting patient safety."}
+{"text": "Gyromitra infula, a kind of poisonous mushroom, contains gyromitrin toxin, which causes epileptogenic neurotoxicity and hemolytic disease. This study aimed to establish a rapid and visual method of G. infula identification based on loop-mediated isothermal amplification (LAMP). A set of specific LAMP primers was designed, and its specificity in G. infula was confirmed against various mushroom species, including its closely related species and other macrofungi. The sensitivity assay showed that the minimum concentration of genomic DNA detected by LAMP was 1\u2009ng/\u03bcl. The method\u2019s applicability was conducted by preparing mushroom samples that were boiled and digested in artificial gastric juice. The results showed that the content as low as 1% G. infula can be successfully detected. This method can be completed within 90\u2009min, and the reaction results can be directly observed by the naked eyes. Hence, the identification method of G. infula established based on LAMP in this study is accurate, rapid, sensitive, and low-cost, which is required for clinical treatment or forensic analysis when mushroom poisoning occurs.With mushroom poisoning emerging as one of the most serious food safety problems worldwide, a rapid identification method of poisonous mushrooms is urgently required to investigate the source of poisoning.  Mushrooms are widely distributed globally, some of which have high nutritional value and medicinal efficacy , but somGyromitra infula (Schaeff.) Qu\u00e9l is commonly mistaken as an edible mushroom, and is distributed in different regions of China during summer and autumn. Gyromitra infula is extremely similar to edible Helvella species (such as Helvella macropus) and tend to be confused with the latter, leading to accidental ingestion and poisoning. Gyromitra infula contains the toxin gyromitrin, which is converted to monomethylhydrazine in human body, one of the raw materials of rocket fuel  when mushroom poisoning occurs is essential and urgent for investigating mushroom poisoning and treatment of poisoning patients  can be selectively added to the system to accelerate the reaction and shorten reaction time , and DNA barcoding . Howeverion time . Compareion time . With alion time . As the ion time , testingion time , environion time , and cliion time . In the G. infula based on LAMP, which can be used in resource-poor areas without expensive and complex instruments. This method is of great significance for the rapid identification of poisonous mushrooms in poisoning incidents, the targeted treatment after poisoning and the prevention of mushroom poisoning.In this study, an accurate, visual, rapid, sensitive and low-cost method was established for the detection of The mushroom materials used in this experiment were collected from the field, and the specimens were deposited in Herbarium Mycology of Jilin Agriculture University (HMJAU). 2O for a total volume of 25\u2009\u03bcl. The ITS amplification condition was initial denaturation at 94\u00b0C for 4\u2009min, followed by 30\u201334\u2009cycles of 94\u00b0C 40\u2009s, 55\u00b0C 40\u2009s, 72\u00b0C 50\u2009s, and then a final extension at 72\u00b0C for 10\u2009min. The 2% agarose gel electrophoresis was used to examine the amplification products. After that, the products were directly sent to Sangon Biotech Co. Ltd. (Shanghai) for sequencing. The Sequencher 5.4.5  was used to assemble the two-way sequencing results, remove the poor fragments of the sequences, check the accuracy of every base, and manually correct the sequencing results according to sequence chromatograms. And then, these sequences were uploaded to National Center for Biotechnology Information (NCBI) for BLAST analysis to validate the accuracy of morphological identification based on sequence similarity and comprehensive score.About 30\u2009mg of every sample were placed in a 1.5\u2009ml centrifuge tube with 2\u20133 steel beads added. The samples were dried in liquid nitrogen and homogenized into powder. Following that, the DNA secures new plant genomic DNA extraction kit  was used for total genomic DNA extraction. NanoDrop 2000 ultra-spectrophotometer was used to measure DNA concentration and purity. After measurement, DNA concentration was diluted to 10\u2009ng/\u03bcl for further study. The ITS1F/ITS4 universal primer  was usedG. infula LAMP-specific primer pairs. Ten G. infula ITS sequences  were downloaded from NCBI GenBank, and the multi-sequence alignment was conducted  and the mushroom sample sequences obtained in this study were used for multi-sequence alignment using the AliView 1.17 , 11 negative controls  were used for the LAMP reaction. If the color of the G. infula (positive control) tube changes from pink to yellow, while the negative control and blank control tubes remained pink, this indicates that the primer set has a good specificity.There were 10\u2009\u03bcl in the LAMP reaction system, which included 5\u2009\u03bcl LAMP master mix , 3\u2009\u03bcl primer mixture , 2\u2009\u03bcl DNA template, and topped up with ddHG. infula and G. infula mixture were used for testing.To further validate the applicability of LAMP primer set I in G. infula and Morchella esculenta were mixed in a mass ratio of 1:1, 1:9, and 1:99 to prepare the G. infula mixture. Following that, the G. infula and M. esculenta mixture was boiled at 100\u00b0C for 10\u2009min. Finally, DNA extraction and LAMP reaction were conducted, and changes in the color of the solution were observed after the reaction.Firstly, G. infula and G. infula mixture  were incubated in an artificial gastric solution at 37\u00b0C for 4\u2009h. Then, DNA extraction and LAMP reaction were conducted and changes in the color of the solution were observed after the reaction.The artificial gastric solution was composed of 0.05\u2009g potassium chloride, 0.42\u2009g sodium chloride, and 0.32\u2009g pepsin and topped up with 100\u2009ml water. Following that, 1\u2009mol/l hydrochloric acid was used to adjust the pH to 3.0 . The boiG. infula and 11 other species  were used as templates. G. infula) showed significant color change (from pink to yellow), proving that successful amplification occurred with the designed primers. The other 11 negative control and blank control tubes remained pink, showing no cross reaction occurred. In this experiment, we carried out three replicates and each replicate showed the same result. This further proved that the LAMP primer set in this experiment only amplified the DNA of G. infula. There was no nonspecific amplification of closely related species, morphologically similar species, and other poisonous and edible mushrooms. To further validate the specificity of primer set I, the control primer set II in G. infula and closely related species. Three replicates were conducted in the control experiment. As shown in Suillus placidus) tube that did not show a color change, other samples  were positive. This showed that the primer set II in G. infula and was not suitable for LAMP testing for G. infula.In this study, DNA from G. infula was serially diluted 10-fold from 10\u2009ng/\u03bcl to 1\u2009fg/\u03bcl  from boiled and digested single and mixed mushroom species (G. infula content low up to 1%). The above applicability test results were all obtained on the basis of three repeated experiments.In actual application, the tested mushroom materials usually undergo processing to a certain degree or are in some abnormal states. For example, humans often cook mushrooms before consumption. When poisonous mushrooms are accidentally ingested, the digestive fluid in the stomach will digest these mushrooms. After poisoning has occurred, only the vomit or feces of patients are usually obtained. These conditions may degrade the mushroom DNA to varying degrees. Therefore, to validate the applicability of the LAMP primer set in these situations, we simulated the cooking and human digestion processes of mushrooms by boiling and digesting mushrooms before LAMP testing. Results are shown in Gyromitra infula is distributed in different regions of China in summer and autumn and is similar to some edible saddle mushrooms, such as Helvella macropus. Humans may confuse G. infula with them, thereby developing mushroom poisoning. The technology of LAMP can be used for rapid detection of G. infula and is a simple method. The species-specific amplification region is an essential challenge in designing efficient LAMP primer sets , and the liquid chromatography-mass spectrometry  might be used for identification of G. infula, they rely on expensive instruments, a long detection cycle, high detection costs, and high sample pretreatment, which are not suitable for application in resource-poor areas and on-site detection. Therefore, the present LAMP method with abovementioned advantages is superior to other methods and is suitable for identifying G. infula. However, we need to pay attention to controlling the content of the DNA template in the reaction system because the larger amount of DNA template can have an inhibitory effect on the LAMP reaction  can be found in the article/supplementary material.Gyromitra, Morchella, Helvella, and Verpa species. XX, RD, BL, CG, and YZ completed the analysis ITS sequences of all specimens and LAMP assay. XX and ET wrote the manuscript. XX, BL, YF, RD, CG, YZ, and ET contributed to collection of specimens used in this study. All authors contributed to the article and approved the submitted version.ET designed the experiments and morphologically identified the species collected in this study. YF provided some specimens and photos of This research was supported by the National Key Research and Development Program of China (2019YFC1604703) and National Natural Science Foundation of China (no. 31860009).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "We developed a dual-reputational rating shopping model to introduce public and institutional reputations. Investor\u2019s and regulator\u2019s penalty rates are described as public and institutional reputations, respectively. We achieved the available conditions of single-rating and dual-rating regulations to prevent rating inflation in this model. To examine the regulatory effects of different types of regulations on Chinese corporate bond ratings, we utilize panel ordered logit models. Theoretical analysis and empirical tests show that, when the reputation effect is low, the single-rating regulation is better at improving rating quality, and when the reputation effect is high, the dual-rating regulation induces rating agencies to provide more accurate ratings. Compared to the regulatory effects of the single-rating and the multi-rating regulations, the dual-rating regulation most effectively improves the rating quality of corporate bonds and prevents rating inflation. The continuous growth of the Chinese capital market, especially in the context of large-scale corporate bonds, necessitates a reliable rating system. The first default on Chinese corporate bonds occurred in 2014 when the \u201c11 super-day debt\u201d was not paid. Ever since\u2014especially since 2018, when the Chinese corporate bonds market underwent some adjustments\u2014defaults on corporate bonds have occurred frequently. https://www.wind.com.cn/en/edb.html), there are two hundred and three defaults on corporate bonds rated high ratings from 2014 to 2018  issued self-discipline guidelines for debt financing instruments of non-financial enterprises. In the 6th provision of [Regulators in the United States, England, and Japan have issued the dual-rating regulation to curb rating inflation. Similarly, since 2013, many regulatory institutions in China have introduced the dual-rating regulation to prevent the inflation of corporate bonds. Under this system, a corporate bond is rated by two rating agencies simultaneously; theoretically, this has certain reputational constraints in terms of cross-checking of ratings. However, the dual-rating regulation has not yet been officially implemented in China.This study considers public and institutional reputations to improve the rating shopping model and discusses the conditions of the single-rating and dual-rating regulations. Additionally, we utilize the data on Chinese corporate bonds to conduct empirical tests. Our research attempts to answer two questions: Can the dual-rating regulation improve the rating quality of Chinese corporate bonds? How are the regulatory effects on different rating regulations?The remainder of this article is structured as follows. Section 2 reviews the relevant literature and Section 3 constructs a dual-reputational rating shopping model. In Section 4, we theoretically analyze the conditions of single-rating and dual-rating regulations. In Section 5, we utilize panel ordered logit models to examine the regulatory effects on different rating regulations. Section 6 briefly discusses the implications of our findings and their prospects.A few credit rating studies are based on the assumption of ratings shopping , that isAs stated above, many countries have adopted the dual-rating regulation. Based on international experience, these regulations are important for order competition and healthy development in the rating industry. To the best of our knowledge, the United States first implemented the dual-rating regulation in 1936. According to , the OffA few researchers have discussed the effects of reputation on rating quality. Rating agencies have a dual-reputation effect, namely, public reputation and institutional reputation . RegulatThe relationship between rating regulations and rating quality has been examined in a few studies. For example, the dual-rating regulation prevents the collusion of inflated ratings with the separation of economic cycles . RegulatResearchers differ on the issue of increased competition among rating agencies. Some opine that this induces rating agencies to provide more accurate information, which benefits investors . ConversWhile a few studies have focused on the rating shopping model to explore the effects of rating regulations on rating quality, others have studied the regulatory effects of different rating regulations. A few researchers have also shown that competition among rating agencies may lead to inflated ratings . It is, The innovations of this study are as follows: First, unlike another study , we intrBased on the perspectives of expected revenue and regulatory cost, we developed a dual reputational rating shopping model to analyze the available conditions for the single-rating and dual-rating regulations.i, and issuers are as follows:The assumptions of the model were similar to those of . We suppm, where m \u2208 . In period 0, zi denotes whether the regulator approves rating agency i to provide a rating service for issuers. If the regulator approves rating agency i in the rating industry, zi = 1; otherwise, zi = 0. wi represents whether rating agency i can issues accurate ratings\u2014If yes, wi = 1; otherwise, wi = 0. The regulator has approval cA and regulatory costs cM for each rating agency.There are two types of corporate bonds: A and B. The real proportion of type-A bonds is i is fi. The rating threshold of type-A corporate bonds is \u03b1i, namely, the number of type-A corporate bonds issued by rating agency i. As a result of rating shopping, there is a slight difference between rating threshold \u03b1i and the real proportion of type-A bonds m. As shown in Figs The rating fee for the rating agency \u03c6, where \u03c6 > 0, whereas the issuer\u2019s utility of a B rating is 0. Di is the demand function of rating agency i. When rating agency i is monopolistic, fi\u2212 and an identical rating threshold \u03b1i\u2212. In the competition of n rating agencies, the demand function of rating agency i is:An issuer\u2019s utility of an A rating is i and the cost function of the regulator are constructed by [\u03c3RA and \u03c3RE represent the discount factors of rating agency i and the regulator, respectively.From Eqs  and 3),,3), the ucted by , where \u03c3In this model, we ignore the dual reputation of rating agencies in the expected revenue function of rating agency i and the regulator\u2019s cost function . Meanwhii and the regulator\u2019s cost function [\u03c3 with the investor\u2019s penalty rates \u03c1RA and regulator\u2019s penalty rates \u03c1RE. Rating agencies can be motivated to improve rating quality through the reputation effect. The dual reputational rating shopping model is:In this model, we ignore the dual reputation of rating agencies in the expected revenue function of rating agency function . Meanwhifunction , 20, we Based on the 6th provision of , we supp\u03d5i and the rating threshold is \u03b1i. Subsequently, if the rating accuracy of rating agency i is lower than that of rating agency j, it will be replaced by rating agency j in next period.In period 0, the regulator approves only one rating agency to provide ratings. The rating fee of rating agency is \u03b1i = m, rating agencies provide accurate ratings. The expected revenue of the rating agency i is:According to \u03b1i > m, rating agencies provide inflated ratings. Owing to the single-rating regulation, the regulator approves only one rating agency to issue ratings. When t = 1 and \u03b1i = 1, the expected revenue of the rating agency i is the highest. In this situation, the expected revenue of the rating agency i is:When \u03b1i < m, rating agencies issue deflated ratings. In this situation, many issuers may decrease rating demands. Only when the rating threshold \u03b1i is the real proportion of type-A bonds can the issuers pay for the rating service. In this situation, the expected revenue of the rating agency i is:When According to i and j have different reputational rankings in rating industry, and their rating thresholds are also different. The rating threshold of rating agency j is m. The rating fees for rating agency i and rating agency j are \u03d5i. If the rating accuracy of rating agency i is low, other rating agencies will replace it. In this situation, the demand function of rating agency i is:In period 0, the regulator requires issuers to buy two ratings from the two rating agencies. We suppose that rating agencies i is higher than that of rating agency j. In this situation, the rating agency i issues accurate ratings, namely, \u03b1i = m, whereas rating agency j provides inflated ratings, namely, \u03b1j > m. The rating fees of the two rating agencies are \u03d5i. According to i is i is:The reputational ranking of rating agency i is lower than that of rating agency j. In this situation, the rating agency i issues inflated ratings, namely, \u03b1i > m, whereas rating agency j provides accurate ratings, namely, \u03b1j = m. The rating fees of the two agencies are \u03d5i. According to i is i is:The reputational ranking of rating agency According to \u03c1RA \u2208 and global-partnered ones  have many differences . As a reAs shown in We utilize panel ordered logit models to analyze the effects of different rating regulations on rating upgrades and downgrades. The dependent variables include rating upgrades and rating downgrades, which are dummy variables. If rating agencies provide rating upgrades or rating downgrades, it will be equal to 1; otherwise, 0. Due to the lack of direct variables to describe different rating regulations, we chose the rating scores of corporate bonds provided by one rating agency, and the average rating scores provided by two and three rating agencies, as proxy variables.In The results demonstrate that the effort of rating agencies is the highest for the dual-rating regulation, and rating agencies can improve their efforts to provide more rating information under different rating regulations.In The results show that the probability of rating defaults is the lowest under the dual-rating regulation, and rating agencies can decrease rating defaults under different rating regulations.To further illustrate the robustness of the results, we utilized the regression results for the models that did not include control variables as the control group . We direAs shown in Tables Overall, the empirical results show that the dual-rating regulation is best for preventing rating inflation and improving rating quality.In this study, we investigated the regulatory effects of different rating regulations on corporate bond ratings. Using the dual reputational rating shopping and the panel ordered logit models, we draw the following conclusions:First, when investors\u2019 and regulators\u2019 penalty rates are low, the single-rating regulation is effective in improving rating quality. However, because of low reputation effect, the dual-rating regulation is ineffective in controlling inflation.Second, when investors\u2019 and regulators\u2019 penalty rates are high, the regulatory effect of the dual-rating regulation is better than that of the single-rating regulation.Third, the comparison of the effects of different rating regulations on rating upgrades shows that rating agencies are more stringent in providing rating upgrades under the single-rating and dual-rating regulations compared to the multi-rating regulation.Fourth, the comparison of the effects of different rating regulations on rating downgrades suggest that the three rating regulations are effective in decreasing rating deflation. The regulatory effect of the dual-rating regulation is the best, and rating agencies can improve rating quality under this regulation.Fifth, the effort of rating agencies is the highest under the dual-rating regulation, and rating agencies can improve their efforts to provide more rating information under different rating regulations.Finally, the probability of rating defaults is the lowest under the dual-rating regulation, and rating agencies can decrease rating defaults under different rating regulations.Based on the current state of the Chinese rating industry, we can develop many new theoretical models to analyze the available conditions of different rating regulations. Meanwhile, given the development of data mining, we will utilize the latest empirical models to discuss the regulatory effect of rating regulations on rating quality.S1 Data(XLSX)Click here for additional data file.S2 Data(XLSX)Click here for additional data file.S3 Data(XLSX)Click here for additional data file.S1 Appendix(DOCX)Click here for additional data file."}
