diff --git "a/deduped/dedup_0272.jsonl" "b/deduped/dedup_0272.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0272.jsonl"
@@ -0,0 +1,47 @@
+{"text": "Allermatch\u2122 A query amino acid sequence is compared with all known allergenic proteins retrieved from the protein databases using a sliding window approach. This identifies stretches of 80 amino acids with more than 35% similarity or small identical stretches of at least six amino acids. The outcome of the analysis is presented in a concise format. The predictive performance of the FAO/WHO criteria is evaluated by screening sets of allergens and non-allergens against the Allermatch databases. Besides correct predictions, both methods are shown to generate false positive and false negative hits and the outcomes should therefore be combined with other methods of allergenicity assessment, as advised by the FAO/WHO.Allermatch\u2122 provides an accessible, efficient, and useful webtool for analysis of potential allergenicity of proteins introduced in genetically modified food prior to market release that complies with current FAO/WHO guidelines. A step-by-step procedure to assess allergenicity is described by the Codex alimentarius and the FAO/WHO consultation group [The safety of genetically engineered foods must be assessed before authorities in most nations will consider granting market approval. An important issue in current food safety assessment is the evaluation of the potential allergenicity of food derived from biotechnology. Since many food allergens are proteins, introduction of a new (\"foreign\") protein in food by genetic engineering can in theory cause allergic reactions. Therefore the allergenicity of novel proteins needs to be assessed. Potential allergenicity of a protein is a complex issue and various tests can be used for prediction, including bioinformatics, on group ,2. An imon group  to estab(1) Obtain the amino acids sequences of known allergens in protein databases in FASTA format .(2) Prepare the complete set of 80-amino acid length sequences derived from the query protein .3) Compare each of the sequences of (2) with all sequences of (1), using the program FASTA [ Compare According to the Codex alimentarius , potenti(a) More than 35 % similarity over a window of 80 amino acids of the query protein with a known allergen.(b) A stretch of identity of 6 to 8 contiguous amino acids.This procedure is described in more detail by the expert consultation and the Codex Alimentarius. Potential allergenicity requires further testing of the protein with panels of patient sera and possibly animal exposure tests ,2.. Leader sequences were, if annotated, trimmed from the sequence. The SwissProt allergen list contains 334 mature protein sequences, while the WHO-IUIS allergen list  contains 632 sequences . These two databases contain 236 duplicate entries. The non-redundant combined database contains 730 sequences  windows using a sliding window with steps of a single residue. Each of these windows is compared with all sequences in the allergen database of choice. All database entries showing a similarity higher than a configurable threshold percentage (default is 35%) to any of the 80 aa query sequence windows are flagged. Upon completion of the analysis, a table is shown with all flagged database entries. Per entry, the highest similarity score is given, as well as the number of windows having a similarity above the cut-off percentage. For each allergen database entry identified, more detailed information on the similarity between the allergen and query sequence can be retrieved, such as those areas of both proteins within all 80 aa windows scoring above the cut-off percentage. The similarity score calculated by FASTA can apply to stretches smaller than 80 aa, Allermatch\u2122 converts such a similarity score to an 80 aa window. For example, 40% similarity on a stretch of 40 aa converts to 20% similarity on an 80 aa window.This method looks for short sub-sequences (words), which have a perfect identity with a database entry. The wordsize is configurable (default is 6 aa). The output given is similar to the output given by Mode 1. All database entries with at least one hit are listed and for each of these, more detailed information can be retrieved upon request.The Allermatch\u2122 webtool also offers a full alignment of the query sequence with either of the allergen databases using FASTA. Although this full alignment is currently not required by the FAO/WHO guidelines, the full alignment of protein sequences helps positioning of regions of potential allergenicity in the whole primary structure of the protein. The FASTA output is parsed and information from the allergen database is added and presented.To examine the predictive performance of the FAO/WHO criteria for potential allergenicity, we have performed two tests. The first test determines the percentage of false negative and the second test assesses the amount of false positives. Both tests are performed with standard settings; for the sliding window approach an 80 amino acid window with a 35% similarity cutoff is used and for the wordmatch approach 6, 7 and 8 aa word sizes are tested.The false negative error-rate is estimated by a leave-one-out method, testing all sequences in each Allermatch\u2122 database against that database with the tested sequence excluded. Each sequence not resulting in a hit is considered a false negative. The results of each method/database combination are summarized in Table i.e. T1 (related to Bet v 1), human serum albumin , and human heat shock protein 70 . A selection of unrelated, non-allergenic proteins is therefore likely to give a lower false positive rate. Caution should be taken in interpreting these false hit rates. The used methods might perform differently with other sets of proteins. For example, a member of a completely novel group of valid allergens is likely to generate a false negative result.In the second test, we assess the odds of a false positive by testing 12 protein sequences known to be non allergenic. This is based on non-reactivity of these proteins towards IgE-sera of allergy patients or on the inability to cause IgE-responses in experimental animals  and confirm results, before arriving at conclusions. To prevent false positives as much as possible, one should choose for the well-annotated SwissProt database. To prevent false negatives, the combination of the larger WHO-IUIS database with that of SwissProt is more appropriate. Updates to the SwissProt and WHO-IUIS allergen lists will be incorporated in the Allermatch\u2122 databases on a regular basis.The prediction of potential allergenicity by primary sequence comparison depends on the quality of the data used for comparison. Addition of a non-allergenic or poorly annotated protein to any of the Allermatch\u2122 allergen databases would obviously result in undesired false positives and should be prevented. A workable strategy could be to use multiple databases, Several other websites in the public domain offer sequence alignment facilities that support the prediction of potential allergenicity, such as SDAP ,11, AlleAllermatch\u2122 is an efficient and comprehensive webtool that combines all bioinformatics approaches required to assess the allergenicity of protein sequences according to the current guidelines in the Codex. The application will be kept up to date with the FAO/WHO criteria and the SwissProt and WHO-IUIS allergen lists. It will be extended with other, supplementary methods to support and refine the prediction of allergenicity..Allermatch\u2122 is platform independent and accessible using any Netscape 4+ compatible webbrowser at MF developed and implemented the Allermatch\u2122 webtool. HN provided the domain name registration and advised in the web site development. GK and AP provided the scientific background and constructed the sequence databases. JPN and RvH provided time, resources and ample discussion. All authors have read and approved the final manuscript."}
+{"text": "Based on a large, representative unscreened cohort from Malm\u00f6, Sweden, we have recently reported that a single prostate-specific antigen (PSA) measurement at or before age 50 is a strong predictor of prostate cancer occurring up to 25 years subsequently. We aimed to determine whether this association holds for advanced cancers, defined as clinical stage T3 or higher, or skeletal metastasis at the time of the cancer diagnosis.In 1974\u20131986 blood samples were obtained from a cohort of 21,277 men aged up to 50. Through 1999, 498 men were diagnosed with prostate cancer, and of these 161 had locally advanced or metastatic prostate cancers. Three controls, matched for age and date of venipuncture, were selected for each case. Conditional logistic regression was used to test associations between molecular markers and advanced cancer.p < 0.0005). Two-thirds of the advanced cancer cases occurred in men with the top 20% of PSA levels (0.9 ng/ml or higher).Median time from venipuncture to diagnosis was 17 years. Levels of all PSA forms and hK2 were associated with case status. Total PSA was a strong and statistically significant predictor of subsequent advanced cancer (area under the curve 0.791; A single PSA test taken at or before age 50 is a very strong predictor of advanced prostate cancer diagnosed up to 25 years later. This suggests the possibility of using an early PSA test to risk-stratify patients so that men at highest risk are the focus of the most intensive screening efforts. We have previously shown that a single prostate-specific antigen (PSA) measurement taken at age 50 or younger is a strong predictor of prostate cancer diagnosed up to 25 years subsequently . Our stuOur finding has several implications, most notably that a single PSA test at age 45\u201350 could risk-stratify the population for the intensity of subsequent screening. However, as is well known, more men die with prostate cancer than from prostate cancer, and many prostate cancers affect neither the length nor the quality of a man's life. For example, autopsy studies of men who die from causes other than prostate cancer have found cancer in the prostates of approximately 20% of men at age 60 and approximately 40% at age 70 ,4; this Accordingly, we decided to reanalyze our data to focus on an endpoint of unquestionable clinical significance: locally advanced or metastatic disease at the time of prostate cancer diagnosis. Skeletal metastases cause symptoms, such as pain, and most men with metastases die of their disease ,7; as reSubjects, matching and analytical methods of the Malm\u00f6 Preventive Medicine study have been thoroughly described in previous reports . The MalWe used a case-control study design nested within the Malm\u00f6 Preventive Project cohort. Participants without a prostate cancer diagnosis at the study close date were matched with cases for age and date of baseline venipuncture (\u00b1 3 months for both factors for ~95% of controls). Controls were then randomly selected from matches. The present investigation included only those cases with advanced prostate cancer and their respective controls. Advanced prostate cancer was defined as metastases verified by bone scan or clinical stage at least T3 at the time of prostate cancer diagnosis.There were 161 cases in the study. Although three controls were initially matched for each case, we later found that 47 controls were not followed until diagnosis of the matched case, usually because of early death, leaving 436 controls. Most cases had either two (24%) or three (73%) matched controls; four cases (3%) had one control. Almost all cases  were ages 40\u201350 at venipuncture. The remaining nine cases were aged less than 40: the ages of each of these patients at venipuncture and at diagnosis were 33/49, 35/53, 35/54, 36/51, 37/57, 37/57, 39/53, 39/59 and 39/59. As age was a matching criterion, the age distribution in controls was very similar.PSA was assayed in anticoagulated plasma stored at -20\u00b0C for 17\u201328 years. Although PSA forms, particularly free PSA, in serum are labile in some storage conditions, we previously showed that the levels of both total PSA and free PSA in anticoagulated plasma are unaffected by long-term storage at -20\u00b0C . The levFor our main analysis we defined an event as metastases or clinical stage at least T3 at the time of prostate cancer diagnosis. We conducted conditional logistic regression based on matching for age and date of venipuncture to determine associations between molecular markers and the event. To calculate predicted probability of the event among Swedish men for a given PSA level, we entered PSA in a logistic model using restricted cubic splines with knots at the tertiles. Owing to the 3:1 matched case-control design, the incidence of advanced cancer in our study was close to 25%. To correct the incidence to the expected probability at age 75, we adjusted the probabilities by adding a constant (a Bayes factor) to the linear prediction. The expected probability of advanced cancer at age 75 was derived by taking the estimated probability of prostate cancer by age 75 in Swedish men (10%) , and mulThere were 161 patients matching the criteria for advanced prostate cancer for our main analysis, 62 with skeletal metastases and 149 with clinical stage at least T3 at the time of prostate cancer diagnosis. Fifty patients had both metastases and clinical stage at least T3. The median time from baseline venipuncture to diagnosis was 17 years , with median age at diagnosis 64 years . Eighteen patients (11%) had WHO grade I disease, 73 patients (45%) grade II and 69 patients (43%) grade III, with WHO grade missing for one patient. Five (3%) patients were clinically judged to have stage T1 disease, 7 patients (4%) T2 and 149 patients (93%) T3\u2013T4. Twelve (7%) patients had lymph node metastases, 57 (35%) patients did not and 92 patients were not evaluated for nodal status.Prostate-specific kallikrein measurements are reported in Table p < 0.0005). An increase of 1 ng/ml in total PSA was associated with an odds ratio for advanced cancer of 4.29  2.98, 6.18). Odds ratios from the multivariable model are not presented here because of high collinearity between the markers: for example, the correlation between free and total PSA was 0.963. To assess whether markers other than total PSA could aid in discrimination of advanced cancer  from no cancer diagnosis, we calculated the area under the curve (AUC) for all markers alone using ten-fold cross-validation. Total PSA (AUC 0.791) and complexed PSA (AUC 0.793) discriminated advanced cancer from no cancer most strongly. We then fitted a multivariable model consisting of total PSA, free PSA, free-to-total PSA ratio and hK2; the AUC for this model was 0.785. Hence, there was no evidence that the additional markers added discriminative accuracy above that of total PSA alone. We therefore focused on total PSA for the remaining analyses.Table p < 0.0005). There was an apparent increase in odds ratio for diagnosis after 20 years. We believe that this is a chance finding related to chance differences in controls; the mean total PSA in controls for patients diagnosed more than 20 years following venipuncture was 0.56 ng/ml compared with 0.69 ng/ml in controls for patients diagnosed less than 20 years after venipuncture. Hence, although our data support the hypothesis that total PSA can predict advanced prostate cancer at the time of diagnosis up to 25 years later, we do not believe they can be used to suggest that total PSA predicts later cancers more effectively than earlier cancers.Small increases in total PSA markedly increased the risk of a subsequent diagnosis of advanced prostate cancer Table . For exap = 0.06) remained statistically significant predictors of advanced prostate cancer among men diagnosed at least 20 years after venipuncture.Similar results were found for the other kallikreins: all but hK2  and 382 controls who were ages 44\u201350 at baseline venipuncture . To check whether our results were sensitive to the definition of advanced cancer used, we performed additional analyses with two different definitions. The first was more inclusive, defining advanced prostate cancer as any of skeletal metastasis, clinical stage at least T3, lymph node involvement or WHO grade III at the time of prostate cancer diagnosis. The second was less inclusive and considered only presence of skeletal metastasis at diagnosis. This did not have a major effect on any of the results: some key statistics are shown in Table The Malm\u00f6 Preventive Medicine cohort was enrolled before the PSA era, and there was no subsequent recommendation for prostate cancer screening in this region. The rate of PSA testing has accordingly remained very low up to our current study endpoint . FurtherOur results describe the relationship between prostate kallikreins in blood plasma obtained at a single occasion at age 50 or below and the diagnosis of advanced prostate cancer up to 25 years later. We found that prostate-specific kallikreins were significantly increased decades before the clinical manifestation of advanced disease. The predictive accuracy of total PSA was very high (AUC 0.791). Modestly increased levels of total PSA in the ranges of 1.01\u20132 ng/ml and 2.01\u20133 ng/ml were associated with 7- and 22-fold elevated odds of advanced prostate cancer, respectively. The majority of advanced cancers (66%) occurred in the 20% of the population with the highest PSA levels. It is also noteworthy that our study of archived blood samples is taken from a highly representative, population-based sample. There was no selection based on test results . As such, we can be confident that our reported test characteristics reflect those of the population to which we would like to apply our results.These results confirm our previous finding of an association between PSA levels and subsequent prostate cancer, and suggest that this association is not restricted to cancers unlikely to affect a man's survival or quality of life. Indeed, we found total PSA to be more strongly predictive of subsequent advanced prostate cancer (AUC 0.791) than of any prostate cancer (AUC 0.762). This illustrates the rule of thumb that it is easier to predict more extreme medical events. Free-to-total PSA ratio and hK2, two markers associated more specifically with malignancy, were far less predictive than total PSA, a marker associated with both benign and malignant prostate conditions. This suggests that PSA elevations in cases below or at age 50 may be related to a premalignant state, or to a carcinogenic process, rather than the presence of malignant cells in the prostate.A possible limitation of our study is that any definition of clinically significant prostate cancer is open to question. However, we repeated our analysis altering our definition of advanced cancer to be more restrictive  or more inclusive  and found no important differences in our results. It might also be argued that death from prostate cancer would be the most appropriate endpoint, but owing to a small number of events in our current study cohort, statistical analysis would have been underpowered. Future studies will address the relationship between kallikreins and death from prostate cancer as the cohort matures.Previously, both our group and other investigators have studied the association between PSA level in the blood and the long-term risk of being diagnosed with any stage of prostate cancer, but did not specifically address whether these findings were applicable to diagnosis of advanced tumors ,14-16. OCurrent US prostate screening guidelines recommend that all men over age 50 who have a life expectancy of at least 10 years should have an annual digital examination and PSA test. Results from ongoing screening trials show that these recommendations result in over-diagnosis and over-treatment. For example, the Rotterdam section of the European Randomized Screening Study for Prostate Cancer have shown that almost 50% of screen-detected cancers are indolent  and thus unlikely to affect a man's survival or quality of life . Over-trThis study is based on a previously published case-control study in which we attempted to predict the occurrence of prostate cancer at any stage. We did not re-match for this study and hence patients with a prostate cancer diagnosis were not included in the sample from which controls were selected. We note that kallikrein levels of these 301 participants are likely to be higher than those of Malm\u00f6 Preventive Medicine participants not diagnosed with prostate cancer, thus inflating differences between cases and controls in our current analysis. However, the original Malm\u00f6 Preventive Medicine cohort contains approximately 21,270 participants who could act as controls, from whom 436 controls were randomly chosen to be included in our current analysis. As there were 462 prostate cancer cases, we would expect prostate cancer patients to comprise approximately 2% of the control group. Therefore, we conclude that our failure to sample from non-advanced prostate cancer cases is unlikely to have any major effect on the current results.A PSA level measured at a single occasion in blood drawn at age up to 50 is a very strong predictor of being diagnosed with advanced prostate cancer up to 25 years later. This raises the possibility that screening for prostate cancer could be risk-stratified so that men at highest risk are the focus of the most intensive screening efforts.AUC, area under the receiver operating characteristic curve; EDTA, ethylenediamine tetraacetic acid; PSA, prostate-specific antigen; WHO, World Health OrganizationDr Hans Lilja holds patents for free PSA and hK2 assays.HL is the principal investigator and was responsible for the study design had full access to all data and data analyses, and had final responsibility for the decision to submit the manuscript. GB was mainly responsible for the study cohort, the case-control design nested within the study cohort. DU, CB and HL were responsible for measuring PSA forms and hK2. DU and TB were responsible for reviewing the patient medical records. AMC and AJV were responsible for all biostatistical analyses and workup. MFO, JAE and PTS actively contributed to all elements of the study. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "PSA gene. Studies of a single nucleotide polymorphism  in ARE1 of the PSA gene have been conflicting for risk of prostate cancer and effect on plasma PSA levels. In this nested case\u2013control analysis of 500 white cases and 676 age- and smoking-matched white controls in the Physicians' Health Study we evaluated the association of rs266882 with risk and survival of prostate cancer and prediagnostic total and free PSA plasma levels, alone or in combination with AR CAG repeats. We used conditional logistic regression, linear regression and Cox regression, and found no significant associations between rs266882  and overall prostate cancer risk : 0.88\u20131.67) or prostate cancer-specific survival . Similarly, no associations were found among high grade or advanced stage tumours, or by calendar year of diagnosis. There was no significant association between rs266882 and baseline total or free PSA levels or the AR CAG repeats, nor any interaction associated with prostate cancer risk. Meta-analysis of 12 studies of rs266882 and overall prostate cancer risk was null.Prostate-specific antigen (PSA) is a protease produced in the prostate that cleaves insulin-like growth factor binding protein-3 and other proteins. Production is mediated by the androgen receptor (AR) binding to the androgen response elements (ARE) in the promoter region of the  PSA gene (Prostate-specific antigen (PSA) is a protease produced primarily in the prostate and has widely been used as a diagnostic marker of prostate cancer since the early 1990s (PSA \u2212158 G/A) of the PSA gene (rs266882), identified in 1999  to evaluate the rs266882 polymorphism in prostate cancer. We examined associations with risk, survival and prediagnostic baseline plasma PSA levels, alone and in combination with \u03b2-carotene among 22\u2009071 US male physicians, aged 40\u201384 years in 1982; none had a cancer diagnosis at baseline  on age  and smoking status  to controls selected at random from among men free from diagnosed prostate cancer at the time the case was diagnosed. A total of 676 controls were included. All men provided informed consent, and the protocol was approved by the Institutional Review Board at Partners Healthcare.PSA gene were amplified and the three possible genotypes were distinguished by cutting with the NheI restriction enzyme. The AR gene CAG repeat length was determined by running the PCR-amplified fragments on a denaturing polyacrylamide gel with automated fluorescence detection of the fragments and sizing by Genescan  using conditional logistic regression, matched on age and smoking status, to evaluate the association between the rs266882 polymorphism and prostate cancer risk. We stratified the analysis further according to tumour grade , stage (T1/T2 or T3/T4) and calendar year of diagnosis (1982\u20131992 or 1992\u20131995). The following number of cases and matched controls  for each subgroup: low grade , moderate grade , high grade , localized: T1/T2 , or advanced: T3/T4  tumour stage, diagnosed 1982\u20131992  and diagnosed 1992\u20131995 .To limit the potential for population stratification, we restricted the analysis to white men (94% of PHS cohort is white). Hardy\u2013Weinberg equilibrium of allelic frequency was tested by a goodness of fit \u22121, \u2a7e4\u2009ng\u2009ml\u22121; free PSA: <15%, 15\u201324%, \u2a7e25%) or number of AR CAG repeats  using likelihood ratio tests.Additionally, we assessed whether the association of rs266882 genotype and prostate cancer risk differed according to categorical pre-diagnostic PSA levels . We used Cox proportional hazard models to calculate hazard ratios and 95% CI, adjusted for aggressive disease , age at diagnosis and date of diagnosis (pre/post 1992).AR CAG repeats was evaluated to determine if the effect of rs266882 genotype differed according to AR CAG repeat length. The SAS Statistical Software (Version 9.1) was used for these analyses.Linear regression was used to estimate the association among PSA levels  with rs266882 genotype, separately for cases and controls. An interaction with vs AA genotypes and GA vs AA genotypes. Inverse variance weighting with a random effects model was used to create a summary estimate using the statistical package Stata  and 31% were advanced tumour stage at diagnosis (8% missing) . The majP=0.18). Controlling for matching factors, there was no evidence of an association between PSA genotype and total prostate cancer risk. Moreover, we found no association between the rs266882 genotype and cancer risk when we stratified within tumour grade or stage, or among those diagnosed pre/post PSA era  was similar to other studies of white men ( PSA era .P for interaction \u223c0.41) or free PSA level (P for interaction \u223c0.70).As shown earlier in AR. Shorter AR CAG repeats, which are associated with greater transactivation of the AR, were associated with higher risk of advanced prostate cancer compared with longer AR CAG repeats  and free PSA levels .An earlier study within the PHS cohort examined a trinucleotide CAG repeat polymorphism in Among the 500 men with prostate cancer, 111 men died of their disease. The median survival time between diagnosis and prostate cancer-specific death was 13.5 years (range: <1\u201324.3 years). We found no association between the rs266882 genotype and prostate cancer survival .PSA \u2212158 G/A) polymorphism (rs266882 genotype) and prostate cancer risk, survival and pre-diagnostic plasma PSA levels. We found no association between the PSA polymorphism and cancer risk, overall or by grade, stage or calendar year of diagnosis. Similarly, the rs266882 genotype was not associated with cancer-specific survival. Finally, there was no association between the rs266882 genotype and PSA plasma levels among cases or controls. There were no significant interactions of the rs266882 genotype with PSA plasma level or AR CAG repeat length for any of the outcomes examined.In this large prospective study, we comprehensively assessed the relation of the ARE1 (\u03b22 (TGF-\u03b22)  reported a positive association of the GG allele of rs266882 with a three-fold risk of advanced cancer  , higher serum PSA levels were statistically significantly associated with AA genotype when all ethnic groups were combined, but not for any of the ethnic groups individually, suggesting population stratification may be a possibility for this finding (\u22121, men with the AA genotype had a 28% higher level of PSA than men with the GG genotype (\u22121 (\u22121 (It has been hypothesised that the rs266882 polymorphism may be associated with serum levels of PSA through higher binding affinity of the ARE1 with either the A or G allele. Results of such studies also have been contradictory. Among healthy controls (PSA levels <4\u2009ng\u2009mlAR regulates PSA expression by binding androgen response elements. Some studies of AR, including ours, found shorter CAG repeats associated with increased expression of AR and with higher risk of advanced prostate cancer compared with longer CAG repeats (AR is of interest. PSA gene. Models were adjusted for age and ethnicity, however residual confounding by ethnicity in this very diverse cohort could account for this borderline significant finding. Four additional studies, as well as the present, found no interaction between rs266882 genotype and AR CAG length in relation to plasma PSA levels (The results of this large study with long-term and prospective follow-up, taken together with earlier findings and the results of the meta-analysis, add further support for the conclusion that the rs266882 polymorphism is unrelated to prostate cancer risk, survival or to plasma PSA levels."}
+{"text": "We used a nested case\u2013control design on data from men in four prospective studies  with available stored serum samples to determine whether there was an advantage in measuring both free prostate-specific antigen (PSA) and total PSA as a potential screening test for prostate cancer. Of these men, 247 were verified through national vital statistics offices as having died of prostate cancer, or having developed the disease, and 953 men who did not develop prostate cancer (controls) were selected, matched to cases for age, study centre and sample storage duration. Fixing the false-positive rate at 1%, the prostate cancer detection rate (sensitivity) over the 3 years following serum collection (based on 14 cancers) increased from an estimated 95% using total PSA to 97% using free and bound PSA . Over a 6-year period (based on 41 cancers) a similar difference occurred (52% and 56% detection rates respectively). We conclude that there is no material advantage in adding free to total PSA in prostate cancer screening trials. \u00a9 2000 Cancer Research Campaign"}
+{"text": "Objective(s): Since each unit of Intravenous Immunoglobulin (IVIG) is obtained from different blood donors, blood-borne viral diseases is of high importance. We aimed at investigating the prevalence of various viral infections: Human T-cell Lymphotropic Virus Type 1 (HTLV-I), Hepatitis B (HBV), Hepatitis C (HCV), and Human Immunodeficiency Virus (HIV) among patients referred for IVIG therapy section in Mashhad University of Medical Sciences, Mashhad, Iran.Materials and Methods: A prospective study was conducted on 130 IVIG recipients admitted to different wards of our Medical Centre: Immunology, Hematology, and Neurology, in 2010. After filling the informed consent form, a 5 cc blood sample was initially taken from each patient. Viral infections including HTLV-I Ab, HIV-Ab, HBsAg, HBc-Ab, and HBV-Ab were assessed using the ELISA technique before and after six three months treatment. Results: Test results for HTLV-I Ab, HBsAg, HBc Ab, HIV Ab, and HCV Ab were negative in all cases before IVIG therapy. After receiving IVIG, two female cases with CIDP showed positive results for HBV Ab (0.8%) and HBS Ag (0.8%) with ELISA and only one patient confirmed with PCR. There was not any significant relation between HBV Ag (P=0.14) and HBC Ab with type of disorder (P=0.66).Conclusion: This study showed that HTLV-I viral replication and the other investigated viral transmissions do not occur in plasma; therefore, the IVIG products are safe. Human T-Cell Lymphotropic virus type 1 (HTLV-I) is a member of Retroviridae family which has been associated with two main diseases: myelopathy/tropical spastic paraparesis (HAM/TSP) and adult T cell leukemia (ATL) .et al , Hepatitis C (HCV), Human Immunodeficiency virus (HIV) and Human T-Cell Lymphotropic Viruses (HTLV-I).During the past two decades the studies reported HCV transmission in PID patients that administrated Intravenous Immunoglobulin (IVIG) , HCV inf Moreover, repeated administration of IVIG antibody caused HBV and markedly prolonged incubation period of this disease in experimentally infected chimpanzees , whereas130 patients that received IVIG therapy in different wards of the Medical Centre i.e. Immunology, Hematology, and Neurology were enrolled in this study. This research project is approved by the Ethics Committee of Mashhad University of Medical Sciences (MUMS), which corresponds to the provisions of the Declaration of Helsinki in 1995. All patients\u2019 documents were kept confidential. Study protocol was expressed for all patients and then the informed consent form was obtained. Five cc blood sample was initially taken from each patient. HTLV-I Ab, HIV Ab, HBsAg, HBc Ab, and HBV Ab were measured using the ELISA technique . Similar immunological tests were repeated three months later. Patients with a negative test for HTLV-I Ab, HBs Ag, HCV-Ab, and HIV- who received IVIG were enrolled in this study. ,s studied exclusion criteria were: 1) Patients with a positive HTLV-I Ab, HBsAg, HCV Ab, and HIV test, 2) Patients receiving other blood preparations with the probability of viral transmission, 3) Cases with high risk factors for HIV, 4) Patients with a positive family history of HBV or HCV, 5) Cases with a sexual partner infected with HTLV-I, HBV, HCV, or HIV, and 6) Patients undergoing any kind of surgery or dental procedure three months before or after receiving IVIG therapy. The study variables included age, sex, serum HTLV-I Ab, HBsAg, HCV Ab, HIV Ab, HBc Ab levels, and type of the IVIG preparation. The study2 test or Mann-Whitney test for non parametric data. A two-tailed P-valve<0.05 was considered statistically significant. The collected data was entered into SPSS software, version 11.05  for all statistical procedures. Differences in proportions of viral infections were analyzed by \u03c7This study included 130 patients aged between 11 to 74 years with a mean age of 29.1\u00b10.92 years old. The studied individuals were 76 (58.56%) female and 54 (41.5%) male. The most common diseases being treated by IVIG were Common Variable Immune Deficiency (CVID) (65.4%), Chronic Inflammatory Demyelinating Polyneuropathy (CIDP) (31.5%), and Guillain-Barre syndrome (3.1%).HBsAg testing before IVIG injection showed negative results in all cases, whereas after receiving IVIG, it was reported positive and was confirmed by PCR only in one female patient (0.8%) who had CIDP. The test results for HBc Ab before IVIG therapy were all negative, but after receiving this type of treatment, it turned out to be positive in another female patient (0.08%) with CIDP. ELISA serologic test results for HTLV-I Ab, HCV Ab and HIV Ab before and after IVIG treatment were negative in all the studied cases. In this study, 130 patients under IVIG injections were studied for viral infection transmission after IVIG therapy. The results showed only one case of HBV transmission and another with HBC transmission. The previous study on IVIG recipients about anti-HIV antibodies reported the viral infection transmission in only one case, a female drug addict who belonged to a high risk group (AIDS). They concluded that IVIG recipients should not be regarded as a group at risk for AIDS .et al (P=0.05). However, our study showed that there was no HTLV-I viral replication in IVIG products.Cabral et al  investigTransmission of HCV via IVIG has been documented before -21. It wet al, patients with non-A, non-B hepatitis following IVIG therapy were studied. They showed that 15 out of 17 (88%) cases that were initially negative for HCV-RNA turned in to positive after receiving IVIG therapy (However, in contrast to these studies, some reported high viral infections transmission of HBV and HCV. In a study by Yap  therapy . Healey  therapy . In the present study, it is not clear whether the infection was transmitted through IVIG therapy or some other routes. Moreover, there was not any reported evidence on HIV and HCV transmission by plasma products. In the statistical analysis of the current study, no association was revealed between infection transmission and the type of disease being treated with IVIG. However, most common treated patients were CVIDs. Moreover, previous studies were in accordance with the results of the present study as IVIG recipients were especially those with primary immune-deficiency and those treated with IVIG after transplantation -27.This study showed that HTLV-I viral replication and other investigated viral transmissions do not occur in plasma, therefore, the IVIG products are safe. Furthermore, no relationship was found between viral infections especially HBSAg and HBC Ab among IVIG recipients. However examining the common viral antibodies through more sensitive methods, i.e., PCR, among serum donors is highly recommend. Moreover, the authors greatly recommend that plasma units not enter the IVIG production process unless they have been fully examined during a 3-6 month period. Thus, it seems that from the aspect of viral transmission, today\u2019s IVIG is safe."}
+{"text": "Thermococcus gammatolerans, the most radioresistant archaeon known to date, is an anaerobic and hyperthermophilic sulfur-reducing organism living in deep-sea hydrothermal vents. Knowledge of mechanisms underlying archaeal metal tolerance in such metal-rich ecosystem is still poorly documented. We showed that T. gammatolerans exhibits high resistance to cadmium (Cd), cobalt (Co) and zinc (Zn), a weaker tolerance to nickel (Ni), copper (Cu) and arsenate (AsO4) and that cells exposed to 1 mM Cd exhibit a cellular Cd concentration of 67 \u00b5M. A time-dependent transcriptomic analysis using microarrays was performed at a non-toxic (100 \u00b5M) and a toxic (1 mM) Cd dose. The reliability of microarray data was strengthened by real time RT-PCR validations. Altogether, 114 Cd responsive genes were revealed and a substantial subset of genes is related to metal homeostasis, drug detoxification, re-oxidization of cofactors and ATP production. This first genome-wide expression profiling study of archaeal cells challenged with Cd showed that T. gammatolerans withstands induced stress through pathways observed in both prokaryotes and eukaryotes but also through new and original strategies. T. gammatolerans cells challenged with 1 mM Cd basically promote: 1) the induction of several transporter/permease encoding genes, probably to detoxify the cell; 2) the upregulation of Fe transporters encoding genes to likely compensate Cd damages in iron-containing proteins; 3) the induction of membrane-bound hydrogenase (Mbh) and membrane-bound hydrogenlyase (Mhy2) subunits encoding genes involved in recycling reduced cofactors and/or in proton translocation for energy production. By contrast to other organisms, redox homeostasis genes appear constitutively expressed and only a few genes encoding DNA repair proteins are regulated. We compared the expression of 27 Cd responsive genes in other stress conditions , and showed that the Cd transcriptional pattern is comparable to other metal stress transcriptional responses  but not to a general stress response. While trace amounts of several metals such as iron (Fe), manganese (Mn), copper (Cu), nickel (Ni), cobalt (Co) and zinc (Zn) are essential to support cell growth, elevated amounts induce cell toxicity Arabidopsis thaliana consists of an upregulation of genes involved in sulfur assimilation-reduction and glutathione metabolism in roots, while several genes involved in phenylpropanoid biosynthesis are induced in leaves Saccharomyces cerevisiae exhibit an upregulation of genes involved in glutathione synthesis and sulfur amino acid metabolism, coupled with an upregulation of common stress-response genes Escherichia coli cells downregulate protein biosynthesis, shift to an anaerobic metabolism and enhance several stress response systems Synechocystis PCC6903 produces and repairs Fe-requiring metalloenzymes by a moderate increase of Fe uptake and breakdown of the Fe-rich photosynthesis machinery to release Fe atoms Deinococcus radiodurans induces genes related to iron uptake, cysteine biosynthesis, protein sulfide stress and several DNA repair systems Pseudomonas brassicacearum intraclonal adaptation revealed a reorganization of the cell wall to limit Cd import, a production of polyamines to counteract Cd-induced damages and a downregulation of genes involved in motility During the last decade, transcriptomic analyses performed in Bacteria and Eukarya to investigate Cd toxicity have provided results illustrating the involvement of similar or specific strategies to withstand Cd ions exposure. Human cells exhibit induction of genes encoding metallothioneins, anti-oxidant and heat shock proteins related to cellular protection and damage control mechanisms 2) for several Thermococcus species is higher than 1 mM Thermococcales are largely unknown, in particular for Cd.Metal concentrations in deep-sea hydrothermal chimneys are in the range of 10\u201340 \u00b5M for Cu, 20\u20132000 nM for Co and 40\u20133000 \u00b5M for Zn Thermococcus gammatolerans EJ3T, a hyperthermophilic archaeon isolated from a gamma irradiated enriched culture of microorganisms collected in a North Pacific hydrothermal vent T. gammatolerans to several metals by measuring the MICs for Cd, Co, Zn, Ni and Cu. The global cellular responses following Cd exposure (100 \u00b5M & 1 mM) on T. gammatolerans exponentially-growing cells were analyzed using microarrays containing one 50-mer oligonucleotide probe for each of the 2157 annotated protein-coding genes  in contrast to what was observed for several Bacillus strains Pyrococcus furiosus challenged with H2O2et al. T. gammatolerans resistance to Co and Zn, two other metals found in hydrothermal environments T. gammatolerans is rather more tolerant to Co (2 mM) than other Thermococcale species described in T. litoralis remains the most Zn resistant Thermococcale tested  that completely inhibits rs as in  and alsotrations . A pregrd \u223c5 mM, . In contte AsO4; . T. gamme medium , whereashan 1 mM . The low4 did not modify the growth rate, higher amounts correlated to a concentration-dependent growth decrease compared to an untreated control culture (2S) produced by cellular metabolism. These aggregates were not disrupted even after three thorough washes in a large volume of fresh medium and only traces of Cd were removed from the cell pellet (8 cells/ml). The number of cell aggregates dramatically decreased, and the percentage of Cd retained by cells is more reproducible  is found in the CdS precipitate fraction  is in average 6.7%, thus 67 \u00b5M and they remain able to grow in a fresh medium with or without Cd (data not shown). Cd chelation seems not to be performed by metallothioneins or polyphosphate or glutathione, since this archaeon does not encode orthologous enzymes involved in their biosynthesis We investigated the impact of a Cd exposure on exponentially growing cells in liquid cultures in ASW-AA-Cyst medium. Whereas the addition of 50 \u00b5M or 0.1 mM CdSO culture . Exposur culture , the amo culture . Howeverl pellet . In ordel pellet , and aftoducible . We quantion F4, . The rem7 cells/mL) were exposed to Cd and were collected after 30 min, 120 min and after 270 min (T. gammatolerans' gene content (Kinetics of gene expression changes induced by Cd were performed at two different concentrations (0.1 mM and 1 mM) and at 3 timepoints . A 0.1mM Cd concentration did not affect the growth rate, whereas 1mM Cd induced a transitory growth arrest for 270 min . Late ex 270 min . For eac 270 min  in respo content , most of content . While a content  as alreaT. gammatolerans was sensing Cd not only at a toxic dose (1 mM) but also at a non-toxic concentration (0.1 mM) that does not affect growth. Interestingly, both toxic (1 mM) and non-toxic (0.1 mM) concentrations induce a transcriptomic response predominantly 120min after stress induction  is not affected by Cd exposure in T. gammatolerans.Three different systems are known to mediate cadmium efflux in archaea and bacteria : P-type ATPases (CadA), resistance-nodulation-cell division (RND)-driven trans-envelope exporters (CzcCBA complex) and cation diffusion facilitators   also displays an upregulation following Co treatment T. gammatolerans, encoding CbiQ a putative cobalt transport protein +H+(out)<$>\\raster=\"rg1\"<$>K+(in)+H+(in)) as well as tg1059 coding an osmotically inducible protein C (OsmC) rapidly upregulated after a 30 min exposure to 1 mM Cd. It has been reported that T. kodakaraensis OsmC protein is overexpressed in response to a saline stress but not under oxidative or heat stress However, the transcriptional response after a 120 min treatment with 1 mM Cd reveals that 11 out of the 82 genes encoding putative transporters and permeases  protein  remains Anabaena is exposed to Cd Several genes encoding predicted transcriptional regulators T. gammatolerans and/or a disruption of iron transporters by an unknown mechanism. At a dose of 1 mM Cd, genes encoding subunits of a putative Fe3+ ABC transporter such as tg1016 and tg1705 are upregulated. Moreover, tg0819 encoding the ATP-binding protein of the Fe3+ dicitrate ABC transporter T. kodakaraensis in low-iron medium D. radiodurans cells challenged with Cd T. kodakaraensis is thought to control the expression of the major iron acquisition effectors T. gammatolerans  is upregulated at both doses of Cd. To assess the relationship between iron availability and cadmium tolerance in T. gammatolerans, we analyzed T. gammatolerans growth over several generations, when inoculated at 107 cells/mL and challenged with 1mM Cd either under iron starvation or iron excess (T. gammatolerans under our culture conditions. No growth change was monitored in the presence of 200 \u00b5M DTPA (4)citrate instead of 40 \u00b5M in ASW-AA-Cyst; T. gammatolerans growth is reduced but not impaired in ASW-AA-Cyst medium containing 1 mM Cd since the MIC for Cd is 2 mM  enhances the growth rate and the final cell density when exponentially growing cells were exposed to low Cd doses citrate probably because a large amount of Fe remains trapped by DTPA (200 \u00b5M). We added to the culture as controls other transition metals , at the same high iron concentration (100 \u00b5M), and tested if they are able to rescue cell growth in the presence of DTPA and Cd . We also tested cobalt, because of the presence of cobalamin (Vitamin B12) added to our culture medium. The ASW-AA-Cyst culture medium was not supplemented with Ni but contains Zn and Co at a concentration of 3 \u00b5M and 3.8 \u00b5M respectively. However, as shown in The presence of both Cd and DTPA in the culture medium results in a drastic reduction of the growth rate . A lag pA and Cd . Zn and Synechocystis cells exposed to cadmium also enhance Fe uptake and degrade their photosynthetic apparatus, to provide extra Fe atoms required to repair damaged [Fe-S] clusters T. gammatolerans to repair damaged iron containing proteins  required for metabolic pathways, energy production and cofactor recycling.At a concentration of 1 mM Cd, a large cluster of genes (tg0035\u2013tg0071) organized in 3 operons, is transiently upregulated at 120 min. Interestingly, several ORFs were also found up-regulated after a 30 min of exposure  suggestiThermococcales2 in the absence of sulfur with the reduction of protons (3H+ +2e\u2212 \u200a=\u200a H2+H+). The surplus of protons is exported to generate the proton gradient used by the A0A1-ATPase for ATP synthesis . Indeed, if the transcriptional role of SurR is conserved in T. gammatolerans, the transient loss of sulfur could keep SurR under two forms (oxidized and reduced) that would trigger Mbh genes activation to maintain/enhance re-oxidization of reduced ferredoxins, proton translocation and energy biosynthesis.In the phylogenetically close The second part of the upregulated cluster is composed of the locus (tg0048\u2013tg0054) that codes for a unique membrane-complex among Archaea named Mbc1, composed of proteins that allow Mbh anchorage to the membrane and a MbhH-like subunit whose role in Mbh is unclear . Mbc1 coThermococcus onnurineus  and molecular hydrogen coupled with proton translocation that increases ATP synthesis The last part of this cluster (tg0055\u2013tg0065) encodes homologues of formate hydrogenlyase subunits found in us Mhy2, . T. gammThermococcales with Thermococcus sp AM4, and which encodes an AMP-forming acetyl-CoA synthetase , is also upregulated, likely leading to an increased ATP production  that governs Ni import T. kodakaraensis, thought to be involved in the expression of the major iron acquisition effectors Thermococcales species.Interestingly, different metal stress induced similar expression patterns although the effects of each metal is more or less pronounced but these patterns clearly differ from that of heat shock and \u03b3-irradiation . Only thThermococcales and closely related to the SpoVT/AbrB family. In Bacillus subtilis, AbrB proteins are transition state regulators that play an essential role in the adaptive capacity and for survival when environmental conditions are deleterious Pyrococcus spOT3 bind specific amino acids Pyrococcus sp OT3 T. gammatolerans FFRPs regulators, the 3 halves FFRPs displayed the same behavior under metal stress condition. Their repression could be associated with a fine-tuning regulation of several metabolic pathways observed here.The most upregulated gene (tg1919) at 0.1 mM Cd was also upregulated at 1 mM Cd as well as with 250 \u00b5M Ni as shown by qRT-PCR . Tg1919 While Cd is known to inhibit base excision repair T. gammatolerans regulates less than 50% of these 27 genes (11 out of 27 for \u03b3-rays) and most of them display a transcriptional downregulation. During the heat shock, T. gammatolerans cells induced tg1688 and downregulated tg1034 that encode a small heat shock protein and a multiantimicrobial extrusion protein respectively as observed in P. furiosus (PF1883 and PF1850) after a 1 hr heat shock treatment at 105\u00b0C T. gammatolerans is grown in sulfur containing medium and cells probably re-oxidize the reduced ferredoxins mainly using the Mbx complexes. Therefore, T. gammatolerans is likely able to develop a set of specific strategies to re-oxidized cofactors and produce energy according to the nature of the stress and its impact on metabolic pathways.Both heat shock and \u03b3-Rays damage cellular components. However, Altogether, these results reveal that Cd transcriptional pattern display close similarities with other metal expression patterns but the Cd transcriptional response is not a general stress response since only few Cd responsive genes were similarly regulated by heat shock or \u03b3-Rays.Thermococcales species thriving in these biotopes are continuously exposed to loads of reduced metals and develop strategies to face such harsh environments. Therefore, T. gammatolerans exhibits elevated resistance to several metals as Cd, Co and Zn, and at a lesser extent to others as Ni, Cu and AsO4. For the first time in Archaea, we performed a time-course transcriptomic analysis to draw a global response to Cd toxicity in growth conditions close to its natural habitat . Several bacterial and eukaryal transcriptomes showed that sulfur compounds play a key role to trap Cd for detoxifying the cells T. gammatolerans is based on amino acid catabolism in the presence of sulfur that continuously produces these compounds and may establish the first efficient barrier of protection against metals T. gammatolerans reprograms, at a sublethal Cd dose, a hundred genes which are predominantly up-regulated 120 min after exposure. Previous archaeal transcriptional analyses also highlighted a regulation of only 50\u2013150 genes following other stresses . Strain EJ3T was grown in serum bottles, 1L Schott bottle or in Hungate tubes, under strictly anaerobic conditions at 85\u00b0C in artificial seawater medium containing amino acids, vitamins and cystine (ASW-AA-Cyst) or in complex organic medium with sulfur (VSM- S\u00b0).2.6H2O 3g; MgSO4.7H2O 6g; (NH4)2 SO4 1g; NaHCO3 0.2g; CaCl2.2H2O 0.3g; KCl 0.5g; KH2PO4 0.42g; NaBr 0.05g; SrCl2.6H2O 0.02g; Fe(NH4)citrate 0.01g; Pipes 3g. This basal ASW medium was supplemented with 0.5 mL per liter of modified 10X Wolfe's trace minerals stock solution 2 0.1g; H3BO3 0.1g and NaMoO4.2H2O 0.1g per liter; The artificial seawater medium (ASW-AA-Cyst) contains reduced calcium and phosphate amount and cystine instead of inorganic sulfur (S\u00b0) as electron acceptor to minimized metal complexation 2.6H2O, 0.5g/l trisodium citrate, 3g/l Pipes, 1g/l yeast extract, 4g/l bactotryptone, 5 ml MgSO4 20%, 1 mL CaCl2 5%, 1 mL KH2PO4 5%, 2g/L inorganic sulfur S\u00b0 . Na2S at a 0.1% final concentration was added to reduce the oxygen dissolved in the medium.The complex organic medium (VSM- S\u00b0) is composed of 20g/l NaCl, 0.25g/l KCl, 0.05g/l NaBr, 0.02g/l boric acid, 0.01g/l SrCl2 . Absence of O2 was followed through disappearance of resazurin sodium salt (1 mg/L) pink color included in the media. Cell culture densities were measured by optical microscopy (Olympus BH-29) using a Thoma counting chamber (Microgravure Precis).For both ASW-AA-Cyst and VSM- S\u00b0 media, NaOH was added to adjust the pH to 6.9 before sterilization. Air contained in the bottles or tubes was first removed using a vacuum and replaced by N4, CoSO4, ZnSO4, NiSO4, CuSO4, ArsSO4 and DTPA (diethylenetriamine-pentaacetic acid) were purchased from Sigma. Stock solutions were prepared in MilliQ water, filter sterilized and stored in the dark.CdSO5 cells/mL with different metal concentrations . To prevent metal precipitation with hydrogen sulfide produced by T. gammatolerans preculture, cells were harvested and washed with sterile basal medium before inoculation. The MIC was defined as the lowest concentration of metal that inhibits growth after incubation at 85\u00b0C on a reciprocal shaker. Cell growth was scored at 24 hrs (as in T. gammatolerans was used as a positive growth control. Growth was measured by direct counts on a Thoma counting chamber. Experiments were repeated in triplicate.The minimum inhibitory concentration (MIC) determinations were performed in ASW-AA-Cyst medium as described above to avoid metal complexation and also in Llannos\u2019 medium  treated with Zn  or Ni  before sampling 120 min after metal addition. Cells were filtered to eliminate cystine  and pelleted by centrifugation , immediately frozen and stored at \u221280\u00b0C until further processing. Each culture was repeated twice.5 cells/mL and incubated at 85\u00b0C. When cell density reached \u223c5\u00d7107 cells/mL, 6 serum bottles cultures were rapidly heated at 95\u00b0C (water bath) and incubated during 15 min while the other serum bottles were kept at 85\u00b0C. Cultures (95\u00b0C and 85\u00b0C) were harvested by centrifugation, immediately frozen and stored at \u221280\u00b0C until needed.For the heat shock experiment, a dozen of 50 mL VSM-S\u00b0 medium serum bottles were inoculated at 5\u00d710137Cs \u03b3-Rays source . The same number of non-irradiated cells was kept in ice during irradiation. Irradiated and non-irradiated control cells were then incubated 120 min at 85\u00b0C in fresh VSM-S\u00b0 medium on reciprocal shaker  following the manufacturer's instructions. RNA quantity and quality were assessed using a Nanodrop BD-1000 spectrophotometer (Nanodrop Technologies) and Experion Automated Electrophoresis System (Bio-Rad Laboratories), respectively. The reverse transcription reactions were performed with 400 units of Superscript II reverse transcriptase (Invitrogen), RNA (20 \u00b5g), random hexamers (6 \u00b5g), 1.5 mM dATP, dCTP, and dGTP, 1.2 mM dTTP, and 0.3 mM amino allyl-dUTP (Sigma) for 1.5 hrs at 42\u00b0C. RNA was then hydrolyzed during 15 min at 37\u00b0C by 2 units of RNase H. The cDNAs were purified with Microcon-G30 (Millipore), dried and resuspended in 10 \u00b5L water. Indirect labeling of cDNA  with either cyanine3 (Cy3) or cyanine5 (Cy5) monofunctional NHS-ester (Amersham Bioscience) occurred after the reverse transcription. cDNAs, mono reactive Cy3 or Cy5 dye and 1\u00b5l of 0.5M pH9 sodium bicarbonate are mixed together and incubated 1 hr at room temperature in the dark for the coupling reaction. The fluorescently labeled cDNAs were purified using a Nucleospin Extract II kit (Macherey-Nagel) and dye incorporation was measured using Nanodrop BD-1000 spectrophotometer (Nanodrop Technologies). The two labeled cDNAs were combined, mixed with 10 \u00b5g polyd(A) and 10 \u00b5g yeast tRNA, precipitated with ammonium acetate/ethanol and resuspended in 50 \u00b5L of hybridization buffer .For microarray experiments, total RNAs were extracted with TriReagent\u2122 solution (Sigma) and contaminating DNA was digested using DNA-After a denaturation step for 2 min at 95\u00b0C, the concentrated Cy3 and Cy5 cDNA were dropped onto glass slide microarrays and incubated in a hybridization chamber (Corning) for 17 h at 50\u00b0C. Four post-hybridization washes of 5 min were carried out at room temperature by incubating slides under agitation in a 2\u00d7 SSC/0.1% SDS solution, in a 1\u00d7 SSC solution, in a 0.2\u00d7 SSC solution and in a 0.05\u00d7 SSC solution, respectively. The slides were dried by centrifugation. Fluorescent signals were detected by a GenePix\u2122 4000B laser microarray scanner (Axon Instruments) with a 10 \u00b5m resolution. All slides were scanned using 100% laser power and PMT voltage auto-adjustment. The resulting 16-bit images were analyzed using GenePix Pro 6.0 software (Axon Instruments). Spots or areas of the array with obvious blemishes, deformation or dust were manually flagged and excluded from subsequent analysis. Raw data overview and preprocessing were processed using MANGO  software http://www-archbac.u-psud.fr/genomes/r_tgamma/tgam_Cd_search.html) with visualization tools developed for this project http://www.ncbi.nlm.nih.gov/geo/) under the accession number GSE13546 All the results are available via an integrated database (www.toxnuc-e.org).One 50-mer oligonucleotide probe for each of the 2157 annotated protein-coding genes was designed with Primer3 Software T. gammatolerans as described above. Reverse transcriptions were performed with 5 \u00b5g of total RNA using reverse PCR primer as gene specific primer  using the LightCycler System (Roche Diagnostics). The specificity of each PCR reaction was checked by measuring fluorescent signals during melting curve analysis . Gene expression was calculated relative to the transcripts levels of the gene rpoB  using the formula 2\u2212\u0394\u0394CtTotal RNA was extracted from c primer  and SupeT. gammatolerans culture supernatants (1 mL) were deproteinized using 100 \u00b5L of ice cold 35% perchloric acid leading to protein precipitation after centrifugation (6000g for 2 min). The supernatants were transferred into a new tube and neutralized with 100\u00b5L of ice cold 7N KOH. The sample are then centrifugated at 6000g for 10min, the supernatants are filtered  and directly used. Acetate assays were performed according to the manufacturer's instructions with an enzymatic kit based on the monitoring of NADH production at 340nm using acetyl-CoA synthetase, citrate synthase, and L-malate dehydrogenase .T. gammatolerans, cells were resuspended in 3 mL ultra pure HNO3 (69%) purchased from Sigma-Aldrich , and were sonicated in a Branson 1210 bath during 1 hr. The solution was diluted 1000 times in HNO3 2% prior analysis by ICP-MS. The washing supernatants were diluted 10 times in HNO3 2% prior analysis by ICP-MS. Rhodium was used as internal standard and quantifications were performed by external calibration Late exponentially growing cells (3 independent cultures in 50 mL ASW-AA-Cyst medium) were challenged with 1 mM Cd during 30 min, 120 min, 270 min or 24 hrs. Then, cells were filtered and pelleted by centifigation . The pellet was thoroughly resuspended three times in 15 mL of fresh ASW-AA medium to eliminate free Cd ions. After centrifugation , the three washing supernatants were pooled for analysis. To quantify Cd retained by Figure S1Experimental design of microarray approach.T. gammatolerans exponentially growing cultures were exposed to 0.1 or 1 mM Cd. As a control, cultures without Cd (w/o Cd) were grown in parallel. Time course aliquots were collected 30, 120 and 270 min after Cd exposure. RNA was purified and reverse transcribed. Labeled cDNA were hybridized onto microarrays containing oligonucleotide probes for all ORFs printed in duplicate (GEO accession number GSE13546). The Cd transcriptional response was monitored in two independent cultures for each condition and each biological replication was hybridized twice on a microarray in a dye swap (ds) manner leading to a total of 8 data points per condition and per gene.(TIFF)Click here for additional data file.Figure S2Quantification by ICP-MS of Cd.T. gammatolerans exponentially growing cells (50 mL) were challenged at a cell density of 5\u00d7107 cells/mL with 1 mM Cd during 24 hrs. Following Cd treatment, cells were filtered and pelleted by centrifugation . The pellet was resuspended three times in 15 ml of fresh ASW-AA medium to removed soluble Cd. The CdS precipitates fraction was filtered (F4) before Cd quantification. The samples (F1 to F5) were analyzed by ICP-MS as described in the materials and methods section. The sum of Cd quantities found from fractions F1 to F5 is consistent with the total Cd amount added to the culture .(TIFF)Click here for additional data file.Figure S3Effect of Zn, Ni, Co availability on T. gammatolerans Cd tolerance. Cd susceptibility was analyzed in ASW-AA-Cyst medium (black line) or in modified ASW-AA-Cyst media supplemented with: 1 mM Cd (yellow line), 1 mM Cd and 200 \u00b5M DTPA ; 1 mM Cd and 200 \u00b5M DTPA and 100 \u00b5M iron (brown line), 100 \u00b5M Co (clear pink line), 1 mM Cd and 200 \u00b5M DTPA and 100 \u00b5M Co (red line), 100 \u00b5M Zn (clear purple line), 1 mM Cd and 200 \u00b5M DTPA and 100 \u00b5M Zn (purple line), 100 \u00b5M Ni (clear green line), 1 mM Cd and 200 \u00b5M DTPA and 100 \u00b5M Ni (green line). The effect of metals availability on Cd tolerance was investigated in each culture medium inoculated with 107 cells/mL and incubated at 85\u00b0C on a reciprocal shaker. Cell densities were scored using a Thoma counting chamber. The values are the mean of three independent cultures (SD \u226410%).(TIFF)Click here for additional data file.Table S1Quantification of cellular Cd by ICP-MS. The amounts of Cd retained by T. gammatolerans cells after a 1 mM Cd challenge were determined in exponentially growing cells for the timepoints 30 min, 120 min, 270 min and 24 hrs . Following Cd treatment, cells were filtered and pelleted by centrifugation . The pellet was resuspended three times in 15 ml of fresh ASW-AA medium to removed soluble Cd. The supernatants were pooled before analysis. The fractions were analyzed by ICP-MS as described in the materials and methods section.(XLSX)Click here for additional data file.Table S2List of the 114 Cd-responsive genes. Microarray analyses monitored 161 transcriptional changes  in response to Cd exposure corresponding to 114 different genes. The expression fold changes and the corresponding p-Value are indicated for each Cd concentration tested (0.1 and 1 mM) and timepoints . Up- and downregulated genes are shown in red and green respectively.(XLS)Click here for additional data file.Table S3List of oligonucleotides used for quantitative real-time RT-PCR. PCR primer pairs were designed using Primer3 software (XLSX)Click here for additional data file."}
+{"text": "In November of 2007 a human adenovirus (HAdV) was isolated from a bronchoalveolar lavage (BAL) sample recovered from a biopsy of an AIDS patient who presented with fever, cough, tachycardia, and expiratory wheezes. To better understand the isolated virus, the genome was sequenced and analyzed using bioinformatic and phylogenomic analysis. The results suggest that this novel virus, which is provisionally named HAdV-D59, may have been created from multiple recombination events. Specifically, the penton, hexon, and fiber genes have high nucleotide identity to HAdV-D19C, HAdV-D25, and HAdV-D56, respectively. Serological results demonstrated that HAdV-D59 has a neutralization profile that is similar yet not identical to that of HAdV-D25. Furthermore, we observed a two-fold difference between the ability of HAdV-D15 and HAdV-D25 to be neutralized by reciprocal antiserum indicating that the two hexon proteins may be more similar in epitopic conformation than previously assumed. In contrast, hexon loops 1 and 2 of HAdV-D15 and HAdV-D25 share 79.13 and 92.56 percent nucleotide identity, respectively. These data suggest that serology and genomics do not always correlate. The first human adenoviruses (HAdVs) were isolated in 1953 from a military basic trainee and the adenoid tissue of a pediatric patient as respiratory pathogens In this report, an adenovirus isolated from a bronchoalveolar lavage (BAL) sample that was biopsied from an AIDS patient who presented with fever, cough, tachycardia and expiratory wheezes is examined using genomics and bioinformatics. Based upon the whole genome analysis and supported by limited serological data, this adenovirus belongs to species HAdV-D, and is a \u2018never seen before\u2019 novel virus, to be given the name of HAdV-D59.The work reported herein was performed under United States Air Force Surgeon General-approved Clinical Investigation No. FDG20040024E, by the Institutional Review Board at the David Grant USAF Medical Center. Informed Consent was not required, because we did not use clinical samples.Adenovirus neutralization assays were run as previously described 2 at 37\u00b0C. Thereafter A549 cells were added, mixed, and incubated at 37\u00b0C in 5% CO2 for 7 days. Each assay contained a back titration of the virus used. Living cells were distinguished from dead cells by measuring the amount of Finter's Neutral Red Equal volumes of diluted virus and immune serum were mixed and incubated for one hour in 5% COThe HAdV-D59 genome sequence and its annotation are deposited in GenBank and retrievable as accession number JF799911. In addition, the following HAdV genomes (GenBank accession numbers) were used for comparative computational analyses: HAdV-D8 (AB448767), HAdV-D9 (AJ854486), HAdV-D15 (AB562586), HAdV-D17 (AF108105), HAdV-D19C (EF121005), HAdV-D22 (FJ404771), HAdV-D25 (unpublished), HAdV-D26 (EF153474), HAdV-D28 (FJ824826), HAdV-D36 (GQ384080), HAdV-D37 (DQ900900), HAdV-D46 (AY875648), HAdV-D48 (EF153473), HAdV-D49 (DQ393829), HAdV-D53 (FJ169625), HAdV-D54 (AB333801), HAdV-D56 (HM770721), and HAdV-D58 (HQ883276).Fiber coding sequences used for analysis were as follows: HAdV-D8 (AB448767), HAdV-D9 (AJ854486), HAdV-D10 (AB369368), HAdV-D19C (AB448774), HAdV-D19a (CS301726), HAdV-D22 (FJ619037), HAdV-D26 (EF153474), HAdV-D28 (FJ824826), HAdV-D29 (AB562587), HAdV-D36 (GQ384080), HAdV-D37 (DQ900900), HAdV-D46 (AY875648), HAdV-D48 (EF153473), HAdV-D49 (DQ393829), HAdV-D54 (AB333801), HAdV-D56 (HM770721), and HAdV-D58 (HQ883276). Fiber genes from species HAdV-D genomes were aligned using ClustalW To amplify regions of HAdV-D59 using the polymerase chain reaction (PCR) protocol, conserved adenovirus sequences in species HAdV-D were used to design primers. All amplicons were then sequenced on an ABI 3130xl using a primer walking strategy. The HAdV-D59 genome was sequenced to 8-fold coverage following PCR amplification, with both strands represented.The HAdV-D59 genome was compared against a select number of viral genomes from the HAdV-D group based on its GC content, which is indicative of HAdV species. The selection of which genomes was based on initial overall high nucleotide identity to HAdV-D59. The data presented are final iterations of analyses that initially included all of the sequenced genomes in species HAdV-D.http://www.ebi.ac.uk/Tools/msa/kalign/) for a broad perspective of the genome. SimPlot Whole genome sequences of HAdV-D59 and members of species HAdV-D were first aligned with kalign , via neighbor-joining methods and bootstrap test of phylogeny with replicates set to 1000.Sequence alignments for phylogenomic analysis were generated using the kalign method noted earlier. Phylogenetic trees were constructed from these aligned sequences using Molecular Genetic Analysis Software  for a diagnostic specimen (via bronchoscopy). A virus was cultured from the BAL sample and sent to the California Department of Public Health (CDPH) for further analysis and identification. No other pathogens were isolated from this patient.The virus was propagated at the Viral and Rickettsial Disease Laboratory at the California Department of Public Health, and was identified as an unknown adenovirus by serum neutralization assay. Initial sequence analysis of amplicons derived from the hexon and the fiber genes revealed similarity to gene sequences from HAdV-D25 and HAdV-D56, respectively. The possibility that this virus might represent a novel, recombinant pathogen provoked whole genome analysis in order to characterize this isolate more thoroughly.To elucidate the genetic characteristics of this pathogen (HAdV-D59), we sequenced and analyzed the entire genome. The genome length of HAdV-D59 is 35,072 base pairs , with a http://zpicture.dcode.org/). Comparisons of the HAdV-D59 genome with the whole genome sequences of HAdV-D9, -D22, -D19C, -D25, -D28, -D36, -D56 and -D58 were performed. Consistent with other previously reported viruses in species HAdV-D Since initial DNA sequencing suggested evidence of recombination, we analyzed the HAdV-D59 genome using zPicture, a dynamic blastz alignment visualization program designed for comparative analysis  in the L1 and L2 domains are greater than 2.5% . Madisch et al stated that percent nucleotide identity differences greater than 2.4% and 2.5% in L1 and L2, respectively, strongly suggests identification of a novel HAdV SimPlot and Bootscan results suggest that a large portion of the E3 transcription region  in HAdV-D59 may have originated from a recombination event between either HAdV-D56 or HAdV-D9 and another yet to be described HAdV . InteresPhylogenetic analyses of two genes (CR1\u03b2 and CR1\u03b3 genes) in the E3 region demonstrate that the coding regions for CR1\u03b2 and CR1\u03b3 in HAdV-D59 are closely related to those of HAdV-D9 and HAdV-D56 .SimPlot analyses of the HAdV-D59 fiber was performed on fiber sequences extracted from GenBank. The results suggested that the fiber gene of HAdV-D59 is nearly identical with sequences from both HAdV-D56 and HAdV-D9 . FurtherHAdV-D59 was neutralized by both HAdV-D25 and HAdV-D15 antiserum, yet not by HAdV-D9 antiserum . InteresOur results demonstrated that HAdV-D25 antiserum was more effective at neutralizing HAdV-D59 than HAdV-D25 . Since LEven though HAdV-D15 and HAdV-D25 showed only a two-fold difference via serum neutralization, they were recognized as different serotypes by Rosen et al, because they had different fiber proteins SimPlot analysis of the HAdV-D59 L1 and L2 regions demonstrates high nucleotide identity between the hexons of HAdV-D25 and HAdV-D59 and suggests that they may be derived from a yet undiscovered common ancestor. If L1 and L2 of HAdV-D25 and HAdV-D59 are from a common ancestor, the recombination event may be ancient, as evidenced by 3.52 and 4.81 percent nucleotide differences in the L1 and L2 sequences, respectively. If the recombination events were recent, SimPlot analysis would illustrate near 100% nucleotide identity, which was shown for HAdV-D53 and HAdV-D56 Multiple studies have shown that HAdVs in species HAdV-D recombine with one another in the penton base and hexon genes The section of the HAdV-D59, -D56, and \u2013D9 genomes that encodes for CR1\u03b2, CR1\u03b3, RID\u03b1, RID\u03b2, 14.7K, and fiber show high nucleotide identity . From th"}
+{"text": "In February of 1996 a human adenovirus (formerly known as Ad-Cor-96-487) was isolated from the stool of an AIDS patient who presented with severe chronic diarrhea. To characterize this apparently novel pathogen of potential public health significance, the complete genome of this adenovirus was sequenced to elucidate its origin. Bioinformatic and phylogenetic analyses of this genome demonstrate that this virus, heretofore referred to as HAdV-D58, contains a novel hexon gene as well as a recombinant fiber gene. In addition, serological analysis demonstrated that HAdV-D58 has a different neutralization profile than all previously characterized HAdVs. Bootscan analysis of the HAdV-D58 fiber gene strongly suggests one recombination event. Adenoviridae, that are organized into seven species (A\u2013G) Human adenoviruses (HAdVs) were first isolated in 1953 from pediatric adenoid tissue and from a military basic trainee as respiratory pathogens Currently there are three human adenoviruses  that are associated with gastroenteritis In this report we examined an adenovirus isolated from the stool of an AIDS patient who presented with severe chronic diarrhea. Based upon whole genomic and bioinformatics analysis, this virus appears to belong to species HAdV-D, with the proposed name HAdV-D58.Cryptosporidium parvum and Giardia lamblia were also found in the fecal matter of the patient; therefore, the clinical symptoms cannot be exclusively linked with the adenovirus infection.In February of 1996 an adenovirus was isolated from the stool of a 31-year-old AIDS patient who presented with severe chronic diarrhea and was subsequently hospitalized. Partial sequencing of HAdV-D58, previously published as the Ad-Cor-96-487 strain human adenovirus D (HAdV-D) (57.0% mean). The organization of the 36 open reading frames (ORFs) that were annotated had a genome organization similar to other mastadenoviruses . The neutralization titer was calculated as the maximum dilution of antiserum that completely inhibited viral growth as evidenced by the lack of cytopathic effects.The isolation of HAdV-D58 (previously known as Ad-Cor-96-487) was previously described http://hadvwg.gmu.edu/.This virus was named HAdV-D58 because the number 57 was already taken in GenBank (HQ003817). For rules of adenovirus nomenclature, see The HAdV-D58 genome and annotation have been deposited in GenBank prior to manuscript submission: accession number HQ883276. The following HAdV genomes (GenBank accession numbers) were used for comparative analysis: HAdV-D8 (AB448767), HAdV-D9 (AJ854486), HAdVD19C (EF121005), HAdV-D22 (FJ404771), HAdV-D26 (EF153474), HAdV-D28 (FJ824826), HAdV-D36 (GQ384080), HAdV-D37 (DQ900900), HAdV-D46 (AY875648), HAdV-D48 (EF153473), HAdV-D49 (DQ393829), HAdV-D53 (FJ169625), HAdV-D54 (AB333801), and HAdV-D56 (HM770721).To amplify regions of HAdV-D58 flanking the sequences previously described by Ferreyra et al. AccuPrep Genomic DNA Extraction Kit (Bioneer Corporation). Finally, the viral DNA was resuspended in deionized water and stored at \u221220\u00b0C until use.HAdV-D58 particles were separated from Hep-2 cells by ultracentrifugation. Genomic DNA was acquired from viral particles using http://www.ebi.ac.uk/Tools/clustalw2/index.html. The default parameters for gap open penalty and gap extension penalty were used.The available genomes from species HAdV-D were aligned using the clustalW Hexon coding sequences used for analysis were: HAdV-D8 (AB448767), HAdV-D9 (AJ854486), HAdV-D10 (AB369368), HAdV-D13 (DQ149616.1),HAdV-D15 (AB330096.1), HAdV-D19C(AB448774), HAdV-D20 (AB330101.1), HAdV-D22 (FJ619037), HAdV-D24 (AB330105.1), HAdV-D25 (AB330106.1|), HAdV-D26 (EF153474), HAdV-D27 (AB330108.1|), HAdV-D28 (FJ824826), HAdV-D29 (AB562587), HAdV-D30 (AB330111.1),HAdV-D32 (AB330113.1), HAdV-D33 (AB330114.1), HAdV-D36 (GQ384080), HAdV-D37 (DQ900900), HAdV-D38 (AB330119.1), HAdV-D39 (AB330120.1), HAdV-D42 (AB330123.1), HAdV-D43 (AB330124.1), HAdV-D44 (AB330125.1), HAdV-D45 (AB330126.1), HAdV-D46 (AY875648), HAdV-D47 (AB330128.1), HAdV-D48 (EF153473), HAdV-D49 (DQ393829), HAdV-D51 (AB330132.1), HAdV-D53 (FJ169625.1), HAdV-D54 (AB333801), and HAdV-D56 (HM770721). SimPlot software was used to complete a bootscan analysis of the aligned hexon genes of the available HAdV-D genomes Fiber coding sequences used for analysis were: HAdV-D8 (AB448767), HAdV-D9 (AJ854486), HAdV-D10 (AB369368), HAdV-D19C (AB448774), HAdV-D19a (CS301726), HAdV-D22 (FJ619037), HAdV-D26 (EF153474), HAdV-D28 (FJ824826), HAdV-D29 (AB562587), HAdV-D36 (GQ384080), HAdV-D37 (DQ900900), HAdV-D46 (AY875648), HAdV-D48 (EF153473), HAdV-D49 (DQ393829), HAdV-D54 (AB333801), and HAdV-D56 (HM770721). Fiber genes from species HAdV-D genomes were aligned using ClustalW To analyze the results by Darr et al http://www.ebi.ac.uk/Tools/mafft/index.html). Phylogenetic distances and trees were generated from these aligned sequences by the Molecular Evolutionary Genetic Analysis software . Distances were obtained with pairwise distance calculation using maximum composite likelihood model. Subsequent phylogenetic trees were obtained using bootstrap tests of phylogeny of 1000 replicates with neighbor-joining method featured in the program.Nucleotide alignment of whole genome, penton, L1 and L2 of hexon, hexon, fiber and fiber knob, ORF2 and ORF3 regions were performed using the multiple alignment software based on a \u201cFast Fourier Transform\u201d algorithm  and loop2 (L2) HAdV-D58 coding regions to homologous sequences from other viruses in species HAdV-D.(PDF)Click here for additional data file.Table S2Percent identities of the nucleotide coding sequences of selected E3 HAdV-D58 coding sequences and their homologs.(PDF)Click here for additional data file."}
