diff --git "a/deduped/dedup_0098.jsonl" "b/deduped/dedup_0098.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0098.jsonl"
@@ -0,0 +1,77 @@
+{"text": "Hepatitis C (HCV), hepatitis B (HBV), the human immunodeficiency viruses (HIV), and other viruses that replicate via RNA intermediaries, cause an enormous burden of disease and premature death worldwide. These viruses circulate within infected hosts as vast populations of closely related, but genetically diverse, molecules known as \"quasispecies\". The mechanism(s) by which this extreme genetic and antigenic diversity is stably maintained are unclear, but are fundamental to understanding viral persistence and pathobiology. The persistence of HCV, an RNA virus, is especially problematic and HCV stability, maintained despite rapid genomic mutation, is highly paradoxical. This paper presents the hypothesis, and evidence, that viruses capable of persistent infection autoregulate replication and the likely mechanism mediating autoregulation \u2013 Replicative Homeostasis \u2013 is described. Replicative homeostasis causes formation of stable, but highly reactive, equilibria that drive quasispecies expansion and generates escape mutation. Replicative homeostasis explains both viral kinetics and the enigma of RNA quasispecies stability and provides a rational, mechanistic basis for all observed viral behaviours and host responses. More importantly, this paradigm has specific therapeutic implication and defines, precisely, new approaches to antiviral therapy. Replicative homeostasis may also modulate cellular gene expression. Hepatitis C (HCV), HBV and HIV are major causes of premature death and morbidity globally. These infections are frequently life-long; Hepatitis viruses may result in progressive injury to the liver and cirrhosis, and death from liver failure, or hepatocellular carcinoma, while HIV causes progressive immune depletion and death from the acquired immunodeficiency syndrome (AIDS). Together, these infections cause millions of premature deaths annually, predominantly in \"developing\" countries. Other viruses replicating via RNA intermediaries cause similar morbidity among domestic and wild animal populations. While education, public health measures and vaccination (for HBV) have resulted in significant progress in disease control, therapy of established viral infection remains unsatisfactory.pol), enzymes that lack either fidelity or proofreading function (t-1)ek, where [RNA]t is virus concentration at time (t) and k a growth constant. However, because of RNApol infidelity, wild-type (wt) virus will accumulate at [RNAwt]t = [RNAwt](t-1)\u2022(1-\u03c1)\u2022K1 and variant forms (mt) at [RNAmt]t \u2248 ([RNAwt](t-1)\u2022\u03c1 + [RNAmt](t-1))\u2022K1, where \u03c1 is the probability of mutation during replication and K1 = ek. Therefore, while wild-type virus predominates early, replication (and intracellular accumulation) of variant virus and viral proteins will accelerate (in a ratio of ([RNAwt](t-1)\u2022\u03c1 + [RNAmt](t-1))/ [RNAwt](t-1)\u2022(1-\u03c1) compared to wild type) and variant viral RNAs will rapidly predominate  represent the immune forces favouring viral clearance and Ve(t) viral forces promoting quasispecies expansion pressures at time (t).2. Let Ic required to clear virus are proportional to viral concentration [V], that is; Ve \u221d [V] (or Ve = ke [V] where ke is some constant), so that Ic required to clear one viral particle Ic(1) is less than that Ic required to clear 10 viral particles Ic(10).3. Assume immune pressures Ic(b or c) \u2248 Ve(b or c). \u00a0\u00a0\u00a0 Eq.14. At equilibrium ] \u21d2 [Ve(b or c)], then immune clearance pressures must exceed viral expansion pressures at that time i.e. Ic(a) > Ve(a). \u00a0\u00a0\u00a0 Eq.25. If I2\u20133 [V(a)] \u2248 [V(b or c)]\u2022 102\u20133, and Ic(b or c)= Ve(b or c) then immune clearance pressures at time A exceed those at time (B or C) by102\u20133 Ic(a) >Ic(b or c)\u2022 102\u20133. That is, immune pressures fall by 102\u20133 between time A and B or C,  by 102\u20133 over days between time A and B or C?i) Why, and by what mechanism, would immune forces, or any other host defense mechanisms, fall by 10cause reduced viral replication. Evidence that prior HCV infection does not confer protective immunity against either heterologous HCV infection in chimpanzee  or reducing intracellular [Envmt] should accelerate viral replication and mutation. In fact, observations relevant to every aspect of this hypothesis have been reported in a variety of systems and circumstances. All outcomes are completely consistent with those predicted by replicative homeostasis. Replicative homeostasis predicts, for example, HCV E2 proteins derived from genotype 1 HCV sequences would reduce HCV replication when administered to patients with heterologous HCV infection  and studies examining heterologous envelope proteins as direct RNApol inhibitors are underway.This hypothesis is simply tested. Manoeuvres that increase intracellular concentrations of variant envelope proteins or decrease wild-type envelope proteins should inhibit viral replication and reduce mutation rates. Conversely, manoeuvres increasing intracellular [EnvReplicative homeostasis immediately resolves the paradox RNA viral quasispecies stability and explains how these viruses persist and, thereby, cause disease. Replicative homeostasis also explains the initial decline of viral replication, resolving the kinetic paradox, rationalizing the dynamics of chronic viral infection and other enigmatic and unresolved viral behaviours. Most importantly, replicative homeostasis implies a general approach to antiviral therapy.Wt: RNApol interactions that, in turn, increase polymerase processivity but reduce fidelity accelerating synthesis of variant viral RNAs and, consequently, increased translation of antigenically diverse proteins, reactively driving quasispecies expansion and generating the extreme antigenic diversity of RNA quasispecies. Alternatively, in the absence of immunological recognition, variant envelope / polymerase interactions predominate, restricting viral replication and mutation, thus maintaining basal output of consensus viral sequences, thus maintaining genotype. Immune escape and maximal cell tropism are inevitable consequences of the potential antigenic diversity generated by RNA replication mediated by the reactive equilibria of replicative homeostasis.The equilibria formed by replicative homeostasis are responsive to disturbance of envelope concentrations ensuring viral mutation is neither random nor passive but highly reactive to external influence: Sustained reduction of viral envelope (by immune or other mechanisms) would favour high affinity Env20 (about 1026) possible conformations, greatly exceeding the ~1010 antibody [5\u20137 viral equivalents / ml they are not likely to be any more effective at 108\u201311 eq/ ml.Potential viral antigenic diversity is numerical superior to any immune response; Theoretically, a small envelope protein of 20 amino acids could assume 20antibody  or CTL rpol inhibition would cause rapidly progressive or fulminant disease , while inadequate replication or generation of diversity will result in viral clearance  will alter extracellular concentrations of Env proteins, thus changing intracellular envelope concentrations once extracellular /intracellular Env concentrations equilibrate. Therefore, antibodies to heterologous envelope proteins \u2013 developing, for example, during immunization against other viruses or heterotypic co-infection \u2013 will reduce relative intracellular concentrations of variant envelope, favouring RNApol:EnvWt interactions, thus enhancing replication and increasing mutation rates, a prediction confirmed in practice [Perturbations of relative intracellular wild-type and variant envelope concentrations alter RNApractice ,56. Contpractice  \u2013 would practice , Dengue practice , Murray practice , Ebola [practice  Coxsackipractice  and othepractice  or tetanpractice  and Dengpractice  co-infecpractice , are alspractice ; persistpractice ; long-tepractice ; spontanpractice   transmission, a prerequisite for viral survival on an evolutionary time scale Figure . A subtlpol properties  and modulate mutations introduced into the RNA templates RNApol synthesises, a subtle form of \"quality control\" is exerted over protein synthesis [Although proposed specifically to explain RNA viral quasispecies stability, replicative homeostasis is, fundamentally, a mechanism that regulates RNA transcription and modulates protein expression. If proteins (i.e. phenotype) modulate RNAynthesis . This meynthesis , a reproynthesis  and, by pol transcription by DNA viruses, cellular micro-organisms , and eukaryotic cells, subtly modulating cell-surface protein expression, via replicative homeostasis, to mediate immune escape, control cell division and differentiation, or other functions would not be surprising.Finally, accessory proteins that alter the processivity and fidelity of both DNA-dependent RNA polymerases  and DNA-"}
+{"text": "Lys3, is selectively packaged into the virus during its assembly, and annealed to the viral genomic RNA. The ribonucleoprotein complex that is involved in the packaging and annealing of tRNALys into HIV-1 consists of Gag, GagPol, tRNALys, lysyl-tRNA synthetase (LysRS), and viral genomic RNA. Gag targets tRNALys for viral packaging through Gag's interaction with LysRS, a tRNALys-binding protein, while reverse transcriptase (RT) sequences within GagPol (the thumb domain) bind to tRNALys. The further annealing of tRNALys3 to viral RNA requires nucleocapsid (NC) sequences in Gag, but not the NC sequences GagPol. In this report, we further show that while the RT connection domain in GagPol is not required for tRNALys3 packaging into the virus, it is required for tRNALys3 annealing to the viral RNA genome.The primer tRNA for reverse transcription in HIV-1, tRNA Lys isoacceptors in mammalian cells, tRNALys1,2 and tRNALys3, are selectively incorporated into the virus [Lys3 is the primer for initiating minus-strand cDNA synthesis, and its annealing to the 18 nucleotide primer binding site (PBS) region in the 5' part of the viral genome via the 3' 18 nucleotides in tRNALys3 complementary to the PBS, is a key step in viral replication [During assembly of HIV-1, the major tRNAlication .Lys3 and sites of annealing in viral RNA contain double stranded regions which may require denaturation for annealing to proceed efficiently. Nucleocapsid protein (NC) has been shown to facilitate tRNALys3 annealing both in vitro [in vivo [in vitro, and that the protein only has very subtle tertiary structural and helix destabilization effects on tRNALys3 alone [Both tRNAin vitro ,6 and in[in vivo , primaris3 alone -11.Lys3 annealing to genomic RNA in vitro, the annealing of primer tRNA onto the genomic RNA within HIV-1, murine leukemia virus, and avian retrovirus occurs independently of precursor protein processing [Lys3 is annealed efficiently in protease-negative HIV-1 (about 80% that found in wild-type virions), optimal placement on the viral genome to achieve efficient initiation of reverse transcription requires exposure of the viral genome to mature nucleocapsid protein [Lys3 annealing, while mutations in NC sequences within GagPol do not, indicating the importance of Gag NC sequences in the annealing [In vitro, Gag has been reported to facilitate tRNALys3 annealing to viral RNA as efficiently as mature NC [Although processed nucleocapsid proteins have been shown to facilitate tRNAocessing -14. Howe protein . In thesnnealing . In vitrature NC .Lys3 annealing onto the viral RNA, independent of its role in the packaging of tRNALys3 into the virion. We present data herein indicating that the RT connection domain, while non-essential for tRNALys3 incorporation into virions, is required for tRNALys3 annealing to the viral RNA genomeNevertheless, we will present evidence in this report that GagPol still plays an important role in tRNALys incorporation into virions, but is required for the annealing of tRNALys3 to the viral genomeThe RT connection domain within GagPol is not required for tRNA.Lys3, to determine the tRNALys3/genomic RNA in each viral variant. These results are shown graphically in Figure Lys incorporation into virions is not dramatically affected until GagPol sequences including the thumb domain of RT are deleted (\u0394581 and \u0394715).293T cells were transfected with protease-negative HIV-1 proviral DNA coding for either full length, protease-negative, GagPol (BH10.P-) or C-terminally deleted GagPol species. The different constructs are shown in Figure Lys3 annealed in vivo to the viral RNA genome, total viral RNA was used as the source of primer/template in an in vitro reverse transcription reaction, using exogenous HIV-1 RT, dCTP, dTTP, \u03b1-32P-dGTP, and ddATP. This assay measures the amount of extendable tRNALys3 placed onto the viral genome. It is not known if all annealed tRNALys3 is extendable. Since the sequence of the first six dNTP's incorporated is CTGCTA, annealed primer tRNALys3 will be extended by 6 bases, and the extended tRNALys3 can be resolved and detected by one dimensional polyacrylamide gel electrophoresis (1D PAGE). These results are shown in Figure Lys incorporation, but do severely reduce the ability of tRNALys3 to be functionally annealed to the viral RNA genome.To measure the amount of tRNALys3 as BH10P-, but cotransfection of mutant DNA with DNA coding for GagPol gives a small increase in tRNALys3 packaged to over 90% of BH10P- .Attempts were also made to rescue tRNAd to Vpr , but unlIn vitro studies of the interaction between purified RT and tRNALys3 have indicated an interaction between the RT thumb domain and the tRNA [In vivo studies also indicate an important role of the RT thumb domain in GagPol in tRNALys3 viral packaging. tRNALys3 incorporation into HIV-1 is not affected by deletion of the IN domain in GagPol, nor by further deletion of the RNaseH and connection domains in RT, but is severely inhibited by further deletion of the thumb domain as well [Lys3 interacts with the RT thumb domain during incorporation into virions, and Gag nucleocapsid plays a role in promoting tRNALys3 annealing to viral RNA [the tRNA -22. In v as well . Thus tRiral RNA -7, presuLys3 annealing? One possibility, suggested by in vitro studies, is that RT plays a direct role in tRNALys3 annealing. Early work indicated that the in vitro annealing of primer tRNATrp to AMV genomic RNA was promoted by the addition of AMV reverse transcriptase [Lys3, HIV-1 RT was also shown facilitate the in vitro annealing of tRNALys3 to the PBS sequence [in vitro works suggest that RT alone can directly promote tRNALys3 annealing to viral RNA. Whether the RT sequences in GagPol can function similarly in vivo is not known.What then is the role the RT connection domain sequence in GagPol in facilitating tRNAcriptase . In a lasequence . These iLys3 bound to the thumb domain in RT closer to either NC in Gag or to the genomic RNA that is bound to Gag NC. Recent work has indicated that that Pol sequences alone can bind to Gag p6 through the RT sequences in Pol [Lys incorporation into the virus and tRNALys3 annealing to the viral genome at levels approximately 35% those achieved using full-length GagPol. Thus, in addition to the interactions which probably occur between Gag and homologous sequences in the Gag part of GagPol, the interaction of RT sequences in GagPol with Gag p6 could place the RT-bound tRNALys3 closer to Gag NC sequences and viral RNA in the packaging complex. It remains to be determined which sequences within RT bind to Gag p6, but if it were those of the connection domain, this could explain how these sequences could promote tRNALys3 annealing through altering the configuration of GagPol.Alternatively, the RT connection domain may undergo interactions with Gag that may result in placing the tRNAs in Pol . Pol proLys3, and its annealing to HIV-1 RNA. One also finds two separate domains in Gag involved in these same processes. Evidence has been presented supporting the role of lysyl-tRNA synthetase (LysRS) in targeting tRNALys for viral incorporation, through a specific interaction of Gag capsid sequence with LysRS in a tRNALys/LysRS complex [Lys3 annealing [Lys3 annealing, and LysRS may be required to dissociate from tRNALys3 so as to free this tRNA for annealing to the viral RNA.Thus, two separate RT domains (thumb and connection) appear to be involved, respectively, in the viral incorporation of tRNA complex , while onnealing ,16,17. IBH10 and BH10P- are protease-positive and protease-negative strains of HIV-1, respectively . All delTransfection of COS7 cells with wild type and proviral DNA was performed using the calcium phosphate method as previously described . BrieflyViral particles were washed with 1X TNE and cellular or viral proteins were extracted with 1X RIPA buffer . Western analysis was performed using 300 mg cellular protein or 10 \u03bcg viral protein, as determined by the Bradford assay [Lys3 into virions, hybridization to dot-blots of viral RNA was carried out with DNA probes complementary to tRNALys3 [Lys3 annealed to genomic RNA, tRNALys3-primed initiation of reverse transcription was measured using total viral RNA as the source of primer tRNA/template in an in vitro HIV-1 reverse transcription reaction, as previously described [Lys3 is extended by 6 bases, and this product can be resolved by 1D PAGE, and quantitated by phosphorimaging, as previously described [Total viral RNA was extracted from viral pellets by the guanidinium isothiocyanate procedure , and distRNALys3  or to getRNALys3 . To measescribed . The seqescribed .SC carried out the molecular genetic studies, assisted by MJ. LK conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript."}
+{"text": "Retroviridae family is strong evidence that a dimerized genome is of critical importance to the viral life cycle. An obvious hypothesis is that retroviruses have evolved to preferentially package two copies of genomic RNA, and that dimerization ensures the proper packaging specificity for such a genome. However, this implies that dimerization must be a prerequisite for genome encapsidation, a notion that has been debated for many years. In this article, we review retroviral RNA dimerization and packaging, highlighting the research that has attempted to dissect the intricate relationship between these two processes in the context of HIV-1, and discuss the therapeutic potential of these putative antiretroviral targets.During virus assembly, all retroviruses specifically encapsidate two copies of full-length viral genomic RNA in the form of a non-covalently linked RNA dimer. The absolute conservation of this unique genome structure within the  However, as with many topics in retrovirology, interest in this area was heightened with the realization that the causative agent of AIDS was a retrovirus. Since then, RNA and protein sequences involved in genome dimerization have been identified for a number of retroviruses, and the dimeric nature of the retroviral genome is known to be important for various critical events in the viral life cycle. These include reverse transcription and recombination, as well as genome encapsidation. To date, a number of informative reviews have been published on retroviral RNA dimerization -3, genomd models . Anotheroviruses . In thisThe first evidence for the existence of a dimerized RNA genome came in 1967 when it was shown that viral RNA from each of Rous sarcoma virus (RSV), avian myeloblastosis virus (AMV), murine leukemia virus (MLV), and mouse mammary tumor virus (MTV) displayed sedimentation constants between 64S and 74S in sucrose gradients . Since tin vivo and in vitro approaches have been used to study retroviral RNA dimerization. The in vivo approach is that whereby RNA is isolated from virions produced in tissue culture and then analyzed by native Northern blotting [in vitro, and then studying the ability of these fragments to form dimers. The HIV-1 DLS was originally identified when it was shown that an in vitro-transcribed fragment of HIV-1 RNA could form two major bands on a native gel after incubation at 37\u00b0C for 15 min [In vivo evidence for a role of the NC protein in the dimerization process was already available [in vitro dimerization assays [Both blotting . The othr 15 min . The lowvailable , and thin assays .in vitro. The palindromic region was termed the dimerization initiation site (DIS) and it was proposed that this structural element could be exploited for targeted antiviral therapy by antisense oligonucleotides [in vitro dimerization of a 224\u2013402 nt RNA fragment was completely blocked by an antisense oligonucleotide that targeted the palindrome [It was subsequently reported that an RNA fragment representing nt 1\u2013311 of HIV-1 RNA  could not only form dimers, but that RNAs containing these first 311 nt could dimerize 10 times faster than RNA sequences at positions 311\u2013415 that were previously shown to be sufficient for HIV-1 RNA dimerization . Based oleotides . These fleotides , and it lindrome . This lelindrome  or \"kisslindrome  of HIV-1lindrome ,31 whichlindrome ,33. Similindrome -41.in vitro evidence supporting the above model of dimer maturation, it was not yet known where or when the RNA dimer was actually formed in vivo. However, native Northern blotting analysis of RNA from two Moloney murine leukemia virus (MuLV) protease-negative (PR-) mutants displayed dimers that migrated more slowly, and showed lower melting temperatures, than that of wild-type [Despite ample ild-type . It was ild-type . On the in vitro analysis showed that NC could convert the less thermostable dimers to a more stable conformation [in vivo, and, in agreement with earlier proposals [in vivo analysis of a panel of HIV-1 NC mutants showed that Cys-Ser substitution of amino acid residues within the second zinc finger decreased genomic RNA dimerization to the same extent as disruption of the DIS [in vivo situation.Evidence for the role of NC in this dimer maturation process came when ormation . Similarormation . Taken troposals , strongl the DIS . This fiWhy a class of viruses would evolve to have such a unique genomic structure is not entirely clear, but it is speculated that the availability of two copies of the genome would be advantageous for recombination during the complex reverse transcription process, that is key to the retroviral life cycle . Indeed,gag coding region  and the rt codon ; howeverrt codon . It was rt codon ,64-68, ain vitro ,69-72. Tin vitro   [cis elements required for packaging was immediately interpreted to mean that retroviral RNA dimerization, activated by either NC or Gag precursors, should direct genomic RNA into the virion, implying that dimerization might be a prerequisite for packaging. Since HIV-1, MuLV, and RSV all contain elements involved in dimerization that were also required for packaging [Early reports on 311\u2013415) ,88, and 311\u2013415) -53. Thisackaging ,89,90, iackaging -27. The in vivo studies analyzing the structure of virion-associated RNA from rapid-harvest avian retroviruses showed that viral RNA appeared to be a mixture of monomers and dimers [- mutants of HIV-1 showed that substantial amounts of monomeric RNA could be detected [- dimers were shown to be less stable than wild-type dimers, it was assumed that dimers were preferentially packaged in PR- particles, but that some fragile dimeric structures had dissociated during RNA preparation. Based on these in vivo results with both MuLV and HIV-1, it was concluded that dimerization is a prerequisite for packaging and should be considered to be a general feature of retrovirus assembly.Early d dimers -93. Simid dimers ,95 and Nd dimers ,94,96,97d dimers . Based odetected . Since PFurther insights into this topic can be obtained by examination of results from a number of studies aimed at understanding the role of the DIS in HIV-1 replication. One such study, in which DIS loop palindrome sequences were mutated, found that mutation of the palindrome to shorter or longer versions of GC stretches did not have major effects on viral RNA dimerization; however, partial RNA packaging defects were observed that also corresponded to diminutions in viral replication . Based oin vivo HIV-1 RNA dimerization process. Yet, these mutant genomes could still be packaged, suggesting that HIV-1 RNAs need not be dimers for this to happen. Thus, the authors concluded that dimerization is not a prerequisite for packaging but rather serves an independent function in the retroviral life cycle. In the above-cited article, the effects of SL3 mutations on dimerization were not studied, but our group later showed that viruses containing even minor substitutions in or around SL3 could have significant effects on both dimerization and packaging [Although several groups had attempted to delineate the relationship between dimerization and packaging, the fact remains that the RNA signals that are important for both of these activities overlap in most retroviral genomes; this makes it difficult to interpret the results of mutagenesis studies. In an attempt to generate viruses that would be expected to display selective defects in dimerization or packaging, one group designed a panel of constructs containing mutations in SL1, SL3, or both . Resultsackaging ,101.in vivo studies described above commonly observed that mutations in 5' RNA sequences affected both dimerization and packaging, presumably due to the close proximity of the RNA dimerization and packaging signals.In summary, the In an attempt to separate the dimerization and packaging functions, and to characterize the DIS-DLS region without altering packaging activity, one group generated mutant constructs carrying a duplication of approximately 1000 nt from the HIV-1 5' region (termed E/DLS) including the encapsidation signal and the DIS-DLS . They foIn a follow-up study, the same group created mutant HIV-1 particles that contained only monomeric RNAs, and concluded that these mutants demonstrated the complete separation of encapsidation from physical dimerization of retroviral RNA . HoweverHowever, the above results do raise the issue of packaging specificity in mutant viruses. We and others have shown that, in COS cells, HIV-1 can incorporate significant amounts of spliced viral RNA when proper packaging of full-length viral genomic RNA is reduced ,104. DurAnother group reported similar phenotypes in the context of an HIV-1 mutant that was designed to have altered Gag/Gag-Pol ratios . AnalysiWe have also been studying the HIV-1 5' UTR and its putative interactions with Gag, and how these interactions affect dimerization and packaging activities. The DIS is known to be important for viral replication ,106-109,In a follow-up study, we created two other DIS deletions and combined them with various combinations of the previously identified compensatory point mutations. We showed that these mutant viruses, \u0394Loop (lacking the loop region of SL1) and \u0394DIS (lacking the complete SL1) displayed defects in replication, RNA dimerization, and packaging. Once more, all of these but dimerization were largely corrected by the compensatory point mutations in Gag . Even a The mechanism(s) whereby these compensatory point mutations functioned to restore replication had eluded us for some time. Recently, however, we employed an RNase protection assay to discriminate between genomic and spliced viral RNA packaged into virus particles. Our results showed that all of our 5' UTR mutant viruses aberrantly packaged increased levels of spliced viral RNA compared to wild-type virions. More importantly, however, the effect of one of our compensatory point mutations  was to exclude spliced viral RNA from being packaged into mutant virions . Surprisin vitro and in vivo protocols. New approaches to study dimerization and packaging within the cell will hopefully allow new hypotheses to be tested.Previous work had suggested that the packaging of spliced viral RNA is a mechanism used by packaging mutants to fill the space that would normally be occupied by genomic RNA . Were thThe packaging of spliced viral RNA and/or the exclusion of such RNA species raises the question of whether the viral RNA sequence, or possibly the RNA structure, is important in proper assembly and/or structural integrity of the virus particle itself. Evidence in support of this possibility comes from studies on the binding of NC, in the context of full-length Gag, to viral genomic RNA. This might concentrate Gag proteins onto one or more RNA molecules, thereby facilitating Gag-Gag multimerization in a template-driven manner. Hence, viral genomic RNA would be a structural element, or scaffold, on which the virion can assemble . Other rAs stated, the link between dimerization and packaging is a subject of ongoing debate ,109,110,It is clear that virus replication capacity is significantly affected whenever dimerization and/or packaging are compromised, suggesting that these activities can be exploited as anti-HIV drug targets. Indeed, the DIS was first proposed to be a potential therapeutic target at least 10 years ago, and antisense molecules were directed at this region of viral RNA ,123, wittat and rev [RNA interference (RNAi) is a novel mechanism that regulates gene expression in which small interfering RNAs direct the targeted degradation of RNA in a sequence-specific manner (reviewed in Lee and Rossi ). Althou and rev . DNA vecThe DIS might also be a good candidate for sequence-specific targeting of HIV by RNAi therapy since it is highly conserved among naturally occurring virus isolates, and, due to its position upstream of the major splice donor, is contained in all HIV-1 RNA transcripts, both spliced and unspliced. Effective DIS-directed degradation of HIV RNA should confer the same viral phenotype as observed with our \u0394DIS mutant, which never showed signs of virus replication in either permissive T cell lines or blood mononuclear cells . One contat and nef genes, and the mutations that were generated blocked the effects of the RNAi without conferring any major detriment to virus replication. In contrast, RNAi may be more useful if targeted to more critical RNA elements within the genome, such as the DIS or the \u03a8 region, since any escape mutations that occur might result in viruses with severely impaired replication ability.Recently, the practicality of RNAi-based therapies against HIV-1 was called into question when it was shown that HIV-1 was able to escape the antiviral pressure of RNAi by generating substitutions or even deletions within RNAi target sequences ,128. ThiAll of these DIS-directed strategies rely on specifically targeting the viral RNA itself, which might not be practical given our inadequate knowledge of the overall structure of the HIV-1 5' region. The fact that RNA sequences such as SL1 and SL3 are known to form relevant RNA-protein interactions raises the possibility that the protein component of these interactions might also provide potential targets for anti-HIV therapy. Such approaches are currently being explored in research aimed at designing inhibitors of the TAR-Tat RNA-protein interaction . Similarin vitro and in vivo approaches toward more biologically relevant methods. One group has taken chemical modification protocols commonly used for in vitro RNA analysis, and adapted them for use in virus-producing cells. Hence, structural analysis of viral RNA, that would previously be carried out only in vitro on short fragments of artificially transcribed RNA, can now be performed on in vivo-generated HIV-1 genomic RNA . This method might also have application in regard to in vivo foot-printing that could allow the study of RNA-protein interactions in the context of virus-producing cells.Current HIV combination therapies have demonstrated that a multi-targeted approach against the virus results in the greatest degree of suppression of virus replication. Therefore, the identification of novel targets for anti-HIV therapy could significantly improve HIV treatment strategies. HIV-1 RNA dimerization is clearly a critical event that could be exploited as a target once its complete mechanism is elucidated. It is pleasing to see that a number of laboratories that have actively researched RNA dimerization and packaging are now moving beyond conventional ion, and ). This min vitro dimerization studies conducted on HIV-1, HIV-2, and SIV RNA [in vivo evidence directly supporting such a model in the case of retroviruses, the results of previous mutagenesis studies from several laboratories correlate with those that would be predicted from the riboswitch model, both concerning RNA packaging and RNA dimerization status [The structure of the viral RNA that exists in the cell has long been a topic of interest, and recent data suggest that different RNA sequences might be involved in higher order intrastrand structures that favor the dimerization of the two RNA molecules. Such a model has been proposed , and is  SIV RNA ,131-133. SIV RNA . Althougn status . In regaOthers have developed a fluorescence resonance energy transfer (FRET)-based system to allow visualization of RNA-Gag interactions within cells . Such a system might provide insight into the timing of genome selection and packaging. It will also be interesting to determine whether this system can be adapted to pinpoint how retroviral RNA dimerization takes place within cells, and whether dimerization indeed occurs before RNA is selected for packaging.None declared.RSR gathered the information discussed in this review, and was primary author of the manuscript. CL and MAW carefully read the manuscript and offered insightful suggestions for its revision. All authors read and approved the final version."}
+{"text": "Retroviruses are unique among virus families in having dimeric genomes. The RNA sequences and structures that link the two RNA molecules vary, and these differences provide clues as to the role of this feature in the viral lifecycles. This review draws upon examples from different retroviral families. Differences and similarities in both secondary and tertiary structure are discussed. The implication of varying roles for the dimer linkage in related viruses is considered. With relatively few genes compared to many other virus families, the retroviridae have evolved over the millenia to maximise the functions of their RNA genome. The genome serves as a versatile template from which various proteins can be translated by the use of splicing and by translational flexibility using scanning, IRES and frameshifting. It is also an RNA molecule capable of interacting with itself, and cellular and viral proteins. By these means, from an RNA around 7 \u2013 12 kilobases long, the retroviridae have evolved to infect a wide range of species and cell types.A unique characteristic of retroviral genomes is the fact that they are dimeric. The reasons for this are as yet unclear, and are discussed below. In brief, it is thought that the diploid genome allows template switching during reverse transcription and may be linked to recombination in some viruses. It may also play a role in translation of proteins and packaging of the RNA.et al this issue [Much of the work on the nature, structure(s), and role of the dimer linkage has been based on Human Immunodeficiency Virus Type 1, and this has been recently reviewed ([is issue ). WhetheRetroviruses were discovered at the beginning of the 20th century ,4. The uRNA dimerisation in the primate lentiviruses, predominantly HIV-1, has subsequently been extensively studied .in vitro the RNA elements involved in the dimer linkage first observed by EM. It was shown that RNA transcripts comprising sequences from the 5' end of the viral genome would migrate as two species of RNA when subjected to electrophoresis. By this means many subsequent studies were able to focus on isolating the elements and structures involved in dimerisation, and to investigate the role of the viral structural proteins in this process.Since 1990  it has bAs yet investigators have not been able to agree on a distinct role for the dimer linkage. The fact that it is conserved amongst the retroviridae does not guarantee that its role will be the same in all retroviral families. The following section of the review will endeavour to explore some of the proposed roles, and examine the evidence from different retroviruses.Several studies have demonstrated that, in HIV-1 and MLV, the dimer linkage serves as a \"hotspot\" for recombination ,15. It iInterestingly, it has been suggested that the nucleocapsid protein (NC) promotes or stimulates the strand transfer reaction. As will be discussed below, NC and the precursor Gag protein both bind the RNA close to the DIS in HIV-1. In addition, there is evidence that the presence of a dimer in the virus particle facilitates the first strand-transfer reaction of reverse transcription .Alpha- and Gammaretroviruses, but not with DIS regions identified in the primate lentiviruses. Within the Alpha- and Gammaretroviruses GACG tetraloops are involved in the packaging of viral RNA [Work in our laboratory has shown that the Maedi Visna Virus DIS is centred on a helix terminating in a GACG tetraloop between positions 281 and 300 in the viral genome; a region which is highly conserved between the ovine and caprine lentiviruses , termed the DM region, rendered the virus severely packaging deficient. The mutation had been designed based on the mfold [In vitro studies using RNA transcripts comprising the leader region with and without the DM deletion, reveal that it does, indeed, render the viral RNA monomeric . Using antisense oligonucleotides, another group have demonstrated that this region may, in fact, play a role in the dimerisation process itself [Another possible role is that of the dimer linkage acting as a switch, its presence permitting or restricting the packaging of RNA. In HIV-2 two regions were originally suggested as dimer initiation sites, one analogous to the palindromic sequence identified as the principal DIS in HIV-1 (termed SL1), one close to the PBS -27. Recehe mfold ,30 predis itself . By freein trans, the latter uses predominantly a cis mechanism. One might postulate therefore, that, if retroviruses must package a dimeric genome, it is critical in the case of HIV-2 that the genome is dimeric before interacting with the Gag polyprotein. Hence, the effect of mutations in the DM region may be to render the RNA monomeric and thus to severely impair packaging.One of the key differences between HIV-1 and HIV-2 replication is their modes of packaging . Whilst trans mechanism is less dependent on a high affinity dimer linkage?It is attractive to speculate that the reason packaging itself is not affected by DIS mutations to the same degree in HIV-1  is this A recurring observation amongst investigators is the fact that mutation or deletion of dimer linkage sites causes viral infectivity to be decreased . One expin vitro [The DLS of Human T Cell Lymphotropic Virus Type 1 (HTLV-1) was identified as a 14-nucleotide sequence just downstream of the splice donor . Removalin vitro ,36. Whenin vitro . Likewisin vitro .et al showed that if the RNA of Rous Sarcoma Virus (RSV) was engineered so that it was monomeric, the virus was non-infectious [in vitro system, dimer formation appeared to inhibit synthesis of the Gag polyprotein precursor [Parent fectious . Interesfectious . This isrecursor .in vitro selection system it has been possible to demonstrate that the DIS has evolved to satisfy both constraints for optimal dimerisation affinity, and the potential to homodimerise [et al, examining the interaction of NC with elements of the packaging signal, of which loop B is one, showed that, in fact, both structures might exist, the flexible one allowing NC binding at high affinity [Undoubtedly the best defined dimerisation structure is that involved in the dimer linkage of HIV-1. The discovery of the sequences involved, the subsequent description of the RNA:RNA interaction, and the elucidation of the tertiary interaction are described elsewhere ) followedimerise . The dimdimerise ,45 and tdimerise  and loopdimerise -49. The affinity . There aaffinity ).Palindromes remain a theme throughout many of the viruses investigated to-date. As already mentioned, the DIS of HIV-2 is less well defined than that of HIV-1. Whilst there is a palindromic sequence at the top of a stem loop structure that closely resembles the HIV-1 DIS (see Figure CH, the strain used in the study. The other 11 sequences comprised three different variants. Eight contained a deletion of C736 (see Figure Recent work by Monie and colleagues  describeThe retroviral RNA genome structure does not stay static during the course of transcription, translation and ultimately packaging. Various investigators have suggested that this constantly changing RNA structure plays an intimate role in the viral replication -61. It sIn vivo data has revealed just how important an intact dimmer linkage may be to a retrovirus. For instance, there are intriguing differences in the effect of dimer mutations on viral infectivity depending on the cell type being infected [infected . What thinfected . One canTo sum up, retroviral dimeric genomes are linked by a variety of RNA structures, including kissing hairpins, GACG tetraloops and unusual CAG-tri loops. The differences in these interactions, and when or where they occur, may reflect different demands upon this unique feature, and highlight the elasticity of the RNA genome.None declared."}
+{"text": "Emergence of viral variants that escape CTL control is a major hurdle in HIV vaccination unless such variants affect gene regions that are essential for virus replication. Vaccine-induced multispecific CTL could also be able to control viral variants replication. To explore these possibilities, we extensively characterized CTL responses following vaccination with an epitope-based lipopeptide vaccine and challenge with pathogenic SIVmac251. The viral sequences corresponding to the epitopes present in the vaccine as well as the viral loads were then determined in every macaque following SIV inoculation.In most cases, the emergence of several viral variants or mutants within vaccine CTL epitopes after SIV challenge resulted in increased viral loads except for a single macaque, which showed a single escape viral variant within its 6 vaccine-induced CTL epitopes.These findings provide a better understanding of the evolution of CD8+ epitope variations after vaccination-induced CTL expansion and might provide new insight for the development of an effective HIV vaccine. Several lines of evidence strongly suggest the key role played by human immunodeficiency virus (HIV)- and simian immunodeficiency virus (SIV)-specific cytotoxic T lymphocyte (CTL) responses in the containment of viral replication and of the disease. CTL responses precede antibody production and coincide with clearance of primary viremia -3. VirusSeveral reports showed that anti-HIV immunodominant CTL responses select viral variants bearing mutations that diminish MHC class I binding and/or CTL recognition -13. The Very few studies addressed the question of SIV escape due to mutations within multiple epitopes recognized by vaccination-induced CTL. Most published reports focused on particular epitopes recognized by vaccine-induced CTL, such as the epitope MamuA1 CM9 in anti-GAG-SIV-immunized macaques  or NEF 1With the aim to induce multispecific CTL responses, we previously immunized a cohort of 8 macaques with SIV-NEF- and GAG-derived lipopeptides coupled to tetanus toxoid (TT) 830\u2013846 lipopeptide . Seven oPrior to SIV infection, CTL activities had been induced in seven out of the eight immunized macaques Figure . Two macIn order to precisely define the CTL-induced responses, we tested overlapping short peptides spanning the entire sequence of the lipopeptides. Two of the vaccinated macaques, namely 125 and 105, had CTL recognizing a single NEF epitope, NEF 169\u2013178 and NEF 128\u2013136 epitopes, respectively . Similarly, epitopes NEF 116\u2013126 and NEF 169\u2013178 were perfectly conserved . Macaque 105 had a significant increase in 136T viral variants (18%\u2192 44%). 122L mutants (40%) occurred in macaque 127. In macaque 129, there were many mutations in NEF 201\u2013211 and NEF 211\u2013219 epitopes and emergence of an exclusive 136T variant (100%) in the NEF 128\u2013136 epitope. No variation was evidenced in the NEF 169\u2013178 epitope, as observed in macaque 125 also. As for macaque 109 that lacked detectable cell-associated viremia, viral DNA integrated in PBMC was identified and sequenced. A single viral variant was detected in this latter animal within all the NEF lipopeptide-induced CTL epitopes.High level plasma viral RNA was observed 15 days post-inoculation in all macaques Figure . The thrCell-associated viremia was measured in all macaques during the same period Figure . All aniCTL responses were tested both between 10 to 13 weeks and between 47 to 60 weeks after SIV challenge by stimulating PBMC with ConA as described in section methods. CTL responses against the epitopes recognized by lipopeptide-induced CTL  had CTL directed only against NEF 169\u2013178, which is perfectly conserved within the challenge SIVmac251 quasispecies. No variation was observed in the sequence of this epitope 35 weeks following SIV challenge. Likewise, this epitope was conserved in both macaques 129 and 109. This result is in accordance with our previous data in another macaque immunized with a similar mixture of NEF- and GAG- lipopeptides . These ogag-pol-IL2, emergence of viral mutants occurred in GAG 181\u2013189 after SIV-challenge under the pressure of mono-epitope CTL [Recently, Watkins et al.  demonstrtope CTL ,26. Thistope CTL  and in Htope CTL . In additope CTL , which sIn the present study, macaque 105 had lipopeptide induced CTL against NEF 128\u2013136, a non-conserved epitope within the pathogenic SIVmac251 isolate, which contains 18% of 136T and 82% of 136A quasispecies. Forty weeks following SIV challenge of this monkey, the percentage of 136T viruses had increased (45%) whereas 136A viruses decreased (55%). The persistence of the two wild type variants within the single vaccine induced CTL epitope did not affect viral replication. The NEF 116\u2013126 epitope recognized by CTL after lipopeptide vaccination in macaque 127 was perfectly conserved in SIV isolate (NEF 116\u2013126) as NEF 169\u2013178 epitope but 122L mutant occurred in 40% of the SIV quasispecies 40 weeks after SIV infection. Nevertheless, the persistence of 60% of wild type viral sequences likely allowed viral replication to remain very high during clinical evolution in this macaque without effect on the high viral fitness.Three of the 4 epitopes recognized by lipopeptide-induced CTL from macaque 129 were not conserved  in SIVmac251 isolates. The emergence of the wild type variants 136T (100%) was observed within the CTL epitope NEF 128\u2013136 after SIV challenge. Epitopes NEF 201\u2013211 and 211\u2013219 shifted by acquiring mutations that had no effect on viral load and the persistence of wild type viral sequences (22%) within these epitopes could also have contributed to intense viral replication.In macaque 109, three of the 6 epitopes recognized by CTL following lipopeptide vaccination, namely epitopes  were perfectly conserved in SIVmac251 isolates used for the challenge. Interestingly, after challenge, we did not observe any variation within all sequenced NEF epitopes from SIV-infected macaque in particular in epitope NEF 116\u2013126, in contrast to the data in macaque 127. Within epitopes NEF 101\u2013110, NEF 128\u2013136 and NEF 215\u2013225, only one viral variant issued from SIVmac251 was selected and expanded in the absence of emergence of new variations. We hence hypothesize that macaque 109 exerted a selection of few-replicative and non-pathogenic viral variant following SIV challenge. This selection could be the consequence of the vaccine induced CTL. However, we cannot formally exclude the role of an uncontrolled and random process.CTL responses were evaluated in the two infected macaques 109 and 129, 12 months post-challenge. They were undetectable against all the identified vaccine peptides except in macaque 129. In the latter animal, CTL response against peptide 128\u2013136 disappeared at week 47, following a 100% selection of 136T viral variant as shown in Table gag-pol-env [nef [gag-pol [gag-pol-env [gag-pol-env [gag [gag-Sendai virus [CTL obtained following vaccination could play a key role in the control of viremia. Decrease and control of viral load have also been reported in macaques vaccinated with MVA--pol-env ,28, MVA-env [nef , MVA-gag[gag-pol , ALVAC-g-pol-env , NYVAC-g-pol-env , adeno-genv [gag , DNA [34env [gag , a combienv [gag ,37 or a ai virus  and chalai virus  or GAG 1ai virus ,35, or tai virus . Indeed,ai virus  observedIn our study, the emergence of several viral mutants in two macaques (127 and 129) within vaccine CTL epitopes was always associated with the persistence of the wild type virus and therefore was not concomitant with the decrease of viral fitness. The occurrence of an exclusive viral escape variant within several vaccine induced CTL epitopes was observed in only one macaque (109) and could be associated either with a selection of a poor replicative virus or with a control of viral replication by CTL.These results tentatively bring a clue for a better understanding of SIV control and might provide new insight for the development of an effective HIV vaccine.\u03b5 palmitoyl-lysylamide at the C-terminal position. A tetanus toxoid (TT) 830\u2013846 lipopeptide was added to the seven SIV lipopeptides [Five peptides from the SIV-NEF protein were synthesized from the sequence of the molecular clone SIV BK-28 . Two peptides from the SIV-GAG protein were also produced (LP6 aa 165\u2013195 and LP7 aa 246\u2013281). These selected sequences were identical to those previously reported  except fpeptides . They weMacaca mulatta) were immunized with SIV-lipopeptides as previously described  [50) of the highly pathogenic SIVmac251 isolate, kindly provided by A.M. Aubertin . Three non-vaccinated control macaques received the same challenges. All animal experiments were performed in accordance with European Union guidelines.Eight rhesus macaques  . They we5/ml twice a week.The lipopeptide-induced CTL responses were examined after the last mixed-micelle immunization by stimulating macaque PBMCs with a mixture of the seven long free SIV peptides corresponding to the sequences of peptides included in lipopeptides. CTL lines were then tested against autologous B lymphoblastoid cell lines (B-LCL) sensitized by the same long peptides or by short peptides. After SIV challenge, production of SIV antigens by infected CD4+ cells for stimulation of CTL lines, was induced by 14 days stimulation of PBMC with 10 \u03bcg/ml concanavalin A . Interleukine (IL) 2  was added on days 3, 7, and 10 and cell concentration was adjusted to 5 \u00d7 10B lymphoblastoid cell lines (B-LCL) were generated as previously described  and cult6) were incubated either overnight or for 1 h with long (10-5 M) or short peptides (10-6 M) at 37\u00b0C in a humidified 5% CO2 atmosphere. B-LCL alone served as controls. B-LCL were washed and labeled with 100 \u03bcCi Na251CrO4  for 1 h, washed twice, and used as target cells. CRT was performed in V-bottomed 96-well microtiter plates. The cytolytic activity of anti-SIV cell lines was measured by mixing 5,000 51 Cr-labeled target cells with effector cells at various effector cell/target cell (E/T) ratios in a final volume of 200 \u03bcl/well. Duplicate wells were seeded for each E/T ratio. Plates were incubated for 4 h at 37\u00b0C; 100 \u03bcl/well of supernatant was then removed from each well and counted. Spontaneous release was determined by incubating target cells with medium alone; it never exceeded 20% of total 51Cr incorporated. Results were expressed as specific Cr release : 100 \u00d7 experimental counts per minute (cpm)- spontaneous cpm/maximum cpm \u2013 spontaneous cpm. The within-sample variation never exceeded 5%. CRT was considered positive when the specific-51Cr release observed against peptide-pulsed target cells exceeded that observed with B-LCL alone by 10% at two effector/target (E/T) ratios.To sensitize target cells by peptides, B-LCL . The detection threshold was 1500 DNA copies per milliliter of plasma.5 CEM X 174 cell hybrids (fusion product of human B-cell line 721.174 and human T-cell line) were co-cultured with fivefold serial dilutions of PBMC. Supernatants of 30-day cultures were tested for the presence of RT SIV antigen.To quantify cellular viremia, 107 cells) were incubated overnight at 52\u00b0C in 1 ml lysis buffer . DNA was extracted with phenol/chloroform and precipitated with ethanol. The pellet was washed with 70% ethanol, dried, resuspended in 10 mM Tris pH 7.5 and quantified by measuring optical densities at 260 nm.PBMC were isolated as above and washed in RPMI medium. Aliquots , and 20 pmol of primer . The primers used in the first round of PCR were nef1 (5'-AGGCTCTCTGCGACCCTACG-3') and nef2 (5'-AGAACCTCCCAGGGCTCAATCT-3'). VJ11 (5'-ATGGGTGGAGCTATTTCCATG-3') and VJ12 (5'-TTAGCCTTCTTCTAACCTC-3') (encompassing the entire nef gene) were used in the second round. For gag gene, primers used in the first round of PCR were VJ23 (5'-ATGGGCGCGAGAAACTCCGTC-3') and SIVGAGrev (5'- CCCCTGTATCCAATAATACT -3'). 2 nested PCR were used in a second round of PCR with VJ23 and SIVG3 (5' TGTTGTCTGTACATCCACTGGAT 3'), SIVG1 (5' AGCGGCAGAGGAGGAAATTAC 3') and VJ25 (5'-CTACTGGTCTCCTCCAAAG 3') respectively (encompassing the entire gag gene). Each initial reaction contained 1 \u03bcg DNA, and 5 \u03bcl of the first PCR round were used in the second round. The reactions were carried out in a DNA thermocycler 9600  for 40 cycles  with a final incubation at 72\u00b0C for 5 min. Amplified products were visualized on 1.5% agarose gels after staining with ethidium bromide.Nested PCR was performed in 100 \u03bcl reaction mixtures containing 200 \u03bcM of each deoxynucleotide triphosphate , 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 8 mM DTT, 400 \u03bcM each dNTP, 50 pmol primers nef2 and nef1, 30 U RNAsin , and 200 U Mo-MuLV reverse transcriptase (Gibco BRL). The PCR mix was incubated for 5 min at 90\u00b0C, and 5 \u03bcl of the cDNA mixture was amplified under the same PCR conditions as above, using VJ11 and VJ12 as primers.Viral RNA was extracted from 400 \u03bcl of the viral stock using 300 \u03bcl phenol acid  and 300 \u03bcl extraction buffer . After vortexing and centrifugation, the supernatant was extracted twice with phenol, twice with chloroform, and then ethanol-precipitated with 2 \u03bcg of tRNA. Following centrifugation, the RNA pellet was washed with 70% ethanol, dried, and resuspended in 50 \u03bcl sterile water. Five \u03bcl were reverse-transcribed for one hour at 37\u00b0C in 25 \u03bcl reaction mixture containing 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2, 1 mM ATP, 1 mM DTT, 5% PEG-8000, and 1 U of T4 DNA ligase (Gibco). A volume of 0.1 \u03bcl of the ligation product was transferred into E. coli TG1, and the few white colonies obtained on Luria Broth  plates with ampicillin were selected. DNA was extracted using the Easy Prep Plasmid Prep kit (Pharmacia) and 500 ng were sequenced using the Dye Terminator chemistry on a 373A sequencer . All sequences were aligned using the SeqEd program.To estimate viral population diversity and eliminate cloning bias, multiple plasmid subclones derived from the same viral template by using endpoint DNA dilution techniques were sequences. The proviral DNA copy number used in each PCR was approximated by duplicate 10-fold serial dilutions of DNA followed by nested PCR capable of amplifying a single provirus (as described above). The highest dilution yielding a positive PCR was used to estimate the proviral copy number. This end-point dilution of all PBMC DNA generated PCR products that were directly sequenced after purification on a Qiaquik column . Following purification, 50 ng of the PCR product was ligated overnight at 15\u00b0C with 50 ng of pTAG vector  in 10 \u03bcl of buffer containing 50 mM Tris-HCl pH 7.6, 10 mM MgClThe author(s) declare that they have no competing interests.nef genes. PV and ZC interpreted the results, prepared the tables, figures and efficiently participated to the writing of the manuscript. LM performed the experiments following lipopeptide vaccination. CB measured cell-associated viremia and HGM synthesized the lipopeptides.FL performed all the sequences of SIV IBV designed and coordinated the study and drafted the manuscript. JGG was responsible for the broad design of the study.All of the authors made meaningful contributions to the process of successive draft versions of the text. All authors read and approved the final manuscript."}
+{"text": "Plasmodiophorales and three species, Polymyxa betae, P. graminis, and Spongospora subterranea, are plant viral vectors. Plasmodiophorid transmitted viruses are positive strand RNA viruses belonging to five genera. Beet necrotic yellow vein virus (BNYVV) and its vector, P. betae, are the causal agents for rhizomania.Plasmodiophorids and chytrids are zoosporic parasites of algae and land plant and are distributed worldwide. There are 35 species belonging to the order P. betae resting spores was initially obtained using immunofluorescence labeling and well characterized antisera to each of the BNYVV proteins. Root cross sections were further examined using immunogold labeling and electron microscopy. BNYVV proteins translated from each of the four genomic and subgenomic RNAs accumulate inside P. betae resting spores and zoospores. Statistical analysis was used to determine if immunolabelling detected viral proteins in specific subcellular domains and at a level greater than in control samples.Evidence of BNYVV replication and movement proteins associating with P. betae suggest that BNYVV resides inside its vector during more than one life cycle stage. These data suggest that P. betae might be a host as well as a vector for BNYVVVirus-like particles were detected in zoosporangia. Association of BNYVV replication and movement proteins with sporangial and sporogenic stages of  Plasmodiophorales (Polymyxa spp and Spongospora spp) and Chytridales (Olpidium spp). These viruses are positive strand RNA viruses belonging to nine genera. Plant viruses belonging to the genera Bymo-, Beny-, Furo-, Peclu-, and Pomovirus are vectored by plasmodiophorids. These viruses are internalized by their vector and can remain in the soil for many seasons [There is a group of soilborne plant viruses transmitted by vectors belonging to the Orders  seasons -3.Polymyxa spp. has two phases known as the sporangial and sporogenic stages [Polymyxa spp, infection begins with penetration of the plant cell wall by swimming zoospores  provided evidence of viral movement protein and RNA inside P. graminis resting spores [A recent study of g spores . SBWMV cg spores . MoreoveBeet necrotic yellow vein virus (BNYVV) with its plasmodiophorid vector, P. betae [Benyvirus. BNYVV is a positive strand RNA virus with four genome segments  roots were similar in age, the zoosporangia were at slightly different developmental stages  samples were also conducted. The replicase and P42 antisera labeled the zoospore cytoplasm, storage bodies, vacuoles, and between zoospores at levels that were significantly different from buffer treated samples and healthy samples  what is the nature of BNYVV association with its vector; and 2) how is virus transferred between the vector and root cells. Using immunofluorescence and immunogold labeling techniques, all BNYVV proteins were detected in P. betae sporosori and zoosporangia. The first model, proposed by Campbell, suggests that the Polymyxa and plant cytoplasms have opportunities to mix and that virus may be freely exchanged on these occasions. Campbell proposed that this may occur before membranes are laid down to form the sporangial plasmodium [P. betae and plant cell cytoplasms to mix. If BNYVV is replicating in the same plant cell that is infected with P. betae, then it is reasonable to consider that all BNYVV proteins move freely between P. betae when there are breaks in the zoosporangial wall as well as during developmental of the sporangial plasmodium.There are two possible explanations for detection of all BNYVV proteins inside asmodium . The datP. betae is a host as well as a vector for BNYVV. The presence of viral replicase inside P betae resting spores and zoospores may be evidence that BNYVV replicates inside its vector. According to this model, accumulation of viral replicase, coat protein, RTD, P25, and P31 proteins, which are expressed from the genomic RNAs, suggests that viral RNAs may be translated as P. betae progresses through its life cycle. The P42, P13, P15, and P14 proteins are produced from subgenomic RNAs derived from BNYVV RNA2. Subgenomic RNA expression is dependent on production of minus strand RNAs involved in virus replication.An alternative explanation is that P. betae life cycle . Fixed roots were screened using light microscopy to identify segments containing P. betae zoosporangia or sporosori. These segments were embedded in LR-White, sectioned, and stained with a mixture of uranyl acetate and lead citrate, as described previously [P. betae infected root cell in each root cross section analyzed.Root systems that tested positive for BNYVV, which necessitated infection with eviously . There wDrs. S. Bouzoubaa and D. Gilmer  provided antisera to each of the nine BNYVV proteins: replicase, coat, readthrough domain of the coat (RTD), P42, P13, P15, P14, P25, and P31 proteins. Each anThick sections (1 \u03bcm) and ultrathin sections (60 nm) were cut using a diamond knife on a Sorvall MT 6000 ultramicrotome. Thick sections were affixed on ProbeOn Plus slides  and ultrathin sections were mounted on formvar coated nickel grids . Immunofluorescence labeling of thick sections was conducted as described previously . A Leica TCS SP2  confocal imaging system was used to study FITC-labeled root cross sections.2HPO4, 3.0 mM NaH2PO4) plus 2% bovine serum albumin  for 15 min, and then incubated with 2% normal goat serum in PBS plus 2% BSA for 15 min. Then samples were incubated with primary antisera diluted 1:500 in PBS plus 2% BSA (w/v), or buffer containing no primary antisera for 2 h. The grids were then washed five times for 5 min with PBS and then with PBS plus 2% fish gelatin (v/v) for 15 min. The grids were then incubated for 1 h with 10 nm gold conjugated rabbit antisera  diluted 1:10 in PBS plus 2% fish gelatin. Grids were washed three times for 5 min with ddH2O, and stained with a solution of 2.5% uranyl acetate and 70% methanol (v/v) for 30 min, and then with a solution of 2% Reynold's lead citrate pH 12.0 (in ddH2O) for 20 min. Samples were washed with lukewarm ddH2O three times for 5 min and then dried. Control samples were incubated with blocking solution plus 10 nm gold-conjugated rabbit antisera (EY Laboratories). The distribution of gold particles in resting spores and zoosporangia were recorded in Tables Immunogold labeling of ultrathin sections was conducted using each antiserum as described previously . Thin seFluorescent samples were studied using a Leica TCS SP2  confocal imaging system. The Leica TCS SP2 system was attached to a Leica DMRE microscope. The microscope was equipped with epifluorescence and water immersion objectives. For confocal microscopy, a krypton/argon laser was used to examine fluorescence. A 488-nm excitation wavelength was used to view FITC labeled samples. Electron microscopic analysis of samples was carried out using a JEOL JEM100 CXII scanning transmission electron microscope. Photographs were taken and developed in a dark room and then scanned using an HP scan jet 4570c. All images, obtained by confocal or electron microscopy, were processed using Adobe Photoshop CS version 8.0 software .The author(s) declare that they have no competing interests.J. V-L conceived the study, carried out immunolabelling, microscopy, and wrote manuscript C. M. R. participated in the design of the study, grew and maintained sugar beets, prepared viruliferous and aviruliferous samples, aided with data interpretation and manuscript editing.M. P. provided the statistical analysis of all data.T. C. carried out LR-white embedding of root samples, performed all microtome sectioning, and developed all negatives.All authors read and approved the final manuscript."}
+{"text": "Mutations that allow SIV/HIV to avoid the cytotoxic T lymphocyte (CTL) response are well documented. Recently, there have been a few attempts at estimating the costs of CTL escape mutations in terms of the reduction in viral fitness and the killing rate at which the CTL response specific to one viral epitope clears virus-infected cells. Using a mathematical model we show that estimation of both parameters depends critically on the underlying changes in the replication rate of the virus and the changes in the killing rate over time (which in previous studies were assumed to be constant). We provide a theoretical basis for estimation of these parameters using in vivo data. In particular, we show that 1) by assuming unlimited virus growth one can obtain a minimal estimate of the fitness cost of the escape mutation, and 2) by assuming no virus growth during the escape, one can obtain a minimal estimate of the average killing rate. We also discuss the conditions under which better estimates of the average killing rate can be obtained. Due to their high mutation rate, RNA viruses\u2014like SIV and HIV\u2014can avoid recognition by the host immune response by evolving new variants . Avoiding the cytotoxic T lymphocyte (CTL) immune responses is one of the major obstacles for the development of vaccines to HIV, and this avoidance seems a major mechanism of HIV disease progression to AIDS. Using a relatively general mathematical model, Ganusov and De Boer suggest a simple technique by which two main parameters determining the likelihood of viral escape can be estimated. First is the \u201ccost\u201d of the escape mutation, which is the relative fitness reduction in the virus replication rate. Second is the rate at which the CTL response specific for one epitope \u201cclears\u201d virus-infected cells. Application of their technique to data on virus escape helps to quantify the costs and benefits of CTL escape mutations in SIV/HIV infection. First, depletion of CD8al loads , and depnfection . Second,nfection \u20136. Finalnfection ,8. Many nfection ,9,10. Whnfection ,12. The mutation . Previoumutation , and thiE, at which the logarithm of the ratio of the wild-type frequency to the mutant decreases with time, is calculated. The sum of the two rates, R + E, provides an estimate of the CTL killing rate, or the rate at which cells productively infected with the wild-type virus are killed by the CTL response due to the expression of the non-mutated epitope [During \u201cescape\u201d experiments in which a wild-type virus is substituted with a mutant, the average rate,  epitope ,12. In t epitope ,15,16, bk(t) = 0 in Equation 8. Since the ratio of the wild-type virus to the mutant should change exponentially (see Equation 8), it is useful to calculate the average rate R at which the logarithm of the ratio z(t) increases with time. If the measurements of the ratio z(t) are available at two time points, st (start) and et (end), with corresponding measured ratios sz = z(st) and ez = z(et), the average replacement rate R of the mutant by the wild-type in the time interval  can be calculated from the data and the model as followsIn the reversion experiments, the dynamics of the CTL escape mutant is observed in a host lacking the MHC class I allele presenting the wild-type epitope. In such a host, the CTL response specific for the wild-type epitope is absent, i.e., R, or other parameters below, from the data, one needs to have at least two time points in which both viral variants are present\u2014when more than two time points are available and the changes in the death rate d(t) with time are known, more sophisticated techniques could be used for parameter estimation [c one needs to know how the virus replication rate, r(t), changes over the time of the experiment. Unfortunately, this replication rate is generally unknown. By comparing the rates of replacement of various escape mutants with the wild-type in different reversion experiments, it is often concluded that the mutant with the highest reversion rate R has the highest cost [r(t) \u2248 1.5 d\u22121), the rate of replication may be lower around the peak of viremia (r(t) \u2248 1 d\u22121), and is likely to approach its lowest value during the stable phase (r(t) \u2248 0.5 d\u22121) [Note that to estimate the rate timation . Importaest cost ,8,12. Ou0.5 d\u22121) \u201321. Reve0.5 d\u22121)  in whichr(t) = max,r the minimal estimate of fitness cost is found using Equation 1Nevertheless, even if the changes in virus replication rate over time are not known, one can make a minimal estimate of the fitness cost of the escape mutation. By assuming that during the experiment the virus population expands exponentially at a fixed maximal rate minc \u2248 0.065).The fact that Equation 2 provides an underestimate of the fitness cost is demonstrated in rate of replacement of the mutant by the wild-type, and not the time to a complete reversion, is proportional to the fitness cost of the escape mutation. Therefore, as an approximate measure of the fitness cost of an escape mutant one should only consider the time period during which the actual substitution of the mutant by the wild-type took place. In many situations, this is the period between the first time the wild-type replaces the mutant  and the last time when only the mutant is present .Two additional points needs to be stressed. It is often concluded that the time taken for replacement of the mutant by the wild-type in reversion experiments is related to the cost of the escape mutations, i.e., longer reversion times from the start of experiment to a complete reversion correspond to lower fitness costs . Clearlc and the virus replication rate r(t), and that changes in the rate of replacement are likely to occur due to changes in the replication rate. Several studies have documented that the fitness cost suffered by CTL escape mutants can be reduced by additional compensatory mutations [We have shown that the rate of replacement is determined by the fitness cost utations \u201326. Chanutations , accumulk(t), and the mutant virus suffers a fitness cost c. To characterize the dynamics of substitution of the wild-type by the mutant, it is useful to estimate the \u201cescape\u201d rate E at which the logarithm of the ratio of the wild-type frequency to the mutant decreases with time. This rate can be calculated from the data and in the model given in Equation 8During escape experiments, the wild-type virus is subjected to additional killing rate s, tet) during the escape; sz and ez are the measured ratios of the density of the wild-type to the mutant virus available during the escape experiment at two time points st and e,t respectively. Equation 3 has a simple biological interpretation: the rate of replacement of the wild-type by the mutant in escape experiments is given by the difference between the average killing rate (at which the wild-type virus is cleared by the CTL response) and the average difference in the replication rate of the wild-type virus and the mutant (at which the wild-type overgrows the mutant).where K can be calculated from Equation 3Two groups have independently proposed to use escape experiments to estimate the rate at which the CTL response kills cells expressing the wild-type CTL epitope ,12. The c, but also to know changes in the replication rate of the virus r(t) with time during the escape experiment. The latter, again, is generally not known. In the absence of such knowledge, two estimates of the average killing rate are possible. First, one could assume that during the escape experiments, there is no virus growth. Letting r(t) = R = 0, one finds a minimal estimate of the average killing rate min,K which is equal to the rate of substitution of the wild-type virus by the mutant in escape experiments, i.e., one obtains minK = E.Importantly, Equation 4 suggests that in order to determine the average killing rate one not only needs to have an estimate of the cost of the escape mutation r(t) = r), and that the CTL response clears virus-infected cells at a constant rate K\u2032 ((R = cr), and one can combine K\u2032 is the sum of the rate of replacement of the mutant by the wild-type virus in reversion experiments (given by Equation 1), and the rate of replacement of the wild-type virus by the mutant in escape experiments, i.e.,Second, one could assume that during both the reversion and escape experiment, the virus replication rate is constant and the same  was E \u2248 0.71 d\u22121. During the reversion (which occurred before the peak of viremia), the mutant was substituted by the wild-type at a rate R \u2248 0.38 d\u22121. By assuming that the rate of virus replication is higher before the peak of viremia than that after the peak, we obtain the following minimal and maximal estimates of the average killing rate of the CTL response specific for the KP9 epitope  = .While Equation 3 delivers the minimal estimate of the average CTL killing rate, the rate minK and/or K\u2032, one always underestimates the maximal killing rate if the killing rate k(t) changes over time (compare estimates obtained in maxk given in the legend to If during the reversion experiments the rate of virus replication is lower than that during the escape experiments (r(t) and the killing rate k(t) [In this paper we have provided a theoretical basis for estimating the costs of CTL escape mutations and the average rate at which the CTL response specific for a given epitope clears virus-infected cells. We show that by assuming exponential growth of the virus during the reversion experiments, one can obtain a minimal estimate for the cost of escape mutation (using Equation 2). Similarly, by assuming no virus growth during the escape experiments, one can obtain the minimal estimate of the average rate at which the CTL response specific to one viral epitope clears virus-infected cells (using Equation 3). Since our model is relatively general, our conclusions about estimating the costs and benefits of CTL escape mutations of SIV/HIV are equally applied to acute and chronic phases of SIV/HIV infection. However, while during the acute phase there are likely to be substantial changes in the rate of virus replication ate k(t) ,15,16, ww(t) or the mutant m(t) viruses, when both viral variants are present in an infected host. The model is given by the following equationsWe assume the following scenario for viral escape. The wild-type virus has a higher replication rate, and cells infected with the wild-type virus are killed at a higher rate by the CTL response. The mutant virus has a lower replication rate and cells infected with the mutant virus are killed at a lower rate by the CTL response. We formulate a mathematical model describing the dynamics of the density of cells productively infected with the wild-type r(t) and r(t)(1\u2212c) is the replication rate of the wild-type and the mutant, respectively, c is the cost of the escape mutation defined as a selection coefficient, d(t) is the per capita clearance rate of both variants , and k(t) is an extra death rate at which virus-infected cells expressing the wild-type CTL epitope are being cleared by the epitope-specific CTL response. Since both SIV and HIV particles are known to be short-lived in vivo [where  in vivo \u201331, densz(t) = w(t) / m(t):It is useful to rewrite cr(t) is the absolute difference in the replication rates of the wild-type and the mutant [z(t) of density of the wild-type virus to the mutant changes exponentially with the time-dependent per capita rate cr(t) \u2212 k(t) determined by fitness cost of the escape mutation c times the rate of replication of the wild-type r(t), and the magnitude of the immune response directed against the wild-type epitope k(t). Importantly, CTL responses to other epitopes of both wild-type and mutant viruses cancel out in Equation 8, and the dynamics of the ratio z(t) is dependent only on the CTL response to the wild-type epitope. This could be different in other models, for example, where CD8+ T cell responses reduce the rate of virus replication by noncytolytic mechanisms (see below). In the main text we consider how the cost c and the killing rate k(t) can be estimated using in vivo data.where e mutant ,14. Thusw(t) and the mutant m(t) viruses is given by the following equations:We consider the case when the escape mutation renders the mutant less fit due to an increased death rate of virus-infected cells. The dynamics of cells productively infected with the wild-type c is the cost of the escape mutation. Rewriting z(t) = w(t) / m(t) for times when both virus variants are present in the host, we obtain:where d(t) is likely to change during the acute phase of SIV/HIV infection, and may be relatively constant in the chronic phase.To estimate the cost of the escape mutation and the average CTL killing rate, one needs to know the changes in the death rate of the cells productively infected with the virus with time. Since these changes will be dependent on the CTL responses specific to both wild-type and mutant viruses, the death rate w(t) and the mutant m(t) viruses, is given by the following equations:The model describing the dynamics of the cells infected with the wild-type + T cell response reduces the rate of virus replication. The reduction in the replication rate is due to the CD8+ T cell response specific for the wild-type epitope k(t) and due to CD8+ T cell responses to other viral epitopes E(t). Note that in contrast with the main model, the parameter k(t) is now dimensionless. As in the main text, we write an equation for the dynamics of the ratio of the density of the wild-type to the mutant z(t):where the assumptions on the virus growth are similar to those in the main model. However, we assume that the CD8+ T cell response directed against the wild-type epitope is absent  = 0), and the change in the ratio z(t) is given byDuring the reversion experiments, the specific CD8rmax in the absence of the CD8+ T cell response (E(t) = 0), one recovers the same equation for z(t) as is given in Equation 8 at k(t) = 0. This suggests that Equation 2 also gives the minimal estimate of the fitness cost of an escape mutant.Assuming that the virus replicates at the maximum rate During the escape experiments Equation 14 holds. One can rewrite this equation:+ T cell response specific for the wild-type epitope.While this expression is somewhat complex, its interpretation is similar to that of Equation 8: the first term on the right hand side corresponds to increase in the frequency of the wild-type due to cost of escape mutation, and the second term corresponds to a decrease in the frequency of the wild-type due to the CD8r(t) corresponds to a faster accumulation. Therefore, slow accumulation of the escape mutants in some experiments may reflect slow replication of the virus. This is in contrast to the prediction found when the CD8+ T cell response controls the virus by killing virus-infected cells, where the opposite trend is observed .There are two differences with the equation found in the main model, however. First, we find that the rate of accumulation of the mutant in the population depends on the replication rate of the virus: a higher replication rate + T cell suppression efficacy k(t) unless changes in the total response E(t) and replication rate r(t) with time are known. Only by assuming that the growth rate and the two immune responses are constant over time, can such an estimate be made. As discussed above, this estimate, however, will also depend on how well the assumptions of the constancy of the immune response and of the growth rate over time are satisfied.Second, there is no an easy way of estimating the CD8"}
+{"text": "Thus, RNApol causes more morbidity and premature mortality than any other molecule. The extraordinary genetic heterogeneity defining viral quasispecies results from RNApol infidelity causing rapid cumulative genomic RNA mutation a process that, if uncontrolled, would cause catastrophic loss of sequence integrity and inexorable quasispecies extinction. Selective replication and replicative homeostasis, an epicyclical regulatory mechanism dynamically linking RNApol fidelity and processivity with quasispecies phenotypic diversity, modulating polymerase fidelity and, hence, controlling quasispecies behaviour, prevents this happening and also mediates immune escape. Perhaps more importantly, ineluctable generation of broad phenotypic diversity after viral RNA is translated to protein quasispecies suggests a mechanism of disease that specifically targets, and functionally disrupts, the host cell surface molecules \u2013 including hormone, lipid, cell signalling or neurotransmitter receptors \u2013 that viruses co-opt for cell entry. This mechanism \u2013 \"Viral Receptor Disease (VRD)\" \u2013 may explain so-called \"viral autoimmunity\", some classical autoimmune disorders and other diseases, including type II diabetes mellitus, and some forms of obesity. Viral receptor disease is a unifying hypothesis that may also explain some diseases with well-established, but multi-factorial and apparently unrelated aetiologies \u2013 like coronary artery and other vascular diseases \u2013 in addition to diseases like schizophrenia that are poorly understood and lack plausible, coherent, pathogenic explanations.Much of the worlds' population is in active or imminent danger from established infectious pathogens, while sporadic and pandemic infections by these and emerging agents threaten everyone. RNA polymerases (RNA Many of the world's population suffer from acute and chronic viral infection. The two common types of chronic viral hepatitis (CVH), hepatitis B (HBV) and C (HCV) are major causes of death and morbidity; conservative estimates suggest 400 million people are persistently infected with HBV, while HCV may infect a further 200 million. Annually, in excess of two million people will die from cirrhosis or liver cancer caused by CVH, and many more suffer chronic ill health as result. During the 20 years since the human immunodeficiency virus (HIV) was identified, perhaps 40 million people have become infected worldwide and each year about a million die from resulting immunodeficiency and consequent opportunistic infections, particularly tuberculosis, and other complications. Poor countries bear a disproportionate burden of disease caused by these viruses that further exacerbate poverty through pervasive economic disruption and diversion of limited resources to healthcare and disease control. Emerging viral pathogens including West Nile virus (WNV), the SARS coronavirus, endemic viruses like Murray Valley, Japanese, and other encephalitis viruses, Dengue and yellow fever, and seasonal influenza, hepatitis A (HAV) and E (HEV) cause enormous further morbidity and mortality, while pandemic outbreaks of virulent influenza strains remain a constant threat. Together, these viruses probably kill more people every ten days than the Boxing Day Tsunami. RNA viral infections, including Foot and Mouth, Bovine Viral Diarrhea Virus (BVDV) and Hog Cholera Virus (HChV), cause similar devastation of animal populations with enormous economic consequences.pol. Thus, RNA polymerases probably cause more morbidity and premature mortality in man, and other animals, and greater economic loss, than any other molecule.RNA polymerases generate massive genetic variability of RNA viruses and retroviruses that circulate within infected hosts as vast populations of closely related, but genetically distinct, molecules known as quasispecies. After translation, this genetic variability causes near-infinite antigenic heterogeneity, facilitating viral evasion of host defences. Tuberculosis, malaria and other cellular pathogens also express broad cell-surface antigenic heterogeneity, generated by DNA-dependent RNADespite a depressing global epidemiology that strongly suggests otherwise, the immune system is thought to \"control\" viruses. What practical meaning does \"immune control\" have for the individual? There is no argument for HBV, and other viruses, high affinity antibody, generated by prior vaccination or other exposures and directed against neutralizing epitopes, will prevent HBV infection , in p10 and 1012 virions per day . In. In23]. nfection . Viral rnfection ,26. Elevnfection  \u2013 often 2\u20133 geq/ml (observation 1), the immune forces must also fall by >102\u20133 between A and B to D for equilibrium to develop (proposition 3). There is no evidence this occurs, and very considerable evidence that immune force(s), as judged by development of specific cytotoxic T cell and antibody responses, are increasing during this time  antiviral mechanisms are operative  immune responses to replication at ~105 geq/ml after week 14, the authors conclude \"..[the data]...appear[s] to be consistent with the interpretation that HBV and HCV are ignored by the adaptive immune system for about 2 months after primary infection\" and \"[in HCV].. the adaptive response seems to really ignore for several weeks a substantial quantity of virus (at least 106 copies/ml)..\". This is certainly an accurate synthesis of an extensive and highly complex literature but does it make any sense?Hepatitis C replication kinetics and their relationship to immune responses are well documented ,33 but r6\u20137 geq/ml at week 6 be invisible to the immune system but visible when replicating at 105 geq/ml long term? Dissection of this problem requires explicit analysis of what is being measured and how.If adaptive immune responses really ignore high level HCV replication for two months, as suggested, then the following mechanism(s) are implied: a) an accurate mechanism for prompt detection of infection; b) A timing mechanism; c) A trigger mechanism for immune responses independent of any viral factor  viraemia); and, as cytomegalovirus (CMV)-specific CD4(+) T cell responses arise within 7 days of CMV infection ; d) A me1. Nonetheless, as 5'UTR HCV RNA concentrations will be proportional to EeRNA concentration, the question remains; why should envelope proteins translated from EeRNA sequences present at concentrations corresponding to ~105 5'UTR geq/ml at 16 weeks be visible immunologically, but envelope proteins derived from EeRNA sequences corresponding to ~106\u20137 5'UTR geq/ml at 4\u20136 weeks remain unseen? Quasispecies biology, specifically variable RNApol fidelity, replicative homeostasis, and sequence-specific requirements for both genetic and immunological detection suggest an answer.Assay of HCV RNA and detection of HCV by immune responses measure two quite different things. Quantitation of HCV is typically performed by branch-chain cDNA assay (bDNA) or quantitative PCR (qPCR) using probes or primers complementary to conserved 5'untranslated (5'UTR) HCV RNA sequences. Immune responses to HCV typically \"measures\" envelope proteins translated from envelope-encoding RNA (EeRNA) sequences and are directed at specific antigenic amino acid sequences and polypeptide conformations, not total viral envelope protein concentrations. While concentrations of 5'UTR RNA will be proportional to EeRNA concentrations in any given sample, they may not be identical for two reasons; i) RNA transcription may prematurely terminate making 5'UTR RNAs relatively more prevalent than EeRNAs and ii) HCV 5'UTR is highly conserved, while EeRNA s are less constrained, making hybridization efficiencies of PCR primers or bDNA probes greater for 5'UTR RNAs than for the population of EeRNAs, causing relative under-estimation of true envelope RNA concentrationpol, an enzyme lacking fidelity or proof reading function  above detection threshold. But why should specific EeRNA sequence frequencies \u2013 in other words, HCV RNApol fidelity \u2013 increase after week 8, facilitating adaptive immune responses? Viral autoregulation, specifically replicative homeostasis, provides an answer.While RNAe figure , allowinpol survival \u2013 on an evolutionary timescale, as argued previously /[Env RNA] for each sample, then a numerical expression describing changing quasispecies complexity over time may be obtained.2.In case prescient genius is unappreciated, Haldane formulated the \"lock and key\" hypothesis on the basis of protein polymorphisms, defined by gel electrophoresis, and some general musing about predation and evolutionary struggle, two decades before the nature of DNA was elucidated.I have no pecuniary interests, whatever, in this work and do not stand to gain financially or otherwise from it."}
+{"text": "Saccharomyces cerevisiae Atg8p, and staining with the fluorophore monodansylcadaverine followed by fixation. Colocalization of LC3 and LAMP1 was observed early in the poliovirus replicative cycle, in cells infected with rhinoviruses 2 and 14, and in cells that express poliovirus proteins 2BC and 3A, known to be sufficient to induce double-membraned vesicles. Stimulation of autophagy increased poliovirus yield, and inhibition of the autophagosomal pathway by 3-methyladenine or by RNA interference against mRNAs that encode two different proteins known to be required for autophagy decreased poliovirus yield. We propose that, for poliovirus and rhinovirus, components of the cellular machinery of autophagosome formation are subverted to promote viral replication. Although autophagy can serve in the innate immune response to microorganisms, our findings are inconsistent with a role for the induced autophagosome-like structures in clearance of poliovirus. Instead, we argue that these double-membraned structures provide membranous supports for viral RNA replication complexes, possibly enabling the nonlytic release of cytoplasmic contents, including progeny virions, from infected cells.Infection of human cells with poliovirus induces the proliferation of double-membraned cytoplasmic vesicles whose surfaces are used as the sites of viral RNA replication and whose origin is unknown. Here, we show that several hallmarks of cellular autophagosomes can be identified in poliovirus-induced vesicles, including colocalization of LAMP1 and LC3, the human homolog of  Poliovirus is a well-studied positive-strand RNA virus, and here it is shown to subvert the machinery of the cellular autophagy pathway at several stages in the viral life cycle Upon infection by poliovirus and many other positive-strand RNA viruses, dramatic changes are rapidly induced in the cellular environment. Poliovirus infection causes the massive rearrangement of intracellular membranes, with double-membraned vesicles 200\u2013400 nm in diameter accumulating in the cytoplasm ,2. ImmunIt has been noted previously that several of the features displayed by the vesicles induced during poliovirus infection ,2 are knIn mammalian cells, the formation and maturation of autophagosomes involves the stepwise acquisition of proteins from disparate cellular compartments . Although poliovirus-induced vesicles display several hallmarks of autophagosomes, other origins for the poliovirus-induced vesicles have been suggested ,31,32. PSaccharomyces cerevisiae, components of the COPII pathway, encoded by the SEC12, 16, 23, and 24 genes, are known to be required for autophagy [Poliovirus-induced vesicles have been shown to contain human COPII proteins Sec13p and Sec31p early in their formation, leading to the hypothesis that they are modified COPII vesicles, subverted from the anterograde transport pathway ,35. Furtutophagy ,38,39, mutophagy ,41 and 5utophagy .Streptococcus infection, genetic disruption of the autophagy pathway in the infected host cells resulted in increased bacterial yield, consistent with a role for autophagy in bacterial clearance [Finally, the idea that poliovirus infection induces autophagosome formation to facilitate viral growth is surprising in view of existing data that autophagy is an effective antimicrobial host response in many cases . Durlearance .Specific markers for autophagosome formation have become available, facilitating the identification of membranes derived from the autophagic pathway . HerTo ask whether the membranes on which poliovirus RNA replication complexes assemble contain constituents of autophagosomes, we monitored the localization of both LC3, a specific marker of autophagosomes, and 3A, a critical component of the poliovirus RNA replication complex, in infected cells. LC3 was expressed via DNA transfection as an amino-terminal fusion with green fluorescent protein (GFP). As can be seen in In nonautophagic cells, LC3, originally identified as a microtubule-associated protein , and LAMS. cerevisiae [Expression of poliovirus proteins 2BC and 3A in isolation can induce the formation of double-membraned vesicles that display biochemical and ultrastructural similarity to those formed in poliovirus-infected cells . Howeverrevisiae ,35,51,52revisiae ,53. To tTo examine further whether the membranes induced during poliovirus infection display additional characteristics of autophagosomes, we employed fluorescent staining with MDC. Under specific fixation conditions, MDC is retained in autophagosomal membranes ,55. As sTo test the hypothesis that the MDC-stained structures observed in To determine whether the autophagosome-like membranes induced during poliovirus infection perform an antiviral function or facilitate viral replication, we tested the effect on poliovirus yield of pretreating H1\u2013HeLa cells with either tamoxifen or rapamycin, known inducers of autophagy. Yield of intracellular virus increased approximately 4-fold when cells were pretreated with tamoxifen, and 3-fold upon pretreatment with rapamycin A and 6B.ATG12 mRNA, and to target both LC3A and LC3B mRNAs  or transfected with plasmids that express poliovirus proteins 2BC and 3A see  and 8. TDo the autophagosome-like membranous structures induced by poliovirus act as scaffolds for RNA replication, or are they part of the host antiviral response? The numerous positive correlations between the functional presence of autophagosomal pathways and increased viral yield lead us to conclude that the autophagosome-like structures observed during poliovirus infection are not antiviral. Instead, we argue that the double-membraned vesicles induced during poliovirus infection facilitate poliovirus replication, and we hypothesize that poliovirus, rhinovirus 2, and rhinovirus 14 subvert the constituents of the cellular autophagy pathway to form membranous scaffolds on which RNA replication complexes can assemble.Other positive-strand RNA viruses that have been shown to localize their RNA replication complexes to double-membraned vesicles in the cytoplasm of infected cells are equine artirivirus , murine For both poliovirus and equine artirivirus, molecular inducers of double-membraned vesicle formation have been identified. Specifically, coexpression of poliovirus proteins 2BC and 3A is required to accumulate double-membraned vesicles  and to eMycobacterium tuberculosis from infected macrophage [Shigella flexneri, the wild-type function of the bacterial icsB gene was shown to be required to prevent autophagic degradation, a process that the authors argue is specifically induced by a bacterial protein, the product of the virG gene [Recent work has highlighted an important role for autophagy in the innate immune response of vertebrates to intracellular pathogens. For example, induction of autophagy has been shown to promote clearance of crophage . FurtherirG gene .S. flexneri, successful microorganisms often display strategies to evade potent host defenses. Furthermore, some microorganisms actively subvert otherwise effective host defense responses for their own benefit: for example, the growth of mink focus-forming virus requires apoptotic caspase activity for the maturation of a nonstructural protein [Legionella infection, several genes, termed Dot or Icm genes, are required to retard the progression of autophagosome maturation, presumably to benefit bacterial growth within organelles that subvert components of the autophagosome [Like  protein , and mur protein ). Simila protein ,43). As  protein ,28. Matu protein . In Legihagosome ,71,72. Whagosome , and murhagosome  have simS. cerevisiae, the yield of replicated RNA actually increased [Why would a virus choose a double-membraned, autophagosome-like vesicle on which to replicate its RNA? Not all positive-strand RNA viruses utilize such structures. For example, Flock House virus RNA replication complexes assemble on outer mitochondrial membranes . When thncreased . TherefoA larger effect on extracellular than intracellular virus yield was observed when the abundance of autophagy proteins Atg12p and LC3 was reduced by RNAi see . PossiblNominally lytic viruses are often assumed to spread exclusively via cell lysis. However, the possibility of nonlytic viral release, even for nonenveloped viruses such as poliovirus, has been suggested from numerous reports of persistently infected cell lines that continuously secreted infectious particles ,75,76,77We suggest a potential mechanism for this nonlytic release of cytosolic viral particles via the formation of double-membraned vesicles throughout the course of infection. Early in infection, the double-membraned structures would entrap cytosol, but this cytosol would be free of virions. However, at later stages of infection, the cytosol trapped by newly generated double-membraned structures would often contain viral particles. Poliovirions and related enteroviruses are relatively resistant to the low pH and active proteolysis that would prevail within the lumen of these vesicles should they mature ,80. As dRecently, HIV has been shown to exit human macrophages via the fusion of multivesicular bodies with the plasma membrane, rather than by directly budding from the cell surface as in HIV-infected T cells ,82,83. H2, and viral titers were measured by TCID50 as described previously [Poliovirus Mahoney type 1 was isolated following transfection with an infectious cDNA  and propeviously .LC3B sequences were amplified by PCR from a Human Lung Library  using targeted primers containing EcoRI sites (ACTGAATTCCCATGCCGTCGGAGAAG andTTTGAATTCTTACACTGACAATTTCA). The LC3A coding region was then inserted into the EcoRI site of pEGFP-C3  to create an EGFP\u2013LC3 fusion protein under the control of the CMV immediate-early promoter. Expression of poliovirus proteins 2BC and 3A was performed as described previously [To construct the GFP\u2013LC3 fusion protein-expressing plasmid, eviously . The 293Cells were fixed using freshly made 4% formaldehyde in PBS for 10 min at room temperature. Poliovirus protein 3A and cellular protein LAMP1 were visualized by indirect immunofluorescence. For visualization of poliovirus 3A protein in the presence of GFP\u2013LC3, cells were washed twice in PBS and incubated in a PBS solution that also contained 0.5% saponin, 10 mM sodium azide, 0.125% BSA, 3A monoclonal tissue culture supernatant at a dilution of 1:30, and rhodamine-linked antimouse secondary antibody  at a dilution of 1:200. Cells were incubated at 4 \u00b0C for 45 min, washed twice with PBS, and placed under Vectashield mounting medium . Visualization of LAMP1 was performed using a monoclonal LAMP1 antibody  at a dilution of 1:200.5 ceramide . Under these conditions, punctate MDC staining was not observed (data not shown).MDC  was stored at \u221220 \u00b0C under desiccant. A fresh stock solution of 5 mM MDC was made in 1:1 DMSO/EtOH immediately prior to adding to cultures. At 1 h before fixation, fresh medium that contained either 10 \u03bcM MDC in DMSO/EtOH or an equivalent volume of DMSO/EtOH was added to the cells. The cells were then fixed using a freshly made 4% formaldehyde solution in PBS for 10 min at room temperature and imaging was performed immediately. To ensure that membrane vesiculation induced by methods other than the induction of autophagy did not show similar MDC staining patterns, Golgi vesiculation was induced with 5 \u03bcM ilimaquinone  or 5 \u03bcM Microscopic analysis was carried out on an Olympus IX70 at 100X magnification. Images were captured and deconvolved using SoftWorx 2.50 on an SGI Octane workstation. MDC staining was detected at 360 nm excitation/457 nm emission. GFP\u2013LC3 expression was detected at 490 nm excitation/528nm emission. Rhodamine was detected at 555 nm excitation/617 nm emission. Individual images from each stack were saved as TIFF files and processed in Adobe Photoshop 7.0.LC3, both LC3A and LC3B RNAs [ATG12 were:GGGAAGGACUUACGGAUGUUU/5\u2032P-ACAUCCGUAAGUCCUUCCCUU;GAACACCAAGUUUCACUGUUU/5\u2032P-ACAGUGAAACUUGGUGUUCUU;GCAGUAGAGCGAACACGAAUU/5\u2032P-UUCGUGUUCGCUCUACUGCUU; and UGUUGCAGCUUCCUACUUCUU/5\u2032P-GAAGUAGGAAGCUGCAACAUU. The siRNA sequences for LC3A were:GGACGGCUUCCUCUAUAUGUU/5\u2032P-CAUAUAGAGGAAGCCGUCCUU; CGGUGAUCAUCGAGCGCUAUU/5\u2032P-UAGCGCUCGAUGAUCACCGUU; ACAUGAGCGAGUUGGUCAAUU/5\u2032P-UUGACCAACUCGCUCAUGUUU; andCGCCCAUCGCGGACAUCUAUU/5\u2032P-UAGAUGUCCGCGAUGGGCGUU. The siRNA sequences for LC3B were:CAAAGUUCCUUGUACCUGAUU/5\u2032P-UCAGGUACAAGGAACUUUGUU; GAUAAUAGAACGAUACAAGUU/5\u2032P-CUUGUAUCGUUCUAUUAUCUU; GUAGAAGAUGUCCGACUUAUU/5\u2032P-UAAGUCGGACAUCUUCUACUU; andAGGAGACGUUCGGGAUGAAUU/ 5\u2032P-UUCAUCCCGAACGUCUCCUUU.siRNA SMARTpools, consisting of four RNA duplexes targeting the gene of interest, and a control siRNA targeting firefly luciferase, were purchased from Dharmacon . For C3B RNAs  were tar5 per 6-cm dish in 2.5 ml EMEM without antibiotics, and transfected using Lipofectamine 2000  according to manufacturer's instructions. For each 6-cm dish, 100 total pmol of pooled siRNA was diluted in 250 \u03bcl of serum-free OptiMEM medium (Invitrogen) and, separately, 5 \u03bcl of Lipofectamine 2000 was diluted in 250 \u03bcl of OptiMEM. After an incubation of 5 min at room temperature, the diluted RNA and Lipofectamine 2000 were combined and incubated for 20 min at room temperature. The 500-\u03bcl mixture was then added to each dish and gently rocked to spread the lipid\u2013RNA complexes. Growth curves and immunoblots were performed 48 h after transfection. Total cell extracts were made using RSB-NP40 extraction buffer  supplemented with protease inhibitors . Extract was separated on a 15% Laemmli gel and transferred to a PVDF membrane for Western blotting. Anti-LC3 immunoblotting was performed using rabbit antibody raised commercially  against a peptide comprising the first 16 amino acids of murine LC3 (MPSEKTFKQRRSFEQR). Anti-Atg12p and anti-GAPDH immunoblotting was performed using antibodies from Zymed  and Research Diagnostics , respectively. Antibodies were diluted 1:3,000 in a PBS solution that also contained 0.1% Tween-20 and 2% BSA, and detected with alkaline-phosphatase conjugated goat antirabbit antibody, at a dilution of 1:10,000 using the ECF reagent from Amersham Biosciences .Cells were grown to densities of 1\u20145 \u00d7 102 in flasks. Cells were infected with virus at an MOI of 50 PFU/cell for poliovirus or 50 TCID50/cell for rhinovirus, then washed three times with PBS, trypsinized, and collected by centrifugation. The cell pellet was resuspended in 0.15 M mannitol in PBS and collected by centrifugation. Aliquots of the resulting pellet were frozen in a Balzers HPM 10 high-pressure freezing apparatus as described previously [For cryofixation and EM analysis, H1\u2013HeLa cells were grown in EMEM supplemented with 0.2 M HEPES and 0.1 M MgCleviously .http://us.expasy.org/sprot/) accession numbers for the gene products discussed in this article are 2BC and 3A (P03299), Atg12p (O94817), Atg8p (P38182), LAMP1 (P11279), LC3 (Q9GZQ8), mTor (P42345), Sec12p (P11615), Sec13p (P5573), Sec16p (P48415), Sec23p (P15303), Sec24p (P40482), and Sec31p (O94979).The SwissProt ("}
+{"text": "In contrast, cytoplasmic vector RNA levels were only marginally affected by Rev. Binding of Rev to the RRE or to a heterologous RNA element was required for Rev-mediated enhancement of RNA encapsidation. In addition to specific interactions of nucleocapsid with the packaging signal at the 5\u2032 end of the genome, the Rev/RRE system provides a second mechanism contributing to preferential encapsidation of genomic lentiviral RNA.The main function attributed to the Rev proteins of immunodeficiency viruses is the shuttling of viral RNAs containing the Rev responsive element (RRE) via the CRM-1 export pathway from the nucleus to the cytoplasm. This restricts expression of structural proteins to the late phase of the lentiviral replication cycle. Using Rev-independent  The AIDS pandemic is still an important public health problem, particularly in developing countries. A comprehensive understanding of the HIV replication cycle might allow development of new therapeutics. Despite 20 years of extensive research, the intracellular fate of the different RNAs produced during virus replication is not fully understood. It is known that the viral regulatory protein Rev binds to large viral RNAs and shuttles them from the nucleus to the cytoplasm by a cellular export pathway. We now provide evidence for a more far-reaching role of Rev. We observed that Rev enhances packaging of viral RNA into viral particles to a much larger extent than its effect on viral RNA levels in the cytoplasm. Thus, an early nuclear event  seems to be intimately linked to RNA encapsidation occurring at a late step of the viral replication cycle. Since Rev is not part of the viral particles, Rev seems to act indirectly, possibly by targeting the viral RNA to a cytoplasmic compartment favourable for RNA encapsidation. Thus, further studies on the function of Rev might also advance our understanding of cytoplasmic RNA trafficking and subcytoplasmic compartmentalization. Alternatively, long-distance interactions as observed for the HIV-1 5\u2032UTR [Virus particles of HIV-1, the major cause of the AIDS epidemic, and other members of the lentivirus family of retroviruses contain an RNA genome. After viral entry, the genomic RNA is reverse transcribed into DNA and integrates into the genome of the host cell. The integrated proviral DNA is transcribed by RNA polymerase II. Complex alternative splicing events with a major splice donor in the 5\u2032 untranslated region (UTR) generate viral mRNAs encoding Env and a number of small regulatory proteins. The unspliced transcript serves as a template for translation of Gag and Pol proteins. During particle formation, the unspliced genomic RNA is also packaged in preference to spliced viral mRNAs and a more than 1,000-fold excess of cytoplasmic cellular RNAs. Packaging signals have been identified in the 5\u2032UTR of lentiviruses , an RNA motif present on the unspliced transcript and the iewed in ). By bin100-fold . Similar100-fold . Both stgag-pol expression plasmid, a VSV-G expression plasmid, a tat expression plasmid, and the prototypic HIV-1 vector construct VH . To exclude the possibility that Rev-independent cytoplasmic localization of vector RNA is simply due to contamination of the cytoplasmic RNA fraction with large amounts of nuclear RNA, pre\u2013glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA levels in cytoplasmic and nuclear RNA preparations were determined by quantitative real-time PCR. As expected for a nuclear RNA, 16-fold higher concentrations of preGAPDH RNA were observed in the nuclear fraction than in the cytoplasm  antibody also cross-reacting with SIV CA was performed. Rev did not affect the amounts of particles produced by the codon-optimized expression plasmids, and no obvious differences in the processing of Gag could be observed .The enhanced packaging efficiency we observed in the presence of Rev could be due to stimulation of particle production and release. It has been previously observed that Rev enhances Gag protein levels in a RRE-dependent manner to a larger extent than its cytoplasmic mRNA levels . Althougobserved A. In conH vector plasmid were cotransfected with constant amounts of packaging plasmids in the absence of Rev and compared with transfections containing a small amount of VH in the presence of Rev. Cytoplasmic RNA levels obtained with large amounts of VH in the absence of Rev were up to 10-fold higher than the levels obtained with a low amount of VH in the presence of Rev  Blasticidin fusion gene expressing vector VSBlas was constructed by deleting nucleotides 8899\u20139375 and all remaining nucleotides between 2031 and 8014 from VGBlas\u0394BH [The HIV-1 vector constructs HIV-CLCG  and HIV-eference ) containGBlas\u0394BH .tat (pcTat), HIV-1 rev (pcRev), a fusion protein of HIV-1 Rev and capsid of bacteriophage MS2 (Rev-MSC), and codon-optimized gag-pol of HIV-1 and SIV, have been described previously [The expression plasmids encoding VSV-G (pHIT-G), HIV-1 eviously ,17,36,37eviously  to generhttp://www.aidsreagent.org) directed against HIV-1 and SIV capsid. The amount of pelleted p24CA was determined using the INNOTEST HIV Antigen mAb Kit . To control for transfection efficiency, GFP expression was determined in lysates of transfected cells using an anti-GFP antibody . For establishment of stable cell lines 293-VH or 293-VSBlas, vector-containing particles were produced as described above. 293T cells were transduced with VH vector particles on three consecutive days. Cells were then sorted for GFP expression by flow cytometry, resulting in a population of 78% GFP-positive cells. For 293-VSBlas cells, 293T-cells were transduced once and selected for Blasticidin resistance essentially as described [Vector-containing particles were produced by transfection of 293T cells using the calcium phosphate coprecipitation method as described . Two dayescribed .2, 0.5% Nonidet P-40, 1,000 U/ml RNase inhibitor, 1 mM DTT) for 5 min on ice. Intact nuclei were pelleted by centrifugation for 2 min at 300g at 4 \u00b0C. The supernatant was harvested as cytoplasmic fraction from which the RNA was isolated with the RNeasy Mini Kit . Viral particles pelleted as described above were resuspended in 140 \u03bcl of PBS, and RNA was extracted using the QIAmp Viral RNA Mini Kit (Qiagen).To prepare cytoplasmic RNA, trypsinized cells were washed with PBS, and the plasma membrane was permeabilized in buffer RLN . Next, 40 \u03bcg protein of each fraction were analyzed by Western blot using the anti-Lamin B antibody C-20 (Santa Cruz Biotechnology). A total cell lysate was also included.To validate the cellular fractionation procedure, cytoplasmic RNA was extracted as described above. Nuclear RNA was also extracted from the pelleted nuclei after one washing step in PBS. Then, 500 ng of cytoplasmic and nuclear RNA were analyzed by quantitative real-time PCR with the primers preGAP-DHE6s and preGAP-DHE6a amplifying intronic sequences of the preGAPDH RNA . Serial gag-specific RT-PCR using primers SK145 and SKCC1B from the Amplicor HIV-1 Monitor test [A heterologous RNA transiently expressed at comparable levels in the cytoplasm was packaged approximately 500-fold less efficient as the vector RNAs, confirming the specificity of the packaging assay . Cytoplator test .http://www.ncbi.nlm.nih.gov/Genbank) accession numbers for the genes and gene products discussed in this paper are HIV-1 vector pNL4\u20133 (AF324493), human GAPDH (J04038), and simian (macaque) immunodeficiency virus, isolate 239 (M33262).The GenBank ("}
+{"text": "Deficient mineral supplementation on a feedlot farm resulted in severe clinical manifestations in fattening bulls. Animals mistakenly received only 60\u201370% of the recommended calcium intake, while simultaneously receiving twice the amount of phosphorus recommended. Thus, the dietary Ca/P ratio was severely distorted. After approximately six months on such a diet, four fattening bulls were euthanized because of severe lameness and 15% of other animals on the farm were having clinical leg problems. Veterinary consultation revealed the mistake in mineral supplementation.Fattening bulls were divided into three groups depending on the time of their arrival to the farm. This enabled the effect of mineral imbalance at different growth phases to be examined. After slaughtering, the bones of both front and hind limbs were macroscopically evaluated.Over 80% of the animals with a calcium-deficient diet had at least one severe osteoarthritic lesion. The economic impact of the calcium deficiency was statistically significant.Calcium deficiency with distorted Ca/P ratio yielded a severe outbreak of osteoarthritis in fattening bulls. Calcium deficiency caused a more serious lesions in age group 5\u201312 months than age group 12\u201318 months. Besides causing obvious economic losses osteoarthritis is also a welfare issue for feedlot animals. Lameness of fattening dairy and meat bulls is an animal welfare issue that also has significant economic consequences. Affected animals often suffer from osteoarthritis (OA) . OA is aOC is believed to be multifactorial, but the exact risk factors are still under debate. Typical predisposing causes connected to the development of OC in cattle and swine are nutritional, environmental ,5 and heAnimals suffering from OA often show such clinical symptoms as lameness and unwillingness to move, fluid in affected joints and difficulty in standing up. Their gait is stiff and the lameness is frequently bilateral. Ruptures of the Achilles tendon have also been reported . MedicalClinically, OC is most often seen in animals aged 14\u201322 months , and OA In this case report, we describe the consequences of an accidental mineral deficiency on a feedlot farm. We analyse differences between exposure groups and estimate the economic losses due to calcium deficiency and OA.A Finnish dairy bull owner contacted the veterinarian because the animals were having an increasing number of leg problems. Affected animals were lame; they had difficulty in getting up and spent most of their time recumbent. The first symptoms were noticed about one month before contacting the veterinarian.Four animals aged approximately 12 months were euthanized because they were unable to stand. Carcasses were sent to the slaughterhouse, where they were inspected by a veterinarian. The first animal had a rupture of the Achilles tendon with suppurative inflammation and an acute, bilateral aseptic inflammation of the stifle joints. The second animal had a bilateral Achilles tendon rupture. The third bull had a fractured front leg and aseptic inflammation of the stifle and elbow joints. The fourth animal had aseptic inflammation bilaterally of the elbow joint and the stifle joint and a ruptured Achilles tendon. The veterinarian sent a hind leg of the fourth animal the Finnish Food Safety Authority, Kuopio Research Unit, for pathological evaluation. Lesions in the hock joint were reported macroscopically to be typical for osteochondrosis.At the time of the author's farm visit (TH); six animals had already been slaughtered due to severe lameness. At the visit, 16 of the 106 animals were found to have some kind of leg problems. Affected animals were lame and had different degrees of swelling of the joints, mainly in the hock and stifle joints.The unit where leg problems emerged was for fattening of dairy bulls from the age of 6 months to slaughter. Target weight at 18 months was 330 kg. Minerals were added to the animals' drinking water. In this kind of system, calcium should also be provided in the ration. However, in this case, calcium was mistakenly not added, and thus, animals aged 6\u201318 months were calcium-deficient. At the time of the farm visit, confusion with the feeding of the minerals had been ongoing for seven months, affecting different growing phases of animals in Groups 1 and 2. Group 3 animals entered the farm after hazard identification  months. This group had received a low-calcium diet on average from the age of 9 months to 16 months. The second group consisted of 16 animals aged 21\u201322 (average 21.7) months. This group had received a low-calcium diet on average from the age of 4.6 months to 11.6 months. The third group consisted of 15 animal aged 18.3\u201320.9 (average 19.2) months; this group had a normal, mineral-balanced diet . Calcium was mistakenly not given in the ration, and animals were therefore calcium-deficient for 8 and 7 months in Groups 1 and 2, respectively (Table During the feedlot period (200\u2013600 kg bodyweight), fattening bulls are fed twice daily. Animals are divided into two feeding groups based on their estimated weight: those weighing 200\u2013400 kg and those weighing over 400 kg. Feeding of the animals is based on a feeding plan Table . The homThe bones  were removed at the abattoir. In Group 1, the bones were collected on a group basis. In Groups 2 and 3, the bones were collected on an animal basis. In Group 2, all scapulas were missed because of a sampling error. Bones were sent to the Section of Veterinary Pathology at the University of Helsinki, where they were stored below 4\u00b0C for 2\u20137 days prior to examination. All joint surfaces were evaluated macroscopically. Location, number and appearance of pathological changes were recorded. Changes were categorized into four grades Fig. . Grade 2Differences in weight gain and income between the three groups were tested by one-way analysis of variance (ANOVA) followed by Tukey's test. Levene's test was used to evaluate the variance within each group. Chi-square test was used to explore differences between groups in the prevalence of severe lesions . McNemar's test was applied to assess the difference between left and right leg bones. The effect of severe lesions in different locations on weight gain in Groups 2 and 3 was determined by t-test. Results are expressed as means or percentages (\u00b1 standard errors of the mean (SE)). P-values of less than 0.05 were considered statistically significant.The scapula was the bone most often affected  and the head of the humerus (27%). OA lesions in the medial trochlea could be divided into two locations; 66% of the changes were found in the medial ridge and 34% in the mid-region. However, the most severe lesions were situated in the lateral trochlea of the humerus.Predilection sites of OA lesions in the head of the radius were the fovea capitis radii (42% of affected bones) and the incisura trochlearis (35%).The predilection site of OA lesions in the femur was the trochlea ossis femoris (60% of affected bones). Lesions in the trochlea of femoris varied from a narrow, fissure-like vertical slit to a \u2265 10-mm crater-like ulceration and OD-like lesions Fig. . LesionsThe predilection site of OA lesions in the tibia was the lateral condyle.The tarsal bones, specifically the talus and the calcaneus, were often affected; predilection sites were the articular surfaces between the tibia and these bones. Lesions in the talus were severe; 16% were classified as grade 4 (OD). The predilection site of OD lesions was the lateral trochlea of the talus.OA lesions were commonly bilateral. Only 13.8% of lesions in the radius and 6.5% of lesions in the tarsus were unilateral. In the femur, 28.6% of lesions were unilateral Table .The weight gain per day varied between groups Fig. . Groups A significant difference was present between groups in the prevalence of severe lesions . Groups with a low-calcium diet (Groups 1 and 2) had a significantly higher prevalence of OA lesions in the talus and trochlea ossis femoris Table . When GrBy studying only the femurs of the bulls, 40% of affected animals  were detected. By combining the findings of femurs, tarsi and radii, the sensitivity was 100% Table .The faulty, heavily distorted dietary Ca/P ratio yielded a severe outbreak of OA in fattening bulls. Over 80% of the animals with a calcium-deficient diet had at least one severe OA lesion. However, OA lesions were prevalent also in animals with balanced diets, 30% of these animals having lesions.Active discussion about the lameness of dairy cows and steering bulls is taking place worldwide. Reports indicate that as many as 60% of dairy cows show lameness at least once a year . LamenesTo enhance animal welfare, it would be beneficial if economic losses were connected to the issue. How much does OA affect productivity? In the present case, the economic losses were obvious. At least six animals were euthanized or sent to the slaughterhouse earlier than planned due to acute lameness. Because of differences in net weight gain per day and in carcass classification on the EUROP.e system, animals in Group 3 produced 20% better income than animals in Group 2 and over 30% more money than animals in Group 1.No significant association could be shown between OA lesions and the growth rate of animals. In Group 2, all animals had at least one severe OA lesion; thus, no case-control comparisons could be performed. In addition, Group 3 lacked sufficient cases for a case-control comparison. However, the overall trend does not rule out the existence of such a connection.Predilection sites in bovine OC literature include stifle, hock, shoulder and elbow joints ,7,10,18.Our findings suggest that calcium deficiency and mineral imbalance are predisposing factors for OA Table . The inc"}