+{"text": "Three new benzothiadiazole (BTD)-containing luminophores with different configurations of aryl linkers have been prepared via Pd-catalyzed cross-coupling Suzuki and Buchwald\u2013Hartwig reactions. Photophysical and electroluminescent properties of the compounds were investigated to estimate their potential for optoelectronic applications. All synthesized structures have sufficiently high quantum yields in film. The BTD with aryl bridged carbazole unit demonstrated the highest electrons and holes mobility in a series. OLED with light-emitting layer (EML) based on this compound exhibited the highest brightness, as well as current and luminous efficiency. The synthesized compounds are not only luminophores with a high photoluminescence quantum yield, but also active transport centers for charge carriers in EML of OLED devices. The studies on covalently linked donor\u2013acceptor (D-A) molecular systems have attracted considerable interest in different organic electronic applications ,19,20,21Taking into account the facts mentioned above and in continuation of our research in the field , here weD1 included a sequence of two Pd-catalyzed cross-coupling reactions starting from readily available 4-bromosubstituted BTD 1  cyclohexane) is a hole transport layer (HTL) widely used in OLEDs +: 336.0388; found: 336.0381.Under argon in a Schlenk tube with a magnetic stirring bar, carbazole  and Cs3) , KOAc , bis(pinacolato)diboron  were added followed by dry dioxane (15 mL). The solution was degassed by argon before adding PdCl2(dppf) . Then, the reaction mixture was stirred at 95 \u00b0C (oil bath temperature) for 24 h. After cooling to room temperature, the mixture was poured into water and extracted with dichloromethane (3 \u00d7 10 mL). The combined organic phases were washed with brine, dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure. Purification by chromatography (eluent\u2013hexane:ethyl acetate 15:1) gave the product  as a white solid. M.p. 111\u2013112 \u00b0C. 1H NMR  \u03b4 8.15 , 7.87 , 7.79 , 7.48 , 7.38 , 7.29\u20137.24 , 7.03 , 2.00 , 1.32 ; 13C NMR  \u03b4 141.4, 140.9, 135.9, 135.8, 135.1, 131.1, 125.9, 123.1, 120.4, 119.5, 110.0, 84.1, 25.0, 17.9, missing one carbon (C-B) due to interaction with the boron atom. HRMS: calcd for C25H27BNO2 [M + H]+: 384.2134; found: 384.2138.Under argon in a Schlenk tube with a magnetic stirring bar, 9-(5-bromo-2-methylphenyl)-9H-carbazole (1) (0.5 mmol), ArBPin or ArB(OH)2 (1.2 equiv.), 1,4-dioxane-water mixture , NaHCO3 (3 equiv.) and Pd(PPh3)2Cl2 (5 mol %). The resulting mixture was deaerated with argon and refluxed under argon for 6 h. On completion, the mixture was poured into water and extracted with dichloromethane (3 \u00d7 10 mL). The combined organic phases were washed with brine, dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure. Purification by chromatography (eluent\u2013hexane:ethyl acetate 30:1) gave analytically pure products.A 25 mL round-bottom flask, equipped with a magnetic stir bar and a reflux condenser, was charged with 4-bromo-7-(4-methoxyphenyl)-2,1,3-benzothiadiazole aniline as red solid . M.p. 227\u2013228 \u00b0C. 1H NMR  \u03b4 8.03 , 7.80 , 7.53 , 7.48 , 7.00 , 3.37 , 3.09 , 2.01 . 13C NMR  \u03b4 160.2, 155.0, 143.7, 133.8, 131.8, 131.0, 130.8, 129.9, 127.6, 126.7, 121.4, 114.3, 54.9, 17.8. HRMS: calcd. for C21H20N3OS [M + H]+: 362.1327; found: 362.1326.Following the general procedure 2 , bromobenzene (2.2 equiv.), palladium acetate (5 mol %), tri-tert-butylphosphonium tetrafluoroborate (10 mol %) and sodium tert-butoxide (2.4 equiv.) were dissolved in dry 1,4-dioxane (4 mL). The solution was degassed by argon. Then, the reaction mixture was stirred at 100 \u00b0C (oil bath temperature) for 24 h. After cooling to room temperature, the mixture was poured into water and extracted with dichloromethane (3 \u00d7 10 mL). The combined organic phases were washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. Purification by chromatography (eluent\u2013hexane:ethyl acetate 30:1) gave D1 as a yellow solid . M.p. 201\u2013203 \u00b0C. 1H NMR  \u03b4 8.02 , 7.89 , 7.54 , 7.47 , 7.11\u20137.05 , 7.01 , 6.82 , 3.37 , 2.19 . 13C NMR  \u03b4 160.5, 154.7, 146.5, 143.4, 138.3, 136.9, 133.3, 132.5, 131.1, 130.8, 130.4, 129.6, 127.2, 121.4, 120.3, 114.4, 54.9, 19.3. HRMS: calcd for C33H27N3OS [M]+: 513.1875; found: 513.1873.Under argon in a Schlenk tube with magnetic stirring bar, D2 was obtained from 1 and 9-phenyl)-9H-carbazole as a yellow solid . M.p. 210\u2013212 \u00b0C. 1H NMR  \u03b4 8.21 , 8.15 , 8.01 , 7.92 , 7.78 , 7.67 , 7.44 , 7.32 , 7.23 , 7.08 , 3.90 , 2.10 . 13C NMR  \u03b4 160.0, 154.3, 154.0, 141.2, 137.4, 136.8, 136.4, 133.3, 131.9, 131.3, 130.6, 129.9, 129.5, 128.1, 127.3, 126.1, 123.2, 120.5, 119.8, 114.2, 110.1, 55.5, 17.7. HRMS: calcd for C32H24N3OS [M + H]+: 498.1640; found: 498.1634.Following the general procedure D3 was obtained from 1 and 4-(9H-carbazol-9-yl)phenylboronic acid as a yellow solid . M.p. 234\u2013236 \u00b0C. 1H NMR  \u03b4 8.22 , 8.19 , 7.98 , 7.87 , 7.78 , 7.58 , 7.46 , 7.33 , 7.12 , 3.92 . 13C NMR  \u03b4 160.1, 154.3, 154.1, 140.8, 137.8, 136.6, 133.5, 131.6, 130.7, 130.6, 129.9, 128.5, 127.4, 127.2, 126.1, 123.6, 120.5, 120.2, 114.3, 110.1, 55.6. HRMS (APPI): calcd. for C31H21N3OS [M]+: 483.1400; found: 483.1402.Following the general procedure TM software for calculation of the phosphorescence lifetime values. Quantum yields of solid films photoluminescence and solution photoluminescence were measured by the absolute method. Light of photoluminescence was collected by Quanta-\u03c6 F-3029-sphere linked with Fluorolog 3 by Fiber-Optics adaptor FL-3000 produced by Horiba Jobin Yvon S.A.S. (France) Photoluminescence quantum yields were calculated by FluoroEssenceTM software.UV\u2013VIS spectra were measured using an AvaSpec-2048 spectrophotometer . The photoluminescence spectra were recorded at 77 K and 298 K, on the Fluorolog-3 spectrofluorometer system . The excitation source was a 450 W Xenon lamp with Czerny-Turner double monochromators, the registration channel was a R928 photomultiplier with Czerny-Turner double monochromators). Pulsed xenon lamp (150 W) was used for phosphorescence spectra and phosphorescence decay curve measurements. The phosphorescence decay curves were analyzed using the FluoroEssenceFor time-resolved photoluminescence spectroscopy was used an experimental setup based on Q-switch YAG/Nd laser , high-resolution monochromator , a fast PMT H10720  and an oscilloscope (Tektronix DPO 3054 (USA)). The third harmonic of YAG/Nd laser with wavelength 355 nm, pulse duration 6 ns and repetition rate 10 Hz was used for samples excitation. The photoluminescence decay was measured at a wavelength of 550 nm for all samples.4PF6, Fluka) in acetonitrile (ACN) was used as an electrolyte. An Ag wire immersed into the electrolyte solution with the addition of 0.1 M AgNO3 was used as a pseudo reference electrode (Ag/Ag+). It was calibrated against ferrocene/ferricenium couple (\u22120.039 V vs. Ag/Ag+) and its potential was recalculated to the energy scale using \u22124.988 eV value for Fc/Fc+ in ACN. Thus, the energy level of Ag/Ag+ in our case is \u22124.95 eV. The substances investigated (0.2 mg) were dissolved in 0.2 M solution of NBu4PF6 in ACN and placed into the working compartment of the electrochemical cell. The values of potentials corresponding to the HOMO and LUMO levels were determined by applying a tangent to the onset of anodic and cathodic currents. Obtained voltammograms are presented in the The HOMO/LUMO levels were determined by cyclic voltammetry (CV) using an potentiostat Autolab AUT204 . The CV experiment was carried out at the scan rate of 20 mV/s in a three-electrode, three-compartment electrochemical cell in the glove box with dry argon atmosphere. Platinum sheets served as working and counter electrodes. A 0.2 M solution of tetrabutylammonium hexafluorophosphate (NBu\u03bc) was measured by using the technique of charge extraction by linearly increasing voltage (CELIV) with metal-insulator-semiconductor (MIS) diode structures. A layer of the D1\u20133/mCP (10 wt %) composite of the thickness ds ranged between 100 nm and 130 nm was deposited onto SiO2/ITO/glass substrate by thermal co-evaporation of mCP and D1\u20133 in a chamber under 10\u22126 mbar vacuum. Then a 80 nm thick Al top electrode was deposited onto the composite layer also by thermal vacuum evaporation (TVE) of the material under 10\u22126 mbar residual pressure at rate of 1.0 \u00c5/s. A SiO2 layer of the thickness id = 70 nm was preliminary deposited onto ITO-coated glass by magnetron scattering at 10\u22123 mbar; the layer served as a charge carrier blocking layer. As a result, for measuring the mobility of charge carriers by the MIS-CELIV technique, the samples of the glass/ITO/SiO2 (70 nm)/D1\u20133/mCP (10%)/Al (80 nm) architecture were prepared. More experimental details and calculations of the charge carrier mobility are described in [In thin layers of the composites, charge carrier mobility . The substrates were pre-cleaned sequentially in an aqueous solution of a detergent, deionized water, and isopropyl alcohol in an ultrasonic bath for 10 min, respectively. Then, the substrates were dried in an Ar flow and treated in oxygen plasma for 2.5 min. The cleaned substrates were placed in a vacuum chamber in a special holder. Then the process of sequential deposition of hole transport, light-emitting, electron transport layers was carried out using TVE at a residual pressure of 4 \u00d7 10\u22126 mbar. After that, the samples were placed in special masks, through which a LiF (1 nm)/Al (80 nm) cathode was applied. The EL spectra of OLEDs were recorded on an AvaSpec-2048 spectrophotometer . Voltage\u2013current and voltage\u2013brightness characteristics were measured with Keithley 2601 Source-Meter (USA), Keithley 6485 pico-ammeter and TKA-04/3 luxmeter-brightness meter . The thicknesses of the films were determined using MII-4 interferometer . The preparation of OLED samples and measurements of their spectral and optoelectronic characteristics were performed at room temperature under argon atmosphere.Organic light-emitting diodes (OLEDs) were fabricated on glass substrates coated with a transparent conductive layer of indium-tin oxides InE(S1), E(T1), and E(T2)) based on the vertical excitations. The first five singlet and triplet excited states of were considered. The UV-VIS spectra were calculated using the range-separated CAM-B3LYP functional, which has been shown to better predict UV-VIS spectra of organic dyes [Geometry optimizations were performed without constraints at the B3LYP/6-31G(d) level using Gaussian 09 software (revision D.01) with corrections for solvation in xylene-mixture (the PCM model). The optimized geometry was verified to have no negative frequencies. Then TD-DFT was adopted at the same level to estimate the excitation energies . Despite the presence of a charge-transfer state and small values of \u2206E"}
+{"text": "Background: Despite daily variability in children's chronic pain experiences, little is known about how parents' emotions and goals toward their child's pain are influenced by these daily changes. This diary study examined how daily child pain intensity (as perceived by parents) moderates the associations between parental catastrophic thoughts about child pain on the one hand, and daily parental distress and parents' goals with regard to their child's pain (pain control vs. activity engagement) on the other hand.Method: Participants were 25 parents of 20 different children . Children, aged 8\u201314 years , experienced either chronic headache or functional abdominal pain with an average pain duration of 22.5 months (SD = 24.5 months). Daily parental responses  were collected through a 3-week daily diary . Parents completed the Pain Catastrophizing Scale for Parents prior to starting the diary  and a daily measure (PCS-P daily) included in the diary. To account for the interdependence of the data, the data were analyzed using multilevel modeling.Results: Perceived daily child pain intensity moderated the impact of parental general and daily catastrophic thoughts on parents' daily distress. Only for parents experiencing low general catastrophic thoughts an increase in distress was observed on days when they perceived their child's pain intensity as high. For all parents, high levels of perceived child pain intensity were related to more distress on days where parents reported high levels of catastrophic thinking . Perceived daily child pain intensity also moderated the impact of parental general catastrophic thinking on parents' daily endorsement of goals. Parents with high levels of general catastrophic thinking reported a lower focus on child pain control on days when child pain intensity was perceived to be low. Parents with low general catastrophic thinking reported lower endorsement of the activity engagement goal on days where the child's pain intensity was perceived to be low.Conclusion: These findings highlight the complexity of daily fluctuations in parental distress and goals regarding their child's pain. Clinical implications and future directions are critically assessed. Chronic pain in children is a common and serious health- and developmental problem that has a major impact on the child's daily living Palermo, . PrevaleChildhood chronic pain can be considered a substantial stressor for parents for which they need to find appropriate coping approaches to avoid or minimize pain-related disability. According to the Interpersonal Fear Avoidance model  with chronic headache or chronic functional abdominal pain, was to examine the associations between parental catastrophizing about the pain of their child, both in general and on a daily level, on the one hand, and daily parental distress and daily parental goals of child pain control vs. child activity engagement on the other hand. We expected that parents with high levels of catastrophic thoughts about their child's pain, compared to parents low on catastrophic thinking, would (1) experience more daily distress, (2) endorse the goal to relieve the pain of their child to a higher extent on a daily basis, but the goal to engage their child in activity engagement (in the presence of pain) less. While no difference in the direction of the associations was expected for general vs. daily parental catastrophic thinking, we expected that the hypothesized associations would be stronger for daily levels of catastrophizing compared to general levels  that consists of two parts; a cross-sectional questionnaire part, followed by an optional 3-week diary part, completed by both children with chronic pain and their parents. The current manuscript focuses on reporting the findings from the diary as completed by the parents and on parental catastrophizing as measured during the questionnaire study prior to starting the diary. The study was approved by the Ethics Committees of the Faculty of Psychological and Educational Sciences of Ghent University, University Hospital Ghent, AZ Maria Middelares Ghent, and General Hospital Nikolaas, Belgium.Families with children with chronic headaches or chronic functional abdominal pain were recruited through four Flemish hospitals . To be eligible for study participation, children had to be aged between 4 and 16 years, children had to be diagnosed by their physician with chronic headache or chronic functional abdominal pain, and both parent and child had to be Dutch-speaking. Children with a developmental disorder, mental delay or migraine were excluded. Families who met the inclusion criteria were informed about the study by their physician. Eighty-two families agreed to be contacted for study participation, of which 48 families  participated in the first part of the study . The main reason for non-participation was parent-reported lack of time. Of the 48 families (covering 62 parents) that completed the questionnaires, 24 families , also completed the diary part. Due to methodological reasons  7 parents were excluded from the analyses. The final sample consisted of 25 parents  of 20 different children. Demographics of the final sample of 25 parents, across 20 children, are presented in All families who were interested in participation and gave written consent to transfer their contact details to the researchers received a phone call with further detailed information about the study. If after receiving all necessary information parents were interested to participate, a home visit was scheduled. During the home visit, the study information was repeated, and parents provided informed consent for themselves and for the child. Children older than 12 years provided, in addition, written informed consent for themselves. In a first phase all parents and children (\u22659 years) completed questionnaires under supervision of a research assistant and the procedure of the diary study was explained. Following the home-visit, parents were sent an email containing a secured weblink to the online diary (LimeSurvey software). Parents were asked to complete the diary every evening for 21 consecutive days. Diaries were completed during school weeks and started shortly after the home visit. All families received 30 EUR as a compensation for participation-related costs.General parental catastrophizing about their child's pain was assessed by the Dutch Pain Catastrophizing Scale for Parents , magnification (the thought that something serious will happen due to the pain), and helplessness (the feeling that you cannot stand it anymore because of the pain), and yields a total score that ranges between 0 and 52, with higher scores indicating more catastrophic thoughts. The PCS-P demonstrated adequate internal consistency in the current study (\u03b1 = 0.90).Below is an overview of the constructs assessed by the diary. All diary items were rated on a 7-point Likert-scale . For constructs assessed by multiple items, the mean of the respective items was calculated, resulting in a total score ranging from 0 to 6. Level-specific reliabilities were estimated based upon a multilevel confirmatory factor analysis framework. Within-parent, between-parent, and between-couple alphas are reported in Perceived daily child pain intensity was reported by the parents and measured by one item: \u201cHow much pain did your child experience today, on average, according to you?\u201dDaily parental distress when confronted with their child's pain was assessed by means of seven items, based upon the theory of Batson et al.  or encouraging their child to engage in activities . The items were formulated based on the items used in the vignette study by Caes et al. . Diaries completed after 10 AM the next day or before 4 PM the same day were deleted (N = 16)  are nested within the participating parents (Level 2), which are nested within a particular family (Level 3). To account for this interdependence and hierarchical nesting of the data, the data were analyzed by means of multilevel modeling  the same set of analyses was performed to test the hypotheses. In a first step, a baseline model, without any predictors was run to calculate the level of variance in the dependent variables accounted for by the variables between parents (Level 2) and within parents (Level 1). In the second step, we added the Level 3 control variables child age, child sex and pain duration. These demographic variables were included in the models as evidence in the literature highlights that pain experiences, and parental responses vary depending on the child's age, sex and pain duration  = 11.36; p < 0.001, r = 0.41] and perceived daily child pain intensity . No main effect of general parental catastrophic thinking  was found. The random error terms for perceived daily child pain intensity and PCS-P daily were significant, so the interaction terms  were added in step 5. Both interaction terms were significant.The intercept model indicated that 11.22% of the variance in parental distress was accounted for by variables on the third level (between families or child characteristics), 62.78% by variables on the second level (parent characteristics), and 38.32% by variables on the first level (within parents or daily characteristics). The model exploring the main effects of the variables across all levels (steps 2\u20134) revealed a significant positive effect of daily parental catastrophic thinking (PCS-P daily) . This interaction reveals that on days that parents catastrophize a lot about their child's pain, their distress is strongly influenced by the daily level of perceived child pain intensity with higher levels of perceived child pain intensity related to more parental distress. On days that parents experience low levels of catastrophic thoughts; parental distress remains lower compared to days on which parents catastrophize a lot and the perceived level of the child's pain intensity does not add much to explaining this distress level  = \u22124.26; p < 0.001, r = 0.18] was found. This finding indicates that for parents with low general levels of catastrophic thoughts about their child's pain, increasing levels of perceived daily child pain intensity were related with increased levels of daily parental distress. However, for parents with high general levels of catastrophic thinking, the perceived level of daily child pain intensity did not add much explanation to the experienced level of daily parental distress  = 5.87; p < 0.001, r = 0.30] and perceived daily child pain intensity . No main effect of general parental catastrophic thinking  was found. The random error terms for perceived daily child pain intensity and PCS-P daily were significant, so the interaction terms  were added in step 5.The intercept model indicated that 25.57% of the variance in the pain control goal was accounted for by variables on the third level (between families or child characteristics), 73.05% by variables on the second level (parent characteristics), and 1.38% by variables on the first level (within parents or daily characteristics). The model exploring the main effects of the variables across all levels (steps 2\u20134) revealed a significant positive effect of daily parental catastrophic thinking (PCS-P daily) . This significant positive interaction reveals no differences between parents with low and high levels of general catastrophizing on days that parents perceive high levels of pain intensity in their child, with all parents showing higher endorsement of the pain control goal on such days. However, on days where perceived child experiences of pain intensity is low, parents with high levels of general catastrophizing show a much more reduced focus on pain control compared to parents with low levels of general catastrophic thinking  was found to be significant , which indicates that parents endorse the activity engagement goal less for girls compared to boys. Furthermore, significant positive effect of daily parental catastrophic thinking (PCS-P daily)  and perceived daily child pain intensity  was found. No main effect of general parental catastrophic thinking  was found. The random error terms for perceived daily child pain intensity and PCS-P daily were significant, so the interaction terms  were added in step 5.The intercept model indicated that 49.52% of the variance in parental priority for the activity engagement goal was accounted for by variables on the third level (between families or child characteristics), 46.44% by variables on the second level (parent characteristics), and 4.03% by variables on the first level (within parents or daily characteristics). The model exploring the main effects of the variables across all levels (steps 2\u20134) revealed a significant negative effect of child sex . This significant negative interaction reveals that for parents with high general levels of catastrophic thoughts about their child's pain, the pursuit of the activity engagement goal is always moderately high and not influenced by perceived daily levels of child pain intensity. However, for parents with low general levels of catastrophic thinking, the focus on activity engagement shows more flexibility depending on the level of perceived child pain intensity: the lower the perceived child pain intensity, the lower the motivation to encourage activity engagement in their child  was found to be significant [\u03b3hild see . ResultsGiven the critical role parents play in understanding childhood chronic pain experiences, the current diary study explored how parental catastrophic thinking about their child's pain influences parents' daily experiences of distress and endorsement of pain control and/or activity engagement goals for their child, and how these associations were influenced by daily perceptions in fluctuations of child pain intensity. For parental levels of distress, our findings revealed that both the impact of general and daily parental catastrophic thoughts was moderated