diff --git "a/deduped/dedup_0379.jsonl" "b/deduped/dedup_0379.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0379.jsonl"
@@ -0,0 +1,41 @@
+{"text": "Cremophor EL, a pharmacologically inactive solubilising agent, has been shown to reverse multidrug resistance (MDR). Using flow cytometric evaluation of equilibrium intracellular levels of daunorubicin (DNR), we found that eight other surface active agents will also reverse MDR. All the active detergents contain polyethoxylated moieties but have no similarities in their hydrophobic components. The properties of three polyethoxylated surfactants that showed the lowest toxicities, Cremophor, Tween 80 and Solutol HS15, were examined in more detail. The concentrations of Tween 80 and Solutol required to reverse DNR exclusion were 10-fold lower than for Cremophor. However while concentrations greater than or equal to 1:10(2) of the former two surfactants resulted in breakdown of cells, even 1:10 of Cremophor did not lyse cells. Studies of the effects of Cremophor on the uptake and efflux of DNR in normal and MDR cell types showed that Cremophor increases intracellular DNR primarily by locking the rapid efflux from the cells. This blockage of drug efflux may be mediated by a substantial alteration in the fluidity of cell membranes induced by Cremophor, as shown by decreased fluorescence anisotropy of a membrane probe. Consistent with these data, coinjection of adriamycin plus Cremophor into mice carrying a multidrug resistant P388 transplantable tumour significantly increased the survival time of the mice compared with adriamycin treatment alone."}
+{"text": "The remaining coordination sites are occupied by two N atoms from one 1,10-phenanthroline (phen) and two O atoms from an L ligand. The six 6-hydr\u00adoxy-1-naphthoate groups coordinate each EuIII atom in three different ways, namely \u03bc2-\u03b71:\u03b71-bridging, \u03bc1-\u03b71:\u03b71-chelating, and \u03bc2-\u03b71:\u03b72-chelating/bridging modes. Adjacent discrete dinuclear units are linked into a two-dimensional sheet parallel to (011) by inter\u00admolecular O\u2014H\u22efO hydrogen-bonding inter\u00adactions. The sheets are cross-linked by water mol\u00adecules, forming a three-dimensional network. In addition, \u03c0\u2013\u03c0 stacking inter\u00adactions, with a centroid\u2013centroid separation of 3.547\u2005(2)\u2005\u00c5 are observed.The title complex, [Eu DOI: 10.1107/S1600536809046091/ci2947Isup2.hklStructure factors: contains datablocks I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "Chronic diseases represent a major challenge for health care and social services. A number of people with chronic diseases require more services due to characteristics that increase their vulnerability. Given the burden of increasingly vulnerable patients on primary care, a pragmatic intervention in four Family Medicine Groups  has been proposed for individuals with chronic diseases  who are frequent users of hospital services. The intervention combines case management by a nurse with group support meetings encouraging self-management based on the Stanford Chronic Disease Self-Management Program. The goals of this study are to: (1) analyze the implementation of the intervention in the participating practices in order to determine how the various contexts have influenced the implementation and the observed effects; (2) evaluate the proximal  and intermediate  effects of the intervention on patients; (3) conduct an economic analysis of the efficiency and cost-effectiveness of the intervention.The analysis of the implementation will be conducted using realistic evaluation and participatory approaches within four categories of stakeholders . The data will be obtained through individual and group interviews, project documentation reviews and by documenting the intervention. Evaluation of the effects on patients will be based on a pragmatic randomized before-after experimental design with a delayed intervention control group (six months). Economic analysis will include cost-effectiveness and cost-benefit analysis.The integration of a case management intervention delivered by nurses and self-management group support into primary care practices has the potential to positively impact patient empowerment and quality of life and hopefully reduce the burden on health care. Decision-makers, managers and health care professionals will be aware of the factors to consider in promoting the implementation of this intervention into other primary care practices in the region and elsewhere.NCT01719991 Because of their high prevalence and significant effects, chronic diseases (CD) pose a major challenge for health care and social services, for society and for the persons affected . These iA number people with CD require higher intensity care because of personal characteristics that increase their vulnerability. This applies especially to the socioeconomically disadvantaged ,11 and tminist\u00e8re de la sant\u00e9 et des services sociaux du Qu\u00e9bec  to improve accessibility, continuity, and coordination of health care in Quebec [In 2004, Family Medicine Groups (FMG) were implemented by the n Quebec . A FMG in Quebec . Since tn Quebec . The curn Quebec , due, amCentre de sant\u00e9 et de services sociaux (CSSS)  of the SLSJ region, including the two CSSS participating in the project. Without being formally evaluated, an assessment of their programs has brought to light several positive points [A major consultation process conducted in 2010 on the organization of CD services in the Saguenay-Lac-Saint-Jean (SLSJ) region of Qu\u00e9bec, identified two potential solutions to meet the challenges posed by vulnerable patients with CD who frequently use hospital services : (1) Impe points : a signiAgence de sant\u00e9 et de services sociaux of the SLSJ region  and the two partner CSSS proposed to implement similar and complementary primary care interventions to allow vulnerable patients with CD to benefit from case management by a nurse within their FMG. The expansion of case management within FMG will allow, together with the case management services already offered by the CSSS, a better response to the complex needs of vulnerable patients, as well as improved services integration. Case management will be performed in the primary care setting, the FMG, ensuring a better collaboration between case management nurse and family doctor [Faced with the growing needs and primary care challenges posed by increasingly vulnerable patients, the y doctor . The preThe proposed intervention seeks to address many of the challenges posed by CD, based on scientific evidence. First, case management by primary care nurses has proven to be effective for various CD -27. In fTo date, strategies to support self-management remain poorly implemented in FMG. However, the positive effects of self-management support groups, such as the Stanford Chronic Disease Self-Management Program, are widely recognized ,30. ThesThis project aims to document the implementation and effects, within four FMG of the SLSJ region , of a pragmatic intervention involving case management by a nurse to promote interdisciplinary person-centred follow-up and group self-management support for frequent users of hospital services  with CD . The evaluation of the intervention has three objectives: (1) to analyze the implementation of the intervention within the existing structures of the four participating FMG in order to: (a) Explain how the various contexts have influenced the implementation of the intervention and the observed effects, and (b) Identify elements that can be assessed and applied in order to improve the intervention and to promote its implementation in other FMG; (2) to evaluate the proximal  and intermediate  effects of this intervention among patients; (3) Conduct an economic analysis of the cost-effectiveness and cost-benefit of the intervention.The theoretical framework of the intervention is based on two conceptual models. One supports the methodology of the clinical intervention, and the other supports the implementation process, change management, and knowledge transfer.The first model is that of the UK National Health Service on innovation in health care and social services for people with CD . This moPromoting Action on Research Implementation in Health Services (PARiHS) [The second model the (PARiHS) ,39. AccoStemming from the theoretical framework described above, the components and activities of the intervention are shown in the logic model presented in Figure\u00a0The first component of the intervention is the follow-up offered under the case management process, which is seen as a collaborative, dynamic and systematic approach to ensure and coordinate care and services for a defined clientele based on interdisciplinary practice. Here the nurse evaluates, plans, implements, coordinates and prioritizes options and services according to patient health needs, in close collaboration with the involved partners . The intThe main duties and responsibilities of nurses in case management will be to: (1) Evaluate the patient\u2019s situation and needs and involve the family, with the patient\u2019s consent; (2) Identify which partners of the CSSS and of the community network to involve; (3) Jointly plan patient follow-up by establishing an ISP with the partners and with the active participation of the patients and family \u2014 minimum of two ISP per patient: one to initiate the intervention and the other approximately 3 months later; (4) Negotiate the services and defend the rights and interests of the individual; (5) Coordinate care and services; (6) Monitor the ISP application; (7) Educate and support the person. The ISP formulation stage will be oriented towards a self-management support approach that will emphasize the following: the patient\u2019s potential; setting objectives according to his or her perspective; developing problem-solving skills; and using the patient\u2019s usual support system . Home viThe intervention will be implemented in each FMG by two nurses. Given the expertise of the nurses already working in the FMG and their established relationships with the medical teams and partners , it is preferable that they implement the intervention rather than nurses hired for this project. This also promotes the sustainability of the intervention in the participating FMG. Nurses selected to conduct the intervention will receive five days of theory and practical training specific to case management and self-management support, provided by the Clinical Project Coordinator (described in following paragraph). Family doctors will be actively sought throughout the intervention to: identify participating patients, problems and intervention priorities, participate in ISP preparation meetings (in person or by having shared their perspective with the nurse prior to the meeting), and provide the medical components of ISP implementation. Partners include the CSSS professionals identified based on the needs of participants, such as psychosocial service providers  currently involved in a patient\u2019s care, or additional professional resources specializing in CD management . The partners also include community organizations , patient associations and community pharmacists.A Clinical Project Coordinator with experience in case management will be hired to coordinate and facilitate the implementation of the intervention (including change management). She will be responsible for: (1) setting up the intervention  leaders for the self-management group support program, organization of support groups, scoping of organizations and community associations in the region and establishing the first contact to ensure their cooperation, etc.), including the communication plan to prepare participating FMG and all partners, in order to facilitate change management; and (2) ensuring the implementation and proper roll-out of the intervention . The Clinical Project Coordinator will be responsible for clinical governance in coordinating care within the network of each CSSS . This clhttp://patienteducation.stanford.edu) to support people living with chronic conditions, the standardized curriculum, materials and program implementation, have made it the most accessible program for clinical and research applications [My Toolbox program (http://mytoolbox.mcgill.ca) at McGill University will train lay leaders according to the Standard four-day training program. These lay leaders will conduct a complete simulation exercise with volunteer patients from their FMG to familiarize themselves with, and standardize, the process before conducting meetings with study participants. Two sessions of the self-management group support program will be implemented in each FMG. These meetings will take place at different times, depending on the availability of participants.The second component of the intervention consists of group meetings (10\u201312 participants) for self-management support in accordance with the Stanford program . Developications . An estiications ,33. The The evaluation of the intervention is based on a mixed design of complex health intervention evaluations . It focuThis analysis will be based on two approaches: a realistic evaluation and a practical participatory approach. Consistent with the PARiHS conceptual framework, a realistic evaluation will help explain how different FMG, presenting a variety of practice environments from various perspectives, influence the implementation and the effects observed . The reaA multiple-case study  will be The pre-implementation phase will describe the context of the intervention regarding: (1) the characteristics of the environment ; (2) the operation and integration of existing services, as well as participant satisfaction; (3) the issues related to the implementation as identified through group discussions. Focus groups will involve FMG doctors , patients and their families  and partners considered to be key participants (n = 4). Individual interviews will be conducted with FMG and CSSS managers (n = 6) and FMG nurses (n = 8).The implementation phase will identify the changes in FMG processes (mechanisms) and the integration of services mid-way through the implementation in addition to learning about the obstacles and challenges encountered, as reported through focus groups with FMG stakeholders (n = 6) and obtained from individual interviews with FMG and CSSS managers (n = 6). Documentation from meetings of the advisory committee and from meetings between the Clinical Project Coordinator and nurses or managers, etc., will be obtained and analyzed in order to identify obstacles and challenges, and adjustments made along the way. An evaluation of the fidelity of the intervention will be conducted to document the degree to which the intervention was implemented; this will vary with the needs of participating patients . After eThe post-implementation phase will describe the implementation process, the obstacles and enabling factors, the effects of the intervention on stakeholders/organizations, and the satisfaction of key players. This will be accomplished through focus groups with FMG physicians (n = 6), patients and their families (n = 8) and partners considered key informants (n = 4), and individual interviews with FMG and CSSS managers (n = 6) and with FMG nurses (n = 8).Data collected from the key stakeholders will be analyzed in three steps according to a qualitative content analysis procedure to identify emerging themes and trends: coding, sorting of documentation by content, and analysis. Driven by the data, inferences will be drawn and information units will be compared . This coThe evaluation of the effects on patients will be based on a pragmatic randomized experimental design with delayed intervention for the control group and measurements taken before and after the intervention (at six-month follow-up). This allows to evaluate interventions in actual clinical settings to maximize their generalizability . ImplemeTargeted patients will be those described in the objectives. The concept of vulnerability will be operationalized by considering both the frequency of the CSSS care use  and patient vulnerability characteristics, based on the judgment of the primary care team in the FMG. This combined approach was proposed as a more favourable strategy for patient identification for this kind of intervention, when compared to using each one of these strategies in isolation . Steps tAfter verifying patient eligibility and obtaining their consent, participants will be allocated to one of two groups  according to a three-stage randomization process : (1) genThe variables defined within the logic model will be measured using instruments that are well known and have been validated in studies similar to the one proposed.Self-Efficacy for Managing Chronic Disease scale [Self-monitoring and Insight sub-scale of the health education impact questionnaire , T1 (3 months) and T2 (6 months) for both groups  selre  re  patn Measure; and (5)ess Scale.Intermediate outcomes, evaluated at T0 and T2  [Disease Burden Morbidity Assessment (DBMA) [A number of covariables will also be documented (T0) to describe participant characteristics: (1) socioeconomic status with family income and patient perceptions of his or her economic situation; (2) social isolation, measured with the social isolation subscale of the h Profile; (3) litital Sign; (4) mene (HADS) ,71; and t (DBMA) . French The evaluation component will be conducted according to the study plan described in Table\u00a0When analyzing quantitative data, we must take into account that part of the effect is potentially associated with each of the eight case management nurses. The intra-nurse or intracluster correlation (\u03c1) is unknown, however, and is specific to each variable. On the other hand, given that series of standardization measures will be implemented to minimize nurse-specific effects, we anticipate that the intracluster correlation will not be higher than 0.10. Sample size was therefore calculated using this maximal anticipated \u03c1-value. Results indicated that a standardized effect size (ES) of 0.5  will beAll statistical analyses will be performed based on an intent-to-treat principle. We will first describe the characteristics of participants in each group, using means and standard deviations (continuous variables) or percentages . The groups will be compared at baseline (T0) using Student\u2019s T test or the Chi-square test. Wherever possible, comparisons will be made between patients who agreed to participate in either phase of the study and those who refused, in order to document biases related to refusals. For outcome indicators at 3 months , groups will be compared at T1 using analysis of covariance adjusted for T0 scores. For indicators measured at six months , repeated measures analysis of variance will compare change over time in the two groups. In all cases, if the groups initially differ with regard to certain characteristics despite randomization, analysis will be adjusted to take into account the relevant variables. In addition, if a nurse effect is present (non-null intracluster correlation), despite efforts at standardization, multi-level analysis will be conducted to take this into account.The economic analysis of the intervention will focus on a cost-effectiveness and a cost-benefit analysis. The implemented intervention and the usual care will be compared in each of these analyses.The cost-effectiveness analysis (CEA) will compare the relative costs invested and effects of implemented intervention and usual care. On the other hand, the cost-benefit analysis will indicate the savings per dollar invested in the implemented intervention in terms of the benefit/cost ratio. Benefits will be assessed by assigning a monetary value to the effects. Because of the ethical and methodological problems in the assignment of a monetary value to quality of life, morbidity and mortality ,78, the Cost analysis. Cost analysis will be performed from an organizational perspective; that is, only costs related to the FMG and CSSS will be outlined. The costs of the intervention and of usual care will be identified. For the experimental group, the average nurse\u2019s salary for the time devoted to intervention will be obtained (average cost per patient). The data on services obtained from the CSSS  and from the FMG  during the six-month follow-up will also be obtained and their monetary value will be estimated, using the average cost per patient for both groups. (2) Measurement of effectiveness. Data collected as part of the impact evaluation (intermediate outcomes) will be used to document the effects of the intervention on empowerment, quality of life, and use of services . The effects will be measured in terms of the empowerment gained, quality of life gained, and, the reduction in use of services. (3) Efficiency analysis. Costs and effects will be compared, in order to identify whether the intervention or the usual care leads to better effectiveness at lower cost. Incremental cost-effectiveness ratios (ICER = \u0394 Effectiveness/\u0394 Costs) will be calculated. This component will address the following three questions: (1) How much does it cost to improve empowerment? (2) How much does it cost to improve quality of life? (3) How much does it cost to decrease use of CSSS or FMG services? (4) Cost-benefit analysis. A cost-benefit analysis will be performed if a reduction in the use of services is documented . The cost differential of the cost of services avoided, related to a reduction in the use of services for the number of patients surveyed (\u0394 benefits), will be compared to the cost differential of the intervention and the usual care (\u0394 costs) so as to assess whether the new intervention is cost-effective. We will calculate the gain per dollar invested in the intervention by estimating the \u0394 benefit/\u0394 cost ratio. If this ratio is greater than 1, a gain will be indicated; otherwise, a break-even point will be estimated by evaluating the minimum cost at which the intervention will become cost-effective. This analysis would also estimate the caseload for obtaining a break-even point and for identifying the profile of patients for whom the intervention was more cost-effective. (5) Sensitivity analysis. Since many uncertainties are generally present in the economic and effectiveness data, it will be important to complete the analysis by: (1) identifying and explaining the sources of uncertainty; and (2) performing sensitivity analyses by varying the value of specific parameters related to the sources of uncertainty, in order to assess the robustness of outcomes [(1) outcomes ,79, and This study was approved by the Research Ethics Board (REB) of the CSSS de Chicoutimi for both CSSS. Informed consent will be obtained from all participants. The six-month wait for the intervention for the control group has a negligible effect given the chronic nature of the conditions for which the intervention is proposed. Specific consent will be sought from each participating patient for access to their administrative health data and its use by the parties involved in the study. Confidentiality will be respected and data security ensured according to the rules in force within both CSSS and by the Research Ethics Board of the CSSS de Chicoutimi. Any publication resulting from this research will respect patient confidentiality.The integration of case management by nurses and of self-management support groups into the FMG has the potential to impact patients positively, as outlined in the logic model. The long-term effects described therein cannot be measured due to the program's short timeframe, but may be confidently assumed from the evidence provided in the literature. FMG nurses will be able to continue to offer the intervention in their FMG after the implementation of the intervention. The caseload numbers that provide an optimal cost-benefit and a positive outcome profile for target patients will inform decision-makers and managers on the human and financial resources required to achieve optimal outcomes. In addition, decision-makers, managers and health care professionals will be aware of the factors to consider that favour the implementation of this intervention in FMG and other CSSS of the region and throughout Quebec.The study design will not allow us to determine the individual effects of each component (case management and self-management group support) of the intervention. It was conceived in order to evaluate the addition of the self-management component for some patients who can benefit from it according to primary care practitioners\u2019 perspective. Independent applications for funding are planned in order to evaluate the effects of each component in a near future. A contamination bias could occur between the case management nurses and the nurses involved with the patient control group. Several precautions will be taken to minimize this bias. First, no nurse will monitor both experimental group and control group. Discussions between nurses caring for the groups will be kept to a minimum with respect to the intervention and the new follow-up methods developed during the first six months of implementation. The implementation analysis will shed a qualitative light on this phenomenon. The presence of eight case management nurses raises the possibility of a \u201ccluster\u201d effect at the analysis level, which will be verified. However, this should be minimal since many precautions will be taken to reduce it: proper training of eight case management nurses to ensure standardization; the important role of the Clinical Project Coordinator in maintaining a comparable level of intervention among the eight nurses; regular discussions (every 1.5 months) among case management nurses. Repeat surveys induce a learning effect; however, the time-lapse between each survey questionnaire will be sufficient for the effect to be minimal. Regarding external validity, the pragmatic nature of the effects evaluation favours generalization. Analysis of the implementation process will identify the factors to be considered and the conditions to be put into place to support implementation of the intervention in other Quebec FMG.Centre de sant\u00e9 et de services sociaux / Health and social services centre; DBMA: Disease Burden Morbidity Assessment; DR: Documentation review; ES: Effect size; FMG: Family medicine group; FG: Focus group; FTE: Full-time equivalent; HADS: Hospital Anxiety and Depression Scale; heiQ: Health Education Impact Questionnaire; IFC: Intervention fidelity checklist; II: Individual interviews; ISP: Individualized service plan; PARiHS: Promoting Action on Research Implementation in Health Services; PRECISE: Program of research on the evolution of a cohort investigating health system effects; SLSJ: Saguenay-Lac-Saint-JeanCD: Chronic disease; CSSS: Fonds de recherche du Qu\u00e9bec - Sant\u00e9 (FRQ-S) or the minist\u00e8re de la sant\u00e9 et des services sociaux (MSSS) - had any role in preparing, reviewing or approving the manuscript. They will not be involved in the collection, analysis or interpretation of the data.This project is funded by the Pfizer-FRSQ-MSSS chronic disease fund. None of the funding agencies - Pfizer, MCC and CH contributed to the conception and design of the study and wrote the draft manuscript. MFD wrote the statistical methods and reviewed drafts of the manuscript. PR, MF and CL contributed to the description of vulnerable patients and measurement tools. They also reviewed and commented drafts of the manuscript. ET wrote the method on the economic evaluation and reviewed drafts of the manuscript. MF, EMC and MS revised the protocol to ensure the applicability of the intervention and that the methodology corresponds to the pragmatic perspective of the trial in the context of the primary care practices in which they are involved. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/13/49/prepub"}