+{"text": "These seemingly independently arising groups of compensatory mutations were functionally interchangeable in regard to the recovery of wild type replication in rhesus PBMCs. These findings indicate that viral reversion that overcomes a genetic bottleneck is not limited to a single pathway, and illustrates the remarkable adaptability of lentiviruses.We have analyzed a SIV deletion mutant that was compromised both in viral replication and RNA packaging. Serial passage of this variant in two different T-cell lines resulted in compensatory reversion and the generation of independent groups of point mutations within each cell line. Within each group, single point mutations were shown to contribute to increased viral infectivity and the rescue of wild-type replication kinetics. The complete recovery of viral fitness ultimately correlated with the restoration of viral RNA packaging. Consistent with the latter finding was the rescue of Pr In the leader of human immunodeficiency virus type-1 (HIV-1), the packaging signal or Psi (\u03a8) is distributed across multiple RNA domains that include stem loop-1 (SL1), SL3 and SL4 [gag-coding regions [The packaging of full-length viral genomic RNA (vRNA) into primate lentiviruses is regulated by a multipartite Comparative packaging studies of simian immunodeficiency virus (SIV) by our group and of human immunodeficiency virus type-2 (HIV-2) by others, have assigned a primary role in packaging to SL1, as compared to all other regions within the SIV and HIV-2 genomes -10. More55 Gag. In the context of Pr55 Gag an important trans-role has been ascribed to the viral nucleocapsid (NC) protein [The foregoing implies the presence of multiple RNA-binding domains within Pr protein ,18, alth protein ,19. Othe protein ,21.Studies on the reversion of SL1 deleted virus in HIV-1 showed that compensatory point mutations in four distant Gag proteins, i.e. nucleocapsid NC-T24I), matrix (MA-V35I), capsid (CA-T24I) and the p2-spacer (p2-T21I) were all involved in restoration of viral growth . GriffinI, matrix55Gag alone has been shown to be sufficient for particle production, numerous host and viral proteins are required for optimal viral assembly and budding [55Gag during protease-mediated cleavages that take place during assembly and at post-budding stages [Although Pr budding . Indeed, budding . The latg stages .mac239  that resulted in a significant delay in viral replication and reduced vRNA packaging. The serial passage of this mutant virus in the CEMx174-T/B-hybrid cell line or in C8166-T cells over protracted periods resulted in the recovery of virus replication [Previous work from our group described a mutant deleted of 21 nucleotides within the 5' proximal stem of SL1 of the infectious molecular clone of SIVBriefly, virus passaged in C8166 cells, a single A-G compensatory point mutation was identified within the viral dimerization initiation site (DIS) at nucleotide position +423 (A423G), while two other compensatory mutations were found in the CA and p6 regions of gag,  . The for55Gag protein processing is commensurate with the return of wild-type levels of packaged vRNA. We also show that some mutations can facilitate partial recovery of RNA dimerization, leading to restored viral core morphology and placement. Thus, compensation may involve different viral gene products, leading to restored infectivity and replicative fitness in primary PBMCs.The present study was designed to elucidate mechanisms whereby various compensatory mutations can restore viral replicative fitness, and the role of different cellular environments on the molecular evolution of SIV genomes harboring deletions in leader sequences. We now show that the recovery of Prmac239[The SD2 variant  were transfected into 293T cells. Mutant viral RNA was extracted from aliquots of the supernatants of these transfections and normalized on the basis of p27-CA. To assess relative packaging efficiency, mutant viral RNAs were used as template in an 18-cycle multiplex RT-PCR reaction run in parallel with multiple dilutions of wild type vRNA as a linear range control, as described previously [The results of RT-PCR Fig. , were suNext, we tested the ability of the two NC mutations to restore vRNA incorporation. Fig The SD2 variant  directed against p27-CA as described previously [The SD2 deletion also resulted in delayed processing and an altered processing pattern of Gag proteins. To study the role of the aforementioned compensatory mutations in this regard, Previously . Indeed,55Gag processing in the SD2 virus. In the presence of the A423G mutation, however, both NC mutations i.e., SD2-A423G, E18G, G31K, were required to restore processing of both the MA-CA (p41) and CA-NC (p39) intermediate processing products, leading to a wild type processing phenotype.The results of Fig. Thus, the A423G point mutation acts to rescue the deficit in viral RNA packaging of the SD2 deletion, while the G49K mutation in p6 or the E18G and G31K substitutions in NC contribute to the restoration of Gag processing.In order to pursue the biological relevance of these compensatory mutations, each mutant proviral construct was transfected into 293T cells and viral supernatanst harvested after 48 hours. Viral stocks were titrated by p27-CA ELISA and assayed for viral replication capacity in PHA-stimulated rhesus PBMC. As shown in Figure 50 per ng p27-CA antigen  were used to calculate TCIDgen Fig. . The resWe next hypothesized that the mutations selected through serial passage might also correct morphological anomalies in the viral core. Transmission electron microscopy (TEM), of ultra-thin sections of transfected cell preparations showed that approximately 80% of wild-type virus particles contained a fully condensed core, typical of mature virus. In contrast, the SD2 mutant resulted in diminished viral production, and about 70% of the SD2 particles observed possessed displaced and/or improperly condensed cores and/or immature core structure Fig. .Both recombinant clones (i.e. SD2-A423G-E18G-G31K and SD2-A423G-K197R-G49K) were also transfected in parallel, and yielded comparable levels of particle production as wild type, as measured by p27-CA levels in culture supernatants (not shown). The results of the EM experiments showed restoration of proper core morphology, and levels of immature virus were comparable to the wild type Fig. .Here, we describe an SIV deletion mutant that was passaged in two different T-cell lines and that employed two different pathways to attain reversion. Retroviruses display genomic plasticity, and sequence diversification in both HIV-1 and SIV can in some cases augment viral replication and pathogenesis -31. The Our findings indicate that reversion is not limited to a single trajectory. Compensatory mutations in both the untranslated leader and the gag-coding region emerged during long-term passage in different T-cell lines, and these mutations were required for full restoration of viral replication. Interestingly, the A423G substitution, located within the DIS, was shown to be active in restoring efficient levels of viral RNA packaging, while mutations in either the nucleocapsid, G31K, E18G, or within the p6 protein of Gag, G49K, were essential for the proper processing of Gag precursors. In each instance, the presence of three point mutations was functionally synergistic in regard to rescue of both viral RNA packaging and Gag processing. Moreover, the observed changes in regard to impaired Gag processing could be corrected by either the E18G, G31K or G49K mutations. We also showed that RNA dimerization could be partially recovered due to compensatory mutations in NC. Several studies have shown the interplay that exists between viral RNA and viral proteins that are involved in regulation of core structure, proteolytic processing, and maturation of RNA dimers ,35. Intemac239 can be rescued by compensatory point mutations elsewhere within the DIS and Gag. The present work shows that restoration of SIV replication involved two distinct sets of mutations, located in both the DIS loop (A423G) and within different Gag proteins, i.e. NC (E18G and G31K) or CA (K197R) and p6 (E49K); these amino acid changes, with the exception of K197R, result in a net increase in the number of positively charged residues within Gag.Numerous studies on HIV-1 have shown that NC is the major protein domain within Gag that recognizes the encapsidation signals present within leader sequences . The NC The finding that mutations within NC can rescue these deficits further confirms the role of this protein in interactions between Gag and RNA leader sequences of SIV, which have been less intensively studied than for HIV. The debilitated SD2 virus may be able to correct the deficit caused by the deletion within the DIS stem by altering both the leader sequence, as well as by reconfiguring Gag proteins, presumably to facilitate both viral RNA-RNA and RNA-protein interaction ,40.55 Gag has been shown to occur on an RNA scaffold, and encapsidation of viral RNA likely requires that leader RNA sequences exist within the constraints of proper tertiary structure, which are highly conserved in both HIV-1 and SIV [Our data also show that p6 plays an important role in the incorporation of viral proteins into virions and the specific encapsidation of viral RNA . We have and SIV ,42-44. D and SIV .These observations suggest the importance of functional interactions between Gag-proteins and the RNA-leader in both HIV-1 and SIV, but also imply that important differences may exist between SIV and HIV-1 in regard to such interactions. We have also demonstrated that different cell types can reproducibly select for different sets of compensatory mutations, but that both of these sets are functionally interchangeable in regard to their ability to restore viral replication, regardless of the cell type in which the virus is ultimately grown. Of course, it is conceivable that either the same mutational spectrum or even different ones may have been observed in either of the cell lines tested had additional replication studies been performed.It is not trivial that the mechanisms of compensation for lentiviruses, grown under conditions of stress as demonstrated here, are apparently not restricted to single pathways. The mechanisms behind viral escape from antibodies, cytotoxic-T lymphocyte pressure and the generation of resistance to antiretroviral drugs are not mutually exclusive. Our results add to what is known about the plasticity and adaptability of lentivirus genomes.mac239 wild type as a template, to generate all the mutants described [A PCR-based mutagenesis method was applied together with conventional cloning techniques using the full-length infectious clone of SIV, termed SIVescribed . All nucescribed .32-ATP in order to visualize PCR products. Equivalent RNA samples, based on p27 antigen levels, were used as templates in an 18-cycle RT-PCR. The products were fractionated on 5% polyacrylamide gels and exposed to X-ray film. Relative amounts of products were quantified by molecular imaging (BIO-RAD Imaging). RNA encapsidation was determined on the basis of four different reactions, and calculated with wild type virus levels arbitrarily set at 1.0.To study packaging of viral genomic RNA we used methods previously described -10. Briemac239 plasmid. These were recovered by gel purification and labelled with \u03b4-P32-ATP by nick-translation following standard protocols . The denaturing Northern analysis of cellular RNA was also conducted in parallel. RNA extraction was carried out in similar fashion to that described for slot blotting above. Cellular RNA from lysates was normalized on the basis of p27-CA antigen present in cellular lysates. Total cellular RNA preparations, i.e. equivalent volumes of RNA, were also run on 1% ethidium bromide (EtBr) stained gels as internal controls for total RNA and 28S and 18S ribosomal RNAs. Probes were prepared as described above. Probes were labelled by nick-translation following standard manufacturer's protocols  and used in standard hybridization reactions.Culture fluids from transfected 293T cells were collected and clarified using a Beckman GS-6R bench centrifuge at 3,000 rpm for 30 min at 4\u00b0C. Viral particles were further purified through a 20% sucrose cushion at 40,000 rpm for 1 hour at 4\u00b0C using a SW41 rotor in a Beckman L8-M ultracentrifuge. Viral pellets were first dissolved in Tris-EDTA (TE) buffer, then in lysis buffer containing proteinase K (100 \u03bcg/ml) and yeast tRNA (100 \u03bcg/ml). Samples were incubated for 20 min at 37\u00b0C, in the presence of 50U of DNAse I, followed by two extractions, first in phenol: chloroform: isoamyl alcohol, then chloroform. Viral RNA was then precipitated, washed in 70% ethanol and stored at -80\u00b0C until required, at which time samples were resuspended in TE buffer at 4\u00b0C. RNA was then analysed by non-denaturing electrophoresis on 0.9% agarose gels in 1\u00d7 Tris-Borate-EDTA (TBE) running buffer for 4 hrs at 4\u00b0C. Products were subsequently denatured in 50 mM NaOH and equilibrated in 200 mM Na-acetate. Following electrophoresis, RNA was transferred to Hybond-N nylon membranes by capillary blotting using a 20\u00d7 concentration of SSPE buffer. Membranes were baked for 2 hrs at 80\u00b0C. Probes were prepared by digestion and purification of the NdeI-BstE III fragment excised from the SIVAt 48 hrs post-transfection, virus-containing supernatants recovered from transfected 293T cells were collected and clarified at 3000 rpm for 30 min, at 4\u00b0C in a GS-6R Beckman centrifuge. Virus was further purified by pelleting through a 20% sucrose cushion by ultracentrifugation at 35000 rpm in a Beckman ultracentrifuge for 1 hr at 4\u00b0C. Cells were washed 2\u00d7 in cold PBS and lysed by the addition of buffer containing 1% Nonidet P-40, 50 mM Tris-CL (pH 7.4), 150 mM NaCl, 0.02% sodium azide, and a cocktail of protease inhibitors . Virus was normalized on the basis of p27-CA protein present in supernatants or cell lysates. Both pelleted virus and cellular lysates were subject to Western blotting with monoclonal antibodies directed at SIV p27-CA antigens  following standard protocols .293T cells were maintained in DMEM medium supplemented with 10% heat-inactivated fetal bovine serum, penicillin, streptomycin and glutamine. CEMx174 or C8166 cells were maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum and antibiotics. All media and sera were purchased from Gibco inc. .Macaca mulatta) housed at L.A.B. Pre-Clinical Research International Inc., . All primates were housed in accordance with accredited laboratory care standards. All donor macaques were tested serologically and were negative for simian type-D retrovirus-1 (SRV-1), simian T-cell lymphotrophic virus type 1(STLV-1), and simian foamy virus (SFV-1) at the initiation of the study.Monkey peripheral blood mononuclear cells (PBMCs) were isolated from the blood of healthy rhesus macaques . For the production of infectious viral stock, 293T cells were transfected using the above constructs together with Lipofectamine-Plus reagent . Virus-containing culture supernatants were harvested at 48 hr post-transfection and clarified by centrifugation for 30 min at 4\u00b0C at 3,000 rpm in a Beckman GS-6R centrifuge. Viral stocks were passed through a 0.2 \u03bcm filter and stored in 1 ml aliquots at -80\u00b0C. All wild type and mutant stocks were titered on the basis of p27-CA antigen in culture supernatants using a Coulter SIV core antigen ELISA assay .PBMCs were purified on Ficoll cushions, washed in supplemented RPMI-1640 media, and purified lymphocytes were then phytohemagglutinin (PHA)-stimulated for 3 days, then maintained in supplemented RPMI-1640 medium containing 10% heat-inactivated fetal bovine serum and 20 u/ml IL-2 at 37\u00b0C with 5% CO2 were added at 37\u00b0C for 0.5 h to eliminate any potential plasmid DNA contamination, prior to inoculation of cells. Infection of rhesus PBMCs was performed by incubating 4 \u00d7 106 PHA-activated cells with wild type or mutant viral stocks containing 10 ng of p27-CA viral equivalent at 37\u00b0C for 2 hours. Infected cells were then washed three times with PBS to remove any remaining virus. Finally, cells were resuspended in fresh supplemented RPMI-1640 medium. Cells were maintained in 3 ml of culture medium as described above, and fresh stimulated PBMCs were added to the cultures at weekly intervals. Virus production in culture fluids was monitored by both RT assay and SIV p27 antigen capture assay.To initiate infection, viral stocks were thawed at room temperature. Then, 100 U of Dnase I in the presence of 10 mm MgCl50) was determined by infection of CEMx174 cells as described previously. TCID50 results were calculated by the method of Reed and Muench [Virus infectivity (TCIDd Muench .Viral ultra-structure for the described mutant viruses was examined by transmission electron microscopy. Briefly, COS-7 cells transfected with wild type or mutant SIV constructs were fixed at 48 hours post-tranfection in 2.5% glutaraldehyde/phosphate buffered saline followed by a secondary fixation of lipids in 4% osmium tetroxide. Samples were routinely processed and serially dehydrated. Samples were embedded in Epon under vacuum followed by heat-induced polymerization. Thin-sectioned samples were stained with lead citrate and uranyl acetate and visualized at 80 Kev using a JEOL JEM-2000 FX transmission electron microscope equipped with a Gatan 792 Bioscan wide-angle 1024 \u00d7 1024 byte multi-scan CCD camera. At least 100 viral particles were scored for each variant to determine the relative percentage of particles with structural anomalies."}
+{"text": "While improved drug regimens have greatly enhanced outcomes for patients with chronic viral infection, antiviral therapy is still not ideal due to drug toxicities, treatment costs, primary drug failure and emergent resistance. New antiviral agents, alternative treatment strategies and a better understanding of viral pathobiology, host responses and drug action are desperately needed. Interferon (IFN) and ribavirin, are effective drugs used to treat hepatitis C (HCV), but the mechanism(s) of their action are uncertain. Error catastrophe (EC), or precipitous loss of replicative fitness caused by genomic mutation, is postulated to mediate ribavirin action, but is a deeply flawed hypothesis lacking empirical confirmation. Paradoxically ribavirin, a proven RNA mutagen, has no impact on HCV viraemia long term, suggesting real viruses, replicating in-vitro, as opposed to mathematical models, replicating in-silico, are likely to resist EC by highly selective replication of fit (~consensus sequence) genomes mediated, in part, by replicative homeostasis (RH), an epicyclic mechanism that dynamically links RNApol fidelity and processivity and other viral protein functions. Replicative homeostasis provides a rational explanation for the various responses seen during treatment of HCV, including genotype-specific and viral load-dependent differential response rates, as well as otherwise unexplained phenomena like the transient inhibition and rebound of HCV viraemia seen during ribavirin monotherapy. Replicative homeostasis also suggests a primarily non-immunological mechanism that mediates increased immune responsiveness during treatment with ribavirin (and other nucleos(t)ide analogues), explicating the enhanced second-phase clearance of HCV ribavirin promotes and, thus, the apparent immunomodulatory action of ribavirin. More importantly, RH suggests specific new antiviral therapeutic strategies. Chronic viral infection, notably with the human immunodeficiency virus (HIV), and hepatitis B (HBV) and C (HCV), as well as other viruses like Ross River and West Nile Viruses, is a global public health problem that affects perhaps a billion people world-wide. About 500 million people are infected with HBV, while perhaps 200 million more are have chronic HCV. Annually, about 2 million people with CVH die prematurely due to liver failure or hepatocellular carcinoma (HCC). Hepatitis C is the most common cause of chronic hepatitis and cirrhosis in the US , and othAntiviral therapy remains extremely problematic: While highly active antiretroviral therapy (HAART) has dramatically slowed disease progression, and has significantly improved outcomes for HIV infected individuals receiving therapy, significant adverse reactions (SARs) are common. Similarly, although treatment of CVH has improved greatly during the past 5 years, about 50% of those infected with genotype 1 HCV will fail to clear virus, even with optimal use of the best currently available treatment regimen(s) in maximally compliant patients ,4. The o+ T-helper (TH1) cytokine profiles, for example, are found more frequently in patients with self limiting viral infections than in those who develop chronic viral carriage [+ TH1/TH2 lymphocyte responses and resulted in attempts to enhance immune responsiveness therapeutically [Despite enormous recent advances in molecular virology and immunology the pathobiology of chronic viral infections is still incompletely understood. In particular, the reason(s) some individuals clear virus, while others remain infected and ultimately develop disease is/are unknown. Many clinical features, including patient age and other demographic data, duration of disease , geneticcarriage ,11 has dutically ,13, in tViruses, like other self-replicating molecules, are primarily concerned with producing more viruses. The survival of viruses, as obligate intracellular parasites, over a geological time scale, implies the development of strategies that allow them to effectively paralyse or to circumvent cellular defence mechanisms \u2013 including the innate immune system and those defences preventing cell entry \u2013 while maintaining those metabolic processes essential for viral replication; cell membrane integrity, cell homeostasis and the apparatus essential for protein synthesis. Long term, those viruses capable of inducing a chronic vegetative cellular state and subverting the cellular machinery necessary for their replication will be selected for, while those causing premature  lethal cell injury will not. Observed viral adaptation  and rapiAt present, the only proven treatment for HCV is Interferon alpha (IFN-\u221d)  or combination IFN-\u221d, now usually administered as long-acting pegylated  or albumH1/TH2 profiles) antiviral responses do not permit spontaneous viral clearance, those patients with less effective immune responses \u2013 assuming, momentarily, normal population-based variations in those responses have any relevance whatsoever to whether or not viral clearance occurs \u2013 are preferentially selected and are over-represented in these trials.A large number of clinical trials confirm that the single most important determinant of HCV clearance in response to treatment is viral genotype -34. Brie+ TH1/TH2 lymphocyte responses [viral factors such as pre-treatment viral load [viral factors rather than any host attributes, are the primary determinants of SVR and non-response. Why should the genotype of HCV  type , cytokinesponses , or any ral load ,44-46 anral load -49  cannot have less fidelity than 10-2 errors/base synthesized, and molecules of greater length  would need progressively more faithful polymerases to prevent genomic disorganization. Eigen suggested this problem could be circumvented by the emergence of molecular co-operation and hypercycles [pol to produce more RNA, or is it, as seems more likely, the RNA polymerase that subtly manipulates and directs its RNA(s) to produce the viral shells necessary for production of more RNApol? In this light is it possible prions are just primitive RNApol or RNApol modulating proteins that simply highjack cellular RNAs coding for cellular RNApol cuckolding them into producing more prion protein?Meaning, if the rate information is lost during replication exceeds the rate at which it is concentrated by any selective advantage these molecules possess, error catastrophe occurs. Because the selective advantage of any single mutation is unlikely to be enormous, log S is unlikely to greatly exceed unity (1), therefore \u03b5 cannot be much larger than Nercycles ,53. Cleaercycles ., dissecercycles  and, theercycles , moleculpol in a series of feedback epicycles that link RNApol functions fidelity and processivity, RNA replication and viral protein synthesis, structure and function  envelope sequences, reflecting overly faithful replication (rendering the virus susceptible to immune-mediated clearance or destruction through attenuation and loss of replicative plasticity), interact with RNApol causing decreased fidelity. The ineluctable consequence of these interactions is the formation of highly stable, but reactive equilibria that permit viruses to respond rapidly to adverse changes to their conditions (e.g. immune recognition of dominant epitopes) and changing characteristics (e.g. evolving receptor polymorphisms) of their hosts.The mechanism of RH has been described in detail previously  but, in  Figures , 3, suchpol modulation in a manner similar to that proposed for HIVnef [only in animals developing anti-envelope (E2) antibodies, whereas failure to produce anti-E2 is associated with viral clearance [Several independent lines of evidence strongly suggest that RH is mediated in HCV by interactions between the E2 protein, with probable contribution from P7 that likely 'fine-tunes' RNAr HIVnef , and ther HIVnef . Second,r HIVnef , other rr HIVnef -60. As wr HIVnef , this mur HIVnef , evidencr HIVnef  and NS5Br HIVnef  and the r HIVnef  is predir HIVnef . Fourth,learance ,67, intulearance . Finallylearance , is alsolearance  and HCV learance , thus deAs it relates to control of HCV RNA quasispecies, RH is primarily a mechanism regulating transcription. However, accessory proteins known to alter the processivity and fidelity of cellular DNA-dependent DNA polymerases  and DNA--1 [6 copies ml-1, developed SVR compared to 41% of those with high base-line viraemia, defined as >2 \u00d7 106 copies ml-1. These viral load-dependent differential responses are seen across genotypes [It is well established that patients with low initial viral load, commonly defined as <800,000 IU ml-1 , respond-1 ,44-46. F-1  56% of tenotypes ,39 and henotypes . Similarenotypes ,49.5 IU ml-1) and a low viral load (<8 \u00d7 105 IU ml-1) is entirely arbitrary, differentiation between responders and non-responders is not defined by any specific viral load, and the absolute difference between high and low levels is completely inconsequential when compared to the 4\u20135 log fall in HCV RNA that will occur if therapy is effective. What determines viral load?However, the influence of initial viral load on response to therapy is extremely unlikely to be due to high absolute concentrations of virus per se and is much more likely due to the underlying reason(s) why viral load is high in the first place; After all, the distinction between a high viral load (>8 \u00d7 10wt:RNApol interactions that RH postulates increase polymerase processivity (while reducing fidelity), thus resulting in a high set-point of the replicative equilibrium. Patients with these viral strains, therefore, will have \u2013 and by the same mechanism \u2013 both high-level basal viral replication and increased quasispecies complexity and diversity compared to strains where Envwt:RNApol interactions are less high-affinity. As RH predicts that mutant viral envelope proteins (Envmt) normally act to decrease RNApol processivity (and increase fidelity), while interferon or/and interferon-induced endogenous cellular effector proteins like PKR act to reduce viral replication by interference with normal Envwt:RNApol interactions, thus reducing RNApol processivity, and that these interactions with RNApol occur at the same binding site(s), probably the thumb domain of nonstructural (NS) region NS5B and the interferon sensitivity-determining region (ISDR) in NS5A. Replicative homeostasis predicts that those virus strains with poor prognostic characteristics  will be resistant to therapy because exogenously administered inhibitors (IFN) or/and their effector molecules like protein kinase (PKR) are less easily able to disrupt the high affinity Envwt:RNApol interactions that cause these adverse viral characteristics to develop. As a corollary, RH would predict mutations within this region would reduce the affinity of any Envwt:RNApol interactions, thus reducing viral load, and rendering them more susceptible to interferon therapy, a hypothesis confirmed experimentally [pol interaction sites may actually increase viral replication, thus explaining the usually transient increase in HCV RNA levels observed in some therapeutic trials [pol interactions, as previously discussed [Replicative homeostasis predicts, in general, that viral load will be high in patients with viral strains that have high affinity Envmentally ,77. Furtc trials ,78,79. Tc trials ,81, Semlc trials  and probc trials , where miscussed . Finallyiscussed ,85  workersIn other words, the adverse prognosis patients with high viral load and quasispecies diversity experience with currently available treatments is an innate consequence of the replicative equilibrium intrinsic to those viral strains, rather than absolute viral load or level of quasispecies diversity per se. Of course, as a secondary consequence, the associated broad antigenic diversity generated by the replicative equilibrium of these viral strains will also impair immune-mediated clearance of infected cells.Accurate diagnostic tests for HCV have dramatically improved the safety of transfusion medicine and caused acute HCV to be an increasingly uncommon clinical entity, however, when it does occur, chronic viral persistence and liver disease develops in 50\u201380% of patients . Treatme7\u20138 copies HCV RNA ml-1, then fall by ~2 logs to 105 copies HCV RNA ml-1 long-term  that phThe interferon family, including the type 1 IFNs interferon -\u221d, \u03b2, \u03c9, and \u03bb, have diverse and intricate intracellular functions, including roles in lipid metabolism, apoptosis, and inflammatory responses , mediatepol can change the enzyme irreversibly to the inactive conformation [pol interactions \u2013 the Replication Modulating Elements (RMEs) \u2013 postulated in RH is interferon directly or/and PKR binding to either Env or RNApol or some other as yet unidentified effector ligand(s), as both regions are highly genotype constrained, , the ous Figure .-5 of the rate U or C are incorporated opposite ribavirin, significantly slowing chain elongation [Ribavirin  is a purine (guanosine) analogue phosphorylated within cells to ribavirin mono-, di- and triphosphate . Ribavirin triphosphate pairs equally efficiently with either uridine (U) or cytidine (C) and is incorporated into nascent RNA strands by viral RNA polymerases without causing chain termination ,106 but H1 helper over TH2 lymphocyte phenotypes [d, app of HCV RNApol for GTP make it highly unlikely that the enzyme would be sensitive to the 2 fold reduction in GTP levels that occurs when cells are treated with ribavirin [A recent review of ribavirin action  suggesteenotypes  ii) GTP enotypes  iii) Direnotypes , to whicenotypes . Howeverenotypes . Second,enotypes . Third, enotypes , the lowibavirin . Direct ibavirin ,114,115 ibavirin , while H12 virions typically generated and cleared daily, and each virion having a half-life (t1/2) of about 2.7 hours [A more fundamental problem is that mechanisms (ii-v) cannot account for the observed effect of ribavirin on HCV clearance kinetics Figure . Hepatit.7 hours . Mechani.7 hours   of HCV RNA. Furthermore, in those patients in whom there had been a fall in viraemia, HCV RNA rebound of HCV RNA to pre-treatment levels  occurred within 4 days. Moreover, just as many of the patients  in HCV RNA during the initial 4 days. The rebound viraemia \u2013 a phenomenon that has reported before for ribavirin [The effect of ribavirin therapy on HCV dynamics was recently carefully re-evaluated leading the authors to state: \"Ribavirin exerts a significant, moderate and transient antiviral effect in a significant proportion of patients\" . The eff et el., ) experieibavirin , interfeibavirin ,79 and cibavirin  treatmenibavirin , like thWhile this paper is not meant as a detailed critique of EC theory as it supposedly relates to clinical viral infections, the mathematical models  used to major paradox that further profoundly undermines EC empirically; As ribavirin is incorporated into the replicating HCV genome  that fit genomes (~consensus sequence) are highly preferentially replicated. Obviously, points ii) and iii) are strong arguments against EC and in favour of RH.Error catastrophe is clearly completely untenable as an explanation for the antiviral action of ribavirin when used to treat HCV; if progressive mutagenesis due to ribavirin caused EC then it should be highly effective as monotherapy. It isn't , and thilication ) and abolication , one miglication , HCV RNAtrations  of ribavisolates , ii) theEven if the assumptions underpinning the theoretical basis of EC for eukaryotic viruses weren't highly dubious, the primary empirical observation commonly taken as proof EC exists as a phenomenon \u2013 namely, the loss of infectivity of viruses serially passaged in the presence of mutagens such as ribavirin  \u2013 has se+ lymphocyte TH1/TH2 subset balance [H1 response an increased cell-mediated immune response with enhanced clearance of infected cells and an increased ALT might be expected.Interferon and ribavirin are clearly synergistic in their action and this is unexplained. Used initially as monotherapy, alpha-interferon was extremely disappointing with sustained viral response rates (SVR) of 6\u201312% after 6 months therapy and just 16\u201320% if therapy was continued for 12 months ,134. Rib balance ,140 to fA coherent explanation of the mechanism(s) of ribavirin action must, therefore, account for i) transient reduction in HCV RNA in a proportion of patients ii) rebound increases in HCV RNA by day 4 in these patients iii) transient, smaller increases in HCV RNA in a similar proportion of patients and iv) the long term alteration to phase 2 kinetics presumably related to enhanced immune-mediated clearance of infected hepatocytes and v) the synergistic effect of ribavirin and interferon.pol, slowing viral replication and causing RNA mutagenesis as both a direct consequence of ribavirin incorporation but also by destabilizing incorporation of canonical bases causing preferentially A-to-G and U-to-A mutations [pol processivity is likely to be low. Once mutated HCV RNA is translated, however, RH predicts mutations to the cognate HCV proteins will have significant effect on the RNApol processivity: Alteration to wild-type HCV Env will abrogate the stimulatory HCV Envwt:RNApol interactions hypothesised to occur under RH, thus significantly reducing RNApol processivity, while the accumulation of HCV Envmt will increase the putative inhibitory HCV Envmt:RNApol interactions, further reducing processivity, but increasing HCV RNApol fidelity , hence reducing the both direct inhibitory effect of ribavirin on HCV RNA synthesis and the rate ribavirin is incorporated into HCV RNA. This latter effect then reverses the altered HCV Env:RNA interactions that occurred initially, increasing Envwt:RNApol interactions and again increasing processivity, returning the equilibrium back towards pre-treatment state. Together, these compensatory homeostatic changes can account for result in the rebound of replication seen with ribavirin monotherapy by day four [Increased HCV RNAectivity  and enhaectivity , and thuday four . Second,day four  and expodirect \"immune stimulation\"?Both interferon and ribavirin are held to have immunostimulatory or immunomodulatory actions. However, like all fervently held beliefs, it is worth asking whether or not this is actually true, and whether these terms help our understanding of how these important drugs work. As discussed above there is no doubt IFN has profound effects on the innate intracellular antiviral responses. There is also no doubt interferon therapy can result in HBeAg-->anti-HBeAb  and occaAdministration of HBsAg as vaccine also results in development of anti-HBsAb, and when administered as therapeutic vaccine to patients with chronic HBV caused HBV DNA clearance in 18 of the 32 patients , while cDevelopment of humoral or T-cell immunological responses against antigens requires homogeneous antigen to be presented in an appropriate immunological context in sufficient concentration. Dose-finding vaccination studies ,150 confpol fidelity. Accordingly, any antiviral therapy that increases RNApol fidelity will restrict the generation of RNA quasispecies diversity, and as a consequence, antigenic diversity, thereby increasing the likelihood any particular viral polypeptide antigen will exceed the TIR, thus triggering an effective immunological response. Abrogation of normal Envwt:RNApol interactions and increased Envmt:RNApol interactions, as RH predicts will occur with IFN and ribavirin, will increase RNApol fidelity thus restricting antigenic diversity hence increasing the probability the TIR will be reached and immunological recognition and clearance of infected cells will occur. Empirically, if this explanation is correct, one would expect the genetic diversity of virus from patients responding to such treatments to decrease, while that from non-responsive patients to be unaffected or to increase, as has been confirmed [Obviously, one determinant of the concentration of viral antigens is viral load. However, and as previously discussed , the quaonfirmed .mt:RNApol interactions and increased RNApol fidelity will result. Similarly, if interferon either acts directly to abrogate Envwt:RNApol interactions, by binding either directly to NS5B, especially at the thumb domain, or to Env itself, especially to E2 as we suggested previously [mt:RNApol RME interactions, then increased Envmt:RNApol RME interactions, increased RNApol fidelity, restricted antigenic diversity and enhanced immune responses will result. Obviously, polymorphisms of the reactive sites of these secondary effector molecules might then explain the reduced effectiveness of interferon therapy in certain populations [wt:RNApol interactions by increasing mutations in Envwt protein RME, reducing their affinity for the RNApol RME, synergistic enhancement of the effect interferon has on these interactions would be expected.If, as has been demonstrated ,109,114,eviously , or if ieviously ,151 and/eviously , to abroulations ,120. FinReplicative homeostasis provides a rational mechanistic basis for the actions of both ribavirin and interferon that explains many phenomena observed during treatment of HCV, including the genotype-specific differences in response rates, and the adverse impact high pre-treatment viral load and quasispecies diversity has on treatment outcome. It also provides a rational explanation for other previously unexplained phenomena like rebound of HCV RNA levels seen during treatment with both interferon and ribavirin, and the transient increased viremia seen in some patients receiving ribavirin, and occasionally, interferon. Replicative homeostasis also suggests an explanation for the apparent immunostimulatory effects of ribavirin ides) and interferon, and thus, elucidates the enhanced phase 2 clearance of HCV RNA seen during treatment ribavirin. Ockham's razor would suggest this mechanism makes it unnecessary to postulate a direct immunostimulatory mechanism for ribavirin, other nucleosides or interferon , although we do not suggest such action(s) is/are excluded.pol interactions will probably be highly genotype-specific and, compared to nucleos(t)ide analogues, have relative lack of toxicity with a high therapeutic index. However, as a consequence of this specificity, their optimal use may require viral genotyping. Second, the reactions postulated to mediate RH result in profound inhibition of viral replication, at least initially during acute viral infection, making it likely therapies targeting this homeostatic function of viruses effectively will be extremely potent. Third, as discussed above, it is possible drugs or therapeutic vaccines that disrupt viral RH and reduce RNApol processivity and increase its fidelity, will restrict viral protein diversity and cause increased cellular expression of dominant viral epitopes beyond TIR, increasing the likelihood of an effective and neutralizing immune response and therefore the likelihood of permenant viral clearance. Fourth, and implicit in the above discussion, the nature of RH implies that the putative Env:RNApol RMEs must be highly conserved; any conformation other than this would result in the polymerase unable to recognise and distinguish between wild-type and mutant envelope motifs, rendering the virus unable to recognise, and respond to, deleterious unbalanced accumulation of excess mutant or wild-type virus, as we have suggested previously [It is worth considering the likely characteristics of the envelope-polymerase interactions postulated to mediate RH and their implications for drug therapy. First, by definition, RH is a mechanism by which, in part, viral genotype is maintained by genotype-specific envelope-polymerase interactions. These interactions, therefore, will be virus genotype and probably virus sub-species-specific, hence therapeutic vaccines and other ligands capable of interaction with the viral polymerase and/or envelope at their RMEs and disrupting normal Env:RNAeviously . It is t"}
+{"text": "This study aimed at investigating a potential effect caused by coccidia on the immune response to vaccine- and very virulent infectious bursal disase virus (vvIBDV) in SPF chickens.Two groups of three weeks old SPF chickens were vaccinated prior to inoculation with coccidia and challenge with virulent IBDV, all within a period of eight days. Two control groups were similarly treated, except that challenge with field virus was omitted in one group while inoculation with coccidia was omitted in the other group. Clinical signs, lesions in the intestines caused by coccidia, lesions in the bursa of Fabricius caused by IBDV, IBDV-antibody titres, and virus detection by reverse transcription polymerase chain reaction (RT-PCR) were compared among the groups. Lymphoid tissues and swab samples were analysed by general RT-PCR, and positive results were identified by strain specific duplex (DPX) RT-PCR.In the tripple-infected groups, vaccine strain IBDV was detected in spleen and thymus tissues, and no field virus was detected in bursa samples, contrary to the double-infected groups.The results suggest an enhancing effect on the immune response caused by subclinical coccidiosis and vvIBDV acting in concert. Gumboro disease, subsequently named infectious bursal disease (IBD) is a disease in young chickens caused by infectious bursal disease virus (IBDV), a double stranded, bi-segmented RNA virus . Two serSalmonella [E. tenella [Infection with virulent IBDV in three to six weeks old chickens causes high morbidity and mortality, followed by immunosuppression in surviving chickens . Exposurlmonella , infectilmonella , Newcastlmonella  and E. t tenella ,14. HoweEimeria species are regarded as ubiquitous parasites in most poultry environments, colonizing chicken guts after oral uptake of sporulated oocysts. Coccidial infections are traditionally controlled by coccidiostats in the feed. However, in Denmark whole wheat is gradually added to the feed, and from the age of three weeks and until processing, 25\u201330% of the broiler feed may be substituted by wheat. The concentration of coccidiostats decreases proportionally, increasing the risk of subclinical coccidiosis. E. tenella mainly replicates in the epithelium of the cecae, but developing stages of E. tenella have been found in the bursa of Fabricius [et al. [Problems due to IBDV outbreaks have been reported from Denmark  and seveabricius , also inabricius . Developabricius , while pabricius , also deabricius . Indeed, [et al.  have repParameters investigated and compared included clinical signs, pathological lesions in the intestines and in the bursa of Fabricius, seroconversion, and presence of viral RNA in lymphoid tissues and bursal swab samples.SPF eggs from Lohmann Tierzucht  were hatched under laboratory conditions, and chickens were reared as described previously . The metVirus strains used included the commercially available IBD vaccine strain D78 and the virulent strain DK01, previously described .E. tenella oocysts from a Swedish field outbreak were kindly provided by Dr. P. Thebo, S.V.A., Uppsala. The oocysts were sporulated and kept in 2% potassium dichromate solution at 12\u00b0C [E. tenella oocysts per ml and approximately 10 E. acervulina oocysts per ml, as estimated by counting in a McMaster chamber under a microscope. The dose of sporulated oocysts was adjusted to infect the birds without causing mortality [E. tenella oocysts were given orally in the following doses, 0, 150, 1500 and 15 000. The chickens were euthanised seven days after inoculation, and autopsy was performed immediately to evaluate the degree of coccidial infection. Lesion score results, evaluated as described under detection of coccidia, were as follows: 0,0,0; 0,0,0; 3,2,2 and 3,3,3. From these results it was decided to inoculate three experimental groups with 1500 sporulated oocysts each, in order to mimic subclinical coccidiosis. at 12\u00b0C . The solortality . The optJohnson & Reid [E. tenella, 0 = no gross lesions, 1 = few scattered petechiae on the cecal wall, normal cecal wall and contents, 2 = more numerous petechiae, cecal wall somewhat thickened, blood present in cecal contents, 3 = coalescent petechiae, cecal walls greatly thickened, much blood and fibrin cloths in cecal contents, 4 = Cecal walls greatly swollen and thickened, distended with blood or caseous clots. Concerning E. acervulina, 0 = no gross lesions, 1 = few elongated white patches in the duodenal wall in a ladder-like aspect, normal intestinal wall and contents, 2 = numerous white patches in the duodenal wall, normal intestinal wall and contents, 3 = coalescent lesions in the entire duodenum, thickened intestinal wall, contents watery and slimy, 4 = completely coalescent lesions, greyish mucosa, greatly thickened intestinal wall, mucoid contents.The intestinal tract was removed immediately after death and examined macroscopically under strong light. Lesion scores were evaluated according to n & Reid . ConcernIn addition, a smear was prepared from duodenum, jejunum and cecum in order to confirm the presence of coccidia by examination directly under light microscope.Bursa tissues were fixed in 4% formaldehyde overnight, embedded in paraffin wax and cut in 2 \u03bc sections, mounted on Super Frost Plus slides and stained with hematoxylin and eosin (HE) .Lesions observed in bursa tissues were quantitatively transformed. Bursa samples showing no lesions were assigned a value of 0, lesions involving between one and 25% of the follicles was assigned a value of 1, 26 to 50% was assigned a value of 2, 51 to 75% was assigned a value of 3, and 76 to 100% affected follicles was assigned a value of 4.Serum samples were stored at -20\u00b0C until analysed. The Infectious Bursal disease Antibody Test Kit 113 from BioChek B.V.  was used as recommended by the manufacturer. Microsoft Exel was used for calculating the IBDV ELISA titres according to instructions from the manufacturer. Microsoft Excel was also used for calculation of average titres within groups including standard deviations, graphically illustrated.RNA extraction and the RT-PCRs were performed as previously described ,26.Four groups 1\u20134), including 23, 24, 23 and 23 chickens respectively were vaccinated as recommended  with strain D78 at the age of 21 days. At the age of 24 days, chickens in groups 1, 3 and 4 were inoculated orally with 1500 sporulated oocysts each. Feed was withdrawn four hours before inoculation to facilitate the flow of the oocysts into the gut. Then, 0.225 ml of the solution of sporulated oocysts was diluted in 5.775 ml tap water, and 0.2 ml of this mixture was inoculated into each chicken orally. Groups 2, 3 and 4 were subsequently challenged with vvIBDV at the age of 28 days  on day 31, seven days after inoculation, and at the same time numerous unsporulated oocysts, corresponding in morphology and size to E. tenella were not observed in any tissue samples from the bursa of Fabricius.Developmental forms of Gross pathological changes due to IBDV were only related to the bursa of Fabricius. Randomly occurring slight enlargements of the bursa were observed on day 28, one week after vaccination. Microscopic lesions were observed in all bursa tissue samples except one from a 38-days old chicken from group 5. The vaccine strain initially caused lymphocyte depletion, interstitial oedema and folding of follicular epithelium. After challenge with DK01, lymphocyte depletion became more pronounced, as vacuoles and necrotic cells were observed in the follicular medulla, and the structure of the follicles was dissolved. Bursa lesions observed in groups 3 and 4 included a larger part of the bursa tissue than the lesions observed in groups 1 and 2 on days 28 or 29. The lesion score decreased with time after 30 days in group 1, while the lesion scores in groups 2, 3 and 4 either remained high or increased after challenge with field virus on day 28 .In group 1, viral RNA identified as D78 was found in bursa tissues only, 96% of these samples being positive Table . In grouTwo days after inoculation with bursa extract, the eleven bursa-inoculated chickens were clinically ill and consequently euthanized. Autopsy revealed swollen bursa of Fabricius and petechial muscular bleedings. DPX RT-PCR using tissue from the bursa of Fabricius detected both D78 and DK01 in all bursa samples (data not shown).E. tenella as previously reported [Although clinical symptoms were not observed, lesion scores and microscopy documented subclinical coccidiosis in groups 1, 3 and 4 two days after the chickens in groups 3 and 4 were challenged with field virus. From the same day, unprotected chickens would be expected to show clinical IBD symptoms . The prereported  could beBursa lesion scores were more severe for groups 3 and 4 than for group 2, except for group 4 on day 30 and both groups on days 38 and 44. The presence of coccidia might have aggravated the development of lesions in the bursa caused by IBDV. As the number of samples in each age group was too small for reliable statistical evaluation of results, further investigations are needed for documentation of a potential influence of coccidia on bursa lesions caused by IBDV.Serology was used only in order to confirm, that all chickens had seroconverted. Titre values were not further interpreted, as this would require investigations into the technical performance of the ELISA-kit used, falling outside the scope of this work .Zhang et al. [p.i. We speculated that this could indicate that vaccine strains generalize and replicate continuously in various lymphoid tissues, but at a lower level than in the bursa, and thus mostly undetectable by our current methods, until replication was enhanced in groups 3 and 4. As enhanced replication in the spleen and thymus was not recorded in groups 1 and 2, the present reaction seemed to depend on a concurrent stimulation of both coccidia and vvIBDV. Rautenschlein et al. [D78 was detected in spleen and thymus tissues from groups 3 and 4 but not from group 2, indicating that the presence of coccidia may have influenced the distribution of vaccine strain RNA. However, this theory was impaired by the lack of D78 in the spleen and thymus tissues from group 1. g et al.  detectedn et al.  suggesten et al. . The sigIn conclusion, coccidia did not seem to affect IBDV vaccination in chickens negatively. On the contrary, our results suggested an additive effect of concurrent stimulation of the immune system by subclinical coccidiosis and vvIBDV, enhancing the replication and distribution of the vaccine strain in chicken lymphoid tissues. Assuming that replication of and presence of vaccine virus in extra-bursal lymphoid tissues mediates improved protection, our experiment indicated that coccidia contributed to an improved immune response following IBDV vaccination. The perspectives of these conclusions might be a possibility of benefiting from an enhancing immunological effect of concurrent, controlled viral and parasitic infections. Further research into immunological consequences of complex infections in chickens is highly relevant.The author(s) declare that they have no competing interests.SK designed and carried out the experiments and drafted the manuscriptKJH supervised and adjusted laboratory processesMB conceived of the study and participated in drafting the manuscriptAll authors read and approved the final manuscript"}
+{"text": "The RNA-dependent RNA polymerase of Influenza A virus is a determinant of viral pathogenicity and host range that is responsible for transcribing and replicating the negative sense segmented viral genome (vRNA). Transcription produces capped and polyadenylated mRNAs whereas genome replication involves the synthesis of an alternative plus-sense transcript (cRNA) with unmodified termini that is copied back to vRNA. Viral mRNA transcription predominates at early stages of viral infection, while later, negative sense genome replication is favoured. However, the \"switch\" that regulates the transition from transcription to replication is poorly understood.in vivo and in confirmation of this, in vitro binding assays showed that temperature increased the rate of dissociation of polymerase from both positive and negative sense promoters. However, the interaction of polymerase with the cRNA promoter was particularly heat labile, showing rapid dissociation even at 37\u00b0C. This suggested that vRNA synthesis fails at elevated temperatures because the polymerase does not bind the promoter. In support of this hypothesis, a mutant cRNA promoter with vRNA-like sequence elements supported vRNA synthesis at higher temperatures than the wild-type promoter.We show that temperature strongly affects the balance between plus and minus-sense RNA synthesis with high temperature causing a large decrease in vRNA accumulation, a moderate decrease in cRNA levels but (depending on genome segment) either increased or unchanged levels of mRNA. We found no evidence implicating cellular heat shock protein activity in this effect despite the known association of hsp70 and hsp90 with viral polymerase components. Temperature-shift experiments indicated that polymerase synthesised at 41\u00b0C maintained transcriptional activity even though genome replication failed. Reduced polymerase association with viral RNA was seen The differential stability of negative and positive sense polymerase-promoter complexes explains why high temperature favours transcription over replication and has implications for the control of viral RNA synthesis at physiological temperatures. Furthermore, given the different body temperatures of birds and man, these finding suggest molecular hypotheses for how polymerase function may affect host range. The genome of influenza A virus consists of eight single-stranded, negative-sense genomic RNA (vRNA) segments, associated with nucleoprotein (NP) and the viral polymerase complex PB1, PB2 and PA) in the form of ribonucleoprotein complexes (RNP)  and PA i. The firThe temporal pattern of RNA production is well established -15. The Understanding the determinants of species tropism for influenza virus has never been more important than it is now, with the concern about the potential of avian H5N1 virus to adapt to human hosts. While tropism is a multifaceted and complex process, it has long been hypothesized that something as simple as the temperature at the site of replication could influence the host and tissue tropism of the virus -33. HumaTo test the influence of incubation temperature on viral RNA synthesis in the context of virus infection, cells were inoculated with influenza A/PR/8/34 (PR8) virus and incubated at different temperatures. Infected cell lysates were harvested every two hours until eight hours post-infection (h.p.i.), and total cellular RNA was isolated. Reverse transcriptase primer extension analysis using two oligonucleotides to simultaneously detect m-, c- and vRNA  was cond35S-methionine labelling. Time course analyses of infected cells showed similar patterns of viral protein synthesis at 37\u00b0C and 41\u00b0C  synthesis and activity plays an important role in the cellular response to stress conditions, such as high temperature ,43. SeveFirst, to test for a correlation between hsp induction and the decrease in viral RNA replication, 293T cells were heated at 41\u00b0C for 4 hours to induce hsp synthesis, infected with influenza virus and incubated at 37\u00b0C for a further 5 hours. Western blotting confirmed that both hsp70 and hsp90 synthesis were induced by incubation at 41\u00b0C and that the same high levels were maintained for at least another 5 hours at 37\u00b0C . Non-preheated cells were also infected and incubated at either 37\u00b0C or 41\u00b0C for 5 hours as controls. Total cellular RNA was isolated and primer extensions performed to analyse viral RNA synthesis from segments 2, 5 and 7. As previously observed, when cells were infected and incubated at 41\u00b0C for 5 hours, vRNA accumulation was reduced compared to 37\u00b0C Fig. . SimilarAlthough hsp induction does not down-regulate vRNA synthesis at 37\u00b0C, a temperature-dependent activity of hsps could be involved. For example, during heat shock hsp90 oligomerizes with the possible activation of functions that are normally silent at physiological temperature . To testNext, geldanamycin was used to interfere with hsp90 function. Hsp90 participates in two multichaperone complexes with opposing activities depending on the co-chaperone proteins attached to it. In one conformation the hsp90 complex binds to and stabilizes its client proteins, in the other, it promotes client protein ubiquitination and degradation by the proteasome. Geldanamycin binds to hsp90 and forces it to adopt the conformation that favours proteasome-targeting and prevents the stabilization function . 293T ceThus, at 41\u00b0C viral genome replication cannot be rescued by inhibiting hsp70 synthesis or hsp90 chaperone function, providing no support for the hypothesis that either of these cellular proteins is responsible for down-regulation of vRNA synthesis at high temperature, despite their known interactions with RNP components.A previous study suggested that RNP formation in infected cells was not impaired at 41\u00b0C on the basis of the glycerol density gradient centrifugation profile of NP . AlthougPrior work has shown that in vitro, ApG primed transcriptional activity of the polymerase is unstable at 40\u00b0C in the absence of vRNA . As our Given our observations of heat stable transcriptionally active polymerase and near normal accumulation of plus-sense RNA species coupled with a specific defect in vRNA synthesis, we hypothesised that the interaction of polymerase with its cRNA template might be particularly temperature sensitive ,53. The To further analyse this hypothesis, we tested whether mutations in the cRNA promoter that render it more vRNA-like would rescue normal viral genome replication at high temperature. For this, we utilised two mutants in which either the 5'-end (3'U-8'A) or the 3'-end (3G-8C) of the cRNA promoter was altered . 293T ceHere, we show that temperature dramatically affects the balance between transcription and replication of the influenza virus genome, with high temperature in particular favouring mRNA production over vRNA synthesis Figs.  and 2. TTwo observations relating to the effects of hsps on virus replication are worthy of further comment. Firstly, while previous observations ,49 regarAlthough temperature sensitive interactions with cellular components other than hsp proteins cannot be ruled out it is appropriate to consider explanations for the loss of vRNA synthesis at high temperature that are intrinsic to the viral components themselves. Temperature-shift cycloheximide block experiments showed that the key determinant that lead to a failure of vRNA synthesis was high temperature during RNA synthesis, and not during polymerase translation, and that polymerase synthesised at 41\u00b0C retained the ability to synthesise mRNA at 37\u00b0C and 41\u00b0C Fig. . Further10 effect of the higher temperature but may also result from loss of normal regulatory patterns (such as nuclear export of vRNA) during viral transcription. Consistent with the latter possibility, previous studies have noted substantial levels of mRNA transcription from a limited number of input vRNA templates when genome replication is blocked by cycloheximide ATP as previously described  GTP and the binding assay protocol have been described previously [5 cpm of labelled probe (5'3'v or 5'3'c) were incubated with 30 \u03bcg of Vac 3P extract for 10 min at 22\u00b0C to allow the polymerase to bind to the RNA. Heparin was then added to a final concentration of 5 mg/ml, sufficient to inhibit all subsequent binding of the polymerase and displace non-specific RNA binding of other proteins in the extract. The binding reactions were then aliquoted into 12 separate tubes and incubated at either 31\u00b0C, 37\u00b0C or 41\u00b0C. At regular intervals, one tube from each temperature was removed and placed on ice until the completion of the time course. The samples were then analysed by non-denaturing electrophoresis and autoradiography as described previously [The preparation of RNA transcripts labelled internally with [\u03b1-eviously . 150 \u03bcl eviously .The author(s) declare that they have no competing interests.RMD performed the majority of the experiments, analysed the results and drafted the manuscript. AEM performed some of the transfection experiments. MJA designed and validated aspects of the primer extension assay. EM generated some of the antibodies used and provided technical assistance. LT performed the band-shift experiments and helped in analysing the results. PD oversaw the project design and completion, provided the resources, aided in analysing the results and helped write the manuscript. All authors read and approved the final manuscript."}
+{"text": "Hepatitis B virus (HBV) infection results in complications such as cirrhosis and hepatocellular carcinoma. Suppressing viral replication in chronic HBV carriers is an effective approach to controlling disease progression. Although antiviral compounds are available, we aimed to identify host factors that have a significant effect on viral replication efficiency.We studied a group of hepatitis B carriers by associating serum viral load with their respective HBV genomes, and observed a significant association between high patient serum viral load with a natural sequence variant within the HBV enhancer II (Enh II) regulatory region at position 1752. Using a viral fragment as an affinity binding probe, we isolated a host DNA-binding protein belonging to the class of heterogeneous nuclear ribonucleoproteins\u2014hnRNP K\u2014that binds to and modulates the replicative efficiency of HBV. In cell transfection studies, overexpression of hnRNP K augmented HBV replication, while gene silencing of endogenous hnRNP K carried out by small interfering RNAs resulted in a significant reduction of HBV viral load.The evidence presented in this study describes a wider role for hnRNP K beyond maintenance of host cellular functions and may represent a novel target for pharmacologic intervention of HBV replication. A host protein -hnRNP K- may have a crucial role in determining how well the Hepatitis B virus replicates in humans. Hepatitis B virus (HBV) infection is a serious public health problem in many parts of Asia and Africa that results in complications such as cirrhosis and cancer of the liver . GloballHepadnaviridae and encodes only four genes in a highly compact viral genome: the surface gene (S), the core gene (C), the X gene (X), and the polymerase gene (P). Viral replication has been shown to occur via an RNA intermediate in the cytoplasm, but, unlike retroviruses, integration of HBV DNA into the host genome is not required. Despite a wealth of information on the virus itself and the possible role that host factors may play in the viral infectious life cycle  buffer [pH 7.9], 1.5 mM magnesium chloride, 10 mM potassium chloride, and 1 mM dithiothreitol [DTT]). After centrifugation at 1,000 rpm for 3 min at 4 \u00b0C, cells were re-suspended in 2\u00d7 original packed cell volume of Buffer A and homogenized in a Dounce homogenizer with an S pestle with 10 strokes. Nuclei fractions were sedimented by a 10-min centrifugation at 2,500 rpm, re-suspended in 1.5\u00d7 Buffer B  and treated with another 10 strokes of Dounce homogenizer. Cell suspensions were then transferred to microcentrifuge tubes and incubated for 30 min at 4 \u00b0C with gentle rotation. Nuclear debris was removed by centrifugation at 13,000 rpm for 40 min at 4 \u00b0C. The supernatant was dialyzed for 4 h against two changes of 200 ml Buffer C  at 4 \u00b0C. After dialysis, nuclear extracts were clarified by centrifugation at 13,000 rpm for 20 min. Nuclear extracts were then aliquoted and stored at \u221280 \u00b0C. Protein concentration was quantitated with the Protein Assay kit  using acetylated bovine serum albumin as standard.Cultures were trypsinized, rinsed twice with ice-cold 1\u00d7 phosphate-buffered saline, and incubated on ice for 10 min with 5\u00d7 original packed cell volume of Buffer A (10 mM 32P-dATP end-labeled probe (1 \u00d7 104 to 1 \u00d7 105 cpm). Free DNA and DNA\u2013protein complexes were resolved on 6% non-denaturing polyacrylamide gels. Gels were dried down under vacuum at 80 \u00b0C for 1 h before exposure to X-ray film  at \u221280 \u00b0C. The sequences of the oligonucleotide probes (nucleotide changes are indicated) were:Binding reaction procedures were performed at 37 \u00b0C for 20 min in 20-\u03bcl reaction mixtures  containing 10 \u03bcg of HepG2 nuclear extracts, 0.1\u20130.2 \u03bcg of non-specific competitor DNA poly (dI\u2013dC) , and Probe 1,AGACTGTGTGTTTAATGAGTGGGAGGAG;Probe 2,AGTTGGGGGAGGAGATTAGGTTAAAGGT;Probe 3,AGACTGTGTGTTTAATGCGTGGGAGGAG;and Probe 4,AGTTGGGGGAGGAGGTTAGGTTAAAGGT.Nuclear protein extracts were obtained from HepG2 cells. HepG2 cells were harvested and rinsed twice with ice-cold Buffer A (0.15 M sodium chloride and 10 mM HEPES [pH 7.4]), and incubated on ice for 15 min with 5\u00d7 original packed cell volume of Buffer B . After centrifugation at 3,000 rpm for 5 min at 4 \u00b0C, the pellet was washed once with Buffer B and re-suspended gently on ice with 200 \u03bcl of Buffer C (0.45 M sodium chloride and 10 mM HEPES [pH 7.4]), with protease inhibitor cocktail [Sigma P8340]). The cell mixture was incubated for 15 min with gentle agitation followed by centrifugation at 13,000 rpm for 5 min. The supernatant was saved for DNA-binding proteins assay. Annealing of double-stranded oligonucleotides probes was done using 100 \u03bcl of deionized Milli Q water containing 1 nmol each of antisense probe and sense probe, which were labeled with biotin at the 3\u2032 end, and 5\u2032 end, respectively. Oligonucleotide mixture solutions were heated at 95 \u00b0C for 5 min and cooled slowly to room temperature. DNA-interacting proteins were captured as described. The oligonucleotide mixture was incubated with 5 mg Dynabeads M-280 streptavidin  at room temperature for 15 min in binding and washing buffer . The magnetic beads were then washed with binding and washing buffer and equilibrated with TGED buffer . 40 \u03bcg of extracted nuclear proteins was mixed 2:1 (w/w) with non-specific competitor DNA poly (dI\u2013dC) , and adjusted to 500 \u03bcl with TGED buffer. Nuclear proteins\u2013poly (dI\u2013dC) solution was added to the equilibrated magnetic beads\u2013oligonucleotide probe at room temperature for 30 min. Unbound proteins were washed out with TGED buffer. Bound proteins were eluted with TGED buffer with 1 M sodium chloride. The same capturing and elution procedure was repeated another four times with new aliquots of nuclear proteins\u2013poly (dI\u2013dC) mixture. Eluted fractions were pooled and subjected to acetone precipitation. We performed 2-D gel electrophoresis according to the Amersham Biosciences protocol, with some modifications. Each sample containing acetone-precipitated proteins was made up to a volume of 350 \u03bcl with rehydration buffer . The mixture was mixed briefly by vortexing, and centrifuged at 13,000 rpm for 10 min. The supernatant was loaded to 18 cm (pH 3\u201310) nonlinear Immobiline DryStrips (Amersham Pharmacia Biotech), and rehydration was carried out actively at constant voltage (50 V) overnight. Isoelectric focusing was performed using IPGphor (Amersham Biosciences) at 20 \u00b0C in stepwise mode. Briefly, strips were focused at 500 V for 1 h, 2,000 V for 1 h, 5,000 V for 1 h, and 8,000 V for 12 h, with a total of 90 kVh accumulated. After isoelectric focusing, the IPG strips were incubated for 30 min in 15 ml of SDS equilibration buffer , followed by second incubation with the same buffer for 30 min with iodoacetamide (375 mg/15 ml) instead of DTT. 2-D vertical SDS-PAGE  was carried out using 10% gels at a constant voltage of 150 V for 6\u20138 h at 15 \u00b0C. Gels were stained with SilverQuest Silver Staining Kit (Invitrogen). Specific protein spots were cored out and de-stained according to manufacturer's instructions, after which the gel plug was dried and MS/MS analysis carried out by Proteomic Research Services .Samples were subjected to trypsin digestion on a ProGest  workstation as follows: Gel plugs were soaked in ammonium bicarbonate solution and reduced with DTT. Alkylation was performed by using iodoacetamide. Samples were incubated at 37 \u00b0C overnight in the presence of trypsin. Formic acid was added to stop the reaction.Liquid chromatography/tandem mass spectrometry (LC/MS/MS) analyses: Peptides were cleaned up by using C18 ZipTips  and eluted with matrix (\u03b1-cyano-4-hydroxycinnamic acid) prepared in 60% acetonitrile and 0.2% TFA. 15 \u03bcl of eluent was processed on a 75-\u03bcm C18 column at a flow-rate of 20 nl/min. Eluent from the C18 column was fed into nano-LC/MS/MS on a Micromass Q-TOF2 mass spectrometer. MS/MS data were searched using a local copy of MASCOT search engine .Small interfering RNA (siRNA) duplexes against hnRNP K were purchased from Dharmacon (SmartPool) , Qiagen (sequence:GCAGUAUUCUGGAAAGUUU), and Proligo (sequence: CUUGGGACUCUGCAAUAGATT) . HepG2 cells were co-transfected in 24-well tissue culture plates with 1 \u03bcg of plasmid DNA (1752A replicative full-length clone) and the respective siRNA duplexes (2 \u03bcg) using 6 \u03bcl Lipofectamine 2000 (Invitrogen). After 48 h, the cells were collected and were RNA and DNA extracted. As controls, cells were also transfected with fluorescence-labeled non-silencing siRNA to monitor the transfection efficiencies. Transfections were performed in duplicate.260 and A280, and adjusted to 250 ng/\u03bcl, which was then used as a template for real-time RT-PCR. 2 \u03bcl of RNA was used in a one-step real-time RT-PCR reaction with the LightCycler RNA Master SYBR Green kit (Roche) using primers 5\u2032-AGACCGTTACGACGGCATGGT-3\u2032 and 5\u2032-GATCGAAGCTCCCGACTCATG-3\u2032, and performed according to manufacturer's instructions. Absolute quantitation of RNA was obtained by using standard curves created with in vitro\u2013transcribed RNA by the T7 RiboMax Express in vitro transcription system (Promega). The concentration of purified transcribed RNA was measured by RiboGreen RNA quantitation reagent (Invitrogen). Serial dilutions of in vitro\u2013transcribed RNA were prepared in duplicate.Total RNA was isolated with RNeasy kit (Qiagen) according to the manufacturer's instructions. The concentration and purity of extracted RNA were determined by measuring the AA multi-alignment sequence analysis of the HBV genomes with ranked HBV viral load was first performed, and we compared the frequencies of the mutations at nucleotide position 1752 using Fisher's exact probability test.p = 0.0001) with viral load as defined by the two broadly partitioned groups of serum viral load described above (using 10 pg/ml as an arbitrary cut-off). As there was no particular physiological phenotype linked to a threshold HBV viral load, we also applied cut-off values of 20 pg/ml and 50 pg/ml; in both instances, the results were similar to the 10-pg/ml value (data not shown). Although the HBV genotypes were predominantly genotype C, we observed a distinct tendency for carriers with high levels of serum HBV DNA to possess an A nucleotide at position 1752 of the virus sequence, while those with low levels of serum HBV DNA tend to have a G nucleotide at this position. This natural variation at nucleotide position 1752 was found to be located at the HBV genome's Enh II region, which has been shown to be a specific regulator of HBV replication [To study the influence of HBV variants on the resultant dynamics of viremia in HBV carriers, we analyzed serum samples from 60 carriers for viral load using a commercially available test kit (Digene). The serum viral load among HBV carriers  was founlication ,11,19,20cis, resulting in higher levels of luciferase expression as compared to all other base substitutions . Bound material was eluted and subjected to 2-D gel analysis. Silver staining of the gels demonstrated positive enrichment of a specific DNA-binding protein compared with the non-specific binding control oligonucleotide probe B. The spTo demonstrate the functional connection of hnRNP K to the regulation of HBV viral load, a 1.4-kb RT-PCR fragment coding for the full-length hnRNP K gene from total RNA extracted from HepG2 cells was cloned into the mammalian expression vector pcDNA 3.1 (Invitrogen). There are two known variants of hnRNP K, termed \u201cvariant 2\u201d and \u201cvariant 3,\u201d which differ only at the last six amino acid residues of the C-terminal region. As there are no reported studies on the functional difference between the two variants, we decided to work with both variants. The two hnRNP K expression constructs were co-transfected separately into HepG2, together with a full-length 1752A replicative clone of HBV driven by the HBV core promoter rather than the CMV promoter ,15 see  to deterAs a further critical proof of the regulatory role of hnRNP K in HBV viral load, the converse experiments to knock down hnRNP K should show a suppressive effect on viral load. To do this, siRNAs against hnRNP K were designed and obtained from three separate manufacturers. HepG2 cells were co-transfected with the replicative HBV full-length clone (1752A) together with the panel of hnRNP K siRNAs, and mRNA and DNA were analyzed 48 h after siRNA transfection. Non-silencing siRNA not matching to any genes and lamin A/C siRNAs were used as controls. The resultant hnRNP K mRNA levels as measured by quantitative real-time RT-PCR showed a 30% reduction relative to the non-transfected cells, non-silencing siRNA, and lamin A/C siRNA controls A. HBV viIn this study, we were able to show that a host protein\u2014hnRNP K\u2014can be isolated by direct binding to a viral fragment derived from the HBV variant of the infected patient, and that hnRNP K binds to and modulates the replicative efficiency of HBV at a precise location at the Enh II regulatory region. Overexpression studies and RNA interference studies show a direct demonstration of the dependence of HBV on a host factor to modulate its replication efficiency, and hold promise as a new class of targets for the intervention of chronic hepatitis B infection.The interesting observation that chronic HBV carriers have different serum viral loads spanning three logs (0.1\u2013376 pg/ml in this study) between patients prompted us to investigate the possible correlation with viral genotype. While no such particular relationship emerged, we detected a solitary yet distinct natural mutation at nucleotide position 1752 that had an \u201cA\u201d that segregated with viral loads greater than 10 pg/ml, while those with \u201cG\u201d segregated with the samples of lower than 10 pg/ml. Of the 60 HBV genomes sequenced, only one sample showed a \u201cT\u201d at position 1752, while \u201cA\u201d and \u201cG\u201d variants were present in almost equal proportions. No natural \u201cC\u201d variant was seen, but this could be due to our limited sample size or an effect related to geographical distribution patterns.myc promoter [src and vav [.To understand whether the natural variants at 1752 had any functional impact, we developed reporter constructs and tested all four possible 1752 variants for the ability to drive reporter gene transcription. It was evident that 1752A had higher activity than the three other non-A constructs. To investigate the underlying basis for this enhanced transcriptional activity, we proposed to search for evidence of possible physical interaction with DNA-binding proteins. Using an initial electrophoretic mobility shift assay followed by an affinity pull-down assay run on 2-D gel analysis, a 1752A oligonucleotide-affinity fragment was able to enrich a host binding factor sufficient for protein sequencing. The binding factor turned out to be hnRNP K, a known protein that has been shown to be involved in a number of cellular functions ,13. It hpromoter \u201330. hnRN and vav ,24,31,32An important next step was to show that hnRNP K acts on a full-length HBV genome and not just the 131-bp enhancer fragment that was tested earlier in the luciferase reporter assay. To this end, we constructed four full-length replicative HBV clones, which were identical except for a single base change at position 1752. Each replicative clone variant was co-transfected with two different hnRNP K expression constructs that represent the two known hnRNP K variants, differing only at the C-terminal end of six amino acids. The results once again confirmed that the 1752A was more efficient than the other three variants, while there was no significant difference between either variant of hnRNP K in enhancing viral load. With escalating doses of hnRNP K, the viral load of the 1752G, 1752T, and 1752C variants increased in a dose-dependent manner. This suggests that the increased cellular concentrations of hnRNP K compensated to some degree for the reduced affinity bought about by the nucleotide substitutions.In order to further demonstrate the role of hnRNP K in HBV replication, we wanted to test not only over-expression but also whether down-regulation of the cellular protein could have an effect. siRNAs designed to knock down endogenous hnRNP K were able to suppress both hnRNP K mRNA, and, along with it, the HBV viral load was greatly reduced. More importantly, the inclusion of control siRNA to lamin A/C suppressed lamin A/C mRNA but had no effect on HBV viral load, thus strengthening the link between hnRNP K and HBV.The mechanistic aspect of hnRNP K on HBV replication needs to be further explored, and efforts are currently under way. There are possibilities such as hnRNP K polymorphisms  see Fig, phosphoOur study shows that the overall viral replication efficiency is determined by a combination of both viral sequence and interaction with specific host proteins. While development of antivirals is an established path, targeting the host remains surprisingly unexplored. Interestingly, a recent study on anti-EGFR antibody treatment of breast cancer cells showed a decrease in the cell-replication rate with a corresponding reduction in hnRNP K expression levels . This suFigure S1(53 KB PDF)Click here for additional data file.Figure S2(59 KB PDF)Click here for additional data file.Hepatitis B is a virus that can cause long-term health problems, including cirrhosis of the liver and liver cancer in people who are not able to clear the virus from their body. Although some drugs can suppress the multiplication of the virus, these drugs do not cure the patient of hepatitis B. Another way of tackling the virus might become clear if it were known exactly how the virus interacts with the patient's cells.They noticed that among patients who carried the hepatitis B virus (HBV), some had higher amounts of the virus in their blood compared to others. The patients with higher levels tended to have a virus that had one particular DNA type, and this particular virus type could bind more closely to a protein found in humans: hnRNP K. In the laboratory, when the investigators increased the amount of this protein in cells infected with HBV, the virus multiplied more; when they decreased it, the virus multiplied less.This work suggests that one way to control the multiplication of HBV in infected people is indirectly, by altering levels of the protein hnRNP K. The next step will be to identify ways to do this safely and reliably.Medline Plus has a section on hepatitis B:http://www.nlm.nih.gov/medlineplus/ency/article/000279.htmThe World Health Organization has a set of information on hepatitis, including hepatitis B:http://www.who.int/topics/hepatitis/en/"}
+{"text": "However, conclusive in vivo control of a challenge inoculation of SIVmac239 was not observed suggesting that CTL epitopes within densely overlapping reading frames are also subject to escape mutations.CTL based vaccine strategies in the macaque model of AIDS have shown promise in slowing the progression to disease. However, rapid CTL escape viruses can emerge rendering such vaccination useless. We hypothesized that such escape is made more difficult if the immunizing CTL epitope falls within a region of the virus that has a high density of overlapping reading frames which encode several viral proteins. To test this hypothesis, we immunized macaques using a peptide-loaded dendritic cell approach employing epitopes in the second coding exon of SIV Tat which spans reading frames for both Env and Rev. We report here that autologous dendritic cells, loaded with SIV peptides from Tat, Rev, and Env, induced a distinct cellular immune response measurable  Several recent HIV vaccine strategies have focused on the induction of potent cellular immune responses . Experimin vivo suggesting that these mutated viruses do not have significantly reduced viral fitness [Most vaccines have used whole viral proteins, delivered in a variety of ways, as immunogens. While some of these proteins in the context of particular major histocompatibility (MHC) antigen alleles show immunodominant epitopes in macaques ,4, a gen fitness . HoweverSince CTL based vaccines reduce, but do not eliminate replication, it is expected that they will select for the emergence of escape viral mutants. For a CTL based vaccine to be durably effective, ideally, the target epitope(s) must be critical for function and be constrained such that any change in epitope sequence results in a significant deficit in the replicative fitness of the virus. Thus, in an operational definition, an \"immutable\" CTL epitope is one which may mutate in response to immune selection, but such mutations are transient and may never be observed because of their significantly deleterious effect on viral fitness.+ T-cell depletion. In the third animal, the viral load initially increased, but then returned to low levels. Further investigation revealed that this third animal, although originally infected with SIVtat1ex, transiently had the emergence of a SIVtat2ex virus which surprisingly reverted quickly back to the less fit SIVtat1ex form. This third macaque has maintained low viral load and high CD4+ T-cell count. Immunologic studies demonstrated that this animal had a strong cellular response directed to the second coding exon of SIV Tat. Provocatively, after 4 years of infection, this animal continued to maintain the low-fitness SIVtat1ex virus with no evidence for the ability of the more fit SIVtat2ex to emerge by correcting the stop codons which prevent the expression of the second coding exon of Tat. Our interpretation of this scenario in the context of our operational definition of an \"immutable CTL epitope\" is that SIVtat2ex is a transitional \"escape\" virus of SIVtat1ex; and that in certain settings SIVtat1ex virus cannot durably transit to its more fit SIVtat2ex form because the host maintains a potent CTL selection targeted against an epitope within the second coding exon of Tat.In a recent study, we explored the concept of such an immutable epitope . We infein vivo. Moreover, because the Rev and Env proteins are expressed from reading frames that overlap the second coding exon of Tat, we believe that such overlap might be an additional reason for the \"immutability\" of this region. Compatible with this notion is the fact that viral sequences in this region are remarkably well conserved  within this region is detrimental to viral replication d Figure . Becausein vivo. Peptide loaded dendritic cells have been used in cancer immunotherapy and in viral vaccine efforts to induce a cellular response against specific epitopes [The above hypothesis posits that mutations in a CTL-epitope(s) embedded within a portion of SIV that codes three overlapping proteins, Tat, Rev and Env, might be difficult. The notion is that such CTL-epitopes might be \"immutable\" because \"escape\" changes in their sequences could alter Tat, Rev, or Env function (singularly or multiply) in ways that produce less-fit progeny viruses epitopes ,8. To teTo assess the effectiveness of the dendritic cell culture protocol, we performed flow cytometry for the MDDC phenotype. After 8 days in culture, cells were stained for HLA-DR and CD83. Immature dendritic cells express relatively low levels of HLA-DR and are CD83 negative, whereas mature dendritic cells express higher levels of HLA-DR and are CD83 positive. Flow cytometry revealed that greater than 80% of the cultured MDDC possessed the mature phenotype (data not shown).Previously, others have shown that surface MHC molecules on dendritic cells bind soluble peptides or portions of them during tissue culture . After iin vitro culturing purposes, the peptides were arbitrarily divided into six pools (see Methods section): Tat A, Tat B, Rev A, Rev B, Env A, and Env B. Experimental animals  developed strong IFN-\u03b3 T-cell responses to all vaccinated peptide pools over the course of the six vaccinations  consistently had responses less than 50 SFC/106 PBMC to each pool  ELISpot assay. For s Figure . Responsl Figure .Six days following the final vaccination (Day 89 of the study), each animal was intravenously challenged with 50 infectious units of SIVmac239. Plasma viremia occurred in each animal and reached a peak by Day 14 post-infection. There were no discernible differences between the viral loads of the experimental animals and the control animals  had developed an A to G mutation at bp 8854 affecting Rev and Env, which quickly became the dominant species and that corresponded to a previously identified sub-optimal nucleotide in the SIVMac239 molecular clone . SeveralIn this study, we show that autologous dendritic cells, loaded with exogenous SIV peptides, can successfully induce cellular immune responses. These responses were moderate to strong, and, in general, increased with repeated immunization (data not shown). However, the vaccinated macaques seem not to effectively control the replication of a challenge virus, and inoculated animals developed viral loads similar to those of the control animals Fig. . Curioustrhcqpeka sequence, then in three of the four (75%) experimental animals  viruses have initiated evasive amino acid mutations. Correspondingly, in the Rev sequence, if a major CTL epitope resided in gpgtanqrr, then viruses in AT57 and BA20  would have started to change. A similar case could be made for Env. If the dominant epitope here is hypothesized as thiqqdpal, then three of the four viruses in vaccinated animals  have changed by day 28. It remains to be established whether our hypothesized epitopes are truly the dominant in vivo SIV moieties. However the observation that the originally detected CTL responses faded quickly after virus challenge is compatible with these being relevant epitopes. Viral escape changes in these epitopes are expected to result in failure to re-stimulate the original CTL and would be consistent with the waning CTL profiles in Figure How could one explain the above findings? We note with interest the sequencing results on virus samples isolated from infected animals on day 28 after challenge Figs.  &7. A clhe four 7% experima priori facile assumptions is probably incorrect. We had assumed that just because a region of the virus is ORF dense that such region would be functionally constrained and difficult to mutate. The empirical results do not support that assumption. For example, the \"k\" in the middle of the Rev sequence seems to be easily changeable; as is the \"r\" in the middle of Env  were obtained from the Tulane National Primate Research Center (TNPRC) . The six adult animals weighed between 6.15 to 10.25 kg, and were all seronegative for SIV. All aspects of this study were approved by the Tulane National Primate Research Center Institutional Animal Care and Use Committee.Six colony-bred rhesus macaques (nd exon (amino acids 98\u2013130). Eleven Rev and twelve Env peptides were selected because their coding sequences completely or partially overlapped Tat's second exon . Each was fifteen amino acids in length, and overlapped adjacent peptides by eleven residues. Nine peptides were selected which completely overlapped the second exon of SIVMac239 tat 27 PBMC per animal were thawed, washed in PBS, plated across a 6-well costar plate in DMEM with 10% FBS, and placed in a 37\u00b0C/5% CO2 to allow monocyte adherence. After three hours, the media and non-adherent cells were aspirated, and the plates washed twice with PBS. Media was replaced with DC media  and 10 ng/ml IL-4 (R&D Systems). Cells were allowed to differentiate for 4 days. On day 4 immature dendritic cells were aspirated from the plate and washed. Cells were resuspended in 5 ml DC maturation media ) in a T25 flask. Dendritic cells from experimental animals  received 5 \u03bcg/ml each of the Tat, Rev and Env peptides. After four additional days in culture, mature monocyte-derived dendritic cells (MDDC) were removed from culture flasks, brought to 10 ml with DC maturation media, counted, and transferred to a 15 ml conical tube for shipment to TNPRC. MDDC cultures were analyzed by flow cytometry on a FACS Calibur .Primary blood mononuclear cells (PBMC) were separated from heparin treated rhesus macaque blood by centrifugation over Ficoll , washed, and cryo-preserved until needed for generation of dendritic cells. For each vaccination, 2.5 \u00d7 106 mature autologous dendritic cells were resuspended in 0.2 ml PBS and injected into a femoral lymph node in each animal. Experimental animals  received MDDC generated in the presence of Tat, Rev and Env peptides. Control animals  were cultured in the absence of peptides.Six vaccinations were scheduled, at two-week intervals. Vaccination number five was delayed for two weeks, thus pushing back vaccinations number five and six. For each time point MDDC were generated as above and shipped overnight at room temperature to TNPRC. After centrifugation, 1 \u2013 2 \u00d7 1050/ml in DMEM and 1 ml was administered intravenously to all animals six days after the final vaccination.The challenge virus, a generous gift of David Watkins, University of Wisconsin, was SIVMac239(open) produced from transfected DNA and expanded in CEMx174 cells. Viral stock was diluted to 50 TCID5 PBMC per well, and 5 \u03bcg/ml of the peptide pool, in duplicate. Plates were incubated at 37\u00b0C in a CO2 incubator for 48 hours, washed, treated with a biotinylated anti-human IFN-\u03b3 (MabTech), and then developed using streptavidin-HRP (Pierce) and Stable DAB (Research Genetics). Spot forming cells (SFC) per million PBMC were determined by subtracting the average background value for each animal from the average of the duplicate wells and multiplying by five.IFN-\u03b3 ELISpot assay  was per+ T-cell concentrations were quantified using standard techniques, as previously described[Plasma samples were separated and stored at -80\u00b0C until assayed. Plasma viral loads were quantified by the Bayer SIV bDNA assay . Periphedescribed.nd exon was amplified by reverse transcription followed by two rounds of nested PCR. Primers used were; 1st round forward \u2013 TGAGACTTGGCAAGAGTGG, 1st round reverse \u2013 GGACTTCTCGAATCCTCTGTAG, 2nd round forward \u2013 GGTATAGGCCAGTGTTCTCT, 2nd round reverse \u2013 TATCAGTTGGCGGATCAGGA. Second round PCR fragment was 173 bp in length and corresponded to SIVMac239 base pairs 8762 to 8934 (GenBank accession # M33262) Fragments amplified by PCR were TA-cloned by topoisomerase into pCR2.1Topo (Invitrogen). Sequencing was performed using M13-reverse primer.At two-week intervals following challenge plasma was obtained from animals for viral sequence analysis. RNA was extracted from plasma samples by Qiagen RNA Isolation kit. The Tat 2"}
+{"text": "Hepatitis C (HCV) viral infection is a serious medical problem in Egypt and it has a devastating impact on the Egyptian economy. It is estimated that over 15% of Egyptians are infected by the virus and thus finding a cure for this disease is of utmost importance. Current therapies for hepatitis C virus (HCV) genotype 4 with interferon/ribavirin have not been successful and thus the development of alternative therapy for this genotype is disparately needed.Although previous studies utilizing viral subgenomic or full cDNA fragments linked to reporter genes transfected into adhered cells or in a cell free system showed promise, demonstration of efficient viral replication was lacking. Thus, we utilized HepG2 cells infected with native HCV RNA genomes in a replication competent system and used antisense phosphorothioate Oligonucleotides (S-ODN) against stem loop IIId and the AUG translation start site of the viral polyprotein precursor to monitor viral replication. We were able to show complete arrest of intracellular replication of HCV-4 at 1 uM S-ODN, thus providing a proof of concept for the potential antiviral activity of S-ODN on native genomic replication of HCV genotype 4.We have successfully demonstrated that by using two S-ODNs [(S-ODN1 (nt 326\u2013348) and S-ODN-2 (nt 264\u2013282)], we were able to completely inhibit viral replication in culture, thus confirming earlier reports on subgenomic constructs and suggesting a potential therapeutic value in HCV type 4. It is estimated that over 170 million people are infected globally with hepatitis C virus (HCV), and its devastating impact is further magnified by the high frequency of HCV persistence during infection, i.e., establishing a chronic infection in up to 85% of cases . There aIn the present study we elected to make use of HepG2 cells infected with native viral particles from HCV type 4 positive serum, the most prevalent type in Egypt. We were able to maintain these cells in culture for more than 4 months and they are capable of supporting HCV replication as indicated by consistent synthesis of plus and minus RNA strands by nested RT-PCR and by real-time PCR technique. We show that the two S-ODNs we selected, S-ODN1 (nt 326\u2013348) and S-ODN-2 (nt 264\u2013282), completely inhibited viral replication in culture, thus confirming earlier reports on subgenomic constructs and suggesting a potential therapeutic value in HCV type 4..E. Coli. Seventeen recombinant plasmids were purified from individual white colonies using mini preparation method . Insert DNA clones were sequenced in both the forward and the reverse directions using Sp6 and T7 primers respectively. Cycle sequencing reactions were performed using the Big Dye terminator method . The sequence of each quasispecies was determined on ABI 310 prism . The sequences obtained from 17 5' UTR fragments, each representing independent isolate, were aligned with the published sequence from HCV genotype, 4a. Alignments of only two local HCV isolates with type 4a are shown in figure Serum samples were collected from five HCV positive patients who were diagnosed by detectable HCV RNA using nested RT-PCR method as described . RNA samThe highly conserved regions among all HCV isolates were identified as targets for antisense (S-ODN). Based on earlier studies ,11 two IAlthough alignment of 5' UTR sequences in type 4a had nucleotide differences ranging from 3.5% to 5.3% when compared to isolates of type 4 used in the present study, the two stem loop targets for S-ODN1 and S-ODN2 are conserved among all isolates analyzed except for a single mismatch in only one isolate (NO1). Therefore, we selected the following two sequences for S-ODN designS-ODN1 (5'TGCTCATGGTGCACGGTCTACGA3');S-ODN2 (5' GGCCTTTCGCGACCCAA 3').Antisense nucleotides were purchased from biognostik, Gesellschaft fur molekulare diagnostik, Gottingen (Germany). Phosphorothioate DNA were synthesized as Na -salts and systematically purified using 2 steps high pressure liquid chromatography followed by cation exchange chromatography, and sterile ultra-filtration to remove any interfering substances that might be toxic to culture systems.2 tissue culture flasks  containing Dulbecco's Modified Eagle's Medium with 0.45 % Glucose and 1 % L-Glutamine  supplemented with 10 % Fetal Calf Serum  and antibiotics (penicillin/streptomycin 10000 \u03bc/10000 \u03bcg/ml (Biochrome KG Berlin Germany) and fungisone . The cells were fed fresh medium every 3 days and were grown to semi-confluence (8 to 10 days) and were then sub-cultured.HepG2 cells were obtained from the American Type Culture Collection (ATCC HB8065) and maintained in 75 cm2. Next day, adherent cells were washed three times with culture medium and incubation continued in complete medium supplemented with 10 % FCS with regular medium changes. Assessment of the viral infection in HepG2 cells throughout the culture duration was confirmed by RT-PCR amplification of plus and minus strand as described previously (13) as well as consistent viral load by real time PCR over 4 month period in culture. S-ODN1 and S-ODN2 were added to infected cells in culture wells (3 wells for each treatment) at 1 \u03bcM and 2 \u03bcM and were maintained for 24, 48 and 72 hours.The principal inoculum was a serum sample obtained from a 23 year old male patient, who was positive for anti-HCV antibodies and HCV RNA. HCV genotype in this sample was identified as type 4 using the method described by Ohno et al . SequencCellular RNA's from three separate wells were extracted using SEEK VIRAL RNA extraction kit  and subjected to nested RT-PCR analysis. Total RNA from cultured HepG2 cells were reverse transcribed and amplified using primer sequences derived from the highly conserved noncoding region of HCV genome as described [escribed . The reaP1 5'AACTACTGTCTTCACGCAGAA 3'P2 5' GGTGCACGGTCTACGAGACCTC 3'P3 5' GTGCAGCCTCCAGGACCC 3'P4 5' ACTCGGCTAGCAGTCTCGCG 3'260. Serial copy numbers ranging from 2 \u00d7 106 \u2013 2 \u00d7 107 copies/reaction were reverse transcribed and amplified using the same RT-PCR primers and same protocol described above for plus strand amplification. Amplified products from nested RT-PCR reactions of RNA isolated from infected cells and standards were resolved on 2% agarose gel and stained with ethidium bromide. Polaroid photographed gels were scanned and the intensity of the amplified bands were analyzed using Total Lab software . Numbers of copies per each 5 \u00d9TR concentrations were plotted against number of intensity units expressed as pixels. The number of copies in each specimen was calculated on the standard curve using the number of pixels in each casePlus-strand RNA was transcribed in-vitro from a cloned fragment of the HCV genome encompassing the entire 5' UTR in pGEM-T plasmid using in vitro transcription system as described by the manufacturer . The transcribed 5' UTR RNA was purified and quantified by O.D5 cells were mixed with 200 nM forward primer, 100 nM reverse primer, 100 nM GAPDH probe, 300 \u03bcM from each of dATP, dCTP, dGTP and 600 uM dUTP, 3 mM manganese acetate, 0.5 u rTth DNA polymerase, 0.5 u Amp Erase UNG, 1\u00d7 Taqman EZ buffer and amplified in the sequence detection system ABI 7700 . The RT-PCR thermal protocol was as follows: Initial UNG treatment at 50\u00b0C for 2', reverse transcription at 60\u00b0C for 30', deactivation of UNG at 95\u00b0C for 5' followed by 40 cycles each consists of denaturation at 94\u00b0C for 20\" and annealing/extension at 62\u00b0C for 1'.To check the integrity of the cellular RNA preparations from HCV infected HepG2 cells, we quantified GAPDH mRNA in the absence and in presence of S-ODN1 and S-ODN2. We wanted to ensure that S-ODN used in this study do not adversely affect the expression of a house keeping gene from host cells. The GAPDH mRNA levels were quantified by real time RT-PCR using TaqMan technology and GAPDH specific primers . AmplifiThe data sown in Figure To determine the conservation of IRES motifs across HCV isolates, nucleotide sequences of 17 5'NCR clones from 5 HCV type 4 infected subjects were analyzed and compared with published 5' UTR. Comparisons of only two isolates (NO1 and NO2) having the greatest sequence diversity within 5'NCR from that of genotype 4a are shown in Fig HepG2 cells infected with HCV type 4 were grown in culture for 24, 48 and 72 hours in the absence and presence of two concentrations of antisense S-ODN (1 \u03bcM and 2 \u03bcM), and the results of nested RT-PCR for HCV plus and minus strand RNA in the absence and presence of S-ODN1 are shown in Fig 3 genome equivalents per 106 cells. When either S-ODN1or S-ODN2 was added at 1 \u03bcM or 2 \u03bcM concentrations to the culture, no significant changes in viral genome numbers were noted indicating that 24 hrs is insufficient to observe detectable inhibition on HCV load. Whereas, approximately 400 HCV genome equivalents per 106 cells representing 5% of the initial copy numbers were still amplifiable after 48 hrs in cells treated with 1 \u03bcM S-ODN1 whereas 2 \u03bcM S-ODN1 totally abolished viral RNA after 48 hrs. Total viral eradication was observed after 48 hrs when cells were stimulated with S-ODN2. In general similar results were obtained after 72 hrs when 1 or 2 \u03bcM of either antisense was tested. This indicates that at least a period of 48 hrs is required for either antisense deoxynucleotide to have 100% inhibitory effect on HCV translation driven from the AUG start codon (nt 326\u2013348) and stem loop IIId (nt 264\u2013282).To quantitatively analyze the inhibitory effect of S-ODN on HCV replication, total cellular RNA was examined for viral copy number in infected cells. Quantification of intracellular plus-strand RNA was performed as described in materials and methods. Figure To demonstrate that the observed inhibitory effect of S-ODN was specific to HCV gene expression, the same cellular RNA samples from HCV/HepG2 cells treated with S-ODN were utilized to amplify the human cellular Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA using real time PCR and Taqman technology. The results displayed in figure 2 plus ribavirin combined therapy has been successful for only 10% among Egyptian HCV patients who are predominantly infected with genotype 4 [4 viral copies per 106 HepG2 cells and prolonged viral replication as well as core and E1 expression for up to 130 days. Furthermore, culture media of these infected cells were found to be highly infectious to na\u00efve cells (results not shown), indicating successful shedding out of infectious viral particles in cell surroundings.The current strategies for treatment of HCV liver disease are not yet satisfactory to the majority of HCV patients. Sustained viral response to interferon \u03b1notype 4 , bridgednotype 4 , inhibitnotype 4 -18, and notype 4 . Howevernotype 4 ; hepatobnotype 4 ,20, fetanotype 4 ,22 or funotype 4 , thus alnotype 4 ,24. Thesnotype 4 ,26. The notype 4 . Severalnotype 4 -29. We, notype 4 ,31 that Wide variability in the inhibitory potency of antisense S-ODN targeted against several viral sequences has been reported in a variety of in-vitro systems. The reasons for the limited success with the use of S-ODN against specific stem loop structures, particularly those constituting the IRES elements, is that some of these stem loops form a very stable secondary structures, so that the target motifs for S-ODN contain up to 75% paired RNA nucleotides ,32 which1and S-ODN2 on other viruses. A more reasonable approach to understand specificity of these molecules is to study their influence on expression of human constitutive genes such as GAPDH. Our results indicated that the S-ODN molecules under study are HCV specific with no detectable inhibition on GAPDH mRNA levels. To ensure biological safety of these molecules, studies of the effect of these S-ODNs on other key genes such as those involved in cell cycle and other major signaling pathways need to be evaluated.In the current studies we have not examined the specificity of S-ODNRecent studies focused on the use of RNA interference (RNAi) as a new strategy against HCV showed similar success to the antisense oligodeoxynucleotides treatment in inhibiting viral replication in cell culture ,35. HoweIn summary, the results described in the present in-vitro system indicated that S-ODN1 has relatively more inhibitory potency than S-ODN2, a finding that supports earlier reports . The res"}
+{"text": "We reported previously on the emergence and clinical implications of simian immunodeficiency virus (SIVmac251) mutants with a K65R mutation in reverse transcriptase (RT), and the role of CD8+ cell-mediated immune responses in suppressing viremia during tenofovir therapy. Because of significant sequence differences between SIV and HIV-1 RT that affect drug susceptibilities and mutational patterns, it is unclear to what extent findings with SIV can be extrapolated to HIV-1 RT. Accordingly, to model HIV-1 RT responses, 12 macaques were inoculated with RT-SHIV, a chimeric SIV containing HIV-1 RT, and started on prolonged tenofovir therapy 5 months later.The early virologic response to tenofovir correlated with baseline viral RNA levels and expression of the MHC class I allele Mamu-A*01. For all animals, sensitive real-time PCR assays detected the transient emergence of K70E RT mutants within 4 weeks of therapy, which were then replaced by K65R mutants within 12 weeks of therapy. For most animals, the occurrence of these mutations preceded a partial rebound of plasma viremia to levels that remained on average 10-fold below baseline values. One animal eventually suppressed K65R viremia to undetectable levels for more than 4 years; sequential experiments using CD8+ cell depletion and tenofovir interruption demonstrated that both CD8+ cells and continued tenofovir therapy were required for sustained suppression of viremia.in vivo. The observations on the clinical implications of the K65R RT-SHIV mutants were consistent with those of SIVmac251, and suggest that for persons infected with K65R HIV-1 both immune-mediated and drug-dependent antiviral activities play a role in controlling viremia. These findings suggest also that even in the presence of K65R virus, continuation of tenofovir treatment as part of HAART may be beneficial, particularly when assisted by antiviral immune responses.This is the first evidence that tenofovir therapy can select directly for K70E viral mutants  Many enofovir ,3-5; theenofovir ,5,6. Howenofovir .in vitro relative to wild-type virus [in vivo, especially when K65R is accompanied by other mutations in RT; some mutations may be compensatory (to improve replicative capacity), while the combination of K65R with certain other drug-selected mutations may be deleterious for viral replicative capacity , or may restore viral susceptibility to other compounds of the drug regimen [in vivo against replication of K65R HIV-1.Although much progress has been made , many unpe virus , it is u regimen -17. It iin vivo to high levels and induced a disease course indistinguishable from that of wild-type virus [in vivo CD8+ cell depletions and treatment interruption, revealed that this suppression of K65R viremia depended on strong CD8+ cell-mediated immune responses, but that continued tenofovir therapy was also still necessary [Simian immunodeficiency virus (SIV) infection of macaques has been a useful animal model to study the emergence, virulence and clinical implications of viral mutants during drug treatment . Prolongpe virus . In the pe virus -22. Furtecessary . Howeverin vivo emergence, virulence and clinical implications of K65R viral mutants during tenofovir treatment can be extrapolated to HIV-1 RT. Some experimental procedures , however, are not ethically or logistically feasible to study in HIV-1 infected humans. Because there is so far no optimal animal model that uses HIV-1, the currently best approach to unravel such questions about HIV-1 RT is the use of macaques infected with RT-SHIV, a chimeric virus consisting of SIVmac239 in which the RT gene is replaced by the counterpart of HIV-1 [in vivo passage of RT-SHIV lead to higher or more consistent virulence, (ii) does prolonged tenofovir treatment initiated during chronic RT-SHIV infection lead to the emergence of K65R viral mutants, (iii) what are the clinical implications of K65R mutants, and (iv) what is the role of CD8+ cells and continued tenofovir treatment in controlling viremia of K65R RT-SHIV?Because there are some important differences in the amino acid sequence of HIV-1 and SIV RT which affect susceptibilities and the mutational patterns to antiviral drugs , it is uof HIV-1 ,25. Whilof HIV-1 ,25-28; tof HIV-1 . Thus, aThe current report is the first one to demonstrate that during prolonged tenofovir therapy, RT-SHIV infected animals developed first K70E mutants, which were then replaced by K65R mutants. Further experiments in one animal that suppressed K65R viremia to undetectable levels demonstrated that, similarly to the findings in the SIVmac251 model, both CD8+ cell-mediated antiviral immune responses and continued tenofovir therapy were important to obtain maximal suppression of RT-SHIV viremia. This suggests that maintaining tenofovir as part of HAART, particularly when CD8+ cell-mediated immune responses are good and no better therapies are available, may still offer clinical benefits to persons infected with K65R mutants.in vivo passages  was administered intravenously to a second group of 4 animals  was injected intravenously into 5 animals . The rapid serial passage in macaques did not have any detectable effect. The 3 animal groups had similar viral RNA levels in plasma and infectious titers in PBMC, and a similar decline in absolute counts and percentages of CD4+ T lymphocytes and CD4+/CD8+ T cell ratios during the first 20 weeks of infection  class I allele Mamu-A*01; 4 other animals expressed the MHC class I Mamu-B*01 allele. Although there was no significant effect of the presence of either one of these alleles and viremia during the first 20 weeks of infection (prior to tenofovir therapy), Mamu-A*01-positive animals responded initially to tenofovir therapy with lower viral RNA levels than Mamu-A*01-negative animals  correlated negatively with baseline viral RNA levels . Other RT mutations, which were likely compensatory mutations, were also detected in viruses by population sequencing . This hutations , necessicarinii) were characteristic of terminal SIV-induced immunodeficiency. The remaining animal, number 30577, became a long-term survivor with undetectable viremia, even though its virus had the K65R mutation in RT. Therefore, this animal is described subsequently in more detail.The median disease-free survival of the tenofovir-treated animals was 150 weeks ~3 years). With the caveat that animal numbers per group were low, there was no significant difference in disease-free survival between Mamu-A*01-positive and -negative animals . Real-time RT-PCR revealed that the plasma viral RNA at peak viremia consisted exclusively of K65R viral mutants, with no detection of the K70E mutation or wild-type sequence; this plasma viral RNA had also the S68N and G196R mutations; virus isolated from PBMC at peak viremia also had the expected K65R mutation, with relatively few other RT mutations compared to virus isolated 4 years earlier . The initial phase of very rapid decline of viral RNA levels during the return of CD8+ cells indicates a half-life of productively infected cells of 0.9 days, suggesting high antiviral potency of the returning CD8+ cells  of RT-SHIV infection. Five weeks later, virus could be isolated again from PBMC, and this virus had the K65R and the same other RT mutations (including S68N) that were also detected during the viral rebound of the CD8+ depletion experiment table . StartinThe current report provides further insights into the many aspects of chronic tenofovir therapy, including the sequential emergence and implications of K70E and K65R viral mutants. These data are important and timely, considering (i) the increased use of tenofovir in HAART regimens, and (ii) the ongoing clinical trials which investigate if chronic administration of tenofovir can protect high-risk groups against HIV infection, particularly since no prophylactic strategy is likely to be 100% effective . The pre6 to 107 viral RNA copies per ml plasma, higher than that observed in some previous studies that used a lower virus inoculum [in vivo passages of RT-SHIV did not lead to detectable changes in virulence, as determined by viremia, and CD4+ and CD8+ T lymphocyte counts. It is plausible that after the high-dose intravenous inoculation, the potential virulence was already maximized, as viremia levels were similar to those commonly observed with the parental SIVmac239 virus [In the current study, intravenous inoculation of the first group of macaques with a high dose of RT-SHIV led to persistent viremia with set-point of 10inoculum ,28,31. S39 virus ,39.4 to 106 RNA copies/ml), viremia was rapidly reduced in all animals [6 to 107 RNA copies/ml). In the present study, a higher pre-therapy viral RNA set-point  correlated with a reduced early virologic response to tenofovir.Others have reported that when RT-SHIV infected macaques were started on short-term tenofovir treatment  either during acute viremia or during chronic infection  were found to be dominant during SIVmac239 infection ,41. In tin vitro and in vivo [in vivo. In the current macaque study, it is possible that a higher precursor mutation frequency at codon 70 (but still below the 0.2% detection limit in the baseline samples) may have predisposed for selective outgrowth of first variants with the K70E mutation which, in vitro, confers only a relatively minor fitness cost and minimal resistance to tenofovir (ranging from no effect to \u2264 2-fold reduced susceptibility)[in vitro than K70E mutants, but in the presence of tenofovir could outgrow K70E mutants due to a slightly higher level (~4\u20135 fold) of in vitro resistance to tenofovir [When RT-SHIV infected macaques were started on tenofovir, there was a rapid selection for viral mutants with a K70E RT mutation. The K70E RT mutants were subsequently replaced by K65R RT mutants. Similarly to observations with HIV-1 ,54, when in vivo ,56. The  in vivo ,58. Beca in vivo ), the detibility). These Kenofovir . This reenofovir . While penofovir ,62-64), The emergence of K65R RT-SHIV mutants during tenofovir treatment was accompanied by an accumulation of other RT mutations, believed to be compensatory mutations that improve the replicative capacity of K65R virus. Many of these mutations have been described previously with or without K65R in HIV-1 infected persons receiving tenofovir-containing or other HAART regimens, and some (such as M41L) have been reported to contribute to a reduced virologic response to tenofovir when in combination with other RT mutations ,59,65,66The clinical implications of the K70E and K65R RT-SHIV mutants were similar to those reported previously for K65R SIVmac251 mutants ,20,22. IWhile 11 of the 12 animals maintained persistent viremia and eventually developed disease, animal 30577 was an exception. Further research is needed to determine which host and/or viral factors  may have been responsible for this different outcome, as animal 30577 was initially indistinguishable from the other animals based on our limited panel of pre- and early post-therapy markers . Animal 30577 first had a rapid 47-fold reduction in viremia within 2 weeks of treatment but then had a 10-fold increase in viremia above nadir levels by 8 weeks of treatment, that was associated with the emergence of K70E followed by K65R viral mutants. Several human studies in which tenofovir-containing HAART regimens were initiated in antiretroviral-na\u00efve patients used virologic criteria  accordiThe CD8+ cell depletion experiment demonstrated that the reduced viremia in tenofovir-treated animal 30577 was mediated largely by CD8+ cells, because removal of CD8+ cells caused a transient ~1 million-fold increase of K65R viremia, to peak levels similar to those observed during acute viremia with wild-type RT-SHIV . In an or cells . In thesor cells ,43; unpuDespite this important role of CD8+ cells, continued administration of tenofovir was still required to maintain maximal suppression of K65R viremia in animal 30577; in other words, both antiviral immune responses and tenofovir were needed. This is similar to previous observations in tenofovir-treated animals that were infected with K65R SIV mutants . A recennd or 3rd line anti-HIV drugs may be limited, and regular monitoring of virus levels and drug resistance (such as K65R) is not always feasible. Simple treatment strategies for which decisions to alter the regimen would be less dependent on frequent monitoring of such laboratory parameters will be more practical and affordable, and can thus benefit the largest number of people.The current findings with RT-SHIV are consistent with but also extend previous observations on the K65R mutation in the SIV model ,22,80, wMacaca mulatta) were juvenile animals from the type D-retrovirus-free and SIV-free colony at the California National Primate Research Center (CNPRC), and were housed in accordance with American Association for Accreditation of Laboratory Animal Care standards, with strict adherence to the \"Guide for the Care and Use of Laboratory Animals\" [All rhesus macaques  per ml. This RT-SHIV stock had the T to C substitution at position 8 of the SIV tRNA primer binding site, which is necessary for rapid replication of RT-SHIV in vivo [An infectious cell-free stock of RT-SHIV  was pre in vivo .5 TCID50). Equal volumes of cryopreserved EDTA-anticoagulated plasma collected from the 3 animals at 2 weeks of infection were thawed, pooled and 0.6 ml was administered intravenously to 4 new animals  was suspended in distilled water, dissolved by the addition of NaOH to a final pH of 7.0 and concentration of 60 mg/ml, filter sterilized , and stored at 4\u00b0C. Starting at 20 or 21 weeks after RT-SHIV inoculation, tenofovir was administered subcutaneously into the back of the animal at a once daily dosage regimen of 10 mg/kg body weight, with dosage changes described in the results section. Animals were monitored regularly by chemistry panels and urinalysis to monitor for renal toxicity that occurs with prolonged high-dose tenofovir regimens, and make the necessary dosage adjustments .CD8+ cells were depleted using the previously described cM-T807 antibody ,87; a toViral RNA levels in plasma were quantified using a real-time reverse transcription-polymerase chain reaction (RT-PCR) assay for SIV gag, described previously ,89. WithInfectious virus was isolated in cultures of peripheral blood mononuclear cells (PBMC) with CEMx174 cells and subsequent p27 core antigen measurement, according to methods previously described . Levels Phenotypic drug susceptibilities of RT-SHIV isolates were characterized by a previously described assay based on a dose-dependent reduction of viral infectivity ,91.Infected CEMx174 and PBMC co-cultures were harvested as soon as culture supernatants were positive by antigen capture ELISA. Genomic DNA was extracted and used for nested PCR; amplicons were purified with a PCR purification kit (QIAGEN) and used for DNA sequencing according to methods and with primers described previously ,31. ThisSensitive testing for the K65R and K70E mutations was performed using real-time PCR-based methodologies as described previously . BrieflyThe real-time PCR reactions were performed in duplicate using 2 \u03bcl of the RT-PCR products for both the total virus copy and mutation-specific tests. Total SHIV RT templates were detected with the primers ComFWD and ComREV, which span n.t. 258\u2013420 in RT, along with the common probe 1. The reactions for detecting the K65R mutation involved the mutation-specific primer HIV-RT 65R.FWD with the primer 65R.REV and FAM-labeled probes mixture, 1P (80%) and 2P (20%). The K70E test used the mutation-specific primer 70E.REV with the primer 70.FWD and probe 70.2P. Differences in total copy and mutation-specific amplification curves (\u0394CT) of \u22649 or \u2264 10 cycles indicated the presence of 65R and 70E, respectively. These assay cutoffs allowed mutant viruses to be detected at frequencies \u2265 0.4%.To evaluate the interplay of the mutations during emergence, the positive mutation-specific amplicons were directly sequenced using the primers 65-118SEQ.1R (5'-CTA GGT ATG GTA AAT GCA GTA TAC TTC CT) and RT-SEQ.2F (5'-AAG GAA GGG AAA ATT TCA AAA ATT GGG CC) for the K65R amplicon and K70E amplicon, respectively. The overlapping amplicon sequences allowed for visualization of the adjacent codons.The ELISA to detect SIV-specific immunoglobulin G (IgG) in plasma samples was performed as described previously .Initially, 3-color flow cytometry techniques were used to detect CD3, CD4, CD8 and CD20 with fluorochrome-conjugated antibodies described previously ,94. Star\u00ae DNA mini kit, QIAgen, Valencia, CA) was used to screen for the presence of the major histocompatibility complex (MHC) class I alleles Mamu-A*01 and Mamu-B*01, using a PCR-based technique [DNA extracted from lymphoid cells . All statistical analyses of viral RNA levels in plasma were performed after log-transformation of the values.This study was partially supported by Gilead Sciences.KKAVR was responsible for the overall design of the study, sample processing, data analysis and preparation of the first draft of the manuscript. JAJ, JL and WH contributed all real-time PCR data including data analysis and interpretation. EJB, RPS and TBM performed DNA sequence analysis, virus isolations and data entry. NB assisted with pharmacokinetic analyses and data interpretation. MLM, NCP, and TWN assisted with the study design and data interpretation. All authors were involved in revising the manuscript draft and approved the final manuscript."}
+{"text": "To better understand in vivo the role of the SR proteins on HIV-1 genomic RNA splicing and virion production, we used a human cell line expressing high levels of complete HIV-1 and either one of the ASF/SF2, SC35, and 9G8 SR proteins. Results show that over-expressing SR proteins caused a large reduction of genomic RNA and that each SR protein modified the viral 9 kb RNA splicing pattern in a specific mode. In fact, ASF/SF2 increased the level of Vpr RNA while SC35 and 9G8 caused a large increase in Tat RNA. As expected, overexpressing SR proteins caused a strong reduction of total Gag made. However, we observed by immuno-confocal microscopy an accumulation of Gag at the plasma membrane and in intracellular compartments while there is a dramatic reduction of Env protein made in most cells. Due to the negative impact of the SR proteins on the levels of genomic RNA and HIV-1 structural proteins much less virions were produced which retained part of their infectivity. In conclusion, SR proteins can down-regulate the late steps of HIV-1 replication.In HIV-1 infected cells transcription of the integrated provirus generates the single full length 9 kb viral RNA, a major fraction of which is spliced to produce the single-spliced 4 kb RNAs and the multiple-spliced 2 kb RNAs. These spliced RNAs are the messengers for the Env glycoproteins and the viral regulatory factors. The cellular SR and hnRNP proteins were shown  From a genome of only 9000 nt in length, HIV-1 directs the synthesis of 15 proteins essential for its replication and dissemination  that mediate their effects by binding these elements [in vitro and ex vivo [HIV-1 splicing regulation relies on the presence of (i) suboptimal splice sites ,6, (ii) elements -15 and (elements -19. SR pelements ). These elements ). The hielements ,21,22. B ex vivo -26, we iIn the present study we show that overexpression of one of the three SR proteins ASF/SF2, SC35 and 9G8 together with HIV-1 strongly affected the full length viral RNA splicing pattern, notably resulting in a strong reduction of the genomic RNA and Env mRNA levels. As a consequence, only small amounts of viral particles were produced which, however, retained part of their infectivity.Human cells 293T) were co-transfected by the calcium phosphate precipitation method with 10 \u03bcg of HIV-1 pNL4-3  and 10 \u03bc93T were versus unspliced RNAs, we purified total RNAs from cells expressing HIV-1 and either one of the SR proteins and subjected 10 \u03bcg total RNA to Northern blot analysis with an HIV-1 env-specific probe. In control HIV-1 cells, 8 % of HIV-1 RNA remained unspliced while this amount was lowered to 0.5% by ASF/SF2 and SC35, and to 1.5% by 9G8. This also caused a decrease of total intracellular viral RNAs by two to five fold . To measure the levels of virion production, culture supernatants were harvested every day for two days, pooled, clarified by filtration and ultracentrifuged through a 20 % sucrose cushion. Pelleted viral particles were resuspended in TNE buffer (see methods) and virus production was monitored by CAp24 ELISA. Series of measurements indicated that ASF/SF2 and SC35 caused about a 10\u201312 fold reduction of total Gag synthesized while 9G8 reduced it by roughly 4 fold. These results are in agreement with the relative levels of the unspliced viral RNA in HIV-1 producer cells Table .versus virion-associated Gag. Despite the low levels of total Gag synthesized as measured by CAp24 ELISA, cell-associated Gag was found at unexpected high levels when either one of the SR proteins was overexpressed. Indeed, cell-associated Gag levels were found to be about 40%, 80% and even 250% upon overexpressing ASF, SC35 and 9G8, respectively, as compared with control HIV-1 cells .To better understand the influence of the SR proteins on Gag and Env synthesis, we examined by immunofluorescence staining and confocal laser microscopy (CLSM), co-expression of the two major viral structural proteins in individual cells. HIV-1 expressing cells were subjected to immuno-staining using anti-MA for Gag (green staining) and anti-gp120 for Env (red staining) antibodies, and all stainings were viewed by confocal microscopy Figure  see met. Co-exprOverexpressing ASF/SF2 as evidenced by a blue nuclear staining in most cells Figure  caused aThe influence of the SR proteins on Gag and Env synthesis was further evaluated with respect to virion production and infectivity.This was examined by monitoring the levels of HIV-1 virion production under conditions of increasing expression of the SR proteins. As shown in Figure Protein composition of the virions generated by cells overexpressing one of the SR factors, at a HIV-1/SR DNA ratio of 1:0.5, was investigated by western blotting using antibodies against the major core component, CAp24, the RT enzyme, viral factor VPR and the envelope glycoprotein TMgp41. As shown in Figure gag-specific probe. For all overexpressed SR proteins, genomic RNA packaging was reduced from 3 to 4 fold compared with control virions . Upon overexpression of each one of the SR proteins, virus infectivity, based on the same amount of genomic RNA, was found to be 30 to 60% of the control virus, or 6 to 12 fold less based on identical amounts of CAp24-associated particles.To determine the infectivity of virions produced by cells overexpressing one of the SR proteins, the same amount of virus-associated genomic RNA was used to infect Hela P4 cells, a HeLa subtype that constitutively expresses the CD4 receptor and contains the It can be concluded that overexpression of each one of the SR proteins caused a strong reduction of the unspliced viral RNA in cells, and this had a more pronounced effet on virion production than on Gag synthesis Figures , 4, 5, 6In the present study, we show that the overexpression of either one of three different SR proteins, namely ASF/SF2, SC35 and 9G8, profoundly affected the HIV-1 splicing pattern . Membra in ref. ). Actual in ref. ,35). In  in ref. .Despite the low level of incorporated Env Figure , virionsIn summary, the data presented here show that elevated concentrations of SR proteins in HIV-1 expressing cells differentially affected viral RNA and protein expression, resulting in a strong decrease of viral progeny made. Thus one can speculate that the coordinated regulation of HIV-1 splice site utilization by SR proteins is of critical importance to maintain high levels and balanced ratios of the viral RNAs and hence of the viral proteins made in order to direct optimal virus assembly and production. Thus, HIV-1 probably needs to interact with the splicing machinery. In accordance with this view, SC35 is up-regulated and 9G8 down-regulated in HIV-1 infected cells ,39. On aPlasmids pXJ41-ASF, pXJ42-PR264 and pXJ42-9G8  that res6 293T cells were inoculated in 10-cm Petri dish  and 293T cells (provided by Genethon) were maintained in Dulbecco's modified Eagle's medium supplemented with 10 % fetal calf serum, 2 mM glutamine and antibiotics . One day before transfection, 3 \u00d7 105 cells per well of a 24-well plate) with purified viruses containing 1 ng of genomic RNA. After 24 h, cells were fixed and incubated in the presence of X Gal substrate at 37\u00b0C until blue color development was complete. Viral titers were determined by counting the number of blue cells in threee different wells.Viral titrations were performed by infection of HeLa P4 cells . Two-third of cells were resuspended in PBS and total cellular RNA was extracted with TRIzol reagent as recommended by the manufacturer (Invitrogen). Culture supernatants were treated as indicated above and the level of CAp24 antigen measured by ELISA. Northern blotting of intracellular viral RNAs was performed with 10 \u03bcg of total RNA and slot-blot of virion-associated genomic RNA was performed with 10 ng of CAp24 antigen. After transfer onto a Hybond-N+ membrane (Amersham Pharmacia Biotech), viral RNAs were probed with radiolabeled fragments from Env for Northern blot and from Gag region for slot-blot. All the mRNAs species were quantified by Storm (Amersham).The splicing products were analyzed by RT-PCR as previously described , except One-third of transfected cells were washed in PBS and lysed in PBS containing 0.5 % Triton. After CAp24 ELISA measurement in cell lysates and in virus pellets, samples were added to 3X gel loading buffer . For immunoblotting, samples containing equal amounts of CAp24 antigen were loaded on a 10 % SDS-PAGE and fractionated proteins were transferred onto a Hybond P membrane (Amersham Pharmacia Biotech). Viral proteins were probed with monoclonal anti-CAp24 (BioM\u00e9rieux), polyclonal anti-Vpr , polyclonal anti-Nef  or monoclonal anti-TMgp41  antibodies. The bound antibodies were detected with peroxidase-conjugated anti-mouse IgG antibodies and visualized by the SuperSignal West Pico Chemiluminescent Substrate (Pierce).4Cl. Cells were then permeabilized using 0.2 % Triton X-100 for 5 min and blocked in 1% BSA. The fixed cells were incubated for one hour at room temperature with primary antibodies: rabbit anti-MAp17 , human anti-HIV-1 gp120 Mab(b12) , rabbit anti-His for His-tagged 9G8 and ASF proteins, and mouse anti-HA1 for HA-tagged SC35 protein (Sigma). The corresponding fluorescent Alexa\u00ae 488, 546 and 633-conjugated secondary antibodies were used at 0.5 \u03bcg/ml (Molecular probes). Coverslips were washed three times with PBS and mounted on microscope slides with Mowiol (Sigma). Images were acquired on Axioplan 2 Zeiss CLSM 510 confocal microscope with Argon 488/458, HeNe 543, HeNe 633 lasers and plan apochromat 63 \u00d7 1.4 oil Ph3 objective, supplied with LSM 510 3.4 software.Transfected 293 T cells were grown on poly-lysine coated coverglass dishes and fixed 24 h post transfection in 3% paraformaldehyde  for 20 min. The fixative was then removed and the free aldehydes were quenched with 50 mM NHHIV-1, Human Immunodeficiency Virus type 1.CAp24, viral capsid protein p24.MAp17, viral matrix protein p17.RT, reverse transcriptase.SR, splicing regulatory proteins.hnRNP proteins, heterogenous ribonucleoparticle proteins.Site A, splicing acceptor site. Site D, splicing donor site.Kb, kilobases. WT, wild type.PBS, Phosphate Buffer Saline.BSA, bovine serum albumin.Mab, monoclonal antibody.SJ carried out analyses on SR protein-mediated effect on HIV-1 RNA splicing.DD was in charge of cell culture and transfection assays. DM performed immuno-confocal microscopy experiments and analyses. JLD is the lab head and arranged the manuscript.The author(s) declare that they have no competing interests."}