by perceived child's pain intensity levels. Daily fluctuations in perceived child pain intensity had the strongest impact for parents with low levels of general catastrophic thoughts about their child's pain , as increasing levels of perceived daily child pain intensity were related with increased levels of daily parental distress. However, for daily levels of parental catastrophic thoughts, the level of perceived child pain intensity mostly modulated parental distress on days where parents catastrophized a lot about their child's pain: on days where parents endorsed high levels of catastrophic thoughts, high levels of perceived child pain intensity were associated with higher levels of parental distress.With respect to parents' daily goal pursuit, the findings illustrate how parents focus on both pain control and activity engagement on days when they have higher levels of catastrophic thoughts about their child pain. This was unrelated to the perceived levels of child pain intensity on that day. On the other hand, the impact of general catastrophic thoughts about their child's pain  was influenced by the level of perceived pain intensity: on days where low levels of child pain intensity were perceived, a reduced focus on pain control was reported by parents with high levels of catastrophic thoughts , while parents with low catastrophic thoughts rather reported a reduced focus on child activity engagement .In sum, these results highlight how parental coping with their child chronic pain fluctuates considerably from day to day, with the impact of parental general tendencies  moderated by daily perceived fluctuations in the child's pain experiences. Such daily differences underscore the need for continuous and situation specific assessment for a comprehensive understanding of how parents cope with their child's chronic pain. It is also interesting to note though that the variability in parents' daily coping responses was situated on different levels depending on the type of coping responses . Indeed, for parental distress most variability was observed between days within the same parent, while for the endorsement of the pain control and activity engagement goal the variability was mostly observed between parents/families. This indicates that parental distress experiences are likely mostly influenced by situational characteristics of a particular day, while goal endorsement is mostly impacted by more stable characteristics of the parent and/or couple. While these preliminary observations need further confirmation, these findings could be of clinical relevance as it allows providing parents an insight on how their emotional responses are variable and changeable. Insight in such variability provides opportunities to teach parents appropriate emotion regulation techniques which would allow them to manage their daily changing levels of distress and engage in more optimal responses.For distress, the results are largely confirming accumulating evidence revealing how parents with high levels of catastrophic thoughts about their child experience heightened feelings of distress  impact how much parents attune their coping responses to the child's pain characteristics. Following this reasoning, it is likely to assume that on days where parents report lower levels of catastrophic thoughts, they feel less threatened by the child's pain, and hence can accordingly attune their responses as reflected in a lesser need to encourage activity engagement. Alternatively, social desirability could also play a role in explaining this unexpected association. Future research is needed to entangle this complexity.The findings with respect to parental goal endorsement are more complex and not completely in line with our hypotheses. For instance, the role of daily parental catastrophic thinking on their goal endorsements was not associated with the perceived level of the child's pain intensity on that particular day and revealed a counterintuitive simultaneous endorsement of both pain control and activity engagement goals on days parents report high levels of catastrophic thinking (as measures by the PCS-P daily). Based on previous evidence  of our target range . This has important implications for our findings as younger children are more dependent on their parents, which could substantially influence parental goals as well as coping responses. Replication within an older sample of adolescents with chronic pain is advised. Lastly, given our focus on children with chronic headache or functional abdominal pain, the results may not be applicable to other pain conditions or different pain locations .Beyond the limitations related to generalization of the findings, it is important to recognize that the level of daily child pain intensity was reported by the parent, rather than the child, thereby potentially introducing a reporting bias and preventing us from inferring causal effects. Previous evidence indeed highlights discrepancies between parent and child reports on the child's functioning, particularly when parents endorse high levels of catastrophic thinking .The study was approved by the Ethics Committees of the Faculty of Psychological and Educational Sciences of Ghent University, University Hospital Ghent, AZ Maria Middelares Ghent, and General Hospital Nikolaas, Belgium. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.LC designed the study procedures, assisted with data collection, took the lead on data analyses, and wrote up the results and discussion section. CG assisted with data collection and contributed substantially to the write up of the manuscript, taking the lead on writing up the methods section, and providing feedback on all other sections. EV, MV, and KK assisted with recruitment of the patients in their respective clinics and provided feedback on all sections of the manuscript. LG assisted with the design of the study procedures and contributed substantially to the write up of the manuscript, taking the lead on writing up the introduction section, and providing feedback on all other sections. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The condition of teeth and function of the oral organs are important when playing wind or brass instruments. Although there are some reports on dental treatment for musicians, few studies have investigated their acoustic performance following treatment. This report describes the prosthodontic rehabilitation provided for an oboist who had lost a tooth as a result of trauma and includes an evaluation of her subsequent musical performance using acoustic analyzes.The patient was a 63-year-old professional oboe player who fractured the upper and lower alveolar bone and avulsed the upper right central incisor during a fall due to epileptic seizure. While the alveolar fracture was healing, she sought maxillofacial rehabilitation for the missing tooth to maintain her ability to play the oboe. Her rehabilitation consisted of a provisional removable prosthesis with an acrylic base and clasps followed by a fixed implant prosthesis. A recording of her musical performance was objectively analyzed at each stage of treatment. Rhythm analysis confirmed the stability of notes played rapidly. Her performance dynamics were analyzed by psychoacoustic measurements. Her satisfaction with the prosthesis was assessed by a self-reported questionnaire. The results of the acoustic evaluation helped to adjust the provisional prosthesis so that it was suitable for playing the oboe and the final prosthesis was designed accordingly.Prosthetic dental treatment for this patient included both subjective and objective evaluations that helped to ensure that she could continue playing the oboe at her previous performance level. AccordiIn an experimental study of musical performance, objective acoustic analyzes could reveal changes in the oral cavity . A case This report describes a prosthetic rehabilitation in an older professional oboist. She was an experienced music teacher and lost a front tooth due to trauma. The prosthodontist objectively assessed her musical performance using acoustic analyzes which guided the prosthetic treatment.2.A 63-year-old woman visited our clinic in 2012 complaining about difficulties in playing the oboe following an accident. She had been an oboe, recorder, and piano teacher for 40\u2009years. Apart from otitis media and hypertension, she had had no known health issues until a week earlier, when she had fallen at home due to an epileptic seizure. She fractured the upper and lower alveolar bone, avulsed and lost the upper right central incisor. Immediately afterward, an oral surgeon reduced the fractures, splinted the teeth using dental adhesive resin cement, and sutured the ruptured gingiva and lip. Seven days later, she was referred to the Department of Maxillofacial Prosthetics, Graduate School, Tokyo Medical and Dental University (TMDU), Tokyo, Japan for dental treatment.She could walk and speak normally. She felt a little pain around the trauma site but had hypoesthesia on the right lower lip and the surrounding area. The upper right central incisor was missing  and therOptions for definitive prosthetic rehabilitation were explained to the patient including removable prosthesis, fixed partial denture, or a fixed implant prosthesis. She chose a fixed implant prosthesis, and early insertion of the implant fixture was planned.Immediately after taking an impression and jaw registration, a removable prosthesis consisting of an artificial tooth and acrylic base was inserted and adjusted. The patient was advised to start with easy practice and playing. The prosthesis had an artificial tooth, acrylic base, and two wire clasps on both first premolars. When the prosthesis was tried, the acrylic base on the palate was reduced according to performance and patient preference .Two weeks later, a titanium dental implant  was placed in the position of the missing incisor . The impA self-reported questionnaire was used to assess the patient\u2019s sensation of the stability and comfort of the removable prosthesis, fit of the oboe reed, blowing comfort, sound quality, and overall satisfaction. Each item was assessed for the removable prosthesis before and after adjustment and the provisional and final superstructures of the implant prosthesis. For comparison, the patient retrospectively assessed each item before the injury.Musical performance was assessed using an acoustic analysis system when the provisional removable prosthesis was tried in/adjusted and when the final prosthesis was seated. Her tonguing control was assessed with rhythm analyzes  by recorAs precise control of dynamics is also important for expressive performance, performance in three different dynamics was evaluated using psychoacoustic analyzes , 2015. A3.The hypoesthesia lessened in the first 2\u2009months and had disappeared entirely by 1\u2009year after the accident. The removable prosthesis and final implant-supported prosthesis fit well and were stable. The patient was able to eat, swallow, and speak well. There was no pain or irritation in the surrounding tissue and the esthetic outcome was excellent. The patient felt discomfort with the removable prosthesis but this diminished when seating the implant prosthesis. The patient rated the final prosthesis suitable for playing the oboe .The expert review showed that the recording sounded comfortable and with more air blown in when final prosthesis was worn .The CV for note length while trying to play a steady rhythm was larger with the removable prosthesis than without it but decreased when the prosthesis was adjusted. The CV was the smallest with the final prosthesis .During 8\u2009years of follow-up after delivery of the final prosthesis, there were no occlusal changes or any bone resorption around the implant . The pat4.The best option to save an avulsed tooth is an immediate reimplantation . HoweverOur patient perceived differences in stability among the prostheses, possibly because the displacement of the removable prosthesis caused by the pressure of the mouthpiece. Discomfort of the removable prosthesis could be explained by the acrylic base on the lingual side where tonguing is performed. In her case, the tooth loss was trauma-related and there was no bone defect, which is why the acrylic base interfered with the performance. Her overall satisfaction was primarily based on the mouthpiece fit and blowing comfort. The acoustic analyzes showed that the patient could play at a relatively high level even without a prosthesis or with the adjustable prosthesis, but more effort was required to achieve a given level of performance resulting in less comfortable playing.Her tonguing control was assessed by rhythm analyzes. Her control was worst with the removable prosthesis before adjustment. Possibly, it was due to the acrylic base in the maxilla made tonguing difficult to control owing to its thickness and loss of sensory feedback from the oral mucosa. Her tonguing became more stable after a base adjustment indicating that the loss of the central incisor affected her playing. The patient showed the best control of rhythm when the final implant-supported prosthesis was seated.Psychoacoustic analyzes  showed tIn the present patient, the evaluation was performed soon after the prosthesis was tried or inserted. A chronological evaluation over longer periods should be investigated in the future. Notably, the patient returned to music even under imperfect conditions. This suggests that patients should be encouraged to return playing there instrument as soon as possible even under imperfect conditions. However, a prompt return to music does not necessarily correspond to full satisfaction. Dentists should always aim for ongoing rehabilitation including adjusting the prosthesis or seeking a further prosthetic treatment, but irreversible treatments should be performed with caution and informed consent.5.Subjective and objective evaluations of a musician\u2019s ability to play their instrument in prosthetic rehabilitation can help dentists to assess performance levels, the treatment satisfaction of the patient and optimize the treatment.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.The studies involving human participants were reviewed and approved by Ethics Committee of the Faculty of Dentistry, Tokyo Medical and Dental University . The patient provided her written informed consent to participate in this study. Written informed consent was obtained from the individual for the publication of any potentially identifiable images or data included in this article.MH and YS: conceptualization. MH and MI: treatment. MH: psychoacoustic analysis. SP: validation. MH, SP, MI, and YS: investigation. MH: data curation and writing \u2013 original draft preparation. YS: writing \u2013 review and editing. NW: supervision and project administration. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.The authors declare that this study received funding from Yamaha Corporation. The funder had the following involvement in the study: study design and decision to publish.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Mage\u2009=\u20092.81), 239 , and 189  children from 25 childcare centers participated in this study. Familial risk factors were assessed at T1 using a caregiver interview and questionnaire. Narrative coherence was assessed using the MacArthur Story Stem Battery that was administered to the children at T2. Children\u2019s emotional problems were rated by the caregivers and by their teachers at T2 and T3. Results suggest that familial risk factors are linked to more emotional problems both in the short-term (T2) and the long-term (T3). Further, although some of the effects of relevant magnitude did not reach statistical significance, results pertaining to the role of narrative coherence indicate that it might have a promotive and protective effect in the short-term as well as a promotive effect in the long-term. These findings point to the relevance of children\u2019s narrative coherence as a cognitive ability and personality factor that contributes to more positive development and to better coping with adverse familial experiences.The present study is a longitudinal extension (long-term follow-up) of a previous study examining the promotive and protective role of children\u2019s narrative coherence in the association between early familial risk factors and children\u2019s emotional problems from early to middle childhood. A total of 293 (T1;  During the first 3\u2009years of life, most children develop from the state of a newborn that is dependent on their caregivers\u2019 care even in the most basic of tasks, to a child that can or begins to show highly complex behaviors: They acquire fine and gross motor skills , they beThe familial context is central during the first years of life . On the One key individual characteristic that has been found to protect from the detrimental effects of familial risk factors, is narrative coherence . Reese eA central aspect of children\u2019s wellbeing is emotional wellbeing. Given that emotional problems such as anxiety and depression are important public health issues , the preThe present study aimed to expand our knowledge about the longitudinal role of narrative coherence in the interplay between early familial risks and children\u2019s emotional development from early to middle childhood. The study is a longitudinal extension of a previous cross-sectional study that was published by H1: Early familial risks are positively associated with emotional problems in middle childhood.H2: Narrative coherence in early childhood is negatively associated with emotional problems in middle childhood.H3: Narrative coherence in early childhood buffers the effect of early familial risks on emotional problems in middle childhood.2.2.1.Mage\u2009=\u20092.81; SDage\u2009=\u20090.55; 47.9% female) and their primary caregivers. In 2010, a sample of 239 children  agreed to continue their participation in the second wave of data collection . Finally, a long-term follow-up was carried out in 2016 (T3) and 189 children  and their primary caregivers agreed to participate again (participation rate\u2009=\u200965% of the T1 sample and 79% of the T2 subsample). The sample was well educated, with 63.1, 64.8, and 69.5% of primary caregivers with at least a university degree in T1, T2, and T3, respectively. As for nationality, 89.2% of the primary caregivers were Swiss. Only 15.8% of the primary caregivers reported not speaking German in their homes. This study was not preregistered.Twenty-five childcare centers were recruited from different cantons of German-speaking Switzerland. All 63 childcare center groups were included. A total of three waves of data assessment were realized. The first assessment (T1) was done in 2009 and included 293 children . As for the reliability, McDonald\u2019s omega values were 0.75 for T2 and 0.65 for T3. Descriptive statistics are shown in The primary caregivers ire SDQ;  both T2 interest . This stinterest . Only thinterest , two ite2.3.3.MacArthur Story Stem Battery  and an expressive language task from the Test 6\u20136 .2.4.t-tests showed that children who participated in both T1 and T2 had comparable family risk scores  to those that only participated in T1. However, lower scores of familial risk factors were found between children participating in T2 and T3 as opposed to those dropping out after T2 . These two groups also had comparable scores for emotional problems  and narrative coherence  at T2. Accordingly, the Full Information Maximum Likelihood (FIML) method was used  and of the modeling details can be found elsewhere . All latwas used . As for was used , we usedwas used  to corre3.Results from the structural equation model are displayed in 3.1.\u03b2\u2009=\u2009\u22120.15; p\u2009=\u20090.26).A higher number of familial risk factors was significantly associated with higher scores in multi-informant emotional problems in early childhood, with a small-to-medium effect size. In contrast, higher scores on narrative coherence were linked to lower scores on emotional problems , although the small-to-medium effect did not reach statistical significance. Additionally, an indication of a protective effect was found in that higher scores on narrative coherence were linked to weaker associations between familial risk factors and emotional problems, although this effect did also not reach statistical significance. As for the control variables, no significant effects were found, although expressive language skills were found to show a small-to-weak negative effect on emotional problems . In contrast, language skills were found to have a non-significant positive effect on changes in emotional problems .Emotional problems in middle childhood were found to be weakly but not significantly linked to emotional problems in middle childhood over and above all other predictors and control variables in the model. Further, familial risk factors were found to lead to more positive changes3.3.