+{"text": "In agreement with the current trend of giving value to natural and renewable resources, the use of natural antimicrobial compounds, particularly in food and biomedical applications, becomes very frequent. The direct addition of natural compounds to food is the most common method of application, even if numerous efforts have been made to find alternative solutions to the aim of avoiding undesirable inactivation. Dipping, spraying, and coating treatment of food with active solutions are currently applied to product prior to packaging as valid options. The aim of the current work is to give an overview on the use of natural compounds in food sector. In particular, the review will gather numerous case-studies of meat, fish, dairy products, minimally processed fruit and vegetables, and cereal-based products where these compounds found application. Listeria monocytogenes, Escherichia coli O157, Salmonella, Staphylococcus aureus, Bacillus cereus, Campylobacter, Clostridium perfringens, Aspergillus niger, and Saccharomyces cerevisiae are affected by a variety of intrinsic factors, such as pH and presence of oxygen or by extrinsic factors associated with storage conditions, including temperature, time, and relative humidity , enzymes obtained from animal sources , bacteriocins from microbial sources , organic acids  and naturally occurring polymers (chitosan). In this context, plant essential oils are gaining a wide interest in food industry for their potential as decontaminating agents, as they are Generally Recognized as Safe (GRAS). The active components are commonly found in the essential oil fractions and it is well established that most of them have a wide spectrum of antimicrobial activity, against food-borne pathogens and spoilage bacteria   Vaara, .Organic acids and their salts are widely used as chemical antimicrobial agents because their efficacy is generally well understood and cost effective. The most effective organic compounds are acetic, lactic, propionic, sorbic, and benzoic acid. Their antimicrobial effect is based on the increase in proton concentration thereby lowering the external pH. Organic acids may affect the integrity of microbial cell membrane or cell macromolecules or interfere with nutrient transport and energy metabolism, causing bactericidal effect Ricke, . ProductAmong the natural antimicrobials, chitosan also received considerable interest for commercial applications. It has been used in medical, food, agricultural, and chemical industry, mainly due to its high biodegradability and antimicrobial properties. The biological activity of chitosan depends on its molecular weight, degree of deacetylation and derivatisation, such as degree of substitution, length, and position of a substitute in glucosamine units of chitosan, pH of chitosan solution and the target organisms . Dipping combined with CA treatment prevented product weight loss and increased polyphenol oxidase activity; regarding microbiological quality, the combined strategies prevented microbial growth after 5 days of storage at 5\u00b0C. The antimicrobial effects of propionic, acetic, lactic, malic, and citric acid against E. coli O157:H7, S. Typhimurium, and L. monocytogenes on whole red organic apples and lettuce were also clearly demonstrated by Park et al. . The active compounds were incorporated into an alginate-based edible coating. Melon pieces were inoculated with a S. Enteritidis (108 CFU/ml) culture before applying the coating. The incorporation of essential oils or their active compounds into the edible coating prolonged the microbiological shelf-life by more than 21 days. Pure citral and citron essential oil were added in the syrup of industrial ready-to-eat fruit salads stored at 9\u00b0C. Both citral (25\u2013125 ppm) and citron essential oil  were able to prolong the microbial shelf-life. Citron essential oil doubled the time needed for the wild microflora to reach concentrations able to produce a perceivable spoilage in condition of thermal abuse (9\u00b0C). The same essential oil showed a strong inhibition against L. monocytogenes, but exerted limited effects on the survival of S. Enteritidis and E. coli , psychrotrophs (3.9 log cfu g\u22121), lactic acid bacteria (3.1 log cfu g\u22121), yeasts and molds (1.1 log cfu g\u22121), and total coliforms (3.8 log cfu g\u22121). An edible coating containing chitosan was also applied on carrot sticks to maintain quality and prolong the shelf-life , aseptic packaging or use of weak acids exclude yeast spoilage. As alternative to these traditional artificial preservatives the use of natural compounds was proposed in the literature , and terpinen-4-ol (marjoram), the cyclic monoterpenes \u03b1-pinene (juniper) and limonene (lemon)  and different amounts of EDTA , and stored at 4 \u00b1 1\u00b0C for 8 days. The packaging system significantly inhibited growth of coliforms and Pseudomonadaceae, without affecting the typical lactic acid bacteria. Conte et al. (2:N2), thus demonstrating that these compounds were valid to prolong cheese shelf life, especially at high lysozyme concentrations.The effectiveness of lysozyme and EDTA on microbiological shelf life of mozzarella cheese was studied by Sinigaglia et al. . Mozzaree et al.  also evaL. monocytogenes in Ricotta cheese. The system not only help in retarding the growth of L. monocytogenes but also help in the maintenance of water content, therefore reducing cheese weight loss  were effective in controlling spoilage microorganisms. Eleven essential oils were evaluated in vitro for their antibacterial properties against Vancomycin-resistant Enterococci and E. coli O157:H7  combined with MAP were also tested by Govaris et al.  to classic Karish cheese at a rate of 0.3% (w/v) was realized in a study conducted by Hosny et al.  was suggested to control L. monocytogenes and E. coli growth and also to extend the shelf life of naturally contaminated ground chicken meat  added individually or in combination with nitrites (150 ppm) as ingredients was tested to protect fresh pork sausages from microbial spoilage. Its application as active coating was demonstrated  and citric acid (250 ppm) individually or in combination, packaged under MAP and vacuum and stored at 1\u00b0C were studied by Huang et al. . AscorbiE. coli, total psychrophilic bacteria, Pseudomonas spp., yeast and molds) and extended shelf life to 10 days  were also tested to increase shelf life of some bakery products. Preliminary results showed that both Gram-positive and Gram-negative bacteria were sensitive to all tested essential oils and phenolic compounds  and toxicology . These strategies have produced many valuable drugs and are likely to continue to produce lead compounds. It must be stated that traditional medicines have not been found by systematic research but by a combination of coincidence and observation, and at best by trial and error. In order to further promote the application of natural active compounds at industrial level, some factors are of striking importance. First of all it is necessary to have a good understanding of the mechanism by which antibacterial agents operate. For many natural compounds these information are still lacking. Better understanding of the modes by which antimicrobials can control microorganisms should provide solid grounds for engineering new and upgraded derivatives with optimized potency and stability. Further research is still necessary for specific case-study because it is well demonstrated that the combination of more than one active agent not always amplifies the antimicrobial effects. Very often, the combined use of some natural essential oils did not induce synergistic effects. So, generally specking some considerations must be taken into account before using antimicrobials in food preservation. One of them is the possible existence of interactions between compounds and food components. Moreover, also the adoption of active compounds under MAP conditions could exert different effects depending on the product.In the specific case of essential oils, despite their great potential, their use in food preservation remains limited mainly due to their intense aroma and toxicity problems. Several authors have reported changes in the organoleptic properties of the food when these oils are used. To minimize the required doses and improve the effectiveness of active coatings enriched with essential oils, interesting options would be micro- and nanoencapsulation of active compounds. In addition, the use of combinations of different food preservation systems, such as the use of proper temperature, could represent another solution to the above-mentioned problem. As regards toxicity, the ingestion of high doses of essential oils can induce serious problems. Thus, it is necessary to find a balance between the effective compound dose and the risk of toxicity. It is also worth noting that the use of essential oils remains expensive, so from an economic point of view this preservation strategy needs further enhancement. Moreover, more specific ISO standards are also necessary to assess the legal aspects to set out the definition, the general rules for their use, the requirements for labeling and the maximum levels authorized.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Stellifer, Odontoscion, Ophioscion, and Bairdiella) were evaluated using 2723 base pairs comprising sequences of nuclear  and mitochondrial (16S rRNA and COI) markers obtained from specimens of nine species. Our results indicate a close relationship between Bairdiella and Odontoscion, and also that the genus Stellifer is not monophyletic, but rather that it consists of two distinct lineages, one clade containing S. microps/S. naso/S. brasiliensis and the other, S. rastrifer/S. stellifer/Stellifer sp. B, which is closer to Ophioscion than the former clade. The O. punctatissimus populations from the northern and southern Brazilian coast were also highly divergent in both nuclear (0.8% for rhodopsin and 0.9% for RAG-1) and mitochondrial sequences (2.2% for 16S rRNA and 7.3% for COI), which we conclude is consistent with the presence of two distinct species. The morphological similarities of the members of the Stellifer group is reinforced by the molecular data from both the present study and previous analyses, which have questioned the taxonomic status of the Stellifer group. If, on the one hand, the group is in fact composed of four genera , one of the two Stellifer clades should be reclassified as a new genus. However, if the close relationship and the reduced genetic divergence found within the group is confirmed in a more extensive study, including representatives of additional taxa, this, together with the morphological evidence, would support downgrading the whole group to a single genus. Obviously, these contradictory findings reinforce the need for a more systematic taxonomic revision of the Stellifer group as a whole.The phylogenetic relationships within the Stellifer group of weakfishes ( The family Sciaenidae includes approximately 70 genera and 270 species of demersal fishes found mainly over muddy or sandy bottoms of the continental shelf of the Atlantic, Indian, and Pacific oceans, as well as freshwater genera in the rivers of the Old and New Worlds Micropogonias, Nebris, Pogonias, Sciaenops, Larimus, Sciaena, Umbrina, Menticirrhus, Lonchurus, Cynoscion, and Stellifer. Of these groups, Stellifer can be distinguished from all the others by the presence of two (rather than one) pairs of large otoliths and a swim bladder with two (rather than one) chambers.Chao The Stellifer group includes four genera \u2013 Stellifer, Ophioscion, Bairdiella, and Odontoscion \u2013 represented by 12 species in the western South Atlantic: Stellifer naso, S. griseus, S. venezuelae, S. brasiliensis, S. microps, S. rastrifer, S. stellifer, Stellifer. sp. A, Stellifer. sp. B, Odontoscion dentex, Ophioscion punctatissimus, and Bairdiella ronchus Bairdiella, Stellifer, Ophioscion, and Odontoscion, although intergeneric and interspecific relationships have yet to be defined conclusively due to the limitations or inconsistencies found in the data, as described below.Species of the Stellifer group are widely distributed in the western Atlantic, where they are abundant in coastal and estuarine waters with sandy or muddy bottoms Stellifer is most closely related to Ophioscion, with Bairdiella appearing as a sister group to Odontoscion. In a subsequent morphological study, Sasaki Ophioscion and Stellifer are sister groups which form a clade with Bairdiella, whereas Odontoscion is related to the sciaenids of the eastern Pacific, Elattarchus and Corvula.The first phylogeny based on morphological traits was proposed by Chao Stellifer and Bairdiella, although they did not include Ophioscion or Odontoscion in their analyses, impeding the systematic assessment of the evolutionary relationships within the group. In a recent study based on both mitochondrial (COI and 16S rRNA) and nuclear markers (TMO-4C4), Santos et al. Stellifer is a sister group of Ophioscion and that Bairdiella is the basal taxon within the group, confirming the proposal of Sasaki Odontoscion was not included in the analyses. Additionally, the relationships among the Stellifer species remain unclear, given that, in Vinson et al. S. microps is a sister group to S. naso and S. rastrifer is closely related to S. stellifer, whereas in Santos et al. S. rastrifer is a sister group to Stellifer sp., and S. stellifer is more closely related to O. punctatissimus.In a phylogenetic study based on 16S rRNA sequences, Vinson et al. Stellifer species. Given this, the present study evaluates the phylogenetic relationships within the Stellifer group, including all of its genera, using nuclear  and mitochondrial (16S rRNA and COI) markers, all of which have been widely used in phylogenetic reconstructions of fish taxa In addition to the divergences in the conclusions of the morphological studies regarding the intergeneric relationships within Stellifer group, then, there are also disagreements among molecular phylogenies, especially with regard to the relationships among the The species analyzed in the present study are not endangered or protected in the regions from which samples were obtained. The specimens were captured by artisanal fishers and processed  with the authorization of the Brazilian Environment Ministry through permit number 12773\u20131 emitted in the name of Dr. Iracilda Sampaio. All work was performed in compliance with and approved by the Ethics Committee of the Federal University of Par\u00e1.A total of 36 samples representing nine species of the four genera of the Stellifer group distributed in the western South Atlantic were collected along the Brazilian coast . Most ofTotal DNA was extracted by using the Wizard genomic DNA purification kit  following the protocol for extraction from muscle tissue as defined by the manufacturer. To evaluate the quality of the DNA, samples were electrophoresed in 1% agarose gel stained with GelRed  and analyzed under a UV transilluminator.2 (50 mM), 1 \u00b5l of DNA (100 ng/\u00b5l), 1 \u00b5l of each primer (50 ng/\u00b5l), 0.2 \u00b5l of Taq DNA Polymerase , and sterile water to complete the final volume. The PCR products were run on an agarose gel (1%) stained with GelRed  to verify the quality of the amplification products under ultraviolet light.The mitochondrial (16S rRNA and COI) and nuclear  regions were amplified by PCR using the primers and amplification cycles described in The positive PCR products were purified with ExoSAP-IT  following the manufacturer's instructions, and sequenced by the di-deoxyterminal method with reagents from the BigDye Terminator v3.1 Cycle Sequencing kit . Electrophoresis was conducted in an ABI 3500XL automatic sequencer (Applied Biosystems).The sequences obtained were manually edited, and aligned using the CLUSTAL W algorithm Ocyurus chrysurus and Lutjanus purpureus, the probable sister group of the Sciaenidae, were used as the outgroups for all analyses  and the concatenated data, using maximum parsimony, maximum likelihood, and normal and hierarchical Bayesian inference approaches. Two species of the family Lutjanidae, analyses . The evoBayesian inference analyses were run in MrBayes 3.1.2 a priori, and each species of the group was considered to be a valid taxon. Markov chain Monte Carlo (MCMC) sampling was performed for 450 million generations with parameters sampled every 1,000 generations, and an initial burn-in of 10%. Convergence of the parameters was evaluated in Tracer 1.5 A species tree was constructed according to the hierarchical Bayesian inference principle in the BEAST 1.7.4 software package p distances in the MEGA 5.2.2 program Nucleotide divergence within and among the lineages for each set of data were assessed using uncorrected A total of 2723 base pairs, including 432 bps for rhodopsin, 401 bps for TMO-4C4, and 752 bps for RAG-1, as well as 508 bps for the mitochondrial 16S rRNA and 630 bps for the COI were obtained from 26 of the 36 specimens analyzed. None of the markers was saturated (data not shown). The complete database of both nuclear and mitochondrial sequences includes 549 sites that are informative for parsimony analysis, with an overall transition/transversion ratio of 3.6.S. stellifer, which grouped with Stellifer sp. B in the Bayesian species tree  and southern (S\u00e3o Paulo) lineages of y values  and 2.This is the first molecular phylogeny that includes species representative of all four genera of the Stellifer group, as proposed by Chao Bairdiella is a sister group to Odontoscion in all the topologies generated in the present study  and southern (S\u00e3o Paulo) coasts of Brazil , one of the two Stellifer clades should be reclassified as a new genus. However, if the close relationship and the reduced genetic diversity (data not shown) found within the group is confirmed in a more extensive study, including representatives of additional taxa, this, together with the morphological evidence, would support downgrading the whole group to a single genus. Obviously, these contradictory findings reinforce the need for a more systematic taxonomic revision of the Stellifer group as a whole.In summary, the morphological similarities of the members of the Stellifer group Stellifer. In addition, marked genetic differentiation was found between the O. punctatissimus populations from northern and southern Brazil, suggesting that speciation occurred in the taxa. All these findings reinforce the need for more comprehensive analyses using both molecular markers and morphological traits for the definition of the phylogenetic relationships within the group.This study presents the most comprehensive molecular phylogeny yet produced for the genera of the Stellifer weakfish group. The analyses found close relationships among the taxa of the group, as well as two distinct lineages of"}
+{"text": "High dimensional feature space generally degrades classification in several applications. In this paper, we propose a strategy called gene masking, in which non-contributing dimensions are heuristically removed from the data to improve classification accuracy.Gene masking is implemented via a binary encoded genetic algorithm that can be integrated seamlessly with classifiers during the training phase of classification to perform feature selection. It can also be used to discriminate between features that contribute most to the classification, thereby, allowing researchers to isolate features that may have special significance.This technique was applied on publicly available datasets whereby it substantially reduced the number of features used for classification while maintaining high accuracies.The proposed technique can be extremely useful in feature selection as it heuristically removes non-contributing features to improve the performance of classifiers. Traditionally, clinical methods are employed to detect cancers such as ultrasonography, X-Ray, Computed Tomography (CT) and Magnetic Resonance Imaging (MRI) . HoweverGenerally, computational methods are used to remove non-contributing and noisy dimensions from data while simultaneously trying to maintain a high classification rate . AdditioFeature selection and extraction is a well researched topic in biomedical fields, especially in the areas concerning microarray data \u20137. Severh+1C2\u00d7(d/h) and (2h\u22121)\u00d7(d/h), where h is the block size and d is the total number of dimensions  and a possible gene mask can be [1 0 0 1 1]. This mask indicates that features f2 and f3 are to be removed from the data and the classification model has to be created using a feature vector comprising of [f1 f4 f5], thus, effectively reducing the dimensionality of data. This process has been depicted in Fig. Gene masking, essentially, is a binary encoded genetic algorithm that generates a template used to represent a chromosome, referred to as a mask, while the individual bits at different indices in the chromosome are annotated as genes. This mask can be visualized as a string of binary digits with length equal to the number of features in data. Each binary digit at a particular index (or a gene in terms of the mask) signifies the presence or absence of the corresponding feature in data. For instance, a problem with five features can represented by a feature vector In gene masking, the GA processes are unmodified and it goes through its basic set of genetic operations. For each generation, fitness is calculated for every mask in the population. These masks are then exposed to the three GA operators; selection, crossover and mutation. Finally, the best performing mask is chosen after the generation limit is reached in GA.In essence, the basic purpose of GA in gene masking can be viewed as heuristically searching for the optimal gene mask that reduces the most features for a particular problem while maintaining high classification accuracy. The holistic approach taken when applying gene masking is shown in Fig. k-fold cross validation. The masked dataset is divided into k number of folds and a model is iteratively built using k-1 folds and while the kth fold is isolated for model evaluation, yielding a set containing k classification accuracy values (one for each fold). Then, the fitness of a mask is computed based on its impact on classification accuracy while also considering the effective reduction in dimensionality. The details of fitness evaluation for gene masking is highlighted in Fig. In order to determine the fitness of each mask, a classifier model is created using the masked dataset and its classification accuracy is evaluated using Upon fitness evaluation, GA goes through its orthodox set of operators, namely selection, crossover and mutation. Selection has been performed using roulette wheel selection, which is biased towards individuals with higher fitness. Crossover is accomplished by performing a random one-point binary crossover to swap the genes and mutation is performed by negating gene values at random locations. However, to preserve the highest performing chromosome between generations, elite selection is used to ensure that a mask with the highest fitness is passed to the next generation unmodified by GA operators.k-fold cross validation and the ratio of features removed from data, which is highlighted in Eq. \u03b1, called the Accuracy to Elimination Ratio, which is empirically chosen to direct the evolution of GA either towards attaining better classification accuracy or reducing the most number of features. The value of \u03b1 is optimized within the interval  of childhood, named as such due to their similarity to routine histology. Each type of tumor can be classified into one of four classes either neuroblastoma (NB), rhabdomyosarcoma (RMS), non-Hodgkin lymphoma (NHL) or the Ewing family of tumors (EWS). The dataset comprises of 63 training samples and 25 test samples, each of which contains 2308 gene expressions from cDNA microarrays , 21. Of GA, and subsequently, gene masking, is stochastic by nature. During our experiment, multiple experiments with the same parameter combinations were executed while tuning GA parameters to get a consolidated view on the performance of gene masks with a particular combination of parameters.k-fold cross validation for k = 5. The actual parameter tuning and selection procedure has been described in an algorithmic form in Table As stated previously, gene masking is implemented by applying a mask to select a subset of features from data. GA is used to heuristically create masks (represented as a chromosome within GA) and evaluate their relative fitness. The parameters for GA were determined by empirical testing, whereby the population size was fixed to 105 and the chromosome length set to 2308 (the number of gene expressions in SRBCT dataset), and the best performing rates for crossover and mutation were determined to be 0.85 and 0.1 respectively. These initial parameter configurations were determined by experimentally evaluating the performance of GA with multiple experimental runs (around 10 runs for each combination of parameters) to produce a baseline from which the best parameter configurations were selected. The initial parameter configurations of GA are shown in Table \u03b1  yielded better results with \u03b1=0.3, giving 100% training and test accuracies.During the initial phases of experiments, NCC was used with gene masking to evaluate the performance against the SRBCT dataset. This approach yielded good results with 100% classification accuracy, however, there was only about 28% reduction in genes (about 650 genes) from the original microarray data. This may be attributed to the fact that NCC is a very basic classifier. Additionally, it can be noted that with NCC, having a lower value for \u0394. The optimal range values for \u0394 that produced the best overall performance were in the interval of , gene masking is able to evaluate interdependencies between the remaining features. With the proposed technique, genes that were previously eliminated solely on the value of \u0394 are kept. Gene masking commences with around 100-120 genes, which are systematically evaluated and eliminated based on the gene masks produced by GA. Eventually, gene masking yields a solution with only 13 genes and as per the results shown in Table In NSCC, if the amount of shrinkage is kept relatively low . These datasets were mixed-lineage leukemia (MLL)  and lungWith these sets of data, gene masking was able to produce 100% training and test accuracy when the datasets were shrunk to about 400 genes using NSCC and gene masking was able to further reduce and isolate about 90 genes each. These results are highlighted in Table It should be noted that gene masking has been derived completely off a basic binary GA. As with most evolutionary global optimization algorithms, the risk of getting stuck in local optima is greater when the search space is extremely large. While searching for global optimal locations in a large search domain, a subsequent degradation in performance can be noted. Gene masking currently suffers from a similar limitation, which is highlighted by the results summarized in Table Even with NSCC as the classifier that allows for an \u201cin-built\u201d feature selection procedure, the performance of gene masking was not as good as those with the SRBCT dataset, if dimensionality reduction is considered as a basis of performance. If the amount of shrinkage by NSCC is increased, there is a lot of loss of information solely on the basis of the magnitude of variation from the overall mean without considering feature interdependencies. Therefore, with NSCC, MLL and LC datasets could only be shrunk to about 400 genes each prior to initializing gene masking. From there onwards, gene masking was able to further reduce the number of genes required to maintain 100% accuracy to about 90 genes for both datasets.Gene masking can be very useful in feature selection as it can isolate features that lead to high classification accuracy. It does so by considering the impact of features on classification and heuristically removes non-contributing features. In this paper, we have demonstrated its viability by achieving 100% accuracy while significantly reducing the number of genes required on SRBCT, MLL and LC datasets containing microarray gene expressions for cancers."}
+{"text": "Introduction: The ability of ischemic preconditioning (IPC) to enhance exercise capacity may be mediated through altering exercise-induced blood flow and/or vascular function. This study investigated the hypothesis that  IPC enhances exercise-induced blood flow responses and prevents decreases in vascular function following exercise.Methods: Eighteen healthy, recreationally trained, male participants  received IPC , REMOTE IPC , or SHAM  in a counterbalanced order prior to 30-min of submaximal  unilateral rhythmic handgrip exercise. Brachial artery diameter and blood flow were assessed every 5-min throughout the 30-min submaximal exercise using high resolution ultrasonography. Pre- and post-exercise vascular function was measured using flow-mediated dilation (FMD).Results: IPC resulted in enlarged brachial artery diameter during exercise  compared to REMOTE IPC, but blood flow during exercise was similar between conditions (P > 0.05). Blood flow (l/min) increased throughout exercise (time: P < 0.005), but there was no main effect of condition (P = 0.29) or condition \u2217 time interaction (P = 0.83). Post-exercise FMD was similar between conditions (P > 0.05).Conclusion: Our data show that local (but not remote) IPC, performed as a strategy prior to exercise, enhanced exercise-induced conduit artery diameter dilation, but these changes do not translate into increased blood flow during exercise nor impact post-exercise vascular function. Ischemic preconditioning (IPC) is an intervention whereby three to four brief periods of ischemia, followed by tissue reperfusion, confer protection against subsequent ischemic insults . A singlIn an isolated exercise model (handgrip exercise), one previous study demonstrated that handgrip performance (time to exhaustion) was enhanced after REMOTE IPC, yet no change in blood flow occurred . The durThe primary aim of this study was to examine the exercise-mediated changes in artery diameter and blood flow in response to IPC and REMOTE IPC in healthy individuals. We hypothesized that both IPC and REMOTE IPC would cause a diameter increase, accommodating a larger blood flow during exercise. A secondary aim of the study was to examine whether IPC and REMOTE IPC could prevent the usual decline in post-exercise vascular function compared to a SHAM condition. Finally, we examined whether (REMOTE)IPC is capable of enhancing MVC capacity when preceded by 30 min of submaximal exercise.