+{"text": "Lentiviral vectors have been designed with complex RNA export sequences in both the integrating and packaging plasmids in order to co-ordinate efficient vector production. Recent studies have attempted to replace the existing complex rev/RRE system with a more simplistic RNA export system from simple retroviruses to make these vectors in a rev-independent manner.6 T.U./mL (n = 4\u20138 preparations). The addition of multiple copies of the murine intracisternal type A particle, the woodchuck post-regulatory element (WPRE), or single and dual copies of the simian CTE had minimal effect on viral titer. Immortalized cell lines from different species were found to be readily transduced by VSV-G pseudotyped lentiviral vectors containing the multiple copies of the CTE similar to the findings in HeLa cells, although the simian-derived CTE were found to have a lower infectivity into murine cell lines compared to the other species.Towards this end, lentiviral transfer plasmids were modified with various cis-acting DNA elements that co-ordinate RNA export during viral production to determine their ability to affect the efficiency of vector titer and transduction in different immortalized cell lines in vitro. It was found that multiple copies of the constitutive transport element (CTE) originating from different simian retroviruses, including simian retrovirus type 1 (SRV-1) and type-2 (SRV-2) and Mason-Pfizer (MPV) could be used to eliminate the requirement for the rev responsive element (RRE) in the transfer and packaging plasmids with titers >10in vitro, but that concatemerization of the CTE or the close proximity of RNA export sequences was needed to enhance vector production.These studies demonstrated that the rev-responsive element (RRE) could be replaced with other constitutive transport elements to produce equivalent titers using lentivectors containing the RRE sequence  For this reason, we cloned the consensus Kozak sequence (CCACCATGG) in front of the Gag-pol genes in the packaging construct to enhance translation of p24 Gag protein production. As shown in Figure 6 T.U./mL) following the production of a lentiviral vector containing the same transfer plasmid, but using two different gag-pol constructs to express the structural and packaging genes. The interesting finding was that inclusion of the Kozak sequence (pCMV.Kozak.gag.pol.RRE.bpA) resulted in an approximate 3-fold increase of p24 Gag protein to 147 +/- 12.5 ng/mL, but the functional viral titer as determined by end-point dilution did not markedly change compared to the packaging plasmid without the Kozak sequence. Interestingly, the p24 Gag levels were 2\u20133-fold higher using a transfer plasmid containing multiple CTE elements with either a RRE-containing packaging plasmid or a WPRE-containing packaging plasmid. The elevated p24 Gag protein levels did not appear to affect the viral titers in a positive way. These results demonstrate that the functional titer is not necessarily a function of the p24 Gag protein levels provided that a minimal threshold of gag protein is produced, and that several different factors, such as optimizing translation start site and other cis-acting DNA elements may play a role in producing high titer vector.Minimal packaging plasmids containing the rev-expressing plasmid during vector production resulted in a consistent increase in viral titer by 2\u20135 fold depending on the transfer plasmid used in these studies , but the main issue is that vector titer using packaging plasmids with multiple copies of the CTE replacing the RRE could produce relatively high titer vector, but that the expression of rev would further increase the viral titer. The mechanism is not known, but it could be due to the significant secondary structure that could form using the multimeric CTE, which could simulate the secondary structure of the RRE, or that rev protein indiscriminately binds to secondary structures or DNA elements in the vector to allow for efficient export of the unspliced gene products and viral genomes into the cytoplasmid for assembly.Another interesting aspect from our experiments was the RRE-dependent increase in vector titer even in the absence of the RRE in both the transfer and packaging plasmids. The co-transfection of the s Figure  and 4C. d Figure . There wrev/RRE system in the production of replication-defective lentiviral vectors.The present study demonstrated the importance of multiple RNA export sequences to replace the rev gene during vector production. RNA export sequences, such as constitutive transport elements (CTE), are known to increase the viability of the RNA genome of simple and complex retroviruses by transporting unspliced genomic RNA from the nucleus to the cytoplasm for packaging and assembly into viral particles. For this reason, the incorporation of alternative RNA export elements into the packaging plasmid would potentially eliminate the need for the expression of the rev gene during vector production.The incorporation of alternative RNA export elements into the packaging plasmid would potentially eliminate the need for the expression of the 6 T.U./mL) compared to lentiviral vectors containing individual copies of the CTE. Other cis-acting elements, such as the woodchuck post-regulatory element (WPRE), did not play a significant role in enhancing viral titer, but may have been involved in transcript stability  or without the WPRE [pHRSVcPGKnlsLacZS1.4(+)]. RAG and MDCK cells were transduced at MOIs of 1 and 3, respectively, using the titered values from HeLa cells. The media was replaced 24 hours following the initial infection, and then the cells were collected 24 hours later. The cells were lysed using the reagents in the \u03b2-gal ELISA kit from Roche . The ELISA was performed as per the manufacturer's protocol and the plate was scanned using a Bio-Rad plate reader 680  at 490 nm.MDCK and RAG cells were plated at a density of 5 \u00d7 10The significance of differences between groups at the same dose of lentivirus was tested by a one-way ANOVA with the use of StatView 5.0 software . If a probability value of P < 0.05 was obtained, the Tukey test was used for comparison of each individual group with the appropriate control groups.The author(s) declare that they have no competing interests.TO and AB were co-authors responsible for the cell culture production and viral titer analysis in Figures GJ was responsible for the cell culture experiments to complete the data for Figure FP was responsible for the design of the experiment, cloning of all of the vectors, and writing of the manuscript."}
+{"text": "We have constructed a series of deletions in the SIVmac239 leader sequence in order to determine the involvement of this region in both the packaging and dimerization of viral genomic RNA. We also assessed the impact of these deletions upon viral infectiousness, replication kinetics and gene expression in cell lines and monkey peripheral blood mononuclear cells (PBMC).The 5' untranslated region (UTR) or leader sequence of simian immunodeficiency virus (SIVRegions on both sides of the major splice donor (SD) were found to be necessary for the efficiency and specificity of viral genome packaging. However, stem-loop1 is critical for both RNA encapsidation and dimerization. Downstream elements between the splice donor and the initiation site of SIV-Gag have additive effects on RNA packaging and contribute to a lesser degree to RNA dimerization. The targeted disruption of structures on both sides of the SD also severely impacts viral infectiousness, gene expression and replication in both CEMx174 cells and rhesus PBMC.mac239, stem-loop1 functions as the primary determinant for both RNA encapsidation and dimerization. Downstream elements between the splice donor and the translational initiation site of SIV-Gag are classified as secondary determinants and play a role in dimerization. Collectively, these data signify a linkage between the primary encapsidation determinant of SIVmac239 and RNA dimerization.In the leader region of SIV This region is also critical for both the encapsidation and dimerization of viral genomic RNA (vRNA). These latter functions act through sequence -3.55Gag), [In regard to vRNA packaging in human immunodeficiency virus type-1 (HIV-1), the primary encapsidation determinant or Psi core (\u03a8) has been shown to be located downstream of the major splice donor (SD), involving those structures that form stem loop-3 (SL3) and SL4 . Upstrea55Gag), -9. Inter55Gag), ,11, the 55Gag), ,12.mac239 is 38 nucleotides longer [mac is longer than the equivalent region of HIV-1. Functionally, this region in SIV has been shown to have internal ribosome entry site (IRES) activity, whereas, in the case of HIV-1, this element includes a region encompassing both sides of the SD [gag-coding region [Although broadly comparable RNA secondary structures have been predicted for the leader regions of HIV-1, HIV-2 and SIV, prominent variations in sequence and structure are evident. For example, the sequences upstream of stem-loop 1 (SL1) in HIV-1 are 59 nucleotides long, whereas the comparable region in SIVs longer . Similarf the SD ,15. Integ region .et al. showed in HIV-2 that a large deletion adjacent to the 3' SD can abrogate encapsidation [et al demonstrated that HIV-2, employs a co-translational mechanism of RNA packaging whereby newly translated Gag polyprotein interacts with vRNA while in a ribosomal translation complex, thereby imparting packaging specificity [Contrary to that described for HIV-1, the primary packaging locus (or \u03a8 core) of HIV-2 is located upstream of the SD ,18. In Ssidation . Griffincificity .Implicit in the encapsidation process of all retroviral lineages except the Spumoretroviruses, is the formation of a linked RNA duplex or dimer consisting of two full-length vRNA molecules. Early in viral assembly, two copies of the viral genome bind at their 5' ends through non-covalent interaction of complimentary sequences located at the terminal palindrome of stem-loop 1 (SL1) . This sein vitro [in-vitro studies with HIV-2 describe alternating RNA structures that regulate both RNA packaging and dimerization [The importance of RNA-RNA interactions in selective genome packaging is based on evidence from the leader region of HIV-1 suggesting that SL1 alone is sufficient to initiate formation of this duplex, and enhances the rate of dimerization in vitro . Forced in vitro . Genome rization -33. Howerization ,35. Otherization .mac239 leader and its impact upon viral replication and RNA encapsidation [mac239 to include the regions on either side of the major SD, as no studies to date have investigated both RNA encapsidation and RNA dimerization in SIV. We show that elements on both sides of the major SD impact both RNA packaging and dimerization, and provide evidence of secondary packaging elements. We have also related deficits in RNA packaging and dimerization to overall viral infectivity and replication capacity.Our group has previously described the upstream SIVsidation ,19. In tmac239  resulted in severely diminished packaging. Thermodynamic analysis of these mutants was also conducted using M-Fold software and revealed a loss of the SL3 element and refolding of the SD loop, but conservation of SL4 and the structural elements upstream of the SD, even though the deletions were quite large . The cytoplasmic viral RNA levels in each case did not significantly deviate from those observed with wild-type virus (not shown).As mentioned above, we also analyzed phenol-chloroform extracted vRNA by non-denaturing Northern analysis for each of the viral mutants from this study to determine their ability to incorporate viral RNA as a dimer. Fig.  shows thThe analysis of regions downstream of the major SD showed that only the largest deletions, i.e. pD\u039460 and pD\u039451, completely disrupted dimerization Fig . In contIn vitro work from other groups has implicated regions upstream of SL1 as involved in the dimerization of HIV-2 RNA [IV-2 RNA -33. To eIV-2 RNA . AnalysiThe results of Fig. The elimination of sequences downstream of the splice donor (SD) site also resulted in impaired viral replication in the CEMx174 line. The most significant deficits in replication resulted from deletions that removed the entire sequence from just downstream of the SD to the gag initiation codon, i.e. pD\u039460 (\u0394+471-530) and, to a lesser extent, pD\u039451 (\u0394+481-531). Smaller deletions spanning this region had relatively little impact on replication kinetics. Of these smaller intermediate deletions, only pD\u039419 (\u0394+511-529) resulted in a significant delay in viral replication kinetics Fig. .We also evaluated the impact of these deletions on viral replication capacity in PHA-stimulated rhesus PBMCs by monitoring the production of SIV capsid protein (p27) in culture supernatants. Under these conditions our results Fig.  show tha50) in CEMx174 cells . The results of Fig. The infectivity of these mutants was assessed using the endpoint dilution method , the mutants' pD\u039460 and pU\u039451 exhibited moderately diminished infectiousness. Again, consistent with that described above, the mutant pD\u039419 displayed a modest but significant reduction in infectivity, while the remaining mutants were not compromised.To determine the impact of deletion mutagenesis within the SIV leader region on gag expression, particle formation, and viral maturation, COS-7 cells were transfected with either wild type or mutant constructs. Virus containing culture supernatants were first clarified then pelleted by ultracentrifugation through a 20% sucrose cushion.55Gag protein. This phenotype was prominent in the Western analysis of deletions within SL1 , and was manifest as an accumulation of the first and second cleavage intermediates  36 hrs after the transfection of COS-7 cells with wild type or mutant proviral constructs. Multiple sections of stained cell preparations were scanned by TEM and approximately 100 particles were scored for each virus mutant see Fig. . Wild-tyIn contrast, both pU\u039419 and pD\u039460 showed diminished particle production in conjunction with abnormalities in the viral core  had no significant effect on viral infectivity or de novo replication kinetics in CEMx174 lines or in rhesus PBMC. Yet, the pU\u039414 mutant was found to reduce vRNA packaging by approximately 40% perhaps indicating that the secondary structure of this element may be more critical than the loss of primary sequence in regard to its function. Thus, the primary role of this element may be as a part of an extended DLS structure, rather than solely as a cis-packaging element.Although other groups have reported that the region flanking SL1 (between SL1 and the SD) harbors the critical upstream packaging determinant, our results show that SL1 acts as the primary mac, contrary to the discrete packaging elements described for simple retroviruses [In regard to vRNA packaging, the nucleotide region downstream of the SD appears to play a secondary role relative to regions located upstream of the major SD. The most dramatic defects on packaging were observed when the entire terminal 3' leader sequence was deleted (in the mutant pD\u039460 or pD\u039451). Surprisingly, even these large deletions failed to completely abrogate genome packaging in SIVoviruses . We usedCollectively, these data show a multipartite contribution of RNA-leader sequences in SIV vRNA encapsidation, similar to HIV-1. However, the importance of these domains in regard to vRNA packaging appears to be reversed in orientation compared to SL1 and the \u03a8 core of HIV-1 ,4. WhileIn regard to RNA dimerization, our non-denaturing Northern analysis has shown that the leader regions involved in dimerization are immediately proximal to the major splice donor. The results presented here are in agreement with the previous studies of HIV-1 ,25,39 anWhether vRNA encapsidation in HIV or SIV preferentially occurs with a single vRNA strand or as a \"dimer\" composed of two full-length vRNA molecules has not been completely elucidated. In the case of MMLV and MLV, recent work has strongly favored the latter notion, and dimerized RNA has been show to be a necessary step prior to encapsidation ,41. In t55 Gag processing, ultimately impacting replication capacity and viral infectivity.Disrupted phenotypes exhibiting or laterally displaced cores were observed for several of our SIV mutants Fig. . SeveralSimilar observations have been reported for HIV-1 where alterations of the \"normal\" vRNA compliment resulted in morphological anomalies ,47. ForcIn sum, the elimination of structures on either side of the SD in SIV yields a replication-impaired phenotype, which is attributable to blocks in RNA encapsidation and dimerization.mac239 was used as a template to construct all deletion mutants [mac239 was replaced by recombinant PCR fragments to generate all mutant constructs  of the major SD i.e. pD\u039460 through pD\u03948  and used in standard hybridization reactions. Relative amounts of products were quantified by molecular imaging (BIO-RAD Imaging). RNA encapsidation was determined on the basis of three different reactions, and calculated with wild type virus levels arbitrarily set at 1.0.For analysis by slot blotting, viral RNA was isolated from purified virus recovered from transient transfection assays, clarified, and subsequently purified through a 20% sucrose cushion. Virus pellets were re-suspended in TE buffer and digested with DnaseI to remove potential plasmid contamination. Sample RNA was purified and then analysed as per Northern analysis described below, using the Scheicher and Schuell Minifold II slot-blotting system. The slot-blot analysis of cellular RNA was also conducted in parallel. Briefly, transfected COS-7 cells were washed twice with cold phosphate-buffered saline and lysed with NP-40 lysis buffer . The celmac239, and pur32-ATP in order to visualize PCR products. Equivalent RNA samples, based on p27 antigen levels, were used as templates in an 18-cycle RT-PCR. The products were fractionated on 5% polyacrylamide gels and exposed to X-ray film. Relative amounts of products were quantified by molecular imaging (BIO-RAD Imaging). RNA encapsidation was determined on the basis of four different reactions, and calculated with wild type virus levels arbitrarily set at 1.0.To study packaging of viral genomic RNA, viral RNA was isolated using the QIAamp viral RNA mini kit (QIAGEN) from equivalent amounts of COS-7 cell-derived viral preparations . RNA samples were treated with RNase-free DNase I at 37\u00b0C for 30 min to eliminate potential plasmid DNA contamination; followed by inactivation by incubation at 75\u00b0C for 10 min. The viral RNA samples were quantified using the Titan One Tube RT-PCR system . The primers sg1 and sg2 were used to amplify a 114-bp fragment representing full-length viral RNA. The primer sg2 was radioactively labeled with \u03b4-Pmac239 plasmid. These were recovered by gel purification and labelled with \u03b4-P32-ATP by nick-translation following standard protocols . The denaturing Northern analysis of cellular RNA was also conducted in parallel. RNA extraction was carried out similar to that described for slot blotting above. The cellular RNA within extracted from lysates was normalized on the basis of p27-Ca antigen present in cellular lysates. Total cellular RNA preparations, i.e. equivalent volumes of RNA, were also run on 1% ethidium bromide (EtBr) stained gels as an internal control for total RNA and 28S and 18S ribosomal RNAs. Probes were prepared as described above Probes were labelled by nick-translation following standard manufacturer's protocols  and used in standard hybridization reactions.Culture fluids from transfected COS-7 cells were collected and clarified using a Beckman GS-6R bench centrifuge at 3,000 rpm for 30 min at 4\u00b0C. Viral particles were further purified through a 20% sucrose cushion at 40,000 rpm for 1 hour at 4\u00b0C using a SW41 rotor in a Beckman L8-M ultracentrifuge. Viral pellets were first dissolved in Tris-EDTA (TE) buffer, then in lysis buffer containing proteinase K (100 \u03bcg/ml) and yeast tRNA (100 \u03bcg/ml). Samples were incubated for 20 min at 37\u00b0C, in the presence of 50 U of DNAse I, followed by two extractions first in phenol: chloroform: isoamyl alcohol, then chloroform. Viral RNA was then precipitated, washed in 70% ethanol and stored at -80\u00b0C until required, at which time samples were resuspended in TE buffer at 4\u00b0C. RNA was then analysed by non-denaturing electrophoresis on 0.9% agarose gels in 1\u00d7 Tris-Borate-EDTA (TBE) running buffer for 4 hrs at 4\u00b0C. Products were subsequently denatured in 50 mM NaOH and equilibrated in 200 mM Na-acetate. Following electrophoresis, RNA was transferred to Hybond-N nylon membranes by capillary blotting using a 20\u00d7 concentration of SSPE buffer. Membranes were baked for 2 hrs at 80\u00b0C. Probes were prepared by digestion and purification of the NdeI-BstE III fragment excised from the SIVMacaca Mulatta), purchased from L.A.B. Pre-Clinical Research International Inc., Montreal, Quebec. All primates were housed in accordance with accredited laboratory care standards. All donor macaques were serologically negative for simian type-D retrovirus (SRV-1), simian T-cell lymphotrophic virus type-1 (STLV-1), and simian foamy virus (SFV-1) at the time of blood collection.COS-7 cells were maintained in DMEM medium supplemented with 10% heat-inactivated fetal bovine serum. All media and sera were purchased from GIBCO Inc. . CEMx174 cells were maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum. Monkey PBMCs were isolated from the blood of healthy rhesus macaques (Primate PBMCs were ficoll-purified followed by phytohemagglutinin (PHA) stimulation for 3 days, then maintained in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum and 20 U/ml IL-2. Molecular constructs were purified using a Maxi Plasmid Kit . COS-7 cells were transfected using the above constructs with lipofectamine 2000 reagent . Virus-containing culture supernatant was harvested at 48 h post-transfection and clarified by centrifugation for 30 min at 4\u00b0C at 3,000 rpm in a Beckman GS-6R centrifuge. Viral stocks were passed through a 0.2 \u03bcm filter and stored in 0.5 ml or 1 ml aliquots at -80\u00b0C. The concentration of p27 antigen in these stocks was quantified using a Coulter SIV core antigen ELISA assay .2 at 37\u00b0C for 0.5 h to eliminate any residual contaminating plasmid DNA prior to inoculation of cells. Infection of CEMx174 cells was performed by incubating 106 cells with 10 ng of viral p27 antigen equivalent for 2 hrs at 37\u00b0C. Infected cells were then washed twice with phosphate-buffered saline and re-suspended in fresh supplemented RPMI-1640 medium. Cells were split at a ratio of 1:3, twice per week. Supernatants were routinely monitored for virus production by reverse transcriptase (RT) assay.To initiate infection, viral stocks were thawed and treated with 100 U of DNase I in the presence of 10 mM MgCl50) was determined by infection of CEMx174 cells as previously described [Virus infectivity .Virus replication was also assessed in rhesus PBMCs. Briefly, 4 \u00d7 10At 48 hrs post-transfection, virus containing supernatants from COS-7 transfected cells were collected and clarified at 3000 rpm for 30 min. at 4\u00b0C in a GS-6R Beckman centrifuge. Virus was further purified by pelleting through a 20% sucrose cushion by ultracentrifugation at 35000 rpm in a Beckman ultracentrifuge for 1 hr at 4\u00b0C. Cells were washed 2\u00d7 in cold PBS and lysed by the addition of buffer containing 1% Nonidet P-40, 50 mM Tris-CL (pH 7.4), 150 mM NaCl, 0.02% sodium azide, and a cocktail of protease inhibitors . Virus was normalized on the basis of p27-CA protein present in supernatants or cell lysates. Both pelleted virus and cellular lysates were subject to Western blotting following standard protocols  with monViral ultra-structure for the described mutant viruses was examined by transmission electron microscopy. Briefly, COS-7 cells transfected with wild type or mutant SIV constructs were fixed 48 hours post-tranfection in 2.5% glutaraldehyde/phosphate buffered saline followed by a secondary fixation of lipids in 4% osmium tetroxide. Samples were routinely processed and serially dehydrated, and subsequently embedded in epon under vaccum. Thin-sectioned samples were stained with lead citrate and uranyl acetate and visualized at 80 KeV using a JEOL JEM-2000 FX transmission electron microscope equipped with a Gatan 792 Bioscan wide-angle 1024 \u00d7 1024 byte multi-scan CCD camera."}
+{"text": "Emergence of drug-resistant strains of human immunodeficiency virus type 1 (HIV-1) is a major obstacle to successful antiretroviral therapy (ART) in HIV-infected patients. Whether antiviral immunity can augment ART by suppressing replication of drug-resistant HIV-1 in humans is not well understood, but can be explored in non-human primates infected with simian immunodeficiency virus (SIV). Rhesus macaques infected with live, attenuated SIV develop robust SIV-specific immune responses but remain viremic, often at low levels, for periods of months to years, thus providing a model in which to evaluate the contribution of antiviral immunity to drug efficacy. To investigate the extent to which SIV-specific immune responses augment suppression of drug-resistant SIV, rhesus macaques infected with live, attenuated SIVmac239\u0394nef were treated with the reverse transcriptase (RT) inhibitor tenofovir, and then challenged with pathogenic SIVmac055, which has a five-fold reduced sensitivity to tenofovir.+ T cell loss and clinical disease progression. By comparison, macaques infected with SIVmac239\u0394nef and treated with tenofovir showed no evidence of replicating SIVmac055 in plasma using allele-specific real-time PCR assays with a limit of sensitivity of 50 SIV RNA copies/ml plasma. These animals remained clinically healthy with stable CD4+ T cell counts during three years of follow-up. Both the tenofovir-treated and untreated macaques infected with SIVmac239\u0394nef had antibody responses to SIV gp130 and p27 antigens and SIV-specific CD8+ T cell responses prior to SIVmac055 challenge, but only those animals receiving concurrent treatment with tenofovir resisted infection with SIVmac055.Replication of SIVmac055 was detected in untreated macaques infected with SIVmac239\u0394nef, and in tenofovir-treated, na\u00efve control macaques. The majority of macaques infected with SIVmac055 experienced high levels of plasma viremia, rapid CD4These results support the concept that anti-viral immunity acts synergistically with ART to augment drug efficacy by suppressing replication of viral variants with reduced drug sensitivity. Treatment strategies that seek to combine immunotherapeutic intervention as an adjunct to antiretroviral drugs may therefore confer added benefit by controlling replication of HIV-1, and reducing the likelihood of treatment failure due to the emergence of drug-resistant virus, thereby preserving treatment options. Initiation of antiretroviral therapy (ART) in patients with HIV-1 infection can rapidly reduce plasma viremia, bolster immune responses, and improve clinical outcome . Despite+ T cells from individuals harboring multi-drug-resistant HIV-1 still respond in vitro to proteins and peptides containing commonly found drug resistance mutations  adenine, PMPA} leads to an increase in viremia, providing direct evidence that these cells significantly contribute to the success of tenofovir in suppressing replication of virulent SIV [In this respect, animal studies using SIV infection of non-human primates provide a useful tool to shed light on the mechanisms of immune-mediated control of infection, the impact of antiretroviral drugs on virus replication , and thelent SIV .In vivo depletion of CD8+ T cells in macaques infected with live, attenuated SIV leads to a marked increase in viremia indicating a critical role for these cells in controlling virus replication [+ T cells.The notion that antiviral immune responses play a critical role in augmenting the efficacy of ART is amenable to further study in rhesus macaques infected with live, attenuated SIV, in which broad SIV-specific cellular and humoral immune responses are induced, and can confer robust protection against exogenous SIV challenge . Intereslication . In the lication  and adullication  animals The immunologic and virologic features of macaques infected with live, attenuated SIV, typified by low-level viremia and strong SIV-specific humoral and cellular immune responses, provide a unique opportunity to examine the contribution of SIV-specific immunity to augmenting ART and suppressing replication of drug-resistant virus during chronic infection. Here, we report on treatment of macaques chronically infected with SIVmac239\u0394nef with a short-term regimen of tenofovir and challenged with drug-resistant SIV. Our results indicate that tenofovir given to macaques with established anti-viral immunity can prevent replication of drug-resistant virus in the setting of chronic SIV infection.4 TCID50 of SIVmac055. Tenofovir treatment was continued for an additional 2 weeks after SIVmac055 inoculation, and virus replication, CD4/CD8 T cell counts, and clinical adverse events were monitored at regular intervals  that experienced a transient drop in CD4+ T cell counts. None of the macaques exhibited any serious adverse events associated with tenofovir treatment.To evaluate the dose and replicative capacity of SIVmac055 in the presence of tenofovir, four drug-na\u00efve adult rhesus macaques were subcutaneously given tenofovir daily for 4 weeks prior to intravenous inoculation with 105 SIV RNA copies/ml plasma. Viral loads remained elevated, and 3 of 4 macaques developed symptoms of simian AIDS and were euthanized within 12 to 15 months after infection. These macaques experienced a significant decline in CD4+ T cells associated with SIVmac055 infection   allele-specific real-time PCR with molecular beacons to discriminate between the two viruses, 2) PCR to detect wild-type and nef-deleted alleles, and 3) PCR amplification and direct sequencing of regions of the SIV pol gene to identify drug resistance mutations within RT.After 4 weeks of drug intervention, the tenofovir-treated and control macaques were intravenously challenged with 10nef alleles demonstrated that, in the first 2 weeks after challenge, the replicating viral population in macaque 1494 was predominantly SIVmac239\u0394nef. However, 6 to 7 weeks after challenge, viral RNA sequences consistent with SIVmac055 were detected. By 10 weeks and thereafter, viral RNA contained wild-type nef alleles and SIVmac239\u0394nef pol sequences suggesting that virus recombination between SIVmac055 and SIVmac239\u0394nef had occurred in this animal. To confirm these results, a 7.0 kb fragment  revealed the presence of SIVmac055 in both animals within several weeks of intravenous challenge Table . Sequenc to 9894 ) spanninlls Fig. .pol genes revealed drug resistance mutations in RT consistent with SIVmac055  also had evidence of SIVmac055 infection with low levels of virus replication. Sequenced 55 Table . An addiths Fig. , and thiThree additional macaques infected with SIVmac239\u0394nef  were treated with tenofovir as described and monitored for viral replication after challenge with SIVmac055. Unexpectedly, one of the tenofovir-treated animals (1498) died within hours of the SIVmac055 challenge. Autopsy revealed severe hepatic degeneration consistent with an idiosyncratic drug reaction to tenofovir and reduced clearance of the anesthetics.nef deletions and pol sequences consistent with SIVmac239\u0394nef  continued to receive daily drug treatment for an additional 2 weeks after SIVmac055 challenge with no adverse events. In these macaques, SIVmac055 RNA was undetectable and remained so throughout a year of follow-up. Several blips of viremia occurred, and analyses of both viral RNA and DNA demonstrated persistence of -up Fig. . Both an+ T cell responses were evaluated in both tenofovir-treated and control macaques before and after challenge with SIVmac055. Antibodies to both SIV gp130 and p27 antigens were detected in all animals prior to SIVmac055 challenge. Titers of anti-gp130 antibodies did not change significantly in any of the macaques as a consequence of tenofovir treatment and similar patterns of responses were seen in both treated and control animals  and untreated  macaques  responses in this study due to sample limitations, we have previously shown that macaques infected with SIVmac239\u0394nef develop both SIV-specific neutralizing antibodies [+ T cell responses [Overall, macaques infected with SIVmac239\u0394nef exhibited SIV-specific antibodies and CD8tibodies  and funcesponses , and theThe results of this study provide further support for the concept that antiretroviral drug treatment augmented by virus-specific immunity can prevent replication of drug-resistant virus during chronic SIV infection. The animals used in this study were previously found to have robust and broadly reactive SIV-specific immune responses induced by infection with live, attenuated SIV . These a+ T cells, which control replication of SIV during both acute and chronic phases of infection [+ T cells are depleted in vivo in macaques on long-term tenofovir therapy, viral rebound is associated with the presence of SIV variants harboring drug resistance mutations and reduced sensitivity to tenofovir [Tenofovir has been shown to mediate potent and durable suppression of virulent SIV in both adult and neonatal macaques ,23,26-32nfection ,33,34, snfection . Interesenofovir , suggestin vivo depletion of CD8+ T cells in macaques infected with SIVmac239\u0394nef results in an increase in viremia, which is temporally controlled with restoration of the CD8+ T cell population, thus supporting the role of these cells in suppressing endogenous virus replication [Our results are consistent with this observation in macaques with strong anti-viral immune responses induced by chronic infection with live, attenuated SIV. Previously we demonstrated that lication . Furtherlication . In the lication .But when combined with a short-course of tenofovir, replication of SIVmac055 was inhibited, suggesting that antiviral immunity can be effective when acting in concert with ART to suppress replication of drug-resistant virus. The macaques in this study were treated with tenofovir for 4 weeks prior to challenge with drug-resistant SIV. While tenofovir has direct antiviral effects against SIV through potent inhibition of the viral RT, it is also known to stimulate secretion of a number of immunomodulatory cytokines and chemokines, including interleukin-1\u03b2 (IL-1\u03b2), IL-10, tumor necrosis factor-\u03b1, RANTES and macrophage inflammatory protein-1\u03b1 ,38. Thes+ T cell epitopes. However, in untreated macaques that failed to be protected, replicating virus contained resistance mutations consistent with SIVmac055 indicating persistence of the drug-resistant genotype. It is known that cytotoxic T lymphocytes (CTL) from HIV-1 infected patients on antiretroviral therapy continue to respond in vitro to peptides containing drug resistance mutations [Our current findings suggest that replication of drug-resistant SIVmac055, which harbors several resistance and compensatory mutations in RT, can be inhibited in immunocompetent animals receiving concurrent therapeutic intervention with tenofovir. SIVmac055 is an uncloned virus stock derived from an infant macaque infected with SIVmac251 and receiving long-term therapy with tenofovir and is therefore genotypically closely related to SIVmac251 . This rautations ,41, and Tenofovir was withdrawn 2 weeks after SIVmac055 challenge in the treated macaques with no evidence of viral rebound, and only intermittent detection of SIVmac239\u0394nef, suggesting immune-mediated control of viremia is sustained in the absence of further drug intervention. No evidence was found for SIVmac055 infection in the tenofovir-treated macaques, in contrast to na\u00efve control animals that received pre-exposure prophylaxis with tenofovir and experienced significant rebound of SIVmac055 viremia and clinical progression after drug was withdrawn. Taken together, these data indicate that SIVmac055 is able to infect and replicate in the presence of tenofovir during primary infection, and immune control of viremia is not sustained when drug is withdrawn. Similarly, macaques infected with SIVmac239\u0394nef that developed SIV-specific immune responses, but were not treated with tenofovir, were unable to prevent infection and replication of SIVmac055 indicating that antiviral immunity alone is insufficient to suppress drug-resistant SIV. Only those macaques that had both demonstrable antiviral immunity to SIV and short-term tenofovir treatment were able to prevent SIVmac055 infection, and these animals sustained low levels of viremia with SIVmac239\u0394nef for over three years after the drug was withdrawn.+ T cells and immune function [in vivo is unknown, but our data in non-human primates support the idea that immune mechanisms contribute significantly to suppression of drug-resistant virus during chronic infection, and can augment the efficacy of ART. Strategies that seek to combine antiretroviral therapy with stimulation of HIV-1 specific immune responses [+ T cell responses, may be effective at treating HIV-1 infection and preventing therapeutic failure associated with the emergence of drug-resistant virus.In humans, potent suppression of chronic HIV-1 replication is achieved through therapeutic administration of antiretroviral drugs, which can reduce viremia often to undetectable levels for sustained periods, and can lead to partial restoration of CD4function . The extesponses , particuMacaca mulatta) were used in this study. Five were infected with SIVmac239\u0394nef  by intravenous inoculation of 4 \u00d7 103 50% tissue-culture infective doses (TCID50) as part of a larger vaccine study [+ T cell responses [A total of nine adult rhesus macaques  at a dose of 30 mg/kg per body weight for six weeks by daily subcutaneous injection.in vitro associated with a K65R mutation in the viral reverse transcriptase [4 TCID50 of SIVmac055 and virus replication was monitored by real-time PCR and molecular beacons designed to differentially quantify SIVmac239\u0394nef and SIVmac055 RNA in plasma and PBMC as previously described [SIVmac055  was first isolated from an infant macaque infected with SIVmac251 and receiving prolonged therapy with tenofovir. SIVmac055 exhibits a 5-fold increased resistance to tenofovir criptase ,40. A stescribed .pol and nef genes were analyzed by cloning and sequencing as described before [To further investigate the genomic characteristics of replicating viruses, SIV d before .+ T cells was modified from Larsson et al. [The ELISPOT assay used for detection of IFN-\u03b3 secretion by CD8n et al.  and prevn et al. ,43. Antin et al. ,35. CD4 n et al. .The author(s) declare that they have no competing interests.+ T cell assays and participated in the design of the study. RIC participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript.KJM carried out SIV viral load quantification and sequence analyses, participated in the conception and design of the study, and drafted the manuscript. JMB carried out immunoassays for quantifying SIV antibody responses. AG coordinated all live animal work including tenofovir treatment and sample collection. PM participated in the conceptual design of the study. DFN conducted CD8"}
+{"text": "Against the constant threat of infection by bacteria or viruses, one line of defense for the eukaryotic cell is the autophagosome. This double-membrane structure, which buds off from the endoplasmic reticulum, traps cytoplasmic intruders and, upon maturation, merges with a lysosome to destroy them. In this issue, however, Karla Kirkegaard and colleagues show that for one class of viruses, the autophagosome is not a holding cell but a breeding ground, and may even provide a novel escape route.The viruses in question are picornaviruses, which include polioviruses and rhinoviruses. Infection of human cells with poliovirus is known to induce proliferation of double-membrane cytoplasmic vesicles that are morphologically similar to autophagosomes, but the origin and ultimate identity of these vesicles has not been resolved. To test whether these viral-laden vesicles are truly autophagosomes, the authors visualized two proteins: LC3, a specific marker for autophagosomes, and 3A, a part of the poliovirus RNA replication complex. After infection, these proteins colocalized, indicating the poliovirus was indeed within the autophagosome-like vesicles. LC3 also colocalized with LAMP1, a marker for lysosomes, indicating these vesicles mature in a manner similar to that of autophagosomes. This same effect could be induced simply by expressing two viral proteins.All these results indicate that the virus stimulates production of vesicles that bear the traits of autophagosomes and contain the virus, but they don't indicate what the consequence is for viral replication. To determine that, the authors increased autophagosome production with two known stimulators of autophagy, tamoxifen and rapamycin. But rather than protecting the cell, this stimulation increased viral yield either 4-fold, in the case of tamoxifen, or 3-fold, for rapamycin. Conversely, inhibiting autophagosome production reduced viral yield. From these results, it seems the virus has subverted the components of the autophagy pathway for its own uses.Inhibiting autophagosome production reduced viral yield inside the cell, but even more so outside. While they were not able to exclude other mechanisms, the authors argue that one possible explanation is that these vesicles are used by the virus to exit from the cell. Supporting this view, they produced electron micrographic images consistent with the fusion of the autophagosome with the plasma membrane and the extracellular release of its contents. This suggests that the virus, which is known to lyse cells to release new viral particles, has another, less lethal means of escape. This may increase the virus's chance of avoiding immune system detection as it infects new cells."}
+{"text": "Both classical and biochemical complementation analysis leads us to predict that the majority of MHV-A59 ORF1a replicase gene products  form a single complementation group (cistron1) while the replicase gene products encoded in ORF1b  are able to function in trans and comprise at least three, and possibly five, further complementation groups (cistrons II\u2013VI). Also, we have identified mutations in the non-structural proteins nsp 4, nsp5, nsp10, nsp12, nsp14, and nsp16 that are responsible for the ts phenotype of eight MHV-A59 mutants, which allows us to conclude that these proteins are essential for the assembly of a functional replicase-transcriptase complex. Finally, our analysis of viral RNA synthesis in ts mutant virus-infected cells allows us to discriminate three phenotypes with regard to the inability of specific mutants to synthesize viral RNA at the non-permissive temperature. Mutant LA ts6 appeared to be defective in continuing negative-strand synthesis, mutant Alb ts16 appeared to form negative strands but these were not utilized for positive-strand RNA synthesis, and mutant Alb ts22 was defective in the elongation of both positive- and negative-strand RNA. On the basis of these results, we propose a model that describes a pathway for viral RNA synthesis in MHV-A59-infected cells. Further biochemical analysis of these mutants should allow us to identify intermediates in this pathway and elucidate the precise function(s) of the viral replicase proteins involved.The coronavirus replicase-transcriptase complex is an assembly of viral and cellular proteins that mediate the synthesis of genome and subgenome-sized mRNAs in the virus-infected cell. Here, we report a genetic and functional analysis of 19 temperature-sensitive  Coronaviruses infect both humans and animals and are associated mainly with respiratory and enteric diseases. The recent outbreak of SARS emphasizes the need to develop new strategies to control these infections. This paper focuses on the proteins involved in the replication of the coronavirus genome and the production of viral mRNAs in the host cell. These so-called replicase-transcriptase proteins are likely to make good targets for the development of anti-coronaviral drugs. The approach used here is to analyze conditional, temperature-sensitive mutants of Murine hepatitis virus that are normal at 33 \u00b0C (the permissive temperature) but are unable to replicate and transcribe viral RNAs at 39.5 \u00b0C (the restrictive temperature). By identifying the genetic changes responsible for these temperature-sensitive mutations and by analyzing the precise nature of the defect in RNA synthesis at the restrictive temperature, the authors are able to propose a model that describes a pathway for viral RNA synthesis in the infected cell. Further analysis of these mutants should allow the elucidation of the precise function(s) of the viral proteins involved. The genomic RNA encodes the structural proteins of the virus, non-structural proteins involved in viral RNA synthesis (the nsp or replicase proteins), and proteins that are non-essential for replication in cell culture but appear to confer a selective advantage in vivo (accessory proteins) /ml). Thus, this protocol prevented the production of revertant virus by a second round of replication. Complementation was measured by determining the complementation index (CI) as described in Materials and Methods. By definition, if the mutations are in the same cistron, the viruses will not complement each other. On the other hand, if the mutations are in different cistrons, the mutants will complement each other and progeny ts virus will be recovered.We began our complementation analyses using Alb ts16 and LA ts6 are shown in ts16 and LA ts6 had a mutation in the same cistron and were, therefore, in the same complementation group. We next determined if Alb ts22 would complement Alb ts16 or LA ts6. As shown in ts22 clearly complemented both Alb ts16 and LA ts6. Therefore, the mutation in Alb ts22 was in a different cistron than the mutations in Alb ts16 and LA ts6, thus identifying a second complementation group. In a series of further experiments, we extended our complementation analysis to include Alb ts6, W\u00fc ts18, W\u00fc ts36, and W\u00fc ts38. Using the same assay, we found that Alb ts6 complemented Alb ts22 but failed to complement Alb ts16 or LA ts6. Thus, we conclude that Alb ts6 was in the same complementation group as Alb ts16 and LA ts6. Finally, we found that W\u00fc ts18, W\u00fc ts36, and W\u00fc ts38 were in a different complementation group(s) from that of either Alb ts6 or Alb ts22, and thus, these mutants defined at least a third complementation group.The results of six individual crosses between Alb ts mutants of MHV-A59 described above, values for the CI were always less than two or more than five and thus readily interpreted as positive or negative without correction for the presence of revertants or recombinants. However, from the results we obtained, it was clear that recombination did occur when there was complementation. The EOP of the virus harvested from cells co-infected with two complementing viruses was usually ~10\u22122, and not the EOP of the individual ts mutants, which was 10\u22124\u201310\u22128. This result is in contrast to similar experiments using Sindbis virus in complementation assays, where we obtained similar EOPs to the input viruses when assaying the progeny from complementing ts mutants (unpublished data). We took these results to indicate that complementation allowed recombination in MHV.In our analysis of the ts mutants. We reasoned that because recombination appeared to be driven by complementation, biochemical complementation  might be detected in cells co-infected with complementing ts mutants, but not in cells infected with ts mutants in the same complementation group. We devised such an assay. Cells were infected at the permissive temperature and were then re-fed with medium prewarmed to the non-permissive temperature and containing dactinomycin to inhibit DNA-dependent RNA synthesis and 3H-uridine to label viral RNA. The infected cells were incubated until 7\u20138 hpi at 39 \u00b0C to 40 \u00b0C or 8\u201312 hpi at 30 \u00b0C, and RNA synthesis was measured by the incorporation of 3H-uridine into acid-precipitable material. ts6, Alb ts16, Alb ts22, and LA ts6 mutants. The data show that at 40 \u00b0C, the mutants Alb ts6, Alb ts16, and LA ts6 were not able to rescue the RNA-negative phenotype of each other and thus, the three mutants were in the same complementation group. In contrast, Alb ts22 was able to rescue the RNA-negative phenotype of Alb ts6, Alb ts16, and LA ts6 and thus, was the sole member of a separate complementation group. This result is identical to that obtained using classical complementation assays and served to validate the new method. The assay was as specific as classic genetic complementation, which measures progeny virus production, but is less time-consuming.This finding provided the means to develop a more convenient and more rapid method of determining complementation for MHV-A59 ts17, Wu ts36, Wu ts38, and Wu ts18 define not one but two additional complementation groups. We found Alb ts17 and W\u00fc ts38 belong to the same complementation group based on their failure to complement each other's defects. However, both of these mutants complemented W\u00fc ts36 and W\u00fc ts18, which did not complement each other.Using this assay, we were able not only to confirm the prediction of at least three complementation groups that were obtained using classical complementation procedures but also to identify a fourth complementation group. The results are presented in ts mutants of MHV-A59 assayed to date. The numbers shown in 3H-uridine incorporation was less than that obtained from mock-infected cells. With this type of assay, we took less than 1% of the MHV-A59 incorporation as indicating failure to complement and greater than 1% as evidence of positive complementation. Based on these results, it was possible to assign a further ten mutants  to the same complementation group as Alb ts6, Alb ts16, and LA ts6 and, it was possible to assign mutant Ut ts145 to the same complementation group as W\u00fc ts18 and W\u00fc ts36. Thus, it was possible to assign the entire collection of 19 RNA-negative ts mutants of MHV to one of four complementation groups, which we have tentatively named cistrons I, II, IV, and VI based on the locations identified for their causal point mutations (see below). This numbering scheme leaves open the possibility of finding two additional complementation groups (cistrons III and V) in the future that would represent gene products of ORF1b (see below).Finally, we extended this assay to include the full collection of mutants that we have available and ts mutant/revertant pairs. In each case, a single nucleotide change was identified as the mutation responsible for the ts mutant phenotype. Using the numbering that we have assigned to the infectious cDNA clone of the MHV-A59 genome  uridine (\u22651.0 TBq/mmol) was added to the medium at either 1.85 or 7.4 MBq/ml. After incubation, the radioactive medium was removed and the cells dissolved with 5% lithium dodecyl sulfate and 200 \u03bcg/ml proteinase K in LEH buffer  at 2\u20135 \u00d7 105 cells per ml. The DNA was sheared by repeated passage through a 27-gauge needle attached to a 1-ml tuberculin syringe. Triplicate samples of 5 \u00d7 104 cells were precipitated with trichloroacetic acid and the precipitates collected on glass fiber filters , dried under a heat lamp, and the radioactivity determined by liquid scintillation spectroscopy. To measure negative-strand synthesis, the dissolved cells were extracted with low pH phenol (pH 4.3), which removed DNA from the aqueous phase, and then with cholorofom:isoamyl alcohol (95:5), and the RNA was precipitated with ethanol. RF RNA was generated by treatment of the RNA with RNase T1  and collected by chromatography on CF-11 cellulose and ethanol precipitation. The incorporation of 3H-uridine into negative strands was measured by denaturing the RF RNA with heat and annealing in the presence of >100-fold excess of unlabeled RNA obtained from purified virions of MHV [Viral RNA synthesis was measured by determining the amount of s of MHV .8 17Cl-1 cells that had been infected at a MOI of ~10 pfu/cell and incubated in low pH DMEM at 30\u201333 \u00b0C. The medium from the infected cells (~225 ml) was collected at 24 hpi and clarified at 4,000 rpm for 30 min. The virions were pelleted by centrifugation at 24,000 rpm for 3 h at 4 \u00b0C. The virus pellet was allowed to suspend overnight on ice in 0.4 ml/tube of 0.15M NaCl and 20 mM HEPES (pH 6.6). The suspended virus from six tubes was pooled and layered over one SW28 tube containing a linear gradient of 40% potassium tartrate (bottom) and 20% glycerol (top), in 0.0.2 M HEPES (pH 7.4). After centrifugation at 24,000 rpm for 3\u20134 h at 4 \u00b0C, the visible band containing the virions was collected, diluted, and pelleted by centrifugation at 24,000 rpm for 3 h at 4 \u00b0C. The pelleted virions were suspended in 0.15M NaCl and 20 mM HEPES (pH 6.6), and LiDS and proteinase K were added to 5% and 400 \u03bcg/ml, respectively, After incubation at 42 \u00b0C for 10 min, the viral RNA was extracted with phenol followed by chloroform:isoamylalcohol (19:1). Viral RNA was ethanol-precipitated and the pellet was washed with 70% ethanol, dried under vacuum, and resuspended in water. Alternatively, 107 17Cl-1 cells were infected with virus, incubated for 13 h at 30 \u00b0C to 33 \u00b0C in 7.5% CO2. The poly(A)-containing RNA was then isolated from the infected cells using oligo-dT25 Dynabeads as described previously [Two different procedures were used to obtain viral RNA for RT-PCR and sequencing. Virions were purified from ~3 \u00d7 10eviously .ts mutant and revertant pairs. To do this, we used a set of 121 synthetic oligonucleotides that are complementary to sequences spaced at approximately 350 nucleotide intervals along the positive- and negative-strand copies of the viral RNA (sequences available on request). Five oligonucleotides, P17, P31, P46, P61, and P65, were used to prime the RT of viral RNA with Superscript II RT . The reaction mix (20 \u03bcl), which contained, in addition to pre-supplied buffer, 35 ng of primer, 10\u2013100 ng of viral RNA, 1 mM dNTPs, 10 mM DTT, 25 U of RNAguard , and 200 U of reverse transcriptase, was incubated at 42 \u00b0C for 60 min and then at 94 \u00b0C for 2 min. The five cDNA templates were then amplified using eight primer pairs, P1/P16, P2/P22, P3/P30, P4/P38, P5/P45, P6/P53, P7/P60, and P8/P64, and thermostable, recombinant Taq DNA polymerase. The reaction mix (100 \u03bcl), which contained, in addition to pre-supplied buffer, 70 ng of primer pair, 1 \u03bcl of RT reaction product, 200 \u03bcM dNTPs, 2 mM MgCl2, and 2.5 U of DNA polymerase, was incubated at 94 \u00b0C for 1 min, then 94 \u00b0C for 20 s, 50 \u00b0C for 20 s, 68 \u00b0C for 3 min, for a total of 35 cycles and a final 10-min extension at 68 \u00b0C. The PCR reaction products were purified by ethanol precipitation using ammonium acetate. Finally, sequence analysis was done using primers P1\u2013P121 and standard cycle sequencing methods. Sequencing reaction mixes (10 \u03bcl), which contained 70 ng of primer, 100 ng of PCR product, and 3 \u03bcl of cycle sequencing mix , were incubated at 96 \u00b0C for 10 s, 50 \u00b0C for 5 s, and 60 \u00b0C for 4 min, for a total of 25 cycles. The reaction products were purified by retention on a size exclusion membrane  as described by the manufacturer; eluted and analyzed with an ABI 310 Prism Genetic Analyzer. Computer-assisted analysis of sequence data was done using the Lasergene bio-computing software (DNASTAR).The entire replicase gene-coding region (ORF1a and ORF1b) was sequenced for eight Figure S1ts17L and Alb ts17S are illustrated. Alb ts17 had a reversion (back mutation) frequency of 2 \u00d7 10\u22126 and there was a mixture of large and small plaques at 40 \u00b0C. The virus from the small and large plaques produced progeny that formed uniformly small or large plaques at 40 \u00b0C, respectively. At 30 \u00b0C, both 17RL and 17RS produced plaques of equal diameter and Alb 17RL produced the same size plaques at 40 \u00b0C as the parental or wt MHV-A59.The plaque morphologies of Alb (1.7 MB PPT)Click here for additional data file.Table S1(31 KB DOC)Click here for additional data file."}
+{"text": "Efficient incorporation of the cellular cytidine deaminase APOBEC3G (APO3G) into HIV-1 virions is necessary for its antiviral activity. Even though cellular RNAs are known to be non-specifically incorporated into virus particles, we have previously found that encapsidation of APO3G into HIV-1 virions is specifically enhanced by viral genomic RNA. Intracellularly, APO3G was found to form large RNA-protein complexes involving a variety of cellular RNAs. The goal of this study was to investigate the possible contribution of host RNAs recently identified in intracellular APO3G ribonucleoprotein complexes to APO3G's encapsidation into HIV-1 virions.Our results show that 7SL RNA, a component of signal recognition particles, and hY1, hY3, hY4, hY5 RNAs were present in intracellular APO3G complexes and were packaged into HIV-1 particles lacking viral genomic RNA unlike APO3G, which was not packaged in significant amounts into genomic RNA-deficient particles. These results indicate that packaging of 7SL or hY RNAs is not sufficient for the packaging of APO3G into HIV-1 virions. We also tested the encapsidation of several other cellular RNAs including \u03b2-actin, GAPDH, \u03b1-tubulin, and small nuclear RNAs and determined their effect on the packaging of APO3G into nascent virions. Again, we were unable to observe any correlation between APO3G encapsidation and the packaging of any of these cellular RNAs.The results from this study support our previous conclusion that viral genomic RNA is a critical determinant for APO3G incorporation into HIV-1 virions. While most cellular RNAs tested in this study were packaged into viruses or virus-like particles we failed to identify a correlation between APO3G encapsidation and the packaging of these cellular RNAs. The pro virions -11. A nu virions ,11-17. Isidation ,11,14,17omic RNA . Furtheromic RNA . HIV-1 vomic RNA . Other somic RNA ,19,20.APO3G is an RNA binding protein  and receRetroviruses including HIV-1 package small cellular RNAs in addition to two copies of viral genomic RNA -32. It iThe current study aimed at the investigation of the possible involvement of cellular RNAs in the encapsidation of APO3G into HIV-1 virions. We focused on RNAs previously identified in intracellular APO3G complexes  is a component of the signal recognition particle (SRP), which is critical for the targeting of nascent secretory and membrane proteins to the endoplasmic reticulum membrane (for review see ). SRP54 First, we verified the association of 7SL RNA with SRP54 in normal HeLa cells. For that purpose, HeLa cell lysates were adsorbed to SRP54 reactive autoantibodies and immunoprecipitation of SRP54 was confirmed by immunoblotting using an SRP54-specific antibody Fig. , mock anNext, the packaging of SRP54 protein into HIV-1 virions was tested. Virus particles were produced as described for figure In vitro studies demonstrated the ability of APO3G to interact with viral Gag protein and the nucleocapsid region of the viral Gag precursor was identified as the likely APO3G binding site [There is general agreement in the literature that APO3G can severely impair replication of HIV-1 and other primate lentiviruses lacking functional Vif proteins. It is also uncontested that the antiviral activity of APO3G \u2013 with the notable exception of resting CD4+ T cells  \u2013 requiring site ,12-14,16ing site ,11-14,16ing site ,11,14,16ing site .The current study was stimulated by recent reports on the presence of cellular 7SL RNA and snRNAs in HIV-1 virions or retroviral particles ,32,41 asU6 snRNA was previously identified in RSV particles . Interesvif-defective HIV-1 particles package a variety of cellular RNAs. Most of the cellular RNAs tested, except hY RNAs, were packaged independent of viral genomic RNA. Packaging of hY RNAs was NC-dependent and inhibited by viral genomic RNA. In all experiments, APO3G packaging correlated well with the presence of viral genomic RNA but not with the presence of any of the cellular RNAs tested. Thus, our data do not support a model in which APO3G is packaged through non-specific or specific interaction with cellular RNAs. In particular, we can rule out that packaging of 7SL RNA is sufficient for the encapsidation of APO3G. Instead, we propose that packaging of APO3G into virus particles is mediated through interaction with viral genomic RNA.We have demonstrated that vif-defective molecular clone pNL4-3\u0394Vif [vif-defective HIV-1 virus stocks. Plasmid pC-Help\u0394Vif was used for the production of vif-defective \u03a8- virus-like particles (VLP). These particles contain undetectable levels of viral genomic RNA [vif-defective pNL4-3 vector [+ but do not support the encapsidation of APO3G [vif-defective variant of DB653 [The L4-3\u0394Vif  was usedomic RNA . Plasmidomic RNA  and was 3 vector . NL4-3mSof APO3G . A vif-dof DB653  was consof DB653  and untaof DB653 .2 flasks to about 80% confluency. Cells were transfected using LipofectAMINE PLUS\u2122  following the manufacturer's recommendations. A total of 5 \u03bcg of plasmid DNA per 25 cm2 flask (5 \u00d7 106 cells) was generally used. Cells were harvested 24 h post transfection.HeLa cells, which do not express endogenous APO3G, were propagated in Dulbecco's modified Eagles medium (DMEM) containing 10% fetal bovine serum (FBS). For transfection, HeLa cells were grown in 25 cmVirus stocks were prepared by transfecting HeLa cells with pNL4-3\u0394Vif, pC-Help\u0394Vif, or pNL4-3mS.1\u0394Vif DNAs in the presence or absence of APO3G expression vector as indicated in the text. Virus-containing supernatants were harvested 24 h after transfection. Cellular debris was removed by centrifugation  and clarified supernatants were filtered (0.45 \u03bcm) to remove residual cellular contaminants. For immunoblot analysis of viral proteins and RNA extraction, virus-containing supernatants 7 ml) were concentrated by ultracentrifugation through 2 ml of 20% sucrose in PBS as described previously [ ml were APO3G was identified using a polyclonal rabbit serum against a synthetic peptide comprising the 17 C-terminal residues of APO3G. Serum from an HIV-positive patient (APS) was used to detect HIV-1-specific capsid (CA) proteins. Tubulin was identified using an \u03b1-tubulin-specific monoclonal antibody . SRP54 protein was detected with a SRP54-specific monoclonal antibody . Immunoprecipitation of APO3G was done using a polyclonal antibody raised against the myc tag . A human SRP54-reactive autoimmune serum was used for immunoprecipitation of SRP54 protein .7 cells with X-100 lysis buffer . For Western blot analysis 50 \u03bcl aliquot was taken and mixed with equal volume of sample buffer . Proteins were solubilized by boiling for 5 min at 95\u00b0C with occasional vortexing of the samples to shear chromosomal DNA. Residual insoluble material was removed by centrifugation . For immunoblot analysis of virus-associated proteins, concentrated viral pellets were suspended in a 1:1 mixture of PBS and sample buffer and boiled. Cell lysates and viral extracts were subjected to SDS-polyacrylamide gel electrophoresis; proteins were transferred to polyvinylidene difluoride membranes and reacted with appropriate antibodies as described in the text. Membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies  and visualized by enhanced chemiluminescence (Amersham Bioscience).HeLa cells transfected with APO3G were used to detect cellular APO3G expression and untransfected HeLa cells were used for the detection of endogenous SRP54 protein by immunoblotting with appropriate antibodies. For immunoblot analysis of cellular proteins, whole cell lysates were prepared as follows. Cells were washed once with PBS, suspended in 450 \u03bcl/10HeLa cells were transfected with pcDNA-APO3G-MycHis. Cells were harvested at 24 h post transfection cell lysates were prepared as follows: Cells were divided into two unequal fractions (30% and 70%). The larger fraction was used for immunoprecipitation studies and the smaller fraction was used for RNA extraction (see below). For immunoprecipitation, cells were washed once with PBS and lysed in 450 \u03bcl of lysis buffer . The cell extracts were clarified by centrifugation  and the supernatant was incubated on a rotating wheel for 1 h at 4\u00b0C with protein A-Sepharose beads  coupled with (IP) or without (Ctrl) anti-myc rabbit polyclonal antibody . Immunocomplexes were washed three times with wash buffer . Bound proteins were eluted form beads by heating in sample buffer for 5 min at 95\u00b0C and analyzed by immunoblotting using antibodies as indicated in the text. For immunoprecipitation of APO3G-RNA complexes, cell extracts were subjected to immunoprecipitation by antibody covered beads or control beads as described above and washed three times with RNA-protein binding buffer . Bound RNA was then extracted as described below.Total cellular RNA was extracted from untransfected and transfected HeLa cells using the RNeasy RNA extraction kit  following the manufacturer's instructions. To isolate RNA from immunocomplexes, beads were washed three times with RNA-protein binding buffer . RNA was then extracted using RNeasy RNA extraction kit. For isolation of SRP54-associated RNA, SRP54 was precipitated with SRP54-reactive human autoantibodies derived from a patient with polymyositis  prior to the RT-PCR reaction. RNA concentrations were determined by spectrophotometry. RT-PCR was performed using equal amounts of RNA and the one-step RT-PCR kit  according to the manufacturer's instruction. Primers for the amplification of specific RNAs are listed in table The author(s) declare that they have no competing interests.M.K. conceived the study, was leading the execution of the experiments, and participated in the writing of the manuscript. K.S. coordinated and supervised the study and was involved in the writing of the manuscript. R.G., S.O., E.M., H.T., and S.K. participated in virus production and sample preparation and provided critical comments on the manuscript. All authors read and approved the final manuscript."}
+{"text": "The Gag protein of Mason-Pfizer monkey virus, a betaretrovirus, contains a phosphoprotein that is cleaved into the Np24 protein and the phosphoprotein pp16/18 during virus maturation. Previous studies by Yasuda and Hunter (J. Virology. 1998. 72:4095\u20134103) have demonstrated that pp16/18 contains a viral late domain required for budding and that the Np24 protein plays a role during the virus life cycle since deletion of this N-terminal domain blocked virus replication. The function of the Np24 domain, however, is not known.Here we identify a region of basic residues (KKPKR) within the Np24 domain that is highly conserved among the phosphoproteins of various betaretroviruses. We show that this KKPKR motif is required for virus replication yet dispensable for procapsid assembly, membrane targeting, budding and release, particle maturation, or viral glycoprotein packaging. Additional experiments indicated that deletion of this motif reduced viral RNA packaging 6\u20138 fold and affected the transient association of Gag with nuclear pores.These results demonstrate that the Np24 domain plays an important role in RNA packaging and is in agreement with evidence that suggests that correct intracellular targeting of Gag to the nuclear compartment is an fundamental step in the retroviral life cycle. Betaretroviruses genus, formerly known as D- and B-type retroviruses, assemble their capsids in the cytoplasm of infected cells instead of at the plasma membrane like most retroviruses. The B-type viruses contain prominent surface glycoproteins and spherical, eccentric capsids and include mouse mammary tumor virus (MMTV) and exogenous and endogenous MMTV-like retroviruses in mice and humans  leucine. Viral particles were pelleted through a 25% sucrose cushion, lysed, and immunoprecipitated using an anti-M-PMV antisera that recognizes the Gag cleavage products as well as gp70 and gp20. Figure \u0394KR processing or an inability of the mutant particles to incorporate the viral glycoproteins.The cell fractionation and pulse-chase experiments combined with the EM analyses showed that the \u0394KKPKR deletion mutant was released from cells as virus-like particles. Furthermore, the presence of reverse transcriptase activity and the CA p27) protein in the culture medium of \u0394KKPKR transfected cells suggest that the deletion did not affect PR-mediated processing of Gag, Gag-Pro or Gag-Pro-Pol Fig.  and 2. T7 proteingag-, pol-, and env-encoded viral proteins, semi-quantitative RT-PCR assays were utilized to address whether the deletion of the KR box altered packaging of genomic RNA into virions. Equivalent amounts of virus, normalized by p27 content from wild-type and mutant virions were pelleted through a 20% sucrose cushion and resuspended in PBS and the viral RNAs were extracted. Two-fold serial dilutions of viral RNAs were used for RT-PCR reactions using primers to amplify CA-coding sequences. The relative amounts of viral RNA that were packaged were estimated by determining the end-point dilution within which viral cDNAs could be detected by ethidium bromide staining. As shown in this representative experiment, the deletion of the KKPKR motif resulted in a 6\u20138 fold decrease in genome packaging, relative to wild-type  and bovine leukemia virus (BLV) which demonstrated that basic residues in the regions of Gag proteins distant from the RNA binding motif within NC influences both Gag targeting and viral RNA packaging  methionine-cysteine . The cells were incubated for 30 minutes at 37\u00b0C, 5% CO2. Cells were either immediately lysed (pulse) or washed with complete medium and then incubated for 1, 2, 3, 4, or 8 hours in complete medium (chase) prior to lysis.For this, subconfluent 60 mm diameter tissue culture dishes containing either untransfected and transfected COS-1 cells were washed twice in DMEM without methionine or cysteine . Cell monolayers were lysed in 1 ml lysis buffer A  containing PMSF, leupeptin, pepstatin, and aprotinin for 30 minutes on ice. Cell debris and nuclei were removed by centrifugation for 2 min in a microfuge. The pellets were discarded and the capsid-containing supernatants were adjusted to 1\u00d7 lysis buffer B by adding 0.1% SDS. All lysates were precleared by incubation with inactivated, formalin-fixed escribed . Immunop3H] leucine was done to assess glycoprotein incorporation and Pr78 processing. Transfected COS-1 cells were starved in leucine-free DMEM for 90 minutes, and labeled overnight with [3H] leucine . The culture medium was filtered with a 0.45 \u03bcm syringe filter, and [3H] leucine-labeled viruses were pelleted through a 25% sucrose cushion by centrifugation at 350,000 \u00d7 g in a TLA 100.3 rotor for 30 minutes at 4\u00b0C. After the viral pellet was solublized in 1\u00d7 lysis buffer B, the viral proteins were using goat anti-M-PMV antibodies and analyzed as described above.Steady state radiolabeling with [2) with 8 \u03bcCi [32P] \u03b1-TTP  and 1.25 \u03bcg poly (A) \u2013 oligo (dT)15 (Roche). The RT reaction was incubated at 37\u00b0C for 2 hours. 10 \u03bcl of the RT reaction was spotted onto a piece of Whatman DE81 paper and allowed to dry. The filter paper was washed twice for 15 min in 2\u00d7 SSC buffer , twice briefly in 95% EtOH, and once in distilled water. The filters were dried and [32P] incorporation was measured by scintillation counting.The infectivity of wild-type and mutant viruses were determined by measuring the increase of reverse transcriptase (RT) activity in the culture supernatants of inoculated HOS cell cultures at various times postinfection. Culture medium was harvested from COS-1 cells that had been transfected 48 h previously with either wild-type or mutant DNA. Loose cells and cellular debris were pelleted by centrifugation for 2 min in a microfuge and the level of RT activity in the clarified culture medium was measured. Hos cells were infected with equivalent amount of RT-containing in the presence of 4.0 \u03bcg/ml of polybrene. Culture fluids were harvested at various days postinfection and assayed for RT activity. RT assays were carried out by pelleting virus from medium by centrifugation at 350,000 \u00d7 g in a TLA 100.3 rotor for 30 minutes at 4\u00b0C. The viral pellet was lysed in 12 \u03bcl of Virion Lysis Buffer  on ice for 15 min. 7.5 \u03bcl of virion lysates were added to 30 \u03bcl of RT Reaction Buffer . First-strand cDNA (5 \u03bcl) were amplified by PCR using the following oligos 5'-CCGCTCGAGCGGGCCGCCATGCCGGTGGCTGAAACCGTTG and 5'-GCTCTAGAGCGGCGGCCATGGCCAGG to amplify M-PMV CA sequences. The relative amount of viral RNA packaged into viral particles was estimated by end-point dilution.Medium from transfected COS-1 cells were clarified and virus was pelleted through a 20% sucrose cushion at 207,570 \u00d7 g in an SW41 rotor for 2 hours at 4\u00b0C and resuspended in 30 \u03bcl of PBS. The amount of viral particles was normalized by quantitation of p27 detected by immunobloting. RNA was extracted from equivalent amounts of virus using QIAamp Viral RNA Mini Kit  as per manufacturers suggestions. Purified RNA was treated with 1 U of Rnase-free Dnase I  for 30 min at 37\u00b0C, followed by inactivation at 70\u00b0C for 30 min. Purified RNA from equivalent amounts of virus was diluted 1:1,000 followed by 2-fold serial dilutions. 5 \u03bcl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)2PO4 and 5 mM phosphoric acid). The cells were rinsed for 30 min with 0.1 M phosphate buffer, followed by osmication (2% OsO4 in phosphate buffer) for 1 hour. The cultures were washed and dehydrated with a graded series of ethanol , followed by a graded series of ethanol/Epon 812 (Shell) mixtures . The cells were infiltrated with pure Epon 812 and polymerized at 60\u00b0C for 48 hours. Thin sections were made with a LBK Ultrotome III, mounted on copper grids, and stained with 2% uranyl acetate and lead citrate. Thin sections were examined and photographed with a HitachiH-7500 transmission electron microscope operated at 60 Kv.Transmission Electron Microscopy (TEM) was utilized to view assembled intracellular procapsids. Transfected COS-1 cells were fixed for 1 hour with two changes of 3% glutaraldehyde in 0.1 M phosphate buffer , fixed in either 4% paraformaldyhyde in PBS for 20 minutes at room-temperature and then subsequently permiabilized with 0.2% TX-100 in PBS for 5 minutes at room-temperature, or fixed in 100% methanol at -20\u00b0C for 10 minutes. The coverslips were washed with PBS, and blocked with Blocking Buffer 1  for 5 minutes, and then blocked with Blocking Buffer 2  for 5 min. Affinity purified anti-Pr78 and MAb414  were incubated on the coverslips for 45 min at 37\u00b0C. The primary antibodies were removed and the coverslips were blocked as they had been previously. Cy2 and Cy5 conjugated secondary antibodies  were incubated on the cover-slips for 30 min at 37\u00b0C and washed in PBS with 0.2% tween 20. The coverslips were mounted on slides using GEL-mount and analyzed by confocal microscopy (Olympus FV500 w/upright BX Olympus florescence microscope). 0.3 \u03bcm Z-sections were stacked and orthogonal views through the cell were generated using Flowview imaging analysis software (Olympus).The intracellular localizations of Pr78"}
+{"text": "Saccharomyces cerevisiae is a well-established model system for understanding fundamental cellular processes relevant to higher eukaryotic organisms. Less known is its value for virus research, an area in which Saccharomyces cerevisiae has proven to be very fruitful as well. The present review will discuss the main achievements of yeast-based studies in basic and applied virus research. These include the analysis of the function of individual proteins from important pathogenic viruses, the elucidation of key processes in viral replication through the development of systems that allow the replication of higher eukayotic viruses in yeast, and the use of yeast in antiviral drug development and vaccine production.The yeast  Saccahromyces cerevisiae has been successfully used for many years as a model organism to unravel biological processes in higher eukaryotes. Because it is easy to grow and to manipulate genetically it has been always at the forefront of technical advances. For example, S. cerevisiae was the first eukayotic organism whose genome was sequenced. The complete yeast genome is known since 1996 and comprises 6000 genes, from which more than 60% have an assigned function. Remarkably, comparative genomic analysis have shown that approximately 40% of yeast genes share conserved amino acid sequences with at least one known or predicted human protein [The yeast  protein . Due to  protein ,4, DNA r protein  and the GAL1 promoter. An additional set of plasmids have been created in which the yeast proteins are fused with different tags such as the Flag epitope, the glutathione S. transferase (GST) or the histidine 6 repeat (his6) [These platforms and tools are commercially available and comprise (i) gene-deletion mutant collections that include ~6000 heterozygous diploid strains, each of which contains a deletion of a single copy of one specific gene, and ~5000 homozygous diploid and haploid strains in which each of the non-essential yeast genes is deleted ,8, (ii) t (his6) -14; (iv)t (his6) ,16, and t (his6) -19.Human immunodeficiency virus (HIV) and the Hepatitis C virus (HCV). In this respect, a detailed understanding of the biology of pathogenic viruses together with new and systematic screening tools for novel antiviral compounds will be most helpful. As for the cellular biology studies mentioned above, virologist have turned to the use of yeast as a model system to approach fundamental issues in basic and applied research of higher eukaryotic viruses. These studies have exploited the classical yeast genetics and also the recent yeast technological platforms that allow to apply a system biology approach to fundamental questions in virus biology. The present review will discuss first the expression of individual proteins from important pathogenic viruses in yeast to elucidate their function. The vast literature on the yeast two-hybrid system as a method to explore protein-protein interactions however is not a subject of this review. Second, the establishment of yeast/virus systems that allow the replication of higher eukayotic viruses in yeast. These systems have made groundbreaking contributions in the dissection of the life cycle of viruses and the host factors involved. Finally, the third and fourth sections will focus on recent advances in applied virus research, the use of yeast as a tool for antiviral drug development and as a vaccine vehicle, respectively.Viruses remain a major thread for human and animal health as well as in agriculture. Nowadays, there is still no vaccine or curative therapy available for main virus pathogens such as the HIV-1 and HCV.Although the expression of viral proteins in yeast not always necessarily reflects their role in higher eukaryotes, here we selected some examples in which the analysis in yeast of their effect on highly conserved cellular processes such as cell cycle control, apoptosis or mRNA degradation have contributed to the current understanding of the pathogenesis of important viral pathogens such as + T cells, which finally leads to the progression to AIDS [+ T cell killing by induction of mitochondrial-dependent apoptosis [Gag to the mature proteins matrix (p17), capsid (p24), nucleocapsid (p7) and p6 proteins [S. cerevisiae demonstrated that the PR specifically arrested cell growth and induced cell lysis mediated by the loss of membrane integrity [+ human T cell line, where a PR-specific inhibitor led to prevention of virus-induced cell lysis [+ T cell loss during infection. Finally, the Rev protein plays an essential role in the HIV replication cycle. Rev mediates the export of unspliced and incompletely spliced HIV mRNAs to the cytoplasm and thus, enables the production of HIV-1 particles. The important finding showing that the Rev protein mediates the export of HIV pre-mRNA by interacting with it via cis-acting Rev responsive elements (RRE) in the context of the spliceosome was first shown in yeast [S. cerevisiae of the small-nucleoporin-like protein Rip1p as the responsible cellular component for Rev-mediated export [With around 40 million people infected worldwide and no effective vaccine or curative therapy, HIV remains a major human thread. A better understanding of the HIV replication cycle and the viral and host factors involved are essential to develop new therapy options. Yeast-based studies have brought to light key aspects of the function of three HIV proteins, the viral protein R (Vpr), the protease (PR) and the regulatory viral protein (Rev). The Vpr protein plays a pivotal role in the pathogenesis of HIV-1. It is involved in the suppression of immune functions and the depletion of infected CD4 to AIDS . Howeverpoptosis . The HIVproteins . Studiesntegrity . The con capsid p, nucleocin yeast . These od export  and of td export .HCV has chronically infected more than 170 million people worldwide and is a major cause of liver cirrhosis and hepatocarcinoma. In spite of the great advances accomplished since its identification in 1989, there are still limited therapy options and no vaccine. The expression in S. cerevisiae of two HCV proteins, the non-structural protein 5a (NS5a) and the core protein, together with the construction of HCV chimeras to study HCV RNA translation have made yeast a valuable tool in HCV research. In yeast and human cells, the NS5a protein predominantly associates with the ER membrane through the highly conserved amphiphatic alpha-helix in its N-terminus [terminus ,29. Thisterminus . Interesterminus -35. HoweThe HCV core protein interacts with NS5a and is linked to many processes in HCV pathology. From mammalian studies it is known that the HCV core protein influences the transcription of cellular and viral promotors , howeverA bicistronic vector has been recently designed to study HCV RNA translation in yeast . The HCVS. cerevisiae. The first higher eukaryotic virus shown to replicate and encapsidate its genome in S. cerevisiae was the Bromo mosaic virus (BMV), a positive strand RNA ((+)RNA) virus from plants [Carnation Italian Ringspot virus (CIRV), Tomato Bushy Stunt virus (TBSV) and Cymbidium Ringspot virus (CymRSV)) or animals (Flock House virus (FHV) and Nodamura virus (NoV)), and (ii) viruses with DNA genomes that infect humans (Human papillomavirus), animals (Bovine papillomavirus) or plants (Mungbean Yellow Mosaic India Virus (MYMIV)) [An understanding of the fundamental steps of virus life cycles including virus-host interactions is essential for the design of novel effective antiviral strategies. Such understanding has been hampered by the complexity of higher eukaryotic host organisms. To overcome these experimental difficulties, systems have been developed that allow the replication of higher eukaryotic viruses in m plants ,47. This(MYMIV)) -53. Impo(MYMIV)) ,55, we wthe severe acute respiratory syndrome coronavirus (SARS). All (+)RNA viruses share common features in their replication cycles. First, the genomic RNA serves as messenger RNA (mRNA) for translation of the viral proteins and as template for replication. Since these two functions are mutually exclusive, the transfer of the genomic RNA from the cellular translation machinery to the replication complex must be highly regulated. Second, viral replication complexes are associated with intracellular host membranes which proliferate and rearrange in response to the expression of viral protein. And third, host factors are required at multiple steps of the viral replication cycle [All RNA viruses that have been shown to replicate in yeast belong to the group of (+)RNA viruses. This large virus group includes many important plant, animal and human pathogens such as HCV and on cycle -58.All the yeast/(+)RNA virus systems developed show common characteristics. (i) the viral RNA-dependent RNA polymerase (RdRp) and additional proteins required for viral replication are expressed in trans from yeast plasmids, (ii) the genomic RNA with authentic 5' and 3' ends is also transcribed from a yeast plasmid or transfected directly into the cell, and (iii) replication is monitored by detecting viral RNA via Northern blot analysis or by measuring the expression of a reporter gene inserted into the viral genome, such that its expression depends on viral RNA replication. The fact that in these systems the individual viral proteins are given in trans from separate plasmids is of great advantage since it allows simplifying and controlling functional studies of each player on viral replication. With this, important aspects of the viral life cycles were studied like translation of viral proteins, the process of template selection, formation of the replication complex, viral RNA replication, encapsidation and recombination  with TBSV . In the TBSV not only replicates in yeast but also undergoes recombination . To elucMajor viral pathogens still remain without effective vaccine or therapy options, thus safer and more effective antiviral drugs are urgently needed. For this, improved screening processes that enable to assess the mode-of-action of the tested compounds are essential. In this section we will discuss the exciting contributions of yeast genetics and high-throughput screenings to drug development. We will present first the principal characteristics of these global approaches and then their application to the antiviral research field.in vitro assays to identify small molecule inhibitors. These assays give only a partial view of the effect of the compounds since, for instance, they cannot fully explore drug effects on other additional targets, which can be the source of undesirable side effects. Putative toxic effects will be tested subsequently in cell culture and in animal models. However, if toxicity is detected, the underlying mechanism will still be unknown and no rational approach is possible to modify the drug to improve safety.The process that leads to the discovery and development of new drugs is long and costly. Two approaches have been traditionally used. If the target is already known, the drug discovery search classically starts with S. cerevisiae that allow to systematically screen putative targets and effects of the selected drugs [An alternative drug discovery approach directly performs cell-based screens for molecules that produce a specific desired effect. This has the advantage that the molecule encounters natural physiological conditions and allows selecting those molecules that are stable within the metabolic environment and discarding those that show toxic effects. However, also with this approach the exact mechanism of action of the selected drug remains unknown. This is a great disadvantage, since its elucidation could lead to the design of new compounds with improved safety and efficacy profiles. Both above approaches will benefit from the large-scale chemical and genetic tools developed in ed drugs ,19. SincThe large-scale chemical and genetic yeast screens use the mutant strain collections and gene expression plasmids described above. There are five main screening approaches . First, Herpesviruses. Furthermore, most antivirals are not curative and produce major side effects. Thus, there is an urgent need of novel and high-quality targets and drugs together with improved screening systems to identify them. Two kinds of targets can be used in antiviral research, viral factors or host factors. Classically, viral proteins have been used as targets for therapeutic interventions because the developed inhibitor molecules were expected not to produce significant side effects. However, this does not seem to be the case and, for instance, all the antiretrovirals currently available produce important side effects. Since drug-resistant mutants are rather easily selected, researchers have shown again interest in host factors. They have the advantage of being genetically stable and may even be efficient as targets against groups of viruses. The above mentioned screening options could be helpful to select those host factors that when targeted by drugs will be lethal for the virus but have minor effects on the cell.After more than two decades of searching for antiviral drugs, a rather limited number of compounds is on the market. From these, almost all focus on HIV and influenza virus has a fundamental role in the disassembly of the influenza virion. In fact, some of the commercially available drugs target this protein.Two yeast cell-based assays have been established to screen for viral inhibitors. The protein M2 of Since expression of the M2 protein in yeast produced a slower growth rate, a screening procedure was set up based on the rescue of wt cell growth in the presence of test compounds . More reKanMx plus two unique tag sequences located up- and down-stream of the marker gene. These tag sequences enabled rapid analysis of strains in a pool by using hybridization to high-density nucleotide arrays. Importantly, the tag sequences were flanked with universal primer sets for polymerase chain reaction amplification [Few studies in antiviral research make fully use of the yeast platforms and tools available. Because of their innovation in the field, we would like to point out two of them that explore the mode of action of antivirals plus other therapeutic compounds. In the first study the heterozygote yeast deletion collection was used to asses the cellular effects of 78 different compounds . It is ification .In a second study a complementary approach was followed. The ~5000 yeast haploid deletion mutant collection was tested for hypersensitivity to 82 different compounds including some molecules with antiviral activity . Since iYeast has been utilized in vaccine development. The classical example is the recombinantly expressed hepatitis B surface antigen that has become a safe and efficient prophylactic vaccine worldwide . HoweverImmunization against bacterial pathogens and viruses is an attractive strategy in combating infectious diseases by stimulation of the immune system. Traditional vaccines like soluble antigens formulated with adjuvants efficiently activate the humoral immune response. The production of neutralizing antibodies that bind to invading microorganisms inhibits their entry into target cells, thereby preventing an infection. However, cell-mediated immunity, not humoral immunity alone, is required to control infections with intracellular pathogens, especially viruses like HIV and HCV. In the classical view of cellular immunity, antigen-presenting cells (APC) present peptides from endogenously synthesized pathogen proteins in the context with MHC class I molecules on their cell surface. Antigen-specific CD8-positive T lymphocytes become activated by recognizing these peptides and subsequently differentiate into a mature effector cell population. These cytotoxic T cells (CTL) are able to recognize and kill the respective infected cells. Additionally, dendritic cells (DC) which are the most potent APC use the mechanism of cross-priming for antigen presentation, wherein peptides from exogenous antigens are also presented via MHC class I molecules . \"DangerSaccharomyces cerevisiae has been used as antigen carrier because this genus combines several advantages. (1) Products with S. cerevisiae, e.g. bread and beer, are consumed in large amounts worldwide and healthy individuals show only moderate T cell responses against S. cerevisiae, probably due to mechanisms of oral tolerance [S. cerevisiae [Whole recombinant yeast cells, known as Tarmogens\u2122 (targeted molecular immunogens) represent a novel vaccination tool for the induction of potent cell-mediated immune responses against target antigens . In mostolerance . (2) Impolerance ,80. Remarevisiae . (3) Yearevisiae . (4) Facrevisiae -83.Stubbs et al. showed for the first time that recombinant yeasts expressing HIV-1 antigens and tumour antigens potently elicit antigen-specific CTL responses, including those mediating tumour protections in mice . FurtherS. cerevisiae expressing Actinobacillus pleuropneumoniae antigen led to the induction of protective systemic and mucosal immune responses [Schizosaccharomyces pombe represents, like S. cerevisiae, a physiologically and genetically well characterized eukaryote that has been used in Africa for hundreds of years in brewing of millet beer, from which it was first isolated. Recombinant Sz. pombe cells expressing the human cytomegalovirus pp65 protein were able to stimulate CD4- and CD8-positive memory T cells in human blood [One advantage of using whole recombinant yeasts as antigen carriers is the oral application route. Feeding mice with esponses . The fisan blood .Instead of using recombinant yeast expressing an antigen of choice as a vaccine, attempts have been made to express MHC proteins plus the desired antigenic peptide on the yeast surface and to use the modified cell as a kind of APC. Brophy and colleagues succeeded in expressing mouse MHC I protein heavy chain, beta2-microglobulin plus an antigenic peptide from a single gene cassette. The resulting complex assembled in a functional conformation on the cell surface and even induced the activation of na\u00efve T cells . HoweverCandida is able to cause a variety of infections from mucosal candidiasis to life-threatening disseminated and bloodstream infections, especially in immunocompromised individuals. Unfortunately, the interplay between protective and inhibitory antibodies dictates the outcome of experimentally disseminated Candidiasis in mice receiving a heat-inactivated whole-cell C. albicans vaccine [Candida antibody titers remain nonetheless susceptible to invasive candidiasis [The strategy to use yeast cells for vaccination could also be used to elicit protective immune responses against human pathogenic yeasts. For example, the genus  vaccine . This obdidiasis . Howeverdidiasis ,89.In conclusion, the yeast system has been extremely valuable in virus research. However, the full potential from the remarkable progress in systemic yeast biology over the last years has yet to be exploited. With the increasing options for analysing protein interaction networks at an unprecedented level of complexity and the rising number of viral replication systems in yeast that correctly mimic the fundamental properties of the virus life cycle in higher eukaryots, the era of system virology is expected to become a new focus in virus research. Subsequently, the better understanding of the virus protein/host cell protein interaction networks will allow the search for and development of more efficient and safer antiviral drugs. Moreover, the acquired information about drug functioning down to the molecular level will help in the search for new drug applications and might significantly reduce the time frame for drug development when a new virus appears to threaten the human population.The author(s) declare that they have no competing interests.All authors have contributed to the content and structure of the present review."}
+{"text": "Retroviral full-length RNA is presented to the host translation machinery with characteristics rarely observed among host cell mRNAs: a long 3' UTR, retained introns, and multiple open reading frames. As a result, the viral RNA is predicted to be recognized by the host NMD machinery and degraded. In the case of the Rous sarcoma virus (RSV), we identified a stability element (RSE), which resides immediately downstream of the pol and src may also function as stability elements.We defined key RNA features of the RSE through directed mutagenesis of the virus. These data suggest that the minimal RSE is 155 nucleotides (nts) and functions independently of the nucleotide sequence of the stop codon or the first nucleotide following the stop codon. Further data suggested that the 3'UTRs of the RSV We propose that these stability elements in RSV may be acting as NMD insulators to mask the preceding stop codon from the NMD machinery. Nonsense-mediated mRNA decay (NMD) selectively recognizes and targets for degradation mRNAs containing premature termination codons. This mRNA quality control mechanism prevents potentially deleterious dominant negative effects of truncated proteins that accumulate if aberrant mRNAs are not degraded -4. In maWhen introns are removed during splicing, a multi-protein complex called the exon junction complex (EJC) is deposited on the mRNA 20-24 nucleotides upstream of the exon-exon junction . When a NMD poses a unique risk to the genome and mRNAs of retroviruses. Although retroviruses encode some enzymatic activities, they rely on the host cell's reservoir of proteins to produce progeny virions. As a result of this dependence on host cell machinery, retroviruses must overcome mRNA quality control measures to ensure their genome is translated in an efficient and timely manner. The genomes of simple retroviruses, such as the Rous sarcoma virus (RSV), possess cis-acting RNA elements that play an essential role in facilitating successful genomic expression -13.During the RSV life cycle, expression of the integrated proviral DNA generates three viral mRNAs that are capped and polyadenylated: two spliced and one unspliced ,15. Fullgag result in a decrease in unspliced viral RNA levels .-47.45-47gag termination codon that makes the full-length RSE viral RNA immune to NMD. Additionally, we have demonstrated that RSV has RNA stability elements immediately downstream of the open reading frames of gag, pol, and src. We propose that these viral stability elements act as insulators, masking the authentic termination codons from the NMD machinery. Furthermore, this study provides more evidence that the exon junction complex is not required for identification of a premature termination codon. This novel type of RNA regulatory structure will likely also be found in some cellular mRNAs. Future studies will focus on the role of protein factors in RSE function, namely assessing the impact of the other NMD factors on decay of the unspliced viral RNA.This paper describes a minimal 155-nt RNA sequence downstream of the RSV 2 in medium 199 supplemented with 2% tryptose phosphate broth, 1% chick serum, 1% calf serum and 1% penicillin-streptomycin. Transient transfection assays were performed with DEAE dextran at a concentration of 200 \u03bcg/mL in serum free medium 199 as previously described [Secondary chicken embryo fibroblast (CEF) cultures were grown at 39\u00b0C and 5% COescribed . Cells wescribed .In vitro transcription of the gag probe was performed from a T7 DNA template and radiolabeled with [a-32P]GTP using viral sequences previously described . The 10.8 viral plasmid used to generate each of the constructs contains a deletion in the nucleocapsid region of the gag gene GGAAGCCAGACCACACQCPTC2535 CATCTGGCTATTCCGCTC[TAGG]GTAAACTTGTAGCGCTAACGCQCPTC2586 GTGGCCCCTCCCT[TAGG]TAGGACATATAGAACCTTCACTTAGTTGTTGGQCPTC2631 CGCAATTAGTGGAAAAAGAATTA[TAGG]GGAAGGCTTCCGGGQCPTC2685 GAACACACCTGTCTTCGTG[TAGG]CCAAGCTTGTTCCTTTTGGQCPTC2736 CATGATTTGCGCGCTGTT[RSV: Rous sarcoma virus; UTR: untranslated region; CEF: chick embryo fibroblastThe authors declare that they have no competing interests.JBW designed and performed experiments, analyzed and interpreted data, and drafted the manuscript. KLB contributed to data interpretation and reviewed and edited the manuscript. All authors read and approved the final manuscript."}
+{"text": "Other secondary structural elements identified include a conserved 150 nt stem\u2013loop (SL2) and a small palindromic stem\u2013loop within gag open reading frame that might act as a viral dimerization initiation site. We have performed extensive mutational analysis of these sequences and structures and ascertained their importance in FIV packaging using a trans-complementation assay. Disrupting the conserved heptanucleotide LRI to prevent base pairing between R/U5 and gag reduced packaging by 2.8\u20135.5 fold. Restoration of pairing using an alternative, non-wild type (wt) LRI sequence restored RNA packaging and propagation to wt levels, suggesting that it is the structure of the LRI, rather than its sequence, that is important for FIV packaging. Disrupting the palindrome within gag reduced packaging by 1.5\u20133-fold, but substitution with a different palindromic sequence did not restore packaging completely, suggesting that the sequence of this region as well as its palindromic nature is important. Mutation of individual regions of SL2 did not have a pronounced effect on FIV packaging, suggesting that either it is the structure of SL2 as a whole that is necessary for optimal packaging, or that there is redundancy within this structure. The mutational analysis presented here has further validated the previously predicted RNA secondary structure of FIV \u03c8.The feline immunodeficiency virus (FIV) is a lentivirus that is related to human immunodeficiency virus (HIV), causing a similar pathology in cats. It is a potential small animal model for AIDS and the FIV-based vectors are also being pursued for human gene therapy. Previous studies have mapped the FIV packaging signal (\u03c8) to two or more discontinuous regions within the 5\u2032 511 nt of the genomic RNA and structural analyses have determined its secondary structure. The 5\u2032 and 3\u2032 sequences within \u03c8 region interact through extensive long-range interactions (LRIs), including a conserved heptanucleotide interaction between R/U5 and  The feline immunodeficiency virus (FIV) is a lentivirus that causes a prolonged disease in domestic cats that is similar in characteristics to AIDS in humans caused by the human immunodeficiency virus (HIV).gag gene, and a region near the 3\u2032 end of viral RNA also facilitate packaging in conjunction with the untranslated leader region (UTR).\u2013,Efficient and specific packaging or encapsidation of retroviral RNA is one of the essential steps in retroviral replication during which two copies of \u201cfull-length\u201d unspliced genomic RNA are encapsidated preferentially into the assembling virus particles from a large milieu of cellular and viral RNAs in the host cell cytoplasm. The process of specific encapsidation involves the recognition of particular sequence(s) and/or structural element(s) of the genomic RNA located at its 5\u2032 end termed the \u201cpackaging signal\u201d (\u03c8).\u2013gag sequences of subgenomic constructs, it has been shown that the FIV packaging determinants consist of two discontinuous core regions. One located upstream of the major splice donor (mSD) from R/U5 at the 5\u2032 end to the first 150\u00a0bp of UTR, while the other is found within the first 100 nt of the gag gene, both of which are equally important and required simultaneously for packaging.Due to the increasing interest in FIV-based vectors for human gene therapy, FIV RNA packaging has been investigated extensively in the recent years. A series of studies have suggested that similar to the packaging determinants of the primate lentiviruses, HIV and simian immunodeficiency virus (SIV), the packaging determinants of FIV are complex and multipartite; however, the precise location and the relative contribution of each of these determinants remain somewhat debatable.gag (nt 644 3\u2032 GGGACAG 5\u2032 nt 638). In addition to the LRI, we identified a prominent 10\u00a0bp (nt 657 5\u2032 AAUGGCCAUU 3\u2032 nt 666) 100% palindromic  sequence in stem\u2013loop 5 within the Matrix coding region of gag.gag proposed by Kenyon et al.gag was their use of multiple sequences derived from the same molecular clone to support their analysis. We have recently performed further structural and functional analysis of the FIV leader in which we have confirmed that the proposed dimerization initiation site (DIS) is in a double-stranded conformation consistent with a loop\u2013loop dimerization initiation reaction and that mutants that disrupt the palindrome abrogate this paired structure (data not shown).Similar to other retroviruses, such as HIV, SIV and Mason-Pfizer monkey virus (MPMV),\u2013\u2013LRIs involving complementary sequences have been shown to exist in other lentivirusesin vivo packaging and transduction assay to determine their effects on packaging and replication efficiency of FIV transfer vectors.The RNA secondary structure of the FIV leader sequence we proposed earlier has not been tested genetically although it provides a mechanistic explanation for the bipartite \u03c8 established by mutagenesis.gag sequence as a component of the packaging signal. This makes examination of packaging using full-length wild type virus highly problematic because mutations will affect the gag open reading frame. Point mutations altering sequence whilst maintaining coding are a possibility but such mutants often have unexpected cis effects such as on RNA trafficking.hygromycin resistance gene thus allowing monitoring of vector RNA propagation. The number of hygromycin-resistant (Hygr) colonies obtained should correlate with the viral RNA content, giving us an indirect measurement of transfer vector RNA packaging efficiency. This trans-complementation assay allowed us to mutate the RNA secondary structure of the sequences that have been implicated in RNA packaging in the sub-genomic viral context without affecting the overlapping Gag/Pol reading frames because these gene products were provided in trans from a separate plasmid.The study of RNA packaging in FIV is limited because of the essential nature of the 5\u2032 trans-complementation assay.Earlier, we showed that the first 105 nucleotides of FIV genomic RNA are involved in extensive LRIs with those at the 3\u2032 end of mSD, including the first 100\u00a0bp of Gag, which includes a conserved complementary heptanucleotide interaction between R/U5 (5\u2032 CCCUGUC 3\u2032) and Gag (3\u2032 GGGACAG 5\u2032).+ cells as well as to isolate packaged virion RNA. Some of the transfected cells were used to prepare whole cell protein extracts to determine the transfection efficiencies and the rest were fractionated into nuclear and cytoplasmic RNA fractions. The infected HeLa CD4+ cells were selected with medium containing hygromycin B to monitor the propagation of the transfer vector RNAs.Briefly, the wild type (TR394) and mutant transfer vectors were co-transfected in 293T producer cells along with MB22 and MD.G in the presence of a control plasmid, pGL3, expressing firefly luciferase. At 72\u00a0h after transfection, supernatants containing virus particles were harvested and used to infect HeLa CD4To determine that transfer vector RNAs were expressed stably and subsequently packaged into the budding virions, both cytoplasmic and viral RNA preparations were analyzed by RT-PCR. However, to eliminate the possibility of the presence of any contaminating plasmid DNA in the RNA preparations before RT-PCR, RNAs were treated with DNase and amplified. The absence of any detectable level of plasmid DNA contamination was confirmed by the lack of amplification using vector-specific primers in both cytoplasmic , similar amounts of virions were used to isolate viral RNA for the mutants and the wild type transfer vectors as shown by western blotting (As shown in ild type d. This wild type a and semblotting e. On theP\u00a0=\u00a00.001) in transduction efficiency (To ascertain whether it is the primary sequence of the complementary heptanucleotides or whether heterologous heptanucleotides maintaining the complementarity between these locations (R/U5 and Gag) would be sufficient to maintain LRI and therefore RNA packaging, we created two mutant clones (AN18 and AN19) to address this paradigm. In the case of AN18, heptanucleotide sequence \u201cX\u201d (5\u2032 CCCUGUC 3\u2032) in R/U5 was substituted with heterologous sequence of equal length (5\u2032 agaguga 3\u2032) such that it would lose its complementarity with the sequence \u201cY\u201d (3\u2032 GGGACAG 5\u2032) in Gag b. As shoficiency d. Howeveficiency c and d.gag stem\u2013loops, although stem\u2013loops 1\u20134 remain intact . In AN19, the LRI was restored with the substitution of heterologous heptanucleotides, and Mfold analysis predicted the restoration of wild type secondary structure, with a similar free energy  compared to the wild type and the RPE data corroborated well with the propagation data  with 100% autocomplementarity in a stem\u2013loop within the first 100\u00a0bp of the ng frame a.31 Thisng frame b. Analysion data d as measP\u00a0=\u00a00.009) and 2.2 (P\u00a0=\u00a00.004) fold, respectively, compared to the wild type, whereas propagation was lowered by twofold and 2.2-fold, respectively  showed that both RPE and propagation were reduced; RPE was reduced by 1.6-fold for both mutants, whereas the propagation was reduced by 1.6-fold and 1.4-fold, respectively, compared to the wild type , further arguing in favor of the primary sequence being more important than its structure for RNA packaging. One caveat is that structural predictions are based on a monomeric RNA and it is not possible to predict exactly how the mutations might affect the intermolecular interaction during dimerization, which also influences packaging in all other retroviruses studied so far.Our earlier structure analysis and biochemical probing of the 5\u2032 end of FIV RNA genome showed a long (approximately 150\u00a0nt) and very stable stem\u2013loop (SL2), which includes a region that has been implicated in FIV RNA packaging.P\u00a0=\u00a00.01) in RPE and 1.2-fold in propagation when compared to the wild type  and propagation by twofold (P\u00a0=\u00a00.002) when compared to the wild type  and propagation (1.4\u20132.3-fold reduction) when compared to wild type  that is complementary to a sequence (3\u2032 GGGACAG 5\u2032) found 342\u00a0bp downstream in the Matrix coding region of Gag, which is structurally conserved between all FIV isolates examined, including those that infect pumas, lions and Pallas cats.gag) have complementary sequences that interact at the structural level to enhance packaging. The involvement of gag sequences as part of packaging determinants of retroviruses, where the core determinant seems to be upstream of the mSD , provide a convenient way of differentiating between spliced and unspliced mRNAs. This may be true for FIV as well as SIV and MPMV.Gag sequences, especially the first half of gag, might have a more mechanistic function. For example, HIV-2 has its major packaging determinants upstream of the mSD; thus, all HIV-2 mRNAs contain the packaging signal. HIV-2 has solved the problem of genomic mRNA recognition by using a unique sorting mechanism whereby primarily only those mRNAs capable of translating gag in cis can be packaged into the virus particle. These mRNAs are captured by the co-translated Gag polyproteins while being translated on polysomes in the cytoplasm.The proposed RNA secondary structure and our mutational analysis data further suggest that the two core FIV packaging determinants  in an FIV transfer vector have been shown to lower the packaging efficiency by more than threefold.A characteristic feature of the retroviral life-cycle is the packaging of two copies of viral genomic RNAs in the form of a non-covalently linked RNA dimer. The conservation of this unique genome organization among retroviruses suggests strongly that a dimerized genome plays a vital role in the viral life-cycle.ild type c, impliccis-acting elements might be independently promoting RNA packaging. For example, there is evidence that sequences in the 3\u2032 end LTR also contribute, although minimally, to FIV RNA packagingOur mutational analysis of SL2 showed only a modest reduction in RNA packaging and propagation efficiencies . This miAlternatively, it could be that part of SL2 is involved in augmenting nuclear export of the viral genomic RNA. The packaging signal of some retroviruses, such as murine leukemia virus, and direct repeats of Rous sarcoma virus (which are involved in packaging) have been shown to play an important role in nuclear export of the viral genomic RNA and their further cytoplasmic transport towards the plasma membrane.Using a biologically relevant assay, our mutational analysis and structural predictions in conjunction with the existence of functionally important LRIs in other lentiviruses provide additional proof for the presence of a similar widespread LRI between R/U5 and Gag in FIV as we proposed earlier, further providing important functional correlates with the published reports on FIV packaging signal. The study described here is a step forward towards our enhanced understanding of RNA structural elements in relation to RNA\u2013RNA and RNA\u2013protein interactions and should provide further insights about FIV RNA packaging and replication, which is imperative for the development of safe and efficient FIV vectors for human gene therapy.Petaluma (34TF10) strain is based on GenBank accession number M25381.Nucleotide designation for the FIVgag/pol genes from a human cytomegalovirus (hCMV)/intron A/promoter enhancer has been described and was used to package the transfer vector RNAs.The FIV packaging construct MB22, which expresses FIV cis-acting sequences needed for genome replication, including transcription, polyadenylation, encapsidation, reverse transcription and integration. TR394 contains a hygromycin resistance (Hygr) marker gene expressed from an internal simian virus 40 (SV40) promoter (SV-Hygr cassette) facilitating the analysis of the effect of these mutations on FIV transfer vector RNA packaging and propagation. In TR394, we have replaced the U3 region of the 5\u2032 end of FIV LTR with hCMV promoter to enhance the expression of our vectors in human cells. In addition, MPMV CTE has been inserted downstream of the SV-Hygr cassette in TR394 to facilitate the efficient nucleocytoplasmic transport and/or stability of transfer vector RNA (Substitution and deletion mutations introduced in different regions of the RNA secondary structure were cloned into the FIV-based transfer vector TR394 a.41 Briector RNA a.57Taq polymerase in PCR super mix (Invitrogen) in the GeneAmp PCR system 9700 (Applied Biosystems).The desired mutations in different components of the proposed RNA secondary structure shown in The details of PCRs, primers, and the intermediate cloning steps are available from the authors upon request.+ cells and the infected cells were selected and stained for hygromycin-resistant (Hygr) colonies as previously described.Wild type or mutant transfer vectors, packaging construct MB22 and envelope expression plasmid MD.G were transfected into 293T cells in triplicate using calcium phosphate as described previously.To isolate the packaged viral RNA, viral supernatants containing virus particles were cleared of cellular debris via low-speed centrifugation  followed by passage through a 0.2\u00a0\u03bcm cellulose acetate syringe filter and pelleted through a 20% (w/v) sucrose cushion by ultracentrifugation. The volume of supernatant to be used for pelleting virus particles for each mutant was determined following normalization with the transfection efficiency. The pelleted virus particles were resuspended in TNE buffer  and RNA was isolated using a TRIzol\u00ae-based method as described earlier.To fractionate the RNA into nuclear and cytoplasmic fractions, transfected cells were removed from the culture plates without trypsinization and then nuclear and cytoplasmic fractions were isolated as described previously.Before cDNA preparation, both viral and cytoplasmic RNA fractions were treated with DNase and amplified using vector specific primers OTR660 and OTR662 as previously described to ensure that the RNA preparations were devoid of any contaminating DNA.Am is the absorbance of the mutant transfer vector RNA, Ab is the background absorbance, Aw is the absorbance of the wild type transfer vector RNA, AcmN is the absorbance of the cellular mutant RNA normalized to relative transfection efficiency (RTE) and AcwN is the absorbance of the wild type transfer vector cellular RNA normalized to RTE.Viral and cytoplasmic cDNAs were amplified as described above using transfer vector-specific primers for calculating the RPE of each mutant. The PCR products were analyzed on agarose gels and transferred to a nylon membrane for Southern blot analysis as has been previously described.As described earlier, one-third of the pelleted virus particles resuspended in TNE buffer were boiled for 5\u00a0min and then subjected to SDS-PAGE.Structural effects of the mutations were analyzed with Mfold sequence analysis software."}
+{"text": "The BALB/c mouse is commonly used to study RSV infection and disease. However, despite the many advantages of this well-characterised model, the inoculum is large, viral replication is restricted and only a very small amount of virus can be recovered from infected animals. A key question in this model is the fate of the administered virus. Is replication really being measured or is the model measuring the survival of the virus over time? To answer these questions we developed a highly sensitive strand-specific quantitative PCR (QPCR) able to accurately quantify the amount of RSV replication in the BALB/c mouse lung, allowing characterisation of RSV negative and positive strand RNA dynamics.in vitro in the mouse cells.In the mouse lung, no increase in RSV genome was seen above the background of the original inoculum whilst only a limited transient increase (< 1 log) in positive strand, replicative intermediate (RI) RNA occurred. This RNA did however persist at detectable levels for 59 days post infection. As expected, ribavirin therapy reduced levels of infectious virus and RI RNA in the mouse lung. However, whilst Palivizumab therapy was also able to reduce levels of infectious virus, it failed to prevent production of intracellular RI RNA. A comparison of RSV RNA kinetics in human (A549) and mouse (KLN205) cell lines demonstrated that RSV replication was also severely delayed and impaired in vitro studies in human and mouse cells suggest this restricted replication is due at least in part to species-specific host cell-viral interactions.This is the first time that such a sensitive strand-specific QPCR technique has been to the RSV mouse system. We have accurately quantified the restricted and abortive nature of RSV replication in the mouse. Further  Respiratory Syncytial Virus (RSV) is the leading cause of lower respiratory tract infection (LRTI) in infants and children world-wide and is increasingly recognised as a cause of serious disease in adults and immune compromised transplant patients ,2. Over Paramyxoviridae family. The negative sense single-strand RSV genome comprises a RNA molecule encoding 11 proteins. Upon host cell infection positive-sense viral mRNAs are synthesised by the viral RNA polymerase, these mRNAs make use of host-cell machinery to synthesise viral proteins. Genome replication occurs via the production of a positive sense replicative intermediate (RI) RNA strand by the same viral RNA polymerase; this RI RNA is used as a template for the synthesis of more negative sense genome [RSV is a negative-stranded RNA virus belonging to the e genome .in vivo models with good clinical translation is vital in the search for new treatments for disease A number of different animal models have been used to study RSV infection and replication and to evaluate potential therapies, including primates, bovines and rodents [in vivo studies have been conducted using either the BALB/c mouse [Sigmodon hispidus) [6 PFU) to achieve viral replication. The actual amount of viral replication occurring following infection with such a supra-physiological dose of RSV has never been accurately determined.The use of  rodents . The maj/c mouse  or the cispidus)  models. ispidus) . The BALispidus)  and, thoispidus) , constitin vitro studies in human and mouse cells demonstrated that although both cell types were equally susceptible to infection; viral RNA synthesis was delayed and impaired in mouse cells. This finding suggests that a species-specific host-virus interaction inhibits the capacity for RSV replication in the mouse.We therefore developed a strand-specific real-time quantitative polymerase chain reaction (QPCR) method to monitor the kinetics of RSV RNA replication in the mouse lung. BALB/c mice were infected with RSV A2 and viral RNA in mouse lungs were monitored over an extended time course. Levels of infectious virus in lungs were also measured. Taken together, results from these 2 assays showed that RSV RNA synthesis and viral replication was severely limited in the mouse. Treatment with a prophylactic antibody  did not affect viral RNA replication and persistence, but did impair the production of infectious progeny virus, indicating that abortive replication  occurs iFemale BALB/c mice (6-8 weeks old), specific pathogen free, were purchased from Charles River Laboratories and housed in an animal care facility in ventilated isolation cubicles. Water and chow were provided ad libitum. Mice were allowed to acclimate to the new environment for 1-2 weeks and housed in groups according to experimental setup. All experiments with animals were carried out in compliance with UK legislation and subject to local ethical review.RSV-A2 was obtained from Advanced Biotechnologies Inc. Stocks were produced by infecting Hep-2 cells at a multiplicity of infection (MOI) of 0.1 focus forming units (FFU) per cell. Following 4-5 days incubation, infected cells were harvested and snap frozen in dry ice and methanol and stored at -80\u00b0C. Viral titres were determined by a HEp2 based immunofluorescence assay and expressed as FFU/ml . UV-inacA549 cells (human lung carcinoma) and KLN205 cells (DBA/2 mouse lung squamous cell carcinoma) were purchased from ATCC and maintained in DMEM or EMEM respectively, each supplemented with 100 IU/ml of penicillin, 100 \u03bcg/ml streptomycin, 2 mM L-glutamine, and 10% foetal calf serum (FCS).Ribavirin was obtained from Sigma-Aldrich and Palivizumab  was obtained from Idis Ltd.6 FFU per animal) or an equivalent concentration of UVRSV. One group of control mice was left untreated. Animals were sacrificed at 1, 5, 8, 17, 24, 48 and 72 hours and 7, 10, 37 and 59 days after infection (3 mice per time point). The lungs were removed from the thorax, dissected into two and each weighed. One lung was placed into RNAlater (Ambion) for subsequent RNA extraction and Taqman analyses. The second lung was processed by hand-held homogeniser (Omni) in 1 ml MEM (Invitrogen). Homogenates were centrifuged, clarified viral supernatant diluted 1:3 in MEM and 50 \u03bcl used in triplicate in immunofluorescence assay [For preliminary RSV replication and dynamics studies, mice were inoculated once intranasally (i.n.) with 50 \u03bcl of either RSV A2 (1 \u00d7 10ce assay .6 FFU/mouse). Ribavirin treatment was re-administered 5 hours post virus inoculation and twice daily dosing of this compound continued for a further day. Ribavirin treatment was not administered on day 2. Dosing continued on day 3 at 50 mg/kg twice daily until day 6 post virus infection. Animals were sacrificed at 1, 8, 24, 48 and 72 hours and 5, 7 and 10 days post infection . Lungs were harvested for viral titrations and RNA extraction.For experiments conducted to investigate inhibition of RSV replication, one group of animals were administered a single intramuscular injection of palivizumab (5 mg/kg of body weight) 24 hours prior to infection with RSV. A second group were administered ribavirin (100 mg/kg of body weight) intraperitoneally one hour prior to RSV challenge. These groups, plus a further untreated group, were inoculated intra nasally with 75 \u03bcL RSV A2 (2.6 \u00d7 10Pwo Superyield polymerase (Roche) with external primers (Table E. coli (Invitrogen) and plasmid purified by QIAprep Spin Miniprep Kit (Qiagen). Clones were sequence-checked at Lark Technologies, UK. The insert plus bacterial promoter vector sequences of verified clones was isolated by PCR using Pwo Superyield polymerase with M13 forward (-20) and reverse primers at an annealing temperature of 55\u00b0C for 35 cycles. Positive and negative sense in vitro transcripts were synthesised by Sp6 and T7 RNA polymerase (Promega) respectively, these products were treated with Turbo DNase (Ambion) and purified by 3 M sodium acetate (pH 5.5) precipitation. Stocks of 108 absolute copies per \u03bcl were prepared and stored at -80\u00b0C.A region of the RSV A2 nucleocapsid domain was isolated using a nested primer approach. RSV A2 viral RNA was prepared from crude preparation using the QIAamp viral RNA minikit (Qiagen). RNA was reverse transcribed using the High Capacity cDNA reverse-transcription kit (Applied Biosystems) with random primers. PCR was conducted using rs Table  at an anrs Table  PCR usin2, 0.5 mM dNTP mix, 2.5 \u03bcM strand-specific primers, 4 U RNase inhibitor and 12.5 U reverse transcriptase with 4 \u03bcl total RNA preparation in water. Reactions were performed at 50\u00b0C for 40 mins followed by 95\u00b0C for 5 mins. Positive strand detection by QPCR was performed using TaqMan\u00ae Universal PCR mastermix (Applied Biosystems) with positive sense RNA specific primer, 800 nM tag-specific primer and 100 nM probe (Table 7 absolute copies/\u03bcl) were processed alongside samples. The limits of detection for this assay were defined as values measured outside the range of the standard curves. RSV copy number per \u03bcl of total mouse lung RNA were normalised to beta-actin detected using commercially available TaqMan\u00ae VIC/MGB primer-limited endogenous control (Applied Biosystems) with random-primed 1st strand cDNA synthesised using the High Capacity cDNA reverse-transcription kit (Applied Biosystems). Absolute values of normalised RSV copy number were subsequently divided by the weight of the lung tissue from which RNA was extracted and expressed as normalised copy number/g lung wt.RNA was prepared from mouse lungs using an RNeasy kit (Qiagen) following manufacturer's instructions. First strand cDNA was synthesised from RNA using Reverse Transcription Reagents (Applied Biosystems) with gene specific primers targeted to the positive or negative sense RSV A2 nucleocapsid region RNA Table . Primers4 cells per well in 96 well plates and infected with RSV A2 to yield various multiplicities of infection (MOIs) ranging from 1 \u00d7 10-3 to 1. Media containing 10% FCS was replaced with fresh media containing 2% FCS after 24 hours. Cells were lysed with RLT buffer (Qiagen) at 1, 8, 24, 48 and 72 hours and after 5 (A549) or 6 (KLN205), 7 and 10 days. Total RNA was prepared using the RNeasy 96 kit (Qiagen). RSV strand-specific QPCR was performed as described above. RSV copy number per \u03bcl of total RNA were not normalised to beta-actin but rather analysed separately due to variable rates of cell death observed throughout the experiment and expressed as RSV copy number.To investigate whether RSV RNA synthesis occurs effectively in a mouse cell line compared to a human cell line in vitro, human lung carcinoma cells (A549) and mouse lung epithelial squamous cells (KLN205) were plated at a density of 1 \u00d7 10For QPCR analyses the ratio of positive to negative copy number is analysed on the logarithmic scale. Treatments are compared to untreated RSV infected controls at each time point by two-sample t-test incorporating Satterthwaite's adjustment to the degrees to freedom. To allow for testing of multiple time points within a treatment a Bonferroni adjustment was made to achieve an approximate 5% significance level within that treatment. Infectious virus assay data were analysed by 1 way analysis of variance (ANOVA) for significant differences (p = < 0.05) between treated groups and untreated RSV infected controls at each time point.st strand cDNA synthesis stage. The strand-specific RSV primers used in the reverse transcription stage contain tag sequences that are incorporated into specifically primed cDNA and this sequence can be specifically targeted by a tag-specific primer during QPCR cycling  RNA and positive sense RNAs (nucleocapsid mRNA and RI RNA) by discrimination at the 1ng Table  and posing Table  strand s6 FFU per animal over a 59 day period. Another group were infected with UV-inactivated RSV as a control.RSV RNAs were analysed in the lungs of female BALB/c mice dosed i.n. with 106 for 24 hours following infection  24 hours prior to infection with RSV. A second group were administered ribavirin (100 mg/kg of body weight) intraperitoneally one hour prior to RSV challenge and re-administered throughout the experiment as described in Materials and Methods. Untreated RSV infected mice were also monitored in this experiment.Having conducted a time-course overview of intracellular RSV RNA in BALB/c mouse lungs, we investigated the effects that palivizumab and ribavirin treatments have on RNAs in RSV-infected BALB/c mice and how these correlated with their effects on infectious virus production. A group of mice infected with 2.6 \u00d7 103-104 normalised copies/g lung wt. on day 10, as was also measured in untreated mice. In palivizumab treated mice the positive sense RNA profile tracked closely that observed in untreated RSV infected mice. Measured RNA quantities were expressed as ratios of positive to negative strand RNA for each treatment  at day 5 which were sustained up to the end of the experiment at day 10. When the cells were infected with higher MOIs of 1 \u00d7 10-1 or greater, the positive and negative RSV RNA attained similar maximum levels to those observed in the lower MOI infections   Figure  and 4D. 5 Figure  and 4D w5 Figure .-3 no viral RNA could be detected .In mouse KLN205 cells infected with RSV at a low MOI of 1 \u00d7 10d Figure . At an Md Figure , but at -1, mean positive sense RSV RNA increased by 2 logs from 104 copies on day 3 to 106 copies by day 7  to day 7 (106 copies) and was maintained until the end of the study at day 10. Similar to cells infected with the MOI of 1 \u00d7 10-1, no increase in negative strand RNA was observed  and positive sense RNA (replicative intermediate and nucleocapsid mRNA). Using this method, we provide a detailed insight into RSV RNA production in infected BALB/c mouse lung. To our knowledge, this is the first time that a strand specific method has been applied to profile RSV RNA dynamics in the BALB/c mouse over such a detailed time course.We have developed a strand-specific QPCR method to measure RSV Early viral RNA synthesis in mouse lungs is characterised by absolute measures of positive and negative sense RNA being equivalent at infection, followed by a 1-2 logs relative increase in positive strand RNA by day 3 post infection. This disparity between RNA strands decreases again from day 7. It should be noted that this window of maximum disparity between the positive and negative strand copy numbers at day 3 coincides with the highest level of infectious progeny virus detected from mouse lungs following infection. It is known that paramyxovirus replicative intermediate RNA represent 10-40% of the genome , therefoThat RSV genome and positive strand RNA can be detected in mouse lungs up to at least 59 days post-infection has been reported both here and elsewhere ,23. It tViral RNA replication has been studied by strand-discriminate QPCR previously in the cotton rat . Viral gRibavirin has been used extensively as an antiviral therapeutic. Its exact mode of action is poorly defined although several mechanisms have been proposed . Here, aProphylactic treatment of RSV-infected mice with the neutralising antibody palivizumab resulted in a reduction in infectious progeny virus detected in the lung, although a reduction in positive sense strand RNA was not observed. These findings agree with those previously observed in the cotton rat, where a lack of detectable progeny virus occurred despite intracellular replication taking place. This phenomenon was termed abortive replication . The autin vivo phenomenon, we infected lung epithelial carcinoma cells from human (A549) and mouse (KLN205) with RSV and studied viral replication by strand-specific QPCR. One hour post infection, the input viral RNA levels were very similar in both human and mouse cells, irrespective of MOI or cell type, indicating that the mouse and human cells had been exposed to equivalent amounts of viral RNA. However, a clear increase in either viral RNA strand only occurred in mouse cells when they were infected with a high MOI of 0.1 or 1. This situation mirrors that which occurs in the mouse in vivo model in that an extremely high viral titre is required for replication [To investigate whether the restricted replication pattern seen in the mouse is purely an lication . Moreovein-vitro [It is unclear why the murine cells did not facilitate RSV RNA synthesis to the same extent as seen in human cells. It may be that RNA replication in KLN205 cells is inhibited either by the presence or absence of one or more host factors required for the viral life cycle. For example, it is known that RSV can modulate host cell anti-viral responses, such as the degradation of STAT2 by NS1 , which iin-vitro . It is pin-vitro .In conclusion, we have demonstrated and quantified the abortive and restricted nature of RSV RNA synthesis and replication in mouse using a highly sensitive and specific QPCR method. We have gone on to provide evidence that the impaired replication may be due to a murine host-virus interaction. We suggest a number of candidates and work is ongoing to identify these interactions.All authors are or were employed in a full-time capacity by Pfizer Research and Development.in vivo and cellular assays and analysis and interpretation of data, EJM, MW and CL participated in the design of the study and analysis and interpretation of data. HB conceived of the study, participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.RB carried out the molecular and cellular studies and drafted the manuscript. DR carried out the"}