\u03b2\u2009=\u2009\u22120.18, p\u2009=\u20090.09). Further, a marginally significant positive correlation between narrative coherence at T2 and cognitive  as well as linguistic skills  was found, with small to moderate effect sizes. While age was found to be positively correlated to narrative coherence at T2 , no gender difference was found . Additionally, familial risk factors were linked to lower cognitive ability  but not to language skills , gender , or age . Turning to the correlations among the covariates, children\u2019s cognitive skills were positively correlated to their linguistic skills , and females were found to score marginally higher on cognitive skills as opposed to males , while no correlation to age was found . Moreover, linguistic skills were uncorrelated to gender , while older children reached significantly higher scores on linguistic skills . Finally, age and gender were not found to be correlated .Narrative coherence at T2 was found to have a marginally significant, small to moderate negative correlation to familial risk factors  and suggests that early familial risks might have long-term effects on children\u2019s emotional development. The bivariate correlations suggest that this link is very different among the three indicators of emotional problems, although there is a general tendency for a positive trend. This pattern of results obtains a certain relevance if the time lag of 6 years between the assessments is considered. However, more research is needed to confirm the validity of this long-term result.Familial risk factors had a positive and marginally significant effect on emotional problems in middle childhood over and above emotional problems in early childhood . This result is in line with those obtained by 4.2.Children\u2019s narrative coherence was found to have both a promotive and a protective short-term effect on emotional problems in early childhood, although both effects did not reach statistical significance despite having a small-to-medium effect size. Accordingly, hypotheses 2 and 3 must be rejected. This absence of statistical significance combined with the relevant magnitude of the effects suggest that the statistical power of the present analyzes was limited. This lack of power might also be attributed to a relatively low reliability of narrative coherence and to the manifest nature of the familial risk variable. Nonetheless, we would argue that these results point toward a possible short-term effect of narrative coherence: Children that are able to tell more coherent narratives in the context of a conflict-based story stem tend to be rated as lower on emotional problems by their caregivers and teachers. Further, these children seem to suffer less from the undesirable effects of early familial risks. These results are in line with those obtained by As for the longitudinal results, narrative coherence was found to have a significant medium-to-large promotive effect on emotional problems in middle childhood over and above emotional problems in early childhood. However, the corresponding long-term protective effect resulted as very small and non-significant. Given that this is the first study to address these research questions with a long-term perspective, the validity of these results remains to be confirmed in future studies. Thus far, we can tentatively derive from these results that narrative coherence seems to be beneficial for all children even in the long-term and to only have a minimal effect on reducing the long-term effects of early familial risks. This conclusion is in line with the concept of narrative coherence as the ability of an individual to build an internal working model of her/his environment  and to sOverall, our results are in line with the assumptions of the resilience model  as they As far as implications for practice are concerned, our results imply that fostering children\u2019s narrative coherence might be an avenue for both more adaptive emotional developments and better coping with familial risk factors. In line with suggestions by 4.3.The present results must be interpreted in the light of the following limitations: Familial risk factors and children\u2019s emotional problems were assessed using self-reports or other-reports and are thus subject to validity issues such as social desirability, selective perception, and memory effects. However, narrative coherence as well as cognitive and language skills were assessed using different methods thus counteracting the common methods bias. Another limitation is the suboptimal reliability of emotional problems and narrative coherence as well as the absence of scalar invariance in emotional problems. These results might have reduced the chances of finding the hypothesized effects. Further, familial risk factors were modeled without accounting for the severity of the various risk factors. In combination with the community-based sample of the present study, the interpretation of family risk factors must be made with caution. Finally, while the prolonged time window between assessments in this study is very valuable, it remains to be studied how the effects of familial risk factors and various promotive and protective factors unfold over time. This question needs to be addressed with more frequent assessments across childhood and thereafter. These conclusions notwithstanding, the unique end novel contributions of the present study enhance our understanding of the complex interplay between risk, promotive, and protective factors in early childhood.The original contributions presented in the study are included in the supplementary material, further inquiries can be directed to the corresponding author/s.Ethical review and approval were not required for the study on human participants in accordance with the local legislation and institutional requirements. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin.FS was responsible for the data management, analyzed and interpreted the data, and wrote the first draft of the manuscript for the present study with valuable feedback from CWS and OG-H. CWS acquired the funding, designed, and managed the study, collected and developed the instruments, and recruited the sample. OG-H helped recruit the sample, organized the data collection, and collected the data together with several undergraduate students. FS, CWS, and OG-H have critically reviewed and revised the manuscript. All authors have read the final version of the manuscript and agreed to publish it in its present form.This study was supported by the Swiss National Science Foundation (Grant Nos. 100019_166003 and 100014_124949) and the Jacobs Foundation. The publication was funded by the Swiss National Science Foundation.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The effect of the SGLT2 inhibitor was similar between HF patients with CKD and those without (P\u00a0=\u00a00.86) (FigureWe analysed four large\u2010scale RCTs selected in the paper by Pandey Renal dysfunction frequently coexists with HF, and the presence of both is associated with worse clinical outcomes than either condition alone. Therefore, the patients with coexistence of HF and CKD need aggressive medical treatment. SGLT2 inhibitors are novel glucose\u2010lowering agents. SGLT2 inhibitors suppress glucose reabsorption by the proximal renal tubules and show an insulin\u2010independent glucose\u2010lowering effect."}
+{"text": "To verify understanding and awareness of fertility preservation (FP) in pediatric patients undergoing FP treatments.A questionnaire survey was conducted before and after explanation of fertility issues and FP treatments for patients 6\u201317 years old who visited or were hospitalized for the purpose of ovarian tissue cryopreservation (OTC) or oocyte cryopreservation (OC), or sperm cryopreservation between October 2018 and April 2022. This study was approved by the institutional review board at St. Marianna University School of Medicine .Participants in the study comprised 36 children . Overall mean age was 13.3 \u00b1 3.0 years. The underlying diseases were diverse, with leukemia in 14 patients (38.9%), brain tumor in 4 patients (11.1%). The questionnaire survey before the explanation showed that 19 patients (52.8%) wanted to have children in the future, but 15 (41.7%) were unsure of future wishes to raise children. And most children expressed some degree of understanding of the treatment being planned for the underlying disease . Similarly, most children understood that the treatment would affect their fertility . When asked if they would like to hear a story about how to become a mother or father after FP which including information of FP, half answered \u201cDon\u2019t mind\u201d . After being provided with information about FP treatment, all participants answered that they understood the adverse effects on fertility of treatments for the underlying disease. Regarding FP treatment, 32 children (88.9%) expressed understanding for FP and 26 (72.2%) wished to receive FP. \u201cFear\u201d and \u201cPain\u201d and \u201cCosts\u201d were frequently cited as concerns about FP. Following explanations, 33 children (91.7%) answered \u201cHappy I heard the story\u201d and no children answered, \u201cWish I hadn\u2019t heard the story\u201d. Finally, 28 of the 34 girls (82.4%) underwent OTC and one girl underwent OC.The fact that all patients responded positively to the explanations of FP treatment is very informative. This is considered largely attributable to the patients themselves being involved in the decision-making process for FP.Explanations of FP for children appear valid if age-appropriate explanations are provided. In recent years, interest in post-treatment quality of life and the late complications of cancer survivors has been increasing. Furthermore, with the aim of popularizing and developing fertility preservation (FP), the \u201cOncofertility Consortium\u201d and \u201cFertiPROTEKT\u201d were established in 2006, followed by the International Society for Fertility Preservation in 2009, the Japan Society for Fertility Preservation (JSFP) in 2012, and the Asian Society for Fertility Preservation in 2015  4),,, E,,, E4),,We therefore undertook a preliminary survey on the perception of FP in pediatric patients, the degree of understanding of FP after provision of an explanation, and feelings toward FP. We believe that this survey will provide basic insights into the actual feelings of pediatric patients and should contribute to the implementation of high-quality FP for pediatric patients.Participants in this study were children between 6 and 17 years old who visited our hospital for the purposes of FP consultation or who were hospitalized for the purpose of OTC between October 2018 and July 2022. All children had a malignant disease such as leukemia or a disease such as aplastic anemia or chronic active Epstein-Barr virus (EBV) infection, in which there was a possibility that treatment of the primary disease with chemotherapy and/or radiotherapy would greatly impair future fertility.Before providing an explanation of FP, we gave the parents and child a leaflet created by the JSFP. After reading the leaflet, the parents and child were given an explanation about FP alike telling a story (suppl. 1). However, we did not verify whether parents had told the child about the contents of the leaflet before the explanation. During the actual explanation, a male FP doctor specializing in reproductive medicine (including FP) and endoscopic surgery subjectively evaluated the development status of child while talking with the child and explaining FP by drawing pictures on a piece of paper. So, the explanation of the FP seemed to tell the story. Moreover, it was remarkable when explaining to younger children. Also, he and young female assistant doctors also provided explanation using an original animated movie currently under development as a supplement. The method of explanation was changed taking into consideration not only age but also comprehension. Basically, after having girls in their teens and beyond puberty read the leaflet, we explained it including a certain degree of specialized knowledge. For elementary school students, we asked their parents to explain without reading the leaflet, and for younger children, we mainly explained with parable. When the subject of the explanation for FP was a girl, consideration was given to female doctors and nurses in attendance as much as possible, so that the explanation would not be given only by male doctors.Before and after the explanation of FP, a questionnaire survey was conducted to evaluate the feelings and perceptions of the child. There was no age-specific version of the survey, and for children who could not read or write sufficiently, parents explained the content and filled it out. Children who can read and write on their own were basically included while confirming the content with their parents. Most of the children after puberty checked the contents by themselves and answered by themselves. Therefore, it cannot be denied that the reliability of this survey declines with low age. The contents of questions before the explanation of FP consisted of 10 questions, including the sex and age of the child. The contents were \u201cDo you know about the planned treatment for your illness?\u201d, \u201cDo you know that treating your illness may make it harder for you to become a mother or father in the future?\u201d, and so on. Details of the questions before providing the explanation about FP are shown in Since the content of the questions set in this study was very sensitive, the questionnaire was filled out with the parents after guaranteeing the right to refuse to answer at any time. In addition, the questionnaire was conducted under careful observation by the medical staff to see if the child exhibited any physical or mental changes while answering the questionnaire. This study was conducted under the approval of the Institutional Review Board at St. Marianna University School of Medicine .A total of 36 pediatric patients participated in this study, with a response rate of 100%. All children and parents agreed to participate in this study. Thirty-four of the 36 patients were girls and the other 2 were boys. The overall median age was 13.3 \u00b1 3.0 years old. The median age of girls was 14 years . The boys were 14 and 15 years old and the primary illness in both cases was ALL. Of these 36 patients, 11 were <11 years old (Group A), 9 were 12\u201314 years old (Group B), and 16 were 15\u201317 years old (Group C). As a result of the explanation about FP, two boys chose sperm cryopreservation, but one was already suffering chemotherapy-induced azoospermia. In addition, 28 girls (82.4%) underwent OTC and one underwent OC, whereas two girls thought that treatment of the underlying disease would have no significant effect on their own ovarian reserve and decided to follow-up on ovarian reserve. Notably, one girl initially chose OTC and was hospitalized, but her feelings changed immediately before the procedure and she eventually declined to undergo OTC. In addition, two girls prioritized treatment of the underlying disease and did not choose any FP. Generally, at our institution, OTC is performed by single-port laparoscopic surgery, and the most important thing is to perform minimally invasive and safe procedures based on the policy of reduced-port surgery.All children were able to answer about their age and biological sex (Q1 and 2). Regarding Q3 (desire to have children in the future), more than half of Groups B and C answered, \u201cI really think so\u201d or \u201cI think so\u201d. However, although no negative answers were seen in the younger Group A, 7 children (63.6%) answered that \u201cI don\u2019t know yet\u201d . None of the children answered, \u201cDon\u2019t really understand\u201d or \u201cDon\u2019t understand at all\u201d . However, the lower the age, the more often the answer was \u201cI don\u2019t know yet\u201d. Previous studies have reported that children over 12 years old have a strong desire to have genetic children, consistent with the present results . HoweverCategorically determining the lower age and intelligence limits at which explanations of FP can be understood is difficult. One challenge of pediatric FP is precisely the need to tailor explanations of procedures according to the understanding of the individual child.nao@marianna-u.ac.jp.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. Please contact Nao Suzuki, The studies involving human participants were reviewed and approved by institutional review board at St. Marianna University School of Medicine. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin. Written informed consent was obtained from the minor(s)\u2019 legal guardian/next of kin for the publication of any potentially identifiable images or data included in this article.ST drafted the manuscript. ST, SF, MS, YY, TM, HK and NS designed the research and contributed to the critical discussion. ST, YI, YoS, HI, RK, ES, KI, YuS, KT, KOy, DK, KN, KOd, YH, LM, AI, AF, LA contributed to collecting and analyzing data. All authors contributed to the article and approved the submitted version."}
+{"text": "Pneumonia is a common pulmonary complication of flail chest, causing high morbidity and mortality rates in affected patients. The existing methods for identifying pneumonia have low accuracy, and their use may delay antimicrobial therapy. However, machine learning can be combined with electronic medical record systems to identify information and assist in quick clinical decision-making. Our study aimed to develop a novel machine-learning model to predict pneumonia risk in flail chest patients.From January 2011 to December 2021, the electronic medical records of 169 adult patients with flail chest at a tertiary teaching hospital in an urban level I Trauma Centre in Chongqing were retrospectively analysed. Then, the patients were randomly divided into training and test sets at a ratio of 7:3. Using the Fisher score, the best subset of variables was chosen. The performance of the seven models was evaluated by computing the area under the receiver operating characteristic curve (AUC). The output of the XGBoost model was shown using the Shapley Additive exPlanation (SHAP) method.Of 802 multiple rib fracture patients, 169 flail chest patients were eventually included, and 86 (50.80%) were diagnosed with pneumonia. The XGBoost model performed the best among all seven machine-learning models. The AUC of the XGBoost model was 0.895 .Pneumonia in flail chest patients was associated with several features: systolic blood pressure, pH value, blood transfusion, and ISS.Our study demonstrated that the XGBoost model with 32 variables had high reliability in assessing risk indicators of pneumonia in flail chest patients. The SHAP method can identify vital pneumonia risk factors, making the XGBoost model's output clinically meaningful. Flail chest is the most severe type of chest trauma, is found in approximately 4% of patients with rib fractures and is defined as at least 3 or 4 consecutive rib fractures in at least two places causing paradoxical movement of the chest wall , 2. It hPneumonia is a common, severe, preventable complication in patients with flail chest, with an estimated incidence rate ranging from 21% to 33.5% \u20136. MoreoThe Clinical Pulmonary Infection Score (CPIS) has been proposed and used clinically for decades and has shown some shortcomings in guiding the management of pneumonia . ConsequMachine learning (ML), a branch of artificial intelligence methods, can develop models from medical data to make clinical decisions and assist doctors in their routine work . In prevIn this study, we aimed to develop an advanced machine learning model, assess how well it predicts the risk of pneumonia in flail chest patients, and provide new approaches for individualized analyses of pneumonia risk factors in hospitalized patients with flail chest.We performed a retrospective cohort study at Chongqing Emergency Medical Center, an urban teaching hospital with 1,200 beds in China, between January 2011 and December 2021. The study included patients with flail chest, defined as at least 3 or 4 consecutive rib fractures in at least two places causing paradoxical movement of the chest wall .3) or leucopoenia   Demographics: age, sex, injury mechanism; (2) Damage level: Injury Severity Score (ISS), number of rib fractures, combined injuries, Glasgow Coma Scale (GCS), admission Revised Trauma Score (RTS), abbreviated injury scale (AIS); (3) Initial vitals: admission temperature, pulse rate, breathing rate, blood pressure; (4) Laboratory values in the first 48\u2005h: blood gas analysis, WBC, RBC, HB, PLT, PCT, CRP, PT, APTT, INR, albumin; (5) Treatment within the first 48\u2005h: transfer, intubation, emergency operation, closed thoracic drainage, tracheostomy, antibiotics, anticoagulants, emergency room stay time, etc.http://www.broad.mit.edu/genepattern/). Second, the dataset with 169 records and 59 features was normalized using the Python Sklearn library. Then, the scores of each feature were computed and ranked based on the Fisher score evaluation system , and differences between pneumonia and nonpneumonia groups were analysed by t test or one-way ANOVA. Data that do not conform to a normal distribution are expressed as median  and can be considered for logarithmic transformation. The F test was performed on the transformed data, and if normality was not achieved, the nonparametric test was applied. Categorical variables are presented as frequencies (percentages). Moreover, Fisher's exact test or chi-square test was used to compare the differences between the distributions of the two groups. The following seven machine learning models with different algorithms were developed and evaluated for their performance: logistic regression (LR) , random n\u2009=\u2009118) into the training set and 30% (n\u2009=\u200951) into the validation set. We performed 3-fold cross-validation and grid search on the training set to tune the model hyperparameters and avoid overfitting. The training set was randomly divided into three subsets; in each iteration, one subset was selected as the test set, and the rest was chosen as the training set , Matthews correlation coefficient (MCC), accuracy, sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV). The best predictive model among the seven models was further used to analyse the risk factor gradient for flail chest pneumonia. Then, the calibration curve was used to evaluate the difference between the predicted and actual values.The Shapley Additive Explanations (SHAP) is a model interpretability method widely used to interpret various classification and regression models , 28, 29.During the study period, 802 patients with multiple rib fractures who were registered in our hospital were selected, and 633 (78.9%) patients were excluded. The search process and full inclusion/exclusion criteria are shown in P\u2009>\u20090.05). Of note, respiratory rate, blood pressure, pulse, haemoglobin, c-reactive protein (CRP), prothrombin time (PT), activated partial thromboplastin time (APTT), and albumin were found to have significant differences between the patients with or without pneumonia (P\u2009<\u20090.05). In particular, the flail chest patients with pneumonia had higher ISS scores and more severe traumatic brain injury and were more likely to be intubated and transferred to the ICU at an early stage early (P\u2009<\u20090.05).We performed feature selection and ranked the levels of feature importance since only partially relevant or less significant characteristics are likely to have detrimental impact on the performance of machine learning models. The optimal feature subset for different machine learning algorithms may vary. The AUC, specificity, sensitivity, positive predictive value, negative predictive value, Matthews correlation coefficient (MCC), and accuracy of each model on the testing set are shown in To better explain the predictive meaning of the XGBoost model to guide clinical practice, we applied the SHAP algorithm to explain how to obtain the predicted probability based on the baseline risk and patient characteristics. As seen in Additionally, As a severe chest trauma, flail chest not only affects the stability of the chest wall but also poses a threat to circulation and breathing, which can directly affect the clinical course and outcome of the patient . FurtherPredictive modelling to aid clinical decision-making is not a new concept. The Scoring System for Pneumonia Risk in Pulmonary Contusion Patients, the \u201cRibScore\u201d, a novel radiographic score based on fracture patterns, and the Clinical Pulmonary Infection Score (CPIS) are all examples of current operational scoring tools , 11, 12.Artificial intelligence and electronic medical records have enabled ML algorithms to be more widely used in individualized medicine to support clinical decisions . XGBoostGiven these results, it appears that not all low-risk-level patients are pneumonia free. We report low-risk groups in several patients with pneumonia . This reIn addition, a predictive model for a disease needs to be interpretable, and this interpretability can promote understanding and acceptance of the model's predictions by physicians . TherefoML models have demonstrated outstanding performance in predicting diseases and clinical conditions, and can be used to guide treatment decisions and interventions . For exak\u2009=\u20093) of every model. However, selection bias was inevitable, and the model's efficacy for predicting pneumonia should be verified in future studies with larger sample sizes. Second, our study was conducted retrospectively. We can only suggest associated and correlated factors, not identify the main factors contributing to pneumonia. Furthermore, there is a possibility that our findings could be biased due to the long duration of patient enrolment. Third, whereas the missing numerical variables were imputed with weighted k-nearest neighbours, essential variables such as CRP and PH value had some missing values. Additionally, the accuracy may be improved by adding more variables currently not collected, such as comorbidity (The study may have several limitations. First, it was a single-centre study with a limited sample size. Given that only four percent of patients with rib fractures develop flail chest, the sample size of flail chest patients in one medical centre was small . To mitiorbidity  (e.g., Corbidity , 45. FouWe successfully established seven ML models to predict the risk of pneumonia during hospitalization in flail chest patients. The XGBoost model has shown better performance than the LR, RF, SVM, ANN, GBDT, and NB models. We anticipate that it is a convenient risk stratification tool that clinicians can use to identify individualized treatment options for patients with multiple rib fractures. To our knowledge, this is the first machine learning based study to provide a novel approach for predicting pneumonia in flail chest patients. However, further external validation is required to test the generalization of our model."}
