diff --git "a/deduped/dedup_0605.jsonl" "b/deduped/dedup_0605.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0605.jsonl"
@@ -0,0 +1,70 @@
+{"text": "As anorexia and hypermetabolism are common in cirrhosis, leptin levels may be increased in this disease. In this study, we investigated the relation between the severity of disease and serum leptin levels in post-hepatitis cirrhosis and the role of body composition, gender and viral aetiology of cirrhosis in this association.Thirty-five cases with post-hepatitis cirrhosis and 15 healthy controls were enrolled in this study. Body composition including body mass index, body fat percentage and body fat mass were determined. Serum leptin levels were assayed.Leptin levels were significantly higher among cirrhotic patients independent of sex compared to controls (p = 0.001). Female patients in both groups have had higher leptin levels than males .Cirrhotic patients in each of A, B and C subgroups according to the Child- Pugh classification revealed significantly different levels compared to controls . Male cirrhotics in Child-Pugh Class B and C subgroups had significantly higher leptin levels compared to male controls . On the other hand, female patients only in Child Pugh class C subgroup have had higher levels of serum leptin compared to controls (p = 0.022).Child-Pugh classification has been found to be the sole discriminator in determination of leptin levels in cirrhotics by linear regression (beta: 0.435 p = 0.015).Serum leptin levels increase in advanced liver disease independently of gender, body composition in posthepatitic cirrhosis. The increase is more abundant among patients that belong to C subgroup according to the Child- Pugh classification. Leptin, a 16-kilodalton protein, is involved in the regulation of food intake and body composition  and has In normal humans, circulating level of leptin is higher in women than in men ,5. BesidMalnutrition is a common feature of cirrhotic patients . A negatIn this study, we investigated the relation between the severity of disease and serum leptin levels in post-hepatitis cirrhosis and the role of body composition, gender and viral aetiology of cirrhosis in this association.Thirty-five cases with post-hepatitis cirrhosis  which were diagnosed on the basis of the clinical, laboratory, radiological, and/or histopathological findings, and 15 healthy controls  were enrolled in this study. Cirrhotic cases were assigned into 3 groups on the basis of the Child-Pugh classification  as folloControl group consisted of healthy individuals with normal medical history, physical examination and blood biochemistry. None of them have had a restriction of diet for loosing weight during the last three months. Subjects who receive any medication have not been included into control group. The local human institutional review committee approved the study and written consents were received from all participants.th percentile  compared to controls  .Gender based serum leptin levels of controls and cirrhotic cases that were grouped according to Child Pugh Classification were as shown in Figure When age, gender, BFM, hepatitis B and C virus as etiologic factors of cirrhosis and child A, B and C as Child-Pugh classification were tested as independent variables for determination of serum leptin levels as dependent variable by linear logistic regression analysis in cirrhotic group, analysis result showed that Child-Pugh classification was the sole discriminator in determination of serum leptin levels in cirrhotic cases  Table .Leptin regulates body weight by suppressing appetite and increasing energy expenditure ,3,4. AnoLeptin levels are higher in woman than in men ,6. McCulSince BMI and BFM values do not differ according to the sex and the presence or absence of cirrhosis, increased serum leptin levels could not be simply dedicated to BFM or malnutrition status in cirrhosis. In addition, linear regression test in the present study has shown that disease severity, which was determined by Child-Pugh classification, was the sole significant determinant of serum leptin levels in cirrhosis. In previous studies, association between the severity of cirrhosis and serum leptin levels is controversial -13. HenrIn an animal study, it has been shown that chronic ethanol consumption leads to increased serum concentrations of tumor necrosis factor and related cytokines such as leptin by inducing over production of these factors in the liver and peripheral adipose tissues . Leptin Serum leptin levels increase in advanced liver disease independently of gender, body composition and viral etiologic factor in post-hepatitis cirrhosis. The increase is more abundant among patients that belong to C subgroup according to the Child- Pugh classification.BMI, body mass index; BFP, body fat percentage; BFM, body fat massThe authors declare that they have no competing interests.Bolukbas FF conceived of the study, and participated in its design and coordination. Bolukbas FF, Bolukbas C, Erdogan M and Zeyrek F collected the samples and carried out the laboratory analysis. Bolukbas C conceived of the study and participated in the sequence alignment and drafted the manuscript. Horoz M participated in the design of the study, participated in the sequence alignment and drafted the manuscript. Gumus M collected the clinical data and performed the statistical analysis. Yayla A drafted the manuscript and revised it critically for important intellectual content. Ovunc O participated in study design and coordination and revised the manuscript critically for important intellectual content.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "More than fifteen years ago it was discovered that intramyocellular triglyceride (imcTG) content in skeletal muscle is abnormally high in conditions of lipid oversupply (e.g. high fat feeding) and, later, obesity, type 2 diabetes (T2D) and other metabolic conditions. This imcTG excess is robustly associated with muscle insulin resistance (MIR). However, to date the pathways responsible for the imcTG excess and the mechanisms underlying the imcTG-MIR correlation remain unclear. A current hypothesis is based on a backward mechanism that impaired fatty acid oxidation by skeletal muscle causes imcTG to accumulate. As such, imcTG excess is considered a marker but not a player in MIR. However, recent results from kinetic studies indicated that imcTG pool in high fat-induced obesity (HFO) model is kinetically dynamic. On one hand, imcTG synthesis is accelerated and contributes to imcTG accumulation. On the other, the turnover of imcTG is also accelerated. A hyperdynamic imcTG pool can impose dual adverse effects on glucose metabolism in skeletal muscle. It increases the release and thus the availability of fatty acids in myocytes that may promote fatty acid oxidation and suppress glucose utilization. Meanwhile, it releases abundant fatty acid products  that impair insulin actions via signal transduction, thereby causing MIR. Thus, intramyocellular fatty acids and their products released from imcTG appear to function as a link to MIR. Accordingly, a forward mechanism is proposed that explains the imcTG-MIR correlation. Intramyocellular triglyceride (imcTG) is an important energy source for skeletal muscle. In 1991, Storlien and associates reported that under high fat feeding, imcTG content is elevated to abnormally high levels and this is correlated with muscle insulin resistance r = 0.86\u20130.95) -7. As sk6\u20130.95 -7Now it is increasingly realized that imcTG is the most robust correlate of MIR, stronger than other metabolic indicators such as % body fat, body mass index (BMI) and waist-hip ratio . This suBy comparison, there have been limited research efforts on the kinetics of imcTG metabolism, and its role in MIR, such as synthesis, turnover and oxidation, the pathways that determine imcTG pool size. In the face of enlarged imcTG pool size, abnormality in imcTG kinetics may function as an independent factor to exert metabolic consequences by altering intramyocellular fatty acid metabolism, thereby contributing to MIR. This review is focused on the synthesis, turnover and utilization of fatty acids and their derivatives derived from the intramyocellular neutral lipid pool (imcTG) and their roles in MIR as related to obesity and T2D.For imcTG content to increase, its synthesis must increase or its utilization decreases, or both. At present time, it is not clear whether it is the synthetic or utilization limb(s) that is responsible for the observed excess imcTG accumulation. Clarifying this question is important, however. If it is the utilization, then it would imply that imcTG excess is merely a marker (consequence) of impaired fatty acid utilization (\u03b2-oxidation). This is termed backward mechanism, meaning that reduced fatty acid oxidation acts backward to cause imcTG accumulation, the substrate source pool for \u03b2-oxidation. In contrast, if it is the synthesis, it would mean that imcTG is more actively involved as a source of MIR by accumulating excess amount of fatty acids in it. To maintain imcTG homeostasis, the enlarged imcTG pool turns over rapidly and thus releases abundant fatty acid products that interfere with insulin signaling. This is termed forward mechanism, meaning that imcTG is the source pool that causes the adverse consequences. For the purpose of pharmaceutical intervention of MIR, the two mechanisms mean different targets. The backward mechanism requires manipulation (to stimulate) of fatty acid utilization in order to normalize imcTG pool size and to eliminate fatty acid products that impair insulin signaling. In contrast, the forward mechanism requires modulation (to suppress) of imcTG turnover or hydrolysis to contain intracellular fatty acid flux and availability. Therefore, it is important to determine which mechanism is (more) responsible for MIR.Toward this direction, we have observed that the rate of incorporation of glycerol and fatty acid precursors into imcTG (synthesis) is grossly accelerated in three muscle types, gastrocnemius, soleus and tibialis anterior, in HFO rats . The ratThe accelerated imcTG synthesis in HFO is consistent with our observation that in these rats, >80%, compared to 50% in lean rats, of plasma palmitate traverses imcTG before being oxidized in gastrocnemius. This indirect oxidation of plasma fatty acids (by traversing imcTG pool first) may make imcTG synthesis falsely high when it is determined based on substrate incorporation as we did. This probably explains why imcTG pool size is not a precise function of its synthesis rate. This illustrates again the point that imcTG pool size is determined by the delicate balance between influx and efflux, but not by either alone. Nonetheless, a conclusion that can be drawn from these observations is that the kinetics of imcTG synthesis in the HFO model is greatly accelerated and it likely plays an important role in imcTG accumulation. So far, while likely involved, the quantitative role of circulating VLDL-TG fatty acids in imcTG synthesis has not been studied.It is important to point out that the accelerated synthesis in the HFO model was not a result of direct (high fat) dietary effects as plasma fatty acids, glycerol, triglycerides and glucose were all experimentally matched between lean and obese groups by substrate co-infusion . Therefo14C-palmitate)-chase (to monitor the decay rate of the incorporated tracer) technique, we have determined that in young and healthy men and women exercising at 45% of VO2max, the fractional turnover rate (FTR) of imcTG was 0.0032 \u00b1 0.0007/min [The study of imcTG turnover kinetics is very limited and no such studies seem to have been reported in relation to MIR. The limited reports indicated that in resting healthy humans, imcTG pool turns over slowly with a fractional rate of 0.0026/min  [0007/min . By comp0007/min . HoweverThese findings are in contrast to the view that in obesity and T2D imcTG is a static pool turning over slowly that contributes to its excess accumulation . The datThe accelerated imcTG dynamics, compounded by its enlarged pool size, translates into remarkable increases in the release of fatty acids from it. This results in increased fatty acid trafficking and availability in myocytes. Indeed, we routinely observed increases in intramyocellular non-esterified fatty acids (NEFA) in the HFO rats compared to lean control . Under the action of acyl CoA synthase, long chain fatty acids are rapidly activated to long chain acyl CoA. They are precursors to several pathways including mitochondrial \u03b2-oxidation and signal transduction.An immediate fate for long chain acyl CoA is \u03b2-oxidation in mitochondria after being converted to long chain acylcarnitines catalyzed by CPT1 . Peroxisomal \u03b2-oxidation is minor as the pathway primarily functions to shorten very long fatty acids for further oxidation by mitochondria ,33. TheoNEFA and their derivatives  are also signaling molecules. Therefore, increased intramyocellular fatty acid availability may exert additional effects on muscle metabolism via signal transduction. Now it is known that the content of these molecules in skeletal muscle is increased with lipid oversupply and in obesity . They ac14C-glycerol, increased production of diacylglycerol from imcTG in gastrocnemius and soleus muscles of HFO rats has been observed compared to lean control. Therefore, an enlarged pool size and accelerated turnover of imcTG perhaps act in concert to increase the production of signaling molecules.The turnover of imcTG releases 1,2-diacylglycerol  and otheWhile diacylglycerol is a classical second messenger, whether the thioester form (acyl CoA) or the free form of fatty acids is the active form for signaling seems unclear. Contrasting to many other reports, Forman et al reported that the carboxyl group, -COOH, is required for the signaling activity and upon thioesterification, the activity is lost . NonetheAlthough elevated long chain acyl CoA and diacylglycerol in conditions of lipid oversupply and insulin resistance have been extensively reported ,19,42,43Fatty acids are also precursor to ceramides, yet another member of the same signaling molecule family with similar functions. Thus, increased fatty acid availability can promote ceramide synthesis, further impairing insulin signaling.Collectively, long chain acyl CoA, diacylglycerol and ceramides can all be produced from imcTG. When imcTG pool becomes enlarged, the fluxes are increased. Hyperdynamic turnover amplifies and worsens this mass effect. As a result, excess amounts of signaling molecules are produced that activate PKC isoforms and inactivate PI3 kinase, thereby resulting in MIR Fig .Given the clear evidence of inhibitory effects of these molecules on insulin signaling, conceptually reduced fatty acid oxidation can further worsens glucose metabolism when more fatty acids become available for signaling. However, this may not necessarily be the case in that increased fatty acid oxidation may not be able to effectively divert fatty acids away from signaling pathways because of the great availability of fatty acids released from imcTG that may suffice for both pathways. In such case, glucose metabolism is subject to dual suppressions. On one hand, insulin-mediated glucose uptake is attenuated as a result of impaired insulin signaling . On the other hand, glucose uptake is reduced via substrate competition due to increased fatty acid oxidation (e.g. postabsorptive). This may be the case when muscle lipid oxidation in obesity and type 2 diabetes is elevated ,28,44,45Studies of imcTG kinetics in humans are rare and virtually lacking as related to obesity, T2D or other metabolic diseases. Limited data are only available for healthy humans where imcTG turns over at 0.26%/min at rest  and 0.32Overall, animal studies on imcTG kinetics are limited as well. By comparison, studies on heart triglyceride kinetics have been more active. Similar to that observed for HFO rats, heart triglyceride synthesis and turnover and fatty acid oxidation are all accelerated in diabetic rats ,48,49. TAs discussed above, in middle-aged HFO rats imcTG synthesis remains accelerated but attenuation was apparent compared to younger age. This pattern of changes in imcTG synthesis is consistent with the known aging-related functional regressions of mitochondria in humans, such as declines in biogenesis, oxidative capacity and oxidation-phosphorylation ,51. As aHowever, the backward mechanism does not appear to explain imcTG excess for other types of insulin resistance such as simple (non-diabetic) and non-severe obesity. Rather, the forward mechanism is more relevant to obesity at relatively young ages where insulin resistance is relatively mild without apparent alterations in mitochondrial structure, morphology or functions as seen in severe obesity, T2D or advanced aging. Indeed, pathological changes in subsarcolemmal mitochondria is more advanced in T2D than in obesity . InsteadThe research on MIR evolves rapidly and some intriguing observations have been reported recently. Increasing imcTG pool size purposely by stimulating synthesis via genetic manipulation surprisingly improved insulin sensitivity and prevented high fat-induced insulin resistance . This ecRecent findings suggested that intramyocellular triglyceride excess is a source, not only a marker, of muscle insulin resistance. The hyperdynamic turnover kinetics and enlarged pool size of imcTG function to release abundant fatty acids and their products known to interfere with insulin signaling and glucose metabolism via signal transduction and/or substrate competition. As such, imcTG hyperdynamics appears to be a link to MIR, as described by a forward mechanism. Alternatively, muscle insulin resistance and mitochondrial dysfunction in advanced obesity, T2D and aging may reverse the course causing imcTG to accumulate, as represented by a backward mechanism. Clarifying the mechanisms has implications to the understanding and potential intervention of muscle insulin resistance. For example, with the forward mechanism, the intramyocellular triglyceride pool is the target whereas it is only a surrogate with the backward mechanism.BMI, body mass indexDAG, diacylglycerolFFA, free fatty acidsHFO, high fat induced obesityimcTG, intramyocellular triglyceridesLCAC, long chain acylcarnitineLCACoA, long chain acyl CoALCFA, long chain fatty acidsMIR, muscle insulin resistanceMRS, magnetic resonance spectroscopyNEFA, non-esterified (free) fatty acidsPL, phospholipidsPKC, protein kinase CRBP4, retinol binding protein-4T2D, type 2 diabetesVLDL, very low density lipoprotein"}
+{"text": "The global pattern of varying prevalence of diseases of affluence, such as obesity, cardiovascular disease and diabetes, suggests that some environmental factor specific to agrarian societies could initiate these diseases.We propose that a cereal-based diet could be such an environmental factor. Through previous studies in archaeology and molecular evolution we conclude that humans and the human leptin system are not specifically adapted to a cereal-based diet, and that leptin resistance associated with diseases of affluence could be a sign of insufficient adaptation to such a diet. We further propose lectins as a cereal constituent with sufficient properties to cause leptin resistance, either through effects on metabolism central to the proper functions of the leptin system, and/or directly through binding to human leptin or human leptin receptor, thereby affecting the function.Dietary interventions should compare effects of agrarian and non-agrarian diets on incidence of diseases of affluence, related risk factors and leptin resistance. A non-significant (p = 0.10) increase of cardiovascular mortality was noted in patients advised to eat more whole-grain cereals. Our lab conducted a study on 24 domestic pigs in which a cereal-free hunter-gatherer diet promoted significantly higher insulin sensitivity, lower diastolic blood pressure and lower C-reactive protein as compared to a cereal-based swine feed. Testing should also evaluate the effects of grass lectins on the leptin system in vivo by diet interventions, and in vitro in various leptin and leptin receptor models. Our group currently conducts such studies.If an agrarian diet initiates diseases of affluence it should be possible to identify the responsible constituents and modify or remove them so as to make an agrarian diet healthier. In this paper we look at global variation in the prevalence of diseases of affluence , such asAmong agrarian societies there is considerable variation both in time and place in the prevalence of diseases of affluence -8. The cThe global epidemiological pattern of varying prevalence of diseases of affluence thus suggests that some environmental factors specific to agrarian societies could initiate these diseases. There are many such candidate environmental factors, and in this paper we study cereals, the clearest defining dietary difference between an agrarian and non-agrarian diet. Since nothing in biology makes sense except in the light of evolution , we lookHomo sapiens suggests that if grass seeds were being incorporated into the diet of our ancestors, they probably only contributed a small part [Homo sapiens emerged about 200,000 years ago [Homo sapiens hunter-gatherers [The grasses emerged between 65 and 55 million years ago . Since tall part . Homo saears ago ,27, and atherers . About 1atherers , and theatherers ,30. Howeatherers . Thus, watherers . Many meatherers -38.Leptin acts as a signal to the brain to inhibit food intake and enable the storage in adipocytes of surplus calories while simultaneously protecting peripheral non-adipose tissue from toxic effects of intracellular lipid overload . Leptin The hominoids  emerged 25\u201330 million years ago . StudiesLectins are proteins abundant in the virus, bacteria, animal and plant kingdom, which bind reversibly to specific sugar structures . DifThe studies on molecular evolution of leptin indicated adaptation of rodent leptin and insufficient adaptation of human leptin to a diet including large amounts of seeds from grass. This adaptation and lack thereof could also involve the leptin receptor, since leptin and leptin receptor coevolves due to interdependency for signalling. An adaptation of the leptin gene could thus be to avoid disturbed function of either leptin or the leptin receptor. It would be interesting to see results from studies on molecular evolution of the leptin receptor, but such studies are unfortunately lacking. However, when considering direct lectin interaction with leptin or the leptin receptor, this interaction could be with either or with both. Lectins binding to sugar structures of a membrane receptor can mimic or block the effect of the physiological ligand ,65,77-82The global pattern of varying prevalence of diseases of affluence suggests that some environmental factor specific to agrarian societies could initiate these diseases ,14. We pThe hypothesis that an agrarian diet could initiate diseases of affluence should ideally be tested in prospective diet interventions comparing this diet with non-agrarian diets. Hard end-points should be various diseases of affluence and soft end-points should be their respective risk factors, specifically including leptin resistance. The only relevant human controlled intervention trial with hard end-points that we are aware of found a non-significant (p = 0.10) increase of cardiovascular mortality in CHD patients who were advised to eat more whole-grain cereals compared to those who were not advised to eat more whole-grain cereals . We perfEvaluating the effects of grass lectins on the leptin system in vivo by diet interventions or in vitro in various leptin and/or leptin receptor models could test the hypothesis that cereal lectins might be the cause of leptin resistance. Our group currently conducts such studies. If dietary lectins could inhibit leptin binding and cause leptin resistance, then the proportion of leptin bound to the soluble leptin receptor in plasma should be lower in more leptin resistant humans on an agrarian diet, and this proportion should also increase with lower intake of dietary lectins. This is supported by the observations that the proportion of leptin bound to the soluble leptin receptor in plasma is lower in supposedly leptin resistant obese humans , and thaIf an agrarian diet initiates diseases of affluence it should be possible to identify the responsible constituents and modify or remove them so as to make the agrarian diet healthier. Furthermore, in animal experiments, the possible species-specific differences in adaptation to diets outlined in this article and their effects on studied parameters should be kept in mind when choosing the animal and the animal feed for the study. Furthermore, if cereal lectins should appear to have significant effects on human metabolism, then it is suggested that other plant lectins like peanut-lectin should be investigated in this regard as well.The author(s) declare that they have no competing interests.TJ conceived of and wrote the article. SO and SL conceived of and participated in the design of the article, and revised it critically for important intellectual content. BA, TB and AD have been involved in drafting the manuscript and revising it critically for important intellectual content. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Background. Proinflammatory cytokines are prime candidates as causative agents of the metabolic changes that eventually result in tuberculosis-associated weight loss. Microbial products and cytokines such as TNF and IL-1 increase leptin expression dose dependently in adipose tissue. Leptin plays an important role in cellular immunity. Objectives. In this study, we investigated serum leptin and TNF-\u03b1 levels before and after antituberculosis therapy in patients with active pulmonary tuberculosis (TB). Methods. Twenty five in patients with active pulmonary TB and 18 healthy controls participated in the study. Leptin and TNF-\u03b1 levels were measured before treatment and six months after the treatment and they were compared with the control group. Body mass index (BMI) and chest X-rays before and after the treatment were also evaluated. Results. The leptin levels before and after the treatment were 1.66\u00b11.68 ng/mL and 3.26\u00b13.81 ng/mL, respectively. The leptin levels of tuberculous patients were significant than in healthy patients (P < .05). The BMI was 19.36 \u00b1 2.55 kg/m2 before the treatment and 22.87 \u00b1 3.13 kg/m2 after the treatment. The TNF-\u03b1 level was 23.19\u00b112.78 pg/mL before the treatment and 15.95\u00b16.58 pg/mL after the treatment. There was no correlation between leptin and TNF-\u03b1 levels. Leptin levels were low in patients who had sequela lesion on chest radiographs. Conclusion. Leptin levels are suppressed in tuberculous patients and low leptin levels may contribute to increased susceptibility to infection and recovery with sequela lesions. Tuberculosis (TB) is a major cause of death around the world, withmost of the 1.5 million deaths per year attributable to thedisease occurring in developing countries .\u03b1), interleukin(IL)-1, IL-6, and IL-8), whereas other cytokines suppress theactivity of proinflammatory cytokines and are calledanti-inflammatory cytokines  [\u03b1 has some harmfuleffects, such as acute-phase pathophysiologic events includingfever and tissue necrosis. It also plays a protective role againstmycobacterial infection [Some cytokines promote inflammation and are called proinflammatorycytokines  and 6 females ) with active pulmonary TB and 18healthy controls 10 males )participated in the study. All patients were recruitedfrom the Erciyes University Medical School, Outpatient Clinic ofPulmonology. On entry, all patients had positive smear foracid-fast bacilli in sputum or bronchial lavage and subsequentcultures of these specimens yielded tubercle bacilli. None of thepatients had any evidence of concomitant bacterial or viralinfections as indicated by sputum and blood cultures and viralserologic study including HIV. All patients were administeredanti-TB therapy in which isoniazid (H), rifampicin (R),pyrazinamide (Z), and streptomycin (S) or ethambutol (E) wereused. All the patients with TB were treated with standard therapyfor active TB regimen which consists of 2 months of initial phaseof HRZ E/S followed by a 4-month continuation phase of HR. Dosagerecommendations of treatment of TB were H 5 mg/kg, maximum300 mg, R 10 mg/kg maximum 600 mg, Z 15\u201330 mg/kgmaximum 2 g, E 15\u201325 mg/kg maximum 1500 mg after 1month reduced to 1000 mg, S 15 mg/kg maximum1 g.All patients had pulmonary symptoms such as cough,fever, and hemoptysis compatible with TB. To assess the presence,form, spread, and size of the TB cavities and infiltrations in thelungs, all 25 patients received plain posteroanterior and lateralchest X-rays. To avoid observer bias, three pulmonary physiciansinitially assessed the X-rays independently. The patients weredivided radiologically into three categories; minimal,moderate-advanced, and far-advanced. In minimal TB, the lesionsinclude those of slight to moderate density but they do notcontain demonstrable cavitations. They may involve a small part ofone or both lungs, but the total extent, regardless ofdistribution, should not exceed the volume of the lung on one sidethat occupies the space above the second condrosternal junctionand the spine of the fourth thoracic vertebra or the body of thefifth thoracic vertebra. Moderate-advanced TB lesions includedisseminated lesions of slight to moderate density that may extendthroughout the total volume of one lung or the equivalent in bothlungs; dense or confluent lesions are limited in extent to onethird of the volume of one lung; and total diameter ofcavitations, if present, must be less than 4 cm. Infar-advanced TB, total cavity diameters are more than 4 cm andlesions are more extensive than moderately advanced.2). A control group of 18healthy volunteer subjects (mean age was 34.99 \u00b1 12.7 years)was also studied. We also evaluated normal volunteers with chestX-rays, routine laboratory tests, and physical examinations. Noneof the control subjects had any evidence of infection and systemicdisorders. All patients and volunteers gave informed consent andthe Erciyes University Medical School, Ethics Committee, approvedthe protocol.Additionally, patients were assessed for loss of appetite, weightloss, and any other weaknesses. Body mass index, erythrocytesedimentation rate (ESR), and body temperature were measuredinitially and after therapy. Body mass index (BMI) was measured asbody weight (kg)/square of height and TNF-\u03b1 using enzyme-linked immunosorbent assay kits. The intra-assay level of leptin was2.75\u00b10.10 ng/mL ((coefficients of variation (CV)3.7%)) and interassay level of leptin was 2.88 \u00b1 0.19 ng/mL (CV 6.6%). The sensitivity of TNF was6 pg/mL (interassay CV: < 7.8% and intra-assay CV:< 7.2%). All samples were assayed in duplicate. Theseparameters were measured in patients after 6 months of anti-TBtreatment.All serum samples were collected from the patients and the controlgroup before and after the 6 months of anti-TB therapy. Serumsamples for the measurement of leptin and TNF-T tests and ANOVA were used for comparisons betweenthe groups. Spearman's rank correlation was used to examine therelationship between the expression individual cytokines andclinical parameters. All P < .05 were considered significant.Stastics were calculated with SPSS software, version 10.0 .The Kolmogorov-Smirnov test was used for confirmation of theparameters. All figures are presented as mean \u00b1 SD. Demographic data of the patients are summarized in2 versus 24.23\u00b13.56 kg/m2, resp.; P = .001). After anti-TB therapy,the BMI of the patients increased significantly and was similar toBMI of the control subjects.The mean ages of the patients and the controls were similar. Before treatment,the BMI of the patients was significantly lower than the BMI ofthe controls (19.36\u00b12.55 kg/mP = .001). Treatment resulted in anincrease in serum leptin levels (3.26 \u00b1 3.81 ng/mL) butpostreatment leptin levels of the patients were stillsignificantlly lower than leptin levels of the controls (P =.001). Although female patients had higher pretreatment leptinlevels (2.17 \u00b1 0.64 versus 1.50\u00b11.88 ng/mL) andhigher posttreatment leptin levels (4.38\u00b12.95 versus 3.18\u00b14.26 ng/mL) than the male patients, they were notstatistically significant.The mean serum leptin levels of the patients before treatment were1.66 \u00b1 1.68 ng/mL, while the mean serum leptin levels of the controls were 15.74 \u00b1 9.12 ng/mL, and the difference between the two groups wasstatistically significant . PostreatmentTNF-\u03b1 levels were similar in both groups. There was nosignificant association between leptin and TNF-\u03b1concentrations. No correlation was found between BMI, bodytemperature, TNF-\u03b1, and leptin levels before treatment . Leptin and TNF-levels are shownin Serum TNF-\u03b1 and leptin in thepatients according to chest X-ray findings are presented inThe concentrations of TNF-\u03b1 and leptin levelsbefore and after the therapy.After treatment, there was a substantial increase in serum leptinconcentrations in minimal and moderate-advanced cases. However, inall the three groups of patients, there were no statisticallysignificant differences in serum TNF-P <.05) but the concentrations of TNF-\u03b1 and BMI between thegroups were similar  than thepatients with no squelae lesions , weakness, fatigue, and headache may bepresent .\u03b1). Several cytokines reduce foodintake after parenteral administration, suggesting that theirenhanced production in respons to microbial products contributesto the anorexia of infection [The anorexia during infection is part of the generalized hostdefense reaction. Despite being beneficial in the beginning,persistent anorexia delays recovery and is ultimately deleterious.Microbial products such as bacterial cell wall compounds , microbial nucleic acids ,and viral glycoproteins cause the anorexia during infections.Microbial products stimulate the production of proinflamatorycytokines (e.g., ILs, TNF-nfection .\u03b1 induces fever and weight loss, which are typicalsymptoms of TB [\u03b1 and low levels of leptin in TB patient group compared to control indicating no significantassociation between these two parameters.TNF-ms of TB . It has ms of TB , 16. Sevms of TB , 18. We \u03b1 and leptin in tuberculosis patients with goodcorrelation of these two parameters and interpreted that theeleveted leptin level leads to weight loss, and may thereforecontribute to the inflammatory process. Conversely, we foundreduced leptin levels in TB patients both before and after thetreatment. Although previous data have shown that plasma leptinlevels are associated with loss of appetite in pulmonarytuberculosis, we were unable to demonstrate significantcorrelation between plasma leptin levels and loss of appetite[Recent findings support the hypothesis that cytokineinduction of leptin may play a significant role in anorexia andcachexia of inflammatory diseases and cancer. Microbial productsand cytokines such as TNF and IL-1 increase leptin expression dosedependently in adipose tissue . The cytappetite.Initially, leptin was considered as an antiobesity hormone, butexperimental evidence has also shown pleiotropic effects of thismolecule on hematopoiesis, angiogenesis, and T lymphocytefunctions , 7, 9. LM. tuberculosis infection [\u03b1, and leptin levels.In a recent study, morbidly obese children, who were congenitallydeficient in leptin, have reduced number of circulating CD4 T celland impaired T cell proliferation and cytokine release,which were reversed by daily subcutaneous injections ofrecombinant human leptin . Leptin nfection , 29, anynfection  and Y\u00fcksnfection . On the nfection  have shonfection  did not \u03b1, leptin concentration, and chest X-ray findings. Tsaoet al. [\u03b1, IL1\u03b2, and TNF-\u03b1 receptor levelsin patients with cavitated and noncavitated tuberculosis. The BALfluid TNF-\u03b1, IL1\u03b2, and TNF-\u03b1 receptor levelswere higher in patienst with cavitated tuberculosis, but there wasno such difference in serum levels. We also could not find anydifference in the serum leptin concentration and TNF-\u03b1levels of cavitated and noncavitated tuberculosois patients. Onthe control chest X-rays obtained after anti-TB therapy,sequele lesions lie chronic fibrotic changes weredetected in 19 patients. There was no difference in theESR, BMI, and TNF-\u03b1 levels of patients with and withoutsequele, but the leptin concentration was significantlylow in patients with sequele. We presume that thesequelae lesions are the result of reduced inflammatory responsedue to low leptin concentration. But we do not know the durationof low leptin concentration in patients with sequelae. We also donot know whether low leptin concentration has any contribution inpatients with relapse. We believe that further studies are neededto answer these questions.In the present study, we could not find any correlation betweenTNF-oet al.  studied In conclusion, leptin release is suppressed in tuberculosis andprobably low leptin concentrations may contribute to the increasedinfection susceptibility and recovery with sequelelesions in patients with tuberculosis."}
+{"text": "Serum leptin variation is commonly associated with fat percentage (%), body mass index (BMI), and activity. In this investigation, we report population differences in mean leptin levels in healthy men as well as associations with fat % and BMI that are independent of these factors and reflect likely variation resulting from chronic environmental conditions.Serum leptin levels, fat %, and BMI were compared between lean American distance runners and healthy Ache Native Americans of Paraguay. Mean levels were compared as were the regressions between fat %, BMI, and leptin. Comparisons were performed between male American distance runners  and highly active male New World indigenous population  in order to determine whether significant population variation in leptin is evident in physically active populations living under different ecological circumstances independent of adiposity and BMI.While the Ache were hypothesized to exhibit higher leptin due to significantly greater adiposity , leptin levels were nonetheless significantly higher in American runners . Significant differences in the association between leptin and fat % was also evident between Ache and runner men. Although fat % was significantly related with leptin in runners  fat % was negatively related in Ache men .These results illustrate that chronic ecological conditions in addition to activity are likely factors that contribute to population variation in leptin levels and physiology. Population variation independent of adiposity should be considered to be an important source of variation, especially in light of ethnic and population differences in the incidence and etiology of obesity, diabetes, and other metabolic conditions. Leptin is a polypeptide hormone that is secreted primarily by adipose tissue and acts as a lipostat to the hypothalamus affecting numerous aspects of physiology including metabolism, immune function, and reproduction . While lAlthough adiposity is a major source of variation in leptin levels, significant population variation is evident with leptin being significantly lower in non-industrialized populations compared to more developed communities -9. The sTo determine whether differences in the association between leptin and adiposity extend also to Ache men, this investigation compares Ache male leptin with a group of comparable adiposity in a developed society, American runners. The significance of this comparison is gain insights into ethnic variation in leptin physiology and to provide a greater understanding of the etiology of metabolic syndrome among Native American groups ,13. BothLeptin and anthropometric data was collected from the Ache by the author and compared with pre-exercise control measures from runners reported in Hickey et al. . SpecifiDespite significantly higher body fat percentage , Ache leptin was significantly lower than runners . There was no significant difference in BMI  or age  Figures . In addiThe hypothesis that leptin should be higher in the group exhibiting greater adiposity was not supported in this investigation. In addition, the hypothesis that leptin should be positively associated with adiposity is only evident among American runners. Therefore other sources of leptin variation, particularly among the Ache, need to be considered. The exact mechanisms that underlie population variation independent of adiposity remain unclear, however genetic differences between populations, chronic environmental influences such as maternal/fetal or childhood nutritional status, and acute lifestyle differences such as diet and physical activity may be contributory. Since American runners were chosen due to their leanness and physical activity compared to the Ache, it is unlikely that acute differences in daily lifestyle patterns related to adiposity and physical activity were a factor in this study.Genetic differences in the Ob gene that codes for leptin as well as its receptor are also possible sources of variation. For example among Taiwanese aboriginal populations, greater incidences of obesity were associated with the G-2548A polymorphism in the promoter region of the leptin gene and the Gln223Arg (Q223R) polymorphism of the leptin receptor gene . Similarth percentile compared to American pregnant women) (unpublished data). However clearly further data on pregnancy and leptin are needed among the Ache.McMillen and colleagues have emphasized the potential role of early developmental processes that may affect leptin and adipose physiology later in adulthood. They suggest high maternal BMI may lead to greater circulating glucose in fetuses and altered adipocyte metabolism during childhood, ultimately leading to greater leptin levels in adulthood and a propensity towards obesity . HoweverIn addition, a comparison of leptin between well-fed Italian and undernourished Gambian boys and girls revealed that Gambian children exhibited consistently lower leptin even after controlling for BMI . Animal In adults, leptin levels and adipose tissue production rates exhibited a more prominent decline in fasted lean women compared to fasted obese women , while fhigher among active tuberculosis patients compared to controls. Treatment elevated leptin levels even higher. Schwenk et al. [Immunological stress, while not quantified in this study, likely differed between Ache and American runner men. Chronic and acute infections affect and are influenced by leptin levels ,35. Speck et al.  also repWhile leptin likely serves as a fat cell mass/energy signal to the central nervous system, acute underfeeding can dramatically lower systemic leptin independent of changes in adipose tissue mass . This isForaging populations are excellent models for assessing the evolutionary implications of exercise physiology. Assessments of physical performance of the Ache have provided evolutionary physiologists with important insights into human biology and their responses to physical activity, both recreational and non-recreational . Indeed,The significant non-pathological range of variability in leptin and other metabolic hormones merits greater awareness and appreciation on the part of human biologists. Moreover, the growing incidence of obesity, metabolic syndrome, and diabetes, along with increasing population heterogeneity due to immigration, strongly advocates that diagnostic and research clinicians would surely benefit from recognizing the importance of leptin variation independent of adiposity.While adiposity has been repeatedly shown to be central to leptin production and circulating levels, we have provided further evidence that leptin levels exhibit a significant range of variation independent of somatic condition, most importantly adiposity. Leptin production rate varies in association with environmental conditions and contributes to population variation. Further research is necessary to ascertain the potential implications for differences in the incidence and etiology of obesity, diabetes, and other metabolic disorders among ethnicities and populations.The authors(s) declare that they have no competing interests.Dr. Richard G. Bribiescas initiated the research question addressed in this manuscript, performed the field collection and conducted the laboratory analysis of the Ache hormonal and anthropmetric data, performed the statistical analysis, as well as contributed to the preparation and editing of the manuscript. He also initiated and procured the grants necessary to collect the Ache data.Dr. Matthew S. Hickey contributed to the collection and laboratory analysis of the American runner hormonal and anthropometric data. He also assisted in the preparation and editing of the manuscript. Both authors were involved with the preparation and editing of the final manuscript."}
+{"text": "Neurons are specialized cells with a complex architecture that includes elaborate dendritic branches and a long, narrow axon that extends from the cell body to the synaptic terminal. The organized transport of essential biological materials throughout the neuron is required to support its growth, function, and viability. In this review, we focus on insights that have emerged from the genetic analysis of long-distance axonal transport between the cell body and the synaptic terminal. We also discuss recent genetic evidence that supports the hypothesis that disruptions in axonal transport may cause or dramatically contribute to neurodegenerative diseases. The axon of a neuron conducts the transmission of action potentials from the cell body to the synapse. The axon also provides a physical conduit for the transport of essential biological materials between the cell body and the synapse that are required for the function and viability of the neuron. A diverse array of cargoes including membranous organelles, synaptic vesicle precursors, signaling molecules, growth factors, protein complexes, cytoskeletal components, and even the sodium and potassium channels required for action potential propagation are actively transported from their site of synthesis in the cell body through the axoplasm to intracellular target sites in the axon and synapse. Simultaneously, neurotrophic signals are transported from the synapse back to the cell body to monitor the integrity of target innervation. The length of axons in the peripheral nervous system can be in excess of one meter in humans, and even longer in larger animals, making these cells particularly reliant on the efficient and coordinated physical transport of materials through the axons for their function and viability.The length and narrow caliber of axons coupled with the amount of material that must be transported raises the possibility that this system might exhibit significant vulnerability to perturbation. It has been proposed that disruptions in axonal transport may lead to axonal transport defects that manifest as a number of different neurodegenerative diseases . In thisSimplistically, the axonal transport system comprises cargo, motor proteins that power cargo transport, cytoskeletal filaments or \u201ctracks\u201d along which the motors generate force and movement, linker proteins that attach motor proteins to cargo or other cellular structures, and accessory molecules that initiate and regulate transport. Defective axonal transport and neurodegenerative diseases could potentially result from disruptions in any of the components required for axonal transport.Long-distance transport in the axon is primarily a microtubule-dependent process. The microtubule tracks within an axon possess inherent polarity and are uniformly oriented with the fast-growing (plus) ends projecting toward the synapse and the slow-growing (minus) ends toward the cell body . The motBased on the kinetics of transport determined from classic pulse-chase labeling experiments, axonal transport is classified as either fast or slow . FasClassic studies using extruded squid axoplasm identified kinesin and cytoplasmic dynein as candidate motors required for axonal transport \u201320. SincDrosophila melanogaster larvae with lesions in Khc and Klc genes. These mutants exhibit axonal swellings containing accumulations of transported vesicles, synaptic membranes, and mitochondria . ,46. 6,46 pathway . This im elegans , althoug elegans . The JIP elegans ,51. Aplichondria . Sunday the axon . Interesthe axon .Another interesting process was recently found in studies of the motor domain of KIF5 which has been suggested to interpret variations in microtubule structure in the neuronal cell body to ensure that cargo is directed into the axon . The mecDrosophila proteins Milton and mitochondrial GTPase Miro are also required for the transport of mitochondria [Milton and Miro result in the specific failure of mitochondria to be transported anterogradely, and they consequently accumulate in the cell body, although the transport of synaptic vesicles is unaffected.The chondria \u201366. LesiDefects in axonal transport have been indirectly linked to a number of progressive human neurodegenerative diseases including Alzheimer disease (AD), Huntington disease (HD), and amyotrophic lateral sclerosis (ALS). One common feature of these diseases is that the proteins encoded by genes linked to each disease are transported in the axon and can perturb transport when manipulated; presenilin 1 and APP in AD, Cu/Zn superoxide dismutase (SOD1) in ALS, and huntingtin (Htt) in HD. Each disease is characterized by accumulations of these or other proteins within axons, similar to defective axonal transport phenotypes observed in animal models of motor protein mutants.Drosophila results in defective axonal transport including axonal accumulation phenotypes [The pathological hallmarks of AD include neurofibrillary tangles of abnormally phosphorylated tau protein and aggregates of amyloid-\u03b2 (A\u03b2) peptide resulting in neuritic plaques in the brain . The traenotypes . Overexpenotypes . These fGlued subunit of dynactin [Drosophila, both a reduction of Htt protein and the overexpression of proteins containing polyQ repeats result in axonal transport defects [HD is a progressive neurodegenerative disorder caused by expansion of CAG triplet repeats in the coding sequence of the huntingtin gene resulting in an expanded polyglutamine tract (polyQ) in the Htt protein and a toxic gain of function. Interestingly, both Htt and the Huntingtin-associated protein 1 (HAP1) are anterogradely and retrogradely transported in axons . HAP1 indynactin \u201375. Rece defects . Full-le defects . Althoug defects ,78. Inte defects . This suGlued in ALS patients [Loa and Cra1 revert axonal transport defects of ALS mice, attenuating motor neuron degeneration resulting in delayed onset of disease and extended lifespan [Lesions in the ubiquitously expressed enzyme SOD1 are a cause of rare hereditary ALS ,81. Mouspatients . Additiolifespan ,90.Although a potential link between axonal transport disorders and neurodegenerative disease has been suggested, a number of critical questions remain unanswered. For example, recent evidence indicates that axonal transport is disrupted in mouse models of ALS, HD, and AD long before detectable pathological hallmarks of the disease are observed ,83,91. S"}
+{"text": "Little information is available on leptin concentrations in individuals with IGT. This study aims to determine and correlate leptin levels to anthropometric measures of obesity in pre-diabetic, (IFG and IGT), type 2 diabetic and normoglycaemic Saudis.308 adult Saudis  participated. Anthropometric parameters were measured and fasting blood samples taken. Serum insulin was analysed, using a solid phase enzyme amplified sensitivity immunoassay and also leptin concentrations, using radio-immunoassay. The remaining blood parameters were determined using standard laboratory procedures.Leptin levels of diabetic and pre-diabetic men were higher than in normoglycaemic men . In females, leptin levels were significantly higher in pre-diabetic subjects (14.09 [2.8\u201344.4] ng/mL) than in normoglycaemic subjects (10.2 [0.25\u201334.8] ng/mL) (p = 0.046). After adjustment for BMI and gender, hip circumference was associated with log leptin (p = 0.006 with R2 = 0.086) among all subjects.Leptin is associated with measures of adiposity, hip circumference in particular, in the non-diabetic state among Saudi subjects. The higher leptin level among diabetics and pre-diabetics is not related to differences in anthropometric measures of obesity. Saudi Arabia, a Middle Eastern country with a population of 22 million, has undergone significant economic and cultural changes over the past thirty years. Approximately 60% of the population are urbanised and have adopted a 'Westernised' lifestyle in terms of diet and physical activity . ObesityIncreased risk of CHD in subjects with IGT is supported by data from the Honolulu , ChicagoDiabetes increases the risk of developing cardiovascular disease by 2\u20133 times and increases by as much as 50% the risks of non-cardiovascular mortality associated with this condition -15. Thisper se which is regarded as a pathogenic mechanism in human obesity. Leptin concentrations vary widely among individuals with similar fat mass, indicating other possible factors for its determination ) than in the controls.2 = 0.086 and p value of 0.006 . Even after adjustment for BMI, there was a positive association between log leptin and hip circumference with an RInsulin resistance is the common factor in a range of risk factors for atherosclerosis, specifically hypertension, dyslipidemia and abnormal glucose metabolism. As has been shown in other populations -29, the Data were presented according to gender, since it is already an established fact that leptin levels are significantly higher in women than in men. There are several possible explanations for the difference. One is that females have more adipose tissue than males, but a growing literature indicates that estrogen, especially at higher levels, will stimulate the production of leptin, whereas androgens will suppress the levels of leptin . In thisSerum leptin concentration may contribute to the risk of CVD by altering lipid metabolism and contributing to hypertension via the activation of the sympathetic nervous system and increasing renal sodium re-absorption ,43. HoweA family history of diabetes was found to have a negative association with leptin in pre-diabetic patients; this confirms a previous study which reported that healthy lean non-diabetic Asian Indians are more insulin resistant than other ethnic groups, despite similarities in their living environment . Waist cThe significant correlation of leptin to selected anthropometric measurements of obesity is confirmed in non-diabetic Saudi Subjects. In those with diabetes, this relationship is lost, reflecting the effect of other factors, including hyperinsulinaemia and the activation of sub-clinical inflammation.The author(s) declare that they have no competing interests.NA for the concept and design as well as statistical analysis; OA for the drafting and revising of the manuscript; KA and AJ for the acquisition and interpretation of data; MM and MK for the screening and collection of data; KS for the concept and final revision of the manuscript. All the authors have read and approved the final version."}
+{"text": "Blood samples were collected by jugular venipuncture before transport (-0.25 h), immediately after (0 h) and at 1 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h relative to time 0 h. The bulls were weighed before transport (- 24 h and - 0.25 h), immediately after (0 h), and at 4 h, 12 h and 24 h relative to time 0 h. Control animals were blood sampled before assignment (-0.25 h) to novel pens, after (24 h), and at 1 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h relative to the 24 h sampling time point.The transport of livestock can have major implications for their welfare, and there is strong public interest and scientific endeavour aimed at ensuring that the welfare of transported animals is optimal. The objective of the study was to investigate the effect of transport on live weight, physiological and haematological responses of bulls after road transport of 0, 6, 9, 12, 18 and 24 hours (h). Seventy-two Charolais bulls (mean weight (s.d.) 367 (35) kg), na\u00efve to transport, were randomly assigned to one of six journey (J) times of 0 h, 6 h, 9 h, 12 h, 18 h and 24 h transport  at a stocking density of 1.02 mBulls travelling for 6 h (280 km), 9 h (435 km), 12 h (582 km), 18 h (902 km) and 24 h (1192 km) lost 4.7, 4.5, 5.7 (P < 0.05), 6.6 (P < 0.05) and 7.5 (P < 0.05) percentage (%) live weight compared with baseline. Live weight re-gained to pre-transport levels during the 24 h recovery period. Lymphocyte percentages were lower (P < 0.05) and neutrophil percentages were greater (P < 0.05) in all animals. Blood protein, glucose and NEFA concentrations and creatine kinase activity were greater (P < 0.05) in the bulls following transport and returned to baseline within 24 h.Under the conditions of the present study, transport of bulls on journeys by road, ranging from 6 h (280 km) to 24 h (1192 km) duration, affected live weight, haematological and physiological measurements of metabolism and inflammation. Our findings showed that live weight and some physiological and haematological responses of bulls returned to pre-transport levels within 24 h with animals having had access to feed and water. Transportation of livestock involves several potential stressors that result in increased cortisol -7, mobilThe objective of the study was to evaluate the effect of transport on live weight, physiological and haematological responses of bulls after road transport of 0, 6, 9, 12, 18 and 24 h and on their physiological recovery during the 24 h period post-transport.2 tended to increase with the longer journeys and values were numerically greater during the 24 h journey compared with the other journeys. The levels of H2S and NH3 remained low throughout the series of transport journeys. Vapour density and ambient temperature during the 9 h transport journey (J 9) was numerically greater compared with the other journey durations.The mean temperature of the shed environment where the animals were housed was 15.6\u00b0C (minimum 6.0\u00b0C and maximum 19.3\u00b0C). The environmental data recorded during each transport journey are reported in Table Table Significant (P < 0.05) live weight loss was observed for the J 18 and J 24 treatments and only at 0 h post-transport Table . Bulls tThere was no effect (P > 0.05) of transport on rectal temperature (data not shown).In control animals (J 0), there was no change (P > 0.05) in albumin concentration Table . There wGlobulin concentrations were unchanged (P > 0.05) Table  in non-tIn non-transported control animals (J 0), there was no change (P > 0.05) in total protein concentration Table . There wIn the non-transported controls (J 0), J 18 and J 24 treatments, urea concentrations were greater P < 0.05) than baseline at 0 h to 12 h and were not different (P > 0.05) at 24 h (Table  than bas\u03b2HB concentrations were greater P < 0.05) at 6 h to 24 h following the end of the 24 h experimental period in non-transported control animals (J 0), when compared with baseline concentrations (Table  at 6 h tCK activities were greater P < 0.05) than baseline in non-transported control animals (J 0) at 0 h to 8 h post the 24 h experimental rest period (Table  than basHaptoglobin concentrations were greater (P < 0.05) than baseline in non-transported control animals at 24 h following the end of the experimental 24 h rest period Table , and werIn non-transported control animals (J 0), glucose concentrations were lower (P < 0.05) than baseline at 0 h, 4 h, 6 h, 8 h and 12 h relative to the end of the initial 24 h experimental period  at 0 h, 1 h, 2, h and 24 h compared with baseline Table . There wWBC numbers were greater (P < 0.05) than baseline at 4 h to 24 h Table  in non-tThe N:L ratio was greater (P < 0.05) than baseline at 12 h Table  in non-tIn non-transported control animals, lymphocyte percentage was lower (P < 0.05) and neutrophil percentage was greater (P < 0.05) than baseline at 6 h to 24 h following the end of the 24 h experimental period Table . AnimalsRBC numbers were lower (P < 0.05) than baseline in non-transported control animals at 0 h to 24 h relative to the end of the first 24 h experimental period Table . There wHaemoglobin (Hgb) concentrations were lower (P < 0.05) at 0 h to 24 h in non-transported control animals compared with baseline Table . There wHaematocrit % was lower (P < 0.05) at 0 h to 24 h post-transport Table  compared3cells/\u03bcL) in non-transported control animals compared with 4 h (mean (s.d.) 536.7 (135.4) \u00d7 103cells/\u03bcL), 6 h (mean (s.d.) 561.3 (155.8) \u00d7 103cells/\u03bcL) and 12 h (mean 539.9 (s.d.) (124.0) \u00d7 103cells/\u03bcL) and values returned to baseline at 24 h. Platelet numbers were not different (P > 0.05) post-transport for the J 6 to J 24 treatments (data not shown).There was no difference (P > 0.05) in mean corpuscular volume (MCV) and MCHC following transport (data not shown). Platelet numbers were lower (P < 0.05) at 0 h (mean (s.d.) 424.3 (140.4) \u00d7 10In the present study, the series of transport journeys 6 h to 24 h) by roads showed that transportation of Charolais beef bulls affected live weight, haematological and physiological measurements of metabolism and inflammation. The biological measures which were most sensitive to the stress of transport, on journeys of 6 h to 24 h duration, were total protein, urea, \u00dfHB, glucose, NEFA, the acute phase protein (haptoglobin) and haematological variables . This was not unexpected as we reported similar responses in young bulls that were subjected to 8 h transport [ h by roaThe present experiment was designed to minimize any possible bias that would affect the study, however, we accept that it is not possible to exclude all bias since all studies are affected by some degree of bias. In the present study, the bulls were habituated to housing for 100 days pre-transport and were fed the same diet. All of the bulls were na\u00efve to transport and each journey was carried out singly over a 6-week period. For each journey, 12 bulls were assigned to two pens on the transporter with 6 animals per pen and each journey was made by the same driver using similar road conditions. The bulls were blood sampled by the same person and the same chute was used at each experimental blood collection time point. In the statistical analysis of the data, animal was the experimental or measurement unit.The changes in live weight post-transport were transitory and may be attributed to a loss of gut-fill over the journeys and possibly due to mild dehydration, urination and fasting during the longer journeys -17,20,21The development of electrolyte and acid-base imbalances has been reported in extended transport journeys where fasting has exceeded 2 days or more . In the Increases in plasma glucose concentrations are mainly due to glycogenolysis associated with the increase in circulating catecholamines and glucocorticoids which are released during the stress of transport . GlucosePhysiological processes, such as the sleep-wake cycles, locomotor activity, body temperature, hormone secretion, and metabolism, are under the control of circadian clocks and are influenced by stress. Circadian control of glucose metabolism was recognized from early studies demonstrating variation in glucose tolerance and insulin action across the day ,29. IncrChanges in acute phase protein concentrations during transportation have been reported but the results are variable. Haptoglobin, an acute phase protein, is released by hepatocytes and mediate the inflammatory response to injury, trauma, or infection . The pread libitum access to water on the transporter and they received the last feeding immediately before loading and these factors may have prevented the animals from showing signs of dehydration. Elevated haematocrit % has been reported following transport in association with greater erythrocyte counts in the circulation [Alterations in immunity are of great importance following transportation stress as these alterations are thought to be associated with increased incidence and severity of respiratory diseases. Many measures of immunological changes relate to immune cell numbers in the blood. Similar to the findings of the present study, most studies observe a leukocytosis that is marked by neutrophilia, which may occur in conjunction with a decrease in the number of other cells  ,10,38. Cculation ,25,46,47Measures of immunological changes relate to immune cell numbers in the blood and immune cell function. A number of studies have reported leukocytosis that is marked by neutrophilia, and which may be present with a decrease in the number of other cells  ,10,17. BIn the current study, several measures of physiological, metabolic and haematological variables were investigated in the plasma of bulls subjected to transport journeys ranging from 6 to 24 h durations. It is evident that transportation of bulls has effects on biomarkers of metabolism as demonstrated by significant changes in the plasma concentrations of protein, glucose and NEFA. Additionally, circulating creatine kinase activity is a useful measure which is often monitored in transported cattle as a measure of bruising. Changes in CK activity indicate that the bulls in the current study may have experienced some muscle damage and physical stress, particularly after the longer duration journeys. The acute phase protein, haptoglobin, is a useful biomarker of inflammation and together with changes in haematological cellular variables would suggest a pro-inflammatory state during transportation stress. The pronounced neutrophilia and lymphopenia following transportation observed in this study are in agreement with previously reported findings following a variety of stressors, including transport stress ,10,17. TConditional on the statistical power of the present study and assumptions about meaningful indicators and effect of size, there were both similarities and differences between control and transported animals, however the differences did not appear sufficiently large or prolonged over the duration of the study. This is a single transport study for each journey duration and most of the physiological, metabolic and haematological variables which changed as a consequence of transport had recovered to baseline values within 24 h of journey completion. Non-transported control animals showed similar biological effects on the physiological and haematological variables to transported animals.An increased understanding of the mechanism of stress and physiological adaptation induced in animals by mixing, handling and transport will lead to a greater understanding of transportation stress. Additionally, the effective recovery of the animals after 6-24 hours transport can lead to an important implication to recommend a proper lairage time when animals are transported by road. The results of this study indicate that the provision of a rest period of up to 24 hours post-transport with animals having access to feed and water should be optimal for animals to recover to their physiological pre-transport baseline.This study was conducted at Teagasc, Grange Beef Research Centre, Dunsany, County Meath, Ireland. All animal procedures performed in this study were conducted under experimental licence from the Irish Department of Health and Children in accordance with the Cruelty to Animals Act 1876 and the European Communities  Regulation 2002 and 2005.ad libitum access to grass silage (in vitro DM digestibility = 762 g/kg), supplemented with 2.0 kg (as fed) barley/soybean concentrate (crude protein = 114.5 kg DM) per animal per day at Teagasc, Grange, Beef Research Centre, Dunsany, Co. Meath. The animals were managed and housed 6/pen in a slatted floor shed at a space allowance of 2.5 m2/head/animal for a 100-day winter period prior to transport and are representative of the type of animals that are commonly transported under commercial conditions. Animals had free access to water which was available through nipple drinkers in their home pens.Seventy two Charolais bulls (mean weight (s.d.) 367 (35) kg) had th of February to the 29th of March. All journeys were made at the same starting time (8:00 h) and with the same transporter, transport conditions and driver. A total of 5 separate transport journeys were made of duration 6, 9, 12, 18 and 24 h. All animals were na\u00efve to transport. On the morning of each journey, the animals were loaded at 8:00 h into two fan-ventilated pens  on the lower deck of an air suspension articulated transporter at a stocking density of 1.02 m2 per animal, and transported by road. The floor of the pens on the transporter was deep bedded with cereal straw for each journey. The animals had access to hay and water was available through nipple drinkers on the transporter, similar to the type that the bulls were accustomed to in their home pens. Bulls travelled for 6 h (280 km), 9 h (435 km), 12 h (582 km), 18 h (902 km) and 24 h (1192 km) and during each journey, transport was by primary (30% of the journey) and secondary (70% of the journey) roads and different road types and surfaces were encountered, respectively. The transporter was fitted with sensors, located 1.2 m above the floor of each pen on the transporter, for measuring ambient temperature (\u00b0C), relative humidity , carbon dioxide , hydrogen sulphide , ammonia  air velocity (m/s) and vapour density (g/m3) continuously during transport. The ambient temperature and relative humidity during transport were recorded continuously using TinyTalk dataloggers . Environmental measurements, including gases , relative humidity (RH) and temperature (\u00b0C), were recorded using QRae , Testo 175 and Testo 445 portable multifunction probes , respectively.The study was conducted in Spring over a 6 week period from the 182/bull. On the morning of the journey the bulls underwent social mixing, were moved from their home pens to a race with a chute to facilitate live weight recordings and blood sampling. The animals were blood sampled pre-transport by jugular venipuncture to provide baseline physiological levels and again after the journey. Blood samples were collected by jugular venipuncture before (-0.25 h), immediately after (0 h) and at 1 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h relative to time 0 h. Bulls were weighed using an animal weighing scale  that was located at the exit area of the chute and rectal temperature was taken before, -24 h, -0.25 h, immediately after, and at 4, 12 and 24 h relative to completion of the transport journey. The bulls were loaded onto the transporter and assigned to two pens on the transporter and remained in the same social groupings for the remainder of the study. The study animals were transported alone on the transporter. On completion of each of the transport journeys (J 6 - J 24) the bulls were returned for a 24 h rest period to novel pens (n = 2) with 6 animals/pen in the housing environment and had ad libitum access to water and grass silage supplemented with 2.0 kg barley/soybean concentrate.Seventy two Charolais bulls (mean weight (s.d.) 367 (35) kg) were randomly assigned by weight to one of six journey (J) treatment times of 0 (no transport), 6 (J 6), 9 (J 9), 12 (J 12), 18 (J 18) and 24 (J 24) h transport  at a stocking density of 1.02 mad libitum access to grass silage supplemented with 2.0 kg barley/soybean concentrate, water, and no hay for the 24 h period coinciding with the 24 h 'post-transport' period. Control animals (J 0) were blood sampled before assignment (at -0.25 h) to the novel pens, after 24 h, and at 1 h, 2 h, 4 h, 6 h, 8 h, 12 h and 24 h relative to the completion of the 24 h experimental period. Control animals were weighed -24 h, -0.25 h, + 24 h and 4, 12, and 24 h after completion of the 24 h experimental period.Non-transported control animals (J 0) (n = 12) were moved to two novel straw bedded pens  in the housing environment and animals had access to hay and water during the duration of the 'experimental' period coinciding with the maximum transport duration (24 h). Afterwards, control animals (J 0) had Water consumption (litres) was recorded during transport and in the 24 h period post-transport. Flow metres were attached to the animal drinking containers and consumption was recorded on a pen basis in the housing environment and on the transporter.The rectal body temperature was monitored before and after transport using a digital thermometer .3-EDTA-treated) whole-blood samples with an automated cell counter  within 1 h of blood sampling. Thin blood smears were also prepared on glass slides and stained using the haematology 3-step stain for differential WBC counts . Plasma haptoglobin concentration was determined as the haemoglobin binding capacity using an appropriate assay , which was previously validated [Heparinised blood samples were collected by jugular venipuncture and the plasma was separated by centrifugation at 1,600 \u00d7 g at 8\u00b0C for 15, and subsequently stored at -20\u00b0C until assayed. Albumin, urea, globulin, total protein, \u03b2 hydroxybutyrate (\u03b2HB), and creatine kinase (CK) were measured on an automated analyser  using the reagents supplied by Olympus. Unclotted (EDTA-treated) whole-blood samples were collected by jugular venipuncture at the same time as the heparinised blood samples for haematological analysis. Red blood cell (RBC) number, white blood cell (WBC) number, differential WBC (percentage lymphocyte and neutrophil), haematocrit (HCT) percentage (%), haemoglobin (Hgb) concentration, mean corpuscular volume (MCV), mean corpuscular haemoglobin concentration (MCHC) and platelet numbers were determined for unclotted . Animal was the experimental unit and was specified as a repeated measures effect, and the dependence within animal was modelled using an unstructured covariance structure. The power of the statistical test was taken into consideration and was defined as the probability that the test will reject a false null hypothesis (i.e. that it will not make a Type II error). As power increases, the chances of a Type II error decrease. The probability of a Type II error is referred to as the false negative rate (\u03b2), therefore power is equal to 1 - \u03b2 . We calcThe authors declare that they have no competing interests.BE designed the study. BE, MM and DJP performed the experiments. BE analyzed the data and prepared the manuscript. All authors read and approved the final manuscript."}
+{"text": "P = .2). Since we did not find any significant changes in leptin responses upon hypoxia, plasma leptin levels do not seem to be affected by short hypoxic episodes of moderate degree.Leptin is involved in the endocrine control of energy expenditure and body weight regulation. Previous studies emphasize a relationship between hypoxic states and leptin concentrations. The aim of this study was to investigate the effects of acute hypoxia on leptin concentrations in healthy subjects. We examined 14 healthy men. Hypoxic conditions were induced by decreasing oxygen saturation to 75% for 30 minutes. Plasma leptin concentrations were determined at baseline, after 3 hours of euglycemic clamping, during hypoxia, and repeatedly the following 2.5 hours thereafter. Our results show an increase of plasma leptin concentrations in the course of 6 hours of hyperinsulinemic-euglycemic clamping which may reflect diurnal rhythmicity. Notwithstanding, there was no difference between levels of leptin in the hypoxic and the normoxic condition ( Hypoxia is suggested to play an important role in the pathogenesis of endocrine and metabolic dysregulation in obesity and the metabolic syndrome . We coulAnother hormone centrally involved in body weight regulation and thereby the development of the metabolic syndrome is leptin . Leptin In order to clarify if hypoxia affects circulating leptin concentrations in humans, we experimentally induced a short hypoxic period as compared to normoxic condition in healthy normal weight participants according to our established study design which has been demonstrated to induce clinically relevant changes in energy and hormone metabolism , 3. Oxygm2), chronic or acute illness (particularly respiratory diseases), alcohol or drug abuse, smoking, competitive sports, exceptional physical or mental stress, and current medication of any kind. Each participant gave a written informed consent, and the study was approved by the local ethics committee.Experiments were performed including 14 healthy men aged 20\u201325 years. Exclusion criteria were overweight (body mass index (BMI) >25 kg/Subjects participated in a hypoxic and a normoxic session separated by an interval of at least 4 weeks. Hyperinsulinemic-euglycemic clamp procedures were performed during the entire experimental testing. A detailed clamping procedure has been described previously , 17. SubFiO2) was varied by adjusting oxygen and nitrogen. Oxygen saturation was continuously measured by pulse oxymeter and was decreased to 75% within approximately 5 minutes. After 30 minutes, oxygen saturation was quickly normalized. Catecholamine levels were monitored at baseline and every 7.5 minutes during hypoxia (versus control).On the days of experimental testing, subjects reported to the medical research unit at 11:00 h after an overnight fast of at least 12 hours. After 3 hours of clamping, hypoxia was induced for 30 minutes by decreasing oxygen saturation to 75%. On the normoxic control condition, oxygen saturation was held at the physiological level of 98%. We assessed the course of leptin concentrations at baseline and repeatedly 3 hours after induction of hypoxia according to leptin's half life in normal weight men of about 3 hours by punctional determination . During CV < 5.4%). Blood glucose concentrations were monitored at 5-minute intervals throughout the experiment . High pressure liquid chromatography was applied to measure plasma epinephrine  and norepinephrine levels .All blood samples were immediately centrifuged and the supernatants stored at \u221224\u00b0C until assay. Leptin concentrations were measured by ELISA  4.4%, intra-assay CV 3.8%). Serum insulin was measured by radioimmunoassay  < 5.8%, intra-assay t-tests were performed to compare hormone concentrations at single time points. A P-value <.05 was considered significant.Values are presented as mean values \u00b1SEM. Analyses of variance (ANOVA) for repeated measurements, including the factors \u201csession\u201d (hypoxia versus normoxia) and \u201ctime\u201d (time points of data collection) were implemented and corrected according to the Greenhouse-Geisser procedure. The interaction effect of these two factors was termed \u201csession by time.\u201d The area under the curve (AUC) was calculated from 6 hours leptin short-profiles to determine overall differences in leptin secretion between the two sessions. In addition, student's paired P = .3) whereas epinephrine levels were significantly higher under the hypoxic condition as compared with the control session (P < .01). The glucose infusion rates were significantly lower during the hypoxic as compared to the normoxic period [Upon induction of hypoxia, oxygen saturation decreased over a period of about 5 minutes and was held stable at a plateau of 74 \u00b1 2%. Oxygen saturation (corresponding to 35\u201341 mmHg PaO2) during the corresponding period under the normoxic condition remained at a mean level of 98 \u00b1 2%. Determination of plasma glucose concentrations and serum insulin confirmed that respective blood levels remained constant after having reached the equilibrium and did not differ between hypoxic and normoxic conditions throughout the study . Also, aP < .001) and normoxia (P < .001) in the overall time course of 6 hours of measurements. There were no statistical differences in leptin levels between hypoxic and normoxic conditions as revealed by ANOVA for repeated measurements for the \u201csession\u201d effect (P = .269) and the interaction effect (P = .638). Analyses of the AUCs of leptin concentrations confirmed that there was no difference between the two conditions (P = .180). Paired t-test comparison revealed that there were no differences between the groups at baseline (P = .446). Similarly, after having reached the euglycemic equilibrium, plasma leptin concentrations showed no significant differences between conditions directly before the induction of hypoxia, during the hypoxic period, and during the 2.5 hours period after hypoxia in t-test comparison of single time points .Our results show that plasma leptin concentrations are not affected by acute hypoxia as compared to normoxic control in healthy subjects at rest. In contrast, previous studies showed an inverse correlation of serum leptin levels to altitude , 19, 20,The underlying cause why our results do not confirm previous data indicating an increasing effect of hypoxia on leptin levels deserves to be explained. One reasoning may be based on hormonal influences. Norepinephrine and epinephrine have been shown to inhibit leptin secretion \u201326, wherOur second finding was a significant increase in leptin concentrations in the course of the six hours of the experimental procedure. This is in line with the finding that circulating leptin concentrations display ultradian and circadian rhythmicity with a nadir about noon and the early afternoon, and peak levels during the night , 30. TheOne central question we intended to focus by our study was if alterations in leptin concentrations in OSAS patients could be assigned either to recurrent hypoxia or to the known high BMI which is a frequently found feature in this disease. Generally, leptin is produced by white adipose tissue and downregulates food intake by inhibiting neuropeptide Y synthesis and elevating alpha-melanocyte stimulating hormone synthesis in the hypothalamus, a feedback mechanism signalling increased peripheral fat reserves to cerebral appetite centers . Indeed,"}
+{"text": "The adipocyte-derived cytokine leptin was implicated to link inflammation and metabolic alterations. We investigated the potential role of leptin components in critically ill patients, because systemic inflammation, insulin resistance, and hyperglycemia are common features of critical illness. Upon admission to Medical Intensive Care Unit (ICU), free leptin and soluble leptin-receptor serum concentrations were determined in 137 critically ill patients  and 26 healthy controls. Serum leptin or leptin-receptor did not differ between patients or controls and were independent of sepsis. However, serum leptin was closely associated with obesity and diabetes and clearly correlated with markers of metabolism and liver function. Leptin-receptor was an unfavourable prognostic indicator, associated with mortality during three years follow-up. Our study indicates a functional role of leptin in the pathogenesis of severe illness and emphasizes the impact of complex metabolic alterations on the clinical outcome of critically ill patients. Hyperglycemia, glucose intolerance, and insulin resistance are common features of critically ill patients, especially in patients with sepsis or septic shock, even in those without preexisting diabetes mellitus \u20133. In pa\u03b3) are involved in adipocyte leptin induction [\u03b1, and other cytokines as inducers of severe systemic inflammation result in a significant elevation of serum leptin concentrations [Since its identification in 1994 leptin, a 16-kilodalton hormone, has been investigated for its role in signalling food intake, glucose homeostasis, and energy expenditure through hypothalamic pathways . Circulanduction , 11. Lepnduction . In clinnduction . Varioustrations , 15.Our study investigated serum leptin and leptin-receptor serum concentrations in a large cohort of critically ill patients (septic and nonseptic patients) from a medical ICU in order to understand the potential involvement of leptin and leptin-receptor in the pathogenesis of insulin resistance in critical illness, its regulation in severe systemic inflammation, and its potential clinical use as a biomarker in ICU patients.The study was approved by the local ethics committee. Written informed consent was obtained from the patient, his or her spouse, or the appointed legal guardian. A total of 137 patients  was studied . PatientThe control group consisted of 26 healthy nondiabetic blood donors  with normal values for blood counts, C-reactive protein, and liver enzymes.n = 54). Non-sepsis patients did not differ in age or sex from sepsis patients and were admitted to the ICU due to cardiopulmonary disorders , decompensated liver cirrhosis (n = 14), or other critical conditions (n = 11). In sepsis patients, significantly higher levels of laboratory indicators of inflammation  were found than in non-sepsis patients , preexisting diabetes mellitus, and severity of disease using the APACHE II score at admittance. Intensive care treatment like volume therapy, vasopressor infusions, demand of ventilation and ventilation hours, antibiotic and antimycotic therapy, renal replacement therapy, and nutrition were recorded, alongside a large number of laboratory parameters that were routinely assessed during intensive care treatment.n = 8) (4.4%\u20136.7% (n = 6)). Human leptin-receptor concentrations in serum were determined using a commercially available ELISA . Intraassay (interassay) coefficient of variation (CV) ranged from 7.1% to 7.3% (n = 8) (6.2%\u20139.8% (n = 6)).Human leptin serum concentrations were determined with a commercial ELISA . Intraassay (interassay) coefficient of variation (CV) ranged from 4.2% to 7.6%  is defined as a value that is smaller than the lower quartile minus 1.5-times interquartile range, or larger than the upper quartile plus 1.5-times the interquartile range. A far out value is defined as a value that is smaller than the lower quartile minus three times interquartile range, or larger than the upper quartile plus three times the interquartile range. All values, including \u201coutliers\u201d, have been included for statistical analyses. Correlations between variables have been analysed using the Spearman correlation tests, where values of P < .05 were considered statistically significant. The prognostic value of the variables was tested by univariate and multivariate analysis in the Cox regression model. Kaplan Meier curves were plotted to display the impact on survival. All statistical analyses were performed with SPSS version 12.0 .Due to the skewed distribution of most of the parameters, data are given as median, minimum, maximum, 95% confidence interval. Differences between two groups are assessed by Mann-Whitney-n = 95) and patients without sepsis (n = 42), no significant difference for either leptin or leptin-receptor concentrations could be detected  had significantly higher serum leptin levels (median 8.8\u2009ng/mL) than patients without diabetes  as well as of overall survival . Using a cut-off value for leptin-receptor of 32\u2009ng/mL, Kaplan-Meier curves were plotted to display mortality . Remarkably, leptin-receptor serum concentrations upon admission to the Medical ICU were an unfavourable indicator of ICU survival  inhibits the binding of leptin to its specific receptor and blocks signal transduction in cultured cells and mouse models; thus, it might attenuate the physiological function of leptin and contribute to the concept of \u201cleptin resistance\u201d . In our Furthermore, we analyzed the association of leptin with markers of organ function in ICU patients. Leptin did not correlate with renal function as reflected by glomerular filtration rate, cystatin C, and creatinine. We observed that the hepatic biosynthetic capacity was closely related to leptin levels . This fiP = .047) as well as of overall survival (P = .034) (Figures Remarkably, leptin-receptor serum concentrations upon admission to the Medical ICU were an unfavourable indicator of ICU survival ( Figures . SurviviAlthough leptin and leptin-receptor serum concentrations do not differ in patients with critical illness or in the subgroups of patients with and without sepsis from healthy controls, serum leptin in critically ill patients is closely correlated with the patients' BMI and metabolic alterations. The possible functional role of leptin in the pathogenesis of severe illness warrants further studies. However, soluble leptin-receptor turned out to be an independent prognostic marker at admission to the Medical ICU, thereby emphasizing the impact of the complex metabolic alterations on the clinical outcome of critically ill patients."}
+{"text": "Leptin, a hormone produced by adipocytes, provides signals to specific regions of the hypothalamus to control energy homeostasis. However, the past decade of research has not only revealed that leptin receptors are widely expressed in the CNS, but has also identified numerous additional functions for this hormone in the brain. In particular, there is evidence that leptin influences neuronal excitability via the activation as well as trafficking of specific potassium channels in several brain regions. Leptin-induced alterations in neuronal excitability have been implicated in the regulation of food intake, reward behaviour and anti-convulsant effects. A number of studies have also identified a role for leptin in cognitive processes that involve activation of leptin receptors in limbic structures, such as the hippocampus. Indeed, leptin influences hippocampal-dependent learning and memory, and more recently leptin has been shown to have anti-depressant properties. Characterisation of these novel actions of leptin is providing valuable insights into the role of this hormone in the regulation of diverse neuronal functions in health and disease. It is well established that the adipocyte-derived hormone leptin plays a fundamental role in the regulation of food intake and body weight; actions mediated by the activation of leptin receptors expressed on specific hypothalamic nuclei. However, leptin receptors are also widely expressed in many extra-hypothalamic brain regions including the cortex, hippocampus, brain stem and cerebellum. Moreover, a growing body of evidence indicates that leptin is a pleiotropic hormone that has diverse actions throughout the CNS. Here, the recent advances in leptin neurobiology are reviewed, with particular emphasis on the role of this hormone in regulating neuronal excitability and cognitive function.ob) gene that is predominantly made and secreted by white adipose tissue and circulates in the plasma at levels relative to body fat content [Leptin is the 16\u00a0kDa protein product of the obese ( content . In addi content  or via t content . Leptin  content . Leptin db) gene, was isolated from mouse choroid plexus [db gene generates multiple variants of Ob-R mRNA and at least six receptor isoforms (Ob-Ra-f) have been identified [Initially the leptin receptor (Ob-R), which is encoded by the diabetes . Leptin binding to Ob-Rb results in the activation and phosphorylation of JAK2, which enables recruitment of various downstream signaling molecules including insulin receptor substrate (IRS) proteins, the p85 subunit of phosphoinositide 3-kinase (PI 3-kinase) and STAT  transcription factors. Another target for JAKs is the adaptor protein Src homology collagen (Shc), which interacts with Grb2, and in turn recruits the Son-of-sevenless (Sos) exchange protein to the plasma membrane culminating in the activation of the Ras-Raf-MAPK pathway .+ (KATP) channels [ATP channels is rapid as channel activation occurs within 10\u00a0min of leptin addition. Furthermore, inhibitors of PI 3-kinase prevent channel activation by leptin thereby implicating PI 3-kinase in leptin receptor coupling to KATP channels [ATP channels [Within the hypothalamus, two neuronal subtypes are key targets for the actions of leptin with respect to its effects on food intake and body weight: the orexigenic neuropeptide Y (NPY) and agouti-related protein (AGRP)-containing neurons, and anorexigenic proopiomelanocortin (POMC) and cocaine and amphetamine regulated transcript (CART)-containing neurons, respectively. Electrophysiological studies have shown that leptin hyperpolarises glucose-responsive NPY/AGRP neurons via activation of ATP-sensitive Kchannels ; an actichannels , a reducchannels . In a machannels .2 into PtdInsP3. Indeed, in a hypothalamic cell line, leptin increases PtdInsP3 immunoreactivity [3-dependent signaling is pivotal for KATP channel activation [3 levels and promote KATP channel activation in an hypothalamic cell line [ATP channels in hypothalamic neurons [3 levels influences actin dynamics.It is well documented that PI 3-kinase promotes the phosphorylation of PtdInsPactivity \u2022. Moreovtivation \u2022\u2022. Functell line \u2022. This n neurons  and insu neurons  involves2+-activated K+ (BK), but not KATP, channels [3. This in turn promotes re-organisation of actin filaments that ultimately results in the activation as well as the trafficking of BK channels to hippocampal synapses [et al. [In contrast to its actions on hypothalamic neurons, leptin inhibits hippocampal neurons via activating large conductance Cachannels . Althougchannels . In suppsynapses . As hipp [et al.  demonstr [et al. , suggestIn addition to regulating hippocampal excitability by modulating BK channel function, there is evidence that leptin evokes a novel form of NMDA receptor-dependent long-term depression (LTD) under conditions of enhanced excitability . The abiin vitro brain slices, results in marked attenuation of the firing frequency of VTA dopaminergic neurons [Recently, leptin receptor expression has been detected on mesolimbic dopamine neurons within the basal ganglia . Moreove neurons \u2022\u2022, indic neurons , suggest neurons \u2022\u2022,30, thN-methyl-d-aspartate (NMDA) receptor-dependent LTP contributes to the formation of spatial memory [db/db mice or fa/fa rats) exhibit impairments in hippocampal LTP and long-term depression [2+ are pre-requisites for the LTP induction in the CA1 region [2+ influx in hippocampal cultures via activation of PI 3-kinase and MAPK-dependent signaling cascades [Xenopus oocytes expressing recombinant NMDA receptors, leptin enhanced currents evoked by maximal, as well as submaximal concentrations of NMDA [It is well established that learning and memory is a key function of the hippocampus. Indeed, one form of synaptic plasticity known as long-term potentiation (LTP) occurs in this brain region; a phenomenon thought to be a cellular correlate of certain aspects of learning, memory and habituation. In the hippocampal CA1 region, l memory . Recentlpression  as well pression . Direct pression  and facipression . Furtherpression  and enhapression . The syn1 region . Moreovecascades . Moreove of NMDA , suggest of NMDA .et al. [Evidence is accumulating that structural changes play a pivotal role in activity-dependent synaptic plasticity and this process is influenced by various neurotrophins. Recently, O\u2019Malley et al. \u2022 demonstSeveral lines of evidence have implicated dysregulation and/or deficiencies in the leptin system in the cognitive deficits associated with neurodegenerative disorders such as Alzheimer's disease. Indeed reductions in the circulating levels of leptin have been detected in Alzheimer's disease patients . MoreoveIn addition to its role in hippocampal-dependent learning and memory, recent studies have demonstrated that leptin has anti-depressant-like activity. Indeed, exposure of rodents to stress paradigms, which induce various behavioural deficits resembling certain aspects of human depression, results in significant decreases in the circulating levels of leptin \u2022. MoreovEvidence is accumulating that leptin plays a pivotal role in modulating diverse neuronal functions. Recent studies have shown that leptin rapidly regulates the excitability of neurons via potassium channel activation in a number of brain regions. In addition, transgenic studies combined with advanced molecular approaches have greatly progressed our understanding of the complex cellular mechanisms coupling leptin receptors to potassium channel activation as well as the resulting functional outputs. In other studies, a role for leptin in modulating hippocampal-dependent cognitive function has been identified. Moreover, major advances have been made in the characterisation of the cellular targets, signaling pathways and structural changes that underlie the effects of leptin on these hippocampal-driven processes.Although the cellular consequences of leptin receptor activation are becoming well characterised, there are still gaps in our knowledge of how the neuronal leptin system functions. For instance, the conditions under which physiologically relevant concentrations of leptin reach the extra-hypothalamic brain regions that respond to this hormone are not clear. Although there is evidence for leptin mRNA in the brain, it is not known if leptin can be released from neurons, and if so the processes regulating the release mechanisms. Many studies have demonstrated that leptin is an important modulator of activity-dependent synaptic plasticity and neuronal development. Moreover, it is well known that developmental processes are under the control of various growth factors and neurotrophins. However, it is not clear if and how the effects of leptin on synaptic plasticity and neurodevelopment are influenced by other hormones and growth factors.Another important focus of current research is the association between obesity-linked leptin resistance and the development of neurodegenerative disorders such as Alzheimer's disease. This, combined with the recent discovery of the anti-depressant properties of leptin, may ultimately result in the generation of promising new therapies to treat a wide spectrum of neurological conditions.\u2022 of special interest\u2022\u2022 of outstanding interestPapers of particular interest, published within the annual period of review, have been highlighted as:"}