-1) were recruited and provided written informed consent in accordance with the Declaration of Helsinki. Physical Activity Readiness Questionnaires were administered to ensure no participant had any cardiovascular or metabolic health issues that would prevent participation. Participants refrained from exercise, and consumption of alcohol at least 24 h and caffeine 6 h prior to all laboratory visits. Participants were instructed to standardized food and drink prior to each trial and visited the laboratory at the same time (\u00b11 h) for each trial to delimit the influence of circadian variation on outcome measures . Visits were separated by 4\u20137 days.Participants reported to the laboratory on three separate occasions, performing unilateral handgrip exercise that was preceded by either Local (IPC), Remote (REMOTE IPC), or SHAM condition (in a randomized order). Upon arrival, a resting FMD test was performed followed by either IPC, REMOTE IPC, or SHAM. Both IPC (upper arms) and REMOTE IPC (upper legs) consisted of four sets of 5 min cuff inflation of the limbs (220 mmHg) followed by 5 min reperfusion periods. SHAM consisted of four sets of 5 min cuff inflations at low pressure (20 mmHg) on the upper legs. Following a 20 min rest period, participants performed 30 min of rhythmic (30 contraction/relaxation cycles/min), submaximal handgrip exercise at 25% MVC. Brachial artery blood flow was monitored throughout the exercise bout. Participants rested for 90 s and then performed a 30 s \u201call out\u201d MVC handgrip contraction. A post-exercise FMD test was then performed 3 min after the completion of the maximal contraction bout  maximal voluntary handgrip isometric contractions (MVC); with each effort separated by 90 s rest. Each participant produced three efforts in total. A dynamometric handheld force transducer using MP35 hardware  and dedicated software  was used to determine force generation. The maximum recorded value (kg) from these three efforts was used to determine MVC. For MVC determination, the signal was amplified (gain = 200) and recorded at a sampling frequency of 10 kHz. A standardized load of 20 kg (20 kg weight plate) was placed on the transducer 10 min after the system was turned on in order to calibrate the system prior to each trial.Table 3 consist of: peak diameter response ; time to peak diameter (defined as the time from cuff release to peak diameter response), and shear rate (four times velocity divided by diameter) area under the curve .Following 5 min of supine rest, the participants arm was extended and positioned at an angle of approximately 80\u00b0 from the torso. A cuff attached to a rapid inflator was placed distal to the olecranon process on the forearm. A 15 MHz multi-frequency linear array probe attached to a high-resolution ultrasound machine  was used to image the brachial artery in the distal third of the upper arm. Once a suitable image was obtained, the probe was held in position and settings were altered to optimize the longitudinal B-mode image of the lumen\u2013arterial wall interface. Settings were identical between all FMD assessments. When collecting continuous Doppler velocity, the lowest insonation angle (<60\u00b0) was used. Following 1 min of baseline recording, the forearm cuff was inflated (>200 mmHg) for 5 min. Image recording commenced 30 s before cuff deflation and continued for 3 min thereafter . VariablTable 4). A 20-min rest period was undertaken prior to experimental handgrip exercise performance. No participants were informed about the purpose or hypothesis of the study.Ischemic preconditioning was performed in the supine position and cuff inflation pressure set at a standardized pressure (220 mmHg) in all experimental IPC conditions. With the use of a rapid inflator (E20) and air source (AG101) , 13.5 cm wide cuffs were inflated to 220 mmHg for 5 min, with the aim of preventing arterial inflow . SubsequFor all experimental trials, handgrip exercise was set at a submaximal intensity of 25% MVC. All sessions were performed at the same time of day, relative to the MVC visit in order to limit time of day effect on grip strength variation . ParticiFollowing cessation of rhythmic handgrip exercise, a 90-s recovery was allocated. Once rest time had elapsed, participants completed a 30-s forearm MVC using the same dynamometric handheld force transducer previously mentioned. Both peak force (kg) and area under the curve (kg) were recorded.During the handgrip task, brachial artery diameter and blood velocity were measured with a linear array probe attached to a high-resolution ultrasound machine . The probe was placed on the distal third of the upper arm for image consistency. Blood flow velocity (derived from Doppler region of interest at 30 Hz) was measured with an insonation angle <60\u00b0. Measurements were taken for 60 s per time point and mean values were calculated. Measures were performed at 1, 5, 10, 15, 20, 25, and 29 min during the 30-min handgrip task. Antegrade blood velocity was measured during the interval between contractions, while retrograde blood velocity occurred during muscular contraction.-1) (independent of viscosity) was calculated as four times mean blood velocity/vessel diameter. The semi-automated software, compared with manual methods, significantly reduces observer error and has shown previous intra-observer coefficients of variation (CoV) of 6.7%  was determined from the synchronized diameter and velocity data at a sampling rate of 30 Hz. Shear rate  and time point . Brachial artery endothelial function measurements were analyzed with condition  and time-point (two levels: pre- and post-exercise). The least-significant method was employed for pairwise comparisons . Data arP < 0.005) . There was a main effect of condition (P = 0.03) whereby diameter during exercise following IPC was 0.016 cm (0.003\u20130.03) greater compared to REMOTE IPC (P = 0.015), while the difference with SHAM did not reach statistical significance . Diameter changes between REMOTE IPC and SHAM [-0.03 (-0.16 to 0.10) cm] were not different (P = 0.66). There was no condition \u2217 time interaction effect (P = 0.48).Diameter increased throughout the 30-min exercise bout (P < 0.005) and condition (P < 0.005) with both IPC  and REMOTE IPC  resulting in lower velocity versus SHAM. There was no difference between IPC and REMOTE IPC . There was no condition \u2217 time interaction (P = 0.78) (Table 1).There was a main effect of time (P < 0.005), but there was no main effect of condition (P = 0.29) or condition \u2217 time interaction (P = 0.83) .Blood flow increased throughout exercise (time: MEAN) , antegrade shear (SRANT), and retrograde shear (SRRET) (Table 1), with all three variables increasing with exercise duration . A main effect of condition was present for SRMEAN (P < 0.005) with IPC being lower  than REMOTE IPC and lower  than SHAM. SRMEAN for REMOTE IPC was -1069 s-1 (-1736 to -402) lower than SHAM (P = 0.002). There was no condition \u2217 time interaction (P = 0.76).There was a main effect of time for mean shear rate (SRP < 0.005) for SRANT (Table 1), with IPC resulting in -938 s-1  lower SRANT compared to REMOTE IPC and -2116 s-1  lower SRANT compared to SHAM. REMOTE IPC resulted in -1178 s-1  lower SRANT when compared to SHAM. There was no condition \u2217 time interaction (P = 0.89). Additionally, no main effect of condition or condition \u2217 time interaction was evident in SRRET (P = 0.68).There was a significant effect of condition . FMD decreased by 1.9%  from pre- to post-exercise (P < 0.005). There were no main effects of condition or condition \u2217 time interaction . Results did not alter when the data were allometrically scaled for baseline diameter.A significant main effect of time was evident for brachial artery FMD (P < 0.005) was evident for peak diameter (Table 2). Peak diameter increased by 0.03 (0.024\u20130.036) cm from pre- to post-exercise. There was evidence of a main effect of condition but this did not reach statistical significance (P = 0.09). Peak diameter was 0.008 (0.001\u20130.16) cm larger after IPC compared to SHAM (P = 0.03). There were negligible differences in peak diameter between IPC and REMOTE IPC  and also between REMOTE IPC and SHAM conditions . There was no interaction between condition \u2217 time (P = 0.14).A significant main effect of time , time to peak diameter (seconds), and shear rate under-the-curve  (Table 2) which all increased from pre- to post-exercise . There was no main effect of condition or condition \u2217 time interaction for any variable .A main effect of time was evident for baseline diameter (cm) .No main effect of condition was evident for either peak force (kg), area under the curve (kg) during the 30-s MVC  was found to enhance blood flow during exercise or prevent the drop in vascular function after exercise.The aim of this study was to examine the exercise-mediated changes in artery diameter and blood flow pattern in response to IPC and REMOTE IPC in healthy individuals. We also examined whether IPC and REMOTE IPC could prevent the usual decline in post-exercise vascular function. The novel findings from the current study are (i) brachial artery diameter was greater during exercise following IPC when compared to REMOTE IPC, but this does not translate to a greater conduit artery blood flow between IPC and REMOTE IPC and (ii) neither IPC nor REMOTE IPC prevented the attenuation in brachial artery FMD following 30 min of hand grip exercise versus REMOTE IPC. While we did not perform a diameter measurement immediately prior to exercise, the larger diameter was evident in the first minute during exercise and continued to remain larger throughout exercise. Whether IPC exerted this dilatory response prior to the onset of exercise versus REMOTE IPC could not be determined in our design. The capacity of IPC to have direct and immediate effects on vasodilation of the conduit arteries infers that IPC could be a useful tool in improving arterial health. For example, in line with the ability of repeated exercise to enhance vascular function  on exercise-mediated conduit artery diameter and blood flow. The current data show IPC resulted in a larger increase in conduit artery diameter that was maintained throughout exercise function , regularfunction . The obsversus SHAM. It could be hypothesized that an ischemia-induced increase in diameter following IPC was responsible for producing lower velocity throughout exercise compared to SHAM; however, REMOTE IPC exerted similar responses in comparison, without significantly lower vasodilation response versus IPC. The underlying changes in blood velocity responses in both (REMOTE) IPC conditions, when compared to SHAM, are therefore unclear and may deserve further investigation.Potential explanations for the larger diameter between IPC and REMOTE IPC include different impact of shear stress. Based on our observations, shear stress levels did not increase after IPC during exercise. While not measured in the current study, shear stress may have mediated larger nitric oxide release at the site of ischemia, or adenosine-mediated actions as a direct consequence of local IPC , contribversus a SHAM condition , given that vascular tone is the product of the competitive balance between intrinsic local vasodilator function and adrenoceptor-mediated vasoconstriction. Possibly, IPC caused a reduction in sympathetic nerve activity (SNA), leading to a relative increase in artery diameter during exercise. Lower SNA has been observed following limb ischemia reperfusion injury preceded by IPC using the gold standard microneurography . Howeverondition . Based oDespite the changes in diameter, this did not accommodate a larger blood flow during exercise. In fact, we even observed a lower mean and antegrade shear following IPC when compared to REMOTE IPC throughout the exercise. This was especially apparent during the first 20-min of exercise. Our findings are in line with a previous study, which found that REMOTE IPC (lower-limb) prior to handgrip exercise to exhaustion did not alter brachial artery blood flow . Nonetheversus SHAM exercise. There are a number of potential explanations for these contrasting findings. Firstly, handgrip exercise activates <1 kg of muscle versus larger muscle mass exercise such as running which can activate up to 10\u201315 kg of muscle  or mean force production (AUC) following either REMOTE IPC or IPC  studies  that hav studies  have demss tasks  remains versus REMOTE IPC, indicative of IPC-induced metabolic alterations  likely provides a different management of vasodilation responses to exercise stimuli when compared to whole-body work. It may therefore not be possible to apply these results to larger active muscle mass areas when running or cycling for example. Secondly, the participation number of In summary, we demonstrate for the first time that IPC performed as a strategy prior to exercise causes enhanced conduit artery vasodilation, maintained during exercise, when compared to REMOTE IPC. While these vascular adjustments do not translate into increase blood flow during exercise, the larger diameter mediated by IPC could indicate acute bouts of IPC contribute to improving the health of arteries.The study was approved by the local Ethics Committee (Anti-Doping Lab Qatar \u2013 IRB F2016000128). All participants provided written informed consent in accordance with the Declaration of Helsinki. Physical Activity Readiness Questionnaires were administered to ensure no participant had any cardiovascular or metabolic health issues that would prevent participation.HJ, DT, MW, SC, and NC developed the concept for this research project. SC performed all data collection and analysis. SC, HJ, and DT drafted and finalized the manuscript. MW, DG, NC, HJ, and DT significantly contributed to the drafts toward the final product and critically reviewed the manuscript. All authors  provided valuable comments throughout and insights throughout the process contributing to the final version of this manuscript. All authors  approved the final version of this manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Death cases reported for 2,4-DNP overdose, particularly among young adults, have raised concerns about the ineffective regulatory control, lack of education and risks associated with impurity, and the unknown concentration of 2,4-DNP purchased on the Internet.Using a sequential mixed method design and based on a hypothetical scenario as if 2,4-DNP was a licensed pharmaceutical drug, first we conducted a qualitative study to explore what product attributes people consider when buying a weight-loss aid. Focus group interviews with six females and three males (mean age\u2009=\u200921.6\u2009\u00b1\u20091.8\u2009years) were audiorecorded, transcribed verbatim, and subjected to thematic analysis. Sixteen attributes were identified for the Best\u2013Worst Scale (BWS) in the quantitative survey with 106 participants , focusing on 2,4-DNP. Demographics, weight satisfaction, and risk for eating disorder data were collected.In contrast to experienced users such as bodybuilders, our study participants approached 2,4-DNP cautiously. Attributes of 2,4-DNP as a hypothetical weight-loss drug comprised a range of desirable and avoidable features. Of the 16 selected attributes, BWS suggested that long-term side effects were the most and branding was the least important attribute. Effectiveness and short-term side effects were also essential. Those in the\u2009>25\u2009year group showed least concerns for legality. Neutral BWS scores for cost, treatment, degree of lifestyle changes required, and specificity required for the hypothetical weight-loss drug to be effective were likely caused by disagreement about their importance among the participants, not indifference.With advances in research, 2,4-DNP as a pharmaceutical drug in the future for treating neurodegenerative diseases and potentially for weight loss is not inconceivable. Caution is warranted for interpreting the BWS scores. Owing to the difference in what data represent at individual vs. population levels, with pooled data, the method correctly identifies attributes by which most people are satisfied but misrepresents attributes that are individually very important but not universally agreed. Whilst this may be an advantage in marketing applications, it limits the utility of BWS as a research tool. WithOne example of substances not licensed for human consumption is 2,4-dinitrophenol , which is an effective but highly dangerous fat burner. Currently, 2,4-DNP has industrial use but it is not licensed for human consumption and its sale as such is prohibited around the world. Despite the danger, 2,4-DNP has re-emerged within the bodybuilding community and extreme dieters, particularly among young adults.The attractiveness of 2,4-DNP arises from the fat-burning effects without the need of dietary control . 2,4-DNP2,4-DNP is an organic compound which is chemically manufactured in two forms  in the UK, EFSA at the EU level] and regulatory policies in place means that perceived safety could backfire. Consumers of dietary supplements may make their decision in a false sense of safety about the products. In fact, research has shown that a significant proportion of physically active people rely on label information when making decision about supplements but only half were concerned about the quality of the information . It is rvia the internet, cases of 2,4-DNP misuse are being seen globally in countries such as America, England, and China  the better we can tailor health education to the users\u2019 wants, needs, and motives. Often, successful health education for prevention and harm reduction requires taking a holistic approach and addressing the problem in a broader context. In the present study, the key research question is not restricted to 2,4-DNP specifically, but rather, 2,4-DNP is used as a controversial example.Thus, using a hypothetical scenario, in this study we set out to explore whether producing the drug with proper quality control and advice on safe use would (1) increase willingness to use and (2) reduce harm from 2,4-DNP and investigated what factors people would consider important in buying 2,4-DNP if it would be a licensed pharmaceutical drug.Alongside this, we also investigated whether demographic details  and health condition (disordered eating) influence the importance of these factors. This will give an indication of who may be at a higher risk of purchasing unsafe weight-loss substances such as 2,4-DNP.Based on the exploratory nature of the research questions, a sequential mixed method design  was usedThe study was approved by the Research Ethics Committee of the Faculty of Science, Computing and Engineering, Kingston University, under the delegated approval scheme. Participation in the study was voluntary and anonymous. Participants were fully informed about the aim of the study and conditions of participation. Consent was implied by voluntary participation in the focus group and/or by completing and returning the survey. Focus group participants also gave written informed consent to the use of their demographic information such as age and gender, purpose for weight loss and past experience with weight-loss products\u2014with anonymity preserved\u2014for scientific purposes and academic dissemination. Consent was obtained prior to the focus group, and participants were asked to complete the \u201cpersonal information sheet\u201d which contained questions about the above demographic details. Participants received no compensation.via personal networks. The focus groups contained six females and three males with a mean age of 21.56\u2009\u00b1\u20091.71\u2009years. In the focus groups, only two participants had previously used weight-loss substances both of which were female and with their main concern being appearance  university students between 18 and 30\u2009years of age The age distribution in the first focus group was slightly more spread (ranging from 20 to 25\u2009years) than in the second group (age range of 19\u201321\u2009years). Both groups were mixed in terms of gender and involvement in sport and exercise but only the first group included participants with the experience of using a weight-loss product.Participants were given documents providing a brief background on the topic , a consent form, and a personal information sheet to gather the demographics of the focus groups  to emerge. Once identified, themes were labelled and grouped together to create higher-order themes. Finally, the data were revisited to ensure that each theme was appropriately represented. Following the second focus group, a satisfactory level of saturation regarding important attributes of 2,4-DNP was reached.Focus group transcripts were analysed using a thematic analysis. Following Braun and Clarke\u2019s  procedurvia social media and in person.In line with the qualitative phase, individuals over 18\u2009years of age were recruited for the survey phase using convenience and snowballing sampling techniques. Apart from the age limit of 18 and over, no specific inclusion/exclusion criteria were set for this phase of the research. The questionnaire was made available online using a closed survey platform (SurveyMonkey) and as a hard paper copy. The content of the two surveys was identical. This allowed participants to be recruited online Desirable attributes of a 2,4-DNP as a hypothetical weight-loss drug were identified using the Best\u2013Worst Scale (BWS) technique which involves choice modelling. In this method, multiple options are provided in several iterations but only the best and the worst option are selected in each case. This method is a multiple-choice extension of the paired comparison method, which is scale-free and forces participants to make a selective choice among the issues under consideration . The atthttp://datagame.io/)   and was Gone on eating binges where you feel that you may not be able to stop? (Defined as eating much more than most people would under the same circumstances and feeling that eating is out of control.); (2) Ever made yourself sick (vomited) to control your weight or shape? (3) Ever used laxatives, diet pills, or diuretics (water pills) to control your weight or shape? (4) Exercised more than 60 min a day to lose or to control your weight? (5) Lost 20 pounds or more in the past 6\u2009months? (6) Have you ever been treated for an eating disorder? The first four questions were rated as Never/Once a month or less/two to three times a month/Once a week/two to six times a week/once a day or more whereas the last two questions were answered as Yes/No. The EAT-26, both the belief section and the behavioural aspects, is one of the most widely used screening tools for identifying high-risk individuals for referral to clinical evaluation, consistently showing good psychometric properties  and whether they wanted to lose weight (Yes/No). In case the answer was yes to the weight-loss goal, the main reason behind this goal was further explored. To facilitate statistical analysis, closed question format questions with pre-set answers were used .Demographic information we collected included age, gender, ethnicity, employment status, and highest completed education level. The categories within the highest completed education level included GCSE, A-Level/B.Tech, Undergraduate level 4, Undergraduate level 5, Degree, Postgraduate, and other. Ethnicity categories were based on the categories recommended by the Office for National Statistics : White, Following the selection count method , we p\u2009<\u20090.05 and tested two-tailed unless specified otherwise. Excel version 2016 for windows and IBM SPSS Statistics 22 were used for data entry and statistical analysis.Descriptive data are reported as median, mean and SD, frequencies, and/or percentages. We dichotomised age (18\u201325\u2009years and\u2009>25\u2009years) and at-risk status for eating disorder . Two affirmative answers were used instead of the traditional \u201chaving an affirmative answer\u201d because the relative high proportion of athletes in the sample might routinely control their weight for sport reasons. Comparisons between two groups were tested using a factorial ANOVA. The association between categorical variables was tested using chi-squared statistics with Fisher\u2019s exact significance. Statistical significance was set at Focus group interviews yielded 16 themes which reflected the characteristics and factors considered when buying weight-loss drugs such as 2,4-DNP. Themes, theme explanations, and supporting evidence are presented in Table I think the price  would hinder me, as it would probably cost ridiculous amounts of money, I think that would be the point where I\u2019d be like no I don\u2019t want it that bad\u201d (Focus Group 1\u2014F2). By contrast, other participants felt that the price would not prevent them from buying the drug and that they may actually choose a more expensive option, if they believed it would be more effective. As another 21-year-old female participant stated: \u201cI know myself if I went to buy a drug and there was one that cost 50p and one that cost \u00a310, I would probably be like the \u00a310 one is more effective\u201d (Focus Group 2\u2014F1). The following quote captures these contracting views surrounding the importance of cost:You get people that are like if it\u2019s like \u00a330 cheaper then its not going to make a huge amount of difference and you get people at the other end of the scale who go well it\u2019s the most expensive so it must be the best. (Focus Group 1\u2014M1)It is important to note that despite an agreement in relation to the importance of drug characteristics, participants did not always agree on how important each attribute was or the reasons why they felt it was important. For instance, participants agreed that the cost of a drug  was important but some participants felt that a high price point would prevent or discourage them from buying it. As one 21-year-old female with experience of using weight-loss substances explained: \u201cI think there\u2019s a lot of stigma around taking pills though\u2026like if you\u2019re talking to someone and saying you\u2019re taking pills for weight loss\u2026their immediate reaction would be like are you sure, where did you get them from, are they legit kind of thing, I probably would go for a shake\u201d (Focus Group 1\u2014F2), whilst other participants favoured the simplicity and efficiency of pills and favoured this over other formulations. The following quote from a 19-year-old female illustrates this point:I don\u2019t like putting things in water, it\u2019s too much effort and it tastes horrible so as soon as I can take it in a tablet and its just done in a couple of seconds for me that is ideal, it would be things like powder and suppository that would be a massive no! (Focus Group 2\u2014F2)In addition to cost, participants also differed in their views regarding the preferred administration  and how the drug is taken . For instance, some participants felt that there was a stigma associated with taking pills for weight loss: \u201cvia pills or shakes), some participants felt that injecting drugs were favourable especially if it resulted in a reduced dosage. As one participant explained:I would prefer an injection if it was less often\u2026 just because I wouldn\u2019t have to remember every day, I would be happy to go to my doctor if it was like once a week\u2026 especially if you can just go to the nurse and like get it (Focus Group 2\u2014F1)Building on this point, although the majority of participants preferred taking drugs orally (n\u2009=\u200981) being between 18 and 25\u2009years of age. For this reason, age groups were divided as 18\u201325 and over 25. Sixty-five percent of the participants were students.The survey sample consisted of 106 individuals . The mean age of the sample was 27.08\u2009\u00b1\u200911.92\u2009years with the majority  being the least important. Drug interactions, user reviews, cost, treatment, lifestyle changes required, drug target specificity, access, and duration of the treatment were placed in the middle region (BWS scores between\u2009+1 and \u22121).p\u2009<\u20090.001) and legality (p\u2009=\u20090.029), and gender effect on branding (p\u2009=\u20090.026) and formulation (p\u2009=\u20090.002). The latter also showed a significant interaction effect between gender and at-risk status (p\u2009=\u20090.035). These are marked in Table Table p\u2009=\u20090.040) and long-term side effects (p\u2009=\u20090.019) with a significantly lower rank in comparison to those unsatisfied with body weight. Alongside this, there was a significant difference in long-term side effect ranks between those who want to lose weight and those that do not. Those wanting to lose weight scored a significantly higher importance (p\u2009=\u20090.003) towards long-term side effects than those who do not want to lose weight. The data show that those who selected health as the main reason for weight loss scored effectiveness differently from those who chose appearance (p\u2009=\u20090.014) or fitness (p\u2009=\u20090.012). Those who chose health for main reason for weight loss scored effectiveness significantly lower than those who chose the appearance or fitness. The only significant result within eating behaviour was those who were not at risk ranked branding significantly lower than those at risk.In stratified analysis by reasons for weight loss, the data showed a statistically significant difference in ranking dosage and long-term side effects between those who were satisfied with weight and those who were not. Those satisfied with body weight scored dosage  but those attributes where participants in the focus group disagreed scored as \u201cneutral\u201d (neither important or unimportant). Using three participants from the set of 106, Figure As the black line (representing the sample average) shows, the attributes were arranged in the order of importance, going from not important (\u22125) to very important (+5). Overlaying individual scores on the sample average highlight the contrasting views on attributes such as cost, change in lifestyle, and dosage. By contrast, the patterns of scores are fairly consistent across the participants for long-term health effects, effectiveness, and branding.The 18\u201325 age group showed a higher risk of developing a potential eating disorder than those aged over 25\u2009years of age. Specifically, within the 18\u201325 age group, under 10% of males and 20% of females were classified as being a non-risk. By contrast, within the over 25-age group, over 30% were classified as a non-risk.Participants who selected appearance or fitness for the purpose of weight loss are at a higher risk of a potential eating disorder than those who chose health. These results may show some bias, as only a small number  of participants were represented within the health category.2\u2009=\u20096.076, p\u2009=\u20090.016) and age . Satisfaction with current weight and \u201cat-risk\u201d status for developing eating disorder only reached the level of statistical significance if one-tailed test statistics were considered .Satisfaction with weight was significantly associated with gender  but not age . Similar to the satisfaction with current weight, \u201cat-risk\u201d status for developing an eating disorder only reached the level of statistical significance for the intention to lose weight if one-tailed test statistics were considered .Intention to lose weight showed statistically significant association with gender . The 18\u201325 age groups indicated more weight satisfaction in comparison to the over 25 age group. The female 18\u201325 age group still indicated slight dissatisfaction, with 58.7% being unhappy with body weight, in contrast to 74.2% of males aged 18\u201325 showing satisfaction of weight. In terms of losing weight, over 70% of males and females over 25 along with females between 18 and 25\u2009years of age expressed desire. By contrast, only 41.9% of males between 18 and 25\u2009years of age wanted to lose weight.Using a stratified sample Figure , the datThe data showed a substantial difference in weight satisfaction in different ethnic groups. Those identified with white ethnic group were the most dissatisfied with their weight, with 57% being unhappy with their current weight. The mixed/multiple ethnic group showed a balanced response with a 50:50 ratio, whereas both the black/African/Caribbean/Black British and Asian/Asian British groups show less dissatisfaction with weight, with 66.7 (Black) and 77.8% (Asian) being satisfied with their current weight, respectively.2\u2009=\u20094.508, p\u2009=\u20090.037). Regardless of the at-risk status, 60\u201365% of the females were dissatisfied with their current