+{"text": "Fusarium verticillioides and related species, as well as some strains of Aspergillus niger. Fumonisin contamination of maize is a concern when grown under hot, dry conditions. When present above regulatory levels, there can be effects on animal health. New tools to reduce the toxicity of maize and maize products with high concentrations of fumonisin are needed. Recently, we reported an amine oxidase (AnFAO) from a fumonisin-producing Aspergillus niger strain capable of oxidatively deaminating intact fumonisins. In this study, AnFAO was used to reduce intact fumonisin concentrations in milled maize flour, whole kernel maize inoculated with fumonisin-producing Fusarium verticillioides, and dried distillers\u2019 grains with solubles (DDGS). The data showed that milled maize flour incubated with 1 \u00b5M AnFAO for 1 h resulted in complete deamination of FB1 and FB2. A greater than 90% reduction in FB1\u20133 concentrations was observed following a simple washing procedure of whole kernel maize in the presence of 1 \u00b5M AnFAO for 1 h. Similarly, a \u226586% reduction in FB1\u20133 concentrations was observed in DDGS after 4 h incubation with 1 \u00b5M AnFAO. Finally, we engineered the methylotrophic yeast Pichia pastoris to produce functional AnFAO in both a secreted and intracellular form. These results support the further development and application of AnFAO as a promising tool to remediate fumonisin-contaminated maize and maize products.Fumonisin mycotoxins are a family of secondary metabolites produced by  Fusarium verticillioides and related species, mainly on maize [Fusarium kernel rot can result in high concentrations of fumonisins. Insects that infest maize increase plant damage and fumonisin concentrations [Fumonisins are a class of mycotoxins produced by on maize . This futrations . While ftrations ,4,5,6.Fumonisins are polyketide-derived linear amino polyols that function as competitive inhibitors of the enzyme ceramide synthase . Ingesti1, FB2, and FB3, alone or in combination in food, and this PMTDI was reaffirmed in 2018. This is based on liver and kidney toxicity in rats and mice [Some older studies suggest that consumption of fumonisin-contaminated maize is associated with esophageal cancer  and neurand mice . The US and mice .Enzymatic biotransformation of mycotoxins can be a rapid, specific, and cost-effective approach to reducing their toxicity. Enzymes that biotransform fumonisins have been previously identified ,18,19,20Aspergillus niger capable of deaminating intact fumonisins [Aspergillus niger fumonisin amine oxidase), is an FAD-dependent monoamine oxidase that converts the fumonisin primary amine into an imine, which then spontaneously hydrolyzes to a ketone moiety , the protein-rich end-feed product of bioethanol production in which fumonisins become significantly enriched when present in the source maize ,28,29. W2O. AnFAO was added to a final concentration of 1 \u00b5M and incubated overnight at room temperature. LC-MS analysis of the reaction indicated that intact fumonisins were converted into their deaminated counterparts . At 10 nM AnFAO, we observed 24%, 46%, 56%, and 76% deamination of intact FB2 following 30, 60, 90, and 120 min treatments, respectively. We observed only minimal deamination of FB1, with ca. 4% of intact FB1 being converted to FPy1 after 2 h.  for both the secreted and intracellular forms of AnFAO. These results indicate that the yeast P. pastoris can produce recombinant AnFAO that is active and capable of deaminating fumonisins in a complex matrix without the need for exogenous FAD cofactor.The methylotrophic yeast activity . The secF. verticillioides than washing protocols alone  can be reduced by a simple washing step, as has been previously reported [1 levels by 69%, while supplementation with AnFAO brought total reduction to 92%. Similarly, FB2 and FB3 levels dropped 60% and 64%, respectively, by washing alone, while the addition of AnFAO brought the total reduction to 98% and 92%, respectively , who observed significant decreases in intact FBwn maize .1, FB2, and FB3 were added at concentrations commonly encountered in DDGS samples isolated from various bioethanol production plants [AnFAO was also effective at deaminating fumonisins within DDGS. FBn plants . We obseP. pastoris deaminated FB2 administered directly to the culture supernatant without the need for affinity tag enrichment or additional FAD cofactor. The intracellular form was also active and capable of deaminating FB2 within the crude cellular lysate  and aminotransferase (FumI) that remove fumonisin TCA side chains and amine moiety, respectively [Exophiala spinifera produces an FAD-dependent amine oxidase similar to AnFAO [E. coli and P. pastoris, at significant yields and does not require exogenous cofactors or additional upstream enzymes for activity. These characteristics make the enzyme an ideal tool for fumonisin deamination in real-world settings, including potentially during bioethanol production, pelletization in animal feed, and direct addition to wash solutions. Furthermore, AnFAO is not predicted to be allergenic [Aspergillus niger. Many strains of this fungus have been granted US GRAS status  and are widely used as an industrial production platform for important enzymes and chemicals [Several enzymes have been documented that biotransform fumonisins into less toxic forms. ectively . FumI reectively . The blato AnFAO ,20. Simito AnFAO . Our reslergenic  and is dhemicals .M = 390.6 \u00b5M and kcat = 8.7 min\u22121 for FB1, KM = 194.7 \u00b5M and kcat = 13 min\u22121 for FB2) [AnFAO demonstrates modest affinity and catalytic efficiency for fumonisins (Kfor FB2) . DespiteF. verticillioides, and DDGS. Deamination with AnFAO is a simple process that does not require additional cofactors or upstream enzymes. AnFAO could be an effective tool for fumonisin deamination in animal feed in developed countries and in food in developing countries that are at high risk of fumonisins exposure.In conclusion, the data provided demonstrated that AnFAO is capable of reducing the concentrations of intact fumonisins in milled maize flour, whole kernel maize infected with 1, 156 \u00b1 21 FB2, and 89 \u00b1 22 FB3). FB1 and FB2 were obtained from Sigma-Aldrich  (Cat. No. F7817 and SML128: 1 mg/mL in DMSO). FB3 was obtained from Romer Labs as a 50.7 \u00b5g/mL solution in acetonitrile (SH-FUM B3). Protein reagents including \u03b2-mercaptoethanol, isopropyl \u03b2-D-1-thiogalactopyranoside (IPTG), and SDS-PAGE gels and supplies were obtained from BIO-RAD . Luria Bertani (LB) growth media, buffers, salts, and all other general reagents were obtained from either Sigma-Aldrich, Fisher Scientific , or VWR .Multitoxin quality control material (QCM) in milled maize flour was obtained from Romer Labs  (Cat. No. QCM7C1)  coupled to an Agilent 1290 ultrahigh-performance liquid chromatography (UHPLC) system as previously described [m/z; the automatic gain control (AGC) target and maximum injection time (max IT) were 5 \u00d7 106 and 64 ms, respectively. The five highest intensity ions from the full scan (excluding isotopes) were sequentially selected using a 1.2 m/z isolation window and analyzed at a resolution of 17,500; AGC target, 1 \u00d7 105; max IT, 64 ms; normalized collision energy (NCE), 30; threshold intensity, 9.1 \u00d7 104; and dynamic exclusion, 1.5 s. Fumonisins were detected by accurate mass (\u00b15 ppm) and retention time (\u00b10.1 min) and verified by MS/MS.LC-MS data were acquired with a Q-Exactiveescribed . A totalE. coli BL21DE3 as an N-terminal 6X His-tagged MBP-fusion protein  and purified to homogeneity via metal affinity, hydrophobic interaction, and gel permeation chromatography steps using a Bio-Rad FPLC system as previously described [Recombinant AnFAO was expressed in escribed . This pu2O. Purified recombinant AnFAO was added to the mixture at concentrations of 10 nM, 100 nM, and 1 \u00b5M. Samples were mixed by vortexing for 30 s and incubated at RT with shaking for intervals from 30 min up to 16 h total. At specified time points, fumonisins were extracted from each sample as follows: 700 \u00b5L of 78% acetonitrile, 2% acetic acid, and 20% Milli-q H2O was added to each sample and incubated at 37 \u00b0C with vigorous shaking for 1 h. Samples were then subject to centrifugation at 20,000\u00d7 g, and 500 \u00b5L of this supernatant was removed and mixed with an equal volume of 100% methanol. The solution was then mixed by inversion and centrifuged at 20,000\u00d7 g to remove insoluble debris prior to LC-MS analysis. Five \u00b5L of each sample was analyzed by LC-MS. Percent deamination was calculated by measuring calibrated peak areas for each intact and deaminated fumonisin and dividing the amount of deaminated fumonisin by the total amount of fumonisin [p < 0.01).In total, 150 mg of QCM containing known levels of fumonisins in milled maize flour was mixed with 500 \u00b5L Milli-q Humonisin ,26. Tuke2O. Excess water was decanted from the kernels prior to autoclave sterilization.Feed maize was obtained from a local mill, and 1 kg was imbibed overnight in a 2 L Erlenmeyer flask with 500 mL Milli-q HFusarium verticillioides (DAOM 250206) grown on Potato Dextrose Agar (Sigma-Aldrich) was aseptically macerated with a polytron blender in 200 mL sterile distilled water. The fungal inoculant was slowly poured over the sterilized maize kernels while swirling the flask to ensure the kernels were coated. The inoculated maize kernels were then grown in darkness at 28 \u00b0C for 2 weeks. Infected kernels were oven dried at 40 \u00b0C for 4 h and were stored in the freezer (\u221220 \u00b0C) until use. Then, 900 g of clean feed maize was fortified with ca. 100 g of the highly contaminated material to produce the experimental maize used to perform subsequent enzyme fumonisin conversion analyses [1, FB2, and FB3, respectively.An agar plug (approximately 7 cm \u00d7 4 cm) from a 7-day-old culture of analyses . The expF. verticillioides-contaminated whole maize kernels were placed in sterile 50 mL Erlenmeyer flasks in triplicate, whereupon 10 mL of Milli-q H2O was added to each. Purified recombinant AnFAO was then added to a final concentration of 1 \u00b5M and incubated at RT with gentle shaking for 60 min. The water and enzyme-washed kernels were then air-dried at RT for 30 min prior to milling and fumonisin extraction and LC-MS analysis (as described previously for QCM flour extraction). Extracted peak areas of FB1, FB2, and FB3 for the water and enzyme washes were compared with the experimental control maize samples. Single-factor ANOVA was performed using Tukey\u2019s post hoc test (p < 0.05) using the log 10 peak areas between treatment groups using the dplyr and multcomp statistical analysis packages in R. All box and whisker plots were produced using R.Approximately 10 g of 1, FB2, and FB3 were dissolved in 100% methanol and added to 100 mg of DDGS to a final concentration of 2.0, 0.47, and 0.27 ppm of FB1, FB2, and FB3, respectively [2O. Purified recombinant AnFAO was added to the mixture at a concentration of 1 \u00b5M. Control reactions included: (1) samples containing known concentrations of \u201cspiked\u201d fumonisins without enzyme and (2) samples of DDGS containing only native levels of fumonisins (non-spiked samples) incubated with AnFAO. Samples were mixed by vortexing for 30 s and incubated at RT with shaking for intervals of 1, 4, and 24 h. At the specified time points, fumonisins were extracted from each sample as described for the QCM experiments. Percent deamination was calculated as described above. Statistically significant differences between the 1 and 4 h time points for exogenous fumonisins were detected by t-test (p < 0.0001) using Sigmaplot.DDGS were obtained from a local bioethanol production facility and were stored at \u221220 \u00b0C prior to use in the experiment. FBPichia pastoris by Gene Universal Ltd. The gene was subsequently cloned into the EcoRI and NotI restriction sites of pPICZ\u03b1A and pPICZB vectors to enable secreted and intracellular expression, respectively, within the methylotrophic yeast Pichia pastoris, as per the manufacturer\u2019s instructions (Life Technologies Pichia Expression kit). Approximately 10 \u00b5g of either pPICZ\u03b1A-AnFAO or pPICZB-AnFAO were transformed into Pichia pastoris strain X33 via electroporation. Transformants were plated onto YPDS  agar plates containing 100 \u00b5g/mL Zeocin and incubated for 48 h at 30 \u00b0C. Colonies were picked and spotted onto YPDS plates containing 1 mg/mL of Zeocin and incubated for 48 h at 30 \u00b0C. Colonies from each construct were then used to inoculate 10 mL of BMGY liquid media , 1.34% yeast nitrogen base (without amino acids), 0.4 \u00b5g/mL biotin, 1.0% glycerol) containing 100 \u00b5g/mL Zeocin and placed in a shaking incubator for 16 h at 30 \u00b0C. Cells were harvested by centrifugation and washed 2\u00d7 with 10 mL of BMMY liquid media (same as BMGY media except containing 0.5% methanol as carbon source instead of 1.0% glycerol). The cells were then suspended at an OD600 of 0.8\u20131 in 50 mL of BMMY (without Zeocin), transferred to sterile baffled flasks, and grown continuously at 30 \u00b0C with vigorous shaking (250 rpm). Samples were taken at 24 h post-methanol induction and were assayed for fumonisin deamination activity via LC-MS as follows: Cultures of the secreted version of AnFAO (pPICZ\u03b1A-AnFAO) were subject to centrifugation, and the cell-free conditioned media was incubated with 1 \u00b5M FB2 for 16 h at 30 \u00b0C before extraction with 50% methanol and analysis by LC-MS. For the non-secreted construct (pPICZB-AnFAO), the cell pellet was lysed in 1 mL phosphate-buffered saline (PBS) (pH 7.4) containing 0.1 mM PMSF and 200 units/mL lyticase using an equal volume of acid-washed glass beads and six rounds of vortexing and incubation on ice. The cell lysate was cleared by centrifugation at 21,000\u00d7 g, and the supernatant was incubated with 1 \u00b5M FB2 at 30 \u00b0C for 16 h before methanol extraction and LC-MS analysis. To check for protein expression, the culture supernatant from the secreted construct (pPICZ\u03b1A-AnFAO) was concentrated 10-fold using a 1 mL Amicon membrane concentrator (30 kDa cutoff) and subjected to SDS-PAGE followed by immunoblotting using an anti6x-His antibody to detect the N-terminal 6x histidine tag. The cell lysate from the non-secreted construct was subjected to SDS-PAGE and Western blotting in the same manner as described for pPICZ\u03b1A-AnFAO to detect the recombinant protein. Statistically significant differences between means at the 0 and 24 h time points were detected by t-test using Sigmaplot.AnFAO was synthesized and codon-optimized for expression in"}
+{"text": "The expression of stress-related gene candidate sam2 increased in the brain of older individuals exposed to stress. Our results suggest there is a close relationship between chronic stress, regeneration, and behavior in zebrafish (Danio rerio), and that the impact of stress is age-dependent.Stress can have a significant impact on many aspects of an organism\u2019s physiology and behavior. However, the relationship between stress and regeneration, and how this relationship changes with age remains poorly understood. Here, we subjected young and old zebrafish to a chronic stress protocol and evaluated the impact of stress exposure on multiple measures of zebrafish behavior, specifically thigmotaxis (open field test) and scototaxis (light/dark preference test), and on regeneration ability after partial tail amputation. We found evidence that young and older adult fish are differentially impacted by stress. Only young fish showed a significant change in anxiety-like behaviors after being exposed to chronic stress, while their regeneration ability was not affected by the stress protocol. On the other hand, older fish regenerated their caudal fin significantly slower compared to young fish, but their behavior remained unaffected after being exposed to stress. We further investigated the expression of two candidate genes ( Physiological balance can be temporarily disrupted by external conditions including stressors. Stress responses are a crucial adaptation for proper resource allocation toward cognitive and muscular performance. Depending on the duration of the exposure to stressful stimuli, stress can be considered acute or chronic. Despite the adaptive value of stress responses, the prolonged activation of the corresponding pathways caused by chronic stress can negatively impact different physiological processes such as digestion, growth, reproduction, immune response, wound healing, and tissue regeneration .These biological processes are not only influenced by the external environment, but also by intrinsic factors such as age. Aging is a complex phenomenon that affects multiple aspects of an organism\u2019s fitness and condition, from the cellular to the organismal level . Aging hThe physiological response to stressors involves alterations at the molecular level that can impact regeneration. Stressors are external stimuli that translate into nervous system signals that trigger the hypothalamus-pituitary-interrenal axis  among other pathways . This axneuroligin 1 (nlgn1) and samdori 2 (sam2), have been shown to mediate adaptive responses to stress, anxiety, neurodegeneration and aging in different species, including zebrafish (crh) and possible neuromodulatory functions , and 52 young adult fish . Zebrafish populations were housed at the Laboratory of Neuroscience and Circadian Rhythms at the University of Los Andes, Colombia, under optimal conditions for the species .We conducted all experiments in zebrafish,  species . Fish weAnimals of both sexes within age groups were pooled and randomly assigned to two experimental groups: Control and Stress. At the beginning of the experiment, both experimental groups remained in separate tanks under standard conditions (as described above) during 24\u00a0h, for habituation. Fish in the stress group were exposed to an unpredictable chronic stress protocol (UCS) that lasted 8\u00a0days as described below . From noArchocentrus nigrofasciatus, for 50\u00a0min avoiding direct contact; 5) low water level until animals\u2019 dorsal body wall were exposed, for 2\u00a0min; 6) tank change, three consecutive times; 7) chasing animals for 8\u00a0min with a net. To maintain unpredictability, time and sequence of stressors\u2019 presentation were randomized and changed daily  Open field test: for this test, we used only the white compartment of the tank  Light-dark preference test: each zebrafish was placed individually in the tank, with access to both compartments . The brains were dissected out under a stereoscope (Nikon SMZ745) and re-stored in RNAlater at \u221220\u00b0C. Total brain RNA was then extracted with Aurum \u2122 Total RNA Mini Kit . The integrity, purity and concentration of RNA were confirmed by gel electrophoresis and NanoDrop measurements (ND-2000 NanoDrop spectrophotometer). cDNA synthesis was carried out with iScript Select cDNA Synthesis Kit . We then used qRT-PCR to quantify the relative expression of nlgn1 and sam2, together with housekeeping genes (ef1a and rpl13a) as endogenous controls. We ran focal genes and housekeeping genes in parallel for all samples, using iTaq \u2122 universal SYBR\u00ae Green supermix kit  in a Qiagen qRT-PCR ROTOR-GENE Q machine .Based on preliminary results of the regeneration process after exposure to stress, we evaluated the expression of We analyzed fluorescence data from qRT-PCR runs with DART-PCR . This meficiency . We calcaterials .p < 0.05, except for specific exceptions specified along the text. All results are expressed as the mean \u00b1 standard error of mean (S.E.M). Statistical analyses were performed in R, using packages lme4, nlme, FSA, dplyr, rstatix, ggpubr, lmtest, and Matrix.After verifying normality with Q-Q plot for each variable in R, results of the behavioral tests were analyzed using Welch\u2019s t-test to compare stress and control groups of each age group. Results of regeneration test were analyzed using a linear mixed model (LMM), that incorporates repeated measures for each growth measurement. Here, we used growth of the amputated section as dependent variable, total tail length as a covariate , the interaction between measurement record and treatment as fixed effect, and the cohort as a random factor. This model allowed us to evaluate whether regeneration changes between treatments at each measurement point. Gene expression results were analyzed using Welch\u2019s t-test to compare stress and control groups. Differences were considered significant with a threshold of p = 0.04, p = 0.04, p = 0.06, In the open field test, young stressed fish traveled significantly longer distances  we found statistically significant differences in the time spent in white zone for young fish  with wounds in the growing caudal fin after the stress protocol, a potential sign of aggression and further impact of stress on young fish behavior . Neverthsam2 and nlgn1 was estimated by normalizing to two housekeeping genes. We found older fish exposed to stress had significantly higher sam2 expression than fish in the control group. Relative expression of sam2 increased by 2.55 \u00b1 0.45-fold in individuals exposed to the stress protocol  , despite a clear trend for stressed fish to express nlgn1 at higher levels (Relative expression of = 0.045) . For nlgr levels . The lacsam2 in the brain of older fish. Our results suggest that this gene can be considered a potential candidate for further study on the mechanisms behind the impact of stress on physiological processes.The response to stress can be an adaptative strategy essential for survival, competition, and general fitness. However, chronic activation of the physiological processes triggered by continuous chronic exposure to stress can be harmful. Several studies have evaluated the relationship between stress and regeneration , regenerStress and anxiety-like responses depend on both extrinsic and intrinsic factors. Extrinsic factors like weather or predation risk, and intrinsic factors such as the age, may affect the baseline behavior of an individual . Our res. As seen in track visualization and heatmaps  and insulin-like growth factor (IGF) signaling are two of the most important pathways in the initial part of the regenerative process, while fibroblast growth factors (Fgf) signaling is determinant during the regenerative outgrowth stage . We know in fish . These e in fish , and imp in fish . We suggOnce more, we found age-dependent effects in the impact of chronic stress on regeneration. Older fish showed a significant reduction in the capacity to grow back the amputated tissue, reflected on the rate at which they regenerated their fins