+{"text": "Here, we report that expression of the immune checkpoint (IC) molecules PD-1, LAG-3, and TIM-3 are differentially expressed on CD4+ and CD8+ T cells in the allogeneic response resulting from a mixed lymphocyte reaction. In these studies, PD-1 expression is higher on CD4+ T cells compared to CD8+ T cells. In contrast, TIM-3 is expressed at higher levels on CD8+ T cells compared to CD4+ T cells with an apparent reciprocity in that PD-1+ CD4+ T cells are frequently TIM-3lo/\u2212, while TIM-3-expressing CD8+ T cells are largely PD-1lo/\u2212. In addition, there is a decrease in the frequency of TIM-3+ CD4+ cells producing IFN-\u03b3 and IL-5 compared to TIM-3+ CD8+ cells. Lastly, the memory T cell phenotype within each IC-expressing subset differs between CD4+ and CD8+ T cells. These findings highlight key differences in IC expression patterns between CD4+ and CD8+ T cells and may allow for more effective therapeutic targeting of these molecules in the future.PD-1, TIM-3, and LAG-3 are molecules shown to have immune modulatory properties, and although initially classified as indicators of T cell hyporesponsiveness, it has become clear that they are also associated with the normal course of T cell activation. Functional studies have focused mainly on CD8 Here, we employ a modification of the mixed lymphocyte reaction (MLR) to dissect the differences in IC expression levels and kinetics on CD4+ and CD8+ T cells to define expression patterns during a physiological immune response. We report that expression of PD-1, LAG-3, and TIM-3 coincides with T cell activation and function, but these molecules are differentially expressed on CD4+ and CD8+ T cells. In addition, CD4+ T cells undergoing proliferation that express PD-1 often exhibit lower expression of TIM-3, while TIM-3 expressing CD8+ T cells have reduced PD-1 expression. These differences extend to cytokine production in that IC expression differs between cytokine-producing CD4+ and CD8+ T cells. Lastly, we find that CD4+ and CD8+ T cells exhibit different memory T cell phenotypes depending on which of these molecules are expressed.Immune checkpoint-expressing CD8ral load , 16, 17.ral load , providiral load , 20. Howactivity . These ptivation , which, + by flow cytometry. Human monocyte-derived dendritic cells (DCs) from healthy donors were purchased from Astarte Biologics  and confirmed to be >90% CD11c+, and >90% CD83+, CD86+, and HLA-DR+ after activation.Purified human pan T cells from healthy donors were purchased from Biological Specialty Corporation . T cells were confirmed to be >95% CD3T cells and DCs were cultured in complete media consisting of RPMI 1640 with Glutamax , supplemented with 5% heat inactivated human serum . DC were cultured overnight with 500\u2009U/mL each of recombinant IL-4 and GM-CSF  and matured with 1000\u2009U/mL recombinant IFN-\u03b3 (Peprotech) and 1\u2009ng/mL LPS (Sigma). Prior to coculture with DC were tested for maturation status by CD83, CD86, and HLA-DR expression by flow cytometry and IL-12 production by ELISA . T cells were labeled with violet proliferation dye 450 (BD) according to the manufacturer\u2019s instructions. T cells were cultured with DC at a 10:1 ratio, incubated at 37\u00b0C for the indicated timepoints, and analyzed for proliferation and activation by flow cytometry. Supernatants were collected and cytokines were measured by multiplex analyses . For ELISPOT analysis, cells were collected on day 6 of MLR and analyzed for IFN-\u03b3 spot production using pre-coated plates . For intracellular detection of cytokines, cells were collected on day 6 of the MLR and treated with PMA (Sigma), ionomycin (Sigma), and GolgiPlug  for 6\u2009h prior to addition of antibodies for flow analysis.All cells were labeled with live/dead dye near infra red (Life Technologies) for dead cell exclusion and treated with Fc Block  prior to staining with fluorescently labeled antibodies. Anti-human antibodies used for DC staining were anti-CD83 PE , anti-CD86-PE-Cy7 (Biolegend), anti-HLA-DR V450 (BD), and anti-CD11c APC (BD). Antibodies used in the T cell characterization were anti-LAG-3 FITC , anti-PD-1 PerCP-Cy5.5, anti-CD3 Alexa700, anti-CD4 Brilliant Violet 650, anti-CD8 Brilliant Violet 570, anti-IFN-\u03b3 PE, anti-IL-5, anti-CD62L PE, and anti-CD45RA Alexa700 , anti-CD25 PE, and anti-IFN-\u03b3 PE-Cy7, anti-IL-4 PE-Cy7 , and anti-TIM-3 APC (R&D Systems). Surface staining and intracellular staining was performed using Cytofix/Cytoperm\u2122 Plus kit (BD) according to the manufacturer\u2019s instructions. Data acquisition was performed using the LSRFortessa flow cytometer (BD). Data analysis was performed with FlowJo version 9 .t-test (Holm\u2013Sidak) and two-way ANOVA (Dunnet\u2019s). Correlation coefficients were determined using two-tailed paired monotonic analysis (Spearman).For all markers analyzed by flow cytometry, isotype controls were used to establish gates by setting gates between 0.5 and 1% positive events. Gates were drawn around each cell division as determined by violet proliferation dye dilution, and subsequent populations were analyzed for expression of CD25, PD-1, LAG-3, and TIM-3. Quantifications were made based on data generated from FlowJo, and statistical analysis was performed using GraphPad Prism version 6. Statistical significance was determined using two-tailed paired + and CD8+ T cells for analysis. As expected, both CD4+ and CD8+ T cells exhibited progressively increasing proliferation  with the majority of T cells divided after 7\u2009days and minimal proliferation by T cells cultured alone. Longitudinal analyses of supernatants collected from these cultures showed levels of TNF-\u03b1, IL-5, and IL-13 increased over time with steady levels of IFN-\u03b3 up to day 7 of MLR, while T cells alone did not produce detectable levels of cytokine , whereas the non-dividing CD4+ and CD8+ populations had a much lower frequency of CD25+ cells  and lower overall mean fluorescence intensity (MFI) as shown in Figure + CD4+ T cells was significantly higher than that of CD25+ CD8+  compared to CD8+ T cells (31.0\u2009\u00b1\u20097.2%). Conversely, CD4+ expression of TIM-3 was lower (53.9\u2009\u00b1\u20094.9%) compared to TIM-3 expression on CD8+ T cells (75.9\u2009\u00b1\u20096.2%). LAG-3 expression on CD4+ (38.8\u2009\u00b1\u20093.8%) was lower than PD-1 and TIM-3; however, LAG-3 expression on CD8+ (49.6\u2009\u00b1\u200915.2%) varied between donors with no significant trend observable. Expression levels of each IC on CD4+ and CD8+ T cells across four donors are summarized in Table + and CD8+ T cells was evident even though analysis was restricted to dividing cells that were CD25+ indicating all were activated. To better understand the relationship between cell division and expression of PD-1, LAG-3, and TIM-3 during T cell activation, further analysis of IC molecule expression was performed by gating on iterative population doublings based on proliferation dye dilution over the course of the 6-day culture. As shown in Figure + and CD8+ T cells exhibited MFI of each IC molecule in correlation with the number of cell divisions, i.e., the more a T cell had divided, the higher the expression of PD-1, LAG-3, and TIM-3, coinciding with the same expression kinetics as CD25. Interestingly, the MFI of CD25 and PD-1 was consistently higher on CD4+ T cells compared to CD8+ T cells, whereas the MFI of LAG-3 and TIM-3 was higher on CD8+ T cells compared to CD4+. The broad distribution of IC expression observed on dividing CD4+ and CD8+ T cells prompted us to evaluate co-expression between these molecules. Upon closer examination of CD25+ proliferating cells, PD-1 presented with differential expression between CD4+ and CD8+ T cells. The majority of CD25-expressing CD4+ T cells also expressed PD-1 (66%), whereas of the CD25+ CD8+ T cells, only 30% expressed PD-1 . By 6\u2009days after stimulation, nearly all dividing CD4+ and CD8+ T cells. However, expression of TIM-3 was significantly decreased on cytokine-producing CD4+ T cells compared to cytokine-producing CD8+ T cells  in the pair comparison was 0.90, p\u2009<\u20090.0001]. Of note, PD-1hiTIM-3lo expression was largely restricted to CD4+ T cells, whereas CD8+ T cells were predominantly PD-1loTIM-3hi . Taken together, these results show that although PD-1, TIM-3, and LAG-3 are upregulated on activated T cells, the expression pattern of these molecules, in particular PD-1 and TIM-3, differs between CD4+ and CD8+ T cells.Having shown that activated and proliferating T cells expressed IC to varying degrees as well as with differential kinetics, we were then interested in analyzing IC expression in association with cytokine production. Based on the cytokine milieu measured in the MLR Figure A, we foc+ and CD8+ T cells, each subset was analyzed for phenotypic memory T cell markers by flow cytometry. To ensure exclusion of naive/non-responding cells, only proliferating cells were analyzed. Nearly all responding CD4+ and CD8+ T cells exhibited either a CM phenotype (CD62L+ CD45RA\u2212) or effector/EM (CD62L\u2212 CD45RA\u2212)  compared to LAG-3-expressing CD4+ (48.2%\u2009\u00b1\u20094.7). LAG-3- and PD-1-expressing CD8+ T cells favored an EM phenotype with less than half the cells exhibiting a CM phenotype . CD8+ T cells expressing TIM-3 had significantly higher frequencies of CM cells compared to the other two IC-expressing CD8+ T cell subsets/populations (52.1%\u2009\u00b1\u20090.9). Distribution of memory subsets on IC-positive cells differed between CD4+ and CD8+ T cells themselves. There were significantly more CD4+ T cells bearing a CM phenotype in LAG-3 and PD-1-expressing populations compared to CD8+ T cells expressing LAG-3 and PD-1  cells. To further understand the difference in IC expression between CD4Over the last decade, several molecules have been shown to be expressed on T cells isolated from patients suffering from chronic viral infection or tumor burden. Poor immune function has been associated with these T cells, thus classifying them as being \u201cexhausted.\u201d Clinical studies evaluating blockade of individual IC molecules, such as PD-1, have shown promising results. In one trial, a response rate of 20\u201325% was reported for patients including those with renal cell carcinoma, melanoma, non-small cell lung carcinoma, and prostate cancer . In a se+ and CD8+ T cells has been reported, it has mainly been in the context of being a phenotypic indicator of T cell exhaustion , the data suggest that activated CD4+ T cells exhibit higher PD-1 expression compared to CD8+ T cells with comparably lower levels of TIM-3 expression, while the inverse expression pattern is observed on activated CD8+ T cells . Although the functional implications of these findings are beyond the scope of this report, results published by others have been mixed regarding expression of IC and T cell function. One study has shown that, in the context of Hepatitis B infection, inhibitory CD4+ T cells maintained high PD-1 expression with low TIM-3  targeting domains could be included in a therapeutic. Another strategy would be to administer different IC blockade (or agonist) to patients depending on their disease state, since kinetics of the immune response can drive upregulation or downregulation of various IC on different cell types. Further studies with different donors  could contribute to a more comprehensive understanding of expression patterns and kinetics, which is undoubtedly required for optimal execution of therapeutics targeting IC. Differences in the kinetics and expression levels of these markers must be taken under careful consideration when designing drugs and biologics aimed to target specific ICs as they may favor certain T cell subsets over another, leading to a wide range of therapeutic outcomes.Overall, our NK cells \u201342; thusNS contributed to data generation and analysis and prepared the manuscript. BH, SS, and LB contributed to data generation and analysis. SS-M contributed to data generation and analysis and reviewed the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "T lymphocytes (T cells) undergo metabolic reprogramming after activation to provide energy and biosynthetic materials for growth, proliferation and differentiation. Distinct T cell subsets, however, adopt metabolic programs specific to support their needs. As CD4 T cells coordinate adaptive immune responses while CD8 T cells become cytotoxic effectors, we compared activation-induced proliferation and metabolic reprogramming of these subsets. Resting CD4 and CD8 T cells were metabolically similar and used a predominantly oxidative metabolism. Following activation CD8 T cells proliferated more rapidly. Stimulation led both CD4 and CD8 T cells to sharply increase glucose metabolism and adopt aerobic glycolysis as a primary metabolic program. Activated CD4 T cells, however, remained more oxidative and had greater maximal respiratory capacity than activated CD8 T cells. CD4 T cells were also associated with greater levels of ROS and increased mitochondrial content, irrespective of the activation context. CD8 cells were better able, however, to oxidize glutamine as an alternative fuel source. The more glycolytic metabolism of activated CD8 T cells correlated with increased capacity for growth and proliferation, along with reduced sensitivity of cell growth to metabolic inhibition. These specific metabolic programs may promote greater growth and proliferation of CD8 T cells and enhance survival in diverse nutrient conditions. In vitro generated Th CD4 T cells are highly glycolytic, performing high rates of glycolysis and minimal fatty acid oxidation. In contrast, inducible CD4 regulatory T cells exhibit low rates of glucose uptake, with high rates of fatty acid oxidation Prior to activation, T lymphocytes (T cells) are quiescent and use only low rates of metabolism to fuel migration and homeostatic proliferation. Once activated by antigen presenting cells, CD4 and CD8 T cells proliferate rapidly and undergo environmentally directed differentiation into diverse effector cell populations. These effector cells optimize the immune response for specific pathogenic challenges. Activated CD4 T cells can differentiate into T helper (Th) subpopulations to combat bacterial or fungal infections, while activated CD8 T cells can differentiate into cytotoxic T cells to combat viral infections. Activation and the transition from na\u00efve to effector lymphocyte greatly alters cellular metabolic demands, as cells require both ATP and biosynthetic components to fuel growth, cell division, migration, and subset differentiation Activation-induced metabolic reprogramming events include elevated expression of metabolite transporters ex vivo and following activation. We demonstrate that activated CD4 lymphocytes have greater mitochondrial mass and are consistently more oxidative, while activated CD8s preferentially adopt a more glycolytic metabolism. This difference is associated with the faster growth and proliferative rates of activated CD8 T cells, along with reduced sensitivity of cell growth to metabolic inhibition.Here, we compare the metabolic programs of CD4 and CD8 lymphocytes both in vivo by stimulation of the TCR by MHC Class II presenting cognate antigen, while the TCR on CD8 T cells binds antigen presented on MHC Class I. These distinct ligands signal through the CD3 components of the TCR complex together with costimulatory molecules such as CD28 to trigger metabolic reprogramming, growth, proliferation, and differentiation in vitro, CD4 and CD8 T cells were isolated from the spleen and lymph nodes of C57BL/6 mice and then stimulated with plate-bound antibodies against CD3 and CD28 in the presence of IL-2. CD4 cells were depleted of CD25+ natural regulatory T cells prior to stimulation. After a 24 h lag period, the viable cell number of CD8 T cells began to rapidly increase. CD4 T cells, however, accumulated more slowly  was similar between resting CD4 and CD8 cells; however, following stimulation CD8 T cells showed more rapid expression of CD25 (IL-2R\u03b1: CD25), which pairs with \u03b3c and IL-2R\u03b2 to form a high-affinity heterotrimeric IL-2 receptor The difference in proliferative response between CD4 and CD8 cells could arise from reduced surface expression of CD3, CD28, or IL-2 receptor on na\u00efve CD4 T cells. However, resting CD4 T cells were found to express slightly more CD3 and CD28 on their surface in comparison to CD8 T cells Fig. 2. ex vivo exhibit only a low oxygen consumption rate (OCR) and extra cellular acidification rate (ECAR)  Fig. 3C.Oxidative metabolism and metabolic flexibility are constrained by mitochondrial oxidative capacity. The maximal respiratory capacity of stimulated CD4 and CD8 T cells were therefore compared. OCR was measured under basal conditions and following the addition of oligomycin (to reduce OCR to baseline by inhibiting ATP synthase), FCCP (to maximize OCR by uncoupling the electron transport chain (ETC) from ATP synthesis), and rotenone plus antimycin A (to block the ETC by inhibiting ETC complexes I and III). The maximal respiratory capacity after uncoupling by FCCP was significantly higher in activated CD4 T cells than in activated CD8 T cells Fig. 4A.CD4 and CD8 T cells were next examined to determine the ability of cells to utilize distinct metabolic fuels that may reflect differential degrees of metabolic flexibility. Nutrients were provided individually to previously activated CD4 and CD8 T cells and OCR was measured. Strikingly, CD8 T cells responded to glutamine with a higher OCR than CD4 T cells Fig. 4B.). Resting CD8 T cells had higher basal cell surface expression of Glut1. After 48 h activation, however, no differences in total or surface Glut1 levels could be detected between CD4 and CD8 T cells  expression in CD4 T cells and an increase in HKI expression in CD8 T cells. In both cell types HKII and HKIII were strongly induced by CD3/CD28 activation, with both activated CD4 and activated CD8 T cells exhibiting similar total levels of HKII and HKIII Fig. 5C. top). CD4 T cells also exhibited higher staining with the potentiometric dye TMRE, both ex vivo and after activation. This suggests that in addition to elevated mitochondrial mass, CD4 cells have a greater mitochondrial membrane potential  middle). Mitochondrial activity can lead to production of reactive oxygen species (ROS) and we also found that resting CD4 T cells had higher levels of staining with the ROS-sensitive dye, DCFDA, and that ROS further increased upon activation ( bottom). Together, our data show that while both CD4 and CD8 T cells reprogram their metabolism following activation, CD8 T cells preferentially adopt a highly glycolytic metabolism, while CD4 cells have greater degree of mitochondrial content and activity.To examine the mechanism of preferentially increased OCR and maximal respiratory capacity after CD4 T cell activation, mitochondrial mass and function were next assessed in each T cell lineage. The relative protein expression of cytochrome c and the OXPHOS mitochondrial complexes were examined in na\u00efve and stimulated CD4 and CD8 lymphocytes Fig. 6A.c plus unique accessory chains; however, they activate PI3K/Akt signaling to different extents, stimulate different JAK/STAT cascades and have different immunoregulatory functions When stimulated with a high dose of anti-CD3, anti-CD28 in the presence of IL-2, CD4 T cells have greater mitochondrial mass and produce more ROS than similarly stimulated CD8 T cells Fig. 6B.T cell priming is refined by both co-stimulatory and co-inhibitory signals from co-receptors. To examine if the metabolic differences between CD4 and CD8 T cells were influenced by co-stimulatory receptors beyond CD28, T cells were activated in the presence of anti-CD3, anti-CD28, plus either anti-4-1BB (CD137) or anti-OX40 (CD134). 4-1BB and OX40 are activation-induced co-receptors that can enhance T cell cytokine release, proliferation, and survival. Activated CD4 and CD8 cells express both receptors; however, 4-1BB stimulation acts chiefly on CD8 cells Collectively, these data demonstrate that while activated CD4 and CD8 T cells are metabolically different, activation-induced metabolic reprogramming in each population is fine tuned by both co-stimulatory and cytokine signals. Metabolic rewiring in both CD4 and CD8 T cells is, therefore, in part dictated by the activation environment but is also distinct due to cell-intrinsic differences between these cell populations.The distinct metabolic phenotypes of CD4 and CD8 T cells may promote specific functional responses. In particular, increased emphasis on glycolysis in CD8 cells may provide biosynthetic intermediates to promote rapid cell growth, while higher mitochondrial oxidative capacity of CD4 cells may allow the use of diverse fuels to efficiently generate ATP under metabolic stress. Prior to proliferation, T cell activation leads to a one-day lag phase in which lymphocytes grow in biomass The increased oxidative capacity of CD4 T cells may allow greater metabolic flexibility. The ability of CD4 and CD8 T cells to grow and proliferate was, therefore, tested with inhibition of glycolysis or electron transport. Isolated CD4 and CD8 T cells were cultured in IL-7 alone to maintain viability or stimulated with anti-CD3 and anti-CD28 for 48 h in the presence of increasing concentrations of either the glycolysis inhibitor 2-deoxyglucose (2-DG) or the mitochondrial complex I inhibitor rotenone. The viability of CD4 and CD8 cells was similarly affected by increasing inhibitor dose Fig. 9C,Na\u00efve CD4 and CD8 T cells perform low rates of oxidative metabolism to maintain survival, perform immunosurveillance, and undergo homeostatic proliferation. After activation, both CD4 and CD8 T cells reprogram towards a highly glycolytic metabolic program, generating energy and biosynthetic materials for rapid growth, proliferation and differentiation. Here we show that CD4 and CD8 T cells share many metabolic characteristics but have key differences that may allow CD8 T cells to rapidly proliferate. Importantly, activated CD8 T cells had a more glycolytic metabolism than CD4 T cells, while CD4 T cells had higher rates of mitochondrial oxidative metabolism and a greater maximal respiratory capacity. Functionally, CD8 T cells grew and proliferated faster than CD4 T cells, and activation-induced growth of CD8 T cells was more resistant to glycolytic inhibition.The finding that T cell subsets are metabolically distinct is consistent with a growing literature of metabolic state coordinating cell function and fate. Within the CD4 lineage, it was recently demonstrated that low doses of the mitochondrial ATP synthase inhibitor oligomycin could block activation-induced proliferation in vivo, where T cells are presented with antigens of varied avidity in the presence of varied cytokine milieus, oxygen tensions, and nutrient environments. Recent studies using nutrient transporter knockout T cells in vivo; however, metabolic comparison of in vivo reprogrammed CD4 and CD8 cells has not yet been performed. Metabolic inhibitors have been shown to suppress T cell responses in EAE, asthma, and graft versus host disease in vivo activation environment alters metabolic reprogramming in specific disease states.While there remained differences between CD4 and CD8 T cells irrespective of activation context, mitochondrial mass and ROS production in each population was dependent on both the strength of the activating stimuli and cytokine context. Metabolic reprogramming is therefore partially dictated by the environment and by co-stimulatory signals. This is likely to be important The signaling pathways that lead to distinct metabolic patterns in CD8 and CD4 T cells are unclear. T cell receptor expression and activation is similar in both subsets, suggesting that receptor proximal events are unlikely to lead to divergent metabolic programs. The metabolic reprogramming differences between these two populations may arise in part from subtle changes in the expression of key metabolic enzymes. CD4 T cells expressed more PKM2 than similarly stimulated CD8 cells. Pyruvate kinase is a central gatekeeper in directing the balance between oxidative and glycolytic metabolism in vitro and in vivo comparisons in vitro or in vivo using the pyruvate dehydrogenase kinase inhibitor dichloroacetate Many cell types adopt aerobic glycolysis as a metabolic strategy to fuel proliferation Collectively, the data presented here demonstrate that CD4 and CD8 T cells utilize distinct metabolic strategies to support specific functional demands. Following activation CD8 T cells had a higher glycolytic flux than CD4 cells, correlating with rapid cell growth. CD4 T cells also induced glycolysis upon activation, but had greater mitochondrial content and oxidative metabolism than CD8 T cells. These metabolic differences are likely fundamental to cellular functions and may provide new directions to selectively target or promote specific T cell subsets.All experiments were approved by the Institutional Animal Care and Use Committee at Duke University Medical Center (Protocol A260-11-10) and strictly followed the National Institutes of Health recommendations cited in the Guide for the Care and Use of Laboratory Animals. The Duke University Medical Center animal management program is accredited by the American Association for the Accreditation of Laboratory Animal Care.mycGlut1) have been described previously Mice expressing endogenous levels of myc-epitope tagged Glut1 . Where indicated cells were activated in the presence of 2-deoxyglucose (Sigma) or rotenone (Seahorse Bioscience).CD4+CD25- and CD8+ T cells were isolated from spleen and lymph nodes to \u226590% purity by magnetic bead negative selection (Miltenyi Biotec). Cells were cultured in RPMI 1640 (MediaTech) supplemented with 10% FBS (Gemini BioProducts), penicillin-streptomycin (Gibco), L-glutamine (Gibco), and 50 \u00b5M \u03b2-ME (Sigma). Where indicated, cells were maintained in a quiescent, viable state using 10 ng/ml IL-7 (eBioscience). Alternatively, cells were stimulated on plates coated with 10 \u00b5g/ml anti-CD3 (clone 2C11) and 10 \u00b5g/ml anti-CD28 (both eBioscience) in the presence of 20 ng/ml IL-2 (Novartis), with a starting density of 0.5\u20131.5\u00d710myc was stained with mouse anti-myc  followed by rat anti-mouse IgG-PE (eBioscience). Mitochondrial content was determined by labeling cells with mitotracker green or Deep Red FM . Reactive oxygen species were assessed by labeling cells with dichlorodihydrofluorescein . Mitochondrial membrane potential was assessed using tetramethylrhodamine ethyl ester . Cell cycle status was assessed by treating methanol fixed cells with RNAse and then labeling DNA with propidium iodide . Viable cell number was determined flow cytometrically by propidium iodide exclusion (1 \u00b5g/ml PI). Proliferation was assayed by flow cytometry of carboxyfluorescein succinimidyl ester  labeled cells. Alternatively, proliferation and viability were assayed simultaneously by co-staining cells with CellTrace Violet  and 1 \u00b5g/ml PI. Cell size was determined by assessment of the visible light forward scatter of PI-excluding cells. Data were acquired on a MacsQuant cytometer (Miltenyi Biotec) and analyzed using FlowJo software (TreeStar).To confirm isolation purity cells were labeled with anti-mouse CD4-eFluor 450, CD8- phycoerythrin. Cy5.5, and Thy1.2- fluorescein isothiocyanate (FITC) . Exofacially tagged Glut1Immunoblotting was performed as described previously Oxygen consumption rate (OCR) and extracellular media acidification rate (ECAR) were measured using a XF24 extracellular flux analyzer (Seahorse Bioscience), as described Statistical analyses were performed with Prism software (GraphPad) by student\u2019s T test or two-way ANOVA. Following ANOVA significant differences were identified by \u0160id\u00e1k multiple comparisons test. Expansion index was calculated using FlowJo software (Treestar). Data shown are mean \u00b1 standard deviation, statistically significant results are indicated (* p<0.05)."}
+{"text": "The inhibitory receptors programmed cell death-1 (PD-1) and T cell immunoglobulin and mucin domain 3 (Tim-3) are well known inhibitory molecules that play a crucial role in regulating CD8+ T cell activation or tolerance. Here, we demonstrate that the co-expression of PD-1 and Tim-3 on CD8+ T cells is up-regulated in AS patients. PD-1+ Tim-3+ CD8+ T cells are enriched for within the central T (TCM) cell subset, with high proliferative activity and CD127 expression. Co-expression of PD-1 and Tim-3 on CD8+ T cells is associated with increased anti-atherogenic cytokine production as well as decreased pro-atherogenic cytokine production. Blockade of PD-1 and Tim-3 results in a decrease of anti-atherogenic cytokine production by PD-1+ Tim-3+ CD8+ T cells and in an augmentation of TNF-\u03b1 and IFN-\u03b3 production. These findings highlight the important role of the PD-1 and Tim-3 pathways in regulating CD8+ T cells function in human AS.T cell-mediated immunity plays a significant role in the development of atherosclerosis (AS). There is increasing evidence that CD8 Atherosclerosis (AS), a chronic inflammatory disease , is cons+ T cells were the focus of interest because they are the predominant T cell type in mouse atherosclerotic lesions[+ T cells in AS has been less investigated. It was recently shown that advanced human atherosclerotic plaques contain activated CD8+ T cells [+ T cells in AS have shown contradictory results. CD8+ T cells have been shown to be more frequent in early lesions and to have anti-atherogenic effects [+ T cells have also been shown to be important in fully established atherosclerotic plaques [+ T cells have a minor role in the progression of AS [+ T cells have different effects on the development of AS [For many years, CD4c lesions. While t T cells ,8. Howev effects ,10. CD8+ plaques  and to h plaques . While son of AS ,14. Recent of AS .+ T responses in a variety of disease conditions. Among these molecules, programmed cell death-1 (PD-1) and T cell immunoglobulin and mucin domain 3 (Tim-3) have attracted the most attention. PD-1 was identified as a marker for T cell exhaustion, and blockade of PD-1 signaling in most cases has shown to revert the dysfunctional state of exhausted CD8+ T cells [+ T cells function, and Tim-3 blockade can restore proliferation and cytokine production of Tim-3+ CD8+ T cells [+ T cells identifies a most severely exhausted CD8+ T cell subset, and combined blockade of PD-1 and Tim-3 pathways has been shown to be the most powerful way to restore the function of exhausted CD8+ T cells [Co-inhibitory molecules are important regulators of CD8 T cells ,17. Tim- T cells ,19. The  T cells ,21. Only T cells ,23,24.+ T cells in human AS has not been previously explored. We hypothesized that co-expression of PD-1 and Tim-3 would demarcate particularly regulatory CD8+ T cells associated with AS. To test this hypothesis, we investigated PD-1 and Tim-3 expression on lymphocytes in the context of AS. In particular, we used detailed surface and intracellular phenotype analyses as well as multifunctional assays to study the role of Tim-3 and PD-1 signaling pathways in regulating CD8+ T cell function in AS.To our knowledge, the functional regulation of PD-1 and Tim-3 on CD8The study group comprised 28 healthy people  with LS columns following the manufacturer\u2019s instructions. CD8+T purity was 96.8\u00b17.8% as determined by flow cytometry (FCM) with FITC-CD8.Blood mononuclear cells were isolated from samples of the femoral artery and peripheral blood of AS patients and healthy individuals. Whole blood containing acid citrate dextrose anticoagulant  was carefully layered over an equal volume of Ficoll  density gradient medium. Tubes containing the blood and Ficoll were centrifuged for 20 min at 2000 rpm. Isolated arterial blood mononuclear cells (ABMCs) and peripheral blood mononuclear cells (PBMCs) were washed two times in phosphate-buffered saline (PBS) and centrifuged for 10 min at 1200 rpm, and cultured in RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum , 100 U/ml penicillin, 100 \u03bcg/ml streptomycin, and 1\u03bcg/ml amphotericin B at 37\u00b0C in 95% air and 5% CO+ T cells were cultured (5\u00d7105 per well) in the presence of 10 \u03bcg/ml anti-Tim-3 , anti-PD-L1 , anti-Tim-3 plus anti-PD-L1, or isotype control. After 48 h, the culture supernatant was collected and further analyzed by FCM.Arterial CD8For intracellular cytokine analysis, brefeldin A (a Golgi inhibitor)  was used for 4h (at the end of the culture) to block the secretion of cytokines into the media after the activation of cells by phorbol 12-myrstate 13-acetate (PMA)  and ionomycin . Cells were harvested and analyzed by FCM for intracellular cytokine production.Cell surface molecular expression and intracellular cytokine production were evaluated using FCM. FITC-conjugated anti-human CD8, CD11c, or CD3, PE-conjugated anti-human Tim-3 or GATA-3, PE/CY7-conjugated anti-human CD4, CD14, CD16, CD69, CD45RO, CD62L, IL-10, TNF-\u03b1 or TGF-\u03b2, APC-conjugated anti-human PD-1 or IFN-\u03b3, Brilliant Violet 421-conjugated anti-human CD127, CD44, IL-4, T-bet or Ki67  were used. For intracellular staining, cells were fixed and permeabilized using a Fix/Perm kit . FCM analysis was performed on a Beckman-Coulter CyAN ADP flow cytometer and analyzed with FlowJo software .The significance of differences between two groups was determined by the post hoc Dunnett t test. Multiple groups were analyzed with GraphPad Prism version 5 by one-way or two-way ANOVA with Bonferroni post hoc t tests. For all statistical tests, a p value <0.05 was considered statistically significant.- Tim-3- cells were decreased in AS patients. Among these immune cells, CD8+ T cells demonstrated the most significant up-regulation of Tim-3 and PD-1. We also compared PD-1 and Tim-3 expression on arterial and peripheral blood lymphocytes form the same donors, and found that the PD-1 and Tim-3 expression levels were accordant in blood form local artery and peripheral vein  and effector memory [+ Tim-3+, PD-1+ Tim-3-, PD-1- Tim-3+, and PD-1- Tim-3- CD8+ T cells in AS. The PD-1+ Tim-3+ population contained the largest fraction of central memory cells, but the lowest fraction of effector memory cells  and memory markers (CD45RO) but higher CD127 than PD-1-Tim-3-T cells . We founry cells . Ki-67 i-T cells . But co-or CD127 .+ T cells in AS exhibited an anti-atherogenic phenotype, fresh isolated ABMCs from local lesional arteries were stimulated with PMA/Ionocymin for 12 h, then stained for CD8 expression, and finally examined for production of pro-atherogenic cytokines (INF-\u03b3 and TNF-\u03b1) and an anti-atherogenic cytokines (IL-10). We found that PD-1+ Tim-3+ CD8+ T cells are associated with decreased pro-atherogenic cytokines but increased anti-atherogenic cytokines [+ T cells following single or combined antibody blockade . We founblockade . We alsoblockade .+ T cells in AS both within the lesional arterial and peripheral venous lymphocytes. Interestingly, the dual expression of PD-1 and Tim-3 on CD8+ T from AS patients was higher than that on CD8+ T cells from healthy individuals both in local arterial and peripheral venous cells, while PD-1- Tim-3- CD8+ T cells were less abundant in AS. Notably, the co-expression of PD-1 and Tim-3 was associated with TCM phenotype and increased anti-atherogenic cytokine production but decreased pro-atherogenic cytokine production by CD8+ T cells from the lesional arterial blood. We further showed that targeting PD-1 and Tim-3 signaling pathways in CD8+ T cells resulted in a decrease in anti-atherogenic cytokine production and in an augmentation in the generation of pro-atherogenic cytokines. These findings, for the first time, highlight the important roles that PD-1 and Tim-3 signaling pathways may play in the regulation of CD8+ T cells function in AS.In the present study, we verified the expression of PD-1 and Tim-3 on CD8+ T cells in AS remains unclear, since contradictory effects of this cell on AS have been reported[+ T cells have different effects on AS may explain this paradox. Although CD8+ effector cytotoxic T lymphocytes promote the development of AS[+ CD25+ T cells has been shown to reduce atherosclerotic lesions[+ CD28high and CD8+ CD25+ T cells can reduce neointima formation after arterial injury [+ Tim-3+ CD8+ T cells are the most severely exhausted CD8+ T cell subset, and combined blockade of ligand-receptor interactions by PD-1 and Tim-3 can restore the function of exhausted CD8+ T cells[+ T cells in human atherosclerotic lesions [+ T cell athero-protective effects, and PD-1+ Tim-3+ CD8+ T cell \u201cexhausted\u201d phenotype, led us to investigate this particular T-lymphocyte subset in human AS.The role of CD8 reported,12,13, ient of AS,12, the c lesions. Furtherl injury ,30. PD-1+ T cells,21. The -/-mice [+ T cells in AS both in lesional arterial and peripheral venous blood. So we wondered whether the Tim-3 and PD-1 signaling pathways are involved in the regulation of CD8+ T cell function in AS. Based on the variable expression of CD44 and CD62L, CD8+ T cells can be divided into two subsets, TCM (CD44+CD62L+) and TEM (CD44+CD62L-)[+ TCM cells but the lowest fraction of CD8+TEM cells were PD-1+ Tim-3+, while the largest fraction of CD8+ TEM cells but the lowest fraction of CD8+ TCM cells were PD-1- Tim-3-. CD8+ TCM cells are less cytolytic and exhibit increased ability of self-renewal compared to CD8+ TEM cells[+ Tim-3+ CD8+ T cells proliferated more than PD-1- Tim-3- CD8+ T cells. This is contrary to what has been observed in chronic viral infection[+ Tim-3+ CD8+ T cells in AS. Further phenotypic profiling demonstrated that these cells expressed less activation and memory markers but higher CD127 than PD-1-Tim-3-CD8+ T cells. CD127 is well known to be lost in exhausted T cells during chronic viral infection[+ Tim-3+ CD8+ T cells, we presume that the co-expression of PD-1 and Tim-3 on CD8+ T cells in AS could not be simply regarded as an \u201cexhausted\u201d marker. Further research in needed to explore the exact mechanism that formation the unique phenotype of PD-1+Tim-3+CD8+T cells in AS.PD-1 is a member of B7 family on T cells . Althoug-/-mice ,32, the 4+CD62L-). We founTEM cells,34,35. Cinfection.We specuinfection. But we + and Tim-3+ CD8+ T cells generate more anti-atherogenic cytokines  and less pro-atherogenic cytokines  than single or negative CD8+ T cells. Single targeting of the Tim-3 and PD-1 pathways has variable effects on the function of CD8+ T cells from the lesional arterial blood, whereas combined targeting of these pathways is highly effective in enhancing pro-atherogenic cytokine and reducing anti-atherogenic cytokine production by PD-1+ Tim-3+ CD8+ T cells from the lesional arterial blood, as well as their respective transcription factors but not affects cells viability (data not shown). Therefore, we hypothesize that higher expression levels of PD-1 and Tim-3 is a physiological response to the atherosclerotic environment. The expression of Tim-3 and PD-1 by CD8+ T cells may be important, at least in part for preservation of AS from deteriorating. However, whether it is the atherosclerotic microenvironment that shapes the distinct CD8+ T subset and that which differentiates CD8+ T cells in this specific microenvironment still needs to be further determined.Chronic inflammation is an important factor during the development of AS. Pro-inflammatory cytokines such as IFN-\u03b3 and TNF-\u03b1 can enhance lesion development, while anti-inflammatory cytokines such as IL-10 have a protective role in AS. Double-+ Tim-3+ CD8+T cells, and that blockage of Tim-3 and PD-1 pathways can suppress the generation of IL-4. While the exact role of IL-4 in AS is still unclear[+ PD-1+ CD8+ T cells plays a similar role as does IL-10. TGF-\u03b2 is a potent anti-inflammatory and anti-atherogenic cytokine[+ T cells. In addition, interference of PD-1 and Tim-3 signaling also has no effect on its production. It has been reported that TGF-\u03b2 has an opposite effect on PD-1 and Tim-3 expression[We also observed more IL-4 production by PD-1l unclear, given il unclear, we susp cytokine, but we xpression; however+ T is up-regulated in human AS, and that this distinct CD8+ T cell subset cannot be simply regarded as an exhausted subset. PD-1+ Tim-3+ CD8+ T cells from the lesional arterial blood produced more anti-atherogenic cytokines, and blockade of PD-1 and Tim-3 signaling pathways aggravated the pro-inflammatory Th1 responses predominate in AS. This knowledge should be considered to add further information regarding risk of AS since PD-1 and Tim-3 are the targets of new therapies for chronic viral infections. Moreover, since single blockade of PD-1 and Tim-3 has been shown to augment atherosclerotic lesion development in experimental AS[Our data demonstrate, for the first time to our knowledge, that the co-expression of PD-1 and Tim-3 on CD8mental AS,23,24, aS1 Fig+ T cells from healthy individuals (NCD8+T) (n = 10) were stained with antibodies against CD44 and CD62L to determine their differentiation phenotype (see + Tim-3+ and PD-1-Tim-3-cells within each population. (B) Quantification of Ki67 staining in PD-1+ Tim-3+ and PD-1- Tim-3- CD8+ T cells; n = 10. (C) CD8+ T cells from venous blood of healthy individuals were stained with antibodies against PD-1, Tim-3, CD45RO, CD69, and CD127, and the PD-1+ Tim-3+ and PD-1-Tim3-phenotypes were compared (n = 10). Horizontal bars denote means. *P<0.05; *** P<0.001, compared with the PD-1+ Tim-3+ group.(A) CD8type see . Percent(PDF)Click here for additional data file.S2 Fig+ Tim-3+, PD-1+ Tim-3-, PD-1- Tim-3+, and PD-1- Tim-3- CD8+ T cells in AS; n = 18. Data represent mean \u00b1 SEM. * P<0.05; compared with the PD-1+ Tim-3+ group.Quantification of flow cytometric analysis of IL-4 (A) and TGF-\u03b2 (B) in PD-1(PDF)Click here for additional data file.S3 Fig+ T cells cultured for 48 h in the presence or absence of anti-Tim-3 antibody (10 \u03bcg/ml), anti-PD-L1 antibodies (10 \u03bcg/ml), or both anti-Tim-3 and anti-PD-L1. Data represent mean \u00b1 SEM (n = 16). CD8+ T cells from the lesional artery. *P<0.05, compared with the control group.Quantification of flow cytometric analysis of IL-4 (left) and TGF-\u03b2 (right) production by CD8(PDF)Click here for additional data file."}
+{"text": "The rate at which HIV-1 infected individuals progress to AIDS is highly variable and impacted by T cell immunity. CD8 T cell inhibitory molecules are up-regulated in HIV-1 infection and associate with immune dysfunction. We evaluated participants (n = 122) recruited to the SPARTAC randomised clinical trial to determine whether CD8 T cell exhaustion markers PD-1, Lag-3 and Tim-3 were associated with immune activation and disease progression. Expression of PD-1, Tim-3, Lag-3 and CD38 on CD8 T cells from the closest pre-therapy time-point to seroconversion was measured by flow cytometry, and correlated with surrogate markers of HIV-1 disease  and CD4 T cell count) and the trial endpoint . To explore the functional significance of these markers, co-expression of Eomes, T-bet and CD39 was assessed. Expression of PD-1 on CD8 and CD38 CD8 T cells correlated with pVL and CD4 count at baseline, and predicted time to the trial endpoint. Lag-3 expression was associated with pVL but not CD4 count. For all exhaustion markers, expression of CD38 on CD8 T cells increased the strength of associations. In Cox models, progression to the trial endpoint was most marked for PD-1/CD38 co-expressing cells, with evidence for a stronger effect within 12 weeks from confirmed diagnosis of PHI. The effect of PD-1 and Lag-3 expression on CD8 T cells retained statistical significance in Cox proportional hazards models including antiretroviral therapy and CD4 count, but not pVL as co-variants. Expression of \u2018exhaustion\u2019 or \u2018immune checkpoint\u2019 markers in early HIV-1 infection is associated with clinical progression and is impacted by immune activation and the duration of infection. New markers to identify exhausted T cells and novel interventions to reverse exhaustion may inform the development of novel immunotherapeutic approaches. After being infected with HIV, the pace of disease progression is highly variable between individuals. Some stay well with functioning immune systems for many years, whilst others progress to AIDS quickly. Understanding the factors that underpin these differences is important and may relate to factors such as viral adaptation and immune exhaustion. Recently, there has been interest in certain molecules\u2014called \u2018exhaustion\u2019 or \u2018immune checkpoint\u2019 markers\u2014which reflect how well the immune system functions. Recent trials show that therapies directed against these molecules can improve anti-cancer immunity. It is known from laboratory experiments that these markers are abundant in HIV infection suggesting that the human immune response to HIV is not fully effective. The relevance of these markers in patient cohorts remains unclear. This study measures three exhaustion markers\u2014PD-1, Tim-3, Lag-3 \u2013in individuals with HIV recruited to a randomised controlled trial of therapy in early HIV infection called SPARTAC. We find a complex picture in which these markers alone, together and in combination with other markers that reflect T cell activation (CD38) help predict the speed of clinical progression and immune decline, with differing effects dependent on the duration of infection. We propose that therapies directed against these markers could impact disease progression, vaccine efficacy or even newer curative strategies. Following infection with Human Immunodeficiency Virus Type 1 (HIV-1) the rate at which an individual develops AIDS is highly variable ranging from \u2018progressors\u2019 who, if untreated, experience rapid CD4 T cell decline in months to years to \u2018elite controllers\u2019, who spontaneously maintain undetectable plasma viraemia, often for decades. The tempo of HIV-1-associated disease progression might rest with particular characteristics of HLA class I molecules and the CD8 T cell immune responses which they dictate . When a We sought to determine whether, in primary HIV-1 infection (PHI), these indicators of CD8 T cell exhaustion would correlate with surrogate markers of disease , CD4 T cell count) and actual time to progression within a strictly defined patient population enrolled into a randomized clinical trial of early antiretroviral therapy (ART). In particular, we wanted to study exhaustion in activated CD38 CD8 positive T cell populations, as CD38 expression has also been correlated with disease progression. We found significant associations between ICR expression and both pVL and disease progression, and an enhanced effect when co-expressed on activated T cells.10 RNA copies/ml, respectively, without significant differences in participants enrolled \u2264 or > 12 weeks into PHI.366 participants were enrolled into the SPARTAC trial. Of 156 The expression of PD-1, Tim-3 and Lag-3 on the surface of CD8 T cells and the subset of activated CD8 T cells that co-expressed CD38 was determined by flow cytometry Fig A in  and was Correlations between the expression of ICRs on CD8 and CD38 CD8 T cells with CD4 T cell count, pVL and time since seroconversion were assessed . PD-1 anNext we evaluated PD-1, Lag-3 and Tim-3 expression and progression to the SPARTAC trial primary endpoint (either CD4 T cell count <350 cells/\u03bcl or (re)initiation of ART). PD-1 expression at baseline on CD8 and CD38 CD8 T cells predicted clinical progression  . This efCox proportional hazards models were used to explore further the association between baseline PD-1 expression on bulk CD8 T cells and clinical progression . The assCox models also demonstrated an effect of bulk CD8 T cell Lag-3 expression on progression when adjusted for ART initiation and CD4 T cell count , but not when including pVL . As for Interestingly, on restricting the Cox models to CD38 CD8 T cells, all three markers were associated with disease progression in unadjusted models or when correcting for ART and CD4 T cell count although, again, not when adjusting for baseline pVL .Having explored the impact of single exhaustion markers on clinical outcome, we next measured whether their co-expression would predict progression Fig D in . In survIn Cox proportional hazards models, there was a strong association with high PD-1/Tim-3 expression on CD8 T cells (above the median) with faster progression (HR 1.64 (95% CI 1.04. 2.60); p = 0.034), after adjusting for baseline CD4 T cell count, ART and pVL. The significant Kaplan-Meier analysis for PD-1/Lag-3 co-expression was not supported by Cox models when adjusting for baseline pVL.CM), effector memory (TEM) and TEMRA constituted 14.1, 4.4, 49.6 and 25.9%  of the CD8 T cell population, respectively .Having determined associations between PD-1, Tim-3 and Lag-3 expression and clinical progression, we next identified the CD8 T cell memory subsets on which these markers were present Fig E in . We analectively . PD-1 andim/Eomeshi are associated with an exhausted functional phenotype with reduced polyfunctionality. ,34. 33,3Tim-3 expression showed distinct associations with clinical disease progression and may even be antagonistic to PD-1 early in HIV-1 infection; Tim-3 was associated with delayed progression in participants identified within 12 weeks of seroconversion, but no effect was seen for Tim-3/PD-1 co-expression. This protective Tim-3 effect was not seen for individuals recruited later than 12 weeks after seroconversion, for whom PD-1/Tim-3 co-expression was disadvantageous. The mechanism of the immuno-regulatory effect of Tim-3 is not clear , but thiEM memory subset. Further in depth longitudinal analyses of these responses in HIV-1 specific T cell populations in conjunction with their activation status will be needed to confirm our findings. Secondly, other investigators have suggested that in acute HIV-1 infection PD-1 expression does not necessarily equate to exhaustion , PD-1 APC 0.5 \u03bcg/100\u03bcl (MIH4)[eBioscience], Tim-3 PE 0.05 \u03bcg/100\u03bcl (344823)[R&D], Lag-3 FITC 2 \u03bcg/100\u03bcl (17B4)[LifeSpan Bioscience] and CD38 PE-Cy7 0.4 \u03bcg/100\u03bcl (HIT-2)[Biolegend]. The isotype controls for Lag-3 was IgG2a isotype FITC 0.4 \u03bcg/100\u03bcl (C45)[AdB serotech], for PD-1 was IgG1 isotype APC 0.4 \u03bcg/100\u03bcl (p3)[eBioscience] and for Tim-3 was IgG2a isotype PE 0.4 \u03bcg/100\u03bcl (R35-95)[BD Bioscience]. Cell population gating was performed based on mean fluorescence intensity \u201cminus one\u201d (FMO)  and unstAnalyses examining ICR expression on T cell memory subsets used cryopreserved PBMCs from the HEATHER cohort. Cells were stained in BD Horizon Brilliant Stain Buffer (BD) containing all antibodies and Live/Dead Near IR at 1 in 300 dilution (Life Technologies) in 96 well-V bottom plates at 4\u00b0C. PBMCs were stained with the following antibodies: CD3 Brilliant Violet (BV) 570 0.16 \u03bcg/100\u03bcl (UCHT1), CCR7 Pacific Blue 1.8 \u03bcg/100\u03bcl (G043H7)[BioLegend], CD4 BV 605 0.05 \u03bcg/100\u03bcl (RPA-T4), CD8 BV 650 0.012 \u03bcg/100\u03bcl (RPA-T8)[BD], PD-1 PE eFluor 610 0.2 \u03bcg/100\u03bcl (eBioJ105), Lag-3 PE-Cy7 0.024 \u03bcg/100\u03bcl (3D5223H), CD45RA FITC 0.4 \u03bcg/100\u03bcl (HI100)[eBioscience] and Tim-3 PE (as above).CM as CD45RA-/CCR7+, TEM defined as CD45RA-/CCR7- and TEMRA as CD45RA+/CCR7-.  and CD38 AlexaFluor 700 0.1 \u03bcg/100\u03bcl (HB-7)[BioLegend]. Fixation and permeabilisation were performed with Foxp3 Buffer Set (BD) as per manufacturer\u2019s instructions in reduced volumes to facilitate staining in 96-well plates. Staining of intracellular epitopes was performed at room temperature in PBS containing 0.5% BSA and 0.1% sodium azide with antibodies to CD3, CD4, CD8 (as above), and T-bet FITC 2 \u03bcg/100\u03bcl (4B10)[BioLegend] and Eomes eFluor660 0.024 \u03bcg/100\u03bcl (WD1928)[eBioscience]. All samples were acquired on a LSR II (BD). Data were analysed using FlowJo Version 10.8.0r1 (Treestar). Na\u00efve T cells were defined as CD45RA+/CCR7+, TAssociations between T cell exhaustion markers on CD8 and CD38 CD8 positive cells and pVL or CD4 T cell count were evaluated using Spearman correlations. The fitted line, superimposed in the relevant scatterplots, was estimated through linear regression. When multiple markers were tested for correlations with other variables (e.g. baseline CD4 T cell count or HIV-1 RNA), the adjusted overall critical p-values were also reported. Adjustments were performed using the method of Simes  targetinIn the analyses from the HEATHER cohort, comparison of exhaustion marker expression across three or more groups was performed using Friedman\u2019s test . Where a difference was found, subsequent pairwise comparisons between groups (Dunn\u2019s test) were performed with adjustment for multiple comparisons targeting on overall significance level of 0.05. Expression of exhaustion markers between two T cell subsets was compared using Wilcoxon matched-pairs signed rank test. Statistical analyses were performed using GraphPad Prism 6.0f.S1 TextTable A. Summary of log rank test results from Fig D in Table B. Demographic and clinical characteristics of participants in the HEATHER trial included in the analyses. Table C. Correlations of PD-1, Tim-3, Lag-3, PD1/Tim-3, PD1/Lag-3 and Tim-3/Lag-3. Table D. Cox Model adjusted for Tim-3, PD-1, Lag-3, baseline CD4 and ART. Fig A. Gating strategy: proportion of the total CD8 T cell population that express PD-1, Tim-3, Lag-3 or CD38. Fig B. Expression of PD-1, Tim-3 and Lag-3 on CD8 T cells in healthy controls and Primary HIV Infection. Fig C. Impact of Tim-3 and Lag-3 expression on CD38 CD8 T cells on clinical outcome. Fig D. Impact of co-expression at baseline on CD8 T cells of PD-1, Tim-3 and Lag-3 on clinical outcome. Fig E. Gating strategy used for the characterisation of PD-1, Tim-3 and Lag-3 on memory subsets. Fig F. Correlation of CD39 expression with PD-1, Lag-3 and Tim-3.(DOCX)Click here for additional data file."}
+{"text": "The blockade of CD160/CD160-ligand interaction restored CD8 T-cell proliferation capacity, and the extent of restoration directly correlated with the ex vivo proportion of CD160+ CD8 T cells suggesting that CD160 negatively regulates TCR-mediated signaling. Furthermore, CD160 expression was not up-regulated upon T-cell activation or proliferation as compared to PD-1. Taken together, these results provide evidence that CD160-associated CD8 T-cell functional impairment is independent of PD-1 expression.Expression of co-inhibitory molecules is generally associated with T-cell dysfunction in chronic viral infections such as HIV or HCV. However, their relative contribution in the T-cell impairment remains unclear. In the present study, we have evaluated the impact of the expression of co-inhibitory molecules such as 2B4, PD-1 and CD160 on the functions of CD8 T-cells specific to influenza, EBV and CMV. We show that CD8 T-cell populations expressing CD160, but not PD-1, had reduced proliferation capacity and perforin expression, thus indicating that the functional impairment in CD160 T-cell immune response is regulated by a variety of molecules known as co-inhibitory receptors. The over expression of co-inhibitory receptors has been observed in several chronic viral infections such as HIV disease, and is found to be associated with severe T-cell dysfunction. Recent studies have demonstrated that the co-expression of several co-inhibitory receptors correlated with greater impairment of CD8 T cells. However, the relative contribution of individual co-inhibitory receptors to the regulation of T-cell functions remains unclear. In order to shed light on these issues, we have evaluated the influence of the expression of 3 major co-inhibitory receptors such as PD-1, 2B4 and CD160 on CD8 T-cell functions such as proliferation, cytokines production and expression of cytotoxic granules. We demonstrate that CD160-associated CD8 T-cell functional impairment is independent of PD-1 expression and that the blockade of CD160 signaling may partially restore CD8 T-cell functions. Co-stimulatory and co-inhibitory molecules play a major role in the regulation of antigen-specific T-cell responses Co-stimulatory/co-inhibitory molecules are commonly divided into 4 families: 1) the B7 family including CD28, Cytotoxic T-lymphocyte associated protein-4 (CTLA-4), Programmed Death receptor-1 (PD-1), Inducible T-cell Costimulator (ICOS) and B- and T-lymphocyte attenuator (BTLA), 2) TNF-\u03b1 receptor family including CD27, 3) the CD2/SLAM family, including Signaling Lymphocyte Activation Molecule (SLAM), 2B4 and CD48 and 4) the immunoglobulin (Ig) family including T-cell Immunoglobulin mucin-3 (TIM-3), lymphocyte Activation Gene-3 (LAG-3) and CD160 During the past decade, many studies performed in mice and humans have underscored the role of co-inhibitory molecules in the functional impairment  of antigen-specific T cells during chronic viral infections such as human immunodeficiency virus-1 (HIV-1) or hepatitis C virus (HCV) Recent studies have demonstrated that HIV-specific CD8 T cells co-expressing several co-inhibitory molecules such as PD-1, CD160 and 2B4 were significantly more functionally impaired than CD8 T cells expressing only one co-inhibitory molecule + CD8 T cells had reduced proliferation capacity, IL-2 production and perforin expression regardless of PD-1 expression thus providing evidence that CD160-associated T-cell impairment is independent of PD-1.In the present study, we evaluated the impact of the expression of co-inhibitory molecules such as 2B4, PD-1 and CD160 on CD8 T-cells specific to influenza (Flu), Epstein Barr virus (EBV) and cytomegalovirus (CMV). We demonstrated that CD160ex vivo using peptide-MHC class I multimer complexes  showed that CMV and EBV-specific CD8 T cells expressed significantly higher levels of 2B4  and CD160  as compared to Flu-specific CD8 T cells (+CD160+PD-1+ and 2B4+CD160+PD-1\u2212 cells were significantly higher in CMV and EBV-specific CD8 T cells than in Flu-specific CD8 T cells (P<0.025) .The expression of PD-1, 2B4, and CD160 co-inhibitory molecules was assessed by multiparametric flow cytometry in CMV-, EBV- and Flu-specific CD8 T cells from 22 healthy individuals omplexes . The gatomplexes . The use T cells . Interes T cells . HoweverP<0.025) . Of noteP<0.025) . Flu-speulations . Interesex vivo frequency of virus-specific CD8 T cells (measured by MHC class I multimer staining). The representative flow cytometry profiles and the cumulative data showed that the proliferation index of Flu-specific CD8 T cells was significantly higher than that of EBV and CMV-specific CD8 T cells    . We thenctively) . In addiulations . These d+CCR7+) were excluded from the analysis. Cell populations were then stimulated with  peptides in the presence of antigen presenting cells (CD8-depleted PBMCs) for 6 days . The representative flow cytometric profiles as well as the cumulative data show that the proliferation capacity of virus-specific 2B4+CD160+PD-1+, 2B4+CD160+PD-1\u2212, 2B4+CD160\u2212PD-1+, 2B4+CD160\u2212PD-1\u2212 CD8 T-cell populations was significantly reduced as compared to 2B4\u2212CD160\u2212PD-1+ and 2B4\u2212CD160\u2212PD-1\u2212 CD8 T-cell populations (P<0.05) (+CD160\u2212PD-1\u2212 and 2B4\u2212CD160+PD-1+ CD8 T cells was not significantly different (P\u200a=\u200a0.0628)  . Of note\u200a0.0628) . These d+CCR7+) were excluded from the analysis. Cell populations were then stimulated with coated anti-CD3 and anti-CD28 MAbs for 6 days, and the proliferation capacity was assessed using CFSE flow cytometry based assay (P<0.05) (+CD160+PD-1+ and 2B4+CD160+PD-1\u2212 CD8 T cells was not significantly different (P\u200a=\u200a0.6786), suggesting that CD160-expessing CD8 T cells are endowed with reduced proliferation capacity, independently of PD-1 expression.To determine the intrinsic CD8 T-cell proliferation capacity, CD8 T-cell populations were sorted based on PD-1, 2B4 and CD160 expression. Of note, na\u00efve CD8 T cells (CD45RAed assay . The rep(P<0.05) . Interes+CCR7+) was excluded from this analysis. The representative flow cytometric profiles as well as the cumulative data showed that the frequencies of IL-2 and IFN-\u03b3-producing cells were significantly reduced in CD160+ CD8 T-cell populations as compared to CD160\u2212 CD8 T-cell populations (P<0.05)  and between 2B4+CD160\u2212PD-1+ and 2B4+CD160\u2212PD-1\u2212 CD8 T-cell populations  (\u2212CD160\u2212PD-1+ CD8 T-cell populations contained higher frequencies of IL-2-producing cells than any other CD8 T-cell population (P<0.05) (In chronic virus infections the loss of CD8 T-cell proliferative capacity is commonly associated with a progressive reduction of IL-2 production (P<0.05) . The frectively) . In addi(P<0.05) , demonst\u2212CCR7+) was significantly enriched in 2B4\u2212CD160\u2212PD-1\u2212 and 2B4\u2212CD160\u2212PD-1+ CD8 T-cell populations, the effector memory compartment  was significantly enriched in PD-1+ CD8 T-cell populations  and the terminally differentiated effector memory compartment  was significantly enriched in the 2B4+CD160+PD-1\u2212 CD8 T-cell population   . These d+CD160+PD-1+ and 2B4+CD160+PD-1\u2212 CD8 T-cell populations were enriched in perforin or granzyme B. Indeed, cytotoxic CD8 T cells exert their antiviral activity primarily through the secretion of cytotoxic granules containing perforin and granzymes +CCR7+) was excluded from this analysis. As shown in the representative flow cytometric profiles and the cumulative data perforin and granzyme B were significantly enriched in 2B4+ CD8 T-cell population as compared to 2B4\u2212 CD8 T-cell populations (P<0.05) . However, perforin expression was significantly reduced in 2B4+PD-1+CD160+, 2B4+PD-1\u2212CD160+ and 2B4+PD-1+CD160\u2212 CD8 T-cell populations as compared to the 2B4+PD-1\u2212CD160\u2212 CD8 T-cell population . Interestingly, perforin expression was significantly reduced in 2B4+PD-1+CD160+ as compared to 2B4+PD-1\u2212CD160+ and 2B4+PD-1+CD160\u2212 CD8 T-cell populations . Finally, the potential association between perforin and co-inhibitory molecule expression was assessed within each differentiated CD8 T-cell subset i.e. na\u00efve, central memory, effector memory and terminally differentiated effector memory. The representative flow cytometric profiles and the cumulative data showed that perforin expression was significantly enriched within 2B4-expressing CD8 T cells in both EM (P\u200a=\u200a0.0011) and TDEM (P<0.0001) (P\u200a=\u200a0.0063) and TDEM (P\u200a=\u200a0.026) and in PD-1-expressing CD8 T cells in both EM (P\u200a=\u200a0.0391) and TDEM (P\u200a=\u200a0.00031) (P>0.05) between 2B4+CD160+PD-1\u2212 and 2B4+CD160+PD-1+ CD8 T-cell populations   consiste<0.0001) . Interes0.00031) . Taken t0.00031) . Of note0.00031)  was not ulations , suggestP<0.0001; and 7.6 fold increase; P<0.0001, respectively)    (P<0.05)  (P>0.05)  (\u2212CD160\u2212PD-1+ and 2B4+CD160+PD-1+ CD8 T-cell populations (+CD160+PD-1\u2212 CD8 T-cell population expressed the highest levels of CD160 (MFI) and 2B4 (MFI) as compared to any other CD8 T-cell population  blocking anti-CD160 monoclonal antibodies (mAbs), 2) blocking anti-PD-L1/2 mAbs, 3) combined blocking anti-CD160 and anti-PD-L1/2 mAbs and 4) isotype controls. Of note, anti-CD160 MAbs did not show any agonistic potential either in absence or in presence of TCR signal (data not shown), as assessed by CD69, CD107a and BCL-2 expression or TNF-\u03b1 and IFN-\u03b3 production (data not shown). The representative flow cytometric profiles showed that both anti-CD160 and anti-PD-1 mAb treatments individually increased the proliferation capacity of EBV-specific CD8 T cells . In addictively) . The eff; N\u200a=\u200a5)  and 2) c; N\u200a=\u200a6) . The cum(P<0.05) . However(P>0.05) . In addictively) . Of noteulations . Interespulation . Taken tex vivo expression levels of CD160 and PD-1. The representative flow cytometric profiles as well as the cumulative data showed that CD160 signaling blockade was significantly more potent in cells harboring high level of CD160 (percentage of virus-specific CD8 expressing more than 20% of CD160) versus cells harboring low level of CD160 (percentage of virus-specific CD8 expressing less than 20% of CD160) (P<0.0001)    . In addictively) . Interesctively) .Previous studies have indicated that PD-1 expression increased following T-cell stimulation and activation Several studies have demonstrated that the increased expression of co-inhibitory molecules including PD-1, 2B4 and CD160 during chronic viral infections is associated with CD8 T-cell dysfunction versus chronic viral infections), the cytokine milieu, the nature of the infected cell population.In the present study, we have evaluated the impact of individual co-inhibitory molecules expression such as 2B4, PD-1 and CD160 on virus-specific CD8 T-cell functions. To address this issue, we have performed both phenotypic and functional characterization of Flu, EBV and CMV-specific CD8 T cells in healthy individuals. We show that EBV and CMV-specific CD8 T cells contained higher frequency of cells co-expressing 2B4, CD160 and PD-1 in different combinations while Flu-specific CD8 T cells had higher frequencies of triple negative, single PD-1 or dual PD-1/2B4 CD8 T-cell populations. In particular, the percentage of CD160 expression was significantly lower in Flu-specific CD8 T cells than in CMV or EBV-specific CD8 T cells. Interestingly, the level of total PD-1 was not significantly different in Flu, EBV or CMV-specific CD8 T cells. These data suggest that CD160 expression in virus-specific CD8 T cells is associated with chronic virus infections such as EBV and CMV. Of note, co-inhibitory molecule expression on virus-specific CD8 T cells are likely influenced by the pathogen characteristics, the type of viral infection  i.e. HVEM (member of the TNF receptor superfamily) and MHC class I molecules ex vivo proportion of CD160 expression independently of PD-1 expression. These results suggested that 2B4+CD160+PD-1+ and 2B4+CD160+PD-1\u2212 CD8 T-cell populations were both rescued by CD160/CD160-ligands signaling blockade.The functions of CD160 are complex, and still remain under debate, with potentially various roles +CD160+PD-1+, 2B4+CD160+PD-1\u2212 and 2B4+CD160\u2212PD-1+ CD8 T-cell populations had reduced expression of perforin as compared to 2B4+CD160\u2212PD-1\u2212 CD8 T-cell population, suggesting that the expression of CD160 and/or PD-1 on 2B4+ CD8 T cells is associated with a reduced capacity to express perforin. Interestingly, CD160 signaling is commonly associated with enhanced NK-cell cytotoxic activity i.e. CD160 and CD160 TM, that are modulated following IL-15 stimulation ex vivo nor following IL-15 or TCR stimulation  was not significantly different between 2B4\u2212CD160\u2212PD-1+ and 2B4+CD160+PD-1+ CD8 T-cell populations  compared to the 2B4+CD160+PD-1+ CD8 T-cell population. The percentage of 2B4\u2212CD160\u2212PD-1+ CD8 T-cell population expressing EOMES, Tbet and CD57 was significantly lower than 2B4+CD160\u2212PD-1+ and 2B4+CD160+PD-1+ CD8 T-cell populations. These data suggest that 2B4\u2212CD160\u2212PD-1+ CD8 T cells may be less functionally impaired than 2B4+CD160\u2212PD-1+ and 2B4+CD160+PD-1+ CD8 T-cell populations.Interestingly, the 2B4In conclusion, while accumulation of different immune check point blockers is clearly associated with progressive dysfunction, the present study demonstrates that CD160-mediated regulation of CD8 T-cell functions is independent of PD-1 expression thus providing evidence that CD160 contributes to the regulation of CD8 T-cell functions.Forty subjects were recruited in this study. Blood samples were obtained at the local blood bank (Centre de transfusion sanguine (CTS), Lausanne, Switzerland). The use of samples used in this study was approved by the Institutional Review Board of the CTS, and all subjects gave written informed consent. Only individuals with no sign of HIV, HAV, HBV and HCV infections were included. Blood mononuclear cells were isolated as previously described The following monoclonal antibodies (mAbs) were used in different combinations. CD8-PB, CD3-APC-H7, PD-1-PECy7, PD-1-PB, IFN-\u03b3-AF700, IL-2-PE, CD4-PB, granzyme B-AF700, perforin-APC were purchased from Becton Dickinson , CD45RA-ECD, CD4-ECD from Beckman Coulter , CCR7-FITC from R&D Systems , 2B4-PECY5.5, CD160-APC, CD160-PE from BioLegend , CD4-eFluor650NC, CD8-eFluor625NC from eBioscience.6) cells were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen) and, when required, stained with appropriately tittered peptide-MHC class I multimer complexes at 4\u00b0C for 30\u2032 in Ca2+-free media as described Cryo-preserved blood mononuclear cells (1\u20132\u00d7106 in 1 ml of complete medium) were stained with 0.25 \u00b5M 5,6-carboxyfluorescein succinimidyl ester  as previously described low CD8 T cells were assessed by flow cytometry.Overnight-rested cryopreserved blood mononuclear cells (106 in 1 ml of complete medium) were stained with 0.25 \u00b5M 5,6-carboxyfluorescein succinimidyl ester  as previously described Cryopreserved blood mononuclear cells  or left unstimulated (negative control) in the presence of Golgiplug  and anti-PD1, anti-CD160 and anti-2B4 mAbs. At the end of the stimulation period, cells were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen), permeabilized   and stained  with mAbs to CD3, CD8, CD45RA, CCR7, IFN-\u03b3 and IL-2 PBMC were stimulated overnight in complete media (RPMI (Invitrogen), 10% fetal calf serum , 100 \u00b5g/ml penicillin, 100 unit/ml streptomycin (BioConcept)) with PBMC were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen). Cells were then washed and stained  with the following mAbs: CD3, CD8, PD-1, 2B4, CD160, CCR7 and CD45RA. Cells were then permeabilized   and stained  with mAbs to perforin and granzyme B PBMC were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen). Cells were then washed and stained  with the following mAbs in different combinations: CD3, CD8, PD-1, 2B4, CD160 and CD57 or CD3, CD8, PD-1, 2B4, CD160, CCR7 and CD45RA. Cells were then permeabilized   and stained  with mAbs to EOMES and T-bet.6 cells) previously selected by MACS cell separation (Miltenyi kit) were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen). Cells were then washed and stained  with the following mAbs: CD8, PD-1, 2B4, CD160, CD45RA, CCR7. CD8 T-cell populations were sorted by BD FACSAria III on the basis of 2B4, PD-1 and CD160 expression after exclusion of na\u00efve T cells (CD45RA+CCR7+). Sorted populations were labeled with CFSE and stimulated with viral peptides (1 \u00b5g/mL) in the context of irradiated (40 Gy) autologous CD8-depleted PBMCs (ratio CD8/feeder cells 1\u223610) or in anti-CD3 (10 ug/ml) and anti-CD28 (0.5 ug/ml) mAbs coated plate or left unstimulated. Proliferation was assessed at day 6 by flow cytometry. Cells were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen). Cells were then washed and stained  with anti-CD8 and anti-CD3 mAbs.Cryopreserved CD8 T cells  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen). Cells were then washed and stained  with the following mAbs: CD8, CD3, CD56, CD160, CD160-TM (rabbit unconjugated). Cells were then washed and stained  with anti-rabbit secondary Ab. To assess their expression after in vitro expansion PBMC were labeled with CFSE and stimulated with IL-15 (50 ng/mL) or with anti-CD3 (10 ug/ml) and anti-CD28 (0.5 ug/ml) mAbs coated plate. CD160 and CD160-TM expression were assessed at day 6 by flow cytometry. Cells were washed, stained  for dead cells using the Aqua LIVE/DEAD stain kit (Invitrogen). Cells were then washed and stained  with the following mAbs: CD8, CD3, CD56, CD160, CD160-TM (rabbit unconjugated). Cells were then washed and stained  with anti-rabbit secondary Ab.CD160 and CD160-TM expression were assessed both http://exon.niaid.nih.gov/spice> 5 and 106 in the flow cytometry experiments.Cells were fixed with CellFix (BD), acquired on an LSRII SORP  and analyzed using FlowJo (version 8.8.2)  and SPICE 4.2.3. When required, analysis and presentation of distributions was performed using SPICE version 5.1, downloaded from <P values) was obtained using one-way ANOVA  followed by Student's t test for multiple comparisons or a Spearman rank test for correlations using GraphPad Prism version 5.0 . Statistical analyses of global cytokine profiles (pie charts) were performed by partial permutation tests using the SPICE software as described Statistical significance  for each of this molecule. Flow cytometric profiles of CD8 T cells expressing PD-1, CD160 and 2B4 ex vivo. Representative example  of co-inhibitory molecules expression by CD8 T cells and the respective FMO for each molecule are shown.(TIF)Click here for additional data file.Figure S2Mean fluorescent intensity (MFI) of CD2B4, CD160 and PD-1 on total CD8 T cells and virus-specific CD8 T cells. The MFI of 2B4, PD-1 and CD160 expression on total CD8 T cells in 22 individuals was evaluated using polychromatic flow cytometry. (A) Cumulative data of the MFI of 2B4, PD-1 and CD160 expression within total CD8 T cells. (B) Ratio between the MFI of 2B4, PD-1 and CD160 expression in Flu, EBV and CMV-specific CD8 T cells and total CD8 T cells.(TIF)Click here for additional data file.Figure S3CD160, but not PD-1 and/or 2B4 expression inversely correlates with CD8 T-cell proliferative capacity. Correlations between proliferation index  and the virus-specific CD8 T-cell subsets distribution Click here for additional data file.Figure S4Expression of EOMES, T-bet and CD57 on CD8 T-cell subsets discriminated by the expression of 2B4, CD160 and PD-1.(A) Representative example (#1074) and cumulative analyses (n\u200a=\u200a7) of EOMES and T-bet expression on distinct CD8 T-cell subsets. (B) Representative example (#1093) and cumulative analyses (n\u200a=\u200a10) of CD57 expression on distinct CD8 T-cell subsets. Red bars correspond to mean \u00b1 SEM. Red stars indicate statistical significance (P<0.05). NS: not significant. Statistical significance  was obtained using One-way ANOVA  followed by a paired Student's t-test.(TIF)Click here for additional data file.Figure S5Mean fluorescence intensity (MFI) of 2B4, CD160 and PD-1 on CD8 T-cell subsets discriminated by the expression of 2B4, CD160 and PD-1. Cumulative data of the mean fluorescence intensity of 2B4, CD160 and PD-1 on distinct CD8 T-cell subsets. Red bars correspond to mean \u00b1 SEM.(TIF)Click here for additional data file.Figure S6Assessment of CD160 and CD160-TM expression. The expression of CD160 and CD160-TM was evaluated by flow cytometry directly ex vivo or after in vitro expansion of NK cells (CD3\u2212CD56+) and/or CD8 T cells (CD3+CD8+). (A) Representative flow cytometric profile of the CD160 and CD160-TM expression ex vivo by NK cells and CD8 T cells. (B) Representative flow cytometric profile of the CD160-TM expression after 5 days stimulation with IL-15 and/or anti-CD3/CD28 MAbs by NK cells and CD8 T cells.(TIF)Click here for additional data file."}
+{"text": "This study investigated the distribution of tumor-infiltrating T-cells subset and the differentiation as well as inhibitory phenotype of T-cells from blood and tissues of GC patients.T lymphocytes play an indispensably important role in clearing virus and tumor antigen. There is little knowledge about impacts of inhibitory molecules with cytokine on tumor-infiltrating CD4Patients with GC diagnosed on the basis of pre-operative staging and laparotomy findings were approached for enrollment between 2014 and 2015 at the Affiliated Cancer Hospital of Zhengzhou University, China. Phenotypic analysis based on isolation of tumor-infiltrating lymphocytes and intracellular IFN-\u03b3 staining assay is conducted. Statistical analysis is performed to show significance.+ T-cells among CD3+ cells in tumors was significantly higher than that in the matched paraneoplastic tissue. CD4+ CD25high CD127low regulatory T-cells (Tregs), PD-1+, Tim-3+, and PD-1+ Tim-3+ cells were up-regulated on tumor infiltrating T-cells from patients with GC compared to their expressions on corresponding peripheral blood and peritumoral T-cells. Blockades of PD-1+ and Tim-3+ were effective in restoring tumor infiltrating T-cells\u2019 production of interferon-gamma (IFN-\u03b3). Combined PD-1+ and Tim-3+ inhibition had a synergistic effect on IFN-\u03b3 secretion by CD4+ T-cells.The results showed that the percentage of CD4The results suggested that the composition, inhibitors, and location of the immune infiltrate should be considered when evaluating antitumor immunotherapy. A new insight into the mechanisms underlying T cell dysfunction is provided.The online version of this article (10.1186/s12935-017-0489-4) contains supplementary material, which is available to authorized users. Gastric cancer (GC), one of the leading causes for worldwide mortality, is considered as the second most common cancer in China , 2. AlthInvestigations showed that T-cell dysfunction in chronic virus infection and human tumor growth was related to the up-regulation of inhibitory molecules such as programmed death 1 (PD-1), T-cell immunoglobulin, and mucin-domain-containing molecule 3 (Tim-3) \u201314. It p+, Tim-3+, and Tregs in the development and maintenance of tumor-infiltrating T-cell dysfunction in GC patients need to be investigated. Thus, it is crucial to discover the complex mechanisms for inducing T-cell dysfunction in GC patients by exploring the subset composition and functional properties of tumor-infiltrating T-cells.Currently, there is little detail of T-cell subsets resident within gastric cancer tissues or the expression patterns in this microenvironment corresponding to those observed in paraneoplastic tissue or in the peripheral blood of GC patients. Moreover, the role of PD-1+ PD-1+ CD4+ T-cells in tumor tissues was found to correlate with the clinical cancer stage and Tregs. These data as well as the corresponding results and the methods provide a new immunotherapeutic approach for the clinical management of GC.In this study, we investigated the distribution of T-cells subset, the differentiation and inhibitory phenotype of T-cells from blood and tissues of GC patients. The results demonstrated that the T-cell subsets resident within GC is different from that in paraneoplastic tissue and blood, and the increase in Tim-3Patients with GC diagnosed on the basis of pre-operative staging and laparotomy findings were approached for enrollment between 2014 and 2015 at the Department of Surgery, the Affiliated Cancer Hospital of Zhengzhou University, China. Thirty-one patients diagnosed with primary GC without previously treatment were qualified in this study. Peripheral blood samples were collected from each patient before treatment. The clinical stage was classified according to the American Joint Committee on Cancer (AJCC) Staging Manual, Seventh Edition (2010). The clinicopathological characteristics of age, gender, and histological grade at the time of blood sample collection were recorded in Table\u00a0Fresh venous blood was collected from patients or healthy donors (HDs) with EDTA-coated vacutainer tubes. Specific anti-CD3-PE-Cy7  or anti-CD3-FITC , anti-CD25-PE , anti-CD127-APC , anti-CD4-FITC , anti-CD8-APC , anti-CD45RA-FITC , anti-CCR7-PE-Cy7 , anti-CD4-PE , anti-PD-1-FITC , anti-CD4-PerCP-cy5.5 , anti-Tim-3-PE , and anti-IFN-\u03b3-APC  were purchased for use. The viability of the cells was assessed by a violet amine reactive dye .Briefly, 50 \u03bcL of blood mixed with 5\u00a0\u03bcL of each antibody was incubated on ice for 20\u00a0min in the dark. Then, 2\u00a0mL of 1\u00d7 lysis buffer  was added to each sample and incubated at room temperature for 15\u00a0min. Samples were washed with FACS buffer , and the pellets were resuspended in 300 \u03bcL of FACS buffer. Flow cytometry was performed on a BD FACS Aria II flow cytometer, and was analyzed with FlowJo software . The values were background-corrected by control sample or fluorescence minus one (FMO). Cells without surface makers were used as control samples.3) and were treated with 1\u00a0\u03bcg/mL of collagenase , 25\u00a0\u03bcg/mL of DNase , and 2% fetal bovine serum in PBS at 37\u00a0\u00b0C for 1 to 1.5\u00a0h. The tissue homogenates were filtered by a 70-\u03bcm cell strainer  before density centrifugation. Density centrifugation was performed using Percoll density gradient, and cells at the interface between 40 and 80% discontinuous Percoll gradient were collected. The leukocyte\u2019s viability was evaluated by trypan blue exclusion.The fresh human tumor samples and matched paraneoplastic tissues from patients with GC were cut into pieces  for 6\u00a0h . After it test was applied to compare the expression of the inhibitory molecules in cancer, noncancerous tissues, and blood. p\u00a0<\u00a00.05 was considered to be statistically significant.Statistical analysis was performed by GraphPad Prism 5.0 . Mann\u2013Whitney test was used to assess the differences between the study groups. A pair wised + and CD8+ T-cells in circulating CD3+ T-cells from GC patients and HDs was measured. However, no significant difference in frequency of CD4+ and CD8+ T-cells were found between GC patients and HDs (data not shown). We then further investigated the differences in frequency of CD4+ and CD8+ T-cells in CD3+ T-cells between TILs and matched circulating lymphocytes or paraneoplastic tissue in GC patients. Flow cytometry results showed that the tumors had a higher frequency of CD4+ CD8\u2212 T-cells (51.3%) and a lower frequency of CD8+ CD4\u2212 T-cells (38.4%) compared with paraneoplastic tissues or blood, which indicated a rising CD4+/CD8+ ratio in tumors  in GC. On CD4+ T-cells, there are 32.67% of central memory T-cells , 6.34% of terminally differentiated T-cells  and 5.72% of naive  T-cells , 14.57% of TCM (14.57%) and 13.81% of Tnaive (13.81%) T-cells . T cell differentiation in HDs is similar to that in HDs (data not shown).The balance of T-cell differentiation plays an important role in successful immune controls. Therefore, T-cell differentiation in GC patients was analyzed according to the expressions of CCR7 and CD45RA. Both the tumor-infiltrating CD4+ Treg was the most extensively studied negative regulator [high CD127low Tregs among CD4+ lymphocytes in GC patients and HDs. The results were showed in Fig.\u00a0high CD127low Tregs among CD4+ cells in GC patients were significantly higher than that in HDs . CD25high CD127low Tregs on tumor-infiltrating CD4+ cells were significantly higher than those in both blood  and paraneoplastic tissue . The CD25high CD127low cells among CD4+ cells from noncancerous tissues was a little higher than that in blood, but showed no significant difference . Representative flow cytometric data of a patient with GC is shown in Fig.\u00a0Tumors escaped from the immune system attack via different regulatory molecules and regulatory cells, of which CD4egulator . So we a+ and PD-1+ on T-cells in blood, paraneoplastic tissue, and tumors was analyzed. Percentages of Tim-3+ and PD-1+ were calculated as a percentage of CD4+/CD8+ positive T-cells. The representative flow cytometric dot plots were shown in Fig.\u00a0+) and Additional file +). The frequency of Tim-3+ cells among CD4+ and CD8+ cells in circulation were significantly higher in GC patients than those in HDs . Consistent with previous studies, a significantly higher level of PD-1+ cells on T-cells in circulation in GC patients were observed compared with HDs . In our study, the median percentage of PD-1+ Tim-3+ cells among CD4+ and CD8+ T-cells in GC patients were also significantly higher than that in HDs .The expression of inhibitory molecules Tim-3+ cells in TILs were significantly increased . PD-1+ was also expressed at a higher level on TILs . Similarly, both the percentages of Tim-3+ and PD-1+ cells in paraneoplastic tissue were significantly lower than those in TILs . Furthermore, PD-1+ Tim-3+ cells among T-cells were significantly higher in tumor tissues than those in blood  and paraneoplastic tissues . Percentages of PD-1+ and PD-1+ Tim-3+ in T-cells of paraneoplastic tissues were all significantly higher than those in blood for both CD4+ and CD8+ T-cells.The difference between the expression of Tim-3 and PD-1 in blood and tissues were also explored. Compared with the matched blood, the percentage of Tim-3+ and/or Tim-3+ was examined. Anti-CD3-mAbs can stimulate T lymphocyte, and brefeldin A treatment facilitates the detection of IFN-\u03b3. After stimulated with anti-CD3-mAbs and brefeldin A, inhibited PD-1+ significantly enhanced the production of IFN-\u03b3 by tumor-infiltrating CD4+/CD8+ T-cells in patients with GC as compared with FMO control . Tim-3 blockade also increased production of IFN-\u03b3 by TILs . Additionally, PD-1-PD-L1 blockade in combination with Tim-3-Tim-3-L blockade further enhanced the capacity of tumor-infiltrating CD4+ T-cells to produce IFN-\u03b3 as compared with anti-PD-1-mAbs group (p\u00a0=\u00a00.0398) or anti-Tim-3-mAbs group (p\u00a0=\u00a00.0027). On the other hand, combination of PD-1+ with Tim-3+ inhibition had no synergistic effects on IFN-\u03b3 induction of CD8+ T-cells. Then, the effect of PD-1+ and Tim-3+ inhibition on IFN-\u03b3 induction of nontumor-infiltrating CD4+ T-cells was examined. Interestingly, blockade of PD-1+ and/or Tim-3+ failed to improve nontumor-infiltrating CD4+ T-cells to produce IFN-\u03b3, but combined PD-1+ with Tim-3+ inhibition had synergistic effects on IFN-\u03b3 induction of nontumor-infiltrating CD4+ T-cells  following in vitro blockade of PD-1+ PD-1+ CD4+/CD8+ T-cells with clinicopathological parameters was further analyzed in cancer patients. Patients were divided by clinical cancer stage. Significant differences were observed for the Tim-3+ PD-1+ CD4+/CD8+ percentage in stage III patients compared to stage I/II GC patients . No correlation was present between the histological grade and Tim-3+ PD-1+ CD4+/CD8+ T-cells . Then, we analyzed the correlation between the Tim-3+ PD-1+ CD4+/CD8+ T-cells and serum concentration of cancer biomarker which was tested pre-treatment. The results showed no correlation between the percentage of Tim-3+ PD-1+ CD4+/CD8+ T-cells and the serum concentration of cancer biomarker CEA  or CA724  infection, which is a major cause of gastric cancer [H.\u00a0pylori\u00a0infection could theoretically decrease the number of cases by 89% [H. pylori infection, the expression of PD-1+ and Tim-3+, and GC needs to be further explored.Recent studies suggested that cells express only PD-1 T-cells \u201316, and patients \u201333. In ac cancer , 35. Stus by 89% , 37. The+, Tim-3+, and PD-1+ Tim-3+ cells among CD4+/CD8+ T-cells were significantly increased in the tumor tissues compared to their counterparts in matched peripheral blood and paraneoplastic tissues. Meanwhile, the percentages of Tim-3+, PD-1+, and PD-1+ Tim-3+ cells among CD4+ cells in paraneoplastic tissues were all significantly higher than those in peripheral blood. These results provided a solid foundation that TILs showed functional exhaustion in patients with GC, and supported the hypothesis that the tumor microenvironment played an important role in the up-regulation of inhibitory receptors [+ and Tim-3+ significantly enhanced tumor-infiltrating CD4+/CD8+ T-cells IFN-\u03b3 secretion in patients with GC compared with the control group. These results were concordant with previous reports of impaired T-cells during viral infections and tumor growth and suggested that co-expression of Tim-3+ and PD-1+ was a marker of tumor-induced T-cell dysfunction [+ blockade with PD-1+ pathway blockade was remarkably more effective in colon carcinoma,\u00a0acute myelogenous leukemia, and melanoma models than with blockade of either the Tim-3+ or PD-1+ pathway alone [+ and Tim-3+ inhibition had a synergistic effect on CD4+ T-cells\u2019 IFN-\u03b3 secretion, which was in an agreement with Smyth and Cunningham\u2019s study [+ and Tim-3+ inhibition did not have synergistic effects on IFN-\u03b3 induction of CD8+ T-cells. This may be caused by the frequency of Tim-3+ PD-1+ T-cells occupying almost 90% of Tim-3+ CD8+ T-cells. In addition, although blockade of PD-1+ or Tim-3+ failed to improve the ability of nontumor-infiltrating CD4+ T-cells to produce IFN-\u03b3, the combined PD-1+ and Tim-3+ inhibition had synergistic effects on IFN-\u03b3 induction of nontumor-infiltrating CD4+ T-cells. These results could be explained by following points:+ and CD8+ T-cells [The hierarchical co-regulation of multiple negative regulatory pathways on CD4 T-cells ;The complex interactions between the inhibitory pathways during long-term in vitro conditions; and+ pathway inhibition [The blocking Tim-3/galectin-9 interactions complementary to PD-1hibition .It was also observed that the percentages of PD-1eceptors , 38, 39.function , 38\u201340. ay alone , 42. In \u2019s study . But comAccording to abovementioned results, combination therapies of the immune checkpoint inhibitors with other targeted agents were alternative for GC patients.+ PD-1+ CD4+/CD8+ among TILs were associated with Tregs and clinical stages, which suggested that Tregs may induce the expression of PD-1+ and Tim-3+. A significant difference was observed between patients with advanced tumors and patients with stage I/II, which indicated that the exhausted T-cells may stimulate tumor progression.One novel finding was that the percentages of Tim-3+ PD-1+ CD4+/CD8+ T-cells in tumors with clinic opathological features and Treg in GC patients. Our findings provide new insights into the mechanisms underlying T-cell dysfunction and allow for future immunotherapeutic strategies in GC.In conclusion, to the best of our knowledge, this is the first study to characterize the subset composition and functional properties of multiple inhibitory molecules on TILs and the correlation of Tim-3Additional file 1: Figure S1. Frequencies of TEM and TCM on CD4+ and CD8+ T-cell. (A) Flow cytometry results; (B) frequencies of TEM and TCM on CD4+; Frequencies of TEM and TCM on CD8+.Additional file 2: Figure S2. Expression of inhibitory molecules Tim-3+ and PD-1+ on CD8+. (A) Flow cytometry results; (B) frequency of Tim-3+ cells among CD4+ and CD8+ cells in circulation of GC patients and HDs; (C) PD-1+ cells on T-cells in circulation of GC patients and HDs; (D) median percentage of PD-1+ Tim-3+ cells among CD4+ and CD8+ in GC patients and HDs; E percentage of Tim-3+ cells in different tissues; F Expression level of PD-1+ for CD8+; G PD-1+ Tim-3+ cells among T-cells.Additional file 3: Figure S3. Effects of PD-1+ and Tim-3+ inhibition on IFN-\u03b3 induction. (A) Flow cytometry results; (B) IFN-\u03b3 induction on CD4+ cells."}