+{"text": "The routine removal of orthopaedic fixation devices after fracture healing remains an issue of debate. There are no evidence-based guidelines on this matter, and little is known on surgeons' practice and perceived effectiveness of implant removal in different clinical settings.A 41-item questionnaire was distributed to 730 attendees of the AO Principles and Masters Courses of Operative Fracture Treatment in Davos, Switzerland, to assess their attitudes towards removal of different types of implants, and perceived benefits and risks with this common procedure.The response rate was 655/730 (89.7%), representing 54.6% of all 1199 course attendees. Surgeons from 65 countries  took part in the survey. Fifty-eight percent of the participants did not agree that routine implant removal is necessary, and 49% and 58% did not agree that indwelling implants pose an excess risk for fractures or general adverse effects. Forty-eight percent felt that removal is riskier than leaving the implant in situ. Implant removal in symptomatic patients was rated to be moderately effective . Eighty-five percent of all participants agreed that implant removal poses a burden to hospital resources. Surgeons were undetermined whether implant removal is adequately reimbursed by payers of health care services (44% \"I-don't-know\"-answers).Many surgeons refuse a routine implant removal policy, and do not believe in clinically significant adverse effects of retained metal implants. Given the frequency of the procedure in orthopaedic departments worldwide, there is an urgent need for a large randomized trial to determine the efficacy and effectiveness of implant removal with regard to patient-centred outcomes. Implant removal belongs to the most common elective orthopaedic procedures in the industrial countries. In a frequently cited Finnish study, implant removal contributed to almost 30% of all planned orthopaedic operations, and 15% of all operations of the department [Controversy exists as to the need for routine implant removal. In children, it may be necessary to remove implants early to avoid disturbances to the growing skeleton, to prevent their bony immuring making later removal technically difficult or impossible, and to allow for planned reconstructive surgery after skeletal maturation .In adults, pain, soft tissue irritation, the resumption of strenuous activities or contact sports after fracture healing, and the patient's demand are typical indications for implant removal in clinical practice. Many surgeons will remember patients whose intractable, hardly explainable local symptoms and complaints resolved quickly after the procedure. However, implant removal requires a second surgical procedure in scarred tissue, and poses a risk for nerve damage and re-fractures -5.Pain may even worsen after implant removal. In a series of 109 femoral nail removals, an increase in pain and discomfort was noted in 4/58 7%) of all patients with, and 10/51 (20%) of all patients without pre-operative symptoms . Similar% of all Corrosion, systemic release of nickel, chromium, and cobalt, and its presumed toxic, allergic, and even carcinogenic potential have been linked to stainless steel implants. As yet, none of these adverse effects had convincingly been confirmed in the clinical setting . OrthopeLittle is known on the attitudes of orthopedic surgeons towards implant removal ,13. We rWe developed a three-page questionnaire with 41 items to determine surgeons' opinions and concerns about implant removal. As a first step, DS undertook a literature review in Pubmed Medline, Embase, SciSearch, and Google to identify available instruments assessing surgeons' beliefs and assumptions about implant removal and other common orthopedic procedures. We considered the items queried by Loder et al. in a recent web survey pragmatic and relevant for this study, and used them as a core set . We thenThe form contained three parts: 1) demographic information , 2) general beliefs about potential benefits and harms of retained material and removal surgery, and 3) reasons for removing implants .We requested participants to describe their practice of informing patients about the need for later implant removal at the time of fracture repair, and to estimate the influence of removal surgery on patients' complaints. Because cold welding may cause problems when attempting to remove interlocking plates, surgeons were asked how often they observe screw breakages, irremovable implant, and fractures with this frequently used material.General beliefs were polled by 5-point Likert-scales. Answer options included \"I strongly agree,\" \"I strongly disagree,\" \"I don't know,\" \"I disagree,\" and \"I strongly disagree.\" For all other questions, ratings were made on 10-point scales ranging from \"1 = never\" to \"10 = always.\"\u00ae player.The survey was conducted during the last three days of the first, and the first three days of the second course week. A booth was established at the main entrance hall of the conference venue to allow participants for completing the questionnaire in a quiet and comfortable surrounding. Assistants addressed course attendants personally and invited them to participate in the survey. Also, posters were put up at main meeting places and the industrial exhibition explaining the goal of the study. As an incentive, all respondents took part in a drawing for an iPodA consent waiver was granted by the Cantonal Ethics Board of Zurich. The participants were informed that, by filling out the questionnaire, they agreed in using the anonymously gathered data for research and publication.All analyses were made in an exploratory intent, and we did not pose a formal null-hypothesis. The target sample size was planned to yield a certain precision of estimates, not to detect a relevant difference between groups with predefined type I and II errors . A samplAccording to the quality of data, results are presented as proportions, means, or medians with their adequate measures of distribution and 95% confidence intervals (CI). For subgroup analyses , Likert-scale type ratings were analyzed by ordered logistic regression. Ten-point scales were analyzed by general linear models. To ease reading and data interpretation, the results from queries on general opinions about implant removal are expressed as proportions of disagreement (including \"I strongly disagree\" and \"I disagree\") and agreement (including \"I strongly agree\" and \"I agree\").Of 730 distributed questionnaires, 655 (89.7%) were completed. This represented 54.6% of all 1199 attendees of the 2006 AO Principles and Masters Courses. Surgeons from 65 countries with a mean age of 38.8 \u00b1 SD 9.3 years  took part in the survey. There were 571 males and 84 women. The demographic profile is summarized in Table Table In contrast to the overall tendency against routine metal removal, 68.9% of all respondents agreed that it represents a therapeutic option in case of otherwise unexplained pain and functional deficits (disagreement: 19.0%). Interestingly, implant removal was considered only moderately effective in resolving local symptoms .Orthopedic surgeons were less enthusiastic about the appropriateness of implant removal in case of \"symptomatic\" implant than general surgeons. Both had similar opinions about the moderate effectiveness of this procedure.A similar proportion of participants disagreed and agreed that implant removal causes additional soft tissue damage (40.1% versus 48.2%).Most respondents considered implant removal a procedure that drains valuable hospital resources .Nearly half of all surgeons (44.4%) could not decide whether implant removal is adequately reimbursed by health care insurance carriers, and 36.8% and 18.8% agreed and disagreed that payments are inadequate for the procedure. However, most surgeons won't charge patients to pay for implant removal by themselves .With a mean rating of 8.2 (95% CI 7.9 \u2013 8.4) on a 10-point-scale, surgeons would recommend the regular removal of elastic titanium nails in children, followed by almost identical ratings for cerclage wires after fixation of fractures of the patella and the elbow . Plates at the humeral shaft were assigned the lowest priority for removal . Findings are illustrated in Figure Palpable and irritating material was considered the main indication for metal removal , whereas the patient's demand ranked lowest on the list of potential indications . Results are depicted in Figure Surgeons tended towards informing patients about the need for later implant removal at the time of fracture repair .Participants reported low rates of intra- and post-operative screw breakages , irremovable implants , and re-fractures .Table Older, male, non-European, and university-based surgeons were more likely to agree that implant removal is inadequately reimbursed by health-care insurers.In 1988, an estimated number of 4.9 million US American citizens had prevalent fixation devices . With exThe findings from this survey indicate that about 60% of all surgeons do not agree in a routine removal policy in asymptomatic subjects, and that the patient's request is the less important reason to remove material. Many surgeons doubt clinically significant adverse effects of indwelling metal like stress shielding or an allergic or even carcinogenic potential -22, and While there are absolute  and relative indications to take out implant , the discrepancy between physical findings, imaging results and complaints can be remarkable. Given the apparently quick and safe removal procedure, many surgeons may be tempted to take their patients to the operating theatre instead of conservative management or watchful waiting.There is currently no controlled trial that would allow for a valid trade-off between the benefits and harms of implant removal, and scientifically grounded counseling of patients. In addition to the possibility of retained material and another period of sick leave and restricted weight bearing, patients must be informed about potential risks of the removal operation ,8,23-25.According to eight retrospective studies enrolling 346 symptomatic patients (Table Elastic stable intramedullary nails (ESIN) ranked first among all implants to be considered for routine removal. This information may add to results from a recent survey of 273 pediatric and 99 non-pediatric specialists regarding implant removal in children . While 6Several limits of this investigation merit discussion. First, as a survey, it can only describe opinions and practice patterns, and does not allow for determining the actual effectiveness of implant removal. Questionnaire surveys are prone to multiple sources of bias  , and ansWe tried hard to cover a broad range of clinical settings, and to enrol a large and possibly representative sample of surgeons. Also, the response rate and the number of completed items make the estimates reliable. Apart from all design limitations, the findings may point towards a true public health problem. Since most surgeons are reluctant in charging patients for the procedure, reimbursement strategies need to be evaluated and adopted to the substantial time and effort associated with implant removal surgery.There is a serious need to study the biological mechanisms and clinical determinants of symptomatic implants, and to develop clinical decision rules that may allow for identifying patients who will benefit most from implant removal. A controlled trial that compares removal to retention is strongly warranted.The authors declare that they have no competing interests.BH and DS had the idea for this study, developed the design, and designed the questionnaires. CvdW made substantial comments on both the study design and the questionnaires justifying authorship. DS performed all statistical analyses. BH and DS jointly drafted the manuscript. All authors read and approved the final version of this paper.The pre-publication history for this paper can be accessed here:"}
+{"text": "We suggest that negative charge is an essential criterion for selective passage through the NPC.Nuclear pore complexes (NPCs) are highly selective filters that control the exchange of material between nucleus and cytoplasm. The principles that govern selective filtering by NPCs are not fully understood. Previous studies find that cellular proteins capable of fast translocation through NPCs (transport receptors) are characterized by a high proportion of hydrophobic surface regions. Our analysis finds that transport receptors and their complexes are also highly negatively charged. Moreover, NPC components that constitute the permeability barrier are positively charged. We estimate that electrostatic interactions between a transport receptor and the NPC result in an energy gain of several  All proteins that move between the cytoplasm and the nucleus must pass through nuclear pore complexes, large aqueous channels around 40nm in diameter. In some cases the nuclear envelope is perforated with several thousand nuclear pore complexes, while in other cases they are few and far between. Macromolecular transport through nuclear pores is highly regulated; an elaborate system, involving the binding and unbinding of accessory proteins (transport receptors), allows regulation of which proteins can pass through the pores. The basic principles that govern this selective filtering are not fully understood. Some proteins pass through the pore without binding to transport receptors, while others require the binding of multiple transport receptors for efficient translocation. How does the pore select which proteins can pass through, and which cannot? This paper carries out a biophysical analysis of the properties of proteins that can translocate through the nuclear pore. We find that proteins capable of fast translocation are highly negatively charged, whereas proteins that cannot pass through the pore are positively charged. Moreover, proteins that constitute the interior of the pore channel itself are net positively charged. This suggests that electrostatic interactions between translocating proteins and the pore are an essential part of the selective filtering mechanism. The defining feature of eukaryotic cells is the separation of nuclear and cytoplasmic compartments by the nuclear envelope. All nuclear proteins, for example polymerases and transcription factors, are made in the cytoplasm and imported into the nucleus. Conversely, RNAs that function in translation are made inside the nucleus and exported to the cytoplasm. The transport of material between the nucleus and cytoplasm occurs through nuclear pore complexes (NPCs), aqueous channels that are embedded in the nuclear envelope. Translocation through NPCs is fully reversible and uncoupled from NTP hydrolysis Homo sapiens, and 14 in the yeast Saccharomyces cerevisiaeProteins above 30\u201340 kDa typically only traverse the NPC at appreciable rates with the aid of dedicated nuclear transport receptors  in Several research groups have established that relatively specific interactions between transport receptors and FG-repeats within nucleoporins are necessary to facilitate selective translocation through the NPC barrier kBT. This could help compensate for the energy barrier that transport receptors encounter on translocating through the spatially confined NPC channel. We propose that positively charged nucleoporin domains are an important component of the selective filter and promote the specific translocation of negatively charged transport receptors, while imposing a large energy barrier against translocation of positively charged cellular proteins.Here, we observe that nuclear transport receptors carry more negative charge than the majority of cellular proteins. The influence of surface charge on the translocation reaction has not been addressed so far. We note that most components of the selectivity barrier within the NPC are characterized by net positive charge S. cerevisiae and H. sapiens  with that of cargo proteins. We assembled a collection of nuclear transport receptors and their cognate cargos from both  sapiens . In addi sapiens . For eve sapiens . This suTo eliminate redundancy in the set of physical properties, we applied principal component analysis (PCA) to the 27 hydrophobicity scales. PCA transforms a number of correlated variables into a smaller number of uncorrelated variables called principal components, ordered according to the amount of variability that they explain.2\u200a=\u200a\u22120.93, X values were obtained from the emboss iep application For the 27 hydrophobicity scales, the first principal component captures 75% of the total variance, and thus serves as an \u201caggregate\u201d hydrophobicity metric that correlates with each of the individual hydrophobicity scales. Moreover, we find that polarity correlates strongly with the aggregate hydrophobicity scale  describes the binding energy of a protein to NPC components, T is the temperature, and \u0394S is the change in entropy as a protein enters the NPC. When the charged protein enters the NPC and becomes spatially confined, the entropy of the system decreases, increasing \u0394G and disfavoring translocation. However, \u0394G can be lowered if specific interactions between a translocating protein and the NPC decrease enthalpy and thereby compensate for the decrease in entropy.The rate at which a protein (or protein complex) translocates through the NPC depends upon the energy barrier that it must overcome to enter the NPC NPCQ, NTRQ) as the sum of its charged residues.We next estimate whether electrostatic interactions between a transport receptor and the NPC interior could in principle be large enough to compensate for the loss of entropy. Within the cell, proteins are surrounded by counter ions that screen their charge; the screening length within the cytoplasm is estimated to be NTRQ and NPCQ, separated by a screening length NTRQ is the charge derived from the transport receptor, NPCQ the charge derived from the NPC and Electrostatic\u0394H predicted by (1), however they should not change the order of magnitude. For human transport receptors at pH 7.2, we find that NPCQ, we approximate the yeast NPC as a cylinder with a radius of \u223c19nm and a height of \u223c37nm NPCQ\u223cWith this approach the electrostatic interaction energy between a transport receptor and the NPC can be approximated by the Coulombic interaction between NPCQ and NTRQ are expressed in units of the elementary charge. Using Q\u200a=\u200aElectrostatic\u0394H\u223c\u22122.5 kBT.Equation (1) implies that We emphasize that the model underlying Equation (2) is simplistic, for example: (i) Our treatment of the electrostatic interactions assumes Debye Huckel interactions, which are quantitatively modified when surface charge densities are sufficiently high; (ii) Detailed structural information for the charge distribution in the NPC channel is not available; (iii) We ignore potential entropic contributions to the electrostatic energy.\u0394S for a particle to enter the pore is complicated Electrostatic\u0394H predicted by Eqn. 2 is the same order of magnitude as \u0394SElectrostatic\u0394H magnitude calculated here would decrease the energy barrier for a transport receptor, increasing translocation efficiency. We therefore propose that electrostatic interactions between negatively charged particles and the positively charged selective barrier components provide a substantial part of the binding energy needed to mediate entry of a particle into the pore.Equation (2) thus represents an order of magnitude estimate. Calculation of the entropic cost Our study finds that transport receptors are more negatively charged than the majority of cellular proteins. Existing crystal structures of transport receptors such as importin\u03b2 reveal that negative charge is distributed over the surface of the protein . High seHow could negative surface charge promote the translocation of transport receptors through the NPC channel? Current models of translocation through the NPC postulate that hydrophobic FG-repeats within the selective barrier principally determine NPC selectivity We propose that their negative surface charge allows transport receptors to adsorb to the positively charged nucleoporin domains via electrostatic interactions, facilitating selective partitioning of transport receptors and transport receptor-cargo complexes into the NPC . Those sQ\u200a=\u200akBT at the NPC, making spontaneous diffusion highly inefficient. By binding to its two transport receptors, importin\u03b2 and importin7 BT. Combining this electrostatic energy gain with the entropic cost of entering the pore, and possible interactions with FG-repeats, could flatten the energy barrier, thus maximizing the H1 translocation rate.Electrostatic interactions as proposed here would help the NPC control entry of particles according to their surface charge, independently of their size, and thereby efficiently hinder passive diffusion of positively charged proteins. This is illustrated by histones, relatively small proteins that do not diffuse efficiently through the pore channel by themselves. Using the simple model in (2) we estimate the contribution of electrostatic interactions to the free energy of translocation for histone1 (H1). H1 has a molecular weight of 21kD and a charge kBT. Thus, phosphorylation of a small number of residues may tune the rate of translocation, even in the absence of a transport receptor.Numerous signal transduction molecules are capable of rapidly shuttling between the nucleus and cytoplasm. How their entry into or exit from the nucleus is regulated is a matter of intense investigation. Specific hydrophobic regions on the surface of nuclear transport receptors are critical for translocation. One important future challenge is to dissect the contribution of both a particle's negative charge and its hydrophobicity to the translocation reaction. This question could be addressed with direct experimental tests that measure a particle's translocation rate as a function of its charge, size and hydrophobicity. The charge and size of particles can be independently varied, and doing so would disentangle their relative contributions to translocation through the pore. The results of such experiments will enable the correlation of a protein's translocation rate through the NPC with its charge and hydrophobicity properties. Moreover, this information could facilitate a novel prediction tool for transport receptor-cargo matching.Figure S12\u200a=\u200a\u22120.93.Correlation between the polarity scale (Grantham) and the aggregate hydrophobicity scale developed in the main text for transport receptors (green squares), complexes (blue triangles), and cargoes (red circles). The correlation coefficient is r(0.10 MB TIF)Click here for additional data file.Figure S2Heat map of the physical properties of transport receptors, cargo proteins, and transport receptor-cargo complexes in Homo sapiens. Each row corresponds to a different protein or complex , and eac(1.27 MB TIF)Click here for additional data file.Figure S3A. The physical properties of H.s. nucleoporins displayed in a heat map. Each column represents a different property , and eac(1.15 MB TIF)Click here for additional data file.Figure S4Crystal structure of importin\u03b2 (0.70 MB TIF)Click here for additional data file.Table S1Saccharomyces cerevisiae  and Homo sapiens  as analyzed in this manuscript.Compilation of nuclear transport receptors, cargos, and cognate transport receptorcargo complexes from (0.28 MB DOC)Click here for additional data file.Table S2Compilation of biophysical properties analyzed in this manuscript(0.12 MB DOC)Click here for additional data file.Table S3Compilation of yeast and human nucleoporins analyzed in this manuscript.(0.20 MB DOC)Click here for additional data file.Table S4Homo sapiens analyzed in this paper.Signaling proteins from (0.06 MB DOC)Click here for additional data file."}
+{"text": "To investigate gender differences, if any, in leptin concentrations from umbilical cord blood of new born infants of mothers with type 2 diabetes mellitus (DM), gestational diabetes mellitus (GDM), and Non diabetic (ND) at delivery. Serum leptin concentrations were measured in 105 newborns . Blood was taken from the umbilical cord of the babies at delivery. Maternal anthropometric measurements were recorded within 48 hours after delivery. Pearson correlation coefficient was used to explore the relationship between serum leptin concentrations and anthropometric measures of the fetus and their mother. Both Serum leptin level and serum C-peptide was measured by chemiluminescence based ELISA. The median range of leptin concentration in cord blood was ND group: Male [13.91 (3.22 \u2013 47.63)], Female [16.88 (2 \u2013 43.65)]; GDM group: Male [32 (7 \u2013 76.00)], Female [36.73 (4.80 \u2013 81.20)]; DM group: Male [20.90 (2 \u201376.00)], Female [32 {2.58 \u2013 80.67)]. Cord serum leptin levels correlated with birth weight, ponderal index (PI) of the babies and body mass index (BMI)  of their mothers but did not correlate with gestational age, cord serum C-peptide concentration or placental weight at delivery. Leptin concentrations were higher in the female fetus in comparison to the male fetus. Birth weight of the female fetuses were also higher than that of male fetus. We found that there are very strong associations between cord leptin concentrations at delivery and birth weight, ponderal index of the baby, body mass index of the mothers with Type 2 DM. We also found that high leptin levels could represent an important feedback modulator of substrate supply and subsequently for adipose tissue status during late gestation or adipose tissue is the major determinant of circulating leptin levels. The hormone, leptin, is an adipocyte secreting signal that contributes to the regulation of energy balance by informing the brain of the amounts of adipose tissue in the body, thereby regulating food intake and energy expenditure.\u20134In women, both the level of obmRNA in adipose tissues and the plasma leptin concentrations are higher than those in men and this has been attributed to relatively greater body fat contents or reproductive hormones.\u20137In a cross-sectional study of a large population of children of both sexes, it was observed that, at any age and at any pubertal stage studied, the girls always had higher leptin concentration than the boys. This finIn the present study, we measured leptin concentrations in umbilical cord serum of a large group of infants of both sexes born to mothers having type-2 DM, GDM, ND at the time of delivery.The study population consisted of 30 babies, 15 male and 15 female babies, from nondiabetic mothers , 45 babies from type-2 DM mothers (DM babies), of them 21 were male babies and 24 were female babies.All of the newborns were healthy and their mothers had no remarkable illnesses during their pregnancy and none was taking any medication, except vitamins and iron supplements.Age of all mothers: 25-35 years.Gestational age at the time of delivery was calculated according to the LMP and confirmed by USG during first trimester.Birth weights of the babies were measured using standard weighing balance. Placentas were delivered within 10 min after delivery of the infants. Placental weight was measured by a weighing balance.A sample of venous cord blood was collected from each newborn just after delivery from placental side of umbilical cord.The serum was immediately separated and frozen at - 70 C until analysis.All of the parents of the newborns gave their written informed consent prior to enrollment.Neonates born to mothers who experienced medical complications other than GDM and type-2 DM during, or before pregnancy were excluded.Laboratory techniques: Serum leptin was measured by chemiluminescence-based ELISA .P<0.05. Data are presented as the median (range).Differences between groups were evaluated by Student's unpaired t-test. Significance was considered to be Birth weights of female babies of ND, GDM and type-2 DM groups were higher compared to the male babies of the respective groups There is ample evidence providing differences in the leptin concentration between sexes.\u201314 VarioHigher leptin in the offspring of diabetic mother has been largely attributed to the increase in the adiposity of the offspring of diabetic mother. Others have proposed a regulatory role of insulin in the production of leptin. Placental production of leptin might be responsible for hyperinsulinemia in the offspring of DM mother.The mechanism of production and regulation of leptin concentration in the fetus is not fully understood. The cause for differences in leptin concentration between the genders is also controversial.et al had shown no gender difference in leptin concentration of the offspring of DM mother. Our present study has also shown gender differences of leptin concentration in the offspring of DM mothers. The differences of findings in the gender difference of diabetic offspring of Kostolova and in the DM mother of the present study could be due to differences in body weight between male and female. This study emphasizes that adiposity of the fetus is one of the most determinant factors of leptin concentration.The present study examined whether sex differences also exist in leptinaemic condition which may provide further clues to the mechanism of sex difference in leptin concentration. Our study reveals significant difference of leptin concentration between male and female fetuses of diabetic mother despite the fact that both male and female babies of DM mother have much higher concentration of leptin than the offspring of non-diabetic mother. In a study, Kostolova Although the adiposity cannot be solely responsible for leptin production in the fetus as there is marked difference of leptin concentration between offspring of diabetic and nondiabetic mothers which cannot be fully attributed due to weight differences of the offspring between the groups.This difference in leptin concentration between offspring of diabetic and nondiabetic mothers group cannot be explained by the presence of higher insulin that exists in the offspring of the diabetic mother because the present study failed to show any correlation between C-peptide and leptin concentration in the offspring of DM mother.\u201322Our study is consistent with other studies; our observations may imply that placental leptin might be one of the responsible factors for higher concentration of leptin in the offspring of diabetic mother.The diabetic male fetus had higher mean value of leptin than that of female which implies that if the female offspring of diabetic mother had similar leptin concentration like that of the male offspring, it could adequately inhibit the hypothalamic control loop.This negates the higher hypothalamic threshold in leptin adiposity control loop as a possible cause for gender difference. So it seems to be more rational to attribute the differences in leptin production to genetic factors.Our study provides information about differences in leptin concentration between two genders in a different leptinaemic situation. This will help to explore the issue further in explaining gender differences in leptin production."}
+{"text": "Obesity has been linked to an increased risk of female infertility. Leptin, an adipocytokine which is elevated during obesity, may influence gonadal function through modulating steroidogenesis in granulosa cells.The effect of leptin on progesterone production in simian virus 40 immortalized granulosa (SVOG) cells was examined by Enzyme linked immunosorbent assay (ELISA). The effect of leptin on the expression of the steroidogenic enzymes  in SVOG cells was examined by real-time PCR and Western blotting. The mRNA expression of leptin receptor isoforms in SVOG cells were examined by using PCR. SVOG cells were co-treated with leptin and specific pharmacological inhibitors to identify the signaling pathways involved in leptin-reduced progesterone production. Silencing RNA against leptin receptor was used to determine that the inhibition of leptin on cAMP-induced steroidogenesis acts in a leptin receptor-dependent manner.In the present study, we investigated the cellular mechanisms underlying leptin-regulated steroidogenesis in human granulosa cells. We show that leptin inhibits 8-bromo cAMP-stimulated progesterone production in a concentration-dependent manner. Furthermore, we show that leptin inhibits expression of the cAMP-stimulated steroidogenic acute regulatory (StAR) protein, the rate limiting de novo protein in progesterone synthesis. Leptin induces the activation of ERK1/2, p38 and JNK but only the ERK1/2 (PD98059) and p38 (SB203580) inhibitors attenuate the leptin-induced inhibition of cAMP-stimulated StAR protein expression and progesterone production. These data suggest that the leptin-induced MAPK signal transduction pathway interferes with cAMP/PKA-stimulated steroidogenesis in human granulosa cells. Moreover, siRNA mediated knock-down of the endogenous leptin receptor attenuates the effect of leptin on cAMP-induced StAR protein expression and progesterone production, suggesting that the effect of leptin on steroidogenesis in granulosa cells is receptor dependent. In summary, leptin acts through the MAPK pathway to downregulate cAMP-induced StAR protein expression and progesterone production in immortalized human granulosa cells. These results suggest a possible mechanism by which gonadal steroidogenesis could be suppressed in obese women. The major function of the female gonad is to differentiate and release mature oocytes for fertilization and successful propagation of the species. The follicular maturation, ovulation and corpus luteum function of mammalian ovaries is regulated by the interaction between gonadotropin releasing hormone, gonadotropins, ovarian sex steroids and a variety of peptide hormones . DysfuncLeptin, a key hormone in energy homeostasis and neuroendocrine function, has a permissive role in initiating puberty and is crucial in the pathogenesis of reproductive dysfunction in several disease states of energy imbalance . In obesIn vitro studies conducted on thecal and granulosa cells have shown that leptin has negative effects on ovarian steroid output in rodent, bovine and human models. In particular, it has been found that: 1) Leptin antagonizes insulin action in human granulosa cells and thereby inhibits their gonadotropin-stimulated progesterone production . It. It15]. To further confirm the role of the leptin receptor in leptin-modulated steroidogenesis in human granulosa cells, we used siRNA technology to knockdown the endogenous expression of the leptin receptor in these cells. The effectiveness of the siRNA was confirmed by Western blot analysis Figure . Knockdoin vitro, we correlated the hormonal secretory responses to mRNA expression levels of StAR, P450scc and 3\u03b2-HSD in cAMP-stimulated immortalized human granulosa cells after exposure to high dosage of recombinant human leptin. In the present study we demonstrate that the physiological induction of StAR protein by cAMP, a rate-limiting step in steroidogenesis in steroidogenic cells, is significantly reduced by leptin treatment. These results confirm the predominantly inhibitory effects that leptin exerts on progesterone production in human granulosa cells. In addition, it was the first demonstration that the leptin short form receptor was involved in leptin-mediated inhibition of cAMP-stimulated steroidogenesis via the activation of the MAPK signaling pathway.Compelling evidence demonstrates a direct inhibitory action of leptin on steroid hormone secretion. Such effects have been independently reported by different groups in the three major steroidogenic tissues, namely the adrenal gland, the ovary and the testis -22. HoweLeptin was shown to be distributed in the intact ovary and have distinct changes in its localization during folliculogenesis . Study sSeveral reports have now demonstrated expression of biologically active isoforms of the leptin receptor in the endocrine pancreas , the ovac-fos and egr-1, that participate in cell proliferation and differentiation [Leptin receptors are structurally similar to the class I cytokine receptor family . In humantiation . The othntiation ,39.Many reports have demonstrated the involvement of the MAPK pathway in steroidogenesis in granulosa cells. Activation of the MAPK cascade by gonadotropins mediates down-regulation of steroidogenesis via attenuation of StAR expression . EGF (epIn conclusion, we demonstrate that the StAR protein participates in the physiological inhibition of granulosa cells function by leptin. This leptin-dependent fine tuning of ovarian function could be of clinical relevance in obesity and related disorders as well as in the pathogenesis of infertility.The authors declare that they have no competing interests.QL and SLP designed the study and performed the experiments and participated in discussion of the results and drafted the manuscript. BHY, LC and PCKL were responsible for supervision of this work. PCKL was responsible for the conception, design, discussion of the results, drafting and critical revision of the manuscript. All authors read and approved the final manuscript."}
+{"text": "For blood purification systems using a semipermeable membrane, the convective mass transfer by ultrafiltration plays an important role in toxin removal. The increase in the ultrafiltration rate can improve the toxin removal efficiency of the device, ultimately reducing treatment time and cost. In this study, we assessed the effects of pulsatile flow on the efficiency of the convective toxin removal in blood purification systems using theoretical methods.In vivo experiments were also performed to verify the model results.We devised a new mathematical lumped model to assess the toxin removal efficiency of blood purification systems in patients, integrating the mass transfer model for a human body with a dialyser. The human body model consists of a three-compartment model of body fluid dynamics and a two-compartment model of body solute kinetics. We simulated three types of blood purification therapy with the model, hemofiltration, hemodiafiltration, and high-flux dialysis, and compared the simulation results in terms of toxin (urea and beta-2 microglobulin) clearance and the treatment dose delivered under conditions of pulsatile and non-pulsatile pumping. Simulation results revealed that pulsatile flow improved the convective clearance of the dialyser and delivered treatment dose for all three types of therapy. Compared with the non-pulsatile pumping method, the increases in the clearance of urea and beta-2 microglobulin with pulsatile pumping were highest with hemofiltration treatment , followed by hemodiafiltration , and high-flux dialysis . EKRc and std Kt/V averaged 28% and 23% higher, respectively, in the pulsatile group than in the non-pulsatile group with hemofiltration treatment.2-microglobulin in the hemodiafiltration and high-flux dialysis treatments.The pulsatile effect was highly advantageous for all of the toxins in the hemofiltration treatment and for \u03b2 Blood purification systems employing semipermeable membranes are widely used in the treatment of patients with chronic renal failure (CRF). The mechanisms underlying toxin removal in these systems are diffusion and convection ,2. As shin vitro experiments to observe the UF efficiency of the dialyser device itself. To our knowledge, in vivo evaluations of the device and its application to patients have not been performed due to difficulties in developing an appropriate animal model. Although animal experiments regarding urea removal during blood purification treatment are relatively easy to perform, serious difficulties exist in establishing an in vivo animal model with a high \u0f9e 2-microglobulin (B2M) concentration. As noted previously by Cameron  was 70% less than that for urea, which exceeded the 20% decrease compared to urea by the convective effect. Therefore, in the case of HDF and HFx, the relative portion of convective toxin removal to diffusive toxin removal for B2M was more remarkable than that for urea. These observations explain why the percentage increase in total clearance by pulsatile pumping for B2M was more remarkable than that for urea, as shown in Figure The sieving coefficient of the dialyser for B2M was 0.8, whereas the value for urea was 1. These observations indicated that in the HF treatment, B2M removal was 20% less than that of urea under the same UF rate conditions. Thus, the convective clearance for B2M was 20% less than that for urea in HF during which convective toxin clearance occurred. However, HDF and HFx use the mechanisms of diffusive and convective toxin removal simultaneously. In these cases, B2M removal was 20% less than that of urea by the convective effect under the same UF rate conditions. In contrast, the diffusive mass transfer coefficient of the dialyser for B2M [Kt/V indices for each case , followed by HDF  and HFx . EKRc and std Kt/V were on average 28% and 23% higher, respectively, in the pulsatile group than in the non-pulsatile group in HF treatment.We proposed a new mathematical model to assess the toxin removal efficiency of blood purification systems in patients, integrating the mass transfer model for a human body with a dialyser. The superiority of pulsatile pumping is significant in HF treatment, which relies only on convection for toxin removal. In both HDF and HFx treatments, the effectiveness of pulsatile pumping on B2M removal, which depends more on convection compared to urea removal, was more remarkable than that on urea removal. Finally, pulsatile system will help any blood purification treatments, whose mechanism of toxin removal is mainly convection, get better performance than conventional non-pulsatile system.A schematic of the experiment is shown in Figure in vitro experiment was to establish reference data for the variation in TMPm and UF coefficient according to pump type and flow rate. Thus, the parameters such as TMPm and the UF coefficient for a specific condition of flow rate and pump type can be obtained by interpolating the reference data.The goal of the Vic), interstitial fluid (Vis) and plasma (Vpl) can be expressed asThe time derivatives of the intracellular fluid  and extracellular  compartments are expressed as follows:The time derivatives of the solute concentrations in the intracellular  and convective clearance (Kcs) as follows:where The diffusive clearance is expressed asKoAs is the diffusive mass transfer coefficient of the dialyser for solute s and Qb and Qd are the blood and dialysate flow rates through the dialyser, respectively. The convective clearance is expressed aswhere Sis is the membrane sieving coefficient of solute s. T, termed the transmittance, represents the mL/min increase in clearance for each mL/min of filtration and can be calculated as follows:where The HF treatment uses only convection for toxin removal, and thus the convective clearance is simply calculated as follows:et al. [More detailed equations were described previously by Ursino et al.  and Depnet al. .To calculate the internal UF rate in the HFx treatment model, we introduce the UF coefficient per unit length, which is determined by dividing the UF coefficient by the dialyser length as follows:Kufl is the UF coefficient per unit length and L is the dialyser length. As a simplified approximation, the local pressure distributions along the dialyser fibres in the blood and dialysate circuits are described as follows:where x indicates the local position along the dialyser, Pb(x) and Pd(x) are the mean pressures at local position x in the blood circuit and dialysate circuit, respectively. The UF rate, which is the primary determinant of the convective clearance of the toxin, is calculated as follows:where M is a local point where neither UF nor backfiltration is generated. The internal UF rate is directly related to the convective toxin clearance in the HFx treatment, and therefore, the convective clearance for the HFx treatment is calculated using Eq. (A9) in the Appendix.where s (TACs) is calculated by integrating the concentration profile of the solute in the plasma compartments with respect to time as follows:The time-averaged concentration of solute EKRs) is calculated as follows:Equivalent renal clearance  is acquired by averaging the pre-treatment concentrations in the plasma compartment at steady state, and the weekly std Kt/V is then calculated as follows:The mean pre-treatment concentration of solute t is the total time. All equations are adapted from Ursino et al. [where o et al.  and Depno et al. .The authors declare that they have no competing interests.KML carried out all the computations and analyzed the computed data. EBS designed the computations, analyzed and interpreted the computed data. All authors were actively involved in the writing of the manuscript, read it and approved the final manuscript.KML received Ph.D. from Dept of Biomedical Engineering of Seoul National University, South Korea at 2008 and thereafter worked for the Biosystems Engineering Lab of Kangwon National University, South Korea, as a post doc. And now he is working for the department of Biomedical Engineering of Johns Hopkins Univ. as post doc.EBS finished undergraduate course at Seoul National University and received Ph.D. from the Mechanical Engineering Dept. of KAIST (Korea Advanced Institute of Science and Technology) at 1994. He received another Ph.D. at the Dept. of Physiology  of Kyoto University, Japan, at 2008. He became a full professor of Kangwon National University from 2004."}
+{"text": "Organisms face trade-offs regarding their life-history strategies, such as decisions of single or multiple broods within a year. In passerines displaying facultative multiple breeding, the probability of laying a second clutch is influenced by several life-history factors. However, information about the mechanistic background of these trade-offs is largely lacking. Leptin is a protein hormone produced by white fat cells, and acts as a signal between peripheral energy depots and the central nervous system. In addition, leptin affects cells at all levels of the reproductive axis and plays a critical role in regulating the allocation of metabolic energy to reproduction. As such, it is possible that leptin levels influence the decision of whether or not to invest time and energy into a second clutch. Accordingly, we expect a treatment with exogenous leptin to result in an increased number of second broods.At a later stage during the first brood, female great tits were treated either with long-term leptin-filled cholesterol pellets  or with pellets containing only cholesterol (the control birds). We found that leptin-treated females were significantly more likely to have a second brood and that the earlier females were more likely to lay a second clutch than the late females.As both timing of first brood and treatment with leptin were important in the decision of having multiple broods, the trade-offs involved in the breeding strategy most likely depend on multiple factors. Presumably leptin has evolved as a signal of energy supply status to regulate the release of reproductive hormones so that reproduction is coordinated with periods of sufficient nutrients. This study investigated the role of leptin as a mediator between energy resources and reproductive output, providing a fundamentally new insight into how trade-offs work on a functional basis. Life histories of organisms can be considered as strategies that optimize reproductive effort and allocation of resources for reproduction Passerines of northern latitudes generally display a strong negative relationship between timing of the breeding season and reproductive output, either because of changes in the seasonal food supply and/or a lower quality and survival of the later-hatched chicks The endocrine system is important for mediating the allocation of energy to breeding effort at the proximate level. A myriad of hormones are directly or indirectly involved in the regulation of reproduction; however, the hormone leptin seems to be the most direct link between fat/metabolism and reproduction Parus major) is a common breeding passerine in Europe The great tit . There was also a significant difference in date of hatching between the females that started a second clutch and those that did not . When we restricted the analysis to leptin-treated females only, the effect of timing was the same . Both treatment and timing were important independently . Females that started a second clutch did not differ from females that did not start a second clutch, in terms of tarsus length , wing length  or mass . One of the five females that started a second clutch was a first-year female, whereas the other four females were older. Females that started a second clutch had a median of six offspring in their first clutch, whereas females that did not start a second clutch had a median of seven offspring .Treatment with leptin had a significant effect on reproductive decision, with five (33%) leptin-treated and no (0%) control-treated females  starting a second clutch approximately 5 to 7 days after the treatment. There was also a significant effect of date of the first laid egg of the first clutch on the probability of laying a second clutch . EarlierOur main result was in accordance with the prediction that leptin implantation increases the probability of a second brood. This decision, however, seemed to be affected by a time component as the birds that laid a second clutch had started their first one significantly earlier than the ones that did not lay a second clutch. Consequently, there must be several trade-offs related to the allocation of reproductive investment in multiple breeding attempts Our results suggested that we successfully manipulated the birds to \u2018believe\u2019 that they had enough resources to start a second brood, and in that way pushed them to lay a second clutch. In late breeders, the manipulation may have increased the perception of energy storage, but not enough to cross the threshold. Studies investigating these trade-offs have shown that the probability of laying a second brood in tits can be influenced by the type of habitat, the age of the female, size of the first clutch, population density and by the time of laying the first clutch The effect of exogenous leptin on the decision of laying a second brood may work on two levels: first, by mediating the neuro-endocrine signaling and making the birds \u201cbelieve\u201d that they were fatter than they actually were, and second, by the general stimulating effect of leptin on reproductive hormone release. It is nearly impossible to separate between these effects of leptin in present study. However, most researchers in the area seem to share the view that after leptin levels have reached a certain threshold value  an additional increase in this hormone does not involve any further endocrine advantages Our results provide support for the hypothesis that a low incidence of second broods is at least partly due to resource availability. It is also possible that the female great tits on Gotland are not adapted to lay a second clutch, and therefore do not store sufficient fat even if the environment provided enough nutritional resources.Other studies have shown that the size of the first brood is an important factor determining the probability of a second brood Many species face seasonal variation in the food supply, and breeding generally occurs during the peak of prey availability. However, although several new studies question the importance of available energy supply as a limiting factor in egg laying Within an evolutionary context, leptin may have evolved to function as a signal of energy supply to the hypothalamic-pituitary axis to regulate the release of reproductive hormones Leptin has rarely been investigated in terms of its evolutionary adaptiveness in non-production or non-domesticated organisms. This study investigated the role of leptin as a mediator between energy resources and reproductive output, providing a fundamentally new insight into how trade-offs work on a functional basis.The experiment was carried out in a well-established nest-box area on Gotland, in southern Sweden, in the spring of 2008. Nestboxes were checked regularly to obtain data on date of first egg, hatching time and breeding success throughout the breeding season. At the end of the first breeding period when chicks were 10 days old, small (ca 1\u00d73 mm) control or leptin-treatment pellets were inserted subcutaneously into 14 control (P) and 15 experimental (L) females respectively. The leptin-treatment pellets released approximately 2 \u00b5g of recombinant chicken leptin/1 g body mass/day for 14 days. Recombinant chicken leptin had been previously purchased from Protein Laboratories Rehovot Ltd. Pellets used for experimental (cholesterol pellet containing leptin) or control (cholesterol only) treatment were produced by Innovative Research of America .To avoid possible effects of lack of breeding sites (nestboxes), one nestbox next to the box where the females were breeding was sealed to prevent other species (e.g. flycatchers) to nest in these boxes. The seal was removed at the later stage of the first breeding, when most flycatchers were already settled. Overall, about 30% of all nestboxes in the area were unoccupied throughout the whole breeding period.Insertion of the pellets was performed during the dark period of the day. Great tit females where caught from nestboxes and a small patch on their right breast muscle disinfected with ethanol. Pellets were inserted with tweezers through a small cut (ca 3 mm) in the skin covering the breast muscle. Additionally, all females were banded individually, measured and aged. Nests were matched in relation to the hatching date of the first clutch.2\u200a=\u200a0.19, df\u200a=\u200a1, P\u200a=\u200a0.66), number of chicks (L: x (\u00b1SE)\u200a=\u200a6.9 (0.43); P: x (\u00b1SE)\u200a=\u200a7.1 (0.30), Mann-Whitney U\u200a=\u200a100.5, P\u200a=\u200a0.84), time of first egg , tarsus length (L: x (\u00b1SE)\u200a=\u200a22.26 (0.13); P: x (\u00b1SE)\u200a=\u200a22.11 (0.15), F1,26\u200a=\u200a0.52, P\u200a=\u200a0.48), wing length (L: x (\u00b1SE)\u200a=\u200a72.7 (0.56); P: x (\u00b1SE)\u200a=\u200a74.2 (0.63); F1,26\u200a=\u200a2.89, P\u200a=\u200a0.10), or mass (L: x (\u00b1SE)\u200a=\u200a18.2 (0.22); P: x (\u00b1SE)\u200a=\u200a18.2 (0.18), F1,27\u200a=\u200a0.04, P\u200a=\u200a0.83). We tested for homogeneity of variances in tarsus length, wing length and mass . Within-cell residuals did not deviate from normality . After the experiment the areas were checked carefully for the presence of second clutches.The treatment and control groups did not differ in terms of age (L: four first-year females and eleven older females; P: three first-year females, and eleven older females; X"}
+{"text": "The present study addressed the hypothesis that leptin promotes leukocyte trafficking into adipose tissue. Accordingly, male Wistar rats were treated with saline or recombinant rat leptin (1\u2009mg/kg) via the tail vein. Leukocyte trafficking in mesenteric venules was quantified by intravital microscopy. Treatment with leptin resulted in a 3- and 5-fold increases in rolling and firm adhesion, respectively. Compared to vehicle controls, leptin enhanced mRNA levels of IL-6 (8-fold) and MCP-1 (5-fold) in mesenteric adipose tissue (MAT). Similar increases in these markers were observed in mesenteric venules and in liver. Finally, the direct effect of leptin was assessed in C3A hepatocytes treated with leptin for 24 hours (7.8\u2009ng/mL\u2013125\u2009ng/mL). Consistent with observations in vivo, production of ICAM-1, MCP-1, and IL-6 by hepatocytes was increased significantly. These findings support the hypothesis that leptin directly initiates inflammation in the local environment of mesenteric adipose tissue as well as systemically. The degree of adiposity, visceral adiposity in particular, correlates with the extent of obesity-associated comorbid conditions such as hypertension, diabetes, and cardiovascular disease. Moreover, it is believed that abdominal adiposity plays a key role in the chronic inflammatory state that predisposes to these comorbidities \u20133. For ee tissue , 5. ConsGrowing adipose tissue depots are characterized by enhanced macrophage content and the induction/activation of several proinflammatory genes. Adipocyte conditioned medium induces the expression of leukocyte-endothelial cell adhesion molecules, and stimulates monocyte diapedesis across monolayers of cultured endothelial cells . HoweverHuman C3A hepatocytes and culture reagents were purchased from ATCC, . Leptin was obtained from Sigma-Aldrich . An RNeasy Mini Kit, for RNA extraction, was purchased from Qiagen . DuoSet ELISA kits for Human ICAM-1, IL-6, and MCP-1 as well as ELISA kits for rat Adiponectin were purchased from R&D Systems . Gene expression Assays for real-time PCR were obtained from Applied Biosystems . n = 6) or recombinant rat leptin  via the tail vein. This dose was based on previously reported doses for rodent studies [\u03bcm in diameter. At least 3 non-overlapping regions were analyzed for each rat. Rolling leukocytes were defined as cells moving at a velocity significantly slower than center line velocity. Adherent leukocytes were determined as cells that were completely stationary for at least 30 seconds.Male Wistar rats were administered saline  supplemented with 10% Fetal Bovine Serum (FBS). When cultures reached confluence, C3A cells were incubated overnight in EMEM medium without FBS for 24 hours prior to treatment with recombinant human leptin (7.8\u2013125\u2009ng/mL). After an additional 24 hours period in the presence of leptin, the culture medium was collected and the cells were harvested. The cell pellet was stored at \u221280\u00b0C until used for RNA extraction. At the time of sacrifice, samples of whole blood were collected from the vena cava of saline controls and leptin-treated rats. Serum levels of the anti-inflammatory adipokine adiponectin were determined by ELISA. Soluble ICAM-1, IL-6, and MCP-1 were measured in samples of culture medium collected 24 hours after leptin exposure using Duoset ELISA kits according to the manufacturer's instructions.\u03bcL of reaction mixture containing 25\u2009mM MgCl2, 10\u2009mM dNTP mix, 50\u2009\u03bcM Random hexamers, 20\u2009U/uL RNase inhibitor, and 50\u2009U/uL multiscribe reverse transcriptase. Reaction mixtures were incubated in a Mastercycler-personal  for 10 minutes at room temperature followed by 60 minutes at 42\u00b0C and 5 minutes at 95\u00b0C.Total RNA was extracted from frozen samples of mesenteric adipose tissue, mesenteric connective tissue containing microvessels, and liver using the RNeasy Mini kit from Qiagen. The integrity and concentration of each total RNA sample were determined by spectrophotometry. A 500\u2009ng aliquot of total RNA was reverse-transcribed to cDNA in 25\u2009t) method as described previously [Relative mRNA expression of ICAM-1, MCP-1, IL-6, and P-selectin was determined using predeveloped assays for real-time PCR . Analysis of each target mRNA was performed in duplicate in separate wells and normalized to amplification of 18S ribosomal RNA subunit. To confirm the absence of genomic DNA contamination, samples without the reverse transcription were also analyzed. The reactions were performed using an ABI Prism 7700 Sequence Detection System with the following cycle parameters: 50\u00b0C for 2 minutes, 95\u00b0C for 10 minutes followed by 40 cycles of 95\u00b0C for 15 seconds and 60\u00b0C for 1 minute. Raw data were analyzed using the ABI Prism Sequence Detection 1.9.1 software. The relative amount of mRNA was calculated using the comparative threshold cycle . On the other hand, PCR analysis of ICAM-1 expression revealed a 2-fold increase in mRNA levels at the 24 hours time point , suggestThe C3A human hepatocyte cell line was used to determine if leptin exposure could directly stimulate a proinflammatory phenotype. After up to 24 hours in culture, protein and mRNA expression of ICAM-1 was monitored using ELISA and real-time PCR, respectively. Protein levels of sICAM released by C3A cells increased in a dose-dependent manner . Leptin Ob) or leptin receptor (Obr) genes inhibit the appropriate production of or response to leptin, respectively. Although rare in humans, these mutations render affected individuals obese. On the other hand, obesity as a result of poor life style choices  is commonly associated with hyperleptinemia. Several studies have shown that serum leptin levels correlate with generalized obesity indexed by BMI and even more specifically with abdominal adiposity. Considine et al. (1996) were among the first to report a positive relationship between leptin and adiposity [Leptin is 16\u2009kDa protein primarily known for regulation of caloric load via appetite suppression and energy expenditure under normal physiological conditions. Mutations in the leptin  and induced the overproduction of matrix proteins that are components of fibrosis scaring such as collagen \u03b1I-1 [Nonalcoholic steatohepatitis is a cryptogenic form of liver disease that is often observed in obese patients without identifiable causes such as alcohol abuse, drug toxicity, or viral infection. As the name suggests, NASH is histologically indistinguishable from alcoholic hepatitis and is characterized by fat accumulation in hepatocytes, mixed cell type inflammation, focal necrosis, and fibrosis. This disease has been observed worldwide and the prevalence of NASH is estimated to be as high as 40\u2013100% in obese adults as reviewed elsewhere . Adiposigen \u03b1I-1 , 27\u201329. gen \u03b1I-1 . Herein,gen \u03b1I-1 \u201333. Studgen \u03b1I-1 , 35. Altgen \u03b1I-1 , 33, theTaken together with previous reports in rodent models as well as humans, data presented herein demonstrate the potential role for leptin in the inflammatory process associated with obesity. Our working hypothesis is outlined schematically in"}
+{"text": "Penicillium spp. have demonstrated their ability to degrade different xenobiotic compounds with low co-substrate requirements, and could be potentially interesting for the development of economically feasible processes for pollutant transformation.The effects on the environment of pollution, particularly that caused by various industrial activities, have been responsible for the accelerated fluxes of organic and inorganic matter in the ecosphere. Xenobiotics such as phenol, phenolic compounds, polycyclic aromatic hydrocarbons (PAHs), and heavy metals, even at low concentrations, can be toxic to humans and other forms of life. Many of the remediation technologies currently being used for contaminated soil and water involve not only physical and chemical treatment, but also biological processes, where microbial activity is the responsible for pollutant removal and/or recovery. Fungi are present in aquatic sediments, terrestrial habitats and water surfaces and play a significant part in natural remediation of metal and aromatic compounds. Fungi also have advantages over bacteria since fungal hyphae can penetrate contaminated soil, reaching not only heavy metals but also xenobiotic compounds. Despite of the abundance of such fungi in wastes, penicillia in particular have received little attention in bioremediation and biodegradation studies. Additionally, several studies conducted with different strains of imperfecti fungi,  The objective of this review is not to be exhaustive, but rather to summarize the remediation potential of Penicillium simplicissimum YK is able to degrade polyethylene, with a molecular weight of 400 to 28,000 . The sorption uptake of Pb(II) remained unchanged in the presence of Cu(II) and As(III), it decreased in the presence of Zn(II), and increased in the presence of Cd(II) anthracene, while the highest increase was observed for pyrene. P. janthinellum VUO 10,201 degraded substantial amounts of the four and five benzene ring PAHs in complex medium or basal salt-glucose medium. However, these PAHs did not support growth and were slowly degraded when supplied as a sole carbon source in basal salt medium pyrene as the sole carbon and energy source, but also to achieve higher rates of its degradation [Biological degradation is the major remediation process of PAH contaminated sites; however, its success has been limited by the failure to remove high-molecular-mass PAHs . In contradation . The ubi5.Phenol and its derivates are widely distributed as environmental pollutants due to their presence in the effluents of many industrial processes. Indeed, phenol is a major pollutant present in several industrial wastewaters such as petroleum refining, petrochemicals, basic organic chemical manufacture, pharmaceuticals, plastics manufacture, tannery, coal refining, pulp and paper manufacture, etc. . Phenol Halogenated compounds are important environmental pollutants of soil, water and air. In addition, the production and the utilization of fluorinated substances  have been increased enormously in the recent years . PentachPenicillium strains have the ability to transform them into products that are less mutagenic that the parent compound. In fact, the genus of Penicillium is a good hydrocarbon-assimilating strain. Scow et al. investigated in liquid medium the mineralization of phenol at low concentrations by Penicillium sp. isolated from silt loam that had been amended with 50 \u03bcg/g of phenol [et al. reported the utilization of phenol by Penicillium frequentans Bi 7/2 as the sole carbon and energy source. Phenol is degraded by the ortho-pathway with catechol as first intermediate product [Penicillium simplicissimum SK9117, effectively degraded 8.5 mM of phenol used as the sole source of carbon and energy. The catabolism of phenol produced catechol, hydroquinone, and cis,cis-muconic acid [Studies conducted with a halotolerant strain of Penicillium chrysogenum isolated from a salt mine  have shown that phenol could be complete degraded by this strain, and the products did not present toxicity. Phenol biodegradation was done with a concentration of 58.5 g/L of sodium chloride. P. chrysogenum CLONA2 strain was able to a rapid detoxification of 300 mg/L of phenol under batch conditions after 100 h of incubation [P. chrysogenum CLONA2 metabolized phenol faster than resorcinol when present as a sole carbon source [Penicillium, there is evidence that supports two possible routes, as it was described for Aspergillus fumigatus ATCC 28282 [P. simplicissimum SK9117 and P. chrysogenum CLONA2, both catechol and hydroquinone were detected as metabolic products of phenol. In one route, phenol hydroxylates at the ortho position to form catechol, and in another route phenol hydroxylates at the para-position to produce hydroquinone .Fungi appear to be predominantly involved in metabolizing those xenobiotics of relative low solubility and high adsorptivity. Several f phenol . At concf phenol . Hofrich product . After 2nic acid . Studiescubation . Later, n source . In spitCC 28282 , 90. In et al. described a Penicillium strain, Penicillium simplicissimum SK9117, able to grow on monofluorophenol. P. simplicissimum SK9117 was isolated from a sewage plant, and was able to metabolize 3-, 4-chlorophenol, and 4-bromophenol in the presence of phenol. The metabolism of all monofluorophenols is enhanced in the presence of phenol, resulting in the simultaneous disappearance of substrate (0.5 mM) and co-substrate (1 mM). When P. simplicissimum SK9117 used monofluorophenols as the sole carbon and energy source, growth was supported and fluoride ions released. The equimolar release of fluoride ions indicates complete mineralization of 3- and 4-fluorophenols.On the other hand, P. simplicissimum SK9117 was not able to utilize monobromo-, and monochlorophenols as carbon and energy source. 3-Chlorophenol was transformed by cometabolism to chlorohydroquinone, 4-chlorocatechol, 4-chloro-1,2,3-trihydroxybenzene, and 5-chloro-1,2,3-trihydroxybenzene. 4-chlorophenol was completely cometabolized, and only 4-chlorocatechol was observed as transient product. Degradations of chlorophenols were reported in other Penicillium, P. frequentans Bi 7/2. This fungus, when pregrown in phenol, metabolized monochlorophenol via the corresponding catechols and muconic acids [P. frequentans was described [et al. showed that the same fungus, using phenol as the only carbon and energy source, transformed difluorinated phenol into corresponding difluorocatechol [Marr ic acids . Later, catechol .Penicillium camemberti has shown removals 86% of PCP and 53% of 2-chlorophenol in batch culture with Tween\u00ae 80 after 21 days of incubation. In addition, under up-flow tubular column reactor conditions a removal of 77% pentachlorophenol from adsorbable organic halogen (concentration of 63.4 mg/L) was achieved after four days of incubation [Penicillium degradation of phenols, chlorophenols and pentachlorophenol is listed in A study with cubation . Penicil6.6.1.et al. reported a release of 2.5 L of waste per liter of oil produced [Penicillium strains possess high catabolic enzyme activity and can utilize a wide variety of simple aromatic compounds. Therefore, these microorganisms exhibited a marked capacity for the detoxification of OMW, removing completely its antibacterial activity. Cultivation of OMW with Penicillium P4, one of the seven strains of Penicillium isolated from undiluted OMW that produce more biomass after 20 days of incubation, caused phenolic reduction of 54%, and COD reduction of 61%. Beside that the process resulted in a decolorization of 80% and no antibacterial activity against Bacillus megaterium was observed [Olives grown in the Mediterranean countries constitute about 98% of the global production. Large quantities of olive mill wastewater (OMW) are produced during the manufacture of oil by traditional milling and press processes. This wastewater is a stable solution made up of vegetation, water from olives, washing and process water, olive pulp and oil. Borja produced . Conventproduced . Aerobicobserved .6.2.et al. reported the degradation of phenolic compound in vinasse by Penicillium decumbens in batch regime [P. decumbens produces a decolourization of the vinasses from the first day of incubation. Higher reductions in colour were achieved between the 4th and 5th days of treatment, with the best result being 41% of the initial colour removed after 100 hours of cultivation [Penicillium decumbens) vinasses in continuous-flow stirred tank reactors [In Europe and USA a large number of industries produce ethanol by fermentation-destillation. These industries produce large quantities of high strength liquid wastes called vinasses, approximately 9\u201314 L of wastewater per liter of ethanol produced. The wastes generated by this kind of industry are strongly acidic (pH: 4\u20135) and have a high organic content (COD range of 50\u2013100 g/L) . Vinasseh regime . The initivation . Later, reactors . The CODreactors .6.3.Arabica variety production forecast to reach 27.6 million bags and Robusta variety production estimated at 10.3 million bags [Penicillium spp. [Penicillium plays an important role in degradation of coffee residue [Penicillium curstosum in roast coffee infusions was reported when caffeine concentration were about 0.45\u20130.59 mg/mL [et al. investigated the effect of additional inorganic and organic nitrogen sources in caffeine degradation by Penicillium verrucosum. In solid state fermentation of coffee pulp total degradation of caffeine was observed in the absence of any added nitrogen source after 72 h of fermentation, in spite of the limited growth of the culture. The presence of a additional source inhibiting caffeine degradation, it was proposed that P. verrucosum used caffeine as a nitrogen source [Penicillium species strains were isolated from coffee pulp. These strains had the ability to degrade almost 100% of caffeine in liquid medium [et al. have found several Penicillium species at four stages of maturation and processing of coffee cherries of Coffee arabica in Brazil. A total of fourteen Penicillium crustosum, three Penicillium restrictum, two Penicillium implicatum, and one Penicillium citrinum strain were isolated. The potential of these strains were not studied, but the species identified include members all known to have pectinase and cellulase activities [Coffee is one of the most important beverages of the world, and about one million tons of it is produced yearly in more than 50 countries. Brazil is the largest producer of coffee and hence of coffee residues in the world. The Brazilian government agency CONAB has released its first official estimate for the Brazilian coffee crop for 2009/10, together with the final official estimate for 2008/09. The average estimate for total production in 2009/10 is 37.8 million bags, with ion bags . At diffium spp.  These st residue . Caffein59 mg/mL . Roussosn source . In anotd medium . Silva etivities .7.Penicillium spp. plays an important role as natural environmental remediation agents in the ecosystem. Studies have shown the considerable potential of Penicillium strains as a naturally, abundant and cheap source for heavy-metal environmental reduction. In this process, fungi act as biosorbents. Their efficiency as adsorbents depends on the capacity, affinity and specificity including physico-chemical nature. Removal of heavy metals from aqueous solution could be achieved by using active, inactive and even dead biomass. The two last processes constitute an innovative and alternative technology for up-take of heavy metals. Biosorption offers an economically feasible technology for efficient removal and recovery of metal(s) from aqueous solution. This process could very interesting, once it could be applicable for treatment of dilute effluent that is originated either from a primary wastewater treatment or industrial plant. The major difficulties, at present, lies with the lack of knowledge on development of metal-resistant species and the performance of binary and ternary metal systems.In this review it has been shown that Penicillium strains, as soil fungi, showed ability to produce extracellular enzymes and metabolize hydrocarbons. The capacity of Penicillium strains to produce cellulose, mannanase and pectinase indicated that these strains should be able to use several agricultural wastes, and the potential for production of these costly enzymes should be considered for biotechnological applications. Some of these strains are not only able to oxidize, but also mineralize hydrocarbons, such as phenol, halogenated compounds and PAHs. Their efficiency depends on several factors such as co-substrate and inorganic macronutrient availability, mainly nitrogen and phosphorus. Recently, the use of fungal-bacterial co-cultures has demonstrated the detoxification of PAHs. Little is known about the biodegradation of complex mixtures of PAHs by fungi. Degradation of phenol and phenolic compounds by Penicillium strains has been achieved successfully at laboratory level despite limited work. However, further research is necessary for identification of metabolites and to elucidate the enzymatic pathways used in the biodegradation process. Genes encoding enzymes involving degradation of these pollutants must be cloned sequenced, and characterized, in order to open a new era in Penicillium applications for the detoxification of different xenobiotic compounds.Penicillium species showed to be able to grow at high concentrations of salt as well as in its absence, while also processing high resistance to heavy metals and hydrocarbon degradation efficiency, could be used as agents for abatement of these pollutants in hypersaline conditions, as well as in non-saline environment.Industrial processes also use salts and frequently release brine-effluent into the environment. Penicillium strains. Perhaps, the costs involved in projects, and the lack of control of natural environmental variables have delayed the implementation of fungi, and Penicillium strains in particular, in the bioremediation field. Therefore, so far we are only able to talk about the potential of Penicillium species in the field of bioremediation.A major concern expressed by several researchers in the bioremediation field is the lack of applicability of laboratory research to actual large-scale problems. Critical analysis reveals that there are relatively few reports of pilot and full-scale studies using"}
+{"text": "Protein-energy malnutrition is a major problem and one of the risk factors for mortality in hemodialysis patients. There is no single index in evaluation of nutritional status in these patients, so leptin can be used as one of the parameters. In this study, the correlation between serum leptin with biochemical and anthropometric parameters of nutrition has been evaluated. This cross-sectional study has been performed on 60 hemodialysis patients  in 2006. The patients on hemodialysis for under 1 year and who has a history of consumption of lipid lowering agents or glucocorticoids, or an infectious or inflammatory disease were excluded. Malnutrition laboratory parameters and serum leptin were measured before hemodialysis. Serum leptin was measured with enzyme-linked immunosorbent assay (ELISA) method with direct dbc kit and malnutrition laboratory parameters measured with standard laboratory methods, patients anthropometric parameters evaluated after hemodialysis. The mean age of patients was 47.5 \u00b1 16.1 years and the range of serum leptin level was 0.6-64.8 ng/ml. Mean serum leptin level were 22.64 \u00b1 19.54 ng/ml in females and 16.74 \u00b1 20.16 ng/ml in males on hemodialysis and in spite of higher level of leptin in females there was not any statistically significant difference between females and males serum leptin. Absolute value of correlation coefficient between serum leptin and anthropometric parameters and most laboratory parameters was < 0.25 . Our results suggest that the increased serum leptin level does not have a major role in diagnosis of malnutrition in hemodialysis patients and there is a poor correlation between malnutrition parameters and serum leptin level. Protein-energy malnutrition is a common problem in hemodialysis patients, which increases their morbidity and mortality and decreases life expectancy as a result of accompanying infection and cardiovascular diseases.1Generally, there are multiple causes contributing to malnutrition in hemodialysis patients. These include restricted diet, metabolic acidosis, gastroparesis, appetite suppression as a side effect of the drugs, chronic volume overload, presence of an acute or chronic systemic diseases which cause inflammatory responses and dialysis itself. Therefore, nephrologists suggest the initiation of hemodialysis before malnutrition has set in.2There is no single index to determine malnutrition in dialysis patients and malnutrition evaluation is done by multiple parameters which need lots of money and time.According to the studies, 40-70% of end-stage renal-disease (ESRD) patients are malnourished which is due to multiple factors. One of the causes of malnutrition is anorexia which may have different reasons.3Leptin is a 16-kDa protein hormone and a product of obesity gene (ob) which is produced exclusively by adipocytes and its main effect on hypothalamus that decreases appetite, increases energy expenditure, and reduces weight.46The exact reason of serum leptin level elevation in ESRD is not known and factors like decrease in renal clearance and erythropoietin level and chronic inflammation, have been thought to be the contributing factors.Our study was a cross-sectional study done on hemodialysis patients in Emam Khomeini Hospital and Sina Hospital in Tehran in 2006.et al.The sample size of the study was calculated by comparison of mean serum leptin in patients with and without malnutrition defined by one of the markers of malnutrition in hemodialysis patients backed up by the study of Koo An informed consent was obtained from all subjects. We explained the importance of malnutrition to patients in their life quality before the examinations were done. A blood sample was taken from each patients before hemodialysis and hemoglobin, quantitative C-reactive protein (CRP), calcium, phosphorous, parathyroid hormone, urea, creatinine, serum iron, total iron binding capacity, ferritin, transferrin, total protein, albumin, triglyceride, cholesterol, low-density lipoprotein (LDL), high-density lipoprotein, and serum leptin were measured. Serum leptin was measured using enzyme-linked immunosorbent assay method by dbc Direct Kit  with 0.5 ng/ml sensitivity. Intraassay coefficient of variation (CV) and interassay CV of the kit were 7.4 and 8.7%, respectively. After the measurement of leptin, adjusted leptin was calculated by dividing serum leptin by body mass index (BMI). The other laboratory tests were done through standard laboratory methods.The following anthropometric parameters were measured 10-20 min after hemodialysis was fulfilled.Usual body weight (UBW): mean body weight of patients during last 6 months using the data of their clinical files.Height: measuring from the vertex to the heel (using tape measure)Body mass index (BMI): The patients body weight in kilograms divided by their square height in meter.Triceps skin fold (TSF) and biceps skin fold (BSF): skin-fold thickness amount in triceps and biceps region .Mid arm circumference (MAC): arm circumference measured in midarm between acromyon and olecranon process (using tape measure).Mid arm muscle circumference (MAMC): Was calculated as follows:MAMC = MAC \u2212 (3.14 \u00d7 TSF)KT/V index which is an indicator for adequacy of dialysis was measured by multiplying clearance of urea by time divided by volume of distribution of urea.The hypothetical cut-offs for defining malnutrition are shown in T-test, and Pearson test) and nonparametric statistical tests (Mann-Whitney and Spearman's rho test) were used.Statistical analysis was done on data gathered using SPSS-11.5 software. To evaluate the correlation of variables considering whether they are quantitative or qualitative and type of their correlation parametric statistical tests  and 28 females (46.7%) with mean age of 47.5 \u00b1 16.1 years were investigated. Mean amount of measured parameters for each gender are presented in The range of serum leptin of hemodialysis patients in our study was 0.6-64.8 ng/ml. Mean serum leptin in women and men were 22.64 \u00b1 19.54 ng/ml and 16.74 \u00b1 20.16 ng/ml respectively and their difference was not statistically significant [Figs. Pearson correlation coefficient for serum leptin level and adjusted leptin with malnutrition laboratory and anthropometric parameters and age, and hemodialysis duration are shown for both genders .r = 0.38, P = 0.007) and correlation with other variables were not significant. The correlation between leptin and other variables was not significant in diabetic subgroup.Comparison of mean serum leptin level and some malnutrition parameters considering the hypothetical cut points are shown in P > 0.05); was marginally significant for BMI, TSF  and was significant for BSF (P = 0.001). Kayardi et al. came to the same results.According to the results of our study, mean anthropometric parameters in hemodialysis patients like UBW, BMI, BSF, TSF, MAC, and MAMC in women were more than in men. This difference was not significant for UBW, MAC, MAMC (P > 0.05) .Our results showed that mean serum leptin and adjusted leptin in male and female patients were not significantly different .Our results demonstrate a poor positive correlation between serum leptin and patients age both in women and men differ and from the results of Yilamz et al.,As in the study of Yilamz et al.,et al.,et al.et al.'s studyAccording to the results of our study, there is a poor correlation between leptin (and adjusted leptin) with hemoglobin, ESR, CRP, and albumin in patients of this study. The same findings are seen in study of Bossola et al.et al.According to the results of our study, the mean of total cholesterol, LDL, and triglyceride in women is significantly more than those of men, but there was no correlation between leptin (and adjusted leptin) with these variables. Bossola Based on the results of our study, there is a positive moderate correlation between ferritin and iron with serum leptin (and adjusted leptin) in male patients. This correlation is not found in female patients. The correlation of ferritin and serum leptin may be due to the fact that ferritin is a acute phase protein and chronic inflammation is a probable cause of increased serum leptin level in ESRD patients.et al.'s study,et al. study.13All the patients of our study were clinically stable and did not have any acute diseases and were not taking corticosteroids. In Bossola The results of our study showed no correlation between serum leptin (and adjusted leptin) with calcium, phosphorus, parathyroid hormone (PTH) in both genders, but mean leptin in female patients who had serum calcium lower than 8 mg/dl was significantly less than serum leptin of the female patients who had serum calcium level equal or upper than 8 mg/ml. The same result was not obtained in male patients.et al. study.KT /V index, which was same as that shown by Koo et al.12Our study showed a moderate positive correlation between serum leptin and urea and creatinine in hemodialysis women. This correlation is not seen in male patients, which was the same as the Johansen In Carmona study, a poor correlation was found between increased serum leptin and the markers of malnutrition in hemodialysis patients.11In diabetic hemodialysis patients in this study, no correlation between serum leptin and other variables was found. In nondiabetic patients the correlation was found only between leptin and age. Only 12 diabetic patients were included in our study.Considering the results of our study and the pervious ones, we noticed varying results. Some of these differences are due to different methods and kits which are used for measurement of leptin. Some studies measured serum leptin and some others measured plasma leptin. Also some measured free serum leptin and sometimes leptin bounded to receptors. Besides the population which were studied differed from each other in their inflammatory status and glucocorticoid usage in last 3 months or taking erythropoietin which may alter serum leptin. Since chronic hemodialysis patient have to take different drugs affecting on iron, calcium, phosphorous, we cannot ignore the effect of these drugs on the laboratory parameters. As shown in Tables According to all the conditions mentioned, it can be concluded that serum leptin level cannot be considered as a marker for malnutrition in hemodialysis patients and more studies should be done with larger sample size that include healthy control group."}
+{"text": "Adipose tissue is an active endocrine organ that secretes various humoral factors (adipokines), and its shift to production of proinflammatory cytokines in obesity likely contributes to the low-level systemic inflammation that may be present in metabolic syndrome-associated chronic pathologies such as atherosclerosis. Leptin is one of the most important hormones secreted by adipocytes, with a variety of physiological roles related to the control of metabolism and energy homeostasis. One of these functions is the connection between nutritional status and immune competence. The adipocyte-derived hormone leptin has been shown to regulate the immune response, innate and adaptive response, both in normal and pathological conditions. The role of leptin in regulating immune response has been assessed in vitro as well as in clinical studies. It has been shown that conditions of reduced leptin production are associated with increased infection susceptibility. Conversely, immune-mediated disorders such as autoimmune diseases are associated with increased secretion of leptin and production of proinflammatory pathogenic cytokines. Thus, leptin is a mediator of the inflammatory response. White adipose tissue plays a very important role in the energetic balance of mammals. This tissue is specialized in storing lipids and supplying fuel to the whole body whenever it is necessary. In order to face energetic requirements, adipocytes regulate fatty acid mobilization in response to catabolic and anabolic stimuli. However, adipose tissue is not only a reserve organ; it is also an endocrine organ able to release hormones, peptides, and cytokines (adipokines) that affect both the energetic status and the immune system . Leptin Rather than a \u201cfasting signal\u201d, leptin is a signal of starvation, in that a falling serum leptin concentration leads to neurohumoral and behavioural changes, trying to preserve energy reserves for vital functions. Thus, during fasting period and after reduction of body fat mass, there is a decrease in leptin levels that leads to a reduction in total energy expenditure to provide enough energy for the function of vital organs, that is, the brain, the heart, and the liver . Even thThe leptin modulation of the immune system is also mediated by the regulation of hematopoiesis and lymphopoiesis , 11 Thus\u03b1, interleukin (IL)-2, or IL-6. Leptin receptor is also upregulated by proinflammatory signals. In this paper, we will summarize data from literature that demonstrate the positive regulation of the immune response by leptin , directing them towards Th1 priming and promoting DC survival via the PI3K-Akt signaling pathway [Dendritic cells belong more to the same cell lineage than to monocytes/macrophages and also present leptin receptors (OBRb) on the cell surface . Thus, l pathway . The inv pathway .The expression of leptin and leptin receptors has been demonstrated on mast cells, suggesting paracrine and/or autocrine immunomodulatory effects of leptin on mast cells .Human polymorphonuclear neutrophils (PMN) have been found to express leptin receptor in vitro and in vivo , 42. HowLeptin promotes neutrophils chemotaxis , 44. In Klebsiella pneumoniae [Moreover, leptin also has a stimulating effect on intracellular hydrogen peroxide production in PMN although this effect seems to be mediated by the activation of monocytes . More speumoniae  and in deumoniae .On eosinophils, leptin could upregulate cell surface expression of adhesion molecules ICAM-1 and CD18 but suppress ICAM-3 and L-selectin. Moreover, leptin could also stimulate the chemokinesis of eosinophils and induce the release of inflammatory cytokines IL-1beta and IL-6 and chemokines IL-8, growth-related oncogene-alpha, and MCP-1 .Human NK cells constitutively express both long and short forms of Ob receptor. Moreover, the leptin receptors can signal in NK cells, since leptin activates STAT3 phosphorylation in NK cells. Moreover, leptin increases IL-2 and perforin gene expression at the transcription levels in NK cells. Consistent with this role of leptin regulating NK cells, db/db mice have been found to have impaired NK cell function , 51.\u03b2, IL-6, and TNF-\u03b1 by monocytes and macrophages [Leptin actions in NK cells include cell maturation, differentiation, activation, and cytotoxicity . Leptin rophages .The role of leptin in cell-mediated immunity has been obtained working with ob/ob mice . These mIn the thymus, Fyn acts as a tyrosine kinase that transduces the leptin signal independently of JAK2 activation and mediates some of the immunomodulatory effects of leptin in this tissue. The tyrosine kinase, Fyn, is constitutively associated with the Ob-R in thymic cells. Following a leptin stimulus, Fyn undergoes an activating tyrosine phosphorylation and a transient association with IRS1 .Phodopus sungorus) and increased splenocyte proliferation in mice [Acute deficiency of leptin has a potent effect on the immune system, which is even higher than that observed in ob/ob mice (genetic defect). Acute hypoleptinemic mice show a higher decrease in the total number of thymocytes, and double number of apoptotic cells than ob/ob mice. Moreover, the acute deficiency of leptin also causes a decrease in splenic cellularity, which does not occur in ob/ob mice, even though they have a smaller spleen than control mice . Both ob in mice  as well  in mice .Lord et al. 1998 , demonst\u03bcg/mL) and after stimulation with PMA-ionomycin [More recently, we have reviewed the role of human leptin on T cell response . Human lonomycin . Howeveronomycin . The actonomycin . The nee\u03b3 in stimulated T lymphocytes. It had been previously shown in mice that leptin can enhance cognate T cell response, skewing cytokine responses towards a Th1 phenotype in mice [\u03b3 [\u03b1 and IL-6 production by monocytes [Human leptin not only modulates the activation and proliferation of human T lymphocytes but also enhances cytokine production induced by submaximal concentrations of PHA . Thus, h in mice . These d mice [\u03b3 . The eff mice [\u03b3 , 62. Th1 mice [\u03b3  and the  mice [\u03b3 . These donocytes , furtheronocytes  as well onocytes . In addionocytes .On the other hand, leptin promotes T cell survival and Jurkat T lymphocytes survival  by modulThe leptin receptor is highly expressed on the cell surface of Tregs. Leptin can act as a negative signal for the proliferation of human Foxp3 (+) CD4 (+) CD25 (+) regulatory T (T(reg)) cells. In vitro, neutralization with leptin monoclonal antibody (mAb), during anti-CD3 and anti-CD28 stimulation, resulted in T(reg) cell proliferation, which was interleukin-2 (IL-2) dependent. Together with the finding of enhanced proliferation of T(reg) cells observed in leptin- and ObR-deficient mice, these results suggest a potential for therapeutic interventions in immune and autoimmune diseases .In conclusion, leptin plays a role in the activation of the immune system, and it is a mediator of inflammation. In this context, leptin may be one of the mediators responsible for the low-level systemic inflammation that may be present in metabolic syndrome-associated chronic pathologies such as atherosclerosis, which is associated with obesity, especially central obesity. Therefore, leptin may be considered as a therapeutic target in some clinical situations, such as proinflammatory states or autoimmune diseases, to control an excess of immune response, as well as in other clinical situations, such as starving, to control an excess of exercise, or immune deficiencies, to improve the impaired immune response. That is why the investigation of the role of leptin in the regulation of the immune response remains a challenge for the future."}
+{"text": "Microfossils are not only useful for elucidating biological macro- and microevolution but also the biogeochemical history of our planet. Pyritization is the most important and extensive mode of preservation of animals and especially of plants. Entrapping in amber, a fossilized resin, is considered an alternative mode of biological preservation. For the first time, the internal organization of 114-million-year-old microfossils entrapped in Lower Cretaceous amber is described and analyzed, using adapted scanning electron microscopy in backscattered electron mode in association with energy dispersive X-ray spectroscopy microanalysis. Double fossilization of several protists included in diverse taxonomical groups and some vegetal debris is described and analyzed.In protists without an exoskeleton or shell , determinate structures, including the nuclei, surface envelopes (cortex or cytoplasmic membrane) and hyaloplasm are the main sites of pyritization. In protists with a biomineralized skeleton (diatoms), silicon was replaced by pyrite. Permineralization was the main mode of pyritization. Framboidal, subhedral and microcrystalline are the predominant pyrite textures detected in the cells. Abundant pyritized vegetal debris have also been found inside the amber nuggets and the surrounding sediments. This vegetal debris usually contained numerous pyrite framboids and very densely packed polycrystalline pyrite formations infilled with different elements of the secondary xylem.Embedding in amber and pyritization are not always alternative modes of biological preservation during geological times, but double fossilization is possible under certain environmental conditions. Pyritization in protists shows a quite different pattern with regard to plants, due to the different composition and cellular architecture in these microorganisms and organisms. Anaerobic sulphate-reducing bacteria could play a crucial role in this microbial fossilization. Agathis and Hymenaea. It acts as a natural embedding agent and it has properties similar to amorphous polymeric glass [A major problem for understanding the origin of life, microbial evolution and phylogeny is the lack of microbial fossils. It is especially evident when we consider the available well-preserved record of pluricellular organisms, animals and plants . Microfoic glass . Amber cic glass . Trappinic glass . Mineralic glass . Pyritizic glass -8. Althoic glass ,9: 1) peOne important feature in the pyritization process is pyrite texture. The term texture is used to define the characteristics  and contact relationships among pyrite crystals. The external form and shape of any aggregate of pyrite crystals is referred to as morphology . Pyrite Paleomicrobiological studies on amber are very scarce. The most ancient eukaryotic microorganisms found in amber date back to the Triassic 220 My ago) . In addi My ago .In the amber site at Pe\u00f1acerrada  the mosThe pattern of pyrite deposition and crystallization presented differences according to each protist morphotype, that is, the cellular organization and composition. However, the general pattern of pyrite crystal distribution was similar in all protists. The size of the cells may have been an important factor in the pyrite texture. Figure Hartmannella. The sulphur and iron contents, detected by microanalysis, are illustrated respectively in Figure 2). As may be observed, the cytoplasm contained numerous vacuoles or vesicles and the pyrite deposition is more intense in the hyaloplasm, a jellified hyaline cap located at the front of the leading pseudopodium [Figure dopodium . HoweverBoth heterotrophic and photosynthetic flagellates of different taxa have been identified in amber. In all of them the pyrite microcrystalline deposits are more intense inside the plasma membrane and cell wall. The cytoplasm of these pyritized cells presents a trabecular appearance with many vesicles and vacuoles of different sizes delimited by a microcrystalline network Figures  and 4. IChlamydomonas. In this case, the nuclear envelope has been replaced by a layer of discrete spheroidal or cubo-octahedral microcrystals or grains (<0.1 \u03bcm), densely packaged. Equimorphic organization of pyrite microcrystals was similar to that from pyrite framboids. However, framboids usually occur in clusters of finite size. The organic core of the nucleus (nucleoplasm) has been degraded and is partially infilled by densely packed groups of subhedral crystals that are bigger  than those from the biomineralized nuclear envelope  of each species Figures  and 8. CCymbella. The species of this genus have a frustule made of very pure silica, coated with a layer of organic material. It is usually easy to identify them, because the valves are asymmetrical around the apical axis and the cells present a slight dorsoventrality. The microanalysis associated with the SEM-BSE indicates that replacement of Si by pyrite took place in these microfossils. The cytoplasm appears very vacuolated with a complex network of microcrystals. A framboid-like pyrite can be observed in the location of the nucleus.Pyritization also affected those protists with a mineralized external skeleton. Figure In the same amber nuggets, we also found abundant pyritized vegetal microdebris, usually containing numerous pyrite framboids with variable sizes <10 to 50 \u03bcm)  have been described [Different cell wall composition in these two types of biological systems, as well as the absence of this structure in some protists , might explain the different patterns observed in protists and plants. When the protist has a skeleton, such as escribed -38. Two The most frequent pyrite textures found in our fossilized protists were microcrystalline and framboidal. However, outside cells but inside the amber and also in the sediments surrounding the amber deposits, we found mainly octahedral or subhedral pyrite in clusters of different sizes. In studies of fossil plants from the Eocene London Clay, Grimes et al reported different textures in adjacent cells of the same vegetal tissue. They stated that there is no exclusive relationship between cell type and a particular texture or combination of textures . This faThese results do not agree with the four-stage model proposed to explain the pyritization of fossils from London Clay , which aThe amber nuggets from Pe\u00f1acerrada had frequent inclusions of vegetal debris, including root fragments, suggesting the microbial and vegetal materials were included in the resin in the soil, before their transport. The sedimentology of the amber deposits, including the type of mineralization found in the layer which was the most productive source of amber lumps, is representative of the early diagenesis caused by diverse populations of anaerobic bacteria that result from the deposition of organic matter, which impedes oxygen diffusion across the sediment . The forIt is important to assign a temporal sequence to both pyritization and trapping in amber fossilization processes that protists underwent more than 114 My ago. Microanalysis of sediments adjacent to the amber deposits indicated that plant debris were pyritized, so the pyritization seems to be a prior and independent process to cellular inclusion into the resin. However, the pyritization may have continued for some time after the cells were embedded in the resin. Two reasons support this hypothesis. Organic matter degradation (decay) and mineralization (pyritization) represent two competing forces during early fossilization, and the amount of detail preserved in a biological fossil is usually a reflection of the end result of the relative timing of these two polar forces . Trappin2 were employed, or by increasing the redox potential of the systems [At present, microbial involvement in both pyrite precipitation to form sediments and pyritization  of organisms, tissues and cells, is the subject of intense controversy. Authors favouring a chemical origin support their hypothesis with two main facts; pyrite framboids have been synthesized in some laboratories (see ), and mi systems . Second, systems -45. Thir systems ,34,46. F systems . Moreove systems .2S emission, fragments of carbonized microcrystalline wood (lignite) and octagonal crystals of pyrite crusts has been described in Pe\u00f1acerrada sediments [Additional valuable information is provided by the characteristics of sediments located around the amber deposits where pyritized (micro/macro) fossils appeared. In the detailed description of fossiliferous amber deposits in New Jersey (Upper Cretaceous) by Grimaldi et al , where tediments . This tyediments . For allUltrastructural examination and microanalysis of fossilized protists in Pe\u00f1acerrada's Lower Cretaceous amber deposits support the view that, under certain environmental conditions, it is possible to find biological records which underwent two different mechanisms of fossilization \u2013 pyritization and entrapping in amber. Therefore, pyritization and embedding in resin are not always alternative modes of biological preservation. These uncommon double fossilizations indicate that anaerobic conditions and abundant organic matter as well as available and permanent/semi-permanent freshwater were present in the ecosystem of Pe\u00f1acerrada during Lower Cretaceous, previous to the biological inclusions in the resins. The comparative study of fossilized plant debris inside amber nuggets and those in sediments surrounding these nuggets showed that, at least in this case, inclusion in resin was a process prior to permineralization. In protists, the pattern of pyritization showed some differences from those observed in vegetal debris, probably due to the drastic differences of composition and cellular organization in these two biological kingdoms.Several tons of deep amber-containing sediments were extracted. Amber deposits were then separated from the rocks, pyrite nodules, lignite fragments and sandstones using a standard concrete mixer. Amber has a low specific gravity and generally floats or is buoyant in water. The concrete mixer was fed with a continuous flow of water, and the slurry resulting from mixing with rocks was poured through a 5 mm mesh. Solids of the lowest density  were collected from the surface, while dense sediments settled to the bottom of the concrete mixer. Each extraction process lasted 10 or 15 minutes. Regardless of size, amber lumps were the first to come out onto the sieve, followed by denser lignite fragments. Material deposited at the bottom of the concrete mixer consisted mainly of sand, fragments of rock, and pyrite nodules, which was free of amber, revealing the efficiency of this method in processing large quantities of amberiferous rocks.Each piece of amber was carefully examined under a stereoscopic microscope to detect biological inclusions, such as small arthropods and plant debris. All amber pieces containing biological inclusions were embedded in the epoxy resin Epotek 301 to eliminate the mirror effect of internal cracks and to avoid natural oxidation and darkening. Internal zones of deeper sediments surrounding amber pieces were collected manually and stored aseptically after processing for electron microscopy.Small pieces of amber were embedded in epoxy resin and after polymerization each block was cut and finely polished . The polEDS: energy dispersive X-ray spectroscopy; Gy: 1000 millions of years; My: millions of years; SEM: scanning electron microscopy; SEM-BSE: scanning electron microscopy in backscattered electron mode.AMG and JCG undertook analysis and microbial identification. JW, JA and CA provided and processed samples. JW and CA carried out the microscopy techniques. AMG, JCG, JW, JA, CA conceived and wrote the paper. All authors have read and approved the final manuscript."}