after stress exposure. On the contrary, younger zebrafish under chronic stress conditions completely regrew the amputated tissue at the same rate as control fish . Our resTelomere length and telomerase activity could be at the basis of this age-dependent effect of stress on regeneration. Telomere length and telomerase activity have been shown to decrease with age  and can sam2 and nlgn1  expression and thus the HPA axis. These findings lead us to predict sam2 expression would increase in fish after stress exposure as a modulator of crh expression. Our results are consistent with this prediction, as sam2 expression was significantly higher in older fish exposed to chronic stress. In the future, it would be interesting to expand this experiment to examine the expression of the candidate genes at different ages.Dissecting the molecular mechanisms linking stress responses in the brain to an organism\u2019s behavior and physiology is key to understanding the stress response. We examined the expression of two candidate genes known to be associated with stress and expressed in the central nervous system, nd nlgn1 . Examiniebrafish . Choi ansam2 expression levels and stress exposure suggest this gene may be part of the stress response in the brain, justifying further work to better understand its role, mechanisms of action and link to physiological processes such as regeneration. Previous work, although limited can help us formulate hypotheses on the potential role of sam2 mediating stress responses. The link between sam2 and the HPA axis revealed by sam2 to physiological processes. Mainly, based on their results the authors suggest that sam2 could regulate CRH neuron activity in the PVN and is thus responsible for triggering gene expression pathways associated with the stress response  on the other hand, is a synaptic cell-adhesion molecule, involved in the formation of CNS synapses related, among other functions, to the perception of environmental stimuli (nlgn1 has been linked with the response to stress and stress related disorders. Its variation has been associated with a predisposition to higher levels of anxiety or fear in mice, and it is important in the associative memory of fear in adult rats (nlgn1 expression and stress, however, is not clear in the literature, as other studies have also reported no change in nlgn1 expression after stress exposure (nlgn1 expression in stressed individuals, our results are not statistically significant and difficult to interpret in the framework of previous evidence. Thus, we cannot determine whether the change in nlgn1 expression in our experiment is indeed related to stress exposure or if it's involved in mediating the stress response.Neuroligin-1 ( stimuli . In geneult rats . While texposure . Despitesam2 mediating stress perception in the brain and hypothesize this gene could trigger activity in the stress response pathways that may ultimately impact physiological processes in older fish. Our findings highlight the importance of understanding the relationship between environmental stimuli and physiological responses, and how they can change at different life stages. By investigating the effects of stress on regeneration, our research provides insights for further research on the design of medical treatments that consider the impact of stress on the recovery processes.Overall, we found stress impacts zebrafish behavior and regeneration, and it does so in an age-dependent manner. While stress mainly affects young fish behavior, it impacts fish regeneration ability. Moreover, we suggest a role of"}
+{"text": "Transcranial direct current stimulation (tDCS) is a promising treatment for Alzheimer\u2019s Disease (AD). However, identifying objective biomarkers that can predict brain stimulation efficacy, remains a challenge. The primary aim of this investigation is to delineate the cerebral regions implicated in AD, taking into account the existing lacuna in comprehension of these regions. In pursuit of this objective, we have employed a supervised machine learning algorithm to prognosticate the neurophysiological outcomes resultant from the confluence of tDCS therapy plus cognitive intervention within both the cohort of responders and non-responders to antecedent tDCS treatment, stratified on the basis of antecedent cognitive outcomes.K equally-partitioned subsamples. The model was iterated k times using K\u22121 subsamples as the training bench and the remaining subsample as validation data for testing the model.The data were obtained through an interventional trial. The study recorded high-resolution electroencephalography (EEG) in 70\u2009AD patients and analyzed spectral power density during a 6\u2009min resting period with eyes open focusing on a fixed point. The cognitive response was assessed using the AD Assessment Scale\u2013Cognitive Subscale. The training process was carried out through a Random Forest classifier, and the dataset was partitioned into A clinical discriminating EEG biomarkers (features) was found. The ML model identified four brain regions that best predict the response to tDCS associated with cognitive intervention in AD patients. These regions included the channels: FC1, F8, CP5, Oz, and F7.These findings suggest that resting-state EEG features can provide valuable information on the likelihood of cognitive response to tDCS plus cognitive intervention in AD patients. The identified brain regions may serve as potential biomarkers for predicting treatment response and maybe guide a patient-centered strategy.https://classic.clinicaltrials.gov/ct2/show/NCT02772185?term=NCT02772185&draw=2&rank=1, identifier ID: NCT02772185. TranscrTo date, several studies have demonstrated the superiority of active tDCS over sham stimulation in inducing clinical and cognitive changes in AD patients . HoweverDifferent functional neuroimaging techniques have been employed to detect alterations in brain activity following tDCS treatment, with Electroencephalography (EEG) playing a crucial role in comprehending the underlying neurophysiological states associated with neuropsychiatric disorders and facilitating identification of biomarkers and diagnostic tools for these conditions . EEG in Prior research has also indicated that EEG oscillatory activity exhibits distinguishing patterns in responders to non-invasive brain stimulation compared to non-responders across various neuropsychiatric disorders . AdditioArtificial intelligence (AI) has the potential to revolutionize medical practice by enhancing diagnosis, prognosis, and medical care planning as clinical decision support . HoweverRecent years have witnessed a surge of interest in applying machine learning (ML) to AD detection, owing to its potential in enhancing understanding and diagnosis. Concurrently, AI-driven efforts have also been directed toward identifying responders and non-responders to interventions, such as tDCS. The variability in findings from resting-state EEG studies concerning brain regions implicated in AD emphasizes the necessity to pinpoint specific neural areas affected in individuals with the disease. This determination is pivotal for distinguishing between intervention responders and non-responders. Existing research has uncovered distinct EEG patterns associated with AD. Noteworthy among these are increases in slow oscillations accompanied by reductions in fast oscillations , as wellGiven the potential of these EEG patterns to unveil unique cerebral functional attributes linked to AD, their investigation assumes paramount importance. Such an approach facilitates the identification of distinctive patterns and potential deviations in brain activity associated with the disease. This, in turn, plays a crucial role in categorizing individuals as intervention responders or non-responders. The inherent heterogeneity in neurodegeneration among AD patients underscores the significance of biomarkers associated with positive responses. These biomarkers can pave the way for precision-targeted treatments, enhancing their effectiveness and efficiency. Consequently, the pursuit of intervention response biomarkers transcends the study of response patterns, offering invaluable tools for tailoring AD treatment and advancing our understanding of disease progression .Against this backdrop, the primary objective of our investigation is to delineate the cerebral regions implicated in AD, addressing the existing gaps in our comprehension of these regions. To achieve this goal, we have harnessed the power of supervised machine learning algorithms to predict the neurophysiological outcomes resulting from the amalgamation of tDCS therapy and cognitive intervention. Our focus rests on discerning between responders and non-responders to antecedent tDCS treatment, stratified based on cognitive outcomes. At the heart of our approach lies the spectral power analysis of EEG during the quiescent resting state at the inception of the study. In tandem, we emphasize the identification of principal cerebral loci associated with these outcomes. Our hypothesis posits the existence of a subset of discerned features with optimized predictive potential, thereby facilitating the identification of functional biomarkers conducive to prognosticating the cognitive response triggered by the confluence of tDCS therapy and cognitive intervention.2.2.1.The data set used in this study was collected as part of a randomized, double-blind, placebo-controlled clinical trial designed to compare the efficacy of tDCS and cognitive intervention in patients with AD have been previously published by our research group . ParticiThe non-pharmacological therapy was administered three times a week for a period of 2\u2009months (24 sessions), and ADAS-Cog assessments were conducted within 7\u2009days of the pre-and post-intervention phases.By using ML models, we aimed to use the EEG oscillatory activity to predict the response of patients with AD to treatment with tDCS combined with cognitive intervention. Responders were previously defined as patients who exhibited a minimal clinically relevant change (MCRC) on the Alzheimer\u2019s Disease Assessment Scale\u2013Cognitive Subscale (ADAS-Cog) during the post-intervention phase (\u201cADAS-Cog pre\u201d minus \u201cADAS-Cog post\u201d\u2009\u2265\u20093.76), as indicated in previous tDCS clinical studies . On the 2.2.The sample was composed of 70 participants diagnosed with AD according to NINCDS-ADRDA , present2.3.\u00ae device  was utilized, featuring 32 channels with active Ag-AgCl electrodes. These electrodes were applied to the scalp using an adjustable cap, following the international 10\u201320 EEG system, to enable bilateral monitoring of the prefrontal, frontal, temporal, parietal, and occipital regions. The specific channels employed were: Fc1, Fc2, Fc5, Fc6, Fp1, Fp2, F3, F4, F7, F8, FT9, FT10, C3, C4, CP1, CP2, CP5, CP6, T7, T8, P3, P4, P7, P8, O1, and O2. Recording commenced once all electrodes achieved impedance below 10 k\u03a9, which took approximately 6\u2009min. The recording included alternating rest periods with eyes open while focusing on a fixed point, with each period lasting 1\u2009min. The data were subsequently processed using the Brain Vision Analyzer software program , including artifact inspection and removal. Following data segmentation, the Fast Fourier Transform was applied to calculate the power spectra of the delta, theta, alpha, beta, and gamma frequency bands.EEG was initially conducted in a controlled environment with the patient in a resting state under quiet conditions to obtain the pre-treatment electrophysiological measurements. A BrainVision actiCHamp2.4.Taking into account the objectives of the study, a detailed analysis of supervised learning ML algorithms was conducted. This approach is characterized by having prior knowledge of the output variable through learning from past values of the target variable . Within 2.4.1.The Random Forest algorithm by Through bagging, the algorithm combines these trees by creating subsets of training data, reducing variance. It also fosters diversity by randomly selecting features during tree construction, minimizing correlation. Typically, the square root of total features guides feature selection per split. In classification, tree predictions merge through majority voting; in regression, they average, boosting accuracy and resilience. The mathematical representation of Random Forest\u2019s final classification prediction is illustrated in Meticulous data cleaning, modeling, and structuring were conducted during the preprocessing phase to ensure data quality. Exploratory data analysis techniques, including the utilization of boxplots, were employed to examine data distribution and detect any irregularities. The analysis confirmed uniform data distribution without outliers, further affirming the suitability of the Random Forest (RF) method for our study. This is a robust ML approach that combines decision trees and proved to be an optimal choice for our study due to its capabilities in handling intricate and extensive datasets, alleviating overfitting concerns, and offering reliable estimates of variable importance . By harnRF was employed during the training process, capitalizing on its ensemble of decision trees to construct a more precise and stable prediction model. Thus, two primary strategies were implemented to combat overfitting: randomization of data samples and selection of variable subsets during tree node splitting. A thorough evaluation of all variables was conducted at each iteration to identify the most informative variable, thereby ensuring minimal error in tree splitting . RF faciK\u2009=\u20093 equally partitioned subsamples. The model was trained K\u22121 times during each iteration using the subsamples as the training set, with the remaining subsample serving as the validation set to evaluate the model\u2019s performance. This process was repeated until each subsample had been utilized as the validation set for the other subsamples.Next, the RandomizedSearchCV classifier from the Random Forest, developed by the Scikit-Learn library , was impSplitting a dataset into training and test sets is vital because it allows for evaluating how well a model generalizes to new data, preventing overfitting by assessing performance on unseen examples. This separation also aids in hyperparameter tuning, performance metric calculation, analyzing bias and variance, comparing models fairly, and building trust in machine learning results. Test sets provide a reliable basis for evaluating model performance, enabling better decision-making and accurate assessments of model effectiveness. The parameter values were adjusted based on the specific dataset used. Given the relatively small size of the dataset, it was determined that the obtained results aligned with the expected outcomes.By incorporating this modified data into the RF algorithm, we obtained the parameters of the RF model, and their corresponding values were as follows: (1) The \u201cBootstrap\u201d parameter was set to \u201cFalse,\u201d indicating a sampling without replacement of the training data; (2) The splitting criterion used was \u201cgini,\u201d which measures the data impurity at each tree node; (3) The maximum number of features considered for each split was limited to \u201csqrt,\u201d corresponding to the square root of the total number of features; (4) A total of \u201c223\u201d decision trees were created in the model; (5) The minimum number of samples required to form a leaf node was set to \u201c4,\u201d while the minimum number of samples to perform a split at an internal node was defined as \u201c2\u201d; and (6) The maximum depth of the tree was specified as \u201c50.\u201d These parameters were optimized using the Random Search technique in conjunction with K-fold cross-validation to ensure the proper performance of the RF model in the study.To judge the performance of the ML classification algorithms, we ran confusion matrices for the calculation of various performance metrics, such as accuracy, precision, recall, and F1-score. These metrics help assess the classifier\u2019s overall performance, including its ability to correctly classify samples, identify true positives, avoid false positives, and detect false negatives. Along with these measures, we carried out response prediction on all patients calculating: the proportion of responders that were correctly classified , the proportion of non-responders that were correctly classified , the proportion of responders that were misclassified as non-responders  and the portion of non-responders that were misclassified as responders .Additionally, we employed entropy to select brain regions that most significantly contribute to classification. The algorithm gauges data distribution across predictor variables by considering fluctuations within the target variable. Higher entropy values indicate more data disorder, while lower values signify enhanced data organization. The algorithm assesses information gain for each variable, quantifying the correspondence between predictor and target variables. Essentially, it elucidates the extent to which the activity within specific brain regions explicates variations in the target variable, which, in the context of this study, could pertain to cognitive response or disease progression. The brain region that showcases the most substantial information gain is subsequently chosen as the pivotal variable for the initial node of the decision tree. This selection process hinges upon the brain region\u2019s capacity to effectively elucidate the intricacies of the target variable, ultimately paving the way for the commencement of the decision tree construction centered around the most influential brain region.3.p\u2009<\u20090.002). In 30 of 70 volunteers, ADAS-Cog decreased with the MCRC and these participants were classified as responders. Non-responders remained on a similar level from baseline or increased their ADAS-cog scores after treatment.All participants were included in the analysis. The baseline characteristics is provided in The RF model identified four key brain activity points at baseline associated with two frequency bands as the strongest predictors of cognitive response to tDCS combined with cognitive intervention in AD patients. These findings are presented in p\u2009<\u20090.01).To investigate the channels that best predict the treatment response, we then compared the error rates across regions. The classification accuracy of individual channels is shown in 4.In this study the objective was to delineate baseline resting-state EEG features capable of effectively discriminating between intervention responders and non-responders among AD patients, while pinpointing the specific cerebral regions most implicated in this classification. Employing a random forest classifier, we leveraged baseline EEG spectral power to prognosticate the cognitive improvement outcomes subsequent to the intervention. Through comparisons of average classifications encompassing all cerebral regions, the frontal and parietal-occipital channels exhibited superior performance in predicting treatment response. Notably, this study represents the inaugural endeavor, to the best of our knowledge, in successfully applying EEG-based machine learning to predict individual responses to brain stimulation therapy for AD.Given the complexity of AD, treatment of patients remains challenging . CurrentOur results further showed that EEG occipital area were predictive of treatment response. This finding may be an indication of the presence of complex and diverse pathway underling AD neurobiology. Interestingly, the reduction in the alpha band and reduced beta power in the parietal and occipital regions has previously been shown to differentiate normal aging, mild cognitive impairment, and AD . AccordiOur study provides valuable insights into personalized treatments for AD by conducting a secondary analysis that goes beyond the overall effectiveness of tDCS. We employed a ML approach to focus on patient stratification and predict cognitive response. The resting-state baseline EEG of AD patients proved to be a reliable predictor of cognitive changes, as measured by the ADAS-cog instrument, following treatment with tDCS combined with cognitive intervention. We specifically identified specific cortical areas that were highly predictive in patients who responded to the intervention. Targeting these regions in the intervention could potentially reduce response variability and enhance the effectiveness of these techniques in clinical practice.According to your results, the brain regions most involved in predicting responders to intervention in AD patients were represented by the channels FC1, F8, CP5, Oz, and F7. FC1 and F8 are situated in the frontal cortex, which plays a pivotal role in cognitive functions such as memory, attention, and executive processes. CP5 is associated with the parietal cortex, involved in spatial processing and attention. Oz corresponds to the occipital cortex, responsible for visual processing, while F7 resides in the frontal-temporal junction, implicated in various cognitive tasks . Yang etThe observed amplification of power in brain regions linked to FC1, F8, CP5, Oz, and F7 channels among AD individuals displaying notable treatment responses (more than 4 points gain in ADAS-Cog scores) adds a layer of complexity to treatment efficacy in the context of AD. These regions, essential for cognitive processes encompassing memory, attention, visual processing, and executive functions, are intertwined with several factors intrinsic to AD\u2019s pathophysiology.The augmented power within regions affiliated with the Default Mode Network  potentiaSpecifically, the identified brain regions in this study exhibit a noteworthy relationship with the Default Mode Network (DMN) . The DMNThe inquiry into the nature of the identified biomarkers prompts an exploration of their attributes and relevance in delineating treatment responders from non-responders. However, it is important to acknowledge the limitations of our study. Firstly, it is worth noting that the eligibility criteria for participants in our randomized clinical trial may differ from the patient profiles encountered in routine clinical practice, such as frontotemporal dementia, mild cognitive impairment, and severe AD. To measure the cofounding effects of inter-individual differences, the development of tDCS protocols considering the EEG characteristics would be useful to the future implementation of these ML models in clinical practice. Secondly, it is essential to highlight that our analysis has predominantly centered on EEG data and its associations with cognitive responses among patients with AD. However, it is of utmost significance to acknowledge that pertinent clinical variables, such as age, sex, and baseline cognitive status, were not encompassed within our analysis. To obtain a more holistic grasp of the multifaceted determinants influencing cognitive outcomes in AD, forthcoming investigations should seek to integrate these pivotal variables. Moreover, broadening the scope of our study to encompass larger and more diverse cohorts would undoubtedly bolster the external validity of our findings. Thirdly, while our study maintains an exploratory and neurophysiological focus, it\u2019s important to note that considering all four participant groups could provide deeper insights into the interactions between tDCS treatment, cognitive intervention, and practice effects on ADAS-Cog scores. By doing so, we could better elucidate the potential interplay between tDCS treatment, cognitive intervention, and practice/learning effects, ultimately leading to a more comprehensive understanding of the observed changes in ADAS-Cog scores. However, our analysis is concentrated on tDCS treatment responders, reflecting the study\u2019s exploratory nature and utilization of machine learning techniques.Overall, our findings underscore the potential of personalized treatments in AD and pave the way for future research to validate and expand upon our results in larger and more diverse cohorts. Indications between augmented power in brain regions found in this study and positive treatment responses in AD hold profound clinical and research implications. These findings underscore the potential of utilizing these regions as biomarkers for treatment responsiveness, allowing for more personalized therapeutic interventions tailored to individual neural profiles. This could enhance treatment efficacy and optimize cognitive improvements in AD patients. From a research perspective, these observations stimulate further investigations into the underlying mechanisms that render these regions more receptive to treatment-induced enhancements.5.Our results support that resting-state EEG dataset could be a viable approach for extracting predictive features of tDCS treatment efficacy in patients with AD. Furthermore, specific cortical regions that are most predictive of the cognitive response to the interventions have been identified. The achieved results hold clinical importance due to the ability to identify cortical regions that would serve as optimal targets for non-invasive brain stimulation in AD treatment. Considering that routine scalp EEG is relatively inexpensive  and feasible to acquire in ambulatory settings, our findings can form the basis for novel and cost-effective ways to assist the AD patients, utilizing prognostic biomarkers can guide and optimize the therapeutic application of cognitive treatment.https://www.clinicaltrials.gov/ct2/show/NCT02772185?term=NCT02772185&draw=2&rank=1.Publicly available datasets were analyzed in this study. This data can be found at: The studies involving humans were approved by Ethics committee of the Federal University of Para\u00edba (CAAE: 44388015.7.0000.5188). The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.SA, LS-S, FF, KM, NA, BF-C and JS are the investigators responsible for project design and protocol writing. SA, CC, EA, EL, FF, MC and JS contributed to the study background, general design, study variable definition, and statistical analysis planning. SA, LS-S, KM, LA, DB, ES, AL, RP, EM, SY, NA, BF-C, and JS contributed to the preparation of the project. All authors contributed to the article and approved the submitted version."}