weight and 70\u201375% wanted to lose weight. Over 70% of the at-risk male group was satisfied with their weight but 51.5% still wanted to lose weight.Stratifying the sample by \u201cat-risk\u201d status for disordered eating showed only one statistically significant association. Among males, at-risk status and weight satisfaction were associated , with appearance dominating the reasons for females. Frequency counts in the stratified sample , treatment, short-term side effects, long-term side effects, effectiveness, storage, preparation, dosage, change in lifestyle, cost, interactions with other substances, drug specificity, legality, branding, and form of drug.The highest and lowest ranking factors across the different age and gender groups were long-term side effects and branding. The long-term side effects were expected to receive a high mark of importance as people tend to avoid harm especially with the severity and length of effects being unknown. Both young  age groups and females over 25\u2009years of age selected effectiveness as a very important factor, indicating that these groups may have a higher interest with weight loss.The older age groups showed a higher concern in terms of legality in comparison to those who are younger. These findings suggest that younger people may be more willing to take risks to achieve their desired physique and as a result are more likely to buy illegal weight-loss drugs. This may go some way to explaining why the majority of mortalities due to 2,4-DNP are among young people .Those wanting to lose weight scored significantly higher in terms of importance regarding long-term side effects than those who did not want to lose weight. Interestingly, this potentially contradicts other research as it may be assumed that those wanting to lose weight would have greater-risk willingness, so would see a reduced concern towards potential hazards. However, this potentially could be because those who wanted to lose weight related more to DNP scenarios, than to those who did not want to lose weight and may have given a more realistic consideration to the potential harms of weight-loss drugs.Those who chose health as the main reason for weight loss scored effectiveness significantly lower. This might be because losing a significant amount of weight in a short period can be considered unhealthy. Therefore, those who are health conscious wouldn\u2019t be as concerned with how effective the drug was. Also, it may be assumed that those choosing health over appearance and fitness are less likely to purchase a weight-loss product due to the potential hazards and so wouldn\u2019t consider effectiveness as important as side effects.Judging from the quantitative BWS scoring alone, it would appear that some attributes  are neither important nor unimportant when in fact any one of these factors alone would stop a person taking 2,4-DNP. The rationale for using BWS instead of scaled responses was to capture the relative importance of attributes if a risky substance such as 2,4-DNP would be manufactured and sold as a pharmaceutical product, and indirectly to shed the light on what aspects are the most important to potential consumers of 2,4-DNP. The latter would help to address public health concerns about 2,4-DNP and devise effective preventive and/or harm-reduction strategies.Best\u2013Worst Scale method  originates from consumer research exploring relative preferences. The BWS model is a multichoice extension of the scale-free paired comparison where respondents are not asked to assess the absolute importance of an issue on some arbitrary scale but presented as a trade-off choice . Because of this characteristic, BWS is thought to resemble the actual cognitive process by which consumers make product choices . In subsSince its conception more than 25\u2009years ago, limitations of a direct preference assessment with BWS have started to emerge e.g., , 78, shoThe questionnaire consisted of 31 questions, with some sections such as the DNP scenario and BWS containing a considerable amount of information resulting in a lengthy survey. It was mentioned by a few participants that the survey was too long, with at least 26 participants taking over 10\u2009min to complete the survey. This may have led to some questions being answered superficially, reducing the accuracy of the results.The majority of participants were young females which inadvertently led to females aged between 18 and 25\u2009years to be over-represented within the data. Given that females are more conscious about weight, talk more about weights , and morLastly, the eating behaviour scale showed some discrepancies, as the tool defines a person at risk of an eating disorder with a score of 1 or higher. However, the survey collected information from a high proportion of young people, mainly students. In this population, many are highly active within sport and require high levels of exercise to control weight and remain competitive. Therefore, many athletes scored at least a 1 due to controlling their weight by exercise. Alongside these, many athletes may experience eating binges more frequently due to this high activity, in which their body needs to quickly replace depleted energy stores.via the Internet, legislation cannot curb its use by the general public which raises public health concerns. Despite numerous warnings to make the public aware of the dangers from using 2,4-DNP, the drug is still showing activity within the weight-loss community.Due to the range of side effects, which vary in severity depending on a person\u2019s tolerance, 2,4-DNP has remained illegal for human consumption since its ban by the FDA in 1938. Facilitated by easy access to the substance via education as well as research into the possibility of making 2,4-DNP a safer drug by controlling purity and quality as well as efforts to mitigate against side effects.With advance in research, 2,4-DNP as a licensed pharmaceutical drug in the future for treating neurodegenerative diseases with chronic micro-dosing and potentially for aiding weight loss is not inconceivable. However, owing to the media reports of deaths and irresponsible marketing, supply, and use, 2,4-DNP has a reputation of being very risky and rightly so. Participants in this study exhibited a reassuringly cautious and conservative approach to a risky drug like 2,4-DNP. Focusing on young adults, we showed that those most interested in weight loss are females predominantly 18\u201325\u2009years of age and indicated that both males and females under 25\u2009years exhibited a higher risk for disordered eating. Due to the rising body pressure effects on these age groups and with a reduced concern towards legality, this group of young people are at risk of becoming susceptible to different weight-loss products, including 2,4-DNP. Vast differences in social group norms  around using pharmaceutical aids to weight loss were noted. There is little doubt that the market for such products exists and current control policies are inadequate; thus there is a need for finding new ways for prevention and harm reduction. Failing to control the risk through supply and access, public health policies should consider pragmatic solutions for controlling 2,4-DNP-related harm However, our results expand beyond 2,4-DNP and speak for young adults\u2019 approach to using pharmaceutical products for achieving a \u201cdesired\u201d body, which provide useful insights for public health policies. Caution is warranted for interpreting the BWS scores. Our combined qualitative and quantitative results showed that the BWS method is capable of correctly identifying attributes most people feel the same way but misrepresents attributes that are individually very important but not agreed upon as unimportant or insignificant. This feature of the BWS method is very suitable for marketing purposes but outcomes should be interpreted cautiously in research applications.The study was approved by the Research Ethics Committee of the Faculty of Science, Computing and Engineering, Kingston University, under the delegated approval scheme. Participation in the study was voluntary and anonymous. Participants were fully informed about the aim of the study and conditions of participation. Consent was implied by voluntary participation in the focus group and/or by completing and returning the survey.AP conceived the study and developed the research protocol with EB. EB collected data and analyzed the data with AP and ST. All authors contributed equally to drafting the manuscript and have read and approved the final version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "HDIs). The potential of nine selected widely used tropical medicinal herbs in inhibiting human cytochrome P450 (CYP) isoenzymes was investigated.Increasing use of medicinal herbs as nutritional supplements and traditional medicines for the treatment of diabetes, hypertension, hyperlipidemia, and malaria fever with conventional drugs poses possibilities of herb\u2013drug interactions . Picralima nitida inhibited CYP3A4 (IC50\u00a0=\u00a045.58\u00a0\u03bcg/ml) and CYP2C19 (IC50\u00a0=\u00a073.06\u00a0\u03bcg/ml) moderately but strongly inhibited CYP2D6 (IC50\u00a0=\u00a01.19\u00a0\u03bcg/ml). Other aqueous extracts of Gongronema latifolium, Bauhinia monandra, and Moringa oleifera showed weak inhibitory activities against CYP1A2. Musa sapientum, Allium sativum, and Tetracarpidium conophorum did not inhibit the CYP isoenzymes investigated.CYP\u2010metabolism\u2010mediated HDIs is possible for Alstonia boonei, Mangifera indica, and Picralima nitida with drugs metabolized by CYP 2C8, 2B6, 2D6, 1A2, 2C9, 2C19, and 3A4. Inhibition of CYP2D6 by Picralima nitida is of particular concern and needs immediate in vivo investigations.Potential for clinically important  Patients who are on medications and consumes these medicinal herbs may not be aware of potential herb\u2013drug interactions (HDIs) that may occur. Others such as Alstonia boonei, Bauhinia monandra, and Picralima nitida are frequently used in sub\u2010Saharan Africa and India in the management of chronic diseases such as hypertension, diabetes, asthma, peptic ulcer, and cancer, as antimalarials and antimicrobials and other minor ailments  isoenzymes  separately at 40\u00b0C for 24\u201348\u00a0hr until a constant weight was obtained. Thereafter, each plant part was blended with Kenwood blender  for 3\u00a0min.Nine medicinal herbs widely used in the tropics for the management of chronic diseases such as hypertension, diabetes, dyslipidemia, chronic kidney disease were selected for this study with the plant parts used and listed in Table\u00a0Alstonia boonei stem bark, Mangifera indica stem bark, Musa sapientum unriped fruits, Bauhinia monandra leaves, Tetracarpidium conophorum seeds, Allium sativum bulb, and Gongronema latifolium leaves were macerated in 1.5\u00a0L of distilled water for 24\u00a0hr according to extraction procedure practiced locally by users of these herbs. Dry powdered Moringa oleifera leaves (50\u00a0g) and powdered dry Picralima nitida seeds (70\u00a0g) were each macerated in 300\u00a0ml of distilled water. Each mixture was filtered, concentrated, and freeze\u2010dried. The freeze\u2010dried extracts were stored at \u221220\u00b0C until needed for in vitro analysis.Three hundred gram each of dried and powdered 2.2Acetic acid and HPLC\u2010grade acetonitrile were purchased from Merck . Hydroxydiclofenac, desmethylomeprazole, 3\u2010hydroxyomeprazole, and hydroxycoumarin were obtained from Sigma\u2010Aldrich, St Louis, USA; 6\u2010hydroxytestosterone, dextrorphan, and desethylamodiaquine form BD Biosciences Discovery Labware, Bedford, USA; 5\u2010hydroxyomeprazole and omeprazole sulfone from Astra Zeneca, M\u00a8olndal, Sweden; 1\u2010hydroxymidazolam from F. Hoffmann\u2010La Roche, Basel, Switzerland; phenacetin from ICN Biomedicals, Costa Mesa, USA. Hydroxybupropion was a free gift from Glaxo SmithKline Research Triangle, NC. Water used was purified by Simplicity 185 water purifier . All other chemicals and reagents were of analytical grade.2.3g. The experiments were performed in duplicate. The validated parameters for the methods were adequate for quantification ranges\u00a0<\u00a01%\u2013300% of the forming metabolite concentrations with LOD 0.2\u201310\u00a0nM, accuracies 85%\u2013115%, and precisions <15% at all concentrations, and with good autosampler stability (>95%) up to 48\u00a0hr. Positive controls . This was used for the metabolite profiling and CYP inhibition study. N\u2010in\u2010one approach (cocktail\u2010approach) for elucidating inhibition toward CYP\u2010specific model reactions was conducted with minor changes as described in earlier studies  values were determined graphically from the logarithmic plot of inhibitor concentration (concentrations of the aqueous extract of each herb) versus percentage of enzyme activity remaining after inhibition using GraphPad Prism 5.40 software . The model equation (1) for the plot was.Fifty percent inhibitory concentration  while others CYPs such as 2A6, 2C19, and 3A4 were weakly inhibited (IC50\u00a0>\u00a0100\u00a0\u03bcg/ml) by the extract. These results are similar to the inhibition of CYP1A2, CYP2C9, CYP2D6, and CYP3A4 by aqueous extract of Mangifera indica stem bark using human liver microsomes and primary hepatocytes reported by Rodeiro et\u00a0al.  significantly by 38% in thirteen male patients after 2\u201330\u00a0days of consumption (Monterrey\u2010Rodr\u00edguez, Feli\u00fa, & Rivera\u2010Miranda, Mangifera indica bark also showed a weak inhibitory effect on CYP2C19 in the present study.Stem bark aqueous extract of o et\u00a0al. , 2013. MMangifera indica stem bark aqueous extract to cause in vivo HDIs specifically with drugs with narrow therapeutic index is supported by the estimated IC50 values in L/dose which are higher than 5\u00a0L. As reported by Strandell et\u00a0al. (50 in L/dose greater than 0.88\u00a0L may cause in vivo inhibition of same CYP isoenzymes similar to the observed in vitro inhibitory potential of the herb on the same CYP isoenzymes.The potential for l et\u00a0al. , herb exSeveral studies have used Strandell et\u00a0al.  methods Picralima nitida seeds, Gongronema latifolium leaves, Tetracarpidium conophorum seeds, Musa sapientum unripe fruits, Bauhinia monandra leaves, and Alstonia boonei stem bark. Our study may be the first report of the in vitro inhibitory potential of these herb extracts. Gongronema latifolium and Alstonia boonei may produce in vivo inhibitory activity on CYP1A2, CYP2C19 and CYP3A4 since the converted in vitro IC50 values are greater than 0.88\u00a0L/dose despite the weak in vitro inhibitory potential on these isoenzymes. Aside from its medicinal properties, Gongronema latifolium is a popular delicacy in African cuisine (Akinsanmi & Nwanna, Gongronema latifolium vegetable. Aqueous extract of Bauhinia monandra leaves is likely to exhibit in vivo inhibition on CYP1A2, CYP2C8, and 3A4 with converted IC50\u00a0>\u00a03.0\u00a0L/dose unit.Currently, no study seems to be available on the in vitro or in vivo inhibitory activity of six of the herbs studied\u2014aqueous extracts of 50 value of these herbs; thus, the manufacturer recommended dose or the local or traditional dose is used to quantify the possibility of in vivo inhibition from in vitro IC50 values using the method described by Strandell et\u00a0al. (50\u00a0>\u00a00.88\u00a0L/dose unit should be investigated further for in vivo HDI. However, herbs with IC50\u00a0> 5\u00a0L/dose unit, the average human blood volume, are more likely to produce significant in vivo HDIs (Strandell et\u00a0al., One of the problems of studying herb\u2013drug interactions is the difficulty in identifying or quantifying the inhibiting components of the complex mixtures of phytochemicals in the herb. Because of this, it is difficult to quantify the molar ICl et\u00a0al. . Though,l et\u00a0al.  that herPicralima nitida seem to be the most potent of the nine herbs studied with IC50\u00a0<\u00a0100\u00a0\u03bcg/ml for CYP2C19 and CYP3A4 and IC50\u00a0<\u00a010\u00a0\u03bcg/ml for CYP2D6. The IC50 value converted into L/dose for CYP2C19, CYP3A4, and CYP2D6 far exceeded the 0.88\u00a0L/dose unit cutoff point by Strandell et\u00a0al. (l et\u00a0al. . With thl et\u00a0al. . This is50 values are apparent values because of the complex mixture of herbs. The preparation of the herb extracts and the dose used also vary between localities. These may affect the computation of the IC50 values in L/dose unit and should be considered when interpreting these results. Also, despite the use of human liver microsomes in the in vitro study, extrapolation of the in vitro findings to in vivo may be limited by the in vivo bioavailability of the phytochemicals in the herbs. In spite of these result limitations, this study assisted in rapidly identifying herb extracts with potential for in vivo HDIs and those requiring further clinical studies.It should be borne in mind that the IC5Picralima nitida, Alstonia boonei, and Mangifera indica showed significant in vitro inhibition of several cytochrome P450 isoenzymes including CYP1A2, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, and CYP3A4 with potential for significant clinical herb\u2013drug interactions. The potent in vitro inhibitory effect of aqueous extract of Picralima nitida on CYP2D6 makes it a candidate for immediate further clinical investigations. However, before this is done, caution should be exercised by clinician and patients alike in recommending or coadministering aqueous extracts of Picralima nitida seeds with substrates of CYP2D6.Of the nine aqueous herb extracts evaluated in this study, Authors have no conflict of interest to declare.This study does not involve any human or animal testing.\u00a0Click here for additional data file."}
+{"text": "Houttuynia cordata Thunb. (H. cordata) is widely used in traditional Chinese medicine due to its excellent biological activities. However, impurities and deficient preparations of the essential oil limit its safety and effectiveness. Herein, we proposed a strategy to prepare H. cordata essential oil (HEO) safely and effectively by combining the solvent extraction and the macroporous resin purification flexibly, and then encapsulating it using microemulsion. The extraction and purification process were optimized by orthogonal experimental design and adsorption-desorption tests, respectively. The average houttuynin content in pure HEO was then validated at 44.3% \u00b1 2.01%, which presented a great potential for industrial application. Subsequently, pure HEO-loaded microemulsion was prepared by high-pressure homogenization and was then fully characterized. Results showed that the pure HEO-loaded microemulsion was successfully prepared with an average particle size of 179.1 nm and a high encapsulation rate of 94.7%. Furthermore, safety evaluation tests and in vitro antiviral testing indicated that the safety and activity of HEO were significantly improved after purification using D101 resin and were further improved by microemulsion encapsulation. These results demonstrated that the purification of HEO by macroporous resin followed by microemulsion encapsulation would be a promising approach for industrial application of HEO for the antiviral therapies.Essential oil extracted from  Houttuynia cordata Thunb. (H. cordata) injection, in which EO is the main active compound, is widely used to treat respiratory infections, conjunctivitis, keratitis, acute, chronic rhinitis, and sinusitis in traditional Chinese medicine therapy. Moreover, H. cordata injection was recognized as the formula for the prevention of Severe Acute Respiratory Syndrome (SARS) by the Health Ministry of China during the outbreak of the SARS epidemic [H. cordata injection was suspended for its severe adverse drug reactions (ADR), such as breathing problems, high fever, rash, anaphylactic shock, and even sudden death by the China Food and Drug Administration (CFDA) in 2006.Nowadays, there is a renewed interest in medicinal plants because of the potentially important sources of bioactive substance that may be very important in the field of medicine. Essential oils (EOs) are volatile, natural, complex compounds isolated from natural plant materials . EOs have a broad spectrum of biological activities, such as anti-microbial ,2,3, antepidemic . HoweverH. cordata essential oil (HEO) is extracted from fresh H. cordata using hydrodistillation extraction and then dissolved in Tween 80 solution to prepare the H. cordata injection [H. cordata injection can also cause hemolysis, which may result from impurities of HEO or Tween 80 in the formulation [Generally, njection ,8,9,10. njection . Howevernjection . Studiesnjection ,14. In amulation ,16. Addimulation . TherefoH. cordata. Generally, liquid\u2013liquid extraction [Xue et al. reported that solvent extraction performed at room temperature is highly efficient to extract Hou-riched HEO . Comparetraction , fractiotraction , and siltraction  are usedtraction . In additraction ,23. Theytraction ,25, sapotraction ,27 and atraction  from traIntravenous microemulsions (MEs) are biodegradable, biocompatible, physically stable, easy to scale up, and cost effective . Most imThe extraction ratio of HEO was affected by many factors, such as solvent polarity, extraction time, root length, and solid-liquid ratio. Among them, the solvent is the main factor that determines the composition of extracts. In order to obtain HEO with high Hou content and narrow down the range of extraction parameters, optimization of solvents with different polarity were optimized before orthogonal tests. Here, solvents including non-polar petroleum ether (boiling range of 60\u201390 \u00b0C), medium polar ethyl acetate, and polar 95% ethanol were chosen for extraction using the Hou content as the index. Results showed that ethyl acetate had the highest Hou extract efficiency. Therefore, ethyl acetate was used as the solvent for the extraction.4 orthogonal tests were employed and the experimental design was shown in ik was the mean extraction ratio of the corresponding level of each factor and R was the range of the ik of each factor [ik was used for judging the optimal level of each factor while R was used for judging the effect of the factors. The results indicated that the optimized extraction condition was A2 (factor A level 2)/B3/C3/D2 and the effect of the factors was D > A > B > C. Therefore, sufficient extraction solvents with proper polarity could easily infiltrate to the herbs thereby improve the extraction efficiency. Additionally, ultrasonic time could improve the extraction efficiency and feasible extraction time and root length were beneficial for the penetration of solvent. Overall, the optimized extraction condition was as follows: the ultrasonic time was 20 min (A2), the extraction time was three days (B3), the H. cordata root length was 1.0 cm (C3), and the solid-liquid ratio was 1/1.5 . Using the optimized extraction condition, the HEO extraction ratio was 0.171% (wt %) and the Hou content in the extract was 8.80% (wt %) based on the GC analysis. Moreover, the extract was treated by alcohol sinking and n-hexane extraction to prepare the crude HEO (Hou 15.0%) for MR purification.To further optimize the extraction conditions, L9 (3) h factor ,31. The MRs were selected in accordance with the structures and polarities of the adsorbed substances and resins . As showAdsorption time is an important factor affecting the adsorption ratio of Hou on D101. The adsorption kinetic curve is one of the important characteristics that define the adsorption efficiency. As shown in v/v)) were used to establish the proper desorption conditions. As shown in v/v) solution was selected as the appropriate desorption solution and used in the following dynamic desorption experiments.Ethanol with low cost and nontoxic is usually used as the desorbent. Here, different concentrations of ethanol\u2013water solutions  were used to flush the resin to remove the high polar components and impurities. Subsequently, ethanol\u2013water  was used as the desorption solution and the dynamic desorption curve was obtained according to the eluent volume of ethanol\u2013water  and the Hou concentration of the eluent. As shown in Before Hou desorption, 2 BV of distilled water and 5 BV of ethanol-water  for 3 h at a flow rate of 6 BV/h. Then, 2 BV of deionized water and 5 BV of 30% ethanol were used to remove the high polar components and impurities. At last, 5 BV of 90% ethanol was used for Hou desorption at a flow rate of 6 BV/h.Qualitative analysis was measured by both GC-MS and GC. Overall, there were nine compounds identified by comparing the obtained MS with those of the NIST library with matching degree \u2265 95% . Then, hHowever, it was important to note that the Hou percentage in To further improve the safety and activities of HEO, HME (pure HEO: 2 mg/mL) was prepared and characterized. As shown in H. cordata injection could cause hemolysis due to the impurities of HEO or Tween 80 in the formulation [It is reported that mulation ,16. In vAcute toxicity test was performed to compare the safety of HEHEO, crude HEO, pure HEO, and HME. Briefly, mice were intravenously injected with Hou at the dose of 30 mg/kg and observed for toxic symptoms and mortality. As shown in Both in vitro hemolysis test and acute toxicity test proved that the HEHEO extracted by hydrodistillation showed serious toxicity, whereas purification followed by ME encapsulation could effectively improve the safety of HEO.50 of 17.24 \u00b5g/mL. For the extracts prepared by solvent extraction, pure HEO (Hou 46.6%) showed significant antiviral activity with IC50 of 7.41 \u00b5g/mL while the crude HEO (Hou 15.0%) showed relatively weak activities (IC50 > 15 \u00b5g/mL). This indicated that the solvent extraction following purification by D101 resin largely increased the content of Hou and, thus, improved the antiviral activity of HEO. Furthermore, the IC50 of HME was 0.35 \u00b5g/mL and SI was no less than 519.5 on CBV6. It is worth mentioning that the SI of HME was at least 100 times higher than that of the pure HEO without ME encapsulation. The largely increased SI indicated that ME encapsulation could simultaneously improve the safety and antiviral activity. The reasons could be explained as follows: HEO was wrapped in the inner oil phase and was controlled and sustained release to the virus by the shell of HME, which prolonged the action time and, thus, improved the activity. Additionally, the biodegradable and biocompatible shell (composed of phospholipids and Poloxamer 188) avoided the contact of HEO with Vero cells effectively, thereby greatly reducing the toxicity of HEO (TC50 > 181.82 \u00b5g/mL) [The in vitro antiviral activities of HEHEO, crude HEO, pure HEO, and HME against CVB3 and B6 were evaluated by using the conventional CPE method . As show2 \u00b5g/mL) . Further2 \u00b5g/mL) .CVBs is one of the most commonly identified agents for infection that is associated with acute and chronic myocarditis. However, there is no approved vaccine or antiviral drug for the prevention or treatment of CVB-induced diseases to date . HME exhD101 macroporous resin was supplied by Sinopharm Chemical Reagent Co. Ltd. . HP-20, HPD100 and AB-8 resins were purchased from Solarbio . All chemicals and solvents were of analytical grade and used without further purification.H. cordata were obtained from Yizhou . The botanical identification of the plant material was performed by Renyun Wang from Institute of Materia Medica and a voucher sample was sealed and stored at \u221240 \u00b0C. Fresh roots were washed, dried in the dark and cut into pieces with appropriate length before extraction.Fresh roots of Sixty ICR mice (20 \u00b1 2 g) of both sexes and one male rabbit (2 kg) were purchased from Charles River . Animals were allowed to acclimate to the laboratory environment for five days. The animal experiments were approved by the Animal Care and Welfare Committee of the Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College.m/z 20\u2013800 amu) and the identifications of the compounds were conducted by comparing the obtained mass spectra (MS) with those of the NIST library.The GC-MS system was composed of an Agilent 7890A series GC connected to an Agilent 5975C mass selective detector. An Agilent HP-5MS capillary column  was used for separation. Ultrapure helium was used as the carrier gas at a flow rate of 1.0 mL/min with injector temperature of 250 \u00b0C. One microliter of sample was injected under split mode (ratio 1:20). The oven temperature program was 50 \u00b0C for 2 min, rising at 4 \u00b0C/min to 150 \u00b0C for 3 min, followed by rising at 20 \u00b0C/min to 300 \u00b0C then held for 10 min. Electronic ionization source and quadrupole temperatures were 230 \u00b0C and 150 \u00b0C, respectively. All mass spectra were recorded in the full scan mode at 70 eV , where Y was the peak area of Hou, and X was the concentration of Hou (\u03bcg/mL).An Agilent 6890N series GC system equipped with a hydrogen flame ionization detector (FID) was used for quantitative analysis. Separation was achieved with an Agilent DB-5 capillary column . The carrier gas was nitrogen with a flow of 1.0 mL/min. The oven temperature was programmed at 50 \u00b0C for 3 min, with a rise of 5 \u00b0C/min up to 150 \u00b0C and held for 3 min, followed by rising at 20 \u00b0C/min to 250 \u00b0C, and held for 5 min. The temperature of both the injector and detector was set at 250 \u00b0C. One microliter of sample was injected under split mode (ratio 1:3). External standard calibration was used for the Hou quantitative analysis. A series of Hou standards in the range of 4.32\u2013216 \u03bcg/mL were prepared in ethyl acetate solution to obtain the linear response  of pparatus . Then, e4 orthogonal experimental design was used to optimize four variables  with the extraction ratio as the index. The factors and levels of individual variables were presented in n-hexane. After removing n-hexane, the crude HEO was obtained and stored at \u221220 \u00b0C.A L9 (3) Four types of MRs  were used in this study. The resins were pretreated by 95% ethanol for 24 h followed by deionized water to remove the monomers and porogenic agents trapped inside the pores during the synthesis process. Prior to use, the resins were wetted with ethanol and then washed with deionized water until the ethanol was thoroughly replaced. The moisture contents of the tested resins were determined by drying the beads at 100 \u00b0C