+{"text": "Leptin, a 167 amino acid peptide hormone, profoundly effects reproduction exerting its biological effects via interaction with the leptin receptor (ObR) which is widely expressed on peripheral tissues. In this study, we have attempted to assess leptin receptor expression in the spermatozoa of fertile males and those diagnosed with male factor infertility; both at the mRNA or protein levels.Semen samples were collected from fertile males and individuals with male factor infertility. In order to evaluate leptin receptor expression several techniques were utilized, including: reverse transcriptase-polymerase chain reaction (RT-PCR), immunostaining, flow cytometry, and western blotting. Mononuclear cells isolated from volunteers' peripheral blood were used as positive controls for leptin receptor expression.leptin receptor was noted on mononuclear cells but we were unable to detect this receptor on spermatozoa at the protein level. Leptin receptor expression was detected on peripheral blood mononuclear cells (PBMCs) as positive controls; however it was not detectable on the spermatozoa of both groups by immunofluorescence microscopy or flow cytometry. Furthermore, positive expression of the ObR long isoform as assessed by RT-PCR was observed in the sperm of only four cases, whereas expression of beta-Actin, a house keeping gene, and HspA2, a testis specific gene, was present in all cases.The long isoform of leptin receptor may not be present on human sperm. Species difference may be accounted for diverse reproductive physiology which depends on metabolic requirement. Leptin receptor expression at the mRNA level in some individuals may be related to contamination by other cells in semen. Hormones play a significant role in the unique and complex process of sperm production, many of which have been studied extensively. However, their precise role remains to be elucidated -3. LeptiMale mice lacking the leptin gene (ob/ob) are infertile and this effect is reversed by leptin treatment . The rolSemen samples were collected from 50 individuals diagnosed with male factor infertility and 22 normal healthy males who were referred to the Isfahan Fertility and Infertility Center. Infertility is classically defined as a state in which a couple desiring a child, is unable to conceive following 12 months of unprotected intercourse. Subjects in the control group were healthy volunteers who had at least one child. All subjects signed an informed consent prior to participating in the study. The study was approved by the local ethics committee of Royan Institute and Isfahan fertility and Infertility Center.Spermatozoa were diluted in PBS and isolated from semen samples by centrifugation (200 g for 10 minutes). The washing procedure ensured a reliable separation of spermatozoa from seminal plasma. Peripheral blood was collected into heparinized tubes and peripheral blood mononuclear cells (PBMCs) were isolated using a density gradient  according to the manufacturer's recommendations. PBMCs were washed twice with PBS and used as positive controls for leptin receptor expression.Total RNA was extracted from sperm or PBMCs with RNXplus . Total RNA 1 ug) was reverse-transcribed and first-strand complementary DNA (cDNA) was synthesized using commercial kits  according to the manufacturers' protocols. Polymerase chain reaction was performed with 2 microlitre of cDNA preparation, using specific primers that were previously published and checked on the basis of gene sequences identified with the BLAST search for Ob-Rb , HspA2 , F-18 goat anti-human OB-R antibody , or 9F8 mouse monoclonal anti-human OB-R antibody  and incubated on ice for 2 hours. Samples were washed twice with PBS and incubated with the appropriate secondary antibody conjugated with FITC (Fluorescein isothiocyanate) and incubated on ice for 1 hour in the dark. Cells were washed twice, transferred to slides, and examined immediately with a fluorescence microscope .To assess leptin receptor expression in sperm and PBMCs, 10Sperm cells (5-10 million/ml) were incubated with 1% BSA in PBS for 30 minutes at room temperature and either 1 microlitre of primary antibody  or isotype-matched control antibody  was added to the cells and incubated for 1 hour on ice. Cells were washed twice with PBS containing 1% BSA, then incubated with 1 microlitre of biotinylated goat anti-mouse IgG antibody . Cells were washed twice and incubated with 1 microlitre of Streptavidin-R-PE  for 1 hour on ice in the dark. Finally, cells were washed twice before analyzing by flow cytometry on a FACS Calibur  flow cytometer.Western blot analysis was carried out according to Nasrabadi and Henkel et al. ,30. BrieSemen samples were collected from 50 individuals with only male factor infertility and 22 normal healthy males who were referred to the Isfahan Fertility and Infertility Center. In this study, out of 50 patients, 24%, 36% and 40% were grouped into oligoasthenoteratozoospermic, asthenoteratozoospermic, and teratozoospermia categories, according to WHO criteria, respectively . DensityRT-PCR revealed the absence long isoform of Leptin receptor expression in 20 out of 23 infertile individuals and a weak expression in 1 out of 10 fertile individuals Figure .HspA2 expression, as a marker of testis specific marker and marker of sperm maturity, was also assessed. Figure The hormonal link between fundamental function such as food intake and energy homeostasis with energy storage is believed to be mediated by leptin, and has been shown to play an important role in fertility in both male and female mice. These tasks are carried out by leptin-leptin receptor interactions in target tissues ,8. LeptiIshikawa has reported that in humans, leptin receptor have been shown to be present in testicular tissue and confined only to Leydig cells and are not expressed by Sertoli cells, germ cells and spermatozoa . In addiThe results of this study showed that leptin receptor was detectable on the surface of human PBMCs as reported before , but werThe leptin receptor (ObR) is a type I cytokine receptor family protein that has a significant amino acid sequence identity with gp130, GM-CSF receptor, and the LIF receptor. Therefore, since different polyclonal antibodies are used in these studies, the difference could be due to the lack of antibody specificity. Indeed, literature studies have revealed that when sperm are stained with antibodies against gp130 and GM-CSF, not only is the tail of the sperm stained, but the sizes of these molecules are within the leptin receptor range, which is 120-150 KD ,36. In aThe results of this study suggest that the long leptin receptor isoform is undetectable in human spermatozoa, however, further studies is required to resolve contradiction regarding presence, position and function of Leptin receptor in human sperm. Species differences have been suggested to be related on diverse reproductive physiology and it is depend on metabolic requirements.The authors declare that they have no competing interests.MHNE conceived and designed the study, interpreted the results performed the statistical analysis and drafted the manuscript. SHR Participated in designing the study. HZE carried out the flow cytometry and helped in drafting the manuscript. LHB and MT processed the samples and carried out the immunohistochemistry analysis. LHB, KGH, ST, and FR participated in RNA isolation, mRNA analysis and Western blot. MT interpreted the results, and commented on the draft manuscript. MRD processed the samples, and collaborated in collected samples and counseling the patient and obtaining the consent form. All authors have read and approved the final manuscript."}
+{"text": "Since its cloning in 1994, leptin has emerged in the literature as a pleiotropic hormone whose actions extend from immune system homeostasis to reproduction and angiogenesis. Recent investigations have identified the lung as a leptin responsive and producing organ, while extensive research has been published concerning the role of leptin in the respiratory system. Animal studies have provided evidence indicating that leptin is a stimulant of ventilation, whereas researchers have proposed an important role for leptin in lung maturation and development. Studies further suggest a significant impact of leptin on specific respiratory diseases, including obstructive sleep apnoea-hypopnoea syndrome, asthma, COPD and lung cancer. However, as new investigations are under way, the picture is becoming more complex. The scope of this review is to decode the existing data concerning the actions of leptin in the lung and provide a detailed description of leptin's involvement in the most common disorders of the respiratory system. In the past years, a growing number of studies have examined the potential role of leptin in the respiratory system. Accumulative data have identified foetal and adult lung tissue as leptin responsive and producing organs, while leptin's involvement in pulmonary homeostasis has become increasingly evident Table . On the ob gene which in humans is located on chromosome 7 [ob gene is expressed in foetal lung tissue in baboons [Leptin, a 16KDa protein of 167 amino acids, represents the product of the mosome 7 . Howevermosome 7 , gastricmosome 7 , and panmosome 7 . Regardi baboons ,9.ob gene expression [ob promoter is induced by several transcription factors, such as hypoxia inducible factor-1 (HIF-1) [Accumulated evidence suggest that leptin production is mainly regulated by food intake; fasting reduces leptin levels while food consumption is associated with a transient increase in pression . Howeverpression . Leptin pression , in accopression , interlepression . In contpression . Moreove (HIF-1) , and sup (HIF-1) . Leptin  (HIF-1)  in agree (HIF-1) . Finally (HIF-1) .ob/ob mice have a single base pair mutation in the leptin gene that results in the absence of functional leptin, increased body weight, hyperphagia, impaired energy homeostasis, and low resting metabolic rate. Exogenous administration of leptin reverses this phenotype [The discovery of leptin was considered synonymous to the discovery of the antidote to obesity. henotype . Additiohenotype . Howeverhenotype . Centralhenotype  and/or dhenotype .+ T lymphocyte proliferation and macrophage phagocytosis [Beyond its metabolic functions, leptin is implicated in various other physiologic processes, including the immune response, with effects in both innate and adaptive immunity. Indeed, leptin up-regulates the expression of several pro-inflammatory cytokines, such as TNF-\u03b1, IL-6, and IL-12, while it increases chemotaxis and natural killer cells function ,25. Leptocytosis . Moreoveocytosis .The pleiotropy of leptin is reflected by the multiplicity of its biologic effects in other tissues. Leptin increases sympathetic nervous system (SNS) activity ,28, withdb gene) gives rise to six receptor isoforms that share a common extracellular and transmembrane domain, and a variable intracellular residue, characteristic for each type. The isoforms are classified according to the length of their cytoplasmic domain to four short  and one long form (Ob-Rb), while a soluble form (Ob-Re) also exists [The leptin receptor (Ob-R) is a member of the class I cytokine receptor super-family, which includes the receptors of IL-1, IL-2, IL-6 and growth hormone . Alternao exists . The lono exists . The shoo exists ,40.db gene is expressed in lung tissue; studies in several animal models, including mice, rats, baboons and other animals, have identified Ob-R presence in the lung , present even before the onset of obesity, when compared to wild-type mice [ob/ob mice, thus it is difficult to determine whether the attenuation of the respiratory complications is caused by mechanical factors or by a direct effect of leptin on lung growth and respiration [Studies in animal models have provided evidence indicating that leptin serves as a stimulant of ventilation. ype mice -57. The ype mice . Chronicype mice . To strepiration . Howeverpiration . Importapiration .ob/ob model represents a model of obesity and systemic inflammation rather than a simple model of leptin deficiency with substantial diversities from human obesity that is associated with hyperleptinemia and central leptin resistance [At this point it should be mentioned that the sistance . While csistance , heart fsistance  and is nsistance ) the patOver the past years, extensive research has been conducted concerning the impact of leptin on various respiratory disorders. Mounting evidence have been published, as the picture is becoming more complex. The scope of this review is to decode the existing data and provide a detailed description of the involvement of leptin in the most common disease entities associated with the respiratory system.2) and sleep disordered breathing, have concurrent OSAHS (i.e. apnoea-hypopnoea index (AHI) > 5) [OSAHS is a common disorder characterized by repeated episodes of partial or complete upper airway obstruction during sleep . ApproxiHI) > 5) , while 1HI) > 5) .Obesity is considered to be the most important risk factor of OSAHS . The impIn the light of these data, researchers have hypothesized that OSAHS is a leptin-resistant state, and that a relative deficiency in CNS leptin levels, due to an impaired transport across the blood-brain barrier, may induce hypoventilation, therefore contribute to the genesis of the syndrome -77. UnfoA subject of ongoing controversy is whether the presence of hyperleptinemia in OSAHS derives from adiposity or it reflects causality due to the effects of sleep-disordered breathing. Leptin levels are 50% higher in OSAHS patients than in controls, suggesting that other factors besides obesity contribute to the elevation of leptin . In consTo make matters more complicated, studies have documented significantly higher leptin levels in non-obese OSAHS patients versus controls ,86. DataAdditional studies examining the effects of nasal continuous positive airway pressure (nCPAP) treatment were designed to elucidate the exact association of leptin with OSAHS. Leptin levels decrease significantly in OSAHS patients, treated with nCPAP for a period of 3 days to 6 months, without any significant change in BMI observed ,83,87-892 retention and depressed HCVR [Few studies in the literature have examined the possible implication of leptin in OHS. As argued earlier, leptin deficient mice exhibit similar to OHS features, i.e. COsed HCVR . In obessed HCVR , while csed HCVR ,96. Leptsed HCVR . Additiosed HCVR . Howeversed HCVR  enrolledsed HCVR .COPD is a disease state characterized by airflow limitation that is not fully reversible, usually progressive, and associated with an abnormal inflammatory response of the lung to noxious particles or gases . ResearcStudies in the literature have examined the hypothesis that underlying abnormalities in the leptin feedback mechanism might be involved in the impaired energy balance responsible for the cachexic status and muscle wasting commonly seen in COPD . HoweverResearchers have investigated the possible involvement of leptin during the acute exacerbations of COPD. Malnourished patients experiencing exacerbation, exhibit significantly higher leptin levels, compared to normal-weight stable COPD patients, an observation not replicated when compared to malnourished stable COPD patients . Similarb m-RNA, suggesting that smoking itself may increase the expression of the leptin/leptin receptor system in lung tissue [The airflow limitation in COPD is linked to structural changes, including the presence of an abnormal inflammatory pattern detected in each lung compartment . AKR/J mg tissue . Howeverg tissue , while ig tissue . Additiog tissue . The divg tissue .+) and to the absence of apoptotic T cells [b in lung epithelium and inflammatory cells combined with the fact that the lung is a source of leptin, suggests the existence of a paracrine cross-talk between resident pulmonary epithelial cells and immune cells in response to noxious particles [Accumulated evidence suggest that leptin may be involved in the local inflammatory response seen in the airways of COPD patients, hypothetically regulating the infiltration and the survival of inflammatory cells in the submucosa of COPD patients . Interes T cells . In addi T cells . Importaarticles . This hy1 decline [Recently, researchers have reported that COPD patients carrying minor alleles of polymorphisms in the Ob-R gene are less susceptible to loss of lung function, as indicated by %FEV decline . AlthougAsthma represents a chronic inflammatory disorder of the airways associated with airway hyper-responsiveness that leads to recurrent episodes of widespread, and often reversible, airflow obstruction within the lung . Obesityob/ob mice exhibit significantly elevated pulmonary resistance (RL) and responsiveness to metacholine in baseline conditions, while ozone (O3) exposure results in greater increase in these two parameters, associated with an enhanced expression of bronchoalveolar alveolar lavage fluid (BALF) protein, eotaxin, and IL-6 when compared to lean controls [L and airway responsiveness following O3 exposure, as compared to fed mice [3. Exogenous leptin administration in wild-type mice results in increased O3-induced cytokine and protein release into BALF [ob murine model, db/db mice  and carboxypeptidase E-deficient (CPEfat) mice  present increased baseline airway responsiveness, as well as augmented responses to O3 exposure, when compared to their lean controls [3-induced pulmonary inflammation, similar to that observed in genetically obese mice [3 exposure, but other effects of obesity may also play an important role [fat mice and mice with diet induced obesity (i.e. mice with reduced and mice with increased leptin concentrations) it seems unlikely that the adipokine can act as an intermediary in the causal pathway [controls . Acute lfed mice . The resnto BALF . Similarcontrols ,120. In ese mice . Collectant role . Since i pathway .Clinical studies provide confounding evidence to the mouse-model observation regarding the role of leptin in asthma. Overweight asthmatic children present twice as high leptin levels as those without asthma, despite no differences in BMI . Similar3-induced airway inflammation [Increasing evidence suggest that the pro-inflammatory effects of leptin may contribute to the higher incidence of asthma in the obese population. As discussed previously, administration of leptin to wild-type mice enhances Oammation , while oammation . Additioammation . Adminisammation . Howeverammation  it is coammation ,126,128.Over the past few years, researchers have hypothesized that decreased immunological tolerance, as a consequence of immunological changes induced by adipokines, may be implicated in the pathogenesis of allergic asthma . As arguAdditionally, studies have raised the issue whether leptin may play an important role on asthma pathophysiology through its ability to activate SNS. Leptin increases the activity of the adrenal medulla and sympathetic nerves in various organs, although its impact on the sympathetic nerves of the lung is unknown ,133. On Increased BMI is significantly associated with higher death rates due to cancer , and it A functional polymorphism in the promoter region of leptin gene is associated with a threefold increased risk of developing non-small cell lung cancer (NSCLC) . The ovedb/db mice demonstrate significantly lower cell proliferation versus those of their lean litternates, while administration of leptin significantly increased cell proliferative ability in lean mice, but not in db/db mice [ob/ob and db/db mice present a remarkably increased number of metastatic colonies when compared to wild-type mice [ob/ob mice abolished the increase in metastasis, indicating a rather prophylactic role of leptin. However, when cancer cells were inoculated orthotopically, through a chest incision, tumor growth at the implanted site was comparable among the groups.In accordance with the previous studies, primary cultures of tracheal epithelial cells of /db mice . Leptin ype mice . AdminisStudies have led to the hypothesis that leptin contributes in cancer development, at least in part, through its up-regulatory role in the inflammatory system . Leptin vs. controls [A number of studies have examined the possible role of leptin in the pathogenesis of cancer-related weight loss. In consistency with earlier studies -145, Karcontrols . PatientKlebsiella pneumoniae [ob/ob mice exhibit increased susceptibility and enhanced lethality following K. pneumoniae administration, as compared to wild-type mice, associated with impaired macrophage and neutrophil phagocytosis of the microorganism, and reduced macrophage leukotriene synthesis in vitro [Recently, several reports have identified a role for leptin in regulating immune function ,25 whileeumoniae . Additioin vitro ,151.b/ob mice display reduced survival following intra-tracheal challenge with Streptococcus pneumoniae [ob/ob mice in vivo improved pulmonary bacterial clearance and survival [4 (LTB4) synthesis and phagocytosis, and killing of S. pneumoniae in vitro [ob/ob or wild-type mice [Concerning the impact of chronic leptin deficiency on gram-positive pneumonia, oeumoniae . This imsurvival . Furtherin vitro . Leptin ype mice .vs. controls. One of the most remarkable ascertainments of this study was the observation that leptin lacked independent prognostic value, since it was displaced by nutritional status on multiple logistic regression analysis, suggesting that leptin cannot act as an inflammatory reactant, but as a nutritional marker. Collectively, the few data that are present in the literature need further validation before any definite conclusions can be made.To gain a more comprehensive understanding concerning the role of leptin in human lung infections, Diez et al , compareObesity is associated with lower risk of pulmonary TB . Thin suEvidence in the literature demonstrates the presence of lower pleural fluid leptin levels in tuberculous pleural effusions when compared to other exudates ,165. PleMycobacterium tuberculosis, most likely by mediating an effective interferon-\u03b3 driven Th1 response, adequate lymphocyte trafficking and granuloma formation [ob/ob mice intra-nasally infected with live virulent M. tuberculosis display a transiently reduced host defense that is partially restored after leptin replacement [Mycobacterium asbcessus, when compared to wild-type controls [Data from animal models suggest that leptin plays a role in the early immune response to pulmonary infection with ormation . ob/ob mlacement . Additiocontrols . Clearlydb/db mice develop less edema and injury, whereas exhibit lower mortality in response to hyperoxia, when compared to control animals [db/db mice, suggesting that leptin induces ALI-related changes [ob/ob mice exhibit increased resistance to hyperoxia-induced ALI, when compared to control animals, while leptin or anti-leptin antibody administration to wild-type mice has no effect on the course of the hyperoxic injury [Most of our knowledge regarding the role of leptin in ALI results from experimental animal models studies. The few data available are rather controversial and inconclusive. Researchers have demonstrated that  animals . In addi changes . In cont changes . To makec injury . The latc injury . More stTo our knowledge, there are no studies in the literature examining the association of leptin with DPLDs. Investigations should be designed in order to examine the possible role of leptin on DPLDs pathogenesis.ob/ob model) that cannot identically represent the complex biological state of human obesity.The role of leptin in lung physiology and pathophysiology has been studied extensively in the last few years. Undoubtedly, leptin has emerged in the literature as a multifunctional hormone with versatile activities and complex counteractions with other cytokines and adipokines. However, decoding its pulmonary impact is not an easy task, since the role of leptin cannot always be separated from obesity and the biology of adipose tissue. Currently, the effect of leptin signaling in the respiratory system remains controversial, possibly due to the fact that much of the existing knowledge derives from animal models of obesity (e.g. The presence of the functional leptin receptor in the lung recognizes the potential involvement of leptin in the pathogenesis of respiratory disorders, however, whether it represents a friend or a foe is not yet elucidated. Although animal studies provide direct indications that leptin enhances lung maturation and stimulates ventilation, further clinical studies are warranted in order to evaluate its significance in humans. The increased leptin levels observed in OSAHS cannot exclude the possible involvement of leptin in the depressed respiratory response during sleep since studies have not yet examined whether the disease is a leptin-resistant state, like obesity per se. Research data suggest that leptin/leptin receptor system expression and signaling is altered in the airways of patients with asthma and COPD. However, whether it represents an epiphenomenon or a pathogenetic mechanism remains poorly defined, revealing the need for further basic research studies. As for lung cancer, the role of leptin as a growth factor, derived by data examining the effects of leptin in cell lines, requires validation by experimental studies examining its pathophysiological impact on cancer development.The boundary from research to clinical application is far from being crossed, as the current data have not revealed an exact role for leptin in the diagnosis, management or follow-up of patients with diseases of the respiratory system. As new investigations are under way, additional consequences of the action of leptin will emerge, adding more information to the already large body of knowledge and thus provide, possibly unexpected, answers to the questions that remain to be answered to date.The authors declare that they have no competing interests.FM, ZD and AP were involved in the study conception and design. FM performed the acquisition and interpretation of data and prepared the manuscript. ZD and KG were involved in revising the manuscript for important intellectual content. All authors read and approved the final manuscript."}
+{"text": "The functioning of living cells requires efficient and selective transport of materials into and out of the cell, and between different cellular compartments. Much of this transport occurs through nano-scale channels that do not require large scale molecular re-arrangements (such as transition from a \u2018closed\u2019 to an \u2018open\u2019 state) and do not require a direct input of metabolic energy during transport. Nevertheless, these \u2018always open\u2019 channels are highly selective and pass only their cognate molecules, while efficiently excluding all others; indeed, these channels can efficiently transport specific molecules even in the presence of a vast excess of non-specific molecules. Such biological transporters have inspired the creation of artificial nano-channels. These channels can be used as nano-molecular sorters, and can also serve as testbeds for examining modes of biological transport. In this paper, we propose a simple kinetic mechanism that explains how the selectivity of such \u2018always open\u2019 channels can be based on the exclusion of non-specific molecules by specific ones, due to the competition for limited space inside the channel. The predictions of the theory account for the behavior of the nuclear pore complex and of artificial nanopores that mimic its function. This theory provides the basis for future work aimed at understanding the selectivity of various biological transport phenomena. Various channels and transporters shuttle molecules into and out of the cell, as well as between different cell compartments. Such channels have be selective, i.e. to pass only certain molecular species in a given direction, while efficiently blocking the passage of all others. Transport properties of some channels (e.g. ion channels), have been extensively studied. However, the mechanisms of channels that conduct larger molecules, such as the nuclear pore complex, which gates all transport between the cell nucleus and the cytoplasm, are less understood. In particular, it is still not clear how such channels can efficiently transport their specific molecules even in the presence of a vast excess of non-specific molecules that potentially could clog the channel. Understanding how such channels work is also important for technological applications, such as design of artificial nano-filters. In this paper, we propose a mechanism of selectivity of such channels in the presence of vast amounts of background molecular noise. The predictions of the theory account for the behavior of the nuclear pore complex and of artificial nanochannels that mimic its function. The theory provides the basis for future work aimed at understanding the selectivity of transport through various biological and artificial channels. Living cells require the efficient and selective trafficking of molecules through various transport channels per se, but by the rates at which the molecules enter, translocate through, and exit from the transport channel Despite their variety, such natural and artificial transporters appear to share common mechanisms of transport selectivity and efficiency. They commonly include a channel or a passageway, through which molecules translocate by diffusion However, in nature  the selected molecules have to be transported through a channel in a vast background of other molecules, many of which can interact weakly and non-specifically with the transport channel. Thus, transport channels have to be able to constantly select their cognate molecules from such a background. It is still not clear precisely how biological and artificial channels can perform selective transport under such conditions, but any useful theoretical description must take into account this non- specific competition. It is likely that various mechanisms can contribute to selectivity. For instance, in some cases, the selectivity arises from the presense of a physical or energetic barrier for the entrance of non-specific molecules into the channel In this paper we focus on the universal selectivity properties of channels, which do not depend on the specific molecular details pertinent to each specific transporter. We show that highly selective transport is possible in the presence of non-specific competition even when the non-specific molecules are free to interact with and enter into the channel. We study the case of a mixture of two molecular species of different trapping strenghts attempting to traverse the channel. Our model relies on only two essential ingredients: transient trapping of the molecules in the channel and inter-molecular competition for the limited space inside the channel. Analysis of the model reveals a novel kinetic mechanism of the enhancement of transport selectivity through narrow channels, which relies on the sequential exclusion of weakly trapped (low affinity) non-specific molecules from the channel due to competition with strongly trapped (high affinity) cognate molecules that spend a longer time in the channel. Comparison of the theoretical predictions with experimental data shows that the predicted mechanism accounts for the transport selectivity observed in an artificial nano-channel that mimics the NPC. Due to its generality, the proposed mechanism of selectivity is expected to play a role in various biological and artificial nano-channels.We model transport through a narrow channel in the framework of a general kinetic theory n and m) attempt to enter the channel from the left , in the absence of competition, when particles of only one type are present  Here, we show the results for the kinetic landscape shown in n-species, so that J that traverses the channel. The latter is the fraction of those particles that have actually entered the channel on the left that reach the other end. The results are summarized in We first review the selectivity conditions when only one species is present  the ability of a particle to enter the channel in the first place (the entrance site might be temporarily occupied which prevents the entrance of new particles) and 2) the probability of a particle to translocate through the channel, articles  and S3.These results are summarized in The heuristic explanation for this phenomenon is that the particles that are strongly trapped in the channel block translocation through it. If, during the time when the channel is blocked by a strongly trapped particle present somewhere inside, a weakly trapped particle enters the channel, the latter will with a high probability quickly exit the channel on the left side. If, on the other hand, a strongly trapped particle comes in when the passage to the right side is blocked by another such particle, then, with high probability, it will stay in the pore long enough for the particle that blocks it to pass through.The inhibition of transport of the more weakly trapped species persists beyond single file transport, when the channel can accommodate several particles at each site as shown in red lines in titrating the strongly trapped species with weakly trapped competitors, so that the total concentration remains constant . The result is shown in The effect of the presence of the weakly trapped (non-specific) species on the transport of the more strongly trapped (specific) one can also be examined from a different angle. Namely, instead of nt as in  one can The enhancement of transport of the more strongly trapped species by addition of more weakly trapped competitors is somewhat counter-intuitive, as one might expect that increasing the concentration of the non-specific competitors would clog the channel and decrease the flux of the specific particles. In particular, the theory predicts that this enhancement is present only for a certain range of trapping strength of the weakly trapped competitors.The heuristic explanation of this effect is as follows. When the trapping strength of the non-specific competitors is close to that of the specific molecules, they block the entry and interfere with the entrance of the strongly trapped particles. On the other end, the very weakly trapped (or non-trapped) particles essentially do not penetrate the channel, and the flux of the strongly trapped ones is unaffected by their presence. However, in a certain range of intermediate trapping strengths, the non-specific competitors, although mostly filtered out, still penetrate the channel to a certain degree, accumulating near the entrance (see inset in We note that the inhibition of transport of the weakly trapped non-specific particles by competiton with the specific ones persists even when there are more than two particle species (data not shown). Such non-linear mutual effects of the particles of different species on each other might shed light on opimization of transport by co-transport factors, commonly encountered in biology and also suggest the possibility of creation of artificial \u2018nano-valves\u2019 with nonlinear flux rectification properties We note that the effect described here is a very general mechanism of selectivity of transport through narrow channels and is not limited to a particular fortuitous choice of the kinetic rate constants, being observed for various choices of channel kinetic profiles. Analytical results shown in the We now turn to comparison of the theoretical predictions with recent experiments on transport through artificial nano-channels that mimic NPC function et al.Jovanovic-Talisman enhanced by the presence of the non-specific competitors. These effects are described in after the particle has entered the channel. Remarkably, the transport of non-specific particles is inhibited even if their flux greatly exceeds that of the specifically binding particles.In nature, transport channels have to select for their cognate cargoes over a vast background of other species that might interact with the channel non-specifically. How can they maintain selective transport in such conditions? It is likely that many different mechanisms of selectivity may be operational in such channels This selectivity enhancement is a purely kinetic, non-equilibrium mechanism. Notably, it does not require input of metabolic energy Predictions of our theory are in agreement with recent experiments on transport through artificial nano-channels that mimic the nuclear pore complex function The analytical calculations were perfromed by pencil and paper with the help of Mathematica 5.2 package. Simulations were implemented in C language and run on a cluster of opteron processors under UNIX. The simulation code is presented in Text S1Supporting information text and figure captions.(0.33 MB DOC)Click here for additional data file.Figure S1A. Kinetic diagram of a channel consisting of two positions. B. Occupancy representation: transition scheme between nine occupancy states: Kinetic diagram of transport of particles of two different species through a two-site channel. (0.64 MB EPS)Click here for additional data file.Figure S2A. Transport of strongly trapped particles is enhanced by the competition with the faster ones. The dotted line shows the transport efficiency of the strongly trapped species of exit rate B. Transport of the weakly trapped species is inhibited by the competition with the stringly trapped one. The dotted line shows the transport efficiency of the weakly trapped species as a function of their exit rate without competition. The black line shows transport efficiency of the weakly trapped particles as a function of their exit rate C. The probability of a particle of weakly trapped species to translocate through the channel is diminished in the presence of the slower particles. By contrast, the probability of a particle of strioingly trapped species to translocate through the channel is enhanced in the mixture. Dotted line - no competition, black line- 1\u22361 mixture Click here for additional data file.Figure S3A. The blue line shows transport efficiency B. Probability of translocation through the channel of the weakly trapped species C. Probability to enter the channel of the weakly trapped species, D. Efficiency of transport of the strongly trapped species in competition with more weakly trapped one, E. Probability of translocation through the channel of the strongly trapped species, F. Probability of the strongly trapped species to enter the channel, D, E, F, the black line represents 1\u22361 mixture (C and F).Selectivity enhancement in a mixture of two species: long channel. In all panels the exit rate of the strongly trapped species is kept fixed (2.68 MB EPS)Click here for additional data file.Figure S4Sensitivity to the choice of the kinetic profile. Ratios of the transport efficiency of the weakly trapped species to the transport efficiency of the strongly trapped species for the different kinetic profiles shown in the insets to each panel for different values of the exit rate of the strongly trapped species. See text in Section 3 of (2.09 MB EPS)Click here for additional data file.Figure S5A: Transport efficiency of the strongly trapped species as a function of the flux of the weakly trapped species, in the case of addition. B: Ratio of transport efficiencies of the weakly trapped species and the strongly trapped species, relative to the no-competition case, as a function of the total flux of the particles of both species, for the case of titration. The ratio of the concentrations is 1\u22361, Dependence of the selectivity on the concentration. Panel (1.09 MB EPS)Click here for additional data file."}
+{"text": "The authors discuss the implications of a new study in macaques of antiretroviral pre-exposure prophylaxis regimens. The introduction of antiretroviral therapy (ART) in the early 1990s profoundly changed the face of HIV infection by improving survival rates ) or aftePLoS Medicine by Walid Heneine and colleagues [Investigators at the United States Centers for Disease Control and Prevention have conducted a series of studies in rhesus macaques to explore antiretroviral prophylaxis. First, they developed a rectal inoculation model using concentrations of simian HIV (SHIV) representative of human exposure . Using tlleagues  extends In the new study, macaques were exposed to weekly rectal virus challenges for up to 14 weeks. The authors compared infections observed in 18 untreated macaques to infections in macaques that received a variety of antiretroviral PrEP regimens containing the nucleotide reverse transcriptase inhibitor emtricitabine (FTC) alone or in combination with TDF. With subcutaneous FTC alone , four out of six animals became infected. With a combination of oral FTC and TDF at a dose equivalent to Truvada (FTC 200 mg + TDF 300 mg) in humans, two out of six animals became infected. With subcutaneous FTC and a supratherapeutic subcutaneous dose of tenofovir (given either daily or in a two-dose regimen before and after exposure), complete protection from infection was observed .For animals that became infected during treatment, the investigators noted that infection was delayed, and all animals had blunted acute viremia, suggesting the possibility of reduced immune damage during acute HIV infection . ResistaPLoS Medicine:This Perspective discusses the following new study published in Garc\u00eda-Lerma JG, Otten RA, Qari SH, Jackson E, Cong M, et al. (2008) Prevention of rectal SHIV transmission in macaques by daily or intermittent prophylaxis with emtricitabine and tenofovir. PLoS Med 5(2): e28. doi:10.1371/journal.pmed.0050028Using a repeat-exposure macaque model, Walid Heneine and colleagues find that pre-exposure prophylaxis with combination antiretroviral drugs provides protection against rectal challenge with a SHIV virus.These and earlier animal studies have provided the basis for human clinical trials with PrEP. The observation of FTC resistance during therapy emphasizes the risk of PrEP to the individual and the community. PrEP continued in the face of unrecognized infection might be expected to promote replication of a resistant variant, which could be transmitted widely . TenofovThis new report  represenThe study had four weaknesses. First, it included only small numbers of animals. Second, nine out of the 18 controls used were historical in nature. Third, FTC and tenofovir doses chosen as human-equivalent were based on first-dose pharmacokinetics in a limited number of animals, and they represent higher drug exposures than seen in humans . In addThese results highlight an exciting and potentially important use of ART to prevent sexual transmission of HIV , and off"}
+{"text": "Human papilloma virus (HPV), known to be an etiological agent for genital cancers, has been suggested also to be a possible contributory agent for lung cancer. Alternatively, lung cancer, formerly considered to be solely a smoker's disease, may now be more appropriately categorised into never smoker's and smoker's lung cancer. Through this paper we attempt to bring forth the current knowledge regarding mechanisms of HPV gaining access into the lung tissue, various strategies involved in HPV-associated tumorigenesis in lung tissue. The World Health Organization (WHO) states lung cancer to be the most common cause of cancer-related deaths worldwide (1.3 million/year). The most important and common cause of lung cancer is the long-term exposure to tobacco smoke. Nevertheless, the global burden of 15% of men and 53% of women with lung cancer, which is not attributable to tobacco smoking, amounts up to 25% of all lung cancer cases worldwide ..30].One of the most important molecular changes documented in lung cancer progression is activation of dominant oncogenes such as ras family genes. Of various genes in the ras family, k-ras gene is found to have point mutations in codon 12, in most of the lung carcinomas. Also, in 50% of HPV positive lung tumors, k-ras mutation was seen to coexist, constitutively activating the Ras/Raf/Mek pathway . This suThe E6 protein has a well-recognised signature in pathogenesis of HPV-induced cervical and oral cancer. E6 is the major viral protein which can activate two independent pathways to prevent apoptosis-p53-dependent and p53-independent pathway . RelatioKinoshita et al. in 1995 reported expression of E6 mRNA in the HPV 18 DNA-positive lung tumor tissues . In thisThe viral oncoprotein E6 can also promote carcinogenesis by upregulating expression of inhibitors of antiapoptosis proteins (IAPs). Inhibitors of antiapoptosis proteins (IAPs) directly inhibit caspases to block cell apoptosis. HPV E6 upregulates the expression of cIAP2 via epidermal growth factor receptor (EGFR)/phosphatidyl inositol 3-kinase (PI3K)/AKT cascade. CREB, which is a regulatory targeting molecule of AKT, and is phosphorylated via the EGFR/PI3K/AKT pathway, which plays a crucial role in the upregulation of cIAP2 by E6 protein . This upin vitro, and can stimulate its degradation, in vivo. Bak can associate with E6-associated protein in the absence of E6 in contrast to p53, and the subsequent inhibits the Bak-induced apoptosis through this E6-AP-dependent process . Th. Th\u03b1 andactivity . HIF-1 iactivity . EGFR upWould the vaccines such as Gardasil, Cervarix, and so forth, directed towards the cervical cancer ensure protection against HPV-induced lung cancer too? This would be a focal question of interest that needs to be addressed to combat the disease prophylactically. Given that the HPV subtypes infecting and most of the molecular events occurring in the cervical cancer may be extended to HPV-induced lung cancer, these vaccines can presumed to be effective against lung cancer too.in vivo studies [Lung cancer in nonsmokers is molecularly different disease from that seen in the smoker population. Mutation frequency as well as profile of the genes encoding EGFR, p53 and k-ras is conspicuously dissimilar in smoking and nonsmoking groups. Also, the HPV infection paves way to altering the signalling pathways leading to cancer. The fact that EGFR has a crucial role in lung carcinogenesis makes it an admirable target for therapy. Monoclonal antibodies targeted against EGF receptors, small molecule TK inhibitors, and antisense oligonucleotides can reduce the activity of EGFR thereby inactivating the mitogenic signalling pathways like Ras/Raf/Mek and PI3k/Akt/mTor pathway. One such anti-EGFR monoclonal antibody being used is cetuximab, in combination with chemotherapeutic agents such as Carboplatin and Paclitaxel, when provided concurrently or sequentially gave positive results in clinical trials \u201360. Othe studies . CombinaMEK, a mitogenic signalling pathway protein activated as a result of k-ras mutations in HPV infection is another, suitable target for therapy. Ci-1040 difluorobenzamide is a MEK inhibitor which has been clinically tested in NSCLC patients . InhibitFrom the reported studies and suspected crosstalks, we robustly argue EGFR to be a core molecular hub in pathogenesis of HPV-induced lung cancer. It can be presumed that combination therapy targeting EGFR and other molecules having crosstalk with EGFR may be effective in treatment of the disease rather than a single target therapy. It is still not apparent whether HPV is a causal factor of lung cancer or whether it is just an opportunistic pathogen in the lung cancer tissue and the exact molecular mechanisms behind it. Almost all of the signalling pathways having a role in lung cancer are found to be altered or blocked by human papilloma viral proteins initiating tumorigenesis. Further evidence is mandatory to substantiate beyond doubt the causative role of HPV in the lung tissue tumorigenesis. Moreover, the cofactors supplementing the HPV in the transformation processes are yet to be classified. Studies directed towards these targets would give a clearer image of the disease which will eventually pave the way to designing new prophylactic or therapeutic strategies in combating the disease."}
+{"text": "Synaesthesia is a heritable condition in which particular stimuli generate specific and consistent sensory percepts or associations in another modality or processing stream. Functional neuroimaging studies have identified potential correlates of these experiences, including, in some but not all cases, the hyperactivation of visuotemporal areas and of parietal areas thought to be involved in perceptual binding. Structural studies have identified a similarly variable spectrum of differences between synaesthetes and controls. However, it remains unclear the extent to which these neural correlates reflect the synaesthetic experience itself or additional phenotypes associated with the condition. Here, we acquired both structural and functional neuroimaging data comparing thirteen grapheme-color synaesthetes with eleven non-synaesthetes. Using voxel-based morphometry and diffusion tensor imaging, we identify a number of clusters of increased volume of gray matter, of white matter or of increased fractional anisotropy in synaesthetes vs. controls. To assess the possible involvement of these areas in the synaesthetic experience, we used nine areas of increased gray matter volume as regions of interest in an fMRI experiment that characterized the contrast in response to stimuli which induced synaesthesia  vs. those which did not (non-meaningful symbols). Four of these areas showed sensitivity to this contrast in synaesthetes but not controls. Unexpectedly, in two of them, in left lateral occipital cortex and in postcentral gyrus, the letter stimuli produced a strong negative BOLD signal in synaesthetes. An additional whole-brain fMRI analysis identified 14 areas, three of which were driven mainly by a negative BOLD response to letters in synaesthetes. Our findings suggest that cortical deactivations may be involved in the conscious experience of internally generated synaesthetic percepts. Synaesthesia is a heritable condition in which particular stimuli generate specific and consistent sensory percepts or associations in another modality or processing stream Galton, . Many diThough originally defined as a cross-sensory phenomenon, many cases involve cognitive or higher-level conceptual inducers and/or concurrents  and electroencephalography studies have provided some insights into the neural basis of synaesthesia but their findings are quite variable  analysis to identify regions of structural differences between groups of synaesthetes and controls. We then used the clusters of gray matter difference as regions of interest for functional analyses, identifying differential sensitivity to the contrast between letters and non-meaningful characters in synaesthetes compared to controls. In parallel, we conducted a whole-brain functional analysis based on responses to visual stimuli that do or do not induce synaesthetic percepts between synaesthetes and non-synaesthete controls. Surprisingly, several of the functional differences we observe are driven by negative blood oxygen level-dependent (BOLD) response, reflecting unexpected cortical deactivations in this sample of synaesthetes in response to letters.SE = 3.6 and 37.1 years, SE = 4.2, for the synaesthete and non-synaesthete groups, respectively). Synaesthetes were identified by repeated testing for consistency of their letter-color associations over time. The details of the consistency tests used are described in Barnett et al.  = 3.8 ms, Relaxation Time (TR) = 8.4 ms, Field Of View (FOV) = 230 mm, 162 mm, 0.898 \u00d7 0.898 mm2 in-plane resolution, slice thickness 0.9 mm, flip angle \u03b1 = 8\u00b0] were acquired before the first functional imaging, to allow for subsequent activation localization and spatial normalization of fMRI data and for the purpose of Voxel Based Morphometry (VBM) analyses.All scanning was conducted on a Philips Achieva 3.0 T scanner, fitted with an eight channel head coil, equipped with a mirror that reflected the display projected on a 640 \u00d7 480 panel. This panel was placed behind the participant's head, outside the magnet. The mirror was mounted on the head coil in the participant's line of vision. 180 axial high-resolution T1-weighted anatomical Spoiled Gradient Echo (SPGR) images . The ANOVA did not identify any regions with a significant main effect for either group or condition. Four of the nine clusters showed a significant group \u00d7 condition interaction for the letter/non-meaningful characters contrast  identified two clusters where a greater response for the \u201cletter\u201d condition was found in the synaesthete group, namely the left lateral occipital cortex/precuneus and the right post-central/pre-central gyrus. In both clusters the mean activation levels revealed significantly greater negative BOLD response to letters in synaesthetes compared to controls , as well as post-central/pre-central gyrus and cerebellum and FA differences apparent in occipital, but also parietal areas and even in thalamic radiations. Though the overall pattern is fairly consistent, no particular locations emerge as a general finding across all these studies.While the details may vary, the primary picture is quite consistent: synaesthetes strongly tend to show greater gray and white matter volume and greater FA in many regions of the brain. We and others have previously argued that these data provide evidence for a structural difference as the primary cause of synaesthesia Hubbard, . While tper se. Finally, synaesthetes showed widespread differences in global network topology based on cortical thickness correlations , it was negative in sign. This is calculated relative to the baseline activity in the individual voxels of each cluster over the course of the experiment. It is thus not an artifact of averaging across the whole brain. As a control, we examined whole-brain responses to colors and achromatic stimuli to ensure that we could detect an expected positive BOLD response to this contrast in our experiment. We did indeed detect such a signal in the generally expected regions of ventral occipitotemporal cortex  study. Terhune and colleagues found that synaesthetes showed enhanced cortical excitability of primary visual cortex, with a 3-fold lower phosphene detection threshold in response to activation by tCDS (Terhune et al., The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Different protocols have been suggested to treat aluminum phosphide (ALP) poisoning. We aimed to evaluate the possible therapeutic effect of hyperinsulinemia/euglycemia (HIE) in treatment of ALP poisoning.In a prospective interventional study, a total of 88 ALP-poisoned patients were included and assigned into HIE group undergoing glucose/insulin/potassium (GIK) protocol and a control group that was managed by routine conventional treatments. The 2 groups were then compared regarding the signs and symptoms of toxicity and their progression, development of complications, and final outcome to detect the possible effect of GIK protocol on the patients\u2019 course of toxicity and outcome.P\u200a<\u200a0.001) and better outcomes . Regression analysis showed that GIK duration was an independent variable that could prognosticate mortality . The risk of mortality decreased by 4.5% each hour after initiation of GIK.The 2 groups were similar in terms of demographic characteristics and on-arrival vital signs and lab tests. Using GIK protocol resulted in significantly longer hospital stays (24 vs 60 hours; GIK protocol improves the outcome of ALP poisoning and increases the length of hospital stay. ALP poisoning was reported in only 59 cases between 1900 and 1958 with 26 of the poisoned patients dead.,4 This rate has dramatically increased within the recent 35 years due to its significant ingestion to commit suicide. It is one of the most common causes of death due to poisoning in Iran with an increased incidence of fatal ALP poisoning from 5.2 to 37 per million of population in 2006 and 2013 in Tehran.\u20137Annually, almost 300,000 deaths occur worldwide due to pesticide poisoning, probably some of whom die due to aluminum phosphide (ALP) intoxication. ALP was first introduced as a pesticide in India. Animal and human studies showed that high exogenous insulin had strong positive inotropic effects.\u201311 Hyperinsulinemia\u2013euglycemia (HIE)\u2014by administrating glucose, insulin, and potassium (GIK)\u2014assists in myocardial uptake of carbohydrates which are the preferred fuel substrate of the heart under stressed conditions. The putative mechanism is correction of calcium antagonist or beta-blockers-induced hypoinsulinemia, leading to improved cell carbohydrate metabolism, increased myocardial contractility and peripheral vascular resistance, and correction of acidosis. The treatment is not expected to improve conduction block or bradycardia. HIE was first introduced as a possible treatment of ALP poisoning in 2008. Although this treatment was tested on only 5 patients at the time of publication of the preliminary results with it and is currently recommended as a treatment in ALP poisoning, no study has proved its efficacy even retrospectively.ALP poisoning has no specific antidote, and therefore, different modalities have been suggested for its treatment, to date. Patients generally die due to multi-organ failure. From the factors associating with poor prognosis, cardiocirculatory collapse and metabolic acidosis are probably the most important ones that do not respond to conventional therapies.1.1Although mortality of ALP poisoning has been reported to be as high as 90% in some studies, no antidote is available to treat the patients.1.2The aim of the present study is to evaluate the probable therapeutic effect of GIK protocol in treatment of ALP poisoning.22.1A prospective interventional study was conducted using a convenient sampling of all patients with ALP ingestion. Further confirmation of ALP exposure was done by silver nitrate test (SNT) or development of clinical signs and symptoms of toxicity. Participants entered into either the intervention group  or control group . Conventional standard therapy included using inotropes, fluids and electrolytes resuscitation, intubation, mechanical ventilation, and antiarrhythmic agents if indicated.2.2,5Loghman-Hakim Hospital Poison Center is the main referral hospital for poisoned patients in Tehran . Over 24,000 to 27,000 intoxicated patients refer to this center annually, of whom, almost 10,000 to 12,000 are hospitalized. There are almost 230 to 280 ALP suspected cases annually.2.3 the desired 95% level of confidence, the desired\u200a\u00b1\u200a10% precision of the estimate, a sample size of 81 was achieved to study the effect of new intervention in reducing mortality. Forty-four subjects per group were recruited after consideration of dropouts.Considering an average mortality of 70% in aluminum phosphide poisoning,2.4Between 2006 and 2012, sampling was conveniently performed. Whenever the authors were on shift and available at hospital and confirmed ALP poisoning in referred cases, the senior attending physician (first author) visited the patients and entered them into intervention group. There was no gender preference for the allocation. When other attending physicians of the department were on shift, patients were included in the conventional therapy group (control group). Written consent forms were taken from the patients or their next of kin if they were included in the intervention group. All relevant information pack was provided to next of kin and the patients. Patients with a positive history of ALP exposure with either a positive SNT result or a systolic blood pressure (SBP) of <80\u200amm Hg/a serum bicarbonate level of 15\u200ameq/L or less/a pH of 7.2 or less were considered to be ALP-poisoned and included , antiarrhythmic medications, calcium gluconate, magnesium sulfate, bicarbonate, and inotropes. The intervention group was treated on the basis of the suggested protocol for study conduction Fig. , while t2.6Patients\u2019 data including age, sex, on-arrival vital signs and lab tests, minimum systolic and diastolic blood pressures (SBP and DBPs) during the course of treatment until discharge or death, signs and symptoms on admission, treatments given, hospital stay, and the final outcome were recorded and entered into social package for statistical sciences software version 17.2.7Outcome measures were patients\u2019 mortality and their length of stay.2.8t test was used. Mann\u2013Whitney U test was performed to compare differences between 2 independent groups when the dependent variable was continuous, but not normally distributed. For the assessment of association between categorical variables, a chi-square test was applied. Pearson correlation coefficient was used for assessing the severity of association between continuous variables. Logistic model determined independent variables predicting death in these patients. Odds ratio (OR) and 95% confidence interval (CI) were used for expressing the severity of this association. A P value less than 0.05 was considered to be statistically significant.Kolmogorov\u2013Smirnov test was used to determine normal and non-normal distributions of the variables, for whose description, mean (\u00b1SD) and median (interquartile range) were given. For qualitative variables, percent of frequency was provided. To compare normally distributed continuous variables between GIK and conventional standard therapy groups, 3From a total of 153 cases referred with possible ALP ingestion, 67 were excluded due to unavailable or negative SNT results as well as lack of development of clinical manifestations. These cases might have ingested nontoxic tablets or might actually be mild ALP-poisoned whose diagnoses could not be confirmed , hospital stay (24 vs 60 hours), and death (72.7% vs 50%) significantly differed between the 2 groups. Although the patients in the standard conventional group had higher blood pressures and seemed more stable regarding their vital signs, they survived less hours and died more . It should be mentioned that median [IQR] (range) of insulin dose/h, duration of GIK administration, and cumulative dose of insulin were 35  (6\u201394), 15  (2\u2013134), and 525   in the GIK group, respectively. Figure P\u200a<\u200a0.001).When comparing the survivors and nonsurvivors of the 2 groups Table , we founP\u200a<\u200a0.02). Regression analysis showed that GIK duration was an independent variable that could prognosticate mortality ; model significance and Nagelkerke R square of 0.032, 0.610 showed that risk of mortality decreased by 4.5% each hour after initiation of GIK.All 8 patients with bradycardia died , they switch to glucose utilization. Hypoinsulinemia may prevent glucose uptake by myocytes ensuingloss of inotropy and decreased peripheral vascular resistance. This may explain the fact that hyperglycemia is a poor prognostic factor in ALP poisoning as confirmed by our results and shown by previous studies. As tissue perfusion falls, decreased delivery of glucose deprives myocytes of needed fuel. Continuation of this cycle leads to hemodynamic deterioration, shock, and death.,19Use of HIE and GIK protocol was first advocated in treatment of toxicity by beta-blockers and calcium channel blockers (CCB) in clinical toxicology. Engebretsen et al described that efficacy of HIE was due to increased inotropy and increased intracellular glucose transport. They mentioned different high-dose insulin treatment protocols. When first introduced, insulin doses were cautiously initiated at 0.5\u200aIU/kg bolus dose followed by a 0.5 to 1\u200aIU/kg/h continuous infusion. With increasing clinical experience and publication of animal studies, high-dose insulin was recommended. Doses up to 1\u200aIU/kg of bolus insulin followed by doses as high as 1 to 10\u200aIU/kg/h of continuous infusion were even advocated. Although the optimal regimen is still to be determined, bolus doses up to 10\u200aIU/kg and continuous infusions as high as 22\u200aIU/kg/h have been administered with good outcomes and minimal adverse events.The exact mechanism of action of HIE therapy is poorly defined. It improves inotropy and peripheral vascular resistance and reverses acidosis by improving myocyte carbohydrate uptake and utilization. In addition, this therapy may promote the metabolism of lactate and limit metabolic acidosis common in ALP poisoning. showed promising results with this protocol in 5 cases of ALP poisoning. Although this treatment is currently advocated as a routine treatment in ALP-poisoned patients in our center, no study has evaluated its efficacy in these patients.The possible therapeutic effect of GIK protocol on ALP-poisoned patients was first suggested in 2008 when Hassanian-Moghaddam,21 Even in the survivors of both groups, minimum SBP was less in the patients of the GIK group (P\u200a=\u200a0.04). The other interesting findings were the probable protective effect of hyperventilation and tachycardia. The more the patients hyperventilated, the more they survived, and all patients with bradycardia died. These findings emphasize the possible role of hyperventilation in treatment of ALP-poisoned patients; meanwhile, higher PCO2 levels and bradycardia may be used as poor prognostic factors in this toxicity.As the results show, GIK protocol can significantly increase the hospital stay and improve the final outcome of the patient. Insulin\u2014as a vasodilator\u2014may also explain the difference of minimal SBP between the groups. Other clinically relevant indices such as frequency or duration of mechanical ventilation and time or total dose of vasoactive support were not evaluated, either. Prospective randomized controlled trials are warranted to evaluate the efficacy of this treatment, although it seems that depriving the patients from this treatment seems unethical.Type of patient selection (nonblinded randomization) is definitely a limitation of the present study. We only entered the patients who referred during our own shifts when we could be available for at least the first hours of initiation of GIK protocol. The nature of shock was not well established as the patients were not investigated by echocardiography or Swan Ganz catheter or even lactometer. Also, we did not document the possible complications of our treatments especially insulin. Exclusion of early deaths (those within the first 2 hours after admission) is definitely another limitation of our study which was inevitable because GIK sometimes takes several hours to affect.Other advanced novel techniques like extracorporeal life support may save the patients and GIK protocol may increase its success rate.5Insulin probably improves inotropy by altering cell metabolism from fatty acids to carbohydrates and restoring calcium flux resulting in improvement of cardiac contractility. In ALP poisoning, GIK protocol stabilizes cardiovascular system, increases hospital stay, and improves the survival rate."}
+{"text": "Verticillium wilt (VW) of alfalfa is a soilborne disease causing severe yield loss in alfalfa. To identify molecular markers associated with VW resistance, we used an integrated framework of genome-wide association study (GWAS) with high-throughput genotyping by sequencing (GBS) to identify loci associated with VW resistance in an F1 full-sib alfalfa population. Phenotyping was performed using manual inoculation of the pathogen to cloned plants of each individual and disease severity was scored using a standard scale. Genotyping was done by GBS, followed by genotype calling using three bioinformatics pipelines including the TASSEL-GBS pipeline (TASSEL), the Universal Network Enabled Analysis Kit (UNEAK), and the haplotype-based FreeBayes pipeline (FreeBayes). The resulting numbers of SNPs, marker density, minor allele frequency (MAF) and heterozygosity were compared among the pipelines. The TASSEL pipeline generated more markers with the highest density and MAF, whereas the highest heterozygosity was obtained by the UNEAK pipeline. The FreeBayes pipeline generated tetraploid genotypes, with the least number of markers. SNP markers generated from each pipeline were used independently for marker-trait association. Markers significantly associated with VW resistance identified by each pipeline were compared. Similar marker loci were found on chromosomes 5, 6, and 7, whereas different loci on chromosome 1, 2, 3, and 4 were identified by different pipelines. Most significant markers were located on chromosome 6 and they were identified by all three pipelines. Of those identified, several loci were linked to known genes whose functions are involved in the plants\u2019 resistance to pathogens. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms of VW resistance in alfalfa. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to the disease. Verticillium alfalfae . It causes severe forage yield loss in US and Canada (Verticillium wilt (VW) is a soil-borne disease caused by the fungal pathogen d Canada . The disd Canada . Methodsd Canada . Howeverd Canada . It has d Canada .Efforts toward the goal of developing alfalfa cultivars resistant to VW have been made using a traditional breeding strategy . HoweverQuantitative traits such as biotic and abiotic stress resistance are most likely under the control of multiple genes and interact with environmental factors. Identification of resistance loci that contribute to variation in such complex traits is a primary challenge in plant breeding and population genetics. An integrated framework that merges a QTL mapping approach called a \u201cgenome-wide association study (GWAS)\u201d with high-throughput genome sequencing methodologies called \u201cgenotyping by sequencing (GBS)\u201d provide a statistical basis for analyzing marker-trait association using linkage disequilibrium, and help to map traits quickly, efficiently, and in a relatively inexpensive manner. GBS generates large raw datasets of sequence reads and requires bioinformatics pipelines to analyze and interpret the GBS datasets. Current GBS pipelines such as TASSEL-GBS (TASSEL)  and the Cultivated alfalfa is an allogamous autotetraploid (2n = 4x = 32) with a basic chromosome number of eight and a genome size of 800\u20131000 Mbp . Alfalfa1 progeny was developed from a cross between the parental plants of 55V50-58 (resistant) \u00d7 55V50-118 (susceptible) at S & W Seeds. The two parents and the F1 progeny were propagated by stem cuttings. Three clones from each individual were evaluated for resistance to VW by the standard assay of the North American Alfalfa Improvement Conference1 as described previously by An alfalfa population containing 188 Ft-tests to evaluate the equality of variance and means (Table 1). Based on the assumption of equal variance, a test for normality was performed on the obtained disease severity scores of the population with the Kolmogorov\u2013Smirnov tests (Table 1) using the SPSS software2. Least square means were estimated from 3 replicated disease severity scores using the SAS PROC mixed  and used for association mapping.The disease severity scores of three replicated clones were obtained for each individual and analyzed using Levene\u2019s and High molecular weight DNA was extracted from leaves of the original plants used to make clones using the Qiagen DNeasy 96 Plant kit, following the manufacturer\u2019s protocol . Genotyping-by-sequencing was carried out as described by M. truncatula , while no reference sequence was used in the UNEAK pipeline. The working flows of the pipelines are outlined in Figure 1. For the FreeBayes pipeline , GBS raw sequence reads were quality checked using FastQC (v0.11.2), followed by demultiplexing with STACKS (v 1.23) (M. truncatula using the Burrows\u2013Wheeler Aligner (BWA) (3) were then used to mark duplicate reads and estimate the average insert size of the single-end reads. The read-depth and coverage data was processed with the Genome Analysis Toolkit (GATK)  pipeline, and the Universal Network-Enabled Analysis Kit (UNEAK) pipeline, were used for SNP/variant discovery. The FreeBayes and TASSEL pipelines used the reference genomic sequences of (v 1.23) . Clean rer (BWA) . SAMtooler (BWA)  and Picat (GATK) , and in-t (GATK) . Sequenct (GATK)  after re5 was used to call SNPs . Tag counts were generated from FastQ files with the FastqToTagCountPlugin. The tag counts were merged with the MergeMultipleTagCountPlugin, the minimum number of five times presence for a tag was required for output. Tags were then aligned to the reference genome of M. truncatula using BWA. Tags were converted to FastQ with the TagCountToFastqPlugin. Counts of tags per individual (taxa) were generated with the FastqToTBTPlugin. Counts of tags per individual were merged with the MergeTagsByTaxaFilesPlugin. SNPs were called using the TagsToSNPByAlignmentPlugin. Duplicate sites were merged with the MergeDuplicateSNPsPlugin and then with the MergeDuplicateSNP_vcf_Plugin followed by the tbt2vcfPlugin. Finally, a filtered HapMap containing GBS SNPs was formatted with the GBSHapMapFiltersPlugin . The minimums of site coverage of 0.8, taxa coverage of 0.1 and MAF of 0.01 were applied in the filter.For the TASSEL-GBS pipeline, a TASSEL_Plugin interface with default parametersFigure 1, right panel). The same parameters used in TASSEL-GBS were used for UNEAK except that an error tolerance rate of 0.03 was used in the network filter and a distance of 1,000 was used for padding tag pairs.For the UNEAK pipeline, a network approach was used for discovering SNPs without a reference genome as described by The GBS data have been submitted to the NCBI Sequence Read Archive with the BioProject ID: PRJNA343543.To estimate effects of genotype and its interaction with environment, we used least square means of replicated disease scores to evaluate associations. A mixed linear model (MLM) was used for analyzing marker-trait association using TASSEL . Each se6) and Phytozome against the Medicago truncatula genome sequence, Mt4.0 v17. Known genes linked to the significant loci were assigned as putative candidates based on the annotation of gene functions.Flanking sequences of significant markers  was less than 0.001 (Table 1). The t-test for equality was significant (p < 0.05). A normal distribution with a mean of 2.75 and a standard error of 0.08 was observed .For phenotyping VW resistance, the foliar symptoms of individual plants were evaluated after pathogen inoculation in the greenhouse and scored for VW resistance. Resistance scores of 3 replications were analyzed for the 190 individuals . The Figure 2, Supplementary Table Table 2). The average minor allele frequency (MAF) was 0.11 . The average heterozygosity was 0.19  with 0.5% SNPs having heterozygosity \u2265 0.5 (Table 2).The FreeBayes pipeline generated 10,403 valid variants after filtering . The averages of MAF and heterozygosity were 0.32  and 0.43 , respectively, and 35% SNPs with heterozygosity \u2265 0.5 (Table 2).The TASSEL pipeline generated 24,176 valid variants . The average of MAF was 0.22 . The average heterozygosity was 0.39 , and 28% SNPs with heterozygosity \u2265 0.5 (Table 2).The UNEAK pipeline generated 14,415 valid variants with site depth of 3.5 and 0.5 missing value . BLAST search of the flanking sequences of the markers against M. truncatula pseudomolecule Mt4.0 v18 revealed that they were located on three chromosomes (Table 3). Among them, eight markers were located on chromosome 6, four on chromosome 1 and one on chromosome 7. The p-values ranged from 7.0E-6 to 8.0E-10 with R2 values of 0.12 \u2013 0.20. The most significant marker was S7_17986403 with p = 8.0E-10 and R2 of 0.20 (Table 3).Using the criteria mentioned in Section \u201cMaterials and Methods,\u201d we have identified 13 GBS markers from the FreeBayes pipeline significantly associated with VW resistance . Among them, 19 were located on 4 chromosomes  and the rest were of unknown location (\u201cU\u201d in Table 4). Of those with a chromosomal location, 13 were on chromosome 6, 3 on chromosome 5, 2 on chromosome 4 and one on chromosome 2. The most significant markers were S6_6801965 and S189473_1178 with p-values of 2.9E-9 and 4.6E-9, respectively (Table 4) and both markers were located on chromosome 6.Twenty-two markers were identified by the TASSEL pipeline . Among them, 16 were located on 4 chromosomes. The location of the reminding 5 markers was unknown (\u201cU\u201d in Table 3).Twenty-one markers were identified by the UNEAK pipeline (Table 5). The most significant markers were S5_59951052 (p = 1.77E-9), S6_162766039 (p = 2.12E-8), S6_31221028 (p = 5.01E-8) and S6_96132030 (p = 9.50E-8). The former was located on chromosome 5 and the later three were on chromosome 6 (Table 5).Of those with known location, 10 markers were on chromosome 6, 3 on chromosome 5, 2 on chromosome 7 and one on chromosome 3 (M. truncatula genome (Table 3). Among them, three markers  located at the same locus on chromosome 1 linked to the same gene, E3 ubiquitin-protein ligase (E3_Ubl). Two markers (S6_10615509 and S6_10615526) at the same locus on chromosome 6 linked to the DNA primase (DNA_P), an enzyme involved in the replication of DNA. On the same chromosome, markers contig_100652_1157 and contig_59661_3280 linked to the ankyrin repeat RF-like protein (ARRF) and Tic22 family protein (Tic22), respectively. Three additional markers  at the same locus linked to the CAP160 repeat protein (CAP160).To identify potential candidate genes linked to marker loci associated with VW resistance, a BLAST search was performed as described in Section \u201cMaterials and Methods.\u201d Of significant markers identified by the FreeBayes pipeline, 10 linked to 5 known genes in the Table 4), two markers (S5_10492250 and S5_10492298) at the same locus on chromosome 5 linked to a leucine-rich repeat receptor kinase (LRR). On the same chromosome, marker S5_25672447 linked to a pumilio-family RNA-binding repeat protein (PRBRP). A number of known genes were linked to significant markers on chromosome 6. A transmembrane amino acid transporter protein (TMTP) linked to marker S6_6801965. A MAP kinase (MAP) was linked to two markers (S6_30922451 and S6_39022471) located at the same locus. Additional markers  were initially with unknown chromosome position but reassigned to chromosome 6 by BLAST search using their flanking sequences against the updated version of M. truncatula genome (Mt4.0 v1), including Contig_17722_2270 linked to the transcription factor IIF beta subunit (TFIIF), Contig_117822_726 linked to AP2 transcription factor (AP2), Contig_189473_1178 linked to a transmembrane protein (TMP), Contig_158631_4246 linked to a RNA-binding protein (RNABP), Contig_110756_995 linked to the vacuolar iron transporter-like protein (VITP), and Contig_2313381_25389 linked to the chromosome condensation regulator RCC1 repeat protein (RCC1). Interestingly, two genes, ARRF and CAP160 linked to Contig_1100652_1157 and Contig_173909_2230 respectively, were also identified by the FreeByes pipeline.Of significant markers identified by the TASSEL pipeline (Table 5), five were linked to the same genes  identified by the TASSEL, and two (Tic22 and ARRF) identified by the FreeByes pipelines. Additional markers were only identified by the UNEAK pipeline, including S5_114680024 and S5_59951052 on chromosome 5 linked to pentatricopeptide repeat (PPR) and neutral amino acid transporter proteins (NAATP), respectively, S6_19276039 on chromosome 6 linked to transmembrane amino acid transporter protein (TMAATP), and S6_96132030 and S6_39177057 linked to unusual kinase (UK) and DUF1442 family protein (DUF1442), respectively. Interestingly, a disease resistance gene, drug resistance transporter-like ABC domain protein (ABC_TP) was linked to S7_131660043 on chromosome 7. Among markers with unknown chromosomal position, two markers, S0_126618054 and S0_32496031 were linked to 45S ribosomal RNA intergenic spacer (45S) and trehalose-6-phosphate synthase (TPS), respectively.Among significant markers identified by the UNEAK pipeline  and only13 markers significantly associated with VW resistance were identified by the FreeBayes pipeline (Table 3). The TASSEL pipeline generated the most variants and identified 22 significant SNP markers associated with VW resistance (Table 4). The number of significant markers (21 SNPs) identified by the UNEAK was comparable (Table 5) to that of the TASSEL pipeline. This may due to the relatively higher coverages were obtained by TASSEL (11.7X) and UNEAK (5.2X) than that by the FreeBayes pipeline (1.4X) (Table 3). Nevertheless, each pipeline identified major resistance loci to VW on chromosome 6, suggesting a consistency of effectiveness among the three pipelines used in the present study in the identification of VW resistance.Among the three pipelines used for genotype calling in the present study, TASSEL and UNEAK were based on single SNPs while the FreeBayes was a haplotype-based pipeline. Both TASSEL and FreeBayes used rameters . Thereforameters  and in arameters . In the M. truncatula provides a useful database for searching for candidate genes underlying the marker loci associated with VW resistance in alfalfa as they are close relatives. Our BLAST search results showed that 29 functional genes are linked to 36 markers identified by the three pipelines in the present study. Most of significant markers were located on chromosome 6 where shared linked genes were identified by at least two pipelines used in the present study. One of them was the ankyrin repeat protein, ARRF that was identified by all pipelines  to a broad spectrum of pathogens. Defective mutants fail to respond to SAR-inducing treatments, inhibiting the expression of pathogenesis-related (PR) genes and exhibiting increased susceptibility to pathogen infections  with the same location (48 bases away) on chromosome 5 were linked to a member of the TIR-NBS-LRR gene family. The NBS-LRR gene family has been well-documented and can be divided into two subfamilies, TIR-NBS-LRR and non-TIR-NBS-LRR . The plaa plants . The ideWe identified an ABC transporter linked to the significant marker, S7_131660043 on chromosome 7 in the present analysis. The ABC transporters are known to participate in many processes including polar auxin transport, alkaloid import, tissue pigmentation, vacuolar xenobiotic sequestration, stomatal regulation, disease resistance, lipid catabolism, antibiotic resistance, assembly of redox-active cytosolic Fe/S proteins, and heavy metal tolerance . One of The genetic basis of alfalfa resistance to VW has been investigated by several research groups. M. truncatula. They include a major QTL on chromosome 7, and two minor QTLs on chromosomes 2 and 6 (M. sativa and M. truncatula. However, additional resistance loci to VW have been identified in M. sativa by both our previous (M. truncatula. For instance, several VW resistance loci were identified on chromosomes 5 and 8 by our previous (M. truncatula.QTLs for VW resistance have been reported in  2 and 6 . In our  2 and 6 . Our rec 2 and 6 . In the previous  and the previous  and the M. truncatula genome revealed multiple resistance loci, several of which are linked to known resistance genes. The putative resistance loci thus identified had similar chromosomal locations to those previously reported in tetraploid alfalfa (M. truncatula (We used three GBS pipelines for SNP discovery and identification of marker loci associated with VW resistance in the F1 alfalfa population using genotyping-by-sequencing and genome-wide association approaches. This is the first effort to compare the effect of pipelines on SNP discovery in alfalfa. Although different markers were identified by different pipelines, most significant resistance loci located on chromosome 6 have been identified by all pipelines, confirming the consistency of SNP discovery and marker identification by GBS pipelines used in the present study. Sequence alignment to the  alfalfa  and in iuncatula . With fuConceived and designed the experiments: L-XY. Performed the experiments: SB, X-PL. Analyzed the data: PZ and DM. Wrote the paper: L-XY and PZ.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Gracilaria salicornia was originally described as being from Manila, the Philippines, and is distributed throughout Asia and the Indian Ocean. To more accurately define this species and its genetic diversity owing to the confusion of identification historically, DNA barcoding using the 5\u2019 end of the COI gene of the mitochondrial genome was applied to specimens collected from the Philippines, Malaysia, Thailand, China, and Japan, and they were compared to other gracilarian species.DNA barcoding is becoming a widely applied tool for the quick and accurate identification of species. The evolution of the mitochondrial cytochrome G. salicornia, comprising the following groups: H1\u2013H3 from the Philippines; H4 from Okinawa in Japan; H5\u2013H7 from Malaysia, Thailand, and China; and H8 from Thailand.Within species, the COI marker yielded two clusters with nucleotide divergences of 0.0\u20131.3%. This divergence is slightly higher than the typical intraspecific variation for red algae. A total of eight COI haplotypes were found for G. salicornia and provides further evidence that DNA barcodes are useful tools for identifying species boundaries and examining biogeographical haplotypes for the genus Gracilaria.Although this work concentrated on a limited geographical region of a widespread taxon, the data shows intraspecific molecular divergences in The online version of this article (doi:10.1186/1999-3110-54-27) contains supplementary material, which is available to authorized users. Gracilaria Greville show a sequence divergence of 9.2\u201314% in the mitochondrial gene cytochrome c oxidase I (COI), whereas a divergence among conspecific individuals is only 0.9%  Dawson commonly occurs in Southeast Asia as a component of the native algal flora  Papenfuss and recognized that the seven haplotypes tended to be geographically related. Kim et al.  according to the manufacturer\u2019s instructions. The COI-5\u2019 region was amplified via polymerase chain reaction (PCR) using the forward primers GazF1, and GWSFn variously combined with the reverse primers GazRI and COX1R1  algorithm based on Kimura two-parameter corrected distances  was comprised of samples from 10 localities, H2 included one sample from the Barangay Bulo site, and H3 (n=24) included samples from 17 sites. These Philippines groups were separated from the Japanese samples taken in Okinawa by six missing haplotypes . The Okinawa samples were more than seven mutation steps apart from the other Southeast Asian samples. H5 was comprised of three samples from Malaysia, Thailand, and China, whereas both H6 and H7 had only a single sample each from Penang and Morib in Malaysia, respectively. The last haplotype H8 (n=4) contained samples from Thailand with one missing haplotype.Haplotype networks were produced for all samples of Thalli were attached to rocks or small pebbles in the intertidal zone of calm areas or covered sand or mud in mangrove forests. Thalli were erect to prostrate, forming a loose tufted aggregation from the discoid holdfast Figure\u00a0A & B. ThGracilaria salicornia from Southeast Asia. Our survey of the literature revealed no similarly comprehensive survey of this group. Although G. salicornia individuals were quite variable in the intraspecific divergence of COI, 49 samples of the species from Southeast Asia produced a strong cluster. This species was also clearly distinguishable from all published sequences of Gracilariaceae in the COI Neighbor-Joining analyses  analysis. In this study, although we could not obtain samples from Port Dickson as were included in the paper by Lim et al. (G. salicornia, further research would be needed to state that the two clusters are not reproductively isolated.Morphological differences among ion. Xia  noted thion. Xia  reportedm et al. , three MG. salicornia in Southeast Asia. The genetic diversity and haplotypes were assessed using COI mitochondrial gene sequences. The single marker COI gene was cost-effective and useful, because there is a distinct barcode gap between the intraspecific and interspecific divergences of G. salicornia from Southeast Asia. The marker COI gene can be used to efficiently identify Gracilaria species along with the threshold approach. This study provides an advanced understanding of this commercially valuable taxa and points to productive new avenues for further research on this important alga.In conclusion, this study represents the first DNA barcoding assessment of"}
+{"text": "To determine a direct measure of publication bias by determining subsequent full-paper publication (P) of studies reported in animal research abstracts presented at an international conference (A).We selected 100 random (using a random-number generator) A from the 2008 Society of Critical Care Medicine Conference. Using a data collection form and study manual, we recorded methodology and result variables from A. We searched PubMed and EMBASE to June 2015, and DOAJ and Google Scholar to May 2017 to screen for subsequent P. Methodology and result variables were recorded from P to determine changes in reporting from A. Predictors of P were examined using Fisher\u2019s Exact Test.62% (95% CI 52\u201371%) of studies described in A were subsequently P after a median 19 [IQR 9\u201333.3] months from conference presentation. Reporting of studies in A was of low quality: randomized 27% , blinded 0%, sample-size calculation stated 0%, specifying the primary outcome 26%, numbers given with denominators 6%, and stating number of animals used 47%. Only being an orally presented (vs. poster presented) A  predicted P. Reporting of studies in P was of poor quality: randomized 39% , likely blinded 6%, primary outcome specified 5%, sample size calculation stated 0%, numbers given with denominators 34%, and number of animals used stated 56%. Changes in reporting from A to P occurred: from non-randomized to randomized 19%, from non-blinded to blinded 6%, from negative to positive outcomes 8%, from having to not having a stated primary outcome 16%, and from non-statistically to statistically significant findings 37%. Post-hoc, using publication data, P was predicted by having positive outcomes , or statistically significant results .Only 62% (95% CI 52\u201371%) of animal research A are subsequently P; this was predicted by oral presentation of the A, finally having positive outcomes, and finally having statistically significant results. Publication bias is prevalent in critical care animal research.The online version of this article (doi:10.1186/s13104-017-2574-0) contains supplementary material, which is available to authorized users. Publication bias (PB) refers to preferential publication of research findings that have statistically significant positive outcomes . This isBiomedical animal research (AR) is used to inform human research and practice on the assumption that animals are causal analogical models of human physiology and response to drugs and disease . If PB iHere we aimed to determine whether AR abstracts presented at an international critical care conference are subsequently published in the peer-reviewed literature, and what the predictors of subsequent publication may be. We chose critical care because inducing critical illness may be one of the most invasive fields of AR. In addition, our method allows a direct assessment of PB of AR that has reached the stage of warranting presentation to peers.The University of Alberta Health Research Ethics Board waived the requirement for review or consent because the study involved only publicly available data, and no individual that would require consent to participation.We reviewed 100 random published abstracts of AR from the 2008 Society of Critical Care Medicine international conference . If therThe data collection form was completed for all 100 critical care AR  abstracts. Both authors independently completed forms for the first 10 abstracts, discussing the data after every fifth abstract until consistent agreement was obtained. Thereafter, one author completed forms on all abstracts, and the other author independently did so for every fifth abstract (with discussion of the data to maintain consistent agreement), and for any data considered uncertain (with discussion until consensus). The instruction manual made clear definitions for all data collection; for example, a sample size calculation was defined as describing, for the primary outcome, a p value , power (1-beta), and minimally important difference (the difference between groups that the study is powered to detect).After the abstract data was finalized in the data collection form, we searched both PubMed and EMBASE to determine subsequent publication of the data presented in the abstracts. The search strategy was defined in the instruction manual. We searched for the first, second, or last author; and at least two MeSH subject terms . The search strategy was developed to be as inclusive as possible, by using the operator \u201cOR\u201d between the authors searched and between the MeSH terms used. Abstracts that were later published as only a small part of a larger study were considered published. All titles and abstracts of identified publications were reviewed to determine if they reported the study from the abstract. To be considered publication of the abstract results the published paper needed to report the same experiment, and we included the publication even if more animals were used and/or more experiments were done than reported in the abstract. If there was any doubt, both authors together discussed the titles and abstracts and reached consensus. If publication could not be found by one of the authors, the second author also independently searched to confirm this; if publication was then found, both authors discussed the finding and reached consensus. The search was done from 2007 (up to 14\u00a0months prior to the conference date) to June 2015 (up to 86\u00a0months after the conference date) inclusive.In response to an anonymous reviewer, in May 2017 one author (ARJ) searched DOAJ  and Google Scholar for subsequent publication of any of the abstracts determined unpublished by the above strategy. The search strategy was modified to be consistent with the PubMed and EMBASE searches. On DOAJ we searched separately for each of the first or last author, and if more than 30 publications were listed, we added  each of two subject terms from the abstract title. On Google Scholar we searched for each of the first or last author, added  each of two subject terms from the abstract title into the \u201ccontains all of the words\u201d box, and limited the search to from years 2007 to 2017. We screened all returned titles, and if necessary, abstracts and full text, up to and including 5 pages of each search result.Finally, as suggested by another reviewer, we emailed an author of each unpublished abstract to ask if the abstract had been published in full, and if so, to provide the citation. For each abstract, one author (ARJ) searched PubMed for the abstract author  in order to obtain a corresponding author email address. To be sure this was a current email for the correct abstract author, the address was to be from a publication since 2010, and on a topic related to the abstract, preferably with a same coauthor(s) as in the abstract. If the email was returned undeliverable, the search was repeated to obtain another of the abstract authors\u2019 email. For the 3 emails that remained undeliverable we identified a current corresponding co-author of a publication with the target author, and asked this contact to forward the request.A data collection form and instruction manual . Assuming the subsequent publication rate of AR will be similar to that for clinical research weighted mean full publication rate of 44.5% 95% CI 43.9\u201345.1%) [.9\u201345.1% 61 [61% (95% CI 51\u201370%)] abstracts were subsequently published after a median 19  months by searching PubMed and EMBASE. The search of DOAJ found no publications, and Google Scholar found one further publication, for a publication rate of 62% (95% CI 52\u201371%). Publication was usually within 3\u00a0years; months to publication was mean 22.6 (SD 17.1), median 19 , range 0\u201368\u00a0months; the 80th percentile was 35\u00a0months (2.9\u00a0years); 90th percentile 52\u00a0months (4.3\u00a0years); and 95th percentile 60\u00a0months (5\u00a0years).Emails were sent on May 25 (and to non-responders again on June 1) to an abstract author for the initially determined 39 unpublished abstracts. There were 13 replies by June 8 (within 2\u00a0weeks): 9 confirmed non-publication, and 4 claimed publication. However, the citations provided in the 4 clearly did not match the abstract methodology despite being on a similar topic . Thus, no publication was identified by this emailing strategy.The differences between published and unpublished abstracts are given in Table\u00a0Changes in reporting between the abstract and publication are given in Table\u00a0Given the unexpected changes from abstract to publication, we determined predictors for subsequent publication using updated numbers combining abstract and publication (when available) data Table\u00a0. The metGiven that oral presentation was a possible predictor of subsequent publication (p\u00a0=\u00a00.025), we compared oral to poster presentations on quality of abstracts and publications Table\u00a0. Orally Given the lack of methodological differences between published and unpublished abstracts, as suggested by a reviewer, we compared quality between lower (at or below median) and higher (above median) journal impact factor publications. There were no statistically significant differences in abstract quality between those subsequently published in lower vs higher impact journals Table\u00a0. The onlThere are several important findings from this study. First, only 62% (95% CI 52\u201371%) of AR abstracts presented at an international critical care conference, the Society for Critical Care Medicine 2008 Conference, were subsequently published. This means that much AR that is ready for presentation to peers does not contribute to the biomedical literature. Second, predictors of publication were oral presentation, and finally having positive outcomes and statistically significant results. Orally presented abstracts were not of higher methodological or ethical quality. These predictors confirm that much of the reason for non-publication is due to PB, which leads to a biased representation of biomedical research in the published literature. This is the first study of which we are aware to directly confirm PB in the AR literature. Third, the reported methodological quality of abstracts and publications is poor, particularly due to no mention of method of randomization, allocation concealment, or sample size calculation, and infrequent mention of randomization, primary outcomes, number of animals used, and numbers with denominators provided for results. This suggests that even published AR has poor internal validity. That the methodological quality did not differ between abstracts and publications suggests that this quality was not a determinant of acceptance for publication. Moreover, quality did not differ between abstracts subsequently published in higher versus lower impact journals. Finally, the change in reporting from abstract to publication is of concern. Although infrequent, the increase in reporting of randomization (by 19%) and blinding (by 6%), the decrease in reporting of a primary outcome (by 16%), and the increase in positive findings (by 8%) and statistically significant findings (by 37%) suggest that in published AR there may be selective analysis and outcome reporting bias that aims to find reportable results. The change in numbers of animals reported from abstract to publication in 13/35 (37%) of those studies reporting animal numbers [in the publication the number was smaller in 3 (9%) and larger in 10 (29%)] also suggests the possibility of checking the data during the ongoing study until a significant difference is found . These changes were not significantly less frequent in publications in higher vs. lower impact factor journals  contributing to science; and those who make health care decisions are faced with a biased subset of scientific evidence \u20134. PB inThere are limitations to this study. First, it is possible that some abstracts were published but this was not detected by our search strategy. Second, it is also possible that methodological quality was better than reported, particularly in abstracts where space limitations are restrictive. We believe that this explanation is problematic. Optimal methods of randomization, allocation concealment, and blinding (of the experiments and assessment of their outcomes) are time consuming and expensive to implement. Randomization, blinding, sample size calculation for a pre-specified primary outcome , and describing research subject numbers  markedly improve the quality, validity, and reproducibility of even preliminary experimental results. Not reporting this information can make published findings unreliable, regardless of whether the information was in fact known to the authors. This is why guidelines for reporting clinical research in conference abstracts include these points in their minimal standards \u201338. ThisNevertheless, the strengths of this study mitigate some of these concerns. This study was done with clear data definitions and a data collection form, and with a clear rigorous search strategy used by two authors independently. In addition, the field of critical care AR usually involves quite invasive management of animals , and therefore might be expected to be most likely to be reported and done to high standards . FinallyA direct assessment of subsequent publication of AR presented as abstracts at an international critical care conference confirms PB is prevalent. This is of concern because it suggests that published AR is a biased representation of research findings, and that animals are harmed without benefit, and with potential harm (misleading literature reviews), to humans. If AR has any chance of translating to human medicine addressing this problem of PB must be a high priority for researchers, funders, journals, and clinicians alike , 40.Additional file 1. The case report form for the study.Additional file 2. The study manual. This file provides the definitions used, and the details of methods for performing this study."}