+{"text": "Due to a production error, there was a mistake in The publisher apologizes for these mistakes. The original version of this article has been updated.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Cryphonectriaceae  contains many important tree pathogens and the hosts are wide-ranging. Tree species of Terminalia were widely planted as ornamental trees alongside city roads and villages in southern China. Recently, stem canker and cracked bark were observed on 2\u20136 year old Terminalianeotaliala and T.mantaly in several nurseries in Zhanjiang City, Guangdong Province, China. Typical conidiomata of Cryphonectriaceae fungi were observed on the surface of the diseased tissue. In this study, we used DNA sequence data  and morphological characteristics to identify the strains from Terminalia trees. Our results showed that isolates obtained in this study represent two species of Aurifilum, one previously described species, A.terminali, and an unknown species, which we described as A.cerciana sp. nov. Pathogenicity tests demonstrated that both A.terminali and A.cerciana were able to infect T.neotaliala and two tested Eucalyptus clones, suggesting the potential for Aurifilum fungi to become new pathogens of Eucalyptus.The family of  Cryphonectriaceae is a fungal family within the order Diaporthales. This family is well-known for containing several species that are serious pathogens of trees, causing a wide range of diseases such as blight, die-back, and cankers  , Psidiumguajava (Myrtaceae) , Syzygiumcumini, S.hancei, S.jambos, S.samarangense    . Inoculation tests have confirmed that all the Cryphonectriaceae species from Combretaceae, Lythraceae, Melastomataceae, and Myrtaceae in China are pathogenic to their original hosts and Eucalyptus  , Melastoyrtales) , 2020, Tetaceae) , Rhodomycalyptus , 2020.Myrtales are commonly found in southern China, and Cryphonectriaceae has been identified as an important pathogen to Myrtales trees in previous studies  malt extract agar (MEA) and incubated at room temperature for three to five days until colonies developed. The pure cultures were obtained by transferring single hyphal tips from the colonies to 2% MEA plates and incubated at room temperature for 7\u201310 days. The pure cultures are stored in the culture collection (CSF) at the Research Institute of Fast-Growing Trees (RIFT) , Chinese Academy of Forestry (CAF) in Zhanjiang, Guangdong Province, China.In May 2019, disease surveys on MEA cultures grown for one week at room temperature was scraped using a sterilized scalpel and transferred into 2.0 mL Eppendorf tubes. Total genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) method described by Representative isolates were selected for DNA sequence analyses, and actively growing mycelium on ITS), two segments of \u03b2-tubulin (BT2/BT1), a partial segment of the translation elongation factor 1-\u03b1 (TEF-1\u03b1) and RNA polymerase II (rpb2), were amplified and sequenced as described by Based on previous research four gene regions, including internal transcribed spacer regions (http://www.ncbi.nlm.nih.gov).All amplified products were sequenced in both directions using the same primers that were used for the PCR amplification. Sequence reactions were performed by the Beijing Genomics Institute of Guangzhou, China. The nucleotide sequences were edited using Geneious 7.1.8 software. The sequences obtained in this study were submitted to GenBank  with the interactive refinement method (FFT-NS-i) setting (To determine the placement of es Table  on combi setting . Then thMP) analyses were performed using PAUP v. 4.0 b10 (ML) analyses were conducted with PhyML v. 3.0  using PAUP v. 4.0 b10 (TL), consistency index (CI), retention index (RI) and homoplasy index (HI) were used to assess phylogenetic trees , to which sterilized freshly cut branch sections (0.5\u20131 cm diam. 4\u20135 cm length) of Eucalyptusurophylla \u00d7 E.grandis (CEPT53) branch sections were added. These fungi with branch sections on 2% WA were incubated at room temperature for 6\u20138 wks until fruiting structures emerged. Representative cultures are maintained in the China General Microbiological Culture Collection Centre (CGMCC), Beijing, China. Isolates linked to the type specimens connected to representative isolates were deposited in the mycological fungarium of the Institute of Microbiology, Chinese Academy of Sciences (HMAS), Beijing, China, and the Collection of Central South Forestry Fungi of China (CSFF), Guangdong Province, China.The representative isolates identified as the new species by DNA sequence analysis were grown on 2% water ager  and sectioned (6 \u03bcm thick) using a Microtome Cryostat Microm HM550  at -20 \u00b0C. Conidiophores, conidiogenous cells, and conidia were measured after crushing the sporocarps on microscope slides in sterilized water. For the holotype specimens, 50 measurements were performed for each morphological feature, and 30 measurements per character were made for the remaining specimens.The structures that emerged on the surface of the Measurements were recorded using an Axio Imager A1 microscope  and an AxioCam ERc 5S digital camera with Zeiss Axio Vision Rel. 4.8 software . The results are presented as (minimum\u2013) (mean \u2013 standard deviation) \u2013 (mean + standard deviation) (\u2013maximum).MEA, a 5 mm plug was removed from each culture and transferred to the central of 90 mm MEA Petri dishes. The cultures were incubated in the dark under temperatures ranging from 5 \u00b0C to 35 \u00b0C at 5 \u00b0C intervals. Five replicate plates for each isolate at each temperature condition were prepared. Two diameter measurements, perpendicular to each other, were taken daily for each colony until the fastest-growing culture had covered the 90 mm Petri dishes. Averages of the diameter measurements at each of the seven temperatures were computed with Microsoft Excel 2016 . Colony colors were determined by incubating the isolates on fresh 2% MEA at 25 \u00b0C in the dark after 7 days. The color descriptions of the sporocarps and colonies were according to the color charts of Isolates identified as new species were selected for studying culture characteristics. After the isolates were grown for 7 days on 2% Eucalyptus hybrid genotypes (CEPT46 and CEPT53) and T.neotaliala to understand the pathogenicity on Eucalyptus plantations and to fulfill Koch\u2019s postulates. The selected isolates were grown on 2% MEA at 25 \u00b0C for 10 days before inoculation. Each selected isolate was inoculated on 10 seedlings or branches of each inoculated tree, and 10 additional seedlings or branches were inoculated with sterile MEA plugs to serve as negative controls. The inoculations were conducted in August 2019, and the results were evaluated after 7 weeks by measuring the lengths of the lesions on the cambium.In this study, inoculations were conducted on two different T.mantaly and two widely planted E.grandis hybrid genotype  to fulfill Koch\u2019s postulates and understand the pathogenicity on Eucalyptus plantations. The selected isolates were grown on 2% MEA at 25 \u00b0C for 10 d before inoculation. Each of the selected isolates was inoculated on 10 seedlings or branches of each selected tree variety, and 10 additional seedlings or branches were inoculated with sterile MEA plugs to serve as negative controls. The inoculations on seedlings of two 1-year-old Eucalyptus hybrid genotypes were conducted in the glasshouse, and the inoculations on branches of 10-year-old T.mantaly were conducted in the field. The inoculations method followed Inoculations were conducted on MEA at room temperature. Re-isolations of all seedlings/branches inoculated as negative controls and from four randomly selected trees per isolate were conducted. The identities of the re-isolated fungi were confirmed by morphological comparisons. The inoculation results were analyzed using SPSS Statistics 26 software  by one-way analysis of variance (ANOVA).Inoculations were conducted in August 2019 and the results were evaluated after 7 weeks by measuring the lengths (mm) of the lesions on the cambium. For re-isolations, small pieces of discolored xylem from the edges of the resultant lesions were cut and placed on 2% T.neotaliala  of ala Fig.  nurseriealy Fig.  nurserieees Fig. . Obviousees Fig. . Developion Fig.  and xyleion Fig. . Orange ion Fig.  and rootion Fig. . The frutriaceae . IsolateCryphonectriaceae genera formed independent phylogenetic clades with high bootstrap values  both in the ML and MP analyses, with the exception of Aurifilum, and strains sequenced in this study formed sub-clades , comparing the combined ITS and BT2/BT1 loci dataset generated a value of P was 0.68, indicating some incongruence in the dataset of the four loci, and the accuracy of the combined data suffered relative to the individual partitions  was used as an outgroup taxon. The partition homogeneity test (PHT), comparing the combined ITS, BT2/BT1, TEF-1\u03b1 and rpb2 loci dataset generated a value of P was 1, indicating some incongruence in the dataset of the four loci, and the accuracy of the combined data suffered relative to the individual partitions .Further species analyses selected twenty-four es Table . Based ortitions . AlthougMP and ML analyses generated trees with generally consistent topologies and phylogenetic relationships among taxa. Among the trees generated by the Aurifilum spp. single loci dataset, the BT2/BT1, TEF-1\u03b1, rpb2 show that 20 isolates obtained in this study mainly grouped into two clades, one clade contained nine isolates cluster into a lineage with A.terminali, the other 11 isolates clade formed a novel monophyletic lineage that was distinct from any known Aurifilum sp., and was supported by high bootstrap values in these gene trees .Among the ant Fig. , which sree Fig.  indicateTerminalia trees in southern China represent two distinct species in Aurifilum. Isolates CSF16295, CSF16309, CSF16310, CSF16343, CSF16356, CSF16377, CSF16380, CSF16387, CSF16388 in phylogenetic cluster with A.terminali , the former institution of the Research Institute of Fast-Growing Trees (RIFT), which served as the identification site for this study on Terminalia trees disease caused by Aurifilum spp.the name refers to China Eucalypt Research Centre  from branch bark of T.neotaliala tree, 23 May 2019, S. F. Chen & W. Wang, holotype, CSFF2078, HMAS350333, ex-type culture CSF16261 = CGMCC3.20107; Guangdong Province, Zhanjiang Region, Suixi District, Diaolou Town  from twigs of T.mantaly tree, 25 May 2019, S. F. Chen & W. Wang, CSFF2079, HMAS350334, culture CSF16384 = CGMCC3.20108.China, Guangdong Province, Zhanjiang Region, Suixi District, Chating Town , whereas for the Eucalyptus clones CEPT46, the lesions produced by Aurifilum species were not significantly different  in southern China (Cryphonectriaceae in Myrtales has been extensively studied in recent years (Members of the rn China . Althougnt years , there int years .Aurifilum isolates were pathogenic to mature T.neotaliala and E.grandis hybrid genotypes of CEPT53 and CEPT46 seedlings. To clarify the threat of these pathogens to Eucalyptus plantations, further inoculations on mature Eucalyptus in the field should be conducted. Variations in pathogenicity among different individuals of the same species have been observed, with some strains showing stronger pathogenicity in different hosts. This phenomenon has also been observed in previous studies (Pathogenicity test showed that all tested  studies , 2020, a"}
+{"text": "Food cravings are common in pregnancy and along with emotional eating and eating in the absence of hunger, they are associated with excessive weight gain and adverse effects on metabolic health including gestational diabetes mellitus (GDM). Women with GDM also show poorer mental health, which further can contribute to dysregulated eating behaviour. Food cravings can lead to greater activity in brain centres known to be involved in food \u2018wanting\u2019 and reward valuation as well as emotional eating. They are also related to gestational weight gain. Thus, there is a great need to link implicit brain responses to food with explicit measures of food intake behaviour, especially in the perinatal period. The aim of this study is to investigate the spatiotemporal brain dynamics to visual presentations of food in women during pregnancy and in the post partum, and link these brain responses to the eating behaviour and metabolic health outcomes in women with and without GDM.This prospective observational study will include 20\u2009women with and 20 without GDM, that have valid data for the primary outcomes. Data will be assessed at 24\u201336 weeks gestational age and at 6 months post partum. The primary outcomes are brain responses to food pictures of varying carbohydrate and fat content during pregnancy and in the post partum using electroencephalography. Secondary outcomes including depressive symptoms, current mood and eating behaviours will be assessed with questionnaires, objective eating behaviours will be measured using Auracle and stress will be measured with heart rate and heart rate variability (Actiheart). Other secondary outcome measures include body composition and glycaemic control parameters.The Human Research Ethics Committee of the Canton de Vaud approved the study protocol (2021-01976). Study results will be presented at public and scientific conferences and in peer-reviewed journals. This prospective observational study fills the knowledge gap regarding brain responses to food viewing during and after pregnancy.This study includes subjective (questionnaires) and objective methodologies , Auracle device, Actiheart) to investigate brain responses to food viewing, eating behaviours and stress responses during and after pregnancy.The study will link the outcomes of physiological and behavioural measures.We will compare eating behaviours between healthy women and women with gestational diabetes, both cross-sectionally and prospectively.Limitations include a small sample size (but comparable to other EEG studies with a similar design) and fact that all analyses (and the correlation of their outcomes) are exploratory, given the lack of data in pregnancy or the post partum.The prevalence of obesity continues to increase worldwide.3The widespread and unrestricted access and intake of foods high in sugar and fat contribute to the obesity epidemic. Foods high in sugar (carbohydrates) and fats, such as chocolate, sweet desserts and salty snacks are the most frequently craved foods.8Another aspect of eating behaviour that relates to metabolic health is eating rate. Studies showed that faster eating rate is associated with increased food intake11Although the underlying cause(s) of food cravings are not deeply understood, it has been shown in the general, non-pregnant population that cue-induced cravings in response to food pictures predict disordered eating and excess weight gain. In a meta-analytical review of 45 studies, exposure to food stimuli (pictures) and the experience of craving influence eating behaviour and further weight gain independently of baseline body mass index (BMI), age and gender.12Some people are more susceptible to an obesogenic environment. This can be also mediated through different brain responses to food in key areas. The few existing clinical data show that reward-related brain regions may be involved in excess weight gain.Furthermore, physiological and metabolic parameters are also related to how the brain reacts to the sight of food. Response to viewing high-energy and low-energy foods differ between obese and healthy weight subjects.20Emotions and stress can influence food choices and eating behaviour.26These results together demonstrate that there is a link between brain responses to food viewing and metabolic health, but also stress and emotions and that reward-related brain regions play a role in the regulation of food intake.Maintaining a healthy body weight is particularly important during pregnancy, as it impacts on the health of the mother and her offspring.28Nevertheless, around 28% of women gain more weight than recommended31During pregnancy, there is a change in eating behaviour that can have long-term effects for the mother\u2019s metabolic health.33Emotions and stress also influence eating behaviour in pregnancy.Regarding metabolic health, insulin resistance increases in pregnancy and around 16% of pregnant women worldwide develop gestational diabetes mellitus (GDM).40There is a lack of data regarding eating behaviours in the post partum and its relationship to PPWR.46EEG and visual evoked potentials  to food viewing offer the advantage of disentangling the temporal as well as spatial dynamics of perception, while fMRI only unravels spatial aspects, that is, brain regions. Some VEP studies have shown differential responses to pictures of high and low-energy foods.Overall, the relationship between weight, GWG, PPWR and adverse perinatal and metabolic health outcomes in the perinatal period and the difficulty to reduce weight or weight gain, highlight the need for novel approaches to understand eating behaviour and metabolic health during pregnancy and the post partum, especially in metabolic high-risk women with GDM.As there are no data regarding brain responses to food in pregnancy and in the post partum, we designed an observational prospective study whose design is exploratory. Nevertheless, based on the above-mentioned data, we hypothesised that brain responses, especially to food high in fat and carbohydrate content would differ between pregnancy and the post partum and between healthy women and women at higher metabolic risk such as GDM. We also hypothesised that there would be a relationship between brain responses to viewing food with different fat and carbohydrate content, eating behaviour and metabolic health and that negative emotions and higher stress levels might influence these brain responses as well as eating behaviour in the perinatal period.The overall aim of this observational study is to investigate brain responses to viewing pictures of foods of different fat and carbohydrate contents in women during pregnancy and in the post partum and their relationship with eating behaviour and metabolic health. We will investigate this in healthy women and in a metabolic high-risk group, that is, women with GDM to include a wide spectrum of metabolic health.The main objectives are as follows:Objective 1: To investigate differences in brain responses to food pictures of varying fat and carbohydrate content  during and after pregnancy, in women with and without GDM.Objective 2: To investigate the cross-sectional and longitudinal relationships between brain responses to food viewing with reported food cravings, eating behaviour and metabolic health outcomes such as weight, body fat and glucose control during pregnancy and in the post partum.Objective 3: To investigate differences in brain responses to food pictures in relationship to different emotional states and stress levels.This is a prospective observational study of women with and without GDM. There will be two visits . Both visits will take place at Lausanne University Hospital.We will include 40\u2009women with valid data for the primary outcomes  at both time points. In the initial tests, the EEG data of 14\u2009women with GDM and 13 healthy controls were not valid , which has been corrected since. We will therefore recruit at least 35\u2009women with GDM and at least 34 healthy controls, in their 24\u201336 weeks of pregnancy, during their antenatal appointments visits at a Swiss University Hospital. GDM women  will be recruited at the GDM clinic whereas healthy pregnant women without GDM (control group) will be recruited at the hospital\u2019s ambulatory clinic.For women with GDM, inclusion criteria are: gestational age 24\u201336 weeks, age \u226518 years, GDM diagnosed at 24\u201332 gestational weeks according to IADPSG and ADA criteria.Exclusion criteria include: pre-existing diabetes, eating disorders , vegetarian/vegan diet, uncontrollable nausea and vomiting, current insulin treatment, participation in an intervention study, current medication to treat psychiatric disorders, active suicidal thoughts.et al, 2011The primary outcomes are EEG viewing responses, specifically to food images depending on fat and carbohydrate content . These responses will be examined in terms of amplitude and latency of the brain responses (VEPs) as well as in terms of response topography. An estimation of the underlying intracranial sources of the VEPs will also be performed. The full analysis pipeline is referred to as \u2018Electrical Neuroimaging\u2019 as has been developed and validated by members of our team and their collaborators , glucose measures at visits 1 and 2 (the latter only in women with GDM) and body composition (fat/lean mass). We will investigate eating rate, objectively using a novel eating recognition device (Auracle) and