+{"text": "All aspects of NC biology, from structure to function and to anti-HIV vaccination, were covered during this meeting.Retroviruses and LTR-retrotransposons are widespread in all living organisms and, in some instances such as for HIV, can be a serious threat to the human health. The retroviral nucleocapsid is the inner structure of the virus where several hundred nucleocapsid protein (NC) molecules coat the dimeric, genomic RNA. During the past twenty years, NC was found to play multiple roles in the viral life cycle Fig. , notably The 6th IRNCS was held in Amsterdam to discuss the most recent advances on the functions of the NC protein in the synthesis, maintenance and integration of the proviral DNA, and in virus particle assembly. All these topics have been covered at the meeting to gain a better understanding of the multifunctional nature of NC  research was at a stage in which an NC symposium would be very useful. There was a general realization that NC was central to many processes in retrovirus replication and the highly conserved NC Znin vitro. Interestingly, the HIV-1 Gag polyprotein was also shown to be a nucleic acid chaperone protein, a property that is likely to facilitate genome dimerization and tRNA primer annealing during virion assembly. Results on different retroviral NC proteins showed that they exhibit significant differences in their overall chaperone activity, decreasing in the order HIV-1 ~RSV > MLV >> HTLV-1. Both K Musier-Forsyth and M Williams found that HTLV-1 NC's poor chaperone activity was caused by its acidic C-terminal domain. Using fluorescence-based techniques and the HIV-1 TAR stem-loop (SL) structure, Y M\u00e9ly and his colleagues  showed that the HIV-1 NC structural determinants, formed by the hydrophobic plateau at the top of the two zinc fingers and the flanking basic residues, are essential for its chaperoning function [This first session on NC structure-function relationships discussed the basis of NC recognition of the genomic RNA and its potent nucleic acid chaperoning activities, discovered in the late 80's -6 (for rfunction -15. Simifunction .CES) of MoMuLV, which comprises stem loops (SL) B-D. Through a combination of nucleotide specific, segmental labeling, and sub-fragment analysis, they have obtained high quality and high resolution NMR (nuclear magnetic resonance) spectra indicative of dimer formation. In particular A289 and A293, which are part of the hairpin loop in SLB, give rise to signature peaks and nuclear Overhauser effect (NOE) patterns upon RNA dimer formation. Residues A330 and A364, which are part of SLC and SLD, respectively, give rise to downfield peaks diagnostic of kissing interactions between SLC and SLD. Additionally, using a novel transverse relaxation-optimized spectroscopy (TROSY) based heteronuclear single quantum correlation (HSQC) pulse sequence, residual dipolar couplings have been measured for isolated B-duplexes and this method is currently being applied to the 198-nucleotide dimeric (\u03a8CES) site. This work will lead to the first high resolution model of the dimeric \u03a8CES site. This group has also analysed interactions between the NC proteins and RNA packaging signals of other retroviruses, including MoMLV and Rous Sarcoma Virus (RSV). It was found that the native MoMLV \u03a8 allowed an average of 15 NCs to bind while mutant-\u03a8, which can not form dimer, allowed only an average of two NC molecules to bind. These results show that exposure of NC binding sites by \u03a8 dimerization occurs in the entire \u03a8-site, by which NC recognizes, selectively dimerizes, and packages its genomic RNA into the virion [Several retroviral RNA structures, such as the 5' untranslated region (5'UTR) or leader, are the subject of intense interest because they are involved in the early and late phases of virus replication via multiple RNA-protein interactions, notably with NC. During retrovirus assembly NC, as the C-terminal domain of Gag, plays an essential role in specifically recruiting two copies of the full length genomic RNA and causing its dimerization. Deciphering the 3D structure of the Psi RNA packaging signal in the the 5' UTR is key to our understanding of NC-genomic RNA interactions. To that end the group of M. Summers  is investing much effort to establish the first high resolution model of the 100 nucleotide core encapsidation signal  reported the first generation of these technologies which involves Selective 2'-Hydroxyl Acylation analyzed by Primer Extension  -24. BecaK. Purzycka and colleagues  pursued their structural and dynamics analyses of the HIV-2 5' UTR RNA. They presented a new structure model for the DIS (dimer initiation site) of HIV-2 based on the high-throughput prediction of 3D RNA structures at low resolution ,26 and mUsing functional assays A Das, M. Vrolijk and colleagues  reinvestigated the role of the highly conserved TAR SL structure in HIV-1 replication . They coA. Lever and colleagues  have long since been interested in the mechanism of HIV-1 genomic RNA selection and packaging during Gag assembly, that relies on the 5' \u03a8 packaging signal formed of SL structures . The tipNC is an obligatory constituent of the viral replication machinery whereby the genomic RNA is converted into the full-length double-stranded viral DNA by RT. This appears to be mediated by tight interactions between NC molecules, the genomic RNA that is in a dimeric form and RT. In a long standing effort to understand the role of NC in viral DNA synthesis, R Gorelick et al.   discussegag and pol genes. They found that rates of recombination were high, corresponding to about 6\u20137 per cycle in T cells and up to 12\u201314 in monocyte-derived macrophages.J. Mak and colleagues  investigated the rate of HIV-1 recombination in cell cultures by monitoring sequence-tag redistribution in the In addition to the genomic RNA, HIV-1 virions can package a substantial amount of spliced viral RNAs, but this seems to be independent of the NC zinc fingers, as reported by M. Mougel et al. . Reverse transcription of these spliced RNAs takes place as efficiently as that of the genomic RNA, but poorly responds to the chain terminator antiviral drug AZT. Thus, AZT treatment might well increase the representativeness of spliced HIV-1 DNAs ,35.All viral RNA, the full length and the spliced forms, contain the TAR sequence at the 5' and 3' ends. NC can induce TAR dimerization as reported by E. Andersen et al  . AccordiThe genomic RNA codes for the Gag and Gag-Pol polyprotein precursors which are synthesized by the host translation machinery. Several characteristics of the HIV-1 5' UTR, such as the 5' terminal TAR hairpin, its length and overall secondary structure, are likely to interfere with ribosomal scanning and suggest that translation is initiated by internal entry of ribosomes (IRES) ,38. To gHIV-1 Gag polyprotein contains all of the molecular determinants required for its intracellular trafficking, and its assembly and budding in the form of virus-like particles (VLPs). The role of NC in Gag assembly has been studied for almost twenty years . A. ReinD. Muriaux, J.L. Darlix and collaborators  have been studying the trafficking and the assembly of HIV-1 in human cells. Viral and cellular factors are involved in these processes, in particular the NC domain of Gag, the genomic RNA, and cellular proteins of the endocytic pathways, and membrane microdomains . They foNC protein can exist in different forms in newly made mature HIV-1 virions, namely NCp15 (NC-SP2-p6), NCp9 (NCp7-SP2) and fully processed NCp7. J.A. Thomas  presented work of collaborators where they investigated the requirement for proteolytic maturation of NC by mutating the protease cleavage sites necessary for the production of mature NCp9 (NCp7-SP2) or NCp7. Interestingly, viruses tailored to make either NCp9 + p6 or NCp7 + SP2 + p6 were fully infectious and could replicate in H9 cells. In contrast, viruses that made either NCp15 or NCp7 + p1-p6 were replication defective. Because the replication block was principally manifested by a severe reduction in integration, it is likely that NCp9 has a role in the integration process  and has Lys3 priming, which requires a hA3G/NCp7 interaction. A greater reduction of ~95% in late DNA synthesis results from the hA3G-induced inhibition of DNA strand transfer, which is correlated with its ability to prevent RNaseH degradation of the template RNA [Human APOBEC3G (hA3G) has been identified as an anti-HIV-1 host factor acting by deaminating the newly made cDNA. S. Cen and collaborators  reported that hA3G inhibits HIV-1 reverse transcription independently of its editing activity. A reduction of 55% in early viral DNA synthesis by hA3G is correlated with a similar decrease in the tRNAlate RNA -48.in vitro. NC-mediated annealing and RNase H cleavage were not affected, but A3G inhibited all RT-catalyzed elongation reactions, independent of hA3G's catalytic activity. These data taken together with complementary biophysical analyses led to the conclusion that deaminase-independent inhibition of reverse transcription is determined by critical differences in the nucleic acid binding properties of NC, A3G, and RT [Y. Iwatani et al  have independently investigated possible effects of hA3G on RT and NC function , and RT ,51.scintillation proximity assay mixture at a ratio of 1 NC molecule per 2, 4 or 8 nucleotides of substrate DNA, either before or with the addition of A3G [In an attempt to understand the possible interactions between HIV-1 NC and hA3G, P Henry et al  expressed hA3G in insect cells and purified it using metal affinity, ion exchange and size exclusion chromatography. Immunoprecipitation of purified NC with purified A3G bound to magnetic beads in the presence and absence of RNA revealed that A3G pulls down NC more efficiently in the presence of RNA, with decreasing efficiency as excess RNA was added to dilute simultaneous binding. The effect of NC on A3G enzymatic activity was examined by adding purified NC to their n of A3G . In all Lys3 annealing, strong-stop DNA synthesis, first strand transfer) and the formation of loose RNA dimers, suggesting that Vif is an RNA chaperone [Lys3 and formation of tight RNA dimers while it collaborates with NC to increase RT processivity. Thus, Vif might negatively regulate NC-assisted maturation of the RNA dimer and early steps of reverse transcription during assembly, but these inhibitory effects would be relieved after viral budding, due to the preferential exclusion of Vif from virions.J.C. Paillart  reported data on a putative new role of the viral factor Vif. Vif is a small basic protein essential to viral fitness and pathogenicity. Marquet, Paillart and coworkers recently showed that Vif preferentially binds to the 5' UTR of the HIV-1 genomic RNA  and to chaperone  However,Ex vivo selection experiments have shown that HIV-1 indeed can use an alternative mechanism by the selection of mutations in the NC/SP2 cleavage site instead of the viral protease. These changes cause resistance to all protease inhibitors by enhancing the processing efficiency of the altered substrate by wild type protease. Modulation of the cleavage efficiency of this site impacts both PI susceptibility and viral replication capacity. Further studies are required to determine to what extent NC/P2 cleavage site mutations may explain virological failure during PI therapy.In this session new anti-viral drugs targeting HIV-1 protease and NC were described. To combat the widespread development of HIV-1 protease resistance in AIDS patients, novel protease inhibitors (PI) with high potency against the known PI-resistant mutants have been developed. M. Nijhuis and collaborators  investigated whether HIV-1 could yet again find a way to become less susceptible to these novel drugs . Ex vivoin vitro and in cell culture assays.Y. M\u00e9ly  in collaboration with J.L. Darlix  and M. Gottikh  developed a screening assay based on the ability of HIV-1 NCp7 to destabilize SL structures such as TAR Fig. . SeveralP. Mahy from H-PHAR  reported new results on HPH116, which is a zinc finger ejector targeting NCp7 protein. HPH116 is a modified synthetic form of azodicarbonamide produced under good manufacturing practices (GMP) conditions developed by H-PHAR. In a TZM-bl cell infection model, HPH116-treated viral particles were found to have lost their infectivity, with up to 100% inhibition at 1 \u03bcM HPH116. Viral inhibition was enhanced when the viral particles were pre-incubated with HPH116 at 0.25 \u03bcM and 0.1 \u03bcM Tenofovir , 0.3 \u03bcM AZT , or with 0.125 \u03bcM T20. Thus, when HPH116 is combined with other known antiretroviral drugs, it can induce a dramatic increase in virus inhibition.S-acyl-2-mercaptobenzamide thioester lead compounds  were invIn vitro, inactivated virions effectively primed both HIV-1 specific responses by MHC-I restricted responses by na\u00efve CD8+ T cells and MHC-II restricted responses by na\u00efve CD4+ T cells. Progress on the use of such particles as a vaccine immunogen was also presented.An update on work involving covalent modification of free S-H groups on internal viral proteins by electrophilic reagents to generate whole inactivated retroviral virions with functional envelope glycoproteins was presented by J. Lifson . Studies with 4-vinyl pyridine showed that covalent modification of NC, without appreciable modification of other virion proteins is sufficient for inactivation. Inactivated viruses are being used for electron tomographic ultrastructural studies of whole virions and envelope glycoprotein spikes . In addiBB organized the symposium. RG and JLD were co-organizers. MFS and YM provided figures"}
+{"text": "N-glycans function as potent live attenuated vaccines to induce near-sterile immunity against the parental pathogenic SIVmac239. In this study, we investigated the protective efficacy of these mutants against a highly pathogenic heterologous SIVsmE543-3 delivered intravenously to rhesus macaques with diverse MHC genotypes. All 11 vaccinated macaques contained the acute-phase infection with blood viral loads below the level of detection between 4 and 10 weeks postchallenge (pc), following a transient but marginal peak of viral replication at 2 weeks in only half of the challenged animals. In the chronic phase, seven vaccinees contained viral replication for over 80 weeks pc, while four did not. Neutralizing antibodies against challenge virus were not detected. Although overall levels of SIV specific T cell responses did not correlate with containment of acute and chronic viral replication, a critical role of cellular responses in the containment of viral replication was suggested. Emergence of viruses with altered fitness due to recombination between the vaccine and challenge viruses and increased gp120 glycosylation was linked to the failure to control SIV. These results demonstrate the induction of effective protective immune responses in a significant number of animals against heterologous virus by infection with deglycosylated attenuated SIV mutants in macaques with highly diverse MHC background. These findings suggest that broad HIV cross clade protection is possible, even in hosts with diverse genetic backgrounds. In summary, results of this study indicate that deglycosylated live-attenuated vaccines may provide a platform for the elucidation of correlates of protection needed for a successful HIV vaccine against diverse isolates.HIV vaccine development has been hampered by issues such as undefined correlates of protection and extensive diversity of HIV. We addressed these issues using a previously established SIV-macaque model in which SIV mutants with deletions of multiple gp120  Molecular epidemiological studies have revealed the existence of an extensive degree of diversity of HIV-1 isolates N-glycans deleted (\u03945G) was found to be profoundly attenuated in rhesus macaques. Thus, while the acute primary viremia showed viral peaks undistinguishable from those measured in animals infected with the wild-type SIVmac239 infection, viral load during the chronic phase was contained at or below the level of detection SIVmac239 infected rhesus macaques gradually develop AIDS after a variable period of chronic infection. In order to investigate the role and function of the glycan shield of the viral envelope, we previously developed a panel of deglycosylated mutants from this pathogenic SIVmac239 backbone The studies reported herein utilized a series of four deglycosylated SIVmac239 mutants as potential live attenuated vaccine viruses and the SIVsmE543-3 isolate The natural protective effects of select rhesus macaque (Mamu) MHC class I alleles such as Mamu B*08, Mamu B*17, Mamu A*01 and the MHC class I haplotype 90120-Ia have been shown to be associated with better control of SIV We herein report data from a series of studies that support the concept that cross-subtype control of HIV-1 is theoretically possible irrespective of genetic background. Data derived herein demonstrate a critical role that glycosylation plays in not only conferring attenuation of SIV/HIV but also the potential role glycosylation plays in conferring pathogenic properties to viruses that emerge following challenge with heterologous viruses.N-glycosylation sites of the gp120 of SIVmac239  (Consistent with our previous studies ion (pi)  and 3. Hion (pi)  and 3. Eion (pi) .It has been well established that SIVmac239 elicits poor NAb in macaques 50) SIVmac239 at 40 weeks following \u201cvaccination\u201d and plasma viral loads were determined  of SIVsmE543-3 delivered intravenously. Additional three na\u00efve animals served as a control for this heterologous challenge experiment  vaccinated with each of the 4 vaccine versions  and 3 of the four animals that were vaccinated (described in the above paragraph) and challenged with SIVmac239 (Mm0307 died of SIV unrelated causes) were challenged with a high dose  were used for these analyses. The alignment data was coordinated with HXB2-LAI-IIIB. These data led to the identification of nine coding regions, as determined utilizing the MEGA4 software http://www.clustal.org).The complete genome sequence alignments consist of 368 HIV-1 isolates  as determined from HIV sequence database  by National Institute of Infectious Diseases Institutional Animal Care and Use Committee in accordance with the recommendations of the Weatherall report. Early endpoints are adopted including frequent monitoring of viral loads and immunological parameters, and humane euthanasia is conducted once any manifestation of clinical AIDS or signs of fatal disease is noted.50 of either of 4 deglycosylation mutants  as shown in 50 of SIVmac239 for purposes of homologous virus challenge studies.Three animals per group were intravenously inoculated with 100 TCID50 of SIVsmE543-3.3 as follows: Mm0517 (\u03945G), Mm0511 (\u03945G-ver1), and Mm0512 (\u03945G-ver2) were challenged at 50 weeks post vaccination with the deglycosylation mutant; Mm0409 (\u03945G), Mm0303 (\u03945G-ver1), and Mm0518 (\u03945G-ver2) were challenged at 61 weeks post vaccination; Mm0515 (\u03943G) and Mm0516 (\u03943G) were challenged at 117 weeks post vaccination. 3 na\u00efve animals  were infected with SIVsmE543-3 as vaccine-na\u00efve controls. Furthermore, three of SIVmac239-challenged animals, Mm0301, Mm0513 and Mm0304 (Mm0307 died with a SIV-infection-unrelated cause) were re-challenged with SIVsmE543-3 at 117 weeks post vaccination and 77 weeks post SIVmac239 challenge.To examine the efficacy of the live attenuated vaccine against heterologous virus, 11 vaccinees were intravenously inoculated with 1000 TCID5\u2032- FAM-GCAGAGGAGGAAATTACCCAGTGC-3\u2032, 5\u2032-CAATTTTACCCAAGCATTTAATGTT- TAMRA- 3\u2032 and probe 5\u2032-TGTCCACCTACCCTTAAGTCCAA-3\u2032, SIVmac239 specific gag primers: 5\u2032-GCAGAGGAGGAAATTACCCAGTAC-3\u2032, 5\u2032-CAATTTTACCCAGGCATTTAATGTT-3\u2032 and probe 5\u2032-FAM-TGTCCACCTGCCATTAAGTCCCGA-TAMRA-3\u2032. These primers and probes do not cross-react with SIVmac239 RNA and SIVsmE543-3 RNA. The detection sensitivity of plasma viral RNA by this method was calculated to be 100 viral RNA copies per ml of plasma.SIV infection was monitored by measuring the plasma viral RNA load using a highly sensitive quantitative real-time RT-PCR. Viral RNA was isolated from plasma samples from infected animals using MagNA PureCompact Nucleic Acid Isolation Kit (Roche Diagnostics). Real-time RT-PCR was performed by using QuantiTec Probe RT-PCR kit (Qiagen) and Sequence detection system SDS7000 (Applied Biosystems). To detect SIVmac239 gag and SIVsmE543-3 gag separately, primers and probe sets were synthesized as follow; SIVsmE543-3 gag specific primers: Viral RNA was isolated using MagNA PureCompact Nucleic Acid Isolation Kit (Roche Diagnostics) and cDNA was synthesized with two-step qRT-PCR kit (Invitrogen). PBMC from vaccine recipients were suspended with lysis buffer (10mM Tris 0.5% NP-40 and 0.5% Tween20) with Proteinase K (200 mg/ml), and incubated at 55\u00b0C for 1 hour, then heat-inactivated at 95\u00b0C for 5 min. Serial 10-fold diluted cDNA or cell lysate was subjected to nested PCR with the Ex-Taq PCR kit  with the following condition: 1 cycle of 97\u00b0C for 1 min. and then 25 cycles of amplification  and 72\u00b0C for 10 min. and then 4\u00b0C for 5 min. Primers were designed to target the several overlapping sequences spanning the open reading frames of SIVmac239 or SIVsmE543-3 as shown in 6 cells/ml in R10 , and rested for 2 h at 37\u00b0C. The cells were washed and aliquots of 105 cells were stimulated with each pool of peptides at a final concentration of 2 mg/ml in an anti-IFN-g Ab-coated plate overnight. ELISPOT assay for the detection of IFN-g secreting cells were performed using a commercial ELISPOT kit (U-CyTech Bioscience). Peptides based on sequences of SIVmac239 viral proteins were synthesized by the Microchemical Facility, Emory University School of Medicine, Atlanta, GA, USA. Peptides based on the sequences of SIVsmE543-3 viral proteins were synthesized by Sigma-Aldrich Japan.The T cells in the animals were examined for virus specific cellular response against the vaccine virus and the challenge virus by using pooled peptides covering overlapping sequences of all viral proteins of SIVmac239 and SIVsmE543-3 respectively. Briefly, cryopreserved PBMC were thawed, resuspended at 2\u00d710Virus neutralizing antibodies were tested according to a protocol using CEMx174/SIVLTR-SEAP cells P values were <0.05.Correlation analysis was performed using Spearman's non-parametric rank test and Mann-Whiney \u2018U\u2019 test by using Graph pad Prism 4.0 software. Correlations were considered statistically significant when The SIV sequences reported in this paper have been deposited in the DNA Data Bank of Japan (accession nos. AB553915 to AB554013).File S1(0.28 MB PDF)Click here for additional data file."}
+{"text": "The results of trans-complementation experiments showed that soluble polymerase complexes can synthesise progeny RNA in trans and become incorporated into progeny vRNPs, but only transcription in cis could be detected. These results are compatible with a new model for virus RNA replication, whereby a template RNP would be replicated in trans by a soluble polymerase complex and a polymerase complex distinct from the replicative enzyme would direct the encapsidation of progeny vRNA. In contrast, transcription of the vRNP would occur in cis and the resident polymerase complex would be responsible for mRNA synthesis and polyadenylation.The influenza A viruses genome comprises eight single-stranded RNA segments of negative polarity. Each one is included in a ribonucleoprotein particle (vRNP) containing the polymerase complex and a number of nucleoprotein (NP) monomers. Viral RNA replication proceeds by formation of a complementary RNP of positive polarity (cRNP) that serves as intermediate to generate many progeny vRNPs. Transcription initiation takes place by a cap-snatching mechanism whereby the polymerase steals a cellular capped oligonucleotide and uses it as primer to copy the vRNP template. Transcription termination occurs prematurely at the polyadenylation signal, which the polymerase copies repeatedly to generate a 3\u2032-terminal polyA. Here we studied the mechanisms of the viral RNA replication and transcription. We used efficient systems for recombinant RNP transcription/replication  in vitro and in vivo recombinant systems for transcription and replication, and polymerase point mutants that are either transcription-defective or replication-defective. These results are compatible with a new model for virus replication whereby a polymerase distinct from that present in the parental RNP is responsible for RNA replication in trans and the progeny RNP is associated to a polymerase distinct from that performing replication. In contrast, transcription is carried out in cis by the polymerase resident in the RNP.The influenza A viruses produce annual epidemics and occasional pandemics of respiratory disease. There is great concern about a potential new pandemic being caused by presently circulating avian influenza viruses, and hence increasing interest in understanding how the virus replicates its genome. This comprises eight molecules of RNA, each one bound to a polymerase complex and encapsidated by multiple copies of the nucleoprotein, in the form of ribonucleoprotein complexes (RNPs). These structures are responsible for virus RNA replication and transcription but the detailed mechanisms of these processes are not fully understood. We report here the results of genetic complementation experiments using proficient  The influenza A viruses are the causative agents of yearly epidemics of respiratory disease and occasionally more severe pandemics Orthomyxoviridae and posses a single-stranded, negative-polarity RNA genome made up by 8 RNA segments, that form ribonucleoprotein (RNP) complexes by association to the polymerase and the nucleoprotein (NP). Such RNPs are independent molecular machines responsible for transcription and replication of each virus gene and contain an RNA-dependent RNA polymerase composed by the PB1, PB2 and PA subunits The influenza A viruses belong to the family de novo initiation, from polyadenylation to full copy of the template, and in addition would induce encapsidation of the RNA product into new RNPs . Transcription initiation takes place by a cap-snatching process whereby the viral polymerase recognises the cap structure of cellular pre-mRNAs in the nucleus, cleaves these some 15 nt downstream the cap and utilises such capped-oligonucleotides as primers to copy the virus template RNA in trans. In this report we used efficient in vivo recombinant replication and transcription systems and defined polymerase mutants specifically affected in either transcription or replication to answer these questions. Our results are consistent with a new model whereby polymerase complexes not associated to the template cRNP are responsible for the replicative synthesis of vRNPs in trans and polymerase complexes distinct from the replicative one specify the encapsidation of viral RNAs. On the contrary, no vRNP transcription could be detected by other RNP or a soluble polymerase complex in trans, suggesting that it takes place by the activity of the RNP-associated polymerase complex.Much information has been obtained during recent years on structural aspects of the RNPs trans-complementation approach. This is based on the ability to reconstitute in vivo an efficient transcription-replication system that mimic these steps of the infection cycle and is more amenable to experimental manipulations To gather information on the mechanisms of influenza virus transcription and replication we have adopted a genetic in trans by co-expression of PB2 point mutants defective in cap-binding 2+-NTA-agarose purification as described in 2+-NTA-agarose purified material. This was indeed the case, as shown in in trans the defect in replication of polymerase mutants R142A or F130A, one would expect the accumulation and purification of RNPs containing these mutant PB2. The results obtained by the co-expression of pairs of replication- and transcription-defective polymerases indicate that such prediction is hold (Using the approaches indicated above we first addressed the question whether the replication deficiency of point mutants within the N-terminus of PB2  is hold . The tra is hold .2+-NTA-agarose chromatography and (ii) the mobility of the PB2 subunit in the Western-blot assay corresponded to the His-tagged subunit and not to the untagged one. It is important to mention that only His-tagged PB2 protein was detected in the purified RNPs and not the untagged counterpart, indicating that no transcription-defective polymerase was co-purified  they could be purified by Nipurified . Furtherpurified . Since tpurified .In the experimental approach used, the reconstitution of a RNP from the viral proteins and genomic RNA has to take place first and its subsequent amplification would account for the bulk of RNPs that can be purified from the transfected cells. Since a RNP template with the replication-defective polymerase does not replicate 2+-NTA-agarose purification, Western-blot and in vitro transcription as indicated above and the results are presented in 2+-NTA-agarose resin , the other one being the NS deletion mutant clone 23 cat RNP in trans, since the mRNA products would be distinguishable by size (720 nt versus 248 nt). The wild-type cat RNPs could transcribe efficiently, both when incubated on their own and when mixed with clone 23 RNPs  in trans. To analyse this alternative we generated in vivo recombinant RNPs containing the negative polarity cat virus replicon, purified them by affinity chromatography as indicated above and used them to transfect HEK293T cultures. Alternatively, the cultures were co transfected with the purified cat-containing RNPs and plasmids expressing the polymerase subunits (see \u22123 to 10\u22124 (data not shown), the CAT protein generated by transfection of wt purified RNPs should represent primary transcription. In agreement with their transcription-defective phenotype, transfection of purified mutant 361 RNPs produced much less CAT accumulation , and various host cell factors  or the NSCAT (720 nt) genomic RNAs were generated and amplified in vivo by transfection of plasmids pCMVPB1, pCMVPB2His, pCMVPA, pCMVNP and either pHHclone23 or pHHNSCAT into HEK293T cells, using the calcium phosphate protocol RNPs see .2+-NTA-agarose as indicated above and the accumulation of progeny RNPs was determined by Western-blot with anti-NP-specific antibodies. The transcription of RNPs in vivo was assayed by transfection of purified NSCAT RNPs into HEK293T cells. The cultures were first transfected with plasmids pCMVPB1, pCMVPB2 (or mutants thereof) and pCMVPA Western-blotting was performed as described 32-GTP (20 \u00b5Ci/\u00b5mol) and either 100 \u00b5M ApG or 10 \u00b5g/ml \u03b2-globin mRNA, for 60 min at 30\u00b0C. The RNA synthesised was TCA precipitated, filtered through a nylon filter in a dot-blot apparatus and quantified in a phosphorimager. To analyse the transcription products, similar reactions were carried out but the specific activity of the labelled GTP was increased to 200 \u00b5Ci/\u00b5mol. The synthesised RNA was isolated by treatment with proteinase K (50 \u00b5g/ml) for 30 min at 37\u00b0C in TNE-1% SdS and phenol extraction. The RNA was ethanol precipitated, resuspended in formamide loading buffer and analysed by electrophoresis in a 4% polyacrylamide-urea denaturing gel.To determine the transcription activity of purified RNPs, samples were incubated in a buffer containing 50 mM Tris-HCl-5 mM MgCl2-100 mM KCl-1 mM DTT-10 \u00b5g/ml actinomycin D-1 u/\u00b5l RNAsin-1 mM ATP-1 mM CTP-1 mM UTP-10 \u00b5M \u03b1-PTo analyse the progeny RNA, purified RNPs were incubated with proteinase K (200 \u00b5g/ml) in a buffer containing 100 mM NaCl-5 mM EDTA-0.5% SDS-50 mM Tris.HCl, pH 7.5 for 60 min at 37\u00b0C, phenol extracted with ethanol precipitated. Samples of the purified RNAs were denatured by boiling for 3 min in 7.5% formaldehyde-10SSC and were fixed onto nylon filters. Replicate filters were hybridised at 37\u00b0C with full-length NS riboprobes of either positive- or negative-polarity in a buffer containing 6SSC-40% formamide-0.5% SDS-5xDenhart's mixture-100 \u00b5g/ml single-stranded DNA. After washing at 60\u00b0C with 0.1SSC-0.1%SDS, hybridisation signals were quantitated in a phosphorimager.Figure S1Expression of wild-type and mutant PB2 proteins. Cultures of HEK293T cells were transfected with plasmids encoding wt or mutant PB2 proteins, as indicated. Total cell extracts were prepared and analysed by Western-blot using anti-PB2 antibodies as described in (0.30 MB TIF)Click here for additional data file.Figure S2Intracistronic polymerase complementation during influenza virus RNA replication. Cultures of HEK293T cells were transfected with plasmids expressing a virus-like replicon of 248 nt, the NP and various combinations of the polymerase subunits as indicated . The progeny RNPs were purified from total cell extracts over Ni-NTA-agarose resin and analysed by Western-blot with anti-NP antibodies. The top panel presents the accumulation of NP in the total cell extract whereas the bottom panel shows the NP accumulation of purified RNPs. In the bottom graph the quantitation of the data is presented as percent of maximal value.(0.59 MB TIF)Click here for additional data file.Figure S3Phenotype of trans-complemented RNPs. The purified RNP preparations presented in (0.51 MB TIF)Click here for additional data file.Figure S4Control of the biological activity of transfected RNPs. To verify the biological activity of the PB2 E361A RNPs used in the experiments described in (0.96 MB TIF)Click here for additional data file.Figure S52+-NTA-agarose resin. Cultures of HEK293T cells were transfected with plasmids expressing PB1, PB2, PA, NP and a model vRNA template (\u0394NS clone 23). At 24 h post-transfection, cell extracts were prepared and used for affinity chromatography over Ni2+-NTA-agarose resin as described under Linearity of the RNP binding to Ni(0.59 MB TIF)Click here for additional data file."}
+{"text": "The viral genome of HIV-1 contains several secondary structures that are important for regulating viral replication. The stem-loop 1 (SL1) sequence in the 5' untranslated region directs HIV-1 genomic RNA dimerization and packaging into the virion. Without SL1, HIV-1 cannot replicate in human T cell lines. The replication restriction phenotype in the SL1 deletion mutant appears to be multifactorial, with defects in viral RNA dimerization and packaging in producer cells as well as in reverse transcription of the viral RNA in infected cells. In this study, we sought to characterize SL1 mutant replication restrictions and provide insights into the underlying mechanisms of compensation in revertants.HIV-1 lacking SL1 (NL\u0394SL1) did not replicate in PM-1 cells until two independent non-synonymous mutations emerged: G913A in the matrix domain (E42K) on day 18 postinfection and C1907T in the SP1 domain (P10L) on day 11 postinfection. NL\u0394SL1 revertants carrying either compensatory mutation showed enhanced infectivity in PM-1 cells. The SL1 revertants produced significantly more infectious particles per nanogram of p24 than did NL\u0394SL1. The SL1 deletion mutant packaged less HIV-1 genomic RNA and more cellular RNA, particularly signal recognition particle RNA, in the virion than the wild-type. NL\u0394SL1 also packaged 3- to 4-fold more spliced HIV mRNA into the virion, potentially interfering with infectious virus production. In contrast, both revertants encapsidated 2.5- to 5-fold less of these HIV-1 mRNA species. Quantitative RT-PCR analysis of RNA cross-linked with Gag in formaldehyde-fixed cells demonstrated that the compensatory mutations reduced the association between Gag and spliced HIV-1 RNA, thereby effectively preventing these RNAs from being packaged into the virion. The reduction of spliced viral RNA in the virion may have a major role in facilitating infectious virus production, thus restoring the infectivity of NL\u0394SL1.HIV-1 evolved to overcome a deletion in SL1 and restored infectivity by acquiring compensatory mutations in the N-terminal matrix or SP1 domain of Gag. These data shed light on the functions of the N-terminal matrix and SP1 domains and suggest that both regions may have a role in Gag interactions with spliced viral RNA. The 5' noncoding leader sequence of the HIV-1 genome contains important cis-acting packaging elements. This leader region forms a series of secondary structures, including the transactivation response element, the poly(A) hairpin, the U5-PBS complex, and stem loops (SL) 1 to 4 [HIV-1 packages two copies of the viral RNA genome, in dimeric form, through Gag-RNA interactions . The cis) 1 to 4 -8. Despi) 1 to 4 ,10. Furt) 1 to 4 -11. The ) 1 to 4 ,11-16. T) 1 to 4 ,18. Howe) 1 to 4 , as SL1,) 1 to 4 ,16.Within the virion, HIV-1 genomic RNA exists as a dimer held together by a noncovalent linkage at the 5' end . The dimGiven the critical role of SL1 in viral RNA dimerization and packaging, it is not surprising that deletion of SL1 from a replication competent HIV-1 molecular clone renders the virus non-infectious in human T cell lines ,33-37. HSeveral restrictions on the replication of SL1 deletion mutant in T cell lines have been identified, including viral RNA dimerization and packaging in producer cells and reverse transcription (RT) of the viral RNA in infected cells -37,39,40Here we report two independent adaptations of HIV-1 that partially restored infectivity in SL1 deletion mutants in a restrictive cell line in as little as 11 days. The revertants retained the SL1 deletion but harbored compensatory mutations in Gag. SL1 deletion mutants carrying these compensatory mutations were effective in excluding spliced viral RNA from packaging. We show that reduced association between the mutated Gag and spliced viral RNA plays a major role in the exclusion of spliced HIV-1 RNAs in the revertants.Previous studies have shown that HIV-1 SL1 deletion mutants do not replicate in human T cell lines and that compensatory mutations that partially rescue the replication defect arise after several passages in culture ,34,41. IThe two distinct growth kinetics of NL\u0394SL1 in PM-1 cells, shown in Figure To identify the mutations responsible for the increased infectivity of NL\u0394SL1 and to rule out the possibility that NL\u0394SL1 had reverted the SL1 deletion, we isolated viral RNA from the culture supernatants, and amplified and sequenced the near full-length genome of the virus. Sequences derived from NL\u0394SL1-D14 and NL\u0394SL1-D22 showed that both variants still harbored the SL1 deletion found in NL\u0394SL1 (data not shown). A G913A substitution (NL4-3 numbering) was found in the matrix (MA) of NL\u0394SL1-D22, leading to an E42K amino acid change in the protein, and a C1907T substitution was found in the SP1 of NL\u0394SL1-D14, corresponding to a P10L substitution. Neither mutation had been associated with enhanced infectivity of HIV-1 prior to this study, nor did we identify additional mutations in other parts of the mutant genomes. A survey of 9675 subtype B MA protein sequences retrieved from the Los Alamos HIV Sequence Database showed that almost all sequences harbor glutamic acid at position 42, whereas lysine was detected in only 10 sequences. Leucine was not present at position 10 in any of 4454 subtype B SP1 peptide sequences retrieved from the sequence database . These results suggest that these two compensatory mutations are uncommon in naturally occurring HIV-1 strains. Furthermore, these data indicate that more than one mutational pathway can compensate for the loss of SL1 secondary RNA structure.To verify the contribution of mutations G913A and C1907T to the enhanced infectivity of the SL1 mutant, we performed site-directed mutagenesis of NL\u0394SL1 to generate NL\u0394SL1-913, NL\u0394SL1-1907 and NL\u0394SL1-913/1907 strains. The mutant vectors were identical to the NL\u0394SL1 sequence, except that NL\u0394SL1-913 contained a G913A substitution in the MA gene, NL\u0394SL1-1907 had a C1907T mutation in the SP1 region and NL\u0394SL1-913/1907 harbored both mutations. Equal amounts of p24-normalized NL4-3, NL\u0394SL1, NL\u0394SL1-913, NL\u0394SL1-1907 or NL\u0394SL1-913/1907 were used to infect PM-1 cells, and growth kinetics were measured. SL1 deletion revertants having mutations in MA, SP1 or both demonstrated intermediate replication efficiencies between NL4-3 and NL\u0394SL1 . We therefore propose that the compensatory mutations in MA or SP1 play a role in making Gag more effective in preventing spliced NL\u0394SL1 mRNA from being packaged. Based on this prediction, we hypothesized that the compensatory mutations in MA or SP1 reduce the association between Gag and spliced viral mRNA, thereby reducing the likelihood of spliced viral mRNA being packaged into the virion. To test this hypothesis, we quantified Gag and HIV-1 RNA association by immunoprecipitation, followed by qPCR as previously described with modifications [The primary recognition sites for NC are the four SLs in the 5' UTR of the HIV-1 genome ,11-16. Bications .In these experiments, we observed different associations between Gag and the RNAs of NL4-3, the SL1 deletion mutant, and the revertants, although these vectors had similar RNA expression in the producer cells Figure . Gag carIn vitro binding assay can be used to confirm the above association between mutant Gag and HIV-1 RNA, but one caveat is that such experiment may not reflect the Gag-RNA association in the physiological condition of a cell. Taken together, these data indicate that HIV-1 can adapt to a severe genetic defect in SL1 through mutations in MA or SP1 that reduce the association of Gag to spliced \u0394SL1 HIV-1 RNA, thus effectively preventing these RNAs from being packaged and subsequently increasing the production of infectious virions.We then examined the association between Gag and spliced HIV-1 mRNA. Compared to the wild type, we found that Gag showed an enhanced association with NL\u0394SL1 spliced mRNA, immunoprecipitating about 4-fold more singly spliced and fully spliced RNA Figure . This isWe demonstrated new pathways for HIV-1 to compensate for a deletion of SL1. A G913A (E42K) mutation in MA and a C1907T (P10L) mutation in SP1 were responsible for the enhanced infectivity of NL\u0394SL1 in PM-1 cells through partially restoring the packaging specificity of viral RNA. These compensatory mutations may enable Gag to exclude spliced viral RNA from packaging and interfere with the production of infectious virus in SL1 deletion mutants. Prior to this study, no mutations at either of these amino acid positions in Gag had been associated with restoring the infectivity of a mutant. We also present evidence that both mutations affect the Gag-HIV-1 RNA association in a cell-based system. This study provides new insights into the functions of the N-terminal MA domain and SP1 and suggests that both regions may have a role in interacting with different spliced viral RNA transcripts.The pNL4-3 molecular clone was obtained from the NIH AIDS Reagent Program  and was The HIV indicator cell line TZM-bl and human T cell line PM-1 were obtained from the NIH AIDS Reagent Program ,58. Huma50 of the virus was determined by the Reed and Muench method.Viruses were generated from 293T cells by transfection using the standard calcium phosphate method. Forty-eight hours after transfection, the culture supernatant was harvested and passed through a 0.45-\u03bcm-pore size filter to remove cellular debris, and centrifuged through a 20% sucrose cushion. The virus pellet was resuspended in PBS and quantified by p24 ELISA (Advanced BioScience Laboratories). The TCID5 cells were inoculated with 10 ng of p24-normalized virus for 4 hours. Unbound viruses were removed by washing with PBS, and the infected cells were cultured in 6-well plates. Cells were split 1:2 every 7 days. Culture supernatants were collected at different times for detection of infectious virus by TZM-bl cells or measurement of p24 by ELISA.A total of 5 \u00d7 10Viral RNA was isolated from the infected culture supernatants using the QIAamp Viral RNA Mini Kit (Qiagen) and converted to cDNA with random hexamers using SuperScript III reverse transcriptase (Invitrogen). The cDNA was amplified using the FastStart High Fidelity PCR System (Roche) in four overlapping fragments covering the near full-length genome of NL4-3. The PCR products were sequenced with overlapping primers, and the resulting sequence contigs were assembled with the Staden Package (PCR and sequencing primer sequences are available upon request) . Every nHIV-1 virion equivalent to 100 ng of p24 was pelleted by centrifugation and resuspended in sample buffer containing 5 mM \u03b2-mercaptoethanol. Samples were separated by SDS-PAGE and transferred to PVDF membrane. Blot was probed first with antiserum to HIV-1 p24 or gp120 (obtained from Dr. Michael Phelan through the NIH AIDS Reagent Program)  and then6 293T cells transfected with different HIV-1 constructs using TRIzol LS Reagent (Invitrogen). The RNA was converted to cDNA and amplified in a standard PCR using forward primer specific for the NL4-3 U5 (nt 551-570) and reverse primer specific for the vpu (nt 6220-6199). The PCR products were analyzed in a 2% agarose gel, gel purified and cloned into the pCR4-TOPO TA cloning vector (Invitrogen) for sequencing.Total RNA was isolated from 2 \u00d7 10Virion equivalent to 200 ng of p24 was pelleted, and the viral RNA was extracted using TRIzol LS Reagent (Invitrogen) and treated with DNase I. The RNA was separated on a nondenaturing agarose gel in 1\u00d7 TBE buffer. After electrophoresis, the gel was incubated in 6% formaldehyde at 65\u00b0C for 30 min, and the RNA was transferred to a nylon membrane. RNA was cross-linked to the membrane and detected by a 235-nt RNA probe synthesized using the DIG Northern Starter Kit (Roche), which corresponds to the R-PBS region of HIV-1 . Hybridization and detection of the DIG-labeled RNA probe followed the manufacturer's protocol, which utilized a chemiluminescence detection reagent. RNA on the membrane was quantified by densitometry using ImageJ software.http://mfold.bioinfo.rpi.edu. Folding conditions were 37\u00b0C and 1 M NaCl. Sequences comprising nt 456 to 2080 of the NL4-3, NL-913 and NL-1907 genomic RNAs and nt 456 to 2037 of the NL\u0394SL1, NL\u0394SL1-913 and NL\u0394SL1-1907 genomic RNAs were used for the folding predictions.RNA secondary structure prediction was performed using Mfold v3.2 ,62, hostenv mRNA or rev mRNA using TaqMan Gene Expression Master Mix (Applied Biosystems) according to the manufacturer's protocol. The same cDNA preparations were also subjected to qPCR using primers specific to the cellular RNA, Y1, Y3 and SRP RNA and the Fast SYBR Green Master Mix (Applied Biosystems). All primer and probe sequences are available upon request.Equivalent amounts of p24 from NL4-3, NL\u0394SL1, NL\u0394SL1-913 and NL\u0394SL1-1907 were treated with DNase I and digested with proteinase K. Viral RNA was isolated with 6 M guanidinium isothiocyanate in the presence of GlycoBlue Coprecipitant (Ambion) and precipitated with isopropanol. The resulting viral RNA was converted to cDNA with random hexamers using SuperScript III reverse transcriptase (Invitrogen) and treated with Dpn I. The cDNA was then subjected to qPCR using primer/probe sets specific for the HIV-1 genomic RNA, 6 cells using TRIzol LS Reagent. The isolated RNA was treated with DNase I before conversion to cDNA using random hexamers. The resulting cDNA was further treated with Dpn I and quantified by qPCR with primer/probe sets specific for the HIV-1 genomic RNA, env mRNA and rev mRNA sequences as described previously. The transfection efficiency was determined by measuring the percentage of GFP+ expression from a co-transfected reporter construct. The copy number in each sample was normalized to the level of PBGD mRNA.For the analysis of viral RNA expression in the producer cells, 293T cells transfected with the corresponding vectors were harvested and washed with PBS. Total RNA was isolated from 2 \u00d7 10env mRNA and rev mRNA as described previously. The transfection efficiency was determined by measuring the percentage of GFP+ expression from a co-transfected reporter construct. The number of cell in the input material was standardized using TruCount Absolute-Count tube (BD Biosciences) and flow cytometry.A previously described protocol with modifications was used . 293T ceThe authors declare that they have no competing interests.N.R. designed and performed experiments, analyzed data and wrote the manuscript. M.P.S.C designed and performed experiments, analyzed data, wrote the manuscript and supervised the project.Supplemental Figure S1. Replication of NL4-3 and NL\u0394SL1 in PM-1 cells as determined by p24 ELISA. PM-1 cells were infected with p24-normalized NL4-3 or NL\u0394SL1. Culture supernatants from the infected PM-1 were collected at different times, and p24 levels were measured by ELISA.Click here for fileSupplemental Figure S2. Predicted secondary structures of NL4-3 and SL1 deletion mutants. Genomic RNA of (A) NL4-3, (B) NL-913 and (C) NL-1907 (nt 456 to 2080) and (D) NL\u0394SL1, (E) NL\u0394SL1-913 and (F) NL\u0394SL1-1907 (nt 456 to 2037) were subjected to Mfold analysis. The SL1 and SL2 and the positions of the MA (913) and SP1 (1907) substitutions are labeled.Click here for file"}
+{"text": "Tomato bushy stunt tombusvirus (TBSV) in a yeast model host revealed the involvement of seven ESCRT  proteins in viral replication. In this paper, we show that the expression of dominant negative Vps23p, Vps24p, Snf7p, and Vps4p ESCRT factors inhibited virus replication in the plant host, suggesting that tombusviruses co-opt selected ESCRT proteins for the assembly of the viral replicase complex. We also show that TBSV p33 replication protein interacts with Vps23p ESCRT-I and Bro1p accessory ESCRT factors. The interaction with p33 leads to the recruitment of Vps23p to the peroxisomes, the sites of TBSV replication. The viral replicase showed reduced activity and the minus-stranded viral RNA in the replicase became more accessible to ribonuclease when derived from vps23\u0394 or vps24\u0394 yeast, suggesting that the protection of the viral RNA is compromised within the replicase complex assembled in the absence of ESCRT proteins. The recruitment of ESCRT proteins is needed for the precise assembly of the replicase complex, which might help the virus evade recognition by the host defense surveillance system and/or prevent viral RNA destruction by the gene silencing machinery.Plus-stranded RNA viruses replicate in infected cells by assembling viral replicase complexes consisting of viral- and host-coded proteins. Previous genome-wide screens with  endosomal sorting complexes required for transport) play important roles in tombusvirus replication. The expression of dominant negative mutants of ESCRT factors inhibited virus replication in the plant host, suggesting that tombusviruses co-opt selected ESCRT proteins for the assembly of the viral replicase complex. In addition, we show direct interaction between the viral p33 replication protein and Vps23p ESCRT-I and Bro1p accessory ESCRT factors. The interaction with p33 leads to the recruitment of Vps23p to the peroxisomes, the sites of tombusvirus replication. We also showed that the viral RNA within the viral replicase complex became more sensitive to ribonuclease in the absence of ESCRT factors, suggesting that the protection of the viral RNA is compromised within the replicase complex assembled in the absence of ESCRT proteins. Intriguingly, the host ESCRT factors also affect the budding of several enveloped viruses, intracellular transport of proteins and cytokinesis. Overall, this work demonstrates that a plus-stranded RNA virus uses the endosomal sorting pathway in a unique way.Plus-stranded RNA viruses, which are important pathogens of humans, animals and plants, replicate in infected cells by assembling viral replicase complexes consisting of viral- and host-coded proteins. In this paper, we show that a group of host factors called ESCRT proteins ( Brome mosaic virus (BMV), Tomato bushy stunt virus (TBSV), West Nile virus and Droshophila virus C, in yeast and animal model hosts led to the identification of host proteins including ribosomal proteins, translation factors, RNA-modifying enzymes, proteins of lipid biosynthesis and others Plus-stranded (+)RNA viruses replicate in the infected cells by assembling viral replicase complexes consisting of viral- and host-coded proteins in combination with the viral RNA template. Although major progress has recently been made in understanding the functions of the viral replication proteins, including the viral RNA-dependent RNA polymerase (RdRp) and auxiliary replication proteins, the contribution of host proteins is poorly documented Saccharomyces cerevisiae) as a model host pol) and 6\u201310 host proteins in the replicase complex pol binds to the essential p33 replication protein that is required for assembling the functional replicase complex TBSV is a small (+)RNA virus that infects a wide range of host plants. TBSV has recently emerged as a model virus to study virus replication, recombination, and virus - host interactions due to the development of yeast . First, we have made dominant negative mutants of two AtVPS23 via deletion of the N-terminal UEV (ubiquitin E2 variant) domain. We have found that co-expression of CNV genomic (g)RNA with either AtVPS23-1dn or AtVPS23-2dn in N. benthamiana leaves from the constitutive 35S promoter via agroinfiltration led to inhibition of CNV gRNA replication in the infiltrated leaves  in N. benthamiana leaves led to dramatic inhibition of CNV gRNA replication in the infiltrated leaves  and AtSNF7-1, respectively, in N. benthamiana leaves when compared with the control samples (Since the ESCRT proteins are involved in membrane bending/invagination  samples .Tobacco rattle virus (TRV), in similarly treated N. benthamiana leaves. These experiments revealed the lack of inhibition of TRV RNA accumulation in leaves expressing the dominant negative ESCRT proteins  DI-72 replicon (rep)RNA were expressed from separate expression plasmids in the above plants. The activity of the isolated tombusvirus replicase was tested in vitro on the co-purified repRNA . Expression of the full-length AtVPS24 and AtVPS4 did not show as much inhibitory effect on the activity of the isolated replicase as the AtVPS24 and AtVPS4(K178A) dominant negative mutants repRNA, which is associated with the replicase vps23\u0394 yeast in contrast with 46% in the wt control samples - and (+)-strand synthesis, takes place in a membrane-bound replicase complex that provides protection against ribonucleases  samples . In addiN. benthamiana, we have developed a novel approach for targeted degradation of minus-stranded RNA replication intermediate via RNA interference (RNAi). We chose the (\u2212)repRNA as a target, since it has been shown to be always part of the membrane-bound replicase complex and it is protected from ribonucleases To confirm the increased sensitivity of the tombusvirus replicase complex to ribonucleases when ESCRT factors are inhibited in AtVPS24, and AtSNF7-1, respectively (AtVPS4(K178A) decreased DI-miR accumulation moderately when compared with the control plants DI-miR RNA to the RNAi machinery when dominant negative ESCRT-III factors are expressed. This, in turn, supports the model that the tombusvirus replicase complexes are assembled less precisely in these plants, making them more accessible to targeted ribonucleases. Overall, these data support the role of ESCRT-III proteins in the precision/quality of viral replicase assembly.Arabidopsis and two Nicotiana homologues of Vps23p interacted with the p33 replication co-factor  with either the UEV domain of Vps23p or Bro1p. In this experiment, the HA-tagged UEV domain of Vps23p and Bro1p were expressed from the original chromosomal locations and the native promoters. Purification of p33HF on a FLAG-column, followed by Western analysis revealed that UEV-HA , lane 2 CUP1 promoter, we observed the partial re-distribution of Vps23p-GFP to the peroxisomal membrane  from its native promoter and chromosomal location in combination with Pex13p tagged with red fluorescent protein (RFP), a marker for the peroxisomal membrane membrane . The co-in vitro strand RNA replicated poorly in N. benthamiana leaves expressing dominant negative ESCRT-III mutants  and other enveloped retroviruses co-opt ESCRT components through direct interaction with Tsg101, the human homologue of Vps23p, and with Alix, a homologue of Bro1p Another novel feature is that Vps23p, in the presence of p33 replication co-factor, is shown to re-localize temporarily to the peroxisomal membrane, which represents the place of tombusvirus replicase assembly vps23\u0394 yeast supported low TBSV repRNA replication  , step 1 A. thaliana VPS4 (At2g27600) A. thaliana total DNA as template. This product was digested with BamHI and XhoI and ligated into similarly digested pGD A. thaliana total DNA as template. These PCR products were digested with NheI, ligated together and the product was re-amplified with primers #2746/#2749. The obtained PCR product was digested with BamHI and XhoI and cloned into pGD. The 3\u2032 terminal portion of the two VPS23 homologues from A. thaliana, namely At3g12400  VPS23 PCR products were digested with BamHI and SalI and cloned into BamHI/SalI-digested pGD-L. To construct pGD-L, the leader sequence from Tobacco etch virus was PCR-amplified using plasmid pTEV-7DA BglII and BamHI and cloned into BamHI-digested pGD to generate pGD-L. The ESCRT-III homologues from A. thaliana, namely VPS24  was digested with 1 \u00b5l of 20 \u00b5g/ml RNase A for 5 min. After the treatment, the RNA was extracted with phenol-chloroform, ethanol precipitated, recovered by centrifugation and analyzed in 5% polyacrylamide denaturing gel, blotted and hybridized with a 32P-labeled (+)DI-72 RNA probe S. cerevisiae strains BRO1::6xHA-KanMX4 and UEV::6xHA-KanMX4 were generated by homologous recombination using strain BY4741 as background. PCR was performed using plasmid pYM-14 (EUROSCARF) EcoRI and NheI and cloned into pPR-N-RE BamHI and NheI and cloned into pPR-C-RE The split-ubiquitin assay was based on the Dualmembrane kit 3 . pGAD-BT2-N-His33 has been described previously A. thaliana UEV-1  and UEV-2  were amplified from genomic DNA with primers #2669/#2670 and #2984/#2985 respectively, digested with BamHI and SalI and cloned into pPR-N-RE digested with BamHI/SalI or BglII/SalI. Nicotiana sp homologues of Vps23-UEV were amplified from N. benthamiana or N. tabacum genomic DNA with primers #2986 and #2987 , digested with BglII and SalI and cloned into pPR-N-RE digested with BglII/SalI.Yeast strain NMY51/vps4\u0394::URA3 was created by homologous recombination using the URA3 gene, which was amplified from plasmid pCM189 S. cerevisiae strain DKY79 , expressing the GFP tagged Vps23p from the native promoter and chromosomal location NcoI/PstI and cloned into similarly digested pGBK-His33/CUP1 NheI/XhoI and cloned into SpeI/XhoI digested pYC2/CT (Invitrogen) generating pYC-CUP-Flag33. PEX13 ORF was amplified by PCR using primers #1277/#1278 and pGAD-pex13-CFP RFP ORF was amplified from genomic DNA of a pex3-RFP yeast strain BglII, ligated and reamplified with primers #1277 and #2663. This product was digested with HindIII and BamHI and cloned into similarly digested pGAD H- 4 to induce p33 expression.Figure S1N. benthamiana cells. Several characteristic virus-induced spherules are marked with arrowheads. These spherules are formed via membrane invagination into peroxisomal or ER-derived membranes. Panels I and II show control samples, which were obtained from leaves either infected with CNV gRNA or agroinfiltrated to express p33/p92/DI-72 repRNA. Panel III shows a magnified portion of panel II to visualize \u223c20 individual spherules within the membranous structure. Note that, in addition to the reduced numbers (not shown), the sizes of the spherules are very variable in cells over-expressing the dominant negative Snf7-1p (panel IV) when compared with the control infections (panels I and II). The expression of the dominant negative Vps4p mutant made portions of the cells containing irregular membranes and we could not definitively identify virus-induced spherules (panel VI).Reduced number of tombusvirus-induced spherules in plant cells expressing dominant negative mutants of Snf7-1p and Vps4p. Representative electron microscopic images of portions of (2.72 MB TIF)Click here for additional data file.Figure S2N. benthamiana plants expressing full-length ESCRT factors. Denaturing PAGE of in vitro replicase activity in the membrane-enriched fraction from co-infiltrated leaves expressing p33, p92pol, DI-72 repRNA, p19 (suppressor of gene silencing) and the shown ESCRT factors using the co-purified repRNA template.The in vitro activity of the isolated tombusvirus replicase preparations from (0.05 MB PDF)Click here for additional data file.Figure S3bro1\u0394 and vps23\u0394 on tombusvirus RNA accumulation in yeast. Total RNA was extracted from yeast 24 hours after inducing repRNA replication. The accumulation of (+)repRNAs was measured by Northern blotting, whereas the ribosomal RNA (rRNA) was used as a loading control (not shown). Each experiment was done at least six times. Overall the result indicates that the lack of BRO1 and VPS23 ESCRT genes inhibits repRNA accumulation, suggesting that these genes play a role in tombusvirus replication.The effect of (0.01 MB PDF)Click here for additional data file.Protocol S1Supplementary materials and methods.(0.08 MB PDF)Click here for additional data file.Table S1List of primers used in this study.(0.04 MB PDF)Click here for additional data file."}
+{"text": "Tomato bushy stunt virus (TBSV) replication in a yeast model host. Additional in vitro assays with whole cell extracts prepared from yeast strains expressing the eEF1A mutants demonstrated several functions for eEF1A in TBSV replication: facilitating the recruitment of the viral RNA template into the replicase complex; the assembly of the viral replicase complex; and enhancement of the minus-strand synthesis by promoting the initiation step. These roles for eEF1A are separate from its canonical role in host and viral protein translation, emphasizing critical functions for this abundant cellular protein during TBSV replication.Replication of plus-strand RNA viruses depends on host factors that are recruited into viral replicase complexes. Previous studies showed that eukaryotic translation elongation factor (eEF1A) is one of the resident host proteins in the highly purified tombusvirus replicase complex. Using a random library of eEF1A mutants, we identified one mutant that decreased and three mutants that increased  Tomato bushy stunt virus (TBSV) replication in a yeast model host. Based on a random library of eEF1A mutants, we identified eEF1A mutants that either decreased or increased TBSV replication. In vitro studies revealed that eEF1A facilitated the recruitment of the viral RNA template for replication and the assembly of the viral replicase complex, as well as eEF1A enhanced viral RNA synthesis in vitro. Altogether, this study demonstrates that eEF1A has several functions during TBSV replication.Plus-stranded RNA viruses are important pathogens of plants, animals and humans. They replicate in the infected cells by assembling viral replicase complexes consisting of viral- and host-coded proteins. In this paper, we show that the eukaryotic translation elongation factor (eEF1A), which is one of the resident host proteins in the highly purified tombusvirus replicase complex, is important for  Genome-wide screens for host factors affecting RNA virus infections have led to the identification of several hundreds host proteins in recent years Tomato bushy stunt virus (TBSV) and other tombusviruses are model plant RNA viruses with 4.8 kb genomic (g)RNA coding for two replication proteins, termed p33 and p92pol, and three proteins involved in cell-to-cell movement, encapsidation, and suppression of gene silencing Saccharomyces cerevisiae) expressing p33 and p92pol replication proteins can efficiently replicate a short TBSV-derived replicon (rep)RNA One of the major advantages of studying TBSV replication is the availability of genomic and proteomic datasets on virus-host interactions pol, the heat shock protein 70 chaperones , glyceraldehyde-3-phosphate dehydrogenase , pyruvate decarboxylase (Pdc1p), Cdc34p ubiquitin conjugating enzyme Additional global approaches based on the yeast proteome microarray (protein array) have led to the identification of over 100 host proteins that interact with viral RNA or the viral replication proteins TEF1 and TEF2), whereas animals and plants have 2\u20137 genes and several isoforms of eEF1A. (ii) eEF1A provides essential functions for cell viability and mutations could have pleiotropic effects on protein translation, actin bundling and apoptosis. (iii) eEF1A is a very abundant protein that constitutes 1\u20135% of total cellular proteins, making it difficult to completely remove eEF1A from biochemical assays using cell extracts. (iv) eEF1A is also required for the translation of viral proteins in infected cells, making it difficult to separate its effect on translation versus replication, processes that are interdependent.eEF1A is a highly abundant cellular protein with a role in delivering aminoacyl-tRNA to the elongating ribosome in a GTP-dependent manner. Many additional functions have been ascribed to eEF1A including quality control of newly produced proteins, ubiquitin-dependent protein degradation, and organization of the actin cytoskeleton Turnip yellow mosaic virus (TYMV) Tobacco mosaic virus (TMV) and Turnip mosaic virus (+)RNA The first evidence that translation elongation factors, such as EF-Tu and EF-Ts, play a role in (+)RNA virus replication was obtained with bacteriophage Qbeta in vitroThe actual biochemical functions provided by eEF1A for (+)RNA virus replication are currently poorly understood. In case of WNV, eEF1A is co-localized with the WNV replicase in the infected cells and mutations in the WNV (+)RNA within the mapped eEF1A binding site have led to decreased minus-strand synthesis pol replication proteins eEF1A has been shown to interact with the components of the tombusvirus replicase, including the 3\u2032-UTR of the repRNA, as well as the p33 and p92in vitro approaches. The obtained data support the model that eEF1A plays several roles during TBSV replication, including facilitating the assembly of the viral replicase complex. Moreover, using in vitro replication assays, we demonstrate that eEF1A enhances minus-strand synthesis via stimulating the initiation step of the viral RNA-dependent RNA polymerase. Since eEF1A is also associated with several other viral replication proteins or binds to viral RNAs, it is possible that the uncovered functions of eEF1A might be utilized by other RNA viruses during their replication as well.In this paper, we characterized the functions of eEF1A in TBSV replication based on identification of functional eEF1A mutants in yeast as well as using TEF1/TEF2) were deleted from the chromosome, while the wt or mutated eEF1A was expressed from plasmids. Importantly, a given eEF1A mutant is the only source of eEF1A in the yeast cells used. Using the high-throughput assay, we identified one yeast strain (N21) expressing an eEF1A mutant that supported reduced TBSV repRNA replication, while the other three strains with eEF1A mutants  showed increased level of repRNA accumulation -stranded repRNA and (+)-stranded progeny Since eEF1A is part of the tombusvirus replicase complex in vitro TBSV repRNA replication more efficiently than the replicase with the wt eEF1A. In contrast, CFE from N21 yeast supported TBSV repRNA replication to similar extent as the CFE containing wt eEF1A  or (\u2212)-strand synthesis, we analyzed the replication products under non-denaturing versus denaturing conditions (32P-labeled (\u2212)RNA product hybridized with the (+)RNA] increased \u223c3-fold in case of C42, C53 and C62 mutants , which is unlike the E. coli-expressed TBSV or CNV p92pol RdRp, does not need the yeast cell-free extract to be functional in vitroin vitro to produce the complementary (\u2212)RNA product RNA synthesis by a viral RdRp.To test directly if eEF1A could stimulate RNA synthesis by the viral RdRp, we chose the in vitro RdRp assay was due to binding of eEF1A to the (+)RNA template and/or to the TCV RdRp protein. Pre-incubation of the purified wt eEF1A with the TCV RdRp prior to the RdRp assay led to a \u223c5-fold increase in in vitro (\u2212)RNA synthesis (Since it is known that eEF1A can bind to the 3\u2032-UTR of TBSV (+)RNA as well as to the tombusvirus replication proteins de novo initiation of RNA synthesis by the TCV RdRp de novo initiation step in the RdRp assay.To test if eEF1A stimulates the rate of initiation of (\u2212)RNA synthesis, we analyzed the amount of abortive RNA products, which are generated during de novo initiation, we analyzed the amount of 3\u2032-terminal extension (3\u2032-TEX) RNA products, which are generated from an internal primer by the TCV RdRp RNA synthesis.To test if eEF1A stimulates the rate of RNA synthesis in the absence of TCV RdRp  [55]. AdTCV RdRp , suggestTo further test the function of eEF1A in TBSV replication, we used chemical inhibitors of eEF1A, including Didemnin B (DB) and Gamendazole (GM). DB inhibits the activity of GTP-bound eEF1A during translation by binding to a pocket in eEF1A involved in the interaction with the aminoacylated tRNA and the nucleotide exchange factor eEF1Balpha in vitro assembly/replication assay, also based on CFE containing endogenous eEF1A 32P-labeled UTP) to the membrane fraction of the CFE to allow for RNA synthesis by the pre-assembled replicase complex  and, second, biotin-labeled viral (+)repRNA was added. After short incubation in the absence or presence of various amount of DB, we performed affinity-purification of the viral RNA. Phosphoimaging revealed that eEF1A was co-purified with the viral RNA and the amount of protein co-purified with the viral (+)repRNA was inhibited by increasing amount of DB in the assay , and template recruitment to intracellular membranes he assay . Altoget(+)RNA virus replicases contain viral- and host-coded components, which likely provide many yet undefined functions to facilitate robust virus replication in infected cells. Translation factors, such as eEF1A, are among the most common host factors recruited for (+)RNA virus replication. eEF1A is an integral component of several viral replicases, including the highly purified tombusvirus replicase complex. Since eEF1A is an essential G protein involved in translation elongation, it is difficult to obtain evidence for its direct involvement in virus replication in living cells. Indeed, down-regulation of eEF1A in cells has led not only to decreased TBSV repRNA accumulation, but also reduced p33 levels pol, but likely via directly altering viral replication and affecting the activity of the viral replicase. On the other hand, N21 mutant of eEF1A resulted in decreased TBSV RNA accumulation and also led to reduction in the level of p33 replication protein. This is reminiscent of the previously characterized GDP-binding mutant T22S Based on the previous successful strategy of analyzing eEF1A mutants, here we generated \u223c6,000 random mutants covering the entire eEF1A sequence and found four mutants, which greatly affected TBSV repRNA accumulation in yeast . Among tpol in this in vitro assay , the role of eEF1A in TBSV replication must be separate from its role in protein translation. Altogether, these data strongly established that eEF1A is directly involved in TBSV replication, independent of the role of eEF1A in protein translation.In addition to this genetic evidence on the relevance of eEF1A in TBSV replication in yeast, we also obtained additional supporting data by showing that chemical inhibitors of eEF1A, such as DB and GM, strongly inhibited replication of TBSV repRNA in the cell-free replication assay . Since wThe identified eEF1A mutants were also useful to dissect the functions of eEF1A in TBSV replication. Based on a cell-free TBSV replication assay in CFE prepared from yeast expressing the C42, C53 or C62 mutants, we found that the minus-strand synthesis was enhanced by \u223c3-fold, while the rate of plus-strand synthesis was proportionate with (\u2212)RNA synthesis, resulting in \u223c10-fold more (+) than (\u2212)RNA products for wt and each mutant.in vitro by using a highly purified eEF1A and the recombinant TCV RdRp, which is closely homologous with the TBSV p92pol. Interestingly, it seems that eEF1A stimulates the RdRp activity directly, since pre-incubation of eEF1A and the RdRp prior to the RdRp assay led to the highest level of stimulation of (\u2212)RNA synthesis repRNA in vitro experiments with purified tombusvirus replicase preparations confirmed the lack of inhibition of RNA synthesis by DB or GM RNA DB or GM  on pre-ain vitroThe inhibition of the tombusvirus replicase complex by DB or GM might come from the ability of these compounds to inhibit the template RNA recruitment step . If the de novo initiation for RNA synthesis. Indeed, the chaperone activity of eEF1A and its bacterial homolog EF-Tu has been shown before The presented data are also in agreement with the function of eEF1A as a chaperone of the viral RdRp. Binding between the eEF1A and RdRp might alter the structure of the RdRp that favors Overall, the current work demonstrates two major functions for eEF1A in TBSV replication : (i) stiSaccharomyces cerevisiae strain BY4741 (MATahis3\u03941 leu2\u03940 met15\u03940 ura3\u03940) was obtained from Open Biosystems . Plasmid-borne TEF1/2 TKY strains  were published before Cucumber necrosis virus (CNV) p33 and the TBSV replicon RNA, called DI-72, was described earlier LYS2-based plasmid pRS317-Tet-His92, expressing CNV p92 under the control of Tetracycline-regulatable (Tet) promoter was constructed as follows: the Tet promoter sequence was obtained from pCM189-His92/Tet EcoRI and BamHI, and CNV p92 coding sequences from pGAD-His92 BamHI and PstI, followed by ligation into pRS317 vector treated with EcoRI and PstI. To generate mutations within TEF1 coding sequence by random mutagenesis, we constructed the TRP1-based plasmid pRS314-pTEF1-TEF1, which expressed TEF1 under the control of its native promoter. The TEF1 promoter sequence, the TEF1 coding region and the Cyc1 terminator sequences were amplified by PCR with the following primer pairs, #2764 (CCGCGAGCTCATAGCTTCAAAATGTTTCTAC)/#2765 (CCGCGGATCCGTAATTAAAACTTAGATTAGATTGC), #2768 (CCGCGGATCCAAAATGGGTAAAGAGAAGTCTC)/#1877 (CCGCCTCGAGTTATTTCTTAGCAGCCTTTTGAGCAGC), and #2769 CCGCCTCGAGGAGGGCCGCATCATGTAA/#2770 (CCGCGGTACCAGCTTGCAAATTAAAGCCTTC), respectively. This was followed by cloning the PCR products into pRS314 digested with SacI and KpnI.2, 0.3 mM MnCl2, 1 mM dCTP and dTTP each, 0.2 mM dGTP and dATP each, 0.2 \u00b5M of each primer, 20 pM of template DNA and 10 units of Taq polymerase in a 10 \u00b5l reaction volume in 10 aliquots. The PCR was performed for 30 cycles at 94\u00b0C for 1 min, 50\u00b0C for 1 min, and 72\u00b0C for 1 min in a conventional thermal cycler. Three overlapping \u223c300\u2013500 bp N-, central- and C-terminal segments of the TEF1 gene were amplified separately by PCR using primer pairs: #2767 (GTTTCAGTTTCATTTTTCTTGTTC)/#2788 (GAGTCCATCTTGTTGACAG), #2787 (CATCAAGAACATGATTACTGGTAC)/#2790 (GACGTTACCTCTTCTGATTTC) and #2789 , respectively.The mutagenic PCR conditions were as follows: 50 mM KCl, 10 mM Tris (pH 8.3 at 25\u00b0C), 7 mM MgCl\u2212) by shaking at 29\u00b0C overnight. To completely suppress TBSV replication before induction, 1 mg/ml Doxycycline was added to the media to inhibit the expression of p92. The plasmid pool carrying the randomly mutated TEF1 gene was introduced into the yeast cells already transformed with the two virus expression plasmids by in vivo gap repair mechanism via homologous recombination  was transformed together with overlapping PCR (20 \u00b5g) products carrying the TEF1 mutations created by random mutagenic PCR (see above). The transformed yeast cells were selected on SC media lacking uracil, tryptophan, leucine, histidine and lysine. The colonies were further streaked onto SC media plate lacking tryptophan, leucine, histidine and lysine (SC-TLHK\u2212) with 0.1%  5-Fluoroorotic Acid (5-FOA) media to select against the URA3-based wild-type TEF1 plasmid repRNA transcript, 400 ng purified MBP-p33, 100 ng purified MBP-p92pol (both recombinant proteins were purified from E. coli), 30 mM HEPES-KOH, pH 7.4, 150 mM potassium acetate, 5 mM magnesium acetate, 0.13 M sorbitol, 0.4 \u00b5l actinomycin D (5 mg/ml), 2 \u00b5l of 150 mM creatine phosphate, 0.2 \u00b5l of 10 mg/ml creatine kinase, 0.2 \u00b5l of RNase inhibitor, 0.2 \u00b5l of 1 M dithiothreitol (DTT), 2 \u00b5l of 10 mM ATP, CTP, and GTP and 0.25 mM UTP and 0.1 \u00b5l of [32P]UTP 32P-labeled RNA products were separated by electrophoresis in a 5% polyacrylamide gel (PAGE) containing 0.5\u00d7 Tris-borate-EDTA (TBE) buffer with 8 M urea. To detect the double-stranded RNA (dsRNA) in the cell-free replication assay, the 32P-labeled RNA samples were divided into two aliquotes: one half was loaded onto the gel without heat treatment in the presence of 25% formamide, while the other half was heat denatured at 85\u00b0C for 5 min in the presence of 50% formamide 32P-labeled RNA was performed at 37\u00b0C for 30 min in a buffer containing 5 mM sodium acetate (pH 4.5 at 25\u00b0C), 0.28 M NaCl, 4.5mM ZnSO4 and 40 U S1 nuclease (Boehringer).Whole cell yeast extract capable of supporting TBSV replication In vitro TBSV replication in the fractions was performed as described Fractionation of the whole cell extract was done according to E. coli were carried out as described earlier with modifications E. coli strain BL21 Rosetta (DE3). Protein expression was induced using isopropyl \u03b2-D-thiogalactopyranoside (IPTG) for 8 h at 16\u00b0C, then the cells were collected by centrifugation . The recombinant TCV p88C protein was purified on an amylose resin column (NEB), as described pol were purified as above, except 30 mM HEPES-KOH pH 7.4 was used instead of 20 mM Tris-Cl pH 8.0. eEF1A was purified from yeast as described Expression and purification of the recombinant TBSV p33 and p92 and TCV p88C replication proteins from 2, 10 mM KCl, 0.5 M NaCl, 0.1% Nonidet P-40 (NP-40), and 1% [V/V] yeast protease inhibitor cocktail (Ypic)] by glass beads using FastPrep Homogenizer . The yeast cell lysate was cleared by centrifugation at 500\u00d7 g for 5 min at 4\u00b0C to remove unbroken cells and debris. The membrane fraction containing the viral replicase complex was collected by centrifugation at 21,000\u00d7 g for 15 min at 4\u00b0C and then solubilized in 1 ml TG buffer with a buffer containing 1% NP-40, 5% SB3\u201310 [caprylyl sulfobetaine] (Sigma), 1% [V/V] Ypic via gentle rotation for 1 h min at 4\u00b0C. The solubilized membrane fraction was centrifuged at 21,000\u00d7 g for 15 min at 4\u00b0C and the supernatant was incubated with 20 \u00b5l anti-FLAG M2-agarose affinity resin (Sigma) pre-equilibrated with 0.7 ml TG buffer. After 2 h of gentle rotation at 4\u00b0C, we washed the resin 5 times with TG buffer containing 1% NP-40, the resin-bound replicase complex was eluted in 100 \u00b5l elution buffer [50 mM Tris\u2013HCl [pH 7.5], 10% glycerol, 15 mM MgCl2, 10 mM KCl, 0.05 M NaCl, 0.5% Nonidet P-40 (NP-40), 1% Ypic and 0.15 mg/ml Flag peptide (sigma)]. In vitro RdRp activity assay was performed by using DI-72 RI(\u2212) RNA template transcribed in vitro by T7 transcription Yeast strains  were transformed with plasmids pESCHIS4-ADH-HF33/CUP1-DI-72 expressing 6XHis- and Flag-tagged CNV p33 and the TBSV DI-72 repRNA, and pRS317-Tet-His92, expressing CNV p92 under the control of Tet promoter 2, 1 mM DTT, 0.1 mM EDTA, 10% [vol/vol] glycerol, 10 U of RNase inhibitor, 10 nM 32P-labeled DI-72 (+) RNA probe and 0.5 \u00b5g purified eEF1A protein EMSA was performed in a 10 \u00b5l-reaction containing 20 mM HEPES [pH 7.6], 50 mM KCl, 2 mM MgCl35S methionine using Rabbit Reticulocyte Lysate (Promega) according to manufacturer's manual. The in vitro eEF1A translation product (10 \u00b5l) was pre-incubated in a 200 \u00b5l binding buffer  with 150 \u00b5M Didemnin B  or DMSO for 30 min at 30\u00b0C and then incubated with biotinylated DI-72(+) RNA-bound SA-PMPs for 1 h at 4\u00b0C. The SA-PMPs were collected in a magnetic stand and washed 5 times with the binding buffer, followed by elution with 30 \u00b5l SDS-PAGE sample buffer. The eluted protein samples were resolved by SDS-PAGE and then exposed to phosphorimager.For in vitro eEF1A-repRNA co-purification, DI-72(+) repRNA was biotin-labeled in standard T7 transcription reaction in the presence of 20 \u00b5M Biotin-16-UTP (Roche). After the T7 transcription, the unincorporated biotin-UTP was removed on a Bio-Rad mini gel filtration column. The biotinylated RNA was immobilized on a column containing Streptavidin MagneSphere Paramagnetic Particles (SA-PMPs). Briefly, a 30-\u00b5l suspension of SA-PMPs (Promega) was washed three times with 1 ml of water and re-suspended in 1\u00d7 Phosphate Buffered Saline (PBS). Biotinylated DI-72(+) RNA (5 \u00b5g) was then added to the suspension of SA-PMPs, followed by 30 min incubation at 4\u00b0C with gentle rotation. The SA-PMPs were collected on the side of the tube in a magnetic stand and washed 3 times with 1\u00d7 PBS buffer. eEF1A was translated in vitro and labeled with 2, 10 mM DTT, 1.0 mM each ATP, CTP, and GTP, 0.01 mM UTP plus 0.1 \u00b5l of [32P]UTP, 7 pmol template RNA, 2 pmol affinity-purified MBP-p88C. 20 pmol eEF1A was added to the reaction at the beginning or as indicated in the text and 32P-labeled RNA products were analyzed by electrophoresis in a 5% or 15% PAGE/8 M urea gel The TCV RdRp reactions were carried out as previously described for 2 h at 25\u00b0C in vitro reaction are indicated in the text. The cell-free TBSV replicase assay and the in vitro TBSV replicase assembly assay were performed according to pol and (+) repRNA were added to the cell-free reaction in the presence of 1.0 mM ATP and GTP in step 1. After incubation at 25\u00b0C for 1 h, the in vitro reactions were centrifuged 21,000\u00d7 g at 4\u00b0C for 10 min. The supernatant containing extra p33, p92pol and repRNA, which were not bound to the membranes in the cell-free extract, was discarded, while the membrane pellet was re-suspended in a standard in vitro replicase assay buffer containing [32P]-UTP and ATP, CTP, and GTP, and incubated at 25\u00b0C for 3 h Purified Didemnin B (NSC 325319) was kindly provided by the Natural Products Branch, NCI , while Gamendazole was a generous gift from Dr. Tash . Both chemicals were dissolved in DMSO . The concentrations of chemical and time point of the addition of the chemicals to the in vitro RNA recruitment reaction was performed according to 32P-labeled DI-72 (+)repRNA were used and rCTP, rUTP, 32P-labeled UTP, and Actinomycin D were omitted from the reaction. As a negative control, a recruitment-deficient repRNA, termed C99-G mutant, was used  in vitro assay, followed by incubation on ice for 10 min. Samples were centrifuged at 35,000\u00d7 g for 1h, and the pellet was washed with 1 ml reaction buffer, followed by centrifugation at 35,000\u00d7 g for 10 min. The membrane-bound repRNA was extracted from the pellet by adding 0.1 ml stop buffer and 0.1 ml phenol/chloroform and vortexing, followed by isopropanol/ammonium acetate precipitation The TBSV viral RNA gets recruited to the membrane from the soluble fraction with the help of TBSV replication proteins and host factors present in the yeast CFE. The was used , lane 2 Figure S1tef1\u0394tef2\u0394 carried a plasmid that expressed one of the random eEF1A (TEF1) mutants from the native promoter. Each yeast strain also carried pESCHIS4-ADH-His33/CUP1-DI-72 and pRS317-Tet-His92 to induce TBSV repRNA replication as described in the M&M section. (B) Additional experiments on the effect of eEF1A mutations on TBSV repRNA accumulation in yeast. The yeast strain expressed only one form of eEF1A, as indicated. Top panel: Replication of the TBSV repRNA was measured by Northern blotting 24 h after initiation of TBSV replication. (C) The accumulation level of repRNA was normalized based on the rRNA . Panels (D), (E) and (F) show the accumulation of p92pol, p33 and eEF1A, respectively, estimated by Western blotting using anti-His and anti-eEF1A antibody. (G) SDS-PAGE analysis of total protein extract from the above yeast strains, after Coomassie blue-staining.Schematic presentation of the random mutagenesis strategy used to obtain 6,000 eEF1A mutants. (A) The yeast strain ((0.15 MB PDF)Click here for additional data file.Figure S2in vitro. (A) MBP-tagged TCV p88C (lacking the p28-overlapping domain from the N-terminus), MBP-TBSV p92, MBP-TBSV p92C (lacking the p33-overlapping domain from the N-terminus) and MBP-TBSV p33 or MBP (1 \u00b5g each) were separately immobilized on amylose beads, followed by incubation with a cytosolic extract prepared from yeast. The bound host proteins were eluted from the beads and were analyzed by 10% SDS-PAGE and detected via Western blotting using anti-eEF1A antibody (Top panel). The affinity-purified recombinant MBP-TCV p88C, MBP-TBSV p92, MBP-TBSV p92C, MBP-TBSV p33 and MBP were analyzed by 10% SDS-PAGE and Coomassie blue-staining (Bottom panel). (B) The effect of eEF1A mutations on binding to the viral p33 and p92 proteins in vitro. MBP-tagged p92, p33 or MBP were separately immobilized on amylose beads, followed by incubation with a cytosolic extract prepared from yeast expressing wt or mutated eEF1A. The bound eEF1A was eluted from the beads and were analyzed by 10% SDS-PAGE and detected via Western blotting using anti-eEF1A antibody (Top panel). The affinity-purified recombinant MBP-TBSV p92, MBP-TBSV p33 and MBP were analyzed by 10% SDS-PAGE and Coomassie blue-staining (Bottom panel). (C) The effect of eEF1A mutations on binding to the viral repRNA. CFE containing WT or mutated eEF1A was incubated with biotin-labeled DI-72(+) repRNA. Then the repRNA was captured with streptavidin-coated magnetic beads, followed by elution of the co-purified proteins from the beads. Western blot analysis shows the amount of co-purified eEF1A using anti-eEF1A antibody.Binding of eEF1A to TBSV and TCV replication proteins (0.12 MB PDF)Click here for additional data file.Figure S3Lack of inhibition of TBSV repRNA replication by Cyclohexamide in a cell-free TBSV replicase assay. The cell-free TBSV replicase assay was performed as described in (0.05 MB PDF)Click here for additional data file.Figure S4in vitro activity of the purified tombusvirus replicase by Didemnin B and Gamendazole. (A) The membrane-bound tombusvirus replicase in a yeast lysate was solubilized with Triton X-100/SB3-10 detergent, followed by purification on a FLAG-affinity column as described. The activity of the affinity-purified TBSV replicase was tested on the same amount of DI-72(\u2212) RNA added to each sample. DB (panel on the left) and GM (panel on the right) were added in the following amounts: 0, 100, 150, 200, 250 \u00b5M for DB and 0, 25, 50, 100, 200 \u00b5M for GM. Denaturing PAGE analysis of the 32P-labeled RNA products obtained with the purified tombusvirus replicase is shown. Note that this replicase preparation is only capable of complementary RNA synthesis on the added template RNA, but incapable of supporting a full cycle of replication. (B) The effect of GM and DB on binding to the viral p33 and p92 proteins in vitro. MBP-tagged p92 and p33 were separately immobilized on amylose beads, followed by incubation in the presence of 0 or 100 \u00b5M GM or 150 \u00b5M DB with a cytosolic extract prepared from yeast expressing wt eEF1A. The bound eEF1A was eluted from the beads and were analyzed by 10% SDS-PAGE and detected via Western blotting using anti-eEF1A antibody (Top panel). The affinity-purified recombinant MBP-TBSV p92, MBP-TBSV p33 and MBP were analyzed by 10% SDS-PAGE and Coomassie blue-staining (Bottom panel).Lack of inhibition of the (0.09 MB PDF)Click here for additional data file."}
+{"text": "ADARs are RNA editing enzymes that target double stranded RNA and convert adenosine to inosine, which is read by translation machinery as if it were guanosine. Aside from their role in generating protein diversity in the central nervous system, ADARs have been implicated in the hypermutation of some RNA viruses, although why this hypermutation occurs is not well understood.Drosophila melanogaster. The clustering of these mutations and the context in which they occur indicates that they have been caused by ADARs. However, ADAR-editing of viral RNA is either rare or edited viral RNA are rapidly degraded, as we only detected evidence for editing in two of the 104 viral isolates we studied.Here we describe the hypermutation of adenosines to guanosines in the genome of the sigma virus--a negative sense RNA virus that infects This is the first evidence for ADARs targeting viruses outside of mammals, and it raises the possibility that ADARs could play a role in the antiviral defences of insects. Adenosine deaminases that act on RNA (ADARs) are RNA-editing enzymes that target regions of double stranded RNA (dsRNA), converting adenosine (A) to inosine (I) . BecauseA = U >C >G), rarely targeting adenosines less than three nucleotides from the 5' terminus, or eight nucleotides from the 3' terminus [Previous studies have shown that ADARs act on dsRNA of ~100 bp or longer, modifying anywhere from a single base to up to 50% of the adenosines  and haveterminus ,5.Drosophila [Drosophila. ADAR-editing in these ion-channel transcripts generates huge protein diversity within the nervous system, for example, cacophony--a voltage-gated calcium channel in Drosophila--is edited at 10 different sites, potentially generating more than 1000 different isoforms [In mammals , Drosophosophila  and squiosophila  most of osophila  and seroosophila , and theosophila , calciumosophila  and sodiosophila  in Drosoisoforms .Drosophila, providing the first tentative evidence for ADARs being involved in tagging viral RNAs for degradation.Aside from editing mRNAs in the central nervous system, ADARs also target transposable elements ,13 and RD. melanogaster. We found hypermutation of A to G in two viral lines, with the mutations being biased towards sites that are predicted to be preferred by ADAR. This is the first evidence to suggest that ADAR targets viruses in insects.In this study, we describe evidence for ADAR caused hyper-editing in the sigma virus--a negative sense RNA virus that is a pathogen of 2 = 11.58, d.f. = 1, P < 0.001), with 21 of the 25 mutations occurring on the A3-E55 lineage. All 21 of these changes were from A to G in the positive sense replication intermediate, and all but one were clustered within a 565 bp region of the gene encoding the PP3 protein , which shared a common ancestor about 15 years ago and found 25 nucleotide differences between them. Using an outgroup, we assigned these mutations to either the lineage leading to A3 or A3-E55 and found a significant difference in the number of mutations on the two lineages  and that were either A to G or T to C changes. In all 102 isolates, we found only two isolates that had groups of A to G or T to C mutations that were significantly clustered: DM113 and Derby (permutation test of clustering: P < 0.0001 in both cases).P = 0.001, see Table In the DM113 isolate, which has the greatest number of singletons of all 102 isolates, all 20 mutations (11 of the 20 mutations were non-synonymous) were from A to G in the positive sense replication intermediate, and all were clustered within a 146 bp region of the gene encoding the PP3 protein  were from A to G in the positive sense replicate intermediate, and all were clustered within a 65 bp region of the gene encoding the PP3 protein Figure . HoweverThis approach of direct sequencing viral genes will only detect mutated viral RNA when the majority of viral copies in the fly have been mutated. However, it is unlikely, especially if these mutation are deleterious to the virus, that all viral copies will be simultaneously mutated. We therefore looked for mutated viral RNA present at a lower frequency. To do this we amplified the PP3 gene by PCR and cloned the PCR product from a subset of our wild viral isolates. However, we found no further evidence of hypermutation: across 86 clones  we found 14 mutations, all of which occurred only once. Of these, 6 of the 14 changes were in the direction of ADAR-editing (A to G and U to C), and 3 of these 6 changes were at sites preferred by ADAR .nAChR transcript at 10 sites and the Rdl transcript at 6 sites [nAChR: F1,116 = 0.386, P = 0.535; Rdl: F1,55 = 0.001, P = 0.969).In the final experiment, we examine whether the sigma virus is capable of suppressing ADAR-activity as a defence against the potentially harmful hypermutations. The rationale for this experiment is based on the observation that the sigma virus has the unusual property of paralyzing or killing flies when exposed to high concentrations of carbon dioxide. Intriguingly, flies that lack a functioning copy of the ADAR gene display a similar symptom, where they are paralysed following anoxia. If ADAR editing has an antiviral function i.e. introducing mutations that are deleterious to the virus, then we might expect the sigma virus to suppress ADAR activity. The suppression of ADAR activity might explain why sigma-infected flies become paralysed when exposed to carbon dioxide. To test this, we examined whether the rate at which fly mRNAs are edited by ADAR is altered by sigma virus infection. ADAR edits the  6 sites . HoweverWe have provided the first evidence from outside mammals to suggest that viruses can be hypermutated by host ADARs. The clustering of A to G changes observed in the laboratory viral lines are typical of mutations that occur as a result of RNA editing by ADARs, in that they are changes from A to G and occur at sites that don't have a 5' G ,5. DefinThe frequency of edited viral RNA is low, and we only found evidence for editing in two of 104 viral isolates. While this may reflect a low rate of editing, it is also possible that the edited RNA is rapidly degraded or hypermutations are deleterious and do not persist within the viral population. This is supported by the observation that the hypermutation events we observed caused numerous changes to the encoded protein sequence. If this is the case, RNA editing may be common but difficult to observe. This may explain why both of the editing events that we observed are in the PP3 protein that has no known function, while, no editing-events were found in the other genes--where hypermutations would likely be removed due to their harmful effects. Alternatively, this region of the genome may be edited more often because it is prone to form dsRNA. We may also lack statistical power to detect some editing events, as two other sequences showed patterns consistent with editing but were not significant.Drosophila ADAR is active in the cytoplasm, but our results suggest that it probably is, or the sigma virus enters the nucleus. One additional factor that may expose the sigma virus to editing by ADAR is that, like other Rhabdoviruses, it is known to infect the nervous system, where ADARs are known to be active [Evidence of RNA-editing by mammalian ADARs has been found in a number of different viruses, including the vesicular stomatitis virus , which is a close relative of the sigma virus --both are active .2. However, we found no evidence that viral infection alters the rate at which host mRNAs are edited, so it is unclear whether these two phenotypes are linked.Intriguingly, ADAR mutants have very similar phenotypes to sigma-infected flies, experiencing nervous-tremors similar to the tremors and paralysis experienced by sigma-infected flies after exposure to COSo why are viruses edited? In hepatitis delta virus, RNA editing is an essential process in the life-cycle of the virus; HDV hijacks ADARs, which edit a single site in the virus, switching production of a protein involved in virus replication to a protein involved in virion assembly . HoweverAlternatively, editing events caused by ADARs might be part of an antiviral defence. Under this scenario, one possibility is that mutations introduced into viral genomes by ADARs could impact the efficiency of the viral multiplication process by altering either the stability of dsRNA formed during viral replication, or the sequence of viral mRNAs, so they no longer encode functional viral proteins . There iDrosophila [The second possibility is that the inosines introduced into viral RNA may act as a tag, marking the virus for subsequent degradation ,28, althosophila ,28,30. Tosophila . Howeverosophila , and so osophila . But eviIn this study, we provide the first evidence that suggests ADARs target viruses outside of mammals, and it raises the possibility that ADARs could play a role in the antiviral defences of insects.AM689308, A3E55; AM691026). These viral lines are a single wild collected isolate which was split between two separate fly lines and maintained at 20 degree Celsius for between 10 and 20 years. We then sequenced 5108 bp of the genome from 102 wild viral isolates collected from 8 populations in Europe and 2 populations in North America . For details of sequencing methods see [GQ451694, U125; GQ451695 and Derby; GQ451693. We went on to test this statistically using a permutation test to investigate whether A to G, or T to C, mutations are clustered together in a sequence. First, we calculated the mean distance (number of nucleotides) between all the mutations in the sequence. We then permuted the order of the nucleotides and recalculated this statistic 10,000 times to generate a null distribution. The proportion of the permuted statistics that are less than the observed statistic was used as a P-value.We sequenced 5744 bp of the genome from two sigma virus lines (A3 and A3E55), supplied by Didier Contamine .To detect mutated viral RNA present at low frequency in the sample, we amplified a region of the PP3 gene using the high fidelity polymerase , cloned the PCR product using a TOPO TA cloning kit  and sequenced individual clones. Next, we tested whether viral infection alters the rate at which ate AP30 ) or uninate AP30 . cDNA waFJ, JC and LK conceived the project. JC, LW, LK performed the experimental research. JC and FJ wrote the manuscript with input from all the authors. All authors read and approved the final manuscript."}
+{"text": "The Fas-Lribozyme-carrying cells grew slightly faster in vitro with better viability than controls. Suppression of Fas-L in B16F10 melanoma cells by Fas-Lribozyme enhanced lung metastasis of the cells in C57BL/6 mice, and that was correlated with reductions in both apoptotic tumour cells and granulocytic infiltration. Mice depleted of granulocytes, but not CD4+ and CD8+ cells, showed a greatly elevated susceptibility to lung metastasis. Moreover, apoptosis in tumour cells was significantly reduced in granulocyte-depleted mice during the course of tumour formation. Taken together, our findings indicate that Fas-L-associated apoptosis in tumour cells determines the metastasis behaviour of melanoma in the lung and this apoptosis is primarily mediated by the cytotoxicity of recruited granulocytes.The survival of tumour cells in a new tissue environment is crucial for tumour metastasis. Factors contributing to the death of tumour cells during metastasis are not completely understood. In murine melanoma model, activation of Fas  signal in tumour cells reduces their lung metastasis potential, which may be associated with an induction of apoptosis in tumours. To elucidate the cellular mechanism, we used a Fas-ligand (Fas-L) specific ribozyme  87, 359\u2013365. doi:10.1038/sj.bjc.1200461www.bjcancer.comCancer Research UK\u00a9 2002  RT\u2013PCR for Fas-L, Fas, TNF-\u03b1 and \u03b2-actin were performed as described previously . The proteins bounded on the membrane were probed with the mouse antibody (Ab)-recognising Fas-L  followed by a sheep anti-mouse IgG conjugated with horseradish peroxidase . The Fas-L band was made visible by fluorography with enhanced chemiluminescence detection kit . Duplicate blot was probed with \u03b1-tubulin-specific Ab  and served as protein-loading control.Cells were extracted with a buffer containing 20\u2009mb) were purchased from the National Laboratory Animal Breeding and Research Center, Taiwan, R.O.C. and maintained under specific pathogen-free condition. All animal experiments have been carried out with approval of the ethical committee of Animal Research Center, National Cheng-Kung University. The ethical guidelines that were followed meet the standards required by the UKCCCR guidelines (5 of tumour cells in 0.1\u2009ml PBS via the tail vein injection (i.v. injection). Metastatic lung tumours in mice were assessed under a dissecting microscopy. Organs were surgically obtained, fixed in 10% buffered formalin solution for paraffin block preparation or for flash-frozen in O.C.T. embedding medium . Five-\u03bcM tissue sections were placed on poly-L-lysine-coated glass slides, fixed with 3.7% paraformaldehyde, and treated with 3% H2O2. Cells were stained with rat anti-NK mAb (DX5), rat anti-CD4 mAb (H129.19), rat anti-CD8 mAb (53-6.7) , rat anti-granulocyte mAb (RB6-8C5), rabbit anti-Fas Ab (M-20) or rabbit anti-Fas ligand Ab (N-20) . Appropriate sheep anti-rat IgG or goat anti-rabbit IgG conjugated with peroxidase  was used as secondary antibodies. Peroxidase staining was developed by aminoethyl carbazole substrate kit  and showed reddish-brown colour. Sections were counterstained with haematoxylin and mounted with glycerol gelatin.Eight-week-old C57BL/6 mice  with a gate set to examine a total of 104\u2009cells. Apoptotic cells in tumour nodules were detected by TUNEL labelling detecting free 3\u2032-OH groups in fragmented DNA in situ . Paraffin-embedded, slide-mounted tissue sections were deparaffinised and treated with proteinase K followed by 3% H2O2. After nick end labelling with digoxigenin-deoxyuridine triphosphate by terminal deoxynucleotidyl transferase, immunostaining was performed using peroxidase-conjugated anti-digoxigenin Ab. Apoptotic cells were visualised with diaminobenzidine substrate and became brown colour.Apoptotic cells become susceptible to merocyanine 540  binding due to alteration of surface membrane and can be detected by flow cytometric analysis  injection on day \u22122. Booster anti-CD4 or anti-CD8 Ab was given twice on days 7 and 14. Depletion of granulocytes was achieved by a serial of i.p. injections with anti-granulocyte Ab according to a modified protocol as previously reported , respectively . However, tumour foci with some infiltrated cells mostly comprised granulocytes were also seen . Thus, the recruited granulocytes mediate primarily the destruction of metastatic tumour cells in the lung.It is noteworthy that the tumorogenic capacity of Vn cells did not positively correlate with their absolute Fas-L amount suggesting that a critical amount of Fas-L protein exists to fully manifest the metastasis-inhibiting effect of Fas-L. When the amount of Fas-L on tumour cells is above the threshold, the effect of Fas-L reaches maximal. Only when the tumour Fas-L is in a range below the threshold, a trend of dose-dependent inhibition on lung metastasis of B16F10 was observable. For example, R4, a clone expressing very low amounts of Fas-L protein, formed the highest number of tumour nodules among all clones tested and that could not be further enhanced by granulocyte depletion. Besides, other uncharacterised factors may also contribute to tumour metastasis, which would attenuate minor differences in tumorigenicity between clones having litter difference in Fas-L expression and diminish the expected dose effect. As mentioned earlier, loss function of Fas has been linked to metastatic progression (in vivo (+ or CD8+ cells did not affect (clone V3) or even slightly inhibit (clone V4) the progression of tumours having high Fas-L. Recent studies have also demonstrated that T cells specific for tumour antigens can become actively tolerated during progression of tumours (A pivotal role of cells of innate immunity in tumour combat has previously been recognised in several tumours. The action of tumour-suppressive Th1 cells through CpG DNA is granulocyte-dependent ("}
+{"text": "The current study indicated that these rat sarcomas could be a good model for their human counterparts and will provide the further insights into the molecular pathways and mechanisms involved in sarcoma pathogenesis.Mesenchymal stem cells (MSCs) are believed to be the cell of origin for most sarcomas including osteosarcoma and malignant fibrous histiocytoma (MFH/UPS). To identify the signaling pathways involved in sarcoma pathogenesis, we compared gene expression profiles in rat osteosarcoma and MFH cells with those in syngeneic rat MSCs. Analysis of genes that characterize MSCs such as CD44, CD105, CD73, and CD90 showed higher expression in MSCs compared to sarcomas. Pathways involved in focal and cell adhesion, cytokine-cytokine receptors, extracellular matrix receptors, chemokines, and Wnt signaling were down-regulated in both sarcomas. Meanwhile, DNA replication, cell cycle, mismatch repair, Hedgehog signaling, and metabolic pathways were upregulated in both sarcomas. Downregulation of  Sarcomas are considered to be malignant neoplasms of mesenchymal origin, occurring mainly in bone and soft tissues such as muscles and adipose tissue. There are more than 100 recognized histopathological subtypes . The outMalignant fibrous histiocytoma (MFH) has previously been one of the most frequently diagnosed sarcoma types. However, this diagnostic category has been reorganized and is now described as undifferentiated pleomorphic sarcoma (UPS), representing a relatively small entity in soft tissue sarcomas . AlthougThe multidisciplinary strategies used to combat sarcomas consisting of surgery combined with chemotherapy and radiotherapy have resulted in a substantial improvement in patients' outcomes. However, the improvement seems to reach a plateau, and 30\u201340% of the patients still die of the disease. Since limited effective therapeutic options are available for those patients with poor prognosis, the need to understand the pathogenesis as well as molecular biological characteristics has emerged to facilitate the development of new diagnostic markers and therapeutic agents .  Except for sarcomas possessing the tumor-specific chromosomal translocations that form the specific gene fusions such as Ewing sarcoma with EWS-FLI1 fusion gene, the genetic loci involved in sarcomagenesis have not yet been fully elucidated, even though numerous genetic changes have been reported in many kinds of sarcomas including osteosarcoma and MFH.  Mesenchymal stem cells (MSCs) are considered to be a potential cell-of-origin for most sarcomas, and several studies have been conducted suggesting sarcomas of MSC origin \u20138. The g2 at 37\u00b0C.Both rat osteosarcoma cell line COS1NR and malignant fibrous histiocytoma MFH1NR were established from chemically induced osteosarcoma in Fischer 344 rats by 4-hydroxy quinolone 1-oxide in our laboratory and revealed those bearing p53 mutation , 10. Ratin vitro transcription was performed using T7 RNA polymerase to obtain Cy3-labeld cRNA.Total RNA was isolated from both COS1NR and MFH1NR cells and MSCs, using an RNeasy mini kit  and quality assessed by Agilent 2100 Bioanalyzer. 500\u2009ng of total RNA was processed by Agilent expression array analysis using a Quick Amp Labeling Kit and Gene Expression Hybridization Kit. Briefly, reverse transcription was performed with primers with oligo-dT in T7 promoter to synthesize the double-stranded cDNA, then To investigate the difference in gene expression between sarcoma cells and MSCs, gene expression profiling was performed by Agilent array analysis . Briefly, the Cy3-labeled cRNA were fragmented with hybridization solution and hybridized with Agilent Expression Array (Whole rat genome array) for 17 hrs at 65\u00b0C and 10\u2009rpm and subsequently washed at room temperature. The microarray slides were scanned on an Agilent DNA Microarray Scanner. Data analysis was carried out using Agilent Feature Extraction software, analyzing pathways that were differentially expressed in sarcoma cells compared to MSCs.In this study, oligonucleotide microarray containing probe sets for 26,930 rat genes were used to obtain genome-wide expression profiles of chemically induced rat osteosarcoma, MFH cells, and MSCs. To gain insight into the biological processes participating in sarcomagenesis, we performed pathway analysis and hierarchical clustering analysis. The hierarchical clustering analysis of expression profiling data clearly showed separate clusters among osteosarcoma, MFH, and MSCs . We subsFirstly, we analyzed stem cell markers including mesenchymal stem cell markers. Mesenchymal stem cell markers, CD44, CD73, CD90, and CD105 were all strongly expressed in MSCs compared to both sarcomas. Other stem cell markers such as STAT3 and Sox4 were also strongly expressed in MSCs, while angiopoietin-1 was highly expressed in osteosarcoma cells .Genes that were differentially expressed were analyzed in the context of the pathways in which they function using the KEGG pathway map. Pathways with a higher incidence of strongly expressed genes in MSCs were cell adhesion molecules, cytokine-cytokine-receptor interaction, ECM-receptor interaction, chemokine signaling, Jak-STAT signaling, and Wnt signaling pathways. Those showing higher incidence in both sarcomas were DNA replication, cell cycle, mismatch repair, and Hedgehog signaling pathways . g scale signal intensity of cell adhesion and extracellular matrix interaction molecules in both sarcomas compared to MSCs are shown in The ratio of Integrins and their ligands CAMS were strongly expressed in MSCs. In particular, differential expression of CAMs between sarcomas and MSCs was significant . Matrix metalloproteinase 2 and 9 also showed higher expression in MSCs. Interleukins and their receptors also showed higher expression in MSCs compared to both sarcomas, except for IL6 and its receptor IL6Ra in osteosarcoma, suggesting the possible involvement of IL6 signaling in osteosarcoma development .The ratio of most chemokines and their receptors also showed predominant expression in MSCs compared to both sarcomas, except for CXCR 3 and 7 . CXCR7 iGenes including Wnt 4 and 5a, beta-catenin, LEF1, and RhoA in Wnt-signaling pathways showed significantly lower expression and DKK1, a Wnt signal inhibitor showed strong expression in both sarcomas, while those in Hedgehog pathways showed higher expression in both sarcomas, especially Gli1 , Table 2Although cyclin-dependent kinase inhibitor p16 was highly expressed in both sarcomas, another CDK inhibitor p21 showed significantly lower expression and cell cycle accelerators including CDK2 and 4, cyclinD1 and E1 were highly expressed in both sarcomas . This inTo identify the possible biological characteristics of osteosarcoma and MFH, a comparison of gene expression profiles with their presumed progenitors, bone marrow-derived MSCs, resulted in a large set of differentially expressed genes.Prx1-Cre;p53fl/fl mice that developed osteosarcoma, rhabdomyosarcomas as well as undifferentiated sarcomas in vivo. Furthermore, deletion of one Rb allele in these mice increased the frequency of osteosarcomas [ Frequently identified genetic alterations in osteosarcoma and MFH are p53 and Rb mutation, MDM2 amplification, loss of function of p16, and CDK4-cyclinD amplification. Most of these are related to cell cycle regulation. The direct evidence for induction of sarcomas by application of these genetic changes was demonstrated by the sarcomas . HoweverThere have been several reports indicating that MSCs could be a potential cell of origin of several sarcomas. Hogendoorn's group reported that the spontaneous malignant transformation of MSCs producing osteosarcoma was linked to loss of p16 function , 14. OthWnt signaling may have a very different role in sarcomagenesis as compared to the development of other malignancies such as colorectal carcinoma . The WntMeanwhile, aberrant activation of Hedgehog signaling is associated with various types of cancers, in which deregulation of cellular growth, survival, and adult stem cell maintenance is believed to be involved. The Hedgehog signaling pathway initiates a signaling cascade, ultimately leading to the activation of the Gli transcription factors that mediate signal transduction to the nucleus. In contrast to the Wnt pathway, Hedgehog signaling has been reported for its activation in sarcomas through the amplification of Gli, a transcriptional factor located downstream of Hedgehog signaling , 29. HedSeveral reports have claimed that surface markers for mesenchymal stem cells such as CD44 and CD90 were expressed in human osteosarcomas \u201337. Yet,Pathways with differentially expressed genes comparing sarcomas to MSC in the current study are summarized as shown in Taken together, these findings have led us to the hypothesis of a model for sarcomagenesis. Wnt and Hedgehog signaling may change during the process of differentiation and might result in cell cycle acceleration in conjunction with p53 mutations as well as DNA replication. An advantage for this study would be that the cells originated from syngeneic rats, indicating that they share the same genetic background. The limitations of this study would be the use of cultured cells at first, which might cause genetic alterations, then the potential presence of cellular heterogeneity, especially in MSCs that were not sorted with specific cellular surface markers. Secondly, further study will be required to validate and confirm these microarray data with different methods such as RT-PCR. Finally, the functional analysis of differentially expressed genes, especially Hedgehog and Wnt signaling, will definitely be required in any future study.  We have found that stem cell markers as well as Wnt signaling pathways were downregulated in sarcomas, while Hedgehog pathways and cell cycle regulation were upregulated. Other pathways might possibly be involved in sarcomagenesis, thus further study will be required including confirmation and functional analysis for differentially expressed genes."}
+{"text": "Aim. To report a unique case of retroperitoneal urinoma extending to the scrotum through the spermatic cord and successfully treated with nephrostomy, drainage, and gracilis muscle flap. A 66-year-old male patient was referred to us from the medical oncology department for a scrotal wound with purulent discharge. On physical examination, he presented with severe asthenia, abdominal pain, cushingoid aspect, tender abdomen mostly on lower quadrants, and reddened, swollen scrotum with foul smelling 4 \u00d7 5\u2009cm defect. The wound presented pus and haematic discharge and exposed spermatic cord and testis . After cPatient's urologic history had started two months earlier, when during oncological followup for metastatic prostate cancer, a CT scan showed a 15\u2009mm left ureteral stone causing hydronephrosis Figures . He was Before the latter, he started external beam radiotherapeutic treatment for D11-L1 bone metastases, and after 9\u2009Gy in 3 fractions, he developed the scrotal abscess. His therapy included daily oral intake of 8\u2009mg of Dexamethasone, infusion of 66\u2009mg of Taxoter twice a month, and monthly infusion of 4\u2009mg of Zoledronic acid. Blood gas showed normal pH and hyperglycemia confirmed by laboratory (793\u2009mg/dL). Blood tests showed also hyponatremia (127\u2009mEq/L), normal renal function (creatinine 0.81\u2009mg/dL), Hb 10.9\u2009g/dL, Hct 34.3%, WBCs 7.730/uL, PLTs 173.000/uL, and a normal coagulation pattern. Peripheral venous access and transurethral catheter were inserted. Insulin drip, intravenous rehydration with 2000\u2009cc of Normo Saline, and empiric antibiotic therapy with Clindamycin 600\u2009mg and Ceftazidime 1\u2009g every 8 hours were administrated. Abdominal CT-scan showed  in the dLeft percutaneous nephrostomy and abdominal drain were immediately positioned. Culture samples were taken.A voiding cystourethrogram (VCUG) was performed this showed no evidence of urine leakage .E. coli sensible to Ceftazidime and the abdominal sample obtained by the drain a Staphylococcus epidermidis growth sensitive to Erythromycin. Antimicrobial therapy was modified, Clindamycin was stopped, and Erythromycin 600\u2009mg was orally administrated every 8 hours. Wound culture samples showed bacterial growth of A second CT scan was performed 10 days after nephrostomy and drain insertion showing complete absence of the urinoma . Urine cPatient was scheduled for wound debridement and closure with gracilis muscle perineal flap.The patient was placed in lithotomy position, and after sterile draping, cystoscopy and proctoscopy were performed without evidence of any fistulae. A longitudinal incision was made along the medial side of the thigh, making it possible to identify the gracilis muscle  and to mThe duration of the procedure was 2 hours. Drains were removed on day 3 postoperatively. Patient began ambulation on postoperative day 3 and was able to seat 1 week after the surgery. The flap survived with good wound healing. The hospitalization after the procedure was 5 days. Time to complete healing of the donor site and perineal defect  was 10 aAfter negative previous transnephrostomic antegrade pyelography, performed 1 month after surgery, transurethral catheter and left nephrostomy were removed. During the 7 months of followup, the patient was satisfied with the functional and aesthetic outcome.Self-limiting urinoma formation due to spontaneous extravasation is rare. McCraw et al. described subcapsular renal urinoma in a patient with gynaecological malignancy treated with previous radiotherapy . AndersoA mininvasive approach is prefered in the treatment of urinoma; a surgical approach is needed in case of scrotal wound."}
+{"text": "CDC\u2019s international capacity-building program shows evidence of progress. During 2004\u20132009, the Centers for Disease Control and Prevention (CDC) partnered with 39 national governments to strengthen global influenza surveillance. Using World Health Organization data and program evaluation indicators collected by CDC in 2013, we retrospectively evaluated progress made 4\u20139 years after the start of influenza surveillance capacity strengthening in the countries. Our results showed substantial increases in laboratory and sentinel surveillance capacities, which are essential for knowing which influenza strains circulate globally, detecting emergence of novel influenza, identifying viruses for vaccine selection, and determining the epidemiology of respiratory illness. Twenty-eight of 35 countries responding to a 2013 questionnaire indicated that they have leveraged routine influenza surveillance platforms to detect other pathogens. This additional surveillance illustrates increased health-system strengthening. Furthermore, 34 countries reported an increased ability to use data in decision making; data-driven decisions are critical for improving local prevention and control of influenza around the world. After the threat of highly pathogenic avian influenza in 2004, the Centers for Disease Control and Prevention (CDC) began an international capacity-strengthening program with national governments across the globe. The program focused on strengthening 2 systems for preparedness: routine laboratory diagnostics to detect seasonal and novel influenza viruses and routine sentinel surveillance for influenza-like illness (ILI) and severe acute respiratory infection (SARI).\u2013To foster sustainable development, the program prioritized the following principles: investing in routine national surveillance systems to ensure that capacities are regularly tested and used; providing long-term technical assistance driven by country performance and needs; and supporting development that builds on the existing World Health Organization (WHO) Global Influenza Surveillance and Response System. This latter principle includes alignment with WHO guidelines and recommendations for strengthening national laboratory capacities, a requirement for designation as a WHO National Influenza Center (NIC) and for implementation of the 2005 International Health Regulations, a legally binding framework for improving commitment to strengthening core aspects of an infectious disease preparedness and response system  of national influenza laboratories, surveillance systems, and core capabilities for influenza pandemic preparedness, each with targeted technical recommendations  diagnostics for influenza  pandemic (pH1N1). Responses used a Likert scale  and described qualitatively the contributions made. We inductively coded the main ideas mentioned and reported them by frequency of mention. To evaluate the growth in surveillance capacity, we analyzed the number of influenza sentinel sites conducting ILI or SARI surveillance and their geographic coverage during the first year of support and compared findings with those data for 2013. We also analyzed questions about additional pathogens that were added to the routine influenza diagnostic testing platforms and other types of syndromic surveillance conducted at influenza sentinel sites. Finally, we analyzed how countries ranked types of CDC program assistance  on the basis of the programs\u2019 ability to improve functioning of the national surveillance system.To assess internal validity of the questionnaire, we asked 2 questions for which we had externally validated data as a proxy test. One question asked if the country was reporting to WHO FluNet before starting the cooperative agreement with CDC. The other asked whether the country was sending specimens or viral isolates to WHO Collaborating Centers for influenza seasonal vaccine strain selection before starting the cooperative agreement with CDC. The accuracy of responses to those questions was >90%, indicating that for those 2 questions, history and maturation bias had little effect on the internal validity of responses. Data were double entered and analyzed by using Epi Info version 7.1.2 .Of the 39 countries that partnered with CDC to improve influenza surveillance capabilities, 36 (92%) transitioned to CDC\u2019s 5-year sustainability cooperative agreement, and 35 (97%) completed the questionnaire . Among tThe number of countries conducting routine virologic surveillance for influenza increased from 19 at the start of the capacity-strengthening program to 35 in 2013. The total annual number of specimens tested increased substantially, from 81,851  at the start of the program to 542,235  in 2013; most growth occurred during the year after the pH1N1 pandemic . BesidesAll national laboratories supported through the program now use real-time RT-PCR as the primary method to detect circulating influenza. Since WHO developed its EQAP quality assurance test for RT-PCR diagnostics for influenza in 2007, the number of countries using RT-PCR diagnostics increased from 11 in 2007 to 34 in 2013. The percentage of countries with no (0.0) error on the EQAP panels increased from 36% (4/11) in 2007 to 85% (30/34) in 2013.The proportion of countries reporting data to WHO FluNet for >90% of weeks per year increased considerably during 2004\u20132013 . Among aThirty (86%) of 35 countries reported by questionnaire that the capacity-strengthening program played a critical (n = 10), major (n = 16), or small (n = 4) role in improving FluNet reporting. At the start of the program, median baseline reporting to FluNet was 0% among those countries reporting that CDC played a critical (IQR 0%\u201325%) and major (IQR 0%\u201374%) role. Those reporting that the program played a small  or no  role had much higher baseline reporting than those countries reporting that the program played an important role in increasing FluNet reporting .The number of countries that contributed isolates or specimens for inclusion in global vaccine strain selection increased from 16 (42%) at the start of the CDC program to 28 (80%) in 2013. Questionnaire responses also showed progress in use of WHO selection criteria; a comparison of data for the start year and 2013 showed that an increased number of countries that selected viruses by age group (7 vs. 18), geographic area (9 vs. 26), phase of influenza season (10 vs. 22), or other high priority criteria for the country (7 vs. 14).>3 surveillance sites since their start year. The number of sites capable of collecting weekly specimens and epidemiologic data from patients seeking healthcare for ILI or SARI increased from 446 at the start of the program to 2,075 in 2013  countries established  in 2013 . MoreoveQuestionnaire responses for 29 (83%) countries indicated that influenza sentinel sites initiated surveillance for other diseases or syndromes . All 29 Among the 35 responding countries, 26 started the capacity-strengthening program before onset of the pH1N1 outbreak; 25 (97%) of the 26 believed that capacity strengthening played a critical (n = 16) or major (n = 9) role in their pandemic response. In an inductive analysis of capacities that countries reportedly experienced as key to outbreak detection and pandemic response, the most common was establishment of routine sentinel SARI or ILI surveillance systems . Also, 1Among 35 responding countries, 29 reported that they have described the seasonality of influenza viruses in their country; 19 (66%) were described for the first time during the program . Thirty-Overall, 34 (97%) countries reported that they were mostly or very able to meet their countries\u2019 needs through the program; 32 (91%) mostly or always perceived that ownership of the capacity building was theirs. Countries had different perceptions of the program\u2019s impact on development of laboratory versus sentinel site systems. For 29 (81%) of countries, the top-ranked type of assistance for strengthening laboratories was financial assistance for laboratory equipment, materials, and reagents. For the remaining 6 (19%) countries, the most critical assistance was staff training and technical advice (n = 4) and the ability to exchange experience with colleagues during national or international meetings (n = 2). Objective assessments of the laboratory were ranked, on average, as the third most critical assistance.Rankings regarding strengthening sentinel surveillance differed among countries. Financial assistance was ranked by 17 (49%) countries as most critical. The most critical assistance among the remaining 18 (51%) countries was trainings for staff and technical advice (n = 11), objective assessments of the surveillance system (n = 4), and the ability to exchange experience with colleagues during national and international meetings (n = 3). In the analysis of recommendations suggested in the questionnaire, the most common was to increase technical assistance for assessing, evaluating, and improving the sustainability of capabilities developed.\u2013In the context of the emergence and reemergence of severe acute respiratory syndrome and highly pathogenic influenza A(H5N1) virus, CDC\u2019s Influenza Division developed an international capacity-strengthening program that enabled countries to detect seasonal and pandemic influenza viruses and to make evidence-based decisions for risk reduction  partly attributed their ability to respond to the pH1N1 pandemic to prior capacity strengthening; this perception of the role of capacity strengthening confirms the critical need for routine clinical, epidemiologic, and virologic influenza surveillance as a preparedness and response strategy. The value of routine surveillance capacity in supporting demands placed on systems during pandemics aligns with previous reports that showed significant progress in core capabilities for influenza pandemic preparedness among the same countries  countries felt ownership of capacity-strengthening offers encouraging evidence for the program\u2019s approach. The perception of increased effects of funding on laboratory strengthening, compared with increased effects on sentinel surveillance, is unsurprising, given the costs of maintaining a laboratory, a well-known barrier to routine surveillance. What is arguably more surprising is the perceived value of technical assistance beyond funding. Some responding countries perceived training and technical advice from experts, objective assessments of capacity, and the ability to share experience as having even greater effects than funding. This finding highlights the need for technical guidance, training, and partnership-building, all of which go beyond basic funding. A review of 8 Central America countries that reported a significant positive correlation between cumulative funding and technical assistance with pandemic preparedness progress supports this finding  had >7 years. The effects of influenza seasonal variation on increases in demand for testing need further elucidation and may be helped by projects such as determining optimal amounts of surveillance needed. Capacity-strengthening gains cannot be precisely attributed to the cooperative agreement because capacity strengthening is complex and involves many systems, organizations, and behaviors beyond the scope of this article.The biggest limitation to this study was the reliance on retrospective data. Although WHO\u2019s externally validated data served to increase the validity of the findings, those data also have limitations. Because of the retrospective nature of the analysis, assessing lags in data availability on WHO FluNet each week was not possible, although this assessment assists in understanding the timeliness of monitoring. By their nature, retrospective questionnaires can be problematic because they rely on institutional memory and experience; however, respondents had a relatively high tenure in their national influenza programs. Most (31/35 [89%]) had In conclusion, considerable progress has been made in laboratory and sentinel surveillance capacities, which have proven to be essential building blocks for knowing which strains of influenza circulate globally, detecting and preparing for novel and pandemic influenza, understanding respiratory illness associated with influenza, and expanding public health surveillance beyond influenza. Countries are translating these capabilities into better decision making for their influenza prevention and control programs. Their ownership of capacity building makes this approach an important model for efforts to enhance global detection and response to emerging infectious diseases such as influenza."}