+{"text": "Scientific Reports6: Article number: 3124510.1038/srep31245; published online: 08102016; updated: 11102016In the Supplementary Information file originally published with this Article, there was a typographical error in the legend of Figure S2 where \u201cEl Chich\u00f3n\u201d was incorrectly given as \u201cEl Chic\u00f3n\u201d. In addition, Figure S3 and its accompanying Figure legend were incorrect. The Reference \u2018Church, John A. et al. Revisiting the Earth\u2019s sea\u2010level and energy budgets from 1961 to 2008. Geophys. Res. Lett. 38, 18 (2011)\u2019 was also omitted. These errors have been corrected in the Supplementary Information that now accompanies the Article."}
+{"text": "When given privileged information of an object\u2019s true location, adults often overestimate the likelihood that a protagonist holding a false belief will search in the correct location for that object. This type of egocentric bias is often labelled the \u2018curse of knowledge\u2019. Interestingly, the magnitude of this bias may be modulated by the social distance between the perspective taker and target. However, this social distance effect has yet to be fully demonstrated when adults reason about false beliefs. Using a continuous false belief task, we investigated i) whether adults were biased by their own knowledge when reasoning about another\u2019s false belief, ii) whether the magnitude of this egocentric bias was modulated by social distance, and iii) whether this social distance effect extended to a heterospecific out-group, namely a dog. To test these hypotheses we conducted three experiments. In Experiment 1 (N = 283), we used an established continuous false belief task, in Experiment 2 (N = 281) we modified this task, and Experiment 3 (N = 744) was a direct replication of Experiment 2. Across these experiments, the curse of knowledge effect was reliably replicated when adults mentalised about an in-group protagonist, and replicated in two of the three studies (Experiments 1 and 3) when adults mentalised about out-group protagonists. In an internal-meta analysis, the curse of knowledge effect was present across all conditions, and there was no effect of social distance. Hence, overall these data are not consistent with the hypothesis that social distance modulates adults\u2019 egocentric biases when reasoning about false beliefs. The finding that egocentric biases of a similar magnitude were observed when adults mentalised about an in-group protagonist and a dog suggests that interpersonal dissimilarity is not in itself sufficient to reduce egocentric bias when reasoning about false beliefs. Although we possess the ability to attribute mental states to others, this so-called Theory of Mind is often sub-optimal. Both adults and children frequently over-extend their own mental states onto others. Such an egocentric bias is seen when we reason about what others see , feel 22, know , and belEpley et al.  proposedcurse of knowledge effect in false belief reasoning has been replicated both conceptually, by using a different paradigm , z = 0.51, p = 0.61, and no significant interaction, \u03b2 = -0.14; 95% CI = , z = -1.19, p = 0.23. There was no evidence of any significant effects of residual heterogeneity, Q(8) = 7.68, p = 0.47. Overall, the best estimate of the curse of knowledge effect across all conditions was, Cohen\u2019s d = 0.314. Individually, the best estimates of the curse of knowledge effect in the in-group, Cohen\u2019s d = 0.407 and out-group, Cohen\u2019s d = 0.224, conditions. The pattern of significance was the same in the raw data analysis, however effect sizes were overall larger in the raw data analysis: overall d = 0.394, in-group d = 0.507, out-group d = 0.285.The meta-analytic summary of Experiments 1, 2 and 3 revealed a significant overall Knowledge effect, \u03b2  = 0.36; 95% CI = , z = 4.20, p < 0.0001, and no significant effect of Protagonist, M = 0.1580; 95% CI = , z = 1.5854, p = 0.1129. By contrast to our internal meta-analysis, here the interaction term was significant, \u03b2 = -0.23; 95% CI = , z = -2.04, p = 0.042. This was driven by a significant curse of knowledge effect across the four experiments in the in-group condition, Cohen\u2019s d = 0.428, 95% CI , z = 4.17, p < 0.001, but not the out-group condition, Cohen\u2019s d = 0.145, 95% CI , z = 1.42, p = 0.16. By contrast, in the raw data analysis, the curse of knowledge effect approached significance across the out-group conditions, Cohen\u2019s d = 0.195, 95% CI , z = 1.83, p = 0.068. There was evidence of residual heterogeneity, Q(12) = 44.58, p < 0.001, which justified the selection of a random effects meta-analysis, as study specific variables between our own and Todd et al.\u2019s studies could have influenced the curse of knowledge or social distance effects [When the data from Todd et al. . To enable comparisons with previous studies, the best estimate of the curse of knowledge effect size across all conspecific conditions of the current study, Cohen\u2019s -Schmidt , d = 0.2type of out-group manipulation being used.By contrast, when the data from Todd et al.  were incThis study tested i) whether adults were biased by their own privileged knowledge when reasoning about another\u2019s false belief, ii) whether the magnitude of this egocentric bias was modulated by social distance and, iii) whether such a social distance effect was still observed with a heterospecific out-group. Across three experiments, participants were biased by their own privileged knowledge when reasoning about the false beliefs of in-group, out-group and heterospecific protagonists. Whilst the data were numerically in-line with the hypothesis that increasing social distance reduces egocentric biases when reasoning about false beliefs, the effect was not significant in i) any of the three studies individually, or ii) overall upon internal meta-analysis. Therefore, the present data do not support the hypothesis that social distance modulates adults\u2019 egocentric biases when reasoning about false beliefs.d = 0.20, than that originally reported by Birch and Bloom [d = 0.469. Nevertheless, the curse of knowledge effect size across both conspecific conditions in the current study, d = 0.314, is larger than Ryskin and Brown-Schmidt\u2019s, and, across the in-group conditions, the curse of knowledge effect was replicated with effect sizes directly in line with Birch and Bloom [d = 0.407 from the logit transformed analysis, and d = 0.507 from the raw data analysis. Therefore, the modified false belief task does seem to reliably elicit egocentric biases in false belief reasoning when participants of white Western European descent mentalise about an in-group protagonist.Our results suggest the social distance effect is unlikely to explain the smaller curse of knowledge effect size observed by Ryskin and Brown-Schmidt , Cohen\u2019snd Bloom , d = 0.4Further, our finding of a significant curse of knowledge effect across the out-group conditions of the current study suggest egocentric intrusion might not be limited to mentalising about in-group members. This diverges from some of the previous literature, in which either no, or negative, egocentric biases were observed when adults reasoned about the preferences , visceraThat participants do sometimes display egocentric biases when mentalising about out-group members is not unexpected. For example, a small degree of egocentric intrusion when reasoning about out-group members is often reported in studies examining social projection . Howevergeneral feature of intergroup cognition. Further, with accumulating evidence that socio-cultural factors may influence perspective taking [That the salience of an out-group could modulate the effects of egocentric intrusion in Theory of Mind highlights the importance of using multiple out-groups before results can be interpreted as a e taking ,17,35\u201337e taking . As wellAlso warranting further investigation is which factors contribute to making an out-group \u2018salient\u2019, particularly with regards to modulating egocentric intrusion in Theory of Mind. A host of correlated features, such as likeability, similarity, familiarity and group-membership have been proposed as potential modulators of egocentric intrusion Click here for additional data file.S2 Fig(TIF)Click here for additional data file.S3 Fig(TIF)Click here for additional data file.S4 Fig(TIF)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S1 Texthttps://osf.io/xm94v/.Raw data, and analysis scripts, are provided at: (DOCX)Click here for additional data file."}
+{"text": "CK1\u03b5 is required for Dvl/Fz association in both canonical and noncanonical signaling. Here we show that differently to its binding to canonical Wnt receptor complex, CK1\u03b5 does not require p120\u2010catenin for the association with the Wnt5a co\u2010receptor Ror2. Wnt5a promotes the formation of the Ror2\u2013Fz complex and enables the activation of Ror2\u2010bound CK1\u03b5 by Fz\u2010associated protein phosphatase 2A. Moreover, CK1\u03b5 also regulates Ror2 protein levels; CK1\u03b5 association stabilizes Ror2, which undergoes lysosomal\u2010dependent degradation in the absence of this kinase. Although p120\u2010catenin is not required for CK1\u03b5 association with Ror2, it also participates in this signaling pathway as p120\u2010catenin binds and maintains Ror2 at the plasma membrane; in p120\u2010depleted cells, Ror2 is rapidly internalized through a clathrin\u2010dependent mechanism. Accordingly, downregulation of p120\u2010catenin or CK1\u03b5 affects late responses to Wnt5a that are also sensitive to Ror2, such as SIAH2 transcription, cell invasion, or cortical actin polarization. Our results explain how CK1\u03b5 is activated by noncanonical Wnt and identify p120\u2010catenin and CK1\u03b5 as two critical factors controlling Ror2 function.Canonical and noncanonical Wnt pathways share some common elements but differ in the responses they evoke. Similar to Wnt ligands acting through the canonical pathway, Wnts that activate the noncanonical signaling, such as Wnt5a, promote Disheveled (Dvl) phosphorylation and its binding to the Frizzled (Fz) Wnt receptor complex. The protein kinase  Dapi4',6\u2010diamidino\u20102\u2010phenylindoleDMEMDulbecco's modified Eagle's mediumDvlDisheveledFzFrizzledGSTglutathione S\u2010transferaseHbherbimycinMDCmonodansylcadaverineMSCsmesenchymal stem cellsPEIpolyethyleniminePP2Aprotein phosphatase 2ART\u2010PCRreverse transcription polymerase chain reactionWBWestern blot12+/calmodulin\u2010dependent kinase  and the co\u2010receptors LRP5 or LRP6, which are two highly homologous proteins (referred to herein as LRP5/6)  has been reported  (15\u00a0\u03bcm) or the Src tyrosine kinases inhibitor herbimycin A (Hb)  (20\u00a0ng\u00b7mL\u22121) were supplemented to the cell medium.HEK293T, SW\u2010480, and IEC\u201018 cells were obtained from the IMIM Cell Bank and cultured in Dulbecco's modified Eagle's medium  supplemented with 10% fetal bovine serum (Invitrogen) at 37\u00a0\u00b0C in 5% CO2.3Human shRNA specific for p120\u2010catenin , CK1\u03b5 , PR61\u03b5 , Ror2 , or a nontargeting control  were obtained from Mission shRNA (Sigma). For transient expression of shRNA in HEK293T cells, the indicated shRNA were transfected using polyethylenimine (PEI)  and downregulation of the investigated protein was analyzed at 48\u201372\u00a0h after transfection by Western blot (WB). Transient overexpression of ectopic Ror2\u2010HA or Ror2\u2010Flag  was achieved by transfecting the indicated eukaryotic plasmid using PEI. Cells were analyzed 24\u201348\u00a0h after transfection.2.4Five different gRNA/Cas9 sequences against CK1\u03b5 or p120\u2010catenin were inserted into pD1301\u2010AD , a plasmid that also expresses Cas9, and transfected individually in HEK293T cell line using Lipofectamine 2000 and according to manufacturer's instructions. The gRNA sequences used for CK1\u03b5 were gRNA1, 5\u2032\u2010ATGGCTCACTCTTGCTGCAG\u20103\u2032; gRNA2, 5\u2032\u2010TCCCGATCTTCCGTCCCAGG\u20103\u2032; gRNA3, 5\u2032\u2010ACCCAGGTAGATATCTCCGA\u20103\u2032; gRNA4, 5\u2032\u2010GCGATGTTGGCACCTGCCCG\u20103\u2032; gRNA5, 5\u2032\u2010TGAGGAAGTCGCCATCAAGC\u20103\u2032; and those for p120\u2010catenin were gRNA1, 5\u2032\u2010TAGGTCTCCACAATCTGCCC\u20103\u2032; gRNA2, 5\u2032\u2010ACTACAGACATGGCTCCCTC\u20103\u2032; gRNA3, 5\u2032\u2010CCGAGTGGTCCCATCATCTG\u20103\u2032; gRNA4, 5\u2032\u2010ACACACGTCTTAGTTTACCG\u20103\u2032; and gRNA5, 5\u2032\u2010ACTTTCTTGACCTGCAAGT\u20103\u2032. gRNA off\u2010target analyses were performed without statistical significance. As pD1301\u2010AD also expresses GFP, 72\u00a0h post\u2010transfection GFP\u2010positive cells were sorted with FACSAria II SORP  and individually plated into a 96\u2010well plate. After cell clones were grown, CK1\u03b5 or p120\u2010catenin protein expression was checked by WB. Clones with no CK1\u03b5 or p120\u2010catenin protein expression were selected.2.5et\u00a0al., et\u00a0al., Generation of the bacterial expression plasmid pGEX\u20106P encoding the glutathione S\u2010transferase (GST) fused to p120\u2010catenin wild\u2010type or to p120\u2010catenin deletion fragments has been previously described  pH 7.0, and 100\u00a0\u03bcm ATP. Reactions were performed for 30\u00a0min at 30\u00a0\u00b0C. Where required, GST was removed using Pre\u2010Scission protease  as reported , supplemented with protease and phosphatase inhibitors as described  using 1\u00a0\u03bcg\u00b7mL\u22121 of the appropriate antibody, or an irrelevant IgG as a control, for 16\u00a0h at 4\u00a0\u00b0C. Samples were incubated for 2\u00a0h with 20\u00a0\u03bcL of \u03b3\u2010bind G\u2010Sepharose . Immunoprecipitates were washed 3\u00d7 with PBS\u20100.1% NP\u201040, and bound proteins were analyzed by WB.Cell extracts were prepared by homogenizing cells in 0.5% NP\u201040 lysis buffer . The immunocomplexes were then incubated with recombinant GST\u2013p120\u2010catenin and phosphorylation buffer supplemented with 100\u00a0\u03bcm ATP in a final volume of 50\u00a0\u03bcL for 30\u00a0min at 30\u00a0\u00b0C. Specific phosphorylation on GST\u2013p120\u2010catenin Ser268 was analyzed by WB with a phospho\u2010specific Ser268\u2010p120\u2010catenin monoclonal antibody  was used as control. Activity of the product of the Renilla luciferase gene under the control of a constitutive thymidine kinase promoter  was used to normalize transfection efficiency.2.114 cells were suspended in 150\u00a0\u03bcL DMEM 0.1% BSA, were seeded on a Transwell filter chamber  coated with 1\u00a0mg\u00b7mL\u22121 collagen type I  and incubated for 16\u00a0h (MSC) or 36\u00a0h (HEK293T). Control or Wnt5a\u2010conditioned medium was used as chemoattractant. Noninvading cells were removed from the upper surface of the membrane, while cells that adhered to the lower surface were fixed with Methanol 100% for 20\u00a0min and stained with crystal violet. Cells were eluted with 30% acetic acid, and the OD was measured at 590\u00a0nm.4\u20137\u00a0\u00d7\u00a0102.124 cells in control or Wnt5a\u2010conditioned medium and 2% Matrigel (V/V) were seeded on top of the solidified gel. Cells were incubated for 2\u00a0h with the indicated media and analyzed by immunofluorescence. For immunofluorescence, cells were first fixed with 4% paraformaldehyde for 15\u00a0min and incubated with PBS\u20100.2% Triton X\u2010100 for 5\u00a0min. After blocking with 3% BSA in PBS for 30\u00a0min at room temperature, CytoPainter Phalloidin\u2010iFluor 647 Reagent  was added for 1\u00a0h at room temperature. Slides were washed three times with PBS and incubated for 10\u00a0min with 4\u2032,6\u2010diamidino\u20102\u2010phenylindole (Dapi) for nucleus identification. Coverslips were mounted on glass slides with Fluoprep , and immunofluorescence was analyzed with a Leica confocal microscope .About 40\u00a0\u03bcL of Matrigel  was deposited on a round coverslip (15\u00a0mm diameter) and incubated at 37\u00a0\u00b0C for 30\u00a0min to solidify the gel. Cells were trypsinized to a single\u2010cell suspension, and 5\u00a0\u00d7\u00a0102.13\u22121 for 10\u00a0min at room temperature. Digestion was stopped with 4\u2010(2\u2010aminoethyl)benzenesulfonyl fluoride hydrochloride (20\u00a0mm), and cells were lysed with RIPA lysis buffer  supplemented with protease inhibitors  at 1\u00a0\u03bcg\u00b7mL2.14\u22121 sulfo\u2010NHS\u2010LC\u2010biotin  at 4\u00a0\u00b0C for 30\u00a0min. After quenching excess of biotin with 50\u00a0mm NH4Cl, cells were lysed in 0.5% NP\u201040 lysis buffer as described above. Lysates were incubated with NeutrAvidin Agarose (Sigma). Beads were collected, washed 3\u00d7 with PBS\u20100.1% NP\u201040 buffer, and analyzed by WB.Cells were incubated with 0.5\u00a0mg\u00b7mL2.15graphpad prism software , and data were analyzed for significance using unpaired Student's t\u2010test. *P\u00a0<\u00a00.05; **P\u00a0<\u00a00.01.Results are representative of at least three independent experiments unless otherwise indicated. Data are presented as mean\u00a0\u00b1\u00a0SD. Where appropriate, statistical analyses were conducted using 33.1et\u00a0al., et\u00a0al., et\u00a0al., et\u00a0al., Dvl\u20102 phosphorylation and binding to Fz is a common response to Wnt ligands acting through both the canonical and noncanonical pathways  associated with Ror2 Fig.\u00a0A; this iet\u00a0al., et\u00a0al., per se, rather than its activity, controls Ror2 protein levels. Both endogenous and transfected Ror2 were less expressed in CK1\u03b5 CRISPR cells (Fig.\u00a0As previously shown in Fig.\u00a0lls Fig.\u00a0C. No diflls Fig.\u00a0D, suggeslls Fig.\u00a0E, thus dlls Fig.\u00a0E, indica3.5Siah2 (Topol et\u00a0al., Siah2 RNA was upregulated by Wnt5a (Fig.\u00a0Siah2 siRNA prevented the \u03b2\u2010catenin down\u2010modulation induced by Wnt5a (Fig.\u00a0Siah2 upregulation for the Wnt5a\u2010induced \u03b2\u2010catenin decrease. In accordance with these and the previous results, Wnt5a failed to increase Siah2 RNA in cells deficient for Ror2, CK1\u03b5, p120\u2010catenin, or PR61\u03b5 (Fig.\u00a0Finally, we determined whether other later responses to Wnt5a stimulation show the same requirement for Ror2, p120\u2010catenin, and CK1\u03b5. Wnt5a promotes \u03b2\u2010catenin downregulation in a manner that is dependent on transcription of the \u03b2\u2010catenin E3 ligase t5a Fig.\u00a0, indicatet\u00a0al., et\u00a0al., Wnt5a also promotes other cellular responses, such as increased cell invasion (Kurayoshi 4et\u00a0al., et\u00a0al., In this work, we have analyzed the signaling pathway stimulated by Wnt5a that \u2013 in contrast to the canonical Wnt pathway \u2013 does not increase \u03b2\u2010catenin levels. We confirmed previous results indicating that Wnt5a requires CK1\u03b5 to stimulate Dvl2 phosphorylation (Bryja et\u00a0al., et\u00a0al., et\u00a0al., Compared to canonical Wnt, much less is known about the noncanonical signaling pathway. However, it is clear that both pathways involve some common elements, such as Fz receptors, CK1\u03b5 and Dvl2 phosphoprotein (Grumolato et\u00a0al., et\u00a0al., et\u00a0al., et\u00a0al., Subsequently, CK1\u03b5 promotes Dvl2 binding to Fz and oligomerization, although the mechanism is still under discussion Fig.\u00a0C, F. CK1et\u00a0al., et\u00a0al., CK1\u03b5 not only transmits the Ror2 action but, through its direct interaction, protects Ror2 from lysosomal\u2010dependent degradation Fig.\u00a0. The CK1et\u00a0al., Besides being controlled by CK1\u03b5, the presence of Ror2 on the membrane is also controlled by p120\u2010catenin, which also directly binds to Ror2. p120\u2010catenin associates with Ror2 through its aa 102\u2013350, a sequence present in p120\u2010catenin isoforms 1\u20133 but not in isoform 4 (Kourtidis et\u00a0al., et\u00a0al., et\u00a0al., et\u00a0al., Through its binding, p120\u2010catenin also stabilizes cadherin at the plasma membrane and prevents its internalization (Davis et\u00a0al., It is important to remark that the noncanonical Wnt model presented in Fig.\u00a0In conclusion, the results presented in this study indicate that p120\u2010catenin and CKI\u03b5 interact with Ror2 and are essential for Ror2\u2010dependent, noncanonical Wnt signaling. CK1\u03b5 is activated by this pathway and is required for Dvl2 recruitment to Fz. Moreover, association between both p120\u2010catenin and CK1\u03b5 is necessary for maintaining Ror2 at the plasma membrane.MD and AGH designed and directed the research. JC, BdV\u2010P, AV, GF, and MV performed the research. RP contributed to essential reagents. AGH and MD wrote the article, with contributions from the rest of the authors.Fig.\u00a0S1. A Wnt5a antibody prevents the stimulation of the JNK2 and ERK2 serine kinases and the association of Fz with Dvl2 induced by Wnt5a.Click here for additional data file.Fig.\u00a0S2. The tyrosine kinase inhibitor herbimycin affects Wnt5a signaling.Click here for additional data file.Fig.\u00a0S3. CK1\u03b5 CRISPR cells contain unaltered levels of CK1\u03b4.Click here for additional data file.Fig.\u00a0S4. p120\u2010catenin deficiency prevents Wnt5a\u2010induced JNK2 phosphorylation and Rac1 activation.Click here for additional data file.Fig.\u00a0S5. CK1\u03b5 deficiency prevents Wnt5a\u2010induced JNK2 phosphorylation and Rac1 activation.Click here for additional data file.Fig.\u00a0S6. N\u2010cadherin is not required for Wnt5a signaling.Click here for additional data file.Fig.\u00a0S7. Herbimycin decreases Wnt5a\u2010induced p120\u2010catenin phosphorylation and its interaction with Ror2.Click here for additional data file.Fig.\u00a0S8. Ror2 interacts with p120\u2010catenin.Click here for additional data file.Fig.\u00a0S9. Herbimycin promotes Ror2 internalization.Click here for additional data file.Fig.\u00a0S10. CK1\u03b5 binds to the C\u2010terminal domain of Ror2.Click here for additional data file.Fig.\u00a0S11. CK1\u03b5 depletion decreases Ror2 protein stability but not Ror2 RNA levels.Click here for additional data file.Fig.\u00a0S12. Siah2 shRNA prevents \u03b2\u2010catenin downregulation caused by Wnt5a.Click here for additional data file.Fig.\u00a0S13. Ror2, p120\u2010catenin and CK1\u03b5 are required for Wnt5a\u2010induced asymmetrical distribution of cortical actin in IEC\u201018 cells.Click here for additional data file.Table\u00a0S1. List of antibodies used in this work.Click here for additional data file.\u00a0Click here for additional data file.\u00a0Click here for additional data file."}
+{"text": "Kbtbd11 in adipose tissue. To elucidate the physiological role of Kbtbd11 gene expression, adipose Kbtbd11 mRNA expression levels were estimated under various feeding states in wild-type mice. Kbtbd11 expression increased in a time-dependent manner in the adipose tissue in mice fed on chow diet, whereas the promotion of Kbtbd11 mRNA expression by refeeding was attenuated in mice fed on high-fat (HF) diet, suggesting the suppression of Kbtbd11 mRNA expression under HF diets and that changes in mRNA levels were associated with regulation of the transcription activity of Kbtbd11 by some transcription factors. To investigate the transcriptional regulation of Kbtbd11, the fragment upstream of either mouse Kbtbd11 or human KBTBD11 promoter was inserted into a luciferase vector. Luciferase reporter assays revealed that both mouse and human KBTBD11 promoter activity was increased by USF1. Direct USF1 binding to the Ebox in the Kbtbd11 promoter was confirmed by electrophoretic mobility shift and chromatin immunoprecipitation assays. In addition, the adipocyte differentiation marker levels increased instantly in Kbtbd11-overexpressing Usf1 knockdown cells than in Usf1 knockdown cells. These results imply an association of between Kbtbd11 with Usf1 expression and suggest the involvement of Kbtbd11 in a novel adipogenesis pathway.The present study aimed to investigate the transcriptional regulation of  Kbtbd11; 3T3-L1 differentiation; USF1; transcriptional regulation.Cell biology; Cell Differentiation; Gene Expression; Gene Regulation; Transcription Factor; Biochemistry; Molecular Biology; Obesity;  The BTB/POZ domain functions as the protein\u2013protein interaction domain to facilitate dimer formation and interaction with nonBTB domain comprising proteins, involving activities such as transcriptional regulation, cytoskeleton dynamics, ion channel assembly and gating, and protein ubiquitination/degradation [Kelch repeat and BTB domain-containing 11 (KBTBD11) is a member of the radation . The Kelradation .KBTBD11 is regulated by MYC. A variant allele of KBTBD11\u2014rs11777210\u2014is significantly associated with cell susceptibility to colorectal cancer. KBTBD11 expression is significantly decreased in tumor tissues compared with adjacent paired normal tissues [Kbtbd11 is involved in nutritional regulation and is highly expressed in the epididymal white adipose tissue (eWAT) in diet-induced obesity (DIO) mice compared with that in mice fed on chow diet [Kbtbd11 in 3T3-L1 cells inhibits mitotic clonal expansion (MCE), which is required during the early stages of 3T3-L1 adipocyte differentiation [Kbtbd11-overexpressing 3T3-L1 promotes MCE, which leads to the expression of adipocyte differentiation markers\u2014C/ebpa and Pparg, and induces lipid accumulation [Kbtbd11 expression levels play a major role in MCE and influence triglyceride accumulation and adipocyte differentiation. In this context, the present study aimed to clarify the transcriptional regulation of Kbtbd11 to elucidate the functions underlying the role of Kbtbd11 in adipocyte differentiation.The putative tumor suppressor gene  tissues . We have22.1For mice experiments, we used 8-week-old male C57BL/6 mice from CLEA Japan. The mice were maintained on a normal chow diet. For fasting\u2013refeeding experiments, C57BL/6 mice were fasted for 24 h and then fed a chow diet or HF diet for 4, 6, 8 and 12 h. Feed ingredient contents were as follows: normal chow diet (CE-2) comprised carbohydrate 50.3%, protein 25.4%, and fat 4.4% and high-fat diet (HFD32) comprised carbohydrate 29.4%, protein 25.5%, and fat 32.0% (CLEA Japan Inc.). Animal experimental protocols were approved by the Animal ethics committee of Jichi Medical University (permit number 17177).2.22. For adipocyte differentiation experiments, at 2 days after 3T3-L1 cells confluence, the medium was replaced with high-glucose DMEM comprising insulin (5 \u03bcg/mL), dexamethasone (1 \u03bcM), and 3-isobutyl-1-methylxanthine (0.5 mM). After 2 days of incubation, the medium was replaced with high-glucose DMEM comprising only 5 \u03bcg/mL insulin. The medium was replaced every alternate day. For adenovirus infection experiments, 3T3-L1 cells at day \u22122 after induction of differentiation were infected with adenovirus. 3T3-L1 cells were infected with the adenovirus at a multiplicity of infection (MOI) of 10 plaque-forming units per cell. The adenovirus used in this study demonstrated to be expressed with an efficacy of almost 100% at an MOI of 30 in 3T3-L1 adipocytes, as assessed by GFP (Human kidney 293T (HEK293T) and 3T3-L1 cells were maintained in low-glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 100 units each of penicillin and streptomycin at 37\u00b0C in 5% COd by GFP .Fig.\u00a01Th2.3Adipocytes were fixed with 10% formalin solution in phosphate-buffered saline (PBS) for 10 min and replaced with 60% isopropanol in PBS for 1 min. The fixed adipocytes were stained with ORO for 20 min at room temperature.2.4Kbtbd11 and human KBTBD11 were generated using PCR with either mouse or human genomic DNA as a template. 3T3-L1 cells were co-transfected with each expression vector, mouse Kbtbd11 and human KBTBD11 promoters that drive firefly luciferase expression (pGL4.10 mKbtbd11-Luc and hKBTBD11Luc) and Renilla reniformis luciferase vector (pGL4.74) for use as an internal control reporter. The cells were incubated for 24 h post-transfection at 37\u00b0C in 5% CO2 and lysed in 100 \u03bcL 1x Passive Lysis Buffer (Promega). Lysate was used for the luciferase assay, and luminescence was detected using a Luminometer (Thermo Fisher Scientific).The Dual-Luciferase Reporter Assay System (Promega) was used to determine promoter expression levels. Mouse 2.5Kbtbd11 Ebox (wt), TTTTCTCCACCCACGTGTAAATG and Kbtbd11 Ebox (mut), TTTTCTCCACCCAaaaGTAAATG.The probes shown in 2.6Kbtbd11 promoter\u2212832 Fwd 5\u2032-CCGCATCCTGGTCACCTTTC-3\u2032 and Kbtbd11 promoter\u2212669 Rv 5\u2032- CCTTCCTTCCGTTCCTGTTGG-3\u2032.For the ChIP assay, we used the SimpleChIP Enzymatic Chromatin IP Kit . Immunoprecipitation was performed using an USF1 tag antibody with mouse IgG as the negative control. After immunoprecipitation, the associated DNA was amplified with a primer pair: 2.7Kbtbd11-cDNA was subcloned into the pENTR/D-TOPO vector (Thermo Fisher Scientific). The pENTR-Kbtbd11  vector was transferred into the pAd/CMV/V5-DEST vector using the Gateway system (Thermo Fisher Scientific). Sequences corresponding to the shRNAs for Kbtbd11 and lacZ were cloned into pBlock-it (Thermo Fisher Scientific). The sequence of the shRNA for Usf1: 5\u2032-cacc GTACGTCTTCCGAACTGAG acgtgtgctgtccgt CTCAGTTCGGAAGACGTAC-3\u2032. The adenoviruses were purified using ViraBind Adenovirus Miniprep Kit (Cell Biolabs) according to the manufacturer's protocol.For adenoviruses amplification, we used ViraPower Adenoviral Expression System (Thermo Fisher Scientific) as described previously . Full-le2.8Kbtbd11 Fwd, 5\u2032-TCAGCGTTTTCCGCTACCAT-3\u2032 and Kbtbd11 Rv, 5\u2032-AACACAACGAAAGGGCTGGA-3\u2032; C/ebpa Fwd, 5\u2032-GCCATGCCGGGAGAACTCTA-3\u2032 and C/ebpa Rv, 5\u2032-GGGCTCTGGAGGTGACTGCT-3\u2032; Pparg Fwd, 5\u2032-TTCCACTATGGAGTTCATGCTTGT-3\u2032 and Pparg Rv, 5\u2032-TCCGGCAGTTAAGATCACACCTA-3\u2032; Usf1 Fwd, 5\u2032-ACCCTTATTCCCCGAAGTCAGA-3\u2032 and Usf1 Rv, 5\u2032-CGGCGCTCCACTTCGTTATGT-3\u2032; Srebp1c Fwd, 5\u2032-CGGCGCGGAAGCTGT-3\u2032 and Srebp1c Rv, 5\u2032-TGCAATCCATGGCTCCGT-3\u2032; Fasn Fwd, 5\u2032-ATCCTGGAACGAGAACACGATCT-3\u2032 and Fasn Rv, 5\u2032-AGAGACGTGTCACTCCTGGACTT-3\u2032; aP2 Fwd, 5\u2032-TTTCCTTCAAACTGGGCGTG-3\u2032 and aP2 Rv, 5\u2032-AGGGTTATGATGCTCTTCACCTTC-3\u2032; Tnf\u03b1 Fwd, 5\u2032-CAGCCGATGGGTTGTACCTT-3\u2032 and Tnf\u03b1 Rv, 5\u2032-GGGCTCATACCAGGGTTTGA-3\u2032; Il6 Fwd, 5\u2032-GAGGATACCACTCCCAACAGACC-3\u2032 and Il6 Rv, 5\u2032-AAGTGCATCATCGTTGTTCATACA-3\u2032; Bax Fwd, 5\u2032-GCTGACATGTTTGCTGATGG-3\u2032 and Bax Rv, 5\u2032-GATCAGCTCGGGCACTTTAG-3\u2032; Bcl2 Fwd, 5\u2032-CTGGGATGCCTTTGTGGAAC-3\u2032 and Bcl2 Rv, 5\u2032-GAGACAGCCAGGAGAAATCAAAC-3\u2032; Rplp0 Fwd, 5\u2032-ATGCAGCAGATCCGCATGT-3\u2032 and Rplp0 Rv, 5\u2032-TTGCGCATCATGGTGTTCTT-3\u2032.Total RNA was extracted with acid guanidinium thiocyanate\u2013phenol reagents . cDNA sy2.9Whole cell lysates were electrophoretically separated on denaturing polyacrylamide gels and transferred to polyvinylidene difluoride membranes. Proteins were detected with USF1 , FLAG , PPARg , SREBP1 , FASN , and \u03b2-actin antibody .2.10t-test. All data were expressed as mean \u00b1 SEM. Statistical significance was set at p < 0.05.Statistical significance was tested using the unpaired two-tailed Student's 33.1Kbtbd11 expression is upregulated at 12 h after a chow diet feeding and is increased in the adipose tissue in HF DIO mice [Kbtbd11 expression in eWAT at an earlier time after feeding, the gene expression levels under various feeding states were estimated in C57BL6/J wild-type mice. Kbtbd11 mRNA expression was increased in a time-dependent manner during chow die refeeding. The increase in Kbtbd11 expression after feeding was attenuated in mice fed on HF diet compared with mice fed on chow diet , Ebox, and CCAAT/enhancer-binding proteins (C/EBPs) response elements. Sterol regulatory element-binding proteins (SREBPs), which are major transcriptional regulators of lipid metabolism, bind to the sterol regulatory element DNA sequence TCACNCCAC [The gene structure of mouse CACNCCAC . The lipCACNCCAC . HepatocCACNCCAC .Fig.\u00a03AcKbtbd11 promoter, the 2.3-kb 5\u2032 region upstream of the mouse Kbtbd11 promoter was cloned into a luciferase vector and a luciferase reporter assay was performed in 3T3-L1 cells. The Kbtbd11 promoter was markedly activated by the co-expression of USF1 (KBTBD11 promoter and found the predicted Ebox motif (5\u2032-CTCGTG-3\u2032) in the 0.5-kb 5\u2032 region upstream of the human KBTBD11  and inflammation markers (Tnf\u03b1 and Il6), in addition to lipogenic (Fasn) and proapoptotic genes (Bax and Bcl2), were not altered. We have previously demonstrated that the effects of Kbtbd11 knockdown on mature 3T3-L1 adipocytes do not vary between the control and Kbtbd11 knockdown conditions [Kbtbd11 plays a role after starvation and/or during lipid accumulation in adipose tissue.Based on the changes in 80-folds B. Howevepression A. Consis3.7Kbtbd11 in adipocyte differentiation, we examined the effects of Kbtbd11 in Usf1 knockdown 3T3-L1 cells. The adenoviral coinfection of Usf1 shRNA and GFP (shUsf1+GFP) constructs reduced Usf1 mRNA expression levels by up to 70% compared with the coinfection of shLacZ and GFP (shLacZ+GFP) control  (To investigate the role of  control A. On day control B and incnd Pparg C. Consismulation B and sigd Pparg) C.Fig.\u00a08TKbtbd11-overexpressing Usf1 knockdown 3T3-L1 cells, the Kbtbd11 mRNA expression increased by 24-folds   C compareL1 cells C. Comparpression C.3.8Kbtbd11 in mature adipocytes, we investigated the effects of Kbtbd11 in Usf1 knockdown mature 3T3-L1 adipocytes. On day 8 after inducing differentiation, mature 3T3-L1 adipocytes were coinfected with adenoviral vectors expressing shLacZ and GFP control, shUsf1 and GFP, or shUsf1 and Kbtbd11. Compared with shLacZ and GFP control, coinfection of shUsf1 and GFP decreased Usf1 mRNA expression levels (by up to approximately 80%)  (Pparg and aP2) and lipogenic (Srebp1c and Fasn) genes significantly decreased in the shUsf1+GFP mature 3T3-L1 adipocyte cells (Pparg and Srebp1c mRNA levels in the shUsf1+GFP cells (Pparg and aP2) and lipogenic (Srebp1c and Fasn) genes increased significantly and nearly recovered in the shLacZ+GFP control (To examine the role of ely 80%) B as wellely 80%) C. ConsisFP cells B. Endogeantibody C. The litaining) A. In addtaining) A. Howevete cells B. PPARg FP cells C. SimilaFP cells A, althou control B. PPARg  control C. FASN p control C.Fig.\u00a09E4Kbtbd11 mRNA expression increases in a time-dependent manner during 3T3-L1 differentiation and increases significantly in eWAT under feeding status and obesity [Kbtbd11 knockdown inhibits mitotic clonal expansion (MCE), and the resulting Kbtbd11 attenuates 3T3-L1 adipocyte differentiation. Unlike Kbtbd11 knockdown in 3T3-L1 cells, Kbtbd11 overexpression promotes MCE, thus leading to the expressions of C/ebpa and Pparg. These results suggest that Kbtbd11 expression regulation plays an important role in adipogenesis. Therefore, we hypothesized that the elevated expression of Kbtbd11 in eWAT in obese mice during 3T3-L1 differentiation could be regulated by transcription factors, including adipogenic and lipogenic transcription factors.We have previously reported that  obesity . MoreoveKbtbd11 expression in 3T3-L1 cell differentiation, we investigated Kbtbd11 transcriptional control mechanisms. We used LASAGNA-Search 2.0 for analyzing the candidate transcription factor binding sites in Kbtbd11 promoter and identified the potential binding sites of lipogenic and adipogenic transcription factors, SREBP1, LXR, USF1 C/EBPa, PPARg, and HNF4a. Subsequently, we investigated whether the transcription factors activate the Kbtbd11 promoter and found that USF1 was bound to the Ebox motif in the Kbtbd11 promoter and it enhanced the activation of Kbtbd11 transcription significantly. In fasting\u2013refeeding experiments, Usf1 mRNA expression was increased in a time-dependent manner during chow diet refeeding, which is consistent with the Kbtbd11 mRNA expression. In addition, the attenuation of Usf1 mRNA after HF diet feeding was also consistent with that of Kbtbd11 mRNA , except after starvation or during energy storage in adipose tissue  . USF1 isipidemia , 17, incipidemia , risk ofipidemia , 20, metipidemia , 22, andipidemia , 24, 25.gulation  during ae tissue .Usf1 knockdown in 3T3-L1 cell differentiation is rescued through Kbtbd11 overexpression. Usf1 knockdown inhibits differentiation into 3T3-L1 adipocytes because USF1, a crucial master regulator of adipocyte differentiation, regulates the transcription of C/ebpa and Fasn by binding to the Ebox region of the promoters [C/ebpa, Pparg, Fasn, and aP2) levels increased significantly Kbtbd11-overexpressing Usf1 knockdown cells compared with those in Usf1 knockdown cells  (Pparg and aP2) and lipogenic (Srebp1c and Fasn) genes significantly increased and nearly recovered in the shLacZ+GFP control  A. Howeve control B, suggesKbtbd11 overexpression did not affect the expressions of adipocyte differentiation markers in 3T3-L1 cells. This result was consistent with Kbtbd11 knockdown in mature 3T3-L1 cells, wherein Kbtbd11 knockdown in mature 3T3-L1 cells was not different from the control adipocytes [Kbtbd11 did not affect the already matured adipocytes and/or adipocytes that have reached the lipogenesis threshold. Conversely, Usf1 knockdown in mature 3T3-L1 cells downregulated adipogenic and lipogenic genes   of Kbtbd11 in adipocyte homeostasis and the physiological functions remain to be fully elucidated.Moreover, ipocytes . These rnd Fasn) . In suchKBTBD11 differed in methylation and expression levels between two subtypes of patients (TCF3-HLF and TCF3-PBX1) based on the presence of chromosomal translocations [KBTBD11 was overexpressed in TCF3-HLF compared with that in TCF3-PBX1 patients, and the CpG sites in the exons of KBTBD11 were hypomethylated before remission in TCF3-HLF patients. Following remission, KBTBD11 methylation increased and gene expression was downregulated. The results suggested that KBTBD11 hypomethylation, expression levels, and/or transcriptional regulation are associated with the regulation of B-cell proliferation and differentiation in B-cell ALL [A recent study has reported the methylation and gene expression profiling of B-cell acute lymphoblastic leukemia (ALL) using next-generation sequencing and showed that ocations . KBTBD11cell ALL .KBTBD11 intron1 and regulated KBTBD11 expression [KBTBD11 in the MYC response element in KBTBD11 intron1, is significantly associated with cell susceptibility to colorectal cancer. KBTBD11 is reported to be downregulated in tumor tissues, and KBTBD11 knockdown promoted cell proliferation and inhibited cell apoptosis [KBTBD11 expression and transcript levels of KBTBD11 play important roles in tumorigenesis and function.In addition, the oncogenic transcription factor MYC bound to a MYC response element in pression , 29. Furpoptosis , suggestKBTBD11 expression levels, methylation, and transcriptional regulation using a variant of MYC and a subtype of TCF3-HLF could be an important proliferation and differentiation function in various cell types. Considering that Kbtbd11 is a target USF1 gene that regulates proliferation and differentiation in adipocytes, genetic variation in USF1 and varying Kbtbd11 expression levels could be associated with obesity.Overall, alterations in Kbtbd11 and found that the effect of Usf1 knockdown is rescued through Kbtbd11 overexpression. However, further research is required to clarify Kbtbd11 methylation and expression differences between normal and obese individuals and elucidate the physiological function(s) of KBTBD11. KBTBD11 can be applied to control the progression and differentiation, including the development, of various cell types, such as adipocytes and cancer cells.In conclusion, we revealed that USF1, an important regulator of lipid metabolism, is involved in the transcriptional regulation of Kazuhisa Watanabe: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Kazuha Yokota, Ken Yoshida, Ayumi Matsumoto, Sadahiko Iwamoto: Contributed reagents, materials, analysis tools or data.Japan Society for the Promotion of Science ; Jichi Medical University young investigator award.This work was supported by grant-in-aid  from The authors declare no conflict of interest.No additional information is available for this paper."}
+{"text": "These results demonstrate the variability among GSL methods and the importance of selecting an appropriate method to accurately project the ecosystem carbon cycling response to longer growing seasons in the future. To encourage this approach in future studies, we outline a series of best practices for GSL method selection depending on research goals and the annual NEP dynamics of the study site(s). These results contribute to understanding growing season dynamics at ecosystem and continental scales and underscore the potential for methodological variability to influence forecasts of the evergreen conifer forest response to climate variability.Growing season length (GSL) is a key unifying concept in ecology that can be estimated from eddy covariance-derived estimates of net ecosystem production (NEP). Previous studies disagree on how increasing GSLs may affect NEP in evergreen coniferous forests, potentially due to the variety of methods used to quantify GSL from NEP. We calculated GSL and GSL-NEP regressions at eleven evergreen conifer sites across a broad climatic gradient in western North America using three common approaches: (1) variable length (3\u20137 days) regressions of day of year versus NEP, (2) a smoothed threshold approach, and (3) the carbon uptake period, followed by a new approach of a method-averaged ensemble. The GSL and the GSL-NEP relationship differed among methods, resulting in linear relationships with variable sign, slope, and statistical significance. For all combinations of sites and methods, the GSL explained between 6% and 82% of NEP with  However, there is little agreement on how to quantify the change in growing season length (GSL) using commonly available field observations. Although many methods exist to quantify metrics of vegetation phenology, calculating GSL from eddy covariance measurements of net ecosystem productivity (NEP) is particularly advantageous due to a large and expanding network of eddy covariance stations6, the integrated ecosystem scale of the data, and the simultaneous measurement of biological and meteorological covariates. Yet, substantial uncertainty remains with respect to the impact of lengthening GSLs on NEP , due to the variety of eddy covariance-derived methods used to quantify GSL14. This lack of standardization highlights the need for an assessment of the variability among methods to quantify GSL, how this variability may differ among ecosystems, and how it may affect inferred ecosystem responses to future climate variability.Growing seasons are lengthening across the globe with consequences for ecosystem function including productivity, nutrient cycling, hydrology, and many associated climate feedbacks16. Phenological transitions are more fluid in evergreen versus deciduous ecosystems because leaf biochemistry is not constrained to the period between leaf-emergence in spring and senescence in fall17, challenging the characterization of a discrete growing season19. The subsequent potential for rapid shifts between transient dormant states also makes remote sensing methods problematic for estimating phenological phase shifts in conifers. For example, previous studies found that photosynthetic upregulation can precede canopy greening by several weeks21, suggesting that remote sensing estimates of GSL determined from changes to canopy spectral properties may be biased towards shorter GSLs and later starts to the growing season. In contrast, the eddy covariance technique provides a direct measurement of the integrated ecosystem-scale carbon flux (i.e. NEP) with high temporal resolution23. Accordingly, eddy covariance data are commonly used to investigate ecosystem- to global-scale carbon cycling questions, and organized networks of flux towers  provide an advantageous research platform to characterize patterns of terrestrial carbon cycling through cross-site comparisons5. While several methods exist for defining GSL from eddy covariance-derived NEP data, detailed comparisons of these methods are lacking. As a result, it is currently unclear how to interpret among studies that have explored the sensitivity of NEP to growing season length while using different methods25.Evergreen conifer forests contribute disproportionately to carbon cycling in western North America and other semi-arid areas and have been identified as a research priority due to their potential sensitivity to disturbance25, we applied three common groups of generalized methods to facilitate standardized comparison among sites. The first group of methods characterizes the beginning (GSstart) and end (GSend) of the growing season using variable length regressions of day of year versus NEP24  because it can be directly measured by the eddy covariance technique and therefore requires no assumptions or statistical estimation of parameters to partition GPP from NEP25. We specifically explored the following research questions: (1) what is the variation among three different types of methods to calculate GSstart, GSend, and GSL from eddy covariance data? And, (2) how do these differences influence the subsequent relationship between GSL and NEP within and across ecosystem types and with respect to climatic variability?This study focused on a subset of the available AmeriFlux data from temperate, subalpine, and boreal evergreen conifer forests in the western United States and Canada that span broad gradients in latitude, air temperature, and precipitation Table\u00a0. Given tP24 Fig.\u00a0. The secl10 Fig.\u00a0. The thi\u00a010 Fig.\u00a0, potentiWe used 76 site-years of eddy-covariance tower data, encompassing different record lengths from 11 sites in the AmeriFlux network Table\u00a0. In the p\u2009<\u20090.01) except for GLEES (p\u2009=\u20090.23), Poker Flats (p\u2009=\u20090.31), and Valles Subalpine (p\u2009=\u20090.19). The variability in GSL estimates from the four models  was generally greatest at the coldest  and warmest  sites with Niwot Ridge (se\u2009=\u20091.5 days) having the least variability. There was little variation in standard error among sites with mean annual air temperature (MAAT) between 4 and 10\u2009\u00b0C (mean se\u2009=\u20093.2 days). The dispersion of GSL around the mean  was greatest at the two boreal sites, Poker Flats and NOBS, with a CV of 20% and 18%, respectively, whereas Sierra 2700 (CV\u2009=\u20092%) and Niwot Ridge (CV\u2009=\u20094%) had the lowest interannual GSL variability. Methodologically, the greatest interannual within-site GSL variability was associated with the carbon uptake period (CUP) method (CV\u2009=\u200911%). The Variable Length Regression (VLR) method resulted in the least interannual within-site GSL variability (CV\u2009=\u20095%). For the smoothing methods, the length of the smoothing window influenced the GSL with five-day smoothing producing a longer GSL than ten-day smoothing by an average of 21 days; this difference was greatest (47 days) at the 2700\u2009m Sierra site and least (3 days) at Flagstaff.Irrespective of method, GSL generally increased with increasing mean annual air temperature Fig.\u00a0. Across Individual GSL methods were variably biased relative to the response to MAAT represented by the ensemble mean of the different methods Fig.\u00a0. Both smstart) and end (GSend) of the growing season (\u0394CV) among sites (2\u2009<\u2009n\u2009<\u200917) increased linearly with MAAT  and Niwot Ridge was the least variable (CV\u2009=\u20095%); the mean CV for GSstart across all sites was 11%. With respect to GSend, the NOBS site was the most variable (CV\u2009=\u20096%) and Valles Montane was the least variable (CV\u2009=\u20090.7%); the mean CV for GSend across all sites was 2%. The NOBS site was also the only location where inter-annual GSend variability was greater than inter-annual GSstart variability. Conversely, GSstart was approximately an order of magnitude more variable than GSend at the Valles Montane and Flagstaff sites.The difference between the temporal variability  associated with the beginning  GSL-NEP regression slopes with inverse signs  and VLR-GSL explained the least (mean R2\u2009=\u20090.12).The ability of GSL to predict NEP was inconsistent among methods and the four AmeriFlux stations with record lengths greater than 7 years . In certain cases, the among-method variability in GSL was large enough to produce statistically significant  is a common metric in ecosystem ecology used to define vegetation boundaries, constrain biogeophysical models, and/or infer ecosystem responses to future climate shifts2. We also observed substantial variation in among-method GSL variability at the two warmest sites (Blodgett and Sierra 2015\u2009m), which was likely due to rapid, transient shifts between periods of photosynthetic activity and dormancy in the spring19 that can complicate the process of quantifying a discrete beginning of the growing season.Calculated GSLs varied among methods at all sites but were most variable at the coldest sites. We therefore highlight that selecting a single GSL method without comparison to other methods has the potential to introduce bias into the interpretation of ecosystem dynamics, especially in high latitude or high altitude systems where vulnerability to a changing climate may be the greateststart occurring before the moving average crossed the zero-NEP threshold. The opposite was true in warmer systems such as the Sierra sites where an increasing frequency of warm-cold cycles in late-spring produced smoothed data with a more gradual transition into the growing season such that the VLR-GSstart generally occurred after the smoothed data had crossed the zero-NEP threshold. Coupled with the general lack of precision in phenological indices, these results support implementations of an ensemble approach that effectively smooths method-specific idiosyncrasies to produce more robust, defensible estimates of GSstart, GSend, and GSL.Variability in GSL among methods was principally due to arithmetic differences in how each method identifies and defines shifts in physiological activity. For example, the VLR method selects the date of transition into the growing season by isolating the first day of a multi-day period with the steepest regression slope. However, depending on the rate of transition into the growing season, this point can occur before or after smoothed data crosses the zero-NEP threshold , and where variability in the maximum daily NEP has been shown to more accurately capture soil or atmospheric drought stress that can reduce carbon fixation such that total respiration produces more carbon than that fixed by photosynthesis (i.e. NEP\u2009<\u20090)10. We also emphasize the potential for temporal asynchrony between respiration and gross carbon uptake to affect the CUP method early and late in the growing season22. This asynchrony can be especially important in snow-dominated ecosystems, such as several included in this study, where snow cover can introduce a temporal lag into the soil carbon efflux by limiting gaseous diffusion to the atmosphere, potentially skewing temperature-based statistical partitioning estimates of carbon fixation and respiration35. For these reasons, we focus this study on NEP, as opposed to gross primary production, but acknowledge the benefit of further inquiry into how the constituent components of the ecosystem carbon cycle affect GSL and vice versa.The carbon uptake period (CUP) is uniquely unconstrained among the methods in this study by the assumption that all carbon uptake must occur within a discrete period between the beginning and end of the growing season. This creates a particular set of advantages and disadvantages that must be considered prior to its use. For example, our results suggest that the CUP approach is conducive to application in evergreen conifer forests where carbon uptake during periods considered outside of the growing season by other GSL methods can contribute significantly to annual NEP37. The co-determination of ecosystem carbon fluxes and GSL from eddy covariance data additionally promotes extrapolation of future conditions from interannual carbon cycling variability, which can supplement modeled representations of ecosystem carbon dynamics in the context of climate variability. However, the methodological disagreement at sites with greater than seven years of data identified by the current study highlights potential risks associated with indiscriminately extrapolating future ecosystem response from eddy covariance GSL and NEP variability. For example, the CUP and HST methods suggested an increase in NEP with increased growing season length at the Metolius site, whereas the VLR method suggested a decrease in NEP under the same conditions. Further, our finding that no method was a significant predictor of the GSL-NEP relationship at Niwot Ridge contrasts previous work that showed a negative GSL-NEP relationship at that location24, although this disparity may be affected by recent corrections made to the published Niwot Ridge dataset39. Regardless, this work identifies the potential for opposing conclusions regarding the NEP response to growing season length to be drawn from the same data, which contributes to lingering uncertainty in carbon cycling projections28.The high temporal resolution of eddy covariance data is conducive to characterizing ecosystem scale phenology and growing season dynamics given that direct measurements of NEP bypass many errors associated with modeled- and/or satellite-based methodsstart and GSend with respect to mean annual air temperature adds context to previous work. For instance, the greater variability in GSstart versus GSend was expected given that previous work has shown spring-onset to be more variable than fall-onset41, and the timing of the winter-to-summer transition is transient in evergreen conifer ecosystems17 due to variability of the temperature controls on GSstart at both the tree and ecosystem scales43. Air temperature anomalies have also been reported to affect GSend variation in temperate and boreal systems, which may be amplified by snow cover effects on albedo and the surface energy balance35. However, the enhanced variability of GSend versus GSstart at the NOBS site was surprising because boreal carbon assimilation can be limited by day length in autumn to reduce frost damage from delayed dormancy onset14. Together with previous studies that have shown greater GSend versus GSstart variability in warmer versus colder ecosystems34, this result could thus signify an important distinction between temperature limitation at colder sites versus water limitation at warmer sites during the autumn. Improved understanding of growing season asymmetries, their effect on annual NEP, and how they vary among ecotypes is essential as spring continues to advance more quickly than fall is delayed, and as warming is amplified at high altitude and high latitude sites45.Among ecosystems, the relative timing of GS19. This conceptual model illustrates that the efficacy of a chosen GSL method will vary depending on the scope of the study and the system(s) being investigated.We identified three distinct categories of annual NEP dynamics that are conceptualized in Fig.\u00a0start and GSend dates are needed, and autocorrelation between annual NEP sums and the number of days with net positive carbon fluxes is inevitable. Conversely, methods that define a discrete GSL as the time between GSstart and GSend will perform poorly in ecosystems with substantial mid-winter carbon uptake, stress induced dormancy during summer, or where the transition into the growing season is characterized by periods of variable but increasing physiological activity. Given the variability in ecosystem dynamics and how different GSL methods capture phenological transitions differently, we urge future studies to compare multiple methods for determining GSL, and to consider compiling ensemble estimates that can be used to quantify uncertainty  environmental signals with inconsistent frequency and intensities26. Consequently, it is imperative that future investigations continue toward realistic application of GSL-NEP dynamics, especially when seeking to model the phenological response to changing GSL.The NEP dynamics identified by this work can be used to guide selection of the most appropriate method for calculating GSL at a given site. For example, the CUP method was the most predictive of NEP, but its usefulness is limited in phenological studies where explicit GSstart and GSend were generally of limited use in ecosystems where the potential for warmer weather patterns during winter and short-term physiological upregulation that contributed significantly to annual sums of NEP. The inconsistent interactions between methodological biases and site-level climate reported herein indicate that an ensemble approach is generally recommended to represent GSL and to characterize the variability resultant from site-specific, methodological, and/or phenological characteristics.Using 76 site-years of data across a variety of conifer ecotypes, we found substantial variation among methods used to determine the beginning, end, and length of the growing season from daily NEP data. When testing the subsequent influence of GSL on annual sums of NEP, propagation of this variability was sufficient to generate opposite conclusions from different GSL-NEP relationships calculated from a single data set using different methods. The threshold-smoothing and VLR methods tested in this study can define phase shifts but there was evidence for opposite biases among the methodological groups that led to diverging GSLs with increasing mean annual air temperature. Similarly, methods that defined the growing season as the time between GShttp://ameriflux.lbl.gov/) and NEP measured by tower-based eddy covariance at each site was gap-filled using the REddyProc package46 in R (version 3.4.4). The selected sites encompassed a wide range of mean annual air temperature (\u22122.7 to 11.2\u2009\u00b0C) and precipitation (275 to 1226\u2009mm) values. We specifically compared three classes of methods to calculate GSstart, GSend, and GSL: (1) Variable-length regression  The smoothed-threshold method14 defines GSstart as the day that an interval-averaged NEP crosses and remains above a threshold for a given number of days, with the converse determining GSend. We chose zero as the NEP threshold for this study and specifically tested low-smooth  and high-smooth  thresholds. (3) The carbon uptake period . We also calculated an ensemble mean of all methods as the arithmetic mean GSL from the three previous methods.Thirty-minute Level 2 processing data files were downloaded directly from the AmeriFlux website ("}
+{"text": "A photoswitchable TPE based supramolecular host can encapsulate C60 in the Z-form with a markedly different visual change in the colour. In addition, the Z-1 bound C60 has been characterized by various spectroscopic methods and mass spectrometry. Upon exposure to visible light (>490\u2009nm), the host switches to the E-form where the structural complementarity with the guest is destroyed as a result of which the C60 is disassembled from the host. The results described herein reveals an actionable roadmap to pursue further advances in component self-assembly particularly light-induced association and dissociation of a guest molecule.Stimuli responsive hosts for C Since C60 is a spherical \u03c0 framework devoid of any functional groups, construction of its receptor has been a challenge for chemists. A number of host molecules for C60 stands as witnesses of ingenuity of molecular architecture4. Complementarity of the spherical shape of the buckyball has been achieved by challenging synthesis of molecular bowls, hoops, peapods and several other flexible structures that undergo induced-fit around the molecule. Cycloparaphenylene acetylenes offer supramolecular complexation with fullerene derivatives5. Platinum-based molecular cages has also been reported to encapsulate the C606. Aromatic molecules such as cycloparaphenylene rings encapsulate C60 as well as other fullerene derivatives8. An aza-buckybowl based system have been reported to act as efficient receptors for C60 and C70 with large association constant9. Larger aromatics such as cyclochrysenylenes form molecular \u201cpeapods\u201d. The complementarity of the convex surface of the buckyball has been achieved by concave bowl-shaped molecules such as corannulenes, sumanenes and even with a expanded rosarin derivative13. Even a nitrogen-containing buckybowl and its assembly with C60 has recently been reported14. Non-planar hydrocarbons such as triptycene also form complexes with fullerenes due to geometrical complementarity of their concave shapes to the spherical surface of the C6015. Fusion of more than one receptor units in a single host molecule displayed enhanced affinity towards the fullerene guest. For instance, a receptor bearing two corannulene units has been reported as a \u201cbucky-catcher\u201d with a high binding constant16.The discovery of fullerene is marked as an epoch in the field of organic nanomaterials21. Light is one of the most extensively used stimuli because of its non-invasive nature and easy regulation by the precise focus of its exposure area, and adjustment of its wavelength and intensity23. Several light-triggered and redox-triggered release of guest molecules have been reported in recent years27. The selective recognition of C60 by a bispyridine ligand with embedded anthracene panels in presence of Ag(I) ion and its light-mediated subsequent release was studied28. Reversible host-guest complexation and decomplexation triggered by light can be achieved by the incorporation of photochromic units in the supramolecular systems29. Azobenzene is a robust photoresponsive molecule which can exhibit significant structural and chemical modification upon exposure of UV and visible light. These photoswitches have been widely used for the rapid and exact modulation of several biological processes45.Stimuli-responsive supramolecular host for fullerenes can open up the possibilities for handling the bucky balls and other carbon-based frameworks with superior controls using the stimuli such as pH, electrical or magnetic fields, electrochemical and photonic signals60 and a photoresponsive group containing nanorings host was investigated and further experimental synthesis of photoresponsive hosts have been predicted46. However, reversible binding and release of C60 still remain a challenge. C60 is known to form stable supramolecular complexes with several compounds having flexible phenyl rings47. Crystal structures showing C60-tetraphenylethene (TPE) bears the witness of the non-covalent van der Waals interactions between the two species48. Recent years, TPE have been widely used due to its abnormal properties i.e. non-luminescent in a solution state and highly emissive upon aggregation and solid state \u2013 so called aggregation induced emission (AIE) active chromophore50.A theoretical study of host-guest interactions between C1, Fig.\u00a060. Binding through supramolecular association is much coveted because it does not perturb the electronic structure of the guest significantly. The azobenzene-TPE photoswitch offers the control of the geometry of the receptor allowed reversible supramolecular interaction with C60.Incorporating a photoswitchable azobenzene unit between two TPE moieties, we have synthesized the azobenzene-TPE , Fig.\u00a01 1 was prepared by reacting 1,2-bis(4-bromophenyl)diazene with 3 equiv. of phenyl)boronic acid in degassed 1,2-dimethoxyethane/2\u2009M Na2CO3  using Pd(PPh3)4 as a catalyst at 100\u2009\u00b0C for 24\u2009h yielded 1 in 69.5% (for details see Supplementary Information).Azobenzene-TPE 1 exhibit E-Z photochromism where the forward and the backward reactions are fully reversible upon exposure to UV and visible light respectively. Upon irradiation with 254\u2009nm light, the n\u2009-\u2009\u03c0* band of the E isomer can be selectively excited leading to the conversion to Z isomer as shown in Fig.\u00a05\u2009M\u22121cm\u22121) becomes broad and the intensity of the band increases with the exposure time. A new broad peak at 550\u2009nm (\u03b5\u2009=\u2009~9.8\u2009\u00d7\u2009103\u2009M\u22121 cm\u22121) arises due to the n\u2009-\u2009\u03c0* transition of the Z isomer which increases in intensity with the 254\u2009nm radiation. The photoisomerization reaction was accompanied by a change in colour that was visually noticeable. The yellow colour of the E isomer was transformed to intense orange under isomerization to the Z isomer  and a shoulder at ~550\u2009nm. In the Z isomer, the fluorescence intensity was less intense (\u03a6F\u2009=\u20090.004) with a single band at 480\u2009nm as shown in Fig.\u00a0The molecule mer Fig.\u00a0 The E toE-Z isomerization of 1 under the exposure of 254\u2009nm light was monitored by 1H spectroscopy , 7.58 (Hb), and 7.32 (Hc). Conversion to the Z-isomer upon exposure to 254\u2009nm UV light triggered an upshifted field shift of the 1H resonances and to \u03b4 values (a) and (b) protons appear at 7.34 (Hc\u2019), 7.19 (Hb\u2019) and 6.83 (Ha\u2019). The TPE protons appeared as multiplets and their change in the 1H NMR spectra was not identifying because of the presence of overlapping multiplets. The composition under the irradiation in the NMR tube corresponded to a ca. 3:1 ratio of the Z: E isomer.The opy Fig.\u00a0 using CS60 to Z-1, the formation of Z-1.C60 was apparent from the instant change in the absorption spectra. Apart from the obvious change in the visual appearance of the solution Z-1 with C60 upon mixing  monitored at 460\u2009nm clearly revealed an association with 1:1 stoichiometry of the host and the guest C60  the peak of the C60 at 143.0 ppm underwent an upfield shift to 142.9 ppm because of the encapsulation within the aromatic rings of Z-1. The change in the 13C resonance of the host also provided an insight of the binding site within Z-1 and C60 host-guest complex formation, respectively6. Importantly, The MALDI-TOF MS of a sample containing Z-1.C60 indicated the presence of the species that matches well with the expected isotopic pattern  takes place in presence of the visible light. The sharp characteristics changes in NMR spectra also prove the encapsulation and release of C60 by the Z form of the molecule. The 1H NMR study was performed with the Z form of the molecule 1 in the presence one equivalent of C60 in CS2. Although the changes in the 1H NMR (Supplementary Fig.\u00a013C NMR was clear. There the peak for the C60 at 143.0 shifted upfield to 142.9 ppm (Fig.\u00a060 upon encapsulation by the host TPE groups in Z form experiences a shielding effect which causes an upfield shift to the C60 nuclei. This change was reversible under exposure to visible light which was also observed earlier with absorption spectroscopy as described earlier.The tra Fig.\u00a0 with theppm Fig.\u00a0. This ch60 molecule fits in perfectly within the aromatic cavity of the Z-1 form. Several phenyl rings of the molecule puckered around to accommodate the C60 with a perfect shape complementarity to form the supramolecular assembly (Fig.\u00a0A three dimensional model of the system obtained from computational simulation using DFT calculation at the B3LYP level displayed clear interactions between the receptor and the fullerene. The Cbly Fig.\u00a0.Figure 5A TPE-linked azobenzene based photoswitchable molecule has been synthesized and characterized by various spectroscopic techniques.E\u2009\u2192\u2009Z isomerisation of the compound 1 offers the possibility of the formation of a complementary pocket for the accommodation of C60 guest molecule.The structural change of the structure upon E and the Z isomers of 1 and the C60 molecule has been investigated by various spectroscopic techniques.Host-guest interaction with both the Z-1.C60 association was pronounced compared to the interaction between the E-1 isomer and C60.It was observed that the Z-1.C60 association can be reversed by the exposure of the system with >490\u2009nm light that converts the Z-1 form to the E-1 form, and thereby weakening the host-guest binding.The To sum-up, our salient findings of this work are as follows.60 molecule51.Thus this work demonstrates the development of the stimuli responsive host system that can be can be used for light-induced association and dissociation of a CSupplementary Information"}
+{"text": "Cytomegalovirus (CMV) infection is common in immunocompetent patients in intensive care units (ICUs). However, whether CMV infection or CMV reactivation contributes to mortality of immunocompetent patients remains unclear.A literature search was conducted for relevant studies published before May 30, 2016. Studies reporting on CMV infection in immunocompetent patients in ICUs and containing 2\u2009\u00d7\u20092 tables on CMV results and all-cause mortality were included.2\u2009=\u200989%, n\u2009=\u20092398) and the CMV reactivation was 31% . The odds ratio (OR) for all-cause mortality among patients with CMV infection, compared with those without infection, was 2.16 . Moreover, upon exclusion of studies in which antiviral treatment was possibly or definitely provided to some patients, the association of mortality rate with CMV infection was also statistically significant . For CMV seropositive patients, the OR for mortality in patients with CMV reactivation as compared with patients without CMV reactivation was 1.72 . Patients with CMV infection required significantly longer mechanical ventilation (mean difference (MD): 9\u00a0days ) and longer duration of ICU stay ) than patients without CMV infection. When analysis was limited to detection in blood, CMV infection without antiviral drug treatment or reactivation was not significantly associated with higher mortality .Eighteen studies involving 2398 immunocompetent patients admitted to ICUs were included in the meta-analysis. The overall rate of CMV infection was 27%  contains supplementary material, which is available to authorized users. Human cytomegalovirus (CMV) is a prototypic member of the \u03b2 herpes virus subfamily . The preIt is well known that CMV infection is common in canonical immunodeficiency patients, such as those with human immunodeficiency virus infection, solid organ or stem cell transplantation and patients undergoing chemo- or radiotherapy \u20139. With Whether CMV infection is associated with increased mortality in immunocompetent ICU patients remains controversial \u201316. A prA literature search for relevant publications included within the electronic databases PubMed, EMBASE and the Cochrane Library was performed using combinations of the keywords \u201ccytomegaloviruses\u201d, \u201csalivary gland viruses\u201d, \u201cherpes virus\u201d, \u201ccytomegaloviral infection\u201d, \u201cHHV5\u201d, \u201cintensive care\u201d, \u201ccritical care\u201d, \u201ccritical illness\u201d, \u201cmechanical ventilation\u201d, and \u201cpulmonary ventilator\u201d. All searches were updated on May 30, 2016. No language restriction was enforced. We also consulted relevant reference articles and searched using Google Scholar.Two researchers (LX and HYB) performed data extraction independently, and any discrepancies were addressed by discussion and reevaluation until consensus was achieved. Observational studies were eligible if they reported on CMV infection in immunocompetent patients in the ICU, and if a 2\u2009\u00d7\u20092 table could be constructed based on CMV results and all-cause mortality. All patients were over 18\u00a0years of age. The systematic review included only studies in which all patients were tested for CMV. An episode of CMV infection was defined by one of the examination CMV viral culture, polymerase chain reaction (PCR), CMV antigen (pp65) in blood, tracheal aspirates, urine, or a combination of these. A case was defined by the presence of reactivation, where the patient had CMV infection and was seropositive. Immunocompetent patients were defined as those patients who did not receive a solid organ or hematopoietic stem cell transplant, did not receive immunosuppressive treatment, did not have human immunodeficiency virus infection, did not have primary immunodeficiency, and did not receive chemotherapy or radiotherapy before ICU admission.We obtained information on basic study characteristics , characteristic population, the site and detection method of sample, CMV seropositivity, CMV infection incidence, all-cause mortality, length of ICU/hospital stay, length of mechanical ventilation, and administration of antiviral drugs.The Newcastle\u2013Ottawa scale, developed for evaluating the quality of observational studies . Meta-analytic pooling was performed for outcome variables with a Logit transformation approach, reporting results as summary point estimates . We used the Mantel\u2013Haenszel method to obtain odds ratios (ORs) and 95% CI. When only the median, range, or interquartile range of length of mechanical ventilation and the length of ICU stay were reported, we used simple formulas to estimate the mean and standard deviation .2 measure of inconsistency and the chi-square test of heterogeneity.Between-study heterogeneity was examined using the ITo evaluate publication bias, we constructed a funnel plot and used the Egger test. Sensitivity analyses of the Begg\u2019s test were additionally conducted to ascertain the robustness of our findings. All meta-analyses were performed with R software (version 3.3.3 for Windows) and SPSS 18 .The initial database search identified 1846 potentially relevant studies. Following this, assessment of the full text yielded 17 studies suitable for analysis. Another publication was incorporated after examining references from the extracted articles . ConsequMost studies were conducted in the United States and Europe, except one cohort study in Egypt , and werA total of 2398 patients were included, having been admitted to the ICU for a variety of reasons, with a median age of 59\u00a0years. The median period of prospective studies was 24\u00a0months, ranging broadly from 3 to 78\u00a0months. All studies used CMV blood assays, and 6 studies also assayed sputum samples. Most studies indicated that the frequency of sample collection was once a week. In our analysis, the methods used to assess CMV infection were virus culture, pp65 antigen detection and PCR detection of CMV DNA in ten, three and two studies, respectively, and combinations of two diagnostic methods in the remaining three studies.2\u2009=\u200989%, n\u2009=\u20092398). As compared with patients without CMV infection, the all-cause mortality of patients with CMV infection was significantly higher   compared with patients without infection  Fig.\u00a0. When an2\u2009=\u200937%, n\u2009=\u2009912) compared with patients without infection  as compared with patients without infection  and 12\u00a0days , respectively, between patients with and without CMV infection  and MD: 9\u00a0days ), respectively  in immunocompetent ICU patients   Fig. .Fig. 5Th2\u2009=\u200929%, n\u2009=\u2009664)   Fig. . But forWe also analyzed the rate of CMV and mortality thought categorized by the detection methods  or in the all-cause CMV mortality analysis . We also used Begg\u2019s test to detect sensitivity analysis, and the results showed that the analyses were robust.We used the Egger test to detect publication bias. There was no publication bias either in the overall CMV prevalence analysis . However, when compared with other methods, the association with mortality was marginally less strong using PCR. We may think that viral burden of CMV is determinant of pathogenesis, and higher CMV loads is correlated with progression of some CMV infection disease [We found that the detection rate of CMV by culture, pp65 and PCR was 13, 22 and 34%, respectively. Desachy et al. demonstrated that positive results for CMV infection were obtained in a median of 4\u00a0days by PCR compared with 11\u00a0days by pp65 antigen detection after onset of sepsis . Therefo disease , 40.The presence of CMV seropositivity, representing previous infection, was found in 71% of immunocompetent ICU patients and the incidence of CMV reactivation was high, observed in 31% of seropositive patients in our meta-analysis. There are several factors that might explain the high prevalence. First of all, the rate of CMV seropositivity increases with advancing age  and in oWhen the mortality analysis was limited to CMV detection in blood, CMV infection without antiviral drug treatment or reactivation was not significantly associated with higher mortality. This maybe explained that the presence of high peripheral levels of functional CMV-specific CD4+ and CD8+ T cells in immunocompetent patients, which can suppress CMV during episodes of reactivation . It was Patients with sepsis have the highest incidence of CMV infection . Early iThere are five limitations in this study. First, we observed large heterogeneity in many of our analyses. However, little or no heterogeneity was observed in the meta-analysis of mortality outcome. Second, most studies were not blind, thus reducing the reliability of the results. Third, lack of sufficient data on clinical parameters  meant that stratified analyses based on such clinical characteristics were not possible. Fourth, the definition of the state of CMV infection was inconsistent and maybe restrictive to capture the dynamics of CMV infection. As such, we could not conduct meta-analysis with outcome data and this is a major limitation of our meta-analysis. Finally, one  cannot dOur findings suggests that there is a high incidence of CMV seropositivity and CMV infection in critically ill patients without immunosuppression. This study suggest that CMV infection without antiviral drug treatment or reactivation in critically ill patients is associated with increased mortality, and is not associated with mortality when CMV infection is detected in blood. Further research is necessary to determine the full role of CMV in this vulnerable patient demographic.Additional file 1:Table S1. The Newcastle\u2013Ottawa scale (PDF 17\u00a0kb)Additional file 2:Figure S1. The effect of CMV infection on all-cause mortality in blood (TIFF 276\u00a0kb)Additional file 3:Figure S2. The effect of CMV infection on all-cause mortality in patients without antiviral therapy in blood (TIFF 150\u00a0kb)Additional file 4:Figure S3. The mean difference in mechanical ventilation days in blood between active and non-CMV infection (TIFF 217\u00a0kb)Additional file 5:Figure S4. The mean difference in the length of ICU stay in blood between active and non-CMV infection (TIFF 222\u00a0kb)Additional file 6:Figure S5. The effect of CMV reactivation on mortality in blood (TIFF 133\u00a0kb)Additional file 7:Figure S6. Subgroup analysis of CMV detection rate according to detection method in all trials (TIFF 552\u00a0kb)Additional file 8:Figure S7. Subgroup analysis of CMV detection rate according to detection method in blood (TIFF 393\u00a0kb)Additional file 9:Figure S8. The effect of CMV infection on all-cause mortality in subgroup analysis according to detection method in all trials (TIFF 582\u00a0kb)Additional file 10:Figure S9. The effect of CMV infection on all-cause mortality in subgroup analysis according to detection method in blood (TIFF 420\u00a0kb)"}