to a constant weight in an oven. The moisture contents of D101, AB-8, HPD100 and HP20 resins were 52.12%, 62.11%, 72.17%, and 57.67%, respectively.v/v), then shaken (120 rpm) for 12 h at 25 \u00b0C. The Hou content in desorption solution was analyzed. The adsorption capacity, desorption capacity and desorption ratio of each resin were selected as indexes and calculated by the following formulas:0 and Ce were the initial and equilibrium concentrations of Hou (mg/mL), respectively; W was the weight of the dry resin (g); V0 and Vd were the volumes of adsorption and desorption solutions (mL), respectively; and Cd represented the concentration of Hou in the desorption solution (mg/mL).In order to select the most suitable MR to purify the crude HEO, the adsorption and desorption properties of the four resins were characterized. One gram of each resin (dry) was placed into a conical flask and 20 mL sample solution (crude HEO 5.0 mg/mL) was added. The flask was then shaken in a shaker (120 rpm) for 12 h at 25 \u00b0C. After reaching the adsorption equilibrium, the sample solution was removed and the Hou content was analyzed by GC. Then, the resin was washed with deionized water and desorbed with 10 mL 80% ethanol (Dynamic adsorption-desorption experiments were performed in a glass columns (1.5 cm \u00d7 20 cm)  wet packed with 12 g (wet resin) of the D101 resin. The bed volume (BV) of the resin was 20 mL. After loading the sample, the column was washed with distilled water (2 BV) and ethanol\u2013water  to remove impurities and then desorption solvents. The conditions were as follows: Hou concentration of the loading sample solution was 0.225 mg/mL; sample flow rate was 6 BV/h, desorption solvents included different ethanol/water solutions  with an adsorption flow rate of 6 BV/h.g for 8 h at 4 \u00b0C.HME was prepared by high-pressure homogenization as previously reported by our team . The HMEg for 10 min to remove the supernatant. The precipitated blood cells were then washed with 0.9% sodium chloride several times until the supernatant was colorless. At last, an erythrocyte suspension  was prepared by suspending the erythrocyte into the 0.9% sodium chloride.About 10 mL of blood was collected from a rabbit and centrifuged at 395\u00d7 v/v) and different amounts of 0.9% sodium chloride were added to make a total volume of 5 mL. For the tubes 6% and 7%, 0.9% sodium chloride and distilled water replaced the sample solutions as blank control and positive control, respectively. Then, the tubes were placed into a 37 \u00b0C water bath with gentle shaking. The results were recorded at 30 min as well as at 1 h, 2 h, 3 h, and 4 h. The results were interpreted qualitatively as follows:Hemolysis (++): transparent and red solution without erythrocyte sinking.Weak hemolysis (+\u2212): light red or brown solution with a small amount of erythrocyte sinking.No hemolysis (\u2212\u2212): erythrocyte sink leaving a colorless and clear supernatant.Agglutination (Agg.): dark brown or reddish flocculent precipitate in the solution.HEHEO, crude HEO, and pure HEO were dispersed in Tween 80 solution (2.5%) to prepare samples with the extract concentration of 2.0 mg/mL, respectively. Tubes 1\u20135 were filled with 0.5, 0.4, 0.3, 0.2, and 0.1 mL of sample, respectively. Then, 2.5 mL of 2% erythrocyte suspension . Before the test, crude HEO and pure HEO were dispersed in Tween 80 solution (2.5%) to prepare samples with the Hou concentration of 1.5 mg/mL, respectively. The crude HEO, pure HEO and HEM (Hou 1.5 mg/mL) were injected through the caudal vein with Hou at the doses of 30 mg/kg. For the HEHEO group, the extract was dissolved in Tween 80 solution (2.5%) with the extract concentration of 4 mg/mL. Negative controls were blank Tween 80 (2.5%) solution and blank ME. Additionally, no-treatment control was set for observation of symptoms and insurance of accuracy. General behaviors of mice and symptoms of toxicity were observed continuously for 24 h after injection.2 \u221295% air). Coxsackie Virus B3  and B6  were obtained from ATCC and propagated in Vero cells.African green monkey kidney cells (Vero) were purchased from the American Type Culture Collection  and cultured in MEM supplemented with 10% FBS and antibiotics  at 37 \u00b0C in a humid atmosphere (5% CO50) was defined as the concentration that inhibited 50% cellular growth in comparison with the untreated controls and calculated using the Reed-Muench method.The cytotoxicity effects of the samples  toward Vero cells were monitored by the MTT assay. Vero cells seeded in 96-well plates were incubated with various concentrations of tested samples or ribavirin and pleconaril (positive controls) for 72 h at 37 \u00b0C. The cells were then incubated with 20 \u00b5L MTT reagent  for 4 h at 37 \u00b0C. The MTT reagent was removed and 150 \u00b5L DMSO was added to each well. The spectrophotometric reading was taken at 490 nm using a microplate reader . 5Fifty percent (50%) toxic concentration (TC50) was determined using the Reed-Muench method. The selective index (SI) was calculated from the ratio of TC50/IC50.The antiviral activity against CVB3 and CVB6 was evaluated using the cytopathic effect (CPE) reduction method. Briefly, cells were plated into 96-well culture plates and incubated for 24 h. The medium was then removed and cells were infected with virus for 2 h. Samples with different various concentrations  were added to each well immediately and incubated until the CPE of the control group cells reached 4. The 50% inhibitory concentration  was prepared by solvent extraction followed by purification using D101 resin. To further improve its safety and antiviral activity, the pure HEO was encapsulated into ME and then comprehensively characterized. The safety evaluation tests and in vitro antiviral test indicated that the safety and antiviral activity of HEO were largely improved after purification by D101 resin and were further improved by ME encapsulation. These results indicated that purification of HEO using D101 resin, followed by ME encapsulation, was of high efficiency, reduced toxicity, and enhanced effect, which was very promising for future therapy of antiviral and infectious diseases. Hou, the major active constituent of HEO, possesses a quite simple chemical structure and high antiviral activities. This is straightforward to evaluate its usefulness as a pure compound in the future."}
+{"text": "DEAD box RNA helicase 17 (DDX17) is a transcriptional regulator of several transcription factors, which is more appreciated than its role in RNA metabolism. However, prognostic value and biofunction of DDX17 in HCC remain unclear. Illuminating the mechanism underlying the regulating HCC progression by DDX17 may contribute to therapeutic strategies. In our study, we report for the first time that DDX17 was overexpressed in HCC specimens by using The Cancer Genome Atlas (TCGA) and immunohistochemistry (IHC) and correlated to clinical pathological characteristics and patients\u2019 survival. In vitro, DDX17 was ascertained to alter HCC migratory and invasive capacities after overexpression and knockdown in HCC cell lines. Moreover, by performing co-immunoprecipitation (Co-IP) and GST-pull down assay, the physical association between DDX17 and Klf4 was discovered and validated. Additionally, DDX17 could modulate expressions of Klf4 target genes including E-cadherin, MMP2 by inhibiting the promoter activity. The potent correlation between DDX17 and Klf4 target gene expressions was further appraised by a same set of 30 HCC tissues. Besides, we discovered that DDX17 could not deploy its function in regulating Klf4 target gene expressions and HCC progression in Klf4-depletion condition. Intriguingly, DDX17 failed to interact with Klf4 once the zinc-finger domain was deleted and inhibited the binding of Klf4 on MMP-2 promoter. Collectively, our study enucleates novel mechanism of DDX17-mediated oncogenesis by suppressing the transcriptional activity of Klf4 thus is likely to be a therapeutic target in HCC. Besides, almost 80 hundred thousand new cases of HCC occurred in 2018 worldwide, surprisingly among them nearly 79 hundred thousand deaths was caused by HCC1, which definitely denotes that the incidence, as well as mortality of HCC have not been decreased although substantial improvement through treatment strategies is achieved. Therefore, pursuing for novel biomarkers with high sensitivity and specificity is so challenging that it requires urgent research.Hepatocellular carcinoma (HCC) ranks as the fifth and seventh most common malignancy globally in men and women, respectively, also is the second leading cause of cancer-related deaths2. Besides, it has become increasingly clear that DDX17 acts as a transcription factors (TFs)-associated protein, such as NFAT-5, HDAC1, SOX2, and beta-catenin6, and exhibits its function in various tumors. Aberrant DDX17 expression was found in colon7 and lung cancers, which promotes tumor progression7. However, the landscape of DDX17 in HCC involving its functional role and molecular mechanisms in the context of oncogenesis has never been deciphered.DDX17 (DEAD Asp-Glu-Ala-Asp) box helicase 17, also known as p72, is a typical member of DEAD box family and it gained attention for its role as a kind of RNA helicases8. Loss of Klf4 expression is well established in different cancers10. Our previous study confirms that Klf4 is also deregulated in HCC and could regulate numerous cancer cell processes12. Corroborated evidence suggests the presence of Cys2/His2zinc-finger motifs in carboxy-terminal domain of Klf4 confers preferential binding to GC/GT-rich or CACCC element sequences in its target gene promoter and enhancer regions followed by expression changes of broad array of genes covering cell cycle and proliferation, such as p21, p27, p5715, and tumor metastasis like matrix metalloproteinase 2 (MMP-2) and E-cadherin17. In our study, we evaluated the prognostic value of DDX17 in HCC and explored its effect on HCC migration and invasion. Besides, we went deeper insight into the molecular mechanism of DDX17 in HCC progression, which unveiled the interaction between DDX17 and Klf4 in regulating HCC metastasis.Kr\u00fcppel-like factor 4  is a well-known TF pivotal for the maintenance of the pluripotency stem cell state in embryonic stem cells (ESC)p\u2009<\u20090.001). Then, we further evaluated its association with clinical pathological characteristics. As shown in Fig. p\u2009=\u20090.03). Therefore, we assumed that non-significance between DDX17 and tumor size or distant metastasis was probably due to lack of large samples, which requires further research to validate.We first utilized TCGA database to access DDX17 mRNA expression and its association with HCC prognosis. As shown in Fig. p\u2009<\u20090.001) and results also showed that the expression of DDX17 was increased significantly as HCC progressed to more advanced stage , nodal involvement (N stage) (p\u2009=\u20090.019), distant metastasis (M stage) (p\u2009=\u20090.037), tumor differentiation (p\u2009=\u20090.0012), and American Joint Committee on Cancer (AJCC) stage (p\u2009<\u20090.001). However, there were no associations between DDX17 expression and patient age and gender.In order to validate that correlation between DDX17 expression and HCC progression, IHC was performed to evaluate the DDX17 protein expression in 105 human HCC specimens and substantially overexpressed DDX17 protein was found in HCC specimens compared to adjacent normal tissue . Besides, high expression level of DDX17 was associated with a trend towards poor OS . In addition, further OS analysis was performed according to tumor stage, and results manifested that patients who were in stage I\u2013II or stage III\u2013IV, with higher DDX17 expression had worse outcome than those with lower DDX17 expression  and MMP-2 (p\u2009=\u20090.024) according to Spearman\u2019s correlation test 22. Recently, DDX17 was demonstrated to interact with \u03b2-catenin and facilitate its nuclear accumulation, thus activating \u03b2-catenin target genes, and ultimately resulting in acquired resistance of non-small cell lung cancer (NSCLC) cells to gefitinib3. However, in our study, we firstly reported that DDX17 was upregulated in HCC and was strongly associated with HCC clinical pathological features as well as prognosis in HCC. Thus, DDX17 was an independent prognostic factor for HCC. We also discovered that DDX17 could promote HCC cells\u2019 progression by contributing to the migratory and invasive capacities of HCC cells. These data revealed that DDX17 might take part in indispensable signaling, consequently promoting HCC progression.DDX17 is overexpressed in colon cancer, lung cancer, and glioma cancer, potentiating tumor cell proliferation and progression17. In addition, DDX17 was capable to directly potentiate MMP-2 promoter activity. Moreover, in HCC tissues, the expression of DDX17 in HCC tissues presented strong correlation with the expression of E-cadherin and MMP-2. Besides, in HCC cell lines, intriguing results were obtained that DDX17 could not further trigger protein and mRNA expression alterations of E-cadherin and MMP-2 in Klf4-depleted condition. In accordance with that, DDX17 overexpression lost its function in promoting HCC cell lines metastasis once Klf4 was depleted. These results might reveal that the process of recruiting Klf4 to its target gene\u2019s promoter by other regulators was prevented by DDX17.Then, our CO-IP assay results confirmed the interaction between DDX17 and Klf4 in HEK293T cells as well as in HCC cells, and GST pull down assay further demonstrated this physical interaction. Moreover, during getting deeper insight into the effects of potent interaction between DDX17 and Klf4 in HCC cell lines, we discovered that DDX17 could modulate Klf4-dependent target genes at both transcriptional and translational levels containing MMP-2 and E-cadherin, which are eligible for tumor cells to migrate and invade and are directly regulated by Klf46. Thus, we proposed that transcriptional activity of Klf4 was also inhibited by DDX17. In fact, our CO-IP assay revealed that DDX17 failed to interact with Klf4 once its functional domain\u2014zinc-finger domain was totally deleted. Therefore, DDX17 indeed impeded the process of Klf4-regulating promoter activity of its target genes. In addition, our studies found that the KLF4 and DDX17 did not co-localize on the promoter of MMP2, but we observed that DDX17 overexpression decreased the binding of KLF4 on chromatin, suggesting that the DDX17 might contribute to the dissociation of KLF4 on chromatin and vice versa. Indeed, lines of studies observed that there are many proteins that shuttles between nucleus and cytoplasm, involved in the regulation of transcription by disrupting the bindings of TFs on chromatin, this report is the first to demonstrate that DDX17 is bound to Klf4 at chromatin.Furthermore, multitudinous evidence has proved that DDX17 usually acts as a positive or negative regulator of TF, such as SOX2, \u03b2-catenin, whose transcriptional activity is modulated by DDX17, further regulating TF target genesHowever, our study suggested that other Klf4-target genes also may be regulated by DDX17. Suppression of DDX17 barely regulated HCC cell proliferation after Klf4 was depleted. This result indicates that DDX17 may also regulate Klf4-target genes associated with proliferation, thus MMP-2 and E-cadherin are not the genes exclusively regulated by DDX17. Our hypothesis is that DDX17 may regulate plenty of Klf4 target genes and can influence the binding of Klf4 on target gene promoter or enhancer. It was noticeable that DDX17 still remained weak ability to promote HCC proliferation. This indicates that Klf4 may be not the only TF that interacts with DDX17. Because DDX17 could act as regulator of many TFs, we assumed that DDX17 may affect transcriptional activities of Klf4 and other transcriptional factors, followed by alteration of a set of their target genes expression and increased cell proliferation. However, whether all of Klf4 target genes are regulated by DDX17 needs further study to validate.In summary, our study report for the first time that DDX17 acts as a negative regulator of Klf4 transcriptional activity in HCC and is an independent prognostic factor of HCC, which might be a potential therapeutic target. We decipher that DDX17 interacts with Klf4 and inhibits its zinc-finger activity in HCC, further being recruited by Klf4 to MMP-2 promoter and modulating their expressions, ultimately promotes HCC metastasis, which was depicted in Fig. 23. The small hairpin RNA (ShRNA) was constructed using the following primers:HEK293T and HCC cells  were cultured as previously describedDDX17 shRNA1: CCCAATCTGATGTATCAGGAT;DDX17shRNA2: GACCACAAGTTGATCCAACTA;Klf4 shRNA: GCTCCATTACCAAGAGCTCAT.23.HA-Klf4 and Flag-DDX17 expression plasmids were obtained from Shanghai Asia-Vector Biotechnology. Mutant Klf4 plasmids were constructed by PCR from HA-Klf4. The MMP2 proximal promoter (\u2212521/\u2212136\u2009bp) was amplified by PCR. Transfection and stable cell lines were performed in detail as previously describedHEK293T and SMMC7721 cells maintained in normal growth medium were transfected with Flag-DDX17 or HA-Klf4 plasmid for 48\u2009h. Transfected cells were harvested and lysed. Then, Flag-M2/HA beads (Sigma-Aldrich) were used to immunoprecipitate with Flag-DDX17 or HA-Klf4, and the precipitate was washed four times using cell lysis buffer. Finally, the proteins were analyzed by Western blotting.GST fusion protein containing pGEX-Klf4 or pGEX vector was induced with 0.1\u2009mM of IPTG (Sigma-Aldrich). GST or GST-Klf4 was purified by GSTrap\u2122 FF . Total cell lysates were incubated with GST beads  overnight at 4\u2009\u00b0C followed by four times washing using washing buffer. Finally, proteins were visible by western blot analysis.To construct rDNA promoter-activated luciferase reporter, \u2212521/\u2212136\u2009bp of rDNA promoter (the transcription start site is represented as +1) was subcloned into PGL3. Luciferase reporter assay was performed in SMMC7721 cell and HepG2 cells. Briefly, cells were seeded in 24-well plates and then were co-transfected with indicated plasmids and the rDNA-promoter luciferase reporter plasmid for 48\u2009h. Luciferase was detected using the Dual-Luciferase assay kit (Promega). Renilla was co-transfected to normalize transfection efficiency.Total RNA was extracted from indicated cells by Trizol (Takara) according to the manufacturer\u2019s instruction, followed by reverse-transcribed by a PrimeScript RT reagent kit (Takara). Real-time PCR was performed in triplicate using SYBR Premix Ex TaqTM (Takara) and by using an Applied Biosystems 7500 Real-time PCR system. The following primers were used:GAPDH, forward 5\u2032-GGCATGGACTGTGG TCATGAG-3\u2032GAPDH, reverse 5\u2032-T GCACCACCAAC TGCTTAGC-3\u2032;DDX17, forward 5\u2032-GATG TTTGTCCTAAACCCGTGT-3\u2032DDX17, reverse 5\u2032-CC AACGGAAATCCCTGGCA-3\u2032;Klf4 forward 5\u2032-CTGGTTCCGCGTGGATCCCCAGGA-3\u2032Klf4 reverse 5\u2032-TCACGATGCGGCCGCTCGAGTCGACCCGG-3\u2032;MMP2, forward 5\u2032-TACAGGAT CATTGGCTACACACC-3\u2032MMP2, reverse 5\u2032-GGTCAC ATCGCTCCAGACT-3\u2032;E-cadherin, forward 5\u2032-CGAGAGCTACACGTTCACGG-3\u2032E-cadherin, reverse 5\u2032-GGGTGTCGAGGGAAAAATA GG-3\u2032.\u00ae Active Motif). Klf4 was immunoprecipitated using anti-Klf4(Abcam). Pre-immune rabbit serum was used as negative control. For chromatin re-immunoprecipitation (re-ChIP) assay, the chromatin immunoprecipitation was eluted from the first ChIP with 10\u2009mm DTT at 37\u2009\u00b0C for 30\u2009min and diluted 20 times with ChIP dilution buffer  and immunoprecipitated with the DDX17 antibody (Proteintech). The immunoprecipitated DNA was uncross-linked, subjected to proteinase K digestion, and purified using QIAquick columns . qPCR was performed to analyze ChIP and re-ChIP samples by using the following primers: forward, 5\u2032-TGGCATAATGATGTGGCTGT-3\u2032, and reverse, 5\u2032-TTGGCTGGAAAAGGTGTAGG-3\u2032 that would amplify the fragment encompassing the Klf4-binding site.ChIP assay was performed on SMMC7721 cells with and without the indicated treatments using a kit according to the supplier\u2019s protocol .Cells migration and invasion were accessed using transwell filter  as described previouslyCCK-8 assay was performed to detect cell proliferation. Different groups of cells were plated in 96-well plate with 100\u2009\u03bcl medium per well. After culture for 6, 24, 48, 72, 96\u2009h, 120\u2009\u03bcl medium containing 10\u2009\u03bcl. CCK8  was added to each well. Cells were cultured for another 2\u2009h in incubator and then the absorbance was measured at a wavelength of 450\u2009nm.3 cells per well and then cultured for 14 days. Then, the cells were fixed using 4% methyl alcohol for 15\u2009min and stained with 5% crystal violet solution for additional 15\u2009min. Finally, clones were counted to evaluate cell proliferation.Cells were seeded in six-well plates, with a density of 1\u2009\u00d7\u200910p-value\u2009<\u20090.05 in all cases was considered statistically significant.All statistical analyses were implemented with the SPSS 23.0 statistical software package. t-text, chi-square text, and Fisher\u2019s exact test were used to analyze in experimental groups. Besides, the Kaplan\u2013Meier test was used to analyze the survival rates. Spearman\u2019s correlation test was applied to analyze the correlation. DDX17 promotes HCC cell proliferation"}
+{"text": "Syphilitic uveitis is an infective uveitis and a great mimicker. Misdiagnosis can lead to delay in the specific treatment resulting in deterioration of uveitis and loss of vision.A 38-year-old unmarried female presented with pain, redness, and blurring of vision in the left eye for the last 5\u00a0days. She denied history of any sexual exposure in the past. Anterior segment examination of the right eye was normal and the left eye showed keratic precipitates with anterior chamber cells and iris pigments on anterior lens capsule. Fundus examination of the right eye showed a hyperemic disc with posterior placoid retinochoroiditis and the left eye showed dense vitritis, hyperemic disc, and superficial retinal precipitates. She was misdiagnosed as viral retinitis elsewhere and started on antivirals with oral corticosteroids which resulted in deterioration of uveitis and progression to bilateral involvement. Further systemic investigations confirmed the diagnosis of syphilis and human immunodeficiency virus infection. She was then started on anti-syphilitic and anti-retroviral therapy which resulted in restoration of the vision in one eye.Syphilitic uveitis does not occur in primary disease and is common in secondary and early latent phase of syphilis. History given by the patient is often contributory however at times can be misleading. A high clinical suspicion and thorough investigation is necessary for the correct diagnosis and timely intervention in preventing loss of vision. Treponema pallidum. It affects most of the organ systems including skin, heart, blood vessels, bone, nervous system, and eye [Acquired syphilis is a sexually transmitted disease caused by spirochetal bacterium  and eye , 2. Ocul and eye . It may A 38-year-old unmarried female patient presented with pain, redness, and blurring of vision in the left eye for the last 5\u00a0days. She had a history of hypothyroidism, recurrent ulceration of breasts, hair loss, nausea, vomiting, and gastric pain. She was on treatment for hypothyroidism, anemia, and esophageal reflux disease. She denied history of any sexual exposure in the past. On examination, the best corrected visual acuity (BCVA) in the right eye was 6/6, N6 and in the left eye was hand movement (HM),<\u2009N36. Intraocular pressure (IOP) was 14\u00a0mmHg in the right eye and 16\u00a0mmHg in the left eye. Anterior segment examination of the right eye was normal and the left eye showed keratic precipitates, anterior chamber cells 2+ with flare (SUN\u2014standardization of uveitis nomenclature grading) [3 and raised erythrocyte sedimentation rate (ESR)\u201435\u00a0mm/h. Mantoux test \u2212\u20090\u00a0mm induration after 72\u00a0h. She was started on oral valacyclovir 1\u00a0g three times a day with topical prednisolone acetate 1% and oral corticosteroids 1\u00a0mg/kg weight which she was using for the last 2\u00a0weeks.She was advised investigations but was lost to follow-up for 1\u00a0month and diagnosed elsewhere as viral retinitis. Investigations done showed decreased white blood cell (WBC) count\u20143980\u00a0mmAfter being lost to follow-up for 1\u00a0month, she presented with blurring of vision in the right eye for last 1\u00a0week and ocular pain in both the eyes. The BCVA in the right eye was 6/36, N24p and in the left eye HM, <\u2009N36. Anterior segment examination showed anterior chamber cells 2+ with flare (SUN grading) in both the eyes, with keratic precipitates and iris pigments on anterior lens capsule in the left eye. Fundus examination of the right eye showed a hyperemic disc with ground glass retinochoroiditis and superficial retinal precipitates along the inferotemporal arcade and the left eye showed dense vitritis with hyperemic disc, intraretinal hemorrhage superonasal to the disc and superficial retinal precipitates Fig.\u00a0. On furtFollow up at 6\u00a0weeks, the BCVA in the right eye was 6/18, N6 and in the left eye finger counting (FC) at 1\u00a0m, <\u2009N36. Fundus examination of the right eye showed pigmentary alterations along the inferotemporal arcade and the left eye showed disc pallor, sclerosed vessels, pigmentary alterations, and ERM at the macula  or acquired in adulthood (acquired syphilis). Syphilitic uveitis is an infectious uveitis. It does not occur in primary disease and is the most common in the secondary stage of acquired syphilis.Syphilis is a sexually transmitted chronic disease caused by the spirochete Ocular involvement by syphilis has varied manifestations such as iridocyclitis, papillitis, retinochoroiditis, retinal pigment epithelitis, serous retinal detachment, cystoid macular edema, vitreous opacity, and neuroretinitis , 6. The Ocular syphilis is a great mimicker , 9. MisdVarious risks factors associated with combined syphilis and HIV infection as reported in the literature include homosexual male, age group 18\u201330\u00a0years, multiple sexual partners , 14. OurOn review of literature, we found a similar case reported by Zambon F et al. , where aDiagnosis of syphilitic uveitis or viral retinitis may be difficult in the presence of severe vitritis. Syphilitic retinitis is a form of necrotizing retinitis , 16. TheSyphilitic uveitis shows a good response to penicillin; however, one may encounter an increased ocular inflammation known as Jarrisch Herxheimer reaction after the initiation of the treatment requiring oral corticosteroids. However in our case, the general health of the patient was not good with underlying HIV infection and she was intolerant to oral corticosteroids ; therefore, it was decided to stop them by the treating physician.We report this case as syphilis which is uncommon in our country; however, there has been a resurgence in the last few years. We routinely investigate our patients based on clinical suspicion and the history given by the patient is often contributory however at times like in our case was misleading, leading to a delay in the management. We need to be aware of the varied manifestations of syphilis and suspect immunosuppression when a patient presents with a zero Mantoux reading in a tuberculosis endemic country like ours. We need to have a high level of clinical suspicion and thoroughly investigate the patient before initiating corticosteroid therapy in an infective uveitis as it may lead to delay in a specific treatment and result in permanent loss of vision."}