+{"text": "Perceptual narrowing is a highly significant development associated with the first year of life. It conventionally refers to an orientation toward nativeness whereby infant's perceptual sensitivities begin to align with the phonetic properties of their native environment. Nativeness effects, such as perceptual narrowing, have been observed in several domains, most notably, in face discrimination within other-race faces and speech discrimination of non-native phonemes. Thus, far, nativeness effects in the face and speech perception have been theoretically linked, but have mostly been investigated independently. An important caveat to nativeness effects is that diversifying experiences, such as bilingualism or multiracial exposure, can lead to a reduction or postponement in attunement to the native environment. The present study was designed to investigate whether bilingualism influences nativeness effects in phonetic and face perception. Eleven-month-old monolingual and bilingual infants were tested on their abilities to discriminate native and non-native speech contrasts as well as own-race and other-race face contrasts. While monolingual infants demonstrated nativeness effects in face and speech perception, bilingual infants demonstrated nativeness effects in the face perception but demonstrated flexibility in speech perception. Results support domain-specific effects of bilingual experience on nativeness effects. This study bears on a weighty question in infant science , tentatively suggesting that they may be driven by a domain-general adaptation to experience. Furthermore, there are broad similarities in timing of narrowing in face and speech perception  by face experience, whereas phonetic perception appears to be more vulnerable to biological constraints and to the timing of exposure  as demonstrated in prior research . Sixteen infants were monolingual (at least 90% exposure to English) and sixteen were bilingual . Parents were interviewed about their infants' language exposure prior to recruitment. This interview consisted of a language exposure questionnaire  by a female native English speaker. Six tokens each of the Hindi voiceless dental-retroflex (/ta/-/\u0288a/) stop consonants were recorded by a female native Hindi speaker. This contrast is not a phonemic distinction in English or Mandarin. These specific contrasts were chosen as they have been widely used to study nativeness effects on speech perception in infancy and have been robustly linked to perceptual narrowing in English monolingual infants .All faces were female. Four faces were used for each race, two for habituation and one for each test block trial . Faces were cropped to the hairline with the neck obscured and controlled for luminance and brightness  face discrimination, non-native (other race) face discrimination) with task order counterbalanced using a Latin Square rotation. Testing was conducted in a dim, quiet room in an Infant Laboratory. Infants were seated on their parent's lap 70 cm away from a 17\u201d LCD monitor on which the stimuli were presented. The experimenter monitored the session in a control room via closed-circuit television. All parents wore black-out glasses and headphones with masking music for all experiments.vice versa for the non-native discrimination task and from /ba/ to /da/ or vice versa for the native discrimination task). Fixation times to the visual checkerboard for control and test trials were logged. The parameters for each session  were identical across tasks to ensure parity in task demands. Experimental parameters for the face habituation tasks were exactly the same, except that speech stimuli were absent and face stimuli were presented visually in place of the checkerboard pattern. The experimenter (DL) was blind to condition but was not blind to group. As experimental sessions were not videotaped, trial length was logged on-line and not off-line. This decision was made based on prior studies demonstrating accurate trial length timing using Habit X. However, the present design does not allow for verification of looking times recorded by Habit X.The paradigm was administered using Habit X 1.0 on a Macintosh computer. Each task began with an attention-getter, followed by infant-controlled presentation of the habituation stimulus for each task. In each task, infants were presented with a series of habituation trials, consisting of a syllable . During habituation, multiple tokens of each sound were played drawing from a set of five tokens and cycling through these tokens in random order. The interstimulus interval (ISI) was 750 msec. Habituation stimuli were played continuously in conjunction with a black and white checkerboard until infants looked away . When the infants' looking time for two consecutive trials declined to a pre-set criterion , the test phase began. Two test trials were presented in succession: a new token of the habituation stimulus with the visual checkerboard was presented for a fixed length of 10 s , followed a contrastive stimulus for the same length   in native and non-native face and speech discrimination tasks. In each task, a significant elevation in fixation to the checkerboard between the first test trial  and the second test trial  provides evidence of discrimination. Fixation times are plotted for each task in Figure p values for comparisons between monolingual and bilingual infants.). Looking times were then compared for control and test trials. As data were not normally distributed, a log transformation was applied to average looking times. A 2 \u00d7 2 \u00d7 2 \u00d7 2  mixed ANOVA was conducted. There was a significant two way interaction of test trial type and group . Moreover, differences in looking time to control and test trials were marginally greater for bilingual infants than monolingual infants . Follow up comparisons for the trial type \u00d7 nativeness interaction revealed that looking times for test trials were significantly higher than control trials for native stimuli }. There was no significant increase in fixation time for non-native faces nor for non-native phonemes {face stimuli: }.A 2 \u00d7 2 \u00d7 2  repeated measures ANOVA was conducted with fixation times to the screen as the dependent variable. Results revealed a main effect of domain }. Unlike monolingual infants, there was also a significant increase in fixation time for non-native phonemes, . Like monolingual infants, there was no significant increase in fixation time between control and test trials for non-native faces . These findings are consistent with the notion that bilingual infants retain sensitivity to non-native contrasts  repeated measures ANOVA was conducted with fixation times to the screen as the dependent variable. Results revealed a main effect of trial type [t(15) = 2.5, p = 0.03 (Cohen's d: 0.67) in non-native speech perception. In contrast, the groups did not differ in their fixation to test trials relative to control trials for non-native (African) face discrimination, t(15) = \u22120.2, p = 0.98.Results demonstrate that monolingual and bilingual infants demonstrated a similar capacity to discriminate native speech and face contrasts. However, the groups differed only in their response to non-native speech contrasts: bilingual infants demonstrated sensitivity to a foreign phonetic contrast while monolingual infants did not. With respect to non-native face contrasts, both groups of infants did not discriminate African faces suggesting that both groups demonstrated perceptual narrowing for faces but only monolingual infants demonstrated perceptual narrowing for speech. To confirm group differences with respect to non-native speech discrimination but similarity with respect to non-native face discrimination, looking time differences to control and test trials were compared across groups for Hindi speech discrimination and African face discrimination. Results revealed that bilingual infants demonstrated significantly higher elevation in test trials relative to control trials compared with monolingual peers The present study aimed to investigate face and speech perception in monolingual and bilingual infants. We report three primary findings. First, monolingual and bilingual infants discriminated native faces and native phonemes, demonstrating expected nativeness effects in face and speech perception. Second, monolingual infants demonstrated evidence of perceptual narrowing in speech perception and did not discriminate a non-native Hindi contrast. In contrast, bilingual infants continued to discriminate the same Hindi contrast, demonstrating perceptual flexibility for non-native contrasts. However, perceptual flexibility in speech perception associated with bilingualism did not generalize to face perception: bilingual and monolingual infants demonstrated a comparable other-race effect. Our findings provide preliminary evidence in support of a domain-dependent account of perceptual narrowing based on our findings suggesting that perceptual narrowing in speech and face perception is dissociatively modified by bilingual exposure.In placing our findings in the context of prior studies, our findings on race sensitivity offer additional insight into those of Kandel et al.  who demoA second possibility is that the other race effect may be attenuated primarily in bilingual groups who encounter greater racial and/or socio-cultural diversity. In the monolingual and bilingual groups sampled by Kandel et al. , nearly Finally, our study employed African faces as these faces were likely to be entirely unfamiliar to our participants, analogous to the Hindi dental-retroflex phoneme contrast. It is possible that African faces are less familiar to our participants than Chinese faces were to bilingual participants in Kandel et al. . Presumain situ may be enhanced by bilingual exposure. In contrast, knowledge acquired over the longer term in vivo that is the product of perceptual expertise may be relatively resistant to environmental modification, and perhaps even more so to second-degree modification . The resistance of the products of perceptual expertise to environmental modification may be attributable to the substantial commitment of resources required to build up expertise within a domain, which may fortify these categories against effects of environmental variation. For example, there is evidence that after infants have undergone perceptual narrowing for linguistic contrast, they then require several weeks of repeated exposure to new information to modify learned categories both in speech perception (Kuhl et al., That bilingual infants retained the ability to discriminate a challenging non-native contrast is consistent with prior studies demonstrating phonological flexibility in bilingual infants in phonetic perception (e.g., Petitto et al., In addition to investigating effects of bilingualism on nativeness effects, our study bears on the issue of whether perceptual narrowing across domains is driven by a common mechanism. Our finding that bilingual infants exhibited distinct patterns for face and speech narrowing provides evidence that these processes may develop independently, albeit contemporaneously. If face and speech narrowing were indeed interlocked and unified by a common mechanism, one might expect both domains to be similarly modified by environmental variation. In this way, investigating the effects of diversifying influences in one domain on narrowing in other domains can inform our conclusions about a single- vs. multi-mechanism account of perceptual narrowing. Co-evolution of narrowing for the face and speech, evidenced in the current study, is perhaps expected on the basis of previously attested links between infants' sensitivity to the face and speech (e.g., Tzourio-Mazoyer et al., The present study sought to investigate cross-domain modification of infant perceptual narrowing by examining effects of bilingual experience on facial and phonetic categories. Results point to stable narrowing in the face in response to bilingual experience and to a modified course of narrowing in the speech on account of bilingual exposure. Dissociative effects of bilingualism on face and speech discrimination provide some support for independent mechanisms governing face and phonetic narrowing. Finally, we suggest that previously reported generalized effects of bilingualism on cognitive flexibility may not extend to knowledge accrued by perceptual expertise.All authors designed and conceptualized the study. DL ran the participants through the study and analyzed the data. LS and DL drafted the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Medullary thyroid cancer (MTC) comprises only 4% of all thyroid cancers and originates from the parafollicular C-cells. HIF-1\u03b1 expression has been implied as an indicator of worse prognosis in various solid tumors. However, whether expression of HIF-1\u03b1 is a prognosticator in MTC remained unclear. Our aim was to evaluate the prognostic value of HIF-1\u03b1 in patients with MTC.All patients with MTC who were operated on between 1988 and 2014 in five tertiary referral centers in The Netherlands were included. A tissue microarray was constructed in which 111 primary tumors could be analyzed for expression of HIF-1\u03b1, CAIX, Glut-1, VEGF and CD31 and correlated with clinicopathologic variables and survival.The mean age of patients was 46.3 years (SD 15.6), 59 (53.2%) were male. Of the 111 primary tumors, 49 (44.1%) were HIF-1\u03b1 negative and 62 (55.9%) were HIF-1\u03b1 positive. Positive HIF-1\u03b1 expression was an independent negative indicator for progression free survival (PFS) in multivariate cox regression analysis . Five-years survival decreased from 94.0% to 65.9% for the HIF-1\u03b1 positive group (p=0.007). Even within the group of patients with TNM-stage IV disease, HIF-1\u03b1 positivity was associated with a worse prognosis, shown by a decrease in 5-years survival of 88.0% to 49.3% (p=0.020).Expression of HIF-1\u03b1 is strongly correlated with adverse prognosis of MTC. This could open up new ways for targeted systemic therapy of MTC. Medullary thyroid cancer (MTC) accounts for 4% of all thyroid cancers and, in contrast to other forms of thyroid cancer, it arises from the parafollicular C-cells. It occurs either as a sporadic disease or in a hereditary context as a manifestation of the endocrine tumor syndrome Multiple Endocrine Neoplasia type 2 (MEN2) (20-25%) . HereditCurrently, clinical variables such as age, extent of the primary tumor, lymph node metastases and distant metastases have been identified as prognostic factors . No furtHypoxia inducible factor-1 (HIF-1) is the key regulator of the hypoxia response. HIF-1 is a protein complex composed of two subunits; constitutive HIF-1\u03b2 and oxygen-sensitive HIF-1\u03b1. HIF-1\u03b1 can either be upregulated due to oncogenic signaling or as a response to tumor hypoxia. Under normal conditions the HIF-1\u03b1 subunit is degraded by the ubiquitin-proteasome pathway. Under hypoxia or as a result of oncogenic signaling, degradation is inhibited resulting in its accumulation, subsequent binding to HIF-1\u03b2, translocation to the nucleus and activation of downstream signaling pathways by binding to hypoxia responsive elements in the promoters of target genes \u20139. IncreIn this regard, the importance of HIF-1\u03b1 and its downstream targets has been investigated in various solid tumors, and the correlation of high HIF-1\u03b1 expression with poor prognosis has been well established . In sporThe mean age of the 111 patients was 46.3 years (SD 15.6), 59 (53.2%) were male. Sixty-five patients (60.2%) had a sporadic medullary thyroid carcinoma, 39 patients (36.1%) had MEN2a and 4 patients (3.7%) had MEN2b, from 3 patients the RET-mutation status was unknown. Fifteen patients presented with stage 1 (13.5%), 26 with stage II (23.4%), 17 (15.3%) with stage III and 53 (47.7%) with stage IV disease. Median tumor size was 25.6 mm  and 79 (63.1%) patients presented with lymph node metastases. Mean follow-up was 79.2 months (SD 60.6).Forty-nine 44.1%) patients were HIF-1\u03b1 negative and 62 (55.9%) HIF-1\u03b1 positive. In univariate analysis, age, gender, heritability, stage, tumor size, lymph node metastases, disease status, microvessel density (MVD) and presence of necrosis or angioinvasion did not differ significantly between HIF-1\u03b1 negative and positive groups  and we used PFS to increase the total number of events. One of the limitations is that immunohistochemistry is inherently a more qualitative than quantitative method. Furthermore, one might argue that due to heterogeneity of the HIF-1\u03b1, CAIX and Glut-1 staining pattern the use of tissue microarrays is suboptimal. However, studies investigating concordance between whole slide analysis and TMA results found good concordance in general . MoreoveIn summary, HIF-1\u03b1 overexpression is a prognostic biomarker in MTC indicating a worse prognosis, particularly, in the subpopulation with TNM-stage IV. Thus, HIF-1\u03b1 may be clinically useful to identify patients in need of more intense follow-up or adjuvant therapy, and may provide an interesting therapeutic target in MTC.Patients who underwent surgery between 1988 and 2014 for MTC were identified from the pathology databases of Leiden University Medical Center (LUMC), Amsterdam Medical Center (AMC), Radboud University Medical Center (RadboudUMC), University Medical Center Groningen (UMCG) and University Medical Center Utrecht (UMCU), The Netherlands . Formalin fixed paraffin embedded (FFPE) tissues were collected from the pathology archives. In total 111 patients were identified from who primary tumor tissue was available for inclusion in the tissue microarray (TMA).Whole slides were scored for necrosis, angioinvasion and desmoplasia. Necrosis and angioinvasion were scored as absent or present and desmoplasia as negative, some, moderate or severe. These scorings were performed on the same FFPE blocks that were used for the construction of the TMA.Clinical and pathological patient information was retrieved from patient files in all five centers. All MEN2 diagnoses were confirmed by germline mutation analysis, sporadic patients were either patients with negative germline mutation analysis or with a negative family history. Microscopic positive resection margins were considered as part of the T-stage and not included as a separate variable. Disease status was based on postoperative calcitonin and CEA measurements; this was scored as a dichotomous variable. Since we included patients from five centers over almost three decades different assays were used for CEA and calcitonin measurements, therefore making it impossible to compare exact values. An elevation in CEA or calcitonin was interpreted as persistent disease, an CEA or calcitonin within normal range was interpreted as cured. Only postoperative CEA and calcitonin measurements were taken into account. Due to the fact that CEA and calcitonin measurements were performed in five centers over almost three decades and different assays were used, doubling times could not reliably be assessed. This study was performed according to national guidelines with respect to the use of leftover tissue  and apprThe TMA was developed on the TMA machine . Three cores of 0.6 mm were punched from FFPE blocks of the primary tumor. To assure that cores were punched from tumor areas, cell rich areas were marked on H&E slides by a pathologist (PJvD), scanned, and marks were manually circled with the TMA software (3D Histech). In this manner cell rich punches were automatically inserted into the recipient block.After deparaffinization and rehydration, endogenous peroxidase was blocked in a buffer solution containing 0.3%hydrogen peroxidase for 15 minutes. For HIF-1\u03b1 antigen retrieval was performed using EDTA buffer, pH = 9.0, at boiling temperature for 20 minutes. A cooling period of 30 minutes preceded the incubation of the slides with protein block  for 5 minutes at room temperature. Incubation of the slides with the HIF-1\u03b1 mouse monoclonal , was done at a dilution of 1:50 overnight at 4\u00b0C. For detection a polymer  was used and developed with diaminobenzidine . For Glut-1, CAIX and VEGF-A, downstream targets of HIF-1\u03b1, antigen retrieval was performed in citrate buffer, pH = 6.0, for 20 minutes at boiling temperature. For Glut-1 and CAIX, a cooling period of 30 minutes preceded the incubation (60 minutes at room temperature) with the primary antibodies. Polyclonal primary antibodies used were Glut-1  and CAIX . For VEGF-A, a cooling period of 30 minutes preceded the incubation of the slides with the VEGF-A rabbit polyclonal antibody . For detTo calculate microvessel density (MVD) CD31 immunohistochemistry was performed on the automatic system . The CD31 mouse monoclonal antibody, clone JC70A .nd experienced pathologist was consulted. For HIF-1\u03b1 the percentage of positive nuclei per core was scored as an absolute number. For statistical analysis this was transformed in a dichotomous variable, which was positive when in either one of the three cores \u22651 percent of nuclei were positive as previously used [All TMA slides were scored by an experienced pathologist (PJvD) and an experienced researcher (LL), when there was inconsistency between both a 2sly used , 11, 27.sly used . VEGF-A Categorical data were summarized with frequencies and percentages, and continuous data were summarized with medians and ranges. Progression was defined as development of distant metastases or dead. This excluded development of lymph node metastases or elevation in CEA/calcitonin. We chose this definition since MTC is an incurable disease when distant metastases occur. Progression-free survival (PFS) was therefore defined as the time to development of distant metastases or dead. To increase the power of the statistical analysis categorical data were recoded into dichotomous variables. Stage I, II, III and IV was recoded into stage I - III and stage IV; hereditability was recoded in either sporadic or hereditable; grade of desmoplasia was recoded in none - some and moderate - severe.The chi-square test was used to assess associations between the dichotomous variables, the Student's t-test was used to test for differences between continuous variables. Kaplan-Meier survival curves were plotted, and univariate survival analysis was performed and the log-rank test was used to calculate significance. Multivariate Cox-regression analysis was performed and Hazard Ratios (HR) of clinicopathologic characteristics on PFS were calculated. Violations of the proportional hazards assumption were tested by the log minus log plot and by adding a time dependent covariate. All reported p-values were two sided. Analysis was performed using SPSS version 22.0 software ."}
+{"text": "There are few studies focus on the factors underlying the late initiation of ART in China. We analyzed the trends in the median CD4 cell counts among different patient groups over time and the risk factors for the late initiation of ART in Shanghai, China.3 or having a clinical AIDS diagnosis prior to ART initiation. Trends in the median CD4 cell count at ART initiation and the proportion of late ART initiation by year were evaluated using Spearman\u2019s correlations and Chi-squared methods, respectively. We used a logistic regression model to analyze the risk factors for late ART initiation. The related factors collected in the multivariate model were the patient\u2019s age, gender, infection routes and marital status.A retrospective cross-sectional survey was made in the Department of Infectious Disease of Shanghai Public Health Clinical Center which is a designated diagnosis and treatment center for HIV-positive patients in Shanghai during the period of January 1st, 2008--June 30th, 2014. Late ART initiation was defined as a CD4 cell count <200 cells/mm3 [interquartile range: 75\u2013287]. The median CD4 cell counts of patients initiating ART late increased from 76 cells/mm3 in 2008 to 103 cells/mm3 in 2014 (p\u00a0<\u00a00.001), and the proportion of late ART initiation decreased from 80% to 45% (p\u00a0<\u00a00.001). The risk factors for late ART initiation were male gender, heterosexual transmission and older age (>30\u00a0years) (p\u00a0<\u00a00.001).A total of 3796 patients were analyzed in this study, with a median baseline CD4 cell count of 205 cells/mmNotable improvements were made in the median CD4 cell count at ART initiation and the proportion of late ART initiation from 2008 to 2014. However, persons with high risk of HIV exposure who are male, older even heterosexual orientation should be given more opportunities to receive frequently screening, earlier diagnoses and timely treatment.The online version of this article (doi:10.1186/s12879-017-2398-5) contains supplementary material, which is available to authorized users. Ever since China began to establish national HIV prevention and treatment programs in 2003, the morbidity and mortality of AIDS have been reduced significantly . Since t in 2008 . In 2013cumented . What evcumented . Both ofcumented . Therefocumented . With thcumented \u201313, a deIn this study, we conducted a cross-sectional survey of clinical data from the Shanghai Public Health Clinical Center. The trends in the median CD4 cell counts among different patient groups over time and the risk factors for the late initiation of ART were analyzed.3 or having a clinical AIDS diagnosis prior to ART initiation. All of the CD4 cell count tests were performed within 30\u00a0days prior to treatment initiation. The diagnosis of AIDS was determined by WHO stage IV disease or symptoms. The WHO stage was assessed by the clinicians in the first visit. The patients\u2019 characteristics were recorded at baseline, including age, gender, marital status, and HIV exposure route. The date of HIV diagnosis was recorded according to the referral list from the Shanghai CDC. The time to ART initiation was defined as the time interval between ART initiation and testing positive for Western Blot. We used month-based intervals to assess the length of time from diagnosis to ART initiation. For those whose time to ART initiation was less than 14\u00a0days, we defined it as 0.5\u00a0month; 15\u00a0days to 30\u00a0days was defined as 1\u00a0month; 31\u00a0days to 44\u00a0days was defined as 1.5\u00a0months; and so forth. In the clinic, some patients reported that no definite infectious routes could be determined, and we identified those patients as having an undetermined route of transmission. All of the related clinical data underlying these results are listed in Additional file Patients who initiated ART during the period of January 1st, 2008-June 30th, 2014 were collected retrospectively for this survey according to the following criteria: HIV-1 test positive (by Western Blot), aged more than 16\u00a0years old, antiretroviral treatment-na\u00efve. Patients with incomplete data, such as a lack of baseline CD4 cell counts, HIV diagnosis date, or information on the time of ART initiation were excluded. Late ART initiation was defined as a CD4 cell count <200 cells/mmp\u00a0<\u00a00.1 in the univariate analyses. The confounding factors retained in the multivariate model were the patient\u2019s age, gender, calendar year of ART initiation, infection routes and marital status. Trends in the median CD4 cell count at ART initiation and the proportion of late ART initiation by year were evaluated using Spearman\u2019s correlations and Chi-squared methods, respectively. All hypothesis testing was 2-sided with a level of \u03b1\u00a0=\u00a00.05. Data analysis was conducted using IBM SPSS version 19.0 , and the figures were constructed using GraphPad Prism version 5.0.Continuous variables were described using the median and interquartile range (IQR), while categorical variables were described by percentages. The Chi-square test was used for categorical variables, and the Mann-Whitney test was used for continuous variables. We built a logistic regression model to analyze the risk factors for late ART initiation. The predictors included in the multivariate model were selected based on a significance level of P\u00a0<\u00a00.0001). Notably, the median time to ART initiation in the late ART group was shorter than the non-late initiation group, and this difference was significant (P\u00a0<\u00a00.0001). More details are listed in Table A total of 3796 patients were selected, and most of them were male 91%). See the participants selection flow chart in Fig. %. See thP\u00a0<\u00a00.01). More details are listed in Table Using a multivariate logistic regression model, we found that the patients\u2019 age, gender, and infection routes and the calendar year of ART initiation were all independently associated with the late initiation of ART. Compared with patients younger than 30\u00a0years old, those who were 31\u201340, 41\u201350 and \u226551\u00a0years old were 1.2-, 1.6-, and 1.7-fold more likely to receive late initiation of ART, respectively. Male patients were more likely to initiate ART late than females . The patients who were infected by heterosexual transmission or other routes (mainly including undetermined routes) had an increased risk for late ART. Finally, compared with patients starting ART in the first half of 2014, those who initiated ART in 2008, 2009, 2010, 2011 or 2012 were more likely to be delayed for ART initiation. All of the aforementioned results were significant . See Fig. In 2008, the median CD4 cell counts among the late ART group, the non-late ART group and the overall patients were 76 cells/mmTo our knowledge, this study is the first survey of the trends in CD4 cell counts and the first analysis of the predictors for late ART initiation of HIV-positive patients in Shanghai. In this study, we observed that the median CD4 cell counts at the initiation of ART among overall HIV patients and in the late initiation group increased steadily from 2008 to 2014 in Shanghai. At the same time, the overall number of patients who received ART increased sharply, while the number of patients initiating ART late grew slowly and the proportion of patients with late ART initiation fell rapidly.3 to CD4 counts <500/mm3 [The above observation reflects the great improvement on HIV prevention and treatment that has been made in Shanghai China for the last few years. Since 2004, China has compiled three editions of its HIV prevention and treatment guidelines, and people meeting the criteria for HIV treatment can obtain free ART medications , 4, 14. <500/mm3 . Consequ<500/mm3 . TherefoWe found that male gender, older age, and heterosexual transmission were all risk factors for delayed ART. Similar to the study from sub-Saharan Africa  and the In comparing the late initiation group and the non-late group, one of the results should be noted: the time to initiation was significantly different between the two groups. Patients with late ART initiation had a much shorter time interval from testing positive to commencing ART. This result is reasonable, and to some extent, it implies that the late ART initiation is mainly due to the patients receiving delayed HIV diagnoses. This finding is consistent with that of previous studies , 24.There are still some limitations to be considered. First, the patients\u2019 information was collected from the clinic, and the information regarding HBV and HCV infection status, educational level, and career background was unavailable. Undoubtedly, this might skew the analysis of risk factors for delayed ART initiation. Second, we did not analyze the impact of late ART initiation on the outcome of HIV-positive patients because of the unavailability of follow-up data. However, many other studies , 8, 9 haNotable improvements are observed in the median CD4 cell count at ART initiation and the proportion of patients receiving late ART initiation from 2008 to 2014 in Shanghai. However the high risk of HIV exposure persons who are male, older even heterosexual orientation should be given more education on HIV test and be encouraged to take HIV screening test in a timely fashion. This study highlights the need to improve strategies to diagnose HIV-positive individuals earlier. In this regard, expanding HIV screening programs to target the population at risk for HIV with the aforementioned predictors represents an ideal strategy."}
+{"text": "Doxorubicin (DOX) is an anticancer drug commonly used in treating cancer; however, it has severe cytotoxicity effects. To overcome both the adverse effects of the drug and mineral deficiency  experienced by cancer patients, we have developed magnesium oxide (MgO) nanoflakes as drug carriers and loaded them with DOX for use as a targeted drug delivery (TDD) system for potential application in cancer therapy. The synthesis employed herein affords pure, highly porous MgO nanoparticles that are void of the potentially harmful metal contaminants often discussed in the literature. Purposed for dual therapy, the nanoparticles exhibit an impressive 90% drug loading capacity with pH dependent drug releasing rates of 10% at pH 7.2, 50.5% at pH 5.0, and 90.2% at pH 3. Results indicate that therapy is achievable via slow diffusion where MgO nanoflakes degrade  under acidic conditions releasing the drug and magnesium ions to the cancerous region. The TDD system therefore minimizes cytotoxicity to healthy cells while supplying magnesium ions to overcome hypomagnesemia. Cancer is one of the leading causes of death, accounting for an annual mortality rate of 163.5 per 100,000 men and women as per 2011\u20132015 death statistics . As suchCancer cells have much higher metabolic rates than healthy normal cells, tending to consume more nutrients and oxygen . An insu3 and MgO, which dissolve at slightly acidic conditions, fulfill these requirements and can be used as drug carriers for transporting anticancer drugs for targeted delivery (TD) and slow release (SR). Since these materials do not dissolve at the physiological pH of blood (7.2), drug release is less likely to occur during the transport process. Instead, it would happen slowly at the extracellular medium of cancerous cells. Such a strategy is useful in reducing cytotoxicity of the drugs to healthy cells. In addition, it helps to minimize the dosage requirement and wastage of the drug while enhancing its efficacy and bio-availability. Recently, we tested the hypothesis using model drug copper bis(8-hydroxyquinoline) in hydroxyapatite nanoparticles and found it to be a viable approach to TD [3 nanoparticles and loaded them with cisplatin for TD and SR of the drug at the cancerous cells [3 nanoparticles encapsulated with cisplatin showed 70 wt% drug loading capacity and cargo releasing rates of 0.18%, 0.98%, 12.0%, 13.6%, and 16.4% at pH values 8, 7, 6, 5, and 4, respectively, thus showing appreciable rates at acidic pH values below 7.0 due to slow dissolution of the CaCO3 nanoparticle carriers, and thereby supplying both the drug and calcium ions. Non-toxic inorganic nanoparticles, such as CaCOch to TD . We thenof blood .2, drug Inspired by Gan et al. , we adva, magnesium chloride (99% assay), calcium chloride (98% assay), sodium sulfate (99% assay), sodium acetate (99% assay), potassium hydrogen phthalate (KHP) (99% assay), ethanol (99% purity), and acetic acid (99.5% assay) were purchased from Sigma-Aldrich . These chemicals were of analytical grade and used without further purification. Doxorubicin vial bottles containing 50 mg powder were purchased from Sri Lanka Pharmacy, Kandy, Sri Lanka. Bittern from Puttalam salt Ltd., Palavi, Puttalam, Sri Lanka  was used as a magnesium source and characterized by specific gravity measured using hydrometer according to the ASTM International standards (D1429) . Solutions of specific gravity >1.25 were used. For a 200.0 mL sample, 5.0 mL of 1.0 mol L\u22121 HNO3 was added and refluxed for 1 h to form a homogenous mixture. The sample was then treated with 0.5 mol L\u22121 barium chloride to remove sulphate ions. After precipitation, the suspension was filtered, and clear filtrate was collected. As the secondary magnesium source, dolomite obtained from marble quarry in Madawala Ulpatha, Sri Lanka  was used. 15.0 g of dolomite was mechanically crushed and ground in a sintered crucible. The powdered sample was sieved to obtain a portion of particles less than 150 \u00b5m in size. These particles were heated at 1000 \u00b0C for 2 h to produce calcined dolomite. Additional details are provided in the Cetyltrimethylammonium chloride (CTAC) (98% purity), nitric acid (68% assay), barium chloride (99% assay), potassium chloride (98% assay), potassium monohydrogen orthophosphate (99% assay), sodium Chloride (99% assay), sodium bicarbonate (99% assay)\u22121 CTAC surfactant was added and stirred for 1 h. 2.0 g of calcined dolomite was then slowly added to the reaction mixture and thoroughly stirred for 12 h. The undissolved part was allowed to settle to the bottom of the beaker and the upper portion was composed of a gel. The gel was separated by filtration and heated in an oven at 100 \u00b0C for 24 h. The dry powder thus obtained was washed several times with distilled water and 5% ethanol. The product obtained was dried and calcined at 450 \u00b0C for 2 h in a furnace.MgO nanoparticles were synthesized as follows ,19: Firs\u22121). The XRD patterns were analyzed with the aid of the ICDD PDF 2 database. The average crystallite sizes of magnesium oxide products were estimated by applying the Scherrer equation to the major XRD peaks.Fourier Transform Infrared (FT-IR) spectra of each product were recorded using a iS50 FT-IR instrument  coupled with Attenuated Total Reflectance (ATR) technology. Samples were dried at 100 \u00b0C, and placed in a dry desiccator under a vacuum prior to analyses. The crystalline phases of the powdered products were analyzed by X-ray Diffractometry (XRD) using a D5000 Powder X-ray Diffractometer   at an accelerating voltage of 20 kV. OXFORD analyzer  coupled with the SEM was used to obtain energy-dispersive X-ray spectroscopic data (EDX). Particle size distribution was characterized by Laser Light Scattering based Particle Size Analysis . Nitrogen adsorption isotherms were measured at \u2212196 \u00b0C on an ASAP 2010 volumetric analyzer . Prior to adsorption measurements, all samples were out gassed under the vacuum at 110 \u00b0C for 2 h. Additional details are provided in the SI.2HPO43H2O, NaCl, NaHCO3, MgCl2.6H2O, CaCl2, and Na2SO4 in distilled water and buffering at pH 7.4 with phosphate and HCl (1.0 M) at 36.5 \u00b0C as described in a previous study [Preparation of simulated body fluid and cancer cellular fluid was carried out as follows. Simulated body fluid (SBF) is an acellular solution with composition and concentration similar to that of human plasma at 36.5 \u00b0C. The SBF was prepared by dissolving KCl, Kus study . The pH Drug loading study was performed using different concentrations of doxorubicin hydrochloride in the range 0.1\u20130.5 mg/mL. 1 mg/mL of MgO nanoparticles were used with each of the solution. A comprehensive study was carried out using 1 mg/mL solution of doxorubicin hydrochloride prepared from dry powder by dissolving 50 mg into 50 mL of double distilled water. 1.0 g of MgO nanoparticles were dispersed separately in 10 mL of each of these solutions. The mixture was first sonicated for 1 h, which was followed by overnight stirring at room temperature in the dark. The samples were centrifuged and washed several times to remove excess DOX. Centrifugation was performed at 5000 rpm until a colorless supernatant was observed leaving a purple residue at the bottom of the centrifuge tube. Aided by UV-Vis spectroscopy, drug loading capacity  and drug loading efficiency  were calculated by measuring concentrations of DOX in the solutions before and after loading. Additional details are provided in the SI.t, t, In-vitro release studies were performed on prepared nanomaterials at 37 \u00b0C in three different media, i.e., (a) KHP buffer at pH 3.0 (b) acetate buffer at pH 5.0 (c) phosphate buffer at pH 7.4. Three portions of MgO nanoparticles (50 mg) were transferred into three dialysis membranes previously soaked overnight in 4.0 mL of buffer. After that, sealed membranes were introduced into three separate flasks containing 100.0 mL of corresponding buffer solution . Samples were shaken horizontally in a thermostat shaker at 37 \u00b0C and 100 rpm. At predetermined time intervals, a 4.0 mL sample of the medium was taken and replaced with the same amount of fresh buffer to maintain a constant volume. The release experiments were conducted in triplicate. The results presented are the average data of three repetitive measurements together with their standard deviations. DOX concentration in solutions was evaluated using UV-visible absorption spectroscopy by measuring absorbance at 253 nm since it is a narrow band with high molar absorption coefficients . Further2) nucleates within the cavities of soft templates formed by cetyltrimethylammonium ions. These nuclei grow to a certain size determined by the cavity volume. Other factors include interactions between the surfactants and Mg(OH)2 particles formed, and surface coverage of particles by surfactant molecules. Calcination of the Mg(OH)2 gel gives MgO nanoparticles. The X-ray diffractogrammes taken before and after calcination of the products are shown in In this synthesis, magnesium ions react with hydroxyl ions and magnesium hydroxide (Mg(OH)2 peaks at 2\u03b8 values of 33.0\u00b0, 37.9\u00b0, 50.8\u00b0, 58.5\u00b0, 62.0\u00b0, 65.2\u00b0, and 69.8\u00b0, which correspond to diffractions from (100), (011), (012), (110), (111), (103), and (021) crystallography planes y planes a. All of2 appear at 2\u03b8 values of 37.1\u00b0, 43.1\u00b0, 62.4\u00b0, 75.3\u00b0, and 79.5\u00b0 (5(CO3)4(OH)2.4H2O) present in both samples that has been formed due to adsorption of carbon dioxide from air.The XRD peaks of MgO obtained after calcination of Mg(OH)nd 79.5\u00b0 b, which 2 precursor particles. In these dimensions, the positively charged head of surfactant ions are stabilized by negatively charged hydroxyl ions, which are coordinated with magnesium ions. Therefore, in the presence of CTAC micelles, Mg(OH)2 forms a metal hydroxide coordination stabilized structure  which accounts for the total percentage of carbon from the drug bound to MgO nanoflaked particles. Nitrogen is due to the presence of amine groups in DOX molecules that accounts for 5.62 wt% by composition. In the final mixture, 18.45 wt% of magnesium is from the MgO particles themselves. A remaining 62.19 wt% is accounted for oxygen from both the drug and MgO.2 gas adsorption/desorption isotherm obtained for MgO nanoflakes is shown in 2 gas adsorption/desorption isotherm. Three bands between 8\u201310 nm, 10\u201318 nm, and 32\u201348 nm pore widths indicate the dimensions of the pores along three Cartesian coordinates. As such, it can be concluded that the pore sizes are in the nano-range of 50% porosity. Such high porosity of MgO nanoflake architecture is advantageous in accommodating large amounts of DOX molecules (vide supra).The N\u22121, O\u2013H and N\u2013H at 3700 cm\u22121, C\u2013O\u2013C at 1116 cm\u22121 and C\u2013O at 1024 cm\u22121. \u22121 indicates the presence of bending vibrations of the intercalated metal\u2013oxide species [\u22121 is assigned to Mg\u2013O bond vibration [\u22121 are generally regarded as a surface mode associated with lattice vibrations, which illustrates the fundamental lattice vibrations (phonon) of MgO nanoparticles due to the creation or annihilation of lattice vibrations.The FTIR spectrum of DOX, as depicted in  species . The banibration . Broad a\u22121 are due to N\u2013H stretching vibrations, while 1638 cm\u22121 are due to N\u2013H bend vibrations of the primary amine structure. However, in the case of DOX-loaded MgO, only a single broad band centered at 3440 cm\u22121 is observed and is due to the overlapping of N\u2013H and O\u2013H stretching vibrations. Comparison of the spectra suggest that there are strong interactions between DOX functional groups and hydroxyl groups of MgO nanoparticles possibly through hydrogen bonding. The appearance of characteristic bands of DOX in the encapsulated product confirm the presence of DOX molecules on the surface of MgO nanoparticles without any modification to DOX molecules. As such, it is possible that DOX molecules are bound to the surface of MgO nanoparticles via the electrostatic interaction of protonated NH3+ of DOX and O2- sites on the surface of MgO nanoparticles as well as through hydrogen bonding between O-H and N-H groups of DOX and O-H groups of MgO nanoparticles.The spectrum shown in DLC and DLE are defined as shown in Equations (2) and (3) respectively.3 nanoparticles [Considerably high values of 90.20% and 92.44% are obtained for DLC and DLE, respectively, for the loading of DOX on MgO nanoflake architectures. Compared to the 70% DLC obtained for cisplatin on CaCOarticles , this istc, at time, t, and correcting to cumulative concentrations, Kinetic analysis of drug release was performed for a 104 hour period by measuring absorbance values at 253 nm and converting them to concentration,  high pH . At pH 3 high pH . The relIn this work, we report the synthesis of flake-shaped MgO nanoparticles with narrow particle size distribution. Nanoflakes agglomerate to form self-assembled structures with 50% porosity. Drugs such as DOX readily bind to the surfaces of these nanoflakes via hydrogen bonding and through electrostatic interactions. The inter-particle spaces of agglomerated nanoflakes can be filled up to 90.0% (loading capacity) with 92.4% drug loading efficiency. All materials synthesized were appropriately characterized by several independent analytical techniques with closely parallel results. The cumulative release kinetics of the drug were investigated at different pH values. Results corroborate the development of a novel material for loading DOX for pH dependent TDD to potentially treat both hypomagnesemia and cancer."}
+{"text": "We observed phosphorylation of TXNIP and used both in\u00a0vivo and in\u00a0vitro kinase assays to demonstrate that TXNIP can be phosphorylated by p38 mitogen\u2010activated protein kinase. Furthermore, we also identified Ser361 in TXNIP as one of the major phosphorylation sites. Cell cycle analysis showed that Ser361 phosphorylation participates in TXNIP\u2010mediated cell cycle arrest. In addition, the C\u2010arrestin domain may also play an important role in cell cycle arrest. We also showed that phosphorylation at Ser361 may be important for the association of TXNIP with JAB1 and that the C\u2010arrestin domain is necessary for the nuclear localization of this molecule. Collectively, these studies reveal that TXNIP participates in cell cycle regulation through association with regulatory proteins, especially JAB1, and that C\u2010arrestin\u2010dependent nuclear localization is important for this function. This work may facilitate the development of a new cancer therapy strategy that targets TXNIP as a key molecule inhibiting cancer cell growth via cell cycle blockade at the G1/S checkpoint.Thioredoxin interacting protein (TXNIP) is a novel tumor suppressor that is down\u2010regulated in several cancer tissues and tumor cell lines. Overexpression of TXNIP causes cell cycle arrest at the G1/S checkpoint in the hepatocellular carcinoma cell line HuH\u20107. TXNIP contains putative phosphorylation sites, but the effects of its phosphorylation have not been fully characterized. TXNIP also contains two \u03b1\u2010arrestin domains (N\u2010arrestin and C\u2010arrestin) whose functions are not fully understood. Here, we reveal an association between TXNIP and cell cycle regulatory proteins (p27 AcGFPAequorea coerulescens green fluorescent proteinCaMKcalmodulin\u2010dependent kinaseCdkcyclin\u2010dependent kinaseGSTglutathione S\u2010transferaseHRPhorse radish peroxidaseJAB1Jun activation domain\u2010binding protein 1LC\u2010MS/MSliquid chromatography\u2013mass spectrometryMAPKmitogen\u2010activated protein kinasePKAprotein kinase APKCprotein kinase CTXNIPthioredoxin interacting protein3 up\u2010regulated protein 1, was originally identified as a molecule up\u2010regulated in HL\u201060 leukemia cells by 1,25\u2010dihydroxyvitamin D3 treatment in\u00a0vitro studies indicate that TXNIP overexpression can inhibit the proliferation of stomach cancer and leukemia cells TXNIP gene showed dramatically increased incidence of hepatocellular carcinoma Thioredoxin interacting protein (TXNIP), also called thioredoxin\u2010binding protein\u20102 or vitamin Dkip1, one of the Cdk inhibitory molecules kip1 is induced or activated by various growth arrest signals kip1 is inhibited by association with a shuttle protein, Jun activation domain\u2010binding protein 1 (JAB1), in the nucleus, since the p27kip1\u2013JAB1 complex translocates to the cytoplasm for subsequent ubiquitin\u2010dependent degradation of p27kip1kip1 and JAB1. Therefore, when a sufficient amount of TXNIP is present in the nucleus, nuclear export of p27kip1 is inhibited, and p27kip1 stably localizes in the nucleus and effectively inhibits the transition from G1 to S phase TXNIP has two independent mechanisms for its tumor\u2010suppressive effect, depending on the cell type and the environment. Firstly, its function depends on apoptosis induction through the inhibition of thioredoxin activity in some cell types It has been reported that Thr349 and Ser361 of TXNIP are phosphorylated in HeLa cells during the G1 stage of the cell cycle Here, we elucidate molecular events concerning cell cycle regulation by TXNIP. We show phosphorylation of TXNIP by p38 mitogen\u2010activated protein kinase (MAPK), a signaling molecule that has various functions in cellular responses including cell cycle regulation kip1, pJAB1\u2010V5, and pAcGFP\u2010TXNIP were described previously kip1, JAB1, Cdk2, and cyclin E cDNA were cloned into pGEX\u20106P\u20101  and used as Escherichia\u00a0coli expression vectors for glutathione S\u2010transferase (GST) fusion proteins. The human TXNIP cDNA was cloned into pCold DNA  and used as the pColdHis\u2010TXNIP E.\u00a0coli expression vector. Point or deletion mutants of pFLAG\u2013TXNIP or Aequorea coerulescens green fluorescent protein (pAcGFP)\u2013TXNIP were prepared using PrimeSTAR Mutagenesis Basal Kit (Takara Bio). pFLAG\u2013TXNIP (T349A) and pAcGFP\u2013TXNIP (T349A) have a single point mutation from threonine to alanine at amino acid 349. pFLAG\u2013TXNIP (S361A) and pAcGFP\u2013TXNIP (S361A) have a single point mutation from serine to alanine at amino acid 361. pFLAG\u2013TXNIP (delN) and pAcGFP\u2013TXNIP (delN) have an amino acid 10\u2013152 deletion, and pFLAG\u2013TXNIP (delC) and pAcGFP\u2013TXNIP (delC) have an amino acid 174\u2013296 deletion.Expression vectors pFLAG\u2010TXNIP, pmyc\u2010p27E.\u00a0coli BL21 strain was transformed with each expression plasmid and was cultured at 37\u00a0\u00b0C until D600 reached 0.5. To express GST\u2010fusion proteins, isopropyl \u03b2\u2010d\u20101\u2010thiogalactopyranoside was supplied at 0.5\u00a0mm and then incubated at 25\u00a0\u00b0C for 4\u00a0h. To express His\u2013TXNIP, the culture was set at 4\u00a0\u00b0C for 30\u00a0min, isopropyl \u03b2\u2010d\u20101\u2010thiogalactopyranoside was supplied at 0.5\u00a0mm, and then the culture was further incubated at 4\u00a0\u00b0C for 4\u00a0h. Each GST\u2010fusion protein was purified using Glutathione Sepharose 4B . His\u2010tagged TXNIP protein was purified using Ni\u2010NTA agarose . Purified proteins were separated by SDS/PAGE and stained with Coomassie Brilliant Blue R\u2010250. The in\u00a0vitro binding analysis of TXNIP and each protein was performed as follows. Two micrograms of each GST\u2010fusion protein and 200\u00a0ng His\u2013TXNIP were incubated in a 500\u00a0\u03bcL binding buffer  at 4\u00a0\u00b0C for 3\u00a0h and was washed 3 times with 1\u00a0mL wash buffer . The affinity of TXNIP and GST\u2010fusion protein was analyzed by western blot for TXNIP.The COS\u20107 cells and HuH\u20107 cells were maintained in Dulbecco's modified Eagle's medium  supplemented with 10% fetal calf serum. Transient transfection was performed using Fugene 6 transfection reagent  for COS\u20107 cells, and using X\u2010tremeGENE HP DNA Transfection Reagent (Sigma\u2010Aldrich) following the manufacturer's protocol.Immunoprecipitations were performed as described previously kip1 antibody , anti\u2010JAB1 antibody , anti\u2010Cdk2 antibody , and anti\u2010cyclin E antibody . Anti\u2010mouse IgG HRP\u2010linked and anti\u2010rabbit IgG HRP\u2010linked  secondary antibodies were used. Data were analyzed using lumivision analyzer 400 software .Western blot analyses were performed as described previously m d\u2010allose  for 48\u00a0h, and cell lysate was immunoprecipitated against anti\u2010TXNIP. COS\u20107 cells were transfected with FLAG\u2013TXNIP expression plasmid, and cell lysate was immunoprecipitated with anti\u2010FLAG agarose as described above. The immunoprecipitates were separated by SDS/PAGE. To visualize phosphoprotein, the gel was stained using the Pro\u2010Q Diamond phosphoprotein gel stain (Thermo Fisher Scientific (Invitrogen)) following the manufacturer's protocol. The p38 MAPK activity was inhibited by pre\u2010incubation in 500\u00a0nm LY2228820  for 2\u00a0h before preparing the cell lysate. The samples for liquid chromatography\u2013mass spectrometry (LC\u2010MS/MS) analyses were prepared by in\u2010gel\u2010digestion of the proteins by trypsin, chymotrypsin, and aspartic protease. The phosphorylation state was analyzed by LC\u2010MS/MS using Micromass Q\u2010TOF , followed by a Mascot search .HuH\u20107 cells were treated with 50\u00a0m\u22121 \u03b3\u2010[32P]ATP, 2\u00a0\u03bcg\u00b7mL\u22121 200\u00a0\u03bcm ATP, and 0.2\u00a0mm dithiothreitol). For the p38 MAPK reaction, 25\u00a0mm Tris/HCl pH 7.5, 10\u00a0mm magnesium acetate, 20\u00a0\u03bcm EGTA, and 10\u00a0ng\u00b7\u03bcL\u22121 p38 MAPK  were added to the kinase reaction mix. For the calmodulin\u2010dependent kinase (CaMK) reactions, 50\u00a0mm HEPES pH 7.5, 10\u00a0mm magnesium acetate, 1\u00a0mm CaCl2, 4\u00a0\u03bcm calmodulin, and 2\u00a0ng\u00b7\u03bcL\u22121 CaMKI or CaMKIV  were added to the kinase reaction mix. For the PKA reaction, 50\u00a0mm Tris/HCl pH 7.5, 10\u00a0mm MgCl2, 2\u00a0\u03bcm cyclic adenosine monophosphate, and 6.7\u00a0ng\u00b7\u03bcL\u22121 PKA  were added to the kinase reaction mix. For the PKC reaction, 20\u00a0mm Tris/HCl pH 7.5, 5\u00a0mm MgCl2, 1\u00a0mm CaCl2, 320\u00a0ng\u00b7\u03bcL\u22121 phosphatidylserine, 32\u00a0ng\u00b7\u03bcL\u22121 diacylglycerol, and 3\u00a0ng\u00b7\u03bcL\u22121 PKC (Promega) were added to the kinase reaction mix. The reaction products were separated by SDS/PAGE. The gel was dried and radioactive phosphorylated proteins were detected by autoradiography.One milligram of purified FLAG\u2013TXNIP was incubated at 30\u00a0\u00b0C for 10\u00a0min in kinase reaction mix (2.96\u00a0MBq\u00b7mL\u22121 RNase A (Sigma\u2010Aldrich) and 100\u00a0\u03bcg\u00b7mL\u22121 propidium iodide  using Intraprep Permeabilization Reagent  following the manufacturer's protocol. Flow cytometry analysis was performed for GFP/propidium iodide\u2010positive cells using a Cytomics FC 500 (Beckman Coulter).HuH\u20107 cells were transfected with expression plasmids for AcGFP\u2010fusion proteins and incubated for 48\u00a0h. Cells were fixed in 5.5% formaldehyde and treated with 200\u00a0\u03bcg\u00b7mL\u22121 4\u2032,6\u2010diamidino\u20102\u2010phenylindole . Signals were analyzed with a confocal laser scanning microscope, Radiance 2100 .Cell culture and immunostaining were performed as described previously kip1 and JAB1 in\u00a0vivo association between TXNIP and cell cycle regulatory proteins by overexpressing these proteins in COS\u20107 cells, followed by immunoprecipitation analysis. The results clearly showed the association of TXNIP with p27kip1 and JAB1 as previously reported cip1 could be detected  suggested that TXNIP contained multiple phosphorylation sites, we analyzed the phosphorylation state of FLAG\u2013TXNIP overexpressed in COS\u20107 cells with the result that TXNIP was clearly detected as a phosphoprotein. The phosphorylation of endogenous TXNIP was also detected using HuH\u20107 treated with ine Fig.\u00a0A. We thenal Fig.\u00a0B. Next, P\u00a0=\u00a00.06, n\u00a0=\u00a04), while T349A showed a similar phosphorylation level to wild\u2010type \u2013TXNIP is overexpressed, the number of cells in the G1 stage increased by more than 15% compared to the control cells (expressing AcGFP), which was consistent with our previous analysis We next analyzed the cell cycle of hepatocellular carcinoma cell line HuH\u20107 overexpressing pAcGFP\u2013TXNIP and its mutants as illustrated in Fig.\u00a0kip1, cyclin E, or Cdk2 at similar levels . Overexpression of T349A showed some reduction of the association between JAB1 and p27kip1 (72.0\u00a0\u00b1\u00a09.7% compared to the control), and that of S361A showed a slight reduction , and only 19.8\u00a0\u00b1\u00a08.6% localized in the nuclei  and the multiple mutant (S346A/T348A/T349A/S361A) show a similar phosphorylation level to the S361 mutant. These results support the idea that none of S346, T348, and T349 is highly phosphorylated. Further mutation and phosphorylation analysis would be necessary to identify other phosphorylation sites and their roles in cell cycle regulation.In addition to S361, other amino acids should be phosphorylated because the S361A mutant was still phosphorylated. The E.\u00a0coli suggested the association of unphosphorylated TXNIP with JAB1, showing a discrepancy with the results of immunoprecipitation analysis. It is possible that unphosphorylated TXNIP has relatively low association with JAB1 and it can associate with JAB1 only in concentrated conditions as observed in the pull\u2010down assay. The phosphorylation at S361 in TXNIP could enhance the association with JAB1 in\u00a0vivo.Here we report the possible role of TXNIP phosphorylation at S361 with regard to its association with JAB1. The pull\u2010down assay using proteins expressed in d\u2010allose, a monosaccharide that dramatically up\u2010regulates TXNIP, in HuH\u20107 cells (data not shown), and our present data show direct phosphorylation of TXNIP by p38 MAPK in\u00a0vitro and possibly in\u00a0vivo. In addition, the p38 MAPK pathway has been reported to regulate the cell cycle kip1 activity is unclear so far. The present results suggest the phosphorylation of S361A by p38 MAPK, and lower association of S361A with JAB1 compared to the wild\u2010type TXNIP in COS\u20107 cells, which express endogenous p38 MAPK. Collectively endogenous p38 MAPK possibly plays a regulatory role in the association of TXNIP with JAB1 and thereby regulates the p27kip1 activity.It has been reported that TXNIP is up\u2010regulated through the activation of p38 MAPK in vascular smooth muscle cells, endothelial cells, and mesangial cells The present results show the association of TXNIP with Cdk2 and cyclin E. Cdk4, cyclin B and cyclin D show relatively low association with TXNIP. The cyclin E\u2013Cdk2 complex specifically accelerates cell cycle progression from G1 to S phase. The cyclin D\u2013Cdk4 complex participates in the regulation of the G0/G1 transition of the cell cycle, and cyclin B plays a role in mitosis. Taken together, TXNIP could specifically associate with the cyclin E\u2013Cdk2 complex and participate in the regulation of the G1/S transition. However, the role of TXNIP in the cyclin E\u2013Cdk2 complex has not been analyzed. Since the overexpression of TXNIP does not change the protein level of cyclin E or Cdk2, TXNIP does not regulate the amount of these proteins. Rather TXNIP possibly regulates the activity of the cyclin E\u2013Cdk2 complex.kip1 and JAB1. In addition, Fig.\u00a0kip1 was increased by the overexpression of TXNIP wild\u2010type, and the amount of p27kip1 was close to the control level in S361A\u2010 or del174\u2013296\u2010overexpressing cells. These data imply that Ser361 and the C\u2010arrestin domain in TXNIP contribute to p27kip1 stabilization. However, we could not observe a significant difference in the nuclear p27kip1 amount between TXNIP\u2010overexpressing cells and each of S361A\u2010 and del174\u2013296\u2010overexpressing cells. This result could be due to the rapid turnover of both p27kip1 and TXNIP caused by ubiquitin\u2010dependent degradation. Further studies would be needed to confirm that both phosphorylation at Ser361 and the C\u2010arrestin domain play certain roles in the p27kip1 stabilization caused by TXNIP.The result in Fig.\u00a0et\u00a0al. have previously reported that amino acids 1\u2013227 of TXNIP were sufficient for the interaction with Rch1, a protein that is responsible for nuclear import of TXNIP. They also showed that this region is necessary for the nuclear localization of TXNIP in MCF\u20107 cells While the arrestin domains in visual arrestin and \u03b2\u2010arrestin participate in G\u2010protein\u2010mediated signal transduction pathways d\u2010allose, a monosaccharide rarely present in nature, is a strong inducer of TXNIP and can inhibit cell proliferation in various cancer cells d\u2010Allose is one of the potential therapeutics, and we have already shown that this potential strategy is effective both in cultured cells Although TXNIP is known as a tumor suppressor, it has not been applied in any cancer therapy yet. Our previous work has shown that KK, FY, and MT conceived and designed the project, KK, YD, CN, YH, IT, and NH acquired the data, KK and FY analyzed and interpreted the data, and KK, AH, AK and MT wrote the paper.The authors declare no conflict of interest."}
+{"text": "O-linked \u03b2-N-acetylglucosamine (O-GlcNAc) transferase isoform 1) and NSL3  are crucial components of the MOF /NSL histone acetyltransferase complex. We previously described how global histone H4 acetylation levels were modulated by OGT1/O-GlcNAcylation-mediated NSL3 stability. However, the specific modification site of NSL3 and its molecular mechanism of protein stability remain unknown. Here, we present evidence from biochemical experiments arguing that O-GlcNAcylation of NSL3 at Thr755 is tightly associated with holoenzyme activity of the MOF/NSL complex. Using in vitro O-GlcNAc-transferase assays combined with mass spectrometry, we suppose that the residue Thr755 on NSL3 C-terminus is the major site O-GlcNAc-modified by OGT1. Importantly, O-GlcNAcylation of this site is involved in the regulation of the ubiquitin-degradation of NSL3, because this site mutation (T755A) promotes the ubiquitin-mediated degradation of NSL3. Further in-depth research found that ubiquitin conjugating enzyme E2 S (UBE2S) accelerated the degradation of NSL3 via direct binding to it. Interestingly, OGT1 and UBE2S competitively bind to NSL3, suggesting the coordination of OGT1\u2013UBE2S in regulating NSL3 stability. Furthermore, O-GlcNAcylation of NSL3 Thr755 site regulates the histone H4 acetylation levels at lysine 5, 8, and 16, suggesting that the O-GlcNAcylation of NSL3 at Thr755 is required for maintaining the integrity and holoenzyme activity of the MOF/NSL complex. In colony formation assays, we found that the integrity of the complex impacts the proliferation of the lung carcinoma type II epithelium-like A549 cells. Taken together, our results provide new insight into the elucidation of the molecular mechanism of the MOF/NSL complex.Both OGT1 ( O-GlcNAcylation is controlled by the OGTand glycoside hydrolase O-GlcNAcase (OGA)  GlcNAc  or 1\u03bcg/\u03bcL cold UDP-GlcNAc, 1 mM dithiothreitol (DTT), were incubated at 37 \u00b0C with 550 rpm. After 90 min incubation, the reaction was stopped by 4\u00d7 SDS sample buffer. Modified proteins were detected by Western blot with anti-O-GlcNAc antibody. Radiolabeled proteins were visualized by autoradiography. Insect cell expressed and purified Flag-tagged full-length NSL3 and OGT1, and intracellular overexpressed wild type or T755A point mutant of NSL3-3 were used in in vitro 5 cells/well) using polyethyleneimine (PEI) . However, for the IP or co-IP experiments, 10-cm tissue culture plates were used. Total transfected plasmids in a 6-well plate were 2\u00b5g/well and for a 10-cm plate were 10\u00b5g. Forty-eighto hours after transfection, cells were lysed in RIPA Lysate buffer  and complete protease inhibitor cocktails. Flag- or Myc-tagged proteins and their associated proteins in whole-cell lysates were purified on anti-Flag (M2)- or anti-Myc-agarose beads, and the immunoprecipitated proteins were eluted with 4 \u00d7 SDS buffer directly or 0.2 mg/mL Flag or Myc peptides. Bound proteins were analyzed by WB with anti-Flag or anti-Myc antibody.Flag- or Myc- tagged full-length or deletion mutants or point mutants of NSL3, full-length OGT1, OGA, UBE2N, UBE2S, and HA-tagged ubiquitin plasmids were transiently transfected into HEK 293T cells cultured in 6-well plates  on each well, were transfected with Flag-NSL3-3 and Flag-NSL3-dC plasmids. Forty-eight hours later, cells were immunostained according to the method previously described . H4K16act-test. The statistical difference of p < 0.05 was considered to indicate a statistically significant result. A549 cells, grown to ~30% confluence in 6-well plates, were treated with scramble siRNA, siNSL3, or siOGT for knockdown NSL3 and OGT1, or were transfected with wild type or T755A point mutant of NSL3-3 with or without OGT1 plasmids. Forty-eight hours later, cells were digested with trypsin, re-suspended in RPMI 1640 medium, and split into a new 6-well plate with 2400 cells/well. Two weeks later, the cell were fixed with 4% paraformaldehyde at room temperature for 15 min and formed colonies were stained with Giemsa for 30 min. Colonies containing > 20 cells were scored as positive. Significant differences between siNT (non-targeting) and specific siRNA groups or different plasmids transfection groups were analyzed via the Student\u2019s HEK293T cells were co-transfected with Flag-NSL3-3 and Myc-tagged OGT1 for 48 h, and Flag IP eluate were analyzed by mass spectrometry."}
+{"text": "Litsea cubeba, an important medicinal plant, is widely used as a traditional Chinese medicine and spice. Using cytotoxicity-guided fractionation, nine new lignans 1\u20139 and ten known analogues 10\u201319 were obtained from the EtOH extract of the twigs of L. cubeba. Their structures were assigned by extensive 1D- and 2D-NMR experiments, and the absolute configurations were resolved by specific rotation and a combination of experimental and theoretically calculated electronic circular dichroism (ECD) spectra. In the cytotoxicity assay, 7\u2032,9-epoxylignans with feruloyl or cinnamoyl groups  were selectively cytotoxic against NCI-H1650 cell line, while the dibenzylbutyrolactone lignans 17\u201319 exerted cytotoxicities against HCT-116 and A2780 cell lines. The results highlighted the structure-activity relationship importance of a feruloyl or a cinnamoyl moiety at C-9\u2032 or/and C-7 ketone in 7\u2032,9-epoxylignans. Furthermore, compound 11 was moderate active toward protein tyrosine phosphatase 1B (PTP1B) with an IC50 value of 13.5 \u03bcM, and compounds 4\u20136, 11 and 12 displayed inhibitory activity against LPS-induced NO production in RAW264.7 macrophages, with IC50 values of 46.8, 50.1, 58.6, 47.5, and 66.5 \u03bcM, respectively. Litsea species (Lauraceae) are widely distributed in tropical or subtropical areas. Litsea cubeba, mainly grown in the east and south of China, is broadly used as a traditional Chinese medicine and spice. \u201cBi-cheng-qie\u201d and \u201cdou-chi-jiang\u201d, the dried fruits and roots of L. cubeba, respectively, have been documented in the Chinese Pharmacopoeia and Chinese Materia Medica as two important traditional Chinese medicines for the treatment of various ailments, including coronary disease, cerebral apoplexy, asthma, and rheumatic arthritis + ion at m/z 552.2234  and 13C-NMR spectrum. In the 1H-NMR spectrum recorded in acetone-d6, the signals for an aromatic singlet integrated for two protons at \u03b4 6.39 , a methoxy singlet integrated for six protons at \u03b4 3.67 , suggested a 1-substituted-3,5-dimethoxy-4-hydroxybenzene ring in 1. Signals of a singlet proton at \u03b4 6.74 and two methoxy protons at \u03b4 3.86 and 3.58 revealed a pentasubstituted aromatic ring attached two methoxy groups. These 1H-NMR signals, together with another two singlet protons at \u03b4 7.19 and 4.62, were indicative of a typical skeleton of 2,7\u2032-cyclolignan-7-en such as thomasic acid -4,4\u2032,9\u2032-trihydroxy-3,5,3\u2032,5\u2032-tetramethoxy-2,7\u2032-cyclolignan-7-en-9-amide. H-7\u2032 appearing as a singlet suggested the dihedral angle for the vicinal protons of H-7\u2032 and H-8\u2032 was nearly 90\u00b0, requiring a trans relationship of H-7\u2032 and H-8\u2032. This assignment was also supported by the NOESY correlations of H-7\u2032 with H2-9\u2032, and H-8\u2032 with H-2\u2032 (H-6)\u2032. Finally, the negative optical rotation of 1 demonstrated the 7\u2032R,8\u2032S absolute configuration of 1 [1 was defined as (\u2212)--N-[2-(4-hydroxyphenyl)-ethyl]-4,4\u2032,9\u2032-trihydroxy-3,5,3\u2032,5\u2032-tetramethoxy-2,7\u2032-cyclolignan-7-en-9-amide.Compound sic acid . Additio\u2032 (C-5\u2032)  confirmeion of 1 ,19. Henc2 was isolated as a white amorphous powder. The IR spectrum exhibited absorptions of hydroxy (3362 cm\u22121), amide (1649 cm\u22121), and aromatic (1612 and 1516 cm\u22121) moieties. Its molecular formula was deduced as C39H42N2O11 from the negative HRESIMS at m/z 713.2719 [M \u2212 H]\u2212  and the 13C-NMR spectrum. This indicated twenty degrees of unsaturation. The NMR spectra of 2 were very similar to those of compound 10, a known lignan diamide that was also isolated from this plant -N2-[2-(4-hydroxy-3-methoxyphenyl)-ethyl]-4,4\u2032-dihydroxy-3,5,3\u2032,5\u2032-tetramethoxy-2,7\u2032-cyclolignan-7-en-9,9\u2032-diamide. Compound is plant , with thide bond . In the 3 gave the same molecular formula, C39H42N2O11, as that of 2 by analysis of the HRESIMS. Compound 3 shared almost identical UV, IR, and 1H- and 13C-NMR features to those of 2, which suggested that they both contained the 4,4\u2032-dihydroxy-3,5,3\u2032,5\u2032-tetramethoxy-2,7\u2032-cyclolignan- 7-en-9,9\u2032-diamide core, a tyramine, and a 3-methoxytyramine moieties. Compound 3, the reverse of 2, via the amide bonds --N1-[2-(4-hydroxy-3-methoxyphenyl)-ethyl]-N2-[2-(4-hydroxyphenyl)-ethyl]-4,4\u2032-dihydroxy-3,5,3\u2032,5\u2032-tetramethoxy-2,7\u2032-cyclolignan-7-en-9,9\u2032-diamide.Further analysis of 2D-NMR data permitted the tyramine and 3-methoxytyramine moieties to be located at C-9\u2032 and C-9 in de bonds , respect4 was obtained as a yellow solid and its molecular formula was deduced as C31H36O10 from HRESIMS. The IR spectrum exhibited absorption bands at 3391, 1608, and 1516 cm\u22121 due to the aromatic and hydroxy groups. The NMR data of 4 showed signals similar with secoisolariciresinol  configuration as that of the known compound (+)--9,9\u2032-di-O-(E)-feruloylsecoisolariciresinol (11), which has been also isolated from this plant -2,3-naphthalene dicarboxamide (10) , (+nol (13) , (+)-9\u2032-nol (14) , (+)-5,514) + and 550 [M \u2212 H]\u2212; HRESIMS m/z 552.2234 [M + H]+  and 574.2048 [M + Na]+ .White, amorphous powder.max (log \u03b5) 204 (4.11), 250 (0.86), 281 (0.30), 328 (0.42) nm; IR (KBr) \u03bdmax 3362, 2919, 2851, 1736, 1649, 1612, 1516, 1464, 1424, 1372, 1328, 1274, 1217, 1115, 1035, 890, 834, 802, 721, 640 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z 713 [M \u2212 H]\u2212; HRESIMS m/z 713.2719 [M \u2212 H]\u2212 .White, amorphous power. max (log \u03b5) 204 (4.12), 248 (0.82), 285 (0.27), 333 (0.45) nm; IR (KBr) \u03bdmax 3391, 2920, 2851, 1647, 1611, 1541, 1517, 1465, 1425, 1367, 1278, 1203, 1116, 1035, 932, 888, 829, 801, 722, 650, 599 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z ESIMS m/z 713 [M \u2212 H]\u2212; HRESIMS m/z 713.2715 [M \u2212 H]\u2212 .White, amorphous power. max (log \u03b5) 204 (4.12), 230 (0.82), 287 (0.39), 329 (0.78) nm; IR (KBr) \u03bdmax 3391, 2920, 2850, 1683, 1645, 1608, 1516, 1463, 1428, 1375, 1341, 1272, 1237, 1155, 1119, 1033, 875, 820, 799, 721, 631 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z 567 [M \u2212 H]\u2212; HRESIMS m/z 569.2387 [M + H]+  and 591.2204 [M + Na]+ .Yellow solid. max (log \u03b5) 206 (4.22), 234 (0.84), 284 (0.36), 326 (0.82) nm; IR (KBr) \u03bdmax 3394, 2921, 2850, 1696, 1604, 1517, 1461, 1428, 1370, 1328, 1273, 1218, 1161, 1117, 1033, 984, 915, 825, 721, 645, 604 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z 621.2299 [M + Na]+ .Yellow solid. max 3367, 2928, 2855, 1683, 1601, 1516, 1454, 1431, 1375, 1271, 1207, 1154, 1033, 935, 846, 801, 724 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z 537.2134 [M \u2212 H]\u2212 .Yellow solid. max (log \u03b5) 211 (4.01), 234 (2.12), 318 (1.96) nm; ECD (MeOH) 331 (\u0394\u03b5 \u2212 0.37), 288 (\u0394\u03b5 + 0.73), 222 (\u0394\u03b5 + 2.01); IR (KBr) \u03bdmax 3409, 2940, 2843, 1701, 1665, 1604, 1516, 1461, 1425, 1371, 1323, 1271, 1215, 1169, 1116, 1032, 983, 912, 845, 827, 765, 712, 662 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z 609 [M \u2212 H]\u2212; HRESIMS m/z 609.1980 [M \u2212 H]\u2212 .Amorphous powder. max 3425, 2937, 2845, 1703, 1612, 1516, 1461, 1427, 1331, 1282, 1218, 1154, 1117, 1041, 980, 913, 832, 719 cm\u22121; 1H-NMR  and 13C-NMR  data, see m/z 625.2297 [M \u2212 H]\u2212 .Amorphous powder. max 3395, 2933, 2849, 1701, 1610, 1517, 1462, 1428, 1372, 1324, 1270, 1214, 1159, 1116, 1033, 983, 909, 831, 703 cm\u22121; 1H-NMR  and 13C-NMR  data, m/z 625.2297 [M \u2212 H]\u2212 .Amorphous powder. 2 and seeded in 96-well plates  at a cell density of 3000 per well over night, and then were treated with various diluted concentrations (each concentration was arranged triple) of compounds 1\u201319, which were prepared with DMSO (Sigma) to 100 \u03bcM stock solution and stored in \u221220 \u00b0C in advance. After 24 h of treatment, 10 \u03bcL of MTT (5 mg/mL in PBS) was then added directly to all wells and the plates were placed in the dark at 37 \u00b0C for 3 h incubation. Cell viability was measured by observing absorbance at 570 nm on a SpectraMax190 microplate reader . IC50 values were calculated using Microsoft Excel software . Taxol was used as a positive control.The cytotoxic activity was determined against human colon cancer (HCT-116), human non-small-cell lung carcinoma (NCI-H1650), and human ovarian cancer (A2780) cell lines which were bought from the Cell Bank of Shanghai Institute of Cell Biology (Chinese Academy of Sciences) and originally obtained from the American Type Culture Collection . Cells were grown in RPMI 1640  supplemented with 10% fetal calf serum , penicillin G (100 U/mL), and streptomycin (100 \u03bcg/mL) at 37 \u00b0C in a 5% COS-transferase-human protein tyrosine phosphatase 1B) bacteria pellets were purified by a GST bead column. The dephosphorylation of para-nitrophenyl phosphate (p-NPP) was catalyzed to para-nitrophenol by PTP1B. Enzyme activity involving an end-point assay, which intensified the yellow color, was measured at a wavelength of 405 nm. All compounds were dissolved in 100% dimethyl sulfoxide (DMSO), and reactions, including controls, were performed at a final concentration of 10% DMSO. Selected compounds were first evaluated for their ability to inhibit the PTPase reaction at a 10 \u03bcM concentration at 30 \u00b0C for 10 min, in a reaction system with 3 mM p-NPP in HEPES assay buffer (pH 7.0). The reaction was initiated by addition of the enzyme and quenched by addition of 1 M NaOH. The amount of the produced p-nitrophenol was determined at 405 nm using a microplate spectrophotometer . IC50 values were evaluated using a sigmoidal dose-response (variable slope) curve-fitting program of GraphPad Prism 4.0 software . Oleanolic acid was used as a positive control.The recombinant GST-hPTP1B  containing 10% FBS. The compounds were dissolved in DMSO and further diluted in medium to produce different concentrations. The cell mixture and culture medium were dispensed into 96-well plates (2 \u00d7 105 cells/well) and maintained at 37 \u00b0C under 5% CO2. After preincubation for 24 h, serial dilutions of the test compounds were added into the cells, up to the maximum concentration 25 \u03bcM, then added with LPS to a concentration 1 \u03bcg/mL and continued to incubate for 18 h. The amount of NO was assessed by determined the nitrite concentration in the cultured RAW264.7 macrophage supernatants with Griess reagent. Aliqueots of supernatants (100 \u03bcL) were incubated, in sequence, with 50 \u03bcL 1% sulphanilamide and 50 \u03bcL 1% naphthylethylenediamine in 2.5% phosphoric acid solution. The sample absorbance was measured at 570 nm by a 2104 Envision Multilabel Plate Reader . Dexamethasone was used as a positive control.In summary, bioassay-guided isolation of cytotoxic fractions of the twigs of L. cubeba revealed the presence of nine new lignans 1\u20139 and ten analogues 10\u201319. Initially, all of the isolated compounds were evaluated against HCT-116, NCI-H1650, and A2780 tumor cell lines. Of the compounds, only 7\u2032,9-epoxylignans with feruloyl or cinnamoyl group  were selectively cytotoxic against NCI-H1650 cell line, with IC50 values of less than 20 \u03bcM, whereas, the dibenzylbutyrolactone lignans 17\u201319 exerted cytotoxicity against HCT-116 and A2780 cell lines, with IC50 values ranging from 0.28 to 18.47 \u03bcM. The results highlighted the structure-activity relationship importance of a feruloyl or a cinnamoyl moiety at C-9\u2032 or/and C-7 ketone in 7\u2032,9-epoxylignans. The isolates were also examined for inhibitory activities against PTP1B and LPS-induced NO production in RAW264.7 macrophages. As a result, compound 11 was moderate active toward PTP1B with an IC50 value of 13.5 \u03bcM and compounds 4\u20136, 11 and 12 displayed inhibitions against LPS-induced NO production in RAW264.7 macrophages, with IC50 values of 46.8, 50.1, 58.6, 47.5, and 66.5 \u03bcM, respectively. The present results provide additional phytochemical and bioactive information of this medicinal and spiced plant."}
+{"text": "This study aimed to explore the mechanism of miR-126-3p in alleviating brain injury after ICH.Serum miR-126-3p levels were compared between patients with IHC and healthy controls. A rat model of ICH was generated by intracerebral injection of Type VII collagenase. The rats were intracerebral injected with miR-126-3p mimics or negative control miRNA. Rat brain microvascular endothelial cells (BMECs) were used as a cell model of blood-brain barrier (BBB), and validated by immunofluorescence staining of Factor VIII. The BBB permeability of BMECs after miR-126-3p antagomir transfection was determined by FITC-dextran 20 through a confluent BMECs layer (measured over 120 min). The binding site of miR-126-3p in the 3\u2032UTR of VCAM-1 was predicated by TargetScan, and verified by dual luciferase reporter assay. The expression levels of miR-126-3p and vascular cell adhesion molecule-1 (VCAM-1) in rat brain tissues and BMECs were measured by real-time PCR or western blotting.Serum miR-126-3p level was markedly down-regulated in patients with ICH. The rats with ICH had decreased miR-126-3p levels in serum and hemorrhagic area, while those changes were reversed by the treatment with miR-126-3p mimic. VCAM-1 is a direct target of miR-126-3p, and VCAM-1 expression in hemorrhagic area was down-regulated by the administration of miR-126-3p mimic in rats. Inhibition of miR-126-3p by anti-miR126 treatment in BMECs resulted in barrier leakage.miR-126-3p attenuates intracerebral hemorrhage-induced blood-brain barrier disruption, which is associated with down-regulated expression of VCAM-1 in hemorrhagic area. Intracerebral hemorrhage is a common life-threatening type of stroke . AlthougMicroRNA (miRNA) is a class of endogenous, 18\u201323 nucleotides non-coding small RNA. Accumulating studies have clarified the origin of circulating miRNAs in serum . In brieMany studies also have highlighted the roles of miRNAs in regulating the pathogenesis, diagnosis, and treatment of ICH. For examples, in vitro BBB models. To a certain extent, brain endothelial cell lines are superior to primary BMECs, because of their rapid growth and stability over several generations. Nevertheless, because of the inherent characteristics of the primary brain cells, BMECs cannot be completely replaced by brain endothelial cell lines. Multiple markers are currently used to assist in the identification of BMECs, including endothelial cell markers and tight junction protein  was approved by the Human Ethical Committee of Shengjing Hospital, China Medical University.n = 48; weighing 250\u2013280 g) were obtained from Charles River Laboratories . All experiments were carried out according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All experiments involving rats were approved  by the Institutional Animal Care and Use Committee of Shengjing Hospital, China Medical University. After anesthetization by injection of 10% chloral hydrate, the rats were placed in a prone position and fixed in a stereotaxic frame. A burr hole (1 mm) was made using a dental drill . Type VII collagenase was injected at 0.4 \u03bcl/min  into the hole to induce ICH (n = 36 rats), as previously described (n = 12 rats).Adult male Wistar rats (escribed . The skun = 12/group). A 1-mm burr hole was drilled at another position . The rats were injected with 10 \u03bcM miR-126-3p mimic [5\u2032-UCGUACCGUGAGUAAUAAUGCG-3\u2032 (forward)], and [5\u2032-CAUUAUUACUCACGGUACGAUU-3\u2032 (reverse)] or negative control  and [5\u2032-ACGUGACACGUUCGGAGAATT-3\u2032 (reverse)]   . After surgery and treatments, the rats recovered for 24 h and were allowed free access to food and water.Immediately after modeling, the 36 rats with ICH were randomly divided into three groups: the untreated ICH group, the miR-NC group, and the miR-126-3p group ( \u03bcl/min) , respectVascular cell adhesion molecule 1 wild-type or mutant 3\u2032UTR fragment was subcloned into pmirGLO . Until reaching 70% confluence, the cells were starved for 12 h and then co-transfected with 75 pmol miR-126-3p mimic or NC mimic and 1.5 \u03bcg recombinant plasmid containing wt or mut 3\u2032UTR. Forty-eight hours post-transfection, luciferase activities were determined by Dual-luciferase reporter assay kit .The rats were euthanized and the blood was drawn from the inferior vena cava. The serum samples were frozen for later determination of miR-126-3p expression. The brain was divided into ipsilateral and contralateral hemispheres in relation to ICH. The perihematomal zone was defined as a 2-mm margin around the hematoma. The perihematomal and hematomal tissues were excised, snap-frozen in liquid nitrogen, and stored at \u221280\u00b0C.TM LTX Reagent and PLUSTM Reagent  according to the manufacturer\u2019s instruction (n = 6 BMECs/group).The brains of neonatal rats were isolated and stored in cold PBS . The cerebellum, diencephalon, pia mater, meningeal blood vessels, and white matter were removed. The cortex was collected, washed with PBS, minced, digested with 0.1% type 2 collagenase  at 37\u00b0C, and filtered through a mesh filter. The mixtures were centrifuged, washed with 20% BSA and digested with a mixture of collagenase and neutral protease . The cell suspension was added into Percoll (Solarbio) and centrifuged at 1,000 \u00d7 g for 20 min. BMECs were obtained and cultured in DMEM  containing 10% FBS . Immunofluorescence was used for BMECs identification. The cells were digested with 0.25% EDTA trypsin, blown into single cell suspensions, inoculated into 24-well plates and cultured for 24 h. After removing the coverslips, washing the cells three times with PBS, and removing the floating dead cells, the rat BMECs were seeded into 6-well plates and cultured in serum-free DMEM for 1 h upon reaching 70% confluence. The cells were transfected with 100 pmol of anti-miR-126-3p (5\u2032-CGCAUUAUUACUCACGGUACGA-3\u2032) or anti-miR-NC (5\u2032-CAGUACUUUUGUGUAGUACAA-3\u2032) using LipofectamineBMECs were seeded into Transwell chamber  at a density of 1 \u00d7 104 cells/chamber. After cells were cultured for 72 h, the medium was discarded and 0.01% FITC-dextran 20  was added into the upper chamber. The medium in the lower chamber was collected at different time points . The fluorescence intensity was determined by a fluorescence microplate reader . All measurements were performed in triplicates.Brain tissues were lysed and the samples were centrifuged at 1000 \u00d7 g for 10 min. BCA assay  was performed to determine protein concentration. Forty micrograms of protein samples were subjected to SDS-PAGE and transferred to PVDF (polyvinylidene difluoride) membranes (Millipore). The membranes were incubated with primary antibodies against VCAM-1 (1:400 dilution) , overnight at 4\u00b0C. Horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG (1:5000 dilution) or HRP-labeled goat anti-mouse IgG (1:5000 dilution) was used as the secondary antibody. Then, the membranes were incubated with ECL (enhanced chemiluminescence) reagent and exposed in a dark room. Optical densities of the blots were analyzed using the Media Cybernetics Gel-Pro Analyzer software . All measurements were performed in triplicates.\u00ae PremixExTaq (TliRNaseHPlus) kits . The amplification conditions were: 10 min at 95\u00b0C; 10 s at 95\u00b0C, 20 s at 60\u00b0C and 30 s at 72\u00b0C (40 cycles). U6 was used as the internal reference for miR-126-3p. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference for the other mRNAs. The 2\u2013\u0394\u0394Ct method was used to calculate the expression of the target gene in the experimental group and the reference group , brain tissue specimens, and BMECs were extracted using Trizol . After determination of the RNA concentration using a Nanodrop2000 device , 1 \u03bcg of total RNA was reversely transcribed into cDNA using the PrimeScript RT reagent kit with gDNA Eraser Kit . DNA removal was conducted at 42\u00b0C for 2 min with the addition of 5 \u00d7 DNA Eraser Buffer and gDNA Eraser. RT-qPCR was carried out on an ABI 7500 quantitative PCR instrument  with the SYBRce group . The prit test (two groups) or one-way analysis of variance (ANOVA) with the Tukey post hoc test (more than two groups). The data with skewed distribution were tested by non-parametric tests. A P < 0.05 was considered statistically significant.Statistical analyses were performed using SPSS 19.0  and GraphPad Prism 6.0 . Tests for normal distribution (Kolmogorov-Smirnov test) and homogeneity of variance (Levene\u2019s test) were conducted. The data with normal distribution were expressed as means \u00b1 the standard error of the mean (SEM) and analyzed by the Student P = 0.0072, ICH group vs. Control group)  . This reP = 0.0092, ICH group vs. Sham group) and hemorrhagic area  in rats. Whereas, the treatment with miR-126-3p mimic significantly increased miR-126-3p levels in rat brain edema area  and hemorrhagic area   . HoweverC group) .P = 0.0002) (P > 0.05)  , there w > 0.05) . It showP = 0.0011, ICH group vs. Sham group). Remarkably, the presence of miR-126-3p mimic significantly reversed the low expression of VCAM-1 caused by ICH    . To explC group) . ConsistC group) .in vitro BBB model for the subsequent experiments. The miR-126-3p levels in BMECs treated with the anti-miR-126-3p were significantly decreased compared to the cells treated with the anti-miR-NC  (P = 0.021(60min) and P = 0.0023(120min), anti-miR-126-3p group vs. BMEC group)  . This inC group) .in vitro miR-126-3p inhibition on VCAM-1 expression in BMECs. As shown in P = 0.0045, anti-miR-126-3p group vs. anti-miR-NC group), as a result of miR-126-3p inhibition. Similarly, the relative mRNA expression levels of VCAM-1 among the three groups were consistent with the patterns of protein expression levels   .in vitro primary rats BMECs model that simulates BBB, through manipulation of miR-126-3p expression by treatments with miR-126-3p mimics and anti-miR126 in BMECs, we confirmed that miR-126-3p could alleviate BBB disruption, which was associated with targeted regulation of VCAM-1.Intracerebral hemorrhage is a common type of stroke and is among the leading causes of death in the world . The expin vitro use of a miR-mimic or antagomir is a well-established method to identify miRNA functions, so far only a few of them have been successfully applied in clinical.Many recent mechanistic studies have revealed the role of different miRNAs in the pathogenesis of ICH. For example, the down-regulation of miR-181b has been shown to increase HSP5A, which is involved in reticulum endoplasmic stress, resulting in secretion of inflammatory cytokines, brain edema, and neurological injury . In addiin vivo, resulting in further tissue damage.The BBB is composed of pericytes, astrocytes, endothelial cells, basement membrane, and extracellular matrix. The BBB can resist harmful components from the blood to enter into brain tissues and protect the brain from invasion . InflammVCAM-1 is a target gene of miR-126 . Studiesin vivo. This indicates that miR-126-3p can reduce the degree of cerebral hemorrhage by targeted inhibition of VCAM-1. The in vitro blocking of miR-126-3p results in the up-regulated expression of VCAM-1 protein and mRNA, suggesting that miR-126-3p directly inhibits the expression of VCAM-1. The reduction of miR-126-3p following ICH is probably directly related to the up-regulated expression of VCAM-1 and exacerbated infiltration of inflammatory cells. Nevertheless, VCAM-1 is probably not the only molecule that is responsible for the functional loss of BBB. Additional studies are required to further elucidate the exact mechanisms and other actors involved.Recently, studies have confirmed that miR-126 in endothelial cells can inhibit the expression of VCAM-1 , therefoThe dysregulation of miRNAs in ICH suggest that miRNAs may be used as biomarkers for the diagnosis and prognosis of ICH . The regin vivo administration of miR-126-3p minics in the rat ICH model and in vitro treatment of BMECs with anti-miR126 alleviated BBB disruption, which was demonstrated to be associated with VCAM-1 regulation. Our work suggests that the miR-126-3p/VCAM-1 axis is a potential therapeutic target for patients with ICH.We confirmed that serum miR-126-3p level is lower in patients with ICH than that in healthy control subjects. The The datasets generated for this study can be found in GenBank (BankIt2245039 rno-miRNA-126-3p MN238920).This study was approved by the Institutional Review Board and the Institutional Animal Care and Use Committee of Shengjing Hospital, China Medical University . The procedures on the animals complied with the Guide for the Care and Use of Laboratory Animals by the National Institutes of Health (NIH Publication No. 80-23). The animal experiments adhered to the principle of using the least number of animals strictly to complete the experiments with minimized pain of experimental animals. Since the data on expression levels of miR-126-3p in human serum were retrospectively analyzed, written informed consents were waived, and this study was approved by the Human Ethical Committee of Shengjing Hospital, China Medical University .XF wrote the manuscript and researched the data. TN contributed to discussion. XL designed the study, reviewed the data, and revised the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Both cholesterol (Cho) and methionine  are risk factors for fatty liver disease. Since Western diets are rich in Cho and Met, we investigated the hepatic effects of feeding a diet enriched in Met and Cho. Further, based on the reported anti-oxidative and lipid lowering properties of sitagliptin (an antidiabetic drug), we tested whether it could counteract the negative effects of high Cho and Met. We therefore hypothesized that sitagliptin would ameliorate the development of liver pathology that is produced by feeding diets rich in either Cho, Met, or both.Male Sprague Dawley rats were fed ad libitum a) control diet, or b) high Met or c) high Cho, or d) high Met + high Cho diets for 35\u2009days. From day 10 to 35, 50% of rats in each dietary group were gavaged with either vehicle or an aqueous suspension of sitagliptin (100\u2009mg/kg/day). Liver samples were harvested for histological, molecular, and biochemical analyses.The high Cho diet produced significant hepatic steatosis which was unaffected by sitagliptin. Contrary to expectation, sitagliptin exacerbated expression of hepatic markers of oxidative stress and fibrosis in rats fed high Cho. Corresponding increases in 4-hydroxynonenal adducts and collagen deposition were demonstrated by immunohistochemistry and sirius red staining. These hepatic changes were absent in rats on the high Met diet and they were comparable to controls. The inclusion of Met in the high Cho diet resulted in significant reduction of the hepatic steatosis, oxidative stress, and fibrosis produced by high Cho alone.Sitagliptin exacerbated the effects of high Cho on both oxidative stress and fibrosis, resulting in NASH like symptoms that were significantly reversed by the inclusion of Met. The widespread increase in the incidences of non-alcoholic fatty liver disease (NAFLD), cardiovascular disease (CVD), diabetes, and obesity are a global health concern. Several of these conditions can be reasonably managed by lifestyle changes including diet and exercise. Animal products such as meat, poultry, and dairy are rich in cholesterol (Cho) and methionine (Met). Cho and Met are therefore consumed together when animal products are major components of the diet. NAFLD affects 15\u201346% of adults and is currently considered the third most common cause of cirrhosis and hepatocellular carcinoma (HCC) following hepatitis C infection and alcoholic liver diseases . DiabeteThe strong association between high Cho and inflammatory diseases like NAFLD and atherosclerosis is well established \u20136. In adMethionine (Met), a sulfur-containing essential amino acid obtained from dietary sources, is involved in protein synthesis. In addition to its roles in cellular redox function, one-carbon metabolism, and pyrimidine synthesis, Met serves an essential role in initiation of eukaryotic protein biosynthesis , 12. TheMet has been considered to be the most toxic amino acid based on the studies comparing the relative toxicities of ingested amino acids , 24. RusHowever, there are also studies which suggest that Met directly or its intermediate SAM have protective effects particularly in cases of drug overdose , 31. NeuThe combined effects of high Cho and high Met in the context of hepatic oxidative stress and fibrosis are not adequately studied. Since HChol and HHcy have been individually shown to result in hepatic lipid accumulation, inflammation and oxidative stress, we investigated the combined effects of feeding high Cho and high Met in inducing hepatic oxidative stress and fibrotic responses. Importantly, in anticipation of seeing robust increase in hepatic oxidative stress, fibrosis, and lipid accumulation in rats fed a combination of high Cho with high Met, we investigated the role of sitagliptin in alleviating these effects. Sitagliptin, an antidiabetic drug belonging to the class of dipeptidyl peptidase-4 (DPP-4) inhibitors, reduces post-prandial glycemia via inhibition of the degradation of glucagon like peptide-1 (GLP-1). In addition to their antidiabetic action, DPP-4 inhibitors have several other health benefits such as improving lipid profile, reducing inflammation, oxidative stress, hepatosteatosis and insulin resistance \u201335. Thern\u2009=\u20097) and fed Control (Con), high Methionine (Met), high Cholesterol (Cho), or Methionine+Cholesterol (MetCho) -enriched diets. Purina rodent diet (#5001) with 0.5% cholic acid and 2% maltose dextrin served as the Con diet. The high Met diet was made by enriching the Con diet with 1.5% methionine, the high Cho diet by enriching the Con diet with 2% cholesterol, and the high Met+Cho diet by enriching the Con diet with 1.5% methionine +\u20092% cholesterol. The energy content of Con, Met, Cho and MetCho diets were 12.71\u2009kJ/g, 12.77\u2009kJ/g, 12.46\u2009kJ/g and 12.52\u2009kJ/g, respectively. All rats were provided their respective diets\u00a0ad-libitum, with free access to water. The experiment lasted for 35 d and the rats were maintained in a light-controlled room (12:12\u2009h\u2009day/night cycle) under a constant temperature (22\u2009\u00b0C). Rats were housed in cages with standard bedding.The approval for all experiments was obtained from the institutional animal care and use committee (IACUC) of Pennington Biomedical Research Center. Male Sprague Dawley (SD) rats between 250 and 270\u2009g were obtained from Envigo RMS, Inc. . The rats were weight-matched and divided into 4 groups (n\u2009=\u20097) and fed the Con diet, the Met diet, the Cho diet, or the MetCho diet for a period of 35\u2009days. From day 10 through day 35, all rats were administered an aqueous solution of sitagliptin (100\u2009mg/kg body weight/day) by oral gavage. In this experiment we had an additional Con group and rats in this group were gavaged with vehicle (water); vehicle Con group. Fasting blood glucose was measured at weekly intervals using a glucometer and tail vein sampling. As was done in the first experiment, an initial blood sample was collected before starting the dietary regimen and a final blood sample was obtained at the end of the experiment.Weight-matched adult male SD rats were divided into 4 groups (n\u2009=\u200916 per dietary group) and fed the Con diet or diets enriched with Cho or with MetCho. From each group 50% of rats (n\u2009=\u20098) were gavaged with an aqueous solution of sitagliptin (100\u2009mg/kg body weight/day) while the remaining 50% were gavaged with vehicle (water) orally starting from day 10 through day 35. Fasting blood glucose was measured at weekly intervals using a glucometer and tail vein sampling.For experiment 3, weight-matched adult male SD rats were randomly assigned to 3 groups . The instrument was calibrated using the appropriate standards for fat, lean mass and water as per the protocol of the manufacturer.2 inhalation just before euthanasia). Serum was separated\u00a0by centrifugation and stored at \u221280\u00b0C for the analysis of biochemical parameters. All the lobes of the liver were carefully dissected and a small segment from the largest lobe of the liver was processed for fixation, paraffin embedding, and sectioning for histological analysis. The remaining tissue was snap frozen in liquid nitrogen and stored at \u221280\u00b0C for further analysis.The final blood sample was collected at the end of each experiment by cardiac puncture . Total RNA was isolated using RNeasy mini kit  according to the manufacturer\u2019s protocol and RNA samples were quantified on a NanoDrop spectrophotometer . 2.0\u2009\u03bcg of total RNA was reverse-transcribed using Oligo-(dT)20 primers and M-MLV reverse transcriptase using the kit from Promega . 10\u2009ng of cDNA was used for quantitative real-time PCR on a Step One Plus System . The sequences of primers used in this study are provided in Table\u00a0\u00a0RNA was isolated from liver using TRIzol  and homogenized by a hand-held homogenizer. After incubation for 5\u2009min at room temperature, 1-bromo-3-chloropropane  was added and vortexed. After centrifugation at 12,000\u2009rpm for 15\u2009min at 4The liver samples were fixed in 10% Neutral Buffer Formalin and processed on a TissueTek VIP 6 Vacuum Infiltration Processor. They were embedded in paraffin and 5\u2009\u03bcm sections were obtained for staining with hematoxylin and eosin (H&E). The H&E staining was performed using a Leica St 5020 Autostainer  and the slides were used for microscopy and histopathological examination. Also, the sections were scanned at 20X using a Hamamatsu Nanozoomer Digital Pathology system .2O2 in TBS. Further, the slides were incubated with blocking buffer for 30\u2009min to block non-specific binding sites followed by overnight incubation in anti 4-HNE primary antibody (Abcam). Detection was performed using Leica Bond Polymer Refine kit and slides were counterstained with hematoxylin. The stained slides were scanned using Hamamatsu Nanozoomer Digital Pathology system  and the digital information were stored for analysis.Immunohistochemistry was performed on paraffin embedded liver sections. Briefly, the slides were first deparaffinized using xylene and dehydrated using ethanol. Theses slides were then pressure heated at 100\u2009\u00b0C for 20\u2009min in Na-citrate buffer. To inactivate the endogenous peroxide activity slides were kept for 12\u2009min at room temperature in 3% HThe triglyceride content in the liver tissue was assayed using a commercially available kit from Cayman chemicals . Briefly, 40\u201350\u2009mg of liver tissue was homogenized in the diluted NP40 buffer containing protease inhibitor cocktail. The homogenate was centrifuged at 10,000\u2009g for 10\u2009min at 4\u00b0C and the supernatant was collected and diluted 10 times before assaying for triglycerides. The procedure followed was according to the manufacturers protocol.To examine lipid deposition in livers from experimental animals, 10\u2009\u03bcm thick liver sections were subjected to Oil Red O staining using the NovaUltra  Oil Red O staining kit. Briefly, frozen liver sections were air dried and fixed in formalin and washed under running water for 1\u201310\u2009min. After rinsing with 60% isopropanol these sections were stained with freshly prepared Oil red O solution for 15\u2009min. After rinsing again with 60% isopropanol and distilled water, the slides were mounted in mounting media and scanned using a Hamamatsu Nanozoomer Digital Pathology system .In order to evaluate hepatic collagen deposition, liver sections were stained using the Picrosirius Red staining kit . Briefly, liver sections were deparaffinized and hydrated with distilled water. Then the samples were immersed into solution A (Phosphomolybdic acid) for 2\u2009min and rinsed with distilled water. Subsequently, the slides were kept in solution B (Picrosirius red stain) for 60\u2009min and then in solution C (0.1\u2009N hydrochloric acid) for 2\u2009min. Following this the slides were placed in 70% ethanol for 45\u2009s, again dehydrated, and used for mounting. The stained slides were scanned using Hamamatsu Nanozoomer Digital Pathology system  and the digital information were stored for analysis.https://chem.utk.edu/facilities/biological-and-small-molecule-mass-spectrometry-core-bsmmsc/).Both initial and final serum samples and liver samples from all 3 experiments were subjected to metabolomic analysis by Dr. Shawn Campagna, the Director of the Biological and Small Molecule Mass Spectrometry Core facility at the University of Tennessee  or two-way analysis of variance for multiple comparisons was performed with diet and sitagliptin treatment as main effects followed by post-hoc analysis using Tukey correction for multiple comparisons. Data are presented as mean +/\u2212 SEM. Nox2, Lox1, and Inos mRNAs were measured in the liver (Experiment 1). We found that the high Met diet had no effect on expression of any of these markers compared to controls , Lox1(22-fold) and Nox2 (12-fold) mRNA expression in livers from rats on the high Cho diet relative to controls . Sitagliptin was without effect on hepatic Inos, Lox1, Nox2). However, these genes were increased multifold when sitagliptin was combined with high Cho diet. The associated increases in expression of Inos, Lox1, Nox2 were 100-, 13- and 6-fold, respectively . As noted in Experiment 2, sitagliptin was without effect on hepatic oxidative stress markers in rats on the Con diet , a product of lipid peroxidation and marker of oxidative stress was performed in liver  and its transcriptional regulator, Klf2 in liver tissues , Tlr4 (2.8-fold), Tll2 (5.8-fold), a-Sma (4-fold), Mmp9 (12.4 fold), and Timp1 (2.6 fold). As noted with other responses, the expression of these genes was suppressed by addition of Met to the Cho diet, implying a countering response by Met in hypercholesterolemic rats  a phenomenal increase in oxidative stress and fibrosis in liver by sitagliptin in a high Cho background and b) protection from hepatic damage due to high Cho plus sitagliptin by the addition of Met.Lox1, Inos and Nox2 as candidate biomarkers of oxidative stress. The rats fed high Met did not show an increase in hepatic markers of oxidative stress, showing expression levels that were comparable to animals on the Con diet. It was only in animals on the high Cho diet where we saw increased expression of markers of oxidative stress. However, we did not see an additional increase in the expression of oxidative stress markers in rats fed the combination diet (MetCho). Importantly, addition of Met to high Cho (MetCho) almost abolished the pathological changes that were seen with high Cho alone. The countering of oxidative stress by Met in high Cho fed rats was a serendipitous finding. Although there are studies documenting an association between toxic effects of higher intake of Met in liver due to Hcy (formed from Met), there are also reports on the hepatoprotective effects of Met. Studies on Met reducing sodium fluoride mediated hepatotoxicity [Oxidative stress is one of the most important factors leading to hepatic injury in NAFLD. It plays a major role in the progression of simple steatosis to NASH. Further, the augmented generation of reactive oxygen species (ROS) induces lipid peroxidation leading to inflammation and fibrogenesis by the activation of stellate cells \u201338. Bothtoxicity  and the toxicity . Additiotoxicity , and redtoxicity  are sometoxicity , 45, 47.Using the same dietary approach, we investigated the role of sitagliptin in the next set of experiments. Sitagliptin, a dipeptidyl peptidase-4 (DPP-4) inhibitor is an antidiabetic drug with documented anti-oxidative and anti-inflammatory properties \u201335. IndeIn our studies, we used sitagliptin to investigate if it elicited beneficial effects of reducing inflammatory and oxidative stress responses based on the literature reports. Sitagliptin is reported to cause delay in gastric emptying, increase in insulin sensitivity and produce anti-oxidative and anti-inflammatory effects (which are independent of hypoglycemic effects) , 34. TheCd36 gene, a fatty acid translocase (FAT) in the liver of rats fed the high Cho diet. In a recent study, it was demonstrated that Cd36 directly contributes to the development of NAFLD under high free fatty acid condition via modulating their uptake in hepatocytes [Cd36 improved hepatic steatosis, insulin sensitivity, and reduced systemic inflammation [Cd36, we also examined the expression of Klf2, a positive regulator of the Cd36 gene. Klf2 is known to promote hepatic steatosis through upregulation of Cd36 expression [Klf2 mRNA expression was increased in rats fed high Cho. We also analyzed the markers of fibrosis . As observed for oxidative stress, the expression of these fibrotic markers was significantly higher in the rats on high Cho diet administered with sitagliptin. Tgf-b, Tlr-2 and Tlr-4 activate pro-fibrogenic signaling pathways which play an important role in the development of NASH [a-Sma is a marker of activated hepatic stellate cells [a-Sma, matrix metalloproteinases such as Mmp9 and Timp1 are also involved in the development and progression of liver inflammation and fibrosis [In view of the clinical importance of sitagliptin for managing hyperglycemia in type 2 diabetics, and also since hypercholesterolemia is commonly seen in type 2 diabetics, we conducted another experiment to better understand the effect of drug and diet interaction (Experiment 3). Since Met alone did not cause any significant changes, we stayed with only three dietary groups . We investigated the drug and diet effect by having both sitagliptin and vehicle groups for each diet. In addition to markers of oxidative stress, we also examined additional markers of hepatic damage such as fibrosis and factors that influence triglyceride accumulation and promote steatosis. This experiment clearly established a negative diet x drug interaction with the high Cho diet and sitagliptin that was not evident in the Con group and produced significant hepatic damage. In contrast, inclusion of Met in the high Cho diet ameliorated the harmful interaction between sitagliptin and high Cho, and reversed the elevated markers of oxidative stress and fibrosis. Also, as seen in the first and second experiments, we found increased lipid accumulation in the rats on high Cho that was unaffected by sitagliptin. Again, we found that Met lowered the Cho-induced hepatic lipid accumulation. We were also able to explicitly demonstrate an increase in expression of atocytes . Furtherammation . In addipression  and Klf2 of NASH , 59. a-Ste cells  that profibrosis . InclusiIn the present work, we demonstrated Met-mediated reduction of oxidative stress, lipid accumulation, and fibrosis in livers of rats on the high Cho diet and administered with sitagliptin. Although there are studies documenting dietary restriction of Met increasing longevity, insulin sensitization, reduction of adiposity in addition to increase in both energy intake and expenditure \u201328, therOur data indicate that sitagliptin in conjunction with high Cho diet intensified the oxidative damage resulting in NASH like symptoms. Surprisingly, the negative effects of high Cho and sitagliptin were at least partially attenuated by the inclusion of high Met in the diet.Additional file 1: Figure S1. Body weight and body composition analysis of rats fed Con, Met, Cho and MetCho diets. Sprague-Dawley rats (age\u2009=\u20096\u2009weeks) were fed control (Con), methionine supplemented (Met), high cholesterol (Cho), or high methionine + cholesterol (MetCho) diets ad libitum for 35\u2009days and body weight and body composition (by TD-NMR) was measured once in a week.Additional file 2: Figure S2. Body weight and body composition analysis of rats fed Con, Met Cho and MetCho diets and treated with sitagliptin. Sprague-Dawley rats (age\u2009=\u20096\u2009weeks) were fed control (Con), methionine-supplemented (Met), high cholesterol (Cho), or high methionine + cholesterol (MetCho) diets ad libitum for 35\u2009days. From day 10 through day 35 animals of each group were orally gavaged with an aqueous suspension of sitagliptin (100\u2009mg/kg/day). In addition of Con+sitagliptin, we had an additional Con and rats in this group were administered the vehicle (water); vehicle Con. Body weight and body composition (by TD-NMR) was measured once in a week.Additional file 3: Figure S3. Representative H&E stained images of the rat livers fed Con, Met, Cho and MetCho diets. Hepatic lipid accumulation was seen in rats of high Cho (shown by arrows). This was significantly reduced in the MetCho group. Scale bars\u2009=\u2009100\u2009\u03bcm.Additional file 4: Figure S4. Representative H&E stained images of the rat livers fed Con, Met, Cho and MetCho diets and gavaged with sitagliptin. Compared to controls, hepatic lipid accumulation is evident in rats fed high Cho diet and gavaged with sitagliptin. This was significantly reduced by addition of Met in high Cho diet. Scale bars\u2009=\u2009100\u2009\u03bcm.Additional file 5: Figure S5. Effects of sitagliptin and atherogenic diets on purine metabolites levels. SD rats were fed ad libitum Con or Cho or MetCho diets for 35\u2009days. From day 10 through day 35, half animals of each group were orally gavaged with vehicle and the remaining half with an aqueous suspension of sitagliptin (100\u2009mg/kg/day). Terminal serum samples were collected and processed for detection of serum metabolites by LC-MS. T-test analysis was performed to show the differences within a group and a heat map was generated. Purine metabolites (inosine and guanosine) were reduced when sitagliptin was given to rats fed high Cho diet and have been highlighted."}
+{"text": "Frontiers in Chemistry. The issue highlights important aspects of structure-function relationship from both molecular design and microstructure control perspectives. We present a collection of 11 featured articles from this exciting field that covers molecular design of novel materials and microstructure control of the bulk heterojunction (BHJ) layer for high-performance polymer solar cells.Photovoltaic (PV) devices can directly convert sunlight into electricity, which enables a practical and facile solution to address the challenge of the ever-increasing energy demand in a sustainable way. Intensive research and development are searching for high efficiency solar cells with low-cost fabrication. So far PV devices based on various inorganic materials dominate the entire market, including silicon (Si), III-V group semiconductors, CIGS, and CdTe. However, partially due to the related environmental issues and high production cost, traditional PV technologies raise the obvious constraints on the further manufacturing capacity of system-cost, scale-up, and their wide adoption. Recently there has been an ever-growing interest in emerging polymer-based PV technology owing to synthetic variability and low-temperature solution-processing of organic semiconductors, and the capacity of lightweight, flexible, easy and low-cost manufacturing of devices. It is our great pleasure to propose this special issue entitled \u201cPolymer Solar Cells: Molecular Design and Microstructure Control\u201d for Yan et al. found that the weight average molecular weight (MW) of polymer had a profound influence on the formation of the percolation network. When the MW of N2200 is larger than 96 kDa, a percolation network structure is formed in the J51:N2200 blend film due to the chain tanglement and multi-chain aggregations, resulting in increased electron mobility and improved device performance .The microstructure of the active layer plays a critical role in photovoltaic outcome. It has been widely believed that percolation networks of both donor and acceptor enable efficient charge transport and collection. Liu J. et al. synthesized random copolymers PNDI-Px by introducing porphyrin unit into NDI-based polymer. Due to the more flexible mainchain, the crystallinity of PNDI-Px was suppressed, achieving a finer phase separation structure . In addition, Huang et al. developed a new strategy to control the polymer regiochemistry, which may be used as an effective method to control the crystallinity of polymers and further regulate the phase separation degree. Small molecules are often characterized by high crystallinity. Liu C. et al. synthesized a new small molecule donor with an acceptor-donor-acceptor structure, namely DRTB16-FT, having fluorine atoms on the thienyl substituent of the central benzodithiophene unit. It shows a low-lying HOMO energy level of \u22125.64 eV, which is beneficial for reducing energy loss when blending with an acceptor. However, the strong aggregation of DRTB16-FT induced the formation of large domain size, causing a low device performance . Li et al. demonstrated that a propeller-like structure could prevent the small molecules from aggregating into undesired large crystals. They designed and synthesized three new propeller-like PDI derivatives with all-fused rigid structures, which showed a more suitable absorption range and charge transport abilities than that of unfused counterparts. Using PTB7-Th as donor and propeller-like PDI derivative as acceptor, micrometer-sized crystals which have been widely found in conventional PDI based solar cells were efficiently diminished .Domain sizes should be carefully controlled owing to exciton diffusion length of only 10\u201320 nm. While it still remains challenging to control the domain sizes as the film formation is more related to thermodynamic process, inhibiting the crystallization of the donor and/or acceptor could reduce the domain size effectively. Shao et al. systematically examine how fluorine substituent impacts vertical phase separation. They found that the fluorination of a polymer enables better vertical phase separation in the blend film, which facilitates more efficient charge generation and extraction . Nowadays the vertical phase separation is measured by non-in-situ methods, which exhibit high cost, complicated operation and low precision. Feng et al. proposed an in-situ measurement method in combination with a self-developed in-situ instrument. This diagnostic method is easily accessible and equipped in laboratories, which provides a convenient way to investigate the film-depth-dependent optical and electronic properties .The vertical phase separation also plays a crucial role in charge transport along the perpendicular direction. In an optimized vertical phase separation, the donor should be enriched at the anode and the acceptor should accumulate at the cathode. Zhang et al. introduced trifluoromethyl on a newly synthesized small molecular DTBO to strengthen hydrogen bonding between DTBO and the acceptor. The hydrogen bonding has a strong impact on electrostatic potential and benefits \u03c0-\u03c0 stacking in the active layer, leading to superior charge extraction and low charge recombination . The addition of a third component also increased the hole mobility of active layer. Liu X. et al. incorporated a state-of-the-art narrow bandgap polymer (PTB7-Th) into the PBDT-TAZ:NOE10 binary system, which enhanced the photovoltaic performance and thermal stability of the device. The improved photovoltaic performance partly benefits from the improved hole mobility, resulting in more efficient charge generation, and balanced charge transport . The photophysical processes of ternary solar cells are investigated by Yin et al. through introducing a small molecule donor BTR as a third component to the PCE-10:PC71BM binary system. It was shown that photocarrier losses via recombination are mitigated and the voltage losses are slightly suppressed in the ternary system, leading to improved performance .The use of a ternary active layer, which is fabricated by introducing a second donor or acceptor into a binary D:A blend is emerging as a promising strategy to improve the device performance. The third component could not only broaden the absorption bandwidth but also regulate the morphology of the active layer. Frontiers in Chemistry for their great editorial support. We sincerely hope that this special issue can contribute to better understanding of the fundamental structure-function relationship in organic PV, and that the readers of Frontiers in Chemistry will find this special issue helpful and enjoy it!This special issue thus represents the state-of-the-art in this challenging and fascinating scientific area. We are greatly indebted to all authors for their significant contributions and enthusiastic support. We also thank JL collected the manuscript and was in charge of reviewing manuscript. KZ organized this issue and was in charge of reviewing manuscript. EW was in charge of reviewing manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "SETDB1, a histone H3K9 methyltransferase, has been reported to be upregulated in a variety of tumors and promotes cancer development. However, the exact pathogenesis of SETDB1 in human colorectal cancer (CRC) is hitherto unknown. Here, we showed that SETDB1 expression was highly amplified in CRC. Functionally, SETDB1 downregulation in SW480 and HCT116 cells reduced cell proliferation, migration, invasion, and increased CRC cells apoptosis. In contrast, SETDB1 overexpression promoted CRC cells proliferation, migration, and invasion. High expression of SETDB1 was associated with a more aggressive phenotype in vitro. Flow cytometry showed that cell cycle was arrested in G1 phase after SETDB1 silencing. Furthermore, depletion of SETDB1 in vivo suppressed CRC cells proliferation. Mechanistically, p21 was identified as the target of SETDB1. After transfected with siSETDB1, expression of p21 was distinctly increased. In contrast, expression of p21 was significantly decreased after overexpression SETDB1. We also showed that SETDB1 could be involved in the regulation of epithelial\u2013mesenchymal transition (EMT) in HCT116 cells. Moreover, we confirmed that SETDB1 could regulate the activity of p21 promoter by dual-luciferase repoter assay, and proved that SETDB1 could bind to the promoter of p21 and regulate its H3K9me3 enrichment level by ChIP-PCR experiment. Finally, we verified that silencing of SETDB1 inhibited CRC tumorigenesis in vivo. In conclusion, our results indicate that SETDB1 is a major driver of CRC development and might provide a new therapeutic target for the clinical treatment of CRC. It is well known that CRC carcinogenesis is complicated and still has not been defined, involving multiple genomic variations and biological processes. Therefore, the molecular mechanism must be further studied to deepen the understanding of CRC.Colorectal cancer (CRC) is the third leading cause of cancer death in men and the second leading cause of cancer death in women, according to the latest global cancer statistic2. Epigenetics changes are independent of DNA sequence, mainly including DNA methylation and histone modification, which are reversible features4. Remarkably, histone can be modified at many sites5. Recent evidence indicates that histone methyltransferases (HMTs) and histone acetyltransferase such as EZH2, JMJD3, UTX, SMYD3, and KAT2A are dysregulated in human cancers8. Previous study showed that p300, a histone acetylase, cooperates with CREPT in CRC activating Wnt/\u03b2-catenin signaling pathway, thus promoting the development of CRC9. Increasing the level of H3K27me3 can improve drug sensitivity of CRC patients10. In addition, histone deacetylase (HDAC) inhibitors against CRC are already available in clinical12. Moreover, a recent study in vivo showed that the offsprings of KDM6A conditional knockout male mice exhibited increased incidence of tumors13. These studies suggest that histone modifications play important roles during the occurrence of human cancer. Cancer genome sequencing evidenced that heterochromatin-associated histone modification H3K9me3 accounts for more than 40% of mutation-rate variation14, and more recently study exhibited the increasing expression of H3K9me3 is associated with treatment-resistant phenotypes15. These suggest that H3K9me3 and its enzymes may be potential therapeutic targets.Epigenetics plays a central role in the pathogenesis of cancer16. SETDB1 is characterized by histone H3K9 methyltransferase activity17, which can catalyze the trimethylation of H3K919. H3K9me3 represents a specific tag for epigenetic repression by recruiting heterochromatin protein1 to methylated histones20. Dysregulation of SETDB1 can affect the normal development of embryos and participate in the pathogenesis of tumors22. Recent years, increasing evidence showed that abnormal expression of SETDB1 is closely related to tumorigenesis, including melanoma, lung cancer, breast cancer, and liver cancer26, suggesting that SETDB1 is involved in the pathogenesis of a variety of human cancers. Moreover, recent literatures have reported that SETDB1 expression is associated with poor clinical outcomes in CRC and is thought to be a dysregulated epigenetic regulator29. However, the role of SETDB1 in CRC is still controversial and has not been defined, the exact pathogenesis needs further investigations.SET domain bifurcated 1 (SETDB1) is also known as ESET/KMT1E and located on human chromosome 1q2131. A recent study reveals that mesenchymal stem cells help CRC cells resist senescence through p53/p21 pathway32. In addition, histone modification has an important role in regulating p21 expression. EZH2 promotes tumor progression in melanoma cells through epigenetically silencing p21 expression33. 4-Nonylphenol could interact with RNF2 and EZH2 resulting in decreased p21 expression via increasing H3K27me3 repressive marks at p21 promoter and promoting MCF-7 cells proliferation34. In multiple myeloma (MM), hydroxamicacid-based small-molecule N-hydroxy-4-(2-[(2-hydroxyethyl) (phenyl) amino]-2-oxoethyl) benzamide (HPOB), a novel HDAC inhibitor, could induce MM cells death via transcriptional activation of p2135. Furthermore, lncRNA CRNDE binding with EZH2 promotes the proliferation of CRC cells by epigenetic silencing of DUSP5/p21 expression36, and another lncRNA HOXA-AS2 can inhibit the expression of p21 and KLF2 in CRC cells by binding with EZH2 and LSD1, which both regulate histone methylation37.p21, also known as CDKN1A and a member of the Cip/Kip family, is a key regulator of cell cycle and cell senescenceGiven the great importance of epigenetic regulators in CRC, in the current study, we investigated the oncogenicity of SETDB1 in CRC and shed light on the importance of SETDB1 in the proliferation, cell cycle, apoptosis, migration, and invasion of CRC cells. We defined SETDB1 as an oncogene via elucidating the epigenetic regulation of the p21 expression. In addition, alteration of epithelial\u2013mesenchymal transition (EMT) markers was observed after inhibition of SETDB1 in HCT116 cells. These results suggest that SETDB1 has the potential to serve as a novel biomarker and therapeutic target in CRC.38 to analyze the expression of SETDB1 in different genders and ages of colon adenocarcinoma (COAD) and rectum adenocarcinoma (READ), and the result showed that SETDB1 was upregulated in both colon and rectal cancer regardless of genders and ages  in Ppara\u2206IE mice could promote carcinogenesis of CRC via repressing the transcription of p21 through DNA methylation55. Long noncoding RNA CRNDE promotes the proliferation of CRC cells partly through epigenetically silencing of DUSP5 and p21 expression by binding with EZH2 and induce H3K27me3 modification at the promoter of these genes36. LncRNA HOXA-AS2 promotes the progression of CRC via repressing the expression of p21 and KLF2 by binding with EZH2 and LSD1, which both regulate the histone methylation37. Therefore, p21 acts as a tumor suppressor gene in CRC, and histone methylation plays an important role in regulating its expression. In our study, we verified that SETDB1 could regulate the promoter activity of p21 in CRC cells through the dual-luciferase reporter assay. Moreover, the ChIP experiment further proved that SETDB1 could regulate the enrichment of H3K9me3 on p21 promoter. Bao et al. reported that lncRNA-p21 prevents cell reprogramming via associating with SETDB1 and DNMT to maintain the heterochromatin state of the gene56, which implicated that the epigenetic regulation of p21 is one of the important mechanisms to contribute to the physiological and pathological function. Here, we reveal a new regulatory mechanism of SETDB1 and p21 in CRC.In current study, we also discovered that the classic tumor suppressor genes p21 is a target gene of SETDB1. p21 is involved in cell cycle regulation, which has been reported as a critical molecule for inhibiting cell proliferation in CRC cells57. For example, some HDAC inhibitors vorinostat, romidepsin, and belinostat have been approved for some T-cell lymphoma and panobinostat for MM. Other HDAC inhibitors such as resminostat, practinostat are in phase I and II clinical trials for the treatment of solid malignancies including hepatocellular and prostate cancer58. Sulforaphane is one of the most potent HDAC inhibitors that can inhibit proliferation and induce apoptosis of CRC cells59. In addition, an early report showed that more than 20 HMT enzymes have been reported to be associated with the occurrence of CRC and drugs targeting histone methylation have been demonstrated promising therapeutic effects in preclinical CRC treatment60. For example, EZH2 and SUV39H1 inhibitors have shown efficacy for CRC treatment in preclinical. EZH2 inhibitor GSK346 and chaetocin, a fungal metabolite inhibiting SUV39H1 which regulates the methylation of H3K9, could reduce migration of CRC cells62. In conclusion, the treatment targeting epigenetic modification is a promising clinical therapeutic strategy.Furthermore, we demonstrated that downregulation of SETDB1 could inhibit HCT116 cells proliferation in vivo. It suggests that SETDB1 may be a potential therapeutic target. Dysregulation of epigenetic markers has been extensively reported in tumors and inhibitors targeting these epigenetic enzymes have been developedIn summary, our study illustrated that SETDB1 was upregulated in CRC tissues and serve as an oncogene in CRC. The function role of SETDB1 on CRC cell proliferation and tumorigenesis is partly through epigenetic silencing of p21 expression. SETDB1 might become a promising target for the diagnosis and therapeutic strategy of CRC.A total of 60 pairs primary tumor tissues and corresponding normal tissues were collected from CRC patients who received surgical treatment at Zhongnan Hospital of Wuhan University  between August 2017 and February 2018. All patients were diagnosed by original histopathological detection and none of them received preoperative adjuvant chemotherapy or radiotherapy. The patients with non\u2010curative resection, cancer recurrence, severe injury of vital organs, or a history of autoimmune diseases were excluded. Samples of the collected tissues were preserved in liquid nitrogen. Clinical case data of patients were also collected. The collection of clinical specimens was approved by the clinical research institution review committee and ethics review committee of the Zhongnan Hospital, and every patient was informed of their consent.Cell lines SW480 and HCT116 were purchased from the China Center for Type Culture Collection , and cells had been authenticated for STR profiling and tested for mycoplasma by the vendor. All the cells were cultured in Dulbecco\u2019s modified Eagle\u2019s medium (DMEM)  containing 10% fetal bovine serum (FBS) , 100\u2009U/ml penicillin, and 100\u2009mg/ml streptomycin , at 37\u2009\u00b0C with 5% CO2. Purinicin-inducible GFP-tagged lentiviral SETDB1 (Lenti-SETDB1) were designed and synthesized by Shanghai Genechem . Cells infected with lentivirus were selected by 2\u2009\u03bcg/ml of puromycin  to obtain stably infected cell lines. siSETDB1 and FAM-labeled siNC were purchased from Guangzhou RiboBio , and transfected into cancer cell lines using Lipofectamine 2000 (lipo2000) . Transfection efficiency of siRNA with lipo2000 was preliminarily assessed by fluorescence microscope  24\u2009h after transfection and the silencing effect of siSETDB1 was further verified by qRT-PCR and WB experiments.The total RNA in tissues and cells were extracted with Trizol reagent , and the reverse transcription was performed using TOYOBO ReverTra Ace kit . mRNA expression was quantified using quantitative reverse transcription PCR (qRT-PCR) on Biorad CFX , and GAPDH were selected as a housekeeping gene. The primers were designed and synthesized by TSINGKE Biological Technology , primer sequences were as follows: GAPDHF-5\u2032GGAGCGAGATCCCTCCAAAAT3\u2032, R-5\u2032GGCTGTTGTCATACTTCTCATGG3\u2032, SETDB1F-5\u2032GGTGGTCGCCAAATACAAA3\u2032, R-5\u2032 GGAAGCATAGCCATCATCAA3\u2032, P21F-5\u2032 TGCCGAAGTCAGTTCCTTGT3\u2032, R5\u2032CATTAGCGCATCACAGTCGC3\u2032. The expression levels of mRNA were calculated using the comparative CT (2-\u2206\u2206CT), and all experiments were performed with three biological replicates.Total protein in CRC lines and subcutaneous tumors was extracted using RIPA lysis buffer  according to the reagent instructions. Western blotting was performed with the specific antibody, SETDB1, p21, GAPDH , E-cadherin , N-cadherin .Cell viability was detected using CCK8 kit . After transfection of HCT116 and SW480 cells with siSETDB1 and Lenti-SETDB1 for 48\u2009h, 1000 cells per well were seeded in 96-wells plates with five replicate wells. CCK8 was added into the wells mixing with cell culture medium and incubate for 3\u2009h. The absorbance at 450\u2009nm was measured with a microplate reader , and the growth curve was drawn according to OD value.5 were seeded in upper chambers with serum-free DMEM medium while the lower chamber was filled with 10% FBS. Cells were stained with crystal violet  and photographed by microscope .Migration and invasion assay were performed using the transwell chambers . One hundred microliters matrigel matrix  was added into upper chamber and incubated at 37\u2009\u00b0C for 1\u2009h for the invasion assay. Two hundred microliters cell suspension about 1\u2009\u00d7\u200910Cell apoptosis assay was performed using Annexin V-FITC/PI apoptosis detection kit , and cell cycle assay was performed using cell cycle and apoptosis detection kit . Cells were collected after 50\u2009h transfecting siRNA, and all operations were performed according to the reagent instructions.After 24\u2009h of siRNA transfection, 500 cells were seeded into a six-well culture plate and incubated at 37\u2009\u00b0C with 5% CO2 and we performed the transfection again in these cells 4 days later, visible colonies could be observed at 9 days. The colonies were fixed with 4% paraformaldehyde and stained with crystal violet. Counting the number of colonies that made up of at least 50 cells.64. The sample size of animal experiment was determined as five nude mice in siSETDB1 group and siNC group and it was carried out randomly. We were not blinded for animal experiment. Two hundred microliters cell suspension (about 5\u2009\u00d7\u2009106 HCT116 cells in PBS) were injected into female BALB/C nude mice at 4 weeks old, five mice per group. siRNA was injected into tumors when the subcutaneous tumor is visible at 9 days and we injected the siRNA into the tumors every 3 days to maintain its function. The tumor size was measured every 3 days using calipers. Mice were sacrificed at 28 days and the subcutaneous tumor was excised and preserved at \u221280\u00b0C. Animal experiments were approved by the Animal Ethics committee of Wuhan University.siRNAs were synthesized and purchased from Guangzhou RiboBio and chemically modified in the form of 2 \u2018Ome\u2009+\u20095\u2019 Chol . Chemically modified siRNAs are very stable which could be used in vivo assaysCRC cells were fixed with 1% formaldehyde and incubated at room temperature for 10\u2009min to make DNA-protein cross-links. Then glycine was added to stop the crosslinking and incubated at room temperature for 5\u2009min. One milliliter cell lysis containing protease inhibitors  was added to suspend cells and then cell lysates were sonicated using EPISONIC (USA) to get 200\u2013300\u2009bp of chromatin fragments. Immunoprecipitation was performed with SETDB1 , H3K9me3  specific antibodies and IgG . The chromatin DNA was extracted using DNA purification kit  and the specific primers of p21 promoter were used for PCR. The primer sequences were as following: p21F 5\u2032-TGCATTGGGTAAATCCTTGCC-3\u2032, R5\u2032-AATGAGTTGGCACTCTCCAGG-3\u2032.The high expression cell line of SETDB1 was constructed by infecting SW480 cells with lentivirus, and then the recombinant plasmid pGL4-basic-p21 was co-transfected with the control plasmid pRL-TK, 24\u2009h after transfection, promoter activity was analyzed using a dual-luciferase assay kit  according to the manufacturer\u2019s instructions.t test was used to analysis data difference between two groups, if not the same, welch\u2019s t-test was used, and chi-squared test was used to analysis clinical data. Statistics analysis was performed using SPSS 17.0 software  and GraphPad prism 7.0 software . p\u2009<\u20090.05 was considered to be statistically significant.In this study, all the experiments were performed in three times and data were exhibited as mean\u2009\u00b1\u2009SD. The sample sizes for relevant experiment were determined by power analysis. When the variance between the two groups was similar, student\u2019s"}