+{"text": "This review summarizes the role of PD-1 in (1) modulating ILC development, (2) ILC function, and (3) PD-1 signaling in ILC. Finally, we explore how PD-1 based immunotherapies may be beneficial in boosting ILC responses in cancer, infections, and other immune-related disorders.Programmed cell death-1 (PD-1) is a cell surface receptor that dampens adaptive immune responses. PD-1 is activated by the engagement of its ligands PDL-1 or PDL-2. This results in the inhibition of T cell proliferation, differentiation, cytokine secretion, and cytolytic function. Although a great deal is known about PD-1 mediated regulation of CD4 Thesels (DCs) ,6. Subsels (DCs) . With thPD-1 is a member of a family of immunoglobulin domain (Ig) co-receptors that modify the outcome of activation of the T cell receptor by an antigen-presenting cell (APC) or infected target cell. Members of this family can be divided into those that predominantly have a positive effect, driving T cell activation, and those that have a negative effect, restraining T cell activation. The inhibitory role of PD-1 was identified in mice that lacked PD-1 expression that developed autoimmune disease relatively late in life . The exp+ and CD4+ T cell activation through T cell receptor results in the upregulation of the PD-1 receptor in in vitro studies. PD-1 is not expressed on resting T cells but can be induced within 24 h post-stimulation [CD8mulation . A similmulation  and NKT mulation . PD-1 bimulation ). Emergi+ T cells are known to express inhibitory co-receptors, of which cytotoxic T-lymphocyte associate protein 4 (CTLA4) is the best characterized, as mice that lack this co-receptor die of auto-immune disease within the first few weeks of life [+ T cells that restrain the immune system; these T regulatory (Treg) cells are characterized by the expression of the master transcription factor Foxp3 and high levels of CTLA4 and CD25. Although PD-1 expression is not a characteristic feature of Treg cells, PD-1 activation has been shown to induce Foxp3 expression and maintain induced Treg cell phenotype [Snapshots of PD-1 receptor expression and its relative contribution towards immune tolerance has been confirmed using animal models of autoimmunity and cancer. However, the molecular mechanisms that control PD-1 expression are relatively unclear. Activated CD4 of life . In addihenotype .+ T cells was first described in a chronic murine lymphocyte choriomeningitis virus (LCMV) model whereby PD-1 blockade revived CD8+ T cell function [+ T cells. Consequently, the idea that PD-1 can be expressed on ILCs that lack antigen-specific receptors was not considered. In addition to T cell receptor activation, other stimuli that induce PD-1 expression include NFATc1 [The importance of sustained PD-1 receptor expression in exhausted CD8function . Indeed,function ) has beefunction ,18,19,20e NFATc1 , the inte NFATc1 .PD-1 is a 50\u201355 kDa type I transmembrane glycoprotein composed of an IgV domain which shares 21\u201333% sequence identity with other members of the Ig co-receptor family including CTLA4, CD28, and inducible T-cell costimulatory molecule (ICOS) . The strThe ITSM is essential for the inhibitory function of PD-1, which was initially demonstrated in B cells . SimilarThe recruitment of SHP1/2 to the ITSM has been analyzed by two groups. In both cases, it was shown that SHP2 had a preferentially binding to the ITSM over SHP1 ,24 PD-1 + T cells enhances the induction of Treg phenotype from na\u00efve T cells to form iTreg cells, and participates in human Treg function and in human Th1 to Treg conversion [PD-1 signaling in CD4nversion ,36,37. Enversion , PD-1 innversion ,36. ThesILCs are innate immune cells that play a major role in immune defense and tissue homeostasis. ILCs are classified into three groups: Group 1 ILCs (including NK cells and ILC1s), group 2 ILCs (ILC2s), and group 3 ILCs (including ILC3s and lymphoid tissue inducers (LTi) . Each IL+KLRG1\u2212), inflammatory ILC2s (KLRG1+ST2\u2212), or mature ILC2s (KLRG1+ST2+) in mice [+ ILC3s are positive for NKp46/NKp44 [\u2212 do not express Nkp46/Nkp44 [\u2212 ILC3s are associated under normal physiological conditions within the skin, with the upregulation of NCR+ cells during inflammatory conditions such as psoriasis [+ ILC3s are the prominent ILC3 population within the intestine of healthy individual. These cells are further defined by the expression of the master transcription factor retinoic-acid-receptor-related orphan nuclear receptor \u03b3 (ROR\u03b3t) and are the innate counterpart of IL-17 expressing T helper (Th17) cells. ILC3s are activated by cytokines such as IL-23 and are efficient at inducing anti-bacterial responses through the production of cytokines such as IL-17 and IL-22. LTi cells are classified within group 3 ILCs, as they share these properties [ILC classification is based on their cytokine phenotype, function, and master transcription factors that drive their function. A comprehensive summary of ILC subsets, the activating stimuli, effector cytokine production and co-receptor expression is summarized in  in mice ,51,52,5346/NKp44 ,55 where46/Nkp44 . NCR\u2212 ILsoriasis ,57,58. Ooperties . The claIn addition to their helper like function, emerging literature suggests that ILCs can also mimic APC function through expression of MHC class II which in-turn can modulate T cell function ,60,61. A\u2212/\u2212 mice [The expression of CD28 co-receptor family on helper ILCs was not considered until recently, when a study by Maazi et al.  demonstr\u2212/\u2212 mice . This ob\u2212/\u2212 mice ,66. Furt\u2212/\u2212 mice . Conside\u2212Flt3lo/\u2212IL7R\u03b1 lo/+\u03b14\u03b27+) and then subjected to single cell RNA-seq. The authors found that within the common helper innate lymphoid progenitors (CHILP) identified as Lin\u2212CD25\u2212IL7R\u03b1+\u03b14\u03b27+ and classified as cluster 6, also expressed PD-1. This PD-1hi population conformed to a progenitor phenotype concurrently expressing Zbtb16, Id2, Tcf7, Tox, and Gata3  and lacRag/\u2212\u2212 mice. We found that blocking PD-1 significantly enhanced the expulsion of worms in Rag/\u2212\u2212 mice. However, this experimental set up included blocking PD-1 in both myeloid and ILC compartments. The function of PD-1 on ILC2 was confirmed as follows: Rag/\u2212\u2212\u03b3c/\u2212\u2212 mice infected with Nippostrongulus brassiliensis were reconstituted with either wildtype(WT) or PD-1\u2212/\u2212 ILC2s. Within this experimental condition, we found that PD-1 deficient ILC2s were significantly superior to WT ILC2s in diminishing worm burden. Blocking PD-1 also enhanced human ILC2 function both in vitro and in vivo suggesting a conserved PD-1 mediated regulatory function in ILC2s. Traditionally associated as a T cell targeting therapy, we describe here a potential novel use of PD-1 blockade to target ILC2s in the context of helminth infection; which was also eluded to by Yu et al. in their model of influenza. Our study also confirmed murine findings in human system where PD-1 blockade enhanced ILC2 function. These combined studies open up a new are of immunotherapy for parasitic helminth disease whereby checkpoint blockade can enhance ILC2-mediated immune responses to parasites. Indeed, one needs to be cautious with such therapies due to their deleterious effects in inducing airway inflammation.PD-1 expression on mature ILCs was also reported by Yu et al. , wherebyRecently, Oldenhove et al.  demonstrThe expression of PD-1 on ILC3 and LTi has been recently reported in the human decidua. In this study, the authors sequentially measured PD-1 expression in the maternal ILC compartment during the first and the third trimester. During the first trimester PD-1 was highly expressed on LTi while expression was also noted on ILC3s. In the third trimester, PD-1 expression was significantly downregulated in the LTi cells but this expression was similar to that noticed in ILC3s. Although NK cells lacked PD-1 expression in the first trimester, they were able to significantly upregulate PD-1 in the third trimester. However, PD-1 expression on NK cells did not reach the same frequency as LTi, ILC3, or T cells. The expression of PDL-1 was restricted to the intermediate extravillous trophoblast (iEVT) at the intersection of the feto-maternal interface, suggesting an ILC mediated tolerance mechanism driven by PD-1/PDL-1 in order to prevent fetal rejection in the early phase of pregnancy . FurtherEmerging evidence of PD-1 expression on ILCs indicate that PD-1 signaling can inhibit ILC function. The precise molecular mechanisms that induce PD-1 on ILCs or the signaling pathways that are activated by PD-1 engagement is yet to be fully understood. While our study and the work of others have shown that PD-1 can be induced by ILC2 and \u03b3c cytokines, the precise molecular events that induce PD-1 has not been delineated in ILC2s. In order to elucidate the molecular signaling pathways that are modulated by PD-1 engagement, we explored the T cell literature to identify relevant PD-1 modulating signaling pathways that might be operational in ILC2s. The work by Franceschini et al.  on HCV sIn light of the success of PD-1 blocking antibodies in cancer immunotherapy, it remains possible that in addition to enhanced T cell responses, PD-1 may regulate the helper ILC arm of the immune system to modulate anti-tumor responses. The function of helper ILCs in anti-tumor responses has been recently explored whereby ILC1s possess both pro  and antiIn summary, ILCs have emerged as an important component of the innate immune system that can influence adaptive immune responses, regulate tissue repair and adipose tissue. The expression of PD-1 on ILCs has identified a new therapeutic window in non-immunogeneic and immunogeneic tumors that needs to be further elucidated. These studies highlight the finding that the role of these receptors is broader than simply modifying the action of antigen receptors. A full comprehensive understanding of ILC modulation by PD-1 will be required in order to fully utilize this signaling pathway in the clinic. Given the number of clinical trials investigating anti-PD-1, PDL-1, and CTLA4 antibodies, it is essential to understand how these interventions affect ILC function within the tumor tissue. With the discovery of ILCs, we have the potential for boosting or dampening tissue-specific immune responses in the context of diseases such as cancer, autoimmunity, and infectious pathogens. Finetuning these responses requires an in-depth understanding of ILC immunobiology and the impact of immune-therapeutics such as jakinib and checkpoint inhibitors in boosting specific ILC responses. Since immunotherapeutic platforms are already well established in cancer and autoimmune diseases such as rheumatoid arthritis, it will be possible to tease out ILC responses to these various therapies in the clinic. Therefore, it is important to include ILCs as a target immune population within these clinical trials in order to fully understand the contribution of these subsets in human disease. In addition, the use of ILCs as a cellular therapy in diseases such as graft-versus-host disease has been recently proposed. The efficacy and clinical feasibility of this process has yet to be fully established . Indeed,"}
+{"text": "Tumor cells experience hypoxia, acidosis, and hypoglycemia. Metabolic adaptation to glucose shortage is essential to maintain tumor cells\u2019 survival because of their high glucose requirement. This study evaluated the hypothesis that acidosis might promote tumor survival during glucose shortage and if so, explored a novel drug targeting metabolic vulnerability to glucose shortage.Cell survival and bioenergetics metabolism were assessed in lung cancer cell lines. Our in-house small-molecule compounds were screened to identify those that kill cancer cells under low-glucose conditions. Cytotoxicity against non-cancerous cells was also assessed. Tumor growth was evaluated in\u00a0vivo using a mouse engraft model.Acidosis limited the cellular consumption of glucose and ATP, causing tumor cells to enter a metabolically dormant but energetically economic state, which promoted tumor cell survival during glucose deficiency. We identified ESI-09, a previously known exchange protein directly activated by cAMP (EAPC) inhibitor, as an anti-cancer compound that inhibited cancer cells under low-glucose conditions even when associated with acidosis. Bioenergetic studies showed that independent of EPAC inhibition, ESI-09 was a safer mitochondrial uncoupler than a classical uncoupler and created a futile cycle of mitochondrial respiration, leading to decreased ATP production, increased ATP dissipation, and fuel scavenging. Accordingly, ESI-09 exhibited more cytotoxic effects under low-glucose conditions than under normal glucose conditions. ESI-09 was also more effective than actively proliferating cells on quiescent glucose-restricted cells. Cisplatin showed opposite effects. ESI-09 inhibited tumor growth in lung cancer engraft mice.This study highlights the acidosis-induced promotion of tumor survival during glucose shortage and demonstrates that ESI-09 is a novel potent anti-cancer mitochondrial uncoupler that targets a metabolic vulnerability to glucose shortage even when associated with acidosis. The higher cytotoxicity under lower-than-normal glucose conditions suggests that ESI-09 is safer than conventional chemotherapy, can target the metabolic vulnerability of tumor cells to low-glucose stress, and is applicable to many cancer cell types. \u2022Tumor cells experience hypoxia, acidosis, and glucose shortage.\u2022Tumor acidosis promotes metabolic adaptation to glucose shortage.\u2022ESI-09, a known EAPC inhibitor, is a novel and safe mitochondrial uncoupler.\u2022ESI-09 kills tumor cells during glucose shortage, even under acidosis conditions.\u2022ES-09 targets metabolically dormant and chemotherapy-resistant tumor cells. The beserfusion , is thouerfusion .The third critical stress in the TME is nutrient deficiency, which is caused by increased nutrient demand for rapid tumor proliferation not met by an adequate supply ,12. AlthAlthough acidosis has been shown to induce a stress response similar to a low nutritional stress response, the role of acidosis in metabolic adaptation to nutrient limitations is not well understood . We hypo22.1The reagents used in this study are listed in 2.22. The H1299, H1975, and PC3 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% FBS. Human pulmonary alveolar epithelial cells (#3200) were obtained from ScienCell Research Laboratories, Inc.  and grown in AEPiCM medium . Human lung microvascular endothelial cells (cc-2527) were obtained from Cambrex Bio Science Walkersville  and grown in a EGM-2MV Bullet kit medium . To assess cell survival, confluent cells were serum-starved for 48\u00a0h in medium containing 0.5% FBS and then incubated in DMEM adjusted to pH 7.4 or pH 6.8 by adding a 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid  solution and an HCl solution supplemented with 0.5% FBS and different glucose concentrations in the presence or absence of the tested reagents. When media were not treated with an HCl solution, an equiosmolar amount of NaCl was included to eliminate any potential effect of differences in medium osmolality. The cell number was measured as described to follow. To assess cell proliferation, actively dividing cells in growth medium containing 10% FBS were monitored for cell number.Non-small cell lung cancer cell lines A549 (CCL-185), H1299 (CRL-5803), and H1975 cells (CRL-5908) were obtained from the American Type Culture Collection . PC3 cells (JCRB0077), another non-small cell lung cancer cell line, were obtained from the Japanese Collection of Research Bioresources Cell Bank . The cell lines were authenticated by short tandem repeat profiling using a Promega PowerPlex 16 HS system . Human fetal lung IMR-90 (CCL-186) fibroblasts were obtained from ATCC. The A549 and IMR-90 cells were maintained in Dulbecco's Modified Eagle medium  containing 10% fetal bovine serum (FBS) at 37\u00a0\u00b0C in a humidified incubator saturated with a gas mixture containing 5% CO2.3Cell number was evaluated using a Hoechst 33,342 DNA quantification assay. Briefly, cells in a 96-well culture plate were lysed in 100\u00a0\u03bcl of distilled water, followed by a freeze-thaw cycle. The cell lysates then were solubilized in 100\u00a0\u03bcl of TNE buffer  containing 10\u00a0\u03bcg/ml of Hoechst 33,342 . The fluorescence intensities were read at an excitation wavelength of 350\u00a0nm and emission wavelength of 460\u00a0nm using a microplate fluorometer .2.4The live, apoptotic, and necrotic cells were distinguished by dual-fluorescence staining with ethidium bromide (2\u00a0\u03bcg/ml) and Hoechst 33,342 (2\u00a0\u03bcg/ml) . Under m2.5LDH activity was evaluated using an enzymatic method with a Cytotoxicity LDH assay WST kit .2.60) were prepared by culturing cells in DMEM supplemented with 10% FBS in the presence of ethidium bromide (50\u00a0ng/ml), sodium pyruvate (1\u00a0mM), and uridine (100\u00a0\u03bcg/ml) for\u00a0>\u00a020 generations. The control parental A549 cells were maintained for the same period in normal culture medium. The successful establishment of the A549 \u03c10 cell line was confirmed by polymerase chain reactions using mitochondrial DNA-specific primers in our previous study [A549 cells devoid of mtDNA  according to the manufacturer's instructions. Briefly, 100\u00a0\u03bcl of lysis/assay solution provided by the manufacturer was added to confluent cell cultures in 96-well plates. After the plates were shaken for 1\u00a0min and incubated for 10\u00a0min\u00a0at 23\u00a0\u00b0C, luminescence was measured in a microplate luminometer (PerkinElmer Arvo X2). The ADP/ATP ratio was determined using an EnzyLight ADP/ATP assay kit  according to the manufacturer's instructions.2.9Cells were incubated in DMEM containing 10\u00a0mM of glucose and 4\u00a0mM of glutamine at pH 7.4 or 6.8. Intracellular ATP contents were determined before and 10\u00a0min after the addition of glycolysis inhibitor 2-deoxyglucose  and mitochondrial ATP synthase inhibitor oligomycin A (2\u00a0\u03bcM). The decrease in intracellular ATP contents following the addition of oligomycin A and 2-DG was referred to as the rate of cellular ATP consumption. The proportion of ATP consumption by protein synthesis and DNA/ribosomal (rRNA) synthesis was determined by measuring the ATP consumption rate in the presence of cycloheximide (2.5\u00a0mM) or actinomycin D (8\u00a0\u03bcM), respectively.2.101F0 ATP hydrolase inhibitor BMS-199264 (2\u00a0\u03bcM). Differences in intracellular ATP contents between the presence and absence of BMS-199264 were referred to as the amount of ATP consumption by mitochondrial F1F0 ATP hydrolase.Intracellular ATP contents were determined before and 10\u00a0min after the addition of 2-DG (30\u00a0mM), and the mitochondrial uncouplers were tested in the presence or absence of selective F2.11(c)\u00a0=\u00a0lactate concentration in the control medium after 6\u00a0h of incubation; Lac(o)\u00a0=\u00a0lactate concentration in the medium after 6\u00a0h of incubation with 2\u00a0\u03bcM of oligomycin; glycolysis %\u00a0=\u00a0Lac(c)\u00a0\u00d7\u00a0100/Lac(o); and OXPHOS %\u00a0=\u00a0100 - glycolysis %. The amount of glucose used for glycolysis was calculated using the following formula based on the assumption that two lactate molecules are produced during glycolysis of one glucose molecule; glucose used for glycolysis (mol)\u00a0=\u00a0amount of lactate production (mol)/2.Confluent cells were incubated in 96-well plates at the indicated pH levels. After 24\u00a0h, a portion of medium from each well was removed and the glucose and lactate concentrations in the culture and original medium (not cultured with cells) were measured using an amperometric blood glucose sensor  and an enzymatic method at an outsourcing laboratory , respectively. Glucose consumption and lactate production were calculated based on the difference between the glucose or lactate concentrations in the original medium vs the culture medium. The relative glucose consumption and lactate production rates were calculated by normalizing each treatment to the control group. The amounts of glycolysis and OXPHOS components in the bioenergetic process were calculated using the following formula : Lac(c)\u00a02.12The amino acid content in the culture medium was measured by liquid chromatography-tandem mass spectrometry at SRL, Inc. .2.13Ongoing rRNA synthesis was assessed by fluorouridine (FUrd) incorporation in in situ run-on assays . Briefly2.14Protein synthesis was assessed via the SUnSET technique using an anti-puromycin antibody for the immunological detection of puromycin peptides . Briefly2.15The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Seahorse XFp analyzer . The cellular bioenergetic profiles were measured using an XFp Cell Mito Stress test kit and XFp Mito Fuel Flex test kit (Agilent) according to the manufacturer's instructions .2.162 production in the mitochondrial matrix [2 and glycolysis-derived lactate to extracellular acidification can be separately determined using this kit.TCA cycle activity was assessed using media without glucose but containing 10\u00a0mM of galactose and 4\u00a0mM of glutamine to measure the ECAR . Under tl matrix . The TCA2.172PO4, 5\u00a0mM of MgCl2, 2\u00a0mM of HEPES, 1\u00a0mM of EGTA, and 0.2% fatty acid-free BSA [The A549 cells were permeabilized with Seahorse XF Plasma Membrane Permeabilizer , and the mitochondria were stimulated with substrates for respiratory chain complex I , complex II/III (10\u00a0mM of succinate and 2\u00a0\u03bcM of rotenone), and complex IV  in the presence of ADP (4\u00a0mM) in a mitochondrial assay solution  for 30\u00a0min\u00a0at 37\u00a0\u00b0C, and fluorescence images were acquired using an Olympus IX71 microscope .2.20Cells were loaded with the plasma membrane potential indicator DiBAC4(3) , and the fluorescence intensities were read using a microplate fluorometer at excitation/emission wavelengths of 485\u2013530\u00a0nm.2.21Intracellular NAD(P)H levels were measured by autofluorescence at excitation/emission wavelengths of 355\u2013460\u00a0nm [2.222 in the medium into the air during the experiment.The oxygen concentration in culture medium was determined using oxygen-sensor microplates  according to the manufacturer's instructions. The well in the OxoPlate was overlaid with 300\u00a0\u03bcl of mineral oil to prevent diffusion of O2.23Hypoxia inside the spheroids was detected using a LOX-1 hypoxia probe  according to the manufacturer's instructions. The hypoxic regions emitting red phosphorescence were visually detected through an Olympus IX71 microscope .2.246 cells) in 100\u00a0\u03bcl of phosphate-buffered saline were injected into the subcutaneous flanks of nude mice. Once tumors became palpable, the tumor size was measured twice weekly using calipers, and the tumor volume was calculated according to the formula: V\u00a0=\u00a0ab2/2, where a and b are the tumor length and width, respectively. When the tumor volumes reached an average of approximately 100\u2013150\u00a0mm3, the mice were randomly assigned to one of the following six treatment groups: 1) vehicle (n\u00a0=\u00a06), 2) ESI-09 , 3) ESI-09 , 4) bevacizumab , 5) bevacizumab , and ESI-09  (n\u00a0=\u00a07) or 6) bevacizumab  and ESI-09  (n\u00a0=\u00a07) for the indicated periods. At the end of the treatment period, blood samples were obtained by vena cava puncture under terminal anesthesia and the tumors were harvested, weighed, fixed in formalin, and embedded in paraffin for further histological analysis. Cell necrosis was evaluated in 3-\u03bcm sections stained with hematoxylin and eosin or DAPI according to the following criteria: cell swelling and lysis, loss of architecture, karyorrhexis, and karyolysis [All of the mice used in the experiments were cared for in accordance with the standards of the Institutional Animal Care and Use Committee under a protocol approved by the Animal Care and Use Committee of the CMIC Pharma Science Co., Ltd., Bioresearch Center . Female BALB/c-nu (nu/nu) mice (5 weeks old) were obtained from Charles River Laboratories Japan, Inc. . The mice were kept in a 12-h light and dark cycle and acclimatized for 1 week before the study. To generate tumor xenografts, A549 cells . The sample size was chosen according to previous empirical experience. The experiments were not randomized and the investigators were not blinded to the allocation. Significant differences were statistically analyzed by performing Student's t test, the Tukey\u2013Kramer test, or Dunnett's test as appropriate. A 33.1To examine the effect of acidosis on lung cancer cell survival under low-glucose conditions, the A549, H1299, PC3, and H1975 cells were grown to confluence in growth medium, then serum-starved and incubated in medium at pH 7.4 or 6.8 containing different glucose concentrations. As shown in 3.2Acidosis decreased intracellular ATP content without increasing the ADP/ATP ratio, showing a reduced ATP pool while maintaining a proper energy balance A. Acidos3.3Upon screening our in-house small-molecule compounds, we identified ESI-09, a previously known inhibitor of exchange protein directly activated by cAMP (EPAC) 1 and 2, for a relevant hit compound that reduced cellular ATP content and cell survival in glucose-free acidic medium . However3.4The Seahorse Mito stress test assay showed that ESI-09 and HJC0197 induced proton leaks that disengaged oxygen consumption from ATP synthesis , indicating that ESI-09 and HJC0197 uncoupled mitochondrial respiration C. Acidos1F0 ATP synthase is presumed to work in reverse mode and hydrolyze ATP to maintain \u0394\u03c8m by pumping protons out of the matrix [1F0 ATP hydrolase inhibitor BMS-199264 [1F0 ATP hydrolase.If mitochondrial respiration is uncoupled , Fe matrix . SupportS-199264 , which iESI-09 and HJC0197 also increased cellular glucose uptake to sustain a compensatory increase in glycolytic ATP production and a futile cycle of OXPHOS . ConsequThese results indicated that ESI-09 and HJC0197 acted as mitochondrial uncouplers that disengaged fuel oxidation and electron transport from ATP synthesis and consequently not only inhibited ATP production but also created a futile cycle of substrate oxidation and electron transport in an effort to maintain mitochondrial membrane potential, leading to wasting of ATP and fuel .3.5Among the tested EPAC inhibitors, only ESI-09 and HJC0197 showed mitochondrial uncoupling activities , indicat0) A549 cells in the low-glucose medium, which verified that the anti-cancer action of ESI-09 is mediated by mitochondrial deterioration , mitochondrial ATP consumption, and hypoxia G. Increa3.8The in\u00a0vivo anti-tumor activity of ESI-09 was evaluated in A549-cell xenograft mice. Because impeding angiogenesis would promote glucose depletion and thus might improve the efficacy of ESI-09, we tested the effects of a monotherapy with ESI-09 , a monotherapy with the anti-vascular endothelial growth factor antibody bevacizumab , and a combination therapy with ESI-09 plus bevacizumab . The mon4We reported two major findings in this study. First, we demonstrated that acidosis limited cellular consumption of glucose and ATP, which caused tumor cells to enter a metabolically dormant but energetically economic state that supported tumor cell survival during glucose starvation. Second, we identified two known EAPC inhibitors, ESI-09 and HJC0197, as compounds that effectively killed tumor cells in the low-glucose medium at either acidic or neutral pH. ESI-09  acted as a mitochondrial uncoupler independent of EPAC inhibition that disengaged fuel oxidation and electron transport from ATP synthesis; as a result, it not only inhibited ATP production but also created a futile cycle of substrate oxidation and electron transport in an effort to maintain mitochondrial membrane potential, leading to wasting of ATP and fuel . Less cytotoxicity of ESI-09 under normal-thlower glucose conditions will be ideal for therapeutic translation in reducing side effects in normal healthy tissue and selectively killing tumor cells in a low-glucose microenvironment. We conclude that ESI-09 is a potent anti-cancer uncoupler that can target metabolic vulnerability to low-glucose conditions, which are often acidic H.We found that the acidosis-induced metabolic reprogramming to save energy (ATP) and fuel (glucose) involved two distinct mechanisms of action by acidosis: first, the inhibition of glycolysis that consumed a large amount of glucose as fuel and second, the inhibition of rRNA/protein synthesis that consumed a large amount of ATP. Our findings are supported by those of several previous studies. For example, acidosis has been shown to inhibit pH-sensitive glycolytic enzyme phosphofructokinase  and stim0F1 ATPase to maintain the mitochondrial membrane potential, and scavenging available fuels (glucose and O2) by a futile cycle of substrate oxidation. Using the analogy of energy production from an automobile engine, we propose that acidosis probably shifts engine operation to an economical mode with lower power (ATP) output but less fuel (glucose and O2) consumption. Unlike ETC inhibitors, which just turn off the engine , mitochondrial uncouplers, such as ESI-09 and HJC0197, are just as likely to rev the engine by keeping the gas pedal in neutral, which continues wasteful consumption of fuels (glucose and O2) and energy (ATP) to maintain futile engine rotation without any substantial energy generation . There is a natural scarcity of nutrients and O2 in the TME. If mitochondrial uncouplers force tumor cells to scavenge all available nutrients, such as glucose, glutamine, and fatty acids, or at least both glucose and O2, they would no longer survive  that enabled partial and reversible pH-dependent polarization. ESI-09 has several advantages over previous uncouplers. ESI-09 had an effective concentration range of 1\u201310 \u03bcM, which was very close to that of the classical uncoupler FCCP, but did not depolarize the plasma membrane, in contrast to FCCP (ESI-09 and HJC0197 have been identified in high-throughput screening as specific competitive inhibitors that target the cAMP-binding domain of EPAC/cAMP-guanine exchange factor (GEF)  Supplem. However to FCCP F, and ex to FCCP . Further to FCCP .2 not only in tumors but also in non-tumorous tissue in poorly vascularized organs. Conversely, however, uncouplers have been reported to prevent ischemia-reperfusion injury by reducing ROS production [However, the clinical application of ESI-09 for cancer therapy may impose several challenges. First, mitochondrial uncouplers generally have a narrow therapeutic window between efficacy and toxicity . For exaoduction . Fourth,oduction .ESI-09 might exert its anti-cancer action not only by mitochondrial uncoupling but also by EPAC inhibition because EPACs, which catalyze the exchange of guanosine 5\u2032-diphosphate and guanosine 5\u2032-triphosphate (GTP) on the small GTPase Rap1 and Rap2, are actively involved in cell adhesion and migration . Recent In conclusion, we identified ESI-09 as a potent uncoupler that can target metabolically vulnerable tumor cells to low-glucose stress even under acidic conditions. The higher cytotoxicity under lower-than-normal glucose conditions suggests that ESI-09 could be safer than conventional chemotherapy for reducing side effects on normal tissue, targeting metabolic dormancy, treating a variety of cancer cell types unlike many drugs specifically targeting genomic alterations, and combating tumor metabolic flexibility and redundancy . Thus, EMinistry of Education, Science, and Culture, Japan .This study was supported by a grant-in-aid for scientific research from the Conceptualization, K.A. Methodology, Y.M., R.K., T.T., and K.A. Investigation, Y.M., R.K., J.K., and K.A. Validation, N.K., K.Y., and H.N. Writing original draft, Y.M. and K.A. Review and editing, K.A., N.K., and H.N."}
+{"text": "The design has several advantages over other traditional closed microfluidic platforms: (1) it enables controlled unidirectional flow of media at physiological rates to support vascular function, (2) it allows for very small volumes which makes the device ideal for studies involving biotherapeutics, (3) it is amenable for multiple high resolution imaging modalities such as transmission electron microscopy (TEM), 3D live fluorescence imaging using traditional spinning disk confocal microscopy, and advanced lattice light sheet microscopy (LLSM). Importantly, we miniaturized the design, so it can fit within the physical constraints of LLSM, with the objective to study physiology in live cells at subcellular level. We validated barrier function of our brain microvessel-on-a-chip by measuring permeability of fluorescent dextran and a human monoclonal antibody. One potential application is to investigate mechanisms of transcytosis across the brain microvessel-like barrier of fluorescently-tagged biologics, viruses or nanoparticles.We describe here the design and implementation of an  The blood\u2013brain barrier (BBB) is a unique and highly selective vascular interface that separates the peripheral blood circulation from the neural tissue in order to maintain a homeostatic microenvironment within the central nervous system (CNS) that allows the neuronal network to function properly .The BBB is a complex vascular structure with specialized endothelial cells as its core element, surrounded by extracellular matrix (ECM) and supporting cells, such as astrocytes and pericytes . Brain mHowever, these highly selective barrier properties also extremely limit the therapeutic efficacy of drugs and hinder the treatment of neurological diseases such as Alzheimer\u2019s disease, multiple sclerosis, Parkinson\u2019s disease, HIV infection and brain tumors . Beyond in vivo models are of highest physiological relevance since the BBB is embedded in its natural microenvironment. These models are, however, limited in their throughput. Furthermore, animal models may not predict BBB penetrance and efficacy of drugs in humans due to interspecies differences in the molecular composition of the BBB microvessels   and transporters (such as Glut-1 and insulin receptor)  . These seceptor) . To overeceptor) . Nevertheceptor) . Hence, in vitro human brain microvessel-on-a-chip consisting of a 3D microfluidic model with a hollow channel in which a continuous monolayer of cells can grow at the interphase between the lumen and the underlying ECM. For our studies, we chose the brain microvascular endothelial cell line TY10 which is a well-established BBB model system . TY10 cells were used between passage 17\u201325 and cultured in ScienCell complete endothelial cell medium . Cell detachment was performed using Accutase\u00ae  when cells were \u223c80\u201390% confluent before being seeded into the microfluidic devices. Cells were routinely tested for mycoplasma contamination and found negative.Human brain derived microvascular endothelial cells (TY10 cell line) were isolated from normal brain tissue from a patient with meningioma, and immortalized with retroviral vectors harboring a SV40 large T antigen gene that is engineered to drive proliferation at 33\u00b0C . The TY1A lentiviral vector expressing a plasma membrane targeted eGFP (memGFP) containing a chimera of the N-terminal 41 amino acids of human myristoylated alanine-rich C-kinase substrate (MARCKS) fused to eGFP was made by co-transfection of a plasmid harboring memeGFP and Virapower Packaging Mix  into 293T cells. Culture media was harvested 72 h later, cellular debris pelleted by low-speed centrifugation, and further clarified by 0.45 \u03bcm filtration with Millipore steriflip vacuum filters . The supernatant from the viral preparation was added to a flask of TY10 cells during passaging  and allowed to incubate for 24 h at 33\u00b0C before switching back to the normal feeding schedule of every other day. The cells were sorted by flow cytometry for eGFP positive cells after 10 days in culture and subsequently expanded and maintained as described above.TM 568 and 647 protein-labeling kits  to produce hmAb-AF568 and hmAb-AF647 following the manufacturer\u2019s protocol.The recombinant monoclonal human IgG1 antibody (produced by Biogen) was expressed in CHO cells and purified through Protein-A Affinity Chromatography. The purified protein was fluorescently labeled with Alex Fluor2. The post-exposure baking was the same as for soft baking. The mold was developed for 10 min in 20 ml MicroChem SU-8 developer, rinsed with isopropyl alcohol and blown dry prior silianization by incubating the wafer in a desiccator under reduced pressure in presence of an aluminum cup with 3 drops of  trichlorosilane . Hard bake was performed on a hotplate at 150\u00b0C for 15 min.Photomasks with the chip design depicted in Microfluidic devices were subsequently produced by soft lithography; Sylgard 184 elastomer Polydimethylsiloxane (PDMS) was mixed with curing agent , at a 5:1 ratio in a mixer including a 2 min de-foaming step before pouring it onto the master silicon wafer designed by our lab and spin-coating at 400 rpm for 40 s. The utilized speed yielded a PDMS film of 160 \u03bcm thickness that was degassed in a vacuum desiccator for 10 min and cured in an oven at 65\u00b0C for 1 h. The PDMS film was peeled off the master and placed in a plastic petri dish at 65\u00b0C overnight to fully cure. To remove non-crosslinked oligomers within the PDMS that can leach out and contaminate the culture medium , cut PDMTM 30 min epoxy  resulted in the sturdiest connection after overnight incubation and further allowed us to remove air bubbles in the epoxy after mixing through centrifugation for 30 s at 14,000 x g in a tabletop centrifuge. The chip was activated by air plasma treatment as above and further cleaned by injecting sequentially 0.5 ml of each acetonitrile, purified water, 0.5 M KOH and again water.To promote bonding, the chips were placed on a hot-plate at 150\u00b0C for 15 min. We tested several glues to fix the Tygon microbore tubing, 0.010\u201d \u00d7 0.030\u201d OD  on the chip and SLOW-CURETo functionalize both glass and PDMS surface with primary amine groups, the chips were silanized by pipetting 0.5 ml of a fresh 1% aqueous solution of 3-(Ethoxydimethylsilyl) propylamine  on the chip and incubation for 15 min at RT before rinsing with twice with 1 ml pure water. Subsequently, the surfaces were further functionalized by adding 0.3 ml 2.5% glutaraldehyde  and incubation for 15 min before the devices were rinsed extensively with pure water. The Schiff bases formed on proteins after glutaraldehyde immobilization are stable without further reduction, as has been demonstrated in surface-protein conjugation . To furtA Pluronic F-127  passivated 100 \u03bcm acupuncture needle was inserted from the outlet toward the inlet of the brain microvessel-on-a-chip to provide the required scaffold for the culturing matrix as indicated in \u00ae . Genipin is a crosslinking agent that covalently attaches to primary amino groups exposed on protein surfaces  according to the manufacturer\u2019s protocol. In brief, Cytofix was added to a 1 ml syringe and perfused through the microvessel at a flow rate of 1 \u03bcl/min for 30 min before changing to the Cytoperm buffer (diluted 1:10 in PBS) for 1 h at 1 \u03bcl/min. The flow was then stopped and the brain microvessel-on-a-chip placed on a well of a six well plate in 2 ml of Cytoperm buffer (diluted 1:10 in PBS) overnight. The microvessel was stained with AlexaFluor488 Phalloidin  and NucBlue  by perfusing the dyes in Cytoperm buffer at 1 \u03bcl/min through the microvessel for 1 h, followed by washing with 0.1% BSA in PBS buffer for 4 h at 1 \u03bcl/min. Images were collected using Zeiss LSM 710 microscope (10x objective) through the bottom glass slide.5 cells per well. Cells were allowed to proliferate for 3 days at 33\u00b0C, 5% CO2 before they were switched to 37\u00b0C, 5% CO2 for 3 days to initiate differentiation of TY10 cells. Cells were fixed with 4% PFA  for 10 min at 4\u00b0C and then blocked with 10% normal goat serum serum  for 30 min at RT. Staining was performed under permeabilized conditions using BD Perm/Wash Buffer . Primary antibodies were incubated for 3 h at RT. The following primary antibodies were used: anti-CD31 , anti-ZO1 , anti-Occludin , anti-Claudin 5 , anti-Glut-1 , anti-TfR  and anti-Laminin . The following secondary antibodies were incubated for 45 min at RT: goat anti-mouse AlexaFluor 488 , goat anti-rabbit AlexaFluor 488 , and goat anti-rabbit AlexaFluor 568 , supplemented with Hoechst 33342 . For imaging, Zeiss LSM 710 Confocal and Leica SP5 Confocal microscopes (40x objective) were used, and image processing was performed in ImageJ (NIH).TY10 cells were seeded in a 24-well glass bottom plate , coated with rat tail collagen type I  at 1 \u00d7 10\u00ae FluoroBriteTM DMEM  was added. Medium containing 25 \u03bcg/ml of 10 kDa FITC-dextran  or hmAb-AF568 was added through the inlet at a flow rate of 1 \u03bcl/min for all the experiments. The inlet was connected to microvessels with and without TY10 cells and image acquisition was started. Leakage of the fluorescent substrate (dextran or hmAb) from the lumen of the microvessel into the adjacent collagen matrix was imaged using a spinning disk confocal microscope with 40x water immersion objective. The fluorescence intensity profiles and ratios between the fluorescent signal in the basal and apical region of the microvessel tube were analyzed using MATLAB . Apparent permeability (Papp) was used for quantifying diffusional permeability as described (0 (r/2), where \u0394I is the increase in total fluorescence intensity upon adding labeled dextran or labeled hmAb to the lumen, (dI/dt)0 is the temporal initial rate of linear increase in intensity as the labeled molecules diffuse out of the microvessel into the surrounding collagen matrix, and (r) is the radius of the microvessel (100 \u03bcm for our brain microvessel-on-a-chip). All experiments were carried out at n = 4\u20136; exact numbers are mentioned per experiment in figure captions. Graphs were plotted using GraphPad Prism 6 .Chips were washed with ECM culture medium (once with 1 ml added to the top of collagen followed by a flow at 1 \u03bcl/min for 15 min) to ensure proper flow profiles during the subsequent barrier integrity assay. Next, all medium was aspirated from the chip and 1 ml of medium without fluorescent compound using Gibcoescribed . In brie2 for 3 days, then switched to 37\u00b0C, 5% CO2 for another 3 days for differentiation, with media changes every other day. Transwell inserts without cells were used as control. On the day of the permeability assay, media was refreshed in both chambers and 1 mg/ml final concentration of 10 kDa FITC-Dextran  was added to the top chamber. The plate was incubated for 1 h at 37\u00b0C, 5% CO2 after which samples of 100 \u03bcl were taken from the bottom chamber and transferred to a black/clear bottom 96-well plate. Fluorescence intensity was determined with a plate reader set at excitation 490 nm and emission 535 nm.Transwell inserts  were coated with 50 \u03bcg/ml rat tail collagen type I  in 1% acetic acid for 1 h and then washed with PBS prior to cell seeding. Per 12-well transwell insert, 125,000 TY10 cells were seeded in 1 ml ECM , and 2 ml ECM was added to the bottom chamber . Cells were allowed to proliferate at 33\u00b0C, 5% COImaging was done using a Marianas spinning disk confocal microscope  with the water immersion objective lens LD C-Apochromat 40x/1.1 . The images consisted of 512 x 512 pixels with a pixel size of \u223c333 nm. The EMCCD camera settings  and laser power were maintained throughout the imaging experiments. Images were acquired using SlideBook 6  and data analysis carried out using SlideBook 8 and custom-made software using MATLAB 2017A . For the analysis of heat maps and Papp, ROIs were the entire original field of view.\u22175-mm rectangular #1.5 glass coverslip was picked with forceps, and placed in the sample bath of the 3D LLSM. The sample was imaged in a time series in 3D using a dithered multi-Bessel lattice light-sheet by stepping the sample stage at 200 nm intervals in the s-axis equivalent to \u223c104 nm translation in the z-axis. Each 3D stack corresponded to a pre-deskewed volume of \u223c80 \u03bcm x 120 \u03bcm x 47 \u03bcm (800 \u00d7 1200 \u00d7 451 pixels). The sample was excited with a 488-nm laser (\u223c100 mW operating power with an illumination of \u223c77 \u03bcW at the back aperture), a 560 nm laser (\u223c100 mW operating power with an illumination of \u223c176 \u03bcW at the back aperture) and a 642nm laser (\u223c100 mW operating power with an illumination of \u223c121 \u03bcW at the back aperture) to acquire 451 imaging planes, each exposed for \u223c44.1 ms and recorded with two Hamamatsu ORCA-flash 4.0-V2 cameras; thus, each 3D image took \u223c60 s to acquire. The inner and outer numerical apertures (NAs) of excitation were 0.513 and 0.55, respectively. The overall 3D volume of \u223c240 \u03bcm \u00d7 880 \u03bcm \u00d7 180 \u03bcm was obtained by stitching together 165 (3 \u00d7 11 \u00d7 5) 3D stacks, with an overlap of 40 and 9 \u03bcm in the y-axis and z-axis, respectively.A microvessel-on-a-chip fabricated on 82, 2.5 mM CaCl2 in 50 mM Cacodylate buffer pH 7.4) (Sigma) and kept at 4\u00b0C, overnight in the dark. Fixed collagen samples were washed 3 times with a solution containing 50 mM PIPES pH 7.4  kept in ice and then they incubated for 2 h in ice and in the dark in a freshly prepared staining solution (SSI) made of 1% OsO4 , 1.25% potassium hexacyanoferrate (II)  and 100 mM PIPES pH 7.4. Samples were rinsed 3 times with ice-cold water and incubated again for a second time for 30 min in ice and in the dark with a freshly prepared staining solution II (SSII). SSII was prepared by 1:100 dilution of SSI in a freshly prepared 1% thiocarbohydrizide . Finally, the samples were washed for 3 times with ice-cold H2O and then incubated overnight in the dark in 1% uranyl acetate  at 4\u00b0C.The collagen matrix including the lumen was washed 3 times with PBS and then fixed by immersion in 5 ml of fixing solution . Next day, the samples were washed 3 times with 100% Epon812 and then kept in an oven for 36 h at 60\u00b0C. Sections of 60\u201370 nm in thickness were cut transversally to the long axis of the lumen and imaged with a JEOL JEM 1200 EX TEM microscope with a voltage of 80 KV and a nominal magnification of 15,000.t-test analyses with Bonferroni post-hoc correction. Data were presented as mean \u00b1 standard error of the mean (SEM) where (\u2217\u2217\u2217) denotes a statistically significant difference with p < 0.001 and (ns) indicates a statistically non-significant difference.StatsDirect 3  was used for one-way ANOVA and student\u2019s We engineered an open design microfluidic chip to generate a 3D microphysiological model of the human brain endothelial microvessel readily accessible to optical imaging. The unique characteristics of this novel brain microvessel-on-a-chip are the open design of the cell culture chamber and a cylindrical hollow lumen amenable to continuous unidirectional flow within a casted gel of extracellular matrix (ECM) components. The open system allows direct access of the collagen matrix for efficient exchange of gases and medium in addition to readily access to optical imaging while cells growing with continuous unidirectional flow at the interphase between the casted gel and the lumen mimic the environment of a microvessel.Spinning disk confocal microscopy is performed through the glass slide at the bottom of the microvessel-on-a-chip, while LLSM or AO-LLSM are carried out from the open top as illustrated in The consecutive stages used to generate the cylindrical hollow lumen within the casted gel followed by seeding of endothelial cells on the wall of the lumen are depicted in Cell seeding was performed with two methods. The first one involved use of a cell-concentrator chip designed and operated as indicated in The second, and in our hands preferred cell seeding method , involven = 8) while method 2 had a lower success of 87% (n = 29). Of note, success rate has been defined by a complete cell seeding of the lumen from the first round, resulting in full coverage of the lumen with endothelial cells, without the need for a second round of cell seeding.Extent of seeding was optically monitored with the aid of an inverted microscope by direct inspection of the device placed inside a closed petri dish to ensure sterility. Cellular viability was determined for both cell seeding methods using exclusion of Trypan Blue. These experiments indicate that the two methods have comparable results . In our hands, method 1 was associated with a 100% success rate  but at the expense of longer incubation time (24 h vs. 4 h required for method 2) and extra time and cost associated with manufacturing of the cell concentrator microfluidic device. For these reasons, we have mainly opted for method 2 in this study, but intended to offer the reader a second option if cell supply is limiting, for instance.in vitro monolayers of endothelial cells grown on a matrix containing fibronectin, laminin, and collagen type IV exhibit enhanced TEER, suggesting a role for these molecules in promoting the formation of tight junctions  derived from control or diseased patients are preferred for in vitro brain microvessels and BBB models. Use of primary cells is restricted to very low passage numbers to prevent down-regulation of the unique features of the BBB  . The repin vitro models of the BBB. Use of this approach is not practical for our brain microvessel-on-a-chip model because the geometric constrains prevent us from positioning electrodes on opposite sides of the endothelial monolayer between the cylindrical lumen and the collagen matrix. To circumvent this limitation, we capitalized on our ability to use fluorescence optical imaging with our device as a way to determine permeability coefficient across the endothelial monolayer and hence establish the extent of the barrier function of cells grown in the brain microvessel-on-a-chip. Using spinning disk confocal fluorescence microscopy, we determined the rate of transport of fluorescently tagged humanized monoclonal hmAb-AF568  were also similar , demonstrating that cells formed a functional barrier   . It is nl models .Our microfluidic device is the only currently available design that can fit within the physical constraints of LLSM objectives (there is only 170 microns left to fit it the entire microfluidic device). In TM goat anti-human IgG coated polystyrene beads in the collagen matrix, to then capture hmAb-AF647 labeled antibodies perfused through the lumen of the microvessel within the chip; visualization was done using LLSM (+7 \u00b1 1.3+7 (mean \u00b1 SEM in arbitrary units) did not show dependence with distance away from the lumen, consistent with efficient capture of the diffusing antibody.We show our ability to image beads interspersed in the collagen matrix that have captured fluorescently tagged antibodies diffusing from the lumen of the artificial microvessel . In thising LLSM , arrows.In the future, we will capitalize on the recently developed lattice light sheet microscope modified with adaptive optics (AO-LLSM) that has significantly improved optical imaging capabilities to better visualize internal cellular compartments and investigate the transcytosis of antibodies and potentially other biotherapeutics across the endothelial barrier. This system has properties ideal for addressing other biological questions that can benefit from the advantages of LLSM and AO-LLSM because of their high temporal and spatial resolution combined with the very minimal bleaching even when the samples are imaged for prolonged times .Compared to traditional closed platforms, our open design facilitates harvesting of cells for gene expression profiling using RNAseq or quantitative PCR, protein expression by Western Blot or Mass Spectrometry, although the number of cells per microvessel may be limiting for some of these applications. Another advantage of the open chip design is the ease for chemical fixation and sample handling of the biological material located within the collagen associated with TEM, with high resolution volumetric imaging using Focused Ion Beam Scanning Electron Microscopy (FIB-SEM) and also with the newly developed modality of expansion microscopy combined with LLSM (Ex-LLSM) .in vivo BBB. Further, our device is amenable to other barrier-forming cell systems found in vascular beds of peripheral tissues such as kidney or lung, for instance, or systems modeling like the gut epithelium.Our results provide a supporting evidence showing how the open design of our microfluidic brain microvessel-on-a-chip device can be used to facilitate future studies of brain endothelial physiology at a subcellular level, particularly since cells can be grown under controlled unidirectional flow conditions. A next-generation model of the microvessel-on-a-chip could include addition of supporting cells such as astrocytes and pericytes to generate a more complex and physiologically relevant representation of the The readily imaging accessibility of our open design is particularly suited for investigations of molecular transport mechanisms involved in the transcellular transport of biologicals, viruses or nanoparticles with the potential of providing insights at extraordinary level of detail. Although we exemplified here the implementation with the LLSM system, it is also designed to take advantage of AO-LLSM, which enables capture of high-resolution 3D movies of collective behavior of cells in a multicellular environment .All datasets used and/or analyzed during the current study are available from the corresponding author TKi upon reasonable request.MS, MD, GM, and TKi conceived the project. MS and GM were involved in all experiments. MD, MS, GM, SU, and TKi designed the brain microvessel-on-a-chip. RH helped with building the brain microvessel-on-a-chip devices under IK and MS supervision. GM and BO provided advice on all aspects of the cell biology associated with this project. BO performed immunostainings. TG performed dextran permeability assays in transwell. IK and MS performed spinning disk confocal microscopy. KO performed lattice light sheet microscopy under TKi\u2019s supervision. GD helped with data analysis. GN performed electron microscopy. FS, YS, and TKa provided the parental TY10 cells and advised on cell culture procedures. TKi supervised the project. MS, BO, and TKi wrote the manuscript with comments from all authors.GM and BO are employees and shareholders of Biogen. TG was employee and shareholder of Biogen at the time the study was performed. TKi is a visiting scientist at Biogen. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "IntroductionThe standard of care for early-stage non-small cell lung cancer (NSCLC) is surgery. However, for medical inoperable patients stereotactic body radiation therapy (SBRT) is an alternative method. The aim of the study is to assess the overall survival (OS), progression-free survival (PFS) and local control (LC) of patients diagnosed with NSCLC\u00a0in Manitoba, Canada, between 2013 and 2017 and managed with SBRT.Materials and methodsThis retrospective study included a total of 158 patients  that were diagnosed with stage I-II NSCLC and were treated with lung SBRT between 2013 and 2017 in Manitoba. Demographics and clinical data were retrospectively extracted from the electronic patient record. Kaplan-Meier and Cumulative incidence curves were used to describe the OS, PFS, and LC outcomes.ResultsFrom the 158 patients, 32 patients were treated with 60 Gy in eight fractions, while 121 patients were treated with 48 Gy in four fractions. Only 85 patients had biopsy-proven NSCLC. The median OS was 2.87 years . OS rates at one and two years were 85% and 66%, respectively. The median PFS was 2.03 years (95% CI 1.65-2.77). Furthermore, one-year and two-year PFS rates were 77% and 51%, respectively. Only 10 patients progressed locally at one year and 17 at two years, making the LC rate 93% at the one-year and 87% at the two-year mark.ConclusionThese findings add to a growing evidence base supporting SBRT in the treatment of clinically suspected and biopsy-proven early-stage NSCLC patients. The most common malignancy worldwide to date is lung cancer, accounting for 11.6% of all new cancers diagnosed , and it There is no screening program for the early detection of lung cancer in Canada although there are studies investigating the feasibility of low-dose computed tomography (CT) for high-risk populations . Chest CA tissue diagnosis is usually made before commencing radiotherapy; however, some patients may have significant comorbidities that may limit tissue diagnosis by biopsy . In suchFor clinically operable early-stage NSCLC, surgical resection is the best treatment modality to achieve a cure . For thoIn Manitoba, SBRT has been offered to medically inoperable patients in early-stage NSCLC patients since 2013. Not all patients who were treated with SBRT had tissue confirmation for malignancy. Furthermore, in this study, we analyze the clinical outcome of patients who were treated with SBRT, whether they had a biopsy or not confirming malignancy in Manitoba.Study population and data accrualThis retrospective chart review was conducted on\u00a0patients diagnosed with early-stage (stage I-II) non-small cell lung cancer in the province of Manitoba, Canada, between January 2013 and December 2017. Patients were included in the study whether they were diagnosed clinically or through biopsy confirming\u00a0NSCLC. The study was approved by the regulatory local ethics committee. Patients were identified through the radiotherapy treatment record registry.Initial tumor node metastasis staging was determined based on imaging studies, including computed tomography of chest, abdomen, and pelvis, PET-CT scans. The overall staging was determined according to the American Joint Committee on Cancer, Seventh Edition guidelines. Local eligibility criteria to receive SBRT included tumors \u22645 cm with or without chest wall involvement; patients with more than one primary lung tumor were also eligible. Patients\u00a0were deemed medically inoperable or declined surgery. Patients were to be considered N0 if the hilar or mediastinal lymph nodes were \u2264 1 cm and there was no abnormal uptake on FDG PET-CT scan. Patients were excluded from receiving SBRT if organ\u00a0at risk constraints were not met, the patient was unable to lie flat for 60 minutes, or intolerant of the immobilization device. Two SBRT dose regimes were mainly used. A dose of 48 Gy in four fractions (BED = 106 Gy10), with fractions at least 36 hours apart, was used when the tumor was more than 10 mm away from mediastinal or pericardial pleura for added safety. The other regimen used was 60 Gy in four fractions (BED = 105 Gy10). This dose fractionation was considered if the tumor was located between 6 mm and 10 mm away from mediastinal or pericardial pleura, or dose constraints for four fractions were not met, excluding the chest wall and ribs.Data collected included patient demographics, staging, pathological details, disease progression, site of progression, and follow up. Data collection was completed on June 1, 2019.Statistical analysesClinical and demographic characteristics of the cohort were described using frequencies and percent for characteristics measured on a categorical scale, while median and interquartile ranges were used to describe characteristics measured on a continuous scale. Measures of overall survival (OS) and progression-free survival (PFS) were estimated using the Kaplan-Meier method, while measures of LC were estimated using cumulative incidence curves. Differences in OS and PFS between categorical patient characteristics were investigated using Log-rank testing, while differences in LC between categorical patient characteristics were investigated using K-sample tests. P values \u2264 .05 were considered indicative of a significant difference. Univariable Cox regression models fitted with restricted cubic splines were used to investigate the relationship between non-linear continuous patient characteristics and OS and PFS. Likewise, univariable competing risk models fitted with restricted cubic splines were used to investigate the relationship between LC and non-linear continuous patient characteristics. The number of knots in each spline function was determined using Akaike\u2019s information criteria. Knots were placed at fixed quantiles of the predictor variable\u2019s marginal distribution for each .A total of 158 patients were included who met the inclusion criteria with a median age of 76 years and an interquartile range of 13. Two-thirds of the study cohort (n=95) were women and one-third were men (n=63). Eighty-five patients (53.8%) had tissue-confirmed NSCLC diagnosis, while 73 (46.2%) did not have a biopsy and were diagnosed clinically. In biopsy-proven NSCLCs, adenocarcinoma was found in 49 patients, almost double the squamous cell carcinoma pathology, which was found in 25 patients. Three-quarters of the study cohort received 48 Gy in four fractions (BED = 106 Gy10). Eighty percent of the population (n=127) were smokers . One- and two-year OS were found to be 85% and 66%, respectively . At one year, the progression-free survival rate was 77% (95% CI 0.69-0.83) and at two years was 51% (95% CI 0.42-0.60)  .Another multi-institutional study across Canada, the USA, and Europe included data on early-stage NSCLC patients treated with SBRT. A total population of 701 patients was assessed, of whom 67% had tissue confirmation of their tumors . They loA population of almost 600 patients with early-stage NSCLC was also studied in the Netherlands, of which 65% of the treated population with SBRT had no biopsy. The outcomes observed showed no difference between biopsied versus non-biopsied patients, with three-year OS and LC rates of 55% and 90%, respectively .An interesting study published by a group from Yale indicated that there is a rising trend observed in the USA in the number of patients undergoing SBRT without biopsy over time.\u00a0This project identified almost 7000 patients within the National Cancer Database in the USA with stage I NSCLC who received SBRT between 2003 and 2011. The majority of the cohort (95%) had a tissue biopsy before SBRT; however, over time, the number of patients treated without tissue biopsy increased. Being medically inoperable, smaller tumor size, and facility type were the only factors in multivariate analysis associated with odds of SBRT without biopsy [Looking at the results presented in the current study, they resemble those discussed previously, with LC of 93% at the one year and 87% at the two-year point. Furthermore, we expected a low median OS that was 2.87 years. OS rates at one and two years were 85% and 66%, respectively; this could be due to the extensive comorbidities found in this frail population.We were not able to report any differences in outcome based on the presence or absence of tissue biopsy, which is comparable to the current literature. Near half of our cohort had no tissue confirmation, which is higher than the Yale study data. One reason could be the higher amount of medically inoperable patients that may have a poor general condition and who are incapable of undergoing certain procedures and investigations. Another reason could be the availability of a multidisciplinary team that discusses thoroughly complex cases in our weekly thoracic disease site conference that have a high comfort level to treat patients empirically based on specific imaging criteria.One of the limitations of this retrospective study is its relatively small sample size. Also, potential selection biases such as poor fitness, personal choice, and other weaknesses were associated with these studies. Looking at the excellent outcomes in the group of patients that had no tissue confirmation and received empiric treatment, we have to question if this was cancer at the time of treatment, especially when we take into consideration that the smaller and less PET avid tumors were more likely present in this group. Moreover, the lack of follow up may influence the OS results. Finally, this work represents a single institutional experience and is retrospective in nature.This study adds to the body of literature that early-stage lung cancer patients treated with SBRT have excellent outcomes, whether they had a biopsy-proven NSCLC or were clinically diagnosed. The authors\u00a0recommend tissue biopsy and pathologic confirmation whenever possible. However, growing literature, including this study, suggests that treating non-pathologically confirmed disease is reasonable. A multidisciplinary team and discussion are crucial and play a remarkable role in the decision making of treating patients without tissue confirmation."}
+{"text": "Efforts to elucidate the function of enhancers in vivo are underway but their vast numbers alongside differing enhancer architectures make it difficult to determine their impact on gene activity. By systematically annotating multiple mouse tissues with super- and typical-enhancers, we have explored their relationship with gene function and phenotype.Though super-enhancers drive high total- and tissue-specific expression of their associated genes, we find that typical-enhancers also contribute heavily to the tissue-specific expression landscape on account of their large numbers in the genome. Unexpectedly, we demonstrate that both enhancer types are preferentially associated with relevant \u2018tissue-type\u2019 phenotypes and exhibit no difference in phenotype effect size or pleiotropy. Modelling regulatory data alongside molecular data, we built a predictive model to infer gene-phenotype associations and use this model to predict potentially novel disease-associated genes.Overall our findings reveal that differing enhancer architectures have a similar impact on mammalian phenotypes whilst harbouring differing cellular and expression effects. Together, our results systematically characterise enhancers with predicted phenotypic traits endorsing the role for both types of enhancers in human disease and disorders. Mammalian gene expression and their parallel gene networks are tightly controlled by non-coding regulatory regions such as enhancers, their accompanying transcription factors (TFs), chromatin re-modellers and non-coding RNAs . Large sBRD4 ), while SEC is depleted .Previous studies have identified SEs to be associated with genes that regulate cell identity and are therefore unlikely to be involved in a housekeeping role , 31. To p\u2009=\u200910\u2212\u20091 and regu mammals ) in browgulation ) in heare marrow ) in bonenscripts , 55) in \u2212\u20098) and abnormal synaptic transmission (q\u2009=\u20092.46\u2009\u00d7\u200910\u2212\u20097), and diseases such as bipolar disorder (q\u2009=\u20098.52\u2009\u00d7\u200910\u2212\u20097) and unipolar disorder (q\u2009=\u20096.26\u2009\u00d7\u200910\u2212\u20095). Similarly, genes related to heart-specific enhancers are enriched for phenotypes like abnormal cardiac muscle contractility (q\u2009=\u20099.05\u2009\u00d7\u200910\u2212\u200916) and diseases like cardiomyopathy (q\u2009=\u20095.45\u2009\u00d7\u200910\u2212\u200914)  in CH12 enhancer associated genes is consistent with the idea that oncogenes are placed under the effect of strong enhancers during cancer development leading to over-expression of these genes ) and TEC . Finally, using GTEx data, we compared the number of expression quantitative trait loci (eQTLs) associated with SEC and TEC and observed no significant difference in the number of cis-eQTLs associated with SEC and TEC   relative to knockouts of other genes (such as those associated with TEs). We compared several standardised phenotyping procedures within the IMPC and observed a significant difference in severity only for acoustic startle and pre-pulse inhibition  Fig.\u00a0. Howeverknockout  to examip\u2009\u2264\u20090.016, except thymus p\u2009=\u20090.056)  among enhancer-associated genes in each of the 22 tissues, using the STRING database . Then inEnhancer regions contain many binding sites for TFs which contribute to important tissue-specific functions by regulating the target genes . To inveSpi1, with cistrome peaks colocalized with bone marrow enhancers, is implicated in myeloid and B-lymphoid cell development [Gata4, with cistrome peaks colocalized with heart enhancers, is involved in myocardial differentiation and function [Dmrt1, with cistrome peaks colocalized with testis enhancers plays a key role in male sex determination and differentiation [p-value <\u200910\u2212\u20093) and 113 TFs (148 TF-tissue pairs) with SEs across all tissues and cell types  and significant colocalisation with corresponding TEs, and 29 TFs with SEs across all tissues and cell types. Examples of such TFs include Hnf6 in liver (\u03c4exp\u2009\u2212\u2009frac\u2009=\u20091), Nkx2\u20135 in heart (\u03c4exp\u2009\u2212\u2009frac\u2009=\u20091), Gata1 in MEL cells (\u03c4exp\u2009\u2212\u2009frac\u2009=\u20090.93) and Neurog2 in brain (\u03c4exp\u2009\u2212\u2009frac\u2009=\u20090.98).First, we found that TFs which have significant colocalisation with enhancer elements include regulators known to be implicated in the corresponding tissue-specific regulation Fig.\u00a0. For exaelopment ; Gata4, function ; and Dmrntiation . OverallOverall, TF cistrome peaks were identified to significantly colocalise with both SEs and TEs, but a greater number of TFs were identified to colocalise with TEs compared to SEs. This could be explained by the relatively large number of TEs in the genome. To investigate this further, for each TF with significant enhancer localization, we computed their transcription factor binding site (TFBS) density in SEs and TEs. The TFBS density could be defined as a measure of TFBS clustering in SEs or TEs see . To summOur findings show mouse enhancer associated genes are correlated to a great extent with tissue-specific gene expression as well as phenotypes. We explored the utilisation of this dataset to infer mammalian gene-phenotype associations as has previously been done for protein-protein interaction (PPI) and gene expression data \u201366. We iBy integrating various features together, 10 combinations were formed, constructing 10 distinct classifiers for each phenotypic domain. The predictive power of each classifier was assessed by generating Receiver Operating Characteristic (ROC) and precision-recall (PR) curves based on 5-fold cross validation, repeated 10 times with different seeds. The classifier trained on all the gene features combined achieved the best performance with a mean AUC-ROC of 0.78 and AUC-PR of 0.27 across all the phenotype domains Fig. . Howeverp\u2009=\u20095.00\u2009\u00d7\u200910\u2212\u20099) based on evidence integrated from a range of data sources by Open Targets platform. Additional\u00a0file\u00a0In order to evaluate the validity of the predictions from the model, we investigated the novel gene-phenotype predictions made by these classifiers. The predictions classified as incorrect are based on the current knowledge of gene-phenotype associations, but it is possible that there are no, or little, prior knowledge about particular gene function, and thus are novel. This also leads to undermining the true predictive power of a classification model. For such reasons, the top false-positive predictions are most interesting as they could provide new hypotheses about gene function. To systematically examine the top false-positive predictions (prediction score\u2009\u2265\u20090.90) in each phenotype domain, we used the Open Targets Platform  and the Regulatory elements have been identified as active in a plethora of cell types and tissues, however there is limited understanding about their relationship to overall gene function and the resulting gene-phenotype relationships. To gain insights into the mammalian regulatory landscape and its potential impact on phenotypic outcome, we focused our analysis on tissue-specific enhancers. By generating a catalogue of super, typical and weak enhancers in multiple mouse tissues we systematically investigated their roles in gene function. From multiple aspects such as gene expression, PPI networks and phenotypes, our study now provides evidence that SE and TE associated genes share common phenotypic outcomes even though their expression profiles and overall numbers in the genome differ.SEs are comprised of dense enhancer clusters spanning large genomic regions and are associated with master transcription factors and other key cell identity genes , 31. We Prior research has thoroughly investigated the role of SEs in complex traits, showing that disease-causing SNPs are more enriched in SEs of disease-relevant cell types , 40, 41.Finally, using a machine learning approach, we systematically evaluated the capability of TSREs and other molecular properties to predict gene-phenotype associations in mouse Fig. . By compIn this study, we systematically characterised different enhancer types with the goal of investigating their roles in gene function. We found that super- and typical-enhancers have different effect on gene expression, but both are preferentially associated with relevant tissue-type mammalian phenotypes and human diseases. We show that genes associated with super- and typical-enhancers exhibit no difference in phenotype effect size or pleiotropy suggesting they share common phenotypic outcomes. Our findings in a diverse range of mouse tissues present opportunities for molecular experiments to investigate regulatory mechanisms in mouse models of human diseases.First, the ChIP-Seq data for histone H3 lysine 4 monomethylation (H3K4me1), histone H3 lysine 4 trimethylation (H3K4me3) and histone H3 lysine 27 monoacetylation (H3K27ac) in 22 mouse tissues and cell lines were collected from ENCODE project (LICR lab) in the form of sequence alignments (BAM files mapped to mm9 mouse genome). The 22 epigenomes include 14 adult tissues: BAT (brown adipose tissue), bone marrow, cerebellum, cortex, heart, kidney, liver, lung, olfactory bulb, placenta, small intestine, spleen, testis and thymus; 2 embryonic tissues: limb and whole brain; and 6 cell lines: bone marrow derived macrophage, CH12 , Esb4 (mouse embryonic stem cells), Es-E14 (mouse embryonic stem cell line E14), MEF (mouse embryonic fibroblast), MEL . Next, we used a multivariate hidden Markov model called ChromHMM to integrate all the ChIP-Seq data and summarise into easily illustratable annotations. The chromatin states were jointly learned across 22 mouse tissues using default parameters. Several HMM models were produced consisting of 4\u20138 chromatin states and identified the 6 state model to provide sufficient resolution to isolate biologically meaningful chromatin states. The resulting chromatin states were then annotated based on the biological significance of the frequencies of combined histone marks. Using this approach, potential active promoter , weak promoter , strong enhancer  and weak enhancer  annotations were mapped across 22 mouse tissues and cell types. To validate our predicted promoter states (states 1 and 2), we compared 217,678 unique non-overlapping promoters to 22,707 known protein coding genes  and recovered 81.66% of known promoters. Similarly, to validate the strong enhancer predictions (state 4), we compared 386,222 unique non-overlapping enhancers to 363 experimentally validated VISTA mouse enhancers and recovered 91.18% of VISTA enhancers from our predictions. Chromatin states with <\u20090.95 posterior probability were filtered resulting in 923,791 strong enhancer (state 4); 309,581 active promoter (state 2); 2,531,993 weak enhancer (state 6); and 427,251 weak promoter (state 1) high confidence annotations respectively.n\u2009\u00d7\u2009s, where n is the number of regulatory elements and s is the number of tissues (i.e. 22). Each row of the matrix is a genomic location of the regulatory element (200\u2009bp in length) and columns represents its posterior probability across all the tissues. The matrices were filtered such that only the regulatory elements with a posterior probability \u22650.95 in at least one tissue were retained. The Tau score for each regulatory element was calculated by the following equation:N is the number of tissues and xi is the posterior probability value. Using the thresholds suggested in [\u03c4reg\u2009\u2264\u20090.15), intermediate (0.15\u2009<\u2009\u03c4reg\u2009<\u20090.85), high (0.85\u2009\u2264\u2009\u03c4reg\u2009<\u20091) and absolute tissue-specific (\u03c4reg\u2009=\u20091).To identify tissue-specific regulatory regions across the 22 tissues, we implemented the Tau method which has been previously used to detect tissue-specific expression , 44. Tauested in , the regFor DNasel accessible regions, we collected DNasel hypersensitivity sites (DHS) in 11 tissues  from ENCODE (UW lab) in the form of hotspots. The mean of DNaseI signal was computed wherever multiple replicates were available within ENCODE. The genomic coordinates of tissue-specific enhancer and promoter elements were compared with DNaseI hypersensitive hotspots using BEDTools  and the To identify SEs in mouse, we implemented an approach similar to previously used by . Using tThe metagene profiles of mean H3K27ac signal across all the SEs and TEs  was calculated as the difference in medians of the two groups divided by the pooled median absolute deviation (MAD). The following formula was used:We used GREAT  to assocFor investigating the expression of enhancer associated genes, RNA-Seq data for all 22 tissues and cell lines was collected from ENCODE as read alignments (BAM files). Data for cell lines CH12 and Es-E14 was collected from Standford/Yale lab while rest of the data was retrieved from LICR lab. From the BAM files, the read counts over all genes  were quantified using HTSeq  and exprt\u2009\u00d7\u2009s, where t is the total number of genes and s is the number of tissues/cell lines. Genes not expressed in any tissue were deleted from the matrix leaving genes expressed in at least 1 tissue. The RPKM values were log2 transformed and quantile normalised (QN)  to allow easier comparison of gene expression across tissues. Genes were then sorted by ascending QN value and divided into deciles of equal density and placed into 10 bins. The lowest decile  was placed in bin 1, the next lowest was placed in bin 2, and so on until the top 10% of QN values were placed in bin 10. The Tau value (\u03c4exp) for each gene was calculated as:N is the total number of tissues, yi is the normalised expression bin profile component of the gene in tissue i. In order to associate \u03c4exp values to tissues, Tau-fraction (\u03c4exp\u2009\u2212\u2009frac) for each gene in every tissue was calculated as ri is the expression of the gene (in RPKM) in tissue i and M is the maximum expression of the gene (in RPKM) across all the tissues. Based on \u03c4exp\u2009\u2212\u2009frac score, the genes were categorised into low (\u03c4exp\u2009\u2212\u2009frac\u2009\u2264\u20090.20), intermediate (0.20\u2009<\u2009\u03c4exp\u2009\u2212\u2009frac\u2009<\u20090.85) or high (\u03c4reg\u2009\u2265\u20090.85) tissue-specific expression in the corresponding tissues. Housekeeping genes were identified based on a strict \u03c4exp threshold. Genes with low \u03c4exp score (\u22640.20) are uniformly expressed across all the tissues and were considered to be housekeeping genes. We identified 1252 housekeeping genes using this threshold out of which 1171 were protein-coding genes.To examine the relationship between enhancers and expression of their target genes, data from all 22 tissues was combined into gene-tissue pairs and grouped into three classes based on their enhancer association: (1) gene-tissue pairs associated with SEs (SEC); (2) gene-tissue pairs associated with TEs (TEC); and (3) gene-tissue pairs associated with weak/poised enhancers (WEC). In order to quantify tissue-specific expression of target genes, we calculated the tissue specificity index for each gene using the Tau method described earlier. We constructed a matrix of expression values with dimensions To visualise the distinct number of enhancer tissue-types calculated for each enhancer-associated gene Fig. f, we genp\u2009=\u20090.012, OR\u2009=\u20090.82) while TEC is enriched .To investigate the molecular functions and biological processes linked with enhancer associated genes, we combined the SE and TE associated genes across the 22 tissues to make two unique lists. This resulted in 3617 genes to be only associated with SEs and 11,437 genes to be only associated with TEs. These gene sets were then used for GO enrichment analysis using ToppGene suite  (Additiop\u2009<\u200910\u2212\u20094). To quantify the severity of phenotypes, we used the percentage change value from each procedure. The percentage change is normalised effect size, which is scaled to make it comparable across various procedures and parameters [https://www.mousephenotype.org/impress). All the parameters within a procedure were grouped together for this analysis. For computing the enrichment of mouse essential genes in SEC and TEC, genes producing a lethal homozygous knockout (960 genes out of 2900) were used.The mouse phenotyping data of enhancer associated gene knockouts was extracted from IMPC . All the statistically significant genotype-phenotype associations and their phenotyping data in IMPC release version 5.0 were used. This version compromised of phenotype data for 3323 gene knockouts, with 2900 genes significantly associated with at least one phenotype attribute  was collected from MGD on 14th June 2017.p-value was calculated as y is number of permuted random-known edges greater than the observed novel-known edges and N is the total number of items in our distribution (i.e. 1001).The predicted protein-protein interactions among the genes of interest were extracted from the STRING database  using thp-value threshold of 5\u2009\u00d7\u200910\u22124 [For the analysis of transcription factor binding sites colocalised with different enhancer sets, we used a cell type independent cistrome, the general genomic map of regions bound by particular TFs in any cell type . The cis5\u2009\u00d7\u200910\u22124  and thenp-values were corrected for multiple testing using Bonferroni correction. Note that the cistrome segments of a TF could significantly colocalise with enhancers in several different cell types, therefore, we counted the number of significant enrichments as TF-tissue pairs. We also performed the analysis with only the cistrome segments that contain high scoring motif hits from HOCOMOCO. The results were very similar to the analysis where all cistrome segments were considered; about 10% of TFs did not have known binding motifs, and for TFs with known motifs, about 90% of significant TF-tissue pairs were independent from whether the motifs were considered or not  of length L, one at 100\u2009L upstream and the other at 100\u2009L downstream. This produced a set of control segments of the same lengths and similar global genomic context as the enhancer segment under study. We checked if any control segments overlapped other constituent enhancers, but such cases contributed only 1\u20132% of the total number of control regions and were safely ignored. The extended enhancer segments and control regions were then intersected with the cistrome peaks of each TF and split into two groups; overlapping (if least 1\u2009bp overlapped) and non-overlapping with the cistrome. The Fisher\u2019s exact test on 2\u2009\u00d7\u20092 contingency tables was used to assess the statistical significance of TF cistrome peaks overlapping constituent enhancers (SE or TE) versus control regions  divided by the total coverage of enhancer-cistrome intersection (in bp). We calculated densities for only those enhancers (constituent enhancers of SEs or TEs) which had at least one motif occurrence in its intersection with the cistrome. The Wilcoxon Rank Sum Test was then used to compare the TFBS densities of TF-tissue pairs in SEs and TEs . The non-corrected p-values were used to order the TF-tissue pairs by their level of TFBS density disparity between SEs and TEs. The TF-tissue pairs were grouped into bins based on their p-value and the number of TF-tissue cases where its TFBS density was more in SEs compared to TEs, or vice versa, were counted . Then, we calculated the -log10 of HOCOMOCO motif hits within these cistrome regions . The respective values for each TF were taken as the TFBS features. The final set of the TFBS features covered all TFs for which we had the ChIP-Seq cistrome peaks and a binding motif model (n\u2009=\u2009297). For PPIs, all the protein interactions in mouse were collected from STRING database version 10.5. For a gene g, its PPI connectivity with all strong enhancer and active promoter associated genes in tissue t was calculated as N is the total number of enhancer or promoter associated genes in tissue t and Ii is the combined interaction score between gene g and ith gene. Similarly for each gene, its PPI connectivity with all genes known to be associated with the phenotype domain to be predicted was computed as I is the interaction score and M is the total number of known phenotype associated genes from MGD.To predict mammalian gene-phenotype associations, features were extracted from TSREs, expression, transcription factor binding and PPI data for all protein-coding genes. From the TSRE profiles across 22 tissues, strong-enhancers and active promoters associated with each protein-coding gene were extracted. A score representing the tissue-specific enhancers and promoters in each tissue was computed as The random forest classifier was implemented in R using randomForest and caret package . We sougAdditional file 1: Figure S1. Chromatin state segmentation and characterisation across 22 mouse tissues. Figure S2. Overview of tissue-specific regulatory elements in the mouse genome. Figure S3. H3K27ac activity within SEs and TEs. Figure S4. Enrichment of chromatin marks over stitched cohesive enhancer units. Figure S5. Chromatin activity within SE and TE constituent enhancers. Figure S6. Region-gene associations of regulatory elements. Figure S7. Relationship between enhancer activity and their target gene expression. Figure S8. Impact of constituent enhancer density on target gene expression. Figure S9. Enhancer usage switch associated with genes within SEC and TEC with multiple enhancer tissue-types. Figure S10. Genomic view of genes demonstrating enhancer usage switch. Figure S11. Breadth of phenotypes associated with SE and TE gene knockouts in mouse. Figure S12. Number of eQTLs associated with genes within SEC and TEC. Figure S13. Protein-protein interaction maps of enhancer associated genes. Figure S14. Protein-protein interaction simulations. Figure S15. Transcription factor binding within SE and TE constituents. Figure S16. Performance of random forest classifiers to predict mammalian gene-phenotype associations. Figure S17. Precision and recall of classifiers used to predict gene-phenotype associations. Figure S18. Evaluation of top-scoring false-positives using the Open Targets platform. Table S1. Mammalian phenotype and human disease ontology terms enriched in genes associated with weak-enhancers.Additional file 2. List of genes associated with SEs (SEC) and TEs (TEC) in 22 tissues.Additional file 3. Comparison of enhancer-gene pairs with TADs and EPUs.Additional file 4. Enhancer tissue-type association of SEC and TEC.Additional file 5. Enhancer usage switch scores of genes within SEC and TEC.Additional file 6. Gene Ontology enrichment of genes within SEC and TEC.Additional file 7. Mouse phenotype and human disease enrichment of genes within SEC and TEC in 22 tissues.Additional file 8. Enrichment of TF cistrome peaks within SE and TE regions.Additional file 9. Performance metrics of all random forest classifiers.Additional file 10. Exploration of top scoring predictions and the evidence supporting their association with the corresponding diseases."}