+{"text": "Publication bias is the tendency of investigators, reviewers, and editors to submit or accept manuscripts for publication based on their direction or strength of findings. In this study, we investigated if publication bias was present in gastroenterological research by evaluating abstracts at Americas Hepato-Pancreato-Biliary Congresses from 2011 to 2013.P value, study design, time to publication, citation count, and journals in which the published report appeared were recorded.We searched Google, Google Scholar, and PubMed to locate the published reports of research described in these abstracts. If a publication was not found, a second investigator searched to verify nonpublication. If abstract publication status remained undetermined, authors were contacted regarding reasons for nonpublication. For articles reaching publication, the P\u00a0value. Of these, 254 (85.5%) contained P values supporting statistical significance. The abstracts reporting a statistically significant outcome were twice as likely to reach publication than abstracts with no significant findings . Overall, 243 (42.7%) abstracts reached publication. The mean time to publication was 14 months and a median time of nine months.Our study found that of 569 abstracts presented, 297 (52.2%) reported a P values had a higher probability of reaching publication. More than half of abstracts presented from 2011 to 2013 failed to reach publication. Readers should take these findings into consideration when reviewing medical literature.In conclusion, we found evidence for publication bias in gastroenterological research. Abstracts with significant  The practice of evidence-based medicine integrates clinical expertise with the best available clinical research evidence . This moPublication bias is one such reason why studies fail to be published. Publication bias is the tendency of investigators, reviewers, and editors to submit or accept manuscripts for publication based on their direction or strength of findings . A substPublication bias may also arise during scientific meetings. Organizations hold scientific meetings to allow researchers to come together to discuss new and ongoing topics related to their field of interest through oral and poster presentations of original abstracts. Because of the competitive publication process, abstracts that are presented likely represent strong research that may influence the current literature . HoweverIn this study, we measured the publication rate of abstracts presented at Americas Hepato-Pancreato-Biliary Association (AHPBA) Congresses and established whether publication bias may have occurred between abstract presentation and publication. We also evaluated the length of time to publication and which journals most frequently publish AHPBA abstracts. For unpublished abstracts, we contacted authors to determine the reason for nonpublication.This study did not meet the regulatory definition of human subjects research as defined in 45 CFR 46.102(d) and (f) of the Department of Health and Human Services\u2019 Code of Federal Regulations and therefore was not subject to Institutional Review Board oversight. We applied relevant Statistical Analyses and Methods in the Published Literature guidelines for reporting descriptive statistics.We located the AHPBA abstracts from 2011 to 2013 through the AHPBA website . We seleUsing a predefined search algorithm, we attempted to locate the published report of conference abstracts . The seaIf the second investigator (KF) could not locate the published report, CM sent a standardized email to an author of the conference abstract see . This emFor studies that were not found to be published and also contained negative findings, we also searched for them on Faculty of 1000 (F1000), BioMed Central , and Cureus, as these sources publish studies with negative findings.Our search dates ranged from June 13, 2017 to June 20, 2017. Once a published study that was thought to be a conference abstract was located, we compared the author list, methods, and results between them. If at least two of the following criteria were met, we considered the abstract published: (1) results in both reports matched; (2) the methodology was similar; and (3) the first author of the conference abstract was included in the author list of the published study.P\u00a0<\u00a00.05). The time to publication was calculated based on the number of months between the first date of the conference and the publication date in print or online, whichever occurred first. Descriptive statistics are reported as both means and medians. The reporting of means allows for interpretation of our findings in the context of other studies. Medians are reported due to the non-normal nature of the time to publication and citation count variables. A Mann Whitney U test was used to evaluate for differences on citation count between studies with positive and negative results. For this analysis, we included sample size and study design as potential predictors of publication. Logistic regression was used to evaluate the associations of sample size and study design with publication. We classified abstracts according to study design, which included such designs as: cohort studies, case studies, and randomized controlled trials. For study design, the investigators retained all study designs that represented at least 10% of abstract presentations for stability of the regression coefficients. Data analyses were performed using Microsoft Excel and Stata 13.1.Data were extracted from the published studies by CM using a Google form. The following information was extracted: publication title, institution of first author, date submitted to journal (when available), date accepted for publication (when available), date of in print publication (when available), date of online publication (when available), sample size (when available), journal name, number of citations, and whether there was a significant outcome  of 569 abstract presentations. Of those with a reported P value, 254 (85.5%) reported significant outcomes. Of the 254 that reported a significant outcome, 139 (54.7%) went on to reach publication. Of the 41 abstracts that reported negative outcomes, 15 (36.6%) went on to reach publication. No abstracts that reported only negative outcomes were found to be published on F1000, BioMed Central, or Cureus. Abstracts with at least one significant outcome were twice as likely to reach publication than abstracts with no significant findings  reached publication. The least common study design was the randomized controlled trial with three abstracts; however, all reached publication. Full study design results can be found in A total of 12 abstracts were found to be published before presentation and were therefore excluded from this study. A From 2011 to 2013 there were 569 abstract presentations, of which 243 (42.7%) reached publication . The meaZ\u00a0=\u00a0\u00a0\u2212\u00a0.34, P\u00a0>\u00a0.05). Results from logistic regression indicated that sample size  retrospective study design , or case reports  were not predictive factors of publication status . Other study designs were encountered too infrequently to include in this analysis.Citation counts were not significantly different between studies with negative results  8\u201328) and studies with positive results  and the Journal of Gastrointestinal Surgery 12 of 243 (4.9%). Fifty-nine journals published abstracts presented at the AHPBA congresses from 2011 to 2013 . There wSome 326 abstract presentations could not be found published as full papers. Email addresses were obtained for 298 authors of these abstracts. Twenty-eight authors of the abstract presentations could not be associated with an email address. Additionally, 42 emails were returned as invalid addresses. Thirty-four authors  responded to emails. Of these 34, 10 authors provided information that their presentation was published, while 24 reported that it never reached publication. The most common reasons for not reaching publication were lack of time (7), lack of manpower (4), in preparation or under review (4), and results negative or not important (3).Our study, like others before it, revealed that investigations with at least one statistically significant outcome had a higher probability of reaching publication than those with insignificant or null findings . FurtherP values are misused in the medical literature. For example, P values are, \u201csimple, reliable, and objective triage tools for separating the true and important from the untrue or unimportant\u201d  and its confidence interval (for interpretation of the precision of the effect estimate) are advocated by the American Statistical Association and many journals  . The ratThe length of time to publication in our investigation  is favorable in comparison with BSG\u2019s mean time of 18.6 months and the same as the mean 14 months reported by Durinka et al. from 2007 to 2009 . FurtherPublication bias is a cause for concern in the medical literature, as studies are often published due to the large magnitude effect sizes reported by investigators. Such effects are not likely reproducible in subsequent studies . Further 1.Gastroenterology journals should pilot test, and work toward the adoption of, a two-stage peer review process in which the first stage is to evaluate the study on the methodological rigor of the study design before the outcomes of the study are known. 2.Gastroenterology journals and conferences need to place value on null and negative findings, encourage authors to submit their research regardless of the nature or direction of their findings. 3.Gastroenterology journals should consider including a negative results section of their journals as has been done in other medical fields .P value from certain analyses could result in a bias in the reported estimate of incidence of significant results included in the studied publications. However, we feel confident that the abstracts identified as published by our search strategy are truly published versions of abstracts presented from 2011 to 2013 at the AHPBA annual congresses. While every effort was made to find author email addresses and make contact, we were unable to find a valid email address for authors of 70 presentations. Researchers only used Google, Google Scholar, and PubMed to find publications. Studies indexed in other databases that do not connect via Google may have been missed. However, given the exhaustive search and the efforts to email the authors, the number of omissions is likely very small. Given that 84% of abstracts were published in less than 24 months, our search interval was likely adequate. Therefore, we caution readers that our findings should be considered a lower bound estimate of the publication rate.We note the following limitations. First, while extensive measures were taken to determine the publication status of each abstract, it is possible that some were missed which could affect the results of this study. Changes in authorship, such as adding additional authors or rearranging the authorship order make matching abstracts with the published report more difficult. Changes to the title poses the same challenge. It is also possible that authors submitted interim results to the Congress yet published the final results, leading to incongruent aggregate outcomes and sample sizes. Other complicating factors include two abstracts being combined to form a single publication or a single abstract being parsed into multiple publications. Additionally, by excluding abstracts that did not report a P values were more frequently published than those with negative results. In addition, more than half of abstracts presented at the 2011 to 2013 AHPBA conferences failed to reach publication. Readers should take these finding into consideration when reviewing medical literature.In conclusion, we found publication bias in the field of gastroenterological research. Abstracts with significant 10.7717/peerj.4995/supp-1Data S1Click here for additional data file.10.7717/peerj.4995/supp-2Appendix 1Click here for additional data file."}
+{"text": "Indeed, an ethanol-mediated reduction in hepatic NAD+ levels is thought to be one factor underlying ethanol-induced steatosis, oxidative stress, steatohepatitis, insulin resistance, and inhibition of gluconeogenesis. Therefore, we applied a NAD+ boosting supplement to investigate alterations in the pathogenesis of early-stage ALD.Chronic alcohol consumption is a significant cause of liver disease worldwide. Several biochemical mechanisms have been linked to the initiation and progression of alcoholic liver disease (ALD) such as oxidative stress, inflammation, and metabolic dysregulation, including the disruption of NAD+ therapy on the early stages of ALD, we utilized nicotinamide mononucleotide (NMN) at 500\u2009mg/kg intraperitoneal injection every other day, for the duration of a Lieber-DeCarli 6-week chronic ethanol model in mice. Numerous strategies were employed to characterize the effect of NMN therapy, including the integration of RNA-seq, immunoblotting, and metabolomics analysis.To examine the impact of NAD+ levels, prevented an ethanol-induced increase in plasma ALT and AST, and changed the expression of 25% of the genes that were modulated by ethanol metabolism. These genes were associated with a number of pathways including the MAPK pathway. Interestingly, our analysis revealed that NMN treatment normalized Erk1/2 signaling and prevented an induction of Atf3 overexpression.Our findings reveal that NMN therapy increased hepatic NAD+-based interventions.These findings reveal previously unreported mechanisms by which NMN supplementation alters hepatic gene expression and protein pathways to impact ethanol hepatotoxicity in an early-stage murine model of ALD. Overall, our data suggest further research is needed to fully characterize treatment paradigms and biochemical implications of NAD The initiation and progression of alcoholic liver disease (ALD) arise through a complex etiology, including oxidative stress, inflammation, and metabolic dysregulation. A central factor in the disruption of hepatocyte metabolism is an ethanol-mediated reduction in NADogenesis , 51, 64. enzymes .+ is an essential cofactor in vital cellular functions including redox reactions, metabolism, and DNA repair mechanisms [+ levels is an emerging area of investigation for the treatment of several metabolic conditions. A growing number of reports have examined the use of NAD+-enhancing supplements like nicotinamide riboside (NR) and nicotinamide mononucleotide (NMN) in ameliorating obesity, aging, and diabetes [+ synthesis and nicotinamide-nucleotide adenylyl transferase (NMNAT1-3) enzymes convert NMN to NAD+. Several reports have demonstrated that a dose of 500\u2009mg/kg of NMN successfully increased liver NAD+ levels, prevented glucose intolerance in type 2 diabetes, improved insulin sensitivity, and prevented aging-related symptoms through multiple mechanisms [+ levels through NMN supplementation in ALD remains uncharacterized, including its transcriptional impact.NADchanisms . Boostindiabetes , 65. NMNchanisms , 66, 70.chanisms . In ALD,chanisms . However+/NADH ratios, which represent hepatic lactate and pyruvate levels, linking Atf3 and hepatic metabolic status [A number of transcription factors have been associated with the pathogenesis of ALD . Activatc status . Atf3 isc status . In the c status , 23, 64.c status , 50. Addc status . These fIn addition to hepatic signaling through Atf3, the mitogen-activated protein kinases (MAPK) are a fundamental cellular pathway that can transduce the activation of extracellular receptors to stressors like ethanol toxicity, impacting proliferation, differentiation, stress response, apoptosis, and survival . Contrad+ supplementation on the underlying mechanisms of early-stage alcoholic liver disease. NMN supplementation in a Lieber-DeCarli 6-week chronic ethanol model was examined utilizing several approaches, including the integration of RNA-seq, immunoblotting, and metabolomics analysis. Our findings reveal that NMN therapy increased hepatic NAD+ levels, limited liver damage as indicated by plasma ALT and AST, and changed the expression of 25% of the genes that were modulated by ethanol metabolism. These genes were associated with a number of pathways including the MAPK pathway. Our analysis further revealed that NMN treatment restored ethanol-perturbed Erk1/2 signaling and prevented an induction of Atf3 overexpression.In this study, we sought to evaluate the effect of ethanol metabolism and NADp = 0.020) and AST (p = 0.017). For both ALT and AST, the interaction effect between NMN treatment and ethanol treatment was statistically suggestive , which indicates that the effect of ethanol differed between animals treated with NMN and animals treated with saline. Interestingly, NMN treatment prevented a significant ethanol-induced increase in plasma levels of both markers. These results suggest a protective role for NMN against ethanol-induced hepatic damage. However, the NMN treatment did not alter the effect of ethanol on other liver markers such as liver triglycerides, liver to body weight ratio, and plasma ethanol concentrations  injection of 500\u2009mg/kg NMN increases liver concentrations of NAD+ and its related metabolites, we evaluated the liver content of NAD+, NMN, NAM, NADH, and among other NAD+-related metabolites. We found that ethanol feeding with NMN injections successfully maintained NAD+ and the majority of its metabolite levels to that of the Control Saline group . We termed the first group as NMN-dependent ethanol genes, which contains 437 genes. The second group focused on NMN-independent ethanol genes and contained 1341 genes. The genes and their categories are found in Additional file p value < 0.0001) are shown in Table We utilized next generation RNA-seq analysis by Illumina NovaSeq to comprehensively delineate the molecular mechanisms underlying how NMN alters ethanol-induced liver damage. We filtered the protein-coding genes with expression levels above background in our samples 10,038 genes) by the overall chronic ethanol effect false discovery rate (FDR) threshold of 0.05. This revealed that ethanol significantly alters the expression of 1778 genes. To identify the role of NMN in modifying the effect of ethanol on these 1778 genes, we separated these genes into two groups based on their interaction effect  and growth arrest and DNA-damage-inducible 45 alpha (Gadd45a). Interestingly, NMN treatment altered that difference Fig. . Dusp8 aA key factor in metabolic stress, Atf3 is a stress-inducible gene linked to symptoms of hepatic dysfunction . The exp+ through NMN treatment effectively prevented ethanol-induced increases in ALT and AST plasma levels and restored Erk1/2 signaling, which was disrupted by ethanol metabolism. A key finding of this study is that NMN therapy significantly reduces Atf3, which has been linked with hepatic steatosis, oxidative stress, mitochondrial function, and ethanol-induced metabolic syndrome [+ in hepatic metabolism, it is not surprising to find that NMN alters Erk1/2 and Atf3 signaling. Importantly, this is the first reported evidence that NMN has the potential to mitigate ethanol-induced liver injury, in part, through MAPK signaling targeted at Erk1/2 and Atf3.The overarching goal of this study was to examine the impact of NMN on the pathogenesis of early-stage ALD. Supplementing NADsyndrome , 30. Giv+ levels through genetic mechanisms. For instance, deletion or inhibition of non-Sirtuin NAD+ consuming enzymes like poly(ADP-ribose) polymerase 1 (PARP1) [+. Currently, PARP1 inhibitors like olaparib, niraparib, and rucaparib are used to treat a number of malignancies including ovarian cancer [+ levels to prevent neuronal cell death by PARP inhibition [Several reports have demonstrated varied physiological outcomes by elevating NAD PARP1)  or clust  or clusn cancer . Anotherhibition . Additiohibition .+ precursors like NR and NMN increases cellular NAD+ concentrations and has also been shown to ameliorate several pathological conditions through complex metabolic signaling mechanisms, including liver fibrosis [ClinicalTrials.gov identifier: NCT03151239). While metabolically targeted NAD+ therapies appear promising, our results suggest the need to continue evaluating the efficacy and mechanisms of these therapies in NAD+-dependent pathologies like ALD, aging, and diabetes [+ metabolome while reducing levels of circulating inflammatory cytokines [The administration of NADfibrosis . For exafibrosis . NMN trefibrosis . Furtherfibrosis . NMN alsfibrosis . Prelimifibrosis  and a cldiabetes . Indeed,+-based therapy, since it directly alters the NAD+/NADH redox state of numerous organs and cell types and impacts a host of NAD+-dependent proteins and pathways. Furthermore, questions remain regarding appropriate doses, frequency of treatment, and routes of administration. Alternatively, several reports revealed that ethanol activates the Erk signaling pathway by lipopolysaccharide (LPS) and acetaldehyde-dependent mechanisms [In this report, we employed RNA-seq to reveal novel mechanisms by which NMN alters ethanol-induced hepatic metabolism, partially by restoring Erk1/2 signaling and by the prevention of ethanol-induced Atf3 overexpression. Our findings are consistent with previous reports linking the inhibition of Erk and P38 pathways to oxidative stress, cholesterol metabolism, and liver regeneration , 58, 68.chanisms , 44. The+/NADH ratios and pyruvate, which support our findings regarding how NMN therapy impacts ethanol-induced hepatotoxicity. Since NMN treatment mitigates Atf3 overexpression, future research is needed to evaluate the role of NMN in treating other conditions that are mediated by Atf3 overexpression, such as hepatic ischemia [Atf3 is a stress-response transcription factor that activates or suppresses the expression of several genes depending on its dimerization, cell type, and stressor . Importaischemia .In addition to pyruvate, our metabolomics analysis identified 2-oxoglutarate as a metabolite of interest that is recovered due to NMN therapy. While ethanol metabolism significantly decreased 2-oxoglutarate, NMN intervention prevented this decrease. The underlying mechanism for this change remains unknown; however, 2-oxoglutarate is a key metabolite related to mitochondrial function and health . Previou+-dependent deacetylase enzymes responsible for removing protein acetylation, and SIRT3 is the main mitochondrial deacetylase. Since NMN treatment increases NAD+ levels, we evaluated the effect of NMN therapy on mitochondrial protein acetylation, including the known SIRT3 target lysines of SOD2. Regardless of NMN treatment, ethanol significantly increases protein acetylation throughout the cell . The diets consisted of 44% fat-derived calories, 16% protein-derived calories and the remaining balance being comprised of either carbohydrate or ethanol-derived calories (EDC). Ethanol-fed mice started the study on a diet consisting of 2% ethanol (v/v), with ethanol-derived calories (EDC) increased on a weekly basis until sacrifice; week 6 consisted of 6% ethanol (v/v) or 31.8% EDC. Pair-fed animals were calorically matched to an ethanol-fed mouse where EDC were replaced with maltodextrin. Twenty male C57BL/6\u2009J mice were divided into two major groups: 10 mice in group A treated with NMN at a dose of 500\u2009mg/kg every other day, prior to evening feedings, and 10 mice in group B injected with normal saline as a control group for the i.p. injection. Each group (groups A and B) was divided into two subgroups, one fed control diet (five mice) and the second group fed ethanol-containing diet (five mice) resulting in four subgroups: Control Saline, Ethanol Saline, Control NMN, and Ethanol NMN. All 20 male mice (8 weeks old) were fed a modified Lieber-DeCarli liquid-based diet for 6\u2009weeks, with a fresh diet provided between 3\u2009p.m. and 5\u2009p.m. daily. Upon completion of the study, animals were anesthetized via intraperitoneal injection of sodium pentobarbital and euthanized via exsanguination. Livers were excised, weighed, and frozen for biochemical characterization, or subjected to differential centrifugation using a sucrose buffer for mitochondrial and cytosolic subcellular fractionation as previously described . MeasureA heterogeneous covariance model was used for statistical analyses of ALT, AST, liver triglycerides, liver weight (compared to body weight), and plasma ethanol levels. Treatment with NMN , exposure to ethanol (ethanol vs. control), and their interaction were used as independent variables within a linear regression model that allowed the within-group variance to differ between groups (group = the combination of NMN and ethanol treatments). Specific comparisons between groups were estimated using linear contrasts. These models were executed using the MIXED procedure in SAS . Figures were generated using GraphPad Prism 6.04 .2O as previously described [2O (1/3/1). Samples were centrifuged at 20,000 rcf at 4 \u00b0C for 10\u2009min. Samples were split into two formed layers, polar and non-polar metabolites, into two tubes, and the bottom polar metabolite layer was speed-vacuum dried and stored at \u2212 80 \u00b0C. The amount of metabolite analyzed was equal to 2\u2009mg of tissue.Liver metabolites were extracted by homogenization of 5\u201310\u2009mg of liver tissue with methanol, MTBE, and Hescribed . The finm/z), 70 to 900 for positive mode (1.31 to 12.5\u2009min) and negative mode (1.31 to 6.6\u2009min) and 100 to 1000 for negative mode (6.61 to 12.5\u2009min); and resolution, 70,000; automated gain control (AGC), 3 \u00d7 106 ions. Customized mass calibration was performed before data acquisition.An ultimate 3000 UHPLC (Dionex) was coupled to a Q Exactive Plus-Mass spectrometer  for metabolite profiling. A hydrophilic interaction chromatography (HILIC) methodemploying an Xbridge amide column  was used for polar metabolite separation. Detailed LC method was described previously  except tLC-MS peak extraction and integration were performed using commercially available software Sieve 2.2 (Thermo Scientific). The peak area was used to represent the relative abundance of each metabolite in different samples. The missing values were handled as described previously . Intensin = 3 per group) according to the RNeasy Plus Mini Kit . RNA quality and concentrations were determined by NanoDrop 2000 spectrophotometer . RNA libraries were constructed using the Illumina TruSeq Stranded mRNA Library Prep Kit  in accordance with the manufacturer\u2019s protocol. Part of this process included isolation of polyadenylated transcripts via Oligo-dT beads that capture polyA tails. An Agilent Technologies Bioanalyzer 2100 was utilized to assess sequencing library quality, and samples were sequenced 2 \u00d7 150\u2009bp paired-end reads on an Illumina NovaSeq at the University of Colorado Genomics Core.Total RNA was isolated and purified from mouse liver  . Low-quaPathway analysis was performed with DAVID Bioinformatics Resources version 6.8 , 28. A ln > 3). Significance was calculated by two-way ANOVA with Tukey\u2019s post hoc test. Results were considered significant if p < 0.05.An aliquot of 20\u2009\u03bcg of protein from mitochondrial, cytosolic, nuclear, or whole cell extracts was loaded onto a 12% stain-free SDS poly acrylamide gel. Gels were activated by the Chemidoc\u00ae MP  before being transferred to PVDF membrane using a semi-dry transfer system , blocked using 5% (w/v) non-fat dry milk in Tris-buffered saline containing Tween 20 (0.1 % (v/v)) (TBST) for 1\u2009h at room temperature and then incubated overnight with primary antibodies at 4\u2009\u00b0C against Atf3 (ab207434) , pErk1/2 (CS4370), Erk1/2 (CS4695), pP38 (CS9211), and P38 (9212) . Membranes were washed three times by TBST, then incubated with appropriate secondary antibodies for 1 h at room temperature, and then washed three times with TBST. Clarity Western ECL Substrate  was applied before imaging via Chemidoc\u00ae MP . A standard method using 2,2,2-trichloroethanol  stain was used to visualize overall protein load . Densitop < 0.05.As detailed above, statistical analyses and graphs were generated using Prism 6.04 . Graphics were generated using R and using Prism 6.04. Differences between groups were calculated using two-way ANOVA with Tukey\u2019s post hoc test. Results were considered significant if Additional file 1: Figure S1: Assessment of liver triglycerides, liver to body weight ratio, and plasma ethanol concentrations. A) Ethanol consumption significantly increased liver triglycerides in saline and NMN groups. B) Ethanol slightly increased liver to body weight regardless of NMN treatment. C) Plasma ethanol levels significantly increased with ethanol feeding and NMN did not affect the blood ethanol concentrations. (n\u22654) (mean +/- SEM) (*p<0.05) (**p<0.01) (***p<0.001) (****<0.0001). Figure S2: The effect of NMN in the control diet. A) A diagram showing the analysis performed on all protein coding genes to identify the effect of NMN in mice fed the control diet. B) Pathway analysis of upregulated genes by NMN in control diet. C) Pathway analysis of down regulated genes by NMN treatment in control diet. Figure S3: Western blot analysis demonstrates that NMN supplementation did not alter hepatic protein lysine acetylation globally within the mitochondria or specifically on SOD2 at lysine 68. Westerns were performed on the same blot, but were cropped for visualization. (mean +/-SEM) (****p<0.0001). Figure S4: Western blot analysis reveals that NMN supplementation did not alter protein lysine acetylation of the nuclear or cytosolic fractions of liver tissue. Saline and NMN Westerns were performed on the same blot, but were cropped for visualization. C, control; E, ethanol. (mean+/-SEM) (**p<0.01) (***p<0.001) (****p<0.0001).Additional file 2: Table S1: Metabolomics.Additional file 3: Table S2: RNA-seq."}
+{"text": "L content with various rod lengths. Identification of a close association of FNRL with both CpcG-PBS and CpcL-PBS brings new insight to its regulatory role for fine-tuning light energy transfer and carbon fixation through both noncyclic and cyclic electron transport.Cyanobacterial light-harvesting complex PBSs are essential for photochemistry in light reactions and for balancing energy flow to carbon fixation in the form of ATP and NADPH. We isolated a new type of PBS without an allophycocyanin core . CpcL-PBS contains both a spectral red-shifted chromophore, enabling efficient energy transfer to chlorophyll molecules in the reaction centers, and an increased FNR Synechocystis sp. strain 6803. We found that ferredoxin-NADP+ oxidoreductase (or FNRL), an enzyme involved in both cyclic electron transport and the terminal step of the electron transport chain in oxygenic photosynthesis, is tightly associated with CpcL-PBS as well as with CpcG-PBS. Room temperature and low-temperature fluorescence analyses show a red-shifted emission at 669\u2009nm in CpcL-PBS as a terminal energy emitter without APC. SDS-PAGE and quantitative mass spectrometry reveal an increased content of FNRL and CpcC2, a rod linker protein, in CpcL-PBS compared to that of CpcG-PBS rods, indicative of an elongated CpcL-PBS rod length and its potential functional differences from CpcG-PBS. Furthermore, we combined isotope-encoded cross-linking mass spectrometry with computational protein structure predictions and structural modeling to produce an FNRL-PBS binding model that is supported by two cross-links between K69 of FNRL and the N terminus of CpcB, one component in PBS, in both CpcG-PBS and CpcL-PBS (cross-link 1), and between the N termini of FNRL and CpcB (cross-link 2). Our data provide a novel functional assembly form of phycobiliproteins and a molecular-level description of the close association of FNRL with phycocyanin in both CpcG-PBS and CpcL-PBS.Cyanobacterial phycobilisomes (PBSs) are photosynthetic antenna complexes that harvest light energy and supply it to two reaction centers (RCs) where photochemistry starts. PBSs can be classified into two types, depending on the presence of allophycocyanin (APC): CpcG-PBS and CpcL-PBS. Because the accurate protein composition of CpcL-PBS remains unclear, we describe here its isolation and characterization from the cyanobacterium  Cyanobacteria use phycobilisomes (PBSs) to harvest light energy and to fine-tune energy allocations for the two linked photosystems , 2. PBSs+) by ferredoxin (Fd). FNR (Fd-NADP+ oxidoreductase) in general plays essential roles in regulating cellular redox homeostasis in plants, bacteria, and the mitochondria of eukaryotes (+ and provides reducing power for CO2 assimilation. The cyanobacterium Synechocystis sp. strain PCC 6803 (Synechocystis 6803) produces two FNR isoforms: a small FNR similar to that in plant plastids (L) associated with the PBSs , a FAD-binding domain, and a NAD-binding domain, belonging to protein families pfam01383, pfam00667, and pfam00175, respectively. Although FNRL binds to PBS rods, its precise binding site and its function are still unclear  unclear , 14, 15.Synechocystis 6803 and Anabaena sp. strain PCC 7120 (Anabaena 7120), there are two types of PBSs, conventional CpcG-PBS and CpcL-PBS  indicated nonstoichiometric binding of FNRL in CpcL-PBS and significant rod length heterogeneity. To accomplish this, we developed a structural proteomic pipeline by combining cross-linking chemistry in combination with liquid chromatography-tandem mass spectrometry (LC-MS/MS) detection of hybrid peptide species and computational biology to pinpoint the structural location of FNRL in both CpcG-PBS and CpcL-PBS.In this study, CpcL-PBS was isolated from Synechocystis 6803 (apcABC operon) cells, respectively   , and alsplicates , and thaplicates . CpcG-PB(\u0394cpcG2) , while t(\u0394cpcG2) , 20, 22.(\u0394cpcG2) , can be solation . FNRL waarations , 20.To characterize further and compare the functional differences of the two PBSs, we obtained room temperature (RT) absorption spectra of CpcG-PBS and CpcL-PBS . The difL, and CpcD are 0.99, 1.00, 0.82, 2.28, 1.99, and 0.77, respectively  and CpcL on their N termini. L was found in conventional PBS  and CpcL-PBS (12%). Acetylation alters several protein properties, including molecular weight, stability, enzymatic stability, interactions with other proteins, and other biological functions , it per PBS . Thus, tCpcL-PBS , i.e., 403 cells . It shou03 cells , indicatunctions , 29. OurL in both PBSs is of crucial interest. We subjected both PBS samples to chemical cross-linking with a 1:1 mixture of BS3 (bis[sulfosuccinimidyl]suberate) (H12/D12) cross-linker (L and either CpcB or CpcA. L and CpcB: FNRL (MGGK69IVSIK) and CpcB . The precursor ions of this cross-link appear as a doublet (1:1) owing to isotope coding on the cross-linkers , exactly as expected from the mass difference between BS3-H12 and BS3-D12. Overall, the product-ion coverage is 93% for y ions and 21% for b ions. The isotopic ion coverage (both y and b ions) is 29%. All major fragments (y and b) in the product-ion spectra match predicted peptide fragments, resulting in a highly confident identification . The dofication  and C.L-1MYSPGYVATSS and CpcB-1MFDVFTR  and one cross-link between FNRL and CpcA (Xlink3)  between FNR(Xlink3) . The amiirements , 32.L-linker domain (LD) (1B33 (\u2013L-LD belongs to the CpcD superfamily (cl03191) of proteins (or rod-capping linker) that are involved in assembly of the phycobilisome  (C7.8), a CpcD superfamily protein, was resolved in the structure and consequently was used as the default template for the homology-modeling algorithm by I-TASSER. Each of the five models has an elongated shape and consists of a three-stranded \u03b2 sheet  and one or two \u03b1-helices, accounting for 48% of the secondary structure and 52% of the loop region   to E. PrD)  and a loop region connecting \u03b2-1 and \u03b2-2 (S29-P40). In all five models, the \u03b1-helix (L53-R65) is always located on one side of a \u03b2-sheet . In the predicted models, orientation of the NTE relative to the conserved secondary structures is variable and is located either on the same side of the \u03b1-helix (model E) or on the opposite side   , leadingL-LD complex by using PDB entry 1B33 as a general template for heterodimeric CpcA/B and FNRL-LD (Synechocystis 6803 CpcA/B (\u03b1\u03b2) crystal structure (PDB entry 4F0T) (L-LD (L-LD and relative to its secondary structure and the three heterodimeric CpcA/B in the context of the CpcA/B-FNRL-LD complex.Our modeling is aimed at achieving a trimeric CpcA/B-FNR FNRL-LD  and I. Wry 4F0T)  and fiveT) (L-LD  to E modL-LD associated with trimeric CpcA/B (C7.8 (PDB entry 1B33), our trimeric Cpc-FNRL-LD model has the CpcA/B:FNRL-LD stoichiometry of 3:1. This means that, given the observed cross-link FNRL:K69-CpcB:1M, CpcB:1M can involve any methionine of the trimeric CpcB (\u03b6), and solvent-accessible surface distance (SASD)  .L-LD model E in trimeric PC methyl]-2-aminoethanesulfonic acid)-KOH (pH 7.5) at 30\u00b0C. Liquid cultures were grown in a 10-liter carboy with fluorescence illumination from both sides, light intensity of 50\u2009\u00b5mol photons m\u22122 \u00b7 s\u22121, and air bubbling from the top and magnetic bar stirring at the bottom driven by a stir plate underneath the carboy. Cell cultures were harvested at log growth phase at an optical density at 730 nm of 0.2 to 0.3 and resuspended in 0.8\u2009M K-phosphate buffer. CpcG-PBS and CpcL-PBS were isolated from CpcL-PBS (WT) and the \u0394AB mutant, which contains no ApcA/B due to the genetic deletion of the apcABC operon  at room temperature, the blue liquid supernatant was loaded immediately onto a sucrose gradient (g) overnight, blue bands of CpcG-PBS and CpcL-PBS samples were collected at the interface of 0.75\u2009M to 1.0 M sucrose and the 0.75\u2009M sucrose region, respectively, and analyzed by using SDS-PAGE. PBS samples without cross-linking chemistry were also directly subjected to trypsin digestion and LC-MS/MS analysis for PBS subunit identification and quantification.Cyanobacterial strains were grown in BG-11 medium supplemented with 20\u2009mM TES ethyl)amino]ethanesulfonic acid, gradient . After u3 and BS3 labeled with 12 deuterium atoms  for 10\u2009min in the dark at room temperature at a cross-linker/PBS molar ratio of 10:1, 50:1, and 100:1. Quenching and desalting of PBS samples were achieved by using Zeba spin columns .The isotope-coded cross-linking experiment was performed as previously described, with minor changes , 47. Brim/z 1.5 and a normalized collision energy of 27%. The mass resolving power employed was 70\u2009K for precursor ions and 17.5\u2009K for product ions (MS2).Desalted cross-linked PBS samples, as well as untreated PBS samples, were precipitated by adding acetone and digested with lysyl endopeptidase (LysC) and then trypsin by following a previously published method . BrieflySynechocystis phycobilisome proteins by using the built-in fusion decoy database for false discovery rate calculation. Search parameters were the following: precursor ion mass tolerance, 10.0\u2009ppm; fragment ion mass tolerance, 0.02\u2009Da; variable modifications, all built-in modifications plus the user-defined light and heavy monolink forms of the cross-linker, 156.0079 and 168.1540\u2009Da, respectively. The instrument mass resolving power was higher than that suggested for reliable cross-linking  for protein identification and label-free quantification . The dat-linking : maximumSynechocystis 6803 phycobilisome protein database and a decoy database containing reversed protein sequences. Search parameters were the following: precursor ion mass tolerance, 20\u2009ppm; fragment ion mass tolerance, 60\u2009ppm; maximum missed cleavage, 2. Common posttranslational modifications and the automatic peptide score were cut. The protein false discovery rate threshold was determined by the score of the highest-ranked decoy protein identified. The search results were combined in Byologic software for validation and extraction of ion chromatograms with a mass window of 20\u2009ppm. Peptides used for protein quantification must meet the following criteria: fragment ion spectrum score above 300, correct monoisotopic mass, and low relative intensity (below 10%) of interference peaks within the peptide isotopic pattern. Chromatogram peaks with multiple MS/MS identifications were integrated by the software for quantification of that peptide. For each protein, at least three peptides were used for relative quantification of that protein. Cpcc1 and CpcD were used for normalization because they are in a 1:1 ratio in the CpcG-PBS. We chose 19 of 25 peptides of FNRL from each PBS for consideration.For the second round of label-free quantification, the LC-MS/MS raw data were submitted to Protein Metrics software (PMI). Database searching was performed by Byonic software using the ICC-Class , 50 and 3 , linked sites, and composition were all required in a configuration file (pConfig). pLink was implemented with the following settings: enzyme, trypsin and up to three missed cleavages; precursor tolerance, 20\u2009ppm; fragment tolerance, 60\u2009ppm; variable modifications, oxidation of M, deamidation of N, Q, and N terminus; minimal peptide length, 6 amino acids; maximal peptide length, 60 amino acids; minimal peptide mass, 600\u2009Da; maximal peptide mass, 6,000\u2009Da. The cross-linked peptides were examined with pLabel, affording a corresponding summary report. The cross-links were identified at a false discovery rate equal to or smaller than 5% at spectral level with a 10-ppm filter tolerance. Isotopic doublets signifying a likely cross-link were manually confirmed in the raw file. Theoretical product-ion information was generated through Protein Prospector MS-Product (http://prospector.ucsf.edu/) for the cross-linked peptides that are shown in the pLink search. Following that, likely relevant product-ion spectra were further validated manually.The raw LC-MS/MS files were also analyzed by pLink . The PBS protein sequence was added manually into the search database. Cross-linker information, including monoisotopic linker masses of light and heavy forms of BSL-LD  and CpcD (ssl3093) protein structure prediction (I-TASSER or Zhang Server was used for FNRediction , 35, 52."}
+{"text": "Little is known about salt taste dysfunction among hemodialysis (HD) patients. This study aimed to elucidate the prevalence of salt taste dysfunction and its relationship with interdialytic weight gain (IDWG) among HD patients.A single-center cross-sectional study involving 99 maintenance HD patients was conducted in September 2015. Salt taste threshold was measured using a salt-impregnated test strip. Salt taste dysfunction was defined as a recognition threshold of \u22650.8%. IDWG was calculated as the mean value of weight gain at the beginning of each week during a 1-month period before the taste test. We performed a multivariate analysis using the standard linear regression model to investigate the association between salt taste dysfunction and IDWG.P\u2009=\u20090.90). A multivariate analysis indicated that salt taste dysfunction is not significantly associated with IDWG .Among the 99 participants, 42% had a recognition threshold of 0.6%, whereas 38% had a recognition threshold of \u22651.6%. Overall, the prevalence of salt taste dysfunction was 58%. The mean (\u00b1SD) IDWG was 4.9% (\u00b11.7%), and there was no significant difference in IDWG between the two groups with (4.9%) and without (4.8%) salt taste dysfunction (The prevalence of salt taste dysfunction was very high among HD patients who had a unique distribution of salt taste recognition thresholds with two peaks. We found no significant association between salt taste dysfunction and IDWG. Patients with chronic kidney disease (CKD), including those on hemodialysis (HD), commonly experience taste dysfunction for reasons such as zinc deficiency, dry mouth due to water loss, peripheral nerve disorders due to diabetes, adverse effects of medication, and uremia \u20136. It waSalt taste dysfunction could be influenced by a variety of factors, including age, sex, smoking, diabetes, and zinc levels \u201317. PrevFor this cross-sectional study, we recruited patients undergoing maintenance HD at Omihachiman Community Medical Center in September 2015. The conditions for participation were as follows: age 20\u2009years or older; consistent outpatient HD three times per week; dialysis history of at least 6\u2009months ; and consented to participate in this study.Candida, cancer of the tongue); active cancer (patients who underwent systematic cancer therapy within the past 5\u2009years or who were scheduled to undergo therapy); active infection ; inability to cooperate during the taste acuity test; missing body weight data for the month prior to the taste test; changes in dry weight (DW) during the month prior to the taste acuity test; and urinary output \u22651000\u2009mL per day.The exclusion criteria were as follows: reduced cognitive function or inability to independently grant consent to participate in this study; psychiatric disorders; intraoral lesions . Written informed consents were obtained from all patients.2 blocker, sleep inducer, Chinese herbal medicine, and nonsteroidal anti-inflammatory drug); and laboratory data investigated immediately before the study. Data regarding history and current status of smoking, drinking, denture use, and education were obtained using questionnaires that patients completed at the time of the taste acuity test.We obtained the baseline data regarding the following potential confounding factors from the medical records: sex; age; BMI; HD vintage; causes of end-stage renal disease ; comorbidities ; medications  . PatientBody weight was measured  with an electronic calibrated scale before and after each dialysis session. IDWG, the primary outcome of this study, was calculated as the mean value of the rate of change in body weight (%) at the beginning of each week during a 1-month period before taste acuity test using the following formula:Continuous variables were presented using the median value (interquartile range [IQR]). The nominal variables  are presented as the number of participants and percentage.P\u2009<\u20090.05.Patients were divided into the two groups with or without salt taste dysfunction. We compared IDWG between the two groups using the Student\u2019s t test. Assuming the prevalence of salt taste dysfunction in HD patients and standard deviation in IDWG as 75 and 1.5%, respectively, to detect a 1% absolute increase in IDWG from 5% in participants without salt taste dysfunction to 6% in those with salt taste dysfunction, with a two-sided significance level of 0.05, a total of 97 participants were required to have a power of 80%. We also explored the factors associated with salt taste dysfunction, including age, sex, HD vintage, smoking, dentures, diabetes, use of RAS inhibitors, and zinc level, by estimating odds ratios (ORs) and 95% confidence intervals (CIs) for the likelihood of having salt taste dysfunction (defined as a recognition threshold of \u22650.8%) using a multivariable logistic regression model. We further analyzed the association between salt taste dysfunction and IDWG by performing a multivariate analysis using the standard linear regression model. We adjusted for the following clinically important confounding factors related to both salt taste dysfunction and IDWG: age, sex, body mass index (BMI), HD vintage, diabetes, and serum albumin level. As a sensitivity analysis, we analyzed the association between salt taste dysfunction and IDWG calculated as the absolute change (not the change rate) using the same model as previously mentioned. Statistical analyses were performed using JMP11 . Statistical significance was set at 2, respectively. The most common cause of end-stage renal disease was glomerulonephritis (47%). One-half of the patients had dentures and 32% had diabetes. Fifty-nine percent of patients were current or past smokers, and 24% were using a RAS inhibitor. The median serum level of zinc was 52  \u03bcg/dL.A total of 107 patients were enrolled in this study. After excluding five patients with missing body weight data, two patients with urinary output \u22651000\u2009mL per day, and one patient with changes in DW during the study period, 99 patients were included in the analysis. Patient characteristics are shown in Table\u00a0The salt taste threshold distribution is shown in Fig.\u00a0P\u2009=\u20090.90)  (Table\u00a0The mean (\u00b1standard deviation [SD]) IDWG was 4.9% (\u00b11.7%) for all participants. The mean IDWG values were 4.9 and 4.8% for groups with and without salt taste dysfunction, respectively, and there was no significant difference between the two groups (90) Fig.\u00a0. The mul2) Table\u00a0. SensitiWe conducted a semi-quantitative assessment of the salt taste threshold of HD patients. Interestingly, the salt taste recognition threshold of HD patients showed bimodal distribution peaks at 0.6% and\u2009\u2265\u20091.6%. Age, HD vintage, and BMI were independently associated with IDWG; however, we found no significant association between salt taste dysfunction and IDWG.Intraoral dryness due to water loss, peripheral nerve disorders due to uremia and diabetes, medication-related adverse effects, and zinc deficiency are likely causes of CKD-related taste dysfunction; however, the mechanisms are not fully understood \u20136. A recThe sensation of taste consists of five components: sweet, sour, salty, bitter, and savory. Among them, salt taste may have the most important role related to the consumption of salt by HD patients, which is associated with blood pressure, volume status, and prognosis . For nonA previous study utilizing SALSAVE reported that 73% of healthy volunteers had a salt recognition threshold of 0.6%, whereas 71% of non-dialysis CKD patients had a salt recognition threshold of \u22650.8% (most commonly 0.8%). CKD patients had significantly higher salt recognition thresholds than healthy volunteers [In this study, we did not detect a significant relationship between salt taste dysfunction and IDWG. It has been generally believed that fluid intake is increased as more salt is ingested, which results in increased extracellular fluid volume . One plaOur study had several strengths. First, to the best of our knowledge, this is the first study to quantitatively evaluate the association between salt taste dysfunction and IDWG in HD patients. Second, the SALSAVE test, which has been validated as a salt taste acuity test for both healthy individuals and CKD patients, is easy, inexpensive, and requires only a few minutes to perform . Third, This study also had several limitations. First, this study was conducted at a single institution and included only Japanese patients, which may make it difficult to generalize the results of this study. Second, although the SALSAVE test can easily evaluate the gustatory threshold for salt taste as a screening test, its sensitivity has been questioned and the availability of impregnated salt concentrations is limited; therefore, we could not evaluate the taste thresholds accurately, especially those lower than 0.6% and higher than 1.6%. Third, our analysis may have been statistically underpowered to detect significant differences or relationships. Finally, we could not attribute causality to the associations between any exposure and IDWG because of the cross-sectional design of our study. Although our hypothesis that salt taste dysfunction causes IDWG is possible and biologically plausible, reverse causality could also exist. Nevertheless, no evidence that supports such an association has been generated.More than 50% of HD patients had salt taste dysfunction, and many patients also had heterogeusia and ageusia. Our findings suggest that more attention should be focused on salt taste when managing HD patients; however, no association was found between salt taste dysfunction and IDWG. Because of the limitations of our study, external validations incorporating mechanistic studies, especially measuring salt intake, which was considered the major intermediate factor in our hypothesis, and larger sample sizes would be helpful. Further studies evaluating the effectiveness of interventions to improve salt taste dysfunction, such as the administration of zinc and in-hospital education programs focused on restricting dietary salt, would also be helpful for HD patients with salt taste dysfunction."}
+{"text": "Relation between atrial fibrillation (AF) and cancer is known but not very well understood. The purpose of this prospective study was to find out whether subjects with cancer were at greater risk of AF than subjects without cancer.The study was based on the OPERA (Oulu Project Elucidating Risk of Atherosclerosis) material and had 1045 subjects and the mean follow-up time of 16.3 years. During the follow-up AF and cancer diagnosis were made  if these events were listed in the National Death Registry and/or hospital discharge registry.In this study 130 subjects (12%) had cancer and 19% of these had AF, whereas only 9% of those without cancer experienced AF during the follow-up (p<0.001). Subjects in the cancer group had greater probability of developing atrial fibrillation during the follow-up time in comparison to the subjects without cancer (Hazard ratio (HR) 2.47 (95%CI) 1.57\u20133.88) in multivariate model including relevant confounding factors.The main finding of this OPERA study was that cancer is an independent risk factor of atrial fibrillation. Still it remains unclear whether this association is causative or whether cancer and atrial fibrillation just share the same pathophysiologic mechanisms. Atrial fibrillation (AF) is the most common sustained cardiac arrhythmia. It affects 1.5% to 2% of the general population and its prevalence and incidence are both expected to rise in the future  Age, hypIt is known that cancer patients suffer from different kinds of comorbidities . It has The purpose of this prospective study was to find out whether subjects with cancer were at greater risk of AF than subjects without cancer. The study was based on the OPERA (Oulu Project Elucidating Risk of Atherosclerosis) material and had 1045 subjects.In the OPERA study, middle-aged hypertensive subjects and age- and sex-matched control subjects were randomly selected from the national registries in the early 1990s . The totDuring the follow-up  AF or caAll the laboratory test samples were obtained after an overnight fast . A HewleThe statistical significances of differences in continuous and categorical variables between the subjects with and without cancer and AF were assessed using the standard t-test and the chi-square test, respectively. Logarithmic transformations were used when variable distributions were not normal , high-sensitive C-reactive protein (hs-CRP), triglycerides, alanine aminotransferase (ALT), creatinine). The cumulative proportional probability of the development of AF requiring hospitalization is shown by the Kaplan-Meier curves. The Log Rank test was used to evaluate the statistical significance of the separation of the curves. The Cox hazards model was used to evaluate the univariate and multivariate significance of different factors in predicting new-onset AF requiring hospitalization. The data were analyzed using the IBM Statistics software 22. A p-value <0.05 was considered to be statistically significant.The baseline features of patients with and without cancer (n = 1045) are shown in In the cancer group the proportion of males was 58% and in the non-cancer group 48% (p = 0.034). The mean age in patients in the cancer group was 53 years whereas in the non-cancer group it was 51 years (p = 0.008). The patients with cancer smoked more (p = 0.003). As regards to echocardiographic measurements, cancer patients had a greater left atrial diameter (p = 0.021) and carotid intima-media thickness (p = 0.033) than those without cancer.Several baseline characteristics differed in the subjects with atrial fibrillation in the follow-up compared to those without AF. This is shown in In multivariate Cox regression analysis of the predictors of atrial fibrillation, see Subjects in the cancer group had greater probability of developing atrial fibrillation during the follow-up time in comparison to the subjects without cancer (Hazard ratio (HR) 2.47 (95%CI) 1.57\u20133.88). After the follow-up time, 19.2% of subjects (n = 25) with cancer at the baseline had been diagnosed with atrial fibrillation, while 8.7% of subjects (n = 80) without cancer had AF. The difference between cancer and non-cancer group was statistically significant (p<0.001). The detailed cumulative proportional probability of AF in the cancer group is shown in The main finding of this OPERA study, including over 1,000 subjects and a long follow-up time, was that cancer is an independent risk factor of atrial fibrillation. Still it remains unclear whether this association is causative or whether cancer and atrial fibrillation just share the same pathophysiologic mechanisms. Previous studies have suggested that cancer itself is a comorbid condition predisposing to AF.The evidence of the association between cancer and atrial fibrillation is still slightly limited, apart from several studies of AF after lung cancer surgery. A large epidemiological study with 24,125 subjects was the first to show that AF is related to poor prognosis in cancer patients . Some ofHow could cancer increase the risk for atrial fibrillation? As seen in our study, both entities shared common risk factors, like age, sex and smoking. In addition, left atrial diameter associated with FA, and IMT thickness reflecting early atherosclerosis, were increased in both conditions. However, although these factors were adjusted for, the association between AF and cancer remained. Therefore, additional mechanism must be involved. In earlier studies, cancer surgery, medical therapy, inflammation, autonomic nervous system imbalance, paraneoplastic manifestations and other cancer-related comorbidities are among the mechanisms reported to be associated with increased atrial fibrillation risk among cancer patients 5]7].[7].5][7].[7].5]. Eve. Eve19].It remains unclear, how exactly cancer and AF relates to each other. Due to the original study design of the OPERA study, we lack many specific data on cancer subjects, like the type of cancer and given treatment. Although this study does not shed new light on the understanding of the pathomechanisms of these two conditions, it confirms the relation between AF and cancer. Interesting result was that IMT (intima media thickness) and left atrial diameter were both increased among cancer subjects in our study. Few studies have suggested that anticancer treatment during childhood affects the IMT , and in In conclusion, the main finding of our long-term follow-up study was that cancer is an independent risk factor of atrial fibrillation. Additional studies are needed to demonstrate the pathophysiological mechanisms underlying the association between AF and cancer. Understanding the mechanism could help to prevent and treat atrial fibrillation among cancer patients."}
+{"text": "Syntenin is an adaptor-like molecule that has two adjacent tandem postsynaptic density protein 95/Discs large protein/Zonula occludens 1 (PDZ) domains. The PDZ domains of syntenin recognize multiple peptide motifs with low to moderate affinity. Many reports have indicated interactions between syntenin and a plethora of proteins. Through interactions with various proteins, syntenin regulates the architecture of the cell membrane. As a result, increases in syntenin levels induce the metastasis of tumor cells, protrusion along the neurite in neuronal cells, and exosome biogenesis in various cell types. Here, we review the updated data that support various roles for syntenin in the regulation of neuronal synapses, tumor cell invasion, and exosome control. Syntenin was first isolated as an interacting partner of the syndecans, cell surface signaling, and trafficking proteins . Simulta2) . B. B15]. BNF2 gene, mutations in which cause type 2 neurofibromatosis in humans . A. A88]. AFurthermore, syntenin-ALIX complex mediates exosome biogenesis in multivesicular bodies. Syndecan, syntenin, and ALIX can form a tripartite complex , and co-Interestingly, knockdown of Src, which is another syntenin-binding partner, also reduced exosome production, indicating that syntenin mediates the function of Src in exosome biogenesis . KnockdoA recent study indicated that exosome-associated proteins, including syntenin, were more abundant in exosomes from Parkinson\u2019s disease patients than in exosomes from the healthy subject group . These cSyntenin participates in biological processes other than those mentioned above, including synaptic regulation, tumor metastasis, and exosome biogenesis. Through the regulation of membrane trafficking, syntenin is involved in the neurite outgrowth and induction of anoikis-resistance of glioma stem cells (GSC). We will briefly describe how syntenin is involved in these biological processes.Uncoordinated (Unc)51.1/Ulk1 and Rab5 are interacting partners of syntenin . Unc51.1Syntenin is involved in the self-renewing of glioma \u201cstem cells.\u201d The concept of the \u201ccancer stem cell\u201d is that cancer is comprised of a variety of cells with the potential to metastasize, interact with the stroma, and regrow after therapy ,98,99. TSyntenin shows a surprising diversity of interacting partners, suggesting that it plays a number of flexible cell type-specific roles. Syntenin forms a variety of complexes. Some of these complexes are specific to a particular cell type, and others are specific to a subcellular compartment involved in numerous intracellular signaling cascades. Because syntenin has two PDZ domains, it can interact simultaneously with two different partners. For instance, syntenin works as a scaffold protein dependent on the intracellular environment or in the subcellular compartment by regulating membrane architecture rearrangement.Syntenin interacts with other synaptic proteins, including ephrin family proteins ,43, neurAs noted, syntenin has frequently been identified as indispensable for cell invasion and metastasis in various cancers ,60, indiExosome biogenesis is involved in cell-cell communication in both central nervous system function and tumor development. Because syntenin is involved in exosome biogenesis, synaptic plasticity and tumor metastasis could also be affected by another function of syntenin. Regulation of syntenin in exosome biogenesis, such as interaction with ALIX, can provide another aspect to inhibit the exosome-mediated tumor development. Moreover, exosome biogenesis in neuronal development and pathogenesis still remains elusive. Further analysis of syntenin in exosomal communications in the brain will pave roads leading to insight into proper nervous system formation and will lead to the development of new diagnostic methods for neurodevelopmental and neurodegenerative diseases."}
+{"text": "Runt-related transcription factor-1 (RUNX1), also known as acute myeloid leukaemia 1 protein (AML1), is a member of the core-binding factor family of transcription factors which modulate cell proliferation, differentiation, and survival in multiple systems. It is a master-regulator transcription factor, which has been implicated in diverse signalling pathways and cellular mechanisms during normal development and disease. RUNX1 is best characterized for its indispensable role for definitive haematopoiesis and its involvement in haematological malignancies. However, more recently RUNX1 has been identified as a key regulator of adverse cardiac remodelling following myocardial infarction. This review discusses the role RUNX1 plays in the heart and highlights its therapeutic potential as a target to limit the progression of adverse cardiac remodelling and heart failure. In mammalian species, three \u03b1-subunits exist, known as RUNX1, RUNX2, and RUNX3, each with its own distinct spatial-temporal and tissue-specific pattern of expression.Runx1 lack definitive haematopoiesis and are unable to survive past an early embryonic stage (days 11.5\u201312.5) due to severe haemorrhage within the central nervous system (CNS), peritoneum, and pericardium.RUNX1 gene is one of the most common targets of chromosomal and genetic alterations in acute leukaemia.RUNX1 is best characterized for its role as a key transcriptional regulator of haematopoiesis and its involvement in blood malignancies.,,,Figure\u00a0). It is likely that the particular combination of mediators recruited to these complexes dictate the profile of the genes targeted and whether they are activated or repressed, leading to both indirect regulation and context-dependent function.Like the other members of the RUNX family, the RUNX1 protein contains the highly conserved 128 aa region known as the Runt homology (runt) domain which mediates binding to DNA and facilitates interaction with CBF\u03b2.RUNX1 gene is under the control of a dual promoter system comprising a distal P1 and a proximal P2 promotor and alternative usage of these promoters leads to the generation of mRNA isoforms that differ in their 5\u02b9-untranslated region (UTR) and N-terminal coding sequences,Figure\u00a0). The biological significance of the dual promoter system has not been fully elucidated; however, their differential expression during developmental haematopoiesis appears important for cell specification.,RUNX1 P1 transcript has a 5\u02b9UTR that is 452 base pairs (bp) in length and is translated efficiently; however, the 5\u02b9-UTR of the P2 transcript is substantially longer at 1631\u2009bp and forms a secondary structure which appears to hinder its translation in vitro.Expression of RUNX1 itself is tightly controlled at the transcriptional, translational, and post-translational level, which also contributes to the strong context specificity of RUNX1 function. The RUNX1 gene products is augmented by splicing and exon skipping of the P1 and P2 transcripts to yield further isoforms with different functions and expression patterns.,RUNX1c isoform, whereas P2 activity yields the RUNX1a and RUNX1b isoforms.,Figure\u00a0). RUNX1a is truncated at exon 7 and so has DNA-binding capacity but lacks the C-terminal transcriptional regulatory domain seen in RUNX1b and RUNX1c. It has therefore been suggested that RUNX1a may act as an antagonist to transcriptional activation driven by RUNX1b and RUNX1c.,Further diversity in the Figure\u00a03). Acting as scaffolds for multiple protein complexes the outcome of RUNX binding to DNA is heavily influenced by interaction with different activating or repressive co-factors. Post-translational modifications can influence RUNX1 activity, affinity for DNA, and its stability at least in part by directing its binding to other co-factors and in this way provides a means to fine-tune RUNX1 activity in response to external stimuli or cellular events.et al.Additional control over RUNX1 stability and function is achieved by a range of post-translational mechanisms including phosphorylation, acetylation, and ubiquitination -mediated Ca2+ release, a faster rate of calcium removal from the cytosol by the SR Ca2+-ATPase (SERCA) and a higher SR content.Runx1-deficient and control cardiomyocytes, the proportion of PLN phosphorylated on Ser16 and Thr17 residues was increased in Runx1-deficient cardiomyocytes. This was accompanied by a parallel decrease in protein phosphatase 1, the phosphatase responsible for the dephosphorylation of PLN.2+ uptake into the SR which lowers end-diastolic cytosolic Ca2+ concentration and improves the relaxation of the heart during diastole.,2+ content is also increased, leading to augmented release of Ca2+ with each electrically stimulated transient and therefore improved contraction.,The improvement in function and myocardial architecture of mouse hearts with et al., into the protection afforded by Runx1-deficiency fit with other studies in the field where improvements in cardiomyocyte calcium handling can have a profound beneficial effect on cardiac structure and function.,,Runx1-deficient mice occurred in the absence of an effect on infarct size, another key determinant of systolic function after MI.Runx1-deficiency likely relates to the ability of viable cardiomyocytes to functionally compensate for cardiomyocyte death via preserving calcium handling rather than a direct effect of Runx1-deficiency on the salvage of ischaemic cardiomyocytes. Importantly and in agreement with mouse studies, several calcium-dependent genes were up-regulated in Runx1 knockout zebrafish hearts.The insights offered by McCarroll 2+ handling are unknown and require further study. Given the preponderance of Ca2+ dysregulation across cardiac pathologies, including diabetic and hypertensive heart disease,,Thus far, the direct mechanisms linking RUNX1 to changes in cardiomyocyte Ca2+ homeostasis may not be the exclusive mechanism underlying protective influence of RUNX1 deficiency on the heart. As a master transcription factor, RUNX1 has the potential to simultaneously influence several downstream signalling pathways which may also dictate cardiomyocyte phenotype and the global response of the heart to injury. Although the direct targets of RUNX1 in the heart have not been elucidated, RUNX1 has been demonstrated to interact with signalling pathways in other tissues that are implicated in cardioprotection and adverse cardiac remodelling.Improved Ca,2) have been shown to increase RUNX1 expressionRUNX1 is known to interact with signalling mediated by hypoxia-inducible factor 1-alpha (HIF-1\u03b1).,,,,TGF-\u03b2-mediated signalling is also linked to RUNX1 and implicated in cardiac remodelling. RUNX1 expression is activated by TGF-\u03b2 and several of the biological effects of TGF-\u03b2 stimulation have been shown to involve RUNX1 including myofibroblast differentiation and fibrosis.,,Another means by which RUNX1 can alter cellular function and response to injury is via interaction with microRNAs (miRNAs). miRNAs are small non-coding RNAs which post-transcriptionally modify gene expression by interacting with the 3\u02b9UTR of target mRNAs. As microRNAs can target hundreds of mRNA sequences and thus simultaneously affect several targets within the one pathway, small changes in their expression has the potential to amount to a significant biological effect.,,The miR-17-92 cluster is a further example of a group of miRNAs that are linked to both RUNX1 and cardiac pathology. The miRNAs in this cluster target the 3\u02b9UTR of RUNX1 to down-regulate its protein expression and are also themselves targeted by RUNX1 as part of a negative feedback loop.,,An interesting comparison can be made between the role of RUNX1 in skeletal and cardiac muscle post-injury and may shed light on potential RUNX1 targets in the heart. Both skeletal and cardiac myocytes have a primary contractile function and are thus equipped with highly organized arrangements of myofilaments and complex calcium signalling mechanisms to facilitate this.,The role of RUNX1 in proliferation and differentiation is well documented. In tissues such as the skin, intestine, mammary gland, and in the haematopoietic system RUNX1 participates in the regulation of stem cell quiescence by directing entry and exit from the cell cycle.,,,,in vitro co-culture model with neonatal rat ventricular cardiomyocytes, dedifferentiation, and proliferation of the adult cardiomyocytes coincided with an increase in RUNX1 expression, which was lost when the cardiomyocytes re-differentiated.,In the heart, RUNX1 may be similarly linked to cell differentiation. This may become important after cardiac injury because the cellular differentiation status of cardiomyocytes in the injured or stressed myocardium,,Transcription factors that regulate the balance between proliferation and differentiation are also of interest because of the centrality of these processes to tissue repair and regeneration. In many tissues, resident stem or progenitor cells can proliferate and differentiate to replace injured cells.Runx1-deficiency in addition to the loss of dystrophin, muscle mass was not maintained beyond 2 weeks, suggesting impaired regeneration of muscle fibres.Runx1-deficient mdx mice were found to have severe muscle deterioration and fibrosis, accompanied by an impaired exercise capacity and reduced evidence of regenerative fibres. In the same study, primary myoblasts with a RUNX1 deficiency showed reduced proliferation, G1 arrest and premature differentiation whereas, ectopic expression of RUNX1 in myoblasts was found to reduce differentiation.In the absence of dystrophin, the mice repeatedly undergo cycles of myonecrosis followed by regeneration which preserves muscle mass. However, when the mdx mice were developed to have a skeletal muscle ,,,In contrast to skeletal muscle, the heart has a very limited capacity to regenerate and this is evidenced by the permanent damage to the myocardium caused by infarction.Whilst RUNX1 has been identified to be a key player in zebrafish heart regeneration following cardiac injury,,,RUNX1 has also been shown to interact with the Hippo pathway, a key pathway linked to cardiac regeneration in neonatal as well as adult hearts.Runx1 mRNA expression is reported in non-cardiomyocyte cells following MI, with 14% of non-cardiomyocytes within the infarct zone expressing RUNX1 at day 1 post-MI and up to 26% and 35% of non-cardiomyocytes expressing RUNX1 within the infarct zone and border zone, respectively, by 2\u2009weeks post-MI.Whilst studies have focused on the function of RUNX1 within cardiomyocytes to date, a role for RUNX1 in other non-cardiomyocyte cells types may also exist. Other cell types within the myocardium include fibroblasts, endothelial cells, resident immune cells, and neural cells, each with their own role in cardiac physiology and disease. Interestingly, increased ,Runx1 deletion in alveolar epithelial cells had up-regulated NF-\u03baB signalling, augmented pulmonary inflammation and an earlier onset of death after pulmonary LPS exposure.,Runx1 with siRNA led to reduced up-regulation of IL-1\u03b2, IL-6, and the adhesion molecules VCAM1 and ICAM1 mRNA in response to treatment with TNF-\u03b1.in vitro the C-terminus of RUNX1 interacts with the p50 subunit of NF-\u03baB to co-transcriptionally activate the production of IL-6 in response to stimulation with LPS.,Many studies document a role for RUNX1 in the development, polarization, and function of the mammalian immune system. A full discussion of RUNX1 in inflammation and immunity is beyond the remit of this review and can be found elsewhere.Runx1-deficient embryos which exhibit defective vascular formation and suffer fatal haemorrhages in the CNS, pericardium, and peritoneum.,Runx1 in cultured human retinal microvasculature endothelial cells (HRMECs) decreased endothelial migration and proliferation.in vitro methodology used to study the angiogenic capacity of cultured cells, treatment of HRMECs with the RUNX1 inhibitor Ro5-3335 was associated with reduced tubular structure formation, indicating depressed angiogenic function.Like the other non-myocyte cell types resident in the heart, endothelial cells are gaining increasing attention for playing an active role in cardiomyocyte function and disease progression.,,in vitro angiogenic capacity of HUVECs.Paradoxically, RUNX1 has been shown to both directly and indirectly limit the expression of the potent pro-angiogenic factor VEGF.,In the injured heart, expansion of the vascular network through angiogenesis is a key response which protects against adverse remodelling and progression to heart failure.Heart failure remains a major global health and economic burden.,,Novel therapies aimed at targeting a master-regulator transcription factor such as RUNX1 may achieve a more efficacious therapeutic response by impacting on multiple downstream signalling pathways to mitigate the adverse cardiac remodelling that initiates heart failure. Given its involvement in systolic dysfunctionTranscription factors have historically been viewed as unlikely and challenging \u2018druggable\u2019 targets due to their pleiotropic actions in multiple cell types and systems during normal development and disease.Importantly, the small molecule benzodiazepine Ro5-3335 was identified as a disruptor of the CBF\u03b2\u2013RUNX interaction.et al.Illendula Accumulating evidence supports that RUNX1 is up-regulated at early time points in the heart in response to a range of cardiac pathologies. New developments in the field have demonstrated that RUNX1 activation in cardiomyocytes after MI is detrimental to systolic function and cardiac structure and have thus unveiled RUNX1 as an attractive novel target to mitigate adverse cardiac remodelling. Understanding of the role of RUNX1 in the heart is in its infancy and there are many pertinent questions to be asked about the identity of the downstream targets of RUNX1 in the heart. Crossing discipline boundaries to understand RUNX1 biology across different organs has offered insight into the potential functions of RUNX1, however, due to the strong context-dependent nature of RUNX1 further work is now needed to evaluate whether the effects of RUNX1 observed in other tissues translate into the cardiac context. This exploration should extend beyond cardiomyocytes to study the role of RUNX1 in other cardiac cell types in heart physiology and pathology. As a master transcription factor, RUNX1 has the potential to act across an entire network of signalling pathways. Unravelling the functional consequences of this network represents an exciting challenge with a translational potential.Conflict of interest: none declared.Funding was received from the British Heart Foundation, PhD studentship FS/15/64/32035 and Project grant PG/18/9/33548."}
+{"text": "Ixeris Sonchifolia (Bae.) Hance (ISH) extract on herpes simplex virus keratitis (HSK) in mice.To investigate the protective effect of A mouse model of HSK was established by inoculating 60 mice (60 right eyes) with herpes simplex virus type 1 (HSV-1) by corneal scratch. The other 15 mice as blank control only received corneal scratch but without HSV-1. From the 2nd day after the successful modeling, the experimental group was fed with ISH total flavonoids  orally, twice a day for 14\u2009days. The model group and control group were given the same amount of normal saline. The pathological changes of cornea were observed once a day by slit lamp microscopy combined with fluorescein staining. The corneal histopathological examination, the survival status and the serum levels of interleukin-2 (IL-2), IL-4 and interferon-gama (INF-\u03b3) were performed at the end of the experiment.The result showed that ISH could significantly improve the corneal lesion degree, increase mice survival rate, and markedly increase the levels of IL-2 and INF-\u03b3, reduce the levels of IL-4 in serum of mice.ISH could increase the anti-virus ability, promote the healing of corneal inflammation and alleviate the pathological damage of cornea, which suggested that ISH has a potential and valuable therapeutic effect on the HSK. Viral keratitis is an inflammation of cornea caused by the infection of viral pathogens, which is one of the most serious blinding diseases in the world . Viral kAt present, drug treatment is still the main cure method for HSK. In the past, the drugs commonly used antiviral eye drops, which is mainly the synthetic nucleoxirus drugs , 6. HoweIxeris Sonchifolia (Bae.) Hance. It mainly used to treat coronary heart disease in clinic [Kudiezi is the whole grass or root of the Compositae plant n clinic . Modern n clinic . In celln clinic . The stun clinic . In addin clinic , and inhn clinic . More imn clinic , anti-tun clinic , and antn clinic . Furthern clinic , sesquitn clinic , 19, sesn clinic , triterpn clinic \u201323 and eIn the study, we used the HSV-1 infected mice model to study the effect and potential mechanisms of ISH total flavonoids on HSK, which could be provide the theoretical basis for HSK therapy in clinic.Mouse interferon-gama , interleukin-2  and interleukin-6  were purchased from Shenzhen Jingmei Bioengineering Co., Ltd. . 1% Sodium fluorescein eye drops obtained from the preparation room of Xuanwu Hospital, Capital Medical University .Ixeris Sonchifolia (batch number: 20171121), a yellow brown dry powder, containing the total flavonoids of 98.7%, was purchased from Beijing Traditional Chinese Medicine Factory . The total flavonoids were obtained according to the reference of Chen et al. reported [Total flavonoids from reported , and thereported .50  was calculated. The TCID50 of the virus is 10\u20139.31/0.l\u2009mL, that is, 0.l\u2009mL per hole of the virus with titer of 10\u20139.31 can cause 50% cells to have obvious pathological changes. The HEK293T cell line was obtained from Cell Bank of Chinese Academy of Sciences (China), and culture in the medium of DMEM \u2009+\u200910% FBS .Standard herpes simplex virus type I (HSV-1) SM44 strain originated from Virus Seed Room of Virus Prevention and Control Institute, Chinese Center for Disease Control and Prevention. The virus was passed on for three generations in human embryonic renal epithelial cells (HEK293T) before use to be activated. The cytopathic changes were observed, and the virus titer TCIDSeventy-five adult male BALB/c mice (body weight 20\u2009\u00b1\u20092\u2009g) aged 6\u2009weeks were provided by the animal experimental center of Capital Medical University . All the mice were reared in SPF grade environment with the temperature and humidity of 24\u2009\u00b1\u20091\u2009\u00b0C and 50%\u2009\u00b1\u20095% under the 12\u2009h\u2009day/night cycle in the animal experimental center of Capital Medical University. Six mice were raised in one polyacrylic cage with free access to food and water, the mice were quarantined for 1\u2009week before the experiment use. All the mice were received humane care according to the terms of National Institutes of Health Guidelines of the USA  and the University ethical regulations of Capital Medical University.50 of 10\u20139.31/0.l\u2009mL onto the surface of the right eye cornea, and massaged the eyelids of the mice gently for 2\u2009min. While for the control group mice, dripped 5\u2009\u03bcL of DMEM without virus onto the surface of the right eye cornea, and massaged the eyelids of the mice gently for 2\u2009min.The HSK animal model establish process as follows: First, mice were anaesthetized by isoflurane inhalation. Use the sterile BD needle to mark out a \u201c#\u201d font in the epithelial layer of the right eye cornea under the microscope. For the model mice, dripped 5\u2009\u03bcL of the DMEM containing the virus with TCID2 asphyxiation using slow displacement of chamber air with compressed CO2 (25%/min).The completely animal experiment were performed at animal experimental center of Capital Medical University, and the experimental protocol was approved by animal care and use committee of Capital Medical University. Sixty modeling mice were randomly divided into 4 groups, 15 mice per group  according to the terms of the routine histopathological examination. The final stained sections were photographed under a light microscope (BX-50 Olympus) at 200\u00d7 magnification.The expressions of INF-\u03b3, IL-2 and IL-4 in serum of mice in each group were detected by ELISA kit according to the manufactory instructions of Shenzhen Jingmei Bioengineering Co., Ltd., .P\u2009<\u20090.05 and\u2009<\u20090.01 were regarded as statistically significant.The values were showed as mean\u2009\u00b1\u2009SD. All statistical comparisons were calculated by means of a one-way ANOVA test followed by Dunett\u2019s t-test with SPSS19.0 statistical software. 2 incubator for 24\u2009h and 36\u2009h respectively, to observe whether the HEK293T cells showed cytopathological changes (CPE). If HEK293T cells become large, round, grape-shape aggregation and float on the cell culture medium, it means the cell is CPE positive  every day, then placed the wet cotton swab into a EP tube (filled with 1\u2009mL DMEM culture medium) for blowing 6 times. Take 200\u2009\u03bcL corneal wipe solution to transplant into the culture flask of HEK293T cells, then cultured in 37\u2009\u00b0C, 5% COIn healthy control group, the corneal epithelial scratches of the mice was healed, the corneal showed smooth, and no abnormal changes were observed after 1\u2009day of the corneal scratches Fig.\u00a0a, c. In Next, we evaluated the degrees of the corneal lesion in each mice of each group. In healthy control group, the cornea of the mice were all normal and smooth, and all the mice were lived in the whole experiment. In model group, 1 mice was dead in the 7th day and 2 mice were dead in the 14th day (Fig.\u00a0The histophaological detection by H&E staining was showed in Fig.\u00a0\u03b3 and IL-2 were significantly decreased in the model group, while IL-4 was markedly increased (P\u2009<\u20090.01, Table \u03b3 and IL-2 were obviously increase in each ISH treated group, compared with the model group (P\u2009<\u20090.05, P\u2009<\u20090.01, Table P\u2009<\u20090.05, P\u2009<\u20090.01, Table The serum levels of inflammation factors were detected and showed in Table\u00a0HSK belongs to the category of \u201cJuxing Barrier\u201d in TCM. Its etiology and pathogenesis are mainly due to heat accumulation or Yin deficiency, wind-heat toxin, stagnation and persistence of fever, and finally lead to the eye disease , 29. CurRecently, many ophthalmologists try to find effective anti-HSV methods and drugs from traditional Chinese medicine. In order to develop new drugs with low toxicity, high efficiency and no drug resistance, the research of TCM has become a hotspot for disease treatment . The antCorneal fluorescein staining is a commonly used method in clinical examination of corneal diseases . Sodium In addition, IL-2 and IFN-\u03b3, the necessary inflammatory regulators, belongs to Th1 cytokines, which can enhance the cellular immune function, mediate the cellular immune response, and play an active role in antiviral and bacterial infection. IL-4 is the key factor to promote Th0 cells to differentiate into Th2 cells, but it, together with IL-13, inhibits the differentiation and function of Th1 cells. It is belongs to Th2 cytokines, which mainly participate in the acute hypersensitivity reaction, have auxiliary effect on all the antibodies synthesized by B-lymphocytes, have inhibitory effect on cell immunity, and mediate the immune response of the fluid. IL-4 can stimulate the proliferation of B cells, promote the expression of MHC II antigen and CD40, enhance the antigen ability of B cells, and promote the production of IgE in B cells. IFN-\u03b3 can inhibit the above biological functions of IL-4, and IL-4 can also inhibit the transcription of IFN-\u03b3 mRNA [In conclusion, ISH could increase the mice anti-virus ability, promote the healing of corneal inflammation, and alleviate the pathological damage of cornea, which indicated that ISH may be a potent and valuable agent for the therapy of HSK in futrue clinic."}
+{"text": "Spices are the esoteric food adjuncts that are used for enhancing the sensory quality of the food in Punjabi diets and add many health benefits. Estimating the intake of spices at the individual level is a challenging task as they are consumed in very small quantities as compared to other foods. The present study aimed to assess the intake and spices consumption level of spices among urban and rural households.A study was carried out among 100 households each from urban and rural areas from Ludhiana district of Punjab, India to collect the information regarding frequency of spice usage and portion sizes using a questionnaire. The information pertaining to sociodemographic characteristics of female respondents from urban and rural households were also collected. The commonly used 25 spices in Punjabi diets were selected to assess their dietary intake at the individual level among households.>dhal\u2009>\u2009curry preparations among urban and dhal\u2009>\u2009vegetable>curry preparation among rural households. Average amount of spices consumed by urban adult women was 10.04\u2009g per day which was higher as compared to spices consumed by rural adult women per day (7.68\u2009g).Spice consumption frequency was more in urban households in comparison to rural households. The maximum mean consumption frequency score among urban and rural households was observed for red chilli powder (5.00) and turmeric powder (5.00). Maximum percentage (76 and 72%) of urban and rural households preferred to use the unroasted form of spices, respectively. The highest mean intake and range was observed for red chilli powder (3.19\u2009g with range 0.35\u20135.23\u2009g) among urban women and (2.41\u2009g with range 0.25\u20133.75\u2009g) for rural women. Spice intake from individual dishes showed the maximum number of portion sizes for red chilli powder that were from vegetableThe study concluded that the urban households showed higher consumption of spices as compared to rural households thus assessing the quantifying intake of spices. Urban adult women consumed more spices per day as compared to rural women. Therefore, more encouragement for increased use of spices is required to reap various health benefits of spices in combating metabolic disorders. In the culinary arts, spices are the esoteric food adjuncts that are used for enhancing the sensory quality of the food. The leaf or the herbaceous part of a fresh plant used for flavoring the food preparation is often referred to as a culinary herb where as, any dried part of the plant is known as a spice . Thus, sIn the present study, an attempt was made to assess the intake and consumption level of spices among adult women of urban and rural households based on the frequency of spice usage and portion size of spice consumed.The study population consisted of selected 100 urban and 100 rural households in different areas of Ludhiana district of Punjab, India. The households belonged to different socioeconomic groups and to different religions. One day intake was noted from adult women from urban and rural households. The commonly used 25 spices in Punjabi diets, were selected to assess their dietary intake among households. Standard household measuring spoons that measure 1 teaspoon, 1/2 teaspoon and 1/4th teaspoon were used to standardize the weight of each selected whole or powdered form of spices as most of them are used in small quantities. Further, some of the spices used in a minute quantity were verified with an electronic balance.An interview schedule cum questionnaire was developed to elicit the information pertaining to the sociodemographic characteristics, the pattern of spice use and intake, frequency of usage, the quantity of spices in routine dishes in each household. The questionnaire was pretested in ten households and was found satisfactory for collecting the required information. The final questionnaire was prepared by undertaking a pilot study involving suitable urban and rural female respondents to ensure the validity of the questionnaire which was excluded from the final sample. The required data were collected using a pre-structured non-disguised questionnaire cum interview schedule from female respondents in the households, who were involved in a cooking activity to elicit information regarding the spice consumption as described in the questionnaire. An individual if does not cook most of their own food, they may not know all the food items contained in mixed dishes, therefore the food preparer was selected to provide information on items that added during cooking.dhal, vegetable and curry were also noted separately from adult women of urban and rural households.Spice intake pattern in urban and rural households was assessed based on the spice usage in the households which include the information regarding the type of spice used, intake and frequency of usage with options of \u2018daily\u2019, \u2018twice\u2019 or \u2018thrice\u2019 a week, weekly and occasionally options as described in the questionnaire. For the easy identification of various spices, common names were also mentioned in the questionnaire. Mean consumption frequency scores were also calculated by giving scores: daily (5), thrice a week (4), twice a week (3), weekly (2) and occasionally (1). For the spice intake, the detailed recipe was noted regarding the type and quantity of different spices added to routine dishes. The most frequently used spices in these dishes were identified by the number of households using them. For each meal consumed by responding women herself, name of the dishes and portion size of spices in individual dishes were elicited using a 24-h recall method. To calculate the portion size of the added spice consumed, the quantity of prepared dish consumed by an individual and number of portions obtained from that quantity was noted. One day 24-h recall method determined the quantity of spice intake by an individual based on the spice intake per portion size consumed from all dishes in 1\u00a0day. Spice intake per portion size of each individual dish consumed like p\u2009<\u20090.01, p\u2009<\u20090.05. For the analysis of data SPSS  and SAS  were used.The intake of individual spices was presented as frequency intake. The quantity of spices intake was expressed as mean\u2009\u00b1\u2009standard deviation (S.D), median, 90th percentile and ranges. Statistically, results were analyzed using Chi-square test of independence of attributes. Wilcoxon-Mann-Whitney test was used to compare the mean consumption frequency of spices among the adult women of urban and rural households. Results were considered statistically significant at In recent times, consumption frequency and measurement of dietary intake of spices is gaining much significance due to various phytochemicals and presence of antioxidant potential in spices that have been recognized to have health-promoting benefits and protective role against chronic diseases.The sociodemographic characteristics of female respondents from urban and rural households is given in Table\u00a0The consumption frequency of spices among urban and rural households is shown in Table\u00a0p\u2009<\u20090.01) higher among urban households for cumin seeds, asafoetida, black pepper, gooseberry powder, mustard seeds, pomegranate seeds, dill, nigella, cinnamon and saffron when compared to rural households. The mean frequency score of bay leaf, black salt, black cardamom, carom seeds, green cardamom, fennel seeds, coriander seeds, dry mango powder and clove showed non-significant difference among the adult women of urban and rural households.The mean consumption frequency score of major spices has been depicted in Table\u00a0p\u2009<\u20090.05) was found in using a different form of spices namely green cardamom, black pepper, asafoetida, cinnamon, fenugreek seeds, coriander seeds, bay leaf, clove, carom seeds and black cardamom among urban and rural households. The overall result, it showed that a maximum of 76% of urban and 72% of rural households preferred to use the unroasted form of spices followed by 19% of urban and 21% of rural households using roasted form of spices and remaining using both roasted and unroasted form of spices.The form of spices used among households is presented in the Table\u00a0p\u2009<\u20090.01 level of significance. The percent of spice median intakes of spices representing below 1\u2009g were 72 and 89% of urban and rural median intakes, respectively. Out of 18, 10 and 7 spices among urban and rural were having 90th percentile above 1\u2009g, respectively. The highest 90th percentile value was observed for red chilli powder (4.41\u2009g) among urban and turmeric powder (3.23\u2009g) among rural. Overall, an average adult woman consumed 10.04\u2009g of spices per day as compared to 7.68\u2009g per day for rural women indicating higher consumption of spices among urban households.Spice intake among adult women based on the portion size and quantity of individual spice consumed from all dishes and foods expressed as mean, median, 90th percentile levels and ranges are presented in Table\u00a0The distribution of the level of spice intake based on portion sizes is depicted in the Table\u00a0dhal, vegetable and curry were evaluated given in the Tables\u00a0Dhal (legume preparation), vegetable (dry vegetables) and curry . Maximum number of portion sizes consumed were highest from dhal followed by vegetable and curry among rural households.The spice intake from individual dishes like dhal among urban households and turmeric powder (1.04) from dhal among rural households elicited in Table dhal were red chilli powder, turmeric powder, mustard seeds, carom seeds, cumin seeds, garam masala, black pepper and asafoetida among urban and rural households. Median intakes above 0.5\u2009g were observed for red chilli powder and turmeric powder among urban households while red chilli powder, turmeric powder and mustard seeds among rural households. The significant difference was obtained for turmeric powder, mustard seeds, carom seeds, black pepper and garam masala intake among urban and rural households (p\u2009<\u20090.05). While, red chilli powder, asafoetida, cumin seeds and dry mango powder showed a non-significant difference between both households. The highest 90th percentile intake level was observed for turmeric powder 1.66 and 2.71 from dhal among urban and rural households, respectively.Mean intakes were highest for red chilli powder (1.88\u2009g) from Data on the intake of spices from vegetables was depicted in Table rajmah, black channa, curry, etc., their spice intake has been presented in Table curry preparation was highest among urban (1.08\u2009g) and rural (1.12\u2009g) households. The non-significant difference was seen among all spices mentioned with exception of red chilli powder and garam masala, which showed a significant difference (p\u2009<\u20090.05) among urban and rural households. Median values obtained above 0.60\u2009g were observed by red chilli powder, turmeric powder, carom seeds, asafoetida, cumin seeds, coriander seeds, black pepper and garam masala among urban households while red chilli powder, turmeric powder, carom seeds, asafoetida and garam masala among rural households. The highest 90th percentile of 1.91 and 1.89\u2009g for turmeric powder among urban and rural households, respectively.Another routinely prepared dishes like  are considered as the main contributor of spices apart from other dishes in 1\u00a0day intake. A maximum number of portion sizes for red chilli powder and turmeric were from vegetables>dhal\u2009>\u2009curry preparation among urban households. While among rural households the maximum number of portion sizes were from dhal\u2009>\u2009vegetables>curry preparation for red chilli powder and turmeric powder.Legumes and vegetables In Indian cuisine, the usage and consumption of spices are mainly due to their extrinsic flavour. Various methods such as food frequency questionnaires supplemented with weighed records, dietary recall method, and portion size estimation were used in previous studies , 8. The lassi and curds during summers and sprinkled on salads. Carom and cumin seeds are frequently used in vegetable tadkas and paranthas among both households. In Norway, it was observed that out of 27 different herbs and spices investigated only eight were consumed by one-third of the population which indicated the lower consumption of spices [The study showed that out of 25 spices studied, most frequently consumed by more than 80 households were 12 and 9 spices among urban and rural households, respectively. Earlier studies in India also showed that consumption frequency of turmeric powder and red chilli powder was higher than most of the other spices which are consistent with the observations in the present study . Black sf spices . Ferrucif spices .The usage form of spices in the households also varied indicating that the unroasted form of spices consumed by the majority of urban and rural households. Generally, spices preferred for roasting are black pepper, asafoetida, carom seeds, cumin seeds, fenugreek seeds, mustard seeds, cinnamon, clove and black cardamom during food preparations. Susheela stated that some spices are processed for their microbial stability and removal of extraneous matter and roasting is one of the cooking processes to release characteristic flavour volatiles and undesirable particles . Moreovegaram masala (33.3%), coriander (33.3%) and turmeric powder (28.6%) in New Delhi. While in Mumbai, chilli powder (58.3%) had the highest median per capita consumption (g/month/person), followed by turmeric powder (21.7%) and cumin seeds (20.0%). Trivandrum was characterized by high consumption (g/month/person) of chilli powder (166.7%) coriander (102.0%) and ginger (373%). Further study revealed that the per capita monthly median intake level of 0.17\u20134.6 and 3.1\u2009g for cinnamon and cloves, respectively in different regions of India which were found to be higher than stated in the present study [Spice intake determination is being acknowledged as they possess bioactive compounds and antioxidant properties. Frequency data of intake together with portion size estimations provided a good quantitative estimation of spice intake at individual level rather than opting for the frequency of spice intake alone. The spice intake varies substantially between different countries, states, geographical regions within the same country possessing different dietary habits and patterns and cuisines within the same region. At an individual level, spice intake measurement is a tough and challenging task than estimating the intake of staple foods like cereals and other foods that are consumed in large quantities daily. Sherman and Hash reviewed through traditional cookbooks which revealed the mean number of spices used in 36 countries were 6.5 and 9.3 spices through vegetable and meat-based recipes in India while in European countries mean number of spices ranged from 1.6 to 4.5 and 0.6 to 4.2 spices through meat and vegetable based recipes, respectively . The meant study . This maoriander 2.0% and owder 21.% and cum powder 2.6% in Nent study . In mostnt study . Severaloriander 2.0% and nt study . Similarin seeds .0%. Trivnt study  while innt study .curry which is prepared daily among all households in Southern India. Further, the highest 90th and 97th percentile values for chillies  were observed from chutney and dhal [These observations assume relevance for quantifying spice intake since all spices are not consumed on daily basis and intake of individual spices varied with frequency of consumption of dishes. Dishes are considered as main contributor of spices on daily basis. In the present study, intake portion size of spices was estimated not herbs and it depends upon the number of spices used and consumed on a daily basis as monthly intake could not provide relevant results. An average portion size intake of total spices and herbs from habitual dishes which ranged from 4.9\u2009g to 26.1\u2009g in Thailand . Turmeriand dhal . These oThe intake levels of spices were relatively much lower than the other foods. It does not necessarily mean that spices are of little value. It is pertinent to mention that spices do not only add flavor and taste but also have high polyphenolic content and antioxidant potential of vital importance. The frequency of spice intake and portion size at the individual level of adult women in urban and rural households will provide a quantitative estimate of spice intake. The present study conducted in Ludhiana district of Punjab (India) showed the most frequently consumed spices among rural and urban households in Punjabi diets were red chilli powder, turmeric powder, cumin seeds, carom seeds, black pepper, asafoetida, green cardamom, black salt, fennel seeds and coriander seeds. The spice consumption was higher in urban adult women as compared to rural adult women. Further studies are required to explore the importance and intake of spices."}