+{"text": "Their antitumoral potential was evaluated in two triple negative breast cancer (TNBC) cell lines\u2014MDA-MB-231 and MDA-MB-468, by sulforhodamine B assay. Their effects on the non-tumorigenic MCF-12A cells were also evaluated. The results demonstrated that three compounds caused growth inhibition in both TNBC cell lines, with little or no effect against the non-tumorigenic cells. The most promising compound was further studied concerning possible effects on cell viability (by trypan blue exclusion assay), cell proliferation (by bromodeoxyuridine assay) and cell cycle profile (by flow cytometry). The results demonstrated that the GI50 concentration of compound 2e (13 \u03bcM) caused a decreased in MDA-MB-231 cell number, which was correlated with a decreased in the % of proliferating cells. Moreover, this compound increased G0/G1 phase and decreased S phases, when compared to control cells . Interestingly, compound 2e also reduced tumor size using an in ovo CAM  model. This work highlights the potential antitumor effect of a novel methyl 3-arylthienopyridine-2-carboxylate derivative.A series of novel functionalized methyl 3-(hetero)arylthieno[3,2- Regardless the great number of research studies worldwide to improve our understanding and effort to develop new therapies, breast cancer is still the most frequent diagnosed cancer and the main cause of cancer death in women . Nowadayb]pyridines and their potential as inhibitors of the vascular endothelial growth factor receptor 2 (VEGFR-2), which is a receptor of tyrosine kinase that triggers signalization pathways that cause endothelial cell proliferation and tumor vascularization (angiogenesis) [b]pyridine-6-carbonitriles, which act by inhibiting the non-receptor tyrosine kinase Src, a kinase implicated in cancer, osteoporosis and ischemic diseases when is overexpressed or overactivated [b]pyridine phenylacetylthioureas inhibit VEGFR-2 and c-Met (receptor for hepatocyte growth factor) both implicated in angiogenesis acting synergistically pyridines, either on the pyridine ring by C-C Suzuki-Miyaura pyridin-7-ylthio)phenyl]ureas with hydrophobic groups m- or p-F, m-CH3, m-CF3, and m-CF3/p-Cl (substitution pattern of Sorafenib) relative to the urea moiety in the terminal aryl ring, as antiangiogenic compounds using several assays in Human Umbilical Endothelial Cells (HUVEC) pyridine derivatives have already demonstrated their potential as anticancer and/or antiangiogenic agents. In summary, some thienopyridine-2-carboxylates by C-C Suzuki Miyaura cross-coupling is presented. Their antitumor potential was further evaluated in two different TNBC cell lines. Three of the thienopyridine derivatives presented antitumor activity against the TNBC MDA-MB-231 and MDA-MD-468 cells, without showing relevant toxicity against a non-tumorigenic mammary epithelial cell line (MCF-12A). Moreover, compound 2e significantly decreased the number of viable cells and cellular proliferation of MDA-MB-231 cells, as well as, increased G0/G1 phase and decreased S phase . Importantly, compound 2e also decreased the size of in ovo grafts of chick chorioallantoic membrane (CAM) with MDA-MD-231 cells. Thus, this work points to the antitumor potential of a series of novel thienopyridine derivatives, highlighting one compound as a promising molecule against TNBC.Herein the synthesis of novel methyl 3-(hetero)arylthienopyridine-2-carboxylate 1 was prepared according to a known procedure, from the corresponding 3-amino compound pyridine-2-carboxylates 2a\u20132h in moderate to high yields (35\u201384%) after column chromatography  and electron withdrawing groups\u2014EWGs\u2014 in the para-position of the phenyl ring relative to the C-C bond formed or with an electron-deficient ring (pyridine) or an electron-rich one (furan).The precursor methyl 3-bromothieno+ (100%). Elemental Anal. calcd for C15H11NO2S: C 66.89%, H 4.12%, N 5.20%, S 11.91%. Found: C 67.08%, H 4.09%, N 5.46%, S 12.16%.From compound 1  and phenylboronic acid pinacol ester  following the general procedure for 3 h; purification by column chromatography using 50% ether/petroleum ether, gave compound 2a as a white solid , m.p. 152\u2013154 \u00b0C. 1  and potassium p-tolyltrifluoroborate  and heating for 4.5 h, after purification by column chromatography using 40% ether/petroleum ether, compound 2b was obtained as a white solid , m.p. 153\u2013154 \u00b0C. 1H-NMR  \u03b4 = 2.44 , 3.85 , 7.33 , 7.39 , 7.42 , 8.24 , 8.80  ppm. 13C-NMR  \u03b4 = 21.5 (Me), 52.4 (OMe), 121.1 (6-CH), 128.7 (3\u2032 and 5\u2032-CH), 130.1 (2\u2032 and 6\u2032-CH), 130.12 (C), 130.7 (7-CH), 131.2 (C), 134.9 (C), 138.2 (C), 144.0 (C), 148.5 (5-CH), 154.6 (C), 162.7 (C=O) ppm. MS (ESI) m/z (%): 284.07 [M + H]+ (83%). Elemental Anal. calcd for C16H13NO2S: C 67.82%, H 4.62%, N 4.94%, S 11.32%. Found: C 68.15, H 4.35, N 5.20, S 11.69%.From compound 1  and potassium 4-methoxyphenyltrifluoroborate , reacting for 4 h, after purification by column chromatography using 25% ether/petroleum ether, compound 2c was obtained as a white solid , m.p. 190\u2013191 \u00b0C. 1H-NMR  \u03b4 = 3.85 , 3.89 , 7.05 , 7.39 , 7.50 , 8.23 , 8.80  ppm. 13C-NMR  \u03b4 = 52.5 (OMe), 55.2 (OMe), 113.4 (3\u2032 and 5\u2032-CH), 121.1 (6-CH), 125.2 (C), 130.7 (7-CH), 130.9 (C), 131.6 (2\u2032 and 6\u2032-CH), 134.9 (C), 143.6 (C), 148.5 (5-CH), 154.2 (C), 159.7 (4\u2032-C), 162.9 (C=O) ppm. MS (ESI) m/z (%): 300.06 [M + H]+ (100%). Elemental Anal. calcd for C16H13NO3S: C 64.20%, H 4.38%, N 4.68%, S 10.71%. Found: C 64.20%, H 4.45%, N 4.84%, S 10.33%.From compound 1  and potassium 4-(trifluoromethyl)phenyltrifluoroborate , reacting for 4 h, after purification by column chromatography using 40% ether/petroleum ether, compound 2d was obtained as a white solid. This was recrystallized from ether to give a colorless crystals , m.p. 170\u2013171 \u00b0C. 1H-NMR  \u03b4 = 3.85 , 7.43 , 7.66 , 7.78 , 8.28 , 8.80  ppm. 13C-NMR  \u03b4 = 52.7 (OMe), 120.6 (6-CH), 124.8 , 124.9 , 130.3 , 130.8 (2\u2032 and 6\u2032-CH), 131.0 (7-CH), 132.3 (C), 135.0 (C), 137.0 (C), 142.1 (C), 148.8 (5-CH), 153.3 (C), 162.4 (C=O) ppm. 19F-NMR : \u03b4 = \u221262.63  ppm. MS (ESI) m/z (%): 338.05 [M + H]+ (100%). Elemental Anal. calcd for C16H10F3NO2S: C 56.97%, H 2.99%, N 4.15%, S 9.51%. Found: C 56.62%, H 2.65%, N 4.35%, S 9.81 %.From compound 1  and potassium (4-chlorophenyl)trifluoroborate  reacting for 3 h, purification by column chromatography using 50% ether/petroleum ether, compound 2e was obtined as a white solid , m.p. 195\u2013196 \u00b0C. 1H-NMR  \u03b4 = 3.85 , 7.43 , 7.49 , 8.27 , 8.81  ppm. 13C-NMR  \u03b4 = 52.6 (OMe), 121.3 (6-CH), 128.3 (2 \u00d7 CH), 131.3 (7-CH), 131.7 (2 \u00d7 CH), 132.2 (C), 134.7 (C), 135.1 (C), 142.1 (C), 148.4 (5-CH), 153.4 (C), 157.3 (C), 162.5 (C=O) ppm. HRMS (EI) Calcd. for C15H1035ClNO2S [M + 35Cl] 303.0121; found: 303.0104. Calcd. for C15H1037ClNO2S [M+37Cl] 305.0091; found: 305.0099.From compound 1  and potassium (4-cyanophenyl)trifluoroborate  reacting for 3 h, gave a solid which was submitted to dry flash till 90% ether/petroleum ether to give compound 2f as a white solid , m.p. 198-200 \u00b0C. 1H-NMR  \u03b4 = 3.86 , 7.44 , 7.65 , 7.80 , 8.27 , 8.78  ppm. 13C-NMR  \u03b4 = 52.7 (OMe), 112.2 (C), 118.9 (C), 121.5 (6-CH), 131.0 (7-CH), 131.3 (2 \u00d7 CH), 131.6 (2 \u00d7 CH), 132.6 (C), 135.0 (C), 138.1 (C), 141.4 (C), 148.8 (5-CH), 153.4 (C), 162.2 (C=O) ppm. HRMS (EI) M+ Calcd. for C16H10N2O2S: 294.0463; found: 294.0474.From compound 1  and 4-pyridine boronic acid , of PdCl2(dppf).CH2Cl2 4 mol% and heating for 4 h, a solid was obtained and submitted to dry flash chromatography till 80% ether/petroleum ether to give compound 2g as a white solid , m.p. 192-193 \u00b0C. 1H-NMR  \u03b4 = 3.90 , 7.50 , 7.90 , 8.32 , 8.79\u20138.82  ppm. 13C-NMR  \u03b4 = 53.1 (OMe), 122.0 (6-CH), 127.8 (3\u2032 and 5\u2032-CH), 131.1 (7-CH), 134.4 (C), 135.1 (C), 137.7 (C), 139.3 (C), 143.0 (2\u2032 and 6\u2032-CH), 149.3 (5-CH), 152.6 (C), 161.7 (C=O) ppm. MS (ESI) m/z (%): 271.04 [M + H]+ (100%). Elemental Anal. calcd for C14H10N2O2S: C 62.21%, H 3.73%, N 10.36%, S 11.86%. Found: C 61.90%, H 3.69%, N 10.06%, S 11.79%.From compound 1 , potassium 3-furanylboronic acid , PdCl2(dppf).CH2Cl2 4%mol and heating for 4.5 h, a solid was obtained and submitted to dry flash chromatography till 30 % ether/petroleum ether to give compound 2h as a white solid , m.p. 130\u2013132 \u00b0C. 1H-NMR  \u03b4 = 3.94 , 7.02\u20137.03 , 7.40 , 7.56\u20137.57 , 8.21 , 8.25\u20138.26 , 8.81  ppm. 13C-NMR  \u03b4 = 52.6 (OMe), 112.3 (CH), 116.7 (C), 121.2 (6-CH), 130.0 (C), 130.6 (7-CH), 134.5 (C), 134.6 (C), 141.8 (CH), 144.3 (CH), 148.1 (5-CH), 153.7 (C), 162.8 (C=O) ppm. MS (ESI) m/z (%): 260.04 [M + H]+ (100%). Elemental Anal. calcd for C13H9NO3S: C 60.22%, H, 3.50%, N 5.40%, S 12.37%. Found: C 60.27%, H 3.33%, N 5.69%, S 12.48%.From compound Fetal bovine serum (FBS) and phosphate buffered saline (PBS) were purchased from Biowest and Gibco, respectively. Acetic acid, dimethyl sulfoxide (DMSO), ethylene diamine tetraacetic acid (EDTA), sulforhodamine B (SRB), trypan blue reagent, doxorubicin, trichloroacetic acid (TCA), Tris base and bromodeoxyuridine (BrdU) were purchased from Sigma-Aldrich. Stock solutions of the synthesized compounds were prepared with the solvent DMSO as vehicle, at stock concentration of 60 mM and kept at \u221220 \u00b0C. The other working stock solutions of 40 mM, 20 mM and 5 mM were also prepared in DMSO and kept at \u221220 \u00b0C.2a\u20132h were freshly prepared from the previous stock solutions in DMSO for the cell-based assays. The effect of the vehicle solvent (DMSO) on the growth of the cell lines was evaluated by exposing untreated control cells to the maximum concentration of DMSO used in each compound for each assay. Appropriate dilutions of compounds 2. Regularly, all cells were observed using an inverted light microscope (Leica DMi1). All the experiments were carried out with cells at the exponential phase of growth and with more than 90% viability. Two human triple negative breast cancer (TNBC) cell lines were used in this work: MDA-MD-231 and MDA-MB-468. Both TNBC cell lines were cultured in RPMI 1640 medium  with 25 mM of glutamine and 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) buffer (from Biowest). These media were supplemented with 5% FBS for the cell growth inhibition assay (SRB) or with 10% FBS for the remaining experiments. The non-tumorigenic cell line MCF-12A was cultured in RPMI 1640 medium supplemented with hEGF , hydrocortisone (500 ng/\u03bcL), 5% FBS and 1% Penicillin-Streptomycin (Gibco), as previously described . All theNeubauer Chamber) using the trypan blue reagent, which distinguishes alive (bright) from dead cells or non-viable cells (blue ones).The cell number and viability were assessed by counting the cells with a hemocytometer (4 cells per mL for MDA-MD-231 and MDA-MB468 cells) by adding 100 \u03bcL of cells per well and then incubated at 37 \u00b0C for 24 h. All experiments were performed in two 96 well-plates, a T0 plate to be analyzed at 0 h (time of treatment with the compounds) and a T48 plate to be analyzed 48 h later. Then, cells were treated with five serial dilutions of each compound (ranging from 150 \u00b5M to 9.4 \u00b5M) by adding 100 \u03bcL of compound per well, and incubated at 37 \u00b0C for further 48 h. The effect of the vehicle (DMSO) on cell growth was also evaluated (control) by exposing untreated cells to the maximum concentration of DMSO . The maximum concentration tested for each compound was 150 mM. However, for some compounds, precipitation was detected within the tested range of concentrations. In those cases, the GI50 concentration was not possible to determine and was indicated as \u201chigher than\u201d the highest concentration tested without causing precipitation. Doxorubicin (ranging from 100 nM to 6.25 nM) was used as positive control. Following 48 h incubation of cells with the compounds in the T48 plate (or 0 h in the T0 plate), cells were fixed by adding 10% (w/v) of cold TCA  during 1 h at 4 \u00b0C. Subsequently, after washing with water, air-dried cells were stained with 0.4% of SRB  for 30 min in the dark at room temperature (RT). At the end, cells were washed with 1% (v/v) of acetic acid and the bound dye was solubilized with 10 mM Tris base solution. The absorbance was measured at 510 nm in a microplate reader (BioTek\u2019s SynergyTM Mx) using the Gen5 software (BioTek) pyridine-2-carboxylates 2a\u20132h were prepared in moderate to high yields by C-C Pd-catalyzed Suzuki-Miyaura cross-coupling of methyl 3-bromothienopyridine-2-carboxylate with different boronated compounds. These were tested against TNBC cell lines and the potential of three novel thienopyridine derivatives 2e, 2f, 2h as anticancer agents in TNBC cell lines was demonstrated. Importantly, no toxicity was observed in non-tumorigenic breast cells. One of the most promising compounds, 2e, presented activity against TNBC both in vitro (by decreasing viable cell number and cell proliferation and interfering with the cell cycle profile) and in ovo (by reducing grafted tumor size). However, further studies must be carried out to unravel the underlying mechanisms of action of this compound. Furthermore, the anticancer effect of compound 2e should be also assessed in vivo, using xenografted mouse models of human TNBC cell lines. Although the present work is focused on compound 2e, the other promising compounds (2f and 2h) will be also explored in the future. Therefore, this work highlights the antitumor potential of a novel thienopyridine derivative against an aggressive type of cancer, TNBC. Eight novel methyl 3-(hetero)arylthieno[3,2-"}
+{"text": "Moreover, keeping constant the presence of the tryptaminic scaffold and binding it to the azelayl moiety, the compounds maintain biological activity. Compound 13 is still active against hematological cancer cell lines and shows a selective effect only on HT29 cells (IC50 = 0.006 \u00b5M) among solid tumor models. Compound 14 loses activity on all leukemic lines, while showing a high level of toxicity on all solid tumor lines tested (IC50 0.0015\u20130.469 \u00b5M). We synthesized five novel tryptamine derivatives characterized by the presence of an azelayl chain or of a 1,1,1-trichloroethyl group, in turn connected to another heterocyclic scaffold. The combination of tryptamin-, 1,1,1-trichloroethyl- and 2-aminopyrimidinyl- moieties produced compound  The latter was subjected to chlorination by treatment with SOCl2 at room temperature in anhydrous THF and under nitrogen flow, in order to remove hydrochloric acid produced during the reaction. Intermediate compound 8 was then reacted without purification with tryptamine (1) and the reaction course was monitored by 1H NMR of a sample of concentrated crude reaction mixture until to reveal a conversion of about 80%. Compound 9 was recovered, after chromatography on neutral alumina, with purity > 99% even if in only 23% yield; the reason of the low yield might be due to the decomposition of the product during the purification step. We tried also the reaction between compounds 8 and 2 but no product was detected, probably because of the low nucleophilicity of the nitrogen amide atom of compound 2. Compound 9 was subjected to biological essays, as well as compound 7, chosen with the aim to compare their activities. 2-Aminopyrimidine  under Schotten-Bauman like conditions. Thus, we first prepared the acyl chloride derivative (12) by reaction between the commercially available azelaic acid monomethyl ester (10) and oxalyl chloride (11). Then, we reacted this activated azelaoyl moiety with tryptamine. The ester bond of compound 13 was further selectively and almost quantitatively hydrolysed to free acid (14) in order to check the biological activity of both, the acid and the ester. The novel compounds have been purified and fully characterized. The synthetic approach, shown in 50) and the results are shown in To investigate whether the compounds have an antitumor activity, we performed in vitro preclinical assays. In vitro growth inhibitory concentration was determined by incubating the cells with increasing concentrations (0.01\u2013250 \u03bcM) of the compounds for 24 h. Data obtained from cell growth assays were elaborated to assess the concentration of each compound required for 50% inhibition of cell viability . However, this compound showed poor biological activity when tested in solid tumor models. Indeed, it was able to reduce cell growth only in the osteosarcoma U2OS cell line at high doses (IC50 = 235 \u00b5M). Compound Apcin interferes with the biological activity of Cdc20, that functions as an oncogenic factor in tumorigenesis: it is upregulated across several cancer types, including ovarian/uterine, colon and colorectal cancer, oral squamous cell carcinoma  and in a9 showed a selective activity against leukemic cell lines, we then investigated whether the tryptaminic and 2-aminopyrimidyl moieties of compound 9 were effective against solid tumor models, when tested separately. We observed that the trichloro-1-(pyrimidin-2-ylamino)ethyl group (compound 7) maintained some activity against Jurkat 6 cells and was more active against U2OS cells, while solely the presence of tryptaminyl and trichloroethyl groups (connected through an ureido moiety) (as in compound 4), produced the total loss of activity against hematological models, while being effective against U2OS and the colon cancer cell line HT29. Moreover, the dimeric form of compound 4, with symmetry with respect to the trichloroethyl group, (compound 5) showed a further activity reduction, being able to reduce cell growth in a single cell line and at very high doses that hamper any preclinical development. Overall, these data suggest that both the triptaminyl and the pyrimidinyl moieties connected through the trichloroehtyl group (compound 9) are relevant to the compound effectiveness against acute leukemia models, while showing a modest and selective activity in solid cancers. Since compound 13), we maintained a biological activity against acute myeloid and B-cell acute lymphoblastic leukemia cell lines and observed a selective effect in HT29 cells, against solid cancer models. Conversely, solid tumor models displayed a specific vulnerability towards compound 14 (the acid free form of the ester of compound 13), that was not effective against hematological cell lines. Of note, compounds 13 and 14 were both active against HT29 cells, in line with previous observations on similar compounds +, 372 [M + Na]+; ESI-HRMS+ (m/z): for C13H14Cl3N3NaO2+ Calc. 372,00493, found 372.0049.After cooling and removal of the solvent in vacuo, the crude residue was subjected to FC on silica gel (eluent: ethyl acetate) to afford compound 3, 0.17 g, 1.03 mmol) was introduced under argon atmosphere. The system was heated at 100 \u00b0C until melting of compound 3, then compound 2  and after 1 h anhydrous toluene (2 mL) was added and the reaction was stirred at 100 \u00b0C overnight and then allowed to cool to room temperature. After adding 10 mL of ethyl acetate the mixture was filtered under vacuum and the obtained solid was washed with methanol to obtain compound 5 as a grey solid.  m.p.: 208\u2013210 \u00b0C; 1H-NMR  \u03b4, ppm = 10.81 , 7.55 , 7.33 , 7.14 , 7.06 , 6.97 , 6.78 , 6.33 , 6.25 , 2.81 , ; 13C-NMR  \u03b4, ppm = 155.9, 136.3, 127.2, 122.7 (CH), 120.9 (CH), 118.4 (CH), 118.2 (CH), 111.7, 111.3 (CH), 103.8, 67.6 (CH), 40.2 (CH2), 25.8 (CH2); ATR-IR: (cm\u22121): 3386, 3329, 3286, 1637, 1558, 740; ESI-MS+ (m/z): 535 [M + H]+ 557 [M + Na]+, 575 [M + K]+; ESI-HRMS+ (m/z): for C24H25Cl3N6NaO2+ Calc. 557.10023, found 557.1002.In a three necked round bottomed flask, partially immersed in an oil bath and equipped with a reflux condenser and a magnetic bar, chloral hydrate  and chloral hydrate  in THF (20 mL) was introduced in a wessel for MW experiments equipped with a heating plate and a magnetic bar. The mixture was heated at 90 \u00b0C for 3 h under MW irradiation (300 W) then allowed to stand at room temperature. The solvent was removed in vacuo and the residue was subjected to bulb-to-bulb distillation . Pure compound 7 was recovered as white solid in the initial bulb . m.p.:166.5\u2013168.0 \u00b0C  \u03b4, ppm = 8.40 , 7.50 , 6.79 , 6.20 ; 13C-NMR  \u03b4, ppm = 160.9, 158.1 (CH), 112.4 (CH), 103.1, 82.5 (CH); ATR-IR: (cm-1): 3300, 1576, 1074, 794; ESI-MS+ (m/z): 242 [M + H]+, 264 [M + Na]+; ESI-HRMS+ (m/z): for C6H7Cl3N3O+ Calc. 241.96547, found 241.9655.A solution of 2-aminopyrimidine  in anhydrous THF (20 mL) was added. A solution of SOCl2  in anhydrous THF (2 mL) was put in the dropping funnel and slowly added (dropwise in 20 min.). During and after the addition of SOCl2 nitrogen was bubbled into the solution in order to remove the gaseous by-products. The reaction course was monitored through 1H-NMR spectroscopy. When the conversion resulted quantitative, the solvent was removed and the white solid obtained was characterized and used without further purification. m.p.: 116.3\u2013118.8 \u00b0C; 1H-NMR  \u03b4, ppm = 8.45 , 7.74 , 6.84 , 6.21 ; 13C-NMR  \u03b4, ppm = 160.2, 158.0 (CH), 112.4 (CH), 102.9, 82.4 (CH); GC-MS (m/z): 189 , 154 , 119 , 79 (20); ESI-MS+ (m/z): 224 [M \u2212 Cl]+.In a flame-dried apparatus, equipped with a reflux condenser, dropping funnel and kept under inert atmosphere, a solution of compound 1, 0.200 g, 1.25 mmol) in anhydrous THF (5 mL) was added to a solution of compound 8  in anhydrous THF (5 mL). The reaction mixture was heated at 50 \u00b0C overnight. After removal of the solvent, the crude was subjected to FC on neutral alumina (changing gradient eluent from n-hexane/ethyl acetate 1/1 until pure ethyl acetate) and 44.2 mg  of pure compound 9, as waxy brown solid was obtained. m.p.: 132.5\u2013134.5 \u00b0C; 1H-NMR  \u03b4, ppm = 10.76 , 8.37 , 7.56 , 7.39 , 7.30 , 7.11 , 7.03 , 6.91 , 6.73 , 5.70 , 3.04\u20132.76 ; 13C-NMR  \u03b4, ppm = 162.0, 158.1 (CH), 157.9, 136.1, 127.1 (CH), 122.6 (CH), 120.8 (CH), 118.1 (CH), 111.9, 111.8 (CH), 111.3 (CH), 103.8, 76.3 (CH), 47.3 (CH2), 25.5 (CH2); ATR-IR: (cm\u22121): 3411, 3221, 1584, 1444, 1415, 798, 784, 740; ESI-MS+ (m/z): 384 [M + H]+, 406 [M+Na]+, 424 [M + K]+; ESI-HRMS+ (m/z): for C16H16Cl3N5Na+ Calc. 406.03690, found 406.0369.Tryptamine  was added to a magnetically stirred solution of crude freshly prepared compound 12 (1 mmol) +, 367 [M + Na]+, 383 [M + K]+; ESI-HRMS+ (m/z): for C20H28N2NaO3+ Calc. 367.19976, found 367.1998.Tryptamine (compound (1 mmol) ,18. Afte2O  was added to a solution of compound 13  in 25 mL of a 20% v/v solution of THF in H2O and the mixture was stirred at room temperature for 3 h. After acidification with 10% aq. HCl, EtOAc and H2O were added to the mixture. The extracted organic layer was dried over anhydrous MgSO4 and concentrated and pure compound 14 was recovered in 86% yield  as pale grey solid: m.p.: 88.0\u201391.4 \u00b0C; 1H-NMR  \u03b4, ppm = 8.42 , 7.58 , 7.37 , 7.19 , 7.11 , 7.01 , 5.63 , 3.60 , 2.96 , 2.38\u20132.28 , 2.09  1.69\u20131.48 , 1.39\u20131.29 ; 13C NMR  \u03b4, ppm = 179.0, 173.5, 173.4, 127.3, 122.2 (CH), 122.1 (CH), 119.4 (CH), 118.6 (CH), 112.7, 111.3 (CH), 39.6 (CH2), 36.7 (CH2), 33.9 (CH2), 30.3 (CH2), 28.8 (CH2), 28.7 (CH2), 25.5 (CH2), 25.2 (CH2), 24.6 (CH2); 1H-NMR  \u03b4, ppm = 9.17 , 7.59 , 7.40 , 7.14 , 7.09 , 7.06 , 6.53 , 3.46 , 2.91 , 2.27 , 2.09 , 1.60\u20131.48  1.34\u20131.20 ; 13C-NMR  \u03b4, ppm = 175.4, 174.1, 137.5, 128.5, 123.5 (CH), 122.3 (CH), 119.7 (CH), 119.4 (CH), 113.4, 112.2 (CH), 40.5 (CH2), 36.8 (CH2), 34.2 (CH2), 29.60 (CH2), 29.58 (CH2), 29.54 (CH2), 26.4 (CH2), 26.0 (CH2), 25.5 (CH2); ATR-IR: (cm\u22121): 3388, 3269, 1710, 1631; ESI-MS+ (m/z): 331 [M + H]+, 353 [M + Na]+, 369 [M + K]+; ESI-HRMS+ (m/z): for C19H26N2NaO3+ Calc. 353.18411, found 353.1841.LiOH\u00b7Hl-glutamine , at 37 \u00b0C and 5% CO2 atmosphere. The compounds were dissolved in DMSO  in a stock solution. The squamous carcinoma (A431), human colon cancer (HT29), human bone osteosarcoma (U2OS), a human T-cell acute lymphoblastic leukemia (Jurkat 6) and acute myeloid leukemia (MV-4-11) cell lines were purchased from American Type Culture Collection . Two additional human cell lines, a B-cell acute lymphoblastic leukemia (REH) and an acute myeloid leukemia (KG-1) model were obtained from Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Germany) and the human ovarian cancer cell line (IGROV1) has been kindly provided by Istituto Nazionale Tumori . Cells were cultured in RPMI 1640 medium , supplemented with 10% heat-inactivated fetal bovine serum  or fetal calf serum , 100 U/mL penicillin, 100 \u03bcg/mL streptomycin  and 2mM 50 was determined from the dose-response curve by using Graph Pad software v.6.0.To evaluate the compounds activity, the cells were treated for 24 h with vehicle  or with the test samples at concentrations between 0.01 \u00b5M and 250 \u00b5M. Cell growth was assessed by the luminescence-based RealTime-Glo MT Cell Viability Assay  or the colorimetric 3--2,5-diphenyltetrazolium bromide assay . RealTime-Glo MT Cell Viability Assay was performed according to manufacturer instructions and luminescence was quantified by using GloMax 96 Microplate Luminometer . As for MTT assays, the culture medium was removed and cells incubated with 0.1 mL of MTT dissolved in PBS at the concentration of 0.2 mg/mL following Micheletti et.al. . The abs4 and 5 bearing one and two tryptamine groups, respectively, were prepared by reaction of 1-(2-(1H-indol-3-yl)ethyl)urea with chloral hydrate. Reaction of 2-aminopyrimidine with chloral hydrate gave compound 7 that, after treatment with thionyl chloride and subsequent nucleophilic attack by tryptamine, produced compound 9. The combination of tryptamine and azelaoyl scaffolds under Schotten-Baumann like conditions produced structural hybrids compounds 13 and 14, a methyl ester and its free acid form, respectively, whose structures recall those of compounds behaving as HDAC inhibitors. We synthesized five novel derivatives characterized by the tryptamine nucleus as the common structural motif. This heterocycle was bound to an azelayl chain through an amide bond or to a 1,1,1-trichloroethyl group, in turn connected to another heterocyclic scaffold. In particular, ureido derivatives Additionally, the biological activity of these compounds was investigated on a panel of solid and hematological cancer cell lines and the data reported suggest that their cellular toxicity could be related to different mechanisms involved in different biological targets. 9 shows a marked cytotoxicity on leukemic cell lines tested, with IC50 values comprised from 28.5 \u00b5M for MV-4-11 to 0.570 \u00b5M for Jurkat 6; was inactive only in KG-1. In all solid tumor lines tested it is inactive, except for the U2OS cell line where it induces cytotoxic effect at high concentrations (IC50 = 235 \u00b5M). Compound 5 loses activity in leukemic and solid tumor cell lines, acting only in HT29 at high concentrations (IC50 = 212 \u00b5M). The binuclear compound 4 loses activity in all leukemic lines, while in solid tumors shows a cytotoxic effect only in HT29 (IC50 = 0.0115 \u00b5M) and in U2OS (IC50 = 22.54 \u00b5M). Compound 9) are relevant to the compound effectiveness against acute leukemia models, while showing a modest and selective activity in solid cancers. These data confirm that both the triptaminyl and the pyrimidinyl moieties connected through the trichloroehtyl group , MV-4-11 (IC50 = 102.50 \u00b5M), REH (IC50 = 29.32 \u00b5M) and a selective effect only against HT29 cells (IC50 = 0.006 \u00b5M), among solid tumor models.Compound 14 loses activity on all leukemic lines, while showing a marked cytotoxicity on all solid tumor lines tested, with IC50 values of 0.0072 \u00b5M for A431, 0.096 \u00b5M for HT29, 0.0015 for IGROV1 and 0.469 for U2OS. Compound Studies addressing the clarification and/or identification of additional biological targets as well as the deepen investigation of structure\u2013activity relationships are currently ongoing in our laboratories."}
+{"text": "Timely and effective contact tracing is an essential public health measure for curbing the transmission of COVID-19. App-based contact tracing has the potential to optimize the resources of overstretched public health departments. However, its efficiency is dependent on widespread adoption.This study aimed to investigate the uptake of the Australian Government\u2019s COVIDSafe app among Australians and examine the reasons why some Australians have not downloaded the app.An online national survey, with representative quotas for age and gender, was conducted between May 8 and May 11, 2020. Participants were excluded if they were a health care professional or had been tested for COVID-19.Of the 1802 potential participants contacted, 289 (16.0%) were excluded prior to completing the survey, 13 (0.7%) declined, and 1500 (83.2%) participated in the survey. Of the 1500 survey participants, 37.3% (n=560) had downloaded the COVIDSafe app, 18.7% (n=280) intended to do so, 27.7% (n=416) refused to do so, and 16.3% (n=244) were undecided. Equally proportioned reasons for not downloading the app included privacy  and technical concerns . Other reasons included the belief that social distancing was sufficient and the app was unnecessary , distrust in the government , and other miscellaneous responses  . In addition, knowledge about COVIDSafe varied among participants, as some were confused about its purpose and capabilities.For the COVIDSafe app to be accepted by the public and used correctly, public health messages need to address the concerns of citizens, specifically privacy, data storage, and technical capabilities. Understanding the specific barriers preventing the uptake of contact tracing apps provides the opportunity to design targeted communication strategies aimed at strengthening public health initiatives, such as downloading and correctly using contact tracing apps. COVID-19 is a viral disease caused by a newly discovered strain of coronaviruses. People affected by the disease commonly present with fever, cough, and shortness of breath. This disease can also cause death, with varying rates observed in different countries. In Australia, the first case of COVID-19 was confirmed in late January 2020, with the first wave occurring between March and May, 2020. In the absence of a vaccine, nondrug interventions for preventing COVID-19 and any other future infectious outbreaks are critical [To improve public health contact tracing and the speed at which it occurs, several countries have introduced app-based contact tracing. Contact tracing apps vary in design, from reporting symptoms to public health authorities  to allowApp-based contact tracing requires public cooperation. Individuals are required to install the app, keep Bluetooth functions on, have the app activated or open on their phones, and carry their phones with them when outside of their home. This sounds simple, but when considered from a behavior change perspective, these behaviors are complex and need to be performed together to optimize contact tracing functionality . To idenParticipants were recruited for a national, cross-sectional, online survey by the panel provider, Dynata. The use of a panel provider for online research provides confidence in attaining a representative sample of the required size and allows for quick completion of time-sensitive projects. The panel provider adheres to our quotas for age, gender, and state/territory of residence, ensuring that our sample is representative of the broader population. Through Dynata, participants received points for completing the survey, which may be used for gift vouchers, donations, or cash redemption. Our sample was representative of all Australian states and territories and met our quotas for age and gender. Participants were included in our study if aged \u226518 years. Participants were excluded if they had, or thought they had, COVID-19. They were also excluded if they were health care professionals, as this group may have systematic differences in knowledge of COVID-19 compared to the general Australian population.Prior to screening, potential participants read detailed study information, including eligibility criteria, what the study involved, and privacy and confidentiality rights. Participants were informed that commencing the survey indicated their informed consent to participate in this study. Ethics approval was obtained from the Bond University Human Research Ethics Committee (#RT03008).All participants were asked whether they had downloaded, or intended to download, the COVIDSafe app. If they responded \u201cunsure\u201d or \u201cno intention to download,\u201d they were asked to provide a reason for their response. We qualitatively coded the reasons for inaction and uncertainty and conducted a thematic content analysis of open-ended responses. Uninformative responses, such as \u201cnot sure,\u201d were not coded. If multiple concerns were mentioned, only the first response was coded. The code frame was initially developed by RT, and then discussed and refined by the other authors. Afterward, 1 author (RT) completed the qualitative analysis of all responses. Participants then rated their strength of agreement for 6 statements related to the app\u2019s purpose and capabilities using a 5-point Likert scale . The survey items and response scale are available in Of the 1802 potential participants contacted, 289 (16.0%) were screened as ineligible prior to completing the survey and were excluded, 13 (0.7%) declined, and 1500 (83.2%) participated in the survey. There was representation across all adult age groups and sexes , and education levels were distributed evenly  .Of the 1500 survey participants, 37.3% (560/1500) said they downloaded the COVIDSafe app, 18.7% (280/1500) had intended to, 27.7% (416/1500) refused, and 16.3% (244/1500) were undecided. Of the 660 who refused or were undecided, 25.0% (n=165) cited privacy concerns as their primary reason. For example, many distrusted the security of the app; some participants believed that the COVIDSafe app was not safe and that it could be hacked, resulting in their information being used without their authority. Another 24.1% (159/660) cited technical problems, such as phones being too old or limitations in data consumption and storage space. Other reasons for being undecided or refusing to download the app included the belief that social distancing was sufficient and the app was unnecessary, distrust in the government, questioning the app\u2019s effectiveness, wanting to explore more information before deciding, and other miscellaneous responses, such as apathy and following the decisions of others .With respect to the app\u2019s intended purpose and capabilities, almost 75% of participants correctly agreed that the app would make contact tracing faster and easier , and almost 72% correctly agreed that more people who were potentially exposed to COVID-19 would be found and informed  . In contIn Timely and effective contact tracing is an essential public health measure for curbing the transmission of COVID-19. Contact tracing apps are controversial in their design and level of effectiveness ,5,6, butIn total, 37.3% (560/1500) of our sample said they had downloaded the app and 18.7% (280/1500) intended to. This proportion is concordant with another Australian survey with a smaller online sample (N=439), in which 44.0% of participants reported downloading the COVIDSafe app . HoweverWith regard to open-ended text responses, 25% of participants in our study who did not download the COVIDSafe app were concerned about privacy. This is lower than the 31% in the smaller Australian study  and the Our study also reveals that there are missed communication opportunities for correcting erroneous beliefs about the capabilities of the COVIDSafe app. Over half of our participants  thought the COVIDSafe app would or might tell them when it was safe to leave the house, and 40.5% (607/1500) thought it would or might tell them whether they had COVID-19 . AddressBased on reviewer feedback and the fact that older adults are disproportionally affected by COVID-19, we performed a posthoc analysis to descriptively examine the uptake of the app by age. App downloads appeared to increase with age, with the 65-74-year and \u226575-year age groups having the highest proportion of downloads, and this trend may reflect older adults\u2019 vulnerability to COVID-19. However, when the number of people who downloaded or intended to download the app were combined, the differences between age groups were much smaller. Almost one-third  of participants, regardless of age, chose not to download the app.To our knowledge, this study is the first to qualitatively analyze open-ended text responses to barriers for downloading a contact tracing app. Compared to having participants select a response from a list of predefined options, our approach decreases potential researcher biases and strengthens the ability to inform communication techniques for improving app uptake. To further minimize bias, we deliberately recruited a sample with representation from all Australian states and territories and quotas for age and gender. We believe this strategy improved the generalizability of our findings to the broader Australian population. However, we did not assess cultural and linguistic diversity. Therefore, the generalizability of our findings is limited to Australians, and our results may not reflect the perceptions of individuals whose primary language is not English.Although the level of effectiveness of contact tracing is still unclear ,6, apps"}
+{"text": "SQSTM1 gene have been recently identified as a rare cause of progressive childhood neurodegenerative disorder. So far, only 25 patients from 10 unrelated families were reported.Mutations in SQSTM1 gene (GenBank: NM_003900.4).We report on the first Tunisian case of an 11\u2010year\u2010old girl with cerebellar ataxia, chorea and ophthalmoparesis. Brain MRI was normal. Whole\u2010exome sequencing revealed a homozygous mutation c.823_824del(p.Ser275Phefs*17) in By pooling our data to the data of literature, we delineated the phenotypic spectrum and stressed on genetic heterogeneity of this rare neurodegenerative disease. SQSTM1 gene have been recently identified as a rare cause of progressive childhood neurodegenerative disorder. We report on the first Tunisian case of an 11\u2010year\u2010old girl with cerebellar ataxia, chorea and ophthalmoparesis. Mutations in  Brain and spine MRI were normal. Laboratory tests, including hemogram, creatine kinase, IgA, and thyroid function tests were unremarkable. Electromyography and muscle biopsy were normal.A written informed consent was obtained from the parents and whole\u2010exome sequencing was performed using a SureSelect Human All Exon 38\u00a0Mb enrichment kit. Co\u2010segregation analysis revealed homozygous frameshift variant c.823_824del(p.Ser275Phefs*17) in SQSTM1 (GenBank: NM_003900.4) as the likely candidate and confirmed that the mutation was inherited from heterozygous carrier parents. No other mutations were detected. The analysis of the gene dosage using exome depth did not indicate any copy\u2010number variation. Our patient has been treated with coenzyme Q10 (100\u00a0mg daily), L\u2010carnitine (1\u00a0g daily), vitamin E (200\u00a0mg twice daily), vitamin C (500\u00a0mg per day), and Piracetam (600\u00a0mg twice daily). She also underwent occupational and speech therapies.3SQSTM1. Sequestosome 1 (SQSTM1), encoding for p62 protein, is an adaptor protein involved in a variety of key cellular processes including oxidative stress response, apoptosis, and cell differentiation . Dystonia and chorea were noted in 15 and five cases, respectively. Dysautonomic features such excessive sweating and orthostatic hypotension with additional features like iridoplegia and anisocoria were reported by Zuniga\u2010Ramirez et al (two patients) , two are insertions (c.875_876insT and c.712_713insTCCTCCGAGTGTGAATTTCCTGA), four are substitutions  , amyotrophic lateral sclerosis (ALS), and frontotemporal dementia (FTLD). Furthermore, causal relationships have been found between mutations of SQSTM1 and the occurrence of these diseases\u00a0(Le Ber et al., In contrast to PDB\u2010associated SQSTM1 mutations predominantly affecting the Ubiquitin\u2010Associated domain, the coding mutations in ALS/FTLD patients are widespread, affecting the regions essential for p62's functions such as the promoter regions (Rubino et al., 4SQSTM1 mutation is a rare cause of neurodegenerative disease characterized by progressive ataxia movement disorders and gaze palsy. Through our study, we highlight the importance of whole\u2010exome sequencing in the diagnosis of rare neurodegenerative disorders. Description of further cases, will allow to better understand the disease and to develop therapeutic trials.The authors declare no conflict of interest.All authors contributed equally to this work."}
+{"text": "Purpose To investigate the potential factors associated with the prevalence of meniscal repairMethods Patients who received partial meniscectomy or meniscal repair in our institution from Jan 2015 to Dec 2019 were included in current study. The inclusion criteria were (1) meniscus tear treated using meniscectomy or repair, (2) with or without concomitant anterior cruciate ligament reconstruction, (3) not multiligamentous injury. Demographic data, including sex, age, body mass index (BMI), injury-to-surgery interval and intra-articular factors such as the location of injury, medial or lateral, ACL rupture or not and the option of procedure  were documented from medical records. Univariate analysis consisted of chi-square. Multivariate logistic regression was then performed to adjust for confounding factors.p = 0.002), patients aged 40 years or younger (p < 0.001), increased weight (p = 0.010), Posterior meniscus torn (0.011), concurrent ACL ruputure (p < 0.001), lateral meniscus (p = 0.039) and early surgery (p < 0.001) were all associated with the prevalence of meniscal repair. However, After adjusting for confounding factors, we found that age , ACL injury , side of menisci , site of tear , and duration of injury  were associated with the prevalence of meniscus repair.Results 592 patients including 399 males and 193 females with a mean age of 28.7 years (range from 10 to 75 years) were included in current study. In the univariate analysis, male (Conclusions Meniscal tear in aged patients especially those with concomitant ACL injury is likely to be repaired. Additionally, in order to increase the prevalence of repair and slow down progression of OA, the surgical procedure should be performed within two weeks after meniscus tear especially when the tear is located at lateral meniscal posterior.Case-control study; level of evidence, 3. Meniscus is a vital intra-articular structure to maintain knee stability and to slow down the progression to osteoarthritis (OA) , 2. It aThe surgeon would determine whether to repair the injuried meniscus for patients based on the following two criterions: the location of meniscal tear and the severity of meniscal injury. If the meniscal tear located in red-red zone or the remaining meniscal tissue is adequate, the repair procedure may be performed . However2,24-27 Kg/m2,and \u226527 Kg/m2 ),.Institutional review board approval was waived as no patients\u2019 private information was involved. 592 patients who received partial meniscectomy or repair in our institution from Jan 2015 to Dec 2019 by three high experienced surgeons were included in current study. The inclusion criteria were (1) meniscus tear treated using meniscectomy or repair, (2) with or without concomitant anterior cruciate ligament reconstruction, (3) not multiligamentous injury. Demographic data, including sex, age, body mass index (BMI), injury-to-surgery interval and intra-articular factors such as the location of injury, medial or lateral, ACL rupture or not and the option of procedure  were documented from medical records. Age was divided into older group (>40) and younger group (\u226440), the duration from injury to surgery was defined as delayed group (>2weeks) and early group (\u22642weeks), BMI was divided into three groups  and intraoperative findings. Surgical procedure were performed by three experienced surgeons  and the procedure was uniform. Anterolateral and anteromedial knee portals were utilized for all patients. Under arthroscopy, the meniscus tear patterns, the site and the potential vascularity were directly seen by the surgeons. Then the surgeon would determine a suitable procedure for each patient based on the following standards: (1) the location of meniscal tear; (2) the severity of meniscal injury. Meniscal repair was implemented through all-inside technique using meniscal repair device  for all patients with meniscal posterior, body or anterior tear. According to the length of tear, one to seven sutures were needed. When repair was not viable, injuried meniscus will be trimmed until a stable peripheral rim was achieved. In the case of a concurrent ACL injury, the ACL reconstruction will be performed firstly by using peroneal longus tendon as graft.Statistical analyses were achieved by using the SPSS, version 23.0 . To assess association between demographic data and the prevalence of partial meniscectomy procedure, chi-squared test were used. In the multivariate analysis, binary regression were used to identify the independent variables for meniscal partial meniscectomy. A p value less than 0.05 were considered statistical significant.From Jan 2015 to Nov 2019, 592 patients including 399 males and 193 females with a mean age of 28.7 years (range from 10 to 75 years) were included in current study. Of these patients, 368 patients underwent concomitant ACL reconstruction, 224 patients underwent isolated meniscal surgery. Partial meniscectomy was performed on 346 patients, the remaining 246 patients received meniscus repair operation , younger than 40 years (p < 0.001), increasing of body weight (p = 0.010), Posterior meniscus torn and multiple site torn injury (p = 0.011), with concurrent ACL ruputure (p < 0.001), performing surgery within two weeks after injury (p < 0.001), and lateral or both sides injury (p = 0.039). Detailed data are displayed in Table In the univariate analysis, seven variables were found to be associated with the prevalence of meniscus repair. male patients , ACL injury , side of menisci , site of tear , and duration of injury  were associated with the prevalence of meniscus repair , lateral meniscus tear, posterior horn tear and accompanying with ACL injury were associated with the prevalence of meniscal repair surgery.The clinical outcomes between partial meniscectomy and meniscal repair has been hotly debated in recent years. In a study performed by Kyu et al , they obThe influence of age on the clinical outcomes after arthroscopic meniscal repair have been widely reported in previous literature. Mike et al  found thIn our study, 472/512 (84.5%) traumatic meniscus tear were accompanyed by a concurrent ACL rupture which was similar to other articles\u2019 results . We founThe association between BMI and the clinical outcomes of meniscal repair had been widely studied in previous literature. In a meta-analysis , the autNonoperative treatment was commonly recommended to patients with degenerative meniscal injury. Partial meniscectomy or meniscus repair will be suggested when meniscal symptoms, including pain and knee locking cannot be relieved after a two-week conservative treatment in our institution. Haroon et al  found thAs we all know, meniscus are classified as three zone, that is the white-white zone, white-red zone and red-red zone according to the vascularity . TheoretNo consensus being reached on whether the side of repair have differential influence on the clinical outcomes and the failure rate . Some stDespite many factors had been studied and shown to be associated with the high failure rate of maniscal repair or partial meniscectomy, whether they can affect surgeons\u2019 decision on treatment options and which will affect have not yet been evaluated. In current study, we found that aged patients especially those with concomitant ACL injury were more likely to receive maniscal repair. Additionally, in order to increase the prevalence of repair and slow down progression of OA, the surgical procedure should be performed within two weeks after meniscus tear. Lateral meniscal posterior horn injury have a higher opportunity for meniscus repair.However, our study have some limitations. Firstly, tear zone of meniscus should be an important predictive factor for treatment options, but we failed to assess it because of data loss. More study is needed, in the future, to investigate whether meniscal tear within the red-red zone is more likely to be repaired compared with those within white-white zone. Secondly, the data in this study were collected from a single medical center in China. Thus,more studies are needed in the future to investigate the relationship between patient-related factors and the prevalence of meniscal repair. Finally, option bias may exists because three different high experienced surgeons performed all arthroscopic meniscal operation, however, we believed this can reflect the realistic clinical issue.Patients should be informed that their meniscus are more likely to be repaired if they are young and operation is performed within 2 weeks after injury, and the meniscus tear is located at lateral meniscal posterior horn especially with concomitant ACL injury."}
+{"text": "Background: Widespread endoscopic submucosal dissection (ESD) in early esophageal cancer patients is closely associated with esophageal stricture, which dramatically reduces patients' quality of life and increases huge medical burdens. Endoscopic injection of steroid was proved as a protective method for post-ESD strictures. Other materials such as botulinum toxin type A (BTX-A) may be potential candidates. We conducted this prospective cohort study to compare the efficacy and feasibility of endoscopic injection of BTX-A and triamcinolone acetonide (TA) for the prevention of esophageal stricture.Methods: Seventy-eight patients with esophageal mucosal defects of more than two thirds of the circumference were successively enrolled and divided into 3 groups: BTX-A group , TA group  and control group . Patients in group A were immediately injected with BTX-A after ESD, in group B were immediately injected with TA and in group C received ESD only. Endoscopy was performed when patients reported dysphagia symptoms and at 6 and 12 weeks post-ESD in patients without symptoms. Patients who experienced post-ESD esophageal strictures in all groups received bougie dilation. All patients were followed up for one year.Results: The proportion of patients developing stricture in BTX-A group was 30.00%  and 26.92% , in TA group was 40.90%  and 43.75% , and in control group was 84.21%  and 83.33%  (p<0.001). When further comparing between each of the two groups, the incidence of esophageal stricture was lower in BTX-A group than that in control group (p<0.001), and lower in TA group than that in control group (p=0.004). Furthermore, in entire circumference mucosal defect subgroup, the esophageal stricture was significantly lower in BTX-A group than that in TA group .Conclusions: Endoscopic injection of BTX-A and TA were effective in preventing post-ESD esophageal strictures and BTX-A injection was particularly effective in entire circumference mucosal defect patients. Multi-centered, randomized prospective study with larger sample size should be conducted.  Endoscopic resection is globally accepted as a minimally invasive treatment for early esophageal cancer The incidence of esophageal strictures after endoscopic resection resulting in large near-circumferential or circumferential esophageal mucosal defects has been reported to be 88% to 100% A preliminary aim of this study was to determine the relationship between the extent of the esophageal mucosal defect after ESD and the risk of stricture formation. Specifically, we determined the risk of strictures in ESD patients with mucosal defects more than one half of the circumference of the esophagus after ESD treatment. Our prospective study's primary aim was to investigate the efficacy and feasibility of the endoscopic injection of BTX-A and TA for the prevention of esophageal strictures after ESD for early esophageal cancer.Originally, 80 patients with early esophageal cancer who underwent ESD at First Affiliated Hospital of Nanjing Medical University from March 2018 to May 2019 were randomly divided into BTX-A group (group A), TA group (group B) and control group (group C). The inclusion criteria for the study were as follows: 1) preoperative pathology indicating precancerous lesions or carcinoma in situ, 2) mucosal defects exceeding two thirds of the circumference of the esophagus, 3) the absence of lymph node metastases confirmed by CT, 4) no contraindications to general intravenous anesthesia, 5) no serious cardiopulmonary disease, 6) the patient's signed informed consent. However, we excluded patients who received additional therapy such as chemotherapy, radiotherapy or additional surgery and those who had non-curative ESD procedures. Patients who diagnosed with invasive esophageal carcinoma or tumor recurrence were also excluded in our study. Patients suffering from other diseases of esophagus such as congenital anatomical structure abnormality, esophageal varices, functional esophageal disease, severe reflux esophagitis were also excluded from the study.Our study has been approved by the Ethics Committee of First Affiliated Hospital of Nanjing Medical University and written informed consent was obtained from each patient. The ethical approval number for this study was 2018-SR-199. .We designed a prospective cohort study. Before ESD procedure, all patients were prospectively divided into three groups. Patients in group A  received endoscopic BTX-A injection immediately after ESD procedure, patients in group B  received TX injection immediately after ESD, and patients in group C  received ESD only without subsequent injection. The mucosal defect after ESD was classified into three groups based on the extent of the areas affected: two thirds to three fourths of the esophageal circumference, three fourths to the full esophageal circumference and full circumferential mucosal defect. In either group A, B or C, all patients with full circumferential mucosal defects received oral prednisolone after ESD.Endoscopic procedures were carried out with an upper endoscope with an outer diameter of 9.9 mm . The electrosurgical unit and knife for ESD consisted of a high frequency generator , the HookKnife and the DualKnife (Olympus Co.). Submucosal dissection was carried out with the autocut mode  to decrease the burning effect on the resected surface, which could reportedly cause severe stenosis after extensive esophageal ESD. The coagulation mode was used only to stop bleeding and for preventive vascular coagulation.Just after dissection and hemostasis, a single-session endoscopic BTX-A or TA injection was administered. BTX-A solution  was injected in 5-mL increments into 10 separate points at the level of the muscularis propria equally spaced along the circumference of the defect with a 25-gauge, 4-mm needle . TA was diluted with 0.9% NaCl to a final concentration of 4mg/ml. A total of 40 mg (10ml) TA was injected into the deep submucosa of the ulcer base at 10 sites, with a 1 mL dose at each site. A total of 100 units of BTX-A was diluted with 5 mL of saline solution (20 units/mL). Where BTX-A or TA, the injections were placed along the junction of the defect and the normal tissue. However, patients with full circumferential mucosal defects were injected superficially into the base of the cautery ulcer. All patients received the same dose of BTX-A (100 units) and TA (40mg), regardless of the lesion size.All patients were requested fasting the first day after ESD, and liquid diets for the next several days. Proton pump inhibitor, antibiotic, and hemostatic were routinely used to promote rehabilitation. The occurrence of perforation, hemorrhage, fever, chest pain, allergy and other adverse events are paid closely attention. In our study, 6 patients had small amount of bleeding during the ESD procedure and all resolved by endoscopic hemostasis with hot forceps. No delay bleeding was occurred in these patients. 24 patients had muscular injury during the ESD procedure, which means myometrial exposure of the wound. The wounds were clipped by titanium clips and no patients were suffered with perforation. Patients with entire circumferential ESD were administered a systemic steroid. Oral prednisolone was started at a dose of 30 mg/day on the second day post-ESD, tapered gradually  and then discontinued 16 weeks (112 days) later. Follow-up endoscopy was scheduled at 6 and 12 weeks after ESD, and telephone follow-up was conducted every week post-ESD for dysphagia and Quality of Life Questionnaire (EORTC QLQ-OES18) scores. Dysphagia was evaluated using the Mellow-Pinkas score as follows: 0=no dysphagia, 1=dysphagia to normal solids, 2=dysphagia to soft solids, 3= dysphagia to solids and liquids, and 4=complete dysphagia, even to saliva. Bougie dilation using Savary-Gilliard dilators  was applied as needed whenever the patients complained of dysphagia. In cases of persistent dysphagia, bougie dilation was performed until dysphagia resolved.Esophageal stricture is defined as a symptomatic dysphagia and/or impossible passage of a standard endoscope at the stricture. Through endoscopy and telephone follow-up, we recorded the number of patients with stricture in each group, and the number of required dilatation procedures for treatment of a stricture, the dysphagia grading score, the Quality of Life Questionnaire (EORTC QLQ-OES18) score, the asymptomatic remission period, the diameter of a narrow esophagus, and the time of first stenosis occurred. During the asymptomatic remission period, patients had a dysphagia score larger than 2, and did not need endoscopic dilatation. The primary endpoint of our study was the stricture rate after ESD with or without BTX-A/TA injection. Secondary endpoints were the number of dilatation procedures, the dysphagia and Quality of Life Questionnaire (EORTC QLQ-OES18) scores, the asymptomatic remission period, the diameter of a narrow esophagus, and the time of first stenosis occurred. Since this study was a prospective cohort study, we defined TA and BTX-A injection as different exposure factors, and the endpoints we mentioned above were the indicators we compared.PASS 15 (Version: 15.0.13) was used for determining sample size in this study. Section of Proportions in PASS for Chi-Square (Contingency Table/Crosstabs) Tests was applied for sample calculation. Based on the 3*2 Contingency Table, Degrees of Freedom was 2 with a power of 0.90, Alpha of 0.05, and W (Effect Size) of 0.432049 . We calculated a sample size of at least 68 patients required for statistical analysis. Based on this, we finally enrolled 90 patients when considering an approximately 20% drop-up rate.Normality tests were applied by Shapiro-Wilk and Kolmogorov-Smirnov test. To compare the means from three groups, One-Way ANOVA was applied in continuous variables with normal distribution and Kruskal-Wall H-test for those with the abnormal distribution. Chi-Square Test or Fisher's Exact Test were used for in dichotomous variables (3\u00d72 Contingency Tables) to compare treatment effects among three groups. Pairwise comparisons were conducted in Contingency Tables using an adjusted \u03b1 level after Bonferroni correction method. Logistic regression was performed to identify any significant risk factors of esophageal stricture. Statistical analysis was performed with IBM SPSS Statistics for Windows, Version 23.0 . P values < 0.05 were considered statistically significant in general comparisons among three groups. For pairwise comparisons, P values < 0.0167 (0.05/3) were considered statistically significant after Bonferroni correction test.Ninety patients who fulfilled the inclusion and exclusion criteria with an esophageal defect greater than two thirds of the circumference were enrolled in this study, of whom 30 received BTX-A injection immediately after ESD procedure, 20 received TA injection immediately after ESD procedure and 40 only received ESD. Seven patients were excluded from the study because they received additional treatments such as additional ESD (N=3), surgery (N=3) and radiation therapy for the non-curative resection based on the postoperative pathologic diagnosis N=1). Two patients died of non-digestive diseases and three patients had intraoperative perforation and were also excluded from our study ) (Table As shown in Table )) Table .Subgroup analysis according to the extent of the defect after ESD was further conducted to compare the esophageal stricture rates among the three groups Table . No patiAfter ESD procedures, patients in group A required an average of 1.19 bougie dilations , patients in group B required an average of 1.31 bougie dilations , whereas patients in group C required an average of 3.14 bougie dilations  (p=0.019). The mean Quality of Life Questionnaire (EORTC QLQ-OES18) score in group A was 24.15\u00b12.19, in group B was 24.88\u00b12.13 and in group C was 23.47\u00b11.1 (p=0.029). The grading of dysphagia was 0.5 (0-3), 1.5 (0-3) and 2 (0-4) in group A, B and C, respectively (p=0.009). As shown in Table Logistic regression analysis was conducted. The following factors of sex, age, smoking and drinking history, family history of esophageal tumor, location of lesion, longitudinal resection length, post-operation pathology and oral prednisolone were not relevant to the development of postoperative esophageal strictures. However, circumferential range , BTX-A injection , TA injection  and depth of infiltration  were shown to be risk factors for the formation of esophageal strictures after ESD. As shown in Table As the increasing numbers of ESD procedures performed, treatment of esophageal stricture is of great clinical importance to improve the quality of patients' life and decrease the burden of society Steroids are commonly used for autoimmune and inflammatory diseases in the clinics It has been reported that the local application of BTX-A inhibited collagen deposition and fibrous connective tissue formation during the injury repair process in the skin, urethra, and joints In this study, BTX-A was injected at the level of the muscularis propria, whereas TA was injected at the base of the artificial ulcer and must be injected into the submucosal layer. A potential problem with endoscopic TA injection is the risk of delayed perforation, which may occur if the steroid is injected into the true muscular layer There were several limitations of this study. First, the sample size of the study was small, and future randomized, double-blinded studies with larger sample sizes are needed. Second, the study was a single-center analysis and possible bias could not be eliminated.Endoscopic injection of BTX-A and TA was effective and safety in preventing post-ESD esophageal strictures and can decrease the times of bougie dilation. Particularly, BTX-A injection was more effective in patients with entire circumference mucosal defect, which is of great clinical importance to esophageal stricture patients after ESD procedures.Supplementary figures.Click here for additional data file."}
+{"text": "Development of lymphoproliferative disorders (LPDs) is one of the well-known life-threatening complications in rheumatoid arthritis (RA) patients. However, there is a lack of definitive conclusions regarding the role of Epstein-Barr virus (EBV) activity in RA initiation and progression, especially in promoting LPDs. A systematic review and meta-analysis of studies that reported an EBV positive result in RA-LPD patients and controls were conducted. Studies published before 27 July 2021 were identified through PubMed, Web of Science, and SCOPUS. A total of 79 articles were included in the systematic review. The prevalence of EBV positive result among RA-LPD patients was 54% . There was a statistically significant association between EBV presence and LPD susceptibility in RA patients in comparison with all controls  and in comparison with LPD patients only . This association was not shown in comparison with patients with autoimmune diseases other than RA who developed LPD . This meta-analysis confirmed a high prevalence of EBV in the RA-LPD population. Furthermore, it provides evidence for the association between EBV presence and LPD susceptibility in RA patients, but not in those with other autoimmune diseases who developed LPD. Rheumatoid arthritis (RA) is a polygenic, multifactorial, and chronic inflammatory systemic autoimmune disease that affects up to 1% of the world\u2019s population . The incHere, it is clear that the hyperimmune state of RA itself and/or the immunosuppressive state induced by the administration of therapy might contribute to the evolution of LPDs. Pro-inflammatory cytokines, such as tumor necrosis factor alpha (TNF-\u03b1) and interleukin-6 (IL-6), have an essential role in RA pathogenesis ,8.Epstein-Barr virus (EBV) infection is an important factor for LPDs development in RA patients . In partFinally, the link between an infectious agent and the triggering of the autoimmune process has long been discussed. However, the current knowledge does not fully explain, not only the risk that the EBV infection carries for the development of LPDs in rheumatological patients, but also the role of this virus in the development of RA itself. Actually, it remains unclear whether the role of EBV is primarily in initiation of rheumatoid arthritis or in disease progression due to the chronic relapsing-remitting nature of EBV infection .Understanding the influence of EBV infection in RA pathogenesis as an isolated causative agent or an accomplice in therapeutic risk is turning to be increasingly relevant. Considering the differences in design and patient population in previous studies, there is the lack of clear interpretation of obtained results and definitive conclusions regarding the association between EBV activity and RA complications, especially its contribution to LPD development. The aim of this systematic review and meta-analysis was to explore this problem.This systematic review was performed in accordance with the PRISMA protocol  and MOOSE guidelines for observational studies ,16.Publications were screened for inclusion in the systematic review in two phases. In addition, all of the disagreements were resolved by discussion at each stage with an inclusion of a third reviewer. Here, we included studies of all types of study design that detected the EBV virus in RA-LPD patients and any other group for comparison. Studies were eligible for inclusion if the EBV virus was detected in both groups. Studies were excluded if they: (i) Investigated other viruses;(ii) did not evaluate the presence of EBV in both groups: RA-LPD and control group; (iii) examined other populations ; (iv) did not assess the presence of EBV, but its function; (v) were abstracts or (vi) were not original articles.Two biostatisticians with expertise in conducting systematic reviews and meta-analyses  developed the search strategy. A systematic review of peer-reviewed publications was performed through searches of three electronic databases: PubMed, Web of Science (WoS), and SCOPUS until 27 July 2021. Search queries and keywords for the PubMed search were: (Rheumatoid arthritis) and (lymphoproliferative disorder* or lymphoma or \u201cEBV-Associated Lymphoproliferative Disorder*\u201d or \u201cMethotrexate-associated Lymphoproliferative Disorder*\u201d or \u201cMethotrexate-related Lymphoproliferative disorder*\u201d or LPD or MTX-LPD or \u201cIatrogenic lymphoproliferative disorder*\u201d or \u201cIatrogenic immunodeficiency-associated lymphoproliferative disorder*\u201d or \u201cHodgkin-like lesion\u201d or \u201creactive lymphoid hyperplasia\u201d or \u201cpolymorphic-Lymphoproliferative disorder*\u201d or PLD or \u201creactive lymphadenitis\u201d or \u201cPlasma cell myeloma\u201d) and ; for WoS: ALL = (Rheumatoid arthritis)AND ALL = (lymphoproliferative disorder* or lymphoma or \u201cEBV-Associated Lymphoproliferative Disorder*\u201d or \u201cMethotrexate-associated Lymphoproliferative Disorder*\u201d or \u201cMethotrexate-related Lymphoproliferative disorder*\u201d or LPD or MTX-LPD or \u201cIatrogenic lymphoproliferative disorder*\u201d or \u201cIatrogenic immunodeficiency-associated lymphoproliferative disorder*\u201d or \u201cHodgkin-like lesion\u201d or \u201creactive lymphoid hyperplasia\u201d or \u201cpolymorphic-Lymphoproliferative disorder*\u201d or PLD or \u201creactive lymphadenitis\u201d or \u201cPlasma cell myeloma\u201d) AND ALL = , and for SCOPUS: TITLE-ABS-KEY (\u201crheumatoid arthritis\u201d) AND,TITLE-ABS-KEY (\u201clymphoproliferative disorder*\u201dOR \u201clymphoma\u201d OR \u201cEBV-Associated Lymphoproliferative Disorder*\u201d OR \u201cMethotrexate-associated Lymphoproliferative Disorder*\u201d OR \u201cMethotrexate-related Lymphoproliferative disorder*\u201d OR \u201cLPD\u201d OR \u201cMTX-LPD\u201d OR \u201cIatrogenic lymphoproliferative disorder*\u201d OR \u201cIatrogenic immunodeficiency-associated lymphoproliferative disorder*\u201d OR \u201cHodgkin-like lesion\u201d OR \u201creactive lymphoid hyperplasia\u201d OR \u201cpolymorphic-Lymphoproliferative disorder*\u201d OR \u201creactive lymphadenitis\u201d OR \u201cPlasma cell myeloma\u201d) AND TITLE-ABS-KEY . Only publications in English were taken into account. In addition, reference lists of articles identified through electronic retrieval were manually searched, as well as relevant reviews and editorials. Experts in the field were contacted to identify other potentially relevant articles. Authors of relevant articles were contacted to obtain the missing data.In the first step, two reviewers  independently evaluated the eligibility of all of the titles and abstracts. Studies were included in the full text screening if either reviewer identified the study as potentially eligible or if the abstract and title did not include sufficient information for exclusion. Studies were eligible for full text screening if they included the detection of EBV virus in RA-LPD patients and control groups. According to the previously defined Inclusion and Exclusion criteria, in the second step, the same reviewers independently performed a full text screening to select articles for qualitative synthesis. Disagreements were resolved by consensus  or arbitration .https://osf.io/hb938/ (accessed on 5 December 2022).Two reviewers independently abstracted the following data: Author(s), country of research, year of publication, study design, study population, RA disease activity, specific type of LPD according to the WHO classification, LPD stage, age, gender, sample size, specimen for EBV detection, EBV positivity/negativity in cases and controls, method for EBV detection, and EBV latency. Each reviewer independently evaluated the quality of the selected manuscripts using an adapted version of the Newcastle-Ottawa tool for observational studies . RevieweThe primary outcome was the frequency of EBV positive patients in RA-LPD patients. As the outcome is dichotomous and the sample size varies, Mantel-Haenszel method was used as a measure of effect size to examine the differences in the ratio of EBV in the evaluated study groups from all of the primary articles. Mantel-Haenszel method is a fixed-effect meta-analysis method that uses a different weighing scheme that depends on which effect measure is used. Heterogeneity was assessed using the Chi-square Q test and I2 statistic. I2 presents the inconsistency between the study results and quantifies the proportion of observed dispersion that is real, i.e., due to between-study differences and not due to random error. The categorization of heterogeneity was based on the Cochrane Handbook  and statp* (1-p)/n), where n is the total number of respondents from the study.The meta-analysis of the prevalence was performed in order to estimate the prevalence of EBV positivity in the RA-LPD study group. The inverse variance method was applied. Data that were entered for each of the studies were the original prevalence from the study and the standard error of the prevalence according to the equation SQRT  removed, the title and abstracts were evaluated for 804 articles. A total of 705 articles were excluded since they were not original articles, did not explore EBV, examined populations other than humans , did not evaluate RA-LPD patients or were in foreign languages. Of the 99 reviewed full text articles, 79 were selected for inclusion in the systematic review. A flow diagram illustrating this selection process is presented in A total of 1294 potentially eligible articles were found. After the duplicates   .p = 0.001) (p = 0.010) (p = 0.630)  . As the = 0.010) . On the = 0.630) .p < 0.001), followed by North America, 39% , whereas the lowest prevalence was seen in Europe, 22%  (p < 0.001), but not in North America  . The highest prevalence was in Asia, 65%  . Moreove= 0.730) .This study provided the first systematic review with a meta-analysis that confirmed a high prevalence of EBV in the RA-LPD population (54%). Additionally, this meta-analysis has shown the association between a positive EBV result and LPD susceptibility in RA patients when compared with all of the controls or when compared with the LPD controls separately, but did not show this association when compared with controls defined as patients with autoimmune diseases other than RA who developed LPD.In the first place, the etiology of LPD includes a still insufficiently defined genetic predisposition, particularly the role of the human leukocyte antigen (HLA). Although, for example, Genomewide association studies (GWAS) have demonstrated a link between HLA class II and Hodgkin\u2019s lymphoma, it was suggested that EBV-positive and EBV-negative Hodgkin\u2019s lymphoma have a different genetic susceptibility. HLA class I alleles are associated with EBV-positive, and HLA class II alleles with EBV-negative Hodgkin\u2019s lymphoma . In addiDuring the life-long persistence in memory B cells, EBV remains largely limited in its activity and replication capacity. This unique property of its viral life cycle is based on the ability to express a different set of latent genes in three latency programs: Six genes of EBV nuclear proteins , three genes of latent membrane proteins , and two non-coding RNAs . Each of the programs could lead to cell transformation and the development of specific malignancies. Moreover, EBV-associated diseases, and consequently each EBV-positive malignancy is clearly defined by the set of expressed genes that characterize one of three latency programs: Burkitt\u2018s lymphoma has a type I latency pattern ; Hodgkin lymphoma and a variety of non-Hodgkin lymphomas have a type II pattern ; and post-transplant lymphoproliferative disorders (PTLD) that develop in an immunocompromised host most often have the type III latency pattern  . This laAccording to the studies included in this analysis, it is observed that there is a lack of common criteria for determining the EBV presence or a positive result in clinical specimens used in the mentioned studies. Immunohistochemistry and in situ hybridization were the most commonly used methods for the detection of EBER or LMP1. However, limitations for interpreting and understanding the viral replication capacity are based on a wide range of cut-offs of some of the methods used, using different methods even within the same studies, and finally, the use of indirect serology testing, such as ELISA .Among the risk factors for LPD in RA patients that are listed as possible triggers during the EBV infection are: the association between the infection and gene promoter methylation . ActuallA considerable number of publications showed individual cases of LPD development in RA patients. As many as 172 case reports were found from this systematic review. Although these cases could not be processed by the meta-analysis, they undoubtedly indicate the association between EBV presence and LPD susceptibility in RA patients with a higher prevalence of EBV positive results in RA-LPD cases than in the systematic review (72% vs. 54%). An almost identical percentage of patients from the case reports received MTX alone or in combination with other anti-rheumatic drugs compared withthe patients included in the meta-analysis.A geographic variation of an EBV prevalence in patients with different EBV-associated disorders has been well documented in previous studies . The geoA significant result of this study that should also be pointed out is the absence of the association between a positive EBV result and LPD susceptibility in RA patients when compared with controls, which is defined as patients with autoimmune diseases other than RA who developed LPD. These data support earlier theories regarding the role of EBV infection in a broad spectrum of autoimmune diseases ,32. Our Our study has several limitations. They originate from the control group variability, a significant number of case reports, huge numbers of different LPD diagnoses within case groups, poor design of original articles, and difficulty to analyze the effect of different factors to the previously assessed effect size. Heterogeneous control groups  may lead to the under/over estimation of the real effect of EBV positive results to the LPD susceptibility in RA patients. A large pool of case reports represents a good descriptive base for further studies. However, 172 case reports screened through our systematic review undoubtedly indicate the association between EBV presence and LPD susceptibility in RA patients. On the contrary, more accurate and valuable results would be obtained from our meta-analysis if these studies could have been used. It is important to highlight the significance of non-homogeneous case groups, as well. The advantage of using a specific LPD diagnosis in RA patients will allow clear conclusions. Although a prospective study design allows a better quality of evidence, most of the studies from this systematic review were of retrospective design. Almost all of the included studies evaluated RA-LPD patients and controls that were treated with MTX, which resulted in homogeneous groups according to this characteristic. This is the reason why it was impossible to evaluate the effect of MTX use to the previously calculated probability of LPD susceptibility in RA-LPD patients and controls through meta-regression.Despite the growth in the number of new therapeutic options that aim to achieve optimal inflammation control and minimize or even prevent the key complications of RA, MTX is still the most commonly used drug for RA-LPDs. In addition, EBV is the most frequently described infectious agent in relation to LPD development in RA patients. Moreover, there are still no distinct features that distinguish MTX-LPDs from other LPDs in RA patients described in the published reports. Guidelines, that are more than necessary for the treatment of RA-LPDs, have not yet been established due to the unknown underlying mechanism of pathogenesis and the baseline risk of malignancies in patients with RA. Therefore, the question of how EBV can be involved in an array of diverse diseases, and how so many, apparently diverse, autoimmune diseases could have a similar risk for the development of LPD, brings up the necessity for a more specific view. For example, earlier literature suggestions, such as the histological categorization or analysis of EBV EBER positivity should be taken into account in the further diagnosis and categorization of LPD patients, i.e., disease course prediction and modulation strategy of existing therapeutic protocols .This systematic review with meta-analysis confirmed a high prevalence of EBV in the RA-LPD population, which points to the role of EBV in the pathogenesis of this complication. However, for the first time, one meta-analysis has shown that there is no association between EBV positivity and LPD susceptibility in RA patients when comparing patients with autoimmune diseases other than RA who developed LPD. This observation shows that EBV plays a distinct role in the pathogenesis of LPDs in RA patients, but also suggests that EBV may contribute to the development of LPDs in other autoimmune diseases."}
+{"text": "The Royal College of Psychiatrists\u2019 Parliamentary Scholar Scheme gives higher trainees in psychiatry the opportunity to spend 1 day a week in the House of Lords working alongside a peer with an interest in health. This article describes the work of the House of Lords and Parliament using examples from the experiences of 2017\u20132018 scholars and outlines ways doctors can get more involved in policy and politics. The Royal College of Psychiatrists set up its Parliamentary Scholar Scheme\u00a0in 2017 with Professor the Baroness Hollins, who is a cross-bench peer in the House of Lords. Professor the Baroness Hollins, a former Consultant Psychiatrist and College President, spends much of her time in the Lords campaigning to improve services for people with learning disabilities, which is one of her specialist areas of interest. The Parliamentary Scholar Scheme, now supported also by the BMA Foundation, gives higher trainees working in psychiatry the opportunity to spend 1 day a week, as a special interest session, in the House of Lords working alongside a peer with an interest in mental health. Peers on the scheme come from across the political spectrum; in the 2017\u20132018 cohort there were peers from the Conservative, Labour and Liberal Democrat parties as well as from the cross-benches.1 The scheme clearly allows participants to develop such skills but it aims to go further \u2013 to enable the trainees to develop skills in influencing the mental health agenda.The scheme gives trainee psychiatrists hands-on experience of working in the field of health policy as well as wider politics. The psychiatric higher trainee curriculum requires the development of \u2018effective leadership skills\u2019 and \u2018an understanding of organisational policy and practice at a national and local level in the wider health and social care economy\u2019.2 and the Darzi fellowship scheme.3 However, as far as we are aware, the Parliamentary Scholar Scheme is the first programme to give trainees experience of working in the House of Lords. Given the current recruitment and retention problems within the mental health workforce,4 this scheme is certainly something that makes psychiatry training stand out from other specialties and may help encourage more doctors into the profession.There are other schemes available to support trainees to develop leadership skills, for example the National Medical Directors Fellowship SchemeThis article aims to guide readers through the work of Parliament, mainly focusing on the House of Lords, using examples from our experiences as 2017\u20132018 scholars.The UK Parliament is made up of the House of Commons, House of Lords and the monarch. Members of the House of Lords, known as peers, are appointed by the Queen (the monarch) on the advice of the Prime Minister and are unelected. The House of Lords has three main roles: making laws, debating public policy and holding government to account. Members of Parliament (MPs) have the power to overrule the Lords, but the Lords can still be very influential in terms of making/changing legislation and policy.5 Peers are nominated either by their political parties or by the House of Lords Appointments Commission, which recommends people for appointment as non party-political life peers.6Peers are often experts with experience from outside of Parliament, for example, the peers we worked with had experience of working in psychiatry, nursing, surgery, trade unions and the civil service. Most are \u2018life peers\u2019, although 92 (at the time of writing) sit by virtue of a hereditary title. Life peers are appointed by the monarch on the advice of the Prime Minister to serve for life; the title is not transferable when they die.8 An example of a Bill that was going through Parliament while the 2017\u20132018 scholars were in post was the Mental Health Units (Use of Force) Bill, otherwise known as \u2018Seni's Law\u2019. The Bill was proposed by Steve Reed, MP for Croydon North, following the death of one of his constituents, Seni Lewis, in 2010. Seni died aged 23, after being restrained on a mental health ward by 11 police officers. The Bill started in the Commons, went to the Lords, amendments were considered in both Houses and then it became an Act in 2018. The new legislation means that mental health units will have to take steps, including better training for staff, to reduce the use of force against patients. Robust data on the use of force will be collected and police will have to wear body cameras when called to mental health settings; recordings from these cameras can be used in evidence.10Bills (draft laws) are introduced to Parliament and then repeatedly reviewed, debated and amended by both the Lords and the Commons. There is a process known as \u2018ping-pong\u2019 where the Bill goes back and forth between each House as amendments are made and agreed or rejected. When the Bill is agreed by both Houses it is given Royal Assent and becomes an Act of Parliament.11 and lays out a new legal framework to replace Deprivation of Liberty Safeguards. Some of the 2017\u20132018 scholars were able to research the framework, liaise with experts and organisations with interests in the area, and contribute to topics such as the role of care home managers in overseeing the safeguards and the central importance of a person's wishes and feelings when decisions are made about them. Many peers spoke on this Bill as it passed through the House of Lords and some of the 2017\u20132018 scholars were able to support their peers in drafting speeches using their own experience of working in mental health services and research briefings.Another example is the Mental Capacity (Amendment) Bill, which is now enacted12One peer put down an amendment to the EU Withdrawal Bill when it passed through the House of Lords in 2018. The amendment focused on the mutual recognition of professional qualifications, which is about ensuring that professional qualifications  continue to be recognised in the EU and UK after Brexit. The 2017\u20132018 scholar attached to this peer undertook some research in this area using a briefing from the Parliamentary library and liaising with relevant organisations, such as the British Medical Association (BMA) and legal firms to seek their perspectives. The scholar then used this information to draft a speech for their peer for the debate on the Bill.13 and to debates on wider healthcare system issues such as long-term NHS sustainability and global nursing.15Alongside debates on specific legislation there are also debates on topical issues and public policy. It is during these that members are able to give speeches, giving their opinions and arguments and the relevant government minister has to respond. Members may speak because they have a particular interest in the area of debate or particular expertise. The 2017\u20132018 scholars had the opportunity to contribute to a variety of speeches for their peers on topics related to mental health, for example for debates on access to mental health services for people from Black and minority ethnic groups17 The government has to respond to each published select committee report and to consider its recommendations, which may or may not influence government policy. The government published its response to this Brexit report in July 2018 and in answer to the recommendation above it said, \u2018At this stage we do not have plans to publish a comprehensive list of the issues relating to medicines, medical devices and substances of human origin. We will continue to be as transparent as possible, but whilst we are engaged in on-going negotiations it is vitally important that we manage information carefully in order to not disadvantage the UK's position\u2019.18MPs and peers hold the government to account. One way of doing this is through the select committees run in the Commons and the Lords. The most important one for health is the House of Commons Health and Social Care Select Committee, which conducts inquiries on a range of topics. Anyone can submit a proposal to a select committee and, as a group of scholars, we submitted a proposal for an inquiry into the state of drug and alcohol services in England. An inquiry we followed during our time in Parliament focused on the impact of Brexit on medicines, medical devices and substances of human origin. Experts (including doctors), interested organisations and members of the public can submit written evidence to inquiries, for example in this one, the BMA and the Academy of Medical Royal Colleges both submitted evidence. The committee also took oral evidence from a range of expert witnesses, including the Rt Hon Jeremy Hunt  and Dr Ian Hudson , which some of the 2017\u20132018 scholars were able to watch. The committee used this evidence to write a report with a series of recommendations. For example, one of the recommendations was that the government should \u2018produce a comprehensive list of all the issues relating to the supply of medicines, medical devices and substances of human origin which require contingency planning for the UK leaving the EU [\u2026] with evidence that plans are in place to address identified risks to patients\u2019.Members also hold the government to account by asking oral or written questions that the government is required to formally answer on the record. Questions on health and social care are answered by the Ministers for Health and Social Care. At the time of writing, Matt Hancock MP is Secretary of State for Health and Social Care. However, there are other government health ministers to be aware of, for example Jackie Doyle Price MP is currently the Parliamentary Under Secretary of State for Mental Health, Inequalities and Suicide Prevention and, in the Lords, the Parliamentary Under Secretary of State (Lords) for Health is Baroness Blackwood. As part of their role, the 2017\u20132018 scholars drafted oral and written questions that could be used by their peers to put to House of Lords ministers. Ideas for questions came from recently published reports, government announcements and stories in the media.19 This question was asked following a widely publicised media story about sleep-in carers being able to claim minimum wage for overnight shifts and was answered by Lord O'Shaughnessy, the then Parliamentary Under Secretary of State (Lords) for Health.Oral questions are posed each day in both Houses. In the House of Lords, there is a 30\u00a0min slot for four oral questions, which peers have to submit in advance. The peer stands up for their slot and puts their question to the minister for the appropriate department, who has to respond; there is then time for other peers to ask the minister supplementary questions on that topic. The 2017\u20132018 scholars also identified upcoming oral questions in the chamber that could be of interest to their peers and drafted supplementary questions to be used in the brief debate to further clarify or challenge the government's position. An example of an oral social care question asked by one of the peers we were working for during our time on the scheme was \u2018To ask her Majesty's Government what steps they are taking to support (a) the care sector, and (b) those receiving care, in the light of the retrospective change in guidance on the application of the national minimum wage to sleep-in shifts for care workers\u2019.20 was published, one of the shadowed peers asked a series of questions about improvements that could be made to medical training and funding, one of which was, \u2018To ask Her Majesty's Government, following the conclusions of the Parliamentary and Health Services Ombudsman, Ignoring the alarms: how NHS eating disorder services are failing patients (HC 634), published on 6 December, what assessment they have made of the recommendations set out in that report; and what discussions they have held with the General Medical Council on reviewing the eating disorders training for junior doctors\u2019. This was answered by Lord O'Shaughnessy.21Peers and MPs can submit written questions to government departments that ministers have to respond to within certain time frames. Peers can table up to six questions each day and can expect an answer within 14 days. For example, when the report by the Parliamentary and Health Services Ombudsman on NHS eating disorder services22 The 2017\u20132018 scholars were able to attend meetings and contribute to the work of some of the APPGs. In 2017\u20132018 the APPG for Mental Health was chaired by Helen Whateley MP and its secretariat was provided by the Royal College of Psychiatrists and Rethink. Some of the 2017\u20132018 scholars had the opportunity to work on the APPG for Mental Health's inquiry into the Five Year Forward View for Mental Health.23 One of the scholars went on a visit to see some of the new services set by Central and North West London NHS Foundation Trust as a result of the Five Year Forward View and to understand the challenges and opportunities involved. We helped with reviewing evidence and recommendations for the report using our clinical expertise.All-party parliamentary groups (APPGs) are informal cross-party groups that have no official status within Parliament. They are run by and for members of the Commons and Lords. Many choose to involve individuals and organisations from outside Parliament in their administration and activities. Examples are the Acquired Brain Injury APPG, the Mental Health APPG and the Psychology APPG.Day to day, most peers have meetings with a wide range of people, such as politicians, representatives from charities, think-tanks and NHS organisations, journalists and lobbyists. The 2017\u20132018 scholars had the opportunity to shadow peers and also contribute to some of these meetings. There are always events taking place in Westminster, for example we were able to accompany our peers to events such as the launch of the report by the Lancet Commission on Liver Disease, the launch of the Schizophrenia Commission report and the Parliamentary Conference on Mindfulness.Peers also receive correspondence from a wide variety of sources, including members of the public, interested organisations and other politicians. The 2017\u20132018 scholars were able to help their peers with responding to enquiries and drafting letters.Our links with the Royal College of Psychiatrists were invaluable, and the advice from its Public Affairs team enabled us to navigate what can be a complex parliamentary process. They were also able to support us with our parliamentary research on specific topics related to mental health. More broadly, the Public Affairs team works with parliamentarians, arm's-length bodies and other political stakeholders to campaign and influence mental healthcare. It sends out written briefings to parliamentarians on mental health topics which are coming up in debates, oral questions or Bills to give an overview of the topic but also to give the College's perspective . Team members regularly meet with politicians face to face about different mental health issues. The Public Affairs team, alongside Rethink, coordinates the APPG on Mental Health and helps to plan their activities and inquiries for the year. The team also sends out a weekly email to College members entitled \u2018Political Week\u2019, which gives an overview of any mental health topics that have come up in Parliament.24 these skills correspond to the \u2018connecting our service\u2019 domain, as we were able to develop an understanding of how different services connect to the broader health landscape, how complex relationships form and how decisions are made. It also corresponds to the \u2018influencing for results\u2019 domain, as we were able to develop our communication skills and our ability to influence people.Our 1-year scholarship was an exciting and unique opportunity to learn more about the interface between politics and healthcare and how Parliament works. As trainees it gave us a better understanding of the wider mental health system and its interactions with government. We developed skills in leadership, policy analysis, speech writing and influencing the mental health agenda, all of which will be helpful for us as consultant psychiatrists. Within the Healthcare Leadership Model,During our time, we were able to meet with a number of MPs and peers who are influential in healthcare to learn more about how they got into politics, their day-to-day work and what their priorities are. In return, we were able to share with them our experiences of working in front-line mental health services. Some of us took our peers to visit our clinical teams so that they could get an in-depth understanding of what it is like to work in psychiatry.All of us have been able to share our learning with colleagues through teaching sessions, blogs and conference presentations. At present there are no objective data to examine the impact of the scheme, but this could be gathered after further cohorts of scholars have completed the placement.https://hansard.parliament.uk), watching Parliament TV (https://www.parliamentlive.tv/Commons) or listening to the BBC Radio 4 programme \u2018Today in Parliament\u2019 (https://www.bbc.co.uk/programmes/b006qtqd), which provides a 30\u00a0min summary of the day's events.There are lots of different ways doctors can get involved in healthcare policy and politics. One way is to join a political party, which will allow you to develop an understanding of the political system and to become politically active. You can write to your local MP, or a peer in the House of Lords with an interest in your issue. Politicians' interests are listed on their Parliament webpage. The select committees regularly run inquiries and, as a doctor, you can submit evidence, propose a topic or go to watch the evidence sessions. You can follow what goes on in the Houses of Commons and Lords by reading Hansard  is in its third year. It is advertised on the Royal College of Psychiatrists website usually in the spring.Our participation in the 2017\u20132018 Parliamentary Scholar Scheme\u00a0was a unique opportunity for us as trainee psychiatrists to learn more about healthcare policy and Parliament. It has enabled us to develop skills in leadership and influencing that will stand us in good stead for our future careers as consultant psychiatrists.25 Our experience of working in Parliament has demonstrated the many areas where policy is made, challenged and communicated. The scope for those with first-hand knowledge of the healthcare system to have input into the areas where policy is influenced is there, but it requires knowledge of the system and a willingness to suggest solutions, not just to criticise the end product.The idea of the medical profession turning to soft power to influence policy has been proposed recently."}
+{"text": "Although some studies have shown that some static magnetic fields (SMFs) can promote wound healing in diabetic mice, it is not clear whether the other diabetes complications, such as liver disease and diabetic nephropathy, can also be alleviated. Here, we constructed two simple magnetic plates using neodymium permanent magnets to examine the comprehensive effects of moderate SMFs on genetically obese leptin receptor-deficient db/db diabetic mice. We found that although the blood glucose was not obviously reduced by these two SMF settings, both of the glycated serum protein (GSP) and malondialdehyde (MDA) levels were significantly decreased (Cohen\u2019s d = 2.57\u20133.04). Moreover, the wound healing, liver lipid accumulation, and renal defects were all significantly improved by SMF treatment (Cohen\u2019s d = 0.91\u20132.05). Wound tissue examination showed obvious nuclear factor erythroid 2-related factor 2 (NRF2) level decrease (Cohen\u2019s d = 2.49\u20135.40) and Ki-67 level increase (Cohen\u2019s d = 2.30\u20133.40), indicating decreased oxidative stress and increased cell proliferation. In vitro cellular studies with fibroblast NIH3T3 cells showed that SMFs could reduce high glucose-induced NRF2 nucleus translocation (Cohen\u2019s d = 0.87\u20131.15) and cellular reactive oxygen species (ROS) elevation (Cohen\u2019s d = 0.92), indicating decreased oxidative stress. Consequently, high glucose-induced impairments in cell vitality, proliferation, and migration were all improved by SMF treatment. Therefore, our results demonstrate that these simple SMF devices could effectively reduce oxidative stress in diabetic mice and may provide a cost-effective physical therapy strategy to alleviate multiple diabetic complications in the future. According to the latest data of the International Diabetes Federation (IDF) in 2021, there are approximately 537 million adults living with diabetes mellitus (DM), a complex disease characterized by hyperglycemia (high blood glucose). Most diabetic patients have multiple skin, liver, and renal complications, which severely impaired their life quality. One of the most prevalent complications in diabetic patients is impaired diabetic wound healing .Oxidative stress, a state when the balance between oxidative and antioxidant actions lean towards oxidation, and excessive reactive oxygen species (ROS), chemically reactive radicals or non-radical molecules derived from molecular oxygen , play imAs a noninvasive physical treatment method, magnetic fields can control the movement and transfer of unpaired electrons in free radicals, which provide a theoretical physical basis for their regulation of ROS ,21. The It has been shown that magnetic fields of hundreds of mTs may have some therapeutic effects, but the magnetic field direction, intensity, and treatment time could directly influence the results . TherefoIn mice experiments, db/db diabetic mice were housed in the cage placed on the top of the magnetic or nonmagnetic plate (Length \u00d7 width: 310 \u00d7 250 mm). Our previous studies indicate that the magnetic pretreatment before the onset of diabetes is beneficial for the diabetic mice  so that N38 Neodymium permanent magnets (length \u00d7 width \u00d7 height: 60 \u00d7 50 \u00d7 35 mm) offered 0.5 T SMF for cellular studies and the details of the magnetic apparatus have been detailed in prior work . The condb/J (db/db) mice were used in this study. Six healthy WT mice served as the control group. Twenty-seven db/db mice served as sham, upward SMF, and downward SMF group (N = 9 mice/group). All mice were purchased from GemPharmatech Co., Ltd. . The mice were provided with standard rodent chow and water and housed in cages (3 mice per cage) that were placed in SPF animal facility with the laboratory maintained at a temperature of 22 \u00b0C and 40% humidity with a 12 h light: 12 h dark cycle. We recorded the changes in body weight and fasting blood glucose of mice during the whole experiment. All animal welfare and experimental procedures were performed strictly according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals . Moreover, the procedures were approved by the Institutional Animal Care and Use Committee of Hefei Institutes of Physical Science, Chinese Academy of Sciences .Thirty-three 4-week-old male BKS wild-type (WT) and BKS-LeprCutaneous wounds were established as detailed by Shang et al. . BrieflyThe mice were randomly sacrificed on day 4, 9, and 22 to collect samples including the injured skin and its surrounding tissues and organs, respectively. Samples were fixed in 4% paraformaldehyde. After being embedded with paraffin, the samples were sectioned with a microtome. The obtained sections (5 \u03bcm) were stained for Ki-67 , hematoxylin and eosin (H&E), Sirius red, periodic acid-Schiff (PAS), Masson\u2019s Trichrome-stained and/or oil red O. Slides were scanned using an Aperio Scanner  and analyzed using CaseViewer software . Quantified analysis of images by Image J software .The malondialdehyde (MDA) level and superoxide dismutase (SOD) level of wound tissues were detected by SOD assay kit  and MDA assay kit . g for 10 min and were analyzed using an automated biochemical analyzer .Three mice in each group were sacrificed on day 4, 9, and 22 to collect blood samples in 1.5 mL centrifuge tubes. To obtain serum, blood samples were centrifuged at 4000\u00d7 2 in a humidified incubator . The mouse embryonic fibroblasts cells (NIH3T3) and fibroblast cells (L929) cells were from American Type Culture Collection  and cultured in DMEM  or RPMI 1640  supplemented with 10% FBS, 2 mM GlutaMAX, and 1% penicillin/streptomycin. Control group cells were cultured with basal medium, and sham and SMF groups cells were cultured with medium supplemented with high glucose (50 mM). All cells were maintained at 37 \u00b0C under 5% CO4 cells/mL), cultured in DMEM supplemented with increasing doses of glucose  at 37 \u00b0C for 24 h before the addition of CCK-8 solution (10 \u03bcL/well). After another 1.5 h of incubation, we examined absorbance at 450 nm with a Microplate Reader .We used Cell Counting Kit-8 (CCK-8)  to measure cell viability. The NIH3T3 cells were seeded in 96-well plates (5 \u00d7 105 cells/mL) were cultured in DMEM including 50 mM glucose at 37 \u00b0C, whereas treated with sham, upward, or downward SMF for 24 h. Intracellular ROS can oxidize the DCFH-DA probe, resulting in fluorescent DCF that can be identified by flow cytometry .The NIH3T3 cells in a 35 mm culture dish  for 1 h, and incubated with the primary antibodies at 4 \u00b0C overnight. The primary antibodies were diluted as follows: NRF2 , Ki67 . Furthermore, the cellular nuclei were stained with DAPI  for 8 min. Finally, slips were mounted in gold antifade reagent  and captured on a confocal microscope .5 cells/mL) cells were planted in a 3.5 cm culture dish and cultured in total media until they reached confluency. The medium was replaced with a medium containing 0.1% serum and normal concentrations of glucose or 50 mmol/L glucose. Next, cell monolayers were scratched by 10\u2009\u03bcL plastic tip to produce straight lines in the cell monolayers and exposed to sham, upward, or downward SMF, respectively. Finally, the distance between the scratches was photographed until recovery of the monolayer, and the results were analyzed by Image J software .The NIH3T3 , then analyze cell numbers with Image J software .The migration of NIH3T3 cells was assessed utilizing a Transwell tool . Almost 5 \u00d7 10g for 5 min to extract cytoplasmic proteins. The pellet was resuspended in nuclear protein extraction reagent to lyse for 30 min and the supernatant was collected as nuclear protein after centrifugation at 13800\u00d7 g for 10 min. Protein quantification was carried out using the BCA protein assay kit .The nuclear and cytoplasmic protein extraction kit  was used to extract nuclear and cytoplasm proteins. Briefly, the NIH3T3 cells were collected into centrifuge tubes. The cells were homogenized and suspended in cytoplasmic protein extraction reagent and were centrifuged at 13,800\u00d7 Equal quantities of the proteins were separated by SDS-PAGE gels, transferred to nitrocellulose membranes, incubated with 5% skimmed milk, and then incubated with the primary antibodies at 4 \u00b0C overnight. The primary antibodies were diluted as follows: NRF2 , \u03b2-tubulin , and Lamin A/C . The membranes were incubated with the HRP-labeled secondary antibody in blocking buffer at room temperature. Blots were developed using an enhanced chemiluminescence reagent . The relative protein density was quantified using Image J software .The NIH3T3 cells were incubated in 96-well plates under the previously described conditions for 24 h. According to the manuscript protocol, Cell-titer glo was applied to measure cell vitality .The Calcein-AM/PI stain kit  was used to distinguish between dead and live cells. The NIH3T3 cells were cultured in 96-well plates at 5000 per well and incubated with different concentrations of glucose . Next, the cells were processed for 24 h in either the sham, upward, or downward SMF. Live cells stained by Calcein-AM emitted green fluorescence and dead cells stained by PI emitted red fluorescence.The NIH3T3 cells were incubated in a 3.5 cm culture dish and incubated with different concentrations of glucose . Next, the cells were processed for 24 h in either the sham, upward, or downward SMF. Then, the cells were incubated with EdU  for 2 h. Subsequently, the cells were collected and measured by Click-iT EdU Flow Cytometry Assay Kits , as described by the manufacturer.t-test. All the statistical analysis was made by GraphPad Prism 9 software  and p value < 0.05 was considered as statistically significant.Data from the experiments were shown as the mean \u00b1 SD and were analyzed by the two-tailed Student\u2019s To investigate the effects of SMFs on diabetic wound healing and other diabetic complications, a sham and two different magnetic plates were used A. We usep < 0.05) and the superoxide dismutase (SOD) levels were also slightly increased (p > 0.05), which indicate the lipid peroxidation and the oxidative stress level in these db/db mice were alleviated by SMFs treatment.We monitored the mice body weight A and fasTo evaluate the effect of SMFs on other complications, we extracted the liver and kidney from mice for tissue analysis. The hematoxylin and eosin (H&E) staining for liver showed that the hepatocytes of db/db mice in the sham group were loosely arranged and had a large number of vacuoles, which were obviously alleviated by SMF treatment . We usedWe examined wound status on day 4, 9, and 22 after wounding and found that SMF treatment significantly increased the wound area closure rate in these diabetic mice (Cohen\u2019s d = 0.91\u20132.05) A,B. Sincp > 0.05) except for the downward SMF to SOD level (p < 0.05) (Cohen\u2019s d = 1.10). This indicated that the oxidative stress and the lipid peroxidation in diabetic mice at the wound tissue were reversed by SMF treatment. Therefore, our animal experiments showed that SMFs could reduce oxidative stress and promote cell proliferation in the wounds of diabetic mice.To study the mechanism by which SMFs promoted wound healing, we evaluated NRF2 A,B and KNext, we used NIH3T3 cells to explore the effects of SMFs on high-glucose-treated cells in vitro. It is obvious that high glucose could decrease cell viability in a concentration dependent manner A. Using Since NRF2 is a crucial controller of the cytoprotective reaction, which is closely related to cellular ROS or oxidative stress ,38, we nSMFs have been shown to have differential effects on blood glucose levels. For example, recently, Carter et al. used a combined SMF and electric field  and our Although ROS and RNS (reactive nitrogen species) are essential for maintaining redox homeostasis in living organisms, excessive ROS and RNS can cause cytotoxicity and oxidative stress, a negative effect produced by free radicals in the body and is regarded to be an important factor in aging and various diseases. ROS plays a crucial part in wound healing, whereas excessive ROS level could induce DNA damage, protein structure changes, lipid superoxidase (MDA), and reduced glutathione-oxidized glutathione (GSH-GSSG) alterations . MoreoveIt has been shown that SMFs could affect cellular ROS levels. On one hand, it may be related to different magnetic field parameters . For example, exposure to 1 T SMF for one day decreased ROS levels , whereasIn this research, we found that the downward SMF was more effective in promoting the wound healing and re-epithelialization than the upward SMF. In addition, in vitro experiments were consistent with the in vivo results that the downward SMF was more effective in promoting the proliferation, migration, and survival of cells than upward SMF. As one of the parameters of the magnetic field, although the mechanism is still poorly explored, magnetic field direction has been shown by multiple studies to influence biological effects ,33,54,55In conclusion, our study revealed that SMFs could reduce ROS and oxidative stress, which further decreased the nuclear NRF2 translocation and the MDA level, promoted diabetic mice wound healing, and reduced liver lipid accumulation and renal defects. Our study demonstrates that SMFs provided by permanent magnets is promising as a low-cost physical tool to ameliorate diabetes induced chronic skin damage, liver, and kidney injury, as well as other oxidative stress-related health conditions in the future."}