+{"text": "An excellent rate capability is achieved with an average capacity of 220.3\u2009mA\u2009h\u2009g\u22121 at the high current density of 5\u2009A\u2009g\u22121. Moreover, the electrocatalytic effects of atomic cobalt are clearly evidenced by operando Raman spectroscopy, synchrotron X-ray diffraction, and density functional theory.The low-cost room-temperature sodium-sulfur battery system is arousing extensive interest owing to its promise for large-scale applications. Although significant efforts have been made, resolving low sulfur reaction activity and severe polysulfide dissolution remains challenging. Here, a sulfur host comprised of atomic cobalt-decorated hollow carbon nanospheres is synthesized to enhance sulfur reactivity and to electrocatalytically reduce polysulfide into the final product, sodium sulfide. The constructed sulfur cathode delivers an initial reversible capacity of 1081\u2009mA\u2009h\u2009g Room-temperature sodium-sulfur batteries hold promise, but are hindered by low reversible capacity and fast capacity fade. Here the authors construct a multifunctional sulfur host comprised of cobalt-decorated carbon nanospheres that impart attractive performance as a cathode in a sodium sulfide battery. On the other hand, new emerging applications, such as electric vehicles and large-scale grids, require battery technologies with low costs and long cycle life6. Lithium-sulfur (Li/S) batteries have attracted intense attention due to high theoretical specific energy, environmental benignity, and the low cost and abundance of sulfur9. Due to efforts over decades, exciting progress on Li-S batteries has been achieved in terms of high capacity, prolonged service life, and remarkable rate capability, which are rapidly bringing this system near delivery to market. Meanwhile, it should be noted that the battery systems based on Li-ion storage are not suitable for large-scale applications, due to the high cost and insufficiency of Li resources11. Therefore, increasing interest is currently transferring to batteries based on low-cost and abundant sodium13. Room-temperature sodium-sulfur (RT-Na/S) batteries are among the ideal candidates to meet the scale and cost requirements of the market due to overwhelming advantages: a theoretical capacity of S (1672\u2009mA\u2009h\u2009g\u22121), low cost, nontoxicity and resource abundance15. Nevertheless, RT-Na/S batteries, which share a similar reaction mechanism to the Li/S batteries, are facing critical problems with respect to low reversible capacity and fast capacity fade17. The poor conductivity of sulfur and sluggish reactivity of sulfur with sodium, resulting in a low utilization rate of sulfur and incomplete reduction to Na2Sx (x\u2009\u2265\u20092) rather than complete reduction to Na2S, are the main reasons for low accessible capacity. In addition, fast capacity fade during the charge\u2212discharge progress occurs due to the dissolution of long-chain polysulfides in the electrolyte, which also leads to the rapid loss of active materials. Hence, effective materials design is the primary factor that is expected to improve the conductivity and activity of sulfur, and prevent the dissolution of polysulfides. So far, the reported sulfur hosts  could exhibit decent enhancement, but a huge leap is needed to reach the standard of practical applications. To the best of our knowledge, the best rate capacity and longest cycling stability for RT-Na/S batteries are observed in those containing the sulfur@interconnected mesoporous carbon hollow nanospheres (S@iMCHS) (127\u2009mA\u2009h\u2009g\u22121 at 5\u2009A\u2009g\u22121)20 and C-S polyacrylonitrile (c-PANS) (150\u2009mA\u2009h\u2009g\u22121 after 500 cycles at 220\u2009mA\u2009g\u22121)21, respectively. It is obvious that the sulfur cathodes based on traditional carbonaceous host materials are not capable of meeting the practical targets for large-scale RT-Na/S batteries.Currently, lithium-ion batteries (LIBs) play a dominant role in battery technologies for portable electronics because of their high capacity, high energy density, and reliable efficiency22 and metal sulfides23, have been investigated in Li/S cells. Compared with bare carbon materials, these polarized host materials have strong intrinsic sulfiphilic property, which are able to impede polysulfide dissolution due to the strong chemical interactions between the polar host materials and the polysulfides. A similar concept has been demonstrated in RT-Na/S batteries; Cu nanoparticles loaded in mesoporous carbon are utilized to immobilize the sulfur and polysulfides24; a novel Cu foam current collector is able to activate sulfur electroactivity as well25. Furthermore, atomic-scale metal materials, including single-atom metals and metal clusters, in general, not only possess amazing electronic and reactive properties, but also could reach the maximum atomic utilization31. It is rational but very challenging to introduce novel atomic metals into a sulfur host, which is expected to maximize the multifunctions of a polarized sulfur host and achieve extraordinary performance for RT-Na/S batteries.Recently, novel sulfur hosts with inherent polarization, such as metallic oxidesn) migration into carbon shells, forming a novel Con-HC host. A sulfur composite, sulfur encapsulated in a Con-HC host (S@Con-HC), is prepared by simply tuning the reaction temperature. When applied in RT-Na/S batteries, the S@Con-HC cathode exhibits outstanding electrochemical performance, which suggests that the maximized atomic utilization could optimize the multiple functions of Co metal towards enhancing sulfur conductivity, activating sulfur reactivity, and immobilizing sulfur and polysulfides. More specifically, the S@Con-HC achieves remarkable cycling stability (507\u2009mA\u2009h\u2009g\u22121 after 600 cycles at 100\u2009mA\u2009g\u22121) and rate performance (220.3\u2009mA\u2009h\u2009g\u22121 at 5\u2009A\u2009g\u22121). A deep insight into the mechanism has also been obtained by cyclic voltammetry (CV), operando Raman spectroscopy, synchrotron X-ray diffraction (XRD), and density functional theory (DFT), confirming that atomic Co could alleviate the \u201cshuttle effect\u201d and also effectively electrocatalyze the reduction from Na2S4 into the final product Na2S.Here, we successfully synthesized a highly effective sulfur host with atomic Co (including SA Co and Co clusters) supported in micropores of hollow carbon (HC) nanospheres. The HC nanospheres are employed as ideal frameworks, which could allow initial anchoring of Co nanoparticles and subsequent S encapsulation. In each HC reactor, it is interesting that the diffusion of sulfur molecules can serve as traction for atomic Co  of HC nanospheres (Co-HC) by controlled thermal treatment method  could be achieved.The synthetic process of the S@Con-HC demonstrate that the uniform dispersion of hollow carbons without any nanoparticles existed; meanwhile, atomic Co (bright dots) are observed in the C shells. The elemental mapping and line-profile analysis of S@Con-HC demonstrates that this atomic Co is well confined in the carbon shells; meanwhile, most of the S is embedded in the carbon shell along with the dispersion of atomic Co, which implies the simultaneous formation of atomic Co and S dispersion. This is attributed to Co atoms migrating into HC shells with S sublimation via an atom migration strategy based on the strong interaction between Co and S. Hence, most of the S molecules diffuse into the C shells, and are adsorbed by atomic Co. The average size of the atomic Co is calculated to be 0.4\u2009\u00b1\u20090.2\u2009nm from 200 single atoms and clusters in Supplementary Fig. 32. Surprisingly, the atomic Co is successfully introduced into the S@Con-HC composite. Active S, in turn, plays a critical role in forming and stabilizing atomic Co by strong chemical Co\u2212S bonds. In sharp contrast, numerous cubic nanoparticles (~ 10\u2009nm) can be observed in HC prepared at 400\u2009\u00b0C  results demonstrate that the contents of Co are comparable, with weight ratios of 7.53, 7.06, and 6.85% in S/Co-HC, S@Con-HC, and S@CoS2-HC, respectively. Meanwhile, the Co loading ratios (5 and 20% of CoCl2) also have been optimized for S@Co-HC as shown in Supplementary Figs.\u00a0As displayed in Fig. ticles ~ 0\u2009nm can n-HC, and S@HC are ~48, 47, and 30\u2009wt%, respectively. The low S loading ratio of 30\u2009wt% indicates that atomic Co in HC is favorable to capture S and enhance S loading amount. There are three states of sulfur in S@Con-HC. The crystalline sulfur on the carbon layer would sublime at a relatively low temperature of ~270\u2009\u00b0C, which accounts for ~33\u2009wt%. Then, a small amount of amorphous sulfur, confined in the micropores15, would evaporate at temperatures from 270 to 530\u2009\u00b0C with a sulfur loss of ~8\u2009wt%; the sulfur encapsulated in the hollow space could finally sublime at a high temperature of 530\u2009\u00b0C, which corresponds to a sulfur portion of ~6\u2009wt%. The S@HC sample shows a similar TGA curve, indicating S present in the same states as those of the S@Con-HC; the amorphous sulfur in S@HC is about ~7\u2009wt%. Compared with other Co-based materials, as shown in Supplementary Fig.\u00a0n-HC is the most difficult to vaporize. The starting temperature of weight loss is 173\u2009\u00b0C for S@Con-HC, which is much higher than that of S/Co-HC (155\u2009\u00b0C), indicating that the binding between S and Co in S@Con-HC is the strongest20. Interestingly, the S loss commences at 171\u2009\u00b0C for S@HC, indicating that the S is firmly embedded into HC after removing the surface S via heat treatment at 300\u2009\u00b0C20. This result also indicates that the S in S@Con-HC not only is physically confined in HC frameworks, but also chemisorbed by atomic Co. The S ratio of S@CoS2-HC (~31\u2009wt%) is low because the formation of CoS2 consumes a certain amount of S. XRD patterns of these samples are shown in Fig.\u00a0n-HC and S@HC are indexed to crystalline sulfur. The low intensity and absence of certain peaks imply that sulfur could be embedded in the Con-HC and HC hosts. CoS2/S-HC has four peaks at 32.5\u00b0, 36.36\u00b0, 46.54\u00b0, and 54.98\u00b0, corresponding respectively to the (200), (210), (220), and (311) planes of CoS2 (JCPDF no. 41-4171). Significantly, the XRD results for S/Co-HC and S@Con-HC indicated that S accounted for the dominant component, and the lack of XRD peaks for Co or any CoSx is likely due to the ultrafine and even atomic size of Co; additionally, the wrapping by S of the surface of Co would decrease its signal as well.The thermogravimetric analysis (TGA) results shown in Fig.\u00a0p3/2,164.0\u2009eV), the S 2p3/2 responses of S@HC and S@Con-HC are shifted at 163.60 and 163.45\u2009eV, respectively. The shift is probably attributable to the adsorption of S by HC33. The lower S 2p3/2 of S@Con-HC could be due to the presence of atomic Co, which is decorated on the carbon shell and could aid HC in immobilizing S by forming Co\u2212S bonds. Interestingly, the S 2p3/2 binding energy of S/Co-HC (165.1\u2009eV) is close to that of CoS2/S-HC (164.90\u2009eV), which indicates that the surface Co nanoparticles of S/Co-HC could be polarized to S2\u2212. To further investigate this hypothesis, we studied the states of Co. The XPS data for S@Con-HC in the Co 2p region in Fig.\u00a00 (778.70\u2009eV) and Co2+ (781.60\u2009eV). The Co2+ (781.60\u2009eV) in S@Con-HC could be attributed to single Co anchored on S-dispersed hollow carbon34, probably through the formation of a Co\u2212S bond. While, except for single Co atoms, Co clusters exist in S@Con-HC as shown in Fig.\u00a0p region for S@Con-HC show evidence of the Co0 state. The binding energy of the Co0 2p3/2 in S@Con-HC is 778.70\u2009eV, which is a shift of 0.5\u2009eV compared with that of pure Co (778.20\u2009eV); this right-shifted binding energy indicates the formation of Co\u2212S bonds between Co clusters and S in S@Con-HC. The XPS spectrum region of Co 2p3/2 for S@CoS2-HC with peaks at 781.10 and 785.80\u2009eV is attributed to Co2+ 2p3/2 and Co4+ 2p3/2, respectively, and the formation of Co\u2212S bonds of CoS235. Since XPS analysis is a surface-sensitive technique, the trend in Co binding energy relies on the size of the Co@CoSx core-shell structure, and that is why the Co oxidation states of S/Co-HC show the highest bonding energy in Supplementary Fig.\u00a0n-HC that S is not only physically adsorbed by HC, but is also chemisorbed by atomic Co, leading to the formation of Co\u2212S bonds. Meanwhile, the S@Con-HC delivers the Co0 state, which could effectively improve conductivity of an S cathode and enhance the performance of RT-Na/S batteries.To investigate the interaction between Co and S, X-ray photoelectron spectroscopy (XPS) was carried out. As shown in Fig.\u00a0\u22121 of S@Con-HC and S@HC cathode materials are shown in Fig.\u00a0n-HC cell shows two long plateaus that run from 1.68 to 1.04\u2009V, and 1.04 to 0.8\u2009V during the initial discharge process: the high-voltage plateau corresponds to the solid\u2212liquid transition from S to dissolved long-chain polysulfides; and the low-voltage plateau is attributed to the further sodiation of long-chain polysulfides to short-chain sulfides. By contrast, the two plateaus of S@HC are at 1.82 and 1.62\u2009V during the initial discharge process. The lower potential plateaus of S@Con-HC in the initial cycle may be attributed to the complex bonds between Co and S (Co\u2212S bonds), so that additional energy is needed to dissociate S from the Co\u2212S bond, resulting in a more negative potential37. Consequently, the following discharge potential plateaus of S@Con-HC shifted to the positive direction39. This phenomenon also could be found in S/Co-HC and S@CoS2-HC, as shown in Supplementary Fig.\u00a0n-HC cell at low current densities (20 and 50\u2009mA\u2009g\u22121) were carried out, as shown in Supplementary Fig.\u00a0n-HC is 1613\u2009mA\u2009h\u2009g\u22121 at 20\u2009mA\u2009g\u22121, which is close to the theoretical capacity of S (1672\u2009mA\u2009h\u2009g\u22121), retaining reversible capacity of 945\u2009mA\u2009h g\u22121 after 40 cycles. When tested at 50\u2009mA\u2009g\u22121, the S@Con-HC delivers an initial reversible capacity of 1360\u2009mA\u2009h\u2009g\u22121, maintaining 904\u2009mA\u2009h\u2009g\u22121 after 40 cycles. During the slow charge\u2212discharge process at current density of 20\u2009mA\u2009g\u22121, the produced long-chain polysulfides could be further fully sodiated to Na2S4. Meanwhile, the atomic Co will effectively alleviate dissolution of Na2S4 and electrocatalytically reduce Na2S4 into the final product Na2S. However, the slow charge\u2212discharge process would aggravate the dissolution and shuttle effect of the long-chain polysulfides, leading to fast capacity decay and inferior capacity retention. This phenomenon is well in agreement with the cycling performance, in which this cathode shows the lowest capacity retention (58.5%) at 20\u2009mA\u2009g\u22121. The comparisons at different currents indicate that the slow charge\u2212discharge process is favorable to realize high reversible capacity but severe capacity decay. It is rational to select a current density that would be slow enough to exert the capacity of all S active materials and fast enough to alleviate the shuttle effect. By contrast, the current density of 100\u2009mA\u2009g\u22121 shows the most satisfactory performance. Meanwhile, the electrochemical performances of different Co loading of S@Co-HC are shown in Supplementary Fig.\u00a0n-HC processes the best performance among these cathode materials.The discharge/charge profiles of the 1st, 2nd, 10th, 50th, 100th, 200th, 300th, 400th, 500th, and 600th cycles at 100\u2009mA\u2009gn-HC cathodes is displayed in Fig.\u00a0\u22121 over 600 cycles. Both S@HC and S@Con-HC display high cycling stability and capacity retention after the initial capacity decay, which indicates that the closed hollow carbon host could effectively manage the fatal polysulfide dissolution. The S@Con-HC delivers an initial reversible capacity of 1081\u2009mA\u2009h\u2009g\u22121 with a Coulombic efficiency of 52.1%, retaining excellent reversible capacity of 508\u2009mA\u2009h\u2009g\u22121 after 600 cycles. The high initial discharge capacity of S@Con-HC (~2075\u2009mA\u2009h\u2009g\u22121) is due to the decomposition of the electrolyte, the side reactions between the carbonate-based solvents and soluble polysulfides, and the formation of the solid electrolyte interphase film25. In sharp contrast, the S@HC cathode delivers the first capacity of 580/1209\u2009mA\u2009h\u2009g\u22121, which declines to 271\u2009mA\u2009h\u2009g\u22121 after 600 cycles. During the first ten cycles, there is obvious capacity decay for both of the S@Con-HC and S@HC cathodes, which is attributed to the loss of dissolved long-chain polysulfides. The cells show relatively stable cycling but with gradual capacity loss for the subsequent 600 cycles, which mainly originates from the impedance increase in the cells due to the formation of Na2S. This is consistent with the synchrotron XRD results . A comparison of the rate capability versus current density of S@Con-HC with the state-of-the-art in the literature is presented in Fig.\u00a045. The polarized Con-HC host is responsible for the prevailing Na-storage properties of S@Con-HC, which plays key roles in maximizing sulfur/polysulfides immobilization and activation via strong electrocatalytic atomic Co, reaching performance that is among the best in the field of RT-Na/S batteries.Rate-capability tests were evaluated at various current densities from 0.1 to 5\u2009A\u2009gn-HC, CV, in situ Raman spectroscopy (at 500\u2009mA\u2009g\u22121) and in situ synchrotron XRD (\u03bb\u2009=\u20090.6883\u2009\u00c5) data, using the Powder Diffraction Beamline , were collected for the initial galvanostatic charge/discharge and the second discharge curve (at 100\u2009mA\u2009g\u22121). Figure\u00a0n-HC, while voltammograms for S@Co-HC, S@CoS2-HC, and S@HC are shown in Supplementary Fig.\u00a0n-HC cell shows two prominent peaks at around 1.68 and 1.04\u2009V during the first cathodic scan. The peak at 1.68\u2009V corresponds to the transition from solid S to dissolved liquid long-chain polysulfides 46; in the following cathodic sweep from 1.68 to 1.04\u2009V, the long-chain polysulfides are further sodiated to Na2S4 and then short-chain polysulfides are sodiated 20. Significantly, the following cathodic peaks move toward positive potential after the first CV cycle, corresponding to the results for the discharge/charge curves, which also demonstrates the formation of Co\u2212S bonds in S@Con-HC. Meanwhile, operando Raman spectra and synchrotron XRD patterns complementarily confirm the mechanism mentioned above. As illustrated in Fig. \u22121 disappears and another peak (451\u2009cm\u22121) appears, which could be assigned to Na2S447. Correspondingly, in situ synchrotron XRD  evolves around the original peak (23.01\u00b0), which could be attributed to the formation of long-chain polysulfides (Na2Sx). When further discharged to 1.4\u2009V, the Na2Sx peak gradually disappeared and a new peak at 13.22\u00b0 developed, which can be attributed to the (213) planes of Na2S4 (JCPDF no. 71-0516). When discharged to 1.30\u2009V, not only is there a main broad band at 451\u2009cm\u22121, but also a new peak at 472\u2009cm\u22121 that appears in the Raman spectra; this new peak could be attributed to the Na2S247. Consistently, a new peak at 18.73\u00b0 in the synchrotron XRD pattern for the sample discharged to 1.2\u2009V could be attributed to the (104) peak of Na2S2 (JCPDF no. 81-1764)20. Furthermore, the in situ Raman spectrum of S@Con-HC that is discharged to 1.0\u2009V also exhibits a new peak at 475\u2009cm\u22121. Given the similar Raman fringes of Na2S and S848, it mostly indicates the formation of Na2S47; when fully discharged to 0.8\u2009V, the only band at 475\u2009cm\u22121 demonstrates that the final product is Na2S. It is convincing that a new peak generated at 17.07\u00b0 could be assigned to the (220) planes of Na2S as well, as shown in Fig.\u00a020. Therefore, the first discharge mechanism is proposed to be as follows:To investigate the mechanism of S@Co\u03bb\u2009=\u20090.688\u2009\u00c5 data, XRD Fig.\u00a0 demonstr2S2 and S are not detectable by in situ Raman spectroscopy or in situ synchrotron XRD, indicating that the reaction is not (or is only slightly) reversible; the processes from Na2S to Na2S4 and to Na2Sx are expected to be reversible. The peaks corresponding to Na2S in the Raman spectra and in the synchrotron XRD patterns always exist after its initial generation, which is probably due to the partial reversibility of the final Na2S product, thus accumulating during the prolonged discharge/charge process.When the cell is charged back to 2.8\u2009V, Na2S2, and the diffraction peak intensity of Na2S4 obviously decreases. It indicates that the reaction rate of reduction from Na2S4 into Na2S is very fast. We thoroughly analyzed this phenomenon, and proposed a new mechanism in which atomic Co could quickly catalyze the reduction of Na2S4 into Na2S; this electrocatalytic reaction could effectively slow down the dissolution of Na2S4 during cycling as well as result in the excellent electrochemical performance of S@Con-HC. Furthermore, the polysulfide dissolution behaviors of S@Con-HC and S@HC electrodes using transparent glass cells are compared in Supplementary Fig.\u00a0n-HC remained colorless during the 10-h discharge process, which implies the alleviation of the polysulfide dissolution and suggests that atomic Co could kinetically catalyze the polysulfide reduction to Na2S instead of dissolution into the electrolyte. However, the yellow polysulfide on the surface of the S@HC electrode was observed upon discharge for 5\u2009h; when upon a 10-h sodiation process, it could be clearly seen that yellow polysulfide dissolved in the cell. This color change of S@HC indicates that the polysulfide dissolution into electrolyte, i.e. shuttle effect, could lead to a loss of active materials. In order to guarantee reliability of the capacity of the S@Con-HC cathode, the capacity contribution of the S host, Con-HC, was evaluated as well. The Con-HC was fabricated from the S@Con-HC sample by dissolving the loaded S with CS2 solvent. The XRD results of Con-HC and S@Con-HC are shown in Supplementary Fig.\u00a0n-HC does not show any S characteristic peaks, indicating that S has been completely removed. The discharge/charge profiles and cycling performance of Con-HC are shown in Supplementary Fig.\u00a0\u22121, only retaining a reversible capacity of 40.1\u2009mA\u2009h\u2009g\u22121 after 200 cycles. By contrast, Supplementary Fig.\u00a0n-HC in the S@Con-HC cathode could be negligible. Meanwhile, the compositional and morphological changes of S@Con-HC after 600 cycles are shown in Supplementary Fig.\u00a0n-HC could effectively enhance the reversible capacity of the RT-Na/S@Con-HC batteries.Significantly, synchrotron XRD data for the second discharge process do not show any trace of Na2S4 cluster adsorption process on atomic Co/carbon \u2009=\u2009E(ad/surf)\u2009\u2212\u2009E(surf)\u2009\u2212\u2009E(ad), where E(ad/surf), E(surf), and E(ad) are the total energies of the adsorbates binding to surface, clean surface and free adsorbate in gas phase, respectively. The adsorption energy of Na2S4 cluster on carbon support is \u22120.64\u2009eV. The binding energy of the Co6 cluster with the carbon support layer is \u22121.21\u2009eV; meanwhile, the Na2S4 initially adsorb on the Co6 cluster with the binding energy of \u22120.64\u2009eV, which is the same with that on the sp3 carbon surface. However, the Na2S4 structure was observed to decompose spontaneously on the Co6 cluster during the AIMD simulation; for pure carbon support, Na2S4 could not be decomposed. As presented in Fig.\u00a02S3, Na2S2, and Na2S clusters were identified respectively on the Co6 cluster and the dissociated S atoms were trapped by the Co6 cluster. Figure\u00a02S4 on Co6 is \u22124.33\u2009eV; for Na2S3, the adsorption energy is negatively shifted to \u22124.85\u2009eV. Furthermore, the adsorption energy of Na2S2 is \u22127.85\u2009eV; surprisingly, the adsorption energy of Na2S negatively shifts to \u221210.67\u2009eV. This strong adsorption energy of Na2S indicates that the reaction from Na4S2 into Na2S is kinetically fast. It is evident that the binding energies of these sodium polysulfide clusters were much stronger than those on pure carbon support, indicating that the decomposition of Na2S4 in the presence of the Co6 cluster could be electrocatalyzed, consistent with the speculation from operando Raman and synchrotron XRD results. The schematic illustrations of electrode reaction mechanisms for the S@Con-HC and S@HC are shown in Fig.\u00a02S by atomic Co, leading to high S utilization. Therefore, the atomic Co in S@Con-HC plays a critical role in achieving sustainable cycling stability and high reversible capacity. By contrast, the intensive \u201cshuttle effect\u201d and incomplete sodiation reactions result in the inferior performance of the S@HC cathode.In order to confirm our hypothesis, ab initio molecular dynamics (AIMD) simulations are used to reveal the decomposition of the Nabon Fig.\u00a0 and carbbon Fig.\u00a0. Figure\u00a0n-HC electrode delivers a high initial reversible capacity of 1081\u2009mA\u2009h\u2009g\u22121; even after 600 cycles, it achieves a superior reversible capacity of 508\u2009mA\u2009h\u2009g\u22121 at 100\u2009mA\u2009g\u22121 without any degeneration of the elaborate nanostructure. The atomic scale of polarized Co is responsible for the outstanding enhancement of the S cathode, which is reaching the limitation of Co (Co-S) for S/polysulfides immobilization and activation in RT-Na/S batteries. Meanwhile, in situ Raman, synchrotron XRD, and DFT are combined to confirm that atomic Co could electrocatalytically reduce Na2S4 into Na2S, which effectively alleviates dissolution of polysulfides and thus impeding the shuttle effect. Significantly, this work introduces atomic Co into electrode design, which innovatively bridges battery and electrocatalyst fields and provides a new exploration direction for novel design of electrode materials for the advancement of various battery technologies, especially in RT-Na/S batteries.Overall, atomic Co, including SA Co and Co clusters, is successfully applied into RT-Na/S batteries as a superior electrocatalytic host. The novel S@Co2O and transferred into a three-neck round-bottom flask. A homogenous dispersion could be obtained after continuous ultrasonication and stirring for 0.5\u2009h, respectively. Secondly, 0.7\u2009g resorcinol, 56.4\u2009mL of absolute ethanol, and 0.2\u2009mL of NH4OH were added in the dispersion sequentially; the flask was maintained at 35\u2009\u00b0C with stirring for 0.5\u2009h, followed by the addition of 0.1\u2009mL formalin. The RF polymerization could be completed after continually stirring for 6\u2009h at 35\u2009\u00b0C and ageing overnight. The obtained Si@RF nanospheres were collected and washed with deionized water and alcohol, respectively. The core-shell Si@C sample was prepared by calcination of the Si@RF powder at 600\u2009\u00b0C for 4\u2009h (5\u2009\u00b0C\u2009min\u22121) in N2 atmosphere. Finally, hollow carbon nanospheres (HC) were prepared by etching the Si template away with a 2.0\u2009M NaOH solution.Commercial silicon nanoparticles (~60\u201370\u2009nm), utilized as hard templates, were first coated with resorcinol formaldehyde (RF) via a sol\u2212gel process. Specifically, 0.15\u2009g Si nanoparticles and 0.46\u2009g cetyltrimethylammonium bromide (CTAB) were added in 14.08\u2009mL of H2 and 100\u2009mg HC in ethanol via ultrasonication. The HC containing CoCl2 was then heated overnight in a blast oven at 80\u2009\u00b0C, by which the mixture could solidify and shrink along with the ethanol evaporation. Afterwards, the above mixture was reduced at 200\u2009\u00b0C for 2\u2009h in a forming gas with 10 vol% H2 in nitrogen, leading to the formation of Co-HC. Three S cathode samples were fabricated accordingly based on this Co-HC host. A mixture of Co-HC:S with a weight ratio of 1:1.5 was first ground by mortar and pestle, and then sealed in a Teflon-lined autoclave. A primary S cathode, S/Co-HC composite, was obtained after the autoclave was heated at 155\u2009\u00b0C for 12\u2009h. When the obtained S/Co-HC composite was further sealed in a quartz ampoule, and thermally treated at 300 and 400\u2009\u00b0C for 2\u2009h in N2 atmosphere, respectively, two new samples denoted as S@Con-HC and S@CoS2-HC could be synthesized. In addition, a contrast sample with plain HC as S host was prepared, in which S was embedded into the plain HC frameworks (denoted as S@HC). The synthesis procedures are the same as that of S@Con-HC by utilizing HC instead of Co-HC.A sulfur host, cobalt nanoparticles-decorated HC (Co-HC), was synthesized by uniform dispersion of 44.76\u2009mg CoClo\u2009min\u22121. XPS measurements were carried out using Al K\u03b1 radiation and fixed analyzer transmission mode: the pass energy was 60\u2009eV for the survey spectra and 20\u2009eV for the specific elements.The morphologies of the samples were investigated by SEM (JEOL 7500), TEM , and STEM . The XRD patterns were collected by powder XRD (GBC MMA diffractometer) with Cu K\u03b1 radiation at a scan rate of 1n-HC, S@CoS2-HC, S@HC), 10 wt% carbon black, and 20 wt% carboxymethyl cellulose (CMC) in an appropriate amount of water via a planetary mixer (KK-250S). Then, the obtained slurry was pasted on Cu foil using a doctor blade with a thickness of 100\u2009\u00b5m, which was followed by drying at 50\u2009\u00b0C in a vacuum oven overnight. The working electrode was prepared by punching the electrode film into discs of 0.97\u2009cm diameter. The sodium foil was employed as both reference and counter electrode. The electrodes were separated by a glass fiber separator. Electrolyte, 1.0\u2009M NaClO4 in propylene carbonate/ethylene carbonate with a volume ratio of 1:1 and 5\u2009wt% fluoroethylene carbonate additive (PC/EC\u2009+\u20095\u2009wt% FEC), was prepared and used in this work. The electrochemical performance was tested on a LAND Battery Tester with a voltage window of 0.8\u20132.8\u2009V. All the capacities of cells have been normalized based on the weight of sulfur. CV was performed using a Biologic VMP-3 electrochemical workstation.The electrochemical tests were conducted by assembling coin-type half-cells in an argon-filled glove box. The slurry was prepared by fully mixing 70 wt% active materials . The acquisition time of each Raman spectrum was 60\u2009s; and lower laser power was utilized to avoid electrode damage during the long-term measurements. For in situ synchrotron XRD measurements, the cells were similar to the above-mentioned coin cells for electrochemical performance testing. To enhance the diffraction peak intensity, a thicker layer of cathode material was loaded on the Cu foil, with loading up to 5\u2009mg\u2009cm\u22122. To guarantee that the X-ray beams could penetrate the whole cell and that the electrochemical reactions could be monitored, three 4-mm diameter holes were punched in the negative and positive caps as well as the spacer. Then, Kapton film (only showing low-intensity responses in XRD patterns) was used to cover the holes in the negative and positive caps, and AB glue was used for complete sealing. The charge/discharge process was conducted with a battery test system (Neware) that was connected to the cell.The in situ Raman cell was bought from Shenzhen Kejing star. The in situ Raman was collected with a Renishaw InVia Raman microscope, with excitation 532\u2009nm laser wavelengths and L50\u00d7 objective lens. The spectra were collected in galvanostatic mode when the in situ Raman cell was discharged/charged at a current rate of 500\u2009mA\u2009g52. Considering the significance of van der Waals (vdW) forces to the adsorption, we utilized the D3 dispersion vdW corrections with zero damping for describing the vdW interactions.54 The Co cluster consisted of six Co atoms with a size of ~0.1\u2009nm and the Co\u2212Co bond distances was 2.24\u2009\u00c5. The Na2S4 cluster was obtained after 10\u2009ps of AIMD simulations at 350\u2009K at first and the final structure was optimized. To gain insights into the Na2S4 dissociative adsorption on carbon-supported Co6 cluster, we firstly performed the AIMD simulation for 10\u2009ps  within the canonical (NVT) ensemble at 350\u2009K to accelerate the dissociation rate of Na2S4 cluster on carbon-supported Co6 cluster. During the AIMD simulations, the carbon support was fixed while the Co6 and Na2S4 clusters were allowed to move. Secondly, we chose some representative sodium polysulfide structures, i.e., Na2S3, Na2S2 and Na2S clusters, which were observed from molecular dynamics simulations. Thirdly, the geometries of these sodium polysulfide clusters were optimized to calculate the total energies. The cut-off energy was set to 370\u2009eV for molecular dynamics simulations and the cut-off energy was 450\u2009eV for geometry optimizations aiming to get the accurate energy. A gamma Monkhorst-Pack k-point sampling was used. In this paper, the adsorption energy was defined as: E(ad)\u2009=\u2009E(ad/surf)\u2009\u2212\u2009E(surf)\u2009\u2212\u2009E(ad), where E(ad/surf), E(surf), and E(ad) are the total energies of the adsorbates binding to surface, clean surface and free adsorbate in gas phase, respectively.The spin-polarized electronic structure calculations were performed in the Vienna Ab-initio Simulation Package code with Perdew-Burke-Ernzerhof (PBE) functional of exchange-correlation. The projector-augmented-wave (PAW) pseudopotentials were utilized to describe core electron interactionsSupplementary InformationPeer Review File"}