+{"text": "Different sensor architectures were evaluated in a broad range of pH values in a Britton-Robinson (BR) buffer using electrochemical techniques, chronoamperometry (CA), and differential pulse voltammetry (DPV), to determine the optimum sensor configuration for 5-ASA sensing. Under optimal conditions, the best analytical performance was obtained with CNT/PMBDES/GCE in 0.04 M BR buffer pH 7.0 in the range 5\u2013100 \u00b5M 5-ASA using the DPV method, with an excellent sensitivity of 9.84 \u03bcA cm\u22122 \u03bcM\u22121  and a detection limit (LOD) (3\u03c3/slope) of 7.7 nM, outclassing most similar sensors found in the literature. The sensitivity of the same sensor obtained in CA (1.33 \u03bcA cm\u22122 \u03bcM\u22121) under optimal conditions  was lower than that obtained by DPV. Simultaneous detection of 5-ASA and its analogue, acetaminophen (APAP), was successfully realized, showing a catalytic effect towards the electro-oxidation of both analytes, lowering their oxidation overpotential, and enhancing the oxidation peak currents and peak-to-peak separation as compared with the unmodified electrode. The proposed method is simple, sensitive, easy to apply, and economical for routine analysis.A novel hybrid composite of conductive poly(methylene blue) (PMB) and carbon nanotubes (CNT) was prepared for the detection of 5-aminosalicylic acid (5-ASA). Electrosynthesis of PMB with glassy carbon electrode (GCE) or with carbon nanotube modified GCE was done in ethaline deep eutectic solvent of choline chloride mixed with ethylene glycol and a 10%  Deep eutectic solvents (DES) are generally composed of at least one hydrogen bond donor (HBD) and a hydrogen bond acceptor (HBA). This mixture particularly resembles a self-melting property as, when put in contact, they form an eutectic phase with a melting point lower than that of each component individually ,2. DES hRecently, multiple ethylene glycol (EG)-based eutectic solvents were synthesized for electrochemical applications . The phyConducting polymers, especially electroactive polymers, have been used, in recent years, to develop new polymeric materials, with significantly good electrical and optical properties and high conductivity/weight ratio that exhibit biodegradable, biocompatible, and porous properties ,10,11. IAnother strategy to obtain highly performing electroconductive platforms is the integration of nanomaterials to form polymer composites. Nanomaterials such as carbon nanotubes, graphene, metallic nanoparticles, or magnetic particles have been introduced in the synthesis of polymer-based materials to obtain hybrid composites with synergetic properties . The use5-Aminosalicylic acid  is one of the non-steroidal anti-inflammatory drugs, structurally related to both acetaminophen and acetyl salicylic acid. It is widely prescribed for the treatment of inflammatory bowel disease (IBD) such as ulcerative colitis and Crohn\u2019s disease and prevention of inflammation-associated colorectal cancer (CRC) ,33. 5-ASDES) combined with multiwalled carbon nanotubes (CNT). First, the oxidation mechanism of 5-ASA was determined, and the experimental conditions optimized for electrochemical detection by chronoamperometry (CA) and differential pulse voltammetry (DPV). Various electrode architectures based on PMBDES and CNT were evaluated with only one, or two components, in order to evaluate the contribution of each component and to find the optimal electrode configuration for 5-ASA determination in pharmaceutical samples and simultaneously with its analogue, acetaminophen.In this work, an electrochemical method was developed and successfully applied for the detection of 5-ASA by using an electrochemical platform composed of a nanostructured phenazine polymer electrochemically synthesized in ethaline  was used for the preparation of all solutions.5-Sminosalicylic acid (5-ASA), acetaminophen (APAP), methylene blue (MB), choline chloride, ethylene glycol, potassium chloride, sodium monobasic phosphate, sodium dibasic phosphate, sodium hydroxide, acetic, boric, hydrochloric, perchloric, and phosphoric acid were purchased from Sigma-Aldrich .For the electrochemical characterization of the modified electrodes, the supporting electrolyte was 0.04 M Britton Robinson (BR) buffer solution, pH 7.0. All experiments were carried out at room temperature (25 \u00b1 1 \u00b0C).2) as the working electrode, a Pt wire counter electrode, and an Ag/AgCl (3.0 M KCl) reference electrode , using a potentiostat/galvanostat \u00b5-Autolab system . Before each use, the surface of the GCE was cleaned with diamond spray and polishing paper .Electrochemical experiments were performed in a three-electrode cell (2 mL), containing the glassy carbon electrode  at room temperature.DES) modified GCE, was prepared, in accordance with the optimized procedure reported in our previous work  (\u03bcM) \u2013 0.13 (R2 = 0.9998). The detection limit (LOD) was calculated as three times the standard deviation of the calibration plot divided by the slope of the calibration plot [\u22122 \u03bcM\u22121, by CNT/PMBDES/GCE sensor.As can be seen in mer film b with thion plot , obtainiDES/CNT/GCE and CNT/PMBDES/GCE sensors, which exhibited the best analytical performance using the fixed potential technique. A sharp and well-defined oxidation peak appears at the peak potential of +0.17 and + 0.19 V in the presence of 5-ASA with PMBDES/CNT/GCE and CNT/PMBDES/GCE, respectively. DES/CNT/GCE and CNT/PMBDES/GCE in BR buffer (pH 7.0). A linear range of 5\u2013100 \u00b5M was obtained for 5-ASA with sensitivities of 3.85 \u03bcA cm\u22122 \u03bcM\u22121  with PMBDES/CNT/GCE and 9.84 \u03bcA cm\u22122 \u03bcM\u22121  with CNT/PMBDES/GCE. The resulting detection limits for 5-ASA were 58.2 and 7.7 nM with PMBDES/CNT/GCE and CNT/PMBDES/GCE, respectively.The quantification of 5-ASA by DPV was carried out in a BR buffer solution, pH 7.0, as supporting electrolyte with PMBDES/GCE sensor showed an overall superior performance to those found in the literature, presenting a significantly lower detection limit with high sensitivity over a wide linear dynamic range. Although the sensor based on CuW NSs/GCE [\u20131 cm\u20132) and peak potential value (+0.33 V). Additionally, the analysis time of our voltammetric sensors is ca. 20 times lower than that of the previously reported sensor (2100 s).The analytical parameters of the developed 5-ASA electrochemical sensors were compared with other reported sensors,  NSs/GCE  had a wiDES/CNT/GCE and 1.6% for CNT/PMBDES/GCE using the CA method and 2.2% for PMBDES/CNT/GCE and 4.9% for CNT/PMBDES/GCE by means of DPV. The stability of both hybrid sensors was evaluated in two steps. First, 30 consecutive measurements of 50.0 \u03bcM 5-ASA were performed, both platforms showed excellent operational and conservation stability, maintaining their electrochemical response (only a 6% decrease). Second, multiple scans in BR buffer were performed with CNT/PMBDES/GCE, the sensitivity decreasing only to 93%. All modified electrodes were stored at 4 \u00b0C.The repeatability of the analytical methods employing the 5-ASA sensors was examined by determining the relative standard deviations of five responses, obtaining 2.5% for PMBDES/GCE) in the presence of its structural analogue APAP, and for real sample analysis due to its advantages such as ca. seven-fold improved sensitivity as compared with the CA technique, the speed of measurement (100 s), lower detection limit (7.7 nM), low background current, and easy signal processing.DPV was selected for the quantification of 5-ASA using the sensor with the best analytical performance  to achieve the accurate simultaneous determination of 5-ASA and APAP in their mixture. DES/GCE for different concentrations (10\u201370 \u00b5M) of 5-ASA in the presence of 10 \u00b5M APAP, while \u22122 \u03bcM\u22121) being very close to that obtained in standard conditions (5.7% decrease).CNT/PMB\u22122 \u03bcM\u22121 and low detection limit (2.9 \u00b5M) was obtained. The potential value (+0.35 V) corresponding to the APAP oxidation peak value is even lower in the BR buffer (pH 7.0) than that in 0.1 M KCl reported in one of our previous studies [DES\u2013CNT film is very sensitive towards simultaneous detection of both analytes.Furthermore, by keeping the 5-ASA concentration constant, a calibration plot for APAP with very good sensitivity of 12.5 \u03bcA cm studies . This shDES/GCE was used under optimized conditions for the analysis of pharmaceutical formulations . After sample preparation and adequate dilution steps, as previously described in the Materials and Methods Section, the sensor was employed for both CA , recovery values were 101.2% \u00b1 2.7% for APAP detection in the presence of 50 \u00b5M 5-ASA constant concentration. For 5-ASA detection from Pentasa\u00ae tablets in the presence of 50 \u00b5M APAP, the recovery values were 102.0% \u00b1 3.3%. The apparent recoveries indicate that the proposed electrochemical sensor is efficient for one component determination, and also for simultaneous analysis of 5-ASA and APAP, having an excellent level of reliability for practical applications.In order to further test the application to different pharmaceutical formulations, the sensor was employed for APAP determination. In Coldrex Max GripDES/GCE electrochemical sensor provides a new, sensitive and selective method for 5-aminosalicylic acid (5-ASA) detection, by utilizing the unique properties of phenazine poly(methylene blue) film synthesized electrochemically in deep eutectic solvents, such as high specific surface area and electrocatalytic properties. The sensing properties were greatly improved by combining the polymer film with carbon nanotubes. The pH of the BR supporting electrolyte and the applied potential in the CA method were optimized and several sensing architectures based on PMBDES and CNT were tested for 5-ASA detection. The CNT/PMBDES/GCE sensor was applied to the simultaneous detection of 5-ASA and acetaminophen; the sensitivity towards 5-ASA decreased by only 5.7% in the presence of APAP. The possible application and robustness of this method were confirmed by the determination of 5-ASA in a drug tablet, without any prior complex sample pretreatment or preconcentration at the electrode surface, with CNT/PMBDES/GCE, in which recovery values between 97.8% and 105.2% were obtained, demonstrating that this method is promising for application to biological samples.In this work, the developed CNT/PMB"}
+{"text": "IL-1RII expression is regulated by NFAT via its interaction with Foxp3. The NFAT/FOXP3 complex binds to the IL-1RII promoter and is critical for its transcription. Additionally, IL-1RII expression is dysregulated in CD4+ T cells from patients with rheumatoid arthritis. Thus, differential expression of IL-1Rs on activated CD4+ T cells defines unique immunological features and a novel molecular mechanism underlies IL-1RII expression. These findings shed light on the modulatory effects of IL-1RII on Th17 responses.Derived from a common precursor cell, the balance between Th17 and Treg cells must be maintained within immune system to prevent autoimmune diseases. IL-1\u03b2-mediated IL-1 receptor (IL-1R) signaling is essential for Th17-cell biology. Fine-tuning of IL-1R signaling is controlled by two receptors, IL-1RI and IL-RII, IL-1R accessory protein, and IL-1R antagonist. We demonstrate that the decoy receptor, IL-1RII, is important for regulating IL-17 responses in TCR-stimulated CD4 Interleukin-1 (IL-1) consists of two distinct forms (IL-1\u03b1 and IL-1\u03b2) and is a master cytokine of local and systemic inflammation\u00a0. PrimariIn human T-cell immunity, IL-1\u03b2 has been identified as an essential cytokine with a role similar to that played by IL-6 in mice for Th17 differentiation, and is also important for expansion, in vivo survival, and effector function of IL-17-producing T cells\u00a0. More refr) cells upregulate IL-1RII to attenuate their IL-1-dependent responses\u00a0. Dimerization of the IL-1R1 and IL-1RAcP cytoplasmic Toll/IL-1R (TIR) domains initiates a signaling cascade through recruitment of adapter proteins\u00a0. The decesponses\u00a0, suggest+ memory CD4+ T cells compared to IL-1RI- memory CD4+ T cells. Further, the negative regulatory role of IL-1RII was further evidenced by the significant augmentation of IL-17 production by IL-1RI+ memory CD4+ T cells in response to IL-1\u03b2 and TCR stimulation after treatment with neutralizing IL-1RII antibody\u00a0 and foxp3+ Treg cells might be not exactly overlapped, foxp3+ cells were markedly removed by our depletion protocol . As seen in +IL-1RII- and IL-1RI+IL-1RII+ had a Th17-associlated phenotype (CD161+CCR6+), whereas IL-1RI-IL-1RII- cells mainly consist of Th1 (CD161-CXCR3+CCR6-) and non-Th1/17 subsets. Moreover, a higher frequency of IL-1RI+IL-1RII+ cells showed a phenotype typical of ex-Th17 cells (CD161+CXCR3+CCR6+), whereas the IL-1RI+IL-1RII- subset included more cells with the Th17 phenotype (CD161+CXCR3-CCR6+). AlthougI- cells . IntraceI- cells . Our fin+ T cells preferentially express IL-1RII , an inhibitor of calcineurin, selectively represses the frequency of IL-1RII+ cells among TCR-induced IL-1RI+ memory CD4+ T cells in a dose-dependent manner -conjugated VIVIT, a selective and potent inhibitor of calcineurin/NFAT interaction, and stimulated with anti-CD3/CD28 mAbs-coated beads for 24 hr. As seen in IL-1RII gene expression. Consistent with a previous report\u00a0. Since both TFs are critical for IL-1RII expression , we next complex , as desc complex . Our dat complex . Thus, tIL-1RII gene, in silico screening was conducted for potential NFAT and FOXP3-binding sites in the minimal promoter of the human IL-1RII gene using PROMO 3.0 software, an algorithm that predicts nuclear-receptor-binding elements\u00a0 using lentiviral vector transduction  in the CNS region of IL-1RII promoter was significantly enriched upon TCR stimulation, whereas Foxp3 was observed to bind a slight distant from the CNS region (Foxp3 B2: \u2212425 to \u2212418) of IL-1RII promoter  and peripheral blood (14.49 \u00b1 1.20%) of RA patients compared with counterpart cells  from age-match healthy controls (HCs)  of IL-1\u03b2-mediated IL-17 production in response to TCR stimulation compared with HCs (2.4 fold-increase)  . Like itpatients . As a cothan HCs . Given teg cells . As seenncrease)  because izing Ab . This da+ effector T cells that elicit protective immune responses against extracellular bacterial and fungal pathogens\u00a0  . Purvis oduction\u00a0. Our finsiveness .+ T cells  in its promoter. Of note, potentially one Foxp3 and two consecutive NFAT binding elements are closely located at positions \u22121236 to \u22121230 and \u22121209 to \u22121188, respectively, near the CNS region  with adjacent binding sites for the two transcription factors\u00a0, CD45RA-FoxP3high (effector Treg), and CD45RA-FoxP3low (Foxp3-expressing non-Tregs) CD4+ T cells. Of these, the CD45RA-FoxP3lowCD4+ T cell subset contains cells with Th17 potential\u00a0, respectively. In some experiments, non-Treg memory CD4+ T cells were obtained by depletion of Tregs from previously purified memory CD4+ T cells using CD4+CD25+CD127dim/- Regulatory T cells isolation kit II .The study protocols were approved by the institutional review board (IRB) of Seoul National University Hospital and Chungnam National University Hospital . Peripheral blood of RA patients and healthy controls (HCs) was drawn after obtaining written, informed consent. The methods were performed in accordance with the approved guidelines. Peripheral blood mononuclear cells (PBMCs) were isolated from blood of RA patients and HCs by density gradient centrifugation method . Naive and memory CD4To generate Foxp3-expressing Jurkat cell line, the lentiviral vector for expression of human FoxP3 (pLEF-puro-FoxP3) was prepared as follows. pLEF-puro was created from biscistronic lentiviral vector, pLECE3, which harbors EF1alpha promoter-driven expression cassette and CMV promoter-GFP expression cassette\u00a0 , by rep+ T cells were cultured in serum-free X-VIVO 10 medium  and RPMI 1640 medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and 1% L-glutamine, respectively. Cells were seeded at 2.5\u00a0\u00d7\u00a0104 into 96-well U bottom plate and stimulated with anti-CD3/CD28-coated microbeads  for 5 or 7 days in the absence or presence of the indicated cytokines or neutralizing antibodies (Abs); recombinant human (rh) IL-1\u03b2 (5 ng/ml), rhIL-6 (25 ng/ml), rhIL-23 (25 ng/ml), rhTGF-\u03b2 , rhIL-2 , anti-human IL-1RII Ab, or mouse IgG2A . In some experiments, cells were stimulated with anti-CD3/CD28-coated microbeads with peptide inhibitors, chemical inhibitors, or reagents: dNP2-VIVIT and dNP2-VEET peptides were synthesized by using a solid-phase synthesis and purified by high performance liquid chromatography  as previously reported\u00a0, PE-Cy7-anti-CD45RA, and APC-anti-CD4 , followed by cell-sorting into IL-1RI+IL-1RII-, IL-1RI+IL-1RII+, and IL-1RI-IL-1RII- cells using FACSAria II (BD Bioscience).Purified naive and memory CD4reported\u00a0. The pepreported\u00a0, CyclospPBMC or cultured T cells were stained for 30 min at 4\u00b0C with following fluorochrome-conjugated Abs: APC-Cy7-anti-CD3, v500-anti-CD4, PE-Cy5-anti-CD25, APC-anti-CD25, PE-Cy7-anti-CD45RA, BV421-anti-CD161, (six from BD Bioscience), FITC-anti-GARP , PE-Cy7-anti-GITR, APC-Cy7-anti-CD73, BV421-anti-CD39, PerCP-Cy5.5-anti-CTLA-4, PE-Cy7-anti-CXCR3 , PE-anti-IL-1RI, APC-anti-IL-1RII, and FITC-anti-IL-1RII (three from R and D systems). For intracellular cytokine staining (ICS), cultured T cells were re-stimulated for 6 hr with PMA (50 ng/ml) and ionomycin (1 \u03bcg/ml) in the presence of BFA for last 4 hr, followed by staining with PE-anti-IL-1RI and FITC-anti-IL-1RII Abs. The stained cells were fixed and permeabilized using Fix/Perm buffer (BioLegend), followed by staining with anti-IL-17A, anti-IFN-\u03b3 (both from eBioscience), and anti-Foxp3 (Biolegend) Abs. The cells were acquired using a BD LSRFortessa (BD Bioscience) and analyzed using FlowJo software .The amounts of IL-17, IFN-\u03b3, and IL-10 in culture supernatant were quantified using commercially available human ELISA kits according to manufacturer's instructions (Both IL-17A ELISA and IL-10 ELISA kits from eBioscience and Human IFN-\u03b3 ELISA MAX Deluxe from BioLegend). Measurement of OD  was performed using Infinite M200 Pro Multimode microplate reader .https://www.ncbi.nlm.nih.gov/tools/primer-blast/) or adopted from previously published primer sequences; Foxp3, 5\u2019-GCACCTTCCCAAATCCCAGT-3\u2019 and 5\u2019-GGCCACTTGCAGACACCAT-3\u2019; IL-1RI, 5\u2019- GTGATTGTGAGCCCAGCTA-3\u2019 and 5\u2019-TGTTTGCAGGATTTTCCACA-3\u2019; IL-1RII, 5\u2019-CCTTGTCAACCTCTGGGGTA-3, and 5\u2019-ACAGCGGTAATAGCCAGCAT-3\u2019; IL-10, 5\u2019- AGCTCCAAGAGAAAGGCATCT-3, and 5\u2019- TATAGAGTCGCCACCCTGATGT-3\u2019; IL-22, 5\u2019- GCTTGACAAGTCCAACTTCCA-3, and 5\u2019- GCTCACTCATACTGACTCCGTG-3\u2019; IL-17, 5\u2019- AACTCATCCATCCCCAGTTG-3, and 5\u2019- GAGGACCTTTTGGGATTGGT-3\u2019; IFN-\u03b3, 5\u2019- TTTGGGTTCTCTTGGCTGTT-3, and 5\u2019- TCTTTTGGATGCTCTGGTCA-3\u2019. The levels of gene expression were normalized to the expression of ACTINB. The comparative Ct method (\u0394\u0394Ct) was used for quantification of gene expression.Total RNA was extracted from purified or cultured T cells with TRIzol reagent (Invitrogen) and cDNA was synthesized using GoScript Reverse Transcription System . Real-time quantitative RT-PCR was performed on CFX system  using SYBR green master mix (Bio-Rad). Primers were designed with Primer designing tool-NCBI . Conserved noncoding sequence (CNS) was analyzed using VISTA tool (http://genome.lbl.gov/vista/index.shtml). The promoter region (\u22121311 to +100) of human IL-1RII (Gene ID: 7850) gene containing both putative NFAT/FOXP3 binding motif and CNS (\u22121306 to \u22121200) was cloned into pGL4.10 basic luciferase reporter vector (pGL4/IL-1RII-a1414). Mutant IL-1RII reporter plasmid  was generated with QuikChange II Site-Directed Mutagenesis Kit . Two truncated reporter vectors, pGL4/IL-1RII-a814 and pGL4/IL-1RII-a215 including \u2212714 to +100 and \u2212115 to +100 of the promoter, respectively, were also cloned. Plasmids were transfected into Jurkat cells using NEON electroporation system , followed manufacturer\u2019s instructions. Foxp3-expressing Jurkat cells or control Jurkat cells were transfected with the indicated IL-1RII promoter cloned luciferase vector and internal control Renilla pGL4.74 by NEON electroporation system (Life Technology). After resting for 5 hr, transfected cells were stimulated with PMA and Ionomycin for 48 hr. Cells were lysed and luminescence was detected using Dual-Luciferase Reporter Assay system (Promega) followed manufacturer\u2019s instructions.Putative NFAT and Foxp3-binding sites were screened using Promo 3.0 software  and soluble anti-CD28  Ab for 24 hr. Cells were cross-linked using 1% formaldehyde for 10 min and lysed with 1% SDS-lysis buffer. ChIP assay were performed using commercially available Ez-ChIP assay kit  according to manufacturer\u2019s instructions. DNA-bound proteins were immunoprecipitated using anti-NFATc2  or anti-Foxp3 (Thermo Fisher Scientific) Ab. Co-precipitated DNA were purified through NucleoSpin gDNA clean-up kit  and used as a template for real-time qRT-PCR using primers as following; NFAT_B1, 5\u2019- ATTTACCCTTTGCTCAACAAACTCC- 3\u2019 and 5\u2019- AGTCCAGACATTTGAGGATGGGG-3\u2019; NFAT_B2, 5\u2019- GAGAGGTCGCAGGGGATGAT- 3\u2019 and 5\u2019- TCTGAGAACTCATGGTCCTGG-3\u2019; NFAT_B3, 5\u2019- GGTGATCATGTACTCAGACCCA- 3\u2019 and 5\u2019-GGGAGCTGGGATTTCCTAACC-3\u2019; NFAT_BC (binding control), 5\u2019- TGCTCTAACTATGCAATGGCT- 3\u2019 and 5\u2019- TGATCAGAGCTCTCTTCTGATTATT-3\u2019; Foxp3_B1, 5\u2019- TAGGGTGGGTGGTTGAGGG - 3\u2019 and 5\u2019- GAAGATAAAACCTCAGCGTCACC \u22123\u2019; Foxp3_B2, 5\u2019- ATTTACCCTTTGCTCAACAAACTCC- 3\u2019 and 5\u2019- AGTCCAGACATTTGAGGATGGGG-3\u2019; Foxp3_B3, 5\u2019- AGAGAGGAGCAACCAACAACA- 3\u2019 and 5\u2019-CTTCTGAAAGTGGGAATCCAGC-3\u2019; Foxp3_BC (binding control), 5\u2019- AGATTCTACTAGACAAGGGCACAG- 3\u2019 and 5\u2019-CATACAAACCAACTGTTCTCTCCC-3\u2019\u00a0 or and Microsoft Excel 2016 as indicated in the figure legends. p-Values of less than 0.05 considered statistically significant.Two-tailed paired or unpaired  In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Acceptance summary:+ T cells is mediated by NFAT/Foxp3 and regulates IL-1\u03b2-dependent IL-17 responses in humans. In addition, TCR stimulation-mediated IL-1RII expression was decreased in memory CD4+ T cells in synovial fluid of rheumatoid arthritis patients.IL-1\u03b2 is known to mediate human Th17 responses. This study clearly shows that expression of a IL-1 decoy receptor, IL-1RII, in IL-17-producing memory CD4Decision letter after peer review:eLife. Your article has been reviewed by two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Satyajit Rath as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Amit Awasthi (Reviewer #2).Thank you for submitting your article \"Induction of the IL-1RII Decoy Receptor by NFAT/FOXP3 Blocks IL-1\u03b2-Dependent Response of Th17 Cells\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.eLife\". Please let us know if you would like to pursue this option. As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv  along with this decision letter and a formal designation that the manuscript is \"in revision at Summary:+ T cells is mediated by NFAT/Foxp3 and regulates IL-17 responses in humans. First, the authors confirmed that IL-1\u03b2 enhances IL-17 responses in human memory CD4+ T cells. Then, the authors showed that CD45RA-CD4+ memory T cells express IL-1RI. TCR stimulation of memory CD4+ T cells increased IL-1RI expression at the early time point (within 12h) and then increased IL-1RII expression (after 36h). In TCR-stimulated (36h) memory T cells, IL-1\u03b2 response was somewhat decreased. Treg-depleted memory CD4+ T cells expressed IL-1RII after TCR stimulation, and these cells also expressed Treg markers including Foxp3. Then, the authors used several inhibitors and activators and showed that NFAT and Foxp3 are required for the induction of IL-1RII. Co-operation of NFAT and Foxp3 for IL-1RII gene activation was demonstrated by luciferase assay. in vitro stimulation of IL-1RI+IL-1RII+ and IL-1RI+IL-1RII- T cells with IL-1\u03b2 showed that the frequency of IL-17 production decreased and Foxp3 expression increased in IL-1RII+ T cells. Finally, the authors analyzed memory CD4+ T cells in synovial fluid (SF) in rheumatoid arthritis (RA) patients. IL-1RI expression was higher, TCR stimulation-mediated IL-1RII expression was decreased in memory CD4+ T cells in SF of RA patients.In this study, the authors showed that expression of IL-1RII in IL-17-producing memory CD4Overall, the experiments were well performed, and the results indicate that IL-1RII is a critical molecule controlling the plasticity of human TH17 cells.Essential revisions:1) The authors should show whether exposure of memory T cells with IL-1\u03b2 increases the expression of the genes which are crucial for pathogenic functions of Th17 cells . It will also be interesting to see whether regulation of IL-1RI+ IL-1RII+ cells vs. IL-1RI+ IL-1RII- in context of Th17 cells pathogenic signature.2) Since IL-23R is very critical for the survival and expansion of Th17 cells and IL-23R predominantly express on memory Th17 cells, the authors should check the correlation of IL-23R with IL-1RI+ IL-1RII+ cells vs. IL-1RI+ IL-1RII- subset of Th17 cells. The reviewer further recommends to test the out of IL-23 exposure to IL-1RI+ IL-1RII+ cells, IL-1RI+ IL-1RII- and IL-1RI- IL-1RII- subset of Th17 cells. This correlation will be very important to bring this study to a more fruitful conclusion.+ T cells. But there is a possibility that residual Treg cells, but not non-Treg memory cells, expanded and expressed IL-1RII. To exclude this possibility, the authors should show that Foxp3+ cells were efficiently decreased by this depletion protocol. In another word, the authors should show \"Treg-depleted memory CD4+ T cells\" do not express Foxp3 before stimulation.3) In Figure 3A experiments, the authors depleted Treg cells, and showed that TCR stimulation induced IL-1RII expression even in Treg-depleted memory CD44) The authors stated that the NFAT/Foxp3 complex binds to the B1 sites of the IL-1RII gene promoter. To show the co-operation of NFAT/Foxp3 which binds to the B1 NFAT site, the authors should analyze whether NFAT binds the B1 site in Jurkat cells without Foxp3 expression.+ T cells. IL-17-producing memory CD4+ T cells are not supposed to express Foxp3. In this context, the authors should show what kinds of stimuli induces Foxp3 expression in memory non-Treg CD4+ T cells.5) The authors showed that NFAT and Foxp3 are essential for IL-1RII expression in memory CD46) Experiments in Figure 6 seem controversial. In Figure 3D, IL-1RI+ IL-1RII+ cells did not produce IL-17, but in Figure 6A, those cells seem to produce significant amounts of IL-17 after IL-1\u03b2 stimulation.7) In Figure 7A-C experiments, the authors should analyze the percentage of Foxp3+ Treg cells in HC PBMC, RA PBMC, and RA SFMC. It is possible that Foxp3+ Treg cells mainly responded and expressed IL-1RII, particularly in HC PBMC. Essential revisions:1) The authors should show whether exposure of memory T cells with IL-1\u03b2 increases the expression of the genes which are crucial for pathogenic functions of Th17 cells . It will also be interesting to see whether regulation of IL-1RI+ IL-1RII+ cells vs. IL-1RI+ IL-1RII- in context of Th17 cells pathogenic signature.+ T cells stimulated with anti-CD3/CD28 microbeads for 7 days in the presence or absence of IL-1\u03b2 . As seen in + T cells under optimal cytokine conditions1,2. As suggested by reviewer, we also compared the expression of Th17-cell pathogenic signature between IL-1RI+IL-1RII+ and IL-1RI+IL-1RII- cells. Our qPCR data showed that several pathogenic Th17 cell-associated genes including IL-22, CCL3, and CSF2 were also upregulated in IL-1RI+ IL-1RII- cells than IL-1RI+ IL-1RII+ cells  Since IL-23R is very critical for the survival and expansion of Th17 cells and IL-23R predominantly express on memory Th17 cells, the authors should check the correlation of IL-23R with IL-1RI+ IL-1RII+ cells vs. IL-1RI+ IL-1RII- subset of Th17 cells. The reviewer further recommends to test the out of IL-23 exposure to IL-1RI+ IL-1RII+ cells, IL-1RI+ IL-1RII- and IL-1RI- IL-1RII- subset of Th17 cells. This correlation will be very important to bring this study to a more fruitful conclusion.+ memory CD4+ T cells had higher expression of IL-23R than IL-1RI- memory CD4+ T cells (3). This finding was also confirmed in the present study. However, it remains unclear whether induced IL-1RI+ memory CD4+ T cells express IL-23R or not. To this end, purified memory CD4+ T cells were stimulated for 2 days with anti-CD3/28 coated microbeads and their expression of IL-1RI, IL-1RII, and IL-23R was analyzed. Although the frequency of IL-23R was comparable among IL-1RI+IL-1RII-, IL-1RI+IL-1RII+, and IL-1RI-IL-1RII- subsets, the MFI (mean fluorescent intensity) of IL-23R was significantly higher in IL-1RI+IL-1RII- subset than other subsets. According to reviewer\u2019s recommendation, purified memory CD4+ T cells were stimulated for 48 h to induce the expression of IL-1RI and IL-1RII. Three different subsets, IL-1RI+IL-1RII-, IL-1RI+IL-1RII+, and IL-1RI-IL-1RII- cells, were purified by cell sorting and cultured for 5 days with exogenous IL-1\u03b2 (5 ng/ml) and/or IL-23 (25 ng/ml). No obvious effect of IL-23 on IL-17 production was observed both IL-1RI+IL-1RII- and IL-1RI+IL-1RII+ compared with PBS control group. Of interest, the expression of IL-1RI and IL-1RII was significantly induced on day 2 after TCR stimulation but the expression of IL-23R gradually increased until day 5, showing the induction kinetics of their receptors were different. Previous our study also showed that IL-1\u03b2 had a dominant effect on IL-17 production in IL-1RI+ memory CD4+ T cells than any other Th17-promoting cytokines (4). However, we cannot rule out the possibility that the IL-17 response was enhanced, if IL-23 was added on the 5th day when IL-23R expression was increased. Further studies are needed on the expression mechanism of IL-23R and the role of IL-23 in IL-IRI+ Th17 cells. We added this data into Figure 2\u2014figure supplement 1, Figure 3\u2014figure supplement 4, and Figure 6\u2014figure supplement 2 of revised manuscript (Results).We appreciate the reviewer\u2019s constructive critiques and agree the reviewer\u2019s point. IL-23 is one of critical cytokines for the differentiation, commitment, and survival of Th17 cells. In the previous study, we clearly showed that ex vivo IL-1RI+ T cells. But there is a possibility that residual Treg cells, but not non-Treg memory cells, expanded and expressed IL-1RII. To exclude this possibility, the authors should show that Foxp3+ cells were efficiently decreased by this depletion protocol. In another word, the authors should show \"Treg-depleted memory CD4+ T cells\" do not express Foxp3 before stimulation.3) In Figure 3A experiments, the authors depleted Treg cells, and showed that TCR stimulation induced IL-1RII expression even in Treg-depleted memory CD4highCD127(dim/-) Tregs were depleted after microbeads-based purification and confirmed that CD25highCD127(dim/-) Tregs were quite efficiently depleted . As pointed out by reviewer, it is possible that Foxp3+ T cells still remain after the depletion because CD25highCD127(dim/-) and Foxp3+ Tregs are not exactly overlapped. To respond the reviewer\u2019s comment, we analyzed the expression of Foxp3 in Treg-depleted memory CD4+ T cells by intracellular staining. As seen in Figure 3\u2014figure supplement 2B, Foxp3+ cells were markedly removed (over 80%) by this depletion protocol. Of note, the residual Foxp3+ T cells after depletion belongs to non-suppressive cytokine-producing Foxp3low T cells  The authors stated that the NFAT/Foxp3 complex binds to the B1 sites of the IL-1RII gene promoter. To show the co-operation of NFAT/Foxp3 which binds to the B1 NFAT site, the authors should analyze whether NFAT binds the B1 site in Jurkat cells without Foxp3 expression.IL-2 promoter region, were comparable between Jurkat cells with or without Foxp3 expression, whereas NFAT recruitment to the B1 site were significantly enriched in Foxp3-expressing Jurkat cells upon stimulation with PMA and ionomycin compared with Jurkat cells without Foxp3 expression. We added this data into Figure 5\u2014figure supplement 3 of revised manuscript (Results).We appreciate the reviewer\u2019s constructive suggestion. To respond the reviewer\u2019s comment, we conducted a ChIP assay in Jurkat cells with or without Foxp3 expression for confirming co-operation of NFAT/Foxp3 which binds to the B1 NFAT site. Conventional Jurkat cells, which lack Foxp3 expression, were stimulated with PMA and ionomycin for 2 hr, followed by ChIP assay using anti-human NFAT mAb. NFAT recruitment to the DNA response element B1 site were compared with that in Foxp3-expressing Jurkat cells. NFAT recruitment to the NFAT BC (binding control), a binding site in human + T cells. IL-17-producing memory CD4+ T cells are not supposed to express Foxp3. In this context, the authors should show what kinds of stimuli induces Foxp3 expression in memory non-Treg CD4+ T cells.5) The authors showed that NFAT and Foxp3 are essential for IL-1RII expression in memory CD4+CD25+ Treg cell function in mice and represents a specific marker for these cells. However, accumulating evidence shows that the expression pattern of Foxp3 differs between mice and humans, as Foxp3 is also transiently expressed in human activated non-regulatory T cells, suggesting that Foxp3, in humans, is not sufficient to induce regulatory T cell activity or to identify Treg cells  . In the previous study, we demonstrated that around 20% of Treg-depleted CD4 T cells induced the expression of Foxp3 upon TCR stimulation with IL-2 and this induction was markedly increased in the presence of 1,25 dihydroxyvitamin D, an active vitamin D3 metabolite (10). To respond the reviewer\u2019s comment, we examined what kinds of stimuli induces Foxp3 expression in Treg-depleted memory CD4+ T cells. Consistent with previous our study10, around 20% of Treg-depleted memory CD4+ T cells gained Foxp3 expression on day 7 upon TCR stimulation alone. The experiments using various chemical inhibitors illustrated that among major TCR signaling pathways, NFAT is critical for Foxp3 induction in Treg-depleted memory CD4+ T cells. Additionally, TGF-\u03b2-mediated Smad3 pathway also contribute to Foxp3 induction. Although this TGF-\u03b2 could be originated from fetal bovine serum in culture media, it should be noted that TGF-\u03b2 is an abundantly and ubiquitously expressed cytokine by most cell types and tissues in vivo. On the contrary, MAPK and NF-\u03baB pathway are not related with induction of Foxp3 expression in Treg-depleted memory CD4+ T cells. We added this data into Figure 3\u2014figure supplement 3 of revised manuscript (Results and Discussion).We thank the reviewer for a valuable comment. It is very important point. Foxp3 plays a key role in CD46) Experiments in Figure 6 seem controversial. In Figure 3D, IL-1RI+ IL-1RII+ cells did not produce IL-17, but in Figure 6A, those cells seem to produce significant amounts of IL-17 after IL-1\u03b2 stimulation.+IL-1RII+ cells in Figure 3D did not produce IL-17. The cells in Figure 3D were harvested at 48 hr after stimulation with only TCR without exogenous IL-1\u03b2 to induce IL-1RI and IL-1RII expression. Of note, only part of IL-1RI-expressing CD4+ T cells was able to acquire IL-1RII during TCR stimulation, suggesting that these IL-1RI+IL-1RII+ cells are in favorable conditions (or precommitted to differentiate into Foxp3+ Treg cells) for a robust cooperation of NFAT/Foxp3 and thus acquire typical features of induced Treg under conditions without IL-1\u03b2. In the Figure 6, highly purified IL-1RI+IL-1RII+ cells were further cultured for 5 days in the presence of IL-1\u03b2 to examine IL-1\u03b2-mediated T-cell responses. As shown in their kinetics , IL-1RII expression might be more rapidly decreased than IL-1RI on these cells. Thus, it is likely that their effect of IL-1\u03b2 is reinforced, followed by increased IL-17 production. In the future, it will be necessary to study detailed mechanisms on this using the IL-RII conditional KO mouse. Nevertheless, it should be noted that IL-1RI+IL-1RII+ cells produce less amount of IL-17 and express higher level of Foxp3 on day 5 compared to IL-1RI+IL-1RII- cells, showing their feature of IL-17 producing Treg cells.We appreciate the reviewer\u2019s constructive critique. As pointed out by the reviewer, IL-1RI7) In Figure 7A-C experiments, the authors should analyze the percentage of Foxp3+ Treg cells in HC PBMC, RA PBMC, and RA SFMC. It is possible that Foxp3+ Treg cells mainly responded and expressed IL-1RII, particularly in HC PBMC.+ Treg cells in HC PBMC, RA PBMC, and RA SFMC. In agreement with previous reports12,13, the frequency of Foxp3+ CD4 T cells in RA SFMC was higher than those in PBMC of HC and RA . A number of studies have investigated the number, phenotype, and function of Treg cells in the peripheral blood, synovial fluid, and synovial membrane of RA patients  . Although conflicting results have been reported concerning Treg cell proportion in RA peripheral blood, majority of data points out an increase of Treg cells in synovial fluid of RA patients, presumably resulting in a compensatory mechanism to counteract local inflammation . We also examined the percentage of Foxp3+ Treg cell upon TCR stimulation, showing that their percentage was comparable in peripheral memory CD4+ T cells between HCs and RA patients .We thank the reviewer for a valuable comment. It is certainly very critical point. According to the reviewer\u2019s comment, we newly recruited HCs and RA patients and analyzed the percentage of Foxp3patients . HoweverReferences:1) Lee Y, Awasthi A et al. Induction and molecular signature of pathogenic TH17 cells. Nat Immunol. 2012 Oct;13(10):991-9.2) Hu D et al. Transcriptional signature of human pro-inflammatory TH17 cells identifies reduced IL10 gene expression in multiple sclerosis. Nat Commun. 2017 Nov 17;8(1):1600.3) Lee WW et al. Regulating human Th17 cells via differential expression of IL-1 receptor. Blood. 2010 Jan 21;115(3):530-40.4) Lee WW et al. Regulating human Th17 cells via differential expression of IL-1 receptor. Blood. 2010 Jan 21;115(3):530-40.5) Miyara M et al. Functional delineation and differentiation dynamics of human CD4+ T cells expressing the FoxP3 transcription factor. Immunity. 2009 Jun 19;30(6):899-911.6) Wang J. et al. Transient expression of FOXP3 in human activated nonregulatory CD4+ T cells. Eur J Immunol. 2007 Jan;37(1):129-38.7) Allan AE et al. Activation-induced FOXP3 in human T effector cells does not suppress proliferation or cytokine production. Int. Immunol., 19 (2007), pp. 345-354.8) Miyara M et al. Functional delineation and differentiation dynamics of human CD4+ T cells expressing the FoxP3 transcription factor. Immunity, 30 (2009), pp. 899-911.9) Ohkura N et al. Development and maintenance of regulatory T cells. Immunity. 2013 Mar 21;38(3):414-23.10) Kang SW et al. 1,25-Dihyroxyvitamin D3 promotes FOXP3 expression via binding to vitamin D response elements in its conserved noncoding sequence region. J Immunol. 2012 Jun 1;188(11):5276-82.11) M\u00f6tt\u00f6nen M et al. CD4+CD25+ T cells with the phenotypic and functional characteristics of regulatory T cells are enriched in the synovial fluid of patients with rheumatoid arthritis. Clin Exp Immunol. 2005 May;140(2):360-7.12) Cao D et al. FOXP3 identifies regulatory CD25bright CD4+ T cells in rheumatic joints. Scand J Immunol. 2006 Jun;63(6):444-52.13) Jiao Z et al. Accumulation of FoxP3-expressing CD4+CD25+ T cells with distinct chemokine receptors in synovial fluid of patients with active rheumatoid arthritis. Scand J Rheumatol. 2007 Nov-Dec;36(6):428-33.14) Moradi B et al. CD4\u207aCD25\u207a/highCD127low/\u207b regulatory T cells are enriched in rheumatoid arthritis and osteoarthritis joints--analysis of frequency and phenotype in synovial membrane, synovial fluid and peripheral blood. Arthritis Res Ther. 2014 Apr 17;16(2):R97.15) Alunno A et al. Altered immunoregulation in rheumatoid arthritis: the role of regulatory T cells and proinflammatory Th17 cells and therapeutic implications. Mediators Inflamm. 2015;2015:751793.16) Cooles FA et al. Treg cells in rheumatoid arthritis: an update. Curr Rheumatol Rep. 2013 Sep;15(9):352."}
+{"text": "Kullback\u2013Leibler divergence (KLD) is a type of extended mutual entropy, which is used as a measure of information gain when transferring from a prior distribution to a posterior distribution. In this study, KLD is applied to the thermodynamic analysis of cell signal transduction cascade and serves an alternative to mutual entropy. When KLD is minimized, the divergence is given by the ratio of the prior selection probability of the signaling molecule to the posterior selection probability. Moreover, the information gain during the entire channel is shown to be adequately described by average KLD production rate. Thus, this approach provides a framework for the quantitative analysis of signal transduction. Moreover, the proposed approach can identify an effective cascade for a signaling network. Kullback\u2013Leibler divergence (KLD) is a type of generalized entropy or information quantity. It was introduced by Solomon Kullback and Richard A. Leibler, who discussed information source coding theory for information transmission efficiency . At presPrevious studies have discussed cell signal transduction through pathways from a viewpoint of similarity in the thermodynamic process that produces entropy . Luo et Previously, the authors reported analyses of biological signal transduction based on information thermodynamics. In these studies, a theoretical framework was developed on Shannon entropy. However, the objective of the present study is to evaluate signal transduction efficiency of KLD in individual steps on the actual biochemical reaction kinetics ,29. KLD m and j represent the number of cascades and the step number, respectively. In this model, the signaling molecule at step 1 of cascade m, denoted by mX1, induces the modification of the mX2 into mX2* by binding the signal mediated molecule A such as adenosine triphosphate (ATP). Subsequently, mX2 activates mX3 in the same manner. In this way, the signaling molecule at the (j \u2212 1)-th step of cascade m, denoted as mj\u2212X1, induces the modification of mjX into mj*X. As the opposite orientation of signal, demodification of mj*X into mjX occurs, at the \u2212(j \u2212 1)-th step of cascade m, and the pre-stimulation steady state is subsequently recovered [The signal events can be modeled as a cascade of modification and/or demodification cycle reactions of proteins in a cell that are named signaling molecules. Equation (1) presents a signal cascade model ,35. Hereecovered :(1)Xm1+Xm represents the total number of the cascade.In the above model, the subscript a priori (prior) selection probability of signaling molecule for the analysis. Here, mjq, which represents the selection probability of inactive mjX used in the j-th step in cascade m (forward direction), takes the form of the j-th molecule. On the other hand, mj*q, which represents the selection probability of active mj*X, is used in the \u2212j-th step for cascade m (backward direction), as follows:We introduce mX indicates the total concentration of signaling molecules in cascade m:Here, m, m0\u03c4, which indicates the sum of forward and backward cascades comprising a set of signaling molecules, is determined by:The total duration of cascade mjq and mjq*:In Equations (2), (5), (6) and (7), the total duration was determined using the probabilities mj\u03c40 and backward \u2212mj\u03c40, are defined as shown in mj\u03c40 and \u2212mj\u03c40 corresponding to the direction of the step in the m cascade [mj\u03c40 represents the duration corresponding to positive code length in which the active molecule mj*X increases in concentration. On the other hand, \u2212mj\u03c40 represents the duration corresponding to negative code length in which the active molecule mj*X decreases in concentration. In this manner, the duration of individual step j-th can be represented as mj\u03c40 \u2212 \u2212mj\u03c40.The suffix 0 represents the prior state. Here, the duration, as forward  cascade ,35. In ta priori. In our previous studies [mH for m-th cascade was demonstrated. Using Equations (3), (5) and (6), entropy mH0 at a priori (prior) state can be represented as:Here, the author hypothesizes that the selection of signaling molecules is equal  studies ,35, ShanmH0, using non-determined parameters m\u03b10, and m\u03b20, in reference to the constraints established by Equations (3) and (8), let us introduce a function G.To maximize Then, we haveG, the right sides of Equations (11)\u2013(13) are equated to zero.To maximize m\u03b20 is independent of the step number j. Therefore, Equations (14) and (15) will be utilized as a prior probability distribution later. Therefore, from Equations (9), (14) and (15) the author has:As indicated above, Equations (14) and (15) imply an important result; the coefficient mq (j|j \u2212 1), which is the transitional probability of the j-th given (j \u2212 1)-th step, and mv (j|j \u2212 1), which is the transitional rate of the j-th step in a forward signaling direction. Given j-th step, mq (j \u2212 1|j) is the transitional probability of the (j \u2212 1)-th step given step j-th step. Similarly, given j-th step, mv (j \u2212 1|j) is the transitional rate of the (j \u2212 1)-th step in a backward signaling direction in a given cascade. The cell system remains at detailed balance around the steady state, the homeostasis, as follows:Next, the kinetics were investigated using Therefore, the author has:j \u2212 1)-th step and the reverse \u2212(j \u2212 1)-th step, m,jk\u22121 and m,kj\u22121)\u2212( in (1), the right side of (18) is givenUsing kinetic coefficients for . Dividing the both sides of above by Using Equations (14) and (15), the author has:\u03c4mj\u22120| is sufficiently longer than \u03c4mj0, according to experimental studies , \u2329mi\u03b6\u232a and \u2329\u2212mi\u03b6\u232a are defined during signal transduction for \u03c4mj0 \u2212 \u03c4mj\u22120 and |\u03c4mj\u22120 \u2212 \u03c4mj0|. respectively for m cascade and reverse cascade \u2212m.In above Equations (22) and (23), | studies  [36,37,3The fluctuation theorem (FT) states that the right sides of Equations (22)\u2013(25) are equal to AEPRm0\u03b2 has the dimension of entropy production rate and AEPRs are independent of the step number. Subsequently, AEPRs are redefined using Equations (14), as follows:Here, Notably, Equations (14), (15) and (28) indicate that AEPR is consistent during signal cascade. Here, the channel capacity is given by AEPR.mjq and duration mj\u03c4, using an arbitrary parameter, \u03b6, which was independent of step numbers [In previous our studies, a simple formulation was proposed between selection probability  numbers ,35.a posteriori (posterior) distribution from the prior distribution in Equations (30) and (31) to a posterior distribution. Let probability mjq be the prior distribution. Therefore, the uncertainty reduces:KLD was used as a measure of information gain when obtaining mD, as the KLD of signal events in cascade m,We define information I with respect to mjp and mj*p. Consequently, KLD is known as information gain. The maximum likelihood estimation is thought to be an estimation method that empirically minimizes KLD.The above equation represents KLD, which indicates the average value of the information obtained from data Posterior probabilities are defined:In addition,mj*q into mj*p with minimum KLD under the given condition.Therefore, when considering the signal transduction occurs under a certain given condition, the probability is transformed from mD (mjp||mjq) using non-determined parameters m\u03b1, and m\u03b2 in reference to the constraints established by Equations (34) and (36), a function L was introduced to apply Lagrange\u2019s method to undetermined multipliers.To minimize m\u03b1 and m\u03b10 and m\u03b20 and m\u03b2 are indicative of the signaling. Subsequently,Here, the differences between L, the right hand sides of Equations (38)\u2013(40) are equated to zero, as follows:For the minimization of Therefore, from (41) and (42), the author hasAccordingly, from Equations (7), (43) and (44), KLD is given by:And the author has:m\u03b2 is equal to the average KLD production rate, \u03b4(mp\u2016mq), during the signal transduction and is consistent during the entire signal cascade. Therefore,Accordingly, mp(j|j \u2212 1), which is the transitional probability of the j-th given (j \u2212 1)-th step, and mv(j|j \u2212 1), which is the transitional rate of the j-th step in a forward signaling direction. In addition, given j-th step, mp(j \u2212 1|j) is the transitional probability of the (j \u2212 1)-th step given step j-th step. Similarly, given the j-th step, mv(j \u2212 1|j) is the transitional rate of the (j \u2212 1)-th step in a backward signaling direction in a given cascade.The author defined mj\u03c4 \u2212 \u2212mj\u03c4 and taking the limit, we have:Likewise from (18)\u2013(20), dividing the both sides of above by Further, Equations (47), (50) and (51) givemj\u03c4 << \u2212mj\u03c4  and (15) in association with FT and source-coding theory [In this work, the author deduced simple but important relational formulae, (47)\u2013(53). For a prior distribution probability g theory . This meg theory . The themjq before stimulus. As reported previously in [mjq, can be described by simple formulae given by Equations (14) and (15), which illustrate the simple relationship between the logarithm of the probability and time elapsed between tentative modification and demodification. Subsequent to the stimulus, the selection probability of the signal molecules are transformed into a posterior distribution probability mjp. It is likely that the formulation of signal transformation using KLD is more intuitive and easier to understand than using mutual entropy. In this study, uniform distribution was not applied as a prior distribution ously in ,35, the mj\u03c4 << \u2212mj\u03c4 (The Mitogen-activated Protein Kinase (MAPK) pathway is a multistep signal conversion step, in which the process of modification and demodification in the entire cascade can be understood as a repeated cycle reaction. It has been experimentally demonstrated that the demodification process is significantly longer than the modification process, as shown in  << \u03c4\u2212mj , with thIn the experimental studies ,44,45,46Thus, KLD and average KLD production rate may be regarded as a critical attribution of cell signal cascade. The thermodynamic approach in this manuscript can provide a theoretical framework for the quantitative analysis of signal transduction."}
+{"text": "A model of signal transduction from the perspective of informational thermodynamics has been reported in recent studies, and several important achievements have been obtained. The first achievement is that signal transduction can be modelled as a binary code system, in which two forms of signalling molecules are utilised in individual steps. The second is that the average entropy production rate is consistent during the signal transduction cascade when the signal event number is maximised in the model. The third is that a Szilard engine can be a single-step model in the signal transduction. This article reviews these achievements and further introduces a new chain of Szilard engines as a biological reaction cascade (BRC) model. In conclusion, the presented model provides a way of computing the channel capacity of a BRC. Information science provides a theoretical framework for understanding cell biology. Variable types of information entropy have been defined and applied for biological research. \u201cSingle cell entropy\u201d was introduced for the estimation of the specified gene and kinase protein expression network ,2. FurthIn addition to these recent develpments, significant achievements have been reported by the application of information thermodynamics to cell system that involves a feedback controller; hence, it can be an integrative system, in which information and thermodynamic entropy intersect ,13,14,15w> that can be extracted from thermodynamic engine depends on the system temperature T, Boltzmann constant Bk, free energy change \u0394F and mutual entropy H informed by the feedback controller [The upper limit of the average work <ntroller ,13,14,15Inequality (1) implies that free energy and mutual entropy are exchangeable parameters. For the isovolumic and isothermal biological system, Inequality (1) can be simplified toSzilard engine is,As shown in below, the work extracted from an ideal Escherichia coli was reported [From the viewpoint of information thermodynamics, the signal transduction in reported . Our earreported ,18,19,20reported .Let us consider modelling signal transduction by focusing on aspects that are common to several signal transductions. In BRC, the substrate protein in the reaction may become an enzyme or modulator in the next reaction. The most well-known example of a chain reaction is the chain of phosphorylation of proteins in the mitogen-activated protein kinase (MAPK) cascade ,24,25,26In this BRC, the epidermal growth factor receptor (EGFR), Ras (a type of GTPase), a proto-oncogene c-Raf, MAP kinase-extracellular signal-regulated kinase (MEK) and kinase-extracellular signal-regulated kinase (ERK) follow the stimulation with the epidermal growth factor (EGF). Phosphatases were omitted in the above equation. This MAPK cascade is a ubiquitous signalling pathway in variable cell types, which allows growth and proliferation. The EGFR mutation promotes the enhancement of this cascade, which contributes to the tumourogenesis of the lung and other cancers .thj and reverse \u2212thj steps can be constructed (1 \u2264 j \u2264 n):To understand the essence of complicated cell signaling, the BRC model consisting of jX in the cytoplasm maintained by a chemical reservoir of mediator A, such as adenosine triphosphate (ATP), and an inactivation of the signalling molecules jX* by enzymes jPh. ATP is hydrolysed into adenosine diphosphate ) and inorganic phosphate (Pi), which modifies the amino acid residue of jX. jX and jX* denote unmodified (inactive) and modified (active) signalling molecules, respectively. The first reaction represents the ligand (L), EGF in the MAPK cascade, an extracellular molecule and stimulates X1, which represents a receptor (R), EGFR in the MAPK cascade, on the cellular membrane. Afterward, X1 \u2212 L* complex promotes the modification of X2 in the cytoplasm into X2* activated by Pi that originated from A, and D is produced. Further, X2* promotes the modification of X3 into X3*. In this manner, the thj signalling molecule, jX*, activates jX+1 in the cytoplasm into jX+1*. Following the (n \u2212 1)th step, the signalling molecule nX* binds to the promoter region of the DNA and induces the mRNA transcription in the thn step. In addition, during the reverse BRC steps, the inactivation of jX* into jX occurs through enzymes that catalyse inactivation or through self-inactivation by jX*, in which Pi is released. Thus, thj and \u2212thj step forms a cycle reaction consisting of activation and inactivation. Finally, a pre-stimulation steady state of the individual step is recovered. Such reaction chain schemes were previously described by Gaspard et al. and Tsuruyama [Each step represents an activation of the signalling molecules suruyama ,28,29,30jX*) and an inactive form (jX) in individual step [\u03a8 in a given BRC event, can be described using the concentration of inactive jX and active molecules jX* as follows:Recent studies showed that the BRC can be interpreted as a binary code system with two forms of signalling molecules, namely an active form S=logthj step component of S in (7) gives:Selecting the thj step, concentrations of jX or jX* fluctuate, and js is given using the probability fluctuation jdp and jdp*,When the signal is transmitted to the j + 1)th step; hence, the entropy of the (j + 1)th step remains:Because the signal has not yet reached the (jH is generated between the thj and (j + 1)th step is presented as follows [Therefore, the entropy difference  follows ,18,19::In addition, the entropy difference per single active molecule, jC was introduced as follows:In previous report , entropyjc per single active molecule is given as:Accordingly, the entropy current density thj cycle (1 \u2264 j \u2264 n) (jh0 is given using jq = jp/(jp + jp*) and jq* = jp*/(jp + jp*), as follows:For the evaluation of mutual entropy in Equation (15) according to information theory, let us consider the channel capacity of the \u2264 j \u2264 n) . The natjh (j + 1|j) from the (j + 1)th step for the given thj step can be described as a linear function of jq* using the probability of the noise occurrence probability j\u03d5 and j\u03be = \u2212j\u03d5logj\u03d5 \u2212 (1 \u2212 j\u03d5)log (1 \u2212 j\u03d5) [jh0 and h(j + 1|j) are chosen in such a manner as to maximize mutual entropy, which is defined by jh0 \u2212 h(j + 1|j), subject to the constraint jq* + jq = 1. The channel capacity is defined as the maximum value of mutual entropy:The conditional entropies (1 \u2212 \u03d5j) :(19)hUj=\u2212Then\u03bb, we have:Setting the right-hand side of Equations (23) and (24) to zero, and eliminating jq + jq* = 1 and (25), the following can be derived:From thj step, jC, is given using (21), (26)\u2013(28) as a maximum value of mutua entropy:As a result, the channel capacity of the hj\u22120 = jh0 = \u2212jqlogjq \u2212 jq*logjq* and mutual entropy as hj\u22120 \u2212 h(\u2212j \u2212 1|\u2212j)  . The fol\u03bej\u2212 = \u2212\u03d5j\u2212 log\u03d5j\u2212 \u2212 (1 \u2212 \u03d5j\u2212) log (1 \u2212 \u03d5j\u2212), and \u03d5j\u2212 denotes the noise occurrence probability in the reverse cascade. Then:In above, \u03bb\u2032, we have:Setting the right-hand side of Equations (31) and (32) to zero, and eliminating Cj\u2212 is given by:Accordingly, the channel capacity thj cycle step is defined and calculated as follows:The channel capacity of the Thus, we can obtain the mutual entropy as entropy difference in Equation (15).Szilard engine, which may serve as a model of the conversion system [BTkln2. This process is equivalent to the system, in which the feedback controller transforms the gained information into the actual expansion work. The feedback controller system has been produced in the actual experimental study [Subsequently, let us consider that phosphorylation and dephosphorylation reactions form a cycle reaction that simultaneously activates the next cycle reaction in a BRC. A cycle reaction of individual step can be modelled as a n system . The Szin system ,32. In tal study ,34. Thern number of hypothetical compartment fields corresponding to the individual thj steps (1 \u2264 j \u2264 n) that corresponds to a single Szilard engine. The diffusion rate of signaling molecule is sufficiently low because of its high molecular weight and they are hypothesised to be localized in the compartment fields. Each field contains all jX+1* and jX+1 species (1 \u2264 j \u2264 n \u2212 1), with the concentrations identical to those of jX+1*st and jX+1st, respectively, at the steady state. The feedback controller has the potential to recognise the molecule concentration. Subsequently, the controller selects jX+1* or jX+1 for its transfer ((i)jX+1* and jX+1 in the thj field.When the signal transduction initiates, the controller measures the changes in the concentration of the active molecule (ii)thj step in the signalling cascade, the feedback controller introduces \u0394jX+1* of jX+1* to the (j + 1)th field from the thj field by opening the forward gate on the boundary in the thj field to the (j + 1)th field. Simultaneously, the controller introduces \u0394j+1X of j+1X to the (j + 1)th field from the thj field by opening the back gate on the boundary.At the (iii)jX+1* can flow back with the forward transfer of jX+1 from the (j + 1)th field to the thj field because of the entropy difference (see Equation (13)). jX+1 can also flow back with the backward transfer of jX+1 from the (j + 1)th field to the thj field because of the concentration gradient.Subsequently, (iv)jX+1* and \u0394jX+1 can quasi-statically rotate the exchange machinery on the hypothetical partition between the thj and (j + 1)th fields, which has the ability to extract chemical work equivalent to wj+1 = BThj+1k. In (iii), \u0394(v)wj+1 is linked to the modification of jX+2 into jX+2*, which further causes the concentration difference of jX+2* introduced by the feedback controller from the (j + 1)th field to the (j + 2)th field. The next step proceeds as aforementioned in (ii) to (iii).As the next step, As reported previously ,19, the transfer . The stej + 1 by j for simplification, the chemical work wj extracted from the thj Szilard engine is given using the mutual entropy jh informed to the controller whether the signalling molecules increase or decrease according to Equations (15) and (35) [Accordingly, replacing the suffix and (35) ,14,18,19j\u03c4 and backward \u03c4j\u2212). Positive and negative values are assigned to j\u03c4 and \u03c4j\u2212 for distinction of the signal direction. j\u03c4 represents the duration of the tentative increase in the active molecule jX*, whilst \u03c4j\u2212 represents the duration to the recovery to the initial state. The step cycle duration is represented by j\u03c4 \u2212 \u03c4j\u2212.Next, let us review the optimized coding way for maximizing the signal event number for a given duration in this binary coding model of signal transduction in a nonequilibrium steady system. First, the duration of signal transduction is defined in consideration of the signal orientation  is defined using a bracket < > as:js is an arbitrary parameter representing the progression of a reaction event [p (j + 1|j) is the probability of the (j + 1)th step given the thj step during j\u03c4, and p (j|j + 1) is the transitional probability of the thj step given the (j + 1)th step during \u03c4j\u2212. The AEPR <j\u03b6 > during the signal transduction from the jth to the (j + 1)th field is given according to fluctuation theorem (FT) at the steady state:The average entropy production on event . The tra\u03b6j\u2212> from the (j + 1)th to the thj field is given:The AEPR <jc in (17) [The following equation is given using signal current density  in (17) ,35:(41)lSubstituting the right side of Equation (17) into the right side of (41), an important result is given :(42)lim\u03c4\u03b2 independent of the step number according to previous reports [When the signal even number is maximised, the logarithm of the selection probability is described simply using the average entropy production rate  reports ,18,19,20This is one type of entropy coding. Substitution of the right sides of Equations (43) and (44) into (42) gives:Likewise,j\u03c4 << \u03c4j\u2212 as shown in jX* takes a significantly longer time, \u03c4j\u2212. Subsequently, Equations (39), (40), (45) and (46) provide:We used In summary, we obtained the following result from Equations (43)\u2013(47):j and \u2212j in j\u03b6 and \u03b6j\u2212 were omitted because j\u03b6 and \u03b6j\u2212 are independent of the step number. Thus, the theoretical basis of the consistency of the average entropy production rate can be obtained.Equations (48) and (49) implies the integration of information entropy, code length, and thermodynamic AEPR. In these equations, step numbers jw> in Equation (36) from (i) to (iv) in The chemical extracted average chemical work <The summation of the right side of (50) gives the total work:j\u03c3 stands for the entropy production during j\u03c4 \u2212 \u03c4j\u2212 at the thj step.Here, (i)The BRC can be expressed by a kind of binary code system consisting of two types of signalling molecules: activated and inactivated.(ii)The individual reaction step of the BRC can be thought of as a cycle of a Szilard engine chain, in which the process of repeats of signalling molecule activation/inactivation.(iii)The average entropy production rate is consistent during BRC.(iv)The signal transduction amount can be calculated through the BRC.Signal transduction is an important research topic in life science, but quantitatively evaluating data remains difficult. This review pointed out the possibility of quantitative signalling to life scientists. The current review can be summarised in the following points:The chain of Szilard engines is a useful model to show how signal transduction in one step induces signal transduction in the next step, in which a series of chains is formed. The most important point of this model is to directly give the signal transduction amount by the exchange work according to Equation (3). The currently introduced chain illustrates that the feedback controller transfers signal molecules based on the measurement of the increase and decrease of the signal molecule. Subsequently, the exchanger molecule on the boundary between the steps can extract work between because of the entropy gradient consisting of the two types of signalling molecules. In this way, the signal transduction amount can be clearly quantified by the combination of chemical work.thj step to the (j + 1)th step, jv, obtained using the kinetic coefficient jk for the thj step as follows:Herein, let us consider the calculation of the entropy production based on the kinetics of the activation of signalling molecules according to (5). The signalling system is contacted with a chemical bath outside the system that provides ATP. The transitional rate from the j + 1)th step to the thj step, vj\u2212, which is equal to the demodification (dephosphorylation) of the backward signal transduction, is given using the kinetic coefficient kj\u2212 for the \u2212thj step:jk and kj\u2212 represent the kinetic coefficients. The signal transduction system remains at a detailed balance around the steady state, the homeostatic point:The transitional rate from the (Combining Equations (47), (54)\u2013(56), we obtain the following from FT:j\u03c4 \u2212 \u03c4j\u2212:Above result contains Equation (42). Therefore, for sufficient long duration Xj+1st*, we have:Using the concentration of the active signalling molecules at the steady state, Substitution of Equation (59) into Equation (58) produces:j\u03c3 in (53) is defined in the thj step:Here, the entropy production jX* is negligible during signal transduction relative to \u0394Xj+1 and \u0394Xj+1* according to experimental data (36). The sum of the concentrations of Xj+1 and Xj+1* is equal to the total concentration jX+10 that is kept constant because the signal transduction rate is significantly greater than the production of signalling molecular proteins. Then:In Equation (61), the fluctuation of Equations (54), (55) and (62) give the concentrations at steady state:jPh+1 signifies the phosphatase concentration in the thj step. The fluctuation of the transmitted information is described as follows using an integral form of Equation (61):x) ~ x in the logarithmic term in (65). A simple calculation of Equations (63) and (64) gives:We used the approximation log  into Equation (65) gives:x) ~ x again and set Ai1 equal to the initial concentration of ATP, A. Thus, ATP is the mediator of signal transduction. In an actual experiment, rigorously measuring the concentration change of ATP at individual signal steps is difficult because ATP is consumed in a variety of reactions as a basic metabolite for cell activity. Alternatively, the ratio \u0394Xj+1/\u0394Xj+1st is negligible during signal transduction according to experimental data [In above, we used the approximation log  indicates that AEPR <Further study is required to prove which signal transduction strategy a biological system will select. For example, the cell system may select a strategy to maximise signal event number during a given duration by application of non-redundant signal system; in contrast, accuracy of the signal transduction may be prioritized by application of redundant signal system. The strategy chosen for signal cascade by the cell system will likely be determined experimentally. The cost-performance of metabolomics substance tradeoffs for cellular regulatory functions and information processing will been argued by evaluation of recent experimental data ,24,25,26The discussion developed herein has some limitations; hence, we would like to mention it at the end. A detailed balancing between modification and demodification is assumed at each step for the application of FT. Therefore, the current discussion is also possible only when the distance from the detailed balance is not great ,18,19,20In conclusion, the information thermodynamics approach described herein provides a framework for the analysis of signal transduction BRC. This theoretical approach appears suitable for the identification of novel active signalling cascades among response cascades in which AEPR is consistent through the given cascade. This review presents that the binary coding system and the Szilard engine chain model may be the theoretical basis of computation of the channel capacity of BRC."}
+{"text": "Although this phenomenon is well supported empirically, its cognitive foundation remains elusive. Here we test two conceivable computational accounts of the memory bias against each other. On the one hand, a single-process account explains the memory bias by assuming a single biased evidence-accumulation process in favor of remembered options. On the contrary, a dual-process account posits that some decisions are driven by a purely memory-driven process and others by a utility-maximizing one. We show that both accounts are indistinguishable based on choices alone as they make similar predictions with respect to the memory bias. However, they make qualitatively different predictions about response times. We tested the qualitative and quantitative predictions of both accounts on behavioral data from a memory-based decision-making task. Our results show that a single-process account provides a better account of the data, both qualitatively and quantitatively. In addition to deepening our understanding of memory-based decision-making, our study provides an example of how to rigorously compare single- versus dual-process models using empirical data and hierarchical Bayesian parameter estimation methods.Human decisions often deviate from economic rationality and are influenced by cognitive biases. One such bias is the  Many decisions in our daily lives, such as where to go on holiday or what to buy in a grocery store, rely on information from memory. Although the role of memory processes in judgements and decision-making has been neglected for a long time, researchers have recently put more emphasis on the relation of these two domains , Gluth et al.,  way.Gluth et al.,  proposed et al., \u2019s accoun et al., . Dual-pr et al., . Type 1  et al., . Such a As we will show, both single- and dual-process accounts can produce the memory bias on choice. Thus, we face a model-selection problem: Two models can account for the same behavioral phenomenon, but the assumed underlying cognitive processes are fundamentally different. To find out which model is more suitable to explain the memory bias, we consider an additional data dimension, namely response times (RTs). The consideration of RTs has a rich tradition in psychological research, since they contain information about the underlying cognitive processes Luce, . AdditioJoint modeling of choices and RTs is often done in the framework of sequential-sampling (or evidence-accumulation) models  and in which RTs were lower than 200 ms (1.4%). We then excluded trials that do not help to discriminate between single- and dual-process accounts: In particular, both accounts make the same predictions for behavior in trials in which both options are remembered or both options are forgotten. Therefore, we restricted our analyses to trials where one snack was remembered and the other was forgotten. This resulted in a total of 8031 trials . See Appendix\u00a0First, we excluded trials that were unlikely to originate from a deliberate process: In particular, we excluded trials in which no choice was made (2.0a determines the (relative) amount of evidence required to terminate the deliberation process. This parameter is responsible for speed\u2013accuracy tradeoffs. Second, the starting-point bias z determines the amount of relative evidence at the beginning of the deliberation process. This parameter reflects prior information or a bias in favor of one of the options. Third, the drift rate \u03bd determines the speed of evidence accumulation. In value-based decision-making, the drift rate is often directly proportional to the value difference between the two available options . An example of a diffusion process is depicted in Fig.\u00a0According to Gluth et al., \u2019s model utility process which captures \u201ccomputational-normative aspects of decision-making\u201d (p. 203). In other trials, a heuristic process favors \u201cintuitive-affective attributes\u201d (ibid) of a choice option with a relatively high drift rate, leading to fast and more consistent responses. The selection of a process in a given trial is supposedly governed by the central executive. It selects the utility process with the probability \u0394 and the heuristic process with 1 \u2212\u0394. The drift rate of the DPDM in a given trial is given byk is the outcome of a Bernoulli trial To model the dual-process account, we adopted the dual-process diffusion model (DPDM) by Al\u00f3s-Ferrer . The DPD\u03bdUtility reflects the utility-maximizing process in which Vrem is compared to the (unbiased) average snack value of all possible snacks Vavg. Thus, the cognitively demanding utility process tends to select the option with the higher subjective utility without a bias towards the remembered option. If individuals do not follow the utility-maximizing process, they rely on a simple decision rule to make a choice. In the context of memory-based decisions, they can use recognition as a cue for value, much in line with the recognition heuristic in judgment tasks  and fast when the speed of evidence accumulation is high 2 shifts the maximum RT along the x-axis. If \u03b22 equals zero, the curve is symmetrical around Vavg which matches the RT predictions of the DPDM. If \u03b22 is larger than 0, the RT curve is shifted to the left, in line with the SPDM.As outlined in the previous section, single- and dual-process accounts predict different RTs patterns. More specifically, the DPDM assumes that the RT curve peaks at 2 parameter, we fitted a hierarchical Bayesian regression model to the log-transformed and z-standardized RTs. RTs of every trial were predicted using s) were drawn from group-level normal distributions:\u03bc parameters) and standard half-normal (for the \u03c3 parameters) distributions.To estimate the \u03b2We leveraged the fact that, in case of the qualitative RT model, the DPDM\u2019s prediction is nested within the SPDM\u2019s prediction with the restriction memory bias on choice as the intercept parameter of a hierarchical logistic regression model. When this parameter is larger than 0, the choice curve shifts in favor of the remembered option. Analogously, we interpret the \u03b22 parameter as memory bias on response times. To assess whether participants who exhibit a larger memory bias on choices also show a larger memory bias on RTs, we performed a Bayesian correlation analysis on the individual-level posterior medians of the intercept and Importantly, the SPDM does not only predict a shift to the left in both the choice and the RT curves see Fig.\u00a0 and d, bIn addition to comparing their qualitative predictions, we performed a quantitative model comparison using a hierarchical Bayesian approach. This comparison offers a more precise evaluation of the validity of the assumed cognitive processes. To the best of our knowledge, the DPDM  are drawn from normal group-level distributions with respective group-level parameters \u03bc and \u03c3  as follows:\u03b3 was the parameter which acts as reference value, indicating the biased value comparison in the SPDM.In the SPDM, choice and RT data come from a diffusion process that results in a Wiener distribution:The DPDM is a mixture model, where the choices and RTs come from two different diffusion processes:a, z and Ter, they differ with respect to their drift rates \u03bdUtility and \u03bdHeuristic. \u03bdUtility is the same as in the SPDM but compares Vrem to the average snack value . To ensure model convergence using the We estimated the parameters of both hierarchical models with Vrem to evaluate absolute model performance . To do so, we simulated 500 experiments using virtual agents who behaved according to the model equations. Note that in the DPDM simulations, each trial was either a heuristic or utility trial, determined by the outcome of a Bernoulli trial with probability \u0394s. Each agent\u2019s parameter vector was drawn randomly from the posterior distribution obtained during model fitting. We aggregated the choices and RTs across trials and participants into 8 bins and calculated the respective 95% highest-density interval , we generated posterior predictive distributions for choice rates and RTs as a function of Vrem. This shift is quantified by the parameter M = .62, 95% HDI: ). The individual-level means were distributed around the posterior M = .49, 95% HDI: ). The RT model predicted the empirical RT data very well  and reproduces the non-Bayesian results reported by Mechera-Ostrovsky and Gluth . As predicted, the individual intercepts from the regression model correlated positively with the \u03b2s2 estimates from the RT-Model  with the \u03b2In addition to the qualitative analysis, we compared the SPDM and the DPDM on a quantitative level by a model comparison within a hierarchical Bayesian framework. Summary statistics of the posterior distributions of all group-level parameters are provided in Table\u00a0SE = 24.74), resulting in a strong standardized effect size of We relied on the WAIC for model comparison. The SPDM had a lower WAIC than the DPDM , with a difference in WAICs of 74.34 . According to this principle, we should prefer hypotheses that can account for a complex phenomenon drawing on a few (rather than many) assumptions. In this study, we found empirical support that a single decision process provides a more parsimonious explanation of memory-based choices compared to a dual-process account. This parsimony is supported both by the Bayes factors and information criteria analyses, established methods to compare models in terms of fit and parsimony . We fit both models in a hierarchical Bayesian modeling framework and outlined a rigorous procedure to empirically test single- and dual-process accounts of decision-making."}
+{"text": "Recent studies have revealed that Capnocytophaga ochracea is one of the dominant members of oral biofilms; however, their potential for OMV production has yet to be investigated. This study demonstrated the biogenesis of OMVs in C. ochracea associated with the concentration of unsaturated fatty acids of phosphatidylinositol (PI) and characterized the size and protein profile of OMVs produced at growth phases. Transmission electron microscopy showed isolated spherical structures from cells stained with heavy metals, indicating the production of OMVs with a size ranging from 25 to 100 nm. Lipidome analysis revealed the presence of phosphatidic acid, phosphatidylethanolamine, phosphatidylcholine, and PI as the main lipids. Some unsaturated fatty acids of PI were present specifically in OMV and little in the outer membrane, suggesting that OMVs are generated from a specific region of the membrane through blebbing rather than a random process such as cell lysis. Furthermore, the lack of similar PI accumulation in the OMV of Porphyromonas gingivalis suggests that C. ochracea has a different biogenesis mechanism. The blebbing mechanism was further supported by higher OMV production occurring at the exponential phase in comparison to the stationary phase, where cell lysis is more likely to occur. Further, comparative protein profile of OMVs isolated under different growth phases may indicate that the OMV cargo does not largely vary with growth phases. The present study provides a basis for further understanding the roles of C. ochracea OMVs in oral biofilms as well as systemic diseases that C. ochracea involves.Bacterial outer membrane vesicles (OMVs) are spherical lipid bilayer nanostructures released by bacteria that facilitate oral biofilm formation  Among the adapted modes for survival, the production of outer membrane vesicles (OMVs) by bacteria, particularly Gram-negative bacteria, plays a prominent role in interactions between themselves and the host . OMVs haPorphyromonas gingivalis, Treponema denticola, and Tannerella forsythia are strongly associated with symptoms of chronic periodontitis, and all three species secrete OMVs , single particle tracking analysis, lipidomics, and polyacrylamide gel electrophoresis. Moreover, P. gingivalis was also cultured to obtain purified OMVs and analyze its lipid components.A recent study revealed that  imaging . Capnocypatients . Althougs of OMV . In thisCapnocytophaga ochracea ATCC 27872 was grown in 80 mL of DSMZ 340 medium supplemented with 1 g/L sodium bicarbonate at 37\u00b0C. The medium, excluding glucose and hemin, was autoclaved for 15 min at 121\u00b0C before the culture. Glucose and hemin were separately prepared and filter-sterilized prior to inoculation. To maintain anaerobic growth conditions, 20 min of N2/CO2 (80:20 v/v) gas sparging was performed prior to culture inoculation. Sterility during sparging was maintained by using 0.22 \u03bcm sterile syringe filters. The medium was inoculated with C. ochracea, incubated at 37\u00b0C, and allowed to achieve one of the five stages of growth explored in this study. The initial pH of the medium was 6.9 \u00b1 0.1. Growth phases were determined by the pH of the culture using a C. ochracea growth curve relating pH and optical density (OD600) with time. The growth phases explored in this study were the lag phase (pH 6.5), early exponential phase (pH 6.0), mid-exponential phase (pH 5.7), late exponential phase (pH 5.3), and stationary phase (pH 5.1). P. gingivalis (strain ATCC BAA-308/W83) was also grown anaerobically, similar to C. ochracea in Gifu anaerobic medium. The culture was grown at 37\u00b0C until the growth reached the late exponential phase, in which the OD600 was 1.0. We used P. gingivalis W83 to compare with C. ochracea because strain W83 is a pathogenic oral bacterium, contributor to periodontal disease, and produces OMVs  in 50 mM Na+-HEPES . Sequential ethanol gradient dehydration and resin embedding procedures were conducted according to a previously described method  were re-suspended and stored in phosphate buffered saline (PBS) at 4\u00b0C until further purification. OMV purification was conducted using an iodixanol (OptiPrep) density gradient. The 60% iodixanol stock solution was diluted to 35, 30, 25, 20, 15, and 10% in PBS. All the stored OMVs for a given condition were combined and ultracentrifuged for 2 h at 140,000 \u00d7 g at 4\u00b0C. This collective pellet was resuspended in 35% iodixanol solution. The six iodixanol density layers were carefully pipetted in decreasing order of percent density into a 7 mL ultracentrifuge tube with the sample containing 35% solution at the bottom and 10% solution at the top. The layers were loaded from the top, with each layer consisting of 1 mL of the desired weight solution. Tubes containing density layers were ultracentrifuged for 16 h at 140,000 \u00d7 g and 4\u00b0C using a swing rotor. Following ultracentrifugation, six 1 mL fractions were taken from each tube and placed into six different Eppendorf tubes to separate the layers. Isolated MVs were placed on Thin Carbon film TEM grids  or formvar-coated copper grids (200 mesh) for TEM observations. Further, TEM observations of isolated OMVs were carried out by staining with 0.5 % sodium molybdate for 60 sec using JEOL-1010 transmission electron microscope. For Nanosight, samples were stained with EM stainer , rinsed and observed using a Hitachi H- 7650 transmission electron microscope .When the desired growth phase for a given condition was achieved, the culture medium was centrifuged for 10 min at 7,800 rpm and 4\u00b0C. The resulting supernatant containing outer membrane vesicles was passed through 0.22 \u03bcm filters to remove any cell debris. The filtered supernatant was ultracentrifuged for 2 h at 126,000 \u00d7 Total protein concentrations were measured for all fractions using a bicinchoninic acid (BCA) assay kit according to the manufacturer\u2019s instructions to determine the fractions containing the greatest concentration of OMVs. The OMV isolation was conducted from the culture stages where the pH of the growth medium was pH 6.5, 6.0, 5.7, 5.3, and 5.1. No significant OMVs were observed in the cultures collected at pH 6.5 and pH: 6.0 (data not shown). The purified OMV fractions collected at different growth phases were subjected to measurement of the concentration and particle size using a NanoSight NS300 .To a 100 \u03bcL of OMV sample, 2 \u03bcL of DNase [13 units (U)/\u03bcL] was added to a final concentration of 2 U to treat the external DNA of OMV. This sample was stored at 37\u00b0C for 30 min, followed by DNase deactivation by heating the sample at 80\u00b0C for 10 min. Later, OMV DNA was extracted from DNase treated and untreated OMVs using the Isoplant-II DNA extraction kit according to the manufacturer\u2019s instructions. The extracted DNA was quantified by using a NanoDrop UV-Vis spectrophotometer .g for 1 h at 4\u00b0C in a Hitachi-type S50A-2130 rotor. The cells were washed with Tris-buffer and the cell envelope fraction (1 mL suspension) was loaded onto a discontinuous sucrose gradient  and centrifuged in a Hitachi-type S50ST-2069 rotor for 12 h at 16,000 g. Cell walls were isolated from middle fractions. OM and IM membrane fractions were confirmed by SDS\u2013polyacrylamide gel electrophoresis, with proteins stained by Gel Code Blue Safe Protein Stain (Thermo Fisher Scientific).This study compared the lipid profiles of Inner membrane (IM), Outer membrane (OM), and OMVs. For IM and OM, the cell membrane was extracted by physical disruption using a bead shocker . Initially, cell pellets were collected from a 500 mL culture and stored at \u221280\u00b0C until further use. The pellet was then resuspended and washed in 20 mM Tris\u2013HCL pH-8 buffer by centrifugation at 7,800 rpm for 10 min at 4\u00b0C, and the pellet weight was measured. Sterilized zirconium beads (0.1 mm) were added to the pellet in a 1: 2 (w/w) cells to beads ratio and resuspended in 15 mL. The cell and bead mixture was transferred to the bead shocker tube and cells were broken for 20 min at full speed . Beaded cells were placed on ice to allow the beads to settle down at the bottom, and centrifuged at 7,800 rpm for 15 min at 4\u00b0C to remove the cell debris. The bead-free supernatant was further centrifuged at low speed  to remove cell debris and repeated twice. Cell-free extract (supernatant) was transferred to an ultracentrifuge tube (15 mL in each tube). Cell envelopes were obtained from the supernatant after centrifugation at 12,000 \u00d7 For lipidome analysis, the bacterial OMV solution was washed with water and transferred to a test tube. Two milliliters of methanol and 2 mL of chloroform were added, and the mixture was shaken for 30 s. The mixture was centrifuged at 3,000 rpm for 5 min, and then the lower layer (organic layer) was transferred to a new tube. Further, 2 mL of chloroform was added to the residue in the upper layer, shaken for 30 s, centrifuged at 3,000 rpm for 5 min, and then transferred to the lower layer in the first test tube in duplicate. The organic layer was dehydrated under a stream of nitrogen. The residue was reconstituted with dichloromethane/methanol  to prepare analytical samples. Chromatographic separation of phospholipids was achieved on an Inertsil SIL-100A column . Eluent A was a 90% methanol solution containing 0.1% ammonia, and eluent B was dichloromethane. Separation was performed by gradient elution at a flow rate of 0.5 mL/min with a Nexera UHPLC system  and eluted with linear gradients from 93% eluent B (0 to 3.5 min), 93 to 74% B (3.5 to 9.0 min), 74 to 25% B (9.0 to 11.0 min), 25% B (held for 5 min), and 93% B . Detection was conducted on a Triple Quad5500 mass spectrometer  with electrospray ionization. A Positive ion\u2013mode precursor ion scan was used for PC with a target ion of m/z 184. A Positive ion\u2013mode neutral loss scan was used for PE, PS, and PG with target ions of m/z 141, 185, and 172, respectively. Negative ion\u2013mode precursor ion scans were used for PA and PI with target ions of m/z 153 and 241, respectively. Quantitation plots of each phospholipid peak area versus the concentration of phospholipids in standard solution were constructed using Analyst 1.7. and least squares linear regression was applied to the data. Concentrations of phospholipids in the analysis samples were calculated using the quantitation plots. The composition ratio of the sum of the alkyl chain lengths and the sum of the degrees of unsaturation of the fatty acids was calculated. OMV proteins at different growth phases were checked using SDS\u2013polyacrylamide gel electrophoresis, with proteins stained by colloidal Coomassie blue (Thermo Fisher Scientific) .C. ochracea cells could produce OMVs through microscopy. Late exponential growth phase cells were used for the observation of OMVs, where thin sections of cells were subjected to TEM analysis. Prior to TEM observations, the cells were treated with Pb, uranium, and osmium heavy metals. The combination of heavy metals produced strong staining of the lipid bilayer and outer vesicle surfaces, and samples with heavy metal staining showed strong contrast in the cell membrane in comparison to cells without staining , phosphatidylethanolamine (PE), phosphatidylcholine (PC), phosphatidylglycerol (PG), and phosphatidylinositol (PI), where PE was the most abundant lipid detected in all samples with a composition of more than 99%  through deacylation of A\u2212LPS has been proposed to increase the curvature leading to OMV formation in P. gingivalis  but also untreated (236 ng/\u03bcL) OMVs, suggesting the encapsulation of cellular DNA while biogenesis of OMVs in both strains.In this study, we also conducted the same lipidomics analysis for and OMVs . In addiand OMVs , and theochracea , suggestngivalis . In thisurvature . AdditioA inside , we alsoC. ochracea at different growth phases. Growth phases were determined by the pH of the culture, as the C. ochracea growth curve showed a relationship between pH and optical density (OD600) with time, as shown in 600 was reached and isolated as previously described. The quantity of OMVs was characterized by measuring the total protein concentration from the gradient purified fractions  contained OMVs ranging mostly between 20 and 150 nm in size. OMVs purified from the late exponential (pH: 5.3) and mid-exponential phase (pH: 5.1) showed OMVs size starting around 50 nm and contained aggregations of OMVs, thus showing a slightly larger diameter  in partiC. ochracea. The results of this study showed that the unsaturated and branched-chain fatty acids of PI lipids in the C. ochracea OMVs were enriched, indicating increased membrane fluidity and likely responsible for biogenesis of OMVs. The heterogeneity of phospholipids in bacterial membranes has already been confirmed  to solid surfaces via their outer membrane   process requires further investigation.Bacterial membranes play a key role in mediating cellular and extracellular activities between living cells and their environment and in helping bacteria adapt to new conditions for their survival. It has been recently discovered that membrane . OMVs aria coli) . These fP. gingivalis OMVs equipped with protease gingipains, that is, cargo proteins of vesicles, stimulate changes in glucose metabolism in the liver and contribute to the progression of diabetes mellitus (C. ochracea development is harbored within oral polymicrobial biofilms. OMVs released from biofilms may be involved in a wide range of pathological processes to attack host cells. This OMV biogenesis study lacks data to explain the inclusive role of OMVs in pathogenesis. Therefore, further studies are needed to understand how C. ochracea OMVs manipulate the host immune response.Interactions between eukaryotic cells and vesicles from pathogenic bacteria suggest a role for vesicles in pathogenesis . Therefomellitus . In addiThe original contributions presented in the study are included in the article/DN, WM, SS, ST, TS: conceptualization, methodology, data curation, writing \u2013 original draft preparation. NN: data discussion. MT: data analysis, reviewing and editing. AO: supervision, conceptualization, writing \u2013 reviewing and editing. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Puccinia polysora Underw that can lead to severe yield losses. However, genomic information and microsatellite markers are currently unavailable for this disease. In this study, we generated a total of 27,295,216 high-quality cDNA sequence reads using Illumina sequencing technology. These reads were assembled into 17,496 unigenes with an average length of 1015\u00a0bp. The functional annotation indicated that 8113 (46.37%), 1933 (11.04%) and 5516 (31.52%) unigenes showed significant similarity to known proteins in the NCBI Nr, Nt and Swiss-Prot databases, respectively. In addition, 2921 (16.70%) unigenes were assigned to KEGG database categories; 4218 (24.11%), to KOG database categories; and 6,603 (37.74%), to GO database categories. Furthermore, we identified 8,798 potential SSRs among 6653 unigenes. A total of 9 polymorphic SSR markers were developed to evaluate the genetic diversity and population structure of 96 isolates collected from Guangdong Province in China. Clonal reproduction of P. polysora in Guangdong was dominant. The YJ (Yangjiang) population had the highest genotypic diversity and the greatest number of the multilocus genotypes, followed by the HY (Heyuan), HZ (Huizhou) and XY (Xinyi) populations. These results provide valuable information for the molecular genetic analysis of P. polysora and related species.Southern corn rust is a destructive maize disease caused by  Puccinia polysora is one of most devastating fungal diseases of corn; it was first described and named by Underw in 18971. SCR is distributed in tropical, subtropical and temperate cultivation regions, including Asia2, the United States4, Australia5 and Africa6. An increase in disease occurrence has been reported in recent years in China. The lack of varieties resistant to SCR and long-distance migration of the disease are the main reasons for severe disease epidemics8.Southern corn rust caused by 12. The risk of the pandemics of this disease is a big threat11. Although several physiologic races of P. polysora have been described17 and resistance has been reported7, the majority of commercial hybrids grown in China and the United Stated are rated as susceptible to P. polysora20. In the past, the disease has caused several serious yield losses in various countries, including West Africa (50%6), the Philippines (80\u201384%21), Brazil (40%22), the United States (30\u201350%3) and China (42\u201353%23).SCR appears to have great potential to damage plants. Symptoms initially appear on leaves and expand through an entire plant, including the leaves, stalks, leaf sheaths and husks, in late-season planting, which can result in leaf necrosis and complete destruction of photosynthetic areas, followed by death of the plantP. polysora remain unknown. The alternate host of P. polysora has never been found. Urediniospores serve as both primary and secondary inoculum sources of mini cycle of the disease2. The aecidial and pycnidial stages of P. polysora are absent9. Teliospores are rarely or not produced2. All experiments attempting to induce the germination of teliospores have been unsuccessful9. The function of teliospores in the life cycle remains mystery, although they could be of significance in assuring extended survival of the pathogen. The highly successful uredo stage and the ease of continuity of this stage may have resulted in the suppression of the sexual phase in the life cycle9. Due to the lack of evidence, Cammack9 provisionally classified P. polysora as a microcyclic and autoecious hemiform.The life cycle and mating system of P. polysora have been deposited in GenBank. The lack of whole-genome sequences means that little molecular information is available for the pathogen, which limits the research on this pathogen. Illumina sequencing of the transcriptomes of model and nonmodel organisms previously confirmed that short reads can be effectively assembled26. For nonmodel organisms with limited genomic information, transcriptome sequencing, which focuses on the sequencing of functional and protein-coding RNAs, is a cost-effective method28. Transcriptome data are invaluable in the discovery of gene functions, metabolic pathways and molecular markers25.Although the disease is a main problem of corn production, few nucleotide sequences of 30, however, no SSR markers for P. polysora have been developed and reported to date. Without effective molecular markers, the genetic diversity of P. polysora has rarely been reported. The population diversity of P. polysora was investigated using restriction fragment length polymorphisms (RFLPs) in Japan31 and inter-simple sequence repeats (ISSRs) in Thailand32 and China33. The traditional and standard methods for developing SSR markers are time-consuming and expensive, whereas transcriptome sequencing provides a high-throughput source for investigating SSRs35.Polymorphic simple sequence repeats (SSRs) have been proven to be important for assessing genetic diversity and population structureP. polysora using an RNA-seq sequencing platform, Illumina HiSeq2000, (2) assemble and annotate the unigenes of P. polysora, (3) develop polymorphic SSR markers, and (4) genotype and characterize the population genetics of P. polysora isolates collected from the cities of Xinyi, Huizhou, Yangjiang and Heyuan in Guangdong Province. The transcriptome sequences provide a valuable genomic resource for the molecular study of P. polysora, and the findings provide the first perspective into the P. polysora population structure in Guangdong Province.The objectives of this study were to (1) sequence the transcriptomes of urediniospores of P. polysora. A total of 28,252,282 raw reads (4.09 Gbp) were obtained. The percentages of Q20 and Q30 were 96.62% and 91.76%, respectively. The GC content was approximately 49.49%. After quality control, the remaining high-quality reads were assembled into 10,539 transcripts with an average length of 1,229\u00a0bp and an N50 of 2,083\u00a0bp  unigenes were annotated. Because of the lack of genome information for There were 6,603 unigenes categorized into three main GO categories: biological process 17,725), cellular component  and molecular function   Fig. . Among tP. polysora, all the unigenes were analysed in the KEGG pathway database. A total of 2,921 unigenes with significant matches were assigned to 32 KEGG pathways in five main categories , which estimates gene diversity, ranged from 0.021 to 0.50236. Simpson\u2019s index \u03bb (the genotypic diversity index) ranged from 0.021 to 0.499, and evenness ranged from 0.353 to 0.998 (Table 37. Locus Ppoly8 had the highest Simpson diversity (0.499) and the most evenly distributed alleles (0.998). A genotype accumulation curve showed that these 9 loci are informative for population genetic analysis  of ed Table . A totalP. polysora isolates. The optimal number of PCs (30) was assessed using the find.clusters function. The cluster membership probabilities of each isolate based on the discriminant functions of DAPC were conducted with cluster numbers (K) from 2 to 8  was performed to analyse the genetic structure of 96 o 8 Fig.\u00a0. With thP. polysora. The structure of P. polysora was dominated by the presence of two clonal linages  phylogenetic tree and minimum spanning network (MSN) were conducted to further assess the population structure of ges Fig.\u00a0B. There ges Fig.\u00a0A. PopulaP. polysora remain unknown. Transcriptome analysis is an attractive alternative to examine the properties of a transcriptome as a proxy for the whole genome38. Transcriptome sequencing is a powerful and cost-effective method for generating large-scale transcriptomes and is used to annotate novel genes for model and nonmodel organisms and to develop molecular markers26. To our knowledge, the present study is the first attempt to perform de novo assembly of the transcriptome and to develop SSR markers of P. polysora.Recently, southern corn rust has become research focus because of its wide distribution, great damage and high incidence in China. Although southern corn rust is a devastating disease worldwide, the complete genome sequence and transcriptomic data for Melampsora larici-populina , M. lini  and P. striiformis . The average length of the unigenes with an N50 of 1,922\u00a0bp was 1,015\u00a0bp. The GC content was 49.49%. These results indicated that the transcripts of P. polysora were of high quality and provided a large amount of valuable transcriptome information for gene annotation, novel gene discovery, and the investigation of molecular evolutionary mechanisms in P. polysora26.In this study, we obtained a total of 27,295,216 high-quality reads with a Q20 of 96.62% using Illumina paired-end sequencing. A total of 17,496 unigenes were assembled, which is similar to the gene numbers predicted for other rust fungi, such as P. polysora, almost half of the unigenes might represent novel genes whose function is unknown. In the Nr database, most unigenes (77.00%) were annotated to Puccinia graminis f. sp. tritici, which causes stem rust of wheat. This result confirmed that P. polysora is closely related to P. graminis which has been completely sequenced43. In addition, we categorized 6,603, 4,218 and 2,921 unigenes into GO categories, orthologous groups (KOG/COG) and KEGG pathways, respectively, indicating that one-third of the unigenes could be well annotated with potential functions. The annotated unigenes might be useful in the investigation of gene function and valuable for further research in the future. These results again demonstrated that genes can be investigated by transcriptome analysis for nonmodel plant species.To annotate the biological function of unigenes at the transcriptome level, sequence similarity searching was conducted against the Nr, Nt, Swiss-Prot, GO, Pfam, KOG/COG and KEGG databases. More than half of the unigenes  were matched with known proteins in public databases. Due to the absence of a reference genome for P. polysora. Only 9 primer pairs with the expected size were polymorphic among the 96 isolates of P. polysora. The primer pairs resulting in PCR products larger or smaller than expected may be due to the presence of introns, insertions or repeats, a lack of specificity, or assembly errors44. The low percentage of polymorphic loci may be due to the close geographic origin of isolates or the clonal reproduction of the pathogen45.In the present research, a total of 8,798 potential SSRs were identified in 6,653 unigenes. We selected 400 high-quality SSR primer pairs for amplification and polymorphism detection via PCR with 96 isolates of P. polysora populations fully support our results33. Using ISSR markers, Unartngam et al.32 found that P. polysora isolates from different provinces in Thailand have similar genetic characteristics and are present in the same groups, likely resulting from spore migration. The same result was found in Chinese populations using ISSR markers33. The urediniospores of P. polysora can be dispersed by air currents up to altitudes greater than 15,000 ft high and spread long distances by wind1. The present study again confirmed that the isolates from different localities presented similar genetic characteristics, which might be due to spore migration.Previous genetic diversity studies of All the populations in Guangdong Province exhibited admixture with other populations and were clustered into two clonal groups, while the YJ population showed the highest genotypic diversity and the most eMLGs. More isolates with unique MLGs were found in the YJ population. The pathogen can survive year-round in the most south city Yangjiang belonging to the tropical zone, which might increase the possibility of new genotypes arising.P. polysora is a microcyclic and autoecious hemiform pathogen32. The index of association IA rejected the null hypothesis of linkage equilibrium in three out of four populations, suggesting high rates of selfing and clonal reproduction. Population XY was the exception and was characterized by only 6 MLGs, of which 5 MLGs were shared with other populations. Eight out of 13 isolates clustered into the clonal groups, and 5 isolates showed slight genetic differentiation. The differences remaining in population XY could lead to not reject the null hypothesis of linkage equilibrium, despite the pathogen truly reproducing clonally. Failure to reject the null hypothesis of linkage equilibrium does not mean the confirmation of sexual reproduction. More isolates in population XY are needed for further confirmation. The majority of isolates were clustered into two dominant clonal groups, which could be additional support for clonality and selfing.Our results confirm the previous study showing that IA showed that the populations HY and HZ are highly clonal or selfing. Therefore, we propose that the observed cryptic diversity is because of sampling bias. Isolates of the cryptically diversity groups likely belong to their own clonal group or groups, that were not sampled deeply enough to obtain their membership.The observed cryptic diversity appeared to be sampling bias. Members of the diverse groups were from HY, HZ and XY; however, most isolates of these populations were clustered into the dominant clonal groups. Furthermore, the index of association P. polysora. More work is needed to investigate the gene function and population structure of P. polysora.This work provides novel insights into the transcriptome, annotated unigenes, polymorphic SSRs and population genetics of P. polysora in China. To investigate the population genetics of P. polysora in Guangdong Province, we collected diseased leaves from the cities of Xinyi, Huizhou, Yangjiang and Heyuan in Guangdong Province. In each city, two to ten sampling sites with distances of at least 500\u00a0m apart from each other were identified, and 10 diseased leaves were randomly collected in each sampling site , HZ (Huizhou), YJ (Yangjiang) and HY (Heyuan). A single pustule was collected from the sampled leaf to obtain each isolate on the assumption that each pustule was caused by a single urediniospore. To obtain enough urediniospores for DNA extraction, reproduction of isolates was conducted using the same method described above. A total of 98 isolates were obtained Tables , 6.Total RNA was extracted using a TRIzol Kit  following the manufacturer\u2019s instructions. Residual DNA was removed using RNase-free DNase I  for 30\u00a0min at 37\u00a0\u00b0C. The purified RNA quality and quantity were verified using a spectrophotometer  and an Agilent 2100 Bioanalyzer .Poly(A) mRNA was enriched by oligo (dT) magnetic beads. All mRNA sequences were cut into short fragments by using fragmentation buffer. Taking the short fragments as templates, random hexamer primers were used to synthesize first-strand cDNA. Then, buffer, dNTPs, polymerase I and RNase H were added to synthesize second-strand cDNA. The cDNA fragments were purified using the AMPure XP system , resolved with EB buffer for end repair and A tailing, and connected with sequencing adapters. PCR was performed using Phusion High-Fidelity DNA polymerase, universal PCR primers and an index primer. PCR products were purified using the AMPure XP system and assessed on DNA high-sensitivity chips using the Agilent Bioanalyzer 2100 system to construct the final cDNA library. The cDNA library was sequenced by Illumina HiSeq2000 sequencing performed by Novogene Bioinformatics Technology Co., Ltd., Beijing, China.46. Unigenes of the transcriptome were annotated using the NCBI nonredundant protein (Nr) database, NCBI nonredundant nucleotide sequence (Nt) database, Kyoto Encyclopedia of Genes and Genomes (KEGG) database, a manually annotated and reviewed protein sequence (Swiss-Prot) database, Cluster of Orthologous Groups of proteins (KOG/COG) database, Gene Ontology (GO) database and protein family (Pfam) database. The statistical enrichment of the unigenes in KEGG pathways was tested by KOBAS software as shown previously48. The annotation with the Nr, Nt, Swiss-Prot and KOG databases used NCBI Blast version 2.2.28\u2009+\u2009with an e-value of 1e\u22125. GO analysis was performed using Blast2GO version 2.549. Pfam protein domain prediction was conducted using HMMER version 3.050.The high-quality clean reads for assembly were separated from adapters. Reads with more than 50% Q20 bases and those with more than 10% ambiguous \u201cN\u201d bases were removed. De novo transcriptome assembly was conducted using Trinity software with an optimized k-mer length of 2551. The parameters were adjusted to identify mono-, di-, tri-, tetra-, penta- and hexanucleotide motifs with a minimum of ten, six, five, five, five and five repeats, respectively. Primer 3 version 2.2.3 was used to design the primer pairs with default settings. Forward primers were labelled with fluorescent tags  to improve the separation of overlapping markers during multiplexing. Ninety-six isolates sampled from Guangdong Province were used for PCR amplification and polymorphic identification. Amplifications were performed with a thermal cycler (Eppendorf AG) under the following conditions: initial denaturation at 94\u00a0\u00b0C for 5\u00a0min, followed by 35 cycles of 94\u00a0\u00b0C for 30\u00a0s, annealing temperature (Tm) 54, Stoddard and Taylor\u2019s index G55, and Simpson\u2019s index \u03bb37, evenness E556, Nei\u2019s unbiased gene diversity Hexp36, and index of association IA57. eMLG estimates the number of expected MLGs that share the same sample size based on rarefaction. H and G both measure richness and evenness, increasing as genotypic richness and evenness increase. G weights abundant MLGs more heavily than less abundant MLGs. \u03bb is an estimation of the probability that two randomly selected genotypes are different. E5 is a measure of the distribution of genotype abundances. E5 is equal to one when a population has equally abundant genotypes and closer to zero when it is dominated by a single genotype. Hexp estimates the average heterozygosity. IA are measures of linkage disequilibrium. Significant disequilibrium is expected due to linkage among loci when a population is clonal, and linkage among loci is not expected in sexually reproducing populations.We used various R packages to perform population genetic analysisape58 was used to draw a neighbour-joining dendrogram with Prevosti\u2019s distance59. Minimum spanning networks (MSNs) were constructed with the genetic distance of Bruvo60 using the package poppr. Discriminant analysis of principal components (DAPC) was plotted using the packages adegenet61 and ade462.The package The transcriptome has been submitted to the National Center for Biotechnology Information (NCBI). BioSample accession: SAMN18713839.Supplementary Information 1.Supplementary Information 2.Supplementary Information 3.Supplementary Information 4.Supplementary Information 5.Supplementary Information 6."}
+{"text": "Emerging evidence suggests a significant functional role of adipose tissue in maintaining whole-body metabolic health. It is well established that obesity leads to compositional and morphological changes in adipose tissue that can contribute to the development of cardiometabolic disorders. Thus, the function and size of adipocytes as well as perfusion and inflammation can significantly impact health outcomes independent of body mass index. Lifestyle interventions such as exercise can improve metabolic homeostasis and reduce the risk for developing cardiometabolic disorders. Adipose tissue displays remarkable plasticity in response to external stimuli such as dietary intervention and exercise. Here we review systemic and local effects of exercise that modulate white and brown adipose tissue cellularity, metabolic function and remodeling in humans and animals. Moreover, smaller adipocytes have been shown to be protective against metabolic decline  is associated with increased rates of development and mortality from cardiovascular disease and various cancers . While t decline  and adip decline . AdiposeAdipose tissue is a complex organ composed of different cells and niches that control key processes including adipogenesis, adipokine secretion and inflammatory responses. While mature adipocytes are the main functional cells regulating lipid uptake and release, they only constitute a fraction (about 20% in humans) of the cells contained in this tissue . Other cEffects of exercise on adipose tissue cellularity in rats have been observed as early as the 1970\u2019s. This early work highlights the potential of exercise to favorably modulate adipose tissue cellularity, with exercising groups consistently presenting with smaller adipocytes in white adipose tissue . These eIn comparison to the work in animal models described above, evidence for an effect of exercise on adipose tissue cellularity in humans is lacking. This is likely due to limitations in obtaining adipose tissue biopsies, especially in VIS fat pads. Additionally, investigators are finding that the physiology of adipose depots in mice may not directly translate to human adipose tissue . In compde novo recruitment and differentiation (adipogenesis) of APCs. Recruitment and differentiation of preadipocytes is believed to be protective against metabolic decline by limiting cell hypertrophy, hypoxia, and adverse tissue remodeling. It has recently been demonstrated that functionally distinct populations of APCs exist in adipose tissue of mice and humans , treadmill exercise in high fat diet (HFD) mice resulted in an increase in preadipocytes in brown adipose tissue (BAT), with increased adipogenic capacity  of UCP1 . Further of UCP1 . The autThere are three primary types of adipose tissue that have been very well characterized: white adipose tissue (WAT), brown adipose tissue (BAT) and beige adipose tissue. WAT has long been thought of as an energy storage depot with the primary function of storing excess lipids. It is now well established that WAT functions as an endocrine organ, secreting various adipokines that affect whole body metabolic homeostasis and normal adipose tissue function is disrupted with obesity . BAT is It has been consistently reported that diet-induced obesity results in a significant decrease in angiogenesis and capillary density in white adipose tissue . This anMdm2 expression increases in both SUB and VIS fat in trained mice and knockdown of Mdm2 in vitro resulted in a decrease in capillary growth following adrenergic stimulation (In animal models, one study found that exercise training in obese rats resulted in improved vessel density in both SUB and VIS fat when compared to sedentary obese animals . Interesmulation . In compmulation . In contmulation . While iObesity is known to cause increased fibrosis in adipose tissue which has been linked to metabolic dysfunction by limiting the healthy expansion of adipose tissue . Minimal+ T cell in adipose tissue with obesity (Infiltration of inflammatory immune cells in adipose tissue has be extensively studied and is known to contribute to obesity-related inflammation and insulin resistance . Exercis obesity . While w obesity . MechaniImmune infiltrates in response to exercise have not been extensively studied in BAT when compared to WAT, however, one study found that exercise training in mice resulted in increased BAT mass and anti-inflammatory gene expression , suggestThere are well documented effects of exercise on mitochondrial activity ,b, gene The effects of exercise on BAT are less clear in comparison to WAT adaptations. Considering that both exercise and BAT increase thermogenesis and energy expenditure, some have hypothesized that exercise may downregulate BAT to maintain body temperature . One stuExercise improves adipose tissue cellularity, stimulates angiogenesis, and improves metabolic function of WAT . Also, eJG wrote the manuscript. SB critically revised the manuscript. Both authors approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Streptococcus uberis (16.0%), Escherichia coli (13.8%), Klebsiella pneumoniae (13.2%), Streptococcus dysgalactiae (6.2%), and Staphylococcus aureus (3.4%). In straw farms, the most frequent species were S. aureus (16.6%), S. uberis (11.0%), E. coli (9.1%), S. dysgalactiae (8.0%), and K. pneumoniae (1.1%). The incidence of clinical mastitis  was not higher in recycled manure solids farms  compared with straw-bedded farms . However, K. pneumoniae clinical mastitis episodes were 7.0 (95% CI: 2.0\u201324.6) times more frequent in recycled manure solids farms than in straw farms. Adjusted least square means estimates were 1.6 K. pneumoniae clinical mastitis cases/100 cow-year (95% CI: 0.8\u20133.4) in recycled manure solids farms vs. 0.2 cases/100 cow-year (95% CI: 0.1\u20130.6) in straw-bedded farms. Klebsiella pneumoniae clinical mastitis is in general severe. Producers interested in this bedding alternative need to be aware of this risk.Bedding can affect mammary health of dairy cows. The objectives of this study were to evaluate clinical mastitis incidence in cows housed on recycled manure solids bedding and, more specifically, to determine which pathogens were involved. We followed 26 recycled manure solids farms and 60 straw-bedded farms as a comparative group during 1 year (2018\u20132019). For each episode of clinical mastitis, defined as a visual alteration of the milk, with or without local or systemic signs of infection, producers sampled aseptically the affected quarter, provided some details about the animal, and sent the sample to the research team at the Universit\u00e9 de Montr\u00e9al. We received and analyzed 1,144 milk samples. The samples were cultured according to the National Mastitis Council guidelines and the different colony phenotypes were subsequently identified with mass spectrometry. In 54.6% of CM cases, a single phenotype of bacteria was cultured (pure culture), while two different phenotypes were found in 16.8% of the samples (mixed culture), and no growth was observed in 14.4% of the samples. Samples with three or more phenotypes were considered contaminated and were not included in the pathogen-specific analyses (14.3% of the submitted samples). The most frequently identified bacterial species in pure and mixed culture in farms using recycled manure solids were  Dairy producers are interested in alternative bedding products that may be less expensive to buy or produce, easily available in large quantities, and secure for animals and humans. There is a growing interest in Eastern Canada to use recycled manure solids (RMS) as bedding. This product is already used in many countries such as the United States, United Kingdom, and the Netherlands. However, there is no consensus on the best technique to produce RMS to ensure its safety. The method used to produce RMS and the different climates where it is used will influence its physicochemical and, possibly, its microbiological characteristics , 2. RecyCryptosporidium parasites were found more frequently from the feces of cows in RMS farms compared with cows housed on straw bedding  were evaluated in two studies that yielded conflicting results. In an experimental study in one dairy facility of 309 primiparous Holstein cows, associations between type of bedding (RMS or sand) and CM incidence could not be highlighted . In a seKlebsiella spp. on farms using RMS bedding. There are two main hypotheses explaining this potential increase in CM incidence. First, this bedding may contain an increased amount of Klebsiella spp. before usage compared with more conventional bedding. However, this hypothesis was refuted in two studies which observed that unused RMS, on average, contained less Klebsiella spp. than straw . This paper was elaborated using the \u201cSTROBE-Vet statement\u201d guidelines .a priori power estimation. We estimated that, using 90 herds (20%: RMS bedding vs. 80%: straw bedding), milking an average of 50 cows, and a baseline probability of clinical mastitis of 20%, we would have >95% power to detect a difference of probability of mastitis corresponding to an odds ratio \u22651.4. For this calculation, we did not account for clustering of cows by herd. Thus, the real power is likely to be smaller than 95%.A list of farms using RMS was generated by contacting RMS equipment dealers and veterinarians and through social media. Straw farms were recruited with the help of Qu\u00e9bec Dairy Herd Improvement Association . For both type of herds, to be eligible, farmers needed to be located within 250 km of the research facilities , to have used the same bedding for >6 months prior to the farm visit, and for the straw farms, to be enrolled in a DHIA milk recording program. This latter condition was added for another part of the study on subclinical mastitis. We aimed at recruiting ~90 farms. This number was determined by an All potential farms were contacted by telephone between July and December 2017 to verify their eligibility and willingness to participate. Basic demographic information such as the number of milking cows in the herd, type of bedding used, and for RMS farms, which equipment they used were also gathered from herds that were excluded, to study their similarities with participants and assess the presence of a selection bias.Farm visits were described elsewhere , 11. BriDuring 1 year following the initial visit, producers were asked to sample aseptically each quarter of cows experiencing a CM. Farmers had to provide information regarding the identification of the cow, its parity, the position of the quarter affected, and the severity of the CM. For the latter, farmers had to categorize CM events as score 1 , score 2 , or score 3  as described by Sears and McCarthy . Two conThe number of CM episodes was compiled for each farm, as well as the number of severe (score 3) CM episodes. Finally, we compiled the CM episodes by specific pathogens. To account for the varying herd size and the exact time period of follow-up, the number of milking cows in each herd and the length of the follow-up period were also compiled.Most CM studies have to deal with different levels of the compliance of producers for reporting CM cases and/or submitting samples. To investigate this potential bias, we used two different approaches to estimate the herd animal-time denominator used to adjust CM incidence. First, we used a common approach which is the exact number of milking cows and the exact period of follow-up  to compuThen, as a sensitivity analysis, we also estimated the follow-up period using the interval between the first and last sampling dates as the definition. Thus, with this alternative method, farms who did not send any samples or that sent only one sample during the 1 year study period were excluded . Moreover, farms that may have sent >one sample but then stopped sending samples at some point in time would be included, but with a shorter time at risk period . Then, we computed the number of cow-year at risk of the herd for each farm by multiplying the number of milking cows of the herd by the follow-up time. Using this alternative method allowed to exclude producers who sent <2 samples during the study period and weighted down producers who possibly stopped sending samples during the study.Statistical analyses were performed using SAS 9.4 . Descriptive statistics were used to explore relations between predictors. To compare the incidence of CM in RMS and straw farms, we used a binomial negative model with the number of CM cases on a given farm as the outcome , type of bedding used (RMS or straw) as the main predictor, and the natural logarithm of the number of cow-year at risk as an offset term. In this model, we also included a number of putative confounding variables as predictors: housing type , time since the last renovations of the stalls (in years), bedding thickness , and herd size (number of milking cows). With such a model, we could thus compute the CM incidence ratio (IR) between RMS- and straw-bedded farms, after adjusting for these confounders, simply by exponentiating the bedding coefficient. Moreover, the mean estimated CM incidence (in cases/100 cow-year) for a given type of herd could be computed simply by adding the intercept and the coefficients corresponding to that farm description, then exponentiating the results and, finally, multiplying the results by 100 cows (to obtain an incidence per 100 cow-year). Finally, all models were ran twice, initially using the complete follow-up period to compute the animal-time at risk of the herd and, then, using the animal-time at risk computed using the alternative method.p < 0.05), the polynomial presentation of the variable was retained in the final model. If overdispersion was observed in the data (Pearson chi-square > 1.2), robust variance was used. Significance level was fixed at p \u22640.05. Data and the SAS code used to construct the models are publicly available at https://doi.org/10.5683/SP2/KIEMHY.The assumption of linearity of the relation between quantitative predictors  and the outcome (logarithmic transformation of the incidence ratio) was verified with the addition of polynomial terms (square and cubic terms) after centering the predictor. If the polynomial terms were significant .We received 1,247 samples during the study period . We exclStreptococcus uberis (16.0%), Escherichia coli (13.8%), K. pneumoniae (13.2%), Streptococcus dysgalactiae (6.2%), and Staphylococcus aureus (3.4%). In straw-bedded farms, S. aureus (16.6%), S. uberis (11.0%), E. coli (9.1%), S. dysgalactiae (8.0%), and K. pneumoniae (1.1%) were the most frequent pathogens. Clinical mastitis episodes due to coliforms (K. pneumoniae and E. coli) were more often severe. Clinical mastitis episodes due to S. uberis, S. dysgalactiae, or S. aureus were, in general, mainly mild or moderate (The most frequent recovered pathogens (in pure or mixed IMI) by bedding type and severity are reported in moderate .Clinical mastitis  incidence distribution estimated using a period at risk extending from start to end of the study is illustrated in K. pneumoniae CM, however, was higher in RMS farms with a LSM of 1.6 cases/100 cow-year  compared with 0.2 cases/100 cow-year  for straw farms. For this comparison, a 7.0 times  higher incidence was observed in RMS farms. There was no significant difference between the two types of farms regarding the incidence of CM due to S. uberis, E. coli, S. dysgalactiae, or S. aureus.The estimated incidence of When using the alternative approach for computing period at risk, we ended up excluding 8 RMS farms and 11 straw-bedded farms that sent <2 samples during the study period . Using tK. pneumoniae was significantly higher in RMS farms with a LSM of 3.4 cases/100 cow-year  compared with 0.6 cases/100 cow-year  in straw farms. This was equivalent to a 5.9 times  higher incidence in RMS farms. There was still no difference between the two groups concerning the incidence of CM due to S. uberis, E. coli, S. dysgalactiae, or S. aureus.As in our first approach, the estimated incidence of CM due to Streptococcus, E. coli, and Klebsiella spp. were identified in 50% of CM culture-positive samples. In that latter study, however, pathogen-specific CM incidence was not reported.To our knowledge, this is the first study to report pathogen-specific CM incidence on RMS farms. In our study, the proportion of contaminated samples was similar to a previously published work  and was K. pneumoniae CM outbreaks in RMS farms. This hypothetical higher incidence of K. pneumoniae CM in RMS farms was confirmed in the current study. One hypothesis to explain these mastitis episodes is that, right from the start, RMS bedding may contain a higher concentration of K. pneumoniae than straw. In a parallel study conducted on the same herds during the same period, we observed that unused RMS contained lower concentrations of Klebsiella spp. than unused straw. However, at the end of the usage cycle , the concentrations of Klebsiella spp. were similar between the two bedding types. Another hypothesis is that the growth rate of Klebsiella spp. would be higher in RMS bedding than in other bedding types. Thus, despite lower bacterial concentrations to start with, the rapid growth of Klebsiella spp. in this bedding type after contamination with feces would quickly lead to increased concentrations of Klebsiella spp. A previous study demonstrated the high potential of RMS for supporting the growth of Klebsiella spp.  for Klebsiella spp. CM, even at the end of the usage cycle. Some other properties of this bedding, for instance its ability to stick to the teats, may better explain the higher K. pneumoniae CM incidence. This latter hypothesis, however, was not investigated in the current study.In our study, we were able to investigate the most common CM pathogens. Prior to conducting this study, veterinarians and producers in our province anecdotally reported lla spp. . Still, K. pneumoniae are usually severe  to compute the animal-time at risk, there were significantly more cases of CM in straw farms. Since herd size varied as function of bedding type, the impact of this more restrictive follow-up period affected differentially the incidence denominator for straw- and RMS-bedded herds. Consequently, since our results on the total CM incidence are affected by the method used to compute them, we can hardly conclude on whether the general CM incidence varied between the two groups of farms. The most commonly used approach in CM research  would conclude on similar CM incidence between bedding types. The more conservative approach (where herds reporting few CM cases or reporting for a limited period of time would be considered non-compliant and excluded) would conclude to a larger general CM incidence in straw-bedded farms. Nevertheless, regardless of the method used, the general CM incidence was never higher in RMS herds. Moreover, our results on species-specific CM incidence appeared to be robust and consistent between both computation methods.A strength of our study was the number of participating farms and the number of cows recruited. To our knowledge, this is the largest number of herds and cows assembled to study the effect of RMS bedding on CM incidence. This is also the first time, to our knowledge, that pathogens responsible of CM were identified. We can now confirm that there are some differences in the pathogen patterns causing CM according to the bedding type. However, since this is an observational study, our study presents some limitations.First, the sampling strategy was not random and some regions were overrepresented due to our proximity criteria. However, to our knowledge, most of the farms using RMS bedding in these regions and during this period were recruited. The bias may be more important regarding recruitment of farms using straw bedding, since we selected only herds enrolled in DHIA for that group. This criterion was not used for RMS farms. Producers enrolled in DHIA may be more concerned about udder health of their cows than the general population of dairy farmers, possibly generating a bias when measuring the association between bedding used and CM incidence. Nevertheless, a good proportion of RMS farms were also enrolled in DHIA, thus limiting the magnitude of this potential bias.Second, the exposition to each type of bedding was not randomly assigned and many confounding factors were possibly operating within these farms. We were able to include in our models some potentially important confounding factors. Thus, our incidence estimates were adjusted for some of the other differences that we observed between RMS- and straw-bedded farms. Nevertheless, some residual confounding is likely to be present. Our results would have to be confirmed using an experimental study design where cows from one or many farms would be randomly assigned to different bedding types while monitoring pathogen-specific CM incidence.Finally, a well-known challenge in studies on CM is the relatively low compliance of farmers for recording CM episodes, which may represent an information bias. We hypothesize that this lack of reporting was similar in the two groups of farms. In our study, to improve the reporting of CM episodes, we covered the costs for all the milk analyses conducted during the year of follow-up, provided timely results  to the herd veterinarian, and called all participants every 4 months to keep them engaged and motivated. Moreover, using the alternative method for computing time of follow-up allowed for the exclusion of some herds that were possibly low-compliance herds.Klebsiella spp. CM is an uncommon health event) would be of great value to confirm these initial findings.In the future, experimental studies could help in confirming the results observed in this observational study. For instance, a randomized controlled trial or a crossover study design conducted in one or a few large herds and over a sufficiently long period of time  can be found at: The animal study was reviewed and approved by Animal Care and Use Committee of the Faculty of Veterinary Medicine, University de Montr\u00e9al. Written informed consent was obtained from the owners for the participation of their animals in this study.All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.This project was funded by grants from Novalait, the Consortium de recherche et innovations en bioproc\u00e9d\u00e9s industriels au Qu\u00e9bec, the Fonds Qu\u00e9b\u00e9cois de la recherche sur la nature et les technologies (2017-LG-201835), and the Natural sciences and engineering research council of Canada (CRDPJ 499421 - 2016). The first author (AF) received funding and support from the Natural Sciences and Engineering Research Council of Canada Collaborative Research and Training Experience program in milk quality, from the Canadian Dairy Commission, from Agria, and from Op+lait.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Specifically, we demonstrated the involvement of STEP in A2AR-mediated cocaine effects in the striatum and, more recently, we found that in the rat striatum and hippocampus, as well as in a neuroblastoma cell line, the overexpression of the A2AR, or its stimulation, results in an increase in STEP activity. In the present article we will discuss the functional implication of this interaction, trying to examine the possible mechanisms involved in this relation between STEP and A2ARs.The STriatal-Enriched protein tyrosine phosphatase STEP is a brain-specific tyrosine phosphatase that plays a pivotal role in the mechanisms of learning and memory, and it has been demonstrated to be involved in several neuropsychiatric diseases. Recently, we found a functional interaction between STEP and adenosine A Since their identification in the late 70s, they have been the subject of numerous studies that established their widespread distribution in the brain and their pivotal role in the functioning of the CNS. The adenosine AP levels . With thuite low . Despitec target . Indeed,levodopa .2AR is the ability to modulate the activation and function of several other receptors, such as dopamine D2, cannabinoid CB1, metabotropic glutamate 5 receptor (mGlu5R), as well as adenosine A1 receptors, by forming heteroreceptor complexes , STEP increases neuronal vulnerability to excitotoxic cell death in primary hippocampal cultures and the sensitivity of neurons to excitotoxicity induced by Status Epilepticus in mice. These effects were due to the blockade of neuroprotective responses initiated by the ERK/MAPK signaling pathway. On the other hand, in an  KO mice . In orde KO mice . In addi KO mice .2ARs , we evaluated the enzimatic activity of the total tyrosine phosphatases, and of STEP in particular, in mice striatal tissue after cocaine stimulation. We could show that cocaine increased tyrosine phosphatase activity, and in particular STEP activity, in A2AR-dependent manner. In fact, cocaine failed to activate STEP in the presence of the A2AR antagonist or in A2AR knock-out mice. These results suggested that a possible mechanism through which cocaine reduced synaptic transmission is the recruitment of A2AR and STEP activation. Indeed, STEP activation results in the dephosphorylation and internalization of NMDA and AMPA receptor subunits causing depression of excitatory synaptic transmission , while ZM241385, the A2AR antagonist, reduced STEP activity in overexpressing rats (up to wild type levels), without any effects in wild type animals. In addition, in A2AR overexpressing rats we found a decrease in the phosphorylation levels of GluN2B and Pyk2, two well-known STEP substrates, consistent with an increased phosphatase activity , rather results in the phosphorylation and inactivation of STEP  assays (2AR (a kind gift from Francisco Ciruela) or luminescent-\u03b2-arrestin 2 protein   and that the signaling route of A2AR to STEP61 probably does not depend on their direct interaction. However, to definitively exclude a direct interaction between A2AR and STEP, BRET experiments should be performed also by using other STEP isoforms .To assess if a physical interaction between A) assays  in SH-SYnsducer) . In our 5R as an interactor of STEP . Even though additional experiments are needed, these results clearly suggest that A2ARs modulate STEP activity through the involvement of mGlu5R  could have clinical relevance and its possible consequences should be contemplated when proposing drugs targeting the A2ARs. Notably, particular attention should be payed when considering A2AR agonists as potential treatment for human pathologies (In conclusion, the interaction between Ahologies , given t"}
+{"text": "Analysis of these early DelVGs revealed that deletion formation occurs in clearly defined hot spots and is significantly associated with both direct sequence repeats and enrichment of adenosine and uridine bases. By comparing intracellular DelVGs with those packaged into extracellular virions, we discovered that DelVGs face a significant bottleneck during genome packaging relative to wild-type genomic RNAs. Interestingly, packaged DelVGs exhibited signs of enrichment for larger DelVGs suggesting that size is an important determinant of packaging efficiency. Our data provide the first unbiased, high-resolution portrait of the diversity of DelVGs that are generated by the influenza A virus replication machinery and shed light on the mechanisms that underly DelVG formation and packaging.Deletion-containing viral genomes (DelVGs) are commonly produced during influenza A virus infection and have been implicated in influencing clinical infection outcomes. Despite their ubiquity, the specific molecular mechanisms that govern DelVG formation and their packaging into defective interfering particles (DIPs) remain poorly understood. Here, we utilized next-generation sequencing to analyze DelVGs that form  Influenza A virus (IAV) populations are highly heterogeneous and largely consist of virions that lack functional copies of one or more gene segments , 2. A ma3\u2013The deletion-containing genomic RNAs carried by DIPs are commonly referred to as defective viral genomes (DVGs) . This teNext-generation sequencing (NGS) represents a powerful new tool for revealing the specific processes and molecular determinants that underly DelVG formation \u201318. The \u2013de novo during the first hours of IAV infection. Careful analysis of hundreds of intracellular and extracellular DelVGs revealed the enrichment of specific sequence elements at deletion breakpoints. We also observed that DelVGs represent a much larger fraction of viral RNAs within the cell compared to what gets packaged, suggesting that IAV DelVGs are packaged much less efficiently than wild-type genomic RNAs.To gain a more accurate, comprehensive understanding of DelVG formation and packaging, we specifically examined the DelVGs that formed Previous investigations of influenza DelVGs have generally focused on the RNAs that get successfully packaged into virions (DIPs). It is not actually clear how well the packaged DelVGs observed within extracellular DIPs represent the total population of DelVGs produced by the IAV replication machinery. To better understand the full array of deletions commonly generated during IAV infection, and by extension the DelVG formation process, we examined the distributions of deletion breakpoints found within intracellular viral RNAs isolated early during infection.50]) with a recombinant stock of A/Puerto Rico/8/1934 (PR8) grown under low MOI conditions to minimize DIP content. We then harvested total intracellular RNA at 3 and 6\u2009h postinfection (hpi) in order to capture the intracellular DelVGs produced early during infection. We also extracted viral RNA from supernatants (extracellular RNA) collected at 24 hpi to capture DelVGs that were successfully packaged into DIPs. These RNAs, along with genomic RNA extracted from the infecting viral stock, were used as the templates for whole-genome RT-PCR and NGS, as we have previously described (We infected MDCK-SIAT1 cells at a multiplicity of infection (MOI) of 10  \u00b1 the standard deviations. * P\u2009<\u20090.05; ** P\u2009<\u20090.01; ***, P\u2009<\u20090.001; ****, P\u2009<\u20090.0001; ns, not significant (two-way ANOVA). Download FIG\u00a0S1, TIF file, 0.9 MB.Segment length and direct repeat sequences in DelVGs. (A) Observed normalized intracellular junction counts per segment at 3 hpi were compared to junction counts predicted by a model (expected) that assumes a simple positive correlation between segment length and DelVG junction count . (B) Same as panel A but at 24 hpi. (C) Numbers of intracellular DelVG junctions detected at 3 hpi with no sequence repetition flanking the deletion breakpoints (direct repeat length\u2009=\u20090) or with repeated sequences of various length (direct repeat length\u2009=\u20091 to 9) for the indicated segments (observed). Expected values plot the numbers of junctions with the indicated repeat lengths predicted from model simulations in which junction formation is random. (D) Same as panel C but at 24 hpi. Junction counts are plotted as a percentage of the total number of DelVGs detected for a given segment. The data are presented as means  and have hypothesized these direct repeats may promote DelVG formation by facilitating RNA-dependent RNA polymerase (RdRp) reengagement during the replication process , 25. In in silico. Comparison of the observed nucleotide frequencies with the null model predictions revealed clear enrichment of adenosines or uridines at the 5\u2032 deletion breakpoint position . Numbers of DelVG junction counts (upper panel) and DelVG-mapping NGS reads (lower panel) of samples were counted for three replicates in each segment at each indicated time point, including the inoculum, normalized to 10Copyright \u00a9 2021 Alnaji et al.2021Alnaji et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.02959-21.3FIG\u00a0S3FIG\u00a0S3, TIF file, 0.6 MB.Extracellular viral RNA exhibits lower DelVGs representation compared to intracellular viral RNA (repeat experiment). Data from a repeat of the experiment depicted in Copyright \u00a9 2021 Alnaji et al.2021Alnaji et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the While normalized DelVG junction count numbers within intracellular RNA samples were similar for individual segments between 6 and 14 hpi, we observed an \u223c100-fold decrease in normalized junction counts in extracellular samples taken at 14 hpi  qPCR quantification for WT, DI244, and DI299 in the inoculum of the experiment shown in n\u2009=\u20093 cell culture wells). Download FIG\u00a0S4, TIF file, 0.2 MB.Control samples for the Copyright \u00a9 2021 Alnaji et al.2021Alnaji et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the t test, P\u2009<\u20090.01) more pronounced in extracellular RNA collected at 14 hpi, where WT PB2 outnumbered DI244- and DI291-derived PB2 \u223c400- and \u223c200-fold, respectively. The significantly decreased proportional abundance of PB2 DelVGs relative to WT PB2 in extracellular RNA compared to intracellular RNA observed in these coinfection experiments further supports the conclusion that DelVGs are packaged less efficiently than WT vRNAs. Finally, we observed no differences in either intracellular or extracellular levels of WT RNA between the WT-only infection and WT/DIP coinfections  and failed to observe any signs of active replication, as expected see . As a pofections , suggestCollectively, these data demonstrate that DelVGs make up a much smaller fraction of packaged viral RNAs compared their proportion of viral genomic RNAs within the infected cell, consistent with a packaging defect relative to WT vRNAs.The discrepancies that we observed in both proportional abundance and distribution among the segments between intracellular and extracellular DelVGs suggested the existence of a significant bottleneck limiting packaging of DelVGs relative to wild-type vRNAs. We hypothesized that this might be due to the potential loss of sequences required for efficient packaging during the formation of some DelVGs. If true, we expected that specific regions of gene segments required for maximal packaging efficiency would be retained within packaged extracellular DelVGs but largely missing from intracellular DelVGs.R\u2009\u2248\u20090.96, P\u2009<\u20090.0001), suggesting no significant differences between the populations. However, the deletion junctions appeared to skew more toward the interior of the segment for the extracellular DelVGs, which led us to ask whether the size of intracellular and extracellular DelVGs varied at 14 hpi , indicating that DelVG size correlates with packaging efficiency.To test this, we first examined the positions of intracellular and extracellular DelVG deletion junctions from at 14 hpi . As we at 14 hpi . Across 10.1128/mBio.02959-21.5FIG\u00a0S5R and P values are placed for both 5\u2032 and 3\u2032 sites . Download FIG\u00a0S5, TIF file, 0.4 MB.Distribution of DelVG junctions show clear clustering toward the termini. (A) The intracellular and extracellular PB1- and PA-derived DelVG deletion junction sites at 14 hpi were mapped to their genome positions with each line representing a distinct DelVG and the colors indicating whether they are from intracellular or extracellular samples. (B) Plots show the cumulative occurrence of DelVG deletions as a function of gene segment position of segment PB2 at both 3\u2032 and 5\u2032 sites. The cumulative score was calculated by starting at zero at the end of the segment and then adding a score of 1 at each nucleotide where a unique junction breakpoint occurred. Scores were normalized by calculating the percentage of final value reached at each position, and finally the average score of the three replicates was plotted per position. Person correlation coefficient Copyright \u00a9 2021 Alnaji et al.2021Alnaji et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the de novo DelVG production by the IAV replicase. We compared these intracellular DelVGs to the population of DelVGs that get packaged into virions, revealing a significant bottleneck in DelVG packaging relative to wild-type vRNAs. Our data contradict the dogma that DelVGs outcompete wild-type vRNAs for packaging and suggest that the commonly observed ability of DIPs to outcompete WT virus over multiple generations must arise from other mechanisms.Despite recent improvements in our fundamental understanding of the structure and function of the IAV polymerase complex, we still do not know how or why DelVGs and DIPs form during IAV replication , 31\u201334. 31\u2013In agreement with previous studies, we found that the majority of extracellular DelVG junctions were derived from the three polymerase segments . Within DelVG formation is thought to occur when the viral replicase pauses synthesis of the daughter vRNA or cRNA but continues processing along the template and reinitiates synthesis at a downstream site on the same template , 36. ThiIt has been suggested that the polymerase translocation is promoted by the presence of a direct sequence repeat and a specific nucleotide composition at the junction site , 16, 25.DelVGs/DIPs are known for their ability to inhibit the replication of WT virus, and it is widely believed that this effect is partially driven by DelVGs outcompeting WT vRNAs for packaging . Our datcis and in trans to facilitate the efficient and selective incorporation of a single copy of each genome segment into the vast majority of virions  was generated from HEK293T cells through standard influenza virus 8-plasmid reverse-genetics transfection. Undiluted transfection supernatants were directly inoculated onto MDCK-SIAT1 cells, and supernatants were harvested at the first signs of cytopathic effect to generate seed stocks. Working stocks of virus were generated by infecting MDCK-SIAT1 cells with seed stock at an MOI of 0.0001 TCID50/cell and harvesting at 48 hpi. The supernatant was clarified at 3,000 rpm for 5 min, and 500-\u03bcl aliquots were stored at \u221270\u00b0C.MDCK-SIAT1 and HEK293T cells were grown in minimal essential medium (MEM) plus GlutaMAX (Gibco), supplemented with 8.3% fetal bovine serum , at 37\u00b0C and 5% CO50/cell. To harvest intracellular viral RNA at 3, 6, and 14 hpi, cells were washed twice with phosphate-buffered saline, and RNA was extracted using a Qiagen RNeasy kit according to the manufacturer\u2019s instructions. To extract extracellular RNA from packaged virions, the supernatant was collected from infected cells at 14 and 24 hpi, clarified, and incubated for 30\u2009min with RNase A (0.25\u2009\u03bcg). Next, 140\u2009\u03bcl of supernatant was used for RNA extraction using the Qiagen QIAamp viral RNA minikit according to the manufacturer\u2019s instructions. All RNA was stored at \u221270\u00b0C.Confluent MDCK-SIAT1 were infected in triplicate with PR8 at an MOI of 10 TCIDUniversal RT-PCR was performed on all the samples before sequencing on Illumina MiSeq or NovaSeq using a previously described method , 48.L41510.1) or DI291 sequence into the pDZ vector and transfected it along with seven plasmids encoding WT versions of segments 2 to 8 plasmids into PB2-expressing HEK293 cells (HEK293-PB2), using a standard eight-plasmid reverse-genetics approach, as previously described  and cloned the full-length DI244 , 1\u2009\u03bcl of universal primer (10\u2009\u03bcM), 1\u2009\u03bcl of RT enhancer, and 1\u2009\u03bcl of Verso enzyme mix, before incubation for 50 min at 45\u00b0C. After this, 1\u2009\u03bcl of the of cDNA product was mixed with 7\u2009\u03bcl of H2O, 1\u2009\u03bcl of forward primers (18\u2009\u03bcM), 1\u2009\u03bcl of reverse primer (18\u2009\u03bcM), 1\u2009\u03bcl of specific probe (5\u2009\u03bcM), and 10\u2009\u03bcl of TaqMan Fast Advanced Master Mix (Thermo Fisher). The qPCR conditions used were as follows: 50\u00b0C (2\u2009min) and 95\u00b0C (2\u2009min), followed by 40 cycles of 95\u00b0C (1 s) and 61\u00b0C (20 s) using a qPCR QuantStudio 3 thermocycler.We designed and optimized specific primer/probe sets see  specific10.1128/mBio.02959-21.6TABLE\u00a0S1Table\u00a0S1, PDF file, 0.05 MB.qPCR primers and probes used for the competition assay. Download Copyright \u00a9 2021 Alnaji et al.2021Alnaji et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the MDCK-SIAT1 cells were coinfected in duplicate at an MOI of 10 PB2 gene equivalents/cell with a 1:1 ratio of WT PR8 and DI244 or DI291 . Fractions of the inoculum mixture before (0 hpi) was set aside for RT-qPCR. After adsorption for 1\u2009h at 4\u00b0C, inoculum was removed, cells were washed, and MEM+FBS was added to the cells. At 3 hpi, neutralizing anti-HA monoclonal antibody H36-26 was added to each well to a final concentration of 25\u2009\u03bcg/ml to block secondary spread. Intracellular and extracellular RNA was extracted as described above.6 mapped reads per library per segment. For the junction count, the number of junctions per segment was multiplied by 106 and divided by the number of NGS reads aligned to the WT gene of the given segment in a given library. The same was done to normalize for the NGS reads, where the junctions\u2019 read number per segment was multiplied by 106 and divided by the number of NGS reads aligned to the WT genome of the given segment plus the number of reads mapped to the junctions.Raw sequencing reads were fed into our DI-detection pipeline for junction detection and characterization, as previously described . To accoThe direct repeat sequence lengths were extracted from the output file \u201cVirus_Recombination_Results.txt\u201d generated by ViReMa algorithm. For the random control, the junction sites were randomized using Excel function \u201c=RANDBETWEEN\u201d based on the actual sequence range and number detected in the 6-hpi population. Next, a custom Perl code was used to extract their sequences from the corresponding PR8 gene segment (PB2 and HA). Finally, the direct repeat lengths were extracted and compared to the real samples.To analyze the nucleotide composition at the junction site, we analyzed the sequences flanking the junction sites for enrichment of specific nucleotides. There are four possible sequence regions that possibly involved in promoting the polymerase translocation, two regions flanking the junction from each site, we numbered them regions 1 to 4 (R1 to R4) . From thThe percentage length of each segment was calculated based on the total genome length 13,585 nucleotides . Next, the percentage length of each segment was used to calculate the number of junctions per segment based on the total normalized number of junctions of each sample (expected). Finally, these values were compared to the observed values from the actual experiments.PRJNA725907.All NGS data sets generated in this study can be found under BioProject accession number"}
+{"text": "H. pylori shows a great variability in genes associated with virulence, which may influence properties related to gastric adenocarcinoma initiation and progression. Among them, cagA and vacA show a strong positive association with the disease. Therefore, a cross-sectional study was carried out with 281 samples of gastric adenocarcinoma, collected at a cancer reference center in the Brazilian Amazon. Detection of H. pylori was proceeded by PCR of the ureA and 16S genes. Positive samples were subjected to the cagA detection and vacA typing. The bacteria were observed in 32.03% of the samples. Positivity for H. pylori was associated with advanced age (p = 0.0093) and metastases (p = 0.0073). Among the positive cases, 80% (72/90) had the cagA gene. For the \u201cs\u201d position of the vacA gene, 98.8% (83/84) of the bacteria had genotype s1 and 1.2% (1/84) were genotyped as s2. For the \u201cm\u201d position, the results were: 63.6% (56/88) with m1 genotype, 2.3% (2/88) genotyped as m2 and 34.1% (30/88) m1/m2. Virulence factors did not impact an increase in the association with age or metastases. In conclusion, H. pylori infection is associated with malignant phenotype cases of gastric adenocarcinoma, involving metastases. The virulence factors related to the cagA and vacA genes showed a high prevalence in the Brazilian Amazon. H. pylori infection in humans, then classified the bacterium as a class I carcinogen [H. pylori infection is the main risk factor for stomach cancer [H. pylori strains, which may be associated with genesis or progression of gastric adenocarcinoma, mainly due to the presence of virulence factors associated with the bacterium genome [Since 1994, the World Health Organization (WHO) and the International Agency for Research on Cancer (IARC) determined that there was sufficient evidence to support carcinogenicity of rcinogen ,3. H. pyh cancer . There im genome ,7. Half m genome ,9,10.cagA, which differs between strains of H. pylori and confers virulence characteristics [cagA is one of the most virulent strains of H. pylori, being associated with gastric ulcer, duodenal ulcer and gastric cancer [Within the CPI, the most studied gene is eristics ,11,12,13c cancer ,15.H. pylori show intact CPI, while 30% of strains of the bacterium found in Europe and North America do not have this island, being considered cagA negative. However, it is possible that cagA positive and negative strains co-exist in the same stomach [In some regions of the world, including Asia and most of Africa, almost all strains of  stomach .After entering the cytoplasm of gastric cells, CagA is phosphorylated at EPIYA sites  by the family of kinases Abl and Src . Once phH. pylori has several other gene regions related to pathogenicity and/or virulence. Among them, we can highlight the genes vacA, iceA and babA [vacA gene is present in the bacterial chromosome and encodes a high molecular weight multimeric protein (VacA) characterized as a multifunctional toxin that induces cell vacuolization, formation of membrane channels, dysregulation of endosomal/lysosomal function, apoptosis and immunomodulation [cagA, the vacA gene is present in all strains of H. pylori but exhibits a high level of genetic diversity. The gene contains two polymorphic regions: the \u201cs\u201d region and the \u201cm\u201d region. The \u201cs\u201d region encodes the signal peptide in the 5\u2032 gene region and can have the s1 or s2 genotypes. In turn, the \u201cm\u201d region is located in the middle region of the gene and encodes the host cell binding site and exists in the m1 or m2 genotypes  of the samples. The Chi square test demonstrated a borderline statistical association (p < 0.05) between the H. pylori and clinical-epidemiological information in females, which presented a relatively higher number of positive cases, compared to the males. A significant difference was observed in the analysis of the patients\u2019 age (0.0093). Kruskal\u2013Wallis test showed that the association with age was reinforced (p = 0.0005), because positive H. pylori patients were older (average of 65.54) compared to negative patients (average of 58.66) (f 58.66) . H. pylori and the presence of metastases (p = 0.0073). Among H. pylori positive samples, 59.6% (53/89) had metastases, while only 41.5% (78/188) of the negative ones evolved to this complication .A robust association was also obtained between positivity for lication . The simH. pylori positive samples, 80% (72/90) were positive for the cagA gene. For the \u201cs\u201d position of the vacA gene, 98.8% (83/84) of the bacteria had genotype s1 and 1.2% (1/84) were genotyped as s2, with 6 not obtaining results for the region. For the \u201cm\u201d position, the results were: 63.6% (56/88) with m1 genotype; 2.3% (2/88) genotyped as m2 and 34.1% (30/88) m1/m2, with 2 cases without information from the \u201cm\u201d region  were defined as s1m1, 1.2% (1/83) s1m2, 33.7% (28/83) s1m1/m2 and 1.2% (1/83) s2m2, and in seven samples a combined vacA genotype were not defined.For the bacteria combined cagA and vacA genotype showed the following result: 53% (44/83) with combined cagA+ s1m1 genotype, 30.1% (25/83) with cagA+ s1m1/2, 10.9% (9/83) with cagA- s1m1, 3.6% (3/83) with cagA- s1m1/2, 1.2% (1/83) cagA- s1m2 cases and 1.2% (1/83) cagA- s2m2.The combined H. pylori genotypes for cagA, \u201cs\u201d or \u201cm\u201d vacA gene with clinical-epidemiological information demonstrated the association only between patients age and the presence of cagA gene . However, it did not follow the same association tendency with the presence of H. pylori, as older individuals were found in the negative cagA group (mean of 75.11) when compared with patients diagnosed with the presence of the gene (mean of 61.90).The comparison of the H. pylori infection is estimated to contribute to more than 80% of gastric cancer cases [H. pylori in gastric adenocarcinoma samples varies from 40% in China [H. pylori showed high prevalence in different regions\u201485.7% in S\u00e3o Paulo [H. pylori presence, suggesting that other factors may have favored the emergence of the neoplasia [H. pylori infection is an important promoter step of gastric carcinogenesis, treatment benefits and eradication on gastric cancer prevention is controversial due to intestinal metaplasia and dysplasia be considered a \u201cpoint of no return\u201d in the precancerous cascade [H. pylori load occurs in the patients with gastric atrophy, intestinal metaplasia, gastric mucosa-associated lymphoid tissue (MALT) lymphoma and upper gastrointestinal bleeding [Although chronic er cases ,34, its er cases , the prein China  to 89.9%in China . In Braz\u00e3o Paulo ,39, 93% eoplasia ,42,43,44 cascade ,46. In tbleeding .H. pylori was slightly higher in females (p = 0.0437); however, we judge this result as a statistical artifact due to the lack of biological basis for the phenomenon and because the epidemiological studies point to an equal proportion between men and women infected with H. pylori or increased risk of infection among the male population [The presence of pulation ,42,43. Apulation , since hH. pylori with the cardiac location [p = 0.0073, by X2 and p = 0.0053 by RLS). Kong et al. demonstrated that the bacteria can positively regulate the expression of CACUL1, a protein associated with the cell cycle that promotes cell proliferation by activating CDK2 in the transition from G1 to S phase [MMP-9 and SLUG genes, important in the process of cell invasion and migration, which confers a great risk of metastases. Infection by the bacterium can produce a more invasive phenotype of malignant cells by releasing gamma-glutamyltransferase, which contributes significantly to the establishment of metastases [MMP-7 was also found in patients infected with H. pylori [The bacterium is normally associated with the intestinal type of gastric adenocarcinoma, with distal or non-cardiac location and with the presence of distant metastases ,48,49. Hlocation . The samlocation , however S phase . CACUL1 tastases . A highe. pylori . BaghericagA gene was found in 80% of the strains. A study carried out in the same geographic region, addressing the same neoplasia, observed the presence of the virulence gene in 88.3% of cases [cagA and younger patients suggests parallel risks for the development of gastric adenocarcinoma, where these patients develop the neoplasia primarily in the presence of the virulence factor, while in the absence of the factor, the bacterium is favored by senility. Additionally, the presence of other pathogenicity island genes may confer greater or lesser effectiveness on the carcinogenic action of CagA [As for the bacterial virulence factors, the of cases . Anotherof cases . The ass of CagA . vacA genotypes were determined as m1/m2. This result reflects an increased exposure to the transmission of the bacterium or an accumulation of strains due to the failure to resolve the first infection [H. pylori in the studied population; however, further studies are needed to better elucidate this finding. A study carried out in Colombia demonstrated that there is a greater number of infections with multiple strains and greater bacterial genetic variability in regions of greater risk for the development of gastric cancer, when compared to regions of lower risk [It is important to highlight the high number of cases with mixed infection by more than one strain: 33.7% of the nfection . Anothernfection . It is swer risk .H. pylori genotype associated as a risk factor (cagA+ s1m1) for gastric adenocarcinoma was found in 83.1% of cases, a percentage similar to that observed by Vinagre et al. at 86.9%, also in the state of Par\u00e1, Brazil. This result demonstrates that the strains of bacteria we have found have great oncogenic potential [otential , which ccagA+, s1, m1, s1m1 and cagA+ s1m1). Some studies observed an association with the development of gastric cancer and the presence of metastases for the cagA+ strains, unlike our results [cagA and the neoplasm, demonstrating that the presence of this virulence factor is still controversial for the increased risk of developing gastric cancer and more accelerated disease progression [cagA (ranging from 1 to 4) and the ignored variability in regions of low coverage by sequencing [H. pylori quantification associated with cagA genotyping in routine workflow for a sensitive and reliable diagnosis, to identify patients at high risk and to manage eradication therapies [The associations found between the presence of the bacterium and the clinical-epidemiological variables had a loss of statistical significance when comparing only the genotypes considered more virulent .\u00ae dsDNA BR Assay kit on the Qubit\u00ae equipment . All samples with concentrations higher or lower than 100 ng/\u00b5L were adjusted for this value.DNA samples were extracted using the QIAamp tissue kit , according to the manufacturer\u2019s protocol, and subjected to quantification with the QubitH. pylori was performed by PCR, using two target regions: the urease A (ureA) genes and the 16SrRNA (16S) gene. Positive samples for at least one of these genes were directed to PCR [cagA virulence gene (cytotoxin-associated gene A) and genotyping through the allelic search for the vacA gene (vacuolating cytotoxin gene A): signal region (s1/s2) and median region of the gene (m1/m2). The PCR primers to search for these genes and the sizes of the amplified fragments are shown in Molecular detection of d to PCR  for the The PCR reactions were performed with a final volume of 25 \u00b5L, using the components and their respective concentrations and volumes according to the specific target as observed in 16SrRNA and ureA, annealing temperatures of 50 \u00b0C and 60 \u00b0C, respectively, were used. For the virulence factor targets cagA and vacA, the annealing temperature was 55 \u00b0C.To perform the cycling, the thermal cycler Veriti Thermal Cycler  was used. Cycling programs were performed at a denaturation temperature of 95 \u00b0C for 5 min, followed by 40 cycles of denaturation, annealing and extension for one minute each and finally an extension step of 7 min at 72 \u00b0C. For the diagnostic targets H. pylori, ATCC 43504 strain and DNA extracted from biopsies with positive urease test were used, while DNA extracted from biopsies with negative urease test were used as negative control.For positive control of the reactions for The PCR products were subjected to electrophoresis on 2.0% agarose gel containing 6 \u00b5L of Sybr Safe  for visualization and determination of the sizes of the amplified DNA fragments. Together with the samples, the positive controls and the molecular weight marker  were applied to the gels for comparison. Electrophoretic migrations were performed under constant voltage of 100 V in TE buffer (Tris-EDTA Buffer) for 45 min. After the migration, the gels were visualized on a transilluminator (ultraviolet light) for visual analysis of the amplified DNA fragments, and the photographic record was performed by the UPV Biolmaging Systems  photo-documentation system.https://www.mamiraua.org.br/downloads/programas/, accessed on 30 October 2021) was used to perform the statistical analyses. Simple and multiple logistic regression tests, chi-square, and Kruskal\u2013Wallis were conducted to verify associations between the epidemiological and histological variables with the presence or factors of H. pylori virulence.Bioestat v5.3 (H. pylori infection in gastric adenocarcinoma in the State of Par\u00e1, Brazilian Amazon, was considerably lower when compared to other similar studies, however, the majority of positive cases had the usual more virulent strains. The presence of the bacteria was associated with advanced age and the presence of metastases, reinforcing the importance of infection for the progression of the neoplasia. Our results suggest that the bacteria may not be present throughout the course of gastric adenocarcinoma, but it has the potential virulence to accelerate the development of the disease in the Brazilian Amazon.Our study demonstrated that the prevalence of"}
+{"text": "Danio rerio) display well-defined, complex behaviors in major neurobehavioral domains which are evolutionarily conserved and strikingly parallel to those seen in rodents and humans. Although zebrafish are increasingly often used to model psychiatric disorders, there are also multiple challenges with such models as well. The field may therefore benefit from a balanced, disease-oriented discussion that considers the clinical prevalence, the pathological complexity, and societal importance of the disorders in question, and the extent of its detalization in zebrafish central nervous system (CNS) studies. Here, we critically discuss the use of zebrafish for modeling human psychiatric disorders in general, and highlight the topics for further in-depth consideration, in order to foster and (re)focus translational biological neuroscience research utilizing zebrafish. Recent developments in molecular biology research utilizing this model species have also been summarized here, collectively calling for a wider use of zebrafish in translational CNS disease modeling.Psychiatric disorders are highly prevalent brain pathologies that represent an urgent, unmet biomedical problem. Since reliable clinical diagnoses are essential for the treatment of psychiatric disorders, their animal models with robust, relevant behavioral and physiological endpoints become necessary. Zebrafish ( Psychiatric disorders are highly prevalent brain illnesses that represent a major urgent, unmet biomedical problem ,2,3,4,5.Danio rerio) are small freshwater teleost fish that have recently become a powerful model organism in translational neuroscience research [Zebrafish focus translational neurobiological research utilizing zebrafish. Recent developments in molecular biology research using this model species have also been summarized here, collectively calling for a wider use of zebrafish in CNS disease modeling.Modern classification of human psychiatric disorders is typically based on the International Classification of Diseases and Related Health Problems (ICD-11) and the Diagnostic and Statistical Manual of Mental Disorders DSM-5, . Since tHowever, as shown in The activation of zebrafish neuroendocrine hypothalamic-pituitary-interrenal (HPI) axis, physiologically homologous to human hypothalamic-pituitary-adrenal (HPA) axis, triggers the release of cortisol , furtherHowever, there are also clear limitations in zebrafish use to study stress pathobiology. For example, since it is impossible to obtain a sufficient amount of blood without euthanizing the animal , the long-term monitoring of stress responses from blood samples is problematic . MoreoveOn the other hand, acute stress studies in zebrafish also present some discrepancies in the existing literature. For example, an analysis of acute stress reaction is currently underrepresented in zebrafish studies (3%), compared to their clinical prevalence of 15% . DescribSuch phenotypic variance highlights several important factors for CNS disease modelling using zebrafish. Consider, for example, a marked difference in the numbers of clinical cases of acute vs. delayed acute severe stress reactions that may correspond to underlying individual differences in stress responsivity between patients, with some subjects being more susceptible to a stress exposure (and developing longer-lasting CNS disturbances) than the others. This aspect is critical for valid CNS disease modelling, since some animals as well may not develop long-lasting deficits without genetic or environmental triggers. Furthermore, the existence of CNS pathologies that are induced by the same factor(s), but occur at different time frames, necessitates detailed phenotyping of the models at different time points. For this, zebrafish may represent a valuable model for time-dependent phenotyping by having a relatively long lifespan (~4 years) with a prolonged duration of the adult state. Such approach has already been implemented in stress studies assessing complex dynamics of behavioral and neurochemical phenotypes in zebrafish affective disorders .Although sleep disorders, especially insomnia, are among the most common human psychiatric disorders , with glFurthermore, because many psychiatric disorders have strong genetic bases ,48,49,50hAPP mutations with M146L and L286V hPSEN1 mutations [hPSEN1, and P301L hMAPT mutations [gr) copies, slc6a4a (one of serotonin transporter copies), and a key interleukin (IL), il10 gene, hence breaking proper HPI/HPA axis signaling, inducing monoamines disbalance, and increasing inflammatory response at the same time. Likewise, combining disc1 (disrupted in schizophrenia-1), nrg1 (neuregulin-1), akt1 (AKT serine/threonine kinase 1), and/or dtnbp1a/b (dysbindin-1 homologues) mutations may eventually lead to interesting models of schizophrenia-like conditions in fish. Clearly, albeit rather underdeveloped in fish, such polygenetic models are critically important and translationally relevant, as they may better reflect \u201ctrue\u201d CNS pathogenesis occurring in human psychiatric disorders.One such genetic animal model targets Alzheimer\u2019s disease to induce a more severe experimental pathogenesis in mice that closely mimics human conditions . For exautations , whereasutations . Howeverstat) 1b and 4, interleukin 21 receptor (il21r), janus kinase 3 (jak3), and suppressor of cytokine signaling (socs) 1a, all long associated with clinical affective pathology and inflammation [Moreover, some translational studies may examine the molecular alterations in other  animal models using omics-related tools  to find evolutionally conserved biomarkers of CNS disorders that may be crucial for neuropathogenesis in both humans and zebrafish. For example, a widely used model of affective pathology in rodents and zebrafish, the chronic unpredictable stress (see further), reveals multiple transcriptomic changes in the brain that parallel deficits seen in human CNS diseases ,65. Specammation ,65.serpini1-/- knockout zebrafish display anxiety-like behavior, with the expression of closely related genes  altered based on RNA-seq analysis, supporting their involvement in affective pathology [Furthermore, such chronic stress alters the expression of multiple endocrine and signaling receptor-related genes, further paralleling human pathology . Interesathology . At the htt a or b) in combination with severe stress exposure may help recapitulate clinical data linking human serotonin transporter 5HTT genetic polymorphisms to affective disorders [disc1 knockout) with prenatal inflammatory exposure  and early life stress, may also be relevant to modeling schizophrenia pathogenesis [Combining genetic, epigenetic, environmental, behavioral or drug-based experimental models to better recapitulate disorders pathogenesis, also seems timely. For instance, as already noted, only few subjects develop PTSD following a severe acute stress exposure, due to specific molecular or environmental risk factors. The gene-environment interactions (GxE) and sex-environment interactions (SxE) have recently gained an increased recognition in psychiatric disorder modeling ,68. GxE isorders ,75. Likeogenesis .per se [Another important factor to consider is that aberrant phenotype itself may affect the environment to which an individual is exposed, without direct effects on disorder pathogenesis per se . For exaper se . Taking Depression is the leading cause of human disability worldwide ,79, reprVarious experimental depression models have been proposed in animals, and some of them are already available in zebrafish . Such moOn the one hand, chronic unpredictable stress is one of most widely used stress models in both rodents and zebrafish . On the Grin2a, Grin2b, Grin2c, Grin3a, Gria4, and Grm3-8) in rodent cerebral cortex and amygdala [Vglut1 and Vglut2) in mice [Slc17a6 and Slc17a8) in young mice, one increasing, and the other decreasing, CNS expression, respectively [Bdnf [Igf-2 [Ffg, Ngf, Vegf, Egf, and Igf-1) in rodent amygdala [In rodents, chronic unpredictable stress markedly affects the expression of various brain genes. For example, 7-week stress lowers the expression of several glutamate receptor subunits , as welamygdala ,104. Howamygdala ,109,110.cdk5) and cholinergic receptor nicotinic alpha 7 subunit (chrna7), are also involved in learning and memory in mammals, while draxin  regulates their hippocampal organization and neurogenesis [her4.2, her6, her8.2, hey1) and genes of interferon alpha-inducible protein IFI6/IFI27-like proteins , occurs in the telencephalon of stressed zebrafish [Several studies have attempted to assess transcriptomic and other molecular changes in zebrafish brain following chronic unpredictable stress. For instance, 2-week chronic unpredictable stress alters the expression of various genes in the telencephalon, a critical CNS area associated with cognitive and affective functions . Ortholoogenesis . The Genogenesis . In contebrafish . While tebrafish . ClearlyOverall, these studies support a significant role of inflammation in the development of affective disorders across taxa in vertebrates. As already noted, chronic unpredictable stress in zebrafish alters CNS cytokine networks, which can be corrected by fluoxetine treatment . Additiozgc:152791) reduce their CNS expression in zebrafish exposed to 5-week chronic unpredictable stress, and some of them remain reduced even after 1-week antidepressant (fluoxetine) treatment [stat1b, stat4, il21r, rsad2, jak3, zap70, socs1a, ror1, and themis) [myl1, myh1.1, my6, tnnt2a, tnnt2d, and tnnt2a.1), as well as ubiquitin-related genes [isg15) that may serve as a molecular hub linking neuroinflammation and cytokine activity to chronic unpredictable stress.Interestingly, genes from IFI6/IFI27-like protein domain  . Furthered genes , which adre04744 pathway), endocrine function , and RNA processing . Notably, treating stressed fish with a conventional, clinically active antidepressant drug fluoxetine normalizes the expression of many of CNS genes affected by chronic unpredictable stress, particularly those related to cytokine activity. Overall, these findings suggest that chronic unpredictable stress and fluoxetine treatment exert complex effects on CNS gene expression in zebrafish models. However, as already noted, various studies can rather vaguely correspond to each other, and also between model species [Stress also disrupts CNS expression of genes related to phototransduction  [s357gr zebrafish display pronounced anxiety-like behavior, whereas fluoxetine exposure efficiently rescues it, without affecting the levels of corticotropin-releasing hormone, serta and gr CNS expression [In general, depression remains relatively understudied in zebrafish , calling for further development of CNS disease models that specifically target core molecular cascades, thereby enabling mimicking disorder pathogenesis per se, unlike much less specific, traditional behavioral models. While genetic vulnerability has a pronounced effect on depression pathogenesis , genetictor (GR) ,115. AduAnother potentially useful strategy in zebrafish CNS disease modeling can involve the inhibition of RNA translation using small interference RNA (siRNAs). While non-specific inhibition of the microRNA pathway may disrupt normal mRNA processing during early zebrafish development ,117, recFinally, while chronic unpredictable stress has a generally good face, construct, and predictive validity as a model of major depression, another affective disorder type related to depression\u2014bipolar disorder\u2014remains remarkably under-represented in zebrafish research , likely Mounting evidence, only briefly discussed here, highlights potential strategic directions for zebrafish-based translational psychiatric research. Firstly, understanding which areas are over- or under-studied, is critical for focusing and refocusing the ongoing zebrafish CNS research. Secondly, some rather fixable factors can further contribute to such imbalances. For example, anxiety, currently grossly over-represented in zebrafish literature , is a frOne problem here is that this may drive the momentum and resources away from studying several other critical affective aspects, such as modeling PTSD- or depression-like states, in zebrafish. Another problem is that simplifying methodological toolbox  may also promote oversimplification of our interpretation of neurobiological phenomena targeted by various models. For example, while anxiety-like behavior is commonly seen following chronic stress paradigms in zebrafish, it remains unclear whether this affective phenotype represents purely anxiety-like state in fish, a comorbid anxiety/depression condition or, alternatively, mixed \u201canxiety+depression-like\u201d affective condition triggered by chronic stressors.In a similar vein, interpreting fish behavior as merely \u201canxiety\u201d  can be misleading, as more thorough analyses may be needed in order to dissect between other related  potential fish responses, such as fear-, panic-, aversive avoidance and anhedonia that, depending on the test, may all present as \u201canxiety\u201d. Likewise, although zebrafish display well-conserved behavior, the complexity of human vs. zebrafish brain makes it difficult to recapitulate the core symptoms of human psychiatric disorders. Thus, this challenge may also explain why some other psychiatric disorders  are not at all well represented in zebrafish CNS disease modeling field.cep41) that is associated with ASD clinically, disrupt social behavior in zebrafish larvae, also affecting neurodevelopment, axonal growth as well as cranial neural crest cells migration [dyrk1a, nr3c2, and reln mutants), sometimes also accompanied by neurological deficits [shank3b-/- zebrafish mutants exhibit both excessive repetitive behaviors, as well as reduced social interaction with developmental deficits, making it one of the most \u201call-in-one\u201d ASD target in terms of supported clinical endophenotypes in zebrafish [syngap1b or shank3a results in common neurodevelopmental phenotype associated with delayed CNS development and motor disruptions [Another widespread human brain disorder, relatively well modelled in zebrafish, is autism spectrum disorder (ASD) , a compligration . Similardeficits ,127,128.ebrafish . Likewisruptions , and maymicall2b knockdown using morpholino oligonucleotides (MO) leads to hyperactive-impulsive-like behavior in zebrafish that is reversed by a common, clinically used anti-ADHD drug, atomoxetine [lphn3.1 [cntnap2 [per1b, encoding period circadian clock 1b) studied in this regard, whose genetic ablation induces both attention deficits and overt locomotion, hence further corroborating mouse data that link per1b to ADHD-like conditions [A common neurodevelopmental disorder that often overlaps with ASD in terms of symptoms and inherent genetics, attention-deficit/hyperactivity disorder (ADHD), unlike autism, remains poorly studied in zebrafish models . Clinicamoxetine . Similar[lphn3.1  and muta[cntnap2  produce nditions .An important, clinically relevant aspect meriting further consideration is the fact that disease prevalence alone does not represent its overall burden, typically measured as Disability Adjusted Life Years in 100,000 population (DALYs). For example, while schizophrenia has a generally low global prevalence compared to other CNS disorders , it presThus, we call for making zebrafish models more balanced and consistent with current global trends of clinical prevalence of major psychiatric disorders, in order to make such translational research more biomedically and societally meaningful. This will not only foster further innovative studies of brain pathogenesis, but may also enable the development of novel CNS drugs that the mankind needs. Furthermore, current landscape of human psychiatric disorders rapidly changes, and some disorders  proliferate more than the others, thereby likely to affect human society more strongly presently than in the past. It is therefore critical that using zebrafish in modeling psychiatric disorders remains focused and up-to-date, following these rapid changes as well, for instance, by paying more attention to the emerging mental health problems  stress in zebrafish can have long-lasting effects on their behavior and physiology [Likewise, albeit not discussed in detail here, not only chronic stress, but also ysiology . In lineysiology . OverallFinally, the use of zebrafish to develop novel therapies for human brain disorders can also markedly benefit from conceptual rethinking and synchronizing the very goals of clinical and preclinical studies. Indeed, while the goal of clinical research is to develop safe efficient medications, pre-clinical screening aims to identify the most efficient (but not necessarily the safest) drug that curbs specific disordered phenotypes. From this standpoint, utilizing zebrafish screens may help reconcile these two goals by \u201cclinicizing\u201d outcomes of animal models , yet at the same time paying more attention  to the safety aspects of drugs tested, in order to be more consistent with the focus of clinical trials. If successful, this can collectively make zebrafish the new gold standard in modeling human psychiatric disorders and their molecular causes, as well as in innovative CNS drug discovery."}
+{"text": "Popliteal artery aneurysms are in most cases asymptomatic but cause significant complications if ruptured. An acute popliteal aneurysm rupture is relatively rare, and few cases have been documented secondary to blunt trauma. Common presenting signs and symptoms include distal limb ischemia and absent dorsalis pedis pulses. Timely management and recognition of this rare presentation are crucial as this condition can result in limb loss or death if not treated in a timely manner.An 80-year-old man with history of hypertension presented to the emergency department complaining of inability to feel sensation below his left knee after falling from ground level. Physical examination was pertinent for bounding radial and femoral pulses bilaterally, although absent dorsalis pedis and posterior tibial pulses to the left lower extremity. Computed tomography angiography identified occlusion of the left superficial femoral arterial lumen associated with a ruptured popliteal aneurysm, approximately eight centimeters in size. He immediately received unfractionated heparin and was admitted to the hospital for left medial thigh exploration and decompressive dermatofasciotomy.After confirmation of popliteal aneurysmal rupture with advanced imaging, heparinization and vascular surgery consultation are critical steps that should be taken to prevent limb loss. Popliteal artery aneurysms are in most cases asymptomatic but cause significant complications if ruptured. The incidence of popliteal aneurysm rupture is rare, estimated at 1% in males aged 65\u201380 years.An 80-year-old man with history of hypertension presented to the emergency department (ED) complaining of inability to feel sensation below his left knee after falling from ground level. Prior to arrival, the prehospital paramedics reported loss of palpable pulses in the left lower extremity. Vital signs upon arrival included a blood pressure of 110/80 millimeters of mercury, heart rate of 110 beats per minute, 16 respirations per minute, an oxygen saturation of 98% on room air, and a temperature of 98.6\u00b0 Fahrenheit. Physical examination was pertinent for the left lower extremity rotated externally in plantarflexion with tenderness and ecchymosis to the left medial thigh. Vascular examination revealed radial and femoral pulses bilaterally, although absent dorsalis pedis and posterior tibial pulse to the left lower extremity. Bedside arterial duplex revealed left posterior tibial monophasic waveforms and presence of diastolic flow.Radiographs of his femur and left tibia were negative for acute fracture or bony abnormality. Computed tomography angiography of the left lower extremity with contrast  and 2 idOur patient was diagnosed with an acute ruptured popliteal aneurysm, likely secondary to blunt trauma after falling from ground level. The incidence of popliteal aneurysm rupture is rare, estimated at 1% in males aged 65\u201380 years.3CPC-EM CapsuleWhat do we already know about this clinical entity?Popliteal artery aneurysms are commonly complicated by thrombosis and distal embolization.What makes this presentation of disease reportable?Popliteal artery aneurysm rupture is rare and few cases have been documented secondary to blunt trauma.What is the major learning point?Management of popliteal aneurysm rupture is facilitated with a detailed physical examination, appropriate radiographic studies, and expeditious consultation with specialists.How might this improve emergency medicine practice?Improved recognition and management of popliteal aneurysm rupture may decrease morbidity and mortality.When performing a primary assessment to an extremity involved in trauma, emergency physicians must assess sensation and motor function as paucity of either may indicate acute limb ischemia. When evaluating for popliteal aneurysms, the knee should be examined in a semi-flexed position, as 60% of patients with popliteal artery aneurysms have a palpable pulsatile mass at the level of the knee joint. Furthermore, the clinician must recognize the time elapsed from the insult as limb ischemia may be secondary to compartment syndrome. Nevertheless, if there is a high index of suspicion for acute limb ischemia, initial management with systemic unfractionated heparin should be prioritized to prevent aneurysmal thrombus propagation. Although no guidelines are available to guide management, most ruptured popliteal artery aneurysms are repaired surgically with rates of endovascular repair on the rise.3Our patient likely had localized trauma to his knee, causing popliteal aneurysm rupture, hemorrhage, and compartment syndrome. He was immediately treated with heparin and admitted to the hospital for left medial thigh exploration, dermatofasciotomy, and left superficial femoral artery and popliteal artery stenting. His hospital course was complicated by proximal stent migration into the aneurysmal sac with thrombus causing a large hematoma approximately 46 centimeters in size. Incidentally, he was found to have a three-centimeter popliteal aneurysm in his contralateral right leg, which had not ruptured suggesting that his left popliteal aneurysm was a chronic issue prior to his insult. Unfortunately, despite pharmacologic and vascular stenting interventions, the patient died secondary to cardiac arrest. Although ruptured popliteal artery aneurysm is a rare event, management in the ED is facilitated with a detailed physical examination, appropriate radiographic studies, and expeditious consultation with specialists. Recognizing popliteal aneurysm rupture, utilization of advanced imaging, and surgical intervention are mainstays to decrease morbidity and mortality."}