+{"text": "The ability of horse chestnut extract (HCE) to induce contraction force in fibroblasts, a process with remarkable significance in skin repair, motivated us to evaluate its wound healing potential in a series of experiments. In the in vitro study of the ability of human dermal fibroblasts to form myofibroblast-like cells was evaluated at the protein level (Western blot and immunofluorescence). The in vivo study was conducted on male Sprague-Dawley rats with inflicted wounds (one open circular and one sutured incision) on their backs. Rats were topically treated with two tested HCE concentrations (0.1% and 1%) or sterile water. The control group remained untreated. The incisions were processed for wound tensile strength (TS) measurement whereas the open wounds were subjected to histological examination. On the in vitro level the HCE extract induced fibronectin-rich extracellular matrix formation, but did not induced \u03b1-smooth muscle actin (SMA) expression in dermal fibroblasts. The animal study revealed that HCE increased wound TS and improved collagen organization. In conclusion, the direct comparison of both basic wound models demonstrated that the healing was significantly increased following HCE, thus this extract may be found useful to improve healing of acute wounds. Nevertheless, the use of an experimental rat model warrants a direct extrapolation to the human clinical situation. Skin wound healing involves four basic steps: hemostasis, inflammation, proliferation, and maturation . EspeciaAesculus hippocastanum L. extracts (horse chestnut extract\u2013HCE) improve the repair of venous ulcers ) and expressed in g/mm2.The measurement technique was described previously . BrieflyWound specimens were routinely processed for light microscopy , and staining with hematoxylin-eosin (HE)).Used semi-quantitative method was described previously . We evalp < 0.05 was considered to be statistically significant. The wound tensile strengths are expressed as mean \u00b1 standard deviation (SD) and were compared by one-way ANOVA, followed by Tukey\u2013Kramer multiple comparison test. The non-parametric data from the semi-quantitative analysis are expressed as median and were compared by Kruskal\u2013Wallis test. Level of In conclusion, the direct comparison of both basic wound models demonstrated that the healing was significantly increased following HCE, thus this extract may be found useful in improving acute skin wound healing. However, we did not observe a direct effect of HCE on fibroblasts to myofibroblast transition, and thus it is essential to perform further experiments aimed at finding the exact underlying mechanism of action and optimal therapeutic protocol. Finally, a direct extrapolation from this experimental model to the human clinical situation presents the third limitation of our study due to inter-species variability. However, general molecular regulation of wound healing should be similar, and thus the present data encourages further respective investigations in other animal models physiologically and evolutionary closer to humans."}
+{"text": "Stocks of yellow fever vaccine are insufficient to cover exceptional demands for outbreak response. Fractional dosing has shown efficacy, but evidence is limited to the 17DD substrain vaccine. We assessed the immunogenicity and safety of one-fifth fractional dose compared with standard dose of four WHO-prequalified yellow fever vaccines produced from three substrains.50). We defined non-inferiority as less than 10% decrease in seroconversion in fractional compared with standard dose groups 28 days after vaccination. The primary outcome was measured in the per-protocol population, and safety analyses included all vaccinated participants. This trial is registered with ClinicalTrials.gov, NCT02991495.We did this randomised, double-blind, non-inferiority trial at research centres in Mbarara, Uganda, and Kilifi, Kenya. Eligible participants were aged 18\u201359 years, had no contraindications for vaccination, were not pregnant or lactating, had no history of yellow fever vaccination or infection, and did not require yellow fever vaccination for travel. Eligible participants were recruited from communities and randomly assigned to one of eight groups, corresponding to the four vaccines at standard or fractional dose. The vaccine was administered subcutaneously by nurses who were not masked to treatment, but participants and other study personnel were masked to vaccine allocation. The primary outcome was proportion of participants with seroconversion 28 days after vaccination. Seroconversion was defined as post-vaccination neutralising antibody titres at least 4 times pre-vaccination measurement measured by 50% plaque reduction neutralisation test  for Bio-Manguinhos-Fiocruz, \u22120\u00b790% (\u20134\u00b724 to 3\u00b713) for Chumakov Institute of Poliomyelitis and Viral Encephalitides, 1\u00b782% (\u20132\u00b775 to 5\u00b739) for Institut Pasteur Dakar, and 0\u00b70% (\u20133\u00b732 to 3\u00b729) for Sanofi Pasteur. Fractional doses from all four vaccines met the non-inferiority criterion. The most common treatment-related adverse events were headache (22\u00b72%), fatigue (13\u00b77%), myalgia (13\u00b73%) and self-reported fever (9\u00b70%). There were no study-vaccine related serious adverse events.Between Nov 6, 2017, and Feb 21, 2018, 1029 participants were assessed for inclusion. 69 people were ineligible, and 960 participants were enrolled and randomly assigned to vaccine manufacturer and dose . 49 participants had detectable PRNTFractional doses of all WHO-prequalified yellow fever vaccines were non-inferior to the standard dose in inducing seroconversion 28 days after vaccination, with no major safety concerns. These results support the use of fractional dosage in the general adult population for outbreak response in situations of vaccine shortage.The study was funded by M\u00e9decins Sans Fronti\u00e8res Foundation, Wellcome Trust (grant no. 092654), and the UK Department for International Development. Vaccines were donated in kind. Yellow fever is a mosquito-borne viral disease that is endemic in 44 countries.Evidence before this studyIn July, 2016, after major yellow fever outbreaks in Angola and DR Congo, WHO published a secretariat information paper including a review of studies assessing the immunogenicity of fractional doses of yellow fever vaccines, and recommended consideration of fractional doses to manage a vaccine shortage. Fractional doses of yellow fever vaccine produced by Bio-Manguinhos-Fiocruz (17DD substrain) were given to approximately 7\u00b75 million non-pregnant adults and children aged 2 years or older in Kinshasa, DR Congo. The evidence to support this action was limited to a single vaccine substrain and to a specific context. To broaden and simplify recommendations, WHO called for additional research to be done.Added value of this studyThis is the first randomised controlled trial assessing all four WHO-prequalified yellow fever vaccines, providing information on the immunogenicity and safety of fractional doses of the vaccine substrains at 10 days, 28 days, and 1 year post-vaccination. The results show that, at 28 days post-vaccination, most participants had high neutralising antibodies and that seroconversion rates in the fractional dose groups were non-inferior to standard dose for all vaccines. Seroconversion rates and neutralising antibodies remained high up to 1 year post-vaccination for both fractional and standard doses for all vaccines. These results are aligned with previous studies using the 17DD substrain vaccine but extend the evidence to randomised comparisons of all four vaccines and to sub-Saharan Africa.Implications of all the available evidenceOur study supports the use of one-fifth fractional doses of all four WHO-prequalified yellow fever vaccines for the general adult population and fills a crucial knowledge gap to support WHO policy on the use of fractional dosing of yellow fever vaccine for outbreak response. The immunogenicity and safety of fractional dosing in children and specific populations, such as those living with HIV, is yet to be established. Long-term studies are warranted to substantiate the duration of protection.An outbreak of yellow fever in 2016 in Angola raised major concerns about the adequacy of vaccine supply. Routine vaccination was suspended in some African countries to meet demand,Four studiesWe assessed, for the first time, the immunogenicity and safety of fractional doses of all four WHO-prequalified yellow fever vaccines, to provide evidence to broaden recommendations to include all WHO-prequalified yellow fever vaccines for fractional dosing.We did this double-blind, individually-randomised non-inferiority trial at the Epicentre Mbarara Research Centre in Mbarara, Uganda, and the Kenya Medical Research Institute-Wellcome Trust Research Programme clinical trials facility in Kilifi, Kenya.The study protocolParticipants were recruited from rural communities in the Mbarara municipality, Mbarara district, Uganda, and Kilifi County, Kenya. Communities were informed about the trial using locally adapted strategies. Individuals interested in participating were invited to the study sites. Written informed consent was required to participate. Eligible participants were aged 18\u201359 years, had no contraindications for vaccination, were not pregnant or lactating, had no history of previous yellow fever vaccination or infection, did not require yellow fever vaccination for travel, and were able to comply with study procedures.Participants were randomly assigned to one of eight equal groups corresponding to the four prequalified yellow fever vaccines at standard or fractional dose. Unique allocation numbers were prepared by an independent statistician  using a computer-generated random number list with non-disclosed fixed blocks of size 10, with equal allocation to dose within a block and to a given manufacturer by site. The allocation sequence was concealed using pre-prepared, sequentially numbered scratch-off booklets that were stored securely. After enrolment, the vaccination nurse scratched off the randomisation code indicating the allocated vaccine and dose for the participant. Vaccines were reconstituted and administered in a private room not accessible to other study staff.Participants were masked by covering the volume of the syringe with opaque tape. The vaccination nurse and supervisor overseeing vaccination were aware of allocation; personnel assessing outcomes and investigators were masked to vaccine and dose throughout.A batch of standard 10-dose vials of yellow fever vaccine was selected from each manufacturer with potency at time of release closest to internal minimum specification. Vaccine potency was independently measured at the National Institute for Biological Standards and Control UK; . The freParticipants were followed up at 10 days (\u00b11 day), 28 days (\u00b13 days), and 365 days (\u00b114 days) after vaccination. Participants had a medical consultation at each study visit, and a blood sample was obtained at the first visit (before vaccination) and at each scheduled follow-up visit.50 and PRNT90).Serum samples were separated and aliquoted into 3 samples within 4 h after obtention and stored in \u221280\u00b0C freezers at the study sites. Serum samples were analysed at the Institut Pasteur Dakar , where neutralising antibody titres against yellow fever were assessed by 50% and 90% plaque reduction neutralisation tests  and geometric mean fold increase . Seroconversion, GMT, and GMFI were also assessed at 10 days and 1 year after vaccination to assess the rapidity of protection and the lasting effect of vaccination. Safety outcomes were also included as secondary outcomes, and included assessment of adverse events (AEs) for 28 days after vaccination, and serious adverse events (SAEs) throughout follow-up. SAEs were defined as any new health-related problem that occurred during follow-up and resulted in death, was life-threatening, necessitated hospital admission or prolongation of existing hospital stay, or resulted in disability or incapacity. AEs included all untoward medical events and were evaluated in the 30 minutes following vaccination and up to 28 days after vaccination. At the visits at 10 and 28 days after vaccination, a clinician asked for the presence of local reaction, headache, fatigue, muscle pain, fever, gastrointestinal problem, and any other symptom since the previous visit. Participants were also asked to report any other symptoms or concerns during and outside scheduled visits. We recorded the nature, relatedness, severity, and outcome of each AE.50 titre \u226510), a sample size of 120 people per unique dose was required (240 per manufacturer). 960 participants were to be recruited (480 per study site).To weigh the public health consequence of loss of protection against an increase in available vaccine doses and coverage, non-inferiority was defined as seroconversion 28 days after vaccination no more than 10% less with the fractional dose than with the standard dose. We assumed 95% seroconversion with standard doses and considered that a loss of protection to 85% seroconversion with fractional doses would still ensure protection above 80%, which is necessary to interrupt local transmission.2 tests  for categorical variables and Student's t-test for continuous variables. Any PRNT50 titre reported as seronegative (limit of quantification [LOQ] <10) was converted to LOQ/2. Any PRNT50 titre greater than 20\u2008480 was designated 20\u2008480, as this was the limit of quantification of titres or the last serial dilution.Analysis consisted of pairwise comparisons of fractional versus standard dose of the same manufacturer's vaccine. No comparisons were made between vaccines from different manufacturers. Comparison of baseline characteristics were done using \u03c7The number and percentage of participants who seroconverted are presented by manufacturer and dose with two-sided exact Clopper-Pearson 95% CI. Non-inferiority for the primary outcome was assessed by constructing a two-sided 95% CI using the Wilson score interval of the point difference between seroconversion rates in the fractional and standard dose arms. Fractional doses were considered non-inferior if the lower bound of the CI for difference in seroconversion was greater than \u221210%.t-distribution. Intervals were transformed to show the ratio of GMT and GMFI for the fractional dose compared with standard dose.Two-sided 95% CIs of the mean difference between log GMT and log GMFI between the standard and fractional dose of each vaccine were generated using the 50 <LOQ), and who had a PRNT50 titre at the time of interest. The intention-to-treat population included any vaccinated participant with at least one PRNT50 result after vaccination.Immunogenicity outcomes were assessed in the per-protocol population and the intention-to-treat population. The per-protocol population included all participants for whom the eligibility criteria were appropriately applied, who were seronegative at baseline . 960 eligible participants were enrolled and randomly assigned to a vaccine manufacturer and dosage  and 11 participants had missing PRNT50 results at baseline or 28 days follow-up (952 (99\u00b72%) of 960 participants completed the 28 days post-vaccination visit and 928 (96\u00b77%) completed the 1 year post-vaccination visit. The most frequent reasons for discontinuation were migration out of study area (n=13), loss to follow-up (n=10) and non-compliance with study visits (n=4). Two participants discontinued due to protocol violation . The primary analysis (per protocol) 28 days post-vaccination included 900 (93\u00b76%) of 960 randomly assigned participants. 49 participants had detectable PRNTollow-up .90 results , fatigue (131 [13\u00b77%]), myalgia (128 [13\u00b73%]), and pyrexia (86 [9\u00b70%]; One-fifth fractional doses of the four WHO-prequalified yellow fever vaccines were non-inferior in seroconversion 28 days post-vaccination compared with the standard dose. Non-human studiesThe results of our trial are aligned with previous studies on fractional dosingFor the first time in a randomised trial including all four WHO-prequalified yellow fever vaccines, we assessed seroconversion rates at 10 days post-vaccination in all participants. These results show overall lower seroconversion and GMTs in the fractional dose groups, suggesting a possible delayed immune response of the fractional doses. However, previous studies have shown that 80\u201390% of standard dose vaccine recipients have a protective concentration of neutralising antibodies 10 days after vaccination.The results of this study are subject to several limitations. First, the study was insufficiently powered to assess non-inferiority of the fractional doses at 10 days post-vaccination. 67% of participants seroconverted in the standard dose groups at 10 days after vaccination. Due to the low rates of seroconversion our study has only 35% power to detect a \u221210% non-inferiority margin difference between fractional and standard dose groups at 10 days post-vaccination, which is insufficient to draw conclusions on non-inferiority, and additional studies might be warranted to better understand the early immune response to vaccination with fractional doses. Second, we did not assess for presence of neutralising antibodies against other flaviviruses that could potentially interfere with the response to yellow fever vaccine. To compensate for this, participants were asked about history of infection with Zika, dengue or West Nile virus, but only one participant reported being aware of a previous infection. In total, only 49 participants had neutralising antibodies against yellow fever at baseline, which is very few. These participants were excluded from the per-protocol analysis. We did supplementary analyses at day 10, day 28, and day 365 including participants who were seropositive at baseline and found no difference in interpretation.Finally, the primary limitation for the generalisability of results are the vaccines used in the study. We used vaccines as close as possible to each manufacturer's internal minimum specification for potency. Vaccines titres were high, however, with potencies 6\u201343 times the minimum specification established by WHO. All fractional doses still contained potencies above the minimum specification of 1000 IU. Vaccines also differed in expiry dates and had between 3 and 16 months of remaining shelf-life at the time of testing at the National Institute for Biological Standards and Control . The yelGiven the longstanding practice of releasing batches with high potency, and the dependence on historical precedent for dose requirements, there was much uncertainty regarding the use of fractional dosing, even for doses above the minimum specifications. This is reflected in the WHO recommendations for fractional dosing that the minimal dose administered should preferentially contain 3000 IU/dose, three times the minimum specification for vaccine potency.These results support the use of one-fifth fractional doses of the four WHO-prequalified yellow fever vaccines for the general adult population when there are insufficient standard doses to protect the population at risk during an outbreak, adding crucial support to WHO policy on the use of fractional dosing of yellow fever vaccine.dpco@epicentre.msf.org, following Epicentre's data sharing policy and in accordance with WHO statement on public disclosure of clinical trial results.Data collected for the study, including deidentified participant data, data dictionary and additional related documents such as study protocol and statistical analysis plan, will be made available to others upon request to"}
+{"text": "A specific neural circuit for resolving the motivational conflict between feeding and acute pain. LHPBN) are nociceptive yet distinct from danger-encoding central amygdala\u2013projecting (CeAPBN) neurons. Activation of LHPBN strongly suppressed feeding by limiting eating frequency and also reduced motivation to work for food reward. Refined approach-avoidance paradigm revealed that suppression of LHPBN, but not CeAPBN, sustained motivation to obtain food. The effect of LHPBN neurons on feeding was reversed by suppressing downstream LHVGluT2 neurons. Thus, distinct from a circuit for fear and escape responses, LHPBN neurons channel nociceptive signals to LHVGluT2 neurons to suppress motivational drive for feeding. Our study provides a new perspective in understanding feeding regulation by external competing stimuli.The motivation to eat is not only shaped by nutrition but also competed by external stimuli including pain. How the mouse hypothalamus, the feeding regulation center, integrates nociceptive inputs to modulate feeding is unclear. Within the key nociception relay center parabrachial nucleus (PBN), we demonstrated that neurons projecting to the lateral hypothalamus ( Feeding is driven by a combination of internal nutritional factors and external factors such as environmental cues or conflicting motivational states  located in the brainstem is a core en route center transmitting nociceptive signals to higher brain regions that integrate and interpret the sensory information (LHPBN (LH-projecting PBN) and CeAPBN (CeA-projecting PBN) neurons are largely nonoverlapping populations and determined the effect of LHPBN neuronal circuit in modulating feeding behavior through reduced motivation to obtain food. We also demonstrated the major downstream target of LHPBN in LH to be VGlut2-positive glutamatergic neurons. Our study thus revealed a distinct neural circuit mechanism for hypothalamic neurons to receive nociceptive signals in modulating feeding behavior, and provided a neural mechanism for pain prioritization.In this work, we first established that BNSTPBN (BNST-projecting PBN) neurons coprojected to CeA and LH, respectively, LHPBN and CeAPBN neurons shared a smaller overlap, suggesting distinct neuronal subpopulations , with partial overlap into the central lateral PBN, was also segregated from BNSTPBN and CeAPBN neurons, which mostly located in the elPBN (VGluT2 or CGRP using RNA fluorescence in situ hybridization (RNA-FISH) and determined LHPBN neurons to be glutamatergic and distinct from CGRP-expressing neurons that project strongly to CeA  expressed in the PBN   (Retro was injected into the LH to enable Cre expression in LHPBN neurons and further genetic manipulation of these neurons when viruses expressing Cre-dependent genes were injected into PBN (LHPBN neurons and confirmed that they mainly located in the dvlPBN but projected sparsely to neighboring elPBN (LHPBN neurons projected densely to LH but not to CeA (We first injected retrograde tracer cholera toxin subunit B (CTB) conjugated with different fluorophores into three main PBN projection regions . We further demonstrated that LHPBN neurons responded to different modalities of nociceptive signals, including tactile itch and inflammatory pain , and the cutaneous sensitivity demonstrated by LHPBN neurons was consistent with pseudotyped rabies virus\u2013mediated retrograde tracing revealing monosynaptic connections between these neurons and the dorsal horn of spinal cord . LHPBN neurons were not robustly responsive to visceral malaise induced by intraperitoneal administration of lithium chloride (LiCl), despite a strong response mounted in elPBN that has been reported to be composed mostly of CGRP neurons  ] associated with 0.7-mA electric shocks [unconditional stimulus (US)] in a CS-US pairing fear-conditioning paradigm , supporting that they detect pain per se but not pain-associative cues or freezing behavior. We verified that the absence of activity signals was not due to technical reasons, since LHPBN neurons in the same animal responded robustly to acute paw and tail pinches as well as warm water tail dipping at temperatures between 40\u00b0 and 52\u00b0C . Hence, nociceptive LHPBN neurons constitute a distinct genetic and functional subdivision from CeAPBN neurons.To assess the ability of otometry . LHPBN nc shocks . We alsoLHPBN activation on feeding behavior in overnight-fasted hungry mice. Optogenetic activation of channelrhodopsin-2 (ChR2)\u2013expressing PBN terminals in LH as well as chemogenetic activation of hM3D-expressing LHPBN neurons commonly resulted in reduced total food intake in the fast-refeeding paradigm . Consistently, movement activity was also reduced in mice with activated LHPBN neurons (fig. S4E). Reduced movement and nesting activity were not due to a more sedentary or freezing state, since activating LHPBN neurons promoted grooming actions (fig. S4F). We further assessed the exploratory behavior of these mice in an elevated plus maze (EPM) (fig. S4G). Compared with GFP control mice, LHPBN-activated mice traveled less and made fewer arm entries . These mice also showed a tendency to avoid the EPM open arms, and the time spent in open arm in each entry was markedly reduced . In contrast, chemogenetic attenuation of LHPBN neurons led to a converse increase in the time spent in the EPM open arms, indicating bidirectional control of exploratory behavior by these neurons . Together, these results showed that reduced food consumption after activating LHPBN neurons was not due to a sedentary or freezing state, but rather a potential loss of motivation to obtain food.We also examined other aspects of behavioral change upon LHPBN activation was due to a reduced motivational drive, we trained mice to perform an operant task in which they learned to perform nose pokes in return for food rewards  injection in GFP control mice did not elicit a significant change  schedule, in which each reward requires a single nose poke , \u03ba-opioid DREADD (KORD), in these neurons to enable inducible neuronal attenuation by salvinorin B  . In contrast, mice expressing KORD in LHPBN consumed more food in shock-off trials upon SalB administration  that was associated with a reduced number of retreating events in the decision zone (fig. S6H).To dissect the roles of B   (36). WeB  . WhereasLHPBN reduced the latency of food intake and promoted food intake in shock-on trials, while no significant change was observed for the other two groups of mice  , an effect that was reported to be partially rescued by inhibiting CeA-projecting CGRP neurons in PBN (LHPBN neurons (figs. S2F and S7C)  , these oLHPBN neurons in the presence of mild acute pain was due to a dampened physical sensation, we performed the von Frey test and confirmed that neither attenuating nor activating LHPBN neurons altered paw tactile sensitivity (fig. S8A). Furthermore, we showed that attenuating CeAPBN rather than LHPBN significantly repressed the escape motion to 0.3- and 0.7-mA shocks (fig. S8B), consistent with the reported role of CeAPBN in mediating threat-associated escape behavior  .While we have revealed the function of PBN neurons that project to the LH, the major downstream targets of  neurons  confirmem dvlPBN . Yet, taerminals  confirme neurons . RNA-FISLHPBN neurons depends on downstream LHVGlut2 neurons. Flp recombinase\u2013dependent ChR2 was expressed in LH-projecting glutamatergic PBN neurons based on the injection of retrogradely transporting canine adenovirus type 2 (CAV2)-FLEX-Flp virus in the LH of VGlut2-Cre mice, and inhibitory DREADD hM4D was coexpressed in LH of VGlut2-Cre mice; this allowed for simultaneous optogenetic stimulation of LHPBN neuron terminals and chemogenetic inhibition of LHVGlut2 neurons . Thus, we demonstrated a necessary role of LH glutamatergic neurons in LHPBN-mediated feeding suppression.We lastly examined whether the feeding effects of  neurons . As expeLHPBN neurons respond to nociceptive inputs . Our study has revealed an unexpected role of LHPBN neurons in transducing nociceptive signals to LHVGlut2 neurons and robustly suppressing feeding behavior in a manner complementary to CGRP neurons (regulating eating frequency versus bout duration).While significant efforts have been invested in understanding how hypothalamic neurons sense nutritional signals to modulate feeding behavior  \u2013projecting glutamatergic LH neurons in limiting food consumption . Since the LHb is a core brain region implicated in depression that mediates avoidance behavior  . Together, these findings suggest that mild acute pain that does not elicit fear  that have been recently shown to function as a key hub in sensing mechanosensory inputs and controlling ingestion behavior . Further studies revealing input modulation to LHPBN and CeAPBN neurons will advance our knowledge of how different aspects of pain are regulated. Neural circuit mechanisms underlying different types of motivational conflicts are still not fully understood, and our results provide a new perspective in understanding how pain is prioritized over other conflicting states .Pioneered by Miller and others  and did not prevent LHPBN neurons from being activated by foot shock pain . Instead, BP markedly reduced appetite  and induced a behavioral state characterized by hyperactivity  , Singapore. Animals were housed in a standard 12-hour light-dark cycle animal facility with ad libitum access to water and chow. Male mice between 2 and 8 months of age were used in most experiments. Wild-type C57BL/6J mice were purchased from InVivos Pte Ltd. , VGLUT2-IRES-Cre (stock no. 016963) and VGAT-IRES-Cre (stock no. 016962) mice were purchased from the Jackson laboratories, and HCRT-IRES-Cre mice were generated for our lab by Cyagen Biosciences.Standard stereotaxic procedures were carried out on mice anesthetized with ketamine/xylazine cocktail . BP analgesic was provided during surgery, and Antipam was used as postsurgery reversal drug. Dexamethasone was additionally given in fiber optic cannula implant procedures to reduce inflammation. During surgery, the mouse skull was exposed via a small scalp incision, and craniotomy was performed using a 0.6-mm drill tip. Viruses or 0.25% Alexa fluorophore\u2013tagged CTB retrograde tracers (Invitrogen) were delivered at 2 nl/s with a Micro4 syringe pump (World Precision Instruments) and 10-\u03bcl syringe fitted with 33-gauge needles (NanoFil). Six-millimeter fiber optic cannulae  were used for optostimulation in LH, while 4-mm fibers were used for photometric measurements in PBN. Retro-Cre viruses [mixed with CTB (0.25 mg/ml) in a 5:1 ratio] were injected 2 weeks before viral injections delivering Cre-dependent genes, while canine adenovirus type 2 (CAV2)-Cre viruses [mixed with CTB (0.25 mg/ml) in a 5:1 ratio] may be injected with Cre-dependent viruses on the same day. EnvA G\u2013deleted Rabies-mCherry (EnvA-RV-\u0394G-mCherry) viruses were injected 2 weeks after AAV8-EF1a-FLEX-GTB (FLEX-TVA-G-GFP) virus injections, and mice were euthanized 7 to 10 days afterward for retrograde tracing in specific brain regions. Similarly, mice used in the CTB retrograde\u2013tracing experiments were euthanized 1 to 2 weeks after CTB injections. Otherwise, mice were allowed to recover for three or more weeks in the animal facility before behavior experiments. Stereotaxic coordinates used for injections or implantations in specific brain regions are listed below :LH: AP, between \u22121.1 and \u22121.3 (depending on bregma-lambda distance); ML, \u00b11.15; and DV, \u22124.9 (for injections) or \u22124.7 (for optic fiber implants)PBN: AP, between \u22125.0 and \u22125.5 (depending on bregma-lambda distance); ML, \u00b11.3 to 1.35; DV, \u22122.5 (for injections) or \u22122.4 (for optic fiber implants)CeA: AP, between \u22120.85 and \u22120.90 (depending on bregma-lambda distance); ML, \u00b12.4; and DV, \u22124.45.q)-mCherry (Addgene), AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene), AAV8-hSyn-dF-HA-KORD-IRES-mCitrine (Addgene), AAV5-EF1a-DIO-hChR2(H134R)-mCherry (UNC), AAV5-CaMKIIa-hChR2(H134R)-mCherry (Addgene), AAVdj-EF1-fDIO-hChR2-YFP-WRPE (UNC), AAV9-Syn-FLEX-GCaMP6s-WPRE-SV40 (Addgene), AAV8-EF1a-FLEX-GTB , EnvA G\u2013deleted Rabies-mCherry , AAV8-CAG-FLEX(FRT)-TVA-mCh , AAVdj-CAG-fDIO-oG , and EnvA G\u2013deleted Rabies-GFP .The following lists viruses used in this study: rAAV-retro-CAG-Cre recombinase [University of North Carolina (UNC)], CAV2-Cre recombinase (Plateforme de Vectorologie de Montpellier), CAV2-FLEX-Flp (Plateforme de Vectorologie de Montpellier), AAV1-pCAG-FLEX-EGFP-WPRE (Addgene), AAV8-hSyn-DIO-hM3D(GThese experiments were conducted in a sound-attenuated fear-conditioning chamber (Med Associates Inc.) with two-third area of the metal grid flooring (grid region) covered by an acrylic board (insulated region). In liquid food experiments, a measurement bottle containing liquid food  was installed in a wall behind the grid region so that mice have to enter the grid region to access food. Mouse diet in the home cage was converted from regular chow to liquid food 2 days earlier to habituate mice to the novel liquid diet. On the third day, mice were habituated for 1 hour in the experiment chamber with ad libitum liquid food access to familiarize with food location. On the fourth day, liquid food was removed from the home cage at 10:00 a.m., and mice were granted a 15-min session between 10:00 a.m. and 1:00 p.m. the following day with free liquid food access in the chamber to accustom them to fast-refeed operation. The 10:00 a.m.\u2013fast 10:00 a.m.\u2013refeed regime was used in all experiments. Separate batches of mice were used for the 0-, 0.12-, and 0.7-mA trials. Each trial lasted 15 min, and specified electric shocks were delivered continuously from the metal grid flooring. For experiments in For experiments involving chow diet, water, and novel female access, the insulative region consisted of an acrylic board with smaller area, and cues were located in the grid region at approximately 10 cm away from the insulative region. In these experiments, separate batches of mice were subjected to shock-off (0 mA) or shock-on (0.12 mA) trials. In both chow and water experiments, the 10:00 a.m.\u2013fast 10:00 a.m.\u2013refeed regime was applied. In the novel female experiment, a 2-month-old virgin female mouse was enclosed in a plastic grid box with a base that shields from electric shocks, and a different mouse was used in each trial. Each trial lasted 15 min, and specified electric shocks were delivered continuously from the metal grid flooring. The amount of food consumed was scored by comparing the weight of the chow before and after the experiment. The latency to reward access and the time spent licking water or social interacting  were manually scored by viewing videos recorded from trials.https://github.com/vivekhsridhar/tracktor) (All experiments were recorded with near-infrared (NIR) video camera with NIR in-house lighting. As illustrated in fig. S4A, vacillation time was obtained by manually observing and scoring the duration each mouse spent moving back and forth along the shock-insulative region border in the decision zone. Timer was started when mouse approached the region border. Care was taken to only consider the time when the head of the mouse is facing the reward zone, and we further excluded the time when mouse was solely engaged in grooming activity at the border. The timer was stopped when mouse returned to the rest zone or when the mouse advanced its body completely into the metal grid region. Zone occupancy times and location frequency heatmaps were automatically generated by motion tracking function in EthoVision XT 12. A Python-based motion tracking program  was intraperitoneally injected in mice in the home cage 30 min before test. Experiments were conducted in the following order on consecutive days: PR4 , PR4 (CNO), FR1 , and FR1 (CNO). Each hourly session was video recorded with an NIR video camera. Nose pokes were recorded by Med-PC software. Reward search, defined as each trip from the nose poke port to liquid dipper port, was automatically scored using the motion tracking option in EthoVision XT 12.Successfully trained mice were subsequently tested for PR4 and FR1 operant tasks with chemogenetic activation of All fasting-refeeding experiments were performed in PhenoTyper chambers (Noldus) delivering a standard 12-hour light-dark cycle. Mice were initially habituated to phenotypers for 2 days with ad libitum access to water and chow. Chow was removed from chambers at 5:00 p.m. on the fourth day and then returned at 10:00 a.m. the following day to accustom mice to fast-refeed. The 5:00 p.m.\u2013fast 10:00 a.m.\u2013refeed regime was used in all experiments.For hM3D chemogenetic experiments, vehicle control trials were performed before CNO test trials, and mice were given at least 1 day of rest in between. Vehicle or CNO (1.5 mg/kg in 0.5% DMSO) was intraperitoneally injected 30 min before refeeding, and food intake was subsequently measured for 3 hours. For experiments involving BP, BP (0.1 mg/kg) or saline was intraperitoneally injected in mice an hour before each trial.2 at 0.5-mm tissue depth. The LED light source was controlled by a programmable time to live (TTL) pulser (Prizmatix) that receives commands from the EthoVision XT software (Noldus) to deliver light at specific timings and frequencies. Specifically, light was delivered on a 1-s on 3-s off protocol for 3 hours, and 20- and 40-Hz stimulation were delivered in 10-ms pulses during the 1-s on period.For ChR2 optogenetic experiments, opto-off trials were conducted before 20- and 40-Hz opto-on trials, and mice were given at least 1 day of rest in between. Food was returned to chambers 5 min after the start of optostimulation, and a 3-hour food intake was measured. A 460-nm LED light source (Prizmatix) was delivered via 400-\u03bcm core, NA 0.48 patch cords connected by rotary joint (Doric Lenses) to fiber optic cannula implanted in mice, and the light power at the fiber tip (200-\u03bcm diameter) was calibrated to be 1 to 1.5 mW/mmFor experiments involving both ChR2 (opto) and hM4D (chemo) components, trials were performed in the following order with at least 1 day of rest in between: opto-off chemo-off (Veh), opto-on chemo-off (Veh), and opto-on chemo-on (CNO). Vehicle or CNO (1.5 mg/kg in 0.5% DMSO) was intraperitoneally injected 1 hour before refeeding, and food intake was measured similarly as above. Feeding bout patterns were measured by PhenoTyper and analyzed by the EthoVision XT 12 software.LHPBN KORD attenuation on LiCl-induced visceral malaise, mice were housed in a home cage with a custom-built confined food feeder. Mice were overnight fasted before each trial. LiCl [84 mg/kg; 0.20 M at 10 ml/kg; Sigma-Aldrich L9650; adapted from  intraperitoneal injections were performed on mice in home cage 30 min before each session, and mice were subsequently confined in the respective zones for 30 min to associate zone-specific wall patterns with paired stimuli. On the final testing day, mice were given 15 min of free access across chamber to determine their conditioned place preference.Optogenetic conditioned place preference test was conducted in the same chamber. On the first day, optic fiber\u2013implanted mice were fitted with patch cords and given 30 min of free access across chamber to acclimatize to the environment and also to determine the basal place preference. Mice were subjected to daily 30-min sessions of closed-loop optogenetic conditioning over the next 5 days. Mice fitted with patch cords were given free access across two zones, and optostimulation was activated whenever mice entered their basal preferred zone. The optostimulation protocol consists of continuous 40-Hz stimulation delivered in 10-ms pulses. A 460-nm LED optostimulation setup is as described above. On the final test day, mice fitted with patch cords were given 30 min of free access to determine their conditioned place preference.In both experiments, sessions were video recorded with an overhead monochromatic video camera (Basler), and motion was tracked and analyzed by the EthoVision XT 12 software. Place preference was determined by the percentage time occupancy in each zone.2 at 0.5-mm tissue depth. Light stimulation frequency was determined by an optical chopper (Thorlabs). GCaMPs or GFP fluorescence emission was received by a femtowatt photoreceiver (NewPort), and signals were phase-lock amplified (Stanford Research Systems) and digitized (LabJack), then recorded by a customized Python program based on Fiberkontrol (https://github.com/logang/Fiberkontrol) (Photometry recording setup is as follows: 473-nm laser (Omicron) was delivered via 400-\u03bcm, core NA 0.48 patch cords connected via rotary joint (Doric) to fiber optic cannula implanted in mice, and the light power at the fiber tip (200-\u03bcm diameter) was calibrated to be 1 to 2 \u03bcW/mmAcute electric shocks experiments were conducted in sound-attenuated fear-conditioning chambers (Med Associates Inc.). Fiber optic\u2013implanted mouse was attached to patch cords and habituated in the chamber for 1 hour. Random interspersed electric shocks of specific intensity and duration were delivered to the metal grid flooring under Video Freeze software command (Med Associates Inc.), and video recording was done using a high-speed firewire monochrome NIR video camera with NIR in-house lighting. TTL signal outputs were sent from Video Freeze to fiber photometry recording program to indicate timings of electric shocks.Shock-tone conditioning was conducted in a fear-conditioning chamber with black acrylic A-roof and steel grid flooring, and surfaces were cleaned with detergent with mild lemon scent. Mice were habituated in this chamber for 1 hour 1 day before conditioning and were further habituated for 30 min on conditioning day. Five 20-s pure tones  (CS) that ended with 1-s electric shocks  were delivered to the fear-conditioning chamber over a duration of 10 min. Mice were then given 10-min rest before return to the home cage. Tone extinction was performed the following day in a separate fear-conditioning chamber consisting of white acrylic curved walls and flooring, and surfaces were cleaned with 2% acetic acid solution. Each mouse was attached to patch cords and habituated in the tone extinction chamber for 30 min. Thirty tone extinction trials consisting of 10-s pure tones  were then delivered to the tone extinction chamber. Photometric recordings were conducted at tone extinction trials 1, 2, 9, 10, 19, 20, 29, and 30, and TTL signal outputs were sent from Video Freeze to fiber photometry recording program to indicate tone timings. Mouse freezing behavior was recorded by the NIR video camera and analyzed by Video Freeze.Acute pinches were conducted on mice lightly anesthetized with 1.25% isoflurane and placed on a platform housed in a fear-conditioning chamber. The experimenter was cued to pinch mice upon hearing a 5-s sound cue commanded by Video Freeze, and pinches were performed by lightly squeezing tail or paws with a blunt tip forceps for 5 s or until a reflex behavior response was triggered.Tail dips were conducted on mice lightly anesthetized with 1.25% isoflurane and placed on a platform housed in a fear-conditioning chamber. The experimenter was cued to lower the mouse tail into a temperature-controlled water bath for 20 s upon hearing a sound cue commanded by Video Freeze. TTL signal outputs were sent from Video Freeze to fiber photometry recording program to indicate timings of sound cues.The experiment was conducted in a standard fear-conditioning chamber (Med Associates Inc.). A day before the experiment, mice were habituated for 30 min in the chamber. On the day of the experiment, mice were given subcutaneous injections of SalB (10 mg/kg in DMSO) and returned to the home cage. Thirty minutes later, mice were placed in the chamber and subjected to 5-s pulses of graded electric shocks  delivered by metal grid flooring with 2-min intervals. Motion tracking was done by Video Freeze (Med Associates Inc.).Mice were first given two daily sessions on the von Frey platform. The platform consisted of an elevated metal grid with 5-mm perforations and 1-mm border, and each mouse was confined in a transparent observation arena measuring 15 \u00d7 10 \u00d7 10 cm. On the third and fourth days, mice were given subcutaneous vehicle injections and placed in the observation arena for 30 min before testing with a series of Semmes-Weinstein monofilaments  to determine basal paw tactile sensitivity. On the fifth day, mice were given subcutaneous injections of SalB (10 mg/kg in DMSO) instead to determine the effect of KORD activation in paw tactile sensitivity. Results from the left and right hind paws were averaged. For experiments assessing the effect of hM3D activation, CNO (1.5 mg/kg in 0.5% DMSO) or corresponding vehicle was intraperitoneally injected 30 min before each trial.The test was performed on a standard EPM (Noldus). Mice were first given intraperitoneal injections of CNO (1.5 mg/kg in 0.5% DMSO) and returned to the home cage for 30 min. Afterward, mice were placed at the center of the platform facing a specific open arm, and their behaviors were recorded for 10 min using a Google Pixel 3 camera at 720p. Motion tracking into the open and closed arms was performed using EthoVision XT 12 software, and automatically generated number of arm transitions were further verified with manual scoring by eye.The test was performed according to an earlier published report  and returned to the home cage. Thirty minutes later, mice were placed back in the habituated cylinder, and their behavior was recorded using a Google Pixel 3 camera at 720p for 15 min. Time spent nesting, defined as the action of pulling and fraying of paper towel, was manually scored by eye. Time spent grooming and the breakdown of grooming activities were also manually scored by eye. The percentage of time engaged in active movement was automatically scored by the activity analysis option in EthoVision XT 12, which scores image pixel changes within the experiment arena over time.LHPBN 1 week before the experiment. Each mouse was individually housed a few days before the experiment to ensure that they do not sustain fight injuries and remain calm. The experiment was conducted in a standard fear-conditioning chamber (Med Associates Inc.). They were then given two daily sessions of 15-min habituation in the chamber. On the day of experiment, each mouse was placed in the chamber and subjected to two 5-s pulses of specified electric shocks  delivered by the metal grid flooring. The mouse was then returned to the home cage and perfused 1 hour later for c-fos immunostaining of PBN. For experiments involving BP, BP (0.1 mg/kg) or saline was intraperitoneally injected in mice an hour before each trial.In this experiment, mice were bilaterally injected with 0.25% Alexa Fluor 555\u2013conjugated CTB in LH for retrograde labeling of LHPBN 1 week before the experiment. To induce visceral malaise, mice were intraperitoneally injected with either LiCl [84 mg/kg; 0.20 M at 10 ml/kg; Sigma-Aldrich L9650; adapted from  was used. Mice were deeply anesthetized with ketamine/xylazine mixture and cervical dislocation was performed. Brains were collected, immediately frozen in optimal cutting temperature (OCT) on dry ice, and stored at \u221280\u00b0C. Brains were sectioned at 20 \u03bcm onto microscope slides, postfixed in cold 4% paraformaldehyde (PFA) at 4\u00b0C for 1 hour followed by a quick wash in phosphate-buffered saline (PBS), and then serially dehydrated in 50, 70, and 100% ethanol. Slides were dried at 40\u00b0C for 20 min and permeabilized at room temperature with protease IV provided with the kit. Probe hybridization was done at 40\u00b0C for 2 hours. After hybridization, slides were washed in wash buffer provided in the kit, and then incubated in the order of amplification reagents (amp 1 to 4). After incubating with 4\u2032,6-diamidino-2-phenylindole for 3 min, slides were mounted and coverslipped.Calb1 (428431), Calb2 (313641), CCK (402271), CGRP (420361), mCherry (431201), Pdyn (318771), Vglut2 (319171), and Fos (316921).RNAScope probes used in the study were Mice were deeply anesthetized with ketamine/xylazine mixture and transcardially perfused with PBS followed by 2 to 4% PFA in 1\u00d7 PBS. Collected brains were postfixed in 2 to 4% PFA overnight at room temperature. Brains were then washed with PBS and transferred into 15 (4 hours) and 30% sucrose (overnight), respectively, for dehydration. Brains frozen in OCT compound  were sectioned at 40 \u03bcm in the coronal plane using Leica Cryostat (CM1950). For PBN c-fos quantification, sections were continually collected from AP coordinates, \u22124.9 to \u22125.4. Free-floating sections were washed with PBS three times for 5 min and incubated in blocking buffer  for 2 hours at room temperature. Sections were then incubated in the respective primary antibodies diluted in blocking solution at 4\u00b0C for 24 to 36 hours. After washing in 0.1% Triton X-100 in PBS three times for 5 min, sections were subjected to secondary antibody incubation in blocking solution for 2 hours at room temperature. Sections were finally washed again before being mounted onto microscope slides  with Fluoromount-G (Southern Biotech) and coverslipped.Primary antibodies used were rabbit anti\u2013c-fos , goat anti-CGRP , and rat\u2013anti-mCherry 16D7 .Secondary antibodies used were Alexa Fluor\u2013coupled donkey anti-rabbit 488 , donkey anti-rabbit 647 , donkey anti-goat 568 , and donkey anti-rat 594 .4, 0.5 mM CaCl2, 26 mM NaHCO3, 11 mM glucose, 1 mM kynurenic acid, pH 7.3, 95% O2/5% CO2. Coronal brain slices were cut at a thickness of 250 \u03bcm using a vibratome  and immediately transferred to an incubation chamber filled with ACSF containing the following: 119 mM NaCl, 2.5 mM KCl, 1.3 mM MgCl2, 2.5 mM CaCl2, 1.2 mM NaH2PO4, 26 mM NaHCO3, and 11 mM glucose (pH 7.3), equilibrated with 95% O2 and 5% CO2. Slices were allowed to recover at 32\u00b0C for half hour and then maintained at room temperature. Whole-cell patch-clamp recordings were performed on GFP-positive glutamatergic neurons in LH. The cells were visualized using a charge-coupled device camera and monitor. Pipettes used for recording were pulled from thin-walled borosilicate glass capillary tubes  using a DMZ Zietz-Puller (Zeitz). Patch pipettes (2 to 4 megohms) were filled with an internal solution containing 135 mM cesium methanesulfonate, 4 mM MgCl2, 10 mM Hepes, 1 mM EGTA (pH 7.2), 0.4 mM Mg\u2013adenosine 5\u2032-triphosphate (ATP), 4 mM Na\u2013guanosine 5\u2032-triphosphate (GTP), and 10 Na2-phosphocreatine  for voltage-clamp recording; and an internal solution containing 105 mM K-gluconate, 30 mM KCl, 4 mM MgCl2, 10 mM Hepes, 0.3 mM EGTA, 4 mM Na-ATP, 0.3 mM Na-GTP, and 10 mM Na2-phosphocreatine  for current-clamp recording. The access resistance, membrane resistance, and membrane capacitance were monitored during the experiment to ensure the stability and the health of cells. To evoke synaptic transmission in ChR2-expressing PBN terminals in LH, 5-ms photostimulation (460 nm) was delivered by LED illumination system (pE-4000), and synaptic responses of the LH neurons were recorded with addition of specific channel blockers into bath of recording chamber.The experiment was performed on acute hypothalamic slices from VGluT2-Cre mice expressing ChR2-mCherry and GFP in glutamatergic PBN and LH neurons, respectively. Mouse brains were rapidly removed after decapitation and placed in high-sucrose ice-cold oxygenated artificial cerebrospinal fluid (ACSF) containing the following: 230 mM sucrose, 2.5 mM KCl, 10 mM MgSOAll images were acquired in the SBIC-Nikon Imaging Centre at Biopolis (Singapore) with an A1R+ SI confocal microscope (Nikon). Images were processed and analyzed using ImageJ.P < 0.05 is considered as significant. All data were first tested for normality using the Shapiro-Wilk test, and then appropriate statistical tests were determined accordingly. All tests were two tailed unless specified. For paired t tests, the Wilcoxon matched-pairs signed rank test was used whenever datasets had nonnormal distributions. For unpaired t tests, the Mann-Whitney test was used whenever datasets had nonnormal distributions. Unpaired tests with normal distribution but unequal SD were further subjected with Welch\u2019s correction. One-way repeated-measures analysis of variance (ANOVA) was used with the post hoc Holm-Sidak\u2019s multiple comparisons test to determine significant differences between specific trials. Two-way repeated-measures ANOVA was used with the post hoc Sidak\u2019s multiple comparisons test to determine differences between the two mouse groups.Statistical analyses were performed using GraphPad Prism 8 software or Microsoft Excel, and all results are listed in table S1. All results are expressed as means \u00b1 SEM, and"}
+{"text": "We use survey data collected from 12,037 US respondents to examine the extent to which the American public believes that political motives drive the manner in which scientific research is conducted and assess the impact that such beliefs have on COVID-19 risk assessments. We find that this is a commonly held belief and that it is negatively associated with risk assessments. Public distrust in scientists could complicate efforts to combat COVID-19, given that risk assessments are strongly associated with one\u2019s propensity to adopt preventative health measures. More than a year after the Centers for Disease Control confirmed the first US COVID-19 case, the novel coronavirus continues to exact a devastating toll. Scientists and public health experts have repeatedly informed the public of the dangers posed by COVID-19 and advocated for the adoption of evidence-based practices  designed to reduce transmission rates. Despite these efforts, many Americans assert that the risks associated with COVID-19 have been largely exaggerated\u2013\u2013a sentiment associated with resistance to adopting preventative health measures . In thisA fundamental role of scientific research is to provide objective evidence that can be used to inform policy debates . DespiteSowing doubt over the impartiality and validity of scientific research and/or disparaging scientists\u2019 intentions and credibility may induce public skepticism about purported COVID-19 risks and science-based policy responses \u201324. AccuThe research team obtained informed consent from all subjects. At the beginning of the survey, respondents were presented with an information sheet detailing the terms of the study. Respondents were informed that \u201cBY TAKING PART IN THESE ACTIVITIES YOU INDICATE YOUR CONSENT FOR YOUR ANSWERS TO BE USED IN THIS RESEARCH STUDY\u201d. Note that the researchers obtained a waiver documentation (signature) of consent from the University of Cincinnati Institutional Review Board (FWA #: 000003152).To evaluate our contention, this study utilizes survey data collected from American adults. Respondents to our web-based survey were recruited via the internet panel provider, Qualtrics, which manages participant compensation and quality control . QualtriRisk-Index\u2014assesses the level of COVID-19 related risk one perceives related to a number of daily activities. Respondents were asked to report on a 0\u201310 scale how safe\u2014where 0 indicates \u201cvery unsafe\u201d and 10 indicates \u201cvery safe\u201d\u2014they would feel doing the following activities: \u201cgoing to the grocery store\u201d, \u201cgoing to work with others\u201d, \u201ceating in a restaurant\u201d, \u201csending a child to school or daycare\u201d, \u201cattending a religious ceremony\u201d, \u201cattending a large public event\u201d, and \u201cvoting in person\u201d. To generate the index, we reverse coded each component  and took the mean value. A Cronbach\u2019s alpha test was conducted to assess the internal consistency of the components. The alpha coefficient (0.9339) reveals high reliability, thus justifying use of an index.The dependent variable\u2014Science Trust\u2014Apolitical Motivations: \u201cA lot of research conducted by scientists is driven by their political motives\u201d. Values range from 0\u201310, where 0 indicates complete disagreement, and 10 indicates complete agreement. These values were then reverse coded . This measure was adapted from a question in the General Social Survey [We use responses to the following statement to construct the variable l Survey .https://doi.org/10.7910/DVN/U6Q5FV).We include a number of control variables that capture i) alternative forms of trust in the scientific community, ii) trust in politicians, media, and how each uses/communicates science, iii) how an individual and people in their network have been physically, financially, and mentally impacted by the pandemic, iv) dogmatism, v) health and risk-factors, vi) knowledge of science, vii) beliefs regarding the role of individuals in creating and addressing/mitigating the pandemic, viii) various individual attributes . Summary statistics for all variables are included in the S1 Table in Science Trust\u2014Betterment and Science Trust\u2014Community, that capture a respondent\u2019s general level of trust in the scientific community. Including these variables in our model allows us to disaggregate the impact of one specific form of trust\u2014trust that political motivations do not impact the manner in which research is conducted\u2014from the broader concept of \u201ctrust in science\u201d. To construct these variables, participants were asked to respond to the following statements: \u201cMost scientists want to work on things that will make life better for the average person\u201d and \u201cI have a great deal of confidence in the people running the scientific community\u201d. Values range from 0\u201310 where 0 indicates complete disagreement and 10 indicates complete agreement.We include two variables, We anticipate that distrust in elites  and the means by which elites use and communicate scientific findings could spill over into sentiments regarding scientists\u2019 research motives. Moreover, individuals who distrust the way that elites convey scientific information to the public may actively avoid and/or dismiss information transfers from such actors\u2014in this case, COVID-19 related information\u2014leading to lower levels of COVID-19 related knowledge \u201336, and Government Trust takes the mean value of the first three components, whereas Media Trust is the reported value of the latter. We also capture trust in how media and politicians use scientific information. Participants were asked to identify the extent to which they agree or disagree with the following statements: \u201cThe news media often skews and misrepresents scientific findings to promote their own interests\u201d; \u201cPoliticians often skew and misrepresent scientific findings to promote their own interests\u201d. Values range from 0\u201310 where 0 indicates complete disagreement and 10 indicates complete agreement. These values were reverse coded  to create the variables Use of Science\u2014Government and Use of Science\u2014Media.We asked respondents how often they can trust the national government, state government, local government, and the news media \u201cto do what is right\u201d. Responses range from 0\u201310 where 0 indicates \u201cnever\u201d and 10 indicates \u201calways\u201d. We include a number of variables that account for the physical, financial, and mental toll that the pandemic and resulting government response has taken on individuals and those they consider close to them. Prior research demonstrates an intimate connection between personal experience and risk processing , 37. WhePersonal Impact\u2014Infected indicates whether an individual has tested positive for COVID-19 , whereas Network Impact\u2014Infected indicates whether someone close to them tested positive . Personal Impact\u2014Finances and Network Impact\u2014Finances report how an individual and those they consider close to them were financially impacted by the virus. Values range from 0\u201310 where 0 indicates a major negative impact, and 10 indicates a major positive impact. Personal Impact\u2014Mental and Network Impact\u2014Mental mirror the aforementioned measures but relate to mental instead of financial health.We also include variables that indicate whether an individual has a number of medical conditions that place them in a high-risk category for COVID-19 related mortality . We antiScientific Literacy gauges one\u2019s level of scientific knowledge. Respondents were asked a number of science-based trivia questions: the final measure reports the proportion of correct responses (0\u20131). Participants were asked to respond, \u201cTrue or False\u201d to the following statements: \u201call radioactivity is man-made\u201d; \u201cthe sun revolves around the earth\u201d; \u201cthe continents on which we live have been moving their locations for millions of years and will continue to move in the future\u201d; \u201cthe center of the earth is very hot\u201d; \u201cantibiotics kill viruses and bacteria\u201d; \u201cvaccines help develop immunity to disease\u201d. These questions were largely taken from the General Social Survey [l Survey . Those wl Survey , thus heIndividuals to Blame and Individual Responsibility capture the extent to which an individual feels like the public  are to blame for the pandemic and should be responsible for solving it. To create the measures, participants were asked to respond to the following statements: \u201cMost coronavirus cases could have been prevented if people were more cautious\u201d; \u201cIt is the responsibility of every individual, not the government, to protect themselves during times of crisis\u201d. Values range from 0\u201310 where 0 indicates complete disagreement and 10 indicates complete agreement. We anticipate that attributions of blame and responsibility for the state of affairs surrounding a certain event may impact attitudes toward decision-makers and policy issues as well as individual behavior [behavior , 43.Dogmatism-Index was constructed by taking the mean value assigned to each of the following statements: \u201cThere are two kinds of people in this world: those who are for the truth and those who are against it\u201d; \u201cA group that tolerates too many differences of opinion among its members cannot exist for long\u201d; \u201cTo compromise with our political opponents is dangerous because it usually leads to the betrayal of our own side\u201d; \u201cOf all the different philosophies that exist in the world there is probably only one that is correct\u201d; \u201cIn the long run the best way to live is to pick friends and associates whose tastes and beliefs are the same as one\u2019s own\u201d. The index mirrors that of Davis and Silver [Next, a d Silver  who arguCollege Graduate indicates whether the individual completed a four-year degree (= 1) or not (= 0). Age indicates a person\u2019s age in years. Race indicates whether a respondent is white (= 0), Hispanic (= 1), Black (= 2), or another race (= 3). Political Party indicates whether a respondent is a Democrat (= 0), Independent (= 1), Libertarian (= 2), Republican (= 4), or something else (= 5). Trump indicates whether a respondent approves of the job Donald Trump is doing as president (= 1) or not (= 0).Finally, several variables are included that historically influence one\u2019s tendency to trust elites and evaluate risks associated with public policies , 44, 45.We estimate a multilevel regression model with random intercepts at the state level to examine how increased beliefs that science is apolitical affect the level of risk one perceives performing daily tasks. Inclusion of random intercepts accounts for unmodeled, state-specific factors  that could impact estimates . We inclRisk-Index across all values of the independent variable. Full regression results are presented in Science Trust\u2014Apolitical Motivations: b = .34; z = 13.38; Science Trust\u2014Apolitical Motivations2 b = -.02; z = -8.36). The impact is striking: those who completely disagree that scientific research is apolitical have an expected Risk-Index score of 4.74, compared to 6.16 for those who completely agree, a 23.06% decrease.Results show that greater confidence that science is apolitical is associated with higher risk assessments, though this effect diminishes at higher values of the independent variable  and Science Trust\u2014Community (r = .22). As such, our independent variable represents an independent construct: one that is strongly associated with risk assessments. Science Trust\u2014Betterment and Science Trust\u2014Community are highly correlated (r = .61). In the S2 Table in Science Trust\u2014Community dropped from the model. As shown, the coefficient estimates of the remaining Science Trust variables are entirely consistent with those in Science Trust\u2014Apolitical has a larger substantive impact on risk assessments. While speculative, we contend that this disparity may be due to highly visible and politically polarizing allegations by media and politicians that science has been politicized during the pandemic.While one may be concerned that the variation in effect between We conduct a number of robustness checks to assess the robustness of our findings. First, we calculate the variance inflation factor Click here for additional data file."}