+{"text": "SA-HC). The cobalt single atoms can activate selenium reactivity and immobilize selenium and polyselenides. The as-prepared selenium-carbon (Se@CoSA-HC) cathodes deliver a high discharge capacity, a superior rate capability, and excellent cycling stability with a Coulombic efficiency of ~100%. This work could open an avenue for achieving long cycle life and high-power lithium-selenium batteries.Selenium cathodes have attracted considerable attention due to high electronic conductivity and volumetric capacity comparable to sulphur cathodes. However, practical development of lithium-selenium batteries has been hindered by the low selenium reaction activity with lithium, high volume changes and rapid capacity fading caused by the shuttle effect of polyselenides. Recently, single atom catalysts have attracted extensive interests in electrochemical energy conversion and storage because of unique electronic and structural properties, maximum atom-utilization efficiency, and outstanding catalytic performances. In this work, we developed a facile route to synthesize cobalt single atoms/nitrogen-doped hollow porous carbon (Co Lithium selenium batteries are attractive energy storage systems, but they are hindered by low selenium reaction activity and rapid capacity fading. Herein, the authors report a selenium host with atomic cobalt electrocatalyst which exhibits superior performances in lithium-selenium batteries. However, the energy density of current LIBs can not meet the ever-increasing demands from many emerging applications such as electric vehicles3. On one hand, lithium\u2013sulfur (Li\u2013S) batteries have attracted growing attention because of several advantages such as the natural abundance of sulfur, high specific energy density (2600\u2009W\u2009h\u2009kg\u22121) and high theoretical capacity (1675\u2009mA\u2009h\u2009g\u22121)4. However, the development of Li\u2013S batteries still suffers from the inherent issues of low electronic conductivity of sulfur and the shuttle effect of polysulfides. As an element in the same group of sulfur in the periodic table, selenium owns similar chemical properties to sulfur and has been considered as an alternative cathode material for lithium\u2013selenium battery because of its high theoretical volumetric capacity (3253\u2009mA\u2009h cm\u22123)6. Additionally, the conductivity of Se (1\u2009\u00d7\u200910\u22123\u2009S\u2009m\u22121) is much higher than that of S (5\u2009\u00d7\u200910\u221230\u2009S\u2009m\u22121), which enables higher active material utilization and better rate capability7. However, the Se cathodes also have a dissolution issue associated with high-order lithium selenides  and large volume expansion during the charge/discharge process, resulting in a low Se utilization, inferior capacity and short cycle life9.Rechargeable lithium-ion batteries (LIBs) are considered to be the promising candidates towards sustainable energy storage devices due to its long cycle life, high specific power and energy density11, various strategies have been proposed to improve the electrochemical performance of selenium cathode. The most effective method is to incorporate Se particles with electronically conductive materials and encapsulate Se particles within a porous carbon matrix13. For Se/porous carbon composite materials, the charge transfer resistance can be decreased and the shuttle effect of polyselenides can be suppressed because of the high conductivity of carbon matrix and the strong affinity of porous carbon for Se particles7. Many porous carbon materials have been studied to construct Se/porous carbon composites for Li\u2013Se batteries, such as carbon nanospheres15, carbon nanofibers16, hierarchical porous carbon17 and porous hollow carbon bubbles18. However, high-power Li\u2013Se batteries with long cycling performance under high currents have never been reported due to the unsatisfactory performance of Se cathodes.From the pioneering work by Amine et al.21. Currently, SACs have been successfully applied in batteries, including metal-air batteries and metal sulfur batteries26. In addition, the metal-organic framework (MOF)-derived SACs have been intensively investigated in the area of electrocatalysts because of their high electrical conductivity, superior activity, and maximum atomic utilization30. However, based on literature reviews, as a result of the great challenge of controllable synthesis atomic metals with a selenium host, there has been no report of single atoms in Li\u2013Se batteries, where single atoms can maximize the multi-functions of a selenium host to achieve high rate and cycling performance in a Li\u2013Se battery.Single-atom catalysts (SACs) consist of isolated metal atoms dispersed or anchored on matrix materials. SACs attracted extensive attention due to their maximum atom utilization efficiency, homogenous active centres, and unique reaction mechanismsSA-HC), nitrogen-doped hollow porous carbon (HC) and cobalt nanoparticles/nitrogen-doped hollow porous carbon (CoNP-HC). In addition, by embedding Se in hollow structured carbon particles, carbon/selenium composites (Se@CoSA-HC) was obtained. When applied as cathode materials for Li\u2013Se batteries, the Se@CoSA-HC cathode exhibited a superior electrochemical performance, including a superior rate capability (311\u2009mA\u2009h\u2009g\u22121 at 50\u2009C) and excellent cycling stability (267\u2009mA\u2009h\u2009g\u22121 after 5000 cycles with a 0.0067% capacity decay per cycle at a current density of 50\u2009C) with the Coulombic efficiency of ~100%. This work reveals that the maximal utilization of cobalt single atoms can optimize the features of porous carbon materials towards the activation of selenium reactivity and immobilization of selenium and polyselenides. Our results demonstrate that the Se@CoSA-HC composite is a promising cathode material for lithium\u2013selenium batteries with long cycle life and high-power.Herein, for the first time, we demonstrate that single-atom catalysts can enable highly effective cathodes for Li\u2013Se batteries with superior rate capability and outstanding long-term cycling performance. A facile and straightforward approach Fig.\u00a0 facilita31. As shown in Supplementary Fig.\u00a032, confirming the formation of bimetallic ZIF structures. This growth strategy can be extended to the fabrication of other types of ZIFs with different dimensions and components. The SEM images and XRD patterns in Supplementary Fig.\u00a02@ZIF. The as-prepared PS@ZIF materials were converted into carbonaceous nanocomposites via one-step pyrolysis. The PS template was removed in situ by evaporation to form a hollow morphology at 700\u2009\u00b0C under a N2 atmosphere. Owing to the composition and size of cobalt in the three products, the obtained carbon materials are denoted Co single atom/nitrogen-doped hollow porous carbon (CoSA-HC), nitrogen-doped hollow carbon (HC) and cobalt nanoparticle/nitrogen-doped hollow porous carbon (CoNP-HC), respectively. In the previous reports, hollow-structured materials have shown excellent electrochemical performance in energy storage due to large interior voids, high surface area, and shortened mass/charge transport lengths37. As shown in the SEM image  and (100) planes of graphitic carbon. After increasing the cobalt content in the CoNP-HC particles, newly formed peaks are observed at 44.6\u00b0, 51.9\u00b0 and 76.7\u00b0, which can be ascribed to cubic cobalt metal (JCPDS 15-0806). The porosity of the CoSA-HC particles was then studied by nitrogen adsorption-desorption analysis. The CoSA-HC displays mixed type I and IV isotherms  in Raman spectra  measurement was performed to investigate the phase structure of Co002) and 0 planes SA-HC, Se@HC and Se@CoNP-HC, respectively. To obtain a high selenium content in the composite materials, selenium powders were mixed with HC particles in a weight ratio of 1:3, respectively. SEM images  revealed the formation of a size-reduced structure. The HAADF-STEM and EDS images in Supplementary Fig.\u00a0SA-HC   and extended X-ray absorption fine structure measurements (EXAFS) were conducted to investigate the chemical state and coordination environment of Co atoms in the CoSA-HC particles. As shown in the XANES spectra 44. The Co\u2013N coordination peak shifts to a low R-position at 1.43\u2009\u00c5 in the HC particles, revealing a slightly variation of Co\u2013N coordination. Compared with the spectra of HC particles and Co foil, no Co-Co peak around 2.1\u2009\u00c5 is observed in CoSA-HC particles, indicating atomically dispersed Co single atoms46. Furthermore, according to the fitting parameters given in Supplementary Table\u00a0SA-HC particles is 3.3, implying that the Co\u2013N interaction within HC particles are consisted of Co\u2013N tridentate (Co\u2013N3) and tetrahedral (Co\u2013N4) coordination. Inductively Coupled Plasma Optical Emission Spectrometry (ICP-OES) analysis of CoSA-HC particles indicates that the cobalt content was determined to be ~1.3%.XPS measurements were also used to explore the chemical environment of Corum Fig.\u00a0, the dectra Fig.\u00a0, the comles Fig.\u00a0, a main SA-HC electrodes at a scan rate of 0.1\u2009mV/s between 1.0\u2009V and 3.0\u2009V. During the first discharge process, two peaks at around 1.74 and 1.78\u2009V are observed, which may be related to the lithiation of different Se molecules in the Se@CoSA-HC composites48. However, these two peaks disappear in the second discharge process, simultaneous with the appearance of two reductions peak at around 1.81 and 2.02\u2009V, resulting from the electrochemical activation behaviour of the Se@CoSA-HC electrode during the lithiation process49. During the charge process, there is only one single anodic peak at 2.07\u2009V in all cycles, and this peak remains stable during following lithiation/delithiation cycles. The CV curves after the second cycle are overlapping, demonstrating the good electrochemical stability of the Se@CoSA-HC electrodes. As illustrated in Supplementary Fig.\u00a0SA-HC at the current density of 0.1\u2009C. Both discharge and charge processes exhibit stable voltage plateaus at around 2.0\u2009V, which is consistent with the characteristic peaks from the CV curves. The specific capacities of Se@CoSA-HC electrodes at different current densities as a function of cycle number (from the second cycle) are presented in Supplementary Fig.\u00a0SA-HC electrodes exhibit high specific capacities of 613, 579, 569, 548, 516, 467, 427, 385 and 311\u2009mA\u2009h\u2009g\u22121 at current densities of 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 and 50\u2009C, respectively, which are higher than those of Se@HC and Se@CoNP-HC \u2009=\u2009log(a) + blog(v), where i and v are the peak current and scan rate, and a and b are derived parameters54. The reaction kinetics can be analysed via the b values. When the b-value reaches around 0.5, a diffusion-limited process is occurring during electrochemical reactions. The electrochemical behaviour is an interface-limited process and more capacitive, then b value is closer to 1, indicating faster kinetics processes55. As shown in Fig.\u00a02Se is faster than that of Li2Se into Se and both conversions are far from being a diffusion-controlled process. Figure\u00a0\u22121. With an increase in the scan rate, the relative ratio of capacitive contribution to the total capacity gradually increases, as presented in Fig.\u00a056. Thus, the high ratio of capacitive-controlled contribution in battery electrodes is highly beneficial for fast transport of lithium ions, which would lead to superior electrochemical performance of rate capability and long-term cyclability.To understand the excellent rate capability of Se@CoSA-HC composite cathodes, EIS spectra were collected as a function of the state of discharge/charge. Supplementary Fig.\u00a0SA-HC composite cathode at 0.1\u2009C. The EIS spectra of the Se@CoSA-HC electrode at various depths , while CPE2 (Constant phase element) describes the space charge capacitance of the layer. W0 is the Warburg impedance corresponding to the polyselenide diffusion processes. The resistance values (R1 and R2) obtained from Supplementary Fig.\u00a01 value is relatively stable throughout the whole cycle process, indicating the excellent charge transfer capability. The variation of the charge transfer resistance is attributed to the transformation of crown-like Se8 to Li2Sex during the discharge process, then maintaining amorphous chain-like Se molecules during the charge process. The formation of a stable layer and the reversible Se transformations are responsible for the superior electrochemical performance. The cell with the Se@CoSA-HC cathode after 1700 cycles was dissembled and the retrieved Se@CoSA-HC cathode materials were characterized by TEM. As shown in Supplementary Fig.\u00a0SA-HC cathode has been well preserved, indicating the superior stability of the cathode structure. From STEM element mapping images in Supplementary Fig.\u00a02Se2/Li2Se, which could enhance the cycling performance of the Li\u2013Se batteries. This result is consistent with the previously reported literature58. Furthermore, EIS spectra were recorded at open-circuit voltage before cycling and after 1st cycle, 2nd cycle, 5th cycle, 10th cycle and 50th cycle at 0.1\u2009C  images in Supplementary Fig.\u00a0SA-HC cathode are stable during long-term cycling. All these key kinetic parameters confirm the catalyst effect of the single cobalt atoms.Owing to the electrocatalytic effect resulting from single cobalt atoms within Coals Fig.\u00a0. This isSA-HC cathode after cycled for 1700 cycles and the cycled bare Se@HC cathode after cycled 0.5\u2009C for 100 cycles were used for the visual observation. As shown in Supplementary Fig.\u00a0SA-HC cathode and bare Se@HC cathode were used as the cathode. The electrolyte in the cell with cycled bare Se@HC cathode  as a reference and atomic Co/nitrogen-doped carbon supports (Co\u2013NC). As shown in Supplementary Fig.\u00a02Se originating from Se8 and Li was considered12. During discharge, the first step involves the reduction of Se8 and the generation of Li2Se8, followed by further reduction and disproportionation with the formation of three intermediate lithium polyselenides, namely, Li2Se6, Li2Se4, and Li2Se2, achieving the formation of Li2Se as the final product12. The Gibbs free energies were calculated for the above reactions on both NC and Co\u2013NC supports  is much lower than that of NC support (0.96\u2009eV), indicating that the reduction of Se is thermodynamically more favourable on Co\u2013NC than on NC support. In the charging process, the transformation of Li2Se is the first step7. Through the climbing-image nudged elastic band method, the transformation energy and barrier of Li2Se were calculated to evaluate the delithiation reaction kinetics from Li2Se to selenium on the surfaces of Co\u2013NC and NC supports. Figure\u00a02Se transformation of Co\u2013NC supports (1.82\u2009eV) is smaller than that of NC (2.04\u2009eV), revealing that atomic cobalt nanoparticles are serving as active sites to enhance the phase transformation of Li2Se and the Se utilization in Li\u2013Se batteries.To further understand the enhancement of reaction kinetics of charge/discharge of the Se@Co2Se2 into Li2Se during the discharging process and the transformation of Li2Se during the charging process. To demonstrate the mechanism, the schematic illustration of electrode reaction mechanisms for the Se@CoSA-HC cathodes is shown in Supplementary Fig.\u00a02Se by single atom Co catalysts, leading to high Se utilization. Therefore, the atomic cobalt on the Co\u2013NC support could effectively alleviate the dissolution of polyselenides, electro-catalyse the transformation from polyselenides to Li2Se and minimize the reaction energy barriers, leading to the full utilization of selenium, superior cycling ability, and reversible capability.In addition, from the DFT calculation results shown in Supplementary Table\u00a061, atomic layer deposition62, pyrolysis63 and photodeposition64. Among them, pyrolysis is a facile method to construct single-atom catalysts through thermal decomposition of suitable precursors. Herein, we have developed a simple synthesis method to achieve hollow structured particles with isolated, positively charged and highly dispersed single Co atoms through tuning the cobalt and zinc contents from bimetallic ZnCo-ZIFs precursors. The aberration-corrected HAADF-STEM image and EXAFS data provide strong evidence that single Co atoms are high dispersed within the CoSA-HC particles. It is also revealed from XANES results that the single Co atoms are positively charged and the EXAFS data show that isolated single Co atoms can be atomically anchored into the carbon frameworks through the formation of Co\u2013N3 and Co\u2013N4 coordination moieties within CoSA-HC particles. By using CoSA-HC particles, more accessible storage sites and larger electrode/electrolyte contact area are provided, and mass/charge transportation lengths are shortened through the formation of the hollow structure. The volume expansion during lithiation can be inhibited by the large internal void spaces.Until now, single-atom catalysts were achieved through various strategies, including wet impregnation and coprecipitation methods2Se2 into Li2Se is noticeably increased during the discharge process by using a single Co atom catalysts. From the charging process data, a smaller value than the calculated energy barriers for Li2Se transformation through the single Co atom catalysts can be obtained. It is proposed that the mechanism of single Co atom enhancement of Li\u2013Se batteries is that single Co atoms can quickly catalyse the transformation from Li2Se2 into Li2Se during the discharging process and the transformation of Li2Se during the charging process. Therefore, the atomic cobalt plays the key role in the alleviation of polyselenide dissolution, maximation of polyselenides immobilization and activation via strong electrocatalytic behaviour, achieving the best cycling performance in the field of Li\u2013Se batteries. Therefore, the Se@CoSA-HC composite is a promising candidate for long cycle life and high-power lithium\u2013selenium batteries.Based on the density functional theory (DFT) calculations, it indicates that the reaction rate from the reduction of LiSA-HC) particles through one-step pyrolysis. To highlight the importance of CoSA-HC particles for energy applications, CoSA-HC particles were used for Li\u2013Se batteries. More specifically, Se@CoSA-HC cathodes delivered an excellent discharge capacity of 564\u2009mA\u2009h\u2009g\u22121 after 100 cycles at a current density of 0.1\u2009C and a superior rate capability of 385\u2009mA\u2009h\u2009g\u22121 and 311\u2009mA\u2009h\u2009g\u22121 at a current density of 20\u2009C and 50\u2009C. In addition, they show a superior reversible capacity of 457\u2009mA\u2009h\u2009g\u22121 at a current density of 0.5\u2009C after 1700 cycles with only 0.011% capacity decline per cycle and 267\u2009mA\u2009h\u2009g\u22121 after 5000 cycles at 50\u2009C with a 0.0067% capacity decay per cycle with Coulombic efficiency nearly 100%. These distinctive features of the HC particles are concluded as follows: (i) the atomic cobalt electrocatalyst could effectively alleviate the dissolution of polyselenides, electro-catalyse the transformation from polyselenides to Li2Se and minimize the adsorption energy barriers; (ii) the hollow structures provide more accessible selenium storage sites, larger electrode/electrolyte contact area, shortened mass/charge transport lengths; (iii) the large internal void spaces accommodate volume expansion during lithiation; (iv) the conductive carbon materials enhance the electrode conductivity and effectively confine the soluble polyselenides. This work provides an efficient route for the preparation of single-atom materials and paves a new strategy for developing high-power electrochemical energy storage devices.In summary, we developed a facile approach for synthesizing core\u2013shell structured PS@ZIF materials which can be further converted into atomic Co electrocatalyst/nitrogen-doped hollow porous carbon (Co3)2\u00b76H2O), cobalt nitrate hexahydrate (Co(NO3)2\u00b76H2O), 2-methylimidazole were purchased from Sigma-Aldrich and used as received without any further purification. Washing was achieved with ultrapure water and reagent grade ethanol where required. Ultrapure water was used for solution preparations.The following provides information on chemicals used in this work: methanol (99%), styrene, potassium persulfate (KPS), polyvinylpyrrolidone , ethanol (95\u2013100%), zinc nitrate hexahydrate  was then added to the above mixture. Then the mixture was heated to 70\u2009\u00b0C and remained at this temperature for 24\u2009h.3)2\u00b76H2O and 0.104\u2009g of Co(NO3)2\u00b76H2O  were carbonized in flowing NSA-HC, HC, CoNP-HC particles with a weight ratio of 1:1 were mixed. Subsequently, the mixture was heated at 300\u2009\u00b0C for 12\u2009h with heating rate of 5\u2009\u00b0C\u2009min\u22121 in a tubular furnace under argon atmosphere to achieve selenium carbon composites. The as-prepared materials were named Se@CoSA-HC, Se@HC and Se@CoNP-HC based on the different carbon precursors.Se powder  and the as-prepared CoSA-HC particles with a weight ratio of 3:1 were mixed, followed by the same heat treatment as described above.To achieve high selenium mass ratio in selenium carbon composite, Se powder and the as-prepared Co2 nanowires: in a typical synthesis, 50\u2009mg of polyvinylpyrrolidone (PVP) and 40\u2009mL of 0.015\u2009M KMnO4 aqueous solution were mixed with magnetic stirring, and then the mixture was transferred into a 50\u2009mL Teflon-lined stainless autoclave. The autoclave was sealed and put in an electronic oven at 160\u2009\u00b0C for 9\u2009h and then naturally cooled down to room temperature. The precipitates were collected by filtration, washed with deionized water and absolute ethanol several times before drying at 60\u2009\u00b0C overnight.Synthesis of MnOSynthesis of reduced graphene oxide (rGO): Graphene oxide (3\u2009mg/ml) solution were dried via lyophilization and then was ground into powder. Reduced graphene oxide can be obtained through hydrothermal treatment of graphene oxide (0.4\u2009g) with 400\u2009\u00b5L hydrazine hydrate at 95\u2009\u00b0C for 24\u2009h.Synthesis of the MnO2@ZIF: in a typical procedure, 0.07\u2009g of as-prepared MnO2 nanowires were fully ground and then dispersed into 90\u2009mL of methanol containing 1\u2009g of PVP (K-30). After ultrasonic dispersion and vigorous agitation for 3\u2009h, 2.125\u2009g of Zn(NO3)2\u00b76H2O and 0.104\u2009g of Co(NO3)2\u00b76H2O . After ultrasonic dispersion and vigorous agitation for 3\u2009h, 2.125\u2009g of Zn(NO3)2\u00b76H2O and 0.104\u2009g of Co(NO3)2\u00b76H2O  in 1,3-dioxolane and 1,2-dimethoxyethane (volume ratio 1:1). Porous polypropylene (Celgard 2300TM) was used for the separator membranes. About 20\u2009\u03bcL electrolyte was added for each coin cell. The areal loading of selenium in the cathode is 0.8\u2009mg\u2009cm\u22122. The cells were discharged and charged galvanostatically in the fixed voltage range 1.00\u20133.00\u2009V with current rates of 0.1 \u201350\u2009C rate using a NEWARE battery tester. Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) were performed on a Biologic VMP3 electrochemical station. CV responses were also tested in voltage range 1.00\u2009V to 3.00\u2009V (vs. Li+/Li) at scan rate from 0.1 to 0.5\u2009mV\u2009s\u22121. EIS (100\u2009kHz to 10\u2009mHz with an amplitude of 5\u2009mV). Analysis was then applied to evaluate electrochemical behaviors of the electrode.Electrodes were prepared by mixing the selenium carbon composite, carbon black and polyvinylidene fluoride at a weight ratio of 8:1:1 in N-methyl-2-pyrrolidone solvent, The slurry was pasted onto aluminium foil and dried in a vacuum oven at 60\u2009\u00b0C for 12\u2009h. CR2032 coin cells were assembled in an argon-filled glove box  and then used for electrochemical evaluation. The electrolyte contained 1\u2009wt% lithium nitrate , transmission electron microscopy . X-ray diffraction (XRD) measurements were carried out by using a scanning step of 0.04\u00b0 per second in the 2\u03b8 range from 10\u00b0 to 80\u00b0 (Bruker D8 Discovery XRD). X-ray photoelectron spectroscopy (XPS) measurements were performed on an ESCALAB250Xi  equipped with mono-chromated Al K alpha (energy 1486.68\u2009eV). The BET specific surface area and single-point pore volume were obtained from nitrogen adsorption isotherms measured at \u2212196\u2009\u00b0C using a nitrogen sorption instrument . Prior to nitrogen adsorption measurements, the samples were degassed at 250\u2009\u00b0C overnight. Raman spectra were obtained from a Renishaw inVia Raman spectrometer system  equipped with a Leica DMLB microscope  and a Renishaw He-Ne laser source producing 17\u2009mW at 633\u2009nm. Thermogravimetric analysis (TGA) was performed with a 2960 SDT system. X-ray absorption fine structure (XAFS) measurements of the Co K-edge were performed at the 1W1B beamline of the Beijing Synchrotron Radiation Facility (BSRF) in transmission mode. The X-ray was monochromatized using a double-crystal Si (111) monochromator and the energy was calibrated by a cobalt metal foil for Co K-edge. Cobalt foil and CoPc were used as the reference substance. The XAFS data was analysed using the WinXAS3.1 program. Cobalt content in HC particles was determined by Inductively Coupled Plasma Optical Emission Spectrometry (ICP-OES).65, as implemented in the Vienna ab-initio Simulation Package (VASP). The generalized gradient approximation (GGA) and Perdew\u2013Burke\u2013Ernzerhof (PBE) exchange functional65 were used. Structural relaxation calculations were performed by using the spin-polarized GGA method66. A supercell of graphene containing 4\u2009\u00d7\u2009267 with 2\u2009\u00d7\u20093\u2009\u00d7\u20091 supercells was employed for the Brillouin zone sampling of N-G and Co\u2212N-G systems. The convergence criterions of energy and force calculations were set to 10\u22125 eV/atom and 0.01\u2009eV\u2009\u00c5\u22121, respectively. The Gibbs free energies for electrochemical reduction of molecular Se8 and polyselenide Li2Sen on the N-G and Co\u2013N-G systems were calculated by the DFT energy difference between two different reduction steps69. The DFT-D2 empirical correction method was employed to describe van der Waals interactions. The barriers for Li2Se transformation on N/G and Co\u2013N/G were calculated with the nudged elastic band (NEB) method to evaluate its delithiation reaction kinetics.All calculations were carried out by using the projector augmented wave method in the framework of DFTSupplementary InformationPeer Review\u00a0File"}