+{"text": "One of the primary health concerns for diabetes individuals is wounds. The used drugs have several side effects, urging the need for new natural sources for therapeutics.Globularia arabica and Malva sylvestris leaves and Rhus coriaria fruits. plant extracts were orally administered to the rats to determine their effect on the wound-healing process.This study was designed to estimate the wound healing potential of the methanolic extract of Plant extracts significantly increased the contraction of the wound in non-diabetic and diabetic rats (P < 0.05) and increased the fibroblast's proliferation and migration resulting in a faster healing process. The plant extracts have no cytotoxic effects. The proliferation assay exhibited the lowest cell mortality after treatment with plant extract.These findings may indicate that the methanolic leaf extract of the above plants can be used as new therapeutics for wound healing in diabetic patients. Cytotoxicity, Diabetes, Medicinal plants, Wounds, Wound healing. MediDiabetes is a severe disease and one of the world's most common chronic diseases. It affects about 381 million adult populations globally , moreovein vivo and in vitro. Those plants are Rhus coriaria, Globularia arabica, and Malva sylvestris , and fruits of R.\u00a0coriaria (2 months after fruits formation) were collected from various locations in Jordan. Prof. Sawsan Oran, Department of Biological Sciences, University of Jordan, Amman, Jordan, authenticated the plants. The University of Jordan's Herbarium received voucher specimens  [In July 2020, leaves of 2.2M.\u00a0sylvestris and G.\u00a0arabica leaves, and R.\u00a0coriaria fruits were cleaned, dried, and ground in a blender before being immersed in 100% methanol. Dried leaves were immersed in methanol (1:10 w/v ratio) for three days at room temperature with constant shaking [ shaking . The sol shaking . The cru2.3G.\u00a0arabica, M.\u00a0sylvestris leaf, and fruits of R.\u00a0coriaria. Investigators picked male rats because they believe that hormonal fluctuations during the female reproductive cycle caused female rats to behave differently to the identical stimuli, rendering them unpredictable and providing scientists with varying results in repeated studies. The animals were kept in separate standard plastic cages in the animal house at Mutah University, Jordan. The temperature was kept at 24 \u00b0C by alternating between 12 h of light and 12 h of darkness to maintain the biological clock of the animal as it was in its natural environment so that the results of the tests would be reasonable. Jordan University's ethical committee granted the study ethics under reference number 47\u20132021. Before conducting the experiments, the animals were given time to adjust to their new surroundings. During the experiments, the animals were separated using separate cages. Various methods were used to collect blood samples  were used to test the healing activities and anti-inflammatory of methanolic extracts of  samples . Biochemy weight , G.\u00a0arabmg/kg wt , and M.\u00a0mg/kg wt ).2.4A single dose intraperitoneal injection of streptozotocin (65 mg/kg body weight) produced diabetes. Diabetes was established after three days by measuring blood glucose concentration in the tail vein with glucometer strips  . Animals2.550 is assumed larger than 5000 mg/kg body weight, representing a great degree of safety. If death is recorded at a certain dose in any of the stages, Another test should be made to verify if the extract caused death. This test simply involves administering the dose of extract that caused death (or low dose that caused death in a condition where more than one death was recorded) to four animals. The rats should then be detected for 1 h after treatment and every 2 h for the next 24 h. If at least two of the four animals die, this should serve as verification and authentication of the test results. This method has several advantages, including the use of fewer animals, the investigation of a varied sort of dosages, and the fact that it is inexpensive [The present study used male rats (180\u2013200 g) that had been fasted overnight. The animals have been separated into five groups each group consisting of two rats. Groups 1\u20134 were given 2 mL of plant extract orally, as shown in xpensive .Table\u00a01D50 was calculated according to the following formula [LD formula .LD50 = , and the skin was removed with a 10 mm biopsy needle  The period of epithelization was observed by noting the number of days required for the eschar to fade away, leaving no raw wound behind . Blood s2.6Animals were separated into two main groups non-diabetic (1\u20133) and diabetic (4\u20136) . Each ma2.72.7.12 at 37 \u00b0C. After 3\u20134 days, cells were fractionated by removing the culture liquid, detaching the cells with 2 mL of trypsin, then adding fresh medium [50. The cytotoxicity of the plant extracts was determined with different concentrations of plant extracts  using a 24-well. Changes in cell shape and morphology were regarded as cytotoxic indicators. As a negative control, cell lines without extract were used [Plant extracts were tested for cytotoxicity against a fibroblast cell line that was kindly gifted by Prof. Yaser Bustanji's lab at the University of Jordan. The cells were grown in Dulbecco's Modified Eagle Medium. Then it was cultivated in 5% COh medium . The plaere used .2.7.2Giemsa staining method was used to measure the inhibition of cell proliferation after the tested compounds were applied to cell lines. The media was aspirated from the wells, then the wells were washed with 0.5 mL PBS and fixed with methanol for 9 min at 36 \u00b0C. After that, the plates were dried for 2 min. Each well was treated with Giemsa stain (1:10 in PBS) for 9 min. Then rinsed with deionized water after aspirating the dye. Using 0.1N HCl, the bounded stain was extracted, and antiproliferative activity was determined using an enzyme-linked immunosorbent assay (ELISA) microplate reader at 630 nm (ELX 800 Instrument). Cell mortality was represented as the percentage of living cells in the tested sample compared to the control . The per2.7.3At a density of 35,000 cells per well, fibroblasts were seeded and incubated until confluent. Using a 200 \u03bcl pipette tip as described by Juszczak et al , a scrat2.8The data were presented as means \u00b1 standard deviations. The statistical significance of differences between groups was determined using Graph Pad Prism version 7, P \u02c2 0.05 was considered significant.33.1R.\u00a0coriaria, G. arabica, and M.\u00a0sylvestris were found to be 4500, 3500, and 4500 mg/kg bw, respectively. Previous studies of acute toxicity have revealed that all the doses of R.\u00a0coriaria and M.\u00a0sylvestris extracts were safe and non-toxic up to 4500 mg/kg bw [G. arabica methanolic extract was safe up to 3500 mg/kg bw [Lethal doses of the extracts of mg/kg bw , 29, andmg/kg bw .3.2R.\u00a0coriaria methanolic extract (200 mg/kg bw) gave significant (P < 0.05) effects on wound healing as matched to the groups that were given vitamin E (M.\u00a0sylvestris (200 mg/kg bw) demonstrated greater healing activity than G.\u00a0arabica (200 mg/kg bw). The healing potential of the two plants is illustrated in Tables\u00a0The itamin E . On the t P < 0.0 effects t P < 0.0 effects R.\u00a0coriaria methanolic fruit extract which may be recommended as another drug for the management of diabetic injuries. It was previously reported that the fruit aqueous extract of R.\u00a0coriaria can cause a decrease in the area of the wounds, increased collagen deposition and hydroxyproline concentration, and reduced collagenase-2 and Myeloperoxidase enzyme activity leading to faster wound healing [Wounds are a clinical problem and they are frequently seen as a serious concern in therapeutic practice. The standard wounds are fixed in a few days, whereas long-lasting wounds are a big problem because of financial and community factors. Because of this, it is important to find new natural products that work better and cost less , 43. Mor healing .G.\u00a0arabica leaves showed a significant (P < 0.05) wound healing efficacy. These results are in accordance with that of Es-Safi et al [G.\u00a0alypum leaves possesses a considerable antioxidant agent, mainly due to the presence of flavonoids and phenyl ethanoid constituents. Therefore, these antioxidant compounds may contribute to the healing process. Methanolic extract of M.\u00a0sylvestris leaves exhibited a less healing potential compared to the other two plants. Our results are in agreement with the results of Kovalik et al [M.\u00a0sylvestris leaf extract had no effect on wound healing in the palatal mucosa of rats. In contrast, a previous study done by Pirbalouti et al [M.\u00a0sylvestris flowers has a good wound healing activity, and Histological examinations revealed a rise in well-organized collagen bands, an increase in fibroblasts, and a decrease in inflammatory cells. This good healing activity of M.\u00a0sylvestris flower extract could be due to the higher content of anthocyanin, malvin, niacin, and folic acid [M.\u00a0sylvestris leaf extract.In all treated groups, the methanolic extract of fi et al  who repoik et al  who repoti et al  revealedlic acid  compared3.350 determination and cytotoxicity of plant extracts at a concentration of 100 \u03bcg/ml are shown in 50 was seen in G.\u00a0arabica, while the lowest cytotoxicity was seen in R.\u00a0coriaria. The ability of plant extracts to enhance fibroblast proliferation and migration was studied by the scratch method which showed the migration of fibroblasts cell line after scratch assay and during the culture with 10 \u03bcg/mL and 20 \u03bcg/mL of plant extracts. The highest stimulatory effect was detected after 48 h of treatment with 20 \u03bcg/mL of R.\u00a0coriaria extract, followed by G.\u00a0arabica (The results of IC\u00a0arabica .Figure\u00a07in vitro wound healing studies [rd day after the injury, however, the enormous mass of fibroblasts begins to produce and create a high amount of collagen in the injured tissues, which defines the wound healing activity [R.\u00a0coriaria and G.\u00a0arabica strongly stimulated the migration of the fibroblasts. These results support and confirm the present in vivo observations, where the methanolic extract of R.\u00a0coriaria and G.\u00a0arabica showed strong stimulation in fibroblast migration. These results are in agreement with that of Abdallah et al [R.\u00a0coriaria methanolic fruit extract increased uterus cervix cell migration capacity and inhibited cervical and breast cancer growth. Therefore, the present study might find the pharmacological efficiency of the above plants in the healing process.Cell proliferation and migration have an important role in the healing process. The scratch method is commonly used for  studies . The fib studies . The fibactivity . our resah et al  and El Hah et al , who rep4G.\u00a0arabica, R.\u00a0coriaria, and M.\u00a0sylvestris. The significance of this study lies in establishing and reporting for the first time the wound-healing benefits of these plants in a model of diabetic rats. Both the methanolic extracts of G.\u00a0arabica and R.\u00a0coriaria exhibited potent wound healing properties. In addition, the extracts were safe and there were no indications of systemic toxicity in the rats.This study focused on the pharmacological benefits of the phytotherapy potential of commonly used plants Ahmad Z. Alsarayreh, Sawsan A. Oran, Jumah M. Shakhanbeh: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Khaled M. Khleifat, Yaseen T. Al Qaisi, Ibrahim I. Alfarrayeh, Ayah M. Alkaramseh: Performed the experiments; Analyzed and interpreted the data; Wrote the paper.This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.Data will be made available on request.The authors declare no conflict of interest.No additional information is available for this paper."}
+{"text": "A quick and effective solution to address the immediate change in teaching methods after the COVID-19 pandemic was digital learning environments (DLEs). The way in which this process of change towards DLEs was tackled was different around the world, depending on multiple factors, including the level of digitization, technology, and innovation. This paper conducts quantitative research on the influence of the COVID-19 pandemic on the adaptation of university professors to DLEs. In order to achieve this objective, a sample of 723 university professors from 15 countries in Latin America and the Caribbean was taken. The participants\u2019 self-perception of the stress generated and their levels of digital competence during the COVID-19 pandemic were studied according to the Global Innovation Index (GII) of their country of origin. The results show that professors have an intermediate\u2013high self-perception of both their digital competence and their ability to adapt to DLEs. It is also shown that neither the professors\u2019 level of digital competence nor the GII of the country of origin fully explain the level of pandemic stress regarding the use of DLEs. This fact suggests that there must be other influential factors to consider, thus opening new lines of future research. On 11 March 2020, the World Health Organization (WHO) declared the outbreak of COVID-19 a pandemic ,4. One oIn order to carry out this rapid adaptation of the educational system towards virtuality, it was necessary to invest considerable economic and technical resources and to rapidly acquire numerous electronic devices and peripherals, i.e., webcams, headsets, and virtual communication platforms. The great development of Information and Communication Technologies (ICT) during the years prior to the pandemic was key to coping with the confinement situation . A quickThis transformation highlighted the weaknesses of the educational system, especially the lack of virtual learning resources since the system was mainly based on the presence of all the actors involved in the teaching-learning process . This miThe Global Innovation Index (GII), published by Cornell University, the Institut Europ\u00e9en d\u2019Administration des Affaires (INSEAD), dedicated to business administration, and the World Intellectual Property Organization (WIPO), analyzes 131 countries around the world from different points of view that define the innovative character of their respective economic developments . Each coLow GII: Corresponds to countries with a GII smaller than the mean GII minus the standard deviation (24.73); it consists of Guatemala, Bolivia, and Honduras;Intermediate GII: Countries with GII between the mean GII minus the standard deviation (24.73) and the mean GII plus the standard deviation (33.84); it consists of Uruguay, Colombia, Peru, Argentina, Panama, Paraguay, Ecuador, and El Salvador;High GII: Countries whose GII is greater than the mean GII plus the standard deviation (33.84); it consists of Chile, Mexico, Costa Rica, and Brazil.The GII distinguishes seven different geographical zones, within each of which countries are expected to have similar economic developments, which justifies comparing digitization levels through the GII: Europe; Northern Africa and Western Asia; South East Asia, East Asia, and Oceania; Northern Africa and Western Asia; Sub-Saharan Africa; Northern America; and Latin America and the Caribbean . The latDifferent studies carried out in recent months have analyzed professors\u2019 perceptions of their own self-efficacy  and theiThe analysis of the emotional effects derived from the digital impact caused by the pandemic is a topic that the specialized scientific literature deals with intensively. Indeed, numerous very recent studies have concluded that there is a psychological impact caused by the necessary digitization of learning environments resulting from the pandemic among university professors ,34. In aThe preceding literature is also concerned, albeit less frequently, with analyzing the affective impact of pandemic-induced digitization among university professors. Typically, these analyses focus on well-defined countries or geographic areas and highlight the concern of university professors about the negative formative consequences of forgoing face-to-face training . RegardiIn view of this situation, the main goals were to analyze the psychological impact of Latin American and Caribbean university professors toward DLEs during the COVID-19 pandemic and analyze the existence of possible statistically significant gaps in these perceptions due to the level of digitization of the participants\u2019 country of origin. In addition, as secondary variables, we will study the existence of differences by gender, age, and area of knowledge in the above perceptions. Furthermore, taking into account that the population analyzed in this study is related to one of the professional sectors that have had to make the most intense digitization efforts after COVID-19, the obtained results could be extrapolated to other professional sectors that have also undergone the digitization effort, i.e., the results of the study are generalizable to more sectors than just the education sector. In order to do this, the results obtained on different self-assessments of the professors are analyzed: (i) assessment of own digital competence; (ii) perception of the professional aspects; (iii) perception of the level of stress; (iv) self-confidence in the professor\u2019s work; and (v) self-concept on adaptation skills to DLEs, according to the GII. In this analysis, it is assumed that the assessments are multivariate normally distributed within each group of the considered characteristics of the sample\u2014GII level, gender, age, and area of knowledge\u2014and that the population covariance matrices of each group are equal. The work is structured in four main sections. The Materials and Methods section describes the sample of participants in the study, the instrument used, the research objectives, variables, and hypotheses, and explains the research methodology. The Results section presents the results obtained from the statistical analysis of the responses to the survey employed. The Discussion describes the main results obtained and relates them to each other and to the previous literature, indicating limitations and future lines of research. Finally, the main conclusions of the work are presented in the last section of the Conclusions.TM. Participants responded to the survey voluntarily, freely, and anonymously. All responses were validated .A total of 723 university professors who work in the 15 countries of Latin America and the Caribbean that have GII participated in this study: Chile, Mexico, Costa Rica, Brazil, Uruguay, Colombia, Peru, Argentina, Panama, Paraguay, Ecuador, El Salvador, Guatemala, Bolivia, and Honduras. These participants were selected through a non-probabilistic convenience sampling process. The professors were contacted by e-mail and were sent the survey that was used as a research instrument through GoogleFormsThe general objective of this research is to analyze the influence that the migration to university teaching DLEs caused by the COVID-19 pandemic has had on the self-concept of professors from different GII areas in Latin America and the Caribbean regarding their digital skills and the confidence they have in their own abilities to adapt to these digital environments. In particular, the following specific objectives are pursued: (i) to analyze the perception that Latin American and Caribbean university professors have about their own digital skills, self-confidence, and ability to adapt to DLEs and about the stress caused by the need to increase the use of digital environments due to the COVID-19 pandemic; (ii) to study whether there are significant differences between professors from the different GII areas in the above respects; and (iii) to identify significant gaps by gender, age or area of knowledge in the analyzed perceptions among professors from each GII area. In the present study, the following independent variables are considered in relation to the sample of participants: (i) GII area to where the country in which he/she teaches belongs; (ii) gender; (iii) age; and (iv) area of knowledge. All the variables mentioned are nominal. The first variable (GII area) is trichotomous and can take the values High GII, Intermediate GII, and Low GII, according to the classification of GII areas that have been defined. The gender variable is dichotomous . Age is defined as a polytomous variable whose values correspond to the following age ranges: 25 to 34 years old, 35 to 44 years old, 45 to 54 years old, and 55 years old or older. Finally, the following areas of knowledge are distinguished: Arts and Humanities ; Science ; Health Sciences ; Social and Legal Sciences ; Engineering and Architecture . The areas of knowledge have been defined according to the International Standard Classification of Education (ISCED) of the United Nations Educational, Scientific and Cultural Organization (UNESCO) [Assessment of own digital competence for the use of DLE use during the pandemic.Perception of the professional aspects linked to the use of DLEs during the pandemic .Perception of the level of stress caused by the pandemic with respect to the professional practice of teaching using DLEs .Self-confidence in the professor\u2019s work during the pandemic.Self-concept on adaptation skills to DLE use during the pandemic.The dependent variables that have been considered in this study are as follows:All dependent variables are ordinal quantitative and have been measured on a scale from 1  to 5 . Throughout the study, the following hypotheses are demonstrated: (i) within the Latin American and Caribbean areas, the level of digitalization of the country significantly influences the self-concept of digital competence and digital pandemic stress expressed by the participants; and (ii) there are gender, age, and area of knowledge gaps in the perceptions of digital pandemic stress suffered.In order to achieve the objectives of this study, a survey of 38 questions or items was used. The survey was designed for this purpose and based on the instrument developed in  for the This paper is quantitative descriptive research based on the analysis of the answers to a survey of 38 Likert-type questions valued from 1 to 5, which has been used as a research instrument. The validation of this instrument was carried out by means of an Exploratory Factor Analysis, which resulted in the definition of five subscales that explain the global survey. The psychometric validation of the instrument was obtained by computing the Pearson correlation coefficients of the different subscales among themselves and with respect to the global survey. Additionally, the convergent validation was analyzed by means of the average variance extracted (AVE) and the internal consistency of the survey through the Cronbach\u2019s alpha parameters and composite reliability (CR) of the subscales. The responses were analyzed using descriptive statistics (mean and standard deviation). Participants were differentiated by the GII area to which their university belongs, and the means of the different subscales of the survey were compared using the ANOVA test and the standard deviations using Levene\u2019s test. Finally, the participants were differentiated by GII area and by the rest of the independent variables of the study , and the mean responses of the different subscales were compared using the multifactor ANOVA test (MANOVA). When it was not possible to assume homoscedasticity, the mean comparison tests were applied with Welch\u2019s correction without assuming equal standard deviations. All tests were performed with a significance level of 0.05.p-value = 0.0086). The most frequent age range in countries with high GII is between 35 and 44 years, while in countries with intermediate GII, it is between 45 and 54 years, and in those with low GII, the two central age ranges have the same frequency . Finally, in countries with high GII, the areas of knowledge with a majority representation are Humanities and Social Sciences, while in countries with intermediate or low GII, there are more professors of Social Sciences and Engineering .As shown in The EFA, performed with Varimax rotation on the survey responses, identifies five factors that explain the survey . The facFor the psychometric validation of the instrument, the Pearson correlation coefficients of the different subscales defined in the EFA model were computed. As can be noted in In general, participants express intermediate\u2013high levels of digital competence and ability to adapt to DLEs . These sp-value = 0.0102) and the adaptation skills subscale . However, participants from countries with high or intermediate GII value professional aspects linked to DLE use more highly  and express significantly higher levels of self-confidence than participants from countries with low GII . Regarding the perception of pandemic stress related to the use of DLEs, professors from countries with high GII expressed higher levels of stress, and those from countries with low GII expressed lower levels of pandemic stress. By GII areas, p-value = 0.7573). For the rest of the subscales, homoscedasticity cannot be assumed. Professors from countries with low GII are more confident than the rest in the assessment of professional aspects linked to DLEs . Regarding the level of adaptation to DLEs, self-confidence, and the level of pandemic stress linked to the use of DLEs, the greatest heterogeneity of responses is found in countries with high GII. The largest differences between deviations are in the adaptation skills subscale  and in the self-confidence subscale . This means that the widest gap between GII areas in terms of participants\u2019 confidence in responding is in the subscales of adaptation to DLEs during the pandemic and self-confidence. The gap between GII areas in terms of deviations is smaller in the subscale measuring digital pandemic stress .Levene\u2019s test of standard deviation comparison shows that homoscedasticity can be assumed in the digital competence subscale when differentiated by the GII area (F = 0.2780; The MANOVA test shows that there are gender gaps in the responses to all subscales of the survey . From thBy age range, the lowest levels of digital competence are expressed by those over 55 years old, although professors in countries with low GII are more digitally competent than those in the rest of the areas in all age ranges . ProfessThe area of knowledge is another discriminative variable for all the subscales analyzed, as shown by the MANOVA test statistics . A signiAlthough the sample of participants on which the research was conducted contains most professors from countries with high or intermediate GII , which iThe specialized literature shows that the stress caused by the COVID-19 pandemic has a decisive influence on various aspects of the professional activity of university professors, such as research activity . The resIn the context described above\u2014greater pessimism about one\u2019s own skills expressed by professors from countries with high GII\u2014the levels of pandemic stress due to DLE use are intermediate but notably higher in countries with extreme levels of GII\u2014low or high\u2014than in countries with intermediate GII . LikewisNumerous studies have found that the migration to digital environments of teaching processes caused by the pandemic has increased the workload of teachers and has generated difficulties in adapting to online environments, which has generated levels of anxiety associated with teaching ,55,56,57The above observations suggest the need to design digital skills training plans aimed at generating solid digital skills training for professors that can induce an increase in students\u2019 digital skills . These eDifferences were also identified by gender, age, and area of knowledge in the assessments of all the variables studied. By gender, women reported greater competence and a higher ability to adapt to DLEs than men . In addiOlder professors express having lower digital competence and lower ability to adapt , in geneA strong gap was also found in areas of knowledge with respect to the variables studied . In counConsequently, the impact of the pandemic on the adaptation to DLEs of professors in the different areas of knowledge depends strongly on the GII area of the country where the university is located. Specifically, as can be seen in the summary graph in The study did not use any exclusion criterion linked to the psychological state of the participants at the time of answering the survey. This fact may constitute a limitation of the study. As a future line of research, it would be useful to explore the academic or sociological reasons underlying the differences observed between GII zones, genders, and ages, in relation to the variables analyzed, carrying out a correlational study. It would also be interesting to identify the latent factors that, together with those studied, influence the determination of the pandemic stress studied. Finally, a comparative study of the perceptions of university professors from areas that differ in the GII would allow us to deepen the degree of influence of the GII in the development of stress due to the use of DLEs. Given that higher education is one of the sectors that has undergone the most intense digital migration process, professors are probably among the professionals who have had to make the greatest digitization effort due to the pandemic. Consequently, the results obtained on the digital pandemic stress of professors may be representative of the impact of the pandemic in other professional sectors, although more in-depth studies along these lines would be needed.In the Latin American and Caribbean areas, university professors have an intermediate\u2013high self-concept of their own digital competence and their ability to adapt to DLEs during the COVID-19 pandemic. However, the perception of the digital technical resources available to them and their self-confidence in the use of DLEs is lower. The level of stress caused by the use of DLEs during the pandemic is intermediate, but, according to the results of this study, it is not significantly conditioned either by the digital competence levels of the teachers or by the GII of the country of origin. This suggests that there are other sociodemographic, cultural, or political factors that also affect this type of stress and should be analyzed in future research.Females generally report higher digital competence and lower digital pandemic stress than males. Older professors are those who express lower digital competence and also lower levels of digital pandemic stress, on average. In addition, there is a strong dependence of the indicated perceptions on the area of knowledge of the professors, the most affected by digital pandemic stress being those related to Health and Humanities."}
+{"text": "Acinetobacter baumannii is an opportunistic pathogenic bacterium prioritized by WHO and CDC because of its increasing antibiotic resistance. Heterogeneity among strains represents the hallmark of A. baumannii bacteria. We wondered to what extent extensively used strains, so-called reference strains, reflect the dynamic nature and intrinsic heterogeneity of these bacteria. We analyzed multiple phenotypic traits of 43 nonredundant, modern, and multidrug-resistant, extensively drug-resistant, and pandrug-resistant clinical isolates and broadly used strains of A. baumannii. Comparison of these isolates at the genetic and phenotypic levels confirmed a high degree of heterogeneity. Importantly, we observed that a significant portion of modern clinical isolates strongly differs from several historically established strains in the light of colony morphology, cellular density, capsule production, natural transformability, and in vivo virulence. The significant differences between modern clinical isolates of A. baumannii and established strains could hamper the study of A. baumannii, especially concerning its virulence and resistance mechanisms. Hence, we propose a variable collection of modern clinical isolates that are characterized at the genetic and phenotypic levels, covering a wide range of the phenotypic spectrum, with six different macrocolony type groups, from avirulent to hypervirulent phenotypes, and with naturally noncapsulated to hypermucoid strains, with intermediate phenotypes as well. Strain-specific mechanistic observations remain interesting per se, and established \u201creference\u201d strains have undoubtedly been shown to be very useful to study basic mechanisms of A. baumannii biology. However, any study based on a specific strain of A. baumannii should be compared to modern and clinically relevant isolates.IMPORTANCEAcinetobacter baumannii is a bacterium prioritized by the CDC and WHO because of its increasing antibiotic resistance, leading to treatment failures. The hallmark of this pathogen is the high heterogeneity observed among isolates, due to a very dynamic genome. In this context, we tested if a subset of broadly used isolates, considered \u201creference\u201d strains, was reflecting the genetic and phenotypic diversity found among currently circulating clinical isolates. We observed that the so-called reference strains do not cover the whole diversity of the modern clinical isolates. While formerly established strains successfully generated a strong base of knowledge in the A. baumannii field and beyond, our study shows that a rational choice of strain, related to a specific biological question, should be taken into consideration. Any data obtained with historically established strains should also be compared to modern and clinically relevant isolates, especially concerning drug screening, resistance, and virulence contexts. Acinetobacter baumannii  multidrug-resistant and most problematic nosocomial pathogens  ( treated . A. baumsettings . The majin (BAP) .A. baumannii to desiccation and disinfectants renders any decontamination strategy a real challenge  genome of only 16.5%, while 25% of the genome is unique to each strain, having no counterpart in any other A. baumannii genome   , in addiA. baumannii instead of the common lipopolysaccharide (LPS). Unlike LPS, the LOS lacks the O antigen and is composed of lipid A with variable amounts of inner and outer core sugars (A. baumannii. OCL types can be divided into two groups (A and B) based on the presence of pda1 and pda2 genes  novel gene(s) may be identified.A new strain collection containing multidrug-resistant, extensively drug-resistant, pandrug-resistant, and carbapenem-resistant modern clinical isolates of ublished . Compari09 genes , represeentified , while tA. baumannii regarding their respective sequence type , capsule locus type (KL), and lipooligosaccharide locus (OCL) types. Twelve ST groups are identified in the modern collection, with ST2 as the most prevalent (25/43) followed by ST636 (6/43), ST1 (4/43), ST85 (2/43), ST78 (2/43) and ST604, ST215, ST158, and ST10 (one isolate each) (\u2013A. baumannii.The genomes of the modern strains were compared to the established strains of te each) . Establite each) . We confte each) \u201326. In te each) \u2013, 27. So A. baumannii to conventional antibiotics (bap) is undetected in all four established strains (bap gene in ATCC 19606-VUB and ATCC 17978-VUB (see Discussion). Employing the MEGARes 2.0 database, we found that only the established strain AB5075-VUB carried all three RND efflux pumps, adeIJK, adeABC, and adeFGH, while DSM30011-VUB, ATCC 17978-VUB, and ATCC 19606-VUB had an incomplete adeABC  and/or adeFGH (lack of adeF gene in DSM30011-VUB and ATCC 19606-VUB) operon. Besides these three established strains, only six modern clinical strains of A. baumannii contain one or more incomplete operons encoding RND efflux pumps.Since we recently described the resistance of examined clinical isolates of ibiotics , here weibiotics  and MEGAibiotics . Among oibiotics , using t strains . HoweverA. baumannii used in this study.A BLAST search facilitated by ABRicate confirmed the presence of the gene encoding H-NS in all the clinical isolates and established strains of A. baumannii bacteria A. baumanA. baumannii isolates , this highlights the absence of a model strain representing this phenotype among the established strains. However, the density gradients cannot be fully correlated with macrocolony types due to their high heterogeneity and certainly cannot be represented by an established strain. In addition, four clinical isolates  are divided into two fractions within the same density gradient . In. InA. baisolates . A high observed , and D. observed  clinicalgradient  34)..A. baumaA. baumannii in terms of the density gradient phenotypes.In conclusion, 8 out of 43 modern clinical isolates are not represented by the here-tested established strains of A. baumannii bacteria as shown before  . As expen before  and thatin vivo virulence. Galleria mellonella larvae were infected with highly, medium-, and weakly capsulated isolates, while the AB5075-VUB established strain was used as a positive control of virulence .As constitutive mucoid strains are observed only among the group of modern clinical isolates, we wondered if this phenotype could be associated with higher irulence . Concernirulence . The medirulence . These de levels , 36. Thee levels  and 6; hA. baumannii strains. AB5075-VUB was used as a positive control due to its verified competence , the broadly used strains ATCC 19606-VUB (ST52), ATCC 17978-VUB (ST437), and DSM30011-VUB (ST738) do not reflect the current trends of ST in clinical settings, at least when referred to our collection here tested, but instead rare sequence types. The lack of representation of the ST of the clinical isolates is expected only in the case of DSM30011-VUB, as this strain has an environmental origin ; therefore, these established strains can still represent a minor proportion of the current clinical isolates of A. baumannii to a certain extent. On the other hand, of four established strains, AB5075-VUB is the most similar to the modern clinical strains of A. baumannii in regard to OCL and virulence genes. When considering AB5075-VUB capsule production, its phenotype resembles phenotypes of clinical isolates with lower production. Nevertheless, similarly to other established strains, adeC and bauA genes are not detected in AB5075. Lack of the combination of these two virulence genes is also detected in 10 modern clinical isolates, proving that AB5075-VUB still shares some characteristics with a subset of circulating modern clinical A. baumannii strains. The listed virulence genes in our study account for only a small amount of the virulence genes as only those genes known to date can be detected; likely, novel virulence genes remain to be identified. Notably, regardless of the observed discrepancy in the detection of the adeFGH operon using VFDB 2022 and MEGARes 2.0 databases, the absence of adeFGH was described previously  dominated while KL3 was detected in five isolates.Capsule heterogeneity is a hallmark of e system , 44. Thee system , with ade system , this diA. baumannii isolates should be considered (see \u201cConclusion\u201d below).In our study, the most prevalent type of locus encoding outer core lipooligosaccharide (OCL) is OCL1 (31/43). However, none of the established strains represents this most prevalent OCL type as they belong to OCL2 (AB5075-VUB and ATCC 17978-VUB), OCL3 (ATCC 19606-VUB), and OCL6 (DSM30011-VUB), suggesting their rarefaction in following the current epidemiological trends. Despite the proven relevance of the clinical isolates of our collection , we cannot rule out any bias to a certain extent and other clinically relevant bap gene encodes a protein required for the formation of three-dimensional biofilm towers and water channels on abiotic and biotic surfaces such as polypropylene, polystyrene, and titanium , which could influence the studies exploring biofilm properties using these established strains. However, bap was found in ATCC 17978-VUB and ATCC 19606-VUB with 86% gene coverage and 97% nucleotide identity (VFDB 2022), as well as in three clinical isolates ; therefore, it was assigned as undetected in bap gene in the strains ATCC 17978-VUB and ATCC 19606 and the three clinical isolates  shows that different thresholds result in positive detection of bap. However, the difficulties with detecting the bap gene in some strains and isolates might be also attributed to a limited set of reference genes in the databases, while the bap gene is variable . BauA protein provides protection against sepsis caused by A. baumannii and was also identified as a vaccine candidate  using transposon insertion. However, phase variation, a hallmark of A. baumannii bacteria, might be involved in defining these macrocolony types  or/and other factors influence the density of A. baumannii bacteria, even if we cannot detect a correlation between cellular density and capsule type in our study. Interestingly, four clinical isolates  are divided into two fractions within the same test tube in the density gradients  or conditions regulating capsule (hyper)production remain to be determined. Notably, the isolates AB193-VUB and AB213-VUB with higher integrity of the CPS layer   as the bacterial model in a specific study associated with a targeted biological question is required. In this context, the new \u201cAcinetobase\u201d   may leadetobase\u201d  is a comA. baumannii organisms are heterogenous bacteria, at both the genetic and phenotypic levels. In this study, we characterized 43 modern clinical isolates from different phylogenetic groups and four established strains with common but also very different features. Therefore, the historically established strains  tested in our study do not cover the whole heterogeneity found in the modern clinical isolates of A. baumannii. The studies previously published using these established strains built a strong state of the art in the A. baumannii field and beyond, showing their usefulness. However, the data presented in our study show that the specific use of one or only a limited subset of established strains can hinder important processes characterizing clinically relevant isolates. As an answer to that identified pitfall, we propose a variable collection of modern clinical isolates that are characterized at the genetic and phenotypic levels, covering the full range of the phenotypic spectrum, with six different macrocolony type groups, from avirulent to hypervirulent phenotype, and with noncapsulated to hypermucoid strains, with intermediate phenotypes as well. This will allow selection of an appropriate strain rationally, facilitated by the new Acinetobase  combined with long reads (Oxford Nanopore Technologies [ONT]) in our previous study (A nonredundant collection of 43 modern (isolated from 2014 to 2017) clinical isolates from the National Reference Center for Antibiotic-Resistant Gram-Negative Bacilli (CHU UCL-Namur) and four established strains, ATCC 17978-VUB, ATCC 19606-VUB, DSM30011-VUB, and AB5075-VUB, were studied. The established strains AB5075, ATCC 17978, and ATCC 19606 are non-MDR (except AB5075) strains of clinical  origin , while Dus study .A. baumannii was assessed by starting an overnight bacterial culture from \u221280\u00b0C stock in 5\u2009mL of LB (37\u00b0C at 160\u2009rpm). The culture was diluted 1:100 in a 2-mL microtube . Then, 3 \u03bcL of the diluted culture was mixed with 3 \u03bcL of plasmid  DNA  to select transformants. The negative control was plated on apramycin-LB agar plates, too. Colonies were counted after overnight incubation at 37\u00b0C.A. baumannii isolates, we spotted 5\u2009\u03bcL of an overnight (O/N) culture of bacteria previously grown in LB medium for 16\u2009h at 37\u00b0C under constant agitation (175\u2009rpm) on 4 different blood agar plates: (i) Columbia agar with 5% horse blood, (ii) Columbia agar with 5% sheep blood, (iii) Trypticase soy agar II with 5% horse blood, and (iv) Trypticase soy agar II with 5% sheep blood, all purchased from BD . To test for secreted protease activity, we used the same approaches as described above and spotted the 5\u2009\u03bcL of bacteria on LB agar plates containing 2% skim milk powder for microbiology . Plates were incubated at 25\u00b0C and monitored for hemolytic and protease activities after 1, 2, and 6\u2009days of incubation.To assess the potential hemolytic activities of the different https://github.com/tseemann/prokka) as an input for the core-genome alignment created using Roary (https://github.com/sanger-pathogens/Roary). RAxML (https://github.com/stamatak/standard-RAxML) was used for the calculation of the phylogenetic tree using the general time reversible with optimization of substitution rates under gamma model of rate heterogeneity method supported by 500 bootstraps. The phylogenetic tree was visualized in iTOL (https://itol.embl.de/).The maximum-likelihood tree depicting the relatedness of the isolates was constructed from assembled complete genomes using predicted open reading frames obtained by Prokka (https://github.com/tseemann/abricate) employing VFDB 2022 (https://github.com/tseemann/abricate) with a custom database containing H-NS of AB5075-UW (accession number CP008706.1) as a reference sequence.The resistance and virulence genes were detected using ABRicate  was plated on Columbia agar with 5% sheep blood purchased from BD . The plates were incubated noninverted for 6\u2009days at 25\u00b0C and subsequently photographed by a Canon camera. The experiments were carried out in biological triplicates confirming the reproducibility of the macrocolony morphology assessment. The representatives of each group were selected  (Escherichia coli S17 (ATCC 47055) was used as a low-capsulated control.One milliliter of overnight culture in a 1.5-mL microtube was centrifuged for 2\u2009min at 7,000 relative centrifugal force (rcf). The supernatant was removed, and the pellet was resuspended in 1\u2009mL of phosphate-buffered saline (PBS). Subsequently, 875\u2009\u03bcL of PBS-resuspended bacteria was mixed with 125\u2009\u03bcL of Ludox LS colloidal silica (30%\u2009[wt/wt] suspension in H[Merck]) , 70. ThiA. baumannii isolates, 8 modern clinical isolates and 3 established strains, which range from high to low densities. The fixation and staining of the bacteria were performed as described before (Transmission electron microscopy (TEM) was used for direct capsule visualization by labeling the capsule of 11 d before . The cupG. mellonella (BioSystems Technology) were stored at 15\u00b0C no longer than 5\u2009days after arrival and were incubated for 30\u2009min at 4\u00b0C prior to injection. Bacteria from an overnight culture were washed with physiological saline (PS) (0.9% NaCl) and diluted to approximately 1 \u00d7 107 CFU/mL. The larvae were injected with 10\u2009\u03bcL of PS containing 1 \u00d7 105 CFU/mL of A. baumannii in the last left proleg using a 0.3-mL insulin syringe (BD MicroFine). Each of the nine selected strains of A. baumannii was injected into 10 larvae, and 10 larvae were injected with PS as a negative control. The experiments were carried out in duplicates, and the survival (assessed by keratinization and mobility) rate was evaluated each day for a period of 10\u2009days as described before (TruLarv research-grade larvae of d before ."}
+{"text": "Ferroptosis is an iron-dependent programmed cell death, which is different from apoptosis, necrosis, and autophagy. Specifically, under the action of divalent iron or ester oxygenase, unsaturated fatty acids that are highly expressed on the cell membrane are catalyzed to produce lipid peroxidation, which induces cell death. In addition, the expression of the antioxidant system [glutathione (GSH) and glutathione peroxidase 4 (GPX4)] is decreased. Ferroptosis plays an important role in the development of diabetes mellitus and its complications. In this article, we review the molecular mechanism of ferroptosis in the development of diabetes mellitus and its complications. We also summarize the emerging questions in this particular area of research, some of which remain unanswered. Overall, this is a comprehensive review focusing on ferroptosis-mediated diabetes and providing novel insights in the treatment of diabetes from the perspective of ferroptosis. In 2012, Brent R. Stockwell and his team found that erastin, a selectively lethal small molecule of oncogenic RAS, triggered a unique form of iron-dependent nonapoptotic cell death\u2014a new form of cell death, called ferroptosis . FerroptSince the discovery of ferroptosis, many studies have confirmed that ferroptosis is related to the occurrence and development of many diseases, such as cancer, diabetes, and ischemia\u2013reperfusion injury . AccordiAs a new form of cell death, ferroptosis was originally discovered by the selective inhibition of erastin and RAS-selective lethal 3 (RSL3) . These t\u2212, a cystine/glutamate antiporter system, is an antiporter made up of two subunits, SLC7A11 (solute carrier family 7 member 11), which is the light chain of the subunit, and SLC3A2 (solute carrier family 3 member 2), which is the heavy chain of the subunit . When erastin inhibits system Xc\u2212, the source of cysteine is reduced and the amount of GSH synthesis decreases, which in turn leads to the accumulation of lipid peroxides, triggers protein and membrane damage, and initiates ferroptosis. Glutamate cysteine ligase (GCL) and GSH synthase (GS) are the rate-limiting enzymes in the GSH biosynthesis pathway. Inhibition of GCL and GS can lead to depletion of GSH and result in ferroptosis  and play an important role in inhibiting ferroptosis . Inhibitroptosis .GPX4 is the fourth member of the selenium-containing GPX family. In mammals, GPX4 is the only GPX family member with the ability to resist peroxide damage . GPX4 reAccording to previous studies, ferroptosis suppressor protein 1 (FSP1) has a proapoptotic effect under certain conditions. FSP1 could translocate into the nucleus and trigger DNA degradation. However, recent studies have shown that FSP1 has an anti-ferroptosis mechanism parallel to the Cyst(e)ine-GSH-GPX4 axis. FSP1 reduces CoQ10 through NAD(P)H, which reduces lipid free radicals, thereby inhibiting lipid peroxidation and consequently inhibiting ferroptosis .\u2212 and the cysteine-providing supersulfur pathway, the FSP1/CoQ10 axis is dependent on the mevalonate pathway. The mevalonate pathway involves the production of isopentenyl pyrophosphate (IPP), squalene , CoQ10, and cholesterol (Unlike the Cyst(e)ine/GSH/GPX4 axis, which is dependent on the cysteine anti-transport system Xclesterol . Inhibitlesterol .2+ + HOOH \u2192Fe3+ + OH\u2212 + OH\u00b7). This reaction is also the basic principle of the lipid peroxidation step in ferroptosis. Namely, iron ions entering the cell undergo a Fenton reaction and peroxidize polyunsaturated fatty acids (PUFAs) to generate lipid peroxides  human osteosarcoma cell line U2OS. The levels of p53 and its downstream targets were unaffected, but the cells underwent ferroptosis when exposed to TBH  and Nutlin (p53 activator), suggesting that p53 induces ferroptosis in a GPX4-independent manner  and found that the mice died of severe diabetes as they matured; in contrast, when the p53 deletion was reversed (p53LFL/FL/arf-bp1FL/Y/RIP-cre), the mice lived longer (d longer . T-cell d longer . P53 is Nuclear factor erythroid 2-related factor 2 (NRF2) is a transcription factor that plays an important role in cellular antioxidant activity, regulates transcription of components of the GSH antioxidant systems, and is involved in phase I and phase II detoxification of exogenous and endogenous products, NADPH regeneration, and heme metabolism enzymes . As manyPatients with type 2 diabetes mellitus commonly experience hyperglycemia, insulin resistance, inflammation, and dyslipidemia, all of which cause intracellular oxidative stress and inflammation . Flavin c\u2212/Gpx4/Nrf2 and inhibiting NCOA4 in diabetes, thereby exerting a strong antidiabetic effect  is an important enzyme in lipid metabolism, which catalyzes the reaction between long-chain fatty acids and coenzyme A to generate acyl-CoA. ACSL4 activates arachidonic acid to arachidonyl-CoA, which is further esterified to phospholipid . The oxiThe ACSL4 protein exists in the \u03b2-cells of human and rat islets, and its distribution site suggests that ACSL4 is involved in insulin secretion by modifying fatty acids in insulin secretion granules and mitochondria . UpregulWFS-T2 encodes the protein NAF-1. NAF-1 is a member of the NEET protein family, a highly conserved [2Fe-2S] protein. NAF-1 localizes to mitochondria, the endoplasmic reticulum (ER), and the mitochondria-associated membrane connecting these organelles, and its unique [2Fe-2S] cluster structure makes NAF-1 essential for autophagy, ferroptosis, redox, and oxidative stress. It plays a key regulatory role in the process of cell proliferation . Researc\u2212, (via iron or polyunsaturated fatty acid overload.This article reviews the mechanism of ferroptosis and the role of ferroptosis in diabetes. At present, diabetes is one of the most prevalent diseases in the world, and its complex pathogenesis and systemic complications make it a very difficult problem. As a new form of PCD, ferroptosis has different characteristics from other cell deaths, and has shown great potential in the diagnosis, treatment, and prognosis of diabetes. Four mechanisms for the induction of ferroptosis have been identified: : inhibit\u2212,  inhibiti\u2212,  depletio\u2212,  lipid peGiven the association between diabetes and ferroptosis, starting from the key targets of ferroptosis might improve diabetes. Improvements in insulin secretion and insulin sensitivity along with better control of blood glucose have been observed after reducing iron storage levels in the body . Althougin vivo, we cannot be sure whether ferroptosis occurs during cell growth and differentiation. In addition, ferroptosis is caused by phospholipid peroxidation, and ROS are also closely related to ferroptosis. Considering the oxygen demand of islet cells, it is unclear whether the ferroptosis process is dependent on the concentration of oxygen. In conclusion, although ferroptosis has not been thoroughly studied and its molecular mechanism in diabetes and diabetic complications needs to be further explored, ferroptosis is a potential target for the therapeutics of diabetes.However, there are still some unanswered questions about the occurrence and development of ferroptosis in diabetes. For example, as there are no markers of ferroptosis"}
+{"text": "Here, we reviewed the latest studies on the regulation of ferroptosis in tumor cells and introduced the tumor-related signaling pathways of ferroptosis. We paid particular attention to the role of noncoding RNA, nanomaterials, the role of drugs, and targeted treatment using ferroptosis drugs for mediating the ferroptosis process in tumor cells. Finally, we discussed the currently unresolved problems and future research directions for ferroptosis in tumor cells and the prospects of this emerging field. Therefore, we have attempted to provide a reference for further understanding of the pathogenesis of ferroptosis and proposed new targets for cancer treatment.Ferroptosis is a type of cell death that depends on iron and reactive oxygen species (ROS). The accumulation of iron and lipid peroxidation primarily initiates oxidative membrane damage during ferroptosis. The core molecular mechanism of ferroptosis includes the regulation of oxidation and the balance between damage and antioxidant defense. Tumor cells usually contain a large amount of H Ferroptosis regulates the balance between oxidative damage and antioxidant defense.It is a type of programmed cell death dependent on iron-mediated oxidative damage.Some ncRNAs related to ferroptosis are mainly miRNA, lncRNAs, and circRNAs.What is the crosstalk between ferroptosis and other cell death pathways?To what extent does lipid peroxidation induce ferroptosis?Are ferroptosis inducers effective in killing tumor cells in clinical therapy?What is the progress of ferroptosis induced by nanomaterials in tumor therapy?Cell death has long been recognized as a characteristic of malignancy , 2. As e2+)-dependent accumulation of lipid peroxides as ferroptosis [In 2012, scientists named a new mode of regulated cell death (RCD) induced by the ferrous ion  and GPX4-non-dependent systems (FSP1-CoQ10-NAD(P)H axis, GCH1/BH4 axis, and DHODH/CoQH2 axis) , 32  biosynthesis (and other biomolecules) and is involved in antioxidant defense mechanism, it is considered to be the rate-limiting precursor of the antioxidant glutathione [The solute carrier family 7-member 11-glutathione-GPX4(SLC7A11-GSH-GPX4) signaling axis is one of the most classic ferroptosis defense pathways \u201335. The tathione  . GSH istathione , 38. GPXtathione , 33. It tathione , 40. It tathione , 41\u201343.l-erythro-5,6,7,8-tetrahydrobiopterin (BH4) complex. Kraft found that the expression of GCH1 triggered the production of potent antioxidant BH4, thus preventing lipid peroxidation [GTP cyclohydrolyse-1 (GCH1) is the rate-limiting enzyme of the 6(R)-xidation ; BH4 hasxidation , 46. Thexidation . GCH1 dexidation \u201349.The pharmacological targeting of FSP1 has a strong synergistic effect with GPX4 inhibitors, which can trigger the ferroptosis of multiple tumor entities , 45. TheDihydroorotate dehydrogenase (DHODH) is a flavin-dependent enzyme located in the inner membrane of mitochondria. Its main function is to catalyze the fourth step of the pyrimidine biosynthesis pathway. That is, dihydroorotate (DHO) is oxidized to orotate (OA), and at the same time electrons are transferred to ubiquinone in the inner membrane of mitochondria, which is reduced to dihydroubiquinone . Mao et ACSL protein mainly exists on the endoplasmic reticulum and the outer mitochondrial membrane and is a fatty acid activating enzyme. It is mainly responsible for the conversion of long-chain fatty acids to their active form acyl-CoA for their oxidation and lipid biosynthesis. Specifically, ACSL4 has a preference for long-chain polyunsaturated fatty acids, such as arachidonic acid (AA) or adrenergic acid (Ada) , 55, andUnder normal circumstances, the accumulation of AA in cells is much lower than that of other fatty acids. The expression of ACSL4 upregulation is considered a biomarker and contributor to ferroptosis, it can esterify free polyunsaturated fatty acids into membrane phospholipids with the help of lysophosphatidylcholine acyltransferase 3 (LPCAT3). Synthesis of PUFA-PL mediated by LPCAT3 and ACSL4, as well as ALOX- and POR-mediated PUFA-PL peroxidation are necessary for ferroptosis to occur. Exogenous supplementation of AA/Ada (and other long-chain polyunsaturated fatty acids) can make ACSL4 knockout cells sensitive to ferroptosis. Hydroxyl radicals can catalyze the peroxidation of various biological macromolecules in cells, including polyunsaturated fatty acids (PUFA), and it is known that various phospholipid bilayers perform important biological functions in cells. The basic unit of phospholipid is composed of hydrophilic phosphoglycerol and hydrophobic polyunsaturated fatty acid chains. The peroxidation of the PUFA chains leads to the destruction of the phospholipid bilayer membrane structure of the cell enhancing membrane permeability, which ultimately leads to cell death , 59.3+ ions into cells [3+ is converted to Fe2+. Excess iron is stored in ferritin, which includes a ferritin light chain (FTL) and ferritin heavy chain 1 (FTH1) [Compared with non-malignant cells, the growth of cancer cells is strongly dependent on the micronutrient iron (ferrum in Latin), which is necessary for the ferroptosis process and can be inhibited by various iron-chelating agents. The excessive iron load may lead to ferroptosis in cancer patients \u201362, membto cells , was alsto cells . Under t1 (FTH1) , 65. The1 (FTH1) . IntraceThe nuclear factor-erythroid factor 2-related factor 2 (NRF2) signaling pathway is an important defense mechanism against ferroptosis, which needs to be activated to exert its antioxidant properties. NRF2 activity is affected by some related regulatory factors during ferroptosis. Subsequently, the activated NRF2 induces and regulates the expression of a series of downstream antioxidant factors. Therefore, in the NRF2 antioxidant regulatory factors category, both activation-related regulatory factors and downstream antioxidant factors or antioxidant systems are included.SLC7A11 in vivo and in vitro and regulates the ferroptosis response in a p53-dependent and p53-independent manner. The ARF\u2013NRF2 interaction is essential for ARF to inhibit p53-dependent tumor growth [A previous study indicated that NRF2 is an important and novel transcriptional regulator of ferroptosis in hepatocellular carcinoma (HCC) cells, and NRF2 activation can inhibit ferroptosis in HCC cells \u201369. Firsr growth , 71. TheFinally, gene inactivation of tumor suppressor NRF2 makes cancer cells in orthotopic malignant mesothelioma mouse models more sensitive to ferroptosis. The results show the role of cell\u2013cell interaction and intracellular NRF2-YAP signaling pathway in determining ferroptosis and show that malignant mutations in the NRF2-YAP signaling pathway can predict the response of cancer cells to future induction therapy for ferroptosis .Recent studies suggest that p53 plays an important role in controlling metabolism and ferroptosis and that p53 in normal cells can negatively regulate lipid synthesis and glycolysis and positively regulates oxidative phosphorylation and lipid catabolism. In tumor cells, mutant p53 positively regulates lipid synthesis and glycolysis. Therefore, in normal tissues, p53 tends to positively regulate ferroptosis, whereas mutant p53 makes tumor cells more sensitive to ferroptosis.SAT1) and glutaminase 2 (GLS2) [p53 plays a dual role in regulating ferroptosis. On the one hand, it promotes ferroptosis by inhibiting the expression of SLC7A11 or promoting the expression of metabolism-related genes spermidine/Spermine N1-acetyltransferase 1 (2 (GLS2) \u201376. On t2 (GLS2) , both inALOX12 by CRISPR/Cas9 can also inhibit cell ferroptosis. These studies indicate that ALOX12 is necessary for p53-mediated ferroptosis [However, p53 activation has no evident effect on the function of GPX4, which shows that it does not induce ferroptosis through GPX4 . In addiroptosis .The stress response gene, nuclear protein 1, transcriptional regulator (NUPR1) is a multifunctional stress-inducing protein, which is produced under a variety of environmental pressures, including oxidative damage and unfolded protein response. Oxidative stress activates NUPR1 by both ER stress  regulates ferroptosis through epithelial membrane protein 1 (EMP1)-NOX4, which means that ferroptosis may be a therapeutic target for renal cell carcinoma and other TAZ-activated tumors . TAZ affIn epithelial cells, E-cadherin inhibits ferroptosis by mediating the interaction of intracellular NF2  and Hippo signaling pathway while antagonizing the signal axis mediated by E-cadherin promotes ferroptosis through YAP . The cadZEB1 gene related to lipid uptake, aggregation, and migration, the sensitivity to ferroptosis and susceptibility to ferroptosis inducers was significantly increased, leading to drug-resistant cancer cell death [ZEB1 expression leads to increased sensitivity to ferroptosis inducers [Both epithelial\u2013mesenchymal transition (EMT) and ferroptosis can be regulated by epigenetics. In tumor cells, the epigenetic reprogramming of EMT makes head and neck cancer (HNC) cells more sensitive to ferroptosis . To obtall death , 98. Theinducers , 99. EMTNoncoding RNAs (ncRNAs) can be divided into micro RNAs (miRNA), long noncoding RNAs (lncRNAs), and circular RNAs (circRNA) , 101. ThmiRNAs may regulate ferroptosis by affecting the expression of ROS . For exaFPN genes [Some miRNAs can induce ferroptosis by regulating the expression of NRF2. First, miR-7 and miR-200A can easily induce the activation of the NRF2 pathway by inhibiting the expression of Keap1 , 124. SePN genes , 128, miPN genes , 130. miPN genes  (Table 1ELAVL1 (ELAV-like RNA-binding protein 1) is highly expressed in many human tumors and regulates eukaryotic gene expression at the post-transcriptional level, which can enhance RNA stability , 133. WaGpx4; thus, circIL4R acts as a tumor promoter and ferroptosis inhibitor in liver cancer through the miR-541\u20133p/Gpx4 network [CircRNAs participate in the ferroptosis process of tumor cells through the competitive endogenous RNA (ceRNA) pathway. For example, CircABCB10 inhibits ferroptosis and apoptosis of rectal cancer cells by regulating the miR-326/CCL5 axis, providing a potential therapeutic target for the treatment of rectal cancer . CircIL4 network . Circ-TT network . The cir network . To dateIn recent years, researchers have detected some ncRNAs associated with ferroptosis in tumor cells. However, the specific mechanism has not been discussed yet, and there are still many obstacles in the clinical treatment of ferroptosis dependent on ncRNAs. The information summarized in our paper is not enough to support the application of ferroptosis inducers in cancer, more ncRNAs identification and further studies are needed. Downstream molecules regulated by ncRNAs, P53, HSPB1, NRF2, and NOX2, key regulators of ferroptosis, are also involved in the regulation of other cell death types , suggestC- and GPX4. In addition, some natural products play an important role in inducing ferroptosis in tumor cells  also acts on System X cystine , causing cystine \u2013153.Sorafenib induces ferroptosis by targeting the cystine/glutamate anti-transport system Xc- \u2013157, an There are some ferroptosis inducers that block the intracellular antioxidant enzyme GPX4 through endogenous pathways. For example, RSL3, an activator of ferroptosis, does not depend on VDAC2/3 and is selective for tumor cells carrying tumorigenic RAS. Based on affinity chemical proteomics, the chloroacetamide part of the RSL3 structure is essential for its activity. The alkylation of selenocysteine directly inactivates GPX4 and induces lipid peroxidation, thereby inducing ROS production , 160. ThFIN56 was discovered through the modulation map of 56 caspase-independent lethal compounds. Idebenone is the only inhibitor of ferroptosis caused by FIN56 . The oxiGlutathione is a tripeptide composed of three amino acids . Buthionine sulfoximine (BSO) can selectively inhibit r-glutamylcysteine synthase (R-GCS), thus preventing the synthesis of dipeptides from glutamic acid and cysteine. Therefore, as a rate-limiting enzyme in the synthesis of glutathione (GSH), BSO can inhibit the synthesis of reduced glutathione, reduce the activity of GPX4, and promote ferroptosis \u2013170.Withania somnifera, is a natural ferritin inducer for neuroblastoma, dose-dependently either activates the NRF2 pathway through targeting of Kelch-like ECH-associated protein 1 (KEAP1) or aspartate aminotransferase (GPX4) to induce ferroptosis [Withaferin A, as a steroid isolated from roptosis , 172.Artemisia annua in the Compositae family. Studies have found that artemisinin can exert anticancer effects by inducing iron-dependent death of tumor cells [Artemisinin is a natural product of sesquiterpenes and is an effective component of the dried stems and leaves of or cells . Mechanior cells . Under tor cells , 176. Afor cells .Statins stand out as promising candidates for the therapeutic induction of ferroptosis in chemoresistant cancer cells . By reduLapatinib is approved for the treatment of ErbB2-positive breast cancer and other cancers that overexpress ErbB2. In particular, it is used as a treatment for patients with advanced or metastatic ErbB2-positive breast cancer , 181. CoBAY-87\u20132243 inhibits complex I (CI) of the mitochondrial respiratory chain then triggers ferroptosis of BRAFV600E melanoma cell lines . On the In addition to the preclinical drugs associated with ferroptosis mentioned above, some ferroptosis inhibitors are widely used in tumor research. Such as ferrostatin-1 and liproxstatin-1, both inhibitors work by inhibiting lipid peroxides, thereby inhibiting ferroptosis in tumor cells , 189. ViWe summarize the mechanisms of ferroptosis in reversing drug resistance in preclinical studies. But there is still a long way to go before it can actually be used in patients. At the same time, we also face many challenges: the development of novel ferroptosis-inducing drugs requires consideration of drug toxicity and prevention of off-target effects to avoid other adverse reactions in patients; ferroptosis may be associated with a variety of pathological conditions\u2014including acute kidney injury, tissue deficiency Blood and reperfusion injury and neurodegeneration, etc., in the process of inducing ferroptosis of tumor cells, it is also necessary to avoid other systemic adverse reactions in patients; In addition, since various types of cancer have different sensitivities to ferroptosis, we are temporarily unable to confirm whether the therapeutic strategy of inducing tumor cells ferroptosis in patients is universal? And which drugs are most suitable for clinical treatment? We also need to identify the target patient population most likely to benefit from this strategy.In recent years, researchers have tried to combine bio-nanotechnology with ferroptosis to develop candidates with a stronger antitumor effect , 194. Th3+ and tannic acid (TA) [3+ to Fe2+ and continuously supply Fe2+ to maintain the iron redox cycle and maintain the Fenton reaction [3O4/Gd2O3 hybrid nanoparticles FeGd-HN@Pt@LF/RGD2 successfully combined and delivered Fe2+, Fe3+, and H2O2 (the reactants involved in the Fenton reaction) to the tumor sites. Their local concentration was increased to accelerate the Fenton reaction, significantly improving the efficacy of in situ brain tumor ferroptosis treatment [Currently, nanomaterials can be used to disrupt pathways related to the activity of GPX4 to induce ferroptosis and drive cancer therapy , 202. Socid (TA) . Sorafenreaction . Shen etreatment ; convers3O4-PLGA-Ce6 coated with PLGA, containing iron oxide (Fe3O4) and photosensitizer Ce6, and used it to synergize ferroptosis\u2013photodynamics anticancer treatment. Fe3O4-PLGA-Ce6 nanosystem can dissociate in acidic TME and release ferrous/iron ions and Ce6. Subsequently, the released ferrous/iron ions will react with excess hydrogen peroxide in the cell to produce a Fenton-like reaction generating hydroxyl free radicals (\u2022OH), and induce ferroptosis of tumor cells [Iron-based nanomaterials can induce cell ferroptosis and provide an innovative method for cancer treatment. Current \u201cferroptosis\u201d therapeutic nano preparations are often combined with other treatment methods, resulting in complex nanostructures and multi-metal compositions. Shasha He and others from Nanyang Technological University in Singapore reported the progress on the development of iron-chelated semiconductor multi-composite nanoparticles (SPFeN) under the guidance of photoacoustic (PA) imaging for the treatment of cancer using photothermal \u201cferroptosis\u201d . Professor cells . In addior cells , 207.Ferroptosis is closely related to the accumulation of lipid hydrogen peroxide in cells, which is mainly derived from PUFAs of membrane phospholipids under oxidative stimulation , 208. ThCombining ferroptosis-inducing inducers with bio-nanotechnology for tumor therapy has broad application prospects , but theSo far, researchers have elucidated some regulatory mechanisms and signal transduction pathways of ferroptosis , 214. An2O2 and iron ions) based on the Fenton reaction of nano-DDS [In addition, nanoparticles carrying chemicals or biological materials will provide the possibility to improve the efficacy of existing ferroptosis inducers and to develop new inducers for the treatment of cancer. Some nanoparticles can sensitize effective ferroptosis, produce mild immunogenicity, and improve the response rate of non-inflammatory tumors in cancer immunotherapy . The bionano-DDS , 200. SeThe antitumor effect of ionizing radiation may be enhanced by triggering ferroptosis and ferroptosis inducers with effective radiosensitizers , 220\u2013224"}
+{"text": "To date, it has been confirmed that the occurrence and development of infectious diseases are tightly associated with regulatory cell death processes, such as apoptosis, autophagy, and necroptosis. Ferroptosis, as a newly discovered form of regulatory cell death characterized by iron-dependent lipid peroxidation, is not only closely associated with tumor progression, but is also found to be tightly related to the regulation of infectious diseases, such as Tuberculosis, Cryptococcal meningitis, Malaria and COVID-2019. The emerging critical roles of ferroptosis that has been found in infectious disease highlight ferroptosis as a potential therapeutic target in this field, which is therefore widely expected to be developed into new therapy strategy against infectious diseases. Here, we summarized the underlying mechanisms of ferroptosis and highlighted the intersections between host immunity and ferroptosis. Moreover, we illuminated the roles of ferroptosis in the occurrence and progression of different infectious diseases, which might provide some unique inspiration and thought-provoking perspectives for the future research of these infectious diseases, especially for the development of ferroptosis-based therapy strategy against infectious diseases. Cell is the basic unit of the biological system, which not only provides the necessary energy and nutrition for physiological events, but also acts as the indispensable one for the host\u2019s immunity against invasion. Various regulated cell death modalities are tightly associated with the pathological processes in many diseases. Strikingly, ferroptosis, a newly discovered cell death, accompanied by iron independence lipid peroxidation (LPO), has become an eye-catching topic nowadays . The mecOver the past few years, shreds of evidences have shown that the close relationship between ferroptosis and cancer, neurodegenerative diseases, ischemia-reperfusion diseases, and kidney diseases , howeverIt is conceivable, but not fully demonstrated, that ferroptosis triggered in infectious diseases acting a double-edged sword role that it may be caused by pathogens for survival or can be exploited as potential therapeutics. In this review, we briefly described the present understanding of ferroptosis induction and execution, and also highlighted the relationships between ferroptosis and infectious diseases so as to further understand the functions of ferroptosis in infectious diseases. Particularly, we hypothesized the therapeutic potential of ferroptosis in these diseases based on the current researches. We hope this review could enhance our understanding of ferroptosis in infectious diseases by exploring how ferroptosis contributes to host control of pathogens, how ferroptosis is triggered by some pathogens to promote disease development, and how ferroptosis can be controlled to defend against infectious diseases.2+ + H2O2 \u2192 Fe3+ + \u2022OH + OH\u2212), can be excessively produced due to an excess of ferrous iron , a selenoprotein, one of the most well-known key factors in the regulation of ferroptosis, can reduce the level of intracellular lipid peroxide via lipids detoxification . Glutath2O2, and the active site was oxidized to sulfonic acid (SO2/3H), which inactivated GPX4 and eventually induced ferroptosis. This work strongly suggests that selenium plays an indispensable role in helping GPX4 resist ferroptosis by regulating lipid peroxidation.Due to the important roles of selenium in GPX4, there is also a close relationship between selenium and ferroptosis . SelenopMoreover, Zhang Y et al. discovered a new pathway regulating GPX4 independently with the level of intracellular GSH . Mammaliin vitro NADPH-dependent coenzyme Q10 (CoQ) oxidoreductase localized on the cell membrane and is able to inhibit lipid peroxidation in a different way  is an rent way . The suprent way . Similarrent way , and avorent way .c\u2212) localized on cell membrane  and amino acid transporter solute carrier family 3 member 2 (SLC3A2) is the main component of the sodium-dependent cystine/glutamate transporter -binding proteins 1 (PCBP1), an iron chaperone from one of the four homologous RNA-binding protein families in KH domain superfamily, can directly bind iron and combine with ferritin to complete the storage of intracellular iron . EvidencIn recent years, the relationship between autophagy and ferroptosis has engaged much attention, and the view that ferroptosis is an autophagy-dependent death is emerged. Many studies have reported that ferritinophagy can trigger ferroptosis . FerritiMeanwhile, a paper proposed that ATG5, an autophagy-related gene, regulated ferritinophagy and then induced ferroptosis . Eunhee Acyl-CoA synthetase long-chain family member 4 (ACSL4) has been confirmed as a key ferroptosis gene, playing a crucial role in the synthesis of long-chain PUFA-CoA . PharmacLipoxygenase (LOX) catalyzes the production of lipid peroxides, as proof, Arachidonate 12-Lipoxygenase (ALOX12), an isoform of the mammalian lipoxygenase family, can inhibit p53-regulated ferroptosis via inhibiting lipid synthesis function by specifically binding to SLC7A11, which abolishes the function of p53 suppressing tumor growth through ferroptosis . Also, oWhat\u2019s more, cellular energy stress might also be closely bound up with ferroptosis. For instance, activation of AMP-activated protein kinase (AMPK) caused by energy stress can inhibit the synthesis of certain anabolism such as PUFAs, which further suppresses ferroptosis . However1 -acetyltransferase 1) gene induced by p53 could trigger lipid peroxidation and sensitize cells to ferroptosis  through pattern recognition receptors (PRRs)  and NOD-like receptors (NLRs)), thus initiating basic, simple, and rapid defensive responses to fight pathogen invasions . Damage-TLRs are able to recognize PAMPs and DAMPs, and initiate corresponding immune responses, such as the immune clearance function of macrophages. Research believed that the efficiency of macrophages to clear apoptotic cells was better than that of ferroptotic cells . HoweverWhat\u2019s more, with the stimulation of pathogen infection, TLR recognition, and interferon signal regulation, macrophages usually differentiate into M1 macrophages equipped with pro-inflammatory effects, while M2 macrophages have the anti-inflammation and tissue repair effects . Also, aOne might wonder whether there are different correlations between macrophage and ferroptosis. Indeed, macrophages not only play a momentous role in anti-infection immunity but also gobble up aging or injured red blood cells and regulate iron homeostasis. Different polarization types of macrophages come with different functions in regulating iron metabolism . It is wNeutrophil is another important member of innate immune system, which counteracts pathogens via some mechanisms, such as phagocytosis and the production of NETs (neutrophil extracellular traps) . Many puA paper illustrating precise cell death pathways and signaling events orchestrate early inflammation after heart transplantation is thought-provoking . They suFH) cells in mouse and human tonsils after ovalbumin injection, with higher levels of lipid ROS, MDA , and 4-HNE in TFH cell compared with non-TFH cells  is critical for long-term persistence of virus-specific memory CD4+ T cells, which ablation will induce aberrant mitochondrial ROS accumulation and ensue ferroptosis-causative lipid peroxidation  was up-regulated, which led to the decrease of SLC7A11 and GPX4 protein levels, while knockdown of p53 reduced the ROS level . And NCOWhat\u2019s more, lipid metabolism is involved in viral replication by regulation of the formation, assembly, and release of replicative organelles. ASCL4, a key factor involved in lipid metabolism and ferroptosis, greatly promoted the replication of some enteroviruses and coronaviruses . In ASCLin vivo, although excess iron could be extremely toxic to Mtb  can induce ferroptosis by catalyzing lipid peroxidation . In generuginosa . Moreove tissues . Oxidatid airway , implicaIn addition, some studies have also revealed the important role of ferroptosis in the development of sepsis. For example, the inhibition of lipopolysaccharide-induced ferritinophagy-related ferroptosis could improve cardiac function and survival prognosis in mice with lipopolysaccharide-induced cardiac injury . At the Cryptococcal meningitis (CM) is one of the most common clinical fungal infections, especially in AIDS patients with immunodeficiency. Notably, iron accumulation and lipid peroxidation occurred in the brains of CM patients , and fer2+, NOXs can regulate ferroptosis induced by exogenous Fe2+ in Aspergillus flavus , however, only a visble crack can be seen in the door of infectious diseases. Therefore, bridging ferroptosis with infectious diseases is particularly on the map. As we reviewed above, multiple functions of ferroptosis in infectious diseases can be generally considered as a double-edged sword . On the via inducing ferroptosis. Also, iron homeostasis is maintained by various proteins and transcription factors, such as iron chaperone proteins PCBP1, a negative regulator of ferroptosis. Although the connections between PCBP1 and infectious diseases haven\u2019t been elucidated, these kinds of functional molecules may provide more inspiration for the future work in this field. Simultaneously, lipid metabolism involved in infectious diseases, such as 15-LOXes in P. aeruginosa catalyzed lipid peroxidation in human bronchial epithelial cells to induce ferroptosis with increased damage, is also worth to be mentioned. This means that ferroptosis-driven lipid metabolism might be a target for the development of infectious diseases. Similarly, it is reported that ROS, which induces ferroptosis, mainly comes from mitochondria (Furthermore, relationships between ferroptosis-related pathways, metabolism, and host immunity against infections are also striking enough in the discovery tour. As proof, the \u201cselenium-GPX4-ferroptosis\u201d pathway provides a novel insight into the development and enhancement of vaccination. Meanwhile, iron homeostasis, one of the key factors of ferroptosis, to some degree is a tiger that host riding with. Excess iron-induced ferroptosis causes the damage, but on the bright side, NCOA4-mediated ferrtinophagy can possibly be utilized by macrophages to kill intracellular bacteria chondria . Given tMany researchers have proposed their perspectives about the role of ferroptosis or illustrated the mechanisms involved in infectious diseases. For example, While Amaral et al. suggested the inhibition of ferroptosis might ameliorate the Mtb infection, they also considered that simultaneously lessen tissue damage while reducing pathogen burden and dissemination is an attractive aspect of this strategy . And YaoHowever, plenty of questions remain unknown, such as whether it is possible to develop ferroptosis as target into a new therapeutic method for infectious diseases or not. To what extent can ferroptosis assist the host killing of pathogens, and how can we minimize the damage of ferroptosis to host physiological functions? How does ferroptosis mediate the pathological progresses during the infections? How do ferroptosis-related regulations affect the innate and adaptive immunity against the infections? What are the similarities and complementarities between ferroptosis and cell death such as autophagy and necrosis in infectious diseases? Undoubtedly, tons of puzzles sitting right there need us to solve in the future. Delving into and thoroughly settling the mechanisms of ferroptosis in host upon infections is a promising, yet albeit challenging strategy to help conquer these diseases. And we believe that with the increasing understanding of the relations and underlying mechanisms between ferroptosis and infectious diseases, the regulation of ferroptosis might be developed into novel therapeutic strategy, which would further benefit the control of the threatening infectious diseases."}
+{"text": "Ferroptosis is a newly discovered form of non-apoptotic regulatory cell death driven by iron-dependent lipid peroxidation. Ferroptosis significantly differs from other forms of cell death in terms of biochemistry, genetics, and morphology. Ferroptosis affects many metabolic processes in the body, resulting in disruption of homeostasis, and is related to many types of lung disease. Although current research on ferroptosis remains in the early stage, existing studies have confirmed that ferroptosis is regulated by a variety of genes, mainly involving changes in genes involved in iron homeostasis and lipid peroxidation metabolism. Furthermore, the mechanism of ferroptosis is complex. This review summarizes the confirmed mechanisms that can cause ferroptosis, including activation of glutathione peroxidase 4, synthesis of glutathione, accumulation of reactive oxygen species, and the influence of ferrous ions and p53 proteins. In recent years, the mechanism of ferroptosis in the occurrence and development of many diseases has been studied; the occurrence of ferroptosis will produce an inflammatory storm, and most of the inducing factors and pathological manifestations of lung diseases are also inflammatory reactions. Therefore, we believe that the association between ferroptosis and lung disease deserves further study. This article aims to help readers to better understand the mechanism of ferroptosis, provide new ideas and targets for the treatment of lung diseases, and point out the direction for the development of new targeted drugs for the clinical treatment of lung diseases. Cell death is an irreversible process that often occurs in normal tissues and is a necessary life process to maintain the function and morphology of tissues. Previous studies have suggested that there are two main pathways of cell death: apoptosis and necrosis. In recent years, a growing number of studies have indicates that there are other types of cell death besides apoptosis and necrosis, such as autophagy, necrotic apoptosis, scorch death, and ferroptosis. In 2003, 2+) mediate lipid oxidation in a manner similar to the Fenton reaction to produce a large number of reactive oxygen species (ROS)  . FerroptFerroptosis cells trigger the innate immune system by releasing inflammation related damage factors, and then stimulate the inflammatory response. Pulmonary diseases, such as asthma, acute lung injury, COPD, and pulmonary fibrosis, are closely related to inflammatory response. Therefore, based on the inducing the operating mechanism of ferroptosis, the exploration on the relevance between ferroptosis and lung diseases will conribute to a deeper perspective on pathogenesis of asthma, COPD and other lung diseases, and provide new ideas and directions in treatment methods and new drug research and development.This review aims to improve our comprehension on the ferroptosis working mechanism so as to provide novel insights during the process of the clinical treatment of lung diseases, and identify the direction for the development of new targeted drugs for the clinical treatment of lung diseases.GPX4 plays an essential part in ferroptosis in ferroptosis  Zhang e. Studies\u2212, which is anchored on the cell membrane and consists of seven members of the solute carrier family 11 (SLC7A11) and three members of the solute carrier family 2 (SLC3A2)  . It can roptosis .2+, which is stored in the cell marginal iron pool (LIP)  . The maiol (LIP) . As showroptosis . In addiroptosis .The main cause of ferroptosis is the accumulation of lipid peroxides . Abnormap53 is a classical tumor suppressor gene that participates in a variety of cellular metabolic reactions through interactions with other proteins and selective transcriptional regulation of a variety of target genes . The accCOPD is a lung disease characterized by airflow restriction and persistent respiratory symptoms. An abnormal inflammatory reaction caused by exposure to chronic cigarette smoke (CS), harmful particles, or gases is one of the main causes of COPD . CS is cAcute lung injury is characterized by acute systemic inflammation. Its clinical manifestations include pulmonary edema, hypoxemia, diffuse alveolar injury, and lung infiltration . Acute lAn increasing number of studies have reported the role of ferroptosis in the pathogenesis and treatment of cancer, including many malignant tumors such as breast cancer , liver cThere is a close relationship between ferroptosis and COPD and lung cancer. COPD caused by excessive smoking is one of the main causes of lung cancer . Many suFerroptosis is closely related to the pathogenesis of pulmonary fibrosis. The accumulation of iron ions, ROS, lipid peroxides, and inhibition of GPX4 activity features critically in the pathogenesis of pulmonary fibrosis . An imbalance of iron and lipid peroxide metabolism often accompanies pulmonary fibrosis . TherefoSince Dixon and others put forward the concept of ferroptosis in 2012, it has received increasing research attention, with a particular focus on the mechanism. Ferroptosis is a novel form of cell death that disticts from common modes such as apoptosis and autophagy; the occurrence of ferroptosis is regulated by iron metabolism-related mechanisms. This controllable regulatory cell death mode provides new opportunities for the treatment of human diseases.With increased research, the inducers, inhibitors, and related mechanisms of ferroptosis have been identified. From the perspective of biochemistry, the cause of ferroptosis can be contributed to GSH depletion, intracellular iron accumulation, lipid peroxidation and GPX4 inactivation. In recent years, more and more inducers and inhibitors of ferroptosis have been identified. For example, Nrf2 and heat shock proteins can regulate ferroptosis. Furthermore, the results of a large number of clinical trials and animal experiments indicates that ferroptosis can be closely attributes to a variety of human diseases and pathological processes. The treatment of pathway intervantion proves effectively delay on the process of certain diseases and relieves the symptoms . AlthougIn conclusion, ferroptosis is a newly discovered form of cell death. With continuous in-depth research, new mechanisms and regulatory factors have been identified, and the connection with the processes of many diseases has been confirmed. It has important theoretical and practical value in guiding the development of new therapeutic schemes and targeted drugs for various diseases presenting with ferroptosis as the entry point."}
+{"text": "Ferroptosis-derived clinical management of musculoskeletal diseases offers tremendous and attractive opportunities. Notably, ferroptosis agonists have been proven to enhance the sensitivity of osteosarcoma cells to conventional therapeutic strategies. In this review, we have mainly focused on the implications of ferroptosis regulation in the pathophysiology and therapeutic response of musculoskeletal disorders. Understanding roles of ferroptosis for controlling musculoskeletal diseases might provide directions for ferroptosis-driven therapies, which could be promising for the development of novel therapeutic strategies.Ferroptosis is a novel type of cell death associated with iron accumulation and excessive lipid peroxidation. Elucidating the underlying molecular mechanisms of ferroptosis is intensively related to the development and treatment of multiple diseases, including musculoskeletal disorders. Moreover,  The denIn mammals, the cyst(e)ine-GSH-GPX4 signaling axis has been identified as the primary regulatory system for ferroptosis. ROS are the byproducts of aerobic metabolism, and unrestrained ROS production significantly contributes to cellular ferroptosis . GSH is via NAD(P)H and subsequently traps lipid peroxides to inhibit ferroptosis -III membrane repair, which is a distinct mechanism independent of ubiquinol /NAD(P)H pathway, which is a GPX4-independent non-mitochondrial coenzyme Q10 (CoQ10)-based antioxidant system. FSP1 can catalyze the production of ubiquinol, the reduced form of CoQ10, at the cell membrane roptosis . Interesbiquinol . In addibiquinol .GCH1/tetrahydrobiopterin (BH4)/phospholipid signaling axis has been recently reported to function as a highly potent ferroptosis suppressor. Moreover, the GCH1-BH4 pathway has been demonstrated as an endogenous antioxidant pathway independent of GSH-GPX4 . BH4 serin vivo study suggests that iPLA2 inhibition may increase the susceptibility of cancer cells to p53-driven ferroptosis, which is independent of GPX4  suppressed the expression of OA-related risk factors, such as IL-1\u03b2, MMPs, and GRP78, and improved the treatment efficacy against OA  and activating p38 signaling. On the contrary, METTL3 knockdown significantly abrogated the activation of ASK1-p38 signaling axis, resulting in ferroptosis attenuation and diabetic bone loss . In addiRheumatoid arthritis (RA) is a systemic inflammatory disease whose pathogenesis is often characterized by the infiltration of pro-inflammatory synovial fibroblasts, elevated frequency of synovial osteoclasts, and progressive joint destruction . MultiplFerroptosis incentive influences RA progression; thus, explicating its underlying molecular mechanism could capture significant attention for RA treatment. Aberrant expression of FSP1, a molecular biomarker for ferroptosis inhibition , may be Exploring the ferroptosis-related molecular mechanisms could provide new directions to study carcinogenesis and treatment response . Previouvia binding to its 3\u2032-untranslated region, hence inducing ferroptosis in osteosarcoma cells. Notably, the intervention of miR-1287-5p led to osteosarcoma cells being more sensitive to cisplatin chemotherapy  could reduce iron-mediated oxidative stress and enhance the safety profile of DFO H, and GCH1-BH4, have been confirmed to be crucial for ferroptosis regulation in musculoskeletal diseases. In the cellular model of TNF-\u03b1-induced RA, the bioactive peptide G1dP3 was demonstrated to be a potential therapeutic agent against RA; this effect was correlated with the increased p53-mediated ferroptosis in synovial fibroblasts . However in vivo . However"}
+{"text": "Ferroptosis is a type of regulated cell death characterized by iron-mediated lipid peroxidation, in contrast with apoptosis, autophagy, and necrosis. It can be triggered by many pathological processes, including cellular metabolism, tumors, neurodegenerative diseases, cardiovascular diseases, and ischemia\u2013reperfusion injuries. In recent years, ferroptosis has been discovered to be associated with p53. P53 is a tumor suppressor protein with multiple and powerful functions in cell cycle arrest, senescence, cell death, repair of DNA damage, and mitophagy. Emerging evidence shows that ferroptosis plays a crucial role in tumor suppression by p53. P53 functions as a key bidirectional regulator of ferroptosis by adjusting metabolism of iron, lipids, glutathione peroxidase 4, reactive oxygen species, and amino acids via a canonical pathway. In addition, a noncanonical pathway of p53 that regulates ferroptosis has been discovered in recent years. The specific details require to be further clarified. These mechanisms provide new ideas for clinical applications, and translational studies of ferroptosis have been performed to treat various diseases. P53 plays a crucial role in ferroptosis. It targets the key proteins and enzymes involved in ferroptosis such as SLC25A28, FDXR, SAT1-ALOX15, GLS2, SLC7A11, DPP4, p21, ALOX12, and iPLA2\u03b2. P53 also regulates noncoding RNAs to promote ferroptosis.Regulation of ferroptosis by p53 is complex, bidirectional, and context dependent. P53 promotes ferroptosis to help the body eliminate tumor cells and abnormal cells. P53 can reduce the sensitivity of cells to ferroptosis and promote normal cell survival.Translational research of p53 and ferroptosis demonstrates potential clinical prospects for tumors and ischemia\u2013reperfusion injury.A form of iron-dependent cell death that cannot be hindered by genetic or chemical inhibitors of necroptosis or apoptosis was first reported a decade ago and named ferroptosis . In subsThe tumor suppressor protein p53 was first discovered in the 1970s , 17. P53Cells undergoing ferroptosis have unique morphological features, including lessened mitochondrial size, increased mitochondrial membrane density, reduced/absent mitochondrial cristae, ruptured mitochondrial outer membranes, and a normally sized nucleus but with no concentration of chromatin . The proIron is a material nutrient and has important biological functions, such as catalyzing various biochemical reactions by accepting and donating electrons . Metabol3+ ions and bind to TFR1. Then the Fe3+-transferrin-TFR1 complex is internalized via endocytosis and release Fe3+ which is reduced to Fe2+  at C-2, and a phosphatidic ester group at C-3 of the glycerol backbone. Peroxidation of PUFAs at C-2 can drive ferroptosis. De novo synthesized fatty acids must be incorporated into PLs by acyl-CoA synthetases (ACSs). Phosphatidylethanolamines containing AA or adrenic acid (AdA) are key PLs that can be oxidized and drive ferroptosis. ACS long-chain family member 4 (ACSL4) first converts AA to acylated AA, and lysophosphatidylcholine acyltransferase 3 catalyzes the incorporation of acylated AA into the PL.A study  confirmeROS (mainly HO\u2022) produced by the Fenton reaction initiate the nonenzymatic free radical chain oxidative reaction of PUFAs on cell membranes and thereby change these membranes to instigate ferroptosis . The oxi2+. These new L\u2022 and LO\u2022 groups react with an adjacent PUFA to cause another chain reaction. This spontaneous process is catalyzed by iron and oxygen. In addition, some lipoxygenases (LOX) can directly oxidize PUFAs and PUFA-containing lipids in biofilms, suggesting that LOX mediate ferroptosis . GP. GP36]. c-) [c-, which is located on the cell surface and is responsible for the exchange of extracellular cystine and intracellular glutamate. Once cystine enters the cell, its disulfide bond breaks to form cysteine, which is one of three substrates for GSH synthesis. Thus, inhibition of SLC7A11 reduces the import of cystine and subsequently reduces synthesis of GSH, which greatly decreases the level of GSH in cells, and this is followed by lower elimination of lipid peroxides via GPX4 [GSH is a cofactor of the lipid peroxide reductase GPX4. The level of intracellular GSH is regulated by the cystine-glutamate antiporter (system Xc-) . SLC7A11via GPX4 .c- [Beclin 1 is a key regulator of macroautophagy/autophagy. It can promote ferroptosis through inhibition of system Xc- . Beclin c- . In beclc- .In recent years, a growing number of studies have confirmed that p53 is closely associated with metabolic pathways of ferroptosis and is a critical regulatory factor of ferroptosis . RegulatThe canonical pathway of p53 that regulates ferroptosis involves metabolism of iron, lipids, amino acids, and ROS Fig. . The corP53 regulates ferroptosis by affecting iron metabolism and ferredoxin reductase (FDXR) levels . There aP53 can regulate the p53-spermidine/spermine N1-acetyltransferase 1 (SAT1)-ALOX15 metabolic pathway to promote ferroptosis . SAT1 isGLS2 and induces its transcription. Thereafter, GLS2 converts glutamine into glutamate and then into \u03b1-ketoglutarate, and the low level of GSH inhibits GPX4, which promotes ferroptosis [Glutamine metabolism is another pathway involved in the regulation of ferroptosis. Glutaminase-2 (GLS2) is a mitochondrial enzyme that catalyzes the first step of glutamine catabolism to glutamate. GLS2 is also a direct transcriptional target of p53 to positively regulate ferroptosis. In the absence of amino acids or even entire or partial depletion of cystine, glutamine can induce ferroptosis in a serum-dependent manner . P53 binroptosis . Jennis roptosis . Tumor cAs mentioned earlier, GPX4 is a selenocysteine-containing glutathione peroxidase that reduces lipid peroxides to the corresponding alcohols . RegulatSLC7A11 to inhibit its expression, and then a cascade reaction occurs. As uptake of extracellular cystine declines, GSH synthesis falls, GPX4 activity decreases, the level of lipid peroxides increases, and finally ferroptosis occurs. P53 also inhibits the serine trans-sulfuration pathway by repressing CBS. This limits GSH production and thereby indirectly inhibits the enzymatic activity of GPX4, eventually promoting ferroptosis [Jiang et al. first reported that p53 transcriptionally inhibits SLC7A11 to sensitize cells to ferroptosis . They idroptosis , 49.PTGS2. PTGS2 encodes cyclooxygenase-2, which is an enzyme that acts both as a peroxidase and a dioxygenase, and catalyzes lipid oxidation. A study by Yang et al. revealed that PTGS2 is the most upregulated gene during erastin- or RSL3-induced ferroptosis [p53 can also promote ferroptosis induced by RSL3 or erastin through upregulation of roptosis .ELAVL1 and inhibiting its expression. This is followed by destabilization of LINC00336 and release of miR-6852. As the level of CBS decreases, ferroptosis is promoted.P53 also can induce ferroptosis by regulating noncoding RNAs. It regulates expression of numerous noncoding RNAs, including microRNAs (miRNAs) and long noncoding RNAs (lncRNAs) \u201353. MeanIn another axis, the lncRNA PVT1 promotes ferroptosis by restraining the miR-214-mediated downregulation of TFR1. P53 can induce expression of PVT1 to promote ferroptosis in cancer and acute ischemic stroke-induced tissue injuries , 55.DPP4 is a ubiquitous enzyme located on the cell membrane or in a soluble form. It activates lipid peroxidation by interacting with NADPH oxidase 1 (NOX1), leading to ferroptosis . In humaIn the noncanonical pathway, p53 regulates ferroptosis through the arachidonate 12-lipoxygenase (ALOX12), arachidonate lipoxygenase 3 (ALOXE3), or iPLA2\u03b2 pathway. These are also potential hot research topics.ALOX12 and ALOXE3 belong to the lipoxygenase family, and are involved in the noncanonical pathway of p53-mediated ferroptosis regulation that is independent of GSH and GPX4. Under normal conditions, SLC7A11 binds to and sequesters ALOX12 from its substrate, PUFAs, including those esterified in membranes . In respALOXE3 was reported to induce ferroptosis similar to ALOX12 in glioblastoma (GBM) cells . Under nIn addition, there is a novel antiferroptosis mechanism that is independent of GPX4 and FSP1. After cleaving the peroxidized PUFAs of membrane PLs, free radicals are released and cleared by various cellular antioxidant systems to solve the problem of PL peroxidation . The corP53 positively or negatively regulates ferroptosis in different cell types and in response to different stress factors through several independent signaling pathways. As mentioned earlier, p53 promotes ferroptosis mainly by promoting activity of SLC25A28 and expression of FDXR, inhibiting transcription of SLC7A11, promoting expression of GLS2, and increasing the levels of SAT1-ALOX15. This promotion of ferroptosis helps the body to eliminate tumor cells and abnormal cells.P53 can reduce the sensitivity of cells to ferroptosis and promote normal cell survival, especially when the injury or stress is mild. Positive or negative regulation of ferroptosis by p53 also depends on the cell type. Xie et al. found that p53 wild-type colorectal cancer (CRC) cells were insensitive to erastin, but the sensitivity of these cells to erastin was restored upon inhibition of p53 activity by gene knockout or drugs . FurtherP21  is also a target of p53. It mediates the function of p53 by inducing cell cycle arrest and senescence in response to stress signals , 63. MeaTranslational research of ferroptosis regulation by p53 mainly focuses on tumors and ischemia\u2013reperfusion injury. Preclinical studies have shown that upregulation of ferroptosis can induce tumor regression, while downregulation of ferroptosis reduces ischemia\u2013reperfusion injury of heart, brain, and lung tissues. Thus, there are potential clinical applications to target p53 and ferroptosis.Regulation of ferroptosis by p53 not only plays an important role in tumor suppression but also enhances sensitivity of tumor cells to radiotherapy, and even has predictive value for antitumor efficacy and prognosis. D13, a novel compound isolated and extracted from the natural saponin Albiziabioside A, triggers apoptosis and ferroptosis of human colon cancer HCT116 cells by activating p53 through the mitochondrial pathway , 66. It Studies of ferroptosis regulation by p53 have also yielded promising results in alleviating ischemia\u2013reperfusion injury. Acute lung injury is a life-threatening disease with high mortality. Interestingly, animal studies have shown that ferroptosis is involved in acute lung injury triggered by ischemia\u2013reperfusion injury . InhibitRegulation of ferroptosis by p53 is very complex and delicate. Different cell types, different stress factors, and even different intensities of the same stress factor may trigger different p53 signaling pathways and lead to different cell fates. Control of ferroptosis by p53 through canonical and noncanonical pathways is context-dependent. Many details of the mechanisms still need to be clarified. Further translational research will help to elucidate these mechanisms and master regulation of ferroptosis by p53 to tackle tumors and other diseases."}