+{"text": "Listeria monocytogenes isolates in Slovakia, which were isolated from various food sectors (61%), food-processing environments (13.7%), animals with listeriosis symptoms (21.2%), and human cases (4.1%). We serotyped these isolates by agglutination method, which revealed the highest prevalence (61.1%) of serotype 1/2a and the lowest (4.7%) of serotype 1/2c, although these represented the majority of isolates from the meat sector. The distribution of CCs analyzed on 176 isolates demonstrated that CC11-ST451 (15.3%) was the most prevalent CC, particularly in food (14.8%) and animal isolates (17.5%). CC11-ST451, followed by CC7, CC14, and CC37, were the most prevalent CCs in the milk sector, and CC9 and CC8 in the meat sector. CC11-ST451 is probably widely distributed in Slovakia, mainly in the milk and dairy product sectors, posing a possible threat to public health. Potential persistence indication of CC9 was observed in one meat facility between 2014 and 2018, highlighting its general meat-related distribution and potential for persistence worldwide.Over the past 11 years, the Slovak National Reference Laboratory has collected a panel of 988  Listeria monocytogenes is a Gram-positive intracellular bacterium responsible for a serious food-borne zoonosis called listeriosis. This pathogen is transmissible to humans through the consumption of contaminated food. It can lead to mild gastroenteritis and also to serious infections of the bloodstream or the central nervous system as well as abortions. The organism is able to pass from cell to cell, allowing it to cross blood\u2013brain and placental barriers (barriers . Immuno-barriers . In 2015barriers . In Slovbarriers .L. monocytogenes strains can persist for a long period of time in various types of food-processing environment (FPE), including chilled processing plants  are in general found in higher frequency in human outbreaks than lineage II strains , which are commonly isolated from food, natural and farm environments, and animal and sporadic human listeriosis cases  had been the gold standard for L. monocytogenes subtyping .1 The PFGE method is routinely performed in the Slovak NRL. The isolates are assigned to an MLST CC using a mapping method detailed in The State Veterinary and Food Institute (SVFI) has been the designated Slovak National Reference Laboratory (NRL) for L. monocytogenes in Slovakia, and they focus only on selected food manufacturers, either in the dairy sector  or from WGS analysis (49 isolates).This study had two objectives. The first was to analyse the genetic diversity of all A panel of 988 isolates collected during the 2010\u20132020 period was selected for this study . The isoThe vast majority of the isolates (947) were from the NRL microbial collection: 603 (61%) isolates were from food, 135 (13.7%) from FPEs, and 209 (21.2%) from animals  with clinical manifestations of listeriosis. Detailed epidemiological information  were compiled in the NRL molecular database .The number of food isolates per sampling period (2010\u20132020) was generally evenly distributed across years, with an average of 54.8 isolates per year . The fooThese food, FPE, and animal isolates were supplemented with 41 isolates (4.1%) from human listeriosis cases . These hn = 51; 29%), 2015 , and 2018  years in which intensive typing had been performed in Slovakia during national surveillance programs. These 121 isolates were then supplemented with 55 isolates (31.2%) from the 2010\u20132020 period, with PFGE or WGS typing data available. Whereas origin of the isolates is very constant throughout time, we considered this selection to be representative extraction of the whole panel. This subset (n = 176) included isolates from four compartments in particular: 115 food sector isolates (65.3%), with 68 dairy isolates (59.2%), 28 meat isolates (24.3%), and 19 isolates (16.5%) from other foods. Of the 61 remaining isolates, 21.3% were from FPEs, 65.6% from animals, and 13.1% from human cases .Serotypes can be identified based on the somatic (O) and flagellar (H) antigens. Antisera against eight somatic  and four flagellar  antigens were used as recommended by the manufacturer of a commercially distributed kit .\u00ae XA system . Salmonella serovar Braenderup H9812 DNA digested by XbaI enzyme  was used as a reference standard.Pulsed-field gel electrophoresis (PFGE) was performed according to the protocol described in L. monocytogenes isolates. Epidemiological duplicates were excluded. They were defined as isolates sharing indistinguishable PFGE profiles, isolated the same year and provided by the same food business operator or the same diagnostic food laboratory, as described in L. monocytogenes isolates were selected for WGS, through the H2020 European Joint Program (EJP) ListAdapt (BioNumerics software (vers. 7.6.3) was used to create a database and compare the PFGE profiles of 164 istAdapt , and twoListeria monocytogenes calculation engine. Raw sequencing reads were quality-checked according to the following criteria: PHRED score of raw reads greater than 30 and average depth coverage greater than 30 \u00d7  ListAdapt  and the han 30 \u00d7 . The tar profile .Out of the 49 isolates for which the whole genome was sequenced, seven CC11-ST451 isolates were collected in Slovakia . These seven genomes were compared with the 144 genomes of CC11-ST451 isolates available in public databases to see the possible relatedness between them as the CC11-ST451 was the most abundant in Slovak isolate collection and not typically present in Europe. One hundred six genomes were from NCBI-ENA databases, 8 genomes from the EFSA project LISEQ , 29 genoOut of the 988 isolates studied, the majority (61.1%) belonged to serogroup 1/2a, 17.8% to 1/2b, 12.7% to 4b, and 4.7% to 1/2c. The remaining isolates (3.7%) were assigned to other serotypes. Serotype 1/2a represented 72.0% of the isolates from the milk and dairy product sector, 64.4% from meat and meat product sector, 38.6% of other food sectors, 57.0% from the FPE sector, 63.6% from animal samples, and finally 41.5% from human cases. In the food sectors, serotypes 1/2b and 4b were mainly detected in food matrices other than dairy and meat  . The disn = 27) (n = 15) was observed in dairy products (CC11-ST451 (serotype 1/2a) was the most prevalent CC in the panel of 176 isolates  . The oriproducts .The CC11-ST451 isolates analyzed here were isolated from very diverse milk and dairy products collected in a geographic area of roughly 200 km in diameter  throughout the 2014\u20132020 period. Many CC11-ST451 animal isolates  were also from the same region and collected during this same time period. These results revealed a wide distribution of CC11-ST451 in the north-western area of central Slovakia.L. monocytogenes mainly grouped into CC9, followed by CC8. Human isolates belonged to CC11-ST451 (Lineage II), CC4, CC6, and CC1 (Lineage I)  . The minneage I)  shows thThe same PFGE profile was observed for three isolates collected between 2014 and 2018 in one meat product facility . This prOut of the 27 CC11-ST451 isolates, 7 isolates were selected for WGS and compared using cgMLST, which showed at least 18 allele differences (AD) between each other, with the exception of human isolates that differed by only one AD. Subsequently, the seven isolates were compared with the CC11-ST451 isolates from public databases and external collaboration (Section \u201cComparison of the Genomes of Seven ST451 Isolates With Publicly Available Genomes\u201d). None of the seven Slovak isolates showed fewer than seven AD with any other isolate . MoreoveListeriosis is a serious public health and food safety problem in European countries, including Slovakia. Little data are available on the population genetic structure of food isolates in this country. Considering that food products are the main sources of human infections, it is very important to study the overall distribution of isolates throughout the country to improve understanding of the circulation of this disease.L. monocytogenes isolates analyzed in this study by Denka Seiken kit which is often considered the \u201cgold standard\u201d for its serotyping . These isolates were collected mainly from production plants. Considering that the typing data in this category were only available for a limited number of isolates mainly from 2014, more extensive evaluation of the CC\u2019s diversity should be performed in future to clarify its importance in public health protection. The decreasing trend of the 1/2b serotype in the period of 2010\u20132020 might be explained by the reduced popularity of rather unhealthy delicatessen products and increased healthier eating habits of Slovak population . PrevaleSerotype 1/2c was prevalent in isolates from meat, corroborating results from other studies conducted on the meat sector in Europe .L. monocytogenes isolate was observed at one meat production site between 2014 and 2018. This result substantiates previous studies demonstrating persistence of CC9 over many years in meat-processing facilities in Switzerland  dairy products are three times more likely to be contaminated with CC11-ST451 than the products from other food categories and (ii) a large part of CC11-ST451 food isolates could be traced back to a specific cheese-producing facility . HoweverThese findings, together with the frequent detection of CC7 in dairy products in Austria  and the CC11-ST451 isolates were also detected in the meat production sector, particularly in one rabbit meat-processing plant in Czech Republic. Persistence of these isolates in FPEs was first suggested by Human cases of listeriosis caused by CC11-ST451 have been reported in Germany , France Conversely, a very low occurrence of ST451 (fewer than 10 isolates) was reported in a wide-scale study  on 1,142The isolate distribution in Central Europe over a period of 11 years highlights a possible distribution of the CC11-ST451 clone in the milk and meat sectors in Slovakia. The seven genomes of Slovak CC11-ST451 isolates were dispersed among the available known genomes of ST451 isolates collected worldwide. The source of the CC11-ST451 isolates in Slovakia can potentially be determined with the systematic sequencing of the ST451 isolate genomes, now being collected by the Slovak NRL.L. monocytogenes isolates in Slovakia and in Europe in general is an important tool for food safety management. With the increasing production of food, globalization of the market, and consumers\u2019 focus on traditional farm products with the characteristic small production and less trained staff in the field of the food safety, there is a higher risk of contamination of FPE and final food products. Isolate typing allows the identification of such threats and control measures implementation.The importance of subtyping of L. monocytogenes isolate diversity in Slovakia, covering isolates from the different food sectors available in the NRL collection, as well as isolates from clinical animal cases and several human outbreaks. The distribution of 988 serotypes was similar to that generally observed in Europe. The CC11-ST451 type, frequently reported in Central Europe, predominated in the Slovakia dataset, being detected mainly in isolates from dairy products.This study is the first comprehensive insight into http://www.ebi.ac.uk/ena/, PRJEB38828, PRJNA475189, and PRJEB45859.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: LC was in charge of serotyping. ZK was in charge of PFGE data production, analysis, and interpretation. ZK and BF performed mapping of PFGE profiles to MLST CCs and WGS analysis. ZK, SR, and BF wrote the manuscript. All authors read, commented, and approved the final version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Glucocorticoids (GCs) are widely prescribed for their anti-inflammatory and immunosuppressive properties as a treatment for a variety of diseases. The use of GCs is associated with important side effects, including diabetogenic effects. However, the underlying mechanisms of GC-mediated diabetogenic effects in \u03b2-cells are not well understood. In this study we investigated the role of glycogen synthase kinase 3 (GSK3) in the mediation of \u03b2-cell death and dysfunction induced by GCs. Using genetic and pharmacological approaches we showed that GSK3 is involved in GC-induced \u03b2-cell death and impaired insulin secretion. Further, we unraveled the underlying mechanisms of GC-GSK3 crosstalk. We showed that GSK3 is marginally implicated in the nuclear localization of GC receptor (GR) upon ligand binding. Furthermore, we showed that GSK3 regulates the expression of GR at mRNA and protein levels. Finally, we dissected the proper contribution of each GSK3 isoform and showed that GSK3\u03b2 isoform is sufficient to mediate the pro-apoptotic effects of GCs in \u03b2-cells. Collectively, in this work we identified GSK3 as a viable target to mitigate GC deleterious effects in pancreatic \u03b2-cells. Glucocorticoids (GCs) are steroid hormones produced by the adrenal gland, under the control of the hypothalamo-pituitary axis . They reUnfortunately, the therapeutic benefits of GCs are accompanied with serious side effects, particularly in the context of chronic treatments. Osteoporosis , loss ofThe exact incidence of GC-induced diabetes is unknown. Hjelmesaeth and coworkers have shown that about 20% of patients treated with GC-based therapy after renal transplantation develop diabetes . OverallA better understanding of the complex regulation of GC signaling and its crosstalk with other intracellular pathways may provide the opportunity to minimize the undesirable effects of GCs and improve their benefit-risk profile for prolonged therapeutic applications.In this study, we investigated the possible implication of Glycogen Synthase Kinase 3 (GSK3) in the mediation of diabetogenic effects of GCs in \u03b2-cells. GSK3 is a serine/threonine kinase, initially described as the kinase inhibiting Glycogen Synthase in the insulin signaling pathway . GSK3, wFirst, we examined the effect of dexamethasone (Dexa), a widely used GC analog, on cell apoptosis in the \u03b2-cell line INS-1 832/13. After 24\u2009h of treatment, Dexa induced cell death, as reflected by the increased incorporation of 7-AAD in INS-1 832/13 cells Fig. . InteresNext, in order to investigate cell apoptosis induced by Dexa in pancreatic islets isolated from Wistar rats, we performed TUNEL staining in islet sections Fig. D, E. DexApoptosis is regulated by the Bcl-2 family of proteins, including pro-apoptotic factors such as Bim or anti-apoptotic factors such as Bcl-2. Here, in INS-1 832/13 and in islets, Dexa increased mRNA and protein levels of Bim and decreased those of Bcl-2, suggesting the activation of apoptosis Fig. \u2013I. The iNOX4, SOD1, SOD2, in cells treated with Dexa. Moreover, the expression of CHOP, a marker of ER stress was unaffected following Dexa treatment  in GSK3\u03b2 and serine 21 (S21) in GSK3\u03b1 are known to decrease their activity. Dexa treatment in INS-1 832/13 cells did not change the levels of phosphorylated S9 and S21 in GSK3\u03b2 and GSK3\u03b1 respectively Fig. ig. F.GCs signaling implicates the nuclear localization of GR upon binding to GC. We performed cell fractionation experiments to separate different cellular compartments. Following 3\u2009h of treatment with Dexa and/or SB216763, the cytoplasmic and nuclear fractions of INS-1 832/13 cells were separated, and the purity of fractions was confirmed by the immuno-detection of nuclear marker histone H3 and cytoplasmic marker tubulin, as shown in Fig. As expected, Dexa treatment strongly induced the nuclear translocation of the GR, as shown by immuno-detection of the GR in the nuclear fraction by western blot, and by immunofluorescent staining Fig. A, B. TreIn addition to the evaluation of GSK3 expression following Dexa treatment described above, we assessed the mRNA and protein levels of GR upon GSK3 inhibition. We found that SB216763-treated INS-1832/13 cells exhibited decreased levels of GR mRNAs and proteins Fig. A, B. DexBecause pharmacological inhibitors used in this study (LiCl and SB216763) inhibit both GSK3\u03b1 and GSK3\u03b2 isoforms, we used genetic approaches to further dissect the proper role of each isoform in the regulation of the GR expression. Using isoform-specific siRNAs, we knocked down GSK3\u03b1 or GSK3\u03b2 in INS-1 832/13. First, we validated by western blot the efficacy of siRNAs in reducing each targeted isoform Fig. . FurtherNext, we carried out additional experiments to determine whether GSK3\u03b2 knockdown can oppose the GC-induced cell death in INS-1 832/13 cells. We showed that in GFP-positive cells, which represent cells expressing GSK3\u03b2 shRNAs, the percentage of 7-AAD positive cells following Dexa treatment was significantly lower compared to the percentage found in Dexa-treated cells infected with scrambled shRNAs, suggesting that GSK3\u03b2 mediates the pro-apoptotic effects of Dexa in \u03b2-cells Fig. . InteresDiabetogenic effects of GCs are largely documented , 27\u201330. SGK1 and Kv1.5, which control the K+ outflow in \u03b2-cells and therefore reduce insulin secretion in vitro in INS-1 cells and in vivo [SGK1 and Kv1.5 expression in rat islets. Importantly, we show for the first time that pharmacological inhibition of GSK3 by either LiCl or SB216763 nearly normalized the glucose-induced insulin secretion in Dexa-treated islets. Furthermore, associated with the recovery of normal insulin secretion, the upregulation of SGK1 and Kv1.5 by Dexa was abrogated by GSK3 inhibitors. The mechanisms underlying the interactions between GSK3 and the GCs pathway have been investigated in several cell systems [The inhibitory effect of GCs on insulin secretion has been reported both in rodent and human islets , 17. Som in vivo , 44. In  systems , 43, 45. systems \u201350 and G systems , 51 in \u03b2 systems , 52\u201355,  systems \u201350, we hMost cellular effects of GCs are mediated by the nuclear translocation of GR upon binding of its ligands. Previous studies have shown that GSK3 participates to the GR nuclear localization in human osteoblasts  and in hFinally, the other major and novel finding of our study was the unraveling of the respective contribution of GSK3 isoforms \u03b1 and \u03b2, to the mediation of pro-apoptotic effects of GCs in \u03b2-cells. Only few studies in other cells systems have investigated the isoform-specific interaction of GSK3 with the GC pathway, and they led to discordant conclusions , 45. In To sum up, this study provides solid evidence for the central role of GSK3 in promoting the diabetogenic effects of GCs in \u03b2-cells, both in term of survival and insulin secretion. Importantly, we unraveled for the first time some of the mechanisms underlying GR-GSK3 crosstalk in \u03b2-cells, and identified GSK3\u03b2 as the main isoform contributing to GC-induced \u03b2-cell death.GCs are widely prescribed for their anti-inflammatory and immunosuppressive properties as treatment for a variety of diseases, including diseases with no alternative therapies. Given the serious diabetogenic side effects of GCs, it is crucial to find new strategies to circumvent the adverse effects of elevated levels of endogenous or exogenous GCs, on organs involved in the regulation of glucose metabolism.Our work has contributed to the identification of GSK3 as a viable target to mitigate GC deleterious effects in pancreatic \u03b2-cells. These novel findings indicate that in susceptible individuals with pre-diabetic condition, GC therapy may become significantly safer, by combining GCs with GSK3 inhibitors as an adjunct treatment, which interestingly has been shown to have powerfull anti-inflammatory effects in chronic inflammatory diseases , 57\u201360.ad libitum on 12\u2009h light/dark cycle. After weaning, animals were fed with a standard chow diet .Animals used in this study were male Wistar rats from our local colony. Animal housing and breeding and relevant procedures were conducted in accordance with the European Community Council directives (2010/63/UE) and approved by the institutional Animal Care and Use Ethical Committee of the Paris-Diderot University (Agreement B-75-13-17). Animal were housed in controlled environment  with food and water Rat islets were isolated from 10\u201312 weeks old male Wistar rats. Pancreatic islets were isolated by Liberase  digestion  and Histopaque\u00ae1077  gradient purification as previously described . Islets Batches of 150 freshly isolated islets were stabilized in RPMI 1640 + Glutamax medium  with 10% Fetal Calf Serum (FCS) , 1% Penicillin-Streptomycin , 1% Hepes , 1% Sodium pyruvate  during 36\u2009h. Islets were then pre-treated or not with 10\u2009mM LiCl  or with 20\u2009\u03bcM SB216763  during 3\u2009h. Next, Dexamethasone  at the concentration of 100\u2009nM was added or not to the medium and incubated for 24\u2009h. Islets were then processed for histology, insulin secretion measurement, real-time PCR or Western blot analysis.Rat insulinoma INS-1 832/13 cells were grown in RPMI 1640 + Glutamax medium with 10% Fetal Calf Serum, 1% Penicillin-Streptomycin, 1% Hepes, 1% Sodium Pyruvate, 50\u2009\u03bcM \u03b2-mercaptoethanol . INS-1 832/13 cells were treated or not with 20\u2009\u03bcM SB216763 and 100\u2009nM Dexamethasone according to the protocol described above. For immunofluorescence analysis and cellular fractionation, cells were subjected to SB216763 and Dexamethasone treatment during only 3\u2009h, in FCS-free medium.Human islets were isolated from four brain-dead non-diabetic donors with prior consent for research use at Saint-Louis Hospital  according to a modified version of the automated method , 63. The5 cells. Following transfection, cells were cultured in OPTI-MEM supplemented with 10% Fetal Calf Serum, 1% Penicillin-Streptomycin, 1% Hepes, 1% Sodium pyruvate, 50\u2009\u00b5M \u03b2-mercaptoethanol. The following siRNAs have been used: Control siRNA , siGSK3\u03b2-Flexitude_3 , siGSK3\u03b1-Flexitube_2 . siRNAs target sequences are provided in Table INS-1 832/13 cells have been transfected with 5\u2009nM siRNA, using the protocol Fast-Forward Transfection with HiPerFect Transfection Reagent  following the manufacturer instructions, in antibiotics and serum-free OPTI-MEM\u2009+\u2009Glutamax medium , on 5\u2009\u00d7\u200910We used two GSK3\u03b2 shRNA constructs  and a scrambled shRNA . The cassettes were inserted in a lentiviral GFP vector. shRNA sequences are reported in Table The culture medium was collected 48\u2009h after transfection of HEK293T and filtered through 0.45\u2009\u00b5m pores. Lentiviral particles were concentrated by ultracentrifugation at 25,000\u2009r.p.m. for 2\u2009h and then resuspended in 200\u2009\u00b5L PBS. For each construct, the lentiviral titer was determined by infection of HEK293T cells and FACS analysis.5 INS-1 832/13 cells were infected with lentiviral particles containing scrambled shRNA-GFP, GSK3\u03b2.1 shRNA-GFP, or GSK3\u03b2.2 shRNA-GFP construct (MOI of 10). Infected cells were treated or not with 100\u2009nM Dexamethasone during 24\u2009h and processed for real-time PCR, western blotting or flow cytometry analysis.2\u2009\u00d7\u200910INS-1 832/13 cell death has been assessed by 7-AAD  incorporation or by Annexin V-FITC incorporation  assay according to the manufacturer\u2019s instructions and quantified on a FACS ARIA II flow cytometer .Total RNA was extracted from rat islets, human islets or INS-1 832/13 cells using the RNeasy mini kit . cDNA of each RNA sample was synthesized with Moloney murine leukemia virus (M-MLV) reverse transcriptase kit . Real-time quantitative PCR amplification reactions were carried out in a LightCycler 480 detection system  using the LightCycler SYBR Green 480 kit . The primer sets were designed using OLIGO7 and are described in Table For immunohistochemical studies, following the treatments described above, islets from each group were hand-picked, fixed in aqueous Bouin\u2019s solution for 1\u2009h, embedded in agarose  and then in paraplast . Blocs were serially sectioned (5\u2009\u03bcm thickness). Cell death was assessed by the TUNEL apoptosis detection kit  on islet sections, according to the manufacture\u2019s protocol, with the modification of TdT enzyme concentration which was further diluted (1/10) to adapt to our experimental conditions. Quantification was made using a computer-assisted image analysis system Histolab 5.14 software . At least 20 islets were counted per experimental condition.3, 1\u2009mM CaCl2, 1\u2009mM MgCl2) containing 0.2% fatty-acid-free BSA  and 2.8\u2009mM glucose, followed by 1\u2009h incubation in 2.8 or 16.7\u2009mM glucose, to measure glucose-induced insulin secretion. Insulin released in the supernatant was measured by ELISA , and normalized to islet DNA content.Freshly isolated Wistar islets were stabilized in RPMI1640\u2009+\u2009Glutamax complete medium during 36\u2009h, then transferred into a RPMI 1640 medium containing or not 10\u2009mM LiCl or 20\u2009\u00b5M SB216763 for pre-treatment. After 3\u2009h pre-treatment, 100\u2009nM Dexamethasone was added or not to the media for 24\u2009h. Following 24\u2009h incubation, batches of 10 islets from each group were pre-incubated for 1\u2009h in a Krebs- Ringer/bicarbonate/Hepes buffer  supplemented extemporaneously with 1\u2009mM DTT, 4% Protease Inhibitor Cocktail  and 5\u2009mM spermine  and spermidine . After 30\u2009min agitation in SF, cells were centrifuged at 720\u2009g for 10\u2009min to separate non-lysed cells, nuclei and cytoplasm. The pellet containing nuclei were washed in SF and resuspended in NL buffer . The supernatant containing cytoplasm were washed to remove traces of nuclei and were ultracentrifugated at 100 000\u2009g for 1\u2009h to separate cytoplasm and membrane fractions. Western blot analysis were performed in nuclear and cytoplasmic fractions.INS-1 832/13 cells were cultured for 3\u2009h in serum-free RPMI1640\u2009+\u2009Glutamax with or without SB216763 20\u2009\u00b5M, and with or without Dexamethasone 100\u2009nM. Cells were resuspended in SF buffer  with 4% protease inhibitor cocktail PIC, PIC2, PIC3 . Fifteen \u00b5g protein were subjected to SDS-PAGE and transferred on a PVDF membrane . After blocking with 5% milk or 5% fatty acid free BSA, the membrane was incubated with corresponding primary antibody: anti-Bim , anti-Bcl-2 , anti-pSer9GSK3\u03b2 , anti-GSK3\u03b2 , anti-pSer21GSK3\u03b1 , anti-GSK3\u03b1 , anti-GR , anti-\u03b2-actin , anti-Histone H3 , or anti-\u03b1/\u03b2-tubulin . The addition of appropriate horseradish peroxidase-conjugated secondary antibody  allowed to visualize the reaction using a chimioluminescence system with ECL Prime . Membranes were then stripped using Re-Blot solution  and then re-probed with appropriate antibody. The results were analyzed and quantified by scanning densitometry using FIJI\u00ae.Following 3\u2009h incubation with the different treatments described above, INS-1 832/13 cells were fixed in a solution of 4% formaldehyde . Then, cells were permeabilized with Triton 0.2% for 20\u2009min, and incubated with 10% goat serum for 1\u2009h. Cells were then incubated with anti-GR antibody overnight at 4\u2009\u00b0C  followed by incubation with anti-rabbit fluorescent secondary antibody for 1\u2009h at room temperature. Finally, cells were covered with mounting medium containing DAPI. Images were acquired using confocal microscopy Zeiss LSM 700.n\u201d is the number of independent experiments performed. When it was possible, the experimental groups were blinded to the investigator that performed the quantification/analyses. For each data set, the outliers were identified by the appropriate statistical test. The statistical significances between means were assessed by Mann\u2013Whitney test (two groups), or by One-Way or Two-Way ANOVA followed by Tukey\u2019s or Dunnett\u2019s post-hoc analysis when more than two conditions were compared, using Graph-Pad Prism 7 software. P-values are indicated in graph as followed: *p\u2009<\u20090.05; **p\u2009<\u20090.01; ***p\u2009<\u20090.001; ****p\u2009<\u20090.0001.Results are expressed as means \u00b1 S.E.M. In the legends, \u201cSupplemental Figure 1Supplemental Figure 2Reproducibility checklist"}
+{"text": "While oncology clinical research coordinators (CRCs) experience a combination of factors that are thought to put them at increased risk for burnout, very little research has been conducted to understand the risk factors associated with burnout among CRCs. We used a mixed-method approach, including self-report questionnaires to assess burnout and compassion satisfaction, as well as individual and interpersonal variables hypothesized to impact CRC well-being. We also conducted a focus group to gain a more nuanced understanding of coordinators\u2019 experiences around burnout, teamwork, resilience, and incivility. Coordinators reported relatively moderate levels of burnout and compassion satisfaction. Resilience, sleep dysfunction, stress, and incivility experienced from patients/family were significant predictors of burnout. Resilience and incivility from patients/family were significant predictors of compassion satisfaction. Themes that emerged from the focus group included that burnout is triggered by feeling overwhelmed from the workload, which is buffered by what was described as a supportive work culture based in teamwork. This study identified variables at the individual and interpersonal level that are associated with burnout and compassion satisfaction among oncology CRCs. Addressing these variables is of critical importance given that oncology CRCs and team-based coordinator care are vital to the success of clinical trials. Clinical research coordinators (CRCs) play a vital role in clinical research activities and interactions with clinical study participants, and they are integral to the success of the clinical trials upon which most oncology advances depend ,2. HowevPrevious research indicates that burnout is driven by both individual and organizational factors, including excessive workload and work-related stress, inefficiencies, interpersonal and moral conflicts, and a clinical and institutional climate that limits the advancement, autonomy, and flexibility of employees ,11,12. AWhile the prevalence of burnout among CRCs is concerning, extensive research also highlights protective factors that are important to consider in understanding burnout within the clinical research team. For example, the presence of positive social support among colleagues reduces burnout and improves both job performance  and attiThe overall goal of this study was to evaluate the individual and interpersonal factors associated with burnout and compassion satisfaction among clinical research coordinators working in a National Cancer Institute (NCI)-designated Comprehensive Cancer Center. Existing frameworks posit that effective approaches to reducing burnout can target multiple levels, including the individual level, the social and team level, and the organizational level . For thiThe research was conducted with our university\u2019s Institutional Review Board\u2019s approval as part of a larger randomized controlled trial evaluating the effect of a team-based intervention to improve resilience and well-being among CRCs (NCT04060901). All work was carried out in accordance with the Declaration of Helsinki. Participants in the randomized controlled trial gave informed consent.n = 130) were invited to participate.CRC participants work in disease-specific teams within an NCI-designated Comprehensive Cancer Center in the Southeastern United States. All coordinators  prior to randomization in the aforementioned clinical trial . To assess burnout and compassion satisfaction, we administered the Professional Quality of Life scale (ProQOL) Version 5 in English . This 30Depression, Anxiety, and Stress Scale 21 (DASS-21) : The DASConnor\u2013Davidson Resilience Scale (CD-RISC-25) : The CD-PROMIS Sleep Disturbance Instrument : A nine-To assess individual factors associated with burnout, we administered:To assess the interpersonal factors associated with burnout, we administered the Nursing Incivility Scale . RespondWe also conducted a focus group discussion to gain a more nuanced understanding of coordinators\u2019 experiences around burnout, teamwork, resilience, and incivility. The focus group lasted approximately one hour and took place in a private room at the cancer center. It was conducted as part of a quality improvement initiative . The focus group was facilitated by a trained member of the research team and followed a semi-structured discussion guide based on the Consolidated Framework for Implementation Research (CFIR) , a widelA deductive codebook was developed based on the CFIR guide and included pertinent constructs such as Needs and Resources, Network and Communication, Culture, Leadership Engagement, and Organizational Incentives and Rewards. Principles of thematic analysis were applied to gain a more in-depth understanding of participants\u2019 reported experiences . In addip > 0.05) to burnout/compassion satisfaction. Next, we performed the same process with interpersonal variables. Finally, in a third step to characterize the amount of variance in the dependent variables explained by both individual and interpersonal variables, we entered all individual and interpersonal variables remaining from the first two reduced  models. If needed, non-significant predictors were removed in a last elimination step to produce a final combined model. All analyses were performed using SPSS Missing items in the psychometric scales were estimated with expectation maximization  using otOf the approximately 130 CRCs working in the center, 45 CRCs completed the self-report survey . Of the p < 0.001). Burnout was significantly positively correlated with stress , anxiety , depression , sleep disturbance , and incivility experienced from patients and their family , and negatively correlated with resilience . Compassion satisfaction was negatively correlated with stress , depression , and incivility from patients  and positively correlated with resilience .As shown in p < 0.001, R2 = 0.61) . Regarding the association between interpersonal variables and burnout, incivility variables were significantly associated with burnout  = 3.32, p = 0.03, R2 = 0.21). However, only incivility experienced from patients was significant in the reduced interpersonal model  = 8.84, p = 0.005, R2 = 0.18). The final combined  included significant associations with sleep, stress, resilience, and incivility experienced from patients and their family  = 17.56, p < 0.001, R2 = 0.66).Results of the multiple linear regression analyses using burnout as the dependent variable indicated a significant collective effect of the individual variables  on burnout  = 10.72,  = 0.61) . Howeverp < 0.001, R2 = 0.49) . Regarding the association between interpersonal variables and burnout, incivility variables were significantly associated with burnout  = 7.76, p < 0.001, R2 = 0.38). However, only incivility experienced from other coordinators and from patients was significant in the reduced interpersonal model  = 11.79, p < 0.001, R2 = 0.38). When the significant individual and interpersonal variables were entered, incivility from co-workers was no longer significant; the final model included resilience and incivility experienced from patients and their family  = 25.57, p < 0.001, R2 = 0.57).Results of multiple linear regression analyses using compassion satisfaction as the dependent variable indicated that there was a significant collective effect of the personal variables  on compassion satisfaction  = 6.65,  = 0.49) . HoweverFive CRCs from two teams participated in a follow-up focus group session; 60% of participants were male with a mean age of 31. Emergent themes included that burnout is triggered by feeling overwhelmed from too many work responsibilities and that it is exacerbated by a lack of understanding from physicians and leadership. While CRCs described a desire for more appreciation from leadership, they stated that there is a supportive work culture among CRCs based in teamwork. Finally, they indicated that interventions to support CRC well-being and cope with burnout would be most beneficial for CRCs who are new to the role. Summary of emergent themes and representative quotes is found in This mixed-method study was conducted to help redress the limited research examining burnout among CRCs. We found that both personal and interpersonal factors are associated with burnout and compassion satisfaction among coordinators working in disease-specific teams within a comprehensive cancer center. The quantitative data indicated that sleep disturbance, stress, and incivility experienced from patients and their family members are risk factors for burnout. Incivility from patients and their family was also associated with reductions in compassion satisfaction. Among personal factors, self-reported resilience was associated with enhanced compassion satisfaction and reduced burnout. These individual and interpersonal factors are highly predictive of well-being in our sample, explaining 66% of the variance in burnout and 57% of the variance in compassion satisfaction. Qualitative focus groups reinforced these findings to some extent, as coordinators reported that burnout is driven by feeling overwhelmed by work responsibilities. CRCs described high levels of team cohesion and indicated that the supportive culture among their team helps to reduce the stress from excessive work.Previous research consistently finds a relationship between burnout and symptoms of depression and stress ,41, and Our study also identified interpersonal risk factors associated with burnout and compassion satisfaction. Clinical research coordinators are critical but under-studied members of interprofessional, team-based oncological care and academic medicine. They play an essential role in multiple distinct and vital aspects of clinical trials research, including participant recruitment, screening, and enrollment. They implement research protocols, interface with regulatory oversight bodies, and support the safety of clinical research participants. They also serve as the primary liaison between the health care team and patients and their family members . At timeInterestingly, there were some domains in which the quantitative and qualitative findings were inconsistent. While coordinators in the focus group indicated that burnout is exacerbated by a lack of understanding or appreciation from physicians and leadership, the quantitative data did not indicate that incivility experienced from physicians and other hospital personnel was associated with burnout. Moreover, discussion of incivility from patients and their family did not arise during the focus group. It may be that the experience of incivility from patients is not as salient to coordinators, or that CRCs do not feel comfortable admitting that it occurs or that they find it distressing. A previous qualitative study of CRCs found that altruism plays a prominent role in coordinators\u2019 orientation to their roles as well as in their day-to-day function in the interprofessional team . MoreoveA limitation of this cross-sectional study is that we cannot definitively determine the causal relationship between the associations identified here. While we have generally interpreted the findings as indicating that sleep disruption, stress, and incivility experienced from patients impact burnout levels, it is likely that burnout is also influencing these personal and interpersonal variables. In fact, it is likely that the relationships are bidirectional, which would indicate a cycle by which problematic personal and interpersonal variables both increase and are made worse by burnout.A second limitation is that our response rate was low and sample size was relatively small, and we may have been underpowered to detect smaller, but still relevant, associations between burnout, compassion satisfaction, and our independent variables. These data were collected from the subset of coordinators who chose to participate in the clinical trials program, and it is possible that self-selection biases influenced our dataset such that the burnout and well-being of our sample is not representative of the larger population of employees. The barriers to conducting research among healthcare providers and staff are well-documented, including the survey fatigue that can be particularly problematic for long survey batteries such as the one used here ,51,52. SOverall, CRCs reported relatively moderate levels of burnout and compassion satisfaction, and they reported feeling overwhelmed from the workload. Resilience, sleep dysfunction, stress, and incivility experienced from patients/family were significant predictors of burnout, while resilience and incivility from patients/family were significant predictors of compassion satisfaction. The fact that the variables identified here explain significant variance in burnout and compassion satisfaction is an important first step toward identifying and addressing the root causes of burnout among oncology CRCs. More research in this area is vital for optimizing the interprofessional work environment for the success of clinical trials."}
+{"text": "In this context, this study aimed to characterize the spatial variability patterns of FCO2 and soil physical, chemical, and microbiological attributes in a sugarcane field area after reform activities. The study was conducted in an Oxisol with the measurement of FCO2, soil temperature (Ts), and soil moisture (Ms) in a regular 90\u2009\u00d7\u200990-m grid with 100 sampling points. Soil samples were collected at each sampling point at a depth of 0\u20130.20\u00a0m to determine soil physical , particle size , and chemical attributes . Geostatistical analyses were performed to assess the spatial variability and map soil attributes. Two regions (R1 and R2) with contrasting emission values were identified after mapping FCO2. The abundance of bacterial 16S rRNA, pmoA, and nifH genes, determined by real-time quantitative PCR (qPCR), enzymatic activity , and microbial biomass carbon were determined in R1 and R2. The mean values of FCO2 (2.91\u00a0\u00b5mol\u00a0m\u22122\u00a0s\u22121), Ts (22.6\u00a0\u00b0C), and Ms (16.9%) over the 28-day period were similar to those observed in studies also conducted under Oxisols in sugarcane areas and conventional soil tillage. The spatial pattern of FCO2 was similar to that of macropores, air-filled pore space, silt content, soil organic matter, and soil carbon decay constant. No significant difference was observed between R1 and R2 for the copy number of bacterial 16S rRNA and nifH genes, but the results of qPCR for the pmoA gene presented differences (p\u2009<\u20090.01) between regions. The region R1, with the highest FCO2 (2.9 to 4.2\u00a0\u00b5mol\u00a0m\u22122\u00a0s\u22121), showed higher enzymatic activity of dehydrogenase (33.02\u00a0\u00b5g\u00a0TPF\u00a0g\u22121 dry soil 24\u00a0h\u22121), urease (41.15\u00a0\u00b5g\u00a0NH4\u2013N\u00a0g\u22121 dry soil 3\u00a0h\u22121), amylase (73.84\u00a0\u00b5g\u00a0glucose\u00a0g\u22121 dry soil 24\u00a0h\u22121), and microbial biomass carbon (41.35\u00a0\u00b5g\u00a0C\u00a0g\u22121 soil) than R2, which had the lowest emission (1.9 to 2.7\u00a0\u00b5mol\u00a0m\u22122\u00a0s\u22121). In addition, the soil C/N ratio was higher in R2 (15.43) than in R1 (12.18). The spatial pattern of FCO2 in R1 and R2 may not be directly related to the total amount of the microbial community  in the soil but to the specific function that these microorganisms play regarding soil carbon degradation (pmoA).The spatial structure of soil CO A decrease in organic carbon affects soil structure, making it more sensitive to compaction and reducing its capacity to retain water and nutrients2.Carbon loss is one of the main threats to soils, as it is listed by FAO as one of the main aspects associated with soil conservation3, the increase in soil organic carbon is considered one of the most economically viable options for adapting and mitigating climate change and combating desertification, soil degradation, and food insecurity. The authors argue that maintaining existing carbon stocks and increasing the potential for sequestration through sustainable soil management practices are the best strategy to offset part of global emissions and simultaneously provide various environmental benefits, increasing soil quality and, consequently, the net primary productivity, thus reducing the economic pressure to convert native lands into agricultural production areas.According to data presented in the IPCC special report on climate change and land useSaccharum spp.) areas modifies soil architecture, increasing the roughness of its surface and the amount of air-filled pore space, creating different aggregate size distributions and changing soil moisture and temperature regimes5.The intense soil tillage carried out during field reforms in sugarcane  has been carried out by several authors, it is always associated with soil physicochemical attributes29 or spatial patterns of vegetation cover in case of forests30. On the other hand, the spatial variability of biological attributes is only studied on small scales, which involve different soil management and use31, mainly due to the high cost of their quantification, preventing the study of a large number of samples. Microbiology is essential to the CO2 production process in the soil and is possibly related to its emission, which has been neglected.Although the study of the spatial variation of soil CO2 emission could be explained by changes in soil microbiological attributes, in addition to the variability of soil physical and chemical attributes. Thus, this study aimed to characterize the spatial variability of soil CO2 emission and soil physical, chemical, and microbiological attributes in a sugarcane area under bare soil conditions.In this context, this study hypothesized that the spatial variation of soil CO1rB\u20324a\u2032 according to the Thornthwaite classification, that is, a humid mesothermal climate with a small water deficit and summer evapotranspiration lower than 70% of the annual evapotranspiration32. The mean annual precipitation registered during the last 30\u00a0years was 1560\u00a0mm, concentrated from October to March, and a mean annual temperature of 22.2\u00a0\u00b0C.This study was conducted in an agricultural area destined for sugarcane production located in Barrinha, S\u00e3o Paulo State, Southern Brazil. The geographical coordinates of the area are 21\u00b013\u2032 S and 48\u00b007\u2032 W, with a mean altitude of 555\u00a0m above sea level. The soil is classified as an Oxisol , with a slope lower than 0.5%. The area occupies a geomorphological province named basaltic cuestas. The regional climate is defined as BSugarcane has been cultivated in the area for more than 10\u00a0years under the mechanized harvesting system, with the last field reform carried out in 2008. Ratoons were mechanically eliminated before tillage operations using an implement consisting of rotary hoes, which cuts the soil and ratoons at a high rotation, and throws them against an impact plate of the implement at a high speed, with the breaking of clods and separation of ratoons from the soil. Limestone and gypsum were applied in the area after ratoon elimination, followed by a leveling harrow operation.\u22121, the second operation immediately after the first one to simulate the effect of the disc harrow11. A regular grid of 90\u2009\u00d7\u200990\u00a0m containing 100 points with minimum distances between sampling points of 10\u00a0m was installed after these operations.Soil tillage operation consisted of the use of an offset disc harrow with 28-notched discs of 28\u2033, half of them in the front section and the other half in the rear section, a working width of 3.5\u00a0m, and a working depth of 0.25\u00a0m. Two operations were carried out with this implement at a mean speed of approximately 7\u00a0km\u00a0h2 flux system  was used to measure the soil CO2 emission (FCO2) in the experimental area. This system monitors changes in CO2 concentration inside a closed chamber using optical absorption spectroscopy in the infrared spectrum. The chamber is a closed system with an 854.2-cm3 internal volume and an 83.7-cm2 circular soil contact area coupled to PVC collars previously inserted at each sampling points to a depth of 3\u00a0cm. In the measurement mode, FCO2 was determined inside the chamber every 2.5\u00a0s and 1.5\u00a0min were required to record it at each point33.Ten measurements were performed over a period of 28\u00a0days  from 8:00 to 10:50\u00a0h. A portable LI-8100 automated soil CO2 assessments.Soil temperature (Ts) was measured using a temperature sensor from the LI-8100 system, which consists of a 20-cm probe that was inserted into the soil near the PVC collars. Similarly, soil moisture (Ms) was measured using a Time Domain Reflectometry (TDR) system , which consists of two 12-cm probes that were also inserted into the soil near the PVC collars. The measurements of Ts and Ms were carried out concomitantly with FCO2 assessments at a depth of 0\u201320\u00a0cm and each grid point. Therefore, 100 disturbed soil samples were collected for chemical analysis, and 100 undisturbed soil samples were taken for physical analysis. For soil chemical analysis, samples were collected with a Dutch auger, being then dried, decloded, and sieved through a 2-mm mesh sieve. The analyses included soil organic matter content (SOM), phosphorus availability (P), K, Ca, Mg, and H\u2009+\u2009Al contents34, sum of bases (SB), and cation exchange capacity (CEC). The total organic carbon (TOC) was estimated by dividing SOM by 1.724. The total soil nitrogen (N) was quantified by the Kjeldahl method35.Soil samplings were performed at the end of FCO\u22121 NaOH as a chemical dispersant and low rotation mechanical stirring for 16\u00a0h36. Fractions containing particles larger than 0.1\u00a0mm were separated by sieving (0.105\u00a0mm sieve) and those of smaller size by sedimentation, according to the Stokes law; silt was determined by difference. Soil bulk density (Ds) was determined from undisturbed soil samples collected with a sampler adapted to cylinders with an internal diameter of 5\u00a0cm and height of 4\u00a0cm. The total pore volume (TPV) was calculated based on Ds, with the pore size distribution determined by a porous plate funnel under a 60-cm water column tension in previously saturated samples. The pore volume retained in the sample corresponded to the micropores, and the difference calculated between TPV and micropores corresponded to the macropores36. Air-filled pore space (AFPS) was calculated as the difference between the porosity fraction filled with water (Ms) and TPV.The particle size distribution of sand, silt, and clay were determined by the pipette method using 0.1\u00a0mol\u00a0L37, using Eq.\u00a0(\u22121), OC is the organic carbon content (g\u00a0kg\u22121), Ds is the soil bulk density (Mg\u00a0m\u22123), and E is the soil layer depth (20\u00a0cm). Soil carbon stability in the sugarcane field reform area was obtained by Eq.\u00a0(k is the soil carbon decay constant and C\u2013CO2 is the labile carbon emitted into the atmosphere as CO2.Soil carbon stock (Cstock) was calculated based on the methodology described by Veldkampsing Eq.\u00a0.1\\documeentclass1pt{minima2 interpolation, being named as R1 (Region 1) and R2 (Region 2), from which soil samples were collected for the microbiological characterization.Two regions with distinct emission potentials were identified after FCOSoil samples were collected from nine points at each experimental area (R1 and R2). Each of these points came from composite sampling, which means that 15 samples were collected in the area around a central point to obtain its results. Pre-sterilized PVC tubes with dimensions of 50\u00a0cm in length and 5\u00a0cm in diameter were used for the soil sampling. These PVC tubes were inserted vertically into the soil to collect soil samples. Subsequently, all the PVC tubes were sealed to avoid losses, stored in iceboxes, and sent to the Laboratory of Biochemistry of Microorganisms and Plants of the School of Agricultural and Veterinarian Sciences of the S\u00e3o Paulo State University (FCAV-UNESP), Jaboticabal campus, S\u00e3o Paulo State, Brazil, where they were stored in an ultra-freezer at \u2212\u200980\u00a0\u00b0C to be used for genomic DNA extraction.38. A 2-\u00b5L Low DNA Mass Ladder (Invitrogen) was used as a molecular standard. This gel was submitted to an electric field of 85\u00a0V for approximately 30\u00a0min. Subsequently, the DNA was quantified in a Nanodrop 2000c spectrophotometer (Thermo Scientific) with an optical density ratio of 1.0 at 260\u00a0nm (OD260) equal to 50\u00a0ng of DNA\u00a0\u03bc\u2212139.The genomic DNA of the soil collected at each region was extracted by the FastDNA SPIN Kit for Soil , following the manufacturer\u2019s instructions, and stored at \u2212\u200920\u00a0\u00b0C. A 5-\u00b5L aliquot was submitted to electrophoresis at 1% (w/v) agarose gel stained in GelRed (Uniscience) in SB buffer to confirm the DNA extraction qualitypmoA, and nifH genes in the SYBER Green I system. The established conditions for each gene are shown in Table Quantitative real-time PCR reactions were performed on the StepOnePlus Real-Time PCR System (Applied Biosystems) for bacterial 16S rRNA, Pseudomonas fluorescens for the bacterial 16S rRNA gene, environmental sample DNA for the pmoA gene, and Bradyrhizobium liaoningense for the nifH gene. The data obtained by amplification of the DNA extracted from soil were interpolated to determine the copy number of the genes under study. The real-time PCR reaction for each gene was prepared at a final volume of 10\u00a0\u00b5L, containing 5\u00a0\u00b5L SYBR Green ROX qPCR Master Mix (Thermo Scientific), 5\u00a0pmol of each forward and reverse primers, 1\u00a0\u00b5L DNA of test sample, and sterile ultrapure water. The data of qPCR were obtained by using the StepOne Software 2.2.2 (Applied Biosystems), being subsequently exported to Excel (Microsoft) to calculate the number of gene copies per gram of dry soil.Standard curves were obtained by performing amplification with the copy number of template DNA of 43 and adapted by Barbosa44. The enzymatic activity of urease and dehydrogenase was determined according to McGarity and Myers45 and Casida et al.46, respectively. Moreover, the enzymatic activity of amylase was determined according to Barbosa44, in which substrate extraction was carried out by the Cole (1977) method, followed by the determination of reducing sugars by the Somogyi47 method. The enzymatic activity of cellulase was determined following the method proposed by Kanazawa and Miyashita48 and the reducing sugar method of Somogyi47.Microbial biomass carbon (MBC) was determined through the irradiation-extraction method, as proposed by Islam and Weil49. The spatial dependence was analyzed using geostatistical techniques, with the estimate of the experimental variograms and permissible model adjustments. The variogram was estimated under the assumption of the intrinsic hypothesis by Eq.\u00a0(N(h) is the number of pairs of points of the experimental observations Z(xi) and Z(xi\u2009+\u2009h) separated by the h distance.The data were initially analyzed using descriptive statistics . The analysis of variance was performed using the software Rs by Eq.\u00a0.3\\docume0), sill (C0\u2009+\u2009C1), and range (a) were estimated for each variable in the adjustment of mathematical models to the experimental variograms. The spatial dependence index (SDI) was used to classify the spatial dependence as weak, moderate, or strong, according to Seidel and Oliveira50. This index considers the C0, a, and contribution (C1) values, the variogram model, and the maximum distance between sampling points. The choice of the best fit to the experimental variogram was based on the lowest sum of squared residuals, the highest coefficient of determination (R2), and the cross-validation through the calculation of the root mean square error (RMSE)52.The parameters nugget effect (CThe estimate of ordinary kriging (OK) at the non-sampled point n by Eq.\u00a0.4\\docume2 emission and the data analyzed in the regions R1 and R2 were submitted to the multivariate exploratory analyses of hierarchical clustering and principal components. The hierarchical clustering analysis is an exploratory multivariate technique to assemble the sample units into groups, allowing the homogeneity within the group and the heterogeneity between groups. The structure of groups in the data is found in a dendrogram constructed with the similarity matrix between samples53 using the Euclidean distance, and the linkage of groups was conducted by the Ward method. Hotelling\u2019s T2 test was performed to test a possible significant difference between groups observed in the dendrogram. Heatmaps were generated using the Euclidean distance as the distance method, being processed using the package gplots in the software R49.Soil CO54. Principal components whose eigenvalues were higher than the unity were considered in this analysis, according to the criterion established by Kaiser55. The coefficients of linear functions, which define the principal components, were used to interpret their meaning using the signal and relative size of coefficients as an indication of the weight to be assigned to each variable. Only coefficients with high values, usually those higher than or equal to 0.70 in absolute value, were considered in the interpretation. The multivariate analyses were processed using the software Statistica 7.0 .Principal component analysis (PCA) is also an exploratory multivariate technique that condenses the information contained in a set of original variables into a smaller set consisting of new latent variables, preserving a relevant amount of original information. The new variables are the eigenvectors  generated by linear combinations of the original variables, constructed with the eigenvalues of the covariance matrix2 (2.91\u00a0\u00b5mol\u00a0m\u22122\u00a0s\u22121) over the 28-day period . Moreover, the values observed for Ts (22.6\u00a0\u00b0C) and Ms (16.95%) were in accordance with the values reported in other studies carried out after sugarcane field reform9. These values are consistent with the characteristics of areas under reform, as soil tillage provides low soil moisture values and high soil temperatures.The mean value of FCO8. Soil tillage also mixes the surface layer, more fertile and rich in organic matter, with deeper soil layers, which is associated with better aeration conditions, adequate moisture, high temperatures, increases in FCO2 due to favorable conditions to the aerobic microbial activity in the decomposition of soil organic matter56, and consequent release of CO2 from soil to the atmosphere58.Tillage operations fractionate soil and incorporate air into it, affecting its temperature regime and accelerating the drying process2 stored in deeper soil layers, an effect usually observed in the short term, which comprises intervals from five59 to 24\u00a0h after soil tillage4. Soil physical attributes and crop growth are also affected by management systems2. Soil density and total porosity reflect the impact to the soil caused by tillage systems and the machinery traffic in the area4. The soil under study had a high density (1.33\u00a0g\u00a0cm\u22123) and predominance of micropores (39.55%) compared to macropores (11.08%). Agricultural areas under conventional soil tillage tend to have a high macroporosity and low microporosity2, justifying the results found in our study. Moreover, soil management does not change soil texture, and soils with a clayey texture (61.58%)  according to criteria proposed by Warrick and Nielsen61, was low compared to the values observed by Silva-Olaya et al.8 and Iamaguti et al.11, also conducted after sugarcane field reform.The sugarcane field reform area had the following mean values for chemical attributes: SOM of 32.17\u00a0g\u00a0dmIn addition, the CV values found for microporosity 12.18%), AFPS (15.10%), silt content (16.62%), and Cstock (12.99%) are also considered moderate (12%\u2009<\u2009CV\u2009<\u200924%). The variables Ts (2.62%), Ms (10.29%), Ds (6.91%), TPV (8.94%), clay content (7.85%), sand content (9.11%), SOM (10.56%), and pH (5.23%) presented CV values considered low (CV\u2009<\u200912%). Moreover, the CV values for P (114.05%), K (31.18%), Ca (78.54%), Mg (47.07%), Al (162.16%), H\u2009+\u2009Al (24.78%), SB (66.26%), CEC (32.46%), and V (24.13%) are considered high (CV\u2009>\u200924%)  tendency and measures of dispersion (variance) to describe a given soil attribute, considering that soil variability occurs entirely random and assuming that its attributes have a normal frequency distribution66 or the alternation between spherical and exponential models69 have been used to describe the spatial variability of FCO2. The ranges of soil attributes of the models adjusted to the experimental variograms presented small changes, varying from 22.3 to 35\u00a0m, except for Ms (53.7\u00a0m), microporosity (38\u00a0m), TPV (37\u00a0m), AFPS (45\u00a0m), and sand content (54\u00a0m) . The similarity in the spatial patterns of these attributes indicates a relationship between them. The spatial structure of soil attributes can be affected by numerous factors in a highly complex way due to the spatial and temporal covariation between influencing factors72. Also, soil management practices contribute to increasing the variability of soil attributes because their characteristics are affected33. Different agricultural practices induce spatial heterogeneity mainly by affecting the ability to retain carbon, water, and nutrients72. In this context, as observed in the maps, the direct relationship between FCO2 and AFPS, macroporosity, SOM, Ca, and Mg is probably due to the activities in the sugarcane field reform, as soil tillage increases the total porosity4.The spatial patterns (maps) of FCOtes Fig.\u00a0 indicate56, promoting favorable conditions for SOM decomposition and, consequently, an increased FCO2. Liming carried out before soil tillage operations contributes to increasing FCO2 due to the chemical dissolution of carbonate, releasing bicarbonate (2HCO3\u2212), which turns into CO2, besides to changes in biological processes that increase SOM mineralization in response to an increased pH74. The direct spatial relationship observed between SOM and FCO2 occurs because the organic matter represents the main energy reservoir for microorganisms76. Thus, the increased supply of energy to the microbial metabolism results in an increased release of CO2 into the atmosphere. According to25, soils without vegetation cover present texture properties that contribute to the spatial and temporal variation of FCO2 since they condition the spatial variability of soil water contents. As in our study, these authors also observed a relationship between FCO2 and silt content.Moreover, soil correction practices increase Ca and Mg contents2 and Ts and Ms. Several authors have observed that the contribution of these factors is not so great when we analyze the spatial variability of FCO277. Soil temperature is characterized as one of the main drivers of the temporal variability of soil respiration78. However, its covariation with soil moisture masks the spatial correlation between soil respiration and soil temperature79.Regarding Ms, a division in the east and west was observed in the area. On the other hand, Ts presented a certain homogeneity throughout the area, except for the central region. The maps did not show a relationship between FCO25. It increases the variability of the flow of soil greenhouse gases, such as CO2, because they are produced or consumed by a great variety of organisms80. In this context, most of the studies on FCO2 variation have observed relationships with microbial activity28, microbial biomass and organic matter content20, and variations in the biomass of living and dead organisms associated with the total soil porosity15. Although the spatial pattern of soil microorganism diversity is often associated with the vegetation present in the ecosystem26, changes occurring in the environment, especially those associated with soil physicochemical management practices, significantly affect its microbiological community81. This effect occurs because physicochemical management influences the abundance and selection of specific communities of soil microorganisms. These microorganisms are the main agents responsible for GHG production, being highly responsive to any change in the environment. Thus, processes that result in GHG emissions depend directly on the functional diversity and structure of soil microbial communities83.As observed in the study area, soil respiration is exclusively due to microbial activity without the presence of plantspmoA, and nifH genes  and R2 (3.1\u2009\u00d7\u2009109\u00a0g\u22121 soil) were compared  and R2   and R2 (2.9\u2009\u00d7\u2009104\u00a0g\u22121 soil) when assessing the abundance of the pmoA gene, related to the carbon cycle  present in the soil, but to the specific function that microorganisms play related to soil carbon degradation (pmoA). Also, the abundance of pmoA genes increases during the dry season41, the period when the present study was conducted. Sengupta and Dick84 assessed the methanotrophic bacterial diversity in two different soils under varying land-use practices as determined by high-throughput sequencing of the pmoA gene and observed that the study of the diversity of specific groups, such as pmoA, can lead us to more accurate interpretations of the correlations between the microbial community and edaphic variables, mainly in studies involving changes in land use aiming at GHG mitigation strategies.However, a difference (p\u2009<\u20090.01) was observed between R1  were observed for the enzymatic activity of dehydrogenase  when compared to R2 (22.90\u00a0\u00b5g\u00a0TPF\u00a0g\u22121 dry soil 24\u00a0h\u22121)  Fig.\u00a0a. R1 als2 since this enzyme is responsible for catalyzing the hydrolysis of urea exoenzymes to form CO2 and ammonium90. The differences (p\u2009<\u20090.01) between R1 (41.15\u00a0\u00b5g NH4\u2013N\u00a0g\u22121 dry soil 3\u00a0h\u22121) and R2 (31.07\u00a0\u00b5g NH4\u2013N\u00a0g\u22121 dry soil 3\u00a0h\u22121)  than in R2 (64.81\u00a0\u00b5g glucose\u00a0g\u22121\u00a0dry soil 24\u00a0h\u22121)  was observed for MBC between R1 (41.35\u00a0\u00b5g\u00a0C\u00a0g\u22121\u00a0soil) and R2 (17.87\u00a0\u00b5g\u00a0C\u00a0g\u22121\u00a0soil) , linked to a shorter Euclidean distance, and Group 2 (R1), linked to a larger Euclidean distance , and pmoA functional gene (0.88), all directed to the same direction as the samples from R1 . On the other hand, there is a relationship of indirect dependence of these attributes with the C/N ratio (\u2212\u20090.86), located in the opposite direction, where the samples of R2 are also located   Fig.\u00a0.2 emission potential in R1 and R2. Therefore, for interpretation purposes, PC1 can be termed as FCO2 potential as a function of soil microbial diversity because there is a close relationship between the spatial pattern of FCO2 and soil microbiota dynamics. This dynamic is regulated by the C/N ratio, that is, the readily available C content, which, as soil pH, has been described in the literature as controlling the taxonomic and functional structure of the microbiota98. In addition, adequate conditions of aeration, nutrient supply, soil moisture, and soil temperature  and the enzymatic activity of dehydrogenase, urease, and amylase, microbial biomass carbon, and soil C/N ratio.In sugarcane field reform areas, the spatial patterns of soil CO2 emission dynamics in agricultural areas. This aims for future mitigation actions that involve less intense tillage activities and restrained and homogeneous applications of soil inputs, reducing production costs and the contribution of these activities to the additional CO2 emission during the sugarcane field reform period.Considering that one of the greatest challenges for new directions in world agriculture is to increase the efficiency of conventional practices of soil management, this study reinforces the importance of understanding the spatial pattern of soil attributes and how they influence soil CO"}
+{"text": "This review examined one of the effects of climate change that has only recently received attention, i.e., climate change impacts on the distribution and toxicity of chemical contaminants in the environment. As ecosystem engineers, earthworms are potentially threatened by the increasing use of pesticides. Increases in temperature, precipitation regime changes, and related extreme climate events can potentially affect pesticide toxicity. This review of original research articles, reviews, and governmental and intergovernmental reports focused on the interactions between toxicants and environmental parameters. The latter included temperature, moisture, acidification, hypoxia, soil carbon cycle, and soil dynamics, as altered by climate change. Dynamic interactions between climate change and contaminants can be particularly problematic for organisms since organisms have an upper and lower physiological range, resulting in impacts on their acclimatization capacity. Climate change variables such as temperature and soil moisture also have an impact on acidification. An increase in temperature will impact precipitation which might impact soil pH. Also, an increase in precipitation can result in flooding which can reduce the population of earthworms by not giving juvenile earthworms enough time to develop into reproductive adults. As an independent stressor, hypoxia can affect soil organisms, alter bioavailability, and increase the toxicity of chemicals in some cases. Climate change variables, especially temperature and soil moisture, significantly affect the bioavailability of pesticides in the soil and the growth and reproduction of earthworm species. Climate change is defined as the alteration in the climate state, evidenced by changes in the variability of its properties such as temperature, precipitation, and wind . These vEarthworms make up 40\u201390% of the soil macrofaunal biomass in many terrestrial ecosystems and thus are vital soil organisms . There aClimate change is a global problem. Generally, when models are used to predict future changes in climate, it usually suggests an increase in more extreme and severe events in the coming decades . The mai2 emissions has slowed down to about 1.5%, and in 2015-2016, it has remained flat. In 2017, 2018, and 2019, the global CO2 emissions increased by 1.4, 2.4, and 0.9%, respectively. The increase was a result of increased consumption in coal. The annual global carbon sequestration potential is about 0.4\u20130.7\u2009Pg C y\u22121, which means that if these rates remain constant until the year 2100, the soil carbon sequestration would only contribute to a maximum of 1\u20133% towards reducing the carbon emissions [2O from the soil with high earthworm population and a warmer climate.The ability of greenhouse gases such as carbon dioxide, methane, nitrous oxide, and fluorinated gases to capture heat from the sun's energy causes the greenhouse effect . The primissions . This scmissions  indicateAs shown in Anthropogenic activity has had an influence on the global water cycle and in turn affected the global precipitation regime by globally increasing the amount of atmospheric moisture and the precipitation patterns over the land . Singh e2, CO, and CH4 and, at the same time, alter the chemistry of organic materials [Ultraviolet radiation is one of the components of solar radiation, and it is separated into UV-A, UV-B, and UV-C . Stratosaterials . Complexaterials .According to Bellard et al. , in fiftTemperature is one of the most important climate change drivers, and it is influential in determining soil biological activity and the decomposition process . The incDendrobaena octaedra, Dendrobaena attemsi, and Satchellius mammalis, and in wetter months, the earthworm numbers increased. Species such as Aporrectodea caliginosa and Lumbricus rubellus had a high tolerance to temperature changes. Also, the study conducted by Berman and Meshcheryakova [A study conducted by Eggleton et al.  showed eeryakova  indicateeryakova  showed teryakova . This aberyakova .The soil environment is affected directly and indirectly by drought . The defAporrectodea caliginosa can form nonpermanent horizontal burrows in the topsoil and form aestivation chambers covered with mucus and gut content and protect themselves against water loss [Earthworms are only active if free water is available in the soil. They are morphologically and physiologically limited in their use of the cuticle to maintain body moisture . When soter loss . The comter loss  suggesteLumbricus rubellus and Allolobophora chlorotica. Sch\u00fctz et al. [Floods, on the contrary, can cause massive changes to the soil  by oversz et al.  and Bullz et al.  suggestez et al.  indicateThe soil acidification process is a gradual and continuous natural process that occurs during pedogenesis and is aided by water leaching basic cations to lower subsoil . The aci\u22121 of nitrogen was accumulated in terrestrial environments. This nitrogen-induced acidification has posed a significant threat to terrestrial ecosystem functioning and species diversity. Using nitrogen fertilizers can have a variety of effects on soil acidification. The NH4+ ions can displace base cations such as Ca2+, Mg2+, and Na+ by binding them and making them more easily leached out of the soils, thus reducing their buffering against acidification, and therefore, when plant roots absorb the NH4+ ions, the H+ ion is released into the soil solution, and this can cause soil acidification [One of the main drivers of soil acidification in terrestrial environments is the accumulated nitrogen deposition, and according to Tian and Niu , during fication . Climatefication . When prfication .The carbon cycle involves the soil, plants, and all animal life, including humans; thus, the disruption of the carbon cycle would mean disaster for all living organisms. Soil organic matter is expressed as soil organic carbon, which plays a vital role in the sorption of soil pollutants . The basThe productivity of the vegetation growing on the soil is related to the soil's carbon input rate, measured by the net primary production (NPP) . The NPPHuman impact disrupts the carbon cycle balance because carbon enters the atmosphere from burning of fossil, cement production, the ocean, land use, animals, plants, and geological reservoirs through mining. The emission rate of carbon in the atmosphere remains unbalanced, and the speed at which carbon is used makes it nonrenewable, which disrupts the global carbon cycle. Climate, vegetation, parent material, topography, and time are all important factors influencing soil carbon. Soil carbon reservoir has been suggested as both a sink and a source of atmospheric carbon dioxide. It is considered a source when net decomposition exceeds carbon inputs into the soil, which could be due to human activities or global warming, and it is considered a sink when the difference between net ecosystem carbon uptake and tree growth rates exceeds the net ecosystem carbon uptake . The deg2) concentrations, which may significantly affect the usage, distribution, and degradation patterns of pollutants such as pesticides [Climate change has left indelible imprints on the ecosystem, including extreme temperature and rainfall events, as well as an increase in atmospheric carbon dioxide  report, the global temperature and other climate change drivers are becoming more severe and erratic; therefore, current research must consider environmental concerns related to climate change. Year 2019 was the second warmest year in 140 years with an increase of 0.95\u00b0C , and theFuture studies must consider collecting relevant data as climate change becomes a more urgent issue. Several studies such as , 101\u2013103+ ions, and only when the H+ input exceeds the maximum of soil buffer capacity, it will cause soil acidification [The soil itself has capabilities to act as a buffer against pollutants as well as variables such as temperature, moisture, and acidification. The properties and make-up of the soil give it these characteristics to act as a buffer. The organic matter (carbon) in the soil can help reduce the effects of heavy metals, for instance, in the soil. The variety of microbial communities in the soil also helps to break down organic pollutants. The soil surface itself acts as a buffer to temperature changes for the lower soil levels. Certain soil types such as clay can retain water for longer periods helping with soil moisture. With regard to the acidification process, it is a slow and natural process although it is hastened by pollution. Soil is the buffer against acidification because soil buffers external Hfication . Soil hefication , making fication . The pos"}
+{"text": "Experimental and epidemiological studies have demonstrated that fine particulate matter with a diameter of <2.5 \u03bcm (PM2.5) affects both the respiratory and immune systems. However, effective approaches to reduce PM2.5-induced hazardous effects have not been discovered yet. Streamer discharge is a category of plasma discharge in which high-speed electrons collide with oxygen and nitrogen molecules. Although streamer discharge can reportedly eliminate bacteria, molds, chemical substances, and allergens, its ability to decontaminate PM2.5 has not been previously demonstrated. The present study explored whether streamer discharge treatment could reduce PM2.5-induced inflammatory responses by employing an in vitro system. PM2.5 was collected under four conditions (Bangkok (Sep.\u2013Dec.), Bangkok (Dec.\u2013Mar.), Singapore, and Taipei). Airway epithelial cells and antigen-presenting cells exposed to non-treated PM2.5 in several conditions resulted in inflammatory responses. Streamer-discharged PM2.5 (Bangkok (Sep.\u2013Dec.)) decreased the expression of interleukin (IL)-6 and IL-8 compared to non-treated PM2.5. Moreover, composition analysis demonstrated that streamer discharge reduced some compounds, such as endotoxins and polycyclic aromatic hydrocarbons, included in PM2.5 that can elicit inflammatory responses. Streamer discharge treatment can reduce endotoxins, polycyclic aromatic hydrocarbons, and the subsequent inflammatory responses induced by PM2.5 in vitro. In Asian countries, atmospheric pollution in the form of particulate matter with an aerodynamic diameter of \u22642.5 \u00b5m (PM2.5) has become a major cause for concern . PreviouPM2.5-induced biological effects indeed vary depending on the origin of the particles, and such variations may be explained by the differences among the chemical constituents of PM based on the evaluated sites . Trace m\u201cStreamer discharge\u201d is a category of plasma discharge in which high-speed electrons collide with oxygen and nitrogen molecules that can cause the oxidative decomposition of bacteria and molds as well as chemical substances and allergens. With respect to the decomposition mechanism associated with streamer technology, a significant streamer discharge affects xenobiotics, decomposing their surface proteins and resulting in destruction through oxidation. The discharge range of the streamer is greater than that of standard plasma discharge (glow discharge). This technology can disseminate various active molecules, which have high oxidation activity generated by their contact with high-speed electrons. Upon reaction, streamer discharge breaks down organic substances into safe molecules, including water and carbon dioxide. Streamer discharge technology has indeed been previously shown to be effective in the inactivation of hazardous materials found in indoor air, such as cedar pollen, influenza virus, norovirus, and toxins and bacteria that can cause food poisoning ,14,15,16In the present study, we aimed to assess the potential improvement of atmospheric air pollution by streamer discharge to prevent PM2.5 from exerting adverse effects on human health. The inflammatory responses of airway epithelial cells and immunocompetent cells to PM2.5 samples collected under different conditions and the in vitro effects of streamer discharge treatment on inflammatory responses or oxidative stress were examined for the purposes of the present study.p < 0.01 for IL-6 at 7.5 \u03bcg/mL for PM2.5-Bangkok (Sep.\u2013Dec.) and 75 \u03bcg/mL for all PM2.5 and for IL-8 at 7.5 \u03bcg/mL for PM2.5-Bangkok (Sep.\u2013Dec.)/(Dec.\u2013Mar.) and 75 \u03bcg/mL for all PM2.5; P < 0.05 for IL-8 at 7.5 \u03bcg/mL for Taipei). On the other hand, PM2.5-Bangkok (Dec.\u2013Mar.) at a dose of 75 \u03bcg/mL induced reactive oxygen species (ROS) in BEAS-2B (p < 0.05 at 75 \u03bcg/mL for PM2.5-Bangkok (Dec.\u2013Mar.)), while no PM2.5 affected cell viability in these cells (PM2.5 was collected under four conditions (Bangkok (Sep.\u2013Dec.), Bangkok (Dec.\u2013Mar.), Singapore, and Taipei). All PM2.5 appeared to induce interleukin (IL)-6 and IL-8 production in a dose-dependent manner in BEAS-2B cells (se cells .p < 0.01 at 75 \u03bcg/mL for PM2.5-Bangkok (Sep.\u2013Dec.)/(Dec.\u2013Mar.)). Furthermore, all PM2.5 also activated cluster of differentiation (CD) 86 expression on the APCs and decreased cell viability in a dose-dependent manner , whereas PM2.5-Singapore reduced IL-8 significantly in BEAS-2B cells. Streamer discharge for PM2.5 did not affect induced ROS production by these particles (Streamer discharge for PM2.5-Bangkok (Sep.\u2013Dec.) at a dose of 75 \u03bcg/mL reduced IL-6 and IL-8 significantly (articles .p < 0.01), while it did not affect other parameters (Streamer discharge for PM2.5-Bangkok (Sep.\u2013Dec.) at a dose of 75 \u03bcg/mL significantly reduced IL-6  samples. Furthermore, the results of the thorough chemical composition analysis of the samples collected in Bangkok (Sep.\u2013Dec.) revealed reduced levels of PAHs and endotoxins in the streamer discharge-treated PM2.5 samples.The biological effects of PM2.5 samples collected in Asian countries have been previously extensively described in epidemiological reports. The severity of atmospheric pollution in Bangkok , Taipei Streamer-discharged PM2.5 at a dose of 75 \u00b5g/mL reduced IL-6 and IL-8 expression compared to non-treated PM2.5. Exposure to streamer-discharged PM2.5 did not significantly affect ROS production in BEAS-2B cells or CD86 expression and viability in APCs. Streamer-discharged PM2.5-Bangkok (Sep.\u2013Dec.) in particular exhibited a significant reduction in these inflammatory cytokines, although it did not affect ROS production by BEAS-2B cells. The reason why streamer-discharged PM2.5 did not significantly affect ROS production may be that PM2.5 Bangkok (Sep.\u2013Dec.) induced proinflammatory responses mainly through a mechanism not mediated by ROS. Therefore, streamer discharge treatment suppressed proinflammatory responses without changing the amount of ROS production. PM2.5-induced inflammatory cytokines could potentially activate ROS-independent NF-\u03baB activation. According to the above, (1) PM2.5 collected from Bangkok  can induce, at least partially, inflammatory cytokines from airway epithelial cells via an ROS-independent pathway and (2) streamer discharge for these PM2.5 could suppress the production through ROS-independent NF-\u03baB inactivation and/or other unexplored mechanisms. Additional studies targeting upstream of these cytokines are thus required.By contrast, a thorough study showed that streamer discharge reduced some compounds, such as endotoxins and PAH. Endotoxin is known to induce inflammatory cytokines, including IL-6 and IL-8. In previous studies, endotoxin has been thought to play an important role in particulate-induced inflammatory responses ,25,26. IPAHs and microbial components in particulate matter contribute to inflammatory responses ,29,30. TIn summary, exposure of airway epithelial cells and APCs to PM2.5 collected from several conditions assisted cellular damage and the activation of inflammatory responses. In addition, streamer discharge partially inhibited this effect. These results provide evidence that the collected PM2.5 elicits inflammatory responses, whereas streamer discharge suppresses the hazardous effects of PM2.5. In particular, streamer discharge can suppress the re-scattering of harmful substances from filters if introduced into the filters of air conditioning systems. Moreover, streamer discharge can improve the safety of workers when replacing the filter. However, further studies are still necessary to elucidate these benefits and to verify that streamer discharge can serve as a promising option for xenobiotic reduction technologies.PM2.5 collection was performed using a high-volume PM sampler, the virtual impactor, and the cyclone technique with no filter or extraction process . PM2.5 w2.The BEAS-2B cell line, which is derived from human bronchial epithelial cells and transformed by an adenovirus 12-SV40 hybrid virus and is not a cancerous phenotype, was purchased from the European Collection of Cell Cultures . Airway epithelial cells were seeded in 96-well or 12-well collagen I-coated plates and incubated for 72 h to reach semi-confluence in the serum-free medium LHC-9  at 37 \u00b0C in a humidified atmosphere with 5% COBone marrow-derived antigen-presenting cells (APCs) were prepared as follows. Ten-week-old SPF NC/NgaTndCrlj male mice were purchased from Charles River Japan . They were housed in an animal facility that was maintained at 24\u201326 \u00b0C with a 12-h light/dark cycle under conventional conditions. The procedures of all animal studies were approved by the Animal Research Committee at Kyoto University. Mice were sacrificed by cervical dislocation and exsanguinated from the cut abdominal aorta and vein. The red blood cells in the bone marrow were lysed with BD PharmLyse . APCs were differentiated using an R10 medium containing 20 ng/mL granulocyte\u2013macrophage colony-stimulating factor (GM-CSF). The differentiated APCs were centrifuged at 400\u00d7 g for 5 min at 20 \u00b0C and then resuspended in a fresh medium. The number of viable cells was determined by the trypan blue exclusion method.For treatment with streamer discharge, PM2.5 was placed 10 cm from the electrode in the chamber (520 mm \u00d7 520 mm \u00d7 430 mm) and was treated with active species generated by streamer discharge (5.6 kV \u00d7 55 \u03bcA) for 140 h. In the preliminary experiment, ambient PM2.5 collected from Japan was treated by streamer discharge for 48 h (2 days) and 184 h (approximately 7 days). Ambient PM2.5 significantly increased IL-6 release compared to the control (0 \u03bcg/mL) in BEAS-2B. Streamer discharge decreased IL-6 release in a time-dependent manner. Therefore, PM2.5 was treated by streamer discharge for 140 h in the present study.2DCFDA fluorescent probe, respectively.After airway epithelial cells were grown to semi-confluence in LHC-9; cells were exposed to PM2.5 at a dose of 7.5 or 75 \u03bcg/mL for 3 or 24 h. The cell viability, cytokine production, and ROS generation were examined through WST-1 assay, enzyme-linked immunosorbent assay (ELISA), and 5-(and-6)-chloromethyl-2\u2032,7\u2032-dichlorodihydrofluorescein diacetate, acetyl ester CM-HAPCs were exposed to PM2.5 at a dose of 7.5 or 75 \u03bcg/mL for 24 h. The cell viability and cytokine and cluster of differentiation (CD) 86 protein expression on the cell surface were evaluated by a fluorescence-activated cell sorter (FACS).After exposure to PM2.5 for 24 h, cell viability was assessed by the WST-1 assay using the Premix WST-1 Cell Proliferation Assay System . In brief, WST-1 reagent was added to each well of a 96-well plate and mixed well by gently rocking the plate. Airway epithelial cells and APCs were incubated with WST-1 reagent at 37 \u00b0C for 3 h and 30 min, respectively. After incubation, absorbance was measured on an iMarkMicroplate Absorbance Reader  at a wavelength of 450 nm with a reference wavelength of 630 nm. Results are expressed as the percentage of viable cells over the untreated cells.After exposure to PM2.5, the cell culture medium was harvested and centrifuged to remove floating cells. The final supernatants were stored at \u221280 \u00b0C until analysis. The levels of IL-6 and IL-8  in the culture medium were measured by ELISA according to the manufacturer\u2019s instructions. Absorbance was measured on an iMark Microplate Absorbance Reader at a wavelength of 450 nm with a reference wavelength of 550 nm. The detection limits of the IL-6 and IL-8 assay in airway epithelial cells were lower than 2.9 and 0.49 pg/mL, respectively. The detection limit of the IL-6 assay in APCs was lower than 6.6 pg/mL.2DCFDA fluorescent probe was employed to measure the intracellular reactive oxygen species (ROS) generation. The fluorescence intensity during 0\u20133 h  was then determined.For this assay, a CM-HFor Fluorescence-Activated Cell Sorting (FACS) analysis, the following monoclonal antibodies were used: Mouse BD Fc Block\u2122 purified anti-mouse CD16/CD32 (Becton Dickinson), CD86 , Rat IgG2a, and \u03ba Isotype Control . After exposure, the cells were resuspended in 50\u2009\u00b5L phosphate-buffered saline with 0.3% bovine serum albumin and 0.05% sodium azide  and incubated with 1\u2009\u00b5g of each antibody for 45\u2009min at 4\u2009\u00b0C. After incubation, cells were washed, and their fluorescence was measured using a FACSCalibur (Becton Dickinson). For each sample, fluorescence data from 10,000 cells were collected; positive cells were expressed as % events, or mean fluorescence intensity was calculated.Bangkok autumn and Bangkok winter PM2.5 samples were utilized in the presence and absence of streamer discharge treatment to examine the effects of the streamer discharge on PM2.5 components. According to the \u201cmeasurement manual for atmospheric particulate matter (PM2.5) components\u201d of the Ministry of the Environment, ion chromatography, Inductively-Coupled Plasma Mass Spectrometry (ICP/MS), thermal optical reflectance, and GS/MS methods were employed in order to quantify water-soluble ion components, metal components, carbon components (EC/OC), and PAHs, respectively, in PM2.5 samples. The levels of endotoxins as inflammatory substances of biological origin were also measured , Japan Environmental Sanitation Center , Sumika Chemical Analysis Service, Ltd. ).p-value lower than 0.05 indicated statistical significance.Data are presented as means \u00b1 standard deviation for each experimental group (n = 3\u20134). The significance of the variation among PM2.5-exposed groups and the 0 \u03bcg/mL group was examined using one-way ANOVA with the Dunnett multiple comparison test. The significance of variation between the streamer-discharged group and the non-treated group was examined using a two-way ANOVA analysis. Differences among groups were assessed using the Tukey multiple comparison test . A"}