+{"text": "Coriolus versicolor and Hericium erinaceus to prevent neurodegenerative processes. Traumatic brain injury was induced in mice by controlled cortical impact. Behavioral tests were performed at various times: the animals were sacrificed 30 days after the impact and the brain was processed for Western blot and immunohistochemical analyzes. After the head injury, a significant decrease in the expression of tyrosine hydroxylase and the dopamine transporter in the substantia nigra was observed, as well as significant behavioral alterations that were instead restored following daily oral treatment with Hericium erinaceus and Coriolus versicolor. Furthermore, a strong increase in neuroinflammation and oxidative stress emerged in the vehicle groups. Treatment with Hericium erinaceus and Coriolus versicolor was able to prevent both the neuroinflammatory and oxidative processes typical of PD. This study suggests that PD-related molecular events may be triggered on TBI and that nutritional fungi such as Hericium erinaceus and Coriolus versicolor may be important in redox stress response mechanisms and neuroprotection, preventing the progression of neurodegenerative diseases such as PD.Traumatic brain injury (TBI) is a major health and socioeconomic problem affecting the world. This condition results from the application of external physical force to the brain which leads to transient or permanent structural and functional impairments. TBI has been shown to be a risk factor for neurodegeneration which can lead to Parkinson\u2019s disease (PD) for example. In this study, we wanted to explore the development of PD-related pathology in the context of an experimental model of TBI and the potential ability of  Traumatic brain injury (TBI) can be divided into three phases: acute 0 to 1 week), post-acute 1 to 4 weeks) and chronic (4 weeks to years). During the first phase, cell necrosis occurs due to the direct impact of an external force on the brain tissue. Cell death subsequently occurs due to axonal changes and inflammation. The post-acute phase can be characterized by a reduction in inflammation, neuronal remodeling but also by an increase in chronic pathology  week, po,3,4. Pro weeks anTo date, there is no real treatment for PD or for the long-term consequences of TBI but only palliative care. Therefore, understanding the mechanistic relationship between TBI and PD is important for studies aimed at discovering compounds that are capable of slowing or preventing PD in at-risk populations. The mechanisms involved in the progression of neurodegenerative diseases such as PD are various. Among the most common we have mitochondrial dysfunction, the accumulation of proteins such as \u03b1-synuclein, oxidative stress and neuroinflammation. TBI is known to cause a breakdown of the blood-brain barrier and damage to the neurovascular unit leading to disruption of homeostasis, excitotoxicity, oxidative stress and inflammation, all factors that over time lead to neurodegeneration ,13,14,15Hericium erinaceus is among the most characterized medicinal mushrooms and with a focus on the nervous system [Hericium erinaceus also reduces the deposition of A\u03b2, improves the expression of nerve growth factor (NGF) and the neurogenesis of the hippocampus [Hericium erinaceus has been demonstrated in models of Alzheimer\u2019s and other models of neurodegenerative disorders such as epilepsy [Hericium erinaceus in addition to having anti-inflammatory activity it also has an anti-oxidant action as it is capable of acting on the NF-E2-related factor 2 (Nrf2)/heme oxygenase 1 (HO-1) pathway [Hericium erinaceus could therefore be considered an excellent neuroprotector. Mushrooms contain a wide range of bioactive compounds that encourage their use both in the maintenance of human health and in the prevention of diseases often related to the central nervous system. In particular s system . An incrs system . In anotpocampus . The antepilepsy . It has  pathway ,21. HeriCoriolus versicolor. Recent studies have suggested that this mushroom has anticancer, anti-inflammatory, antioxidant, antibacterial and immunomodulatory properties [Hericium erinaceus, Coriolus versicolor has also been shown to improve spatial memory in a mouse model of AD by increasing antioxidant activity (superoxide dismutase (SOD) and catalase (CAT)) and inhibition of pro-inflammatory cytokines  and TNF-\u03b1) [Coriolus versicolor has been shown to promote the up-regulation of the anti-inflammatory mediator lipoxin A4 and the increase in the levels of proteins involved in the cellular stress response such as heat shock protein 70 (Hsp70), HO-1 and thioredoxin (Trx) in the cortex and hippocampus [Another mushroom extensively studied in recent years and which has been shown to have a neuroprotective effect is operties ,23,24. Ld TNF-\u03b1) . Furtherpocampus . Hericium erinaceus, Coriolus versicolor and with their association was able to act on the molecular, biochemical and cellular changes that occur in the brain after trauma and that increase the risk of developing PD. On the basis of the data in the literature, the aim of our study was to evaluate how treatment with Male CD1 mice  were used for all studies. Mice were housed in individual cages (five per cage) and maintained under a 12:12 h light/dark cycle at 21 \u00b1 1 \u00b0C and 50 \u00b1 5% humidity. Standard laboratory diet and tap water were available ad libitum. The Review Board for the care of animals of the University of Messina approved the study . We respected the legislation for the protection of laboratory animals (D.Lgs 2014/26 and EU Directive 2010/63).TBI was induced in mice by a controlled cortical impact (CCI) as previously described ,28. A crAll animals were randomized in the indicated groups (10 mice for each group): Sham + vehicle group: mice were subjected to the surgical procedures as above except that the impact was not applied and animals were treated o.s. with vehicle;Hericium erinaceus (H): mice were subjected to the surgical procedures as above except that the impact was not applied and animals were treated o.s. with H (data not shown);Sham + Coriolus versicolor (C): mice were subjected to the surgical procedures as above except that the impact was not applied and animals were treated o.s. with C (data not shown);Sham + Hericium erinaceus + Coriolus versicolor (H + C): mice were subjected to the surgical procedures as above except that the impact was not applied and animals were treated o.s. with H + C (data not shown);Sham + TBI + vehicle group: mice were subjected to CCI plus administration of vehicle ; Hericium erinaceus (H): As for the TBI + vehicle group but H was administered o.s. at 200 mg/kg in saline for 30 days after TBI; TBI + Coriolus versicolor (C): As for the TBI + vehicle group but C was administered o.s 200 mg/kg dissolved in saline for 30 days after TBI; TBI + Hericium erinaceus + Coriolus versicolor (H + C): As for the TBI + vehicle group but H (200 mg/kg) + C (200 mg/kg) was administered o.s for 30 days after TBI.TBI + H. erinaceus and C. versicolor biomasses including mycelium and primordia of the respective mushroom, generous provided by Mycology Research Laboratories Ltd. , as the product commercially existing, were used for investigates. Optimal quantity (200 mg/kg) was selected according to the dose used in clinical trials with cancer or HPV patients (3 g/day) [3 g/day) , a regim3 g/day) ,26.Mice were sacrificed 30 days after surgical procedures brain was collected for histological and biochemical investigation. In addition, over the 30-days experimental period behavioral changes at 1, 7, 14, and 30 days were evaluated.\u00ae Integral water purification system with Q-pod . Formic acid was purchased from Carlo Erba . Ethanol, acetonitrile and methanol from Merck . Ammonium acetate, acetone and 2-propanol were purchased from Carlo Erba . The SPE cartridges Waters Oasis HLB (200 mg) from Waters S.p.A. . Standard solutions of gallic acid, ascorbic acid, vanillic acid, caffeic acid, chlorogenic acid, catechin, epicatechin, vanillic acid, coumaric acid and hydroxybenzoic acid were purchased from Extrasynthese ; quercetin, rutin, apigenin, luteolin, ferulic acid, kaempferol, palmitic acid, stearic acid, oleic acid, linoleic acid, glucose, N,O-bis(trimethylsilyl) trifluoroacetamide (BSTFA), trimethylchlorosilane (TMCS) and pyridine were acquired from Sigma-Aldrich S.r.l. .All reagents used are HPLC grade. Ultrapure deionized water, with resistivity of 18.2 megaohm-cm was obtained from a Milli-QThe sample of C, in the form of tablets, was subjected to crushing in a mortar and passed through a sieve with a mesh size of 20 \u00b5m. The H sample in powder form was only sieved with a mesh size of 20 \u00b5m. Gas Chromatography-Tandem Mass Spectrometry (GC-MS/MS) analyses. The ethanol extract was reduced in small volumes in an evaporator under a current of nitrogen and taken up with 1 mL of mobile phase.Two 0.1 g aliquots of C powder and 0.1 g aliquots of H powder were solubilized in 10 mL of ethanol and 10 mL of acetonitrile, respectively, in orbital shaker incubator  at room temperature for 24 h. The extracts were filtered in a syringe filter  of size 0.45 \u03bcm. Solubilized samples were then passed through SPE cartridges, previously conditioned with 4 mL of methanol and 2 mL of deionized water, followed by washing with 2 \u00d7 10 mL of water and eluted with 1 mL of ethanol for Liquid Chromatography-Orbitrap-Mass Spectrometry (LC-Orbitrap-MS) and 1 mL of acetonitrile for1 mL of the acetonitrile extract got was mixed with 30 \u03bcL of N,O-bis(trimethylsilyl) trifluoroacetamide (BSTFA), 10 \u03bcL of 1% trimethylchlorosilane (TMCS) reagent, and about 15 \u03bcL of pyridine inside a tube. Then, the tube was positioned into a water bath at 70 \u00b0C for 2 h; the mixture was ready for GC-MS/MS analysis. The derivatization was carried out in order to improve the chromatography and the identification of the peaks. The extract was analyzed with a Thermo Scientific TSQ-Quantum XLS Triple Quadrupole GC-MS/MS gas chromatography mass spectrometry system . MS acquisition time of 15.52 min for analysis of C and 15.50 min for H in full scan mode (50\u20131000 amu) equipped of a TR-5MS column 5% phenyl methyl siloxane, 30 m \u00d7 250 \u03bcm \u00d7 0.25 \u03bcm; scan time 0.272; Q1 peak width 0.70 eV in positive and negative polarity. Furnace temperatures have been set: initial holding time 100 \u00b0C and rate of 14 \u00b0C/min for 1 min at 330 \u00b0C; 5 \u03bcL injected in programmed temperature vaporization (PTV).TM Mass Spectrometer  equipped with a Heated ElectroSpray Ionization (HESI) system was used in positive and negative polarity manners for the identification of the precise masses. The operation parameters were as follows: cover gas flow amount, 35 (random units); aux gas flow amount, 10 (random units); spray voltage, 3.50 kV; capillary temperature, 300 \u00b0C; tube lens voltage, 55 V; heater temperature, 305 \u00b0C; scan mode: full scan; scan range (m/z) 100\u20131000; microscans, 1 m/z; positive resolution: 70,000; fourier transform (FT) automatic gain control (AGC) target: 3 \u00d7 10; negative resolution: 35,000; automatic gain control (AGC) target: 1 \u00d7 106; maximum IT: 100 ms. The chromatographic parameters were as follows: column temperature, 30 \u00b0C; sample temperature, 6 \u00b0C; flow rate, 0.2 mL min\u22121. The autosampler sample holder temperature was maintained at 7 \u00b0C. The mobile phase consisted of eluent A: 30 mM ammonium acetate (pH 5), eluent B: methanol, eluent C: water (0.5% formic acid), and eluent D: acetonitrile/acetone/2-propanol (4:3:3). Moveable phases A and B were used to enhance the chromatographic resolution; moveable phases B, C, and D were obligatory for purification in TurboFlowTM . The sample injection volume was 5 \u03bcL with injection syringe. Cyclone P column ; a Hypersil Gold  column was working as the analytical separation column. The total run time was 10 min for analysis of C and 13 min for analysis of H. The data analysis was performed using Thermo Scientific XCalibur  version 4.0 software and Qual Browser .A Q-Exactive Plus Hybrid Quadrupole-OrbitrapAll animals were subjected to behavior examinations at 1, 7, 14, and 30 days post-CCI. The mice were positioned in behavior places 5 min for 2 days for acclimation earlier to the onset of behavioral analysis. Three different reliable expert observers blinded to the injury status of the animals conducted the behavioral tests. Tests are described below:The Elevated pluz-maze Test (EPMT) test was performed as described previously . The EPMLocomotor activity and anxious behavior were videotaped for 5 min using the open field test (50 \u00d7 50 cm Plexiglas box with the floor divided into 16 squares). Four squares represented the center and 12 squares along the walls represented the periphery. Each mouse was placed in the center and activity was evaluated as a line that crosses when a mouse moves its four legs from one square and enters another. The line passes and the time spent in the center have been counted and marked .The Barnes Maze is a validated and often used test to assess spatial learning and memory in rodents. Test was performed as described previously . Performn = 5/each group) were fixed, cut and stained . Afterward, the slices were detected under an optical microscope associated to an imaging system . Histopathologic changes of the gray matter were scored on a six-point scale as described by Campolo et al. [The brains , anti-DAT . In order to assess the specificity of the antibodies, brain sections (from five mice for each group) were treated with primary antibody or secondary antibody only. The images were taken using a Zeiss microscope  and AxioVision software . The ImageJ IHC profiler plug-in  was used for densitometric analysis as described by Sawant et al. [The technique we used was performed as previously described . The antt et al. . The rest et al. . ImmunohWestern blot analysis was performed on brains of five mice for each group with the protocol that we previously described . The levp-value of minus than 0.05 was considered significant.All the values observed in the figures and in the text are expressed as mean \u00b1 standard error and refer to at least three experiments carried out at different times. Data analysis was performed by a one-way study of variance followed by a post-hoc Bonferroni test for multiple comparisons. A Histological examination of the brain collected by TBI animals, at 30 days post-impact, showed significant tissue alteration in the perilesional area of the cortex F compareIn addition, H&E staining was performed to evaluate the histopathological alteration induced by TBI in midbrain region. The Sham mice showed a normal brain architecture and a normal number of neurons in the midbrain F. InsteaTo study the activation of astrocytes and microglia in relation to chronic TBI and PD pathology, Western blot analysis was applied to quantify the expression of GFAP and Iba-1, markers of astrocytes and microglia, respectively. Levels of GFAP and Iba-1 were very low in the Sham group, while they were significantly elevated 30 days after TBI. Under these conditions, treatment with H or C and even more with the combination significantly reduced the increase in GFAP and Iba-1 expression in the midbrain A\u2032,B\u2032. Furthermore, in order to evaluate the mechanism by which H or C or the combination attenuated the neuroinflammatory processes that led to the development of PD, we studied the expression of NF-\u03baB p65 and I\u03baB-\u03b1 by Western blot analysis. The results obtained showed a basal expression of I\u03baB-\u03b1 in the control group, while a significant degradation of this protein was observed after the TBI. Treatment with the individual substances and more particularly that with the association between H and C was able to reduce the cytoplasmic degradation of I\u03baB-\u03b1 C\u2032. RegarFurthermore, the levels of GFAP, Iba-1 and IkB-\u03b1 were measured by Western blot analysis in the cortex (Cx), in the hippocampus (Hp) and in the cerebellum (Cb). A significant increase of GFAP and Iba-1 was observed in the TBI group, while in animals treated with H and C and especially with H + C, a significant decrease was observed for GFAP and Iba-1 in all regions of the brain examined , in the hippocampus (Hp) and in the cerebellum (Cb). In animals treated with H and C and especially with H + C, a significant increase of HO-1 was observed in all regions of the brain examined, while this significant increase was not observed in the TBI group. Basal levels were observed in the control animals A\u2019\u2013C\u2019. The same trend was observed for Hsp-70. Except at the level of Cb only the H + C treatment has been shown to significantly increase the expression of this protein A\u2019\u2013C\u2019. Also, with regard to \u03b3-GCs, a significant increase in the expression of this protein was observed by treatments with H, C and H + C in all brain areas examined, compared to the Sham and TBI group A\u2019\u2013C\u2019. Finally, the expression of the Trx protein was significantly increased by treatments with H, C and H + C only in Cx and Hp. No significant increase was observed at the Cb level A\u2019\u2013C\u2019.To observe if chronic TBI can modify PD-like markers, brain sections from mice of each groups were stained with dopaminergic-specific markers (TH and DAT). The expression of TH-positive neurons and DAT was notably decreased 30 days after TBI F compareOn the contrary, by Western blot analysis we observed that chronic TBI caused an evident increase in \u03b1-syn compared to the Sham group, while the treatment with the single compounds reduced \u03b1-syn in the brain but the association acted more on the prevention of the accumulation of this protein A\u2019.In order to investigate the effect of H or C or the association H + C on apoptotic events induced by chronic TBI we assessed, by Western blot analysis, the expression of pro-apoptotic protein such as Bax. The results obtained displayed an important increase of Bax levels after TBI respect the Sham group, while a reduction of expression of Bax was evident after H or C treatment, especially after the administration of H + C B\u2019. MoreoUsing various behavioral tests, such as the EPM, open field test and Barnes maze, we compared the degree of anxiety and locomotor function of mice undergoing chronic TBI with control mice and treatment mice at different days . In the EPM test we observed that TBI mice spent less time in open arms than control mice, while treated mice tended to spend more time in open arms especially those treated with H + C A. This sC. versicolor in GC, the most commonly found compounds are hexadecenoic acid (15.14), glucose (14.04%) and hexadecane (13.59%)  , Table 1(13.59%) , Table 2H. erinaceus, ergosterol (15.34%), ergothioneine (12.72%), coumaric acid (11.03%), glucose  and tartaric acid (10.45%) are the most representative compounds (As for the GC analysis of ompounds , Table 3ompounds , Table 4H. erinaceus and C. versicolor mushrooms have been shown to have antioxidant and anti-inflammatory power, especially in diseases affecting the nervous system. In particular, their beneficial power was observed in AD [H. erinaceus and C. versicolor were able to prevent the propagation of secondary damage in remote areas with respect to the primary region of the lesion in the advanced stage of TBI and therefore to slow down or inhibit the progression of the neurodegenerative processes leading to PD. Several studies have validated that in animal models of TBI there is the appearance of pathophysiological processes characteristic of PD [The study of natural compounds is of worldwide interest due to their numerous biological activities. Many sources of these compounds including ed in AD . On the ic of PD ,40,41. Iic of PD . Our hisic of PD , we haveic of PD . For thiic of PD ,9,38,44.ic of PD ,46. As dic of PD ,48. In tH. erinaceus and C. versicolor and in particular their combination are able to act on specific molecular mechanisms that link chronic TBI and PD. In particular, they seem to act on microglia and consequently on the NF-\u03baB pathway, reducing the neuroinflammation that spreads from the cortex to other areas of the brain. Furthermore, these compounds act on oxidative stress which also spreads to the midbrain thus limiting the accumulation of \u03b1-syn and the development of PD. Therefore, H. erinaceus and C. versicolor could be used as nutritional products for the prevention of neurodegenerative processes related to chronic TBI. However, further studies will be needed to investigate which of the various compounds characterized in these two mushrooms are most implicated in this neuroprotective role.In conclusion, our discovery opens up potential neuroprotective strategies since for the first time it has been shown that the mushrooms"}
+{"text": "The aim of this study was to explore the incidence of depression and anxiety disorder diagnoses in a large German cohort of patients with Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL) diagnoses in comparison to patients without cancer over a 10-year time frame.n=687) and NHL (n=4130) were matched to cohorts without a cancer diagnosis (n=687 and 4130) by age, sex, and yearly consultation frequency. The primary outcome of the study was the incidence of depression and anxiety disorders. The relationship between lymphoma, separated into HL and NHL, and both depression and anxiety disorders was investigated using Cox regression models.Patients with HL (p<0.001) and NHL  were positively associated with incident depression. The HR for anxiety disorders was 1.64  in patients with NHL, while HL was not associated with incident anxiety disorders .We compared 687 patients with HL with 687 matched non-cancer individuals and 4130 patients with NHL with 4130 matched non-cancer individuals. Within 10 years of the index date, 24.0% of patients with HL and 22.3% of patients with NHL were diagnosed with depression. Anxiety disorders were diagnosed in 6.7% and 5.3% of patients with HL and NHL, respectively. On regression analyses, HL (HR 2.30, 95% CI 1.65\u20133.21, Lymphoma constitutes a risk factor for emerging depression and anxiety disorders. Following the diagnosis of lymphoma, screening and strategies to prevent the occurrence of these diseases seem warranted. Depression and anxiety disorders  are common mental health disorders in Germany . In 2019In patients with cancer that suffer from cancer-related psychological distress, the risk of depression and anxiety disorders is even higher . UnrecogGenerally, a higher age and female sex are both associated with higher lifetime risk of depression and anxiety disorders in the general population . HoweverMalignant lymphoma is generally distinguished into Hodgkin lymphoma (HL) and non-Hodgkin lymphoma (NHL). The diagnosis relies on clinical examination, and morphological and immunophenotypic assessment from a lymph node biopsy. HL is an uncommon B cell malignancy, accounting for about 10% of all lymphoma, with high incidence in young adults (median age at diagnosis: 39 years) . TreatmeAlthough therapy regimens for malignant lymphoma have been improved over the last decades, a substantial proportion of patients does not experience cure or long-term disease control, which may negatively affect the occurrence of depression or anxiety disorders in these patients. However, data on the incidence of these diseases in patients with lymphomas are currently scarce. Therefore, we hypothesized that patients with lymphoma have a higher incidence of depression and anxiety disorders and explored the coded incidence in a large cohort of patients with HL and NHL in Germany.th revision [ICD-10]), prescriptions , which compiles drug prescriptions, diagnoses, and basic medical and demographic data of outpatients obtained directly and in anonymous format from computer systems used in the practices of general practitioners \u201316. Diagfication  system),fication .This study included patients who were coded for the first time with a diagnosis of Hodgkin ICD-10: C81) or non-Hodgkin (ICD-10: C82-C88) lymphomas in one of 1274 general practices in Germany between January 2000 and December 2018 (index date). Included patients were aged \u226518 years at the index date and had never been diagnosed with cancer (ICD-10: C00-C97) prior to the index date. Patients with depression , bipolar disorder (ICD-10: F30), and anxiety disorder (ICD-10: F41) diagnoses prior to or on index date were excluded. After applying similar inclusion criteria, patients without cancer were matched (1:1) to those with lymphoma based on sex, age, index year, and yearly consultation frequency. The reasons for the matching criteria were as follows: higher age and female sex are known to be associated with depression and could therefore bias the results. The index year is correlating with follow-up time and was consequently included into the matching process to enable similar follow-up durations for both cohorts. Finally, we matched for consultation frequency, as patients with cancer usually have a much higher consultation frequency than patients without cancer and this may lead to a higher likelihood of coding a diagnosis (in our case depression/anxiety). For individuals without cancer, the index date corresponded to a randomly selected visit date between January 2000 and December 2018 . We used anonymous electronic medical records for research purposes with no directly identifiable data. Accordingly, this study did not collect informed consent from individual patients and according to German regulations, no ethical approval is needed. Anonymized data were analyzed as aggregates with no protected health information available.The study outcome was the cumulative incidence of depression and anxiety disorders as function of lymphoma. After 1:1 matching, the age, sex, and yearly consultation frequency of lymphoma patients were compared with those without cancer using McNemar tests for categorical variables and paired Wilcoxon signed-rank test for continuous variables. Kaplan-Meier curves were used to compare the incidence of depression and anxiety disorders in the 10 years following the index year between the lymphoma and the non-cancer cohort. As there was no information on mortality, dead patients were considered lost to follow-up. Finally, the relationship between lymphoma, separately Hodgkin and non-Hodgkin, and both depression and anxiety disorders in the overall sample and in sex and age subgroups was investigated using Cox regression models. There were five age groups . The results of the Cox regression analyses are presented as hazard ratios (HRs) with 95% CIs.P-values <0.05 were considered statistically significant. All analyses were performed using SAS 9.4.Power analysis was conducted using an alpha of 0.05, a power of 0.80, and two cohorts (1:1). Based on the aforementioned assumptions, the required sample size was determined to be 944 per cohort. This study included 4817 patients with lymphoma (687 with HL and 4130 with NHL) and 4817 patients without cancer. After 1:1 matching, there were no differences in age, sex, and consultation frequency between lymphoma cohorts and non-cancer cohorts. The average age of HL patients was 49.8 (SD: 18.2) years, and 45.6% were women. Patients with NHL were 61.9 (SD: 16.7) years in average, and 44.0% were women (Table p < 0.001) but no differences were observed in terms of anxiety disorders .The cumulative incidence of depression was significantly higher in individuals with HL than in those without cancer  and anxiety disorders  was significantly higher than in those without cancer .In regression analyses, NHL was positively associated with depression  and anxiety disorders  . This translates into a more than doubled risk increase with a HR of 2.30, which remained significant across different age groups. Interestingly, the association of incident depression was stronger in men than in women. However, we did not detect an impact of HL on the incidence of anxiety disorders. Our findings regarding a relevant association between HL and depression are comparable to a recent Danish nationwide cohort study of 945 HL patients, investigating depression and anxiety disorders by using psychotropic drug prescriptions as a proxy for these diseases. Here, the authors demonstrated that HL patients had higher 5\u2010year cumulative incidence of receiving a prescription for a psychotropic drug (21.5%) as compared to a matched cohort (8.4%) [Since patients with HL are mostly diagnosed at a young age and become long-term survivors in more than 90% with current therapy options, it is of pivotal importance to characterize the risk for the development of depression and anxiety disorders. In the current analysis comprising 687 patients with HL, the cumulative incidence of depression was significantly higher than in those without a cancer diagnosis  and anxiety disorders  was significantly higher than in those without cancer. Interestingly, the association between NHL and the incidence of depression remained robust across all age groups and in both men and women. These findings are in line with a smaller French study investigating the incidence of psychotropic drug use during the diagnosis and active treatment phase in patients with B-NHL. Here, among 745 newly diagnosed B-NHL patients with a mean age of 65.1 years, psychotropic treatment\u2014reflecting the possible prevalence of depression or anxiety disorders\u2014was initiated in 31.5 %, compared to 7.6% in the general population during the same period [Besides the detrimental effect of HL on depression and anxiety disorders, we also investigated the impact of NHL on these mental diseases. In our cohort of 4130 NHL patients with a mean age of 61.9 years, the cumulative incidence of both depression (22.3% versus 11.9%, e period . Anothere period . Here, aThe current study expands the existing literature by analyzing a very large dataset of patients and analyzing the coded incidence of depression and anxiety disorders instead of medication prescriptions or questionnaire results. The results presented in this study support the hypothesis that lymphoma has a relevant influence on the occurrence of depression and NHL is additionally associated with the occurrence of anxiety disorders. Additionally, we are able to give a robust estimate on the risk increase in these patients.The prevalence rates of mental disorders may be notably higher during the episode of cancer diagnosis and following chemotherapy, due to the high degree of perceived uncertainty and fear. Still, impaired mental health often remains unnoticed by health care providers , 20. SinSince therapeutic options for both HL and NHL have improved over the past decades, many patients become cancer survivors. Multimodal therapy consisting of chemotherapy, immune therapy, or radiation can lead to complete remission, but may result in a substantial amount of long-term sequelae apart from depression, such as chronic fatigue, neuropathy, neurocognitive decline, sexual changes, and many more . Our stuThe following limitations need to be acknowledged. First, this study has the weaknesses inherent to all database analysis, as it relies on ICD-10 codes for establishing diagnoses. Thus, the extent of underlying misclassification related to miscoding or undercoding of diagnoses cannot be assessed. However, the German Disease Analyzer database has been used, and its reliability has been validated in several medical studies , 15, 27.In conclusion, this study demonstrates that the coded incidence of depression is high in German patients with lymphoma. This resulted in a robust association between HL as well as NHL with an increased incidence of depression compared to matched non-cancer individuals. Additionally, we observed an association between NHL and the incidence of anxiety disorders. Therefore, patients with malignant lymphomas should be closely screened for depression and anxiety disorders even several years after the initial diagnosis of the disease."}
+{"text": "NR3C1) gene. Variants in the NR3C1 gene have been reported in patients with MDD and obesity and found to confer reduced risk for quantitative metabolic traits and T2D in Cushing syndrome; variants have not been reported in T2D and MDD-T2D comorbid patients. We studied 212 original Italian families with a rich family history for T2D and tested 24 single nucleotide polymorphisms (SNPs) in the NR3C1 gene for linkage to and linkage disequilibrium (LD) with T2D and MDD across different inheritance models. We identified a total of 6 novel SNPs significantly linked/in LD to/with T2D  and 1 SNP (rs10482668) significantly linked to/in LD with both T2D and MDD. These findings expand understanding of the role that NR3C1 variants play in modulating the risk of T2D-MDD comorbidity. Replication and functional studies are needed to confirm these findings.Impairment in the hypothalamic-pituitary-adrenal (HPA) axis and cortisol pathway may be major contributing factors to the common pathogenesis of major depressive disorders (MDD) and type 2 diabetes (T2D). A significant player in the neuroendocrine HPA axis and cortisol response is the glucocorticoid receptor (GR), which is encoded by the nuclear receptor subfamily 3 group C member ( NR3C1 gene [NR3C1 gene affect coping style and depression vulnerability [NR3C1 gene have been reported to contribute to: the risk for MDD [NR3C1 gene might underlie the MDD-T2D comorbidity and aimed at investigating whether NR3C1 variants might predispose to familial T2D, MDD, and/or MDD-T2D comorbidity in affected families.Major depressive disorder (MDD) and type 2 diabetes (T2D) are two common complex multifactorial disorders that share several genetic and environmental risk factors such as hypercortisolism and related genes\u2019 risk variants within the stress response and neuroendocrine hypothalamic-pituitary-adrenal axis (HPA) . Stress 3C1 gene . Epigenerability ,13,14. V for MDD ; antidep for MDD ; metabol for MDD ; reduced for MDD ; reduced for MDD ; and inc for MDD . Of note for MDD  and depr for MDD  respectiNR3C1-variants to both T2D and T2D-MDD comorbidity. Of 24 studied variants in the NR3C1 gene, 6 independent single nucleotide polymorphisms (SNPs) were significantly linked to/in LD or associated with T2D , and 1 SNP (rs10482668) significantly linked to/in LD or associated with both T2D and MDD (p < 0.05). , and association of < 0.05). . The SNP< 0.05). .CRHR2 [MC1R-MC5R) [NR3C1), which is an important component of the cortisol pathway. We have reported finding six NR3C1 variants that are significantly linked/in LD to/with T2D and one variant significantly linked/in LD to/with both MDD and T2D across different inheritance models. Except for rs6196, these variants are novel, and have not previously been reported with either MDD and/or T2D. Of note, the risk allele (A) of the T2D-risk rs6196 variant in our study was previously reported in a haplotype in Caucasian patients with MDD [NR3C1 variant was associated with reduced risk of T2D in patients with Cushing syndrome [Cortisol is a pleiotropic glucocorticoid that upon binding to its widely distributed GR, mediates the adaptive, physiologic, or pathologic responses to chronic stress, such as mood changes and hyperglycemia ,25,26,27CRHR2  and the 1R-MC5R)  are linkwith MDD , but thiwith MDD ,31,32 anwith MDD , probablwith MDD . Moreovewith MDD . As glucsyndrome .NR3C1-variant rs41423247 , which is known to be associated with MDD [NR3C1 and its reported genetic variants in the mental-metabolic comorbidity. If the variants in our study are found to be associated with structural or functional impairment of NR3C1 and defective binding to circulating cortisol, it could potentially explain the MDD-related [The mechanism by which these variants modulate the risk of T2D and/or MDD could not be fully determined. In fact, our in silico analysis  among the risk variants, we analyzed the LD matrix of the Tuscany Italian population derived from the 1000 Genomes Project ) [We recruited 212 families originating from the Italian peninsula ascertained for T2D and rich family history of T2D. The families were also afflicted with several cases of MDD, diagnosed according to DSM-IV criteria. Given that the families are three-generation Italians, that uncertain paternity cases as well as adopted cases and identical twins were excluded, and especially that the families derive from the gene pool of a peninsular population, the chance of identifying genetic markers in linkage and LD  for the ascertained phenotypes is high. We genotyped 24 SNPs within the ng PLINK . We thenng PLINK , which ir 2021)) . This anNR3C1 gene to T2D and T2D-MDD comorbidity. Our results expand the understanding of the role that NR3C1 variants play in modulating the risk of T2D-MDD comorbidity. Replication and functional studies are needed to confirm these findings.We report novel linkage, linkage + association, and association of the"}
+{"text": "Early detection of postural disorders is essential for timely interventions in patients with imbalance.A pilot study describing a new tool for evaluating static postural balance.A cross-sectional study of a contemporary series.Twenty-five volunteers (15 women and 10 men) were evaluated. The mean age was 25.8 \u00b1 4.2 years, the mean weight was 63.9 \u00b1 13.1Kg, the mean height was 1.68 \u00b1 0.08 m and the body mass index was 22.3\u00b13.3kg/m2. Posturography was done by analysing postural sway with an electromagnetic system; a sensor was attached to the skin over the spinous process of the first thoracic vertebra. Tests were carried out with the subjects in the orthostatic position for 90 seconds, with eyes opened(EO) and closed(EC) on stable and unstable surfaces.When the influence of the surface was analyzed (stable x unstable) in the EO condition, there were significant differences in the middle-lateral parameters (m-l) (p=0.004) and total path (p=0.01), and in the m-l (p=0.004) and total (p=0.014) speed. In the EC condition, there were significant differences in all parameters (p<0.001). The influence of the vision was observed in all parameters only on unstable surfaces (p<0.05).The new tool was efficient for analysing postural sway. Evaluating balance in medical practice is essential for the early detection of postural disorders and for appropriate interventions in patients with balance disorders; this provides a better understanding and recognition of differences among individuals.When individuals are in the upright position, their bodies move as a simple inverted pendulum; muscles that cross the main rotation axis - the ankle - are able to control the position of the body center of mass (CM).7The ability to maintain posture depends on sensory information, which is necessary for the nervous system to detect anticipatorily and suddenly any external perturbation, and to generate coordinated responses to bring back the body center of mass to the basis of support.15At present, there are several tools for quantifying body balance, such as force platforms, baropodometry, and 3D electromagnetic sensors. Using these tools, however, may be expensive and time-consuming, and requires expert labor to acquire and analyze data; thus, these tools are not used as often as wished in clinical and some research settings.The Clinical Test of Sensory Interaction and Balance (CTSIB), which employs computerized dynamic posturography, was developed to identify the contribution of the three balance sensory systems .An available tool that has not been evaluated adequately for investigating postural balance is the 3D electromagnetic sensor system; its advantages are lower cost and ease of transportation to different sites. At present there are several models of this device, each with a different number of sensors. These may be employed in multisegmental posturography because minor oscillations of different body segments - and thus a direct investigation of posture controlling kinematics - can be studied.21Accornero et al. used this technology with two sensors (one on the head and the other on the lumbar area) to study volunteers on a stable surface with eyes open and closed. Head sensors, however, limit the possibility of analyzing several degree of freedom of this bodily segment.The purpose of this study was to evaluate a new method for analyzing static postural balance by employing a 3D electromagnetic system with a single sensor, during a modified clinical test of sensory interaction and balance (mCTSIB). The advantages of this method are its portability and reasonable cost; it also yields simple and easily interpreted data.This was a contemporary cohort cross-sectional study that enrolled 25 healthy volunteers  aged 18 to 35 years. Volunteers were chosen from students and staff of a public university campus. All volunteers were informed in detail about the methods of this study and signed a free informed consent form. The institutional review board approved the study (Process 244/2008).A clinical history was taken of volunteers to identify possible medical conditions. Exclusion criteria were the presence of vestibular, neurologic, osteomuscular, cardiovascular, and psychiatric disorders, and visual difficulties without corrective lenses.The weight and height of volunteers was measured to calculate the body mass index (BMI). The body weight was measured on Filizola digital scales  with the subjects using light clothes and no shoes. Body height was measured with a non-extendible 0.5 cm graded vertical bar stadiometer. All volunteers were classified as sedentary according to the International Physical Activity Questionnaire .st thoracic vertebra of each volunteer was measured. The system transmitter was placed over an uncoupled support from the volunteer's body at a 40 cm distance and at the height of the sensor  electromagnetic sensor system was employed to measure the 3D position and spatial orientation of volunteers. The relative position  of the receptor sensor fixed over the spinous process of the 1e sensor . Data we3 density foam platform .The surfaces were a wood platform  and a 30 kg/mVolunteers remained in orthostatism with arms held loose alongside the body and feet slightly apart over a reference surface during data acquisition. They were instructed to remain static, not moving the upper limbs, ankles and feet over the wood platform (stabile surface) and on the foam platform (unstable surface). The mCTSIB, which consists of four sensory condition, was applied in the following order: condition 01: stable surface, eyes open (OASE); condition 02: stable surface, eyes closed (OFSE); condition 03: unstable surface, eyes open (AOSI); condition 04: unstable surface, eyes closed (OFSI). In the eyes open conditions, subjects were asked to fix their gaze on a point 1.5 meters facing them. Each sensory condition was assessed during 90 seconds.Data in the laptop were processed mathematically using software designed for this purpose in the LabView 8.0 environment and transformed into maximum displacement, velocity and path values.The maximum anteroposterior displacement was the largest amplitude of anteroposterior movement (a-p); maximum middle-lateral displacement was the largest amplitude of middle-lateral movement (m-l). The path  was defined as the total path taken by the body during the data acquisition time in the anteroposterior and middle-lateral directions. The mean velocity was calculated as the ratio between the path  and time. The calculation variable/height was done for the corrected statistical data analysis according to the height of each volunteer.\u00ae) version 16.0 was used for electronic data processing; the Origin\u00ae, version 6.0  statistical software was used for building the charts.The Shapiro-Wilk test was applied to test whether variables were distributed normally. Student's t test was applied to analyze the physical characteristics of the study population. The ANOVA test and Tukey's post hoc test were applied for comparisons among sensory conditions - bicaudal test at 5% significance. Pearson's correlation test was applied to analyze the correlation among variables without and with volunteer height correction. The SPSS  for postural balance without correcting for height of individual in the open eye condition revealed significant differences in the parameters m-l path (p=0.004), total path (p=0.014), m-l velocity (p=0.004) and total velocity (p=0.014). There were significant differences in all parameters in the closed eye condition (p<0.001).A strong correlation  was found among all variables without and with correction for individual height.\u00ae) with a single sensor placed over the thoracic spine was effective for recording information about postural oscillation and for detecting differences among sensory conditions. Our group developed specific software for acquiring, treating and analyzing information about human posture collected with this device. Therefore, the method became easy to apply and data interpretation and analysis was facilitated.Using a 3D electromagnetic device  and a surface . The resulting six sensory conditions help identify which sensory information the patient primarily trusts in for spatial orientation and which sensory conflict situations cause instability.\u00ae) was also able to demonstrate significant differences among open and closed eyes on an unstable surface, which traditionally do not occur on a stable surface. This suggests that proprioceptive information is more relevant than visual information for static balance.The 3D system and testing in different sensory conditions enabled us to analyze the influence of vision (eyes open and closed) and the surface (stable and unstable) for maintaining balance. As noted in several studies that applied the force platform,According to Chiari et al., height is a relevant parameter for analyzing balance in an inverted pendulum model.\u00ae) has several uses; it is able to measure the real time spatial position and orientation of an object with a 2 mm accuracy. This device, however, is not often used for posturography. As far as we know, a single study by Accornero et al. (1997) has been published using this technology.The 3D electromagnetic sensor system (PolhemusBased on our study, we propose a different method by employing a single sensor in a different position, which was able to measure postural balance parameters and detect changes in sensory conditions. We also developed a new data acquisition and analysis software. Furthermore, while Accornero et al. studied volunteers only on stable surfaces, our work evaluated postural oscillation on stable and unstable surfaces.The limitations of this equipment are the data acquisition environment - places with considerable structural metal content or major electrical systems should be avoided, which may affect the magnetic field and interfere with data gathering. This was a pilot study enrolling only young healthy subjects. Additional studies are needed to define the sensitivity of this method so that parameter differences may be detected in several populations. Adding a stimulus that causes visual conflict to then proceed with the original CTSIB, and using a moving surface to evaluate the dynamics of postural control, may increase significantly the scope of this device.We present an affordable method employing an easily transported device for analyzing postural oscillation in different sensory conditions. Data on healthy subjects are presented to be later compared with other populations and individuals with several diseases. This tool may become useful for helping define appropriate rehabilitation measures and to provide information to be used when monitoring the results of any given therapy."}
+{"text": "Reining in Anxiety (RiA) is a therapeutic program for youth with mild-to-moderate anxiety delivered in a therapeutic riding setting by Certified Therapeutic Riding Instructors. RiA is based on five foundational components of Cognitive Behavioral Therapy (CBT): in vivo exposure, cognitive restructuring, youth psychoeducation, relaxation, and caregiver psychoeducation about anxiety. The intervention sought to support youth between the ages of 6\u201317 with self-identified anxiety. Due to global pandemic trauma, in the second iteration of the protocol, researchers also included two evidence-based trauma components: maintenance and personal safety skills. All instructors were trained in the RiA curriculum and delivered the same lessons. In addition to assessing the youth\u2019s perception and changes over time, the researchers also assessed changes in the horses, both through saliva sampling. The authors learned that RiA may be a promising approach for reducing anxiety and stress among youth and that the intervention can be delivered by adaptive/therapeutic horseback riding instructors in a non-clinic setting.n = 39) ages 6\u201317 with caregiver-identified mild-to-moderate anxiety participated in a ten-week therapeutic intervention (RiA), which combined adaptive riding and components of CBT. Physiological data and self-report measures were taken at weeks one, four, seven, and ten for the youth and horses. Saliva assays assessed cortisol as a physiological marker of stress and anxiety, and oxytocin as a measure of relaxation. Fidelity data were recorded per session. Anxiety, as measured by caregiver self-reporting, significantly decreased from pre- to post-test, while emotional regulation scores increased. No significant changes in self-efficacy from pre- to post-test were observed. Saliva samples obtained from participants before and after riding sessions showed a consistent decrease in cortisol and a significant increase in oxytocin at two of the four timepoints (Week 1 and Week 7), but no overall pre- to post-test changes. Horse saliva data were collected using a modified bit; there were no significant changes in oxytocin or cortisol, suggesting that the horses did not have an increase in stress from the intervention. RiA may be a promising approach for reducing anxiety and stress among youth, as measured both by self-reported and by physiological measures. Collection of salivary assays for both youth and horses is feasible, and the intervention does not increase stress in the horses. Importantly, RiA can be delivered by adaptive/therapeutic horseback riding instructors in naturalistic  settings. As youth anxiety is a growing public health problem, novel interventions, such as RiA, that can be delivered naturalistically may have the potential to reach more youth and thus improve their quality of life. Further research is needed to examine the comparative value of RiA with other animal-assisted interventions and to assess its cost-effectiveness.Reining in Anxiety (RiA) is a therapeutic program for youth with mild to moderate anxiety delivered in a therapeutic riding setting by Certified Therapeutic Riding Instructors. RiA was developed after a review of the evidence base for youth anxiety, is manualized, and includes five core CBT components: in vivo exposure, cognitive restructuring, youth psychoeducation, relaxation, and caregiver psychoeducation about anxiety. This study extended findings from a prior RCT that examined (1) the feasibility of collecting saliva samples from horses and children to measure stress (cortisol) and relaxation (oxytocin); (2) whether changes in stress and relaxation occurred both during each lesson and over the course of the 10-week intervention for horses and youth; (3) whether changes in anxiety symptoms, emotional regulation, and self-efficacy found in the first trial were comparable; and (4) if fidelity to the program was reliable. Youth participants ( Anxiety disorders are the most common class of mental health conditions in childhood and adolescence ,2, affecAnxiety interferes with academic functioning and negatively impacts youths\u2019 relationships with family members and peers . AdditioCognitive\u2013Behavioral Therapy (CBT) is the evidence-based practice (EBP) considered to be the gold standard of treatment for youth with mild and moderate anxiety. In ,11, the However, EBPs such as CBT are largely unavailable or inaccessible to most youth ,15. Fami\u00ae  on treatment for anxiety in youths. PracticeWise\u00ae provides a virtual warehouse of synthesized research findings from more than 1000 controlled studies of effective psychosocial interventions for youth with mental health disorders, including anxiety. The adaptive riding program, called Reining in Anxiety (RiA), was designed specifically for youth with mild-to-moderate anxiety, with the intention of being delivered in an arena with fidelity by CTRIs, not licensed mental health clinicians [In 2018, the authors, who include Professional Association of Therapeutic Horsemanship International (PATH) Certified Therapeutic Riding Instructors (CTRI), equine owners, and child mental health research and treatment specialists, developed a novel adaptive riding program, drawing core elements from the comprehensive evidence-based reviews summarized by PracticeWiseinicians ,24,26,27RiA was initially tested in a randomized trial in New York City with a sample of youth between 6 and 16 years of age who met criteria for mild-to-moderate anxiety . Youth wParticipants were 39 youth between 6 and 17 years of age with mild-to-moderate anxiety, as measured via self-reports from their caregivers. All participants were active students at Fieldstone Farm Therapeutic Riding Center (FSF), a premiere Professional Association of Therapeutic Horsemanship International (PATH)-accredited facility in northeast Ohio. The Center is located on 45 acres, with 40 horses and 19 CTRIs. A CTRI is a credentialed professional through PATH International who provides adaptive/therapeutic horseback riding lessons, mounted or unmounted, to individuals with special needs. Each lesson had 2\u20134 students within a reasonable developmental age, and the instructor had the skill to successfully teach the group. Lessons were pre-established based on initial enrollment at the Center and were maintained throughout the study. Adaptive horseback riding lessons are often supported by 1\u20133 volunteers per rider.Screening for study eligibility was conducted by FSF using the Generalized Anxiety Disorder 2-item instrument (GAD-2)  and the Inclusion criteria were English-speaking youth between 6 and 17 years of age who had a score of 2 or greater on the GAD-2 and a score of 41 or higher on the CGAS based upon caregiver reports. Exclusion criteria included youth who did not meet the inclusion criteria , had a score below 2 on the GAD-2, or did not meet a minimum level of functioning (did not meet a score of 41 or higher on the CGAS). Inclusion criteria for caregivers included being aged 18 years or older and speaking English; exclusion criteria for caregivers included being younger than 18 years of age or unable to provide informed consent. Staff from FSF were trained by a member of the research team to screen potential participants and refer caregivers of eligible participants to the NYU study team for more information about the study.Recruitment and delivery of the intervention occurred between January and May of 2021. Of the 43 youth/caregiver dyads approached, 39, or 91%, agreed to participate. Data were collected in weeks one (pre-test), four, seven, and ten (post-test). Since volunteers are an integral part of adaptive riding lessons, all volunteers participating in RiA were provided information about the study.Of the 40 horses homed at the Center, 8 horses were engaged in the study. As a premier PATH-Intl.-accredited center, all horses are under the care of a trained equine director. The Center meets the ten equine welfare and management standards, in addition to equine skills, facilities, and other areas of assessment . All horThe New York University (NYU) Langone Health Institutional Review Board (IRB) and the Biomedical Research Alliance of New York LLC (BRANY#183361) IRB approved the protocol. Potential participants were recruited through conversation with existing FSF program attendees and advertisements posted on the FSF webpage. Caregivers and potentially eligible youth met with the study\u2019s research coordinator, who explained the study in detail and secured written informed consent from the caregiver and assent from the child. After consent and assent was obtained, eligible participants were assigned to RiA, an adaptive riding group intervention, with up to four youth per group.\u00ae [\u00ae database, the focus was on treatments for anxiety disorders. The top-five most effective components, or those with the \u201cbest supported research\u201d were: in vivo exposure (92%), cognitive restructuring (66%), client psychoeducation (56%), relaxation (44%), and caregiver psychoeducation (40%). PractiseWise\u00ae provides \u201cpractitioner guides\u201d for each of these core elements, which were utilized by authors to develop session content [\u00ae database. Authors specifically excluded the top effective core element of narrative creation due to the group setting and use of non-mental-health-providers in its delivery. Authors also consulted with PraciceWise\u00ae providers on the structure and sequencing of core elements.The authors of this paper, all of whom are either CTRI professionals, mental health services researchers, and/or licensed mental health professionals, developed a 75-page manualized program for Reining in Anxiety (RiA). RiA is not intended to be a treatment for a diagnosis or disorder; rather, the intervention aims to teach skills that may mitigate the symptoms of anxiety. The intention is to teach skills that youth find helpful and that can translate to other environments. It includes both mounted and unmounted equine interaction activities to develop horsemanship skills, but also adds an intentional focus on mental health goals. Development of the content of the intervention was based on information drawn from PracticeWise\u00ae , a websi content . AdditioThe identified components were integrated into ten, 45 min adaptive/therapeutic riding sessions, detailed in a comprehensive intervention manual, with delivery supported by a separate set of implementation props. Each 45 min session focused on skill development of a specific component of CBT  using repetition, and was reinforced through a weekly homework journal to promote the generalization of skills outside of sessions. While the instructors were responsible for delivering the content of the RiA session, they also had time to teach horsemanship skills in alignment with their role as CTRI, adaptable to riders\u2019 current skill level. The caregiver psychoeducation component was delivered in 7 min segments at the end of each session, with the intention to relay information to the caregiver, as well as an opportunity for instructors to assess children\u2019s skill and knowledge retention. All learning was supported by both a website  and writEight FSF CTRIs were trained in delivery of the RiA protocol. The PATH CTRIs had over ten years of teaching experience with FSF and attended a three-day, in-person training provided by a co-author and co-developer, who is both a PATH CTRI and a licensed mental health clinician. Training the CTRIs in the intervention consisted of an overview of the therapeutic stance, practice of CBT skills , small group discussion, and content evaluation to ensure material retention. Instructors also received extensive implementation supports, including props, such as cards outlining each session\u2019s components and fidelity checklist cards for instructors to assure that essential elements of that session were completed.Instructors participated in weekly peer study groups starting the week following the training, which continued for the duration of the study. The instructors also met weekly for supervision with the co-author and co-developer of RiA during the active portion of RiA. Instructors participated in providing feedback on RiA via survey and focus groups after completion of the protocol trial.The Research Coordinator, located on-site at FSF, is a Licensed Social Worker and CTRI with five years of teaching experience, four of which were at FSF. She was also trained as an Equine Specialist in Mental Health and Learning through PATH Intl. The Research Coordinator served as the Program Director for the Center, and as such, also provided weekly supervision to the instructor, but did not teach any weekly intervention sessions.Fidelity to the manualized protocol was assessed throughout the intervention. The fidelity checklists from the initial study were used for each of the ten sessions, with an adaptation to include the addition of the trauma components. The checklist identified key elements of the session the instructors needed to complete. An example checklist item is: \u201cInstructor gave riders three chances each to provide examples of the connection between a thought, feeling, and action.\u201d The number of items on the checklist for each session ranged from 13 to 18 items.Checklists were completed by direct observation. A research assistant checked a binary yes/no rating on whether or not the instructor completed that part of the session, and fidelity was scored by calculating the percentage of elements marked \u2018yes\u2019 in each session. Research assistants were trained to observe the lessons from outside the arena, where they could see and hear the lesson, but would not be a distraction to the riders or horses. Of the 141 lessons/sessions completed, 136 were rated for fidelity (96.5%). Fidelity scores per individual session  ranged from 88.4% to 100%. Average fidelity scores by instructor ranged from 92.5% to 100%. The average fidelity percentage across all sessions was 97.14%.Youth were assessed via caregiver reports pre-test and at the end of the 10-week session on symptoms of anxiety , attachment anxiety , and self-efficacy . Caregivers also provided sociodemographic data at baseline. Baseline measures were administered in person using iPads, with caregivers answering through REDCap . Post-survey measures were sent to caregivers via email and completed online at home via REDCap. For details on the psychometrics of the psychological measures, see Acri et al. .Saliva samples were collected in weeks one, four, seven, and ten from youth participants before and after each session. Saliva samples were also collected from the horses if the student rode one of the eight horses identified for engagement in the study. Youth used a sterile vial and straw to collect pooled saliva. Due to the COVID-19 pandemic, caregivers were encouraged to collect their child\u2019s saliva while wearing sterile gloves. The Research coordinator and research assistants provided verbal directives. If students were unable to generate 1 mL of saliva or were unable to collect pooled saliva, researchers allowed the use of a cotton swab to be placed under the youth\u2019s tongue in order to collect a specimen.Using a similar process, the horses\u2019 saliva samples were collected before and after their lesson at weeks one, four, seven, and ten. Each horse had a bitless bridle, with the modified bit attached where a typical bit would be. The modified bit was created based on Contreras-Aguilar\u2019s  design: Using sterile gloves, clean cotton gauze was inserted prior to collection. The horse wore the bit for 90 s before the lesson and for 90 s after the lesson. The Research Coordinator was solely responsible for the collection of the saliva samples from the horses. All saliva samples for both children and horses were marked with unique identifiers. Once saliva samples were provided by both humans and equines, they were stored in a privately secured and locked freezer.Univariate statistics were used to describe the sociodemographic characteristics of all participants including children and caregivers. Paired t-tests were used to assess pre/post differences in anxiety (SCARED), emotional regulation (ECR), and self-efficacy. A linear regression was conducted to test if the pre/post changes differed by age. A two-sample t-test was conducted to test if pre/post changes differed by gender, and an ANOVA was conducted to test if pre/post changes differed by race. Linear mixed-effects models were performed to examine changes in oxytocin and cortisol of the participants over time at week one (pre-test), four, seven, and ten (post-test). Wilcoxon signed-rank tests were performed to analyze the pre/post changes in oxytocin and cortisol of the kids at each of the four timepoints. The same analyses were performed for horses. Mean values were used for the horses with different riders at each time point. All analyses were conducted with the software R.SD = 2.8), and slightly over half were female . The majority of children were white , followed by 5 (12.8%) who identified as Black/African American. All identified as non-Hispanic. Almost two-thirds had a mental health diagnosis , which is representative of the individual students who engage in weekly lessons at the center. Caregivers were 45.3 years of age on average (SD = 6.33), primarily female , White , and married . Over one-third  completed a graduate or professional degree, and over half  were employed full-time. The majority of families had an annual family income of over $50,000 USD (n = 29); ten families stated income of less than $50,000 USD.The sample consisted of 39 youth/caregiver dyads. Children were 11.5 years of age on average (SD = 16.46), indicating the likely presence of an anxiety disorder. Post-test, the scores ranged from 40 to 97 (M = 59.65 SD = 12.18), a statistically significant reduction in symptoms of anxiety (p = 0.001). In terms of emotional self-efficacy, pre-test, this subscale score ranged from 8 to 39 , and post-test, it ranged from 8 to 40 , indicating moderately low levels of self-efficacy. There was no statistically significant difference between self-efficacy scores from pre- to post-test (p = 0.07), although the trend was in the expected direction.There was a significant difference in anxiety levels as measured by the total SCARED score from pre-test to post-test. Pre-test, the scores ranged from 42 to 101  and from 32 to 78 post-test ; this change was statistically significant (p = 0.033), indicating an improvement in emotional regulation post-intervention. A linear regression was conducted to test if the pre/post changes differed by age, and there was no statistically significant difference. A two-sample t-test was conducted to test if pre/post changes differed by gender, and again, there was no statistically significant difference. An ANOVA was conducted to test if pre/post changes differed by race. While the SCARED and SEQ-C were not significant, race did predict pre/post changes for the ERC (p = 0.034).Emotional self-regulation as assessed with ERC pre-test ranged from 32 to 77  showed a consistent decrease in cortisol, along with a significant increase in oxytocin at two of the four timepoints (Week 1 and Week 7). In weeks one and four, cortisol and oxytocin levels remained the same, while week seven showed a decrease in cortisol and an increase in oxytocin, and week ten showed a decrease in cortisol and an increase in oxytocin see . Howeverp = 0.203). Similarly, oxytocin was consistent, and there were no statistically significant changes (p = 0.936).To mirror the analysis of the riders, linear mixed-effects models were performed to examine changes in oxytocin and cortisol in the horses over the four timepoints and over the entire 10-week period from pre- to post-test. There were no changes pre- to post-test during any of the weeks. A Wilcoxon signed-rank test showed no significant changes in oxytocin or cortisol. Over the entire course of the 10-week period, while cortisol increased, there was no statistically significant change  used a randomized controlled design and found that RiA reduced symptoms of anxiety and increased perceptions of competence or self-efficacy in managing symptoms more than standard adaptive/therapeutic horseback riding instruction ,27.The study reported in this paper was conducted at a different equine facility in a different state focused on recreating findings related to changes in psychological outcomes  and on examining with exploratory analyses the feasibility of collecting biomarkers for anxiety, stress, and relaxation through saliva assays.Saliva assays assessed cortisol as a physiological marker of stress and anxiety and oxytocin as a measure of relaxation. Specifically, the interest was in exploring the feasibility of collecting saliva samples from horses and youth in order to observe whether changes occurred and, if so, whether these changes followed a similar pattern to the psychological changes in self-reported anxiety over the course of the 10-week program. We also aimed to assess the patterns of these physiological changes during each lesson. Because there is increasing attention to the bi-directionality of protections for human subjects as well as animal participants in research, particularly in studies of animal-assisted interactions, a secondary goal of the research was to examine whether horses experienced an increase in stress due to their participation in the study ,30. ThisSince self-reported assessments of youth anxiety can have inherent biases, we included objective measures of stress, anxiety, and its opposite  to see if the same trends would be observable. Pooled saliva  was used to collect salivary assays from youth, and a modified bit  was usedSaliva was collected at four timepoints throughout the ten weeks of the program and, therefore, could be used to assess changes within each of those four lessons, as well as across the entire program. Among the youth sampled, we found a consistent decrease in cortisol and increase in oxytocin at two of the four timepoints (week 1 and week 7), and no change in the other two.Overall trends from pre-test to post-test for youth showed no changes. The changes in two of the four individual timepoints may suggest that the program was influencing physiological levels of stress during some lessons and not others. Because of the small sample size, it is also possible that the study was underpowered in detecting an effect. The lack of significant changes from pre-test to post-test in these physiological measures was disappointing, but not surprising. RiA was 45 min per week, a fraction of time in the context of a youth\u2019s daily life, so it would likely require a larger intervention over a longer period of time to influence levels of cortisol. Further, it is well known that cortisol levels change frequently over the course of a single day, so consistent and measurable changes over a ten-week period would be challenging to find.A welcome finding was that among the horses, we found no change in stress or relaxation. This held true both for the individual four timepoints as well as across the ten-week program. This suggests that the riding program itself did not add stress to the horses\u2019 daily routine.Fidelity to the program\u2019s core components when delivered with supervision and supports by non-mental health providers, specifically PATH CTRIs, was assessed and found to be excellent: instructors achieved an average score of 97.14% across sessions. This was almost identical to the high-fidelity ratings for this intervention in our first study [As with our prior study, caregiver reports of youth anxiety significantly decreased from pre-test to post-test, and emotional regulation significantly increased. This suggests that the 10-week program seemed to benefit youth. There were no significant changes in self-efficacy, unlike in the prior study, although the trend was in the expected direction. This may be due to factors that could not be controlled, such as the level of prior experience managing anxiety, prior experience riding, length or intensity of the program, or measurement error due to the appropriateness of the scale for this sample .The sample for this study was largely white (79%), and thus, the findings cannot be assumed to generalize to non-white samples. A lack of access to adaptive/therapeutic riding programs for youth of racially diverse backgrounds is a limitation. It is encouraging to note that Fieldstone and a growing number of EAS programs now offer scholarships to support programming for families who may be facing financial hardships, and this often includes families from diverse racial/ethnic backgrounds.n = 39) and involved exploratory analyses, it was underpowered to detect some effects and, unlike our original study of RiA, did not include a comparison group. While the optimal timepoints for saliva collection are not established, it is feasible to collect the same assays from both horses and humans. Moreover, we found that doing so does not add stress to the horses. Similarly, the participants\u2019 typical riding time was not augmented to adjust for ideal saliva collection time points, but rather, they continued riding at their scheduled time (between 4 p.m.\u20138 p.m. ET), when cortisol\u2019s diurnal rhythm varies [Because this was a small sample (m varies ,41,42. WAdditional limitations include that only intervention fidelity was measured in this study. Additional research is needed to confirm that not only was the skill delivered, but that the instructors taught the skill correctly. While there was live observation during sessions, the sessions themselves were not video/audio-recorded, and thus not independently coded for interrater reliability.Results from this study, combined with our prior RCT study, suggest that RiA may be a promising approach for youths aged 6 to 17 in reducing symptoms of mild-to-moderate anxiety and improving emotion regulation. High fidelity to the protocol is possible in therapeutic riding environments. The fact that RiA can be delivered by adaptive/therapeutic horseback riding instructors with fidelity is important, because most children and adolescents with anxiety rarely receive treatment. Traditional mental health services are difficult to find, have long waiting lists, and are typically not evidence-based. EAS that have data to corroborate their effectiveness and that can be delivered by CTRIs can reach a much larger group of children and adolescents who suffer unnecessarily from anxiety. There are over 873 therapeutic riding centers accredited by PATH Intl. employing more than 4800 certified instructors and equine specialists . Given tFurther research on this and other alternative evidence-based services are needed to broaden the reach of effective programs into non-traditional mental health settings, including stables. Cost-effectiveness studies are needed to determine whether the benefits of these programs outweigh the costs to families and to stables. Such studies could also assess whether participation in these kinds of programs reduces the need for or intensity/dosage of medication treatments. Comparative studies of animal-assisted interventions are also needed to better understand the mechanisms of action, the relative effectiveness of them vs. other types of therapies, and the associated costs.The COVID-19 pandemic, coupled with an increased prevalence of youth mental health challenges, including rising rates of suicide, depression, and anxiety, speak to the looming public health crisis for the next generation. A recent Surgeon General\u2019s Advisory on Youth Mental Health  called f"}
+{"text": "Gossypium barbadense.PIN proteins are an important class of auxin polar transport proteins that play an important regulatory role in plant growth and development. However, their characteristics and functions have not been identified in G. barbadense, Gossypium hirsutum, Gossypium raimondii, and Gossypium arboreum, and detailed bioinformatics analyses were conducted to explore the roles of these genes in G. barbadense using transcriptome data and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) technology. Functional verification of the genes was performed using virus-induced gene silencing (VIGS) technology.PIN family genes were identified in the cotton species GbPIN gene family members were widely distributed on 20 different chromosomes, and most had repeated duplication events. Transcriptome analysis showed that some genes had differential expression patterns in different stages of fiber development. According to \u2018PimaS-7\u2019 and \u20185917\u2019 transcript component association analysis, the transcription of five genes was directly related to endogenous auxin content in cotton fibers. qRT-PCR analysis showed that the GbPIN7 gene was routinely expressed during fiber development, and there were significant differences among materials. Transient silencing of the GbPIN7 gene by VIGS led to significantly higher cotton plant growth rates and significantly lower endogenous auxin content in leaves and stems. This study provides comprehensive analyses of the roles of PIN family genes in G. barbadense and their expression during cotton fiber development. Our results will form a basis for further PIN auxin transporter research.A total of 138 PIN family genes were identified in the four cotton species; the genes were divided into seven subgroups.  PIN genin roots . Elementin roots . Howeverstrength ; howeverrt genes . TherefoG. barbadense resource materials that had been preserved by the Key Laboratory of Crop Genetic Improvement and Germplasm Innovation, College of Agriculture, Xinjiang Agricultural University, Urumqi, China. The fiber characteristics of the samples are provided in We used PimaS-7 (low fiber strength) and 5917 (high fiber strength) The test materials were planted in an experimental field of the Xinjiang Academy of Agricultural Sciences, Urumqi, China. Cotton fiber samples were collected at 0, 5, 10, 15, 20, 25, 30, and 35 days post-anthesis (DPA), immersed in liquid nitrogen, and refrigerated at \u201380 \u00b0C until use.G. hirsutum TM-1 (ZJU-AD1_v2.1_a1.0) (G. barbadense Pima3\u201379 (HAU_v2.0) (Gossypium arboreum (CRI-A2_v1.0) (Gossypium raimondii (JGI_221_v2.1) (http://www.cottongen.org). PIN family accession numbers were cross-referenced with Pfam database (https://pfam.xfam.org/) and the associated Markov model files were downloaded. A local database was constructed using HMMER 3.3.2 software to retrieve the initial files, and the amino acid sequences were reconstructed and loaded into the Pfam database for searching (https://cottonfgd.net/) and ExPASy program (https://web.expasy.org/protparam/) was used to predict the length, molecular weight (MW), isoelectric point (pI), instability coefficient, and hydropathic index of the corresponding proteins.We downloaded PIN genomic data for .1_a1.0) , G. barbAU_v2.0) , GossypiA2_v1.0) , and Gos21_v2.1)  from theearching . All amihttps://itol.embl.de/). PIN gene conserved domain positions were determined using the National Centers for Biotechnology Information (NCBI) browser (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi) and the Clustal Omega tool ; Jalview software was used for sequence alignment and to visualize the results.The amino acid sequences of PIN genes were loaded into the MEGA-X software, and the neighbor-joining method was used to construct an evolutionary tree, which was visualized using the iTOL online tool ; the first 2,000 bp of the start codons of PIN genes were loaded into the PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) to predict the motif structure and promoter elements of the PIN genes.The amino acid sequences of PIN family members were loaded into the MEME tool (https://www.ncbi.nlm.nih.gov/), then remove PimaS-7 and 5917 transcripts in the laboratory Group data , and water to a final volume of 20 \u03bcL. The reaction conditions were 40 cycles of 94 \u00b0C for 30 s, 94 \u00b0C for 5 s, and 60 \u00b0C for 30 s.Total RNA was extracted from the collected samples using a polysaccharide polyphenol plant extraction kit provided by Beijing Tiagen Reagent , according to the manufacturer\u2019s instructions. The ABM reverse transcription kit was used to reverse convert the extracted RNA into first-strand cDNA, and the reaction was conducted according to the manufacturer\u2019s instructions. qRT-PCR analysis was performed as follows. The primer GB-UBQ7 was designed using the cotton GbPIN7 gene was subcloned and loaded into the target site of a pTRV2 vector. Agrobacterium containing pTRV1, pTRV2-GbPIN7, and pTRV2-CLA was mass cultured, followed by 1:1 configuration of the transformed bacteria. Working solutions of the experimental group (pTRV1+pTRV2::GbPIN7), positive control (pTRV1+pTRV2::CLA), and negative control (pTRV1+pTRV2 empty) were each injected into PimaS-7 and 5917 plants that had not yet grown true leaves. After inoculation, the plants were grown at a constant temperature of 25 \u00b0C in an artificial culture room under a 16 h/8 h light/dark cycle. After 2 weeks, the albino phenotype was observed and photographed. Leaves were collected from the negative control and experimental groups for qRT-PCR analysis.A cotton gene silencing system was established based on the tobacco rattle virus (TRV) vector . The 320G. barbadense, 46 in G. hirsutum, 24 in G. raimondii, and 24 in G. arboreum. The resulting phylogenetic tree . The lengths of the DNA sequences varied from 767 to 13,644 bp, and those of the coding sequences varied from 576 to 1,938 bp.The amino acid sequence lengths ranged from 191 to 645; the pI values ranged from 4.85 to 9.65; protein molecular weights were distributed from 20.97 to 70.48 kDa; the hydropathic index ranged from 0.21 to 0.76, indicating that all members were hydrophobins. Among the 45 PIN family genes, 16 were unstable proteins, and 29 were stable structures. All members of the three PIN subgroups were localized on the cell membrane, whereas all members of the four PILS subgroups were localized outside the cell .GbPIN13 and GbPIN14 contained six motif structures, three of which were at the beginning of the sequence . Two genes (GbPILS7 and GbPILS9) contained only 3\u2032 UTRs, and the remaining 34 genes had two UTRs  are shown in G. barbadense and G. hirsutum, three sets of collinearity in G. raimondii, and no collinearity in G. arboreum. These results indicate that each member of this gene family in G. arboreum remains highly independent in diploid cotton material; after combining to form tetraploid cotton, they corresponded to each other on chromosomes A and D, but then were lost, possibly due to duplication of function. There were 63, 42, and 22 sets of collinear relationships between G. barbadense and G. hirsutum, G. raimondii, and G. arboreum, respectively. These results may simply correspond to numbers of genes; however, the lack of collinearity between G. barbadense and G. arboreum may indicate that G. arboreum PIN family genes were largely lost through recombination into the G. barbadense gene.Comprehensive genome collinearity analysis results for the four cultivated cotton species  were very low at various stages of fiber development; only GbPIN7 had a high expression level, which differed between the two materials and was directly related to endogenous auxin content.Correlation analysis showed that the expression levels of only five genes were significantly correlated with endogenous auxin content in PimaS-7 and 5917 at different stages of fiber development. rrelated . HoweverGbPIN3, GbPIN4, and GbPIN8) showed a trend of increasing expression from 5 to 25 DPA, followed by low expression  increased at 5\u201315 and 20 DPA, and decreased thereafter in 5917, whereas those of PimaS-7 gradually increased from 5 to 25 DPA, and then decreased  exhibited changes in the number of PIN genes compared with their diploid ancestors (G. arboreum and G. raimondii). The PIN5/6/8 and PILS5 subgroups of G. barbadense had two fewer genes than the sum of genes in Raymond\u2019s cotton and Asian cotton, which indicates that some genes in this subgroup may not be necessary for cotton development. The number of genes in PILS1/3 subgroup increased during evolution. Compared to the original species, the number of genes in this subgroup increased by one, suggesting that the functions of this subgroup of genes functionally expanded during evolution. The remaining four subgroup genes were well represented in terms of quantity and the sequence relationship during evolution from the original cotton material to allotetraploid cotton, indicating that members of this gene family are involved in cotton growth and development.In terms of the number of PIN gene family members, the allotetraploid cotton  in addition to the nucleolus (Arabidopsis during ovule development (PIN3, which led to prediction of the potential auxin flow path in the cotton ovule: auxin moves from the ovule root through the vascular bundle to the fiber cells and nucleolus (In ucleolus , suggestelopment . Previouucleolus . In thisPIN7 gene can influence plant root tillering (PIN7 regulates the growth of various plant tissues.The illering , negativillering , epidermillering , tissue illering , and floillering , but notGbPIN7 gene. The gene downregulation affected plant growth promotion. This study provides a reliable theoretical basis for studying the PIN auxin transporter in sea island cotton and will further assist the molecular breeding process in cotton.This study comprehensively analyzed the PIN gene family in sea island cotton. The results showed that multiple genes in this family were directly related to the accumulation of endogenous auxin during cotton fiber development, thereby regulating cotton fiber development and silencing the 10.7717/peerj.14236/supp-1Supplemental Information 1Click here for additional data file.10.7717/peerj.14236/supp-2Supplemental Information 2Click here for additional data file.10.7717/peerj.14236/supp-3Supplemental Information 3Click here for additional data file.10.7717/peerj.14236/supp-4Supplemental Information 4Click here for additional data file.10.7717/peerj.14236/supp-5Supplemental Information 5Click here for additional data file."}
+{"text": "The prognostic factors for patients with epithelial sarcoma remain unclear. The study aims to develop a practical clinical nomogram that predicts prognosis in patients with ES using the Surveillance, Epidemiology, and End Results (SEER) database.We extracted clinical data from 2004 to 2015 from the SEER database about patients with ES. All patients were randomly divided into training cohort and validation cohort. Kaplan\u2013Meier analyses were used to compare outcomes between different subgroups. In order to estimate the chance of survival for patients with ES, we developed a nomogram. Nomogram performance was evaluated by discrimination and calibration. Additionally, an analysis of decision curves was conducted to evaluate the clinical usefulness of this newly developed model.In the primary cohort,320 met the inclusion criteria to be entered into this study. The median OS was 66.000\u2009months (range 34.704 to 94.296\u2009months), and the 1\u2010, 3\u2010, and 5\u2010year OS rates were 70.7%, 56.1%, and 50.4%, respectively. For the validation cohort, we studied 136 consecutive patients. Age, primary site, grade, AJCC (American Joint Committee on Cancer) T, AJCC M, and surgery were included in the nomogram. The C\u2010index values for the training set and validation set were 0.817 and 0.832, respectively. The calibration plots showed good agreement between the prediction and the observation. Based on the clinical decision curve, the model has a good clinical net benefit for ES patients.It is the first study that developed an effective survival prediction model for patients with ES. Using this nomogram can assist in clinical decision\u2010making as it has satisfactory accuracy. Even so, additional external validation is needed. It is the first study that develope an effective survival prediction model for patients with ES. Using this nomogram can assist in clinical decision\u2010making as it has satisfactory accuracy. Even so, additional external validation is needed. These records represent over 30% of the total U.S. population. All cases were obtained from 18 local cancer registries. We attempt to find the independent risk factors affecting prognosis and develop a nomogram to predict the survival of patients with ES based on clinicopathological data. We used the SEER database to identify all cases of ES diagnosed between 2004 and 2015 based on ICD\u2010O\u20103.2.2p\u00a0<\u20090.05 in two\u2010sided analyses. Survival curves are calculated using Kaplan\u2013Meier method. Based on the log\u2010rank test, we evaluated the survival differences between the subgroups. To identify prognostic variables, the Cox regression model with hazard ratios (HRs) and 95% confidence intervals (CIs) was used in the training cohort. A multivariate analysis using forward stepwise regression was conducted using variables selected in univariate regression with a p\u2010value\u2009<\u20090.05. We chose T, N, and M variables instead of stage variables to avoid multicollinearity in the multivariate analysis. Identification and calibration measurements were used to verify the nomogram model. We calculated the C\u2010index, which quantifies the difference between observations and predictions, and shows the predictive power of the model. ROC curves (Receiver operating characteristic curve) and calibration curves are plotted to verify the discrimination and calibration of the model. The calibration plot of the model displays the calibration between the predicted and actual rates of survival. Additionally, decision curve analysis (DCA) was performed to evaluate the clinical effectiveness and benefit of the prediction model. We used IBM SPSS Statistics 23 and R software (version 4.0.3) for our statistical analyses.A patient's survival time is defined as the period between the time of diagnosis until the last follow\u2010up or death. Statistical significance is defined as 33.1From 2004 to 2015, SEER recorded 622 patients with ES. Our analysis involved 456 patients .The variables in the univariate Cox regression that were statistically significant (p\u00a0<\u20090.05) were incorporated into the multivariate analysis. In the multivariate analysis of OS, variables including age, primary site, grade, AJCC T, AJCC M, and surgery were all statistically significant. According to multivariate analysis, the outcomes were improved in patients with younger age, superficial Primary site, well\u2010differentiated stage, lower T and M stage, surgery.Results of univariate and multivariate Cox regression for OS were stated in Table\u00a03.3We depict the model incorporating six independent factors that affect overall survival. Figure\u00a0 The C\u2010in4According to our knowledge, no existing epithelioid sarcoma prognosis prediction nomogram has been developed and validated before this study. Nomograms rely on easy\u2010to\u2010use digital interfaces, better accuracy, and more clear prognoses to help doctors make better decisions. Currently, nomograms are widely used in clinical work as prognostic devices. The prognostic predictors for the nomogram were age, primary tumor site, grade, surgery, T stage, and M stage. Figure\u00a0.In terms of the ability to predict the prognosis of patients, we compared our prediction model with the TNM staging system. In training and validation cohorts, the C\u2010index was 0.818 and 0.832 for predicting OS, while the C\u2010index for TNM stage was 0.744 and 0.724. In terms of predicting the 1\u2010year, 3\u2010year, and 5\u2010year OS, the areas under the curves of our model are 0.846, 0.809, and 0.802, respectively, while the areas under the curves of TNM stages are 0.838, 0.777, and 0.784, respectively. From the results of the above, we can easily find that our model based on more clinical information has a better predictive effect than the TNM staging system.p\u00a0<\u20090.05). According to a previous study by Livi et al.Using the SEER database, we created a prognostic model to determine the prognosis of ES patients based on large\u2010sample data. A total of 456 patients were enrolled in this study. This study supports previous research that elderly patients have a poorer prognosis.Our research shows that the model efficiently predicts the survival of patients with ES, thereby improving the accuracy of clinical decision\u2010making. There are some limitations to our study that should be noted. Firstly, stages were organized based on the 6th AJCC staging system, which could limit its effectiveness. Secondly, our nomogram was constructed based on the SEER database, where partial patient information is necessarily lost. As a result, there may be fewer qualified cases, which may increase the selection bias. Lastly, the study is a retrospective cohort study. In the current situation, given that ES is a very rare soft tissue sarcoma, the most reliable way to study the prognosis of this disease is using public database. Yet, the prognostic nomogram we constructed needs to be validated by further prospective cohort studies.5It is the first study that developed an effective survival prediction model for patients with ES. Using this nomogram can assist clinical decision\u2010making as it has satisfactory accuracy. Even so, additional external validation is needed.Study design: DZ, JH, and ZL. Methodological development: DZ and JH. Data acquisition and statistical analysis: DZ, JH, ZL, HW, and HC. Study Research guidance and supervision: CL. All authors contributed to the article and approved the submitted version, and wrote the manuscript.This work was supported by the Science and Technology Program of Guangzhou(202102010259).The authors declare that they have no conflicts of interest related to this paper.No personal identifying information was used in the study. Hence, we did not require Institutional Review Board approval or patient informed consent.All authors agreed with the content, all gave explicit consent to submit, and we obtained consent from the responsible authorities at the institution where the work has been carried out, before the work is submitted."}
+{"text": "Optimizing equine wellbeing is of concern to horse owners and key stakeholders in the equine sector. However, the language horse owners use to discuss wellbeing is not well understood and terms such as quality of life and welfare are often used interchangeably. Little is known about how those providing day-to-day care of horses use terminology, or what this means for wellbeing assessment. This study collected qualitative data from focus group discussions with UK leisure horse owners. Analysis identified that horse owners did not clearly delineate between different terms. Individually constructed equine wellbeing assessments were ongoing, and shaped by factors such as the horse\u2019s purpose and owner\u2019s ideas about good horse care. Strategies to support owners and improve communication must pay attention to the dynamic and contextualised nature of horse owners\u2019 experiences.Human assessment of equine wellbeing is fundamental to ensuring the optimal care of domestic horses. However, terminology associated with wellbeing is still not fully defined and there are currently no validated quality of life (QoL) assessment tools. Furthermore, little is known about what equine wellbeing or QoL means to horse owners, or how their beliefs impact on the management decisions they make for their horse. This study sought to establish how UK leisure horse owners use wellbeing-related terminology by exploring their accounts within a focus group setting. Four online focus group discussions (FGD) were held and qualitative data were collected. FGDs involved a semi-structured discussion, followed by a group activity to compare seven equine wellbeing-related terms of interest introduced by the facilitator. The collected data were analysed using a constructivist grounded theory approach, and also by content analysis, to examine the frequency and subjective meaning of the terms of interest. The results showed that horse owners did not clearly delineate between different terms, rather, they used the terms in the context of their own assessments of their horse. The meanings assigned to what owners experienced with their horse were individual and subjective, shaped by past experiences, relationships with their animal, and peers or social groups. This individualised construction of equine wellbeing impacted on the meaning conveyed when using wellbeing-related terminology. In this study, we extend the literature on equine wellbeing terminology usage, and highlight differences between the academic literature and the real-world experiences of horse owners. In the field of equine welfare science, strategies to improve equine lives have focused on enhancing human assessment of the horse, on the premise that better recognition of poor wellbeing could enable horse keepers to improve welfare outcomes . ScientiResearch has found that horse owners and veterinary surgeons (veterinarians) use terminology such as quality of life, wellbeing and welfare when discussing topics including equine obesity, ageing and end-of-life care ,8,9. At While the meaning of the word \u201cwelfare\u201d has received extensive attention in scientific writing ,12,13, oTo date, there are no validated Quality of Life (QoL) assessment scales for horses, and so assessment is encouraged through the use or adjustment of existing welfare assessment tools and pain scales ,16,17. RDespite the attention and care devoted to leisure horses, health and wellbeing issues are widespread: these include unrecognised pain, obesity and delayed euthanasia ,20. SeveThe aim of this study was to establish how leisure horse owners conceptualise horse wellbeing and use wellbeing-related terminology. Using a qualitative approach, this study sought to explore horse owners\u2019 use of equine wellbeing terminology, to understand the relationships between the terms of interest and to observe the process of collective understanding in a group context . This paper reports on qualitative data collected from four focus group discussions (FGD) held from February to April 2021. Participants who identified themselves as leisure horse owners were recruited using targeted social media advertisement and gatekeepers known to the research team. Initially, all participants who applied to take part in the study were included; however, no male horse owners had replied, and hence purposive sampling with an advert specifically seeking male participants was employed. Participants had varying degrees of equine experience, kept horses for different leisure roles (ranging from amateur competition through to retirement), and were from across the UK and a range of ages. Brief participant information is given in FGD were held online using Zoom and were approximately of 90 min duration. RS and TF facilitated the semi-structured FGD. Following an explanation of the study\u2019s purpose and planned methods, participants introduced themselves to one another. The sessions then consisted of two parts which aimed to first elicit participant\u2019s own experiences of thinking about wellbeing and explore the language used in their spontaneous speech, then to explore the terms of interest comparatively. To achieve this, an initial discussion using a topic guide  using a constructivist Grounded Theory methodology . This apOne FGD transcript was selected for open coding by RS, TF and CB, who initially coded the transcript individually by assigning iteratively developed codes or \u201clabels\u201d to units of speech. Initial codings were jointly reviewed and codes amended to ensure consistency. Further analysis involved constant comparison, through which data were compared and codes were reviewed and refined. This involved examining language and the context of its use, as well as how participants interacted during discussions. During this process, codes were grouped into larger categories and conceptual themes were developed. Conceptual models were developed as a way of analysing relationships between data. Using theoretical sampling, we recruited participants for a male-only fourth FGD in order to explore whether wellbeing assessment was different in the context of these horse-human relationships.In addition, a content analysis of the data was undertaken to enable direct comparison of the frequency and use of terms. Results are discussed in Section 3.2Whilst reflecting on our own roles as researchers we felt it was important to consider our experience of owning or caring for leisure horses and position as equine welfare researchers. We met regularly to discuss our own interpretations of meaning in the data and reviewed ongoing analysis. Upon collection of data from the four FGD we considered our analysis to be conceptually rich and we describe this as reaching theoretical saturation . All quoThis study identified themes which were developed into a conceptual model to illustrate how individuals viewed a horse\u2019s wellbeing: demonstrating the ways in which this was shaped by their past experiences, social influences and their relationship with their horse. These individualised constructions of wellbeing reflected differences in how participants constructed the relationship between health and wellbeing.There was diverse use of terms such as wellbeing, welfare and happiness across the groups, but despite this, there were no examples of confusion around item meaning between participants. Participants demonstrated a tacit understanding of the concepts being used even though the same words were used in different contexts. The terms most often used in spontaneous speech by participants to describe a horse\u2019s state were welfare, and happiness. Each of the terms of interest were used with a variety of meanings, incorporating a great deal of crossover. This highlights the semantic fluidity of the language used to describe animal wellness, with meaning being constructed through the context in which the language is used.The results section will focus first on how participants\u2019 understandings were generated, before focussing on the linguistic constructs explored in this study. everyday\u201d or \u201call the time\u201d.Participants\u2019 understanding of horse wellbeing were generated through ongoing informal assessments as part of everyday horse care. When asked to tell the group about a specific time when they had thought about one of their horse\u2019s or any horse\u2019s wellbeing, participants said \u201cFour major themes were identified as shaping participant\u2019s individualised understanding of wellbeing, which in-turn shaped how they made more formalised judgements. These were \u2018principles of \u201cgood\u201d horse care\u2019, \u2018modifying outside influences\u2019, \u2018ways of knowing\u2019 and \u2018assessing the individual horse\u2019 .At the broadest level, \u2018principles of \u201cgood\u201d horse care\u2019 were particular ways of managing a horse that participants believed were most aligned with achieving optimal wellbeing. \u2018Modifying outside influences\u2019 were factors which informed these principles. These factors generated understanding around what was necessary to provide for a horse, without needing to be situation-specific.As owners considered more specific, situational wellbeing assessments, \u2018ways of knowing\u2019 provided a means for owners to make decisions about what was \u201cright\u201d or \u201cwrong\u201d for an individual horse. These ways of knowing could shape the subsequent perception of a horse\u2019s wellbeing and were closely related to an owner\u2019s relationship with a horse. Through a person\u2019s interactions with their horse, their principles were constantly adapted and updated in line with their changing knowledge about, and relationship with, the horse. Therefore, the process of caring for a horse, as well as wider societal change, shaped the lens through which assessments were made. Consequently these horse owners might have an entirely different perspective on the wellbeing of their individual horse, based on individual experiences and ideologies, compared to the assessment performed by another person, such as a veterinarian or another horse owner.As these ongoing wellbeing assessments were part of owners daily interactions with their horse, they formed a basis for making decisions about care. In this way, care practices comprised an ongoing, iterative cycle of observation and management adaptation.Each of the four themes will be discussed in turn, beginning with the broadest level (principles of \u201cgood\u201d horse care) and moving to the most specific .Participants\u2019 understanding of care practices that aligned with \u2018responsible\u2019 horse ownership translated into judgements about what was \u201cright\u201d or \u201cbest\u201d in terms of horse care, e.g., not riding a horse before physical maturity, keeping horses barefoot (without shoes), or not selling horses. Principles were constructed, such as discourse advocating keeping a horse \u201cnaturally\u201d. Where participants were aligned with these principles, this became part of their horse-keeping identity:\u201cI like them to have as natural a lifestyle as possible\u2026 Everyone is out 24/7. There\u2019s no rugs, there\u2019s no clipping. The ones that are ridden are bitless. There\u2019s no shoes. Natural is just my thing.\u201d(focus group 4)As participants communicated with one another regarding these ideologies it was evident they were used as a way of expressing their own sense of self. For example, keeping horses barefoot was constructed as a major part of ones\u2019 identity as a horse owner, and a shorthand for an ideology around \u201cnaturalness\u201d; a discussion which formed a core part of focus group three.Individuals understood that a horse had certain needs, both in terms of provisions and activities involving the horse. However, the practicalities of this were closely linked to a horse\u2019s given purpose, and this impacted on beliefs around the provision of turnout, companionship and ridden exercise:\u201cHe was a show horse. So they would want to keep everybody separate\u201d(focus group 3)\u201cI had a horse who would have been quite happy as a pasture ornament. But for him to be a respectable member of society he wasn\u2019t allowed to do that, he needed a job\u201d(focus group 2)Beliefs around how a horse should ideally live, and what compromises were acceptable, were understood to differ in line with discipline norms. Therefore, what one group may consider to be a concern, another may not:\u201cI\u2019ve known people tell me about a quarter of a million pound Olympic dressage horses, which are psychotic, because they can only be ridden by one person, they can only be ridden in a strict routine, from the stable to the arena. Never ridden outside, never goes into a paddock. So you\u2019ve got these sort of quality of life.\u201d(focus group 4)These constructs were also expected to change in line with increasing age, requiring an individual approach to wellbeing assessment:\u201cthose words, good life, best life or life worth living, are things that we impose on our horses or animals, from a perspective, even our relatives. That\u2019s where our own sort of personal views and values come in, to make that judgement on what we feel a horse\u2019s quality of life is going to be like. That quality of life is going to change at the various stages of their life and how old they are.\u201d(focus group 4)Social norms linked to specific disciplines or horse use shaped individual owners\u2019 beliefs and values relating to what equine wellbeing meant, and what was necessary to ensure it. However, there was acknowledgement by some participants that views on this varied:\u201cif you had a young horse that then sustained an injury that meant that it wasn\u2019t going to be a racehorse, like it was expected to be. But it\u2019s still going to be able to be a good companion horse, someone might feel that actually that\u2019s not a good quality of life for that horse that had the potential of being something amazing and might take a different view on its wellbeing\u201d(focus group 4)When conversations were theoretical , these principles were strongly relied upon. For example, when applied to weighing up equine QoL or potential euthanasia decisions, participants also made judgements about horse-keeping practices which did not align with their own principles. One participant described drawing on these principles when considering situations such as the need to box rest a horse for a lengthy period of time:\u201cif it had been my pony I think I would have had her put to sleep, because it just felt cruel that this pony was literally living in a box. And I don\u2019t think that is right, personally.\u201d(focus group 3)As well as questioning others\u2019 practices, one participant also spoke about their own experiences of being reported to an animal welfare charity, despite believing their horses were being well-managed. As each individual horse owner constructed their own unique \u2018principles of \u201cgood\u201d horse care\u2019, and assessed a particular horse in the context of it, in reality, perceptions of equine wellbeing differed between participants.Similar inter-participant differences have been revealed about the moment at which euthanasia was deemed appropriate. Despite end-of-life decision-making being constructed by participants across the focus groups as a part of responsible ownership, the point at which wellbeing was considered compromised enough to warrant euthanasia, varied from person to person, and could be reconstructed at later time points.In this study participant\u2019s horse-keeping environments included livery yards, retirement livery, private or home premises. Many participants were conscious of the influence of peers within their horse-keeping environment, particularly when individual beliefs on appropriate care conflicted with peers, leading to differences in perception of an individual horse\u2019s wellbeing:\u201cSome people on the yard think we\u2019re ridiculous, keeping her going, given that we don\u2019t use her, other than walking her out every day and so on\u201d(focus group 2)These environments created the context in which relationships with, and care of, the horse took place. Decisions about where a horse was kept were multifactorial, and owners often had to make compromises regarding their horse\u2019s lifestyle when making yard choices. On livery yards the individual horse\u2019s care was situated alongside the needs of all the other horses on the yard, meaning that the owner\u2019s preferred options  might not have been possible. As choices made by owners were based on their principles of ideal horse care\u2014for example, the desire to offer daily turnout as a perceived core component of wellbeing\u2014this sometimes led participants to choose yards with turnout which were impractical in other ways. Some owners had moved premises, some preferring to move from livery yards to private/individual premises in order to achieve more control over their horse\u2019s daily care and offer a lifestyle which contributed to a perceived higher level of wellbeing:\u201chaving to compromise when farmers or livery owners, yard owners don\u2019t want to mess with their fields, well, do you know what, I don\u2019t care about messing up a field. The horses\u2019 wellbeing comes first for me, and that\u2019s why I ended up just renting a field so that I got that choice, and I\u2019ll never go back.\u201d(focus group 1)\u201cI have moved yards before because they didn\u2019t have enough turnout, for instance, and my one needs to be out or she is not healthy or happy, and she gets those stereotype behaviours, and it is just not great\u201d(focus group 3)When considering their horse\u2019s wellbeing, owners\u2019 views were sometimes informed by independent research as well as professional advice. For some participants, the need for social support which aligned with their own views meant advice was sought online, where groups of horse owners could come together around a locality  or principle of horse care . In these groups, principles of care were socially reinforced, leading to owners forming communities of practice around perceived methods of improving equine wellbeing. For example, the following participant had started a new online group for owners of horses who had 24/7 turnout:\u201cWe\u2019ve got over 8000 members now. And so many people come on there and go, \u201cI am so glad to have found this group because on my yard everybody\u2019s saying \u2018Why isn\u2019t your horse wearing a rug, why isn\u2019t your horse clipped, why doesn\u2019t your horse come in at night, why are you leaving him out in all the rain?\u2019\u201d You know, and they\u2019re so pleased to find a group that agrees with everything they say because most of the yards are still treating horses like they were dogs or humans.\u201d(focus group 1)These groups contributed to and supported owners\u2019 perceptions of what constituted equine wellbeing by providing social validation, often in situations (as in the example) where others had contested those views.Veterinary advice was infrequently discussed in this study. Advice was reportedly sought when deemed necessary or relevant to an issue of concern. For some participants, veterinarians could provide specific additional knowledge:\u201cI don\u2019t have my vet\u2019s skill, tools or ability to assess their physiology or to see what\u2019s going on.\u201d(focus group 4)However, there was some scepticism over seeking veterinary advice. For example, perceptions of a limited knowledge of an individual horse, unsuitable husbandry advice, or inappropriate guidance around diagnostics or treatments, impacted on how veterinary knowledge was perceived:\u201cAnd even my vet, with the last laminitic episode that my quarter horse had, said you need to only feed her so much. She\u2019s not overweight. It wasn\u2019t that, it was the type of forage, so he was completely off the ball and he\u2019s lost a bit of credibility with me but that\u2019s another issue.\u201d(focus group 1)Owners employed three strategies in order to make judgements about a horse\u2019s wellbeing. These included ongoing learning about the horse, monitoring a situation over time, and using heuristics. Owners combined these strategies to make decisions, though in some situations one strategy could be more strongly relied upon than others. Although these strategies or \u2018ways of knowing\u2019 could be applied to any horse or situation, relationships with individual horses were needed to make the most appropriate judgements.Ways of Knowing: Ongoing, Experiential learningThe ability to understand horse wellbeing and horse care was constructed as an ongoing journey. Participants suggested that they were continually updating their knowledge and practices. Ongoing learning was a result of increasing their knowledge , and experience. Consequently, owners often viewed their past actions as examples of poor horsemanship which resulted in compromised wellbeing in their own horses:\u201cYou learn something that works and then you are like ashamed of what you used to do.\u201d(focus group 3)\u201cAs I\u2019ve tried to find out more and more, I\u2019m still aiming for my horse to have its best life for each one of them. I\u2019m probably not perfect, well, there\u2019s no probably, I\u2019m not perfect, I\u2019m still not there but I know that my horses have a much better welfare standard than what they would have been 15 years ago with what I\u2019m doing and how I\u2019m keeping horses. They\u2019ve got a much better quality of life for sure\u201d(focus group 1)Participants described scenarios in which, on reflection, their equine-related knowledge had increased over time. For example, one participant described his increased confidence in monitoring his partner\u2019s horse\u2019s welfare, as a result of his increased time spent with, and therefore better knowledge of their horse:\u201cWhat I\u2019m getting from a lot of the gents here is that experience over many years has led them to be able to recognise that. At first, maybe in the first few months of me looking and caring after the horses at the time, I didn\u2019t recognise those things because I wasn\u2019t sure what I was looking for. But now, three years down the line, I start to feel like I could pick up things like lameness or just a general, being subdued, whilst in the stable etc\u201d(focus group 4)Along with scenarios in which experiential knowledge was applied to the judgement of equine wellbeing, some participants shared how end-of-life decisions would likely be altered by knowledge from previous experiences. Past experience could form a frame of reference within which judgements about current situations could be made:\u201cIf she ever had that again, I don\u2019t think we\u2019d put her through it. So, welfare and wellbeing, it obviously worked out she had another three years fine, but if it ever happened again, I don\u2019t think we\u2019d do that again, would we?\u201d(focus group 2)Ways of knowing: Monitoring over TimeMonitoring changes over time allowed horse keepers to determine whether the horse\u2019s wellbeing was subject to change; change was considered indicative of a potential problem which could warrant attention:\u201cI think if anything changes from the normal. That\u2019s what I would indicate as an issue, if their behaviour changes.\u201d(focus group 2)Participants described that all horse interactions involved some level of (often unconscious) monitoring of the horse\u2019s wellbeing over time:Would you be able to tell us about a specific time when you\u2019ve thought about your horse\u2019s wellbeing?\u201cFacilitator: About every day. (Laughter) \u2026\u2026 you\u2019re constantly thinking about the welfare and wellbeing of your horses. It is a constant\u201dParticipant: (focus group 1)This strategy could be used for any horse seen over a period of time; some participants spoke about monitoring and assessing the wellbeing of horses owned by others but which they were in contact with regularly. One participant was an instructor to other horse owners and was able to monitor their horses during her teaching sessions, while others spoke about observing the wellbeing of horses on their yards, or nearby fields over time. Contrastingly, several owners described the ongoing monitoring of their horse\u2019s wellbeing by livery yard employees, particularly where a horse was on full livery.Interestingly, monitoring for changes in all circumstances was informal, with no instances of participants describing keeping registers or diaries of behaviour or physical health .Ways of knowing: HeuristicsHeuristics are a \u201cdecisional short cut\u201d  in which\u201cI felt that wasn\u2019t a quality of life. I thought it was a horrendous life for that horse. It existed.\u201d[about a horse on long term box rest] (focus group 3)\u201cin my head, I\u2019m very clear that, if I can\u2019t get him right, he is going to the big paddock in the sky. Because I\u2019m relatively young and relatively fit and if I won\u2019t sit on it, nobody else is going to.\u201d(focus group 2)box rest is not good quality of life\u201d and \u201cI would not sell a difficult horse\u201d). In both instances, and many others in the data, participants described principles they used in order to make wellbeing associated judgements Interestingly, there were many instances throughout the data in which people felt it necessary to diverge from the heuristics that they relied upon in other situations. For example, participants who preferred not to stable a horse also described times when the situation necessitated stabling, or participants who preferred horses to be kept in company described keeping a horse in isolation:\u201cI have got a little field near where I live, so I have kept her in there for quite a few years on her own. I don\u2019t think it is ideal having them by themselves but needs must. But she does get out a lot. She goes out riding a lot with other horses. So I don\u2019t feel that she was particularly unhappy in her little paddock by herself.\u201d(focus group 3)Participants\u2019 heuristics were therefore broadly applied but could be flexible when an individual situation demanded a compromise.Participants were clear about the importance of knowing and assessing their horse as an individual in order to make more accurate distinctions about his or her wellbeing. Unanimously, discussions between participants were based on an agreed underlying assumption that all horses have individual personalities, likes and dislikes, and that owners learnt about the individual horse through their ongoing relationship, and subsequently use this knowledge to assess his or her wellbeing and inform care choices.Knowing the Horse as an IndividualKnowledge of the horse\u2019s individual personality and physical wellbeing was generated over time through the horse-human relationship. This included an interpretation of the horse\u2019s needs and known likes and dislikes. For example, one participant described that her mare \u201ccraves\u201d human interaction, despite not wanting interaction with other horses:\u201cI think human interaction. I know that [Pearl] craves it, doesn\u2019t she? She doesn\u2019t really like other horses. She\u2019s a mare and a chestnut mare, typical, she\u2019s a right bully. And I\u2019ve seen her\u2014I\u2019ve had her 21 years and I\u2019ve seen her groom another horse twice. But she will crave human interaction.\u201d(focus group 2)This knowledge, reinforced over the 21 years of ownership, translated into an adapted model of care for Pearl, who was kept alone but with plenty of human interaction. Similarly, other owners interpreted their horse\u2019s needs and preferences, such as turnout and exercise requirements:\u201che likes a job. If he\u2019s in the field 24/7, if there aren\u2019t enough people to cause trouble with, then he starts causing trouble in other ways\u201d(focus group 2)no-one knows them like you do\u201d.Such knowledge was built through the horse-human relationship over time, leading to a deep understanding of that individual which was part of ownership. As one participant commented \u201cAssessment Tools Knowing the horse intimately meant that horse owners could use different components of their understanding of the individual animal in order to assess the horse\u2019s current state of wellbeing, establish appropriate individualised management, and monitor changes over time. The knowledge of the horse therefore becomes a type of social capital, respected by other equestrians as unique knowledge built between that horse and owner as a result of their ongoing relationship. Participants described monitoring behaviour, demeanour, physical wellbeing, or \u201clistening\u201d to the horse as tools for evaluating and managing the individual horse.Assessing the horse\u2019s physical wellbeing was considered to be relatively straightforward and thus conducted on an ongoing, informal basis alongside the horse\u2019s daily care, and led to individualised management decisions. For example, participants monitored their horse\u2019s physical condition in order to decide how to feed, rug and exercise their horse to optimise health. One participant discussed how her assessment of individual physical needs led to her rugging her horses in different ways:\u201cI\u2019ve got two native ponies, they\u2019re both trace clipped, they haven\u2019t got a rug on. Right? I\u2019ve got a Lusitano imported, if it rains heavily in the winter, she is shivering because she\u2019s got no waterproofing in her coat. So she\u2019s got a full coat and has to wear a rug and the other two are trace clipped and you never see them shiver. And it can depend on the individual horse as well, not just the breed. I know other people who\u2019ve got Lusitanos who are like yaks in the winter.\u201d(focus group 1)Importantly, this participant described that her decision was based very much on the specific horse in her care; she did not use other heuristics, such as breed, as a proxy for individual knowledge.Behaviour and demeanour were also used to assess individual wellbeing; for example, one participant described a friend whose horse\u2019s demeanour changed as a result of a management intervention :\u201cshe had a really arthritic mare, who just couldn\u2019t get out of the way of other horses. And she said that she noticed as soon as she went into individual turnout she just seemed so much more relaxed, because she wasn\u2019t constantly worrying about having to get out of the way of other horses.\u201d(focus group 3)The change in demeanour of this horse enabled the owner to re-evaluate the horse\u2019s needs in relation to socialisation, despite the fact that all participants agreed that group turnout was generally the ideal in most instances.By reading their horse\u2019s behaviour, participants could also \u201clisten\u201d to the horse, which sometimes extended to allowing the horse to make choices about how their own care was navigated. A common example of this was in relation to the extent to which horses \u201cwanted\u201d to be turned out compared to in stables, which was often viewed as dependent on the individual personality of the horse:\u201cit is just again based on my horse\u2019s personal preference. Like my red mare doesn\u2019t want to be out 24/7. I tried that and she hated it. She likes to come in for a bit to get a break from the wind and the rain. The other one is kind of take it or leave it with turnout.\u201d(focus group 3)\u201cListening\u201d to the horse sometimes transcended other types of knowledge; for example, one participant described that reading her horse\u2019s behaviour led her to eschew her traditional knowledge and learning:\u201cthat point was the first time I listened to my horse and said, Okay, whatever I know and whatever I\u2019m being told and whatever is traditional horse-husbandry isn\u2019t actually working for you, so we\u2019ll try a different path\u201d(focus group 2)Issues with Wellbeing Assessment Based on Individual KnowledgeWhile participants largely relied on the assumption that experiential individual knowledge was an essential component of wellbeing assessment, there were examples in the data of retrospective discussion about \u201cknowing\u201d the horse being inadequate for providing an accurate picture of wellbeing. For example, horses who had behaved in ways which were indicative of pain throughout the duration of the horse-human relationship, could have those pain-related behaviours overlooked, attributed to a part of that horse\u2019s individual personality and shaped by the horse\u2019s assigned purpose. For example, the following case study describes an owner who felt she knew her horse \u201cinside out\u201d \u201clike an old pair of slippers\u201d, overlooked behavioural indicators which were indicative of pain because she assumed they were simply a feature of being a \u201ctypical thoroughbred\u201d:\u201cmy black horse, the one who started all this off, I always thought he was just a typical thoroughbred. He hated being groomed, he was really flighty, whatever, whatever. He wasn\u2019t particularly affectionate, he\u2019d come from a competition yard, he didn\u2019t know what an apple or a carrot was. He had had a really bad start in life. So, I just thought that was him. And then as I was going down the whole rabbit hole of natural husbandry and barefoot care and stuff like that, I started reading about ulcers. Anyway\u2026 after 10 days on Omeprazole, it was like he\u2019d had a character transplant\u2026\u2026So, this horse that I had had for 10 years, that I thought I knew- Well, I did know inside out, that was like an old pair of slippers, suddenly turned into this affectionate donkey that couldn\u2019t get enough of being groomed and used to follow you around the field\u2026. suddenly I was like, \u201cShit, this horse I know really well is actually someone else entirely.\u201d(focus group 2)The transformation from a \u201cflighty, typical thoroughbred\u201d to \u201caffectionate donkey\u201d caused this participant to question and re-evaluate her knowledge of the horse as an individual, and reattribute aspects of his behaviour. Although fundamental to enacting care, the meaning of this owner\u2019s knowledge was reconstructed in a new context. By incorporating new knowledge and different management approaches, here the horse-human relationship has been transformed.Descriptions of a horse\u2019s state included reflection on a horse\u2019s physical and mental wellness; this was expressed variously through the terms; \u201cwelfare\u201d, \u201cwellbeing\u201d, \u201chappy\u201d and sometimes \u201cquality of life\u201d. Results of a content analysis of the terms of interest are presented below in \u201cyou\u2019re constantly thinking about the welfare and wellbeing of your horses. It is a constant and it probably changes with the weather\u201d(focus group 1)\u201cI think that is a nice quality of life. She seems to be happy. So I am just going to keep doing it until she can do no more.\u201d(focus group 3)Although the non-specific usage of these terms (as above) was common, on other occasions participants used the terms comparatively to express and differentiate their understanding of equine wellness states. The following section will focus on those differentiated meanings. The diverse usages of each term are displayed in welfare is something that we give to the horses\u201d), a minimum acceptable environment , minimum acceptable equine experience , neglect, or positive equine experience.The term \u201cwelfare\u201d had the most diverse usage, being variously described to mean general equine physical and mental wellness, a general sense of provision welfare issue\u201d in relation to having a hoof abscess when her shoes were removed\u2014a relatively minor, short term and common problem. Other participants also referred to \u201cwelfare\u201d in relation to relatively minor issues which were being constantly monitored:Participants used the term in conversation with one another with reference to this broad range of meanings; for example, one participant with a legal background familiar with the legal sense of \u201cwelfare\u201d, nevertheless described their own horse\u2019s \u201c\u201cwe\u2019ve been monitoring our guys welfare. My wife\u2019s horse is coming back from a tendon injury that he did last summer, so we\u2019ve been doing some rehab with him.\u201d(focus group 4)As identified above, welfare could denote the delivery of minimal standards. For example, one participant described ponies kept in a barren environment:\u201cI see people there every day, so they get water, but they don\u2019t look well cared for. But I know those people are doing the best they can, and I know that they\u2019re there every day, they have fresh haylage, fresh water. But for me, I don\u2019t think it\u2019s a good life for the horses. But I do think that their welfare has been met. But is it the best life? No.\u201d(focus group 2)In this instance, \u201cwelfare\u201d reflects the basic and suboptimal provision for the ponies. On other occasions, participants\u2019 linguistic usage reflected different meanings, with \u201cwelfare\u201d denoting a minimum standard of care, and \u201cwellbeing\u201d associated with affective state:\u201cfor me, every day with a horse is a question, \u201cHow are you? How are you feeling? What can I do for you today?\u201d And some of that is wellbeing. But the stuff like, should horses be in a paddock on their own, should they be confined for 23 h a day? All of that stuff, that\u2019s welfare. It\u2019s not whether you destroy them or not because they\u2019re limping down the road, it\u2019s every decision you make for your horse when you\u2019re keeping them should be a welfare issue.\u201d(focus group 2)\u201cQuality of life\u201d was most commonly used in relation to considerations over a minimum acceptable life experience for a horse, and hence its use was often described around euthanasia decisions:\u201cIt didn\u2019t want to do anything. It came out of the field. It went in the stable. It went back. To me, I felt that wasn\u2019t a quality of life. I thought it was a horrendous life for that horse. It existed. And it didn\u2019t look like a happy horse... I just felt it was cruel, again, keeping it going\u201d(focus group 3)In this extract, QoL is considered in relation to the horse\u2019s lack of \u201chappiness\u201d. QoL was also used to relate to positive wellbeing more frequently than most other terms, again highlighting the diverse usage of each item of interest.The following terms were not generally volunteered by participants; they were infrequently used in the first activity whereby participants described their own horses, but were readily understood and discussed during the second task which involved comparing the terms. When prompted, participants used terms such as \u201ca good life\u201d, \u201ca life worth living\u201d and \u201cbest life\u201d to refer to the horse-related outcomes of their care provision:\u201cRacehorses, they don\u2019t have a life worth living. They really don\u2019t. They don\u2019t have anything a horse needs, the top show jumpers and especially the top dressage horses, they don\u2019t have the life worth living at all.\u201d(focus group 1)\u201ca good life and best life obviously aren\u2019t the same thing, because a horse can have a good life but a horse\u2019s best life, it certainly wouldn\u2019t ever been ridden or has to do anything for humans\u201d(focus group 1)During this comparative exercise, a \u201clife worth living\u201d was considered a minimum acceptable standard of living, compared with a \u201cgood life\u201d usually referring to an acceptable life, and \u201cbest life\u201d to an optimum level of wellbeing.\u201cA life worth living\u201d and to a lesser extent \u201cbest life\u201d and \u201cgood life\u201d generated additional discussion about the relevance of human judgement on equine wellbeing. For example:\u201cI think the life worth living\u2014who decides? It\u2019s the same thing. I\u2019m a cancer surgeon as well\u2014who decides what life is worth living. I guess some of the decisions we make for our older horses, that\u2019s what we\u2019re doing every day, isn\u2019t it?\u201d(focus group 2)\u201cLife worth living, best life, those are judgements made by owners, they\u2019re not something that a horse is ever going to consider\u201d(focus group 4)Participants most commonly referred to happiness through its absence: they used the terms \u201cunhappy\u201d or \u201cnot happy\u201d throughout their narratives to describe a general sense of equine malcontent, whether physical or psychological:\u201cIf the end goal is worth it, yes, you may inconvenience your horse by putting in a stable for box rest. It might not be particularly happy about that but if you know that, in the end, it will come good, then that\u2019s worth it. Maybe it\u2019s a bit unhappy for a few weeks, you try and do the best you can, entertain it.\u201d(focus group 2)The term \u201chappy\u201d was used in relation to positive equine affect only six times; instead participants predominantly used it in the general sense of wellbeing described above, or to denote a state of \u201ccontentment\u201d, which was considered to better express equine experience compared to \u201chappiness\u201d:\u201cI think if you want to know if your horse is happy, look for contentment. You know, are they chilled out when they\u2019re just roaming around having a munch? And you can see horses that aren\u2019t happy that are weaving, because they\u2019ll weave in a field, they\u2019ll chew the wood, they\u2019ll chew the fence, they\u2019ll not stand still\u201d(focus group 1)The above participant conflates a lack of happiness with behaviours which may be indicative of more severe or prolonged distress.This study represents the first attempt, to our knowledge, to identify and explore leisure horse owners\u2019 conceptualisation of wellbeing, and use of wellbeing terminology, through qualitative methods. In doing so, we have highlighted the complexity of this topic: wellbeing-related terms are used to represent a variety of meanings depending on context. Importantly, it was not the words themselves that represented different levels or aspects of wellbeing to horse keepers, but the relationship with the individual horse in the context of that person\u2019s experience and value judgements.Despite participants using these terms to represent a variety of meanings, groups were able to freely converse around issues of horse wellbeing. In the study of human language (linguistics), the ability of people who are using different languages to understand one another is described as mutual intelligibility . Our finHorse owners incorporated both physical and mental health when assessing equine wellbeing, and considered these as independent but intertwined; for example, they spontaneously discussed examples of horses who had good mental wellbeing despite physical health issues, and vice versa, yet considered that each impacted the other. Owners felt responsible to maintain an equilibrium between both equine mental and physical health, based around their knowledge of the individual animal  and their specific personality and care needs. In racehorse welfare, individualised care decisions were considered to be necessary for racehorses to live their \u201cbest life\u201d  as compaWhile owners considered mental health in their understanding of horse wellbeing, it was clear through the analysis that perceptions of wellbeing were primarily focussed on avoiding negative experience, rather than the promotion of positive experience. For example, the most commonly used expression of welfare (regardless of word choice) was a general absence of nothing being overtly wrong, often represented through the horse not showing signs of distress such as stereotypical behaviours or physical health issues. There was also an assumption that wellbeing could be a result of the provision of horses\u2019 basic needs . Combined, these results suggest that the levels of wellbeing horse owners consider acceptable may be more focussed on the avoidance of negative welfare indicators than the expression of positive ones. This has also been found in a previous study of stakeholders in equestrian sports , where tNone of the participants in this study discussed having used welfare assessment tools or checklists, and our interpretation of their descriptions of their thought processes suggested that their assessments were far more complex, nuanced and dynamic than wellbeing checklists provide. For example, although the participants discussed measurable concepts such as lameness, appetite, and interactivity which might be expected on a welfare checklist, they placed each of these items in the context of their ongoing daily assessments, heuristics, and knowledge of that individual animal. Similar findings were reported by farmers interviewed about their approach to treating lameness in dairy cattle, where participants relied upon being able to detect problems through daily routines and believed that objective tools such as mobility scoring would add nothing more to the detection process .Despite the range of examples of welfare described across the focus groups, participants did not at any point describe wanting assistance in monitoring or assessing wellbeing. Reimagined welfare assessment support as a result of this study could incorporate an understanding of the dynamic, daily nature of the equine monitoring which horse owners undertake as part of their ownership responsibilities, as well as assisting in bringing to the fore owners\u2019 individual value judgements and ethics. For example, owners may not feel that they need a formalised tool or checklist to help them monitor aspects which they already think about . HoweveOwners felt a responsibility to make appropriate decisions and when doing so they made, or questioned, judgements about what was considered to be \u201cright\u201d or \u201cwrong\u201d. In this study, people\u2019s approaches to horse care changed over time and so did the circumstances in which they considered their horse\u2019s condition or management to necessitate a concern. Our findings highlight the network of influences which shape a person\u2019s ethical views; one major influence was the social groups which shaped their beliefs. Taken-for-granted norms about horse-keeping practices and what constitutes \u2018optimal\u2019 equine wellbeing are established and maintained through equine communities and these can negatively impact horse wellbeing. Elsewhere Hausberger et al.  discuss In canine health, researchers have argued that those seeking to improve dog welfare need to look beyond increasing owner knowledge through education, by considering the complexity of real life interactions with owners and dogs and incorporating internally held attitudes, values and beliefs around welfare . Equine In our study, owners also used heuristics as a strategy to assess what was right or wrong about a situation, they found it easier to apply those heuristics to others\u2019 horses as compared with their own situations. As well as assisting owners in increasing knowledge about affective states, we consider that encouraging owners to explore their taken-for-granted value judgements could help them to make informed decision about their horse\u2019s wellbeing and needs. Providing support which accommodates for multiple perspectives on horse-keeping practices and acknowledges these conflicts that arise will be important to their applicability to practice.Veterinary advice in relation to equine QoL was infrequently discussed in this study. Nevertheless, assessing a horse\u2019s QoL is considered a core part of clinical decision-making for veterinarians , and ownIn this study, owners felt that euthanasia should result if they could not maintain the horse within their construct of an acceptable range of wellness and it was generally considered a responsible course of action. However, descriptions of issues requiring euthanasia varied dramatically between participants and findings highlight the very individual nature of deciding what is, or is not, an acceptable life for an animal. Owners\u2019 principles were contextualised as specific situations arose and therefore highlight how decision-making is shaped by individual horse-human relationships. In order to explore how different horse-human relationships shape approaches to end-of-life decision-making, further research into the perspectives of other equine caregivers and professionals is needed.This study used qualitative research methods, specifically focus groups, to explore horse owners\u2019 experience; while there are numerous benefits to this choice, there are also limitations. Firstly, participants who took part in the focus groups may have represented those with a particular interest in, and time to consider, equine welfare. Future studies could aim to include a convenience sample of more diverse perspectives, as well as comparing horse-keeper perspectives with those of other stakeholders such as veterinarians and livery yard managers. Secondly, this study explored owners\u2019 perspectives, but those may not always match the behaviours people enact in real-life settings, and additional ethnographic or observational methods would be required to compare the dilemmas around welfare that owners describe with their actions and experiences in real-time. Finally, it has been documented that focus groups lead participants to form consensus opinions ,39. WhilThis study has demonstrated that horse owners did not clearly delineate between the terminology associated with equine wellbeing. Rather, we found during focus group discussions terms were used by participants to express their experience of making ongoing, informal assessments of their horse. Knowledge produced through individual horse-human relationships generated capital, and this contributed to owners\u2019 understanding of wellbeing both in terms of what was necessary to provide for a horse and in how to interpret the horse\u2019s experience.These findings also demonstrate how terms were employed by participants when expressing judgements about whether horse-keeping practices were \u2018right\u2019 or \u2018wrong\u2019. Constructs of wellness were fluid, and in certain situations, necessitated compromise when managing their own horse. While participants used wellbeing related terminology interchangeably, the context of discussions about horse-keeping led to a mutual intelligibility. It was not the terms themselves that were important in describing wellbeing between participants, but their context.The use of relatively reductionist approaches such as tick lists or welfare checklists may seem obsolete to owners, who already feel they are assessing wellbeing on a daily basis. Rather than focussing on basic indicators, such as appetite or lameness , instead, owners relied upon other factors they considered to be important, such as their knowledge of the horse or \u2018capital\u2019. We suggest that encouraging owners to explore their own attitudes, values, and beliefs will have merit in changing perspectives around issues that impact equine welfare, particularly coupled with resources which broaden their experience of welfare assessment decision-making."}