subjectively (reported perceived eating rate). Using validated self-report questionnaires, we will assess eating behaviours, including cravings (Food Craving Questionnaire-Trait-reduced), intuitive eating  ), external, emotional eating and cognitive restriction (The Three-Factor Eating Questionnaire). Depression scores will be assessed by Edinburgh Postnatal Depression Scale and current mood by PANAS questionnaire Positive and Negative Affective Schedule. Other measures will include self-reported stress level assessed with a questionnaire  and objectively measures of stress using Actiheart.The study started in March 2022 and the end of the study is scheduled for June 2024.The first visit will take place during pregnancy, at 24\u201336 weeks gestational age (visit 1) and the second visit at 6 months postpartum (visit 2).After signing the informed consent, and before visit 1 and visit 2, participants will complete validated questionnaires online . They will be contacted by phone to complete missing data regarding their medical history as well as their lifestyle behaviours.Before each visit, participants will be asked to eat a balanced meal around 12.00 hours  to minimise the bias of different satiety level, will come to the hospital at 13:30 hours and testing will be completed at 16\u2009hours .The development of the research question and outcome measures was also based on remarks from patients that were followed in clinical settings and we informally asked their advice while designing the study. Some results will be provided to participants at the end of their study as feedback by sending them to their healthcare providers. Interested patients will also receive an overall return of the results.We will employ a behavioural task involving food pictures of variable fat and carbohydrate content and will record high-density VEPs  . Using tHIGH-FAT was defined by a fat content of >5\u2009g/100\u2009g (21.6\u00b113.77\u2009g/100\u2009g) and LOW-FAT of <5\u2009g/100\u2009g (mean 1.1\u00b11.29\u2009g/100\u2009g). Similarly, HIGH-CARB was defined as >15\u2009g/100\u2009g carb (48.57\u00b121.13\u2009g/100\u2009g) and LOW-CARB as <15\u2009g/100\u2009g (4.59\u00b14.59\u2009g/100\u2009g). We aimed for the contents to be as far as possible away from the cut-off to provide the best distinction.Images will be identical in size, controlled for low-level visual features (like luminance) and will be presented on the computer monitor during EEG recording sessions. Immediately after the presentation of each image, women have to decide if the presented picture is a food or non-food object by pressing a button 1 or 2 on a response box. Accuracy and reaction time of behavioural responses will be collected. At the beginning of the experimental session, the participant will be presented with the instructions and will have to perform some trials (seven pictures of food and three of non-food) to familiarise herself with the task. Continuous 128-channel EEG will be recorded on the head surface. VEPs will be calculated separately for each image category . The preparation for the EEG recording will take approximately 30\u201345\u2009min, while EEG sessions will last maximum 55\u2009min. When the EEG experiment is completed, the patient will move to the preparation room for the validation task. Twenty pictures of food (five pictures from each food category) will be presented and the patient will be asked to rate how much she wants this food. During visit 2, four blocks with randomised images of food and non-food objects will be presented in a different order than during visit 1 to minimise potential sources of bias.During EEG and the Auracle testing, we will monitor the participant\u2019s heart rate and heart rate variability to assess the level of arousal of the autonomic system. We will perform baseline and recovery measurements (2\u2009min each) before and after EEG and the Auracle testing. For this purpose, we will use Actiheart, a compact chest-worn monitoring tool that apart from heart rate, measures inter beat interval. Specific time points before and after the test will be identified by a stopwatch. To analyse the data, we will use the commercial Actiheart Software and Kubios.Body composition will be measured by bioimpedance  at both visits. Using four electrodes  and low-voltage electric flows, we will measure the resistance (Rz) and reactance (Xc) of tissue to assess the fat and lean mass. We will also use BIA InBody s10 to measure body composition by bioimpedance at both visits. The body composition analysis of InBody S10 is derived from the four-compartment model, which include Total Body Water, Protein, Mineral and Body Fat.54The Auracle see  will be 55 56Eight different crunchy snacks of different carbohydrate and fat content (two of each corresponding to one of the four categories described in the EEG part) will be offered . As eatiCapillary blood will be collected to measure HbA1c level. HbA1c will be analyzed by Afinion.https://www.libreview.com/). During pregnancy, results will be discussed with their healthcare provider during the visits. For the post partum visit, patients will receive feedback by phone.Women with GDM will use Freestyle Libre 1 glucose sensors (Abbott) for flash glucose measurement for 14 days. Sensors will be applied on the back of the arm, with a sterile fibre being inserted under the skin into the interstitial fluid. Patients use a dedicated application LibreLink and will have to scan the glucose sensor at least every 8\u2009hours to transfer data. Data will be linked in a coded form to the online platform Libreview (Women with and without GDM will fill out the same questionnaires during both visits (visits 1 and 2). Most women will fill out the questionnaires in French and a few in English, as around 80% of patients that participate in our studies are French-speaking. The following questionnaires will be filled out online before the study visits:The French IES-2:et al.60The Three-Factor Eating Questionnaire-Revised 18 (TFEQ-R18): Eighteen-item self-report questionnaire that measures three aspects of eating behaviours including cognitive restraint (six items), uncontrolled eating (nine items) and emotional eating (three items). Items are scored on a Likert scale ranging from 1 \u2018almost always\u2019 to 4 \u2018never\u2019. A short, revised version of the Stunkard and Messick TFEQ was developed by Karlsson Food Craving Questionnaire-Trait-reduced:62Edinburgh Postnatal Depression Scale (EPDS):64Edinburgh Handedness Inventory short form:66During the study visits, participants will complete the following questionnaires:The Positive and Negative Affective Schedule questionnaire (PANAS):68The Perceived Stress Scale (PSS-10): Ten-item questionnaire widely used to assess stress levels during the last month. Responses are rated on a Likert scale from 0 \u2018never\u2019 to 5 \u2018very often\u2019. The results range from 0 to 40, with higher scores indicating higher perceived stress. The French version of PSS-10 has shown good psychometric properties.69The Food Craving Questionnaire-State:66The current hunger level scale: This is one item developed for this study assessing the current perceived hunger level using a Likert scale ranging from 1 \u2018just a little/not at all\u2019 to 5 \u2018very much\u2019.The food wanting questionnaire: Twenty-item questionnaire was developed for this study and will be completed after the EEG . Women will be shown 20 pictures of food and asked \u2018How much do you want this food?\u2019. They will then have to indicate their response on a Likert scale from 0 \u2018not at all\u2019 to 10 \u2018very much\u2019.2 tests will be used to determine group differences between responses to food and non-food pictures, different food categories, brain responses between pregnancy and post partum states, between women with and without GDM and between normal weight and overweight/obese women. Regression analyses will be used to model the relationships between predictor variables and outcomes . In the second step, we will investigate the impact of covariates, where appropriate, such as maternal age, gestational age and prepregnancy BMI on outcomes and adjust for them if necessary.The sample size is based on previous EEG studies of similar design,Twenty women with valid data for the primary endpoint in each group (n=40) will be investigated during pregnancy and at 6 months postpartum. In order to achieve this, we had to include more patients.The local ethical committee approved the study protocol (study number 2021-01976). The study poses little to no risk to participants. Signed informed consent will be obtained from all participating women. The results of the study will be disseminated through national and international conferences, in peer-reviewed journals and presented at public conferences and other scientific meetings.The prevalence of obesity continues to increase worldwide. This study seeks to understand brain reactions to the viewing of food images and their changes during pregnancy and in the post partum period. Food cravings and disordered eating behaviours include implicit processes in the brain. Studying these processes could help unravel mechanistic pathways associated with weight gain. Our study may provide novel evidence of scientific and clinical importance to understand eating behaviour, potentially opening perspectives for future interventions that alter reactions to energy-dense food in general or at specific food nutrients and/or brain regions to manage excessive GWG, weight retention, and to reduce adverse metabolic outcomes in the post partum period. It is a potential opportunity to reduce craving, incentive sensitisation and thus the overstimulation of reward circuits by food cues in pregnant and post partum states where a dynamic change in craving and weight gain is observed. The study aims to provide data for a better understanding and long-lasting interventions that can influence the health of the mother and the child."}
+{"text": "Preparing flame-retardant polyamide 66 (PA66) fibers through melt spinning remains one of the biggest challenges nowadays. In this work, dipentaerythritol (Di\u2212PE), an eco-friendly flame retardant, was blended into PA66 to prepare PA66/Di\u2212PE composites and fibers. It was confirmed that Di\u2212PE could significantly improve the flame-retardant properties of PA66 by blocking the terminal carboxyl groups, which was conducive to the formation of a continuous and compact char layer and the reduced production of combustible gas. The combustion results of the composites showed that the limiting oxygen index (LOI) increased from 23.5% to 29.4%, and underwriter laboratories 94 (UL-94) passed the V-0 grade. The peak of heat release rate (PHRR), total heat release (THR), and total smoke production (TSP) decreased by 47.3%, 47.8%, and 44.8%, respectively, for the PA66/6 wt% Di\u2212PE composite compared to those recorded for pure PA66. More importantly, the PA66/Di\u2212PE composites possessed excellent spinnability. The prepared fibers still had good mechanical properties (tensile strength: 5.7 \u00b1 0.2 cN/dtex), while maintaining good flame-retardant properties (LOI: 28.6%). This study provides an outstanding industrial production strategy for fabricating flame-retardant PA66 plastics and fibers. A survey from the Fire and Rescue Department Ministry of Emergency Management of China reports that 1.324 million fire accidents, 11,634 deaths, and 6738 injuries resulting from residential fires occurred nationwide over the period of 2012\u20132022. Polymeric materials are widely used in everyday day life, which increases the fire hazards [Conventional approaches that can be considered to improve the flame retardance property of PA66 fabric include post-finishing, copolymerization, and blending. Among them, the flame-retardant finishing of PA66 fabric is the most widely used due to its simple processing ,6,7. ThiCompared with post-finishing, copolymerization can impart PA66 intrinsic flame-retardancy and enhanced durability ,14,15,16Herein, a series of PA66 flame retardant composites were prepared by the simple blending method using dipentaerythritol (Di\u2212PE) as a flame retardant. The effect of different mass ratios of Di\u2212PE on the flame retardancy of the PA66/Di\u2212PE composites was investigated by limited oxygen index, underwriter laboratories 94, and cone calorimeter tests, and the possible flame retardancy mechanism was also explored. More importantly, PA66 fibers with excellent flame retardance performance were finally obtained via melt spinning and their mechanical properties were also evaluated.PA66 was purchased from Shen Ma Industry Co., Ltd., China. Di\u2212PE (90%) was purchased from Shanghai Aladdin Bio-Chem Technology Co., Ltd., Shanghai, China. The materials were used as received. The twin-screw extruder used  was purchased from Nanjing GIANT Machinery Co., Ltd., Nanjing, China. The vertical injection molding machine (TY-200) was purchased from TAYU Machinery Co., Ltd., China. The two-component composite spinning machine  was purchased from Abe Corporation, Japan.Di\u2212PE and PA66 were dried overnight in a vacuum oven at 110 \u00b0C. The flame retardant PA66 composites were obtained by extruding the mixtures of PA66 and Di\u2212PE in a twin-screw extruder. The temperature of the extruder was maintained at 230 \u00b0C, 245 \u00b0C, 260 \u00b0C, 270 \u00b0C, 265 \u00b0C, and 265 \u00b0C from hopper to die. The dried pellets of the composites were molded by the vertical injection molding machine at a temperature in three heating zones .The pellets of PA66 and PA66/Di\u2212PE composites were melt-spun with the two-component composite spinning machine. The main spinning parameters are summarized in The LOI test was determined on an oxygen index meter  with 80 mm \u00d7 10 mm \u00d7 4.0 mm specimens according to GB/T 2406.2-2009.The UL-94 tests were performed based on a horizontal and vertical burning test instrument  according to the GBT2408-2008 testing procedure, using samples with dimensions of 127 mm \u00d7 12.7 mm \u00d7 3.2 mm.\u22121.The ATR-FTIR spectra of the PA66/Di\u2212PE composites and char residues were obtained with a Nicolet 6700 FTIR instrument . The wavenumber range was set from 4000 to 600 cmThe thermal properties of the samples were studied with a thermogravimeter . Fir this, 5\u201310 mg samples were heated at 20 \u00b0C/min from 25 to 700 \u00b0C under air atmosphere.Differential scanning calorimetry (DSC) was performed on a Netzsch DSC 204 F1 , with a heating rate of 20 \u00b0C/min up to 280 \u00b0C under nitrogen and held for 2 min to completely remove the previous thermal history. Then, the samples were cooled down to 25 \u00b0C and finally heated to 280 \u00b0C at the cooling and heating rates of 10 \u00b0C/min.2.The combustion performance was evaluated with a cone calorimeter  in accordance with ISO 5660-1 standard, using specimen with dimensions of 100 mm \u00d7 100 mm \u00d7 3 mm with 50 kW/mThe residual chars were obtained in a muffle furnace at 500 \u00b0C, then observed by a scanning electron microscope  at the accelerating voltage of 10 kV.\u22121 region.The Raman spectra of PA66 and the PA66/Di\u2212PE composites residual chars were obtained with a laser Raman spectrometer  using a 532 nm helium\u2013neon laser line focused on a micrometer spot on the sample surface and scanning in the 2000\u2013800 cmThe XPS data were carried obtained with an Escalab 250Xi electron analyzer .\u22121.The TG\u2013FTIR was conducted on a thermogravimeter instrument  with a Fourier transform infrared spectrometer . About 10 mg of the samples was heated at 20 \u00b0C/min from 25 to 800 \u00b0C under air atmosphere. The pyrolysis gaseous products were tunneled into the FTIR device and scanned in the range from 4000 to 600 cm5% is the temperature corresponding to a 5 wt% weight loss and is indispensable to evaluate the thermal decomposition behavior of a polymer in the initial stage. The pure PA66 presented almost no char residue above 600 \u00b0C, and the T5% and Tmax (the temperature at the maximum weight loss rate) were about 396.3 \u00b0C and 477.7 \u00b0C, respectively.Thermogravimetric analysis (TGA) and derivative thermogravimetry (DTG) curves in the air atmosphere were utilized to assess the thermal-oxidative degradation behavior of PA66 and its composites . The sum5% and the Tmax of the PA66/Di\u2212PE composites decreased, while the char yields of the PA66/4 wt% Di\u2212PE and PA66/6 wt% Di\u2212PE composites at 600 \u00b0C or 700 \u00b0C were much higher than that of pure PA66. In order to more intuitively verify that Di\u2212PE promoted char formation from PA66, PA66 and PA66/6 wt% Di\u2212PE were placed in muffle furnaces at different temperatures, and it was found that PA66/6 wt% Di\u2212PE formed carbon layers earlier than PA66 at the same high temperature  [2, 112.8 kW/m2, and 60.1 MJ/m2, which represent a reduction by 47.3%, 68.6%, and 47.8%, respectively, compared to pure PA66. In order to further evaluate the combustion process of the PA66/Di\u2212PE composites in real combustion situations, the cone calorimetry test (CCT) was implemented. The CCT is a significant method to evaluate the fire behavior of polymers. It simulates fire hazard conditions and provides a series of key flammability parameters such as heat release rate (HRR), peak of heat release rate (PHRR), total heat release (THR), effective heat of combustion (EHC), mass loss rate (MLR), total smoke production (TSP), peak of smoke production rate (PSPR), average carbon monoxide yield (av-COY), average carbon dioxide yield (av\u2212CO2Y) ,21, and 2Y) ,23. In gAdditionally, the flame retardancy index (FRI), a non-dimensional criterion to evaluate the flame-retardant properties of composites, was calculated according to the following formula:The FRI is an important parameter for evaluating the flame-retardant properties of a composite. More specifically, the FRI is classified as Poor (FRI \u2264 1), Good (1 < FRI \u2264 10), and Excellent (FRI > 10) . With thThe Cone test not only describes the flame retardance of samples but also can be used to study flame-retardant mechanisms . The TTI2Y shown in 2Y decreased with the increase of Di\u2212PE loading. These results showed that Di\u2212PE also played a flame-retardant role in the gas phase.EHC is an important parameter to demonstrate the degree of combustion of volatile gas in the gas phase . Figure In order to fully understand the flame retardance mechanism of the PA66/Di\u2212PE composites, ATR-FTIR, SEM, Raman spectroscopy, XPS, and TG-IR were utilized to investigate the properties of the char residues and the volatile components. D/IG); the fitting equation is Gaussian, and the lower the ID/IG value, the higher the graphitization degree [D/IG value decreased with the increasing content of Di\u2212PE. Therefore, both the microstructure and the graphitization degree of the char residuals further indicated that Di\u2212PE played a positive effect on enhancing the flame retardance in the condensed phase, which could promote the formation of a compact and continuous char layer with a high graphitization degree, thus protecting the matrix effectively.Moreover, besides the morphology of the char, the graphitization degree of the char also played an important role in improving the flame-retardant properties. The higher the graphitization degree in the char structure, the better the protection against thermal degradation of the material. Thus, Raman spectroscopy was applied to analyze the carbonaceous structures and graphitization of residual char . The gran degree ,28,29. I\u22121 for the samples PA66/4 wt% Di\u2212PE and PA66/6 wt% gradually decreased. XPS can determine precisely the reaction between a polymer and an additive by the change in chemical bonding. In \u22121 and 2856 cm\u22121 attributed to the -CH2- stretching vibration. Meanwhile, some new characteristic peaks were observed at 1648, 1531, 1456, 1375, and 723 cm\u22121. The peak at 1648 cm\u22121 corresponded to the stretching vibration of the aromatic structure of the benzene ring, and the characteristic peak at 723 cm\u22121 was attributed to the Carom-H rocking [\u22121 (-CONH-) of PA66 was not observed for the char residues, while the char residues of the PA66/Di\u2212PE composites retain a visible characteristic peak here, proving that Di\u2212PE caused the incomplete degradation of PA66 [\u22121 correspond to the -CN- stretching vibration [The mechanism by which Di\u2212PE could promote char formation of nylon 66 was further explored by FTIR analysis, as shown in  rocking , showing rocking ,33. In a of PA66 . The peaibration ,36,37. C3 (930\u2013960 cm\u22121), hydrocarbons with the C-H functionality (2850\u20132950 cm\u22121), carbonyl compounds , CO (2150\u20132180 cm\u22121), and CO2 (2300\u20132400 cm\u22121), were further investigated [3 for PA66/6 wt% Di\u2212PE slightly increased compared to that of pure PA66, indicating a possible dilution of the flammable gas and oxygen, thus inhibiting gas combustion in the gas phase [2 confirmed that Di\u2212PE promoted the incomplete combustion of the PA66/Di\u2212PE composites, which is in accordance with the CCT results. All these observations confirmed that Di\u2212PE also has a positive effect in the gas phase during the combustion process.TG-IR is used to characterize volatile components during heating in the air atmosphere. It could help us to investigate the flame-retardance mechanism of Di\u2212PE in the gas phase. It can be observed in stigated . As depiO2 2300\u201320 cm\u22121, wThe tensile properties of pure PA66 and the PA66/Di\u2212PE composite are shown in The influence of Di\u2212PE on the crystallization behavior of the PA66/Di\u2212PE composites was investigated by DSC. The DSC cooling and second heating curves of PA66 and the PA66/Di\u2212PE composites are shown in Thanks to the excellent melt processing performance and high thermal stability of the PA66/Di\u2212PE composites, PA66/Di\u2212PE fibers could be obtained via melt spinning. In addition to the mechanical properties, the maintenance of the flame-retardant properties of fibers is very important. 3. More importantly, the flame retardant PA66/4 wt% Di\u2212PE composites could be made into fibers by melt spinning. The LOI, after-flame time, and damaged length of the PA66/4 wt% Di\u2212PE fabric were significantly improved compared with those of pure PA66, and the absorbent cotton was not ignited. This work provides an outstanding industrial production strategy for fabricating flame-retardant PA66 plastics and fibers and shows that Di\u2212PE has a great potential to reinforce the flame retardancy of PA66.Flame retardant PA66/Di\u2212PE composites and fibers were prepared by blending and the melt spinning technology. It was found that Di\u2212PE could significantly improve the flame-retardant properties of PA66 through the end-group blocking effect. The PA66/6 wt% Di\u2212PE composite achieved the most outstanding LOI value of 29.4% and passed the V-0 rating of UL-94. The CCT results of PA66/6 wt% Di\u2212PE showed that the PHRR and THR were reduced by 47.3% and 47.8%, respectively, compared to those of pure PA66. The FRI of the PA66/4 wt% Di\u2212PE and PA66/6 wt% Di\u2212PE composites reached 1.53 and 2.42, respectively. Moreover, the addition of Di\u2212PE was confirmed to lead to the formation of a continuous and compact char layer, which could cut off the transfer of heat, combustible gas, and oxygen, as well as decrease the release of total gas and flammable hydrocarbons and increase the release of incombustible gas NH"
\ No newline at end of file