+{"text": "Prostate cancer is a major disease that threatens men\u2019s health. Its rapid progression, easy metastasis, and late castration resistance have brought obstacles to treatment. It is necessary to find new effective anticancer methods. Ferroptosis is a novel iron-dependent programmed cell death that plays a role in various cancers. Understanding how ferroptosis is regulated in prostate cancer will help us to use it as a new way to kill cancer cells. In this review, we summarize the regulation and role of ferroptosis in prostate cancer and the relationship with AR from the perspective of metabolism and molecular pathways. We also discuss the feasibility of ferroptosis in prostate cancer treatment and describe current limitations and prospects, providing a reference for future research and clinical application of ferroptosis. Prostate cancer is second only to lung cancer in male incidence.There is no effective treatment for distant metastasis and castration resistance of advanced prostate cancer.The role of ferroptosis in prostate cancer has been verified, but there is a lack of summary at the metabolic level and the relationship between ferroptosis and AR.Could the interaction of ferroptosis and AR be the key to block the progression of prostate cancer with ferroptosis combination therapy?Can ferroptosis-related genes be used as specific biomarkers to judge the prognosis and immunotherapy sensitivity of prostate cancer?Is it possible to establish an individualized plan for phased ferroptosis combined therapy according to the patient\u2019s metabolic level and tumor stage?Prostate cancer (PCa) is the main disease that threatens the health of male urinary system . PCa usuThe concept of iron death was first proposed in 2012 . SubsequUnlike apoptosis, autophagy and necrosis, ferroptosis regulates cell death through iron-associated lipid peroxidation. Interestingly, the process of ferroptosis is unique among other forms of cell death in that it can occur in a wave-like pattern from one cell to another . Cells uTransferrin-mediated and lactoferrin-mediated iron uptake pathways are the main pathways for cells to take up iron, after binding to iron, the two proteins enter cells through corresponding receptor/non-receptor pathways . In PCa,Cellular iron export depends on ferroportin (FPN), as the only exporter of cellular iron identified so far, FPN is downregulated in PCa . ThroughIron regulatory proteins (IRPs) are important regulators of cellular iron metabolism, whose activity is affected by iron levels . IRPs ar-, which can absorb cystine into cells and excrete glutamate 1:1 [- consists of 2 subunits, solute carrier family 3 member 2  and solute carrier family 7 member 11 . SLC7A11 is a transmembrane protein, mainly involved in the antiport of cystine/glutamate on the plasma membrane, while SLC3A2 mainly acts as a chaperone to stabilize SLC7A11 and help protein complex localize to the membrane [Glutathione (GSH) is a major antioxidant produced by the liver and consists of steine, glutamate, and glycine. As the preferred substrate of gpx4, depletion of GSH will reduces GPX4 activity and accelerates ferroptosis . Cancer mate 1:1 . The cysmate 1:1 . The sysmembrane , 31.The expression of SLC7A11 in PCa is increased compared with normal, which may be a strategy to combat ferroptosis . The effThe antioxidant enzyme GPX4, a selenocysteine-containing enzyme that blocks iron-mediated peroxidation by eliminating lipid peroxides (LPO) and thus protects cell membranes from damage. The excessive expression of GPX4 can inhibit RSL3-induced iron death, and absence of GPX4 will reduce the resistence to ferroptosis . ChaC glThe extensive physiological functions of GSH make it a factor that cannot be ignored in the occurrence and development of PCa. GSH depletion is inevitable during aging and commonly occurs in tissues and blood of aging organisms, which also increases damage associated with oxidative stress. Due to the inhibitory role of GSH in carcinogenesis, GSH depletion may in part contribute to increased cancer risk , 60. A mPhospholipids containing PUFAs in cell membranes are highly sensitive to lipid peroxidation, which is critical for ferroptosis . TherefoLipoxygenase, a non-heme iron- or manganese-containing oxygenase with the ability to oxidize polyunsaturated fatty acids and their derivatives in cell membranes, plays a key role in ferroptosis . In PCa,The imbalance of the antioxidant system will cause the oxidation of PUFA and the accumulation of LPO, which will trigger a series of pathological or physiological changes. To detect this process, lipid peroxidation is usually labeled with specific electrophilic reactive aldehydes (end products of PUFA oxidation) such as malondialdehyde, 4-hydroxyhexenal, and 4-hydroxynonenal . CompariTo meet the needs of growth and development, tumor cells undergo a series of metabolic shifts, but unlike other tumors, PCa cells tend to enhance oxidative phosphorylation rather than glycolysis at an early stage . This meNeuroendocrine prostate cancer (NEPC) is a deadly subtype of prostate cancer that is often seen in CRPC therapy and presents enormous difficulties for treatment . Unlike 3+ to Fe2+ through its ferroreductase activity while depleting available NADPH. Increased Fe2+ and decreased NADPH lead to increased intracellular ROS levels [- by regulating its downstream target gene SLC3A2, and further regulate amino acid transport [The androgen receptor (AR), as a steroid hormone receptor, can activate the transcription of androgen target cells in a ligand-dependent manner, and is an important driving factor for the progression of prostate cancer. In recent years, the regulatory relationship of AR in ferroptosis has been gradually discovered Fig. . In ironS levels . In lipiS levels . An impoS levels . In GSH S levels . In addiransport .Fig. 2ThThe relationship between AR and ferroptosis is reciprocal, AR is also affected by some of these factors while regulating ferroptosis. Selenite can downregulate AR expression by depleting GSH, and it can be reversed by adding GSH, which illustrated the positive regulatory relationship of GSH to AR . PUFAs c-, respectively, which were opposite under high-concentration BCAA conditions [Similar to glutamine, the metabolism of branched-chain amino acids (BCAAs) can also affect ferroptosis. High concentration of BCAA can promote ROS generation and damage mitochondrial function through Akt-mTOR pathway . The BCAnditions , 114. Innditions . The regnditions .10, which has antioxidant properties [10 is more obvious in non-malignant cells [Ferroptosis inhibitory protein 1 (FSP1), as a glutathione-independent anti-ferroptosis factor, can catalyze the production of coenzyme Qoperties . At presnt cells . For theCompared with primary PCa, the level of oxidative damage in PCa bone metastases cells is elevated, suggesting that the latter is responsible for higher oxidative stress . InteresThe bone microenvironment acts as an important mediator in the process of PCa cell metastasis to bone, which can affect the transition between the dormant and proliferative states of cancer cells . High frThe appropriate iron level can maintain the stability of the bone environment, and excessive or insufficient iron content will disrupt the balance of bone turnover by affecting the differentiation of osteoblasts and osteoclasts . STAMP2,Given its role in the prostate, ferroptosis is a promising strategy for treating PCa. In recent years, people have discovered many different mechanisms of ferroptosis inducers, and confirmed the inhibitory effect of ferroptosis inducers in PCa Table  134\u2013145145.TableEnzalutamide and abiraterone, the second-generation AR antagonists, are commonly used drugs in the treatment of advanced PCa. Recent studies found that the combination of enzalutamide or abiraterone with erastin and RSL3 was more effective in suppressing PCa tumors than when they were used alone. Mechanistically, enzalutamide can reduce the expression of heat shock proteins (HSP) to reduce the resistance to ferroptosis, thereby synergizing with ferroptosis inducers to exert curative effect . On the Besides these common inducers of ferroptosis, some novel factors have also been shown to induce ferroptosis. The antimalarial drug flubendazole was recently found to inhibit SLC7A11 transcription by activating p53 expression to further down-regulate GPX4 levels and induce ferroptotic cell death in PCa cells . AndrogeIn nature, specific components in some herbal remedies have also been shown to affect ferroptosis. Artesunate (artemisinin derivative) , diallylFerroptosis can be affected by externally adding ferroptosis-related metabolic substrates. The addition of iron and docosahexaenoic acid (DHA) can induce ferroptosis in PCa cells by affecting the balance of cellular iron metabolism and lipid metabolism, respectively , 154. MoIn the process of drug treatment, PCa cells may undergo neuroendocrine transdifferentiation and thus acquire drug resistance. Along with cell differentiation, the activity of polyunsaturated lipid synthases is also upregulated, which provide conditions for lipid peroxidation. This alteration in lipid metabolism makes drug-resistant cancer cells more dependent on GPX4 and more prone to ferroptosis . Taking In addition to inducing ferroptosis, ferroptosis inducers also have an effect on drug resistance. RSL3 can induce ferroptosis by inactivating GPX4, and studies have found that RSL3 can also induce glycolytic dysfunction in PCa cells by reducing ATP and pyruvate content and protein levels of PKM2, PFKP, and HKII, which can be rescued by supplement of exterior sodium. More importantly, this effect of RSL3 on cellular glycolysis can enhance the sensitivity of PCa to cisplatin, and in vivo studies, combined treatment of low-dose RSL3 and cisplatin significantly reduces PCa expansion with no significant adverse effects . In DX-rIn PCa cells, some components can act as a \u201cbridge\u201d between ferroptosis and drug resistance and function in both. CHAC1 promotes ferroptosis by upregulating LPO levels and downregulating GPX4 levels. The addition of docetaxel (DTX) along with plasmid overexpression of CHAC1 significantly reduced cancer cell viability, whereas docetaxel alone had a negligible effect . DocetaxWang et al. , Liu et The important role of ferroptosis in PCa has been proved by more and more studies. However, there are still some issues that need to be clarified before ferroptosis therapy can be introduced into the clinic. First, the key mechanisms of ferroptosis in PCa need to be revealed. In recent years, the mechanism of ferroptosis has been broadly understood but lacks validation in PCa. For example, mitochondria, as energy powerhouses in eukaryotic cells, powering the initiation of ferroptosis, but there is a lack of related experiments in PCa, which casts a veil on the mechanism of ferroptosis. Second, there is a lack of reliable FRG as biomarkers. Although studies have found that FRG levels can reflect the prognosis of prostate cancer and the sensitivity of immunotherapy to a certain extent, the expression of these genes may be affected by the relevant metabolic levels of the individual, leading to misjudgment of the disease, so specific ferroptosis-specific biomarkers are crucial for clinical application of ferroptosis. Finally, is it possible to design an individualized protocol for the clinical application of ferroptosis? Metabolism related to ferroptosis will be affected by individual factors such as age, gender, diet, and genetic differences. At the same time, in different stages of PCa progression, tumor metabolism levels are also different, which will affect the efficacy of ferroptosis therapy. Therefore, the diagnosis and treatment plan for clinical application of ferroptosis must be individualized and phased, and the combination of related drugs also needs to be selected according to the patient\u2019s condition.The correlation between iron and prostate cancer was first proposed nearly 40 years ago, and then the emergence of the concept of ferroptosis successfully revealed the mechanism behind this relationship, provided a new idea and perspective for cancer research, and also brought a glimmer of hope for clinical cancer treatment. In this article, we summarize the regulation of ferroptosis in PCa at the metabolic level, and analyze the application prospects and limitations of ferroptosis therapy in the treatment of PCa, providing a reference for future research and clinical application of ferroptosis.Screenshot from email of all authors agreeing to change co-author"}
+{"text": "Cardiovascular diseases (CVDs), encompassing ischaemic heart disease, cardiomyopathy, and heart failure, among others, are the most prevalent complications of diabetes and the leading cause of mortality in patients with diabetes. Cell death modalities, including apoptosis, necroptosis, and pyroptosis, have been demonstrated to be involved in the pathogenesis of CVDs. As research progresses, accumulating evidence also suggests the involvement of ferroptosis, a novel form of cell death, in the pathogenesis of CVDs. Ferroptosis, characterised by iron-dependent lipid peroxidation, which culminates in membrane rupture, may present new therapeutic targets for diabetes-related cardiovascular complications. Current treatments for CVDs, such as antihypertensive, anticoagulant, lipid-lowering, and plaque-stabilising drugs, may cause severe side effects with long-term use. Traditional Chinese medicine, with its broad range of activities and minimal side effects, is widely used in China. Numerous studies have shown that active components of Chinese medicine, such as alkaloids, polyphenols, and saponins, can prevent CVDs by regulating ferroptosis. This review summarises the recent findings on the regulatory mechanisms of active components of Chinese medicine against ferroptosis in CVDs, aiming to provide new directions and a scientific basis for targeting ferroptosis for the prevention and treatment of diabetic CVDs. Over the past 3\u00a0decades, the number of individuals with diabetes has quadrupled, with approximately 1 in 11 adults currently affected. According to estimates by the International Diabetes Federation, the number of individuals with diabetes is projected to rise to 642 million by 2040, with over 90% of cases to be type 2 diabetes mellitus (T2DM) . DiabeteCell death is a fundamental biological process, crucial in all aspects of embryonic development, growth, and aging . VariousTherefore, studying the mechanism of ferroptosis may allow finding new targets for the treatment of CVDs. Currently, antihypertensive, anticoagulant, lipid-lowering, and plaque-stabilising drugs are commonly used in the clinical treatment of CVDs . However\u2022OH) and reactive oxygen species (ROS) and to the oxidation of polyunsaturated fatty acid (PUFA)-containing phospholipids (PUFA-PLs)  . This prUFA-PLs) . The speIron is one of the essential trace elements in the human body. The ability of iron to provide or accept electrons in the intra- and extracellular environments makes it highly reactive and toxic . The maiFth1 gene in mouse cardiomyocytes increases ROS accumulation, thereby increasing the sensitivity to ferroptosis  , the onlval time .TFR1 mRNA and DMT1 mRNA, stabilising transcription and enhancing translation. Conversely, IRP1 or IRP2 binds to the IREs in the 5\u2032UTRs of FTH1 mRNA and FPN1 mRNA, inhibiting translation. When cellular iron is sufficient, IRP1 assembles a cubane Fe\u2013S cluster, preventing its binding to IREs, while IRP2 is degraded, thereby inhibiting iron accumulation (The iron-responsive element/iron regulatory protein (IRE/IRP) regulatory system regulates iron homeostasis at the transcriptional level. When cells are iron deficient, IRP1 or IRP2 binds to the IREs in the 3\u2032untranslated regions (UTRs) of mulation . Researcmulation .2+, and biliverdin; HO-1 expression is regulated by nuclear factor-erythroid 2-related factor 2 (NRF2)  . However2 (NRF2) . Furtheroduction .bis-allylic position of PUFAs, they are susceptible to peroxidation  is capable of catalysing the binding of PUFAs (particularly arachidonic and adrenic acids) to CoA to generate PUFA-CoAs. Subsequently, lysophosphatidylcholine acyltransferase 3 (LPCAT3) incorporates them into PLs, forming PUFA-PLs (primarily arachidonic acid-phosphatidylethanolamines and adrenic acid-phosphatidylethanolamines) . ACSL4 ay injury , while iy injury .\u2022OH, and unlike strictly controlled enzymatic reactions, they are poorly controlled and prone to chain reactions (PUFA-PLs form hydroperoxides (PUFA-PL-OOHs) through nonenzymatic or enzymatic oxidation reactions . Nonenzyeactions . Lipoxygeactions . Knockineactions . As the The glutathione (GSH) peroxidase 4 (GPX4)-mediated GSH metabolic pathway is a crucial defence mechanism against ferroptosis . GPX4 cac\u2013) (c\u2013belongs to the heterodimeric amino acid transporter (HAT) family and is composed of the light chain subunit SLC7A11  and the heavy chain subunit SLC3A2   can maintain GSH levels . Depletic\u2013) . System s 4F2HC) . SLC7A11s 4F2HC) . Extraceynthesis . SLC7A11ynthesis . p53, a ynthesis . NRF2 caynthesis . Additioroptosis .10  into CoQ10H2 . As a lipophilic antioxidant, CoQ10H2 can prevent lipid peroxidation and inhibit ferroptosis  can convert CoQroptosis . Similarroptosis . GTP cycroptosis . These p2+ triggers the Fenton reaction, resulting in the production of large amounts of ROS. Owing to the weak antioxidant capacity of pancreatic \u03b2 cells and low expression and activity of superoxide dismutase (SOD) and GPX4, these cells are susceptible to oxidative stress-induced damage , myocardial infarction (MI), myocardial I/R injury, cardiomyopathy, and HF . The speInvestigating the role of ferroptosis in CVDs may reveal novel therapeutic targets.2+ under the action of HO-1. Iron overload and ferroptosis in macrophages accelerate AS progression , and erastin can exacerbate ERS by inducing ferroptosis. Conversely, inhibiting ERS can alleviate ferroptosis and myocardial injury  is a severe complication of diabetes, unrelated to hypertension and coronary artery disease . Long-teHF is a severe cardiac disease due to myocardial injury, wherein the cardiac output cannot meet the needs of the body, and HF is the final stage of various CVDs . There iDespite significant progress in the basic research of ferroptosis, the path to clinical applications has not been straightforward . CurrentThe lack of specific biomarkers for ferroptosis has been a major limiting factor in the development of this field . Currentc\u2013inhibitors, and GPX4 inhibitors, which are mostly used in the treatment of tumours and neurological diseases  P. K. Hsiao, B. chinensis DC., and Anemarrhena asphodeloides Bunge. Saponins possess various biological activities, including anti-inflammatory, antiviral, immunomodulatory, cardiovascular protective, and anticancer effects . Astragaloside IV activates the NRF2 signalling pathway, thereby increasing GPX4 expression, and reduces the expression of the positive regulator of ferroptosis NOX, thereby inhibiting Adriamycin-induced myocardial ferroptosis (Bupleurum chinensis, increases GSH levels and SOD activity, reduces MDA levels, upregulates GPX4 expression, downregulates ACSL4 expression, and inhibits ferroptosis in a concentration-dependent manner, thus showing promise as a novel option for AS prevention and treatment (Saponins are a class of natural glycosides that are divided into triterpenoid and steroid saponins and are widely found in TCMs such as  effects . Ginsenoroptosis . Ophioporoptosis . Saikosareatment . Aralosireatment .2O2-induced oxidative damage, tanshinone IIA protects cardiomyocytes by activating the NRF2/HO-1 signalling pathway, enhancing GSH-Px activity, and reducing MDA activity (Gardenia jasminoides J. Ellis (Tanshinone IIA, a natural diterpene quinone compound, exhibits various biological activities, including anti-atherosclerosis effects, and alleviates angina and MI . In a raactivity . Tanshinactivity . GeniposJ. Ellis , alleviaJ. Ellis . ThymoquJ. Ellis , activatJ. Ellis .Although CVDs are multifactorial and complex diseases involving multiple mechanisms, diabetes is a major risk factor. Increasing evidence suggests that ferroptosis plays an important role in diabetes and its cardiovascular complications , thus pr10H2, DHODH/CoQ10H2, and GCH1/BH4 systems. These genes could potentially serve as therapeutic targets for diabetic CVDs. Despite certain advancements in the study of ferroptosis mechanisms, challenges remain; in particular, specific biomarkers are currently lacking for ferroptosis, and many studies assess ferroptosis based on Fe2+ levels, ROS accumulation, and GPX4 expression. However, there are other forms of iron-dependent cell death that are distinct from ferroptosis, and ROS accumulation also occurs in oxidative stress. Therefore, finding specific biomarkers for ferroptosis is of great value. Furthermore, diabetic CVDs involve various mechanisms, including inflammation, oxidative stress, necrosis, apoptosis, pyroptosis, and ferroptosis. Identifying which mechanism dominates the development of disease and finding how to combine medications are problems that need to be solved in the future. Lastly, various organelles and proteins participate in the regulation of ferroptosis, increasing the difficulty of selecting targets for inhibiting ferroptosis. Different diseases have different therapeutic targets. Promoting ferroptosis in tumour cells helps inhibit and kill tumours, but normal cells, such as cardiomyocytes, pancreatic \u03b2-cells, and neurons, are also sensitive to ferroptosis. Determining how to selectively regulate ferroptosis is a major issue that requires extensive future research.In this review, we summarised the prerequisites for driving ferroptosis, including iron overload, ROS generation, and lipid peroxidation, as well as the defence mechanisms against ferroptosis, including the GPX4/GSH, FSP1/CoQTCM has a long history of treating CVDs and has achieved a significant efficacy. The active ingredients of TCMs have various biological functions, and the discovery and continuous exploration of ferroptosis mechanisms provide a new theoretical basis for the treatment of CVDs with TCMs. Research findings on the treatment of CVDs through ferroptosis-related mechanisms by active ingredients of TCMs, such as alkaloids, polyphenols, and saponins, are summarised in In conclusion, ferroptosis participates in the development of diabetes and CVDs, and a large amount of evidence shows that targeting ferroptosis in the treatment of CVDs by active ingredients of TCMs has certain advantages. In the future, it is necessary to continue research to improve the understanding of the signalling pathways and mechanisms related to ferroptosis, to provide new directions for the development of ferroptosis inhibitors, and thus provide new strategies for the treatment of diabetic CVDs."}
+{"text": "The majority of organisms detected were skin-flora-type, low pathogenicity organisms, including coagulase-negative staphylococci and Cutibacterium acnes, with little change in the frequency of clinically significant organisms identified over time. Both protocols prevented the issue of potentially harmful components contaminated (rarely) with a range of pathogenic bacteria, including Escherichia coli, Serratia marcesens, Staphylococcus aureus, and streptococci. Culture positivity of outdates post-LVDS whereby 100% of expired platelets are retested provides a residual risk estimate of 0.06% (95% CI 0.016\u20130.150). However, bacterial contamination rates in expired platelets did not demonstrate a statistically significant difference between the pre-LVDS 0.100% (CI 0.033\u20130.234) and post-LVDS 0.059% (0.016\u20130.150) periods .Bacterial contamination of platelet components (PC) poses the greatest microbial risk to recipients, as bacteria can multiply over the course of PC storage at room temperature. Between 2010 and 2020, the Irish Blood Transfusion Service (IBTS) screened over 170,000 buffy coat-derived pooled (BCDP) and single-donor apheresis platelets (SDAPs) with the BACT/ALERT 3D microbial detection system , using a two-step screening protocol which incorporated primary and secondary cultures. Although the protocol was successful in averting septic transfusion reactions (STRs), testing large sample volumes at later time points was reported to improve detection of bacterial contamination. A modified large-volume delayed sampling (LVDS)-type protocol was adopted in 2020, which in the case of SDAP was applied to collections rather than individual splits . Rates of bacterial contamination for BCDP were 0.125% on Day-2, 0.043% on Day-4 vs. 0.191% in the post-LVDS period. SDAP contamination rates in the pre-LVDS period were 0.065% on Day-1, 0.017% on Day-4 vs. 0.072% in the post-LVDS period. Confirmed STRs were absent, and the interdiction rate for possibly contaminated SDAP was over 70%. In the post-LVDS period, BCDPs had a higher total positivity rate than SDAPs, 0.191% (1:525) versus 0.072% (1:1385), respectively, (chi-squared 12.124, 1 df,  The eYersinia infections in recipients, a relatively frequent and sometimes fatal transfusion transmitted bacterial infection (TTBI) in the 1980s and 1990s [Further improvements in bacterial safety involved the use of plastic polymer sterile collection packs, closed systems, accessed if required with the use of sterile connection devices. In addition, changes to donor selection criteria regarding recent gastrointestinal illness contributed to a reduction in nd 1990s .As unlike viruses, most bacteria can multiply over the course of the room-temperature-stored platelet concentrates\u2019 shelf life, storage time limitations varying from 72 h to 7 days is perhaps the most variable and debated safety measure . Many seSkin-surface derived Gram-positive organisms comprise the most frequently implicated group of bacteria in platelet contamination. Unlike blood-borne viruses (BBVs), these microorganisms are part of the skin microbiome of blood donors worldwide; providing a protective barrier against colonisation of other agents, but harmful when transfused in a large volume or high concentration to vulnerable recipients. Improved skin disinfection protocols, emphasizing \u2018no retouch\u2019 techniques and importantly the diversion of the initial blood volume obtained from the donor were popularised in the 2000s and offered at least a 70% reduction in contamination levels [However, bacteria still enter blood and platelet collection bags at rates of 1/1000\u20132500, well in excess of transfusion relevant viruses. This can come as a surprise as the procedures for blood-donor skin disinfection were informed by those used for \u2018invasive\u2019 healthcare-associated procedures requiring an aseptic environment. Gram-negative contaminations, which can cause the rapid demise of a recipient, are not averted by skin cleansing. Indeed the introduction of primary culture in the late 1990s and 2000s was key to reducing the risk of fatal STRs .Acinetobacter spp., Staphylococcus saprophyticus, and Leclercia adecarboxylata with a probable common source. This cluster of cases has been a cause of concern, as bacterial risk-reduction measures were applied in the majority of cases [Since 2018, seven platelet STRs, some of which were fatal, have been reported in the United States, involving closely related isolates of of cases ,10,11,12From the mid-2000s onwards and by 2009 the IBTS had introduced risk-reduction measures targeting platelet bacterial contamination with bacterial culture, volume diversion, and improved skin disinfection. Pressure remains on blood services to evaluate new strategies to mitigate bacterial risk for platelet components (PCs), with many opting for large-volume delayed sampling (LVDS) protocols to enhance bacterial detection. The subject of this report is the description of our findings from 10 years of a primary and secondary culture protocol (2010\u20132020) followed by almost 3 years of an LVDS-type screening protocol.The IBTS produces buffy coat-derived platelet pools (BCDP) and single-donor apheresis platelets (SDAP).\u00ae PL System for Platelet Pool preparation , after an overnight hold of the whole blood unit at 22 \u00b0C. Four buffy coats from individual donors are pooled with approximately 25 mL of plasma from each donor, and resuspended in approximately 70% Platelet Additive Solution .Platelet pools are prepared using the TACSI\u00ae Automated Blood Collection System  and suspended in 100% plasma. Approximately 77.5% of SDAP collections yield triple doses (TDs), 17.4% are double doses (DDs) and 5.1% yield a single dose (SD) of platelets. The proportion of all platelets collected by apheresis is approximately 60\u201370%; prior to 2019, the ratio of SDAP to BCDP was 80:20. All platelets are leucodepleted as part of the manufacturing process. (See SDAP are collected using Trima Acceless. See .In the manufacture (\u226536 h from phlebotomy). By the end of 2005, secondary culture was performed on Day-4, which allowed extension of expiry to Day-7; this involved individual sampling of SDAP splits. Sample volume was 16 mL in total, BPA and BPN bottles each being inoculated with 8 mL of platelet product, as previously described [In late 2004, the IBTS commenced screening of all platelet products for the presence of bacteria using the BACT/ALERT 3D Blood Culture System   SDAP colescribed . Once inIn late 2020, the IBTS adopted a modified * large-volume delayed sampling (LVDS) single-test protocol for all platelet components. The sample for bacterial screening, obtained on Day-2, must be delayed until \u226536 h post-phlebotomy for both BCDP and SDAP. An 8 mL sample is inoculated into each of a BPA and BPN bottle from the BCDP or the \u2018mother-bag\u2019 , rather than the individual splits of SDAP ,15. A 12As described by Murphy et al., expired units are retested with a 10 mL sample inoculated into an aerobic and anaerobic bottle on BACT/ALERT 3D and incubated for 7 days . PositivPositive flags on the BACT/ALERT 3D instrument trigger an alarm on our environmental monitoring system ; this is achieved through a voltage change at the monitoring probe. IBTS scientists are then alerted by telephone in relation to the positive flag (24/7/365). The positive BACT/ALERT 3D bottles are removed and referred to the medical microbiology laboratory of a large teaching hospital on the shared campus of our blood centre in Dublin. Bottles are subcultured by the IBTS onto Columbia Blood and Chocolate Blood agar under aerobic and anaerobic conditions (30\u201335 \u00b0C) and read after a minimum of 48 h. A Gram stain is either performed by scientists in the IBTS or, alternatively, a Gram stain is requested of and then reported by the reference laboratory \u2018urgently\u2018, if the PC or co-components have already been infused. Full identification of cultured isolates is performed using MALDI-TOF methodology ; an antimicrobial sensitivity profile is provided when required.Product recall is initiated immediately for all relevant products, which in the case of a platelet pool, includes four associated red cells and plasma components . All recalled products are investigated in the same manner as the primary culture. Medical teams are informed of the initial Gram stain and final culture result of contaminated components; we record the status of the recipient and their outcome.Recalled platelets are examined for signs of discolouration, aggregates, and leaks prior to testing. A 10 mL sample is inoculated into both BPA and BPN bottles and incubated for 7 days. The platelet/blood packs are then incubated at 32\u201335 \u00b0C for 3 days and tested again for an additional 7 days.Classification of Positivity is dependent on ability to confirm the presence of bacteria in associated products ,13.Confirmed Positive refers to a positive signal on BACT/ALERT 3D, a positive subculture from the BACT/ALERT bottle, and a further culture of the same species from the platelet unit, or, for pools, from the pool or from one other component from the donations used in the pool.False Positive refers to a positive signal on BACT/ALERT 3D, but no organism detected on subculture or Gram stain of the associated bottles, or on reculture of the unit.: positive subculture from the initial BACT/ALERT bottle but not confirmed on subsequent reculture of remaining components, irrespective of the proportion of the associated components available for testing ; or no residual components were available for retesting. * Please note these cases are not considered false positive by our definitions.Indeterminate Positive : positiThe primary culture obtained from SDAP and BCDP are reported under \u2019Day-1 or -2 testing\u2018 (day of donation being Day-0). A proportion of SDAP and BCDP underwent a second test approximately 4 days post-donation and are referred to here as Day-4 testing. The platelets screened from 2010 to 5 November 2020 are referred to as \u2018pre-LVDS\u2019 and the platelets screened from 6 November 2020 to June 2023 are referred to as \u2018post-LVDS\u2019.tests conducted on platelets, 178 flagged with positive cultures . SDAP had lower rates of false positives on both Day-1 (0.086% (1:1163)) and Day-4 (0.032% (1:3083)) compared to BCDP samples, which generated false positive rates of 0.104% (1:966) and 0.048% (1:2095) on Day-1 and Day-4, respectively.p = 0.0005) Only three samples (0.007%) were categorised as false positive post-LVDS. These false flags were generated from SDAPs 0.013% (1:7846).The positivity rate for all platelets in the post-LVDS period was 0.128%, with 0.090% (1:1116) confirmed and 0.038% (1:2626) indeterminate see . BCDPs hCutibacterium acnes (previously Propionibacterium acnes) was isolated in 54% (n = 55) and coagulase-negative staphylococci (CNS) in 27% (n = 27) of confirmed investigations. The indeterminate category yielded a similar profile, with Cutibacterium spp. and CNS being identified in 33% (n = 26) and 35% (n = 27) of positive cultures, respectively (Staphylococcus aureus was isolated in five (5%) confirmed cases but evaded the screening test twice thus indicating a false negative test. The units were recalled for reculture based on abnormalities observed on visual inspection. Gram-negative organisms were identified in only two (2%) confirmed  and three (4%) indeterminate cases in a 10-year period (pre-LVDS). The organisms isolated in the indeterminate cases were likely to be contaminants  as they failed to culture from the resampled residual components.Pre-LVDS, 101 organisms were identified in confirmed investigations out of 287,698 platelets tested on Day-1, -2, -4 see . Of the ectively . StaphylIn the 10-years pre-LVDS, there were 91 positive cultures derived from BCDP samples. Of these, 47% were associated with a component infused prior to recall. In 41%, the pool alone was infused, in 2% the red cell was also infused, and in 4% the red cell only was infused. In 87 positive SDAPs, 43% were infused. In 28%, all splits were infused and in 15% an associated split had been infused at the time of recall see . For 42 Cutibacterium acnes accounted for 56% (n = 24) and 61% (n = 11) of the organisms found in confirmed and indeterminate cases, respectively. Coagulase-negative staphylococci were found in 28% of both confirmed (n = 12) and indeterminate (n = 5) cases. Nearly all CNS organisms flagged within the first 10 h of monitoring on the BACT/ALERT 3D except for Staphylococcus saccharolyticus, which had a mean TTD of approximately 50 h.In the three years since the change to an LVDS type protocol and 12 h hold, we recorded 43 confirmed and 18 indeterminate positives out of 51,451 platelets tested on Day-2 or at outdate see . This inC. acnes accounted for 93%  and 82% , respectively. C. acnes is also the organism that had the longest time to detection, 100 h on average. S. aureus was isolated in four of the confirmed cases (none infused), one of those, an expired SDAP, was missed on the first test. Further information on S. aureus contamination of PC can be found in the data reported in Of the 61 confirmed and indeterminate (43 and 18) positive detections for which 25 (41%) were already infused, only was infused. Of the 17 positive apheresis platelets, 24% were infused. In 18% all splits had been infused and 6% had an associated split infused prior to recall . Whilst the majority of organisms in SDAP continued to be isolated from BPN bottles post-LVDS, there was a notable decrease from 76% to 55% in the proportion of anaerobic bottle detections. This change was coupled with an increase in the rate of positive detections observed in both bottles, and the aerobic bottle alone  see . In contCombined positivity rates for BCDP and SDAP range between 0.06% and 0.26% for BCDP (average 0.15%) and 0.01% and 0.12% for SDAP (average 0.07%). See . Rates ap = 0.604487) (see Clostridium perfringens). In the other cases, at least one split was already infused, but the other available split(s) was retested and negative (Corynebacterium spp. \u00d72). For BCDP, there was one confirmed S. epidermidis contamination at expiry, cultured from plasma and four RCCs, and one indeterminate positive, a probable contaminant with Bacillus spp. where all available material tested negative on reculture . The overall positivity rate was 0.100% (CI 0.033\u20130.234), representing n = 5 positives. The SDAP rate of 0.085%  was not significantly different to the BCDP rate of 0.136% ;  see . One outture see , Table 3Cutibacterium spp. \u00d71, S. aureus \u00d71; one in BCDP Cutibacterium sp.)) and one indeterminate positive in SDAP with Cutibacterium sp. (where the remaining components tested negative)  and post-LVDS 0.059% (0.016\u20130.150) periods . Further information on expired platelets and false negatives is contained in Since the transition to LVDS in November 2020, 100% of platelets are screened upon expiry (Day-8) to establish the rate of false negative results. Four positive cultures (0.059%) were obtained from screening a total of 6809 expired platelets   see . In addiAccording to the European Commission, between 2010 and 2016, 1% of notifications of serious adverse reactions in recipients concerned transfusion-transmitted infections (TTIs); 63% of these infections were caused by bacterial contamination .As in many other countries, Ireland\u2019s commitment to blood safety is evidenced in IBTS modelling calculations, which estimate a residual risk for BBV of less than 1 in 5 million donations. In contrast to virus-related risk, the continuous and incremental improvements in bacterial safety described earlier, have not led to as dramatic a reduction in the rate of bacterially contaminated PC. This is a gap that blood operators globally have a challenge in narrowing, even with screening-independent methods like pathogen-reduction technology ,19.Serratia marcesens-contaminated BCDP after 6 h of incubation prompted the evaluation and ultimately implementation of a single test, LVDS-type strategy and a 12 h quarantine/minimum incubation period. These two measures involved significant operational and logistical challenges for the organisation. The marked 90% reduction in STRs, achieved by the NHSBT with an LVDS approach, provided compelling evidence in support of change [A review of local and international data and bacterial mitigation procedures in 2018 and 2019 highlighted the limitations of an early sampling protocol and therefore an opportunity to reduce the potential for false-negative \u2018early\u2019 bacterial screens was identified ,20,21. Ef change . Equallyf change . Additiof change .S. aureus \u00d71 (interdicted), one microaerophillic Streptococcus (infused)). Sepsis did not occur with un-intercepted, confirmed (or indeterminate) secondary culture positive BCDP components, which yielded skin-flora-type organisms in the majority (see S. aureus and Group C Streptococcus*. BCDPs yielded \u2018significant\u2019 pathogens more frequently than SDAP (14 vs. 10) despite being the minority component. This is a reminder that the contribution of four \u2018donor BC\u2019 to each pool leads to a greater likelihood of contamination , which at the time was conducted on approximately 30% of residual BCDP inventory. Analysis of the available data for the risk assessment of changing to a single-test protocol demonstrated the combined rate at which bacteria were identified from the primary and secondary screen of pooled platelets for the 10-year period  was >0.10% see . The valrity see . The secrity see . Crucialtion see . A modelS. epidermidis) and one indeterminate/contaminant (Bacillus spp.) from 1468 expired pooled platelets tested (0.136%) over ten years, represented a crude estimate of the residual risk for the period prior to LVDS. As only a very small proportion of the outdates underwent screening, it was hypothesised that the combination of LVDS plus 12 h quarantine would result in a greater proportion of contaminants being identified and intercepted during live testing, thus yielding a safer product overall. There was also a clear opportunity for enhanced and more accurate microbiological surveillance by screening 100% of outdates with the new protocol.Two positive culture results, one confirmed (p < 0.00001). The latter was influenced by the contribution of four donors per pool, and the application of a more sensitive (later) test. Approximately 36% of SDAP components underwent a second Day-4 test to allow for expiry at Day-7. Significant isolates confirmed by the Day-4 test included S. aureus and a Streptococcus infantarius; the latter, arguably more of an issue for the donor than for a recipient, even if it had been infused. The vast majority of secondary cultures yielded low pathogenicity organisms.For apheresis platelets, as one might expect, the combined positivity rates from either Day-1 (rate = 1:1535) or Day-4 (rate = 1:5962) testing were lower than that of BCDP  . C. perfringens has been implicated as a transfusion-relevant organism with fatal outcomes, which can affect more than one patient even from a single donation [The expired SDAP cultures also uncovered mostly low pathogenicity skin-flora-type organisms with the exception of one case of donation ,25.Low concentrations of bacteria obtained in the primary sample of SDAP collections taken as early as 12 h post-phlebotomy may explain the relatively low rate of culture positives in single-donor platelets (0.065%). The rate remained low even with the second Day-4 test at 0.017% (which must be interpreted with knowledge that the denominator represents tests rather than donations), whilst rising to 0.085% at expiry. The expired rate was derived from a very small sample of under 4000 tests over 10 years  but is indicative of missed contaminations in live testing. The newly employed (delayed) sample was expected to yield rates closer to a combination of the primary and secondary culture positive rate of the pre-2020 period. The SDAP contamination rates for 2021, 2022, and 2023 (until June) ranged between 0.01% and 0.124%. The CBS and NHSBT reported lower SDAP contamination rates than the IBTS with a \u20187-day expiry\u2014single-test\u2019 strategy , despite collecting a higher proportional sample volume ,15. Thispan-contaminated\u2019. Of note, if the indeterminate cases where more than one split was available for testing are taken into account , the rate of pan-contamination reduces to 49% (31/63). Kamel et al. demonstrated a minimal proportionalmother-bag sample volume of 3.8%, distributed across two bottles and obtained at 24\u201336 h, enhanced detection and interdiction of contaminated Day-5 SDAP. Therefore, it could be argued that an individual sample may not be absolutely necessary [A notable weakness in the IBTS protocol is that the delayed sample is obtained from the \u2018mother bag\u2019 of the original collection, rather than each individual split, as described by McDonald et al. ,26. Prevecessary ,28. In aecessary . ObtainiStaphylococcus spp. and some of the S. aureus cases already mentioned.In the consideration of added value and safety, it was estimated the 12 h hold  would facilitate the interdiction of the majority of significant contamination events, particularly those with fast- to moderately fast-growing organisms. Exceptions concerning the former would include Streptococcus dysgalactiae, which flagged at 9.36 h from a BCDP that was already infused, could have been avoided with a 12 h hold. Further discussion on this and other S. dysgalactiae cases can be found in Listeria monoctyogenes prior to issue from an asymptomatic donor, which did not flag until 18 h post-incubation. Recently, in Italy, an unscreened PC led to a transfusion reaction with this species [Klebsiella spp. [Escherichia coli and Serratia marcesens were detected within 6 and 8 h of primary culture, respectively. The quarantine period remains under review in the IBTS. The 12 h hold can hinder the supply of more urgently required platelet components. In these circumstances, IBTS physicians can order the nonstandard exceptional release of the component for a patient in need.Indeed, the case of  species . Vollmerlla spp. ,31. The p = 0.0011). This finding without the second Day-4 culture is interesting, as the timing and volume of the singular post-2020 sample was not altered and therefore was not expected to offer a change in sensitivity. A review of potential contributors to this observation in relation to component collection and processing did not reveal a likely explanation. (The * ChloraPrep product changed mid-study (2021); after an initial rise in the first 3 months, rates reverted to baseline). It could be that a much larger sample size is required to detect a true change in the rate of detection [Rates of bacterial detection in BCDP from the single-test protocol (0.191%) is higher than either of the pre-2020 Day-2 or Day-4 rates (0.125% and 0.043%), or a combination thereof (see etection . It has etection . The expetection . In the p = 0.0437).For SDAP, the smaller representative sample volume acknowledged earlier as a potential weakness with the single test  may have been offset by the effect of the delayed sample, as evidenced when comparing the rate post- and pre-LVDS 0.072% vs. 0.043% (Day-1 and Day-4 combined), respectively, , indeterminate (n = 1)) compared to 0.085% at expiry pre-2020. The latter represents a small sample of less than 5% of the total number of apheresis collections over 10 years and should be interpreted with that in mind. We can see from the interdiction rate of over 70% post-2020 that the delayed sample allows for a larger proportion of contaminations to be captured with live in-date testing. It may be too early to tell if there has been a true change in the sensitivity of the updated SDAP test; direct comparisons are difficult to make knowing the second Day-4 culture was obtained from each dose previously, and the sample size since the changeover is relatively small. To fully realise the advantages of LVDS, it would appear that the IBTS may need to move towards individual split testing.Cutibacterium acnes [confirmed outdate rates for all platelet types . Noting the small sample sizes . These data are also suggestive of comparable effectiveness of the pre- and post-LVDS strategy.LVDS has proved a successful measure in reducing STRs in several blood services such as the NHSBT and CBS, as previously mentioned . Data frum acnes . It is uum acnes ,33. If tum acnes . They re5 CFU/mL is required for a clinical reaction to be apparent [It has been estimated that the residual risk of bacterial safety could be as low as one in a million and therefore within reported estimates of virus-associated risk . Howeverapparent . Althougapparent ,38,39.Ireland has screened close to half a million platelet doses in less than two decades; it is inevitable that an STR will occur as reported by most of the larger blood establishments, irrespective of the risk mitigation strategy. The realistic goal of platelet screening is the interdiction of clinically significant levels of contamination, as sterility is not achievable. It is important that clinicians are aware not only of the \u2018negative-to-date\u2019 aspect of release criteria, but also of the limited sensitivity of the test applied compared to those used to screen for viral agents. False-negative screens have been estimated to occur in 10\u201350% of early sample screens . Of courpositive category also includes false positives, as the organism detected in the culture may simply be a contaminant of the bottle and not the component itself. Direct comparisons (in the pre-2020 testing) of BCDP and SDAP donations are obscured by the SDAP rate for the Day-4 test being representative of the number of tests rather than the number of donations*. Limitations of the updated protocol have been highlighted in the text, e.g., mother-bag-only testing of apheresis donations and the loss of the second Day-4 screen for BCDP post-2020.The reporting of our data over the last 13 years was challenged by manually maintained databases and the complexity of the pre-November 2020 screening strategy. Several possible permutations for screening of a single donation could have occurred at this time, including primary, secondary, and expired cultures testing, as well as investigation of co-components after a primary or secondary positive culture. This was difficult to collate and report. We do not have visibility on the age of the platelet at the time of issue  to fully inform an assessment of risk post-changeover to the LVDS-type protocol. As described in the methods section, the definitions the IBTS apply to categorise data could be criticised. In particular, the \u2019indeterminate positive\u2019 category includes cases that could have been true (confirmed) positive, for the want of the availability of a co-component that was already transfused  or if the concentration had reached the threshold for detection. The indeterminate The single test approach will continue to be used by the IBTS, as approximately 60% of contaminated components are being interdicted prior to transfusion; SDAP and BCDP are now both screened after an optimised interval post-collection, wastage has been reduced, and false flags appear to be decreasing. One could say that the system regularly falls short as contaminated platelet concentrates have been issued to patients and near misses have still occurred; however, our goal is to issue safe PCs and avoid morbidity and mortality. Zero risk is not achievable with any risk mitigation strategy, all of which have \u2018failed\u2019 at some point according to the literature. Although fatal septic transfusion reactions have not been reported in Ireland since implementation of BACT/ALERT 3D screening, transient bacteraemia leading to a mild or unnoticed reaction is more common than records will document. Perhaps the future will facilitate synthetically produced platelets in a high grade \u2018pharmaceutical\u2019 atmosphere, without the need for a living donor. More realistically, platelets could be cryopreserved or cold-stored rather than facilitating the propagation of bacteria at \u2018room temperature\u2019 prior to issue . A basic"}
+{"text": "Beh\u00e7et syndrome (BS) is a chronic, multisystemic inflammatory condition with unanswered questions regarding its pathogenesis and rational therapeutics. A microarray\u2010based comparative transcriptomic analysis was performed to elucidate the molecular mechanisms of BS and identify any potential therapeutic targets.Twenty\u2010nine BS patients (B) and 15 age and sex\u2010matched control subjects (C) were recruited. Patients were grouped as mucocutaneous (M), ocular (O), and vascular (V) according to their clinical phenotypes. GeneChip Human Genome U133 Plus 2.0 arrays were used for expression profiling on peripheral blood samples of the patients and the control subjects. Following documentation of the differentially expressed gene (DEG) sets, the data were further evaluated with bioinformatics analysis, visualization, and enrichment tools. Validation of the microarray data was performed using quantitative reverse transcriptase polymerase chain reaction.p\u2009\u2264\u20090.05 and fold change \u22652.0 were chosen, the following numbers of DEGs were obtained; B versus C: 28, M versus C: 20, O versus C: 8, V versus C: 555, M versus O: 6, M versus V: 324, O versus V: 142. Venn diagram analysis indicated only two genes, CLEC12A and IFI27, in the intersection of M versus C \u2229 O versus C \u2229 V versus C. Another noteworthy gene appeared as CLC in the DEG sets. Cluster analyses successfully clustered distinct clinical phenotypes of BS. While innate immunity\u2010related processes were enriched in the M group, adaptive immunity\u2010specific processes were significantly enriched in the O and V groups.When CLEC12A, IFI27, and CLC seemed to be operative in the disease pathogenesis. Based on these findings, future research should consider the immunogenetic heterogeneity of BS clinical phenotypes. Two anti\u2010inflammatory genes, namely CLEC12A and CLC, may be valuable as therapeutic targets and may also help design an experimental model in BS.Distinct clinical phenotypes of BS patients displayed distinct expression profiles. In Turkish BS patients, expression differences regarding the genes  CLEC12A, CLC, and IFI27 may be among these differentially expressed genes in Turkish BS\u00a0patients. Another significant characteristic of BS\u00a0is the observation of distinct expression profiles and molecular disease mechanisms in its clinical subgroups/phenotypes.Beh\u00e7et syndrome (BS), a chronic, multisystemic inflammatory condition seems to harbor an impaired balance between anti\u2010 and proinflammatory gene expressions.  The etiopathogenesis of the condition and its rational therapeutics are among these questions waiting for an answer. Three important properties of BS, namely (1) the divergent and sometimes paradoxical immunological findings observed in the studies, (2) the occurrence of diverse clinical features among different ethnic groups, and (3) the distinct clinical phenotype clusters within the syndrome, complicate the clarification of a sound, shared, and comprehensive etiopathogenesis for BS.CD69, CLEC12A, TNFAIP3), (2) neutrophil granule proteins , (3) antigen processing and presentation proteins , and (4) regulators of immune response  were shown to be potentially instrumental in BS immunopathogenesis.Previously, by borrowing the microarray data  of the study by Xavier et al.,In our present study, we performed a microarray\u2010based comparative genome\u2010wide expression analysis in Turkish BS patients and a sex and age\u2010matched healthy control group. We aimed (1) to elucidate the molecular disease mechanisms in Turkish BS patients, (2) to document any discrepancies between BS clinical phenotypes/patient subgroups regarding these disease mechanisms, and (3) to identify any potential therapeutic targets for BS.22.1The Ethics Committee of Ufuk University  approved the study with decision number 08065 dated 06.24.2009.The BS patients included in this study consisted of BS cases visiting the outpatient clinics of Ufuk University Faculty of Medicine Department of Dermatology, Ankara University Faculty of Medicine Division of Rheumatology, and Ankara Numune Training and Research Hospital Rheumatology Clinic, for their routine follow\u2010up visits, who fulfilled the International Study Group for Beh\u00e7et's Disease criteria for diagnosis of Beh\u00e7et's disease and agreed to participate in the study by signing the relevant, informed consent form.The control group individuals included in the study were chosen to be compatible with the BS group regarding their age and gender. They were selected among individuals visiting Ufuk University Faculty of Medicine hospital checkup outpatient clinics, who were in absolutely good health, did not report any complaints consistent with an infectious or inflammatory disorder, did not have any current or past significant health issues, did not demonstrate any abnormal physical exam and laboratory findings, did not have a personal history of BS or a BS history in their families, and agreed to participate in the study by signing the relevant, informed consent form.2.2Blood samples of BS patients and control group individuals were collected using PAXgene\u00ae Blood RNA Tube . A total of two tubes (samples) were obtained from each BS case and each control group individual included in the study, one for use during the study and the other as a precautionary measure. The blood samples collected were preserved at room temperature for the first 24\u2009h, at \u221220\u00b0C for the next 24\u2009h, and then at \u221280\u00b0C until the day they were to be analyzed, following the manufacturer's protocol (PAXgene\u00ae Blood RNA Tube Handbook).The relevant clinical information of the BS cases and the control group individuals included in the study were obtained using the specifically designed \u201cCase Report Form\u201d , ocular BS (O), vascular BS (V), and other BS (D) according to their individual clinical characteristics and the criteria presented in Table\u00a02.4U and the \u03c72\u00a0tests to compare two independent groups were used. The p values of the analyses were presented with their absolute numerical values, and a p\u2009\u2264\u20090.05 was considered statistically significant. Statistical analyses of the demographic data were performed using \u201cSPSS for Windows, Version 16.0\u201d software .As the demographic data of the study did not follow a normal distribution, the median as a measure of central tendency together with the minimum and maximum values, and the Mann\u2212Whitney 2.5The flowchart summarizing the in vitro experiments of the study is presented in Figure\u00a0RNA isolation & purification from blood samples collected for the study were performed using the PAXgene\u00ae Blood RNA Kit . Following the manufacturer's protocol, the tubes removed from the freezer just before the RNA isolation process were first equilibrated to room temperature and then kept at room temperature for an additional 2\u2009h. All steps of the RNA isolation & purification process were performed in complete adherence to the protocol recommended by the manufacturer's, as described in the PAXgene\u00ae Blood RNA Kit Handbook. For every purified RNA sample, a 500\u2009ng amount required for the downstream analysis was stored at \u221280\u00b0C, in addition to aliquots for RNA quantity/quality analyses and stocking purposes.2.6The RNA samples isolated were run and evaluated in a 1% agarose gel. A260 and A280 values were measured using a nano\u2010spectrophotometer . Consequently, they were analyzed by automated electrophoresis  and their RNA integrity number (RIN) values were calculated. For the nano\u2010spectrophotometric and the automated electrophoretic evaluations, the protocols defined by the manufacturer's were followed strictly . The agarose gel images of randomly selected 20 RNA samples are shown in Supporting Information:\u00a02.7Before the microarray hybridization step, the target RNA was amplified, labeled with biotin, and then fragmented to increase the hybridization efficiency and obtain optimal results. Starting with an RNA sample of 500\u2009ng, this step was carried out using the \u201cGeneChip\u00ae 3'\u00a0IVT Express Kit\u201c  and the protocol described by the manufacturer's . Biotin\u2010labeled amplified RNA was evaluated for quantity and purity by nano\u2010spectrophotometer  and then fragmented and visualized on a 1% agarose gel. The concentrations and A260/A280 ratios of the amplified RNA samples are presented in Supporting Information:\u00a02.8For microarray hybridization, \u201cGeneChip\u00ae Human Genome U133 Plus 2.0\u201d  microarrays were used, representing more than 47,000 transcripts/variants including 38,500 well\u2010defined genes of the human genome. Each microarray was loaded with a target RNA sample of 15\u2009\u00b5g added to a hybridization cocktail prepared using the \u201cGeneChip\u00ae Hybridization, Wash, and Stain Kit\u201d . The preparation of the hybridization cocktail and the loading procedure of the microarrays were carried out in complete adherence to the manufacturer's protocol . Loaded microarrays were then allowed to hybridize in \u201cGeneChip\u00ae Hybridization Oven\u201d  at a temperature of 45\u00b0C and 60\u2009rpm rotation speed for 16\u2009h.2.9Microarrays, upon completion of the hybridization step, were subjected to washing and staining processes in the \u201cGeneChip\u00ae Fluidics Station 450\u201d , using the relevant components in the \u201cGeneChip\u00ae Hybridization, Wash, and Stain Kit\u201d . Again, the protocol defined by the manufacturer's was precisely followed for this step .Consequent to the washing & staining steps, the microarrays were transferred to and scanned on the \u201cGeneChip\u00ae Scanner 3000\u201d  by using the \u201cAffymetrix,\u00ae\u00a0GeneChip\u00ae Command Console\u00ae 4.0\u201d (AGCC) software. Upon completion of the scanning process, the AGCC software generated \u201c.dat\u201d and \u201c.cel\u201d files along with \u201c.exp,\u201d\u00a0\u201c.chp,\u201d\u00a0and \u201c.rpt\u201d files. Among these files, the.dat file contained the scanned microarray image, and the.cel file contained the light intensity (brightness) values of each probe set, defined by a grid. For the downstream bioinformatics analyses, these raw.cel files were used.2.10PPIB) was chosen as the \u201chousekeeping\u201c gene.Validation experiments of this hybridization\u2010based expression study were performed using qRT\u2010PCR. For this purpose, the first 12 genes presented in the first column of Table\u00a02.11https://brb.nci.nih.gov/BRB-ArrayTools/). Initially, the raw microarray data existing as individual.cel files were collated using the data import function of the \u201cBRB\u2010ArrayTools\u201d software. Normalization of the imported microarray data was performed using the \u201cRobust Multiarray Average\u201d\u00a0algorithm, which includes (1) background correction, (2) binary logarithmic transformation, and (3) quantile normalization.The metadata, raw, and final/normalized data of the study are deposited to the GEO\u00a0repository . The flowchart summarizing the bioinformatics analyses of the study is presented in Figure\u00a02.12https://brb.nci.nih.gov/BRB-ArrayTools/). For the class comparison analyses, a two\u2010sample t\u2010test with a random variance model was implemented. The p value was chosen as \u22640.05 and the FC value as \u22652. For certain occasions, where a greater number of differentially expressed genes (DEG) are a prerequisite for optimal results , an FC value \u22651.5 was also additionally used. The Venn diagram analysis of the findings of the class comparisons was performed with \u201cVenny 2.1.0\u201d developed by Juan Carlos Oliveros (https://bioinfogp.cnb.csic.es/tools/venny/).Class comparison analyses were performed using the \u201cBRB\u2010ArrayTools v4.4.1\u201d software (http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm#ctv).t\u2010test for all).For clustering analyses of BS cases, the built\u2010in clustering tools of \u201cBRB\u2010ArrayTools\u201d software and \u201cCluster 3.0\u201d and the \u201cTreeView\u201d software packages were used (Gene ontology (GO) term enrichment analyses of the DEG sets were performed using the \u201cWEB\u2010based Gene Set Analysis Toolkit\u201d  and specifically focused on the sub\u2010title of biological processes.33.1The essential demographic characteristics of the BS patients and the control subjects are presented in Table\u00a03.2The detailed demographic and clinical characteristics of the BS cases and the control subjects included in the study are presented in Table\u00a03.3Following the preprocessing steps performed on the collated 44.cel files, 10,785 probe sets out of the 54,675 present on the \u201cGeneChip\u00ae Human Genome U133 Plus 2.0\u201d microarrays, passed the adjusted filters and were used during the subsequent bioinformatics analyses.3.4Details regarding the number of the DEGs obtained during the class comparison analyses are shown in Table\u00a0The top 20 (10 increased and 10 decreased) most differentially expressed genes, obtained by the class comparison analyses of the BS patient subgroups with the control group, are listed according to their FC values and presented in Table\u00a0The Venn analysis diagram of the DEG sets obtained during class comparison analyses between the BS patient subgroups and the control group is shown in Figure\u00a03.5The dendrogram and heatmap representations of clustering analyses performed among subgroups of patients with BS\u00a0are presented in Figure\u00a03.6Selected findings of the GO\u00a0enrichment analyses, performed using the DEG sets of the class comparisons M versus C, O versus C, and V versus C, are presented in Table\u00a03.7The findings of the validation experiments, performed using a qRT\u2010PCR approach, are presented in Table\u00a04CLEC12A, IFI27, and CLC in Turkish BS cases, (2) the presence of significant gene expression differences among distinct BS subgroups, (3) divergent roles and variant predominance of the innate and adaptive immune responses in mucocutaneous versus ocular & vascular BS cases, and (4) a loss of potentially important information at the molecular level by examination of distinct BS clinical phenotypes gathered into a single patient group.This study performed a comparative genome\u2010wide expression analysis of Turkish BS patients, using a novel study design that differentiated it from other similar studies in the relevant literature.At the beginning of the discussion and before going deep in dissection of the findings, the authors of the study emphasize that the approach of collecting and studying distinct BS clinical phenotypes as a single group, may unintentionally lead to loss of important information, especially at the molecular level. In other words, as the authors we believe that, the study design has a significant impact on the findings of BS studies.EREG\u2010AREG and NRG1 genes and the EGF/ErbB signaling pathway might play a role in BS susceptibility.CD69, CLEC12A, CLEC12B, TNFAIP3), neutrophil granule proteins , antigen processing and presentation proteins , and regulators of immune response  appear to be instrumental in BS immunopathogenesis.CLEC12A which appeared in the \u201cnegative regulators of inflammation\u201d gene group of Oguz et al., was also a significant finding of the present study.The combined gene\u2010expression profiling and genome\u2010wide association study by Xavier et al. is one of the earliest research performed in cases of BS.CLEC12A and IFI27 in the DEG sets of the class comparisons M versus C, O versus C, and V versus C. Besides their potential functional significance in BS pathogenesis, CLEC12A and IFI27 both were among the top 10 DEGs  is an innate immune system receptor, expressed on the surface of granulocytes, monocytes/macrophages, and NK lymphocytes with an inhibitory function.CLEC12A exerts its inhibitory effect via the immunoreceptor tyrosine\u2010based inhibitor motif (ITIM) present on its cytoplasmic tail.CLEC12A, of which uric acid crystals have been shown as one of its endogenous ligands, is thought to have an important role in regulating the immune response and maintaining homeostasis by reducing the severity of the inflammatory reaction, especially in the presence of tissue injury.CLEC12A.CLEC12A function or its decreased expression is associated with an increased RA disease activity and inflammation severity.CLEC12A in Turkish BS cases during preliminary analysis of their transcriptome data and by collecting the findings in the literature on CLEC12A, proposed the hypothesis that CLEC12A may be a common denominator in the development of BS and gout.CLEC12A expression with hyperinflammatory responses, (2) the presence of CLEC12A polymorphisms with functional and clinical effects in certain inflammatory diseases, (3) the dual use of colchicine for the treatment of BS and gout, (4) the exaggerated inflammatory response to uric acid crystals detected in both BS and gout cases, (5) the presence of the genomic locus of the CLEC12A gene , among the findings of the GWAS and GWLS of BS, and (6) their preliminary finding of decreased CLEC12A expression in Turkish BS cases.CLEC12A is proved with well\u2010designed studies in the future, scientists may be able to go a long way toward\u00a0the elucidation of the pathogenesis of BS & gout, and also an animal model development for BS.CLEC12A, could be potential treatment targets by playing important roles in the regulation of sterile inflammation.CLEC12A inhibit neutrophil activation and cytokine release.CLEC12A ranked among the top 10 DEGs of the class comparisons M versus C and O versus C. When the Y chromosome genes  are excluded from the M versus C list, CLEC12A becomes the most downregulated gene in both of the M versus C and O versus C class comparisons  is one of the genes belonging to the group of interferon\u2010stimulated genes (ISG), mediating the antiviral, immunomodulatory, and antiproliferative effects of interferons.IFI27 expression have been reported.CLEC12A, IFI27 is also among the top 10 most DEG\u00a0of the class comparisons   group.IFI27 expression with inflammatory conditions has been consistently documented, the mechanisms underlying this finding remain to be clarified .4) Table\u00a0. As a reCLC. As is presented in Table\u00a0CLC ranked second with an FC of \u22122.57 for O versus C and 7th with an FC of \u22123.57 for V versus C class comparisons. CLC  has historically been identified as an important component of human eosinophil leukocytes and is named after the Charcot\u2212Leyden crystals, which are frequently observed at sites of eosinophilic inflammation.CLC, which was thought to have lysophospholipase function for a long period of time, is now accepted as a member of the galectin (lectin) gene family.CLC, with a primary carbohydrate affinity for mannose, is shown to play a role in immune system surveillance against inflammation and tumors.CLC that came as a surprise.CLC is highly expressed in CD4+CD25+ regulatory T cell (Treg cell) cytoplasm, and this expression seems to be essential for the adaptive immune response suppressive functions of the regulatory T lymphocytes.CLC protein in regulatory T lymphocyte cytoplasm resulted in loss of regulatory T lymphocyte suppressor function.+ (high expression) eosinophil granulocyte population suppressed T lymphocyte functions via CLC.CLC in the ocular and vascular BS subgroups may indicate that, in addition to CLEC12A and IFI27, CLC may also be playing a role in (1) the emergence of the characteristic hyperinflammatory manifestations of BS, and (2) the addition of the adaptive immune response to the initial scene of innate immunity in BS, particularly in ocular and vascular cases.Another gene that drew attention in the class comparisons of the ocular and vascular BS groups with the control group was CLEC12A and IFI27, which are already discussed .Mucocutaneous findings  are hallmarks of BS which unequivocally occur in BS cases, regardless of their disease clusters.d Figure\u00a0. When weC1QBP, F13A1, H3F3A, ITGA2B, and TREML1  are noticed  are currently reported to be among the genes involved in NET formation.The gene set enrichment analyses of our study yielded distinct results in different BS subgroups. As can be seen in Table\u00a0When gene set enrichment analyses of the ocular and vascular BS subgroups are reviewed, in addition to the GO terms such as \u201cImmune response,\u201c\u00a0\u201cLeukocyte migration,\u201c and \u201cLeukocyte activation\u201c which refer to immune responses in general, GO terms such as \u201cAdaptive immune response,\u201c\u00a0\u201cLymphocyte activation,\u201c\u00a0\u201cIL\u20102 production,\u201d\u00a0\u201cLymphocyte differentiation,\u201d and \u201cT cell mediated immunity\u201d which are specifically related to the adaptive immune response were found to show significant enrichment Table\u00a0. In the The findings of the gene set enrichment analyses of our study which we briefly mentioned above, can be wrapped up as \u201can immune\u2010mediated disorder with innate and adaptive immune responses contributing to it, which displays an innate immunity predominance in its \u201cmild\u201d forms, whereas adaptive immunity is in front in its \u201csevere\u201d forms.\u201d\u00a0This statement seems to be in harmony with the current pathogenetic mechanism definition of BS which goes as follows: \u201cA complex genetic background leading to a proinflammatory, innate\u2010immune system derived activation perpetuated by adaptive immune responses against environmental and autoantigens.\u201dLike every other scientific study, our study has its own limitations. One of these limitations is about the transcriptome profiling technology implemented in our research. While transcriptome profiling can be performed by hybridization or next\u2010generation sequencing based (RNA\u2010seq) methodologies and we have implemented a microarray, therefore a hybridization based methodology, RNA\u2010seq has well known advantages when compared with microarrays. Just to make a brief mention of these advantages, we should point that, RNA\u2010seq enables detection of biologically relevant genetic variants , quantification of gene expression across a wider dynamic range with absolute values, performing analysis with a low total RNA, obtaining larger DEG sets with a higher sensitivity, and identification of the rare and low\u2010abundance transcripts compared to microarray experiments. There are also a few points to mention, regarding the design of the research. First and foremost, it would be a better practice to view and interpret our findings while bearing in mind that they belong to a Turkish BS population. Because of major ethical concerns related to the potential threatening consequences of discontinuing their therapeutic schemes, every BS case enrolled in our study continued his/her pharmacological therapy, and this should be noted as another limitation of our study. When contrasted with similar other studies in the literature, the total number of BS cases present in our study is seemingly high. Nevertheless, the lack of BS patients with involvements of relatively uncommon organ systems  may be listed as an additional limitation of our study. Thus, we believe that it is important to plan and conduct new studies with large numbers of treatment\u2010naive BS cases. Still another important point to remember is that, although we have searched for gene expression differences observed in BS patients, we did not obtain any information about the mechanisms responsible for the observed gene expression differences. Both epigenetic control, in the form of DNA methylation or histone modification variations, and certain single nucleotide polymorphisms (SNPs), located in the upstream and downstream transcriptional control sequences of the respective genes may well be responsible for the observed expression differences. This situation requires planning for further epigenetic or SNP (expression quantitative trait loci) analyses, which will seek to document epigenetic and genetic variants that affect the expression levels of these genes. It is also essential that the findings of our study should be validated in another Turkish BS patient cohort.A supplement to \u201cDiscussion\u201d section can be found in Supporting Information:\u00a05CLEC12A, IFI27, and CLC, appeared to be potentially instrumental in BS immunopathogenesis and these genes may be of value for therapeutic targeting and animal model development purposes. The authors of the study believe that, at least in the case of Turkish BS patients, novel targeted therapy drugs specifically \u201ctargeting\u201d CLEC12A, CLC, and IFI27 genes/proteins may prove to be of value for therapeutic purposes. It was also shown that BS patients displayed distinct gene expression profiles and molecular disease mechanisms in different BS clinical phenotypes. A significant consequence of this finding appeared as a loss of information with the single group analysis of BS patients of different disease clusters. The authors believe that the nomenclature as the \u201cBeh\u00e7et syndrome\u201d should be preferentially utilized and future research should take into account the molecular level heterogeneity of the distinct BS disease clusters. New studies enrolling treatment naive BS patients will be of great value and will add vital information to the topic.This comparative gene\u2010expression profiling study of Turkish BS cases revealed a couple of important findings regarding the immunopathogenesis of BS. First of all, three genes, Mehmet Nejat Akar\u00a0and Ali Kemal O\u011fuz\u00a0conceived and designed the research.\u00a0Ali Kemal O\u011fuz\u00a0collected the data (and the samples).\u00a0Hilal \u00d6zda\u011f,\u00a0Ali Kemal O\u011fuz,\u00a0and Seda Ta\u015f\u0131r\u00a0performed the analysis (the in vitro experiments).\u00a0Hilal \u00d6zda\u011f, Ali Kemal O\u011fuz,\u00a0and Seda Ta\u015f\u0131r\u00a0analyzed the data (the bioinformatics).\u00a0Ali Kemal O\u011fuz\u00a0and \u00c7a\u011fda\u015f \u015eahap Oyg\u00fcr\u00a0wrote the manuscript.\u00a0Ali Kemal O\u011fuz, \u00c7a\u011fda\u015f \u015eahap Oyg\u00fcr, Seda Ta\u015f\u0131r, Hilal \u00d6zda\u011f,\u00a0and Mehmet Nejat Akar\u00a0all have read and approved the final submitted version of the manuscript.The authors declare no conflict of interest.The Ethics Committee of Ufuk University  approved the study with decision number 08065 dated 06.24.2009.Support1 File.Click here for additional data file.Support2 Fig.\u00a0Click here for additional data file.Support3 File.Click here for additional data file.Support4 File.Click here for additional data file.Support5 File.Click here for additional data file.Support6 File.Click here for additional data file.Support7 File.Click here for additional data file.Support8 File.Click here for additional data file."}
+{"text": "The canonical Wnt inhibitor Dickkopf-1 (Dkk-1) has the capacity to modulate homeostasis between canonical and non-canonical Wnt pathways and also signal independently of Wnt. The specific effects of Dkk-1 activity on tumor physiology are therefore unpredictable with examples of Dkk-1 serving as either a driver or suppressor of malignancy. Given that Dkk-1 blockade may serve as a potential treatment for some types of cancer, we questioned whether it is possible to predict the role of Dkk-1 on tumor progression based on the tissue origin of the tumor.Original research articles that described Dkk-1 in terms a tumor suppressor or driver of cancer growth were identified. To determine the association between tumor developmental origin and the role of Dkk-1, a logistic regression was performed. The Cancer Genome Atlas database was interrogated for survival statistics based on tumor Dkk-1 expression.p = 0.0198) or endoderm (p = 0.0334) but more likely to serve as a disease driver in tumors of mesodermal origin (p = 0.0155). Survival analyses indicated that in cases where Dkk-1 expression could be stratified, high Dkk-1 expression is usually associated with poor prognosis. This in part may be due to pro-tumorigenic role Dkk-1 plays on tumor cells but also through its influence on immunomodulatory and angiogenic processes in the tumor stroma.We report that Dkk-1 is statistically more likely to serve as a suppressor in tumors arising from the ectoderm (Dkk-1 has a context-specific dual role as a tumor suppressor or driver. Dkk-1 is significantly more likely to serve as a tumor suppressor in tumors arising from ectoderm and endoderm while the converse is true for mesodermal tumors. Patient survival data indicated high Dkk-1 expression is generally a poor prognostic indicator. These findings provide further support for the importance of Dkk-1 as a therapeutic cancer target in some cases. The canonical Wnt/\u03b2-catenin (cWnt) pathway has garnered intense interest for its role in the regulation of cancer progression. The earliest work on cWnt signaling strongly implicated it as a driving factor in tumorigenesis based on initial observations that cWnt is upregulated by viral integration in murine breast tumors , and mutTo date, 19 homologous members of the Wnt ligand family have been discovered in human tissues , generalDickkopf-1 (Dkk-1) is the most intensely studied of the cWnt inhibitors, initially identified as a factor with the capacity for induction of a second head when its mRNA was injected into xenopus embryos . Dkk-1 iGiven that Dkk-1 blockade may serve as a valuable adjunct treatment for some types of malignancy , 40, 41,https://pubmed.ncbi.nlm.nih.gov/) was searched using the term \u201cDkk-1 and cancer\u201d with the date range set to 1999-2022. After exclusion of reviews and editorials, original research articles that described Dkk-1 in terms a tumor suppressor or driver in a cancer cell or tumor growth were identified and shortlisted (https://discovery.lifemapsc.com).The Pubmed database . Studies were categorized based on whether Dkk-1 was reported as a driver or suppressor of tumorigenesis , then further categorized on the basis of tumor origin . To determine the association between tissue layer and the role of Dkk-1, a logistic regression was performed. The independent and dependent variables were designated tissue layer and tumor suppression, respectively.https://drbioright.org was employed to interrogate The Cancer Genome Atlas (TCGA) database for overall survival statistics for patients harboring tumors with high or low Dkk-1 expression . The dataset included specimens from brain, ovary, lung, prostate, uterus, bladder, testis, esophagus, pancreas, kidney, liver, cervix, soft tissue, breast, thymus, pleura, colon, stomach, bile duct, thyroid, head neck, bone marrow, rectum, skin, lymph nodes, adrenal gland, eye cancer patients. Survival data were analyzed by log rank test.The DrBioRight bioinformatics platform Dkk-1 and cancer\u201d between 1999-2022, yielding 260 results. Original research articles were shortlisted if they described Dkk-1 in terms of a tumor suppressor or driver in a cancer cell or tumor, and also specified the nature of the tumor or cancer cell studied, resulting in 57 remaining articles (The PubMed database was searched using the terms \u201carticles Table\u00a01 p = 0.0334) for the endoderm layer, 0.33  for the mesoderm layer, and 4.66  for the ectoderm layer  whereas one demonstrated a relatively weak association with survival and high Dkk-1 expression  . Dkk-1 cIn tumors where expression data could be stratified into high and low Dkk-1 expression, patient survival data indicated high Dkk-1 expression was generally a poor prognostic indicator. With limited mechanistic data it is difficult to ascertain whether Dkk-1 is upregulated in these tumors in an effort to limit high cWnt signaling , or whetTo our knowledge, this is the first time a relationship between the malignant driver/suppressor role of Dkk-1 and the developmental origin of the tumor has been demonstrated. While this preliminary work could offer a biological explanation for some of the controversies of the field, it has limitations. The hypothesis was tested using a relatively small data-set, limiting the current predictive power of this work, and another concern lies in the need to address paracrine actions of Dkk-1 on the tumor originating from host tissue. Further research utilizing the growing repository of clinically-annotated single-cell resolution transcriptomic data from the tumor and its associated stroma could provide substantial mechanistic clarification, and in the future, predict the efficacy of Dkk-1 blocking agents for a broad range of malignancies.In summary, a systematic review of the literature indicated that Dkk-1 is more likely to play a suppressor role in tumors of ectodermal and endodermal origin where cWnt signaling is a predominantly proliferative force. In the case of mesodermal tissues, the role of cWnt is more complex, and Dkk-1 appears to be more likely to be associated with tumor promoting roles. Survival analyses using datasets from the TCGA database indicated that were where survival rates for patients can be stratified by high and low Dkk-1 expression, high Dkk-1 levels are usually associated with poor prognosis. This in part may be due to pro-tumorigenic roles Dkk-1 plays on tumor cells but also through immunomodulatory, developmental and angiogenic influences on the stroma too. Overall, the available data suggest that Dkk-1 blocking strategies may be effective in directly preventing the expansion of specific tumor types, but a more universal application for Dkk-1 blockade may lie in its capacity to target tumor-supporting components of the stroma.The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.DD and CG curated data, screened articles and wrote the manuscript. CB and DT performed the statistical analyses, CG conceptualized article, organized the work and acquired funding. All authors contributed to the article and approved the submitted version."}
+{"text": "Zymomonas mobilis ZM4 pretreated using energy-efficient and eco-friendly cold plasma.Lignocellulose-derived aldehyde inhibitors seriously blocked the biorefinery of biofuels and biochemicals. To date, the economic production of lignocellulose-based products heavily relied on high productivities of fermenting strains. However, it was expensive and time-consuming for the achievable rational modification to strengthen stress tolerance robustness of aldehyde inhibitors. Here, it aimed to improve aldehyde inhibitors tolerance and cellulosic bioethanol fermentability for the chassis Z. mobilis, and thus was attributed to the inhibition of the lignocellulose-derived aldehyde inhibitors in CSH. Convincingly, it further confirmed that the mixed aldehydes severely decreased bioethanol accumulation through additional aldehydes supplementary assays in synthetic medium. After assayed under different processing time (10\u201330\u00a0s), discharge power (80\u2013160 W), and working pressure (120\u2013180\u00a0Pa) using cold atmosphere plasma (CAP), it achieved the increased bioethanol fermentability for Z. mobilis after pretreated at the optimized parameters . It showed that cold plasma brought about three mutation sites including ZMO0694 (E220V), ZMO0843 (L471L) and ZMO0843 (P505H) via Genome resequencing-based SNPs (single nucleotide polymorphisms). A serial of differentially expressed genes (DEGs) were further identified as the potential contributors for stress tolerance via RNA-Seq sequencing, including ZMO0253 and ZMO_RS09265 (type I secretion outer membrane protein), ZMO1941 (Type IV secretory pathway protease TraF-like protein), ZMOr003 and ZMOr006 , ZMO0375 and ZMO0374 (levansucrase) and ZMO1705 (thioredoxins). It enriched cellular process, followed by metabolic process and single-organism process for biological process. For KEGG analysis, the mutant was also referred to starch and sucrose metabolism, galactose metabolism and two-component system. Finally, but interestingly, it simultaneously achieved the enhanced stress tolerance capacity of aldehyde inhibitors and bioethanol fermentability in CSH for the mutant Z. mobilis.It was found that bioethanol fermentability was weaker in CSH (corn stover hydrolysates) than that in synthetic medium for Z. mobilis treated with cold plasma was conferred upon the facilitated aldehyde inhibitors tolerance and bioethanol production. This work would provide a strain biocatalyst for the efficient production of lignocellulosic biofuels and biochemicals.Of several candidate genetic changes, the mutant  As a potential resource for bioethanol production, valorization of lignocellulosic biomass available in massive quantities significantly offered positive environmental impacts through lessening greenhouse gas and other pollutant emissions , 2. It iZymomonas mobilis ZM4 performed its great potential in the lignocellulosic biorefinery fields [Z. mobilis was sensitive to furanic and phenolic aldehydes [Z. mobilis, such as directed gene evolution [Z. mobilis.Of high ethanol productivity and flexible genetic manipulation feasibility, the ethanologenic strain y fields , 19. Howldehydes , 20. Manvolution \u201324, genevolution \u201330 and gvolution . HoweverZ. mobilis ZM4 using cold plasma.Plasma, a quasi-neutral ionized or partially ionized gas in electric discharge, comprised the varied charged particles, metastable particles, molecules, neutral atoms, particles and photons , 33. AccThe current study tried to enhance aldehyde inhibitors tolerance and bioethanol production in corn stover hydrolysates (CSH) using cold plasma. Here, it assayed processing time, discharge power and working pressure to establish the optimum parameters. Furthermore, genetic variation and transcriptional profiling were uncovered through genome resequencing-based single nucleotide polymorphisms (SNPs) and transcriptional sequencing. This study would provide a strain biocatalyst as the potential producer of cellulosic biofuels and biochemicals.The commercial enzyme cellulase purchased from Sigma-Aldrich  was determined of the 235 FPU/mL of filter paper activity following the NREL protocols LAP-006 method . All theZ. mobilis ZM4 was cultured in corn stover hydrolysate (CSH) liquids or RM (Rich Medium) medium containing 20.0\u00a0g/L glucose, 2.0\u00a0g/L KH2PO4, and 10.0\u00a0g/L yeast extract. A 1.0\u00a0mL of seed cultures was inoculated in 100\u00a0mL fresh RM medium in a 250-mL flask without shaking at 30\u00a0\u00b0C for the single-factor assays after cold plasma pretreatment. Sampling was at a 4\u00a0h interval till 24\u00a0h. The other fermentation assays were carried out with a 10% inoculation. It was added 4-hydroxybenzaldehyde, syringaldehyde, vanillin, furfural and HMF with the corresponding concentration of CSH to assay the tolerance of aldehyde inhibitors. For genome resequencing and RNA-Seq sequencing assays, the fresh culture of Z. mobilis ZM4 was harvested from 100\u00a0mL cultures at 4\u00a0h for RNA isolation. All assays were carried out in triplicate.Harvested from Lianyungang, Jiangsu province, China, in the fall of 2021, corn stover milled to a size\u2009<\u20093\u00a0mm was pretreated with dilute acid , 49. HydZ. mobilis ZM4 streaked on the fresh RM plates cultured at 30\u00a0\u00b0C overnight was placed in the chamber of a cold plasma modification apparatus. The test parameters were covered as follows: processing time 10\u201330\u00a0s, discharge power 80\u2013160 W and working pressure 120\u2013180\u00a0Pa. After processed, the treated samples and the un-treated controls were re-activated by streaking on the fresh medium before fermentation assays.Processed with cold plasma generated from the radio frequency power supply (13.56\u00a0MHz) using helium as working gas , Z. mobiZ. mobilis ZM4 pretreated with cold plasma under the optimum parameters, genome resequencing-based single nucleotide polymorphisms (SNPs) were performed by Beijing Novogene Bioinformatics Technology Co., Ltd (China).To confirm the genetic changes for \u00ae 2.0 Fluorometer (Thermo Scientific) after isolated according to the SDS method [\u2122 DNA Library Prep kit for Illumina  following the manufacturer\u2019s recommendations. After purified with AMPure XP system and analyzed on Agilent 2100 Bioanalyzer , it sequenced the whole genome of Z. mobilis ZM4 using Illumina NovaSeq PE150. The original data derived from high-throughput sequencing were transformed into raw sequenced reads using base calling of CASAVA software before stored in FASTQ format. BWA software (version 0.7.8) and SAMTOOLS software (version 0.1.18) were separately used to map the Reads to the reference sequence of the wild Z. mobilis ZM4 and count the coverage of the reference sequence to the Reads [http://deconseq.sourceforge.net/) to eliminate the false signals from the potential bacterial or fungi contaminations before the assembly and the downstream analysis.Genomic DNA was quantified using QubitS method . It genehe Reads , 54. SNPhe Reads . To showhe Reads . The rawhe Reads . For genZ. mobilis ZM4 samples using TRIzol\u00ae reagent . The RNA was purified with the NucleoSpin RNA clean-up kit  and qualified with RIN (RNA Integrity Number)\u2009\u2265\u20097.0 and the ratio of 23S rRNA: 16S rRNA\u2009\u2265\u200915: 1 using Bioanalyzer 2100  before kept at \u221280\u00a0\u00b0C.Following the manufacturer\u2019s instructions, the total RNA was isolated from https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/) to screen contamination. HTSeq (high-throughput sequencing), a Python framework, was used to calculate gene counts of mRNA [p\u2009<\u20090.05. Here, differentially expressed genes (DEGs) was defined as an absolute value of log2 ratio\u2009\u2265\u20091.0, and the significant DEGs were required an additional p\u2009\u2264\u20090.05.RNA-Seq sequencing assays were carried out by CapitalBio Technology Co., Ltd, Beijing, China. It quantified the initial concentration of the total RNA as 0.1\u20131.0\u00a0\u03bcg using Qubit RNA assay kit following the manufacturer\u2019s instructions. The fragmented and primed mRNA from the rRNA depleted total RNA was used as the templates to synthesize the first strand of cDNA. Using dA-Tailed and ligating adaptor cDNA as the templates, PCR products were quantified with the Qubit DNA HS assay kit and qualified with 2100 Bioanalyzer chip. RNA-Seq sequencing assays were carried out on the Illumina NovaSeq 6000 platform. It used FastQ Screen ( of mRNA . The dif of mRNA . Gene On2SO4 as mobile phase using Thermo Scientific\u2122 Dionex\u2122 Ultimate\u2122 3000 high performance liquid chromatography (HPLC) equipped with a refractive index detector ERC RefractoMax 520  and a Aminex HPX-87H column . Furanic aldehydes and phenolic aldehydes were determined according to the previous methods [Glucose and ethanol were determined at 55\u00a0\u00b0C and 0.6\u00a0mL/min using 5.0\u00a0mM H methods , 60.Z. mobilis ZM4  and working pressure (120 W)  Fig.\u00a0. CompareZ. mobilis ZM4 was carried out under the above assayed optimum parameters of cold plasma   Fig.\u00a0. Cell gr W) Fig.\u00a0a, glucos W) Fig.\u00a0b and eth W) Fig.\u00a0c. It indZ. mobilis ZM4, it simultaneously carried out genome-based resequencing and transcriptomic sequencing.In order to confirm the genetic changes and transcriptional landscapes derived from cold plasma pretreatment for ZMO00694 (E220V) at the position of 691271 for genome and 659 for conserved gene sequence  at the position of 849208 for genome and 1411 for conserved gene sequence and ZMO0843 (P505H) at the position of 849311 for genome and 1514 for conserved gene sequence  and seven down-regulated DEGs, including ZMO0253 and ZMO_RS09265 , ZMO2035 , ZMO0095 , ZMOr003 and ZMOr006  and ZMO1941 (Type IV secretory pathway protease TraF-like protein), the other 25 up-regulated DEGs were involved with hypothetical protein, levansucrase, protein of unknown function DUF847/DUF81, phage terminase, large subunit, PBSX family, putative phage major head protein, conserved hypothetical protein, constituent protein and thioredoxin domain protein . Convincingly, 0.01\u00a0g/L 4-hydroxybenzaldehyde, 0.55\u00a0g/L syringaldehyde and 0.08\u00a0g/L vanillin were separately degraded by 87.22% at 24\u00a0h, 81.68% at 48\u00a0h and 87.82% at 60\u00a0h. The conversion rate of 0.16\u00a0g/L furfural and 0.75\u00a0g/L HMF was 76.31% and 84.55%, respectively, at 72\u00a0h. Therefore, it concluded that cold plasma pretreatment simultaneously conferred the robustness of aldehyde inhibitors tolerance and bioethanol fermentability for the mutant Z. mobilis ZM4.Here, the resulting aldehyde inhibitors were derived from corn stover pretreated with dilute HSO4 Fig.\u00a0a. AlthouSO4 Fig.\u00a0, it knewZM4 Fig.\u00a0b. TherefZM4 Fig.\u00a0c. Compar31% Fig.\u00a0c. It proZ. mobilis was always regarded as a robust ethanologen chassis, especially for bioethanol production using lignocellulosic materials. However, the lignocellulose-derived furanic aldehydes and phenolic aldehydes seriously blocked bioethanol accumulation for Z. mobilis [With lots of desirable industrial strain biocatalysts brought about,  mobilis , 61\u201363.Z. mobilis ZM4, furanic aldehydes and phenolic aldehydes were more toxic than weak acids  [Z. mobilis ZM4 under the same concentration of 5\u00a0mM, followed by vanillin and syringaldehyde [Z. mobilis ZM4. Here, inhibitory intensity of cell growth , glucose consumption  and ethanol production  were separately established. Obviously, mixed aldehydes were the most toxic for Z. mobilis, and thus well proved that the bioethanol fermentability was weakened by aldehyde inhibitors in CSH. What needs to be noted was that synergistic inhibition should be stressed, although Z. mobilis ZM4 was well tolerant furanic acids and phenolic acids [The degradation of biomass during pretreatment may bring about the release of sugar monomers, furanic compounds, weak acids and phenolic compounds. The inhibitory intensity of the above inhibitors was usually different for the type of biorefinery strains \u201366. For ic acid) , 20, 62.aldehyde . Here, iic acids .Z. mobilis ZM4 enough for the efflux of the small molecules (such as glucose). Therefore, the parameter of processing time might play a very vital role for Z. mobilis ZM4 to accumulate bioethanol.The effect of cold plasma on organism modification was tightly related to its generating device, the composition of the working gas, the distance from the cold plasma source to the samples and processing parameters including processing time, discharge power and working pressure . Here, tZ. mobilis ZM4, and thus was supported by the mutagenicity from cold plasma in bacteria in a parameter-dependent manner [Here, it was found that cold plasma pretreatment under the sub-lethal condition  produced a mutagenic effect on t manner , 70\u201372.Z. mobilis ZM4, and thus was consistent with the previous studies [ZMO0253 and ZMO_RS09265 encoding type I secretion outer membrane protein (from TolC family) within the RND (Resistance-Nodulation-cell Division) efflux systems were differentially down-regulated after pretreated with cold plasma. Known as an ABC transporter system responsible for protein secretion without the cleavage of the signal sequence, outer membrane proteins were confirmed to involve with type I protein secretion and the efflux of the small molecules [Z. mobilis ZM4 after pretreated with cold plasma. (2) Of ionized gases with high energy of electrons and relatively low temperature of gas particles, cold plasmas could affect the exposed living cells [ZMO1941 (Type IV secretory pathway protease TraF-like protein) was also predicted as one of the contributors for its assayed gene function of stress tolerance [ZMOr003 and ZMOr006. (4) Levansucrase (EC2.4.1.10), a fructosyltransferase exoenzyme, was of with sucrose hydrolytic and levan biosynthetic activities. Specially, a certain amount of the levan could provide protection against diverse stresses protection [ZMO0375 and ZMO0374 encoding levansucrase were predicted to relate with stress resistance-derived from cold plasma pretreatment. (5) Here, ZMO1705 encoding thioredoxins was up-regulated for Z. mobilis ZM4 after pretreated with cold plasma. Of a conserved active site motif (CGPC), thioredoxins (Trxs) could well perform stress tolerance through redox regulation of target proteins [Z. mobilis, and thus was supported by some studies [The impact of the plasma largely relied on the kind of an organism and its specific cell properties , 74. In  studies . Some caolecules . Outer molecules , and thung cells . Typicalng cells . Therefoolerance . (3) As olerance \u201382. Hereotection \u201385. Therproteins . Convincproteins \u201390. Most studies .Z. mobilis ZM4 in CSH. It was proposed the genetic and transcriptional changes for the increased bioethanol fermentability achieved both in synthetic medium and CSH. However, most importantly, why did cold plasma pretreatment deliver stress tolerance of aldehyde inhibitors in CSH for the train Z. mobilis ZM4? The potential reasons were given as follows: (1) usually, mutations derived from the adaptation and evolution could make the bacteria fit and respond to a certain stress environment. Here, it predicted that the three identified point mutation derived from cold plasma pretreatment were possible in charge of the augmented aldehyde inhibitor tolerance and bioethanol fermentability for Z. mobilis ZM4, and thus was supported by YfdX family protein (ZMO0694) and arginine-tRNA ligase (argS) (ZMO0843) involved with stress resistance [Z. mobilis could efficiently accumulate bioethanol after defensed themselves against all the possible environmental threats, such as the toxic aldehyde inhibitors and cold plasma pretreatment. During this process, Z. mobilis cells would have to start a series of complex regulatory networks to overcome the adverse conditions and maintain their cell integrity. The stress resistance-related candidate genes might be responsible for the stress of aldehyde inhibitors, and thus be in agreement with the documented molecular mechanism of the stress tolerance [Convincingly, it confirmed that cold plasma pretreatment simultaneously reinforced aldehyde inhibitors tolerance and bioethanol fermentability for sistance ; (2) Z. olerance , 93, 94.Z. mobilis from cold plasma pretreatment should be confirmed, and thus would provide a potential clue for the applications of the methodology in biorefinery fields. Secondly, it would assay the contribution of the three mutation sites to stress tolerance and bioethanol production. Last but not the least, the established gene and pathway datasets from deep sequencing would be investigated by gene engineering to promote the stress tolerance of the lignocellulose-derived inhibitors and the accumulation of biofuels and biochemicals from biomass for biorefinery strains.The future study would be carried out as follows: firstly, the genetic stability of the mutant Z. mobilis ZM4 pretreated with cold plasma. Compared with the control, a 6.99\u00a0g/L of bioethanol accumulation  at 24\u00a0h was acquired from Z. mobilis pretreated with cold plasma  in CSH. The specific genetic and transcriptional changes were also revealed for the augmented bioethanol production for Z. mobilis ZM4. This work would provide a strain biocatalyst for the efficient production of biofuels and other biochemicals in biorefinery fields.The work was focused on the enhancement of aldehyde inhibitors stress tolerance and bioethanol fermentability in CSH for"
\ No newline at end of file