+{"text": "Nailfold video-capillaroscopy (NVC) is an inexpensive method of assessing microcirculation. We reviewed the literature to assess whether changes to the nailfold capillaries exist in patients with cardiovascular disease (CVD).PubMed, Scopus and Cochrane Library databases for original research articles relating to the use of noninvasive microvascular assessment in patients with CVD. Methodological quality was assessed with the \u2018Quality Assessment Tool for Observational Cohort and Cross-sectional Studies.\u2019 The results obtained from NVC were analysed qualitatively and compared with other forms of microvascular assessment.We searched In total 2759 articles were screened, of which 22 studies involving 562 patients (~40% women) with CVD were included. Mean age ranged between 3.7\u201368.4\u2009years (cases) and 4.0\u201358.0\u2009years (controls). Reduced capillary density and increased capillary dimensions were seen in patients with pulmonary arterial hypertension (PAH). Among patients with systemic sclerosis, advanced scleroderma patterns can be used to identify patients with or at risk of developing PAH. Functional nailfold changes precede structural changes in patients with hypertension. However, the studies were heterogeneous in the diagnosis of disease and the measurement of nailfold parameters. Most studies did not exclude conditions with altered nailfold features, and only one study performed a power calculation. Furthermore, abnormal nailfold findings are present in patients without systemic disease.Structural and functional changes to the nailfold are a feature of established CVD and precede the development of PAH. However, heterogeneity in measurement and abnormal findings in healthy participants limit their use in the wider population. Resistance arteries are responsible for the perfusion of organs and tissues, as well as for maintaining peripheral vascular resistance . Small rSeveral means of assessing the microvasculature exist. Tissue perfusion may be assessed using a laser beam (laser-Doppler flowmetry and laser speckle contrast imaging) ,4 or infVideo-capillaroscopy is the visualisation of the capillaries ,8 often CVD is common in patients with connective tissue disease and represents a major cause of death. In people lacking traditional cardiovascular risk factors, atherosclerotic CVD was approximately three times as prevalent compared with control populations . HoweverThis review adhered to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses statement . We inclPubMed, Scopus and Cochrane Library databases for articles published until 14 January 2022. The following Medical Subject Headings terms were used: \u2018Microscopic Angioscopy\u2019 OR \u2018Thermography\u2019 OR \u2018Laser-Doppler Flowmetry\u2019 AND \u2018Cardiovascular Diseases\u2019. The results were entered into EndNote X9. The protocol has been registered on PROSPERO (CRD42021286490).A search was performed in Two independent reviewers (M.L. and D.S.) performed a literature search, data extraction and quality assessment. Disagreements were resolved by consensus or the involvement of a third reviewer (P.C.). Titles and abstracts were screened to identify eligible articles, which were retrieved and read in full. Reference lists from the selected articles were examined to identify additional articles.Data extracted included the name of the first author, publication year, study design, sample size, NVC measurement (site and nailfold parameters) and key findings. The results were entered into Microsoft Excel spreadsheets and analysed qualitatively. A meta-analysis was not performed as the studies were heterogenous in the diagnosis of CVD and measurement of nailfold parameters.To assess methodological quality, we used the National Institute of Health Quality Assessment Tool for Observational Cohort and Cross-Sectional Studies . This tohttp://links.lww.com/BPMJ/A182). The remaining 10 articles and an additional 12 articles identified from citation searching were included in this systematic review.The initial search identified 2948 records Fig. . After eThe studies were published from 1997 to 2021 and included a total of 562 patients with CVD . Mean ages ranged from 3.7 to 68.4\u2009years (cases) and 4.0 to 58.0\u2009years (controls) . Among t2 may also be measured [Capillary density is commonly defined as the number of distal capillary loops per mm Fig. a. The tomeasured \u201328. An ameasured . In addimeasured . All meaCapillary dimension is another important parameter Fig. a. CapillThe normal capillary is hairpin-shaped with a venous limb wider than the arterial limb Fig. a. MorphoUsing frame-to-frame analysis software, the flow of individual red blood cells can be visualised. From this recording, the speed of travel (red cell velocity) is calculated ,30. AlthNailfold changes were present across the spectrum of pre-capillary pulmonary hypertension Table . Three mIn four studies involving patients with idiopathic PAH \u201334, the et al. [P\u2009<\u20090.001), increased capillary width  and apical diameter . In addition, patients with idiopathic PAH had an increased number of avascular areas (P\u2009<\u20090.01) but the proportion of patients with at least one avascular area was similar. Two adjacent 1\u2009mm fields were observed in all fingers excluding the thumbs. The results agree with a previous study which showed reduced capillary density and increased apical diameter [In a study involving 14 patients with idiopathic PAH and 30 healthy controls, Arvanitaki et al. . reportediameter .et al. [r\u2009=\u2009\u22120.67; P\u2009\u2009=\u20090.001). However, capillary dimensions did not differ. The study design may explain the difference: capillary dimensions were calculated from the widest capillaries. Whereas in previous studies, measurements were taken from all the visible capillaries [In addition, Hosftee et al.  demonstrillaries ,32. Thiset al. reported reduced capillary density  and increased capillary width  in patients with Eisenmenger syndrome [N-terminal pro-brain natriuretic peptide .PAH is frequent in patients with congenital heart disease. In Eisenmenger syndrome, a left-to-right shunt leads to increased pulmonary vascular resistance and pulmonary artery pressure . Arvanitr\u2009=\u2009\u22120.58; P\u2009=\u20090.039) [et al. did not find any differences in capillary dimensions [Connective tissue disease, another major cause of PAH, has been investigated in eight studies. The diagnosis was confirmed by right heart catheterisation in five studies ,33,36,37r\u2009=\u20090.54, P\u2009<\u20090.005) [P\u2009<\u20090.05) [et al. found no associations between scleroderma patterns and PAH [n\u2009=\u20095) may explain the null findings.Abnormal morphology is a distinguishing feature of PAH secondary to connective tissue disease. Among patients with systemic sclerosis, those with PAH had advanced (active and late) scleroderma patterns ,36. Scle\u2009<\u20090.05) . However and PAH . The smaet al [Nailfold patterns may also be used to identify patients at risk of developing PAH. In a cohort study of 40 patients with systemic sclerosis, Voilliot et al . reporteet al .et al [P\u2009<\u20090.001) and increased capillary width . Patients also had nonspecific nailfold findings, which included thrombosis and ramifications.Nailfold findings have also been reported in patients with chronic thromboembolic pulmonary hypertension (CTEPH). In the same study by Arvanitaki et al ., patienP\u2009<\u20090.05; 0.98 vs. 1.17\u2009mm/s; P\u2009<\u20090.05). In two studies by Sern\u00e9 et al., patients with uncontrolled hypertension had reduced maximal [Five studies investigated nailfold changes in 146 patients with systemic hypertension Table . Capilla maximal  and perf maximal ,28 capilPatients with controlled hypertension had reduced baseline capillary density , a findiP\u2009=\u20090.026) with reduced venous limb diameter  [P\u2009<\u20090.05). No difference in capillary density or other capillary dimensions was reported. Patients with Beh\u00e7et\u2019s syndrome had dilated capillaries and haemorrhages, but do not display other morphological features [Three types of vasculitis were assessed Table . Patient=\u20090.049) . In addifeatures . Childrefeatures .P\u2009<\u20090.05) [P\u2009=\u20090.03) [P\u2009=\u20090.03) [Abnormal morphology was more commonly observed among patients with heart failure with a preserved ejection fraction compared to heart failure with a reduced ejection fraction or healthy controls (\u2009<\u20090.05) . Among p\u2009=\u20090.03)  or strat\u2009=\u20090.03) . Advance\u2009=\u20090.03) .http://links.lww.com/BPMJ/A182). Inter-rater agreement was 79% with a Cohen\u2019s kappa of 0.70 , suggesting substantial agreement. No study fulfilled the entire criteria. The study by Huang et al. was given a poor rating because the siblings of patients were used as healthy controls [The risk of bias was assessed using the Quality Assessment Tool for Observational Cohort and Cross-Sectional Studies  and a statistically significant increase in capillary width  among patients with PAH . In addiNailfold findings have been reported in other cardiometabolic disease. Tortuous and ramified capillaries are a feature of diabetes . PatientCapillaroscopy may be performed in the middle phalanges of the fingers. As the capillary loops are perpendicular to the skin surface, only capillary density can be measured. Patients with hypertension had reduced capillary density  that incSeveral mechanisms have been proposed to explain the microvascular changes observed in CVD Fig. . Tissue VEGF, along with cytokines interleukin-6 and tumour necrosis factor, leads to the mobilisation of endothelial progenitor cells (EPCs) . In the Given that the microcirculation, in particular the arterioles, are key in maintaining peripheral vascular resistance, the loss of capillaries and narrowing of existing capillaries may contribute to systemic and pulmonary hypertension . EndotheTissue perfusion may be affected by the physiological properties of red blood cells, which include fluctuations in membrane thickness (membrane deformity) and aggregation . InsultsIn addition, inflammation plays a role in endothelial dysfunction and the development of cardiovascular disease . Elevatehttp://links.lww.com/BPMJ/A182). Laser-Doppler flowmetry measures blood flow in terms of red cell flux, which is the product of capillary density and red cell velocity [The parameters obtained from microvascular assessments have been illustrated  in the title and abstract ,28,34,37Limitations of NVC should be addressed. The reduced capillary visibility in patients with dark skin pigmentation  means thDuring interpretation, nailfold images are compounded into a single mosaic, a process that is time-consuming and operator-dependent . These lAbnormal nailfold findings are present in patients with comorbidities and receiving different medications , and mayIn conclusion, NVC has been used across the spectrum of CVD. This assessment may detect microvascular changes present in patients with CVD and predict cardiovascular risk in patients with systemic sclerosis. However, heterogeneity in NVC measurement, along with abnormal findings in healthy patients without systemic disease and other limitations outlined in this review, poses a significant barrier to the implementation of this inexpensive technique in the wider population.The authors are grateful for the nailfold images taken by the Clinical Research Facility, Queen Elizabeth University Hospital .M.W.S.L. has been supported by the James Patterson Bursary, D.S. by the European Commission\u2019s Horizon 2020 Framework Programme (No 954798), and S.J.H.D., N.N.L., C.D. and P.J.C. by the British Heart Foundation Centre of Research Excellence Award (RE/18/6/34217).There are no conflicts of interest.Data supporting this research has been presented in the paper. For any further requests please contact the corresponding author."}
+{"text": "Visual disturbances are amongst the most commonly reported symptoms after a traumatic brain injury (TBI) despite vision testing being uncommon at initial clinical evaluation. TBI patients consistently present a wide range of visual complaints, including photophobia, double vision, blurred vision, and loss of vision which can detrimentally affect reading abilities, postural balance, and mobility. In most cases, especially in rural areas, visual disturbances of TBI would have to be diagnosed and assessed by primary care physicians, who lack the specialized training of optometry. Given that TBI patients have a restricted set of visual concerns, an opportunity exists to develop a screening protocol for specialized evaluation by optometrists\u2014one that a primary care physician could comfortably carry out and do so in a short time. Here, we designed a quick screening protocol that assesses the presence of core visual symptoms present post-TBI. The MOBIVIS  protocol takes on average 5 min to perform and is composed of only \u201chigh-yield\u201d tests that could be performed in the context of a primary care practice and questions most likely to reveal symptoms needing further vision care management. The composition of our proposed protocol and questionnaire are explained and discussed in light of existing protocols. Its potential impact and ability to shape a better collaboration and an integrative approach in the management of mild TBI (mTBI) patients is also discussed. Visual disturbances are amongst the most commonly reported symptoms after a traumatic brain injury (TBI)  as the most frequently occurring visual dysfunction in mTBI. A recent meta-analysis and systematic review on the occurrence of visual complaints after an mTBI reported a prevalence of 43.2% for accommodative dysfunction and 37.2% for convergence insufficiency  for the screening of TBI patients presenting visual sequelae. These resources are presented in The recurring nature of vision related TBI sequalae means that most resources presented a high degree of consistency and had similar procedures with only minor differences in the method of testing. The only two testing protocol designed using a standardized method mentioned above also presented high degree of similarity  , which was also the same gradation used by the COVD questionnaire. For the 28 items questionnaire, the BIVSS reports that a score of 45 and suggests significant visual disturbance related to TBI symptoms. Since our questionnaire is mostly based on the BIVSS while representing only a sixth of its length, a score of eight and above in our questionnaire could potentially be suggestive of a significant visual discomfort for TBI related symptoms. All questions must be asked specifically by the GP regarding changes perceived after the trauma to avoid registering symptoms that were present before the trauma.These questionnaires are relatively long with 28, 19, and 17 questions, respectively. They are detailed and require a degree of understanding and participation from the participant which makes them ideal for Q1. Binocular vision involvement is very frequent post-TBI and many patients may suffer from convergence insufficiency (CI)  or being disturbed in a moving or busy environments?Q5. While questions 1\u20134 had mostly a visuo-motor component, question 5 is primarily targeting the presence of photophobia, which is amongst the most prevalent symptoms post-TBI   and chronic (persistent after 3 months and even after a year) (Masel and DeWitt, While we have singled out GPs as the main users of this protocol, the quick and easy nature of its design makes it a very valuable tool to be used by any frontline health care professional in a wide variety of settings. This can include nurses and physicians' assistants and other health care providers likely involved in post-TBI rehabilitation such as physiotherapists and occupational therapists.comotio retinae (Pelletier et al., after their head injury. This can however be easily tested at the optometrist upon referral.Our quick protocol is, by design, limited to visual disturbances that arise following brain injury specifically. In some cases, head trauma can also happen in conjunction with ocular trauma, especially when the injury is close to the ocular globe and orbital region. In such cases, it is very important that a patient be referred to an optometrist for a dilated fundus exam regardless of their answers and results from our protocol as injury to the eye can cause severe complications such as angle recession, dislocated lens, secondary glaucoma or We specifically designed our protocol targeting mTBI for two reasons. First, because of their higher occurrence rate (Cassidy et al., Our protocol's ability to become a standard in the field rests on its usability and its sensitivity in referring TBI patients needing prompt vision care. To our knowledge, none of the protocol consulted in With the growing awareness of TBI impact on brain health, patients are likely to consult a health care physician with greater frequency. Our growing use of electronic devices, especially the overwhelming presence of screens and near work has made the visual disturbances of TBI even more disruptive to quality of life as they often lead to dropped productivity and increased frustration for the patient (Broshek et al., Conceptualization and writing\u2014review and editing: RAF and RF. Methodology, review of literature, data curation, and writing\u2014original draft preparation: RAF. Funding acquisition: RF. Both authors have read and agreed to the published version of the manuscript.This work was supported by a Canada Research Chair research stipend to RF.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Igeo), thecontamination factor (CF), and the pollution load index (PLI) to evaluateboth water and soil pollution geogenically or anthropogenically. Also,the metals were clustered to support the pollution source with Pearson\u2019scorrelation, principal component analysis (PCA), and hierarchicalcluster analysis (HCA). Forty-five natural water samples and 12 soilsamples were collected spatially. To perform pollution assessment,two fundamental treatment processes to remove Al pollution from thesample including the highest Al concentration (38.38 mg/L) in waterwere applied: (1) precipitation with pH adjustment and (2) removalwith ion exchange. The pH values of water samples were changed inthe range of 3\u20139 to test the dissolution of Al. The resultsdemonstrated that the study area was mostly under the influence ofgeogenic aluminum pollution.The \u00c7anakkale\u2013Kirazl\u0131 region (Turkey)is enrichedwith minerals, especially aluminum (Al), which dangerously get transportedinto aquatic media due to several mining and geological activitiesin recent years. In this study, Al and other potentially toxic metals(PTMs) including B, Ba, Cd, Co, Cr, Cu, Fe, Mn, Ni, Pb, Si, and Zn,in both water and soil samples, were measured for quality determination.Selected metals were also analyzed by the enrichment factor (EF),the geoaccumulation index ( Anthropogenic releases are in the form of air emissions,industrial effluents, and solid wastes. High aluminum concentrationin an aquifer due to low pH is caused by geogenic  and anthropogenicfactors. The latter are mostly acid mine or rock drainages processes,4 redundant alum usage, or lack of treatment of domestic and industrialwastes,6 but the former occurs naturally with interactionof water\u2013rock or geothermal fluid\u2013geological formation(rock), and are generally the main reason for the huge amount of Altransferred from the soil into natural water sources.9 The amount of aluminum in natural waters varies from 0.0001 to 1mg/L, and in acidic waters (pH < 5), the concentration of aluminummay even exceed 100 mg/L. Aluminum compounds show low solubility inthe pH range of 6\u20138; therefore, in surface water and groundwater,the concentrations of aluminum are in the range of 0.060\u20130.30mg/L.10Aluminum (Al) is the thirdmost abundant element in the earth\u2019scrust, comprising about 8.8% by weight (88 g/kg), and occurs naturallyin combination with oxides and silicate minerals. Clays and othersecondary minerals range from 45% A1 for boehmite to 3% A1 for glauconite.Of the sedimentary rocks, shales generally have the highest contentof A1 (7.8\u20138.2%), followed by sandstones (2.5\u20134.2%)and carbonates (0.4\u20131.3%).12 Al species tend to be soluble and form ligands with inorganic andorganic matters at pH below 5 in natural waters by acid rain or acidmine tailings or at pH above 8.1 Mobilityand transport of Al ions into the water change with the generatedsulfate concentration by oxidation of sulfureous soil minerals, thecomposition of the geological materials, the coordination chemistry,and the flow of water in acidic environments, which is influencedby especially troublesome phenomena such as acid mine drainage (AMD).13 Mining activities result in many metals gettingmobilized and reacting with water and the atmosphere from the surroundingrock, causing exposition and reaction of the pyrite mineral, whichform a solid metal hydroxide complexation and decrease the pH by sulfuricacid production, thereby increasing the toxic metal concentrationsin aquatic media.14 Because of the obtained highsolubilization capacity, the concentration of Al found in these waterscan reach up to 90 mg/L.15 Al is becominga major contributor to environmental problems, not only causing diseases,illnesses, and disorders  but also entering the food chain owing to its bioaccumulative andnonbiodegradable properties;20 hence, it has to beremoved from wastewaters in related facilities properly. The UnitedStates Environmental Protection Agency (USEPA) and the World HealthOrganization have maximum allowable aluminum concentrations of 0.05\u20130.2and 0.20 mg/L in drinking water, respectively.21 Potentially toxic metals (PTMs), especially heavy metals, are currentlyremoved using many water treatment methods such as coagulation\u2013flocculation,22 electrocoagulation,24 ion exchange,26 adsorption,29 and membraneprocesses.31Interaction between rockand water, including Al solubility andspeciation, is supported by the acidic pH values and affects the qualityof drinking water as well as the environment it reaches.35 For instance, the heavy metalcontamination of groundwater resources in the Bafra Plain was evaluatedconsidering geostatistical and ordinary kriging approaches.36 The authors reported that the Al, As, Fe, andMn concentrations were above the levels permissible for drinking waters,with a considerably high heavy metal pollution index of 21.97%. Ina separate study, an assessment of the health risk and ecotoxicologicalparameters was conducted considering potentially toxic elements  in sediments for somerivers of Giresun, especially located in hazelnut production areas.37 Al and Fe were the dominant elements in sediments,with high concentrations compared with other metals, and Al concentrationswere in the range of 27\u202f869\u201345\u202f060 mg/kg. Onthe other hand, the contaminant factor (CF) of Al with 0.5 revealedthat the Al in all sediment samples causes a low level of contamination(CF < 1). In addition, the health risk assessment results showedthat the hazard index (HI) values of elements were ranked in the followingorder: Fe > Co > As > Al > Pb > Cr > U > Mn >Cu > Ni > Cd > Zn. Overall,there was no significant noncarcinogenic toxicity of selected elementsas HI values were less than 1. The contaminant levels of heavy metalsin a subtropical river basin system of Giresun were also studied byUstao\u011flu and Ayd\u0131n.38 It wasreported that the contamination level of Al (267 \u03bcg/L) in theriver was considerably above the WHO permissible levels (200 \u03bcg/L).Moreover, the Nemerow pollution index, which presents individual informationtaking standard values into consideration about the contaminationdegree of pollutants as well as focuses on key pollutants, was determinedfor all heavy metals, and the values were in the range of 0\u20131.43.These results revealed that only Al metal had a significant impacton heavy metal load in all river samples. The principal source ofmetals in rivers may thus be lithological, with no significant anthropogenicheavy metal pollution. In the Melet River , which issurrounded by agricultural fields, heavy metal concentrations mostprobably originating from agricultural residues, mining activities,and household residues were determined in water and sediments.39 The heavy metal concentrations were reportedin the following order: Fe > Al > Mn > As > Zn > Cu> Ni > Cr > Cd= Pb = C and Fe > Al > Mn > Zn > Cu > Pb > Cr >As > Co > Ni > Cdin water and sediment media, respectively. Similar to the previousstudies performed in the Giresun rivers, Al and Fe were found to bethe most dominant metals in the Ordu river sediment and water samples.Furthermore, the spatial-temporal pollution indices and distributionof heavy metals in Ordu at the Turnasuyu stream sediment were assessedsystematically by considering seasonal samples from various sites.40 As expected, average concentrations of 15\u202f080and 6416 mg/kg were observed for Fe and Al elements, respectively.Furthermore, the calculated mean geoaccumulation index values of \u22124.23for Al and \u22122.23 for Fe revealed that the sediment sampleswere unpolluted with Al and Fe and there was no environmental risk.In most of these reviewed studies, specific research on aluminum contaminationsin soil, sediment, and water environments is insufficient. Furthermore,studies on environmental risk assessment considering Al are limited,according to our humble opinion. Therefore, there is a crucial needfor a comprehensive study on the assessment of environmental risksof Al pollution as well as monitoring of Al contamination in waterand soil media.To date, several studieshave been conducted on heavy metal contaminationin the soil, sediment, and water in Turkey.Igeo), contamination factor (CF),and pollution load index (PLI) on the samples collected from Kirazli,\u00c7anakkale. Additionally, correlation of the metals with thesource was owing to multivariate analyses , and hierarchical cluster analysis(HCA)). Finally, two economically feasible removal methods were appliedto remove Al: pH adjustment and ion exchange.Although geogenic Al pollution has been seenin different regionsof Turkey, this study attempts to determine potentially toxic metal(PTM) pollution in both natural waters and soils and assess the sourceof the pollution using the enrichment factor (EF), geoaccumulationindex \u2013zinc (Zn)\u2013copper (Cu) and gold(Au) metal deposits and industrial minerals such as clay (Al2O3\u00b72SiO2\u00b72H2O), coal,and kaolinite (Al2Si2O5(OH)4) have been identified.42The study area of 1115.3kmprovince 1.Kirazl43In \u00c7anakkale, Biga and some nearby towns are known for having a total of 204 metallic mineral deposits,and the most important ones are Cu, Pb, Zn, antimony (Sb), and gold(Au) reserves. Volcanic units at Kirazl\u0131 belong to the Mioceneage, which host alternating zones and precious metal mineralizationand contain feldspar, mafic minerals, and some quartz. The enrichmentof metals is Al + K in the argillic and Mg + Ca + Fe in the propyliticalteration types. Moreover, two Au mineral deposit reserve placesare found\u2014Kartal Dag and Maden Dag\u2014and deposits of Feand Mn also have found been as small mass reserves. Environmentalchanges (causing geogenic interaction between soil and water) affectthe enrichment and leaching of metals; for example, Ca, Mg, and Fewere leached during argillic alteration, whereas strong Na leachingis evident in all alteration types.41 Generally, the main alluvial aquifers in theregion serve as the main water resources.41 As seen in 44 X and Y in 42The hydrogeology of the Kirazl\u0131 region generally comprisesvolcanic units. Most of the springs in the study area are betweenthe silicified zone and the argillic zone. Several springs surfacefrom volcanic soils such as tuff and agglomerate in the Biga Peninsula.These springs have flow rates between 0.01 and 3 L/s. In the region\u00c7anakkale and Koca streams discharge into the Atikhisar Reservoir,which serves the water supply system of \u00c7anakkale city.2.2n = 3, nos.:W11 (dam water), W2, and W32 (stream water)) and groundwater ,were collected in polyethylene bottles (500 mL), with the followingsampling and analytical procedure carried out using the Standard Methodsfor the Examination of Water and Wastewater.45 Electrical conductivity (EC), total dissolved solid (TDS), dissolvedoxygen (DO), and pH were measured on-site. Additionally, total alkalinity,sulfate ion (SO42\u2013), and metal analysiswere conducted at the laboratory of the Environmental EngineeringDepartment of Gebze Technical University. The metals investigatedwithin the scope of this study were selected by taking into accountthe metals and metalloids in the soil and water samples as a resultof the preliminary analysis by an inductively coupled plasma-opticalemission spectrophotometer .As a result of the preanalysis, metals such as As, Cr, Hg, and V werenot detected in the samples; therefore, these metals were not consideredin the study. Consequently, total concentrations of 15 metals  were analyzedby ICP-OES.Samplinglocations were determined with the help of GPS coordinates (GARMINGPS eTrex 30x) surrounding Kirazl\u0131 village. Water and soil sampleswere collected during the dry season .Water samples, including surface water (n = 12 S1\u2013S12) and collectedinto polyethylene bags. All samples were transferred to the laboratoryand stored at 4 \u00b0C. Before being ground to <100 \u03bcm witha mortar, the soil samples were dried at 105 \u00b1 2 \u00b0C for48 h. Then, 0.25 g of sample was exposed to 2 mL of HNO3, 2 mL of HF, 1 mL of HCl, and 1 mL of H2O2 in Teflon vessels for 24 min and digested in a model Milestone Ethos1600 advanced microwave digestion apparatus. Then, each digestatewas diluted to 50 mL with ultrapure water, and the resulting solutionwas analyzed for the 15 metals with the water samples by ICP-OES.All reagents used were of analytical grade. X-ray diffraction  was applied for mineralogical identificationson randomly collected soil samples. The identification was also supportedby scanning electron microscopy equipped with energy-dispersive X-ray spectroscopy .Each of the surface soil samples (\u223c500 g)was collected from close to the springs at 0\u201310 cm (upper soillayer) soil samples  of the data set were calculated to determinethe coefficient  variation ofsampling locations. The statistical analysis was performed by SPSS using the Pearson correlation coefficient matrix,principal component analysis (PCA), and hierarchical cluster analysis(HCA) to show the correlation between elements and physicochemicalparameters to assess pollution origin.2.42.4.146 It helps determine whether the pollution sourceis anthropogenic or geogenic.47 It is calculatedusing 48 This metal can be a reference or backgroundmaterial because it is also an abundant metal on the earth, it hasno outlier, and it was normally distributed, as obtained by the normalitytest and Box\u2013Whisker plots.5051EF was computedto assess the type and degree of PTM pollution in the studied soils.2.4.252 Itis widely used in defining river sediment quality in studies, butthis index is also preferred to express metal pollution in soils.54nC is the current metal (n) concentration in the soil and Bn is the geochemical background value (BGV) of the metal inthe sample. The factor 1.5 is the coefficient for the background matrixcoming from geogenic variations. Igeo wascategorized into six classes:52 <0:unpolluted; 0\u20131: unpolluted to moderately polluted; 1\u20132:moderately polluted; 2\u20133: moderately to strongly polluted;3\u20134: strongly polluted; 4\u20135: strongly to extremely polluted;and >5: extremely polluted.The metal pollution index is a measure ofsoil quality by evaluating single substances. It was introduced byM\u00fcller to evaluate the measured metal concentrations by comparingpreindustrial levels in sediments.2.4.355 It is calculated as shown in CMe is the metal concentration in the soil and Cn is the geochemical background concentrationof the metal. This factor is defined using four classifications: CF< 1: low contamination; 1 \u2264 CF < 3: moderate contamination;3 \u2264 CF < 6: considerable contamination; and CF > 6: veryhigh contamination.56 In n is the number of metalspossibly toxic to the site. When PLI < 1, it means that the backgroundand raw data are similar and there is no pollution, and when PLI >1, it indicates pollution by the metals analyzed.CF is used for determining toxic metal pollutionin soils.3The resultsof the study are submitted in four parts. The firsttwo parts are about determination of PTMs and the physicochemicalparameters in water samples. The third part is determination of thesoil quality, and the fourth part presents the efficiency of Al removalby precipitation and ion-exchange methods. Additionally, the secondand third parts evaluate the pollution source of PTMs.3.157 Turkish Drinking Water Quality Standards (TDWQS)58 with A1\u2013A3 classes, and Turkish regulationon waters for human consumption (WHC).59 In TDWQS, classes A1, A2, and A3 represent, respectively, waterthat becomes high-quality potable raw water after simple physicaltreatment and disinfection; slightly polluted water that becomes potableafter physical treatment, chemical treatment, and disinfection; andpoor-quality water that becomes potable after physical treatment,chemical treatment, advanced treatment, and disinfection. WHC explainswater is hygienically and technically suitable for drinking by humans.The pH of the water samples ranged between 3.33 and 9.92, with anaverage of 6.03; the maximum pH was at W6 and the minimum was at W41.The physicochemical parameters  and metal concentrations measured from analysis of watersamples are shown in 11 or human beings. The water temperature differed between 14 and 20.4\u00b0C, which affects the availability of inorganic constituents(PTMs) and the growth of microorganisms.57 There is no information about EC to compare the measured valuesin the water, and it was on average 593.3 \u03bcS/cm, with the maximumat the W22 and the minimum at the W4 sampling site. TDS was mostlyin classes I and II range with a mean concentration of approximately294.2 mg/L. DO levels ranged from 4.21 to 10.17 mg/L; the lowest DOlevel was from well number W1 close to \u00c7iftlikdere. Sulfateions fluctuated from 16.68 to 567.40 mg/L, with the average valuebeing 130.4 mg/L. The high values of the ions might be due to thepollution caused by acidic mining drainage and soil weathering.60 Ba, Cd, Cr, Cu, and Pb metals were within thetoxic limits of TWQS, WHC, and WHO. Some metals such as Co, Fe, Mg,Mn, Si, and Zn have no limit of concentration defined by WHO; however,these metals should be monitored in drinking waters since these metalsact as indicators for pollution before water treatment becomes obligatory.On the other hand, B may be in the suitable range for drinking, butit is an indication of anthropogenic pollution. Because in previousstudies63 B was not determined in soil or rock analysis, whileAl, Mg, Mn, Fe, and Si were found, it can be said that the metal presencecomes from human activities.It is recommended by TDWQS (class A1) and the WHOthat the pH shouldbe within 6.5\u20139.5, but according to the mean value of the pH,this sampling site was found to be acidic in nature. Acidic watersdissolve chemical constituents, affect the transport of toxic elementsin water, and might harm aquatic organisms3.23.2.1Pearson\u2019scorrelation was studied to investigate the association between PTMsand physicochemical parameters 2. Kirazl42\u2013 (0.668), and naturally found metals in waters, such as Ca (0.855)and Mg (0.478). Both TDS and EC are closely related to the numberof ions present in the water,64 and itis supported by the Pearson correlation. Al has significant positivecorrelations with Si (0.508), Zn (0.475), Mn (0.428), and SO42\u2013 (0.345). SO42\u2013 hascorrelation nearly with all variables such as Mn (0.534), Ca (0.479),Si (0.412), Zn (0.369), B (0.373), and Al (0.345) besides DO, Fe,Mg, Co, and Ni. The presence of SO42\u2013 in groundwater and surface water samples is geogenically due topyrite oxidation, which occurs mostly from the soil weathering processby AMD, and this ion can be used as an indicator.60The results indicate that they all mostly have positivecorrelationsbetween each other. While TDS represents dissolved ions and is mostlyrelated to the aquifer rock geochemistry, it is strongly possibleto have a direct correlation with EC (1.000), SO3.2.2Table S1 in the Supporting Information, and the HCA dendrogramis presented in 42\u2013;as PTMs\u2014Mn, B, K, Al, Ca, Mg, Si, Co, Ni, and Zn, to clustergroups of samples with similar characteristics. In HCA, the variableswere combined using different methods. The best dendrogram was obtainedusing the Pearson correlation with the between-group linkage method.PCA is a method offactor analysis, and it was applied to concentrations of PTMs andphysiochemical parameters of water samples for presenting how spatialvariations in water chemistry can be interpreted in terms of waterhydrogeology. The application of PCA and HCA to water samples formultivariate association between these factors has been successful.The PCA technique for water samples is shown in 42\u2013 (0.651), Mg (0.625), and B (0.529). The second HCAcomprised Mn, Al, Si, and Zn, which correlated with PC2, and had highpositive loadings of 0.843, 0.772, 0.725, and 0.666, respectively,and a considerable percentage of 20.5% of the total variance in thedata set. PC3 explained 10.6% of the total variance and 1.484 of theeigenvalues and gave an inverse relationship between Fe (0.696) andDO (0.776), which is possible in groundwater because Fe dissolvesunder a smaller amount of oxygen. In this case, this relationshipcan also be attributed to the fact that the acidity in the water increasedand there was Fe dissolution as a result of organic acid formation.60 The variables that highly loaded in the fourthcluster and PC4 were Co (0.843) and Ni (0.744), and the percent contributionof PC4 to the total variance was 10.6%. The variables in PC1\u2013PC3are mostly due to natural occurrences, implying that the pollutionsource is lithogenic in nature, which is contributed by acidic miningdrainage. However, no geologic sources of boron (B), cobalt (Co),and nickel (Ni) elements were found in general in Kirazl\u0131 andits surroundings, but \u00c7an basin coals used in the \u00c7anthermal power plant were found to possess the hazardous trace elementscobalt,65 boron, and nickel,66 which indicates that their presence might bedue to anthropogenic pollution.The first cluster group in HCA that was correlatedwith PC1 had28.1% total variance, 3.939 of the eigenvalue, and strong positiveloadings for EC (0.949), TDS (0.949), Ca (0.905), SO3.33.3.167 BGV is significant for geochemical data in distinguishingsite-related contamination and giving the baseline concentration forthe sampling location. In this study, it was calculated by a normalitytest (Shapiro\u2013Wilk), which helps understand whether the PTMsshow a normal, logarithmically normal, or skewed distribution. Beforeapplying the normality test, outliers were determined by Box\u2013Whiskerplots and removed from the raw data. BGV was an arithmetic mean (M) if the data were normally distributed, a geometric mean(GM) if the data were distributed logarithmically, or a median ifthe data showed a skewed distribution. Standard deviation (SD) waschanged to the geometric standard deviation (GSD) in a logarithmicallydistributed data set to define a range. Mean* (M*)and SD* refer to values computed after eliminating the extreme values.68The determinationof environmental background values (BGVs) is necessary to evaluatePTM pollution in all soils because they represent the PTM concentrationin soil, unaltered by human activity (preanthropogenic level).69 measured some of the HMs in Chinese soil and found theirconcentration as follows: Co, 12.7 mg/kg; Ni, 26.9 mg/kg; and Zn,74.2 mg/kg. In our study, the Co concentration was 14.2 mg/kg andthe Zn concentration was 79.4 mg/kg, while their detected levels weremuch lower. Wilcke et al.54 studied 30different Bangkok topsoils (0\u20135 cm) from young deposits ofnear-pristine materials. The average concentrations of Al and HMswere below our BGVs, except for Ni and Zn  has the highest EF for Ba (47.43) and the second highest EF forNi (6.15); this can be attributed to the high concentrations of Baand Ni caused by mining tailings via groundwater flows, and its effectivenessdecreases on moving toward the dam. Al showed generally minor anthropogenicpollution. The second highest EF was calculated for S1 (taken fromthe stream connected to the At\u0131khisar Dam) as 45.91 for Ni,indicating very severe enrichment, and additionally, EFs for B andMn were estimated as 4.44 and 3.07, respectively (Table S2). The EF values of PTMs were in good agreement withthe previous studies performed in the soil of this region.72 However, in some sampling points, while soil samples were withinthe limits of pollution indices , Al in water samples demonstratedhigh concentrations. Hence, in the sampling points that showed lowEF values in the soil and high Al concentrations in water samples,the pollution source for Al was determined to be lithogenic-based.For instance, S2, S4, S6, S9, and S11 had minor pollution, but inthe same points, W32, W12, W14, W42, and W45 had 10.05, 8.12, 2.48,2.04, and 7.70 mg/L Al concentrations, respectively. These samplingpoints were located around the mining site. This implies that themineral containing this metal dissolved and leached away during minesearching processes in the bedrock and passed from the soil to thegroundwater by dissolving Al. On the other hand, in the region ofsamples with both high EF value in soil and high Al concentrationin water, it was concluded that the source of pollution was not onlylithogenic but also anthropogenic. These samples were S15 (EFAl = 1.8), W18 (11.54 mg/L), and S17 (EFAl = 2.45)\u2013 W20 (2.60 mg/L). Regarding the high EF values (>1.5),Mnand Ni enrichment in S1 and S2, B and Ni enrichment in S3 and S8,and Co and Zn enrichment in S8 and S10 because of human-induced activitieswere deduced. Nevertheless, to confirm that PTMs in sampling locationswere contributed by not anthropogenic but geogenic activities, othersoil contamination indices, which are Igeo, CF, and PLI, were calculated and discussed.Three soil pollution indices  were applied to normalizethe soil pollution concentration of PTMs see 4. EF is Table S3 shows that Igeo values classified almost all PTMs as unpollutedbyhuman activities. It varied from \u22122.08 to 0.88 with a meanvalue of \u22120.62 for Al, \u22121.51 to 1.64 with a mean valueof \u22120.01 for B, \u22121.45 to \u22120.08 with a mean valueof \u22120.65 for Co, \u22121.73 to 0.13 with a mean value of\u22120.66 for Fe, \u22122.49 to 1.04 with a mean value of \u22120.58for Mn, \u22122.24 to 4.84 with a mean value of 0.48 for Ni, and\u22123.11 to 0.87 with a mean value of \u22120.64 for Zn (Table S3). The average values of Igeo are on the order of Fe < Co < Zn < Al <Mn < B < Ni. It supports the site\u2019s pollution sourceas either geogenic- or pedogenic-based (Igeo < 0) mostly, which is similar to the conclusion obtained withEF. In other words, if Igeo is lower than0, the pollution is caused by soil weathering.73 As seen in Table S3, Ni showedthe relatively highest Igeo values forS1  and S2 . Besides Ni, B has the highest artificiallydeposited pollutant and was recorded in S1, S3, S5, and S6 collectedlocations.Table S4). Also, 50% of the points was determined as pollutedwith respect to PLI, 42% of the points was observed as moderatelypolluted, while 6% was polluted to a considerable level. Due to PLI,S1\u2013S3, S6, S8, S10, and S12 were found to be polluted. It wascontributed by CF, which presented the common metals for contamination,such as Al, Ni, and Zn.CF was also considered for assessing the soil pollutionby metalsin each of the sampling sites with PLI. These indices are commonlyused to normalize the metal concentrations. Extreme contaminationof Ni in S1 and S2 points was also confirmed by CF and PLI values,which amounted to 43.07 and 8.71, respectively . The Pearson correlationshowed positively strong relations between Ni and Ca (0.950), Na andSi (0.752), and Na and Mg (0.63). Since there are just four componentswith respect to the PCA techniques (Table S5), the Pearson correlation supported the fact that the analyses perfectlymatched each other. The PCs accounted for 90.8% of the total variancein the data set. Si, Na, and Mg were clustered as PC1 had 32.5% ofthe total variance and had strong positive loadings. These analysesalso evidence that these metals were naturally found in the soil.For instance, as seen in Figure S2a,b,S1 possesses them as in montmorillonite minerals. XRD analysis showedthe minerals, in Table S6, for each soilsample (S1\u2013S12). PC2 also had positively strong loadings betweenNi (0.953) and Ca (0.953). PC3 had a considerable proportion of 15.4of total variance and had strong loading for Fe (0.977), while PC4represented 13.3% of the total variance for Al (0.934). While bothFe and Al are abundant metals found as minerals in the soil of theregion such as montmorillonite, gismondine, nontronite, and kaolinite,they were clustered as independent variables and associated with allmetal groups.Pearson correlation, PCA,and HCA analyses were carried out on the soil data set taking intoconsideration the variables  Al, Ca, Fe, Mg, Na, Ni,and Si to highlight that these metals were originally in the soil. According to this, due to the proximity of thesamples and the similarity of the features, the Al concentrationsof W32 and W33 were due to to acidic mining drainage. Hence, bothW32 (10.05 mg/L) and W33 (16.26) had high Al concentrations, whichwas also contributed by S2 .Due to these metals being lithogenically presentin the soil matrix, the metal pollution was assumed to be caused geogenically,for instance, soil weathering or acidic mining drainage.3.4Acidic natural ground or spring waters withhigh Al concentrations eventually merge into receiving water sources. Al concentrations will decreasein these water sources due to dilution and precipitation reactions.However, these natural waters with high Al concentration and low pHin the Kirazl\u0131 region of Northwestern Turkey are used in ruralsettlements for the purpose of irrigation of fruits and vegetables,sometimes for domestic purposes, and also as drinking water by animalssuch as cattle and sheep. In addition, these natural water resourceshave decreased due to global climate change, so spring waters in thesesettlements have become important. Therefore, it may be possible touse them when Al is removed from these waters.76 Especially, adsorption has emerged as the most efficient techniquedue to its simplicity of application, environmentally friendly nature,and low cost. Various adsorbents, such as granular activated carbon,5 magnetic iron oxide nanoparticles,77 iron-modified carbons,78 natural zeolite,79 and carbon nanotubes,80 have been utilized for Al removal in waters.However, these adsorbents have the disadvantages of relatively lowadsorption capacity, regeneration difficulties, disposal of precipitatedwastes, and requirement of a long operation time, hence limiting theirreal-scale practical applications.79 Alremoval techniques like sedimentation, electrolysis, membrane processes,and filtering are also moderately effective, complex, and expensive.81 On the other hand, precipitation with pH adjustmentand ion exchange are promising methods for Al removal consideringtheir ease of application, relatively low costs, and considerablyhigh removal efficiencies.5 Namely, byadjusting the pH to an alkaline level with the help of calcium carbonateand lime, Al from acidic effluents can often be removed from the waterby forming an insoluble precipitate.82 Furthermore,the removal of heavy metals in waters using an ion-exchange processwith different synthetic or natural resins is one of the most promisingmethods owing to its features of easily recoverable end-products,the possibility of reuse after the regeneration step, and effectiveness.Heavy metal removal by various ion-exchange resins has been examinedby many previous studies.84 However, there is noavailable research on the removal of Al from real water resources.86 Moreover, the Al removal performance of the ion-exchange processin the presence of various metals has not been investigated adequately.To the best of our knowledge, the use of ion-exchange resins for Alremoval in real wastewater or waters is also very limited. There areonly two studies in the literature discussing Al removal by the ion-exchangeprocess from water resources.88 Use of the ion-exchangeprocess for Al-containing real water treatment is challenging dueto the high variability of electrical conductivity, pH, and competitionbetween ions. Overall, the originality of this paper lies in investigatingthe selective removal of Al by the Amberlite IR-120H resin and pHadjustment from real groundwater resources in the presence of otherions.Various advancedchemical and physical treatment techniques, such as adsorption withnanomaterials, chemical precipitation, electrolysis, ion exchange,membrane processes, biological methods, and hybrid processes, havebeen used to eliminate Al from water resources.3(s). At pH values below 3.5, the Al ion is thepredominant species. Monomeric and polymeric Al species such as Aln(OH)nn)+(3\u2013: Al(OH)2+, Al(OH)2+, Al(OH)4\u2013, Al6(OH)153+, Al7(OH)174+, Al8(OH)204+, Al13(OH)345+, and Al(OH)3(s) are formedin solution between pH 3.5 and 14.89 Thesolubility product of Al hydroxide, Al(OH)3(s), is Ksp 1.9 \u00d7 10\u201333 at 25\u00b0C. The pH of minimum solubility of the solid Al(OH)3(s) is about 5.0\u20136.5, and the total soluble Al3+ concentrationis (3 \u00d7 10\u20136) to (3 \u00d7 10\u20134) M (or 0.025\u20132.5 mg/L) between pH 5 and 9.According to the results of the Al pollution detectionstudy carriedout in the study area, the removal results were evaluated by applyingprecipitation with pH adjustment and treatment with the ion-exchangeprocess on the W33 and W39 samples with the highest Al concentration.The results of Al removal by adjusting the pH are shown in The results obtained from W33 (pH 3.59) and W39(pH 3.54) for Alremoval using different ion-exchange resin amounts are shown in Overall, these results clearlyshowed that pH adjustment only didnot work in the case of high Al contamination and relatively low removalwas achieved when compared with the ion-exchange-resin Al removalperformance. In addition, making a continuous pH adjustment to increasethe Al removal efficiency will also increase the operating cost considerably.Similarly, when Al removal is performed using only an ion-exchangemethod, although high Al removal efficiencies are achieved, the resinlifetime ends in a short time, creating a serious problem in realapplications. Therefore, these results revealed that the environmentallymost compatible and cost-effective solutions include a combinationof pH adjustment and ion-exchange process. Furthermore, although thescale of the processes in some of these situations is comparativelysmall, as in the case of rare-earth components or noble metals, theutility of the recovered metals is extremely great. The ion-exchangeprocess is especially appropriate for separation of metal ions witha low handling and high value. Ion-exchange procedures are widelyused in hydrometallurgy, and their use is increasing yearly.4This study offers a multivariatesimultaneous statistical evaluationof PTMs and physicochemical parameters using PCA and HCA classificationto assess the water and soil quality of Kirazl\u0131 and the villagesof \u00c7anakkale. The impacts of geogenic and anthropogenic sourceson various parameters were investigated in short-term observationmonitoring data. Promising basic treatment processes were experimentedto remove Al pollution in highly polluted waters. Hence, simple traditionalmethods can be implemented at lower costs in villages where thereis mining activity, affording safe water supply for animals or agriculturalirrigation."}
+{"text": "Combining games with mobile commerce applications has been a trend in recent years. Mobile commerce is attracting a large number of people, especially females, to play mini games on the platform. The gamification of mobile commerce may affect users\u2019 platform satisfaction. This study aims to explore the intention of female users to play mobile commerce games and its impact on platform satisfaction. We collected data from females in China who played mobile commerce games and then used a structural equation model to test the various hypotheses we made. The results showed that game use intention fully mediated the impact of performance expectation, hedonic motivation, and social influence on platform satisfaction. Effort expectation had no significant impact on game use intention but had a positive impact on platform satisfaction. Game use intention had a positive impact on platform satisfaction. The frequency of playing games and the amount of money spent on the platform were positively correlated with game use intention. Females over 25\u2009years old preferred to play mobile commerce games. This study provides a theoretical reference and practical enlightenment and makes a specific contribution to the development of mobile commerce platform and the application of gamification. However, this study has limitations in terms of test samples, research methods and research content, and further research on mobile commerce is required in the future. As a universal form of entertainment, games are a part of people\u2019s daily life. With the rise of the Internet, the channels and ways of playing games have become more diversified to meet the different game needs of people. According to the annual report on mobile apps/games from In recent years, the use of games as tools in non-game scenes has become increasingly common. Mobile commerce (m-commerce) has been a mature business phenomenon for a long time, and the marketing community is using gamification to improve customer retention and sales growth. Mini games, such as solving puzzles, keeping virtual pets, and planting virtual trees, have become mainstream games for m-commerce applications. Ant Forest is a green, low-carbon public welfare game launched by Alipay. Virtual energy created by players\u2019 green lifestyle  is used to raise virtual trees. From 2016 to 2020, the number of participants in Ant Forest grew to more than 550 million, and more than 223 million virtual trees were transformed from Ant Forest and public welfare partners into real trees in desert areas . With 85According to a Baidu game user insight report from In this study, the carriers of the games are m-commerce platforms and such game players themselves are the consumer groups of mobile Internet. There is a lot of literature on satisfaction and behavioral intention. For example, Although there have been previous studies on female users, game use intention, and platform satisfaction, no scholars have closely linked these three aspects to discuss the reasons females play m-commerce games and their impact on platform satisfaction. This study believes that it is necessary to carry out detailed research on this comprehensive correlation issue and comprehensively explain the reasons and relations. The main questions this paper addresses are: (1) Why do females play m-commerce games from the perspective of UTAUT2 theory? (2) What is the impact of female willingness to play m-commerce games on platform satisfaction? (3) How can the game use intention and platform satisfaction of female users be further improved through UTAUT2 theory? (4) Are there differences in behavioral intentions among m-commerce game players with different basic demographic characteristics? On the basis of UTAUT2 theory and the concept of satisfaction, this study attempts to establish a research model of females playing m-commerce games.Games have been an integral part of human activities since time immemorial. Playing games is not only a pleasant pastime but also a social activity. The game use intention in this study refers to the willingness to play m-commerce games. These games are relatively simple and usually do not need mastering difficult game skills or meeting arduous challenges. The games have elements such as points, badges, and leaderboards and provide cash rewards, discounts, and other benefits. Using literature review to analyze relevant papers on the adoption and use of online games, The UTAUT2 model proposed by The gamification of m-commerce in this study aims to motivate users to buy and pay. Playing games may help players purchase goods on the platform at a reduced cost or get additional payment rewards. Therefore, this study integrated the price value dimension of UTAUT2 into the performance expectation dimension and did not take price value as a separate dimension in the empirical study. M-commerce games have social attributes that can enhance the community communication of products through sharing and enhance user participation through competition and cooperation. Therefore, this study taken the social influence dimension as an important research variable. Providing an interesting and enjoyable environment can help improve users\u2019 understanding of technology acceptance . M-commeIn the early stage of m-commerce, facilitating condition is an important factor affecting people\u2019s use intention. However, nowadays, people have relatively abundant equipment and resources to use mobile applications. For example, studies by To sum up, UTAUT2 theory was selected as an important reference in this study. On this basis, combined with the specific situation of gamification of m-commerce, research variables slightly different from previous studies were proposed: performance expectation , effort expectation, social influence, and hedonic motivation.As a strong predictor of intention, performance expectation helps to identify users\u2019 behavioral intentions . RelevanH1a: Performance expectancy is positively related to game use intention.H1b: Performance expectancy is positively related to platform satisfaction.Many scholars believe that hedonic motivation is a strong trigger in the context of online games and has a significant impact on players\u2019 willingness to continue . In a stH2a: Hedonic motivation is positively related to game use intention.H2b: Hedonic motivation is positively related to platform satisfaction.Social interaction can form flow, fun, and social influence, which can generate a positive attitude among players toward the game so as to encourage them to continue to use the game . M-commeH3a: Social influence is positively related to game use intention.H3b: Social influence is positively related to platform satisfaction.Relevant studies have confirmed that effort expectation is one of the important determinants of playing online games on mobile phones and may positively affect behavioral willingness . ProvidiH4a: Effort expectancy is positively related to game use intention.H4b: Effort expectancy is positively related to platform satisfaction.Previous studies have shown that satisfaction has a significant impact on the willingness of a player to continue using some platforms, such as mobile shopping apps, metaverse platform, online social networks, and book self-service systems . SatisfaH5: Game use intention is positively related to platform satisfaction.The subjects of this study were females who played m-commerce games, so the title of the questionnaire emphasized the word \u201cfemale\u201d and the first question was designed as a gender screening question. If the subject chose the male option, the system automatically terminated the questionnaire. In addition, we found in the pre-test that females who rarely played m-commerce games tended to score lower on the game use intention option. Therefore, in the formal research stage, we set a question regarding how often they had played m-commerce games in the past 6 months, providing five options: never played, rarely played, 3\u20135 times a month, 2\u20134 times a week, and every day. If the respondent chose the option never played or rarely played, the questionnaire would stop automatically. The pre-test questionnaire in this study contained items from the habit dimension of UTAUT2 theory. In the formal survey stage, only females who played m-commerce games frequently were accepted, so there was no question related to the research variable \u201chabit\u201d in the formal questionnaire. By default, all the subjects had the habit of playing m-commerce games.On the basis of the classification framework of age, education level, frequency of use, and residence, this study paid to promote the questionnaire content on a nationwide questionnaire distribution platform in April 2022. This part was probability sampling. In addition, respondents could forward the questionnaire to their friends for a small reward. This part was snowball sampling. After removing the questionnaires where the participants had taken too short a time to fill out the forms, illogical questionnaires, and the questionnaires with all same-scale items, we were left with 609 valid questionnaires. The statistical results showed that females from 28 provincial-level administrative regions in China participated in the survey, which ensured that the research sample was sufficiently representative.In the measurement of UTAUT2, game use intention, and platform satisfaction, we referred to the scale items of international published academic literature and made appropriate modifications based on the research topics so as to adapt the items to the purpose of this study. A five-point Likert scale was used in the questionnaire, in which 5 indicated absolute agreement and 1 indicated absolute disagreement. The specific contents of the scale are shown in Data were analyzed using Amos 22 Graphics and SPSS Statistics 26 software. In this study, there were 6 latent variables and 25 observed items in the structural equation model. If the sample number suggested by In this study, it was found that the types and proportions of m-commerce platforms that respondents usually used were Taobao (96.39%), Alipay (85.22%), Pinduoduo (79.64%), and others (9.52%). In terms of the multiple-choice questions on which m-commerce games were played recently, the types and proportions of platforms the respondents selected were Taobao (87.03%), Alipay (84.40%), Pinduoduo (64.04%), and others (7.09%). As to which type of m-commerce games they had played, the types and proportions of the games the respondents selected were Ant Forest (87.52%), growing fruits (84.73%), solving puzzles (68.47%), raising pets (53.69%), and others (4.96%). The above data indicate that the game types and m-commerce platforms selected in this study were sufficiently representative. In addition, 92.61% of the respondents indicated that they had played independent applications that were similar to m-commerce games before.p\u2009<\u20090.001), indicating that the data used were suitable for factor analysis  square root of a dimension was greater than the correlation coefficient between this dimension and other dimensions, it indicates that there was discriminant validity between each dimension . It can The overall model fit analysis results of this study are as follows. CMIN\u2009=\u2009472.957, CMIN/df\u2009=\u20091.792, GFI\u2009=\u20090.943, AGFI\u2009=\u20090.930, SRMR\u2009=\u20090.0360, RMSEA\u2009=\u20090.036, NFI\u2009=\u20090.942, IFI\u2009=\u20090.974, CFI\u2009=\u20090.974, RFI\u2009=\u20090.935, and PNFI\u2009=\u20090.829. It can be seen that the indicators of absolute fit measures, incremental fit measures, and parsimonious fit measures in this study all performed well, meeting the requirements of relevant academic research .p\u2009<\u20090.001), hedonic motivation , and social influence  all positively affected the game use intention. Therefore, the results supported H1a, H2a, and H3a. Effort expectancy  positively affected platform satisfaction, so the result supported H4b. However, performance expectation , hedonic motivation , and social influence  had no significant influence on platform satisfaction. Therefore, H1b, H2b, and H3b were rejected. Effort expectancy had no significant impact on game use intention, so H4a was rejected. In addition, game use intention was positively related to platform satisfaction , so the results supported H5. The hypothesis test results are shown in The structural equation model was used to examine the research conceptual model, and p\u2009<\u20090.001), hedonic motivation , and social influence  had a significant indirect impact on platform satisfaction.We tested the mediating effect of the research model. The results showed that game use intention acted as a full mediation in the impact of performance expectation, hedonic motivation, and social influence on platform satisfaction. Performance expectancy  was significantly higher than that of females under 25\u2009years old (M\u2009=\u20094.018). There were significant differences in the willingness of users to play games on m-commerce platforms daily (M\u2009=\u20094.380), 2\u20134 times per week (M\u2009=\u20094.005), and 3\u20135 times per month (M\u2009=\u20093.602). The game use intention of users who spent more than 501 yuan (M\u2009=\u20094.273) on the mobile commerce platform every month was significantly higher than that of users who spent less than 200 yuan (M\u2009=\u20094.028) and 201\u2013500 yuan (M\u2009=\u20094.030). However, regarding game use intention, there was no significant difference among game players with different education levels. In addition, the effect of game use intention on platform satisfaction was not moderated by age, game frequency and educational level. However, the effect of game use intention on platform satisfaction was moderated by monthly platform expenditure (the higher consumption group was more significant).In the context of m-commerce incorporating mini games, this study established a research model and put forward hypotheses from the perspective of UTAUT2 theory. On the basis of questionnaire data, the behavioral intention of females using m-commerce games and its influence on platform satisfaction were investigated. This study confirmed that game use intention had a full mediating effect between performance expectation, hedonic motivation, social influence of the self-variable and platform satisfaction of the dependent variable. Effort expectation had no significant impact on game use intention but had a positive and significant impact on platform satisfaction. According to the relevant demographic results, further explained the behavior intention of female m-commerce game players. The results of this study are expected to supplement and expand the research in related fields and contribute to the development of m-commerce and the application of games.In view of the game characteristics and users of m-commerce, this study modified the research variables of the UTAUT2 model. In the revised model, we incorporated the variable of price value into performance expectation, deleted the two variables of convenience facilitation and habit, and retained the three variables of effort expectation, hedonic motivation, and social influence. In this study, the modified UTAUT2 model was used as the self-variable, the game use intention as the intermediary variable, and the platform satisfaction as the dependent variable. The collected data had good model fitness and explanatory power through empirical analysis. It extends the application of UTAUT2 to user-related research and is an important contribution of this study.M-commerce games are utilitarian products. The games involve browsing the advertising page, purchasing goods, signing in, donating the number of walks, and so on. The player has to solve the challenges in the game by completing tasks. Appropriate incentives can further motivate players to complete tasks within the time limit. Games help to visually explain complex tasks or features, engaging participants through competition, teamwork, curiosity, and problem solving . Providivia a sense of pleasure and achievement. According to the classification of The reason females play m-commerce games is not only to gain some utilitarian value but also to enjoy the mini games themselves, for example, M-commerce mini games require little or no attention and can be played while multitasking. The study results show that the performance expectation, hedonic motivation and social influence have no direct and significant impact on platform satisfaction of m-commerce, but game use intention can significantly affect platform satisfaction. This finding is not completely the same as the research results of The empirical results of this study indicate that effort expectation had no significant impact on game use intention of the m-commerce platform, which was consistent with the research results of Studies on game use intention and satisfaction simultaneously usually take independent game apps as objects and explore the influence of game satisfaction on game use intention . HoweverThe research results confirmed that the frequency of playing games is directly proportional to game use intention. This is consistent with previous research showing that game use intention of m-commerce has a positive influence on platform purchase intention . The resThis study makes some academic theoretical contributions, reveals the reasons why females play m-commerce games, and confirms that game use intention positively affects the satisfaction with m-commerce platforms, thus filling the gaps in academic research in related fields. For m-commerce platforms incorporating game attributes, a deeper understanding of the potential causes behind the behavior of female gamers will help more effectively predict and guide user behavior and provide reference for management decisions to improve the satisfaction with m-commerce platforms. The research results can not only provide a reference basis for China\u2019s m-commerce but also be potentially applied to the international market. This may help enterprises seek new competitive value by using game methods, so as to obtain more long-term competitive advantages.In this era of vigorous m-commerce development, this study constructed a research model from the perspective of the revised UTAUT2 theory to explain the reasons females play m-commerce games and its impact on platform satisfaction. The hypothesis relationship was verified by path analysis and was credible and persuasive to an extent. The results showed that performance expectation, hedonic motivation, and social influence have no direct effect on platform satisfaction but can indirectly affect platform satisfaction through game use intention. Effort expectation had no direct and significant impact on game use intention but had a positive and significant impact on platform satisfaction. This study also further explored game use intention and platform satisfaction in terms of age, playing frequency, education level, and monthly spending on the platform. The overall model contributes to explaining the games and satisfaction with the m-commerce platforms.However, this study has the following limitations: (1) From the empirical aspect, the test sample of this study was limited to some female users who played games on the Taobao, Pinduoduo, and Alipay m-commerce platforms. Since mainstream m-commerce platforms and built-in mini games in other countries or regions may be different, as would be people\u2019s living habits and ways of thinking and the factors influencing their behavior, whether the results of this study can be replicated among people in other countries or regions still needs to be verified by subsequent empirical studies. It is necessary to expand the research scope to different m-commerce platforms or regions in the future. (2) We collected the questionnaire samples of this study within a few days and analyzed the data using SEM. In the future, other methods, such as longitudinal study, can be adopted to track the follow-up dynamics of target users through irregular interviews or questionnaires so as to gradually overcome the limitations of this study. (3) The categories of games in this study were Ant Forest, growing fruits, raising pets, and solving puzzles, but there was no detailed discussion and comparison on the use intention and users\u2019 reasons behind playing each category of games. Future research can further study the behavior and willingness of players in terms of different m-commerce games and put forward specific and feasible design suggestions for game developers.The original contributions presented in the study are included in the article/Supplementary material, further inquiries can be directed to the corresponding author.The studies involving human participants were reviewed and approved by Research Ethics Committee of Quanzhou Normal University. Written informed consent to participate in this study was provided by the participants\u2019 legal guardian/next of kin.Y-TH, NY, and C-YC contributed to conception and design of the study. NY organized the database, performed the statistical analysis, and wrote the first draft of the manuscript. Y-TH and NY wrote sections of the manuscript. Y-TH edited the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Previously the effect of the pruritogens, such as histamine and chloroquine, was tested in 11 inbred mouse strains, and this study aimed to identify resistant and sensitive strains, consistent with the observation that underlies the large variability in human populations. In the present study, we used the low responder C3H/HeJ (C3H) and the more sensitive C57BL/6J (C57) strain to find out if resistance and sensitivity to develop pruritus is restricted to only histamine and chloroquine or extends to other known pruritogens as well. We tested five additional commonly known pruritogens. We established dose-response relationships by injecting four concentrations of the pruritogens in the range of 0.3, 1, 3, and ten-fold in the nuchal fold. Then we assessed the scratching behavior for 30 min after injection with an automated custom-designed device based on the bilateral implantation of mini-magnets in the hind paws and on single cages placed within a magnetic coil. We found that the resistance to pruritogens is a general phenotype of the C3H strain and extends to all pruritogens tested, including not only histamine and chloroquine, but also endothelin, trypsin, 5-HT (serotonin), the short peptide SLIGRL, and Lysophosphatidic acid (LPA). C57 was more sensitive to all pruritogens and, in contrast to C3H, dose-response relationships were evident for some of the pruritogens. In general, comparable peak scratch responses were observed for the 0.3-fold concentrations of the pruritogens in C57 whereas C3H required at least the ten-fold concentration and still displayed only between 5 and 33% of the scratch responses observed in C57 for the respective pruritogen. The general resistance to pruritogens and the low level of scratching behavior found in the C3H strain is an interesting trait and represents a model for the study of the heritability of itch. It is accompanied in C3H with a higher sensitivity in assays of nociception. From an evolutionary point of view, acute pruritus is a protective alarm signal to defend the skin from harmful damage. The reflex-induced scratching is supposed to remove the potentially dangerous stimulant and bring relief by activating the reward system in the brain . Only in 1997, a specific itch-related pathway was identified  was identified to be one of the inbred strains with little sensitivity to chloroquine and histamine. Here we tested if the low sensitivity to chloroquine and histamine observed in C3H extends to other commonly known pruritogens, including endothelin, trypsin, 5-HT (serotonin), SLIGRL, and Lysophosphatidic acid LPA, . Before injection, all pruritogens were dissolved in phosphate-buffered saline (PBS) except LPA, which was dissolved in 0.1% mouse serum albumin (MSA) and PBS. All pruritogens and the respective stock concentrations are listed in For the injection of pruritogens, we used Omnicanvia Charles River, Germany (Stock Numbers 664 and 659). Colonies were established using brother \u00d7 sister or offspring \u00d7 parents mating. For C3H, 21 females and 30 males were used. In female mice, the age ranged between 57 and 112 days (71.42 \u00b1 17.21 days) and weight between 15.5 and 21.4 g (18.33 \u00b1 1.59 g). Whereas in male mice, age ranged between 57 and 112 days (79.8 \u00b1 19.17 days), and weight between 20.7 and 28.9 g (26.64 \u00b1 2.31 g). For the C57 mouse strain, 24 females and 30 males were used. In female mice, age ranged between 66 and 96 days (81.53 \u00b1 9.31 days) and weight between 18.5 and 22.7 g (21.10 \u00b1 0.98 g). Whereas in male mice, age ranged between 59 and 99 days (79.8 \u00b1 13.10 days), and weight between 21.1 and 28.7 g (25.15 \u00b1 2.02 g). The mice were housed at the Preclinical Research Center of the Universit\u00e4tsklinikum Erlangen in Erlangen, Germany. Mice were kept in groups with a minimum of two and maximum of five animals in one cage, respectively, according to their litter size after birth and to FELASA recommendations. All mice were kept under a 12:12 h light: dark cycle regulated between 4:30 AM and 4:30 PM. Ambient temperature and humidity were kept at 22 \u00b1 2\u00b0C and 55 \u00b1 10%, respectively. Food and ozonized tap water were available ad libitum.Breeding pairs of C57BL/6J (C57) and C3H/HeJ (C3H) strains were purchased from the Jackson Laboratories  Scratching in mice is a characteristic and uniform movement with restriction to the hind paws. In order to automatically quantify this type of behavior, we used a magnetic coil-based detection system, where the mice get small magnetic implants in both hind paws. The magnets are placed under the skin and below the knee. For placement of implants, we anesthetized mice with isoflurane (2%\u22123%) using a face mask. Then the hind legs were shaved up to the hips with a razor . On this occasion, the mice were also shaved in the neck fold to prepare the skin for the pruritogen injection. For subcutaneous injection of magnets, both hind legs were held in position with tape and a 2 mm skin incision was made at the level of the hip on both sides. PTFE-coated magnets  were implanted subcutaneously in both hind legs with the help of a pet chip injector. The PTFE-coating prevents tissue response against the implants, and during the course of this and other studies, we never observed tissue inflammation due to foreign body rejection. The proper position of the magnet was verified manually at the end of each surgery and the resulting skin incision at the level of the hipbone was sewed with one stitch. Afterward, the mice placed back into its home cage. After at least 7 days of recovery in their home cages, the mice were transferred to the experimental room. They were single-housed during experiments and therefore placed in individual cages at least 120 min before the actual measurement in order to acclimate them to the measurement environment. They had free access to food and water, but no enrichment or nesting materials. For the measurements, the cages were placed in a frame with a magnetic coil. Within this frame, every movement of the hind limbs led to the movement of the magnet implants and induced an induction current in the magnetic field. This current was registered in gap-free mode and analyzed with custom-designed software. Immediately before the measurements, the mice were carefully taken out of their individual cages, the hindlimbs were manually checked for correct placement of magnets, and then the mice were released in a mouse restrainer. Then the pruritogens, diluted in PBS to the respective concentration, were injected with a hypodermic needle into the skin of the neck fold. Mice were gently released from the restrainer and put back in the measurement cages. From this moment onward, the acute scratching behavior was registered for 30 min. The pruritogens were tested per group and in each group, four concentrations were tested. The smallest concentration was injected on the last day, in order to become aware of potential sensitization. There were intervals of 48 h between the injection of the different concentrations. The pruritogens injection sequence and dosage are outlined in SiMon software , and 30 min periods were extracted offline for every mouse individually using the Scratch Analysis software . The resulting 30 min test files were then analyzed for scratch time, bouts, and events by a custom-made Python program written by Ron Castel. All data were then further processed in Excel (Version 2016) and plotted in R. From there, scratching was analyzed as scratch time , the number of scratch bouts (the number of uninterrupted scratch movements in a 30 min test period) and the number of scratch events, whereby scratch events contained several scratch bouts from the moment of one paw lift until the paw was let down. There was a maximal coefficient of variation of 40% between the beats of one bout  while the lowest dose produced 280 \u00b1 77 bouts. The dose-response relationship was linear and increasing doses produced significantly larger responses . In the C3H strain, the 10-fold concentration was also the most potent, but more than fourfold less effective. It provoked 405 \u00b1 82 bouts , with a smaller, but significant effect of dose . The 0.3-fold concentration produced the least number of bouts, which was 111 \u00b1 30 . Previously an inverted U-shaped dose-response profile was described for chloroquine . In C3H, the largest response occurred with the ten-fold dose  and the smallest as well with the one-fold dose (73 \u00b1 17). In C3H, chloroquine produced a 3.7-fold smaller response than the most potent dose in C57 and we observed no relevant effect of dose  and the one-fold concentration produced the smallest reaction  and LPA  produced increasing dose-response relationships and scratch responses of almost similar extent (F = 8.4 and p = 0.0007 for trypsin and F = 8.1 and p = 0.0008 for LPA). For both pruritogens, the ten-fold concentration was most potent and resulted in 549 \u00b1 92 and 378 \u00b1 80 bouts, respectively. The lowest responses were provoked by one-fold (138 \u00b1 43) and 0.3-fold (61 \u00b1 17) bouts, respectively. In C3H, these two pruritogens produced at the most potent concentration five-fold smaller responses. For both pruritogens, the ten-fold concentrations were most potent and produced for trypsin 106 \u00b1 19  and LPA 78 \u00b1 16 bouts , respectively (F = 2.7 and p = 0.09 for trypsin and F = 1.9 and p = 0.2 for LPA), but at least for trypsin, the ten-fold concentration produced significantly more scratch bouts than the three-fold concentration.In C57, the doses in the respective concentration range for trypsin  and 5-HT  were equally effective and they produced both inverted U-shaped response-relationships with respect to scratch events (F = 14.4 and p = 0.00005 for histamine and F = 7.5 and p = 0.001 for 5-HT), but with respect to scratch bouts, the highest concentrations were not significantly different (F = 15.7 and p = 0.00001 for histamine and F = 6.9 and p = 0.002 for 5-HT). The largest number of scratch bouts were provoked by the three-fold doses, and these were 406 \u00b1 37 and 409 \u00b1 63, respectively. In C3H, histamine was the least effective of all pruritogens and provoked the highest response at 0.3-fold concentration, which was 19 \u00b1 9 bouts in 30 mins . Differences between the doses were small, but significant (F = 3.7 and p = 0.04). Similarly, 5-HT produced very little response, at the most 55 \u00b1 19 bouts at the one-fold concentration , although the dose, according to the ANOVA, still had a significant effect . Taken together, histamine and 5-HT were therefore at least 7\u201321-fold more potent pruritogens in the C57 strain and C3H was practically resistant . Contrary to C3H, SLIGRL, at its most potent concentration (10-fold), produced only 72 \u00b1 13 scratch bouts, which corresponds to a third of the response. In this experiment, only 3 concentrations were tested, however, the influence of dose was apparent . There was a significant effect of increasing the dose . In some preliminary tests, we found no sensitization of the mice after multiple subsequent injections of the same substance. Thus, it is assumed that the substances were fully absorbed and metabolized within 48 h and any subsequent scratching behavior was not influenced by prior injections.In a previous screening study in 30 inbred mouse strains, we assessed diurnal and nocturnal in-cage activities in male and female mice in an automated home cage system  and previous observations from our unpublished screening study conducted in 21 inbred strains with the respective one-fold pruritogen dose in even numbers of both sexes. In this study, we observed sex differences to be smaller than 12% across all strains. Despite our observations of small differences in male and female scratching behavior, the literature database is inconsistent in this matter and does not allow a final conclusion. The first mouse study to address sex differences in pruritogen susceptibility was performed by Green et al. in 2006 and was based on 11 inbred strains and described 23% higher scratching readouts in female individuals following histamine or chloroquine injection in the nape of the neck  and -B receptors expressed in endothelial and immune cells and in sensory neurons. Although the difference between both strains was almost five-fold, the effect of endothelin was more potent than any other pruritogen. The gastrin-releasing peptide receptor is a member of the bombesin subfamily of GPCRs and its expression in the lamina I of the dorsal spinal cord marks a specific pathway for itch which does not affect the transmission of nociceptive signals  was proposed based on a selection of 11 inbred strains and failed only for Balb/cJ  under the file number 55.2 DMS-2532-2-240. Experiments involving live animals were conducted in accordance with the International Association for the Study of Pain Guidelines for the Use of Animals in Research.Conception or design of the work: KZ and AK. Data collection: YZ and CK. Data analysis and drafting the Figures: YZ, NR, and CK. Drafting the article: YZ and KZ. All authors critically revised and approved the article.YZ was supported by a fellowship from Zhengzhou University First Affiliated Hospital, No. 1 Jianshe East Road, Zhengzhou City, Henan Province, People's Republic of China and from the German Academic Exchange Service (DAAD) via the Department of International Affairs, University of Erlangen-N\u00fcrnberg. The project was funded by the Deutsche Forschungsgemeinschaft  - project numbers ZI1172/4-4 to KZ, KR3618/3-1, and KR3618/3-2 to AK.