+{"text": "A collaborative study was undertaken in which five international laboratories participated to determine amino acid fingerprints in 39 authentic nonfat dry milk (NFDM)/skim milk powder (SMP) samples. A rapid method of amino acid analysis involving microwave-assisted hydrolysis followed by ultra-high performance liquid chromatography-ultraviolet detection (UHPLC-UV) was used for quantitation of amino acids and to calculate their distribution. The performance of this rapid method of analysis was evaluated and was used to determine the amino acid fingerprint of authentic milk powders. The distribution of different amino acids and their predictable upper and lower tolerance limits in authentic NFDM/SMP samples were established as a reference. Amino acid fingerprints of NFDM/SMP were compared with selected proteins and nitrogen rich compounds  which can be potential economically motivated adulterants (EMA). The amino acid fingerprints of NFDM/SMP were found to be affected by spiking with pea, soy, rice, whey, fish gelatin and arginine among the investigated adulterants but not by wheat protein and melamine. The study results establish an amino acid fingerprint of authentic NFDM/SMP and demonstrate the utility of this method as a tool in verifying the authenticity of milk powders and detecting their adulteration. Milk is nature\u2019s most complete food , playingThe production of dairy products has been increasing but still is not able to meet the rising consumer demand at affordable prices worldwide. This gap in supply and demand may be one of the driving forces behind adulteration of milk by producers and others involved in its distribution . The gloThe value of milk powder is linked to its protein content; standard methods for protein analysis rely on a simple nitrogen assay . CurrentAmino acid fingerprints have been used in detection of food adulteration in a variety of food matrices. Cotte et al. (2004)  used amiThe United States Pharmacopeial Convention (USP) has led many international collaborative research projects to develop a toolbox of screening methods and reference standards for authenticating milk powder samples and detecting their adulteration . Test meThe study was designed to determine the amino acid fingerprints of authentic NFDM and SMP samples as well as those spiked with selected potential adulterants. NFDM and SMP share most specifications. For the discussion in the manuscript, we consider them the same product.Five laboratories participated in this collaborative study, four in the U.S. and one in China. Laboratories participating in the study included the following, Waters Corporation laboratory, Milford, MA, USA; USP, Rockville, MD, USA; Nestle NQAC, Dublin, OH, USA; Covance Laboratories/Eurofins, Madison, WI, USA, and Shanghai Jiao Tong University, Shanghai, China.Each participating lab in the study analyzed eight core authentic NFDM/SMP samples and one NIST reference material. Each lab also analyzed an additional set of four to five authentic NFDM and/or SMP samples. This enabled inclusion of the broadest possible range of authentic NFDM/SMP samples in the study.To evaluate the performance of the amino acid fingerprint methodology in detection of adulteration of NFDM/SMP samples, one of the authentic NFDM/SMP samples, was spiked separately with each of the eight potential adulterants investigated. Amino acid composition of adulterant spiked samples as well as non-spiked authentic NFDM/SMP samples was determined.Thirty-eight authentic NFDM/SMP samples representing six countries and eight production locations were analyzed in the study. These samples were provided to each laboratory by USP, Rockville, MD 20852, USA. NIST SRM 1549a Milk Powder  was analyzed along with the NFDM/SMP samples. The certificates of analysis (COA) of the commercial milk powder samples provided information about the milk type (SMP or NFDM), product origin details (raw milk geographic origin), processing conditions , and chemical composition . Details about each of the authentic milk powder samples are shown in One of the authentic NFDM/SMP samples (S091) (the base authentic NFDM/SMP), was spiked separately with one of the eight potential adulterants including plant/animal proteins and other nitrogenous substances, i.e., melamine and arginine. Each of the five participating laboratories analyzed the selected NFDM/SMP unspiked sample as well samples spiked separately with each of the eight adulterants at 3 or 4 concentration levels. All adulterants were supplied by USP. Details of the adulterants and their spiking levels studied are presented in An aliquot of about 30 mg of the sample was suspended in an appropriate hydrolysis tube assembly with 2.5 mL of internal standard solution and 2.5 mL of HPLC grade water with the aid of a micro stir bar. Borosilicate glass pressure vessels (pressure rated up to 600 psi) of 10 mL volume  were used along with silicone caps . Teflon coated micro stir bars  were used for mixing.Separate aqueous solutions of each adulterant were prepared so that the required amount of the adulterant could be spiked into the NFDM/SMP sample. About 30 mg of S091 (base milk powder), the required amount of the adulterant spike solution and HPLC water  and 2.5 mL of internal standard solution were added in the hydrolysis tube assembly and mixed with the aid of a micro stir bar.The sample solutions were hydrolyzed using a microwave hydrolysis instrument with optional auto sampler (Discover SP or Discover SP-D (CEM Corp.), following the parameters listed in The efficiency of the microwave method of hydrolyzing proteins was evaluated by comparing digestion of a casein sample using this method to hydrolysis of the same sample using a reference method for protein hydrolysis, AOAC method 982.30 . The amiTotal amino acids in samples\u2014including proteinogenic as well as those present as free\u2014were analyzed in this study. The amino acids analyzed included those listed in standard solution . AspartiTM Ultra Derivatization Kit (P/N 186003836), was obtained from Waters Corp., Milford, MA, USA.All chemicals and reagents used in the study were of analytical or HPLC grade with the highest purity. Ortho-phthalaldehyde (OPA) was obtained from Millipore Sigma, St Louis, MO, USA. Amino acid derivatization reagent, 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC), part of the AccQ\u2022TagThis was a quantitative mixture containing 2.5 \u03bcmol/mL of each of the following amino acids in 0.1 N HCl: L-alanine (Ala), L-arginine (Arg), L-aspartic acid (Asp), L-glutamic acid (Glu), L-glycine (Gly), L-histidine (His), L-isoleucine (Iso), L-leucine (Leu), L-lysine-HCl (Lys), L-phenylalanine (Phe), L-proline (Pro), L-serine (Ser), L-threonine (Thr), L-tyrosine (Tyr), L-valine  . A separate stock standard solution of L-methionine (Met)  was prepared whenever this amino acid was analyzed. Similarly, a separate stock standard solution of trans-4-hydroxyproline (Hyp)  was prepared whenever this amino acid was analyzed.Norvaline (2.50 \u00b5mol/mL) solution was prepared in 12M HCl . The standard stock solution and internal standard solution, 100 \u00b5L of each, was mixed with 800 \u00b5L of 0.1N HCl to prepare 1000 \u03bcL of the solution . A separate calibration solution of Met (250 nmol/mL) containing internal standard (250 nmol/mL) was prepared by mixing 100 \u00b5L of Met stock standard and 100 \u00b5L of internal standard solution with 800 \u00b5L of 0.1N HCl to prepare 1000 \u03bcL of the solution whenever this amino acid was analyzed. Similarly, a separate calibration solution of Hyp (250 nmol/mL) containing internal standard (250 nmol/mL) was prepared by mixing 100 \u00b5L of Hyp stock standard and 100 \u00b5L of internal standard solution with 800 \u00b5L of 0.1N HCl to prepare 1000 \u03bcL of the solution whenever this amino acid was analyzed.N-hydroxysuccinimidyl carbamate (AQC) reagent, separated on a C18 UHPLC column, and detected with an ultraviolet (UV) detector. The details of the method are described in the following section.Amino acids in the hydrolysates were analyzed using AOAC method 2018.06 , in whicAn aliquot of 1.0 mL of the hydrolysate stock solution was combined with 1.0 mL of 6 N NaOH and 3.0 mL of 0.2 M HCl and filtered through a 0.45-\u00b5m PVDF membrane filter (Millipore Sigma) into an HPLC vial.TM Ultra Derivatization Kit  following a method consistent with the instructions provided by the manufacturer.The sample hydrolysate solutions and the working standard solutions were derivatized with the AccQ\u2022Tag Derivatized standard and sample solutions were transferred to HPLC vials and the amino acids were analyzed. The method used a commercially available, proprietary kit combined with UHPLC analysis by either Chromatographic system A or B as described in the following section.ACQUITY H-Class UPLC system (Waters Corp).Mode: UHPLCDetector: UV (260 nm)Column: 100 mm \u00d7 2.1 mm column with octadecyl silane TM) Ultra column .Stationary phase 1.7 \u00b5m particle size (AccQ-TagFlow rate: 0.7 mL/minPre-injector volume: 100 \u00b5LInjection volume: 1.0 \u00b5LWash-solvent pre-inject: 0 sWash-solvent post-inject: 6 sSample temperature: AmbientColumn temperature: 43 \u00b0CTM Ultra Eluent A Concentrate (P/N 186003838. Waters Corp.)Mobile phase Solution A: AccQ\u25cfTagTM Ultra Eluent B (P/N 186003839. Waters Corp.), Mobile Phase Solution B: Water and AccQ\u25cfTagMobile Phase Solution C: WaterTM Ultra Eluent B (P/N 186003839. Waters Corp.)Mobile Phase Solution D: AccQ\u25cfTagMobile Phase: Gradients utilized of mobile phase solutions listed in ACQUITY Binary UPLC system (Waters Corp.)Mode: UHPLCDetector: UV (260 nm)TM Ultra Column Column: 100 mm \u00d7 2.1 mm column with octadecyl silane stationary phase, 1.7 \u00b5m particle AccQ-TagFlow rate: 0.7 mL/minInjection volume: 1 \u00b5LSample temperature: AmbientColumn temperature: 55 \u00b0Cv/v)Weak needle wash: Acetonitrile and water Strong needle wash: Acetonitrile and water  AccQ\u25cfTagTM Ultra Eluent A Concentrate = Mobile Phase Solution B: AccQ\u25cfTagMobile Phase: See below gradient table .The percentage of each amino acid was calculated on an as-is basis using the following equation:rU = internal standard ratio  obtained from the hydrolyzed/derivatized sample solutionrS = internal standard ratio  obtained from the derivatized Working standard solutionSC = concentration of amino acids in the Working standard solution, corrected for purity based on the reference material label claim (pmol/\u03bcL)UC = concentration of sample in hydrolysate solution (mg/mL)\u22126 = combined factor for pmol to mol conversion and the mg to g conversion in case of each amino acid10F = molecular weight of each amino acid.The amount of amino acid in the working standard is provided as nmol/mL, which is first converted to moles and then to grams; these adjustments have been made in the above calculations.The distribution of each amino acid in the sample was calculated as the percent of the sum of all amino acids analyzed in the sample  by the following equation:PS = (PU/\u2211P) \u00d7 100 PU = percentage of amino acids on an as-is basis P = sum of percentage of amount of 15 amino acids on an as-is basis (PU)\u2211t distribution approximation which can be interpreted as an approximation to the marginal posterior distribution of future results. The limits were calculated as mean \u00b1 k \u00d7 SD, where mean is the grand mean of all results, SD is the root-sum of all variance components, and k is obtained astdf0.95, is the 95th percentile of the Student\u2019s t-distribution having df degrees of freedom. The fractional value for df was obtained using the Satterthwaite approximation.Prediction limits for authentic NFDM/SMP: The estimations of lower and upper tolerance limits are based on approximate 95% confidence prediction bounds. These approximate limits were obtained using a p \u2264 0.05.Significant differences in means were detected using one-way ANOVA and post-hoc Dunnett\u2019s test. Statistics were analyzed using Minitab software, version 19 . Statistical significance was defined at The multivariate modelling, including the principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) were performed by a MATLAB R2019a  in-house script.The protein hydrolysis was performed using a microwave hydrolyzer because of its speed, ease of the use, as well as its rigorous control of hydrolysis conditions. The parameters  were optimized in preliminary studies. The efficiency of the microwave method in protein hydrolysis was evaluated by comparing the results of digestion of a casein sample by this method with that of the hydrolysis performed using the reference method for protein hydrolysis, the AOAC method 982.30 . The resThe results in n = 274). The results were calculated in the normalized format  based on the concentration of amino acids in the sample. The normalization was conducted because there was a wide discrepancy among absolute amino acid concentrations in different laboratories and normalization improved the precision of the results. Results in k) values.Amino acid analysis in 39 authentic NDFM/SMP samples  by five Amino acid distribution in NFDM/SMP samples showed a remarkably high level of glutamic acid (plus glutamine as glutamic acid), which accounted for about 22% of the sum of contents of all fifteen amino acids analyzed and present in the samples . Pro, LeThe obtained NFDM/SMP amino acid composition data compared well (within \u00b10.1\u20131.1% range) with the corresponding literature values . These vThe presented distribution of different amino acids in the authentic NFDM/SMP samples along with their corresponding lower and upper tolerance limits can be used as a reference amino acid fingerprint for authentic NFDM/SMP samples. These results are based on a large number of types of NDFMs/SMPs and take into account most the variation expected.The highest % RSD value of replicate NFDM/SMP analyses among amino acids was 11.5%, with the exception of that of His, which exhibited somewhat higher variation at 18.3% . The latThe study attempted to evaluate the precision of the amino acid analysis method (% RSD). This was performed by analyzing amino acids in one of the NFDM samples (S091) in a higher number of replicates, i.e., 17\u201318 replicates by each laboratory with a total of 86 independent replicates. Analysis of amino acids using a large number of replicates of the same sample provides a correct estimate of precision of the analytical method. The average values of amino acid distribution in S091 and all of the NFDM/SMP samples, together with the corresponding % RSDs from analysis of S091 and all of the NFDM/SMP samples are compared in The averages of the distribution of amino acids in the sample S091 compared well with that of the corresponding overall mean of all NFDM/SMP samples and results were within \u00b10.08% for most of the amino acids. The average value of aspartic acid of S091 was lower by 0.13% as compared to the overall average of all the samples. The variation (% RSD) in replicate analyses of different amino acids in the S091 sample and all NFDM/SMP samples was similar for most of the amino acids and was within \u00b10.72% of the respective values for all NFDM/SMP samples. The % RSD for His in S091 was, however, considerably lower (4.46%) as compared to the respective value for all samples.The results in One of the objectives of this study was to perform a preliminary evaluation to detect differences in the amino acid composition between the authentic NFDM/SMP samples and some of the cheaper plant and animal proteins, which can potentially be used as adulterants. The adulterant proteins studied included slightly hydrolyzed soy protein isolate, pea protein isolate, hydrolyzed wheat protein isolate, rice protein isolate, whey protein isolate and high molecular weight fish gelatin. The soy and pea protein isolates were analyzed in duplicate; all other adulterant proteins were analyzed in triplicates. Amino acid analysis of these samples was performed by the same method as described for milk powders and those spiked with adulterants. The content of each amino acid is calculated as % of the sum of the contents of all analyzed amino acids in every potential adulterant as well as in NFDM/SMP samples. Average results of amino acid composition are presented in Amino acids found to have a different distribution profile in different adulterants included at least one of the following: Ala, Arg, Asp, Glu, Gly, Lys and Pro. It may be added that Hyp was only detected in fish gelatin; it was not detected in any of the other potential adulterant proteins, nor was it detected in any of the NFDM/SMP and NIST samples or the milk powder samples spiked with the adulterants except fish gelatin at higher levels (0.3% and 0.6%). The presence of Hyp can be used as a marker for potential adulteration with fish gelatin.Gly distribution was higher in all plant proteins and fish gelatin compared to milk powder. Arg was high in gelatin and plant proteins, except wheat. Ala was higher in rice, whey, and gelatin than in milk. Pro had a lower distribution in pea, rice soy, and whey compared to milk. Asp distribution was lower and Glu was higher in wheat protein. Lys was lower in wheat, rice, and gelatin. Gelatin was lower in additional amino acids including Tyr, Leu, Ile, Val, Phe and His.The major differences in the amino acid distribution in the evaluated potential adulterant proteins as compared to NFDM/SMP are summarized in The observed similarity in amino acid distribution in large number of authentic NFDM/SMP samples produced at different geographical locations by different manufacturing methods is important and encouraging and should be leveraged to authenticate NFDM and SMP samples. The resulting amino acid fingerprint thus can be used as one of the parameters to establish authenticity of NFDM/SMP samples. Considerable differences in the distribution of amino acids in the potential adulterants as compared to NFDM/SMP help further to illustrate the utility of using an amino acid fingerprint in authenticating milk powder samples and detecting adulteration. Studies were undertaken to determine the effects on the amino acid distribution of spiking NFDM/SMP samples with adulterants at different levels.The amino acid composition of the authentic NFDM/SMP samples and those spiked with the potential adulterants was analyzed. The adulterants included plant and animal proteins as well as arginine and melamine and are listed along with their spiking levels in p > 0.05.The NFDM/SMP amino acid fingerprint was found to be affected by spiking with some adulterants at certain spiking levels. The significance of the differences of amino acid composition of the spiked samples from that of the non-spiked sample was tested by ANOVA and post hoc Dunnett\u2019s test at Spiking of NFDM/SMP sample with melamine and wheat protein did not affect the distribution of any of its amino acids significantly at any of the spike levels. Melamine spiking is not expected to affect the amino acid profile of milk. Its spiking may cause a discrepancy between the measurement of total proteins in milk based on nitrogen content and that estimated by summation of all amino acids, but this evaluation was not performed in the current study. Distributions of some of the amino acids in the NFDM/SMP sample were affected by spiking with adulterants other than melamine and wheat protein, mostly at the highest spike levels.The distribution of Gly in NFDM/SMP was increased significantly by spiking with pea or rice protein isolates at 2% levels (highest) and gelatin at 0.6% and 0.3% levels (highest and 2nd highest levels). Spiking with soy protein isolate also increased Gly distribution significantly at the 1% level while observed increases at other levels (including the 2% level) were of lesser magnitude and were not significantly different, probably due to analytical variability.Spiking of NFDM/SMP with pea protein at 2% caused a significant increase in distribution of Phe and Tyr and a decrease of Lys.Spiking with whey protein isolate at the highest spike level (3%) significantly increased distribution of Leu and decreased that of Pro. The distribution of Leu along with Thr increased at the 1.5% spike level. The increase in Thr distribution was not significant at other spike levels, including the 3% level.Spiking of NFDM/SMP with Arg was also evaluated in the study because of its potential to be used for EMA due to its high nitrogen content. As expected, the distribution of Arg in milk protein amino acid fingerprint increased at the two highest spike levels evaluated (0.1% and 0.5%).In general, the pattern of results of NFDM/SMP spiking with various adulterants is consistent with the major differences observed in amino acid composition of adulterants with that of milk powder , i.e., hThe amino acid fingerprint of NFDM/SMP was affected by spiking with some adulterants at certain spiking levels, i.e., often at the highest and/or 2nd highest spiking level used. The distributions of amino acids significantly affected by spiking with adulterants are summarized in The results of the spiking study demonstrate the utility of amino acid fingerprinting in detection of adulteration of NFDM/SMP samples. Some amino acids can be more helpful in detection of adulteration depending on the adulteration agents; spiking with plant proteins and gelatin were observed to cause an increase in Gly distribution. Spiking with whey similarly affected Leu, Pro and Thr. Additional studies may be helpful to evaluate the effects of more potential adulterants as well as adulteration using wheat protein at higher spike levels.The results of spiking NFDM/SMP with various adulterants in the current study are based on the spiking of a single NFDM/SMP sample, as mentioned earlier. Similar adulterant spiking studies with various NFDM/SMP samples will be helpful not only to confirm the current findings, but also to know whether the sensitivity of these affects is changed by differences in the geographic origin and manufacturing processes associated with the milk. The results of the current study are important given the close similarity in amino acid composition of different NFDM/SMP samples, regardless of the geographic origin and manufacturing processes.Amino acid fingerprinting analysis has been used previously to differentiate milk and non-milk proteins . Our finAmino acid values calculated as % of sum of contents of all amino acids of spiked and non-spiked samples were further computed to understand the integrated effects of adulterant spiking on amino acids. The amino acids results of the NFDM/SMP and samples spiked with various adulterants were calculated as amino acid ratios (AAR) of the sum of the amino acids which showed a tendency to increase by adulterant spiking against valine values (which often decreased with adulterant spiking). The formula used to calculate amino acid ratios is as follows.The multiplication constants in the calculations are used to improve the sensitivity of this metric in differentiating values of adulterant spiked samples from the non-spiked results. These were derived based preliminary evaluations of different constants.The results are presented in The amino acid ratio value of non-spiked samples was found to generally increase with adulterant spiking (except 0.05% Arg spike) . SpikingPCA and PLS-DA were performed on the whole data set. However, limited classification of possible adulterations was found. The PCA scores plot is shown in The current study provides an amino acid fingerprint of authentic NFDM and SMP differing in geographic origin and manufacturing processes. The variance in the values of the distribution of each amino acid was used to calculate the lower and upper prediction tolerance limits of amino acid distribution in the authentic samples. The amino acid fingerprint and the corresponding prediction tolerance limits resulting from the current study can be useful in evaluating the authenticity of NFDM and SMP samples.Some potential adulterants analyzed in the current study, including vegetable and animal proteins, showed a different amino acid distribution in comparison to the milk powder. The amino acids which often differed in their distribution in potential adulterant proteins in comparison to milk powder included Gly, Arg, Ala, Pro, Lys and Glu.The NFDM/SMP amino acid fingerprint was found to be affected by spiking with some adulterants. Gly distribution was affected significantly by spiking with vegetable proteins such as soy, pea, or rice proteins and fish gelatin, but not with wheat protein. Pea protein also affected the distribution of Arg, Phe, Tyr and Lys and AAR. Whey protein spiking, on the other hand, affected distribution of Leu, Pro and Thr. Arg spiking impacted its levels, as well as the AAR. The latter was also affected by gelatin spiking. Melamine spiking, as expected, did not change the amino acid fingerprint of milk samples. The adulterants whose spiking significantly affected the distribution of amino acids in NFDM/SMP samples are summarized in The integrated effects of adulterant spiking on amino acid distribution in NFDM/SMP could be demonstrated by calculating AAR in adulterant spiked samples. The AAR values showed a tendency to increase with spiking, but it was significantly different from the non-spiked value only in the case of certain adulterants, i.e., pea protein isolate, fish gelatin, and arginine, at least in the samples spiked at the highest level.The study describes a rapid, accurate and precise method for the determination of the amino acid fingerprint in milk powder samples. The results of the current study demonstrate the utility of amino acid fingerprinting as one tool to establish authenticity of NFDM/SMP samples and detect adulteration, particularly EMA. The amino acid fingerprint of authentic NFDM/SMP samples based on the results of the current study can be very helpful in this objective."}
+{"text": "Pasteurella multocida (P. multocida), serotypes B:2 and E:2, are reported to be the main causes of HS wherein serotype B:2 is more common in Asian countries including Pakistan and costs heavy financial losses every year. As yet, very little molecular and genomic information related to the HS-associated serotypes of P. multocida isolated from Pakistan is available. Therefore, this study aimed to explore the characteristics of novel bovine isolates of P. multocida serotype B:2 at the genomic level and perform comparative genomic analysis of various P. multocida strains from Pakistan to better understand the genetic basis of pathogenesis and virulence.Haemorrhagic septicaemia (HS) is a highly fatal and predominant disease in livestock, particularly cattle and buffalo in the tropical regions of the world. P. multocida serotype B:2 strains isolated from the Faisalabad (PM1), Peshawar (PM2) and Okara (PM3) districts of Punjab, Pakistan. Together with the other nine publicly available Pakistani-origin P. multocida strains and a reference strain Pm70, a comparative genomic analysis was performed. The sequenced strains were characterized as serotype B and belong to ST-122. The strains contain no plasmids; however, each strain contains at least two complete prophages. The pan-genome analysis revealed a higher number of core genes indicating a close resemblance to the studied genomes and very few genes (1%) of the core genome serve as a part of virulence, disease, and defense mechanisms. We further identified that studied P. multocida B:2 strains harbor common antibiotic resistance genes, specifically PBP3 and EF-Tu. Remarkably, the distribution of virulence factors revealed that OmpH and plpE were not present in any P. multocida B:2 strains while the presence of these antigens was reported uniformly in all serotypes of P. multocida.To understand the genomic variability and pathogenomics, we characterized three HS-associated OmpH and PlpE in the analyzed P. multocida B:2 strains, which are known surface antigens and provide protective immunity against P. multocida infection. The availability of additional genomic data on P. multocida B:2 strains from Pakistan will facilitate the development of localized therapeutic agents and rapid diagnostic tools specifically targeting HS-associated P. multocida B:2 strains.This study's findings indicate the absence of The online version contains supplementary material available at 10.1186/s12864-023-09626-5. Pasteurella multocida (P. multocida) is a Gram-negative, facultative anaerobe and an economically important veterinary pathogen. It exists both as a commensal and an opportunist pathogen, found in nasopharyngeal microflora as well as in the proximal gastrointestinal tract of animals  of P. multocida indicating the universal presence of plpE gene across all serotypes [Surprisingly, ce, OmpH  and PlpEce, OmpH , 44 conferotypes , 46. Forerotypes . Howevererotypes . Similarerotypes .P. multocida (serotype A), it was reported that they exhibited high genome similarity (99%), sharing common virulent factors. The differences in pathogenicity between the two strains was attributed to the differential expression of virulence genes [P. multocida revealed the presence of four hypervariable extracellular loops, predicted to be more antigenic in bovine isolates compared to porcine isolates [Beyond the mere presence of particular VFs in the genomes, their expression levels play an important role in determining pathogenicity and disease manifestation in the host. When conducting a comparative genome analysis between the highly virulent strain PmCQ2 and naturally attenuated strain PmCQ6 of ce genes . Similarisolates . These lP. multocida serotype B:2 with nine publicly available Pakistani origin P. multocida strains and a reference strain Pm70. The core-genome SNPs-based phylogenetic analysis indicated a close resemblance among Pakistani strains and few genes (1%) of the core-genome serve as a part of virulence and defense. Surprisingly, VFs like OmpH and PlpE were not found in any Pakistani P. multocida strains while these surface proteins are used in vaccine studies and reported to provide protective immunity. Therefore, this study warrants further research to investigate the diversity and prevalence of PlpE and OmpH genes in HS-associated Pakistani P. multocida strains to develop domestic HS-associated P. multocida specific therapeutics.This study comprised a comparative genomic analysis of three novel strains of HS-associated Pasteurella multocida isolate PM1 was isolated from the heart blood of an infected buffalo in Faisalabad, PM2 from the blood of an infected buffalo in Peshawar, and PM3 was isolated from a buffalo (PM3) died apparently with the symptoms of HS in Okara, Pakistan. The morphological characteristics of the isolates were observed by growing on BHI and MacConkey agar by incubating at 37 \u2103 for 16\u201318 h. The genomic DNAs (gDNAs) were extracted from purified cultures using GeneJET Genomic DNA Purification Kit, cat # K0721 (Thermo Fisher). The extracted gDNAs were quantified using nanodrop , and the integrity and purity of the extracted gDNAs were tested through agarose gel electrophoresis. The serotypes were confirmed by molecular analysis of gDNAs through species-specific and type-specific PCR [kmt1 gene was amplified using KMT1SP6-KMT1T7 primers that identify P. multocida species (species-specific) whereas the 6B gene was amplified using KTSP61-KTT72 primers that distinguish HS-associated P. multocida serotype B:2 strains (type-specific).ific PCR . The kmtP. multocida strains PM1, PM2 and PM3 was achieved using Illumina HiSeq 2500 platform. The sequence reads were trimmed using Trimmomatic 0.30 [The whole-genome shotgun sequencing of newly isolated tic 0.30 . The gentic 0.30 .P. multocida typing database (https://pubmlst.org/bigsdb?db=pubmlst_pmultocida_seqdef) [P. multocida. The multi-host MLST scheme includes isolates from a range of hosts such as birds, pigs, sheep, and cattle, and is based on seven housekeeping genes . The RIRDC MLST scheme is based on seven housekeeping genes  developed to investigate avian isolates.The in silico MLST genotyping was performed at PubMLST using the _seqdef) . The Pubrep) were identified by PlasmidFinder 2.1 at the default parameters [The prophages in the sequenced genomes were identified and annotated using PHASTER  and the rameters .P. multocida genomes (n\u2009=\u20099) available at NCBI were downloaded with a reference strain Pm70. In addition, three genomes of P. multocida (sequenced in the current study) were also included (Table ). To proceed with pan-genome analysis all selected genomes were first annotated by Prokka at default parameters [https://cge.food.dtu.dk/services/CSIPhylogeny/ [P. multocida strain PVAcc (serotype B:2) and a maximum likelihood tree was generated using FastTree 2 tool [The Pakistani origin ed Table . To procrameters . The panrameters . For, whylogeny/  with thee 2 tool .https://rast.nmpdr.org/rast.cgi [The functional annotation of core and unique genes was achieved using Rapid Annotation using Subsystem Technology (RAST), available at rast.cgi . RAST corast.cgi .P. multocida VFs were retrieved from the NCBI database . (A) The amplified product of kmt1 gene using Pasteurella species-specific primers. (B) amplified product of 6B gene using HS causing P. multocida B:2 type-specific primers. Figure S2. Core-genome SNPs-based phylogenetic relationship of the sequenced strains  with 9 other Pakistani P. multocida strains  and a reference strain Pm70."}
+{"text": "Leishmania donovani, the trypanosomatid parasite, greatly depends on receptor-ligand mediated signalling pathways for cellular differentiation, nutrient uptake, secretion of virulence factors, and pathogenesis. Lipids, despite being important signalling molecules, have intracellular transport mechanisms that are largely unexplored in L. donovani. We have identified a repertoire of sixteen (16) potential lipid transfer protein (LTP) homologs based on a domain-based search on TriTrypDB coupled with bioinformatics analyses, which signifies the presence of well-organized lipid transport machinery in this parasite. We emphasized here their evolutionary uniqueness and conservation and discussed their potential implications for parasite biology with regards to future therapeutic targets against visceral leishmaniasis.Eukaryotic cells have distinct membrane-enclosed organelles, each with a unique biochemical signature and specialized function. The unique identity of each organelle is greatly governed by the asymmetric distribution and regulated intracellular movement of two important biomolecules, lipids, and proteins. Non-vesicular lipid transport mediated by lipid-transfer proteins (LTPs) plays essential roles in intra-cellular lipid trafficking and cellular lipid homeostasis, while vesicular transport regulates protein trafficking. A comparative analysis of non-vesicular lipid transport machinery in protists could enhance our understanding of parasitism and basis of eukaryotic evolution.  Informadium sp.  and Entatolytica ,40. The ndidates .L. donovani possesses only one steroidogenic acute regulatory protein-related lipid transfer (START) domain containing protein (LdBPK_292840.1). Apart from its lipid sensing domain, this sterol specific LTP lacks any potential membrane anchoring domain indicating their cytosolic localization  potential Sec14 homologs (L. donovani. Two candidates (LdBPK_301680.1 and LdBPK_353610.1) contain additional CRAL-TRIO domain, while one candidate (LdBPK_360640.1) possesses both CRAL-TRIO domain and Cytoskeleton-associated protein-glycine-rich (CAP-Gly) domain along with Sec14 domain  of Lipocalin  in humans and with Scs2p in yeast , increased pathogenicity , and parasite protection [tryparedoxin peroxidase (cTXNPx)], which influence the pathophysiology of the disease by induction of inflammatory cytokines, particularly IL-17a [Saccharomyces cerevisiae [S. cerevisiae [E. histolytica and Trichomonas vaginalis [L. donovani (LdBPK_281800.1) with endosomal membrane phosphoinositides targeting modules  could also regulate the endosomal trafficking and signaling cascades [Exoproteome analysis of y IL-17a ,154,155 y IL-17a . Neverthrevisiae ,156,157.revisiae ,156,157.revisiae . The ideaginalis ,159. MorLeishmania parasite largely depends on their ability to sense and respond to ever-changing host derived micronutrients for successful navigation through its life cycle. However, Leishmania parasite largely depends on flagellar membrane proteins and downstream signal transduction system like, glucose/hexose transporter 1 (GT1) and TOR3 signaling pathway [E. histolytica [Plasmodium sp. [L. donovani with CAP-Gly domain (LdBPK_360640.1) could regulates the cytoskeleton reorganization and motility of the parasite, as CAP-Gly domain interacts with the C-terminal EEY/F-COO\u2212 sequence motifs of \u03b1-tubulin and other microtubule-associated protein [ pathway ,161, aqu pathway , Arginin pathway  for sens pathway . Above rtolytica , Plasmoddium sp. ,45 and odium sp. . Modulatdium sp. ,169,170.dium sp. ,171,172. protein ,22.Leishmania spp. lack the enzymes for Chol synthesis [Leishmania sp. [L. donovani substantially depends on the autophagy protein Atg8 for infection and survival under stress [Entamoeba sp. [Leishmania promastigotes can either inhibit phagosome maturation by accumulating F-actin in the periphagosome [P. falciparum [L. donovani secretory lipases to provide lipid precursors for amastigote metabolism [L. major [Post-internalization of promastigotes by macrophages, intramacrophagic transformation of promastigotes into amastigotes requires substantial changes in lipid and FA compositions . The freynthesis , while iania sp. . Such stania sp. . L. donor stress ,125,126.oeba sp. ,129,130.hagosome , retainihagosome  or prevelciparum . Furthertabolism , as suggL. donovani by a domain-based survey of LTP homologs in TriTrypDB. The genome of L. donovani possesses single homolog of START domain protein, which could potentially be implicated in inter-organellar lipid transport from ER to various cell organelles [L. donovani might indicates its potential ability to perform diverse biological functions, usually regulated by different START protein candidates in other eukaryotes [L. donovani also has multiple homologs (fourteen) of Sec14 domain containing protein. Eleven (11) of them with solely Sec14 domain, similar in yeast could function as lipid sensors [L. donovani lacks the important homologs of PITPs, which are known to regulate the in-situ lipid metabolism in a cell by providing precursors to metabolic enzymes and also participate in receptor-ligand interaction and the signal transduction process during host-parasite interaction at the cell periphery [L. donovani could potentially function as PITP, as reported in Saccharomyces sp. [Plasmodium sp. [E. histolytica [L. donovani lacks the homologs of ORPs, regulates the intracellular movement of transport vesicles and exocytosis [Saccharomyces sp. [L. donovani genome do not possesses homologs of PRELI protein, which regulates the mitochondrial lipid transport in higher eukaryotes [L. donovani in compare to other parasitic protists [L. donovani lacks homologs of SMP domain containing proteins, which are organized at various MCSs and ERMES complexes in other eukaryotic systems [L. donovani genome also lacks the homologs of the ML domain of the bovine NPC2 (binds with Chol sulfate), the LBP/BPI/CETP domain of the CETP (interacts with two molecules each of cholesteryl ester and PC), the SCP2 domain of the yellow fever mosquito SCP2-like 3 , the NPC1 NTD of the NPC1 (interacts with Chol) and the GLTP domain of the GLTP (binds lactosylceramide) [We have identified a repertoire of LTPs in ganelles ,89,90 anganelles . The prekaryotes ,89,90. T sensors ,97,98 an sensors ,100. Sec sensors ,22. The  sensors . Howevereriphery . The ideyces sp. , Plasmoddium sp. ,45 and Etolytica . L. donoocytosis ,79. The yces sp. . L. donokaryotes ,79. Howeprotists . Such LT systems . L. donoeramide) ,22. Detaeramide) ,177, suc"}
+{"text": "Although time-stretch spectroscopy is an emerging ultrafast spectroscopic technique, the applications in industrial fields have been limited due to the low output power caused by undesirable nonlinear effects occurred in a long optical fiber used for pulse chirping. Here, we developed a high-power time-stretch near infrared (NIR) spectrometer utilizing arrayed waveguide gratings (AWGs). The combination of AWGs and short optical fibers allowed large amounts of chromatic dispersion to be applied to broadband supercontinuum pulses without the power limitation imposed by employing the long optical fiber. With the proposed configuration, we achieved chirped pulses with the output power of 60\u00a0mW in the 900\u20131300\u00a0nm wavelength region, which is about 10 times higher than conventional time-stretch spectrometers using long optical fibers. With the developed spectrometer, the NIR absorption spectra of a standard material and liquid samples were observed with high accuracy and precision within sub-millisecond measurement time even with four orders of magnitude optical attenuation by a neutral density filter. We also confirmed the quantitative spectral analysis capability of the developed spectrometer for highly scattering samples of an oil emulsion. The qualitative comparison of the measurement precision between the developed spectrometer and the previous time-stretch spectrometer was also conducted. In addition, NIR light has the ability to penetrate deeper into the samples than IR light because the absorption of the combination and overtone bands appearing in the NIR wavelength region is much weaker than that of the fundamental absorption peaks in the IR region. This allows us to obtain chemical information inside or through a thick sample non-invasively. Recent developments in computational techniques such as chemometrics and machine learning, which enable quantitative spectral analysis, are also promoting practical applications in many fields, including food, agriculture, pharmaceuticals, and chemicals6. Total inspection in production is one of the attractive applications to fully exploit the unique nature of NIR spectroscopy, but it is still challenging mainly due to the slow spectral acquisition rate of conventional NIR spectrometers. Fourier Transform Infrared (FT-IR) spectrometers need the precise mechanical scanning of the optical path length of the interferometer within the system to record the interferogram, limiting the spectral acquisition rate between a few to tens of Hz. For example, to achieve the spectral resolution of 10\u00a0cm\u22121, the mirror in a Michelson interferometer has to be scanned 0.5\u00a0mm under a precise control of movement. Although diffraction-grating-based NIR polychrometers have a maximum spectral scan rate of a few kHz, the practical measurement rate is limited to several hundred Hz or lower. Because the throughput of polychromators is limited by the entrance slit and a low numerical aperture, the spectral averaging is required to obtain the NIR spectrum with a high signal-to-noise ratio (SNR).Near-infrared (NIR) spectroscopy is an emerging technique for rapid and non-destructive quality assessment in various industrial fields. An NIR spectrum provides information about the molecular vibrations of the sample, which allows the monitoring of chemical properties such as moisture content, chemical constituents, and so on9. In these methods, the optical spectrum is converted from the temporal waveform of the chirped pulse measured with a single high-speed photodetector at a pulse repetition rate exceeding MHz frequency. Studies of instantaneous dynamics, including optical pulse evolution and gas mixtures, have been successfully demonstrated using time-stretch spectroscopy12. To apply this technique to high-speed NIR spectroscopy of industrial objects that are usually low-transmittance, it is essential to improve the output power of time-stretch spectrometers. Conventionally, most time-stretch spectrometers have employed a kilometer-long optical fiber for pulse chirping due to its simplicity and robustness9; however, the accessible optical power is limited by undesirable nonlinear effects in the long optical fiber. For example, the stimulated Raman effect and four-wave mixing limit the available output power at the desired wavelength because the excess energy above their nonlinear threshold is converted to other wavelengths14. To realize the highly sensitive measurement while avoiding the undesirable nonlinear effects, an advanced configuration using distributed Raman amplifiers has been demonstrated15; however, the system becomes somewhat complicated. Another approach based on free-space angular-chirp-enhanced delay (FACED) has recently been demonstrated16. However, the need for careful alignment of bulky optical components (a diffraction grating and large mirrors) may limit its feasibility in industrial applications.In recent years, high-speed spectroscopic methods using chirped  optical pulses, called time-stretch spectroscopy or dispersive Fourier transform spectroscopy, have emerged as a promising alternative17. AWG is an optical waveguide device commonly used in optical communications for spatially separating and combining light waves of multiple wavelengths19. The combination of AWGs and short optical fibers allows us to generate temporally dispersed pulse trains at different wavelengths while avoiding the power limitation caused by using long optical fibers. Our developed time-stretch spectrometer using AWGs achieved a high output power of 60\u00a0mW in the wavelength range of 900\u20131300\u00a0nm, which is about 10 times higher than that of conventional time-stretch spectrometers based on long fibers12. With the developed spectrometer, we performed transmission spectroscopy of opaque samples. The absorption spectra of low-transmittance samples were observed with high accuracy and precision in sub-millisecond measurement time. We also confirmed the quantitative spectral analysis capability of the developed spectrometer for highly scattering samples (oil emulsion).In this study, we demonstrated NIR spectroscopy of low-transmittance, highly-scattering samples with a time-stretch spectrometer using arrayed waveguide grating (AWG) technology. The concept of the developed spectrometer was previously described in our patentFigure\u00a020. Because the reference material is relatively highly transparent, a neutral density (ND) filter, which is commonly used to reduce the optical intensity with less wavelength dependence, was added in front of the reference material to imitate the measurement of low-transmittance samples. We used the ND filter with an optical density (OD) of 3.8, that is, the intensity of the sample beam decreased by about four orders of magnitude through the ND filter. Figure\u00a020. The high measurement precision was achieved for the wavelength above 950\u00a0nm (the coefficient of variation of <\u20092%); in contrast, the precision gradually degraded for shorter wavelengths mainly due to the low detection intensity caused by a low sensitivity of the InGaAs photo-detector we used. As shown here, our developed spectrometer achieved the high measurement accuracy and precision with sub-millisecond measurement time even though about four orders of magnitude optical attenuation by the ND filter.We characterized the measurement accuracy and precision of our spectrometer when measuring low-transmittance samples, which is our main target, with a standard reference material By using the developed spectrometer, we performed NIR spectroscopy of low-transmittance samples. As the proof of concept for the total inspection in industrial field, the absorption spectrum of the samples  moving fast was observed. Same as in the previous section, we added the ND filter (OD 3.8) in front of the liquid samples to imitate the measurement of low-transmittance samples. A schematic diagram and photograph of the experimental setup are shown in Fig.\u00a023 (a soybean oil emulsion). To confirm whether quantitative spectral analysis was possible, we assessed the determination coefficient (R2) of the calibration model of the volume fraction developed from the transmittance spectra of the samples. The details of spectral measurement, pre-processing, and data analysis are described in the \u201cWe also demonstrated NIR spectroscopy of a highly scattering sample, which is typical of industrial materials. As a highly scattering sample, we selected aqueous dilutions of Intralipos24 can be seen clearly with a high SNR. Supplementary Fig. 24 for development of the calibration model. The prediction results of the volume fraction of Intralipos dilutions using the developed model are plotted in Fig.\u00a02 value of 0.996 was achieved, which also implies that our spectrometer can measure the spectral change according to the volume fraction of the sample at a high SNR. For comparison, we also performed the same analysis with NIR spectra measured with a commercially available FT-IR spectrometer. The R2 value was limited to 0.53 even with a longer measurement time (26\u00a0s/sample), probably due to the lower SNR of the measured spectra . The combination of AWGs and short optical fibers allowed us to introduce a large temporal dispersion to the broadband SC pulses. As a result, chirped pulse trains with a high output power of 60\u00a0mW were achieved in the 900\u20131300 nm wavelength range. The maximum spectral acquisition rate was 1.2\u00a0MHz. By using the developed spectrometer, we demonstrated NIR spectroscopy of low-transmittance and highly scattering samples. The absorption spectra of the low-transmittance samples  were observed in sub-millisecond measurement time at high accuracy and precision. With highly scattering samples of soybean oil emulsion, we confirmed the potential of the developed spectrometer for quantitative spectral measurement at millisecond measurement time.25, the small foot print of the AWG enables us to control the device temperature easily with such as small peltier devices.We expect that our spectrometer is suitable for industrial applications also in terms of the long-term reliability of the measurement due to the high stability against external disturbance. The spectroscopic characteristics including spectral accuracy and bandwidth in our spectrometer are solely determined by the AWG and they are almost insensitive to the optical alignment with optical fibers, ensuring the high stability to external vibrations. In contrast, in case of polychrometers those characteristics are varied by the relative position and angle between a grating and linear sensor. Although it is well known that the optical waveguide including the AWG is susceptible to the ambient temperature11 even with four orders of magnitude optical attenuation by a ND filter. The details of the comparison are shown in Supplementary Note Differently from conventional time-stretch spectrometers, our developed spectrometer is specialized for highly-sensitive broadband absorption spectroscopy at the expense of spectral resolution. Most conventional time-stretch spectrometers have been developed for the analysis of dynamics of gas mixtures or optical pulses in which a high spectral resolution such as few tens of picometer is required. The high spectral resolution has been realized by the high-speed sampling of optical spectrum of an optical pulse continuously chirped with a long optical fiber. In contrast, our spectrometer records the intensity of spectrally-divided optical pulses by the AWG, that is, at each measurement channel (sampling point in spectrum) we measure the optical intensity integrating for multiple wavelength components whose bandwidth is determined by the AWG. In this work, we designed our AWG with the bandwidth of 6.6\u00a0nm for each output channel see Fig.\u00a0b, yieldi16 is also one of the possible systems for highly-sensitive and high-speed NIR spectroscopy. Since it uses only free-space optics (grating and mirrors), higher output power would be achieved than our spectrometer using the AWG and optical fibers. While it was used in mid-infrared wavelength region in the previous report, the operation in NIR region would be readily achieved because of the less wavelength dependence of the optical components used. However, its applications in industrial fields may be challenging due to the high susceptibility to the alignment of optical components in the system. The spectrum and amount of dispersion of chirped pulses are largely varied by slight changes in the angle and distance of two mirrors26.The time-stretch spectrometer based on FACED geometry3N4) has been successfully demonstrated in many reports29. For example to extend the wavelength range to 1700\u00a0nm where the strong absorption peaks of C\u2013H and S\u2013H appear, the analysis of organic materials including plastics and resins can be realized30. The recent development of SC sources with an extended spectrum in the visible to mid-IR wavelength range also encourages the extent of applications in broader wavelength region32. Secondly, high-resolution spectroscopy is also possible since AWGs were originally developed for high-density wavelength division multiplexing (WDM) optical communication33. Thanks to the higher output power derived from the proposed configuration, highly-sensitive monitoring of such as gases would be realized. However, one has to be careful that the improvement factor of the sensitivity will be somewhat limited because the narrower spectral width of the output channel of the AWG decreases the detection sensitivity of the transmittance signal at each measurement channel in spectrum. Lastly, even higher spectral acquisition rates can be achieved by reducing the number of spectral output channels of the AWG. By reducing the number of output channels, we can increase the pulse repetition rate of the SC source without cross-talk between temporally dispersed pulse trains. This configuration is still useful for some applications where it is necessary to monitor specific spectral bands.Our spectrometer can be applied to not only broadband NIR spectroscopy, as shown in this manuscript, but also various spectroscopic measurements with modification of the optical design of the AWG device. Firstly, the operation wavelength range can be broadly changed from visible to short-wavelength infrared (SWIR). The wideband operation capability of optical waveguides using silicon nitride (Si\u22121 (~\u20096.6\u00a0nm in wavelength). The peak transmittance of the 61 output channels of the AWG was 30\u201350%, mainly limited by the coupling loss of the SC pulse. The 1/e2 bandwidth of each output channel was ~\u20096.6\u00a0nm. Although the AWG had three additional output channels below 900\u00a0nm, we did not use these channels for spectroscopic measurements. The sub-pulses were then transferred to the delay line unit consisting of 64 single-mode fibers to introduce a temporal delay between them. The fiber lengths ranged from 1 to 150 m, with a length increase of ~\u20092.35\u00a0m, corresponding to a temporal delay of 11.5\u00a0ns applied to sub pulses at adjacent wavelengths. We determined the amount of temporal delay to avoid overlap between pulses in the time domain, taking into account the response time of our photodetector used in the spectroscopy. Finally, the temporally delayed pulses at different wavelengths were recombined into a single channel using the second AWG. The intensity of the recombined beam was ~\u200960\u00a0mW. The total throughput of our spectrometer was about 7% at this moment, which can be further improved by increasing the coupling efficiency between the SC pulses and the AWG.A custom-made SC source (NKT Photonics) was used as the light source. In this work, we selected the wavelength range of 900\u20131300\u00a0nm for NIR spectroscopy because of the high spectral intensity of the SC source in the wavelength region. The other wavelength components were filtered out at the exit of the SC source by using long- and short-pass filters. The pulse duration was ~\u2009500\u00a0ps and the pulse repetition rate was 1.2\u00a0MHz. The SC pulse was coupled into the first AWG using an achromatic lens. In this study, we optimized the AWG design for broadband NIR spectroscopy in the 900\u20131300\u00a0nm wavelength region. The footprint of our AWG was 22\u00a0mm\u2009\u00d7\u200925\u00a0mm. The AWG split the SC pulse into 61 sub-pulses with center wavelengths spaced every ~\u200956\u00a0cmFor absorption spectroscopy, the output beam from the second AWG was collimated to a diameter of 2.8\u00a0mm. The transmission signal through the sample was measured with a custom-made pin InGaAs photodiode (3\u00a0GHz bandwidth) and recorded using a high-speed oscilloscope  or digitiser . A small portion of the sample beam was picked up via an optical window and recorded simultaneously with the sample beam to compensate for the spectral intensity fluctuation of the SC source. The transmittance spectrum of the sample was obtained from the area of each pulse signal after baseline correction using a polynomial fit. The absorption spectrum was calculated by dividing the transmittance spectra observed with and without the sample.20) and a ND filter with OD of 3.8 (Thorlabs). The OD of the ND filter slightly depended on the wavelength, and it varied from 4.0 to 3.7 in 900\u20131300\u00a0nm wavelength region. The signal was recorded with the oscilloscope (2.5\u00a0GHz bandwidth and 5\u00a0GHz sampling rate). To improve the SNR of the signal we averaged 1000 signals, corresponding to the measurement time of 0.83\u00a0ms. For the calculation of the absorption spectrum, the transmittance signal of only the ND filter was also measured as a blank signal. Therefore, the optical loss of the ND filter is canceled in the resultant absorption spectrum  and liquid samples . The liquid samples were contained in glass cuvettes with a 5\u00a0mm path length  and placed on a rotating plate. The radius of the plate was 180\u00a0mm, and there were 6.5\u00a0mm-diameter holes every ~\u200919\u00a0mm around the circumference. The sample cuvettes were placed at every second well, and wells without samples were blocked. An empty cuvette was also provided to serve as a reference for calculating the absorbance of the samples. The plate was rotated at 160\u00a0rpm, corresponding to a sample moving speed of ~\u20093\u00a0m/s. The sample beam was made to pass through the liquid sample for 2\u20133\u00a0ms, during which >\u20091000 spectra were observed at the 1.2\u00a0MHz pulse repetition rate of the SC source. The transmittance signal was recorded using an oscilloscope with a bandwidth of 2.5\u00a0GHz and a sampling rate of 5\u00a0GHz. A single non-averaged acquisition was performed after the rotational speed of the holder had stabilized at 160\u00a0rpm. To calculate the absorption spectrum of the samples, the signals generated by 1000 SC pulses were extracted from the raw signal and averaged for each sample to improve the signal-to-noise ratio. In the absorption spectrum . A 10 mm path length cell  was used. The measurement took ~\u20091\u00a0min for each sample with a bandwidth of 2\u00a0nm and a recording pitch of 1\u00a0nm. The resulting absorbance was divided by two to estimate the absorbance for 5\u00a0mm path length (same path length as the measurement with our spectrometer). According to the specification sheet, the measurement precision of the monochromator is 0.00028 Abs.\u22121, and 128 spectra were averaged (measurement time was 26\u00a0s for each sample). For each system, we obtained 13 transmitted spectra  to develop the calibration model.We prepared aqueous dilutions of Intralipos 20%  so that the volume fractions of Intralipos were 16, 17, 18, 19 and 20%. We prepared three samples for each of 16, 18, and 20%, and two samples for each of 17 and 19%. We measured the transmittance spectra of the dilutions with a 5\u00a0mm path length cuvette using the developed spectrometer and a commercially available FT-IR spectrometer . For the measurement with the developed spectrometer, the illumination power on the sample was 60\u00a0mW, and the transmitted spectrum was recorded with a digitizer. We applied 5500 times spectral averaging to improve the SNR of the spectrum (measurement time was 4.6\u00a0ms for each sample). For the measurement with the FT-IR spectrometer, the resolution was set to 60\u00a0cm34 and Savitzky\u2013Golay differentiation filter to develop the calibration model with high prediction accuracy. SNV transformation corrected variations in the baseline level of the spectrum caused by the scattering in the sample and scatters with different particle sizes. Savitzky\u2013Golay differentiation filter reduced the noise in the spectrum and improved the separation of the absorption peaks overlap each other. We used a polynomial order and frame length of 2 and 3, respectively. We chose a differentiation order of 1 since higher differentiation orders can increase the random noise that can affect prediction accuracy although it improves the separation of the peaks overlap each other. Then, for each spectrometer, the calibration model for prediction of the volume fraction of Intralipos was developed with the 13 preprocessed spectra. We used the partial least squares (PLS) regression that provides a highly reliable prediction result by circumventing the multicollinearity problem of the NIR spectrum35. The accuracy of the developed model was validated using the leave-one-out cross-validation (LOOCV) method. The number of loading components used to develop the calibration model was chosen so that the mean squared error (MSE) between the predicted and objective variables became minimum. As a result, we used the only first and five components for the data sets obtained with the developed and FT-IR spectrometers, respectively . For spectral preprocessing, we applied standard normal variate (SNV)Supplementary Information.Supplementary Movie 1."}
+{"text": "Research priority setting (RPS) studies are necessary to close the significant gap between the scientific evidence produced and the evidence stakeholders need. Their findings can make resource allocation in research more efficient. However, no general framework for conducting an RPS study among public health stakeholders exists. RPS studies in public health are rare and no such study has been previously conducted and published in Germany. Therefore, we aimed to investigate which research topics in public health are prioritised by relevant stakeholders in Germany.Our RPS study consisted of a scoping stage and a Delphi stage each split into two rounds. Firstly, we invited members of the German Public Health Association to gather expert insights during two initial workshops. Next, we defined the relevant stakeholder groups and recruited respondents. Thereafter, we collected research topics and assessment criteria with the respondents in the first Delphi round and aggregated the responses through content analysis. Finally, we asked the respondents to rate the research topics with the assessment criteria in the second Delphi round.In total, 94 out of the 140 invited public health organisations nominated 230 respondents for the Delphi study of whom almost 90% participated in both Delphi rounds. We compiled a comprehensive list of 76 research topics that were rated and ranked by several assessment criteria. We split the research topics into two types, substantive research topics and methodological-theoretical research topics respectively, to ensure the comparability among the research topics. In both types of research topics\u2014substantive research topics and methodological-theoretical research topics\u2014the respective top five ranked research topics hardly differed between public health researchers and public health practitioners. However, clear differences exist in the priority ranking of many (non-top priority) research topics between the stakeholder groups.This research demonstrates that it is possible, with limited resources, to prioritise research topics for public health at the national level involving a wide range of pertinent stakeholders. The results can be used by research funding institutions to initiate calls for research projects with an increased relevance for health and/or scientific progress.The online version contains supplementary material available at 10.1186/s12961-023-01039-w. The COVID-19 pandemic has made the importance of high-quality evidence abundantly clear to policy-makers. Hence, the pressure for policy-makers to gather and assess all available evidence when making decisions is increasing \u20134.Research also shows a significant gap between the scientific evidence that is produced by researchers and the actual scientific evidence demanded by policy-makers and other stakeholders \u20138. IdentFunders of public health research have to decide which research projects to support while facing competing demands and scarce resources \u201318. HoweAlthough several frameworks for priority setting in health research are suggested , 24\u201330, Most notably, many studies incorporated Delphi-like techniques in RPS . The DelMoreover, rating of research topics should preferably be done using more than a single assessment criterion to measure different dimensions of why specific topics are prioritised , 29, 31.RPS studies focussing on the field of public health are rare: Selected public health topics are considered occasionally in RPS studies that focus on health in general or on a (sub)field that overlaps with public health . Participants of two workshops, organised by the DGPH in 2015 and 2016, discussed and proposed potential research topics that should be covered in an RPS study. The invitations for the workshops were sent to all members of the DGPH. Additionally, individuals with a clear public health expertise, mainly consisting of established researchers in Germany and representatives of German research funding agencies, were invited. In total, the number of participants during the workshops varied between 40 and 50 individuals.During the first workshop called \u201cPriority topics for public health research\u201d, members of the DGPH were invited during a 5-h-long exploratory roundtable discussion to discuss which research topics for public health research need most attention. The workshop was publicly announced and open to all members of the DGPH. The participants could propose topics or broader research areas themselves for different domains of public health and they could critically reflect on the topics that were proposed by other participants. The exploratory results were recorded in the minutes and distributed to the members of the DGPH by email.. We also used the domains as guidance for the respondents in the first Delphi round, allowing the respondents to consider the different broader public health research areas. The domains wereResearch on current/contemporary issuesEffectiveness researchPolicy researchImplementation and/or participatory researchTheories and theoretical conceptsMethodological researchResearch on indicatorsIn order to frame the discussions in this stage regarding potential research topics, we defined domains, i.e., broader public health research areas, to group similar research topics together to ensure comparabilityThe second 2-h-long workshop took place during the annual conference of the German Society for Social Medicine and Prevention (DGSMP). In this plenary discussion the results of the first workshop and the planning for our RPS study were presented and discussed with representatives of German research funding agencies.The author team approached established researchers and practitioners in the field of public health in Germany to form an advisory board. The advisory board consisted of five researchers and practitioners in total , with both subject matter and methodological expertise , 31, 48.The advisory board members reviewed the design and the proposed analyses of the study, particularly with regards to the scoping stage of the study and the questionnaire design. The advisory board was in particular helpful for framing if a research topic can be reasonably considered within the realm of public health research. In our definition for this study, public health research encompasses population level and health systems research, which excludes research topics that are predominantly clinical or biomedical research.Public health research and educationPublic health administration and policy-makingNon-governmental organisations (NGO) and representatives of the publicRepresentatives of health professionals and health care institutionsSelf-governing associations of health providers and statutory health insuranceMoreover, we identified the stakeholder groups that are active in German public health and who are therefore relevant for inclusion in our RPS study , 44, 49:The stakeholder groups stand for different professional fields who are either producers, facilitators, or consumers of public health research in Germany. Hereafter, we identified specific organisations that fall within each of the stakeholder groups. We used this list of organisations for the recruitment of individual respondents for the Delphi stage  participated and nominated in total 230 individuals. The participation rate in the first Delphi round was 87% (201 respondents) and in the second Delphi round 88% (203 respondents).Table We will report the results of each Delphi round in turn.The respondents voted for research topics and assessment criteria from the initial expert list and could also propose further research topics and assessment criteria for inclusion in the second Delphi round. In total, the respondents proposed 529 research topics and 50 assessment criteria which we aggregated through a content analysis into 76 sufficiently distinct research topics and 6 assessment criteria, respectively.The content analysis of the assessment criteria revealed, however, two types of research topics that could not be assessed meaningfully with the same set of criteria: Substantive research topics and methodological-theoretical research topics. Substantive research topics focused on specific thematic contents, for example \u201cClimate change and health\u201d or \u201cHealth literacy\u201d. Methodological-theoretical research topics focused on the application or development of specific research methods and paradigms as well as on the development of theories and concepts for public health research, for example \u201cParticipation in health research\u201d or \u201cInterdisciplinary research\u201d. This split resulted in 46 substantive research topics and 30 methodological-theoretical research topics, each with three associated assessment criteria. The operational definitions of the 6 assessment criteria are shown in Box Box 1: List of assessment criteria for substantive (S1 to S3) and methodological-theoretical (M1 to M3) research topicsIn the second Delphi round the respondents rated the research topics using the assessment criteria on a 4-point Likert scale, ranging from 1 \u201ctotally agree\u201d to 4 \u201ctotally disagree\u201d. Alternatively, the respondents could also select the option \u201cI cannot assess this\u201d.Table This table shows the results of the assessments of all the respondents per criterion. The respondents had to rate the research topics according to the assessment criteria on a 4-point Likert scale, ranging from 1 \u201ctotally agree\u201d to 4 \u201ctotally disagree\u201d. Alternatively, the respondents could also select the option \u201cI cannot assess this\u201d.We asked each respondent to assess approximately 50% of all the research topics in order to reduce the workload. The selection and order of the research topics that each respondent had to rate was randomised. Therefore, the total number of respondents that assessed a certain topic differs slightly.As shown in Table In addition to the rating score, we also provided the rank of each research topic. For some research topics, the ranking per criterion showed slight differences, whereas for other research topics we found larger differences. For example, the research topic \u201cSocial inequality and injustice\u201d was not ranked very high according the assessment criterion \u201cInsufficient research\u201d (ranked 20th out of 46); however, according to the assessment criteria \u201cImproving health\u201d and \u201cHealth justice\u201d, the same research topic was ranked very high .th with the assessment criterion \u201cPotential for innovative insights\u201d. With the assessment criteria \u201cImpact on public health research\u201d and \u201cImpact on public health practice\u201d, the same research topic was ranked much lower .Table \"Public health research and/or higher education\" group. The other stakeholder groups, \"Representatives of the general public\", \"Administration and/or politics\", \"Self-governing associations of health providers and statutory health insurance\" and \"Healthcare professionals\" were grouped together and defined as \"Public health practitioners\". This allowed for a comparison between these two major stakeholder groups.As shown in Table Additional file \"large\" or \"very large\" may seem somewhat arbitrary, we calculated the interrater reliability by stakeholder group, i.e., public health researchers vs. public health practitioners. The interrater reliability can be quantified by calculating an agreement coefficient (AC). We calculated Gwet\u2019s AC because it allows for multiple rates and multiple topics [As the judging difference in ranking as e topics , 55. Thee topics , 57.In Table For all three methodological rating criteria the agreement among public health researchers could be considered moderate (Gwets AC between 0.41 and 0.60). However, among public health practitioners there was only fair agreement (Gwets AC between 0.21 and 0.40). Moreover, the coefficients for the methodological-theoretical assessment criteria were slightly lower than for the substantive assessment criteria. Concerning criteria M2  there was no statistically significant difference between the two groups of stakeholders.Funding decisions in public health research are complex and multiple criteria play a role. Consequently, priority setting becomes a challenge that policy-makers cannot solve easily , 58. TheWe conducted an RPS study with the aim to investigate which research topics in public health should be prioritised in Germany according to different stakeholders. To the best of our knowledge, we conducted the first structured and transparent RPS study for public health research topics in Germany.Improved transparency in RPS can strengthen the acceptability of the prioritised research topics, not least because research efforts and funding can be directed towards research that is relevant to all stakeholders . InvolviWe used a multi-stage approach to balance two conflicting aims, i.e., (i) eliciting proposals from a wide range of stakeholders and (ii) yet ensure that the proposals are within the realm of public health research. In order to ensure the latter, we defined domains that each stand for a broader public health research area and created\u2014by conducting expert workshops in cooperation with the DGPH\u2014an initial list of relevant research topics.In the first Delphi round, we collected additional proposals for research topics from the participating stakeholders. The findings of the first Delphi round demonstrated clearly the need to split research topics into two groups . We applied a different set of assessment criteria to these two types of research topics in the second Delphi round, as methodological-theoretical research topic cannot be assessed by the same criteria as substantive research topics.The overall rating score for a particular research topic is the average of the rating scores for the three corresponding assessment criteria. No research topic received an overall score lower than 2.5. That is, on average no research topic was considered unimportant.We found large differences in the rating and ranking of the research topics when differentiating the results along the three assessment criteria. These results corresponded to our expectation that the assessment of a particular research topic depends on the criterion applied . It shows that the assessment criteria are measuring distinct dimensions of a research topics and can give an indication on why a particular research topic is prioritised high or low. Although many studies highlighted the importance of selecting multiple assessment criteria that fit to the specific context and that can sufficiently discriminate between the assessment of different research topics , 31, 61,The descriptive comparison of the priority ranking of the research topics by stakeholder groups, showed that both public health practitioners and public health researchers ranked predominantly similar research topics as top priorities. However, it should also be noted that clear differences exist in the priority ranking of many (non-top priority) research topics between the two stakeholder groups. Moreover, the degree of agreement among the respondents on the importance of research topics differed by stakeholder group: Public health practitioners had on all criteria a lower degree of agreement than public health researchers. This overall lower degree of agreement among public health practitioners might be a result from the existing variation within the stakeholder group, as several more narrowly defined stakeholder groups were aggregated together and labelled \u2018public health practitioners\u00b4. Further research is needed to investigate how different and/or more narrowly defined stakeholder groups might produce differing results in an RPS. However, the group sizes of the more narrowly defined stakeholder groups in our RPS study were too small, which prevented a comparison between them.Public health is a complex and multifaceted field that is mainly conducted in a real-life setting, which makes it a challenge for researchers and other stakeholders in public health research to develop a common understanding of what research is most relevant or important .The top Funders in Germany can use the results of this RPS study to discuss future calls in a transparent and structured manner. The overall results show which research topics are prioritised highest by a respective stakeholder groups, while the assessment criteria also help to explain why particular topics are rated lower or higher. A worthwhile next research step should be to investigate if and how funders and other policy-makers in Germany make use of the findings of this RPS study.This is, to our knowledge, the first RPS study for public health research in Germany. So far no widely accepted standards exist on how to conduct such an RPS. Hence, our works was in many ways novel, but limitations have to be acknowledged.We recruited respondents for the Delphi stage by identifying relevant organisations in the field of public health and ask them for the nomination of respondents. The approach may seem onerous, but it has been successfully applied already before  and had The validity of the sample is limited by the specific public health organisations we identified in our search . A difference in minus means the research topic is ranked higher by public health researchers; a difference in plus means the research topic is ranked higher by public health practitioners."}
+{"text": "Application of our method to the cells in the early embryos of mice and the nematode Caenorhabditis elegans revealed that cell\u2013cell interaction forces can be written as a pairwise potential energy in a manner dependent on cell\u2013cell distances. Importantly, the profiles of the pairwise potentials were quantitatively different among species and embryonic stages, and the quantitative differences correctly described the differences of their morphological features such as spherical vs. distorted cell aggregates, and tightly vs. non-tightly assembled aggregates. We conclude that the effective pairwise potential of cell\u2013cell interactions is a live measurable parameter whose quantitative differences can be a parameter describing three-dimensional tissue morphologies.Mechanical forces are critical for the emergence of diverse three-dimensional morphologies of multicellular systems. However, it remains unclear what kind of mechanical parameters at cellular level substantially contribute to tissue morphologies. This is largely due to technical limitations of live measurements of cellular forces. Here we developed a framework for inferring and modeling mechanical forces of cell\u2013cell interactions. First, by analogy to coarse-grained models in molecular and colloidal sciences, we approximated cells as particles, where mean forces (i.e. effective forces) of pairwise cell\u2013cell interactions are considered. Then, the forces were statistically inferred by fitting the mathematical model to cell tracking data. This method was validated by using synthetic cell tracking data resembling various  C. elegans early embryogenesis, revealing a direct link between cellular level mechanical parameters and three-dimensional morphologies. Our framework provides a noninvasive tool for measuring spatiotemporal cellular forces, which would be useful for studying morphogenesis of larger tissues including organs and their regenerative therapy.Emergence of diverse three-dimensional morphologies of multicellular organisms is one of the most intriguing phenomena in nature. Due to the complex situations in living systems (e.g. a lot of genes are involved in morphogenesis.), a model for describing the emergent properties of multicellular systems has not been established. To approach this issue, approximation of the complex situations to limited numbers of parameters is required. Here, we searched for mechanical parameters for describing morphologies. We developed a statistical method for inferring mechanical potential energy of cell\u2013cell interactions in three-dimensional tissues; the mechanical potential is an approximation of various mechanical components such as cell\u2013cell adhesive forces, cell surface tensions, etc. Then, we showed that the quantitative differences in the potential is sufficient to reproduce basic three-dimensional morphologies observed during the mouse and  In multicellular living systems, various three-dimensional morphologies are observed in tissues and organs, which are often tightly linked to their physiological functions. Morphogenetic events are thought to be primarily dependent on the mechanical properties of the constituent cells \u20135. MechaTo search for mechanical parameters which are directly linked to three-dimensional morphologies, we focused on mechanical potential energies of pairwise cell\u2013cell interactions as follows. Cell\u2013cell adhesion forces, which are mediated by cell adhesion molecules such as cadherin proteins, can be approximated as attractive forces in isolated two cell systems , whereasin vivo. On the other hand, in molecular and colloidal sciences, we found a strategy worth considering: a top-down approach is adopted for inferring pairwise potentials, where positions of the objects such as radial distribution functions are solely used . D. Inferred DF curves under different radius of spheres. Two snapshots under the different radius are shown. In the case that 9.5\u03bcm, the particles were very closely contacted each other so that the distances between the adjacent particles seemed to be less than the diameter of the particles. Therefore, each particle was compressed. In the case that the radius was 100\u03bcm, the spherical constraint was sufficiently large so that the particles are not in contact with the surface of the constraint. The black scale bars and the gray ones correspond to the diameter of the particles and the diameter of the spherical constraint with the radius = 14.5\u03bcm.(TIF)Click here for additional data file.S5 FigInference of effective forces under spherocylindrical constraints. Simulation data were used to validate our inference method. Systems with spherocylindrical constraints were implemented. A. Particles were embedded into a spherocylindrical constraint (A-i and -ii). Definitions of the radius and the length of the spherocylinder, and the radius of particles are shown (A-ii and -iii). The simulation procedures when a particle collides with the spherocylindrical constraint were implemented in a similar manner to (TIF)Click here for additional data file.S6 FigC. elegans. In the top left panel, the minimizations of Equation S6 were performed from different initial force values as described in the x- and y- axes. In the top right panel, the initial forces were given as uniform random numbers ranging from -0.03 to 0.03 in the y-axis. The inferred values of each cell-cell interaction were plotted by crosses. The inferred values from the different initial force values were absolutely correlated in the all cases, suggesting that a unique solution was obtained in each system. In the bottom panels, different cut-off distances were given as indicated , and the minimizations were performed. The inferred values were strongly correlated when the cut-off distances were greater than 2.8-fold diameter of cell bodies, suggesting that a unique solution was obtained under these conditions.Uniqueness of solutions of effective force inference in (TIF)Click here for additional data file.S7 FigC. elegans and mouse embryos. A. The Morse potential was used for fitting. The formula of the Morse potential is: U is the potential energy, D is the particle\u2013particle distance, and Ue, De, and a are the fitting parameters. Cell\u2013cell distances were normalized by the distances providing the potential minima in the inferred potentials. Effective potential energies were normalized so that the potential minima become -1.0. t36-75 and t156-195 are from the C. elegans as defined in Fitting of the previously-reported potentials to inferred distance\u2013potential (DP) curves in (TIF)Click here for additional data file.S8 FigC. elegans embryos. A. Comparison of the inferred DP curves under the two models: the absolute velocity-based and the relative velocity-based models. The effective potential energies were normalized so that the potential minima become -1.0. The time frames  were defined in C. elegans embryo at the t36-75 time frame. The values of \u03b3 in Equation S1-2 were variously set. The inferred DP curve from the absolute velocity-based model (model-1) is also presented for comparison, where \u03b3 was set 1.0. In the relative velocity-based model, because \u03c9g(Dpm) in the Equation S2-1 was set to be 1.0 at Dpm = the diameters of cell bodies, the values of {\u03c9g(Dpm)\u03b3} at Dpm = the diameters of cell bodies are equal to \u03b3.Inferred distance\u2013potential (DP) curves under the assumption of the relative velocity-dependent model (Eq S1-2) in (TIF)Click here for additional data file.S9 FigDistance\u2013force and distance\u2013potential curves in mouse embryos. Inferred DF and DP curves in mouse 8-cell and compaction stages. Four independent embryos (#1\u20134) were analyzed for each stage. #1 for each stage corresponds to (TIF)Click here for additional data file.S10 FigDistance\u2013force and distance\u2013potential curves of different cell types in mouse embryos. A. Inferred DF and DP curves of outer (blue circles) and inner (green circles) cells in mouse compaction stage. There are three possible interactions: inner\u2013inner, outer\u2013outer, and inner\u2013outer cells. These data were obtained from embryo #1 in (TIF)Click here for additional data file.S11 FigExperimental design for inhibiting compaction in mouse embryos. The experimental design of (TIF)Click here for additional data file.S12 FigDistance\u2013potential curve in compaction-inhibited mouse embryos. The DP curves in (TIF)Click here for additional data file.S13 FigHistological observations of compaction-inhibited mouse embryos. A. Immuno-staining of E-cadherin. Two examples are shown for the normal or EDTA-treated embryos (#1 and #2). Conditions without the 1st anti-body is also shown as the negative control. BF, bright field; 3D, three-dimensional image. Green, Histone-EGFP. B. Phalloidin staining for F-actin. Two examples are shown for the normal, cytochalasin D-treated, or blebbistatin-treated embryos (#1 and #2). BF, bright field; 3D, three-dimensional image. Green, Histone-EGFP. CytoD. Cytochalasin D; Bleb, blebbistatin. C. FM4-64 staining for cell membrane. Two examples are shown for the normal, EDTA-treated, cytochalasin D-treated, or blebbistatin-treated embryos (#1 and #2).(TIF)Click here for additional data file.S14 Figp-values for \u201cNo Drugs\u201d vs. \u201cEDTA\u201d, vs. \u201cCytoD\u201d, and vs. \u201cBleb\u201d are 0.21, 0.21, and 0.036, respectively. In the case for 10% potential minima Click here for additional data file.S15 FigList of simulation results of compaction-inhibited mouse embryos. Simulations were performed under the all DP curves obtained from the compaction-inhibited embryos in (TIF)Click here for additional data file.S1 MovieThis movie corresponds to (AVI)Click here for additional data file.S2 MovieThis movie corresponds to (AVI)Click here for additional data file.S3 Movie(MOV)Click here for additional data file.S4 Movie(MOV)Click here for additional data file.S5 Movie(AVI)Click here for additional data file.S6 Movie(AVI)Click here for additional data file. 14 Mar 2023Dear Dr. Koyama,Thank you very much for submitting your manuscript \"Effective mechanical potential of cell\u2013cell interaction explains three-dimensional morphologies during early embryogenesis\" for consideration at PLOS Computational Biology.As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.When you are ready to resubmit, please upload the following:[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Philip K MainiAcademic EditorPLOS Computational BiologyDaniel BeardSection EditorPLOS Computational Biology***********************Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1:\u00a0Re: Review of \"Effective mechanical potential of cell-cell interaction explains three-dimensional morphologies during early embryogenesis\".------------------------------------------------------------------------------Summary:------------This study develops a top-down method to statistically infer the pairwise radial forces between cells using particle tracking data. The method's suitability is verified using synthetic data generated from a particle model, the methods reproduces the critical features of the pairwise interaction potential. Using cell tracking data from in vivo systems  the authors demonstrate that the pairwise interaction potentials can be inferred from experimental data. Furthermore, upon simulating a particle model using the inferred interaction potentials, the simulated cell configurations quantitative macroscopic properties (e.g.\\\\ shape) matched those observed in the experimental systems. Biological system perturbations are considered, yielding different pairwise interaction potentials, and different simulations results, which once again matched experimental observations.In my opinion, this study is timely, interesting, and provides a first method to address the long standing question of who force potentials for in-silico biological systems should be chosen. This paper will be of considerable interest to those simulating biological systems using force-based approaches. The paper is well written, easy to follow, and appears to contain all required pieces to reproduce and build on the work done. I have collected a few minor comments below (they verge on being nit-picky). I recommend this paper for publication.Minor comments:------------Line 125: I don't think the statement that pairwise interactions between cells have never been measured is correct. There definitely are experiments that have looked at the pairwise interaction potentials between cells in atomic microscopy settings. Having said that, I agree with the authors general assertion that such profiles have not been inferred in multicellular systems(as done in this study).Line 213: Is the role of F_i^2 essentially to force a minimization of forces between cell pairs?Fig 2: The inferred potentials can clearly match the potential dip. However, it appears that in all the scenarios the inferred potential increases faster to 0 after the dip. Is there a reason for this? Could this be caused by crowding? i.e. that piece of the potential cannot be inferred because due to crowding i.e. cell pairs of that separation are not observed in the data?Line 267: I generally agree with the statement. However, there are maybe two points worth discussing or mentioning:1. Cell volumes can change. Some cells feature aquaporins which facilitate the transport of water between the extracellular and intracellular space.2. Many particle models  rely on cell compression in growth control (i.e. the transition from a growing cell to a quiescent cell). While cell volumes do not necessarily change, resolving these compressive forces is crucial to correctly model tumour spheroid growth.Line 291: What does it mean to essentially have a unique solution?Line 457: There are also 3D vertex models see the work by Durney and Feng.Line 65: parameters at the cellular levelLine 70: interactions are considered.Line 141: we develop a top-down methodLine 150 and following: On first look cells in embryos appear highly changing , maybe the authors could add a sentence to clarify the differences between epithelial, mesenchymal and blastomeres and their properties here.Line 164: which originate fromReviewer #2:\u00a0The review is uploaded as an attachmentReviewer #3:\u00a0In their work, Koyoma and co-authors present a procedure for the inference of effective (relative) cell-cell interaction forces based on (relative) cell trajectories.The work is based on simple idea of minimizing a cost function that compares the actual experimental displacement to a simulated displacement for a given cell-cell interaction force.The idea itself is very useful, since both computational models and experimental characterizations can greatly benefit from a data-based and model-agnostic representation of the cell-cell interaction force. Moreover, the results are clearly presented and the data shown support the reported results.The forces that are derived also appear realistic, showing a smooth potential with a relative long adhesive tail that is expected for interaction between adhering, strongly deformable mechanical entities (see further in point 8)The results of the paper are straightforward and well-presented. However, I do have a few remarks that in my opinion warrant further discussion:1. An important limitation is that forces are considered as pair-wise potentials, this means that for a given contact pair, the force is only dependent on state variables of the two interacting particles, but not the surrounding. In reality, this assumption will break down for the interaction between highly deformable bodies, in which the mechanical state is determined by the balance of surface tension and adhesion across all contacts. For example, a doublet that is laterally confined by other cells will not adhere to the same extent as an isolated single cells. For stiff particles / colloidal particles, this limitation does not play a role, since deformations are strongly localized (e.g. Hertz assumptions) and the pair-wise potential still holds. However, this is not expected for many cell types, certainly those that are typically modeled using vertex-like models. I think the authors should investigate the limitations of their approach for these highly deformable cells (preferably quantitatively) and discuss these in the manuscript.2. In the same line of reasoning, their model assumes there are no contact-specific state variables (i.e. contact state) that play a role since the potential only takes into account the positions of the particles. In reality, contacts between cells involve bonds, which give rise to a clear hysteresis upon approach / retraction. This hysteresis is for relatively stiff particles captured in JKR-like potentials and for liquid-droplet / foam-type models will play an even bigger role. The authors should motivate their choice of neglecting this hysteresis. Effectively, it implies that the cell is always able to 'probe' its neighbourhood and react mechanically in accordance, even at a distance away from the cell 3. Another important limitation in the potential is the lack of a velocity-dependent component in the interaction force. Typically, individual cell-based models take these velocity-dependent forces into account, as relative frictional forces, see e.g. this old work:Drasdo, Dirk, Stefan Hoehme, and Michael Block. \"On the role of physics in the growth and pattern formation of multi-cellular systems: what can we learn from individual-cell based models?.\" Journal of Statistical Physics 128 (2007): 287-345.In case of C. elegans, it makes sense that there are strong viscous contributions that determine the relative velocities (and thus relative displacements) of adjacent cells. For example, the cortical material of the egg has revealed a hydrodynamic length-scale of 68 um.Saha, Arnab, et al. \"Determining physical properties of the cell cortex.\" Biophysical journal 110.6 (2016): 1421-1429.If this is the case, viscous forces can be propagated over long distances in the embryo and the intercellular potential will not only be determined by the relative distance between two cells, but also by their relative velocity. It would greatly benefit the generality of this paper if the authors assess the effect of such a contribution in their model. In this case, Eq. 1 would not be correct, as this equation uses a single global damping coefficient gamma (representing some kind of medium damping), rather than a viscosity that would be dependent on the relative velocity of the two cells. For C. Elegans, these relative velocities are available, so it would be a matter of including this additional parameter in their model.4. On line 210 it is explained that the cost function Eq. 3 'worked well'. The authors should in the main text specify more clearly what it means to 'work well', and why the previous proposal does not 'work well'.5. Small remark, but the shape in Fig. 3 is a spherocylinder or capsule, not a cylinder.6. I do not agree with the reasoning in line 266-270. There are cells that can live in a compressed context and it is not because the cytosol itself is incompressible that cells cannot be in a general compressed state (meaning that they exert a net repulsive force on their neighhourhood). More weakly, it is true that in most tissues, a tensile state is observed (if the boundary conditions permit). However, in some cases it is obvious that local compressed states must exist: For example, take a free tissue spheroid or cell aggregate: The cells at the periphery will generate a net tissue surface tension. Young-laplace law dictates that the core of the tissue spheroid must be under pressure, and that, on average, these cells must exist in a compressed state, see e.g.Cuvelier, M., Pe\u0161ek, J., Papantoniou, I., Ramon, H., & Smeets, B. (2021). Distribution and propagation of mechanical stress in simulated structurally heterogeneous tissue spheroids. Soft Matter, 17(27), 6603-6615.I think this reasoning should be removed from the paper as it does not further benefit the presentation of the results.7. I am not convinced by the results presented in Fig 6 and Fig 8, which aim to show that for the measured differences in cell potential, different behaviors of cell assemblies will be expected. I think these figures are very qualitative and miss any depth or physical interpretation. If the aim is truly to investigate the difference between these potentials on tissue morphology, the rheological and physical properties of these tissues arising from the difference in potential should be investigated. E.g. the difference in tissue surface tension, shear rigidity, apparent elasticity. Also, it is expected that glassy states emerge for such sphere-approximations of cells. In practice these could be overcome by actual deformable cells and actual cell activity, which is not taken into account in this. I suggest that the authors remove these figures to the supplementary information, as they only make a weak point on the effect of these differences in potential.8. The derived potentials (e.g. fig 4) look very interesting. However, it is a shame that the authors did not quantify the properties of these potential in more detail and do some comparison with classical models used in cell-based simulation. For example, it looks like these potentials more closely correspond to a model such as used in:Delile, J., Herrmann, M., Peyri\u00e9ras, N., & Doursat, R. (2017). A cell-based computational model of early embryogenesis coupling mechanical behaviour and gene regulation. Nature communications, 8(1), 13929., which is commonly used in cell-based simulations these days, and it looks less similar to e.g. JKR or similar model descriptions.Could the authors do an attempt to fit these very simple mathematical models to their derived potential and discuss eventual discrepancies?**********Have the authors made all data and (if applicable) computational code underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data and code underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data and code should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data or code \u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example in PLOS Biology see here: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at AttachmentPaper_Review.docxSubmitted filename: Click here for additional data file. 11 May 2023AttachmentResponse_to_reviewers230510v2_forSubumit.pdfSubmitted filename: Click here for additional data file. 26 Jun 2023Dear Dr. Koyama,We are pleased to inform you that your manuscript 'Effective mechanical potential of cell\u2013cell interaction explains three-dimensional morphologies during early embryogenesis' has been provisionally accepted for publication in PLOS Computational Biology.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Computational Biology.\u00a0Best regards,Philip K MainiAcademic EditorPLOS Computational BiologyDaniel BeardSection EditorPLOS Computational Biology***********************************************************Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #2:\u00a0The authors have addressed the concerns raised by this reviewer. It is therefore the recommendation of this reviewer that the journal accepts the paper for publication.Reviewer #3:\u00a0I thank the authors for their extensive reply to the raised concerns and for the additional simulations and experiments that were performed to improve the manuscript.I apologize for my misunderstanding of (my) point 2. Indeed, the temporal resolution of intercellular forces ensures that possible hysteresis effects would be automatically retrieved by this method, a possible avenue of future researchAll other concerns were addressed in-depth by the authors and I think the manuscript has been significantly improved.I think this is solid research and a great contribution to the field.**********Have the authors made all data and (if applicable) computational code underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data and code underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data and code should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data or code \u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  1223-442824 | ploscompbiol.org | @PLOSCompBiolPLOS Computational Biology | Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom"}
+{"text": "During early development, cartilage provides shape and stability to the embryo while serving as a precursor for the skeleton. Correct formation of embryonic cartilage is hence essential for healthy development. In vertebrate cranial cartilage, it has been observed that a flat and laterally extended macroscopic geometry is linked to regular microscopic structure consisting of tightly packed, short, transversal clonar columns. However, it remains an ongoing challenge to identify how individual cells coordinate to successfully shape the tissue, and more precisely which mechanical interactions and cell behaviors contribute to the generation and maintenance of this columnar cartilage geometry during embryogenesis. Here, we apply a three-dimensional cell-based computational model to investigate mechanical principles contributing to column formation. The model accounts for clonal expansion, anisotropic proliferation and the geometrical arrangement of progenitor cells in space. We confirm that oriented cell divisions and repulsive mechanical interactions between cells are key drivers of column formation. In addition, the model suggests that column formation benefits from the spatial gaps created by the extracellular matrix in the initial configuration, and that column maintenance is facilitated by sequential proliferative phases. Our model thus correctly predicts the dependence of local order on division orientation and tissue thickness. The present study presents the first cell-based simulations of cell mechanics during cranial cartilage formation and we anticipate that it will be useful in future studies on the formation and growth of other cartilage geometries. In embryos, the initial skeleton is made out of cartilage. As the embryo grows, this cartilage needs to increase in size while correctly maintaining shape. A recent study revealed that for cartilage found in growing skulls, a flat sheet-like geometry is reflected in a distinct arrangement of cells at the microscopic level. Cells sharing a common ancestor are arranged into short columns such that the sheet grows in thickness by lengthening columns, and expands length-wise by adding new columns from single precursor cells. In this work we investigate the mechanical principles underlying column formation and insertion using a computational model that individually represents cells and their behavior. We confirm that arrangement of clonal columns perpendicular to the main expansion direction of the sheet requires oriented cell division. Moreover, we find that column order benefits from an increased amount of extracellular matrix between cells. Similarly, our model suggests that new clonal columns are able to insert themselves into pre-existing cartilage if sufficient matrix is available. Our model constitutes an important step to study cartilage formation and growth in different geometries which will be useful for understanding skeletal developmental disorders as well as for applications in tissue engineering. Correct formation of embryonic cartilage is essential for healthy development. Cartilage provides structural support to the growing embryo and it serves as precursor to bone formation. A recent study investigating the cellular structure of cartilage in mouse embryos revealed that embryonic cartilage is highly geometrically ordered .More specifically, cells inside growth plates of the cartilaginous skull are arranged in columns. These columns are oriented transversally and arranged adjacent to each other in the lateral direction, see et al. showed that column formation relies on oriented cell division, which can be perturbed by ectopic activation of ACVR1, a receptor of Bone Morphogenetic Protein (BMP)  is added to each coordinate of all cell midpoints to allow for biologically realistic variations on the cell positions. Note that the rigid boundaries of the condensation are enforced at the cell midpoints, meaning that parts of the cell\u2019s spheres in visualisations can cross the boundary planes, as visible in pmax = 0.1 d is chosen small enough as to not significantly alter the geometrical arrangement of the initial mesenchymal condensation.Additionally, a perturbation drawn uniformly from  and the polar angle \u03b8 \u2208 . In this framework, strictly vertically oriented cell division directions correspond to a polar angle of \u03b8 = 0\u00b0 for any angle \u03c6. To investigate the influence of small deviations from the vertical division direction onto column order, we allowed \u03b8 to randomly vary at each division event, with a maximum value of \u03b8max. This was achieved by drawing a value for cos(\u03b8) from a uniform distribution between cos(\u03b8max) and 1, and calculating \u03b8 from the sampled value. The azimuthal angle \u03c6 was drawn from a uniform distribution between 0 and 2\u03c0. Drawing cos \u03b8 rather than \u03b8 from a uniform distribution ensured that the endpoints of division vectors were evenly spaced on the unit sphere  A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.\u00a0Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).Important additional instructions are given below your reviewer comments.Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.Sincerely,Philip K MainiAcademic EditorPLOS Computational BiologyMark AlberSection EditorPLOS Computational Biology***********************Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1:\u00a0The comments are attached as a .pdf file.Reviewer #2:\u00a0Re: Review \"Contributions of cell behaviour to geometric order in embryonic cartilage\"----------------------------------------------------------------------------------------This article develops a three-dimensional model investigating the formation of columnar structure in early cartilage (and bone) formation during organism development. The model is motivated from a separate experimental / modelling paper (the model there was a cellular automaton on a lattice). In detail, the authors consider two scenarios: (1) the emergence of columns from dense collections of mesenchymal cells; and (2) the insertions of additional columns into an existing columnar structure (e.g.\\\\ tissue growth).The authors goal is to elucidate the effect mechanical forces and cell division play in this process. For this purpose they propose a simple centre based model implemented in Chaste, with isotropic cell-medium friction, and cell-cell repulsion as the only cell-cell forces. Cells are placed in a three dimensional rectangle with a solid repulsive boundary placed below and above. The model setup resembles as cross-section of the modelled tissue configuration. Since previous modelling for this system was done using a lattice based model, mechanical insights were limited, which is being addressed in this article.Through simulation studies the authors demonstrate that cell-cell repulsion with oriented cell division along the z-direction is sufficient for columnar structure to form, from an initially condensed group of cells (fairly flat). Further the authors demonstrate that oriented cell division is required, without columns do not form. The ''columnarness'' of their simulation outputs is quantified using an adequate order parameter. In addition, the authors investigate the effect and role other key parameters in their model play. Finally, the authors investigate whether their model supports the insertion of additional column. I suspect the motivation is to investigate what happens in a growing tissue? Their model cannot recapitulate the insertion of novel columns, hinting that additional mechanisms are required.The paper is well written, all details are included, the code is available, and I feel confident that the results are reproducible. In my opinion this article provides a simple mechanical explanation for the formation of the observed columnar structure, the article clearly demonstrates limitations of their model, which highlight areas of future investigation. I do have some small remarks, and questions below, but I expect those to be easily addressable, and following revisions recommend this article for publication.Comments------------ I have three questions regarding the model for cell-cell division. As far as I understand cell division is implemented as follows. When the cell cycle time is completed two cells are placed a given distance apart along a given orientation.Q1: Is the volume of the cells increased as they progress through the cell cycle?Q2: Does simply placing the cells a distance r_0 apart immediately not lead to simulation challenges? If I were to implement this, I would let the cell double volume, then place two cells of the same volume at the same location, and then slowly push them apart to avoid numerical integration problems, and keep the system close to mechanical equilibrium. Is this not required since the cell population is always somewhat sparse?Q3: In the simulations in which columns form, the division orientation is always along the z-axis i.e. fixed. Have the authors considered mechanical re-orientation of the cell division axis? In other words, let the mechanical interactions of the dividing cell determine the cell division axis? Or are the authors convinced that only the gradient of BMP guides the division axis?- This comment is more of an observation. The authors demonstrate that oriented cell division is not sufficient to explain the intercalation of new columns into a pre-existing structure, unless sufficient space is available. This somewhat reminds me of classical Turing system results on growing domains see for instance Crampin et. al. (1999) i.e.\\\\ a new spike or stripe can be formed when sufficient space is available in the domain to accommodate it. Similarly, with the coarsening phenomena linked to growth .- Line 150: I follow the authors argumentation regarding why only a repulsive cell-cell interaction potential is used. But why is this interaction potential quadratic. Why not for instance, use a Hertz interaction potential or yet a different power? The authors finally explain their choice in the discussion. In my opinion it would make sense to explain their decision in the method or at least refer the reader to the discussion.- I'm confused about with the authors description of the proliferation control. In detail, the paragraph beginning on line 184. Does this mean each cell can only divide a maximum of four times? If not how is the clonal envelope defined and computed?- Clonal envelopes are referred to many times before they are defined. It's confusing.- On line 218 the authors state that they do not impose any boundary conditions in the xy-plane. Does this mean that periodic boundary conditions are imposed?- Lines in Figure 4d, 5d, 6d, 7d are not distinguishable in BW or for people with color seeing challenges. I would encourage the authors to employ different linestyles to avoid that challenge.- Line 380: The authors hypothesize that column formation is aided by increased distance due to reduced mechanical repulsive forces. Would it be possible to quantify this interpretation?- Line 382: Which is the perichondrial boundary again? Maybe just reiterate this as many readers will have forgotten at this point i.e.\\\\ that this is a discussion on the mechanical forces generated by planes located at z = u, l.Reviewer #3:\u00a0The review is uploaded as an attachment.**********Have the authors made all data and (if applicable) computational code underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data and code underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data and code should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data or code \u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0NoneReviewer #3:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool, Data Requirements:http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example in PLOS Biology see here: Reproducibility:https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at AttachmentReview comments.pdfSubmitted filename: Click here for additional data file.AttachmentR_Manuscript_PCOMPBIOL-D-23-00028.pdfSubmitted filename: Click here for additional data file. 3 Oct 2023Attachmentresponse_to_reviewers_comments20230926.pdfSubmitted filename: Click here for additional data file. 3 Nov 2023Dear Miss Mathias,We are pleased to inform you that your manuscript 'Contributions of cell behavior to geometric order in embryonic cartilage' has been provisionally accepted for publication in PLOS Computational Biology.Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Computational Biology.\u00a0Best regards,Philip K MainiAcademic EditorPLOS Computational BiologyMark AlberSection EditorPLOS Computational Biology***********************************************************Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1:\u00a0In my opinion the authors have made changes that were in line with suggestions of the reviewers, which in turn improved the quality of the manuscript.Reviewer #2:\u00a0The authors addressed my comments, and I have no further comments, and stand by my earlier recommendation that this article is publishable.Reviewer #3:\u00a0The authors have satisfactorily addressed all my comments, and the manuscript has greatly improved after revision.**********Have the authors made all data and (if applicable) computational code underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data and code underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data and code should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data or code \u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article  1223-442824 | ploscompbiol.org | @PLOSCompBiolPLOS Computational Biology | Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom"
\ No newline at end of file