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The Guideline on Second trimester anomaly scan has been prepared by the National Maternal Fetal Medicine guidelines committee, approved by the Society of Obstetricians and Gynecologists Pakistan. These guidelines are developed in 2022 and will be reviewed after two years.The current document provides guidance about the importance of second trimester scan to practicing clinicians and sonologists. It will enable them to offer it timely offer to their patient this scan and refer them to the Fetal medicine specialist when indicated. It is unique as the document is modified according to local needs. The Guidelines are developed in 2022 and will be reviewed after two years. Congenital anomalies are a major cause of perinatal morbidity and mortality. Timely screening and detection of these anomalies by a non-invasive and cost-effective method of sonography can be done in majority of such cases. These guidelines are prepared by a group of experts from Pakistan to develop a consensus-based recommendations of performing second trimester scan that can be adopted throughout the country.Second trimester anomaly scan is performed to detect structural anomalies and identify markers for chromosomal anomalies. At this time placental localization and liquor volume are also assessed and dating of the pregnancy is done for those attending late.1It is best performed between 18 \u2013 22 weeks of Gestation, In Pakistan we recommend anomaly scan earlier by 20 weeks for timely detection of anomalies and decision for continuation of pregnancy.2Advanced maternal age (>35 years)Previous fetus or child with chromosomal and structural abnormality.Previous child with Genetic Syndrome.First Trimester scan showing Nuchal translucency 3 mm or more.st trimester.Abnormal maternal serum markers in 1Fetal growth restriction in the current Pregnancy.Pregestational diabetes or gestational diabetes diagnosed before24 weeks.Multiple or higher order pregnancy.Teratogen exposure and maternal drug use.Congenital fetal infections.Oligo and PolyhydramniosNuchal Edema.Ventriculomegaly.Cardiac defects.Echogenic Bowel.Short Femur/Humerus.Duodenal Atresia.Renal Pelvic Dilatation.All fetal conditions are not diagnosed by ultrasound. They can be categorized into those that are diagnosed most of the time and should not be missed on ultrasound. While some conditions can be missed on the scan and some are those that are not diagnosed by ultrasound.3Patients Biodata:Name, Husband name, Age, Parity,Family history of congenital anomalies.Last Menstural period (LMP) and Expected date of delivery (EDD)Indication of Anomaly scan:Presentation and lie of fetusPlacental position. Any placental abnormality.Biparietal diameter, Occipito frontal diameter (OFD)Head circumference.Femur and Humerus.Ventricular atrium.Transverse Cerebellar diameter (TCD), Cisterna magna.Abdominal circumferenceAmniotic fluid index (AFI)& Estimated fetal weight (EFW)Doppler where applicable\u2022Head: Intact cranium, shape\u2022Brain - Cavum septum pellucidum, Midline falx, Thalami, Cerebral ventricles, Choroid plexus, Cerebellum and Cisterna magna.\u2022Face - Both orbits, Median facial profile, Mouth, Upper lip.\u2022Neck \u2013Any mass, cystic hygroma\u2022Chest- lungs, pleural effusion, Diaphragm\u2022Abdomen - Abdominal organs, their situs, Stomach and intestines, Kidneys and urinary bladder. Ascites, abdominal mass and abdominal wall defects.Heart: Cardiac activity, Four-chamber view of the heart, Outflow tracts andthe three-vessel and tracheal view where possible.Spine and Limbs.Before performing the invasive procedure, couple is counseled regarding the procedure, its risks, benefits and outcomes. Informed decision about undergoing these tests is made by the couple. A prior written consent is obtained mentioning the risk of miscarriage in these procedures (0. 22% for CVS and 0.11 % for amniocentesis).5Invasive Procedures like CVS and Amniocentesis need to be performed by a certified operator.History of previous baby with Chromosomal abnormalities.Presence of sonographic marker or structural abnormality is the commonest indication for invasive testing.Genetic Syndromes or single Gene disorders in family.Women above 35 years of age.Abnormal four chamber view or three vessel view or Fetal arrhythmia detected by routine ultrasound.Raised Nuchal Translucency (>3 mm).Fetal Chromosomal abnormality.Family history of congenital heart disease,Maternal diabetes, Thyroid disorder or systemic lupus erythematosus.Fetal exposure to a teratogen or drugs like Ace inhibitors, NSAIDS, Anti epilepticsMultiple Pregnancy in particular Monochrionic twins.Repeat ultrasound scan is offered if first scan is not complete due to maternal obesity, uterine Fibroids or sub optimal position of baby.6Operator should be Certified and trained in Performance and interpretation of a detailed fetal scan.Operator has special expertise in the identification and diagnosis of fetal anomalies.Real time, grey scale ultrasound capabilitiesCurvilinear probeColor DopplerTransabdominal ultrasound transducers (3 \u2013 5 MHz range)Freeze frame capabilitiesElectronic calipersCapacity to print/store imagesRegular service recordSafe for clinical practice.Fetal exposure times should be minimized,Use lowest possible power output.Every pregnant patient should be offered second trimester anomaly scan.Detailed anatomic survey is mandatory at 18-20 weeks scanLiquor and Placental abnormalities are to be excluded at this timeIf any anomaly is suspected or detected patient is referred to Fetal Medicine specialistfor further management.nd trimester fetal ultrasound.All sonographers should have proper training for doing 2NZ: Designed and prepared the manuscriptSM: Edited the manuscriptSE: Data collectionSB: Critically reviewed the manuscriptHY and RK: Conceived the idea of making SOGP MFM guidelines according to needs of Pakistan.Lees CC UK Based expert on the subject has reviewed these guidelines.Guidelines are prepared by Prof. Nishat Zohra with input from members of Guideline committee including Prof. Shehla Baqai, Prof. Halima Yasmin and Prof. Shamila Ijaz in consultation and review by Chair of guideline committee Prof. Shama Munim. Nishat Zohra takes the responsibility and is accountable for the content of article."}
+{"text": "Bouveret syndrome (BS) is a rare but serious complication of gallstone ileus that can cause gastric outlet obstruction secondary to a gallstone impacted in the pylorus or proximal duodenum. Gallstones pass from the gallbladder to the GI tract via a cholecystoenteric fistula that forms as a result of chronic inflammation and adhesions between the biliary system and GI tract. Although the case we are presenting is of a 53-year-old Hispanic male, females and the elderly are particularly at an increased risk of this condition. BS can present as typical mechanical obstruction symptoms that include\u00a0nausea, vomiting, and diffuse abdominal pain. The vague symptoms patients present with makes the diagnosis difficult and often delayed, which can be fatal. In our case, the diagnosis of BS was supported by a CT with contrast, MRI, and an esophagogastroduodenoscopy (EGD) study. Our patient underwent an exploratory laparotomy after the diagnosis was made, and the stone was removed. Here, we aim to raise awareness of the importance of early recognition, and immediate action in establishing an early diagnosis of BS in patients presenting with nonspecific abdominal symptoms, which can prevent mortalities. Bouveret syndrome (BS) is a very rare type of gallstone disease, making up only 2-3% of all gallstone-related intestinal obstructions, which by itself accounts for only 1-4% of all small bowel blockages [A 53-year-old Hispanic gentleman presented to the emergency room with complaints of abdominal pain, nausea, and vomiting lasting two days. After dinner, two nights before coming to the emergency room, he started noticing upper abdominal discomfort and heartburn sensations. Throughout the night, he felt extremely nauseous. He continued to notice the discomfort of the burning sensation up into the mid-central portion of the chest, which would radiate into the epigastric region upon burping. After he continued to have the symptoms, he could not sleep well. He did force himself to vomit, which made him feel much better. He had a good night's sleep and went to work the next day with no issues. Later in the evening, he started having the same sensation again. His upper abdominal pain was starting to get worse. He started vomiting again. He could not get comfortable throughout the night and into the early morning until he finally came to the emergency room around 3 AM. He denied having any fever, chills, dark stools, bloody stools, diarrhea, problems voiding urine, cough, chest pain, shortness of breath, burning or pain with urination, new onset of skin rashes, headaches, blurred vision, or muscle weakness. There were no sick contacts at home and no recent trauma to the abdomen. He was later consulted by gastroenterology after the emergency room stabilized him and ruled out any acute conditions.Upon consultation with a gastroenterologist, the patient claimed he had been taking an oral supplement of iron for the past few months due to a previous history of chronic anemia. He said that he ate a quesadilla and salsa a few days prior and later had heartburn with reflux symptoms which were worse with laying down. He denied similar symptoms before, and the symptoms occurred multiple times over the next couple of days. He eventually vomited and noted phlegm and a dark brown liquid output. He denied bloody vomitus or black vomitus. He had been vomiting for about 20 minutes after eating anything, which got progressively worse. The patient stated he began to feel lightheaded and presented to the hospital for further evaluation. He denied any changes in bowel habits and continued to have a bowel movement daily, which was dark brown in color since starting his oral iron. He had a prior history of appendectomy but denied prior cholecystectomy or other abdominal surgery. He denied a family history of stomach cancer but said that his father had stomach ulcers and that his mother and two sisters had gastroesophageal reflux. He never had an upper endoscopy or colonoscopy before.His physical exam and laboratory values were unremarkable except for some mild tenderness in the epigastrium with no guarding or rebound upon palpation. A CT with intravenous contrast of the abdomen and pelvis was performed in order to visualize the vasculature and soft organs. There were no acute abnormalities in the vasculature, but there was an abnormality involving the duodenum and what appeared to be the gallbladder. The appearance was unusual and suggested a possible fistula between the gallbladder and duodenum, which could have been secondary to a contained duodenal perforation and/or acute cholecystitis as seen in Figure A surgical consultation was advised and an MRI of the abdomen without intravenous contrast was ordered to further evaluate the abnormal CT findings. The MRI confirmed the suspected irregularity and showed what appeared to be a fistulization from the gallbladder to the first portion of the pyloric/duodenal region with potential stones. This connection appeared to be associated with a contained duodenal perforation that measured 3.8 x 1.8 cm. An ovoid structure was also noted within the gastric lumen that may have represented a foreign body or bezoar. An esophagogastroduodenoscopy (EGD) study was performed to really evaluate and visualize if there was a stone and fistula. Upon completion of the EGD, a cholecystoduodenal fistula and a retained gallstone within the stomach were confirmed. Given the clinical presentation, CT findings, MRI findings, and EGD, a diagnosis of BS was established. An exploratory laparotomy surgery with cholecystectomy, gastrotomy, extraction of gallstone, pyloric exclusion, gastrojejunostomy, and repair of duodenotomy was planned and performed to fix the malformation. It was recommended that the large gallstone within the stomach be removed as this was the cause of gastric outlet obstruction. During the surgery, a gallstone that measured 6 cm in length and 3 cm in diameter was retrieved from the lumen of the distal stomach, and the cholecystoduodenal fistula was repaired through a gastrojejunostomy without any complications. An image of the gallstone postoperatively is shown below in Figure BS usually presents with non-specific symptoms and relies on a combination of clinical suspicion and imaging for diagnosis . The symBS is most commonly found in the elderly female population ,3,5. AccTreatment options for BS can be generalized into surgical intervention and minimally invasive procedures. Surgical techniques are often more favored due to their higher success rates and include gastric or enteral lithotomy through laparoscopy or laparotomy as well as repair of the fistula between the gallbladder and duodenum or the common bile duct and duodenum . A choleThis paper was limited by the emergent presentation of the patient. The patient had not been going to a medical professional which limited information on the patient's health baseline. It would have also been useful to be able to perform some genetic tests to rule in or out factors that may have predisposed the patient to the formation of gallstone, such as being Native American or having the adenosine triphosphate binding cassette subfamily G member 8 (ABCG8) gene [Our case presents a relatively young individual with very few apparent risk factors who had sudden onset of BS. However, due to the increased incidence of gallstones in the United States as stated by Unalp-Arida et al. , it is pBS is a rare type of gastric outlet obstruction secondary to a large gallstone impacted in the upper GI tract. It is often a challenging diagnosis as patients typically present with inconsistent abdominal symptoms. Our patient presented with nausea, vomiting, and abdominal pain for two days which\u00a0made him visit the emergency room and eventually get evaluated by a GI specialist. BS has a high prevalence in elderly females and can be life-threatening if not recognized early. Gallstone ileus is best evaluated through CT as X-ray can be nonspecific for soft tissue imaging. The clinical presentation of abdominal symptoms guided by radiological imaging should prompt physicians to consider the possibility of BS. Even if the patient does not fit the typical age and sex, they could still be at risk for BS."}
+{"text": "These results suggested that the high ROS levels generated by the PAM treatment reversed the EMT process by inhibiting the WNT/\u03b2-catenin pathway in NSCLC cells and thus inhibited the migration of NSCLC cells. Therefore, these results provide good theoretical support for the clinical treatment of NSCLC with PAM.This study explored the molecular mechanism of the plasma activation medium (PAM) inhibiting the migration ability of NSCLC  cells. The effect of PAM incubation on the cell viability of NSCLC was detected through a cell viability experiment. Transwell cells and microfluidic chips were used to investigate the effects of PAM on the migration capacity of NSCLC cells, and the latter was used for the first time to observe the changes in the migration capacity of cancer cells treated with PAM. Moreover, the molecular mechanisms of PAM affecting the migration ability of NSCLC cells were investigated through intracellular and extracellular ROS detection, mitochondrial membrane potential, and Western blot experiments. The results showed that after long-term treatment with PAM, the high level of ROS produced by PAM reduced the level of the mitochondrial membrane potential of cells and blocked the cell division cycle in the G2/M phase. At the same time, the EMT process was reversed by inhibiting the Wnt/ Despite the rapid development of medicine today, the threat of cancer to human health continued to increase. According to research papers published in the International Journal of Cancer, there was an estimated 18.1 million new cancer cases and 9.6 million cancer deaths worldwide in 2018 ,4. Lung 2O2) and nitrite (NO2\u2212) were the main long-acting substances of RONS, and their intracellular interaction was an important reason for the selective apoptosis of tumor cells [Plasma was the fourth state of existence of a substance which consisted mainly of positively charged ions, electrons, and neutral particles . The plaor cells . Recentlor cells ,25,26. Ior cells , but whe\u03b2-catenin signaling pathway is the most closely related [\u03b2-catenin pathway also plays an important role in regulating cell proliferation, as well as cell migration and invasion [\u03b2-catenin signaling pathway [\u03b2-catenin signaling pathway, thereby promoting the metastasis of pancreatic cancer cells [\u03b2-catenin pathway in cancer cells and inhibiting the EMT process has not been explored, and our research was dedicated to this. Cancer metastasis is a complex process. When cancer cells lose polarity, intercellular adhesion decreases and tight junctions are further lost, thus obtaining the mesenchymal phenotype. This process is called epithelial\u2013mesenchymal transition (EMT), which is characterized by changes in the levels of three prominent biomarkers . E-Cadherin expression is down-regulated, while the up-regulation of Vimentin and N-Cadherin leads to the occurrence of EMT ,29. The  related . Moreoveinvasion ,32,33. M pathway ,36,37,38er cells . However\u03b2-catenin-signaling-pathway-related proteins were detected via Western blot experiments to explore the internal mechanism of PAM affecting cell migration.In this study, the effects of PAM on the cell migration of NSCLC were detected at the in vitro level using microfluidic chips and Transwell cells. The expression levels of EMT and Wnt/2. When the cells reached approximately 80% plate bottom coverage, they were incubated in LTP-treated medium for 0 s, 10 s, 15 s, 20 s, 25 s, and 30 s.NSCLC cells H460, H1299, A549, PC-9, and H1975 were purchased from the ATCC cell bank. The NSCLC cells were cultured in RPMI medium 1640 Basic  containing 10% fetal bovine serum  and 1% penicillin/streptomycin . Cells were cultured in a 37 \u00b0C cell incubator  with 5% COThe DBD dielectric barrier discharge device used in this study was described in Zhou et al. . The eff3--2, 5-diphenyltetrazole bromide  was used as a cell viability assay. There were five NSCLC cell lines, including H460, PC-9, A549, H1299, and H1975. When the cells grew to be suitable for passage, the adherent cells were digested with trypsin and added to cell culture solution to make a cell suspension, and then transferred to each Petri dish evenly. When the cells in each dish grew to about 80% of the bottom of the dish, they were incubated with PAM for 24 h. After the PAM was discarded, 1 mL of pre-prepared MTT working solution was added into each dish for continuous incubation for 4 h. The plates were removed from the MTT working solution and an equal volume of dimethyl sulfoxide  was added to each plate to dissolve the crystals in the cells. After sufficient shaking, 150 \u03bcL of dissolved liquid was added to each well in a 96-well plate, and a microplate reader was used to determine the absorbance at 492 nm for each well. Cell viability was calculated according to a standard curve. H460 and PC-9 cells were incubated in 10% fetal bovine serum until the bottom of the plate fused. The original culture medium in the Petri dish was discarded, and the monolayer on the cell fusion surface was scraped off with a 20 \u03bcL white pipette head. The scraped cells and cell fragments were washed with PBS three times, and the cells were incubated in PAM without FBS. Cell migration of PAM after incubation for 4 h, 12 h, 24 h, and 48 h was observed and recorded using an inverted microscope , and the scratch surface area after the different incubation times was quantified using different gray values.5/mL. In total, 500 \u03bcL 10% FBS medium was added into the outer chamber of the Transwell plate, and 200 \u03bcL cell suspension was added into the inner chamber. The cells were fixed and stained after incubation for 24 h. The inner chamber was wiped and observed under an inverted microscope. Five fields of view were randomly selected.In addition to the scratch experiment, this study also used the Transwell tool to further explore cell migration and analyze the influence of PAM on cell migration. The experiment was carried out in an 8 \u03bcm 24-hole Transwell plate . H460 and PC-9 cells were incubated in PAM for 4 h, digested by trypsin, and added to the FBS-free medium to prepare a cell suspension. A cell count was carried out to make the cell concentration of the cell suspension about 1 \u00d7 10\u03b2-catenin signaling pathway, we added IWP-2, an inhibitor of the Wnt/\u03b2-catenin pathway , in a complementary migration experiment. The experiment was divided into four groups, namely, the control group, the PAM (30 s) treatment group, the IWP-2 treatment group, and the PAM (30 s) + IWP-2 treatment group. The working concentration in the IWP-2 treatment group was 12.5 \u03bcL, and the specific steps in the migration experiment were the same as those above.In addition, to further explore whether the inhibition of high-dose PAM treatment (30 s) on the migration of H460 cells and PC-9 cells was achieved by down-regulating the Wnt/The microfluidic chip was designed using AutoCAD . A single-cell migration testing unit included a cell loading unit, a chemotactic migration unit, and a cell separation unit. The fabrication steps of microfluidic chips were described in detail in a previous study . The mas3) and C2 = 0 mol/(L m3), respectively; liquid density was 103 kg/m; dynamic viscosity was 10\u20133 Pa s; and diffusion coefficient D was 7.5 \u00d7 e\u201311 m2/s. The liquid height difference at the inlet and the outlet of the microfluidic concentration gradient chip pipeline could form a pressure difference inside the pipeline to promote fluid flow. The height of the chip body was set to 5 mm so that the pressure at the chemokine injection port and the cell culture medium injection port could be set to 50 Pa at most, and the pressure at the output port was set to 0 Pa assuming an infinite diameter and no liquid at the outlet. Identical and stable chemical gradients could be rapidly generated in the six test channels without requiring external pumps for up to 48 h, which was sufficient for the cancer cell migration experiments. For the cancer cell experiments, the chemoattractant solution and medium were topped up intermittently to the inlet wells to maintain the stable gradient for a longer period of time. The cell docking structure aligned cells next to the barrier channel before the chemical gradient exposure, which simplified cell migration assay operation and analysis and improved the accuracy. It could simply involve cell seeding and solution loading followed by incubation and final end-point imaging analysis, while still offering the option of real-time monitoring and cell tracking analysis via time-lapse microscopy.Six independently controlled cell migration test units were configured on a single chip, allowing parallel testing for different conditions A\u2013C. The PC-9 cells were divided into a control group and a 30-spam treatment group. Then, the cells were loaded into six parallel test units of the microfluidic chip from the cell inlet. PC-9 cells in the control group were injected into channels I, II, and III, and PC-9 cells in the 30 s PAM treatment group were injected into channels IV, V, and VI. An equal volume of chemical attraction solution  at a concentration of 200 ng/mL and cell culture medium (1% 1640) were injected into the cell chemotaxis unit and the cell culture medium unit, respectively. The microfluidic device was then placed onto the imaging stage of an inverted microscope.2 between the imaging time points. The microscope was equipped with an environmental control chamber to maintain the microscope stage at 37 \u00b0C. It is worth noting that the six migration units were captured by connecting a smartphone camera to the microscope eyepiece.For the cancer cell migration experiment, the images of cells in the device were captured every 6 h for a total of 24 h and the device was kept in a 37 \u00b0C incubator containing 5% CO5 cells were analyzed for each experiment. The calculation of cell migration distance  along the gradient from the docking region was mentioned in a previous document ; 1 \u00d7 1052O2 detection kit  and NO detection kit , respectively. According to the kit instructions, 50 \u03bcL of PAM was added to each well in a 96-well plate for incubation for different times, followed by the detection of ROS and RNS concentrations in the medium with H2O2 and NO detection reagents. The concentrations of H2O2 and NO in the culture medium were detected again after the cells were incubated with PAM for 4 h. The absorbance was determined at 540 nm and the concentration was calculated from the standard curve.The extracellular active substances in PAM were mainly reactive oxygen species (ROS) and reactive nitrogen species (RNS). Therefore, extracellular ROS and RNS were detected by using a HIn this experiment, ROS in the cells incubated with PAM was detected using a reactive oxygen species detection kit . H460 and PC-9 cells were incubated with PAM at 37 \u00b0C for 4 h and then with the addition of a DCFH-DA fluorescent probe for 30 min. After incubation, the cells were washed three times, and observed and recorded using a fluorescence microscope . In addition, to explore whether the inhibition of NSCLC cell migration via high-dose PAM is related to the high level of ROS produced, a group of ROS verification experiments were performed on PC-9 cells. N-acetyl-l-cysteine  was added 1 h before the LTP-treated cell culture medium at a working dose of 10 mM, and the time gradients of LTP-treated PC-9 cells were 0 s, 10 s, 20 s, and 30 s. To observe the effect of NAC pretreatment on cell migration ability, Transwell chamber and scratch experiments were used for verification. The specific experimental steps were the same as those mentioned above. The mitochondrial membrane potential detection kit  was used to detect the intracellular mitochondrial membrane potential after cell PAM treatment. After the lung cancer cells H460 and PC-9 were incubated with PAM for 4 h, the old medium was discarded and washed with PBS. A mixture of 1 mL of medium and 1 mL of JC-1 working solution was then added to each dish and incubation continued for 20 min at 37 \u00b0C. After incubation, the samples were washed with JC-1 staining buffer, followed by the addition of the medium to each dish and the green and red fluorescence were observed and recorded using fluorescence microscopy .The lung cancer cells treated with PAM were subjected to cell cycle testing according to the cell cycle testing kit . After PC-9 cells were incubated with PAM for 24 h, they were digested with trypsin to prepare the cell suspension, which was collected into each tube for centrifugation. After washing twice with PBS and centrifugation, the supernatant was added with 1 mL of 70% ethanol and stored at 4 \u00b0C overnight. Each tube was added with 500 \u03bcL staining solution (RNase: propidium iodide = 1:9) in a dark configuration, stained for 30 min, and cell cycle was detected using flow cytometry .\u03b2-catenin antibodies , rabbit anti-VEGF antibodies , and rabbit anti-VEGFR 2 antibodies  were detected. Rabbit anti-N-Cadherin antibodies , rabbit anti-E-Cadherin antibodies , rabbit anti-Vimentin antibodies , rabbit anti-c-Jun antibodies , and rabbit anti-Cyclin D1 antibodies  were incubated overnight at 4 \u00b0C, respectively. Post-horseradish peroxidase  was used as a second antibody for 40 min. Finally, luminescence imaging was performed using a chemiluminescent kit  and a chemiluminescent gel imaging system . The blot was quantified using a gray value detection method.PC-9 cells were collected after 24 h incubation with PAM. PC-9 cells were lysed according to the kit description, and the BCA protein detection kit  was used to quantitate the extracted protein. Electrophoresis was performed and Western blot analysis was performed using a gel prepared with the SDS-PAGE gel kit . After 10 \u03bcL protein was added to each electrophoresis tank, the protein was transferred to nitrocellulose membrane  after electrophoresis. After 2 h of blocking with 5% defatted milk, rabbit anti-Wnt3A antibodies , rabbit anti-t-test was used for comparison between the two groups, and Bonferroni\u2019s corrected one-way analysis of variance (ANOVA) and two-way analysis of variance (two-way ANOVA) were used for comparison between the two groups. The statistically significance difference was based on * p < 0.05, ** p < 0.01, *** p < 0.001.The data are reported as the average standard deviation of three independent experiments. A As shown in According to previous studies, when the cell viability was less than 75%, the unavoidable reduction in cell viability induced by PAM will decrease the cell migration and invasion ability . To avoiThe cell scratch test and the Transwell tool were used to examine the effect of PAM incubation on cell migration in the H460 and PC-9 cells. As shown in The microfluidic chips could simulate the physiological environment in vivo and more truly reflect the migration status of NSCLC cells during the incubation process of PAM. PC-9 cells in the control group and the 30 s PAM-treated group were simultaneously loaded into microfluidic chips and observed continuously for 24 h. The results showed that the cell migration distance in the control group was 186 \u00b5m, while that in the 30 s PAM treatment group was 64 \u00b5m . The resPAM was obtained from the cell culture medium after LTP treatment, and the active substance content was immediately detected. The results are shown in To further verify that the inhibition of migration of NSCLC cells by PAM was due to the increase in ROS production caused by LTP treatment, a further set of ROS verification experiments was performed using PC-9 cells. Compared with the control group, there was no statistical difference in the area of cell scratches A,B and tFluorescence microscopy was used to observe the experimental results. As shown in Flow cytometry was used to detect the changes in the division cycle of PC-9 cells after LTP treatment for different durations. The results are presented in The EMT process was closely related to cell migration. Western blot was used to detect the expression levels of EMT-process-related proteins in NSCLC cells after LTP treatment. The results are shown in \u03b2-catenin as well as their downstream proteins c-Jun and Cyclin D1 slightly increased in the 10 s LTP treatment group. However, expression levels of Wnt3A and \u03b2-catenin and their downstream proteins decreased in a dose-dependent manner in the 20 s and 30 s PAM-treated groups with the prolongation of LTP treatment  and vascular endothelial growth factor receptor (VEGFR) proteins in the short-term PAM treatment group increased, while the expressions of VEGF and VEGFR proteins decreased in a dose-dependent manner when the LTP treatment time further increased . These r\u03b2-catenin signaling pathway to explore whether PAM-induced inhibition of NSCLC cell migration was mediated by the inhibition of the Wnt/\u03b2-catenin signaling pathway. As shown in \u03b2-catenin signaling pathway.We also treated PC-9 cells with an inhibitor (IWP-2) of the Wnt/The blood supply of human lung organs is extremely rich, and tumor cells from lung tumors can transfer to various parts of the body with the blood flow, forming near-distant metastatic tumors. Studies have shown that PAM can not only inhibit the migration of prostate cancer cells, block the cell cycle, and induce apoptosis , it can EMT is an important process for cancer cells to acquire invasiveness . When ca\u03b2-catenin is a key event in the Wnt signaling pathway and the occurrence and development of colon cancer [\u03b2-catenin signaling pathway, thus completing distant metastasis [\u03b2-catenin signaling pathway, leading to poor tumor prognosis, and confirmed that GPX2 can reduce apoptosis by reducing intracellular ROS accumulation, which fully proved the close relationship between ROS and the Wnt/\u03b2-catenin signaling pathway and EMT process in tumor cells [\u03b2-catenin signaling pathway, regulating the expression of EMT-related proteins, and accelerating the metastasis and progress of colon cancer [\u03b2-catenin signaling pathway. Angiogenesis is a complex dynamic process, which is a basic event in the process of tumor growth, metastasis, and spread. The VEGF pathway is considered one of the key regulatory factors in this process [In this study, with the prolongation of LTP treatment time, the intracellular ROS level increased in a dose-dependent manner. Therefore, we think that PAM obtained via long-term LTP treatment can inhibit the EMT and migration of NSCLC cells by increasing the ROS levels entering cells. Another study shows that the typical Wnt signaling pathway is considered the driving factor of colon cancer. As a functional effector of the Wnt signaling pathway, the modification and degradation of n cancer . At the tastasis . Studiesor cells . At the n cancer . Therefo process . Among t process . Reducin process . Studies process . Therefo2O2 (the main species of reactive oxygen species) [2O2, cell growth is slow and development and regeneration are impaired; in addition, the cells tended to be in a resting state with no tendency to proliferate and differentiate. When the nerve cells were exposed to H2O2 in the range of 1\u201310 nM, the growth of axons and dendrites was promoted. It was mainly because the cells produced oxidative stress under this H2O2 concentration, which stimulated the proliferation and differentiation of cells. In addition, the study also showed that a modest increase in H2O2 concentration (up to about 100 nM) could further promote dendritic growth. Abnormally high H2O2 (more than 100 nM) can lead to the death of nerve cells and tissue degradation [The results of the MTT assay showed that different NSCLC cell lines had different sensitivities to PAM. Studies have shown that the effect of PAM on NSCLC cells is mainly mediated by increasing the intracellular ROS level. ROS first contacts the cell membrane, so the research on PAM-sensitive types mainly focuses on the cell membrane. The first view is that the content of aquaporin on the cell surface is the key to the sensitivity of cells to LTP. The higher the content of aquaporin on the cell surface, the more ROS will enter the cell and the greater the damage to the cell . The secspecies) . For nerradation .2O2 and the state and fate of nerve cells, we believe that this characteristic may exist in all cells, including NSCLC tumor cells. There are a lot of studies on long-term LTP treatment inducing tumor cell apoptosis to kill tumors [According to the relationship between different concentrations of Hl tumors ,73, and l tumors ,75,76. T\u03b2-catenin cell pathway, which makes PAM very likely to be an inhibitor of NSCLC tumor metastasis in the future. Our plan and assumption is to provide the tumor site with PAM in a certain way (such as injection to the tumor site), especially for patients with advanced NSCLC. By inhibiting the metastasis of tumor cells, we can buy time for the treatment of tumors  or improve the prognosis of patients. At the same time, we will further explore the specific molecular substances in PAM that inhibit tumor cell migration, so as to further concentrate and remove unnecessary impurities, so as to achieve a single-cell migration inhibition effect on tumor cells. Of course, we still have a lot of work to undertake before PAM enters clinical application, for example, the further exploration of whether PAM has the same inhibitory effect on the NSCLC cells of p53mut. In addition, we also need to conduct many animal experiments and, later, clinical experiments. Through a lot of data analysis and clinical experimentation, PAM can finally be better used in the clinical setting.According to the results of our experiment, PAM treated with LTP for a long time (30 s) can obviously inhibit the migration of NSCLC cells through the Wnt/\u03b2-catenin pathway, which inhibited the EMT process. Therefore, this study showed that high ROS generated by long-term PAM discharge could reverse the EMT process by inhibiting the Wnt/\u03b2-catenin pathway, thereby inhibiting the migration of NSCLC cells. The results of this study provided strong theoretical support for the clinical treatment of NSCLC with PAM.This study was the first to report the effects of PAM on the migration ability of NSCLC cells. Our results indicated that extracellular RONS and intracellular ROS levels in NSCLC increased in a dose-dependent manner with the increase in LTP treatment. The viability of NSCLC cells was controlled at about 75% by the MTT assay to ensure that the inhibitory effect of PAM on cancer cell migration was not caused by decreased cell viability. The results of the scratch test, cell migration test using the Transwell tool, and the cell migration detection test using microfluidic chips mimicking an in vivo environment all showed that short-term PAM treatment promoted the cell migration of NSCLC, while long-term PAM treatment significantly inhibited its migration. Further exploration is required in the revealed internal mechanism where the mitochondrial membrane potential of NSCLC cells decreased with the increase in LTP treatment. Cell cycle detection also showed that long-term PAM treatment could block the cells in the G2/M phase. The results showed that long-term treatment with PAM induced the early apoptosis of NSCLC cells by reducing the mitochondrial membrane potential and blocking the cell cycle. In addition, the WB assay results showed that long-term PAM treatment inhibited the cell migration of cancer cells in the Wnt/"}
+{"text": "C. elegans models of neurodegeneration. Among the tested TDZD analogs, PNR886 and PNR962 were most effective, significantly reducing both the number and intensity of Alzheimer-like tau and amyloid aggregates in human cell-culture models of pathogenic aggregation. A C. elegans strain expressing human A\u03b21\u201342 in muscle, leading to AD-like amyloidopathy, developed fewer and smaller aggregates after PNR886 or PNR962 treatment. Moreover, age-progressive paralysis was reduced 90% by PNR886 and 75% by PNR962, and \u201chealthspan\u201d (the median duration of spontaneous motility) was extended 29% and 62%, respectively. These TDZD analogs also extended wild-type C. elegans lifespan by 15\u201330% (p < 0.001), placing them among the most effective life-extension drugs. Because the lead drug in this family, TDZD-8, inhibits GSK3\u03b2, we used molecular-dynamic tools to assess whether these analogs may also target GSK3\u03b2. In silico modeling predicted that PNR886 or PNR962 would bind to the same allosteric pocket of inactive GSK3\u03b2 as TDZD-8, employing the same pharmacophore but attaching with greater avidity. PNR886 and PNR962 are thus compelling candidate drugs for treatment of tau- and amyloid-associated neurodegenerative diseases such as AD, potentially also reducing all-cause mortality.Chronic, low-grade inflammation has been implicated in aging and age-dependent conditions, including Alzheimer\u2019s disease, cardiomyopathy, and cancer. One of the age-associated processes underlying chronic inflammation is protein aggregation, which is implicated in neuroinflammation and a broad spectrum of neurodegenerative diseases such as Alzheimer\u2019s, Huntington\u2019s, and Parkinson\u2019s diseases. We screened a panel of bioactive thiadiazolidinones (TDZDs) from our in-house library for rescue of protein aggregation in human-cell and  Many neurodegenerative diseases have increased in incidence over the past several decades, including Alzheimer\u2019s disease (AD), Huntington\u2019s disease (HD), and Parkinson\u2019s disease (PD) ,2,3 in pAD impairs cognition and memory of humans, a property also apparent in animal models with pathology mimicking AD. Genetic factors (such as ApoE polymorphism), and non-genetic factors including age and diet, have been implicated in the relative risk and etiology of AD ,21,22,23inactive conformation and impedes its return to the active state ; CL4176 , which expresses human A\u03b21\u201342 in body wall muscle; and AM141  expressing polyglutamine [Q40] fused in-frame to YFP [Q40::YFP] in muscle cells. C. elegans worms were maintained at 20 \u00b0C on 2% (w/v) agar plates in nematode growth medium (NGM), seeded in the center with E. coli strain OP50.All nematode strains used in this research were obtained from the Caenorhabditis Genetics Center : wild-type C. elegans, were prepared at least one day ahead of use. C. elegans worms of strain AM141 were treated on these plates with each compound at final concentrations of 1\u201340 \u00b5M. Individual gravid adult worms were \u201caxenized\u201d, i.e., lysed in alkaline hypochlorite to recover a synchronous cohort of eggs. Drugs were allowed to diffuse throughout the medium on plates (~60 h), before adding eggs. Only the TDZD type and doses were varied; all other conditions were held constant as AM141 larvae hatched and developed into adults. In each experiment, a control group was treated with vehicle only (DMSO/medium) at the same final concentration, as a reference baseline for comparison to treated groups. C. elegans eggs at 20 \u00b0C normally hatch in ~8 h. Young-adult AM141 (3.5 days post-hatch) were placed on drug or control plates and transferred on alternate days onto fresh plates with the same drug doses, plus fresh E. coli to avoid even transient starvation. Equal samples (each N = 25) were randomly picked from experimental and control groups for microscopic imaging to quantify aggregates.Fresh agar plates supporting bacterial lawns, which serve as food for t tests, and displayed as histograms (mean \u00b1 SEM) of counts or intensity per worm for each treatment or control group.An in-house plug-in for ImageJ software (NIH) was used to process ~30 images of AM141 adults for each group, counting the number of aggregate foci per worm and measuring fluorescence intensity per aggregate (as an indication of their amyloid content), summarized in a spreadsheet. Each experiment was conducted multiple times to ensure reproducibility. Data were analyzed for significance of inter-group differences by heteroscedastic, two-tailed C. elegans strain CL4176, expressing A\u03b21\u201342 in muscle after induction, worms were maintained at 20 \u00b0C on plates with ample E. coli (strain OP50). At day 3.5 post-hatch (after ~24 h as adults), C. elegans worms were lysed, and unlaid eggs were released and transferred to 100-mm Petri dishes containing NGM\u2013agar seeded in a central area with OP50 bacteria. Plates were pre-equilibrated with PNR886 and PNR962 (at varying doses) or vehicle, each with a final concentration of 0.02% v/v DMSO. Expression of the human A\u03b21\u201342 transgene was induced by upshifting C. elegans to 25.5 \u00b0C at the L3-L4 transition, with an assay after a further 48 h; alternatively, worms could be allowed to age without induction and assayed at a series of later times. Paralysis was assayed as described previously [To obtain synchronized cohorts of transgenic strain OP. At day eviously ,103.v/v DMSO). Beginning at the L4 larval stage, worms were transferred daily to fresh plates for 7 days and thereafter on alternate days until the last worm died. C. elegans worms that moved spontaneously or responded to gentle prodding were scored as alive. Worms lost for reasons other than natural death were censored after their last observation reported as \u201calive\u201d. The methods described above are adapted from previously published experimental procedures [To obtain synchronized cohorts for lifespan studies, Bristol-N2 worms (DRM culture) were maintained continuously for 3 generations, avoiding contamination and starvation. Healthy, well-fed adult worms from the third generation were then lysed and eggs placed on plates equilibrated with appropriate doses of PNR886, PNR962, or DMSO vehicle  simulation was run as described previously [For protein\u2013ligand simulations, each ligand-protein complex  was enclosed in an orthorhombic box with edges passing within 10 \u00c5 of the protein. Solvation and charge neutralization within the box were accomplished with simple point charge (SPC) water and Naeviously ,107, holbinding) of ligand-protein complexes . To estimate the binding free energy of individual ligands attached to GSK3\u03b2, we employed the inbuilt Prime module of Schr\u00f6dinger Suite for the MM-GBSA procedure. Ligand exchange to compare GSK3\u03b2 binding to TDZD-8 vs. PNR886 or PNR962 provides reliable estimates of ligand-free-energy changes. Using results from Glide docking described above, the inactive conformation of the GSK3\u03b2 target protein is complexed with PNR886 and PNR962 and exported in the Schr\u00f6dinger Maestro 2017-2 Suite. The binding energy of TDZD-8 to GSK3\u03b2 was computed (represented as \u0394Gbinding) and then TDZD-8 is replaced by PNR886 or PNR962, after which the change in binding free energy is computed using the Ligand-FEP protocol from Schr\u00f6dinger Suite. The difference between these energies, denoted as \u0394\u0394G of binding to GSK3\u03b2 , represents the ligand free energy change due to the perturbation (ligand exchange).Glide docking poses served as the initial inputs for computing the retrospective solvent-based free energies . Two-tailed t tests were used if the direction of change was unknown but were replaced by one-tailed tests once that direction was established. To assess results from staining with thioflavin T or antibody, the mean counts or fluorescence intensities of 15 random fields per well were treated as individual points for each treatment group. Chi-squared or Fisher exact tests (depending on N per group) were used to evaluate inter-group differences in proportions  within individual experiments.Significances of survival-curve differences were assessed pairwise by Gehan\u2013Wilcoxon log-rank tests. Between-group differences in measures of protein aggregation, chemotaxis, and paralysis experiments, treating replicate assays as individual points, were assessed by Fisher\u2013Behrens heteroscedastic C. elegans models of neurodegeneration-associated aggregation. Future research will employ in vitro and in vivo approaches to elucidate whether protein targets other than GSK3\u03b2 are involved in the benefits conferred by PNR886 and PNR962. Further characterization and mechanistic studies on these novel analogs and their targets might offer novel and effective pharmacological interventions for diverse neurodegenerative diseases \u2014Alzheimer\u2019s and Parkinson\u2019s diseases, amyotrophic lateral sclerosis, etc. Hyperphosphorylation of \u201coff-target\u201d protein targets, by GSK3\u03b2 and other kinases, contributes to protein misfolding and aggregation that are strongly associated with a wide variety of neurodegenerative diseases.Protein aggregation and aggregation-associated behavioral traits seen in neurodegenerative pathological models are strikingly inhibited by unique TDZD analogs, PNR886 and PNR962. These novel drugs ameliorated protein aggregation in both human neuronal and embryonic kidney cell models and in nematode"}
+{"text": "This study aimed to evaluate and compare local tolerability of investigational drug TV-46046 and reference drug Depo-subQ Provera 104, both containing medroxyprogesterone acetate (MPA) as an active ingredient.We conducted a randomized, crossover, single-center study. Twenty-seven healthy women aged 25 to 47 years at low risk of pregnancy received a subcutaneous injection of each of the four study drugs  in different quadrants of the abdomen. We assessed local tolerability by occurrence of injection site reactions (ISRs), as well as injection site pain and overall safety for at least 9\u00a0months postinjections.n\u00a0=\u00a024), bruising (n\u00a0=\u00a04), and atrophy/dimple (n\u00a0=\u00a02). Eleven cases of hypopigmentation occurred following 25 full-dose injections of undiluted TV-46046 (44.0%), six following 27 full-dose injections of diluted TV-46046 (22.2%), and seven following 26 full-dose injections of Depo-subQ 104 (26.9%). Hypopigmentations occurred on average 8\u00a0months postinjection. Injection pain was minimal and dissipated quickly after all four injections.Of a total of 108 study injections, three injections were partial due to needle blockage. We observed a total of 30 ISRs following 105 full-dose injections, including hypopigmentation (Subcutaneous administration of MPA in a suspension formulation is associated with the delayed onset of hypopigmentation at the site of injection. Although not statistically significant, the rate of ISRs was over 60% higher for undiluted TV-46046 compared to Depo-subQ 104. This difference bears careful monitoring in future studies of TV-46046.From a safety standpoint, investigational drug TV-46046 is appropriate for further clinical testing as a 6-month contraceptive injectable. The previously underreported hypopigmentation associated with subcutaneous administration of MPA warrants further investigation and acceptability assessment among users of existing Depo-subQ 104 as well as careful monitoring of local tolerability of TV-46046 in future clinical trials.Registered at clinicaltrials.gov no: NCT02817464 The first-in-human noncomparative study (NCT02817464) suggested that TV-46046 may be associated with a higher rate of injection site reactions (ISRs) when compared to the historical data for the reference Depo-subQ 104 22.1We conducted this randomized, single-group, crossover, local tolerability study at the Biomedical Research Department at PROFAMILIA  between December 2018 and October 2020. FHI 360\u2032s Protection of Human Subjects Committee, the Comit\u00e9 de \u00c9tica de PROFAMILIA, and CONABIOS in the DR approved the study. All participants provided written informed consent before entering the study.Healthy women aged between 18 and 50 years at low risk of pregnancy, who had no desire to become pregnant within the subsequent 18\u00a0months and had no skin disorders were eligible for the study. We excluded women who recently used contraceptive injectables, had medical contraindications or known sensitivity to MPA, or used pain medication on a chronic basis.We hypothesized that the dose and/or concentration of MPA or the excipients of TV-46046 could be associated with local irritation. Therefore, we tested two doses and concentrations of TV-46046 400\u00a0mg/mL  and a single dose of TV-46046 placebo, which had an identical composition to undiluted TV-46046 but without MPA. Our reference drug was Depo-subQ 104 (0.65\u00a0mL of a 160\u00a0mg/mL formulation) supplied in a prefilled glass syringe.We planned to enroll and randomize 24 participants to 24 injection sequences of the four study drugs. We designed the randomization scheme to result in each drug being injected first, second, third, and fourth on six occasions, and each drug being injected in each quadrant of the abdomen on six occasions. Each woman served as her own control to minimize the variability of treatment comparisons. We concealed allocation assignments using a centralized randomization application RANDOMISE within the OpenClinica data management system.The study was not fully blinded due to differences in appearance and volume of the treatments. Designated unblinded study staff conducted randomization procedures; the staff preparing and administering injections were also unblinded to treatment sequence but were trained to shield the syringe prior to and at the time of injection from the view of the participant and study staff assessing study outcomes. Staff involved in randomization and administering injections were not involved in the assessment of study outcomes. Research staff responsible for assessing primary and secondary outcomes remained blinded to treatment assignments throughout the study.2.2During their enrollment visit (day 0), each participant received a total of four injections, one of each of the four study drugs: 120\u00a0mg/0.3\u00a0mL of TV-46046 (with 23\u00a0G needle), 60\u00a0mg/0.3\u00a0mL of 1:1 saline-diluted TV-46046 (with 23\u00a0G needle), 0.3\u00a0mL of TV-46046 placebo (with 23\u00a0G needle), and 104\u00a0mg/0.65\u00a0mL of Depo-subQ 104 (with the supplied 26\u00a0G needle). Each injection was separated by approximately 1\u00a0hour to eliminate carryover effect of pain of the previous injection. We administered all four injections subcutaneously in four abdominal quadrants, starting with the participant\u2019s right upper quadrant and progressing to the left upper quadrant, left lower quadrant, and right lower quadrant per the randomized sequence. We marked each injection site at the time of the injection and, after the fourth injection, took a photo of the four marked injection sites for future identification.We followed participants for at least 9\u00a0months after the administration of study drugs. We assessed local tolerability by evaluating ISRs twice on the day of the study drug injections (day 0): immediately after  and 1\u00a0hour (\u00b15\u00a0minutes) after each injection; at days 1, 3, 7, and 14; at months 3 and 6; at study exit; and at additional visits if indicated. Participants with ISR(s) were followed monthly through the resolution of the ISR or month 18, whichever came first. We asked participants to assess their injection site pain twice on day 0 at the same time points when we evaluated ISRs. Thereafter, injection site pain was documented only if reported by the participants.The scope of the safety evaluation in this study consisted of adverse events (AEs), use of concomitant medications, vital signs, and weight, measured in all participants throughout the study.2.32 surface area) or causing greater than minimal interference with usual social and functional activities; and any ISR that met the definition of a \u201cserious adverse event.\u201dWe assessed local tolerability by occurrence of ISRs, the primary outcome, that included but was not limited to erythema , swelling, pruritus , bleeding, bruising, injection site discoloration/hypopigmentation , or atrophy . We assessed ISRs by visual examination of the site of injection by blinded study staff and/or participant\u2019s self-reports. In addition to documenting all ISRs, we recorded the following ISRs as AEs: injection site pain with a Numeric Rating Scale score of 7 to 10; localized injection site pruritus (or itching) requiring \u226548-hour treatment or generalized itching causing inability to perform usual social and functional activities; injection site erythema and/or induration/swelling, both of \u22655\u00a0cm in diameter  and 10 (worst pain). In addition, 1\u00a0hour after the fourth  injection, participants provided an overall ranking of all four administrations from least 2.4We selected the planned sample size of 24 participants to provide at least 80% power to detect differences in the rates of ISRs of the magnitude (>40%) observed in previous noncomparative studies of TV-46046 and Depo-subQ 104 (unpublished data). Although not designed to obtain precise estimates of less frequent ISR occurrence , there was a high (>90%) probability of detecting one or more specific ISR types if the true rate of such events was at least 10%.We summarized demographics and baseline characteristics descriptively. We summarized ISRs, the primary outcome of the study, by reaction type and treatment group and assessed pair-wise differences between treatment groups using exact McNemar\u2019s tests conducted at the 0.05 level of significance without adjustment for multiple comparisons. We summarized injection site pain scores, the secondary outcome of the study, immediately after injection and 1\u00a0hour after injection by treatment group using descriptive statistics. We assessed differences between treatment groups in injection site pain scores immediately after injection using Poisson regression and 1\u00a0hour after injection using binomial regression. We assessed differences in ranking of the most painful injection using an exact multinomial test for homogeneity across groups. We conducted all analyses using SAS/STAT software, Version 9.4 of the SAS System for Windows .33.1We screened 29 and enrolled 27 women in\u00a0the study (93.1%). The median age of enrolled participants was 36\u00a0years, and the median weight was 66.0\u00a0kg. The majority were married/cohabitating (77.8%), had >9 full years of education (63.0%), and were biracial  to deliver the full dose. Despite the manipulation, three participants did not receive a full dose of a study treatment (two injections of undiluted TV-46046 and one injection of Depo-subQ 104). Based on a blind review of data, the Study Review Committee overseeing this study decided to exclude the three partial injections from the primary analysis. As a result, a total of 105 full-dose injections contributed to the primary analysis . All five participants who experienced needle blockage, regardless of whether the full dose was delivered, were entirely excluded from the secondary comparative pain score analysis. We expanded the final sample size from the planned 24 to 27 participants to maintain planned power when accounting for these exclusions.3.3p\u00a0>\u00a00.125 for each active group comparison). However, the rate was significantly higher for each active treatment compared to TV-46046 placebo, the only group that had no ISRs  were skin discolorations . Of these 24 events, 11 occurred following 25 full-dose injections of undiluted TV-46046 (44.0%), six following 27 full-dose injections of diluted TV-46046 (22.2%), and seven following 26 full-dose injections of Depo-subQ 104 (26.9%). The mean diameter of hypopigmentations was 13\u00a0mm (range 5-20\u00a0mm) and similar between the treatments  or atrophy/dimple (one participant each in the TV-46046 undiluted and Depo-subQ 104 groups). No ISRs met the protocol definition of an AE.3.4p\u2009=\u20090.006, 0.014, and 0.000 for the TV-46046 undiluted, TV-46046 diluted, and Depo-subQ 104 treatments, respectively). Injection site pain was immediate and dissipated quickly as indicated by the mean (SD) scores 1\u2009hour after the injection of 0.2 (0.50), 0.2 (0.50), 0.6 (1.00), and 0.1 (0.29) for the TV-46046 undiluted, TV-46046 diluted, TV-46046 placebo, and Depo-subQ 104 treatments, respectively  scores immediately after injection were 2.1 (1.72), 1.9 (1.46), 3.3 (2.15), and 1.2 (1.40) for the TV-46046 undiluted, TV-46046 diluted, TV-46046 placebo, and Depo-subQ 104 treatments, respectively. While the differences between the three active treatments were not statistically significant, they were significant for each active treatment when compared to TV-46046 placebo (ectively . Over ha3.5Most participants (85.2%) reported at least one AE, many of which were treatment related (55.6%) but could not be attributed to a particular injection. The most frequently occurring AE in all treatment groups was headache. Only one serious AE of cholelithiasis  was reported during the study. It was considered not related to treatment and resolved without sequelae. No deaths or AEs leading to withdrawal occurred during the study.4Although not statistically significant, the rate of ISRs was over 60% higher following SC administration of undiluted TV-46046 compared to Depo-subQ 104. This difference bears careful monitoring in future studies of TV-46046. The most common ISR in our study was mild skin discoloration, specifically hypopigmentation, which occurred in each of the active  treatments but not in TV-46046 placebo, suggesting that MPA is likely responsible for the effect. This hypothesis is supported by the findings from in vitro studies that progesterone can inhibit proliferation of human melanocytes The trend toward a higher number of hypopigmentations associated with undiluted TV-46046, which contained both the highest concentration and dose of MPA, further suggests that the skin discoloration effect of MPA may be dose- or concentration-dependent, or both. Importantly, 38% of hypopigmentations did not resolve within 18\u2009months of follow-up, and for those that did resolve, it took on average 6\u2009months.Our findings are consistent with the results from a recently completed multicenter phase 3 trial of Sayana Press when injected every 4\u2009months Of the four study injections, TV-46046 placebo was the most painful, and Depo-subQ 104 was the least painful. Importantly, injection pain in all groups was minimal and short lived. While injection site pain, given its mild and transient nature, is unlikely to have a major impact on acceptability of the new injectable, future trials should evaluate and provide more conclusive evidence of acceptability and satisfaction with TV-46046.Our study has both strengths and weaknesses. The main strength of our study is its crossover design, which enabled us to test all four study drugs with women serving as their own control. Randomization to 24 unique injection sequences of the four study drugs counterbalanced the potential effects of injection order or abdominal quadrant on study outcomes. Other strengths included the extended follow-up period, allowing us to identify late-onset ISRs that could have been missed in other studies, as well as to assess the time to their resolution. Ethnic homogeneity of our study population is a possible weakness. With more than 96% of study participants being biracial with dark skin, generalizability of our results may be limited. In addition, the reference drug was administered with the needle of a smaller diameter compared with the investigational drug, which may explain lesser pain reported in that group.Based on our findings, we conclude that from the safety standpoint, investigational TV-46046 is appropriate for further clinical testing as a 6-month contraceptive injectable. We also demonstrated that the SC use of MPA is associated with the delayed onset of hypopigmentation at the injection site. While it is not a safety concern and size of skin discolorations is relatively small, its long-term nature may be problematic, especially for users with dark skin. Multiple re-injections, particularly in exposed areas, such as the upper arm, may be considered an undesirable cosmetic defect and adversely impact the acceptability. This previously underreported finding requires further research and acceptability assessment among users of existing Depo-subQ 104 as well as careful monitoring of local tolerability of TV-46046 in future clinical trials.The authors declare that they have no known competing financial\u00a0interests or personal relationships that could have appeared to influence the\u00a0work reported in this article."}
+{"text": "Cardiometabolic risk is high in patients with hypogonadism. Visceral adiposity index (VAI) and triglyceride/high-density lipoprotein cholesterol (TG/HDL-C) ratio are the practical markers of atherosclerosis and insulin resistance and independent predictors of cardiaovascular risk. To date, no study has evaluated VAI levels and TG/HDL-C ratio in hypogonadism. A total of 112 patients with congenital hypogonadotrophic hypogonadism (CHH)  and 124 healthy subjects  were enrolled. The demographic parameters, VAI, TG/HDL-C ratio, asymmetric dimethylarginine (ADMA), high-sensitivity C-reactive protein (hs-CRP), and homeostatic model assessment of insulin resistance (HOMA-IR) levels were measured for all participants. The patients had higher total cholesterol (p = 0.04), waist circumference, triglycerides, insulin, and HOMA-IR levels  than the healthy subjects. VAI and ADMA and TG/HDL-C levels were also higher in patients than in healthy subjects . VAI was weakly correlated with ADMA , HOMA-IR , hs-CRP , and total testosterone  levels, whereas TG/HDL-C ratio was weakly correlated weakly with ADMA , HOMA-IR , and total testosterone  levels. Neither VAI nor TG/HDL-C ratio determined ADMA, HOMA-IR, and hs-CRP levels. The results of this study demonstrate that patients with hypogonadism have elevated VAI and TG/HDL-C ratio. These values are significantly correlated with the surrogate markers of endothelial dysfunction, inflammation, and insulin resistance. However, the predictive roles of VAI and TG/HDL-C ratio are not significant. Prospective follow-up studies are warranted to clarify the role of VAI and TG/HDL-C ratio in predicting cardiometabolic risk in patients with hypogonadism. Hypogonadism is a syndrome characterized by low testosterone levels and a clinical spectrum of poor libido, energy loss, muscle atrophy, and depression. In addition to fertility disturbance, cardiometabolic risk is increased in patients with hypogonadism ,2. ThVisceral adiposity index (VAI) is a mathematical model based on simple anthropometric [body mass index (BMI) and waist circumference (WC)] and metabolic [triglycerides (TG) and high-density lipoprotein cholesterol (HDL-C)] parameters and is considered as a simple surrogate marker of visceral adipose dysfunction . VAI isTo date, no studies have investigated VAI and TG/HDL-C ratio in patients with hypogonadism. Therefore, we designed the present study to answer the following questions: 1. Do VAI and TG/HDL-C ratio differ between patients with hypogonadism and healthy subjects? 2. Are insulin resistance, inflammation, and endothelial dysfunction associated with VAI and TG/HDL-C ratio?This retrospective analysis was performed by evaluating the database of the Department of Endocrinology and Metabolism, Gulhane Military Medical Academy School of Medicine, Ankara, Turkey. Military service is compulsory for all young men in Turkey, and Gulhane Military Medical Academy School of Medicine is the tertiary medical center for military recruits. Patients with hypogonadism are referred to the Department of Endocrinology and Metabolism for both treatment and follow-up. Some of these patients, generally those living in rural regions, have never received treatment. A total of 273 young patients with hypogonadism were registered between 2007 and 2012. Of these, 64 patients were excluded because of a history of androgen replacement; 27 because of high testosterone levels (200\u2013300 ng/dL); 16 because of liver, kidney, or pulmonary disease; 22 because of a diagnosis other than hypogonadotropic hypogonadism ; and 32 because of incomplete data on demographic and metabolic parameters. A total of 112 treatment-naive patients  with congenital CHH were included. The control group included 124 age- and BMI-matched healthy subjects .A portion of the data for this study population was previously published -11. N2). WC was measured on the line between the iliac crest and the lower costal margin parallel to the ground after subjects exhaled. The pubertal developments of the subjects were assessed according to the Tanner stages. CHH diagnosis was based on a history of failure to undergo spontaneous puberty before 18 years of age and was confirmed with tests demonstrating low serum total testosterone and normal or low gonadotropin levels. Pituitary hormones were evaluated in all patients to exclude panhypopituitarism, and pituitary or hypothalamic mass lesions were excluded by evaluation with magnetic resonance imaging.Detailed medical histories of all patients were obtained before the study. Height, weight, and WC were measured with the subjects in their underwear. BMI was computed as the ratio of weight to the square of height . Low-density lipoprotein cholesterol level was calculated using Friedewald\u2019s formula . Results are expressed as means \u00b1 standard deviation. The variables were assessed for normality using the Kolmogorov\u2013Smirnov test, and the equality of variance was evaluated using the Levene\u2019s test. Inter-group differences were analyzed using the Student\u2019sp= 0.04); WC, TG, insulin, and HOMA-IR levels ; and ADMA and TG/HDL-C levels and VAI . VAI were weakly correlated with ADMA , HOMA-IR , hs-CRP  levels, whereas TG/HDL-C ratio was weakly correlated with ADMA , HOMA-IR  levels. In a stepwise linear regression analysis, neither VAI nor TG/HDL ratio remained in the model to be independent determinants of ADMA or HOMA-IR levels. Total testosterone level was the only significant independent determinant of ADMA level, whereas WC was an independent determinant of HOMA-IR level.The demographic and biochemical characteristics of the patients and control subjects are given inThe results of the present study show that patients with hypogonadism have significantly higher VAI and TG/HDL-C ratio than control subjects. Moreover, VAI and TG/HDL-C ratio are significantly correlated with endothelial dysfunction, insulin resistance, and inflammation (VAI only). However, neither VAI nor TG/HDL-C ratio is applicable as the independent predictor of endothelial dysfunction, inflammation, or insulin resistance in patients with CHH.Cardiovascular and metabolic disorders, such as obesity, dyslipidemia, hypertension, and type 2 diabetes mellitus, are prevalent in patients with hypogonadism -27, bVAI has been recently developed as a novel sex-specific index based on WC, BMI, TG, and HDL-C . VAI isTG/HDL-C ratio is another clinical indicator of insulin resistance and has been evaluated as a predictor of diabetes and coronary heart disease -36. TADMA is an endogenous inhibitor of nitric oxide synthase and a well-known surrogate marker of endothelial dysfunction . ElevatOur results show that VAI and TG/HDL-C ratio are significantly increased in patients with hypogonadism and are related to markers of inflammation, insulin resistance, and endothelial dysfunction. However, the roles of VAI and TG/HDL-C ratio in predicting endothelial dysfunction, inflammation, and insulin resistance are not sufficiently robust for these parameters to be applicable in clinical practice to predict cardiometabolic risk in patients with hypogonadism. According to the results, total testosterone level and WC are the only independent determinants of endothelial dysfunction and insulin resistance, respectively.This study has both limitations and advantages. The study population comprising young, treatment-na\u00efve patients with CHH may not be representative of the general population of patients with hypogonadism. Our small sample size may be another limitation. However, because few patients with hypogonadism reach adulthood without receiving treatment, we believe that the number of the patients in our study is adequate because of the unique conditions of the study population. The advantages of the present study are its homogeneous study population and the lack of confounding factors, such as chronic metabolic disorders and concomitant medications.In conclusion, the present study shows that patients with hypogonadism have elevated VAI and TG/HDL-C ratio, which are significantly correlated with the surrogate markers of endothelial dysfunction, inflammation, and insulin resistance. However, the predictive roles of VAI and TG/HDL-C ratio for endothelial dysfunction, inflammation, and insulin resistance are not significant. Prospective follow-up studies are warranted to clarify the role of VAI and TG/HDL-C ratio in determining cardiometabolic risk in patients with hypogonadism."
\ No newline at end of file