+{"text": "A neuroblastoma (NB) is a solid paediatric tumour arising from undifferentiated neuronal cells. Despite the recent advances in disease management and treatment, it remains one of the leading causes of childhood cancer deaths, thereby necessitating the development of new therapeutic agents and regimens. Retinoic acid (RA), a vitamin A derivative, is a promising agent that can induce differentiation in NB cells. Its isoform, 13-cis RA or isotretinoin, is used in NB therapy; however, its effectiveness is limited to treating a minimal residual disease as maintenance therapy. As such, research focuses on RA derivatives that might increase the anti-NB action or explores the potential synergy between RA and other classes of drugs, such as cellular processes mediators, epigenetic modifiers, and immune modulators. This review summarises the in vitro, in vivo, and clinical data of RA, its derivatives, and synergising compounds, thereby establishing the most promising RA derivatives and combinations of RA for further investigation. A neuroblastoma (NB) is an aggressive heterogeneous solid tumour arising from the sympathetic nervous system\u2019s precursor or immature cells during embryonic development or early postnatal life ,2. NeuroMYCN status [NB is highly heterogenic clinically, and the disease progression and outcome depend on many risk factors, including the age at diagnosis, tumour size and localisation, histopathologic classification , genetic abnormalities, and N status . Newly dN status ,6. The pN status . Cell fate determination and differentiation are crucial in assigning cells to their functional roles in any given tissue. Differentiation, however, is largely impaired in neuroblastoma, wherein immature cells of the sympathetic nervous system, known as the neural crest cells, lose the ability to differentiate and fail to develop into mature cells at some point. These neural crest cells give rise to stromal Schwann and neuroblastic cells that are present at varying degrees of differentiation in neuroblastoma tissue. Schwann cells\u2019 differentiation degree and the tumour grade serve as predictive biomarkers for disease outcome by classifying tumour into three subtypes\u2014undifferentiated, poorly differentiated, and differentiating . FurtherMany processes rely on the retinoic acid signalling pathway through heterodimerisation of the retinoic acid receptor (RAR) and retinoid X receptor (RXR) groups. The retinoic acid (RA) signalling pathway plays a vital role in early embryo development and neurodevelopment. In this context, neuroblastoma, which derives from immature nerve cells, is often seen as a disease with a broken RA pathway. Repairing differentiation in neuroblastoma could potentially halt disease progression and improve the patient outlook. Isotretinoin, also known as 13-cis-retinoic acid, is currently used as part of the treatment regimen for high-risk neuroblastoma patients and induces some neuroblastoma cell lines to differentiate ,11,12. AThis review summarises RA\u2019s current data, its metabolites, its derivatives, and drugs that modulate its actions published from 1 January 1980 to 1 July 2020.The articles investigated in this review were obtained by searched PubMed databases using the keywords \u201cretinoic acid\u201d and \u201cneuroblastoma\u201d. The search was limited to original papers published in the English language, clinical trials, comparative studies, observational studies, system reviews, and meta-reviews published between 1 January 1980 and 1 July 2020. The initial search yielded 331 articles. After screening titles and abstracts, 87 relevant primary studies were identified and included in the review. An additional 15 studies were recovered after analysing the review articles on retinoic acid derivatives. The information about using retinoic acid and its derivatives in clinical trials was obtained from PubMed and ClinicalTrials.gov databases. The initial search in PubMed databases identified 12 randomised control trials of interest, all of which were reviewed in this article. The currently undergoing studies on the retinoic acid were accessed in ClinicalTrials.gov databases, resulting in 41 clinical trials that either supported the previously identified PubMed published studies were actively recruiting, terminated, active, or compete without yielding statistical data. We carried out a systematic review adopting the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines , while tTwo authors (N.B. and E.C.) accessed the titles and abstracts of the retrieved publications for inclusion into the study, with the assistance of the second author (O.P.) in case of discrepancies. The studies selected for this review followed these inclusion criteria: (1) randomized control trials, clinical trials, comparative studies, and primary research papers; (2) peer-reviewed studies published in English with full text available; (3) studies using the human/animal cell lines.The exclusion criteria were as follows: (1) reviews and meta-analysis papers, case reports, letters to the editor, and conference/meetings abstracts; (2) non-English publications; (3) non-full text articles; (4) using exclusively biological techniques/treatment (including silencing of genes via mRNA/ssRNA/CrisprCas9 and use of antibodies); (5) examining the role of RA signalling in organism development.The author (N.B.) extracted data from the papers included and entered them into an Excel worksheet. Any disagreement was resolved through discussion between the authors . The following information were recorded in the Excel form: data about the publication , investigated treatment , experimental model , experimental results ), and phenotypic changes induced by differentiation markers .Three-hundred and thirty-one articles were yielded initially through an online database search, while an additional 15 papers were identified through examining the references of the review papers. The resulting 346 articles were then evaluated based on title, abstract, and keywords, which led to the exclusion of 259 articles. The full text of the selected 87 articles was accessed, which resulted in the exclusion of 21 articles that focused solely on biological treatment. Finally, 66 articles were selected and included in the review. Out of those, 54 were primary articles and 12 were randomized clinical trials. Our selection strategy for original research is illustrated with the appropriate flow diagram in Derived from retinol through two oxidation reactions, RA is found in three isomers: all-trans RA (ATRA), 13-cis RA, and 9-cis RA. ATRA, the most predominant form in the cells, is responsible for gene expression change through activation of RAR . Both deApplied to neuroblastoma cells, ATRA induces neurite formation and outgrowth, which are the hallmarks of neuronal differentiation . 13-cis MYCN amplified (MNA) cells more rapidly [MYCN non-amplified (non-MNA) cells [RAR-a, and RAR-b mRNA) and the decreased expression of MYCN [Among the listed RA isoforms, 9-cis RA could be considered the most potent inducing NB cell differentiation in vitro. Compared to ATRA, 9-cis RA induces the morphological indicators of neuronal differentiation of  rapidly  and leadA) cells . Further of MYCN . The obs of MYCN ,20. Howe of MYCN . Further of MYCN  , 200% , SH-EP, and WAC(2)), and 400% (IMR-32) [and Sox2 . FurtherRetinoic acid-triazolyl compounds are other RA derivatives exhibiting potent anti-NB effects. Out of the investigated chemicals, -(1-(2-nitrophenyl)-1H-1,2,3-triazol-4-yl)methyl 3,7-dimethyl-9-nona-2,4,6,8-tetraenoate and -(1-(2-fluorophenyl)-1H-1,2,3-triazol-4-yl)methyl 3,7-dimethyl-9-deca-2,4,6,8-tetraenoate inducted differentiation in NB cells more effectively than ATRA, both leading to a 2.6-fold greater increase in the expression of maturation marker NeuN in murine the Neuro2a line compared to non-treated cells . Cyclic While not being investigated explicitly for neuroblastoma, several retinoic derivatives were found to induce differentiation in other cancer types. Two of those compounds affecting cancer cells are N-(4-hydroxyphenyl) amido (4HPTTNPB) and 4-hydroxybenzyl (4HBTTNPB). They were derived from TTNPB, an RXR receptor agonist that is also an extremely potent teratogen . Both itIn a cell, RA-mediated RAR activation results in increased expression of the CYP26 enzymes. Those enzymes are primarily important for metabolism and inactivation of all RA isoforms, so their activation acts as a negative regulator on the RA pathway. Contrarily, an inhibition of those enzymes could lead to the amplification of RA signalling. Testing this theory, the effect of R116010, an inhibitor of CYP26, on RA-mediated differentiation of NB cells, was investigated . The simMYCN mRNA expression in the MNA NGP cell line, but the mechanism of this change is not understood. Furthermore, the compound was retained its properties in vivo when tested in the immunodeficient athymic nude mice model. In animals bearing SH-SY-5Y xenografts, the administration of R116010 before ATRA and 13-cis RA resulted in increased plasma concentrations of RA  [Conversely, SH-EP and GIMEN cell lines, which exhibited the constant levels of CYP26 expression following ATRA treatment, did not benefit from additional R116010 treatment. Interestingly, R116010 alone increased ctively) .Inhibition of RA metabolism also contributes to the neuroprotective action of the tetracycline antibiotic minocycline. This drug alone inhibited RA metabolism and enhanced RA-activated \u03b2-galactosidase activity in RA-pre-treated human and murine NB cells in vitro .Vitamin A and vitamin D share similar properties as fat-soluble compounds that activate the same nuclear RXR receptor. Therefore, there is a high likelihood of vitamin D derivatives attenuating RA signalling or sharing RA properties. Stio et al. examined the impacts of 1,25-dihydroxyvitamin D3, 24,25(OH)2D3, KH 1060, and EB 1089 on SH-SY-5Y NB cells . Out of While vitamin E does not share a signalling pathway with vitamin A, it is still implicated in cancer prevention due to its antioxidative action. Nevertheless, Trolox, a vitamin E analogue, did not affect ATRA-treated non-MNA SH-SY-5Y cells . On the RA exerts its major cellular effects through activating nuclear receptors and initiating changes in gene expression. However, its downstream signalling elements interact extensively with other signalling pathway cascades . Thus, tOn the contrary, in parental SHSY5Y inhibition of MEK results in the diminished effects of ATRA, as was evident in the experiment with PD98059. Administered before ATRA treatment, this compound counteracted RA-mediated neurite formation . In addiStudies report contradictory effects of c-Jun N-terminal kinase (JNK) signalling inhibition on RA cellular action. SB203580, JNK1/2 inhibitor, exhibited no effect on the RA-treated NB cells, but curcumin, which also interferes with the JNK pathway, blocks RA-mediated NB differentiation without causing cellular proliferation arrest ,44. WhilIn addition to PI3K, vascular endothelial growth factor receptor 2 (VEGFR2), epidermal growth factor receptor (EGFR), and rearranged during transfection (RET) pathways were also found to be essential for RA-mediated differentiation. Their antagonist, Vandetanib, impedes neurite formation in RA-treated SH-SY5Y, SKN-BE2n, SKN-BE2c cell lines at concentration 5 \u03bcmol/L . While VWhile the inhibition of MAPK, PI3K, and RET pathways impairs RA-induced NB differentiation, inhibition of the protein kinase C (PKC) pathway has the opposite effect. Co-exposure of H7, PKC inhibitor, and ATRA resulted in increased neurite formation in non-MNA SH-SY5Y and MNA LA-N-5 NB lines . SimilarAnother pathway, derivatives of which attenuate RA signalling, is arachidonic acid metabolic cascade. Lipoxygenase (LOX) pathway inhibition enhanced the pro-differentiation action of RA. Co-treatment of ATRA with caffeic acid or celecoxib\u2014LOX and cyclooxygenase 2 (COX2) inhibitors\u2014increased the expression of mature neuronal markers NF-200 and NeuN in MNA SK-N-BE(2) cells . InteresThe pathways mentioned previously are essential for RA\u2019s effects or counteracting RA signalling, yet activation of other pathways could also enhance RA actions on NB cells. For example, the activation of transforming growth factor \u03b2 (TGF-\u03b2) signalling pathway by kartogenin allowed RA-resistant MNA IMR32 cells to undergo differentiation . AdditioWhile multiple pathways mediate RA effects, RA treatment could also affect other signalling cascades. As such, 72 h pre-incubation with 9-cis RA predisposed non-MNA SH-EP, SH-SY5Y, and Kelly but not MNA LAN-5, SK-N-LO, and SK-N-FI NB cell lines to decreasing viability after subsequent exposure to STI-571, imatinib, a tyrosine kinase pathway inhibitor. This effect was not evident in cells which competed for differentiation or acquired RA resistance .Finally, RA signalling might be modulated by non-specific compounds targeting proteasomes. The introduction of MG132, a protease inhibitor, resulted in increased apoptotic processes in RA-treated SK-N-BE(2) and SH-SY5Y cells; furthermore, surviving cells differentiated, obtaining the neuronal morphology, and stopped expression of stem markers PCNA, NF-\u03baB, Sox2, Oct4, and Nestin .Epigenetics refers to the reversible alterations to the gene expression in response to chemical changes of DNA without changing nucleotide sequencing and histones, the proteins binding DNA and supporting DNA coiled structure. The two most common types of drugs that work through epigenetic modulation are histone deacetylases (HDACs) and methylation inhibitors.HDACs affect gene expression by inhibiting histone deacetylases, which increases the acetylation of the histones. After accepting an acetyl group, histones typically bind DNA strand with lesser affinity. This, in turn, liberates DNA regions and allows for the initiation of the transcription. Changes in gene expression ultimately affect all cell processes, so drugs targeting epigenetic modifications might affect cellular response to RA treatment . Thus, tin vivo. The tumour burden was decreased with minor animal toxicity, the specificity of the response attributed to the increased histone acetylation [In turn, compounds targeting the HDAC8 demonstrated a pro-differentiating action. Combined treatment with PCI-48012 and ATRA increased the neurite formation in BE(2)-C cells and IMR-32 by 150% and 50%, respectively. Additionally, the drug combination decreased the MYCN expression by 60% compared to RA alone in BE(2)-C cell line . Furthertylation .Methylation of the histones results in the opposite effects that of acetylation. Methylated histones become bound to DNA more tightly, thereby restricting the binding of transcription machinery to the gene promotor sequences, silencing gene expression. The inhibition of histone methylation restores the transcription of the affected genes.In addition to inhibiting histone deacetylase, activation of transcription could be achieved though inhibiting methylation. This is the mechanism of action of GSK-J4, an inhibitor of H3K27 and JMJD3 demethylases. Treatment by each of them contributed to a more prominent decrease in cellular viability than ATRA treatment alone .Another demethylating agent, 5-Aza-deoxycytidine (AZA), enhanced RA actions both in vitro and in vivo . ExposurThis section of the review focuses on the interactions between RA and drugs used in clinical practice, examining the combinations showing the most potent differentiating or pro-apoptotic actions. For example, the co-treatment of ATRA and herbimycin A resulted in a marked increase in NB differentiation in vitro . ContrarMYCN mRNA in LAN5 cells compared to either treatment alone [Substantial evidence supports the synergy between RA and IFN\u03b3. The initial studies showed that co-treatment of IFN-\u03b3 with ATRA led to a greater decrease of nt alone . Subsequnt alone . The IFNnt alone . The obsnt alone .Similarly, a synergy between RA and dehydroepiandrosterone (DHEA), a steroid hormone precursor was reported. Co-administration of those drugs resulted in decreased cellular movements, more prominent neurite elongation, more significant cell proliferation arrest, and increased expression of GAP-43 in SK-N-BE cells . FinallyThe majority of the reviewed studies investigated RA effects in vitro by utilising traditional 2D NB cell models. Traditional 2D cell cultures, while being an affordable mean of screening for the potential compounds of interest, fail to reproduce the complexity of the NB at the tissue level. One of the main reasons for this model inadequacy is limited interactions between cultured cells and a complete absence of the interactions with other cell types and extracellular matrix. Those interactions were found to be extremely important in NB differentiation and progression ,73. The After determining the compound\u2019s action in vitro, the subsequent step is to verify its efficiency in vivo. The reviewed studies utilised the murine xenograft models using either athymic (nu/nu) or severe immunodeficiency strain, allowing them to receive the transplanted NB cells, usually SH-SY-5Y, LAN5, and BE(2)-C cell lines . After aRA has limited clinical efficiency and is suspect to drug resistance due to hydrophobic nature, short half-life, varying plasma concentration between patients, and cytotoxicity. To overcome those limitations, two approaches are being investigated, using RA compounds in combination treatments  and imprA more recent study investigated the efficiency of a multifunctional nanobiohybrid material composed of Ag@Bi2Se3/RNA . This na2/day, administered orally in two divided doses) for 14 consecutive days in a 28-day cycle. The participants in the control group received no supplemental therapy. The patients who received 13-cis RA treatment had a significant increase in 3-year event-free survival rate (46 \u00b1 6 per cent compared to 29 \u00b1 5 per cent).RA isomers\u2019 success as pro-differentiation agents in preclinical research opened opportunities to advance them to NB clinical trials . ATRA anFurthermore, this effect was observed in both transplantation and chemotherapy cohorts . A subseThe efficacy of 13-cis RA treatment alone in treating NB might be even more limited, as supported by the subsequent study focused on 175 high-risk stage 4 NB patients. The obtained data displayed no significant difference in 3-year event-free survival rates between patients receiving the RA therapy and patients treated with placebo, yet those results could be attributed to the suboptimal amount of the administered compound . Neverth2/day in three divided doses, three consecutive days per week) and IFN\u03b12a  in four cycles). The study determined complete response as normalization of urinary catecholamines, complete resolution of all soft tissue tumours, and partial response as a 50% reduction of all measurable tumour. Unfortunately, the participants failed to benefit from the treatment, suggesting the lack of ATRA-IFNa2 efficacy in NB [While most RA clinical trials focused on the 13-cis RA isoform, a phase II clinical trial investigated the efficacy of ATRA-IFN\u03b12a combination. Sixteen NB patients were administered ATRA  and Il-2 (3.0 \u00d7 106 IU/m2/day for 4 days in week 1 and 4.5 \u00d7 106 IU/m2/day for 4 days in week 2). This treatment was beneficial for the patients in immunotherapy group, who experienced increased rates of event-free survival (66 \u00b1 5% vs. 46 \u00b1 5%) and overall survival (86 \u00b1 4% vs. 75 \u00b1 5%) at 2 years compared to the patients in standardised treatment group. Despite the effectiveness of the treatment, 52% of the patients experienced significant neuropathic pain of grade 3, 4, and 5 [2/day) and isotretinoin (160 mg/m2/day for 2 weeks) and IL-(6.0 \u00d7 106 IU/m2/day for days 1\u20135 and 8\u201312) for 5 or 6 cycles [The combination of differentiating and antibody-based therapies may work together well tackling tumour through different pathways. Here, we will discuss those studies that assessed efficacy of anti-GD2 antibody in a combination with isotretinoin. Several therapeutic antibodies directed against disialoganglioside GD2, an antigen highly expressed on neuroblastoma cells have been developed, tested in clinical trials, and reviewed . A phase4, and 5 . This di6 cycles . A subse6 cycles . The pat2), the second\u20143F8 + IV GM-CSF + 13 cis-RA RA , and the third\u20143F8 + SC GM-CSF + 13-cis RA . The latter group also had 28 patients deemed ultra-high-risk, who received additional induction therapy. The patients in the third cohort received the most benefit from the treatment, as their 5-year progression free survival was 62%, while the overall survival reached 81% (compared to 44%/49% and 56%/61% of cohorts 1 and 2), the results demonstrating that anti-GD2 3F8 antibody\u2013GM-CSF\u201313-cis RA polytherapy is effective against minimal disease.Another anti-GD2 antibody of interest is a murine 3F8 antibody. Its properties were determined in Phase III trial, which included 169 children with refractory stage 4 NB in first remission . The pat2/day divided into three equal doses, while those >18 years of age were treated with 1800 mg/m2/day divided into two equal doses for seven days followed by two weeks rest. For statistical analysis, the patients were stratified based on their initial NB presentation. Stratum I was composed of 38 patients with a CT/MRI measurable tumour; 24 patients without a CT/MRI measurable tumour but exhibiting a MIBG avid tumour and/or a tumour in the bone marrow were assigned to stratum II. Fenretinide treatment resulted in one partial response in stratum II and 13 cases of a prolonged stable disease divided between strata (seven patients in stratum I and six patients in Stratum II), affecting 24% of exposed patients. Hence, this compound failed to meet the protocol criteria for efficacy, attributing to its poor bioavailability [Fenretinide, a derivative of RA, exhibited a potent cytotoxic effect on NB cells, as discussed in lability . An attelability . Its effThere is a lack of clinical trials focusing on the potential combinations of RA and synergistic drugs. A phase I clinical trial investigating the combination of RA and ZD6474, an inhibitor of VEGF signalling, was commenced in 2007 but was terminated due to the lack of enrolment (Despite the limited interest in investigating RA and synergistic drug combinations\u2019 efficiency, the discovery of the novel potent anti-cancer meditation might give rise to the future RA clinical trials. Many in vitro studies confirmed the synergic effect of interaction between the RA signalling and all mentioned pathways. Those drugs might be more efficient in combination with RA and give rise to the more potent NB treatment. Currently, several phase I clinical trials recruit NB patients to investigate the compounds affecting MAPK, PI3K, ERK1/2, and proteasomal signalling.Neuroblastoma is a highly heterogeneous solid malignancy that consists of neuroblasts and undifferentiated Schwann cell precursors. This offers a window of opportunities to develop a pro-differentiating and anti-proliferative therapy for high-risk NB; however, a systems biology approach to devising such strategies is currently missing.We attempted to systematically review current efforts to differentiate neuroblastoma directly targeting the classical retinoic acid pathway and indirectly by mimicking their downstream effects of RA published from 1 January 1980 to 1 July 2020. The complexity of neuroblastoma biology makes it difficult to identify intercellular signals that could be either disrupted or induced, to drive tumour cells towards differentiation ,93,94. SCurrently, the only form of RA employed in clinical practice is 13-cis RA, also known as isotretinoin, as part of the treatment regimen for high-risk neuroblastoma patients; however, some patients display a varied response to the drug, with many being non-responsive to this therapy ,12,17,97The only other derivative of RA to reach clinical trial is a cytotoxic compound fenretinide. Initially deemed inefficient due to low bioavailability, subsequent studies led to the development of a novel fenretinide/LXS formulation which achieved a higher drug plasma concentration. This compound is currently undergoing clinical trials which will evaluate its efficacy in NB treatment. This highlights the importance of further screening on retinoid chemical compounds with the aim of identifying less toxic and more potent pro-differentiating effects. To advance RA derivatives being identified and brought to clinical trial, there is a clear need for more effective pharmacokinetic mortification, to reduce drug toxicity and improve bioavailability. The success in vitro of alternative delivery systems at solving these limitations, such as the use of nanoparticles to administer RA therapy to neuroblastoma cell lines, demonstrates the potential of this area to increase the clinical application of RA therapy. Further investigation is required to access the use of established DDS in neuroblastoma differentiation treatment.in vivo. To date nine clinical trials have taken place to determine the potential of this combinational treatment in high-risk NB patients. Further efforts are still required for more clinical validation to find better therapeutic regimens for high-risk NB patients.The most promising direction of RA therapy is the creation of synergistic multidrug treatments, composed of drugs that target different signalling pathways. This strategy aims to reduce drug resistance to standard care caused by the persistence of immature nerve cell precursors. The data suggest the synergistic interactions between RA and drugs in the following categories: MAP/PI3K/TGF-\u03b2 agonists and CYP26/PKC/tyrosine kinase/proteosome inhibitors. Therefore, combining RA and several drugs from those classes might further promote their pro-differentiating actions in NB. Recent interest in the area of immunotherapy has led to the use of RA therapy in combination with anti-GD2 antibodies and IL-2, which has seen an improvement in neuroblastoma patient overall survival. In addition, there is strong evidence of the synergy between RA and epigenetic modulators, predominantly HDAC inhibitors, which were shown to induce NB differentiation in vitro and Unfortunately, while the simultaneous usage of RA and other compounds to treat NB cells has been examined in vitro, there is a relative lack of further studies examining their interactions in vivo. As such, signalling cascade effector drugs have not been tested in combination RA in animal models or in 3D models, which could capture the NB tumour heterogenicity better than traditional 2D cell cultures . Hence, To improve the survival score of RA as a monotherapy or in combination with targeted treatments, there is a need for a more personalised medicine approach\u2014enabling patients to receive earlier diagnoses and optimal treatment regimes, ultimately leading to a change in clinical treatment practice from a trial-and-error approach to the right drug, for the right patient, at the right time . To achi"}
+{"text": "The World Health Organization recommends postpartum family planning (PPFP) for healthy birth spacing. This study is an evaluation of an intervention that sought to improve women\u2019s access to PPFP in Tanzania. The intervention included counseling on PPFP during antenatal and delivery care and introducing postpartum intrauterine device (PPIUD) insertion as an integrated part of delivery services for women electing PPIUD in the immediate postpartum period.This cluster-randomized controlled trial recruited 15,264 postpartum Tanzanian women aged 18 or older who delivered in one of five study hospitals between January and September 2016. We present the effectiveness of the intervention using a difference-in-differences approach to compare outcomes, receipt of PPIUD counseling and choice of PPIUD after delivery, between the pre- and post-intervention period in the treatment and control group. We also present an intervention adherence-adjusted analysis using an instrumental variables estimation.We estimate linear probability models to obtain effect sizes in percentage points (pp). The intervention increased PPIUD counseling by 19.8 pp (95% CI: 9.1 \u2013 22.6 pp) and choice of PPIUD by 6.3 pp (95% CI: 2.3 \u2013 8.0 pp). The adherence-adjusted estimates demonstrate that if all women had been counseled, we would have observed a 31.6 pp increase in choice of PPIUD (95% CI: 24.3 \u2013 35.8 pp). Among women counseled, determinants of choosing PPIUD included receiving an informational leaflet during counseling and being counseled after admission for delivery services.The intervention modestly increased the rate of PPIUD counseling and choice of PPIUD, primarily due to low coverage of PPIUD counseling among women delivering in study facilities. With universal PPIUD counseling, large increases in choice of PPIUD would have been observed. Giving women informational materials on PPIUD and counseling after admission for delivery are likely to increase the proportion of women choosing PPIUD.clinicaltrials.gov (NCT02718222) on March 24, 2016, retrospectively registered.Registered with  The World Health Organization (WHO) recommends postpartum family planning (PPFP) for healthy birth spacing . PPFP isWHO recommends lactational amenorrhea (LAM), condoms, male or female sterilization, progesterone-only pills, implants, and the copper intrauterine device (IUD) immediately following delivery for women who plan to breastfeed . Other mIn Tanzania, the median inter-birth interval has increased over time and most recent estimates report an inter-birth interval of 35\u2009months , which iThe present study is an evaluation of an intervention that sought to improve women\u2019s access to PPFP in large, tertiary care facilities in Tanzania. The intervention focused on increasing counseling on PPFP during antenatal care (ANC) visits and integrating PPIUD insertion within delivery services for women choosing PPIUD in the immediate postpartum period. The analysis focuses on the effect of the intervention on this newly added service, including effects on PPIUD counseling and women\u2019s choice of PPIUD (i.e. having a PPIUD inserted) before being discharged from the hospital after delivery. We also assess factors associated with choice of PPIUD, including measures of counseling quality and women\u2019s socio-demographic characteristics. The intervention was implemented by the International Federation of Obstetricians and Gynecologists (FIGO) in partnership with its Tanzanian affiliate, the Association of Gynecologists and Obstetricians of Tanzania (AGOTA), as part of a larger project that implemented and evaluated the FIGO PPFP intervention in three countries: Tanzania, Nepal and Sri Lanka. The results of the evaluations in Nepal and Sri Lanka are published elsewhere , 12.clinicaltrials.gov (NCT02718222), and the full study protocol has been published elsewhere [Data were collected through a cluster-randomized stepped-wedge trial to evaluate the impact of an intervention that introduced PPIUD services in six tertiary health facilities in Tanzania. The trial was registered with lsewhere . The stuFor this cluster-randomized stepped-wedge trial, six large, tertiary care facilities were selected by AGOTA, the implementing agency for the intervention, to provide coverage of PPIUD services for different regions of Tanzania. The stepped-wedge design was selected to measure intervention effectiveness because it is characterized by staggered intervention implementation in all study facilities, which ensured that all women delivering in study facilities could potentially benefit from the intervention. The evaluation team matched facilities in pairs based on annual delivery caseload, and within each pair, one facility was randomly assigned to Group 1 (early intervention implementation) and the other to Group 2 (late intervention implementation). The matched pair group assignments were as follows: Dodoma General Hospital in Dodoma (Group 1) and Mt. Meru Hospital in Arusha (Group 2), Muhimbili National Hospital in Dar es Salaam (Group 1) and Sekou-Toure Regional Referral Hospital in Mwanza (Group 2), and Mbeya Zonal Referral Hospital in Mbeya (Group 1) and Tumbi-Piwani Regional Referral Hospital in Kibaha (Group 2).After randomization, there were two key deviations from the stepped-wedge protocol. First, before data collection started, the evaluation team decided to drop Sekou-Toure Regional Referral Hospital from the evaluation because the hospital served as a family planning model facility for the country and had an ongoing PPIUD intervention, which would make it difficult to isolate the effect of the newly implemented FIGO/AGOTA intervention. Data for the evaluation were only collected in the remaining five hospitals. Second, significant delays in intervention implementation in the Group 2 hospitals  led to insufficient data collected after intervention implementation began. Group 2 hospitals were scheduled to start intervention implementation on 15th September 2016, but implementation was delayed until 17th November 2016, 1\u00a0month before the end of data collection, providing data for only 1\u00a0month rather than the planned 3\u00a0months. As a result, we have dropped the intervention period for the Group 2 hospitals and will consider the Group 2 hospitals as control facilities that are only observed in a state where they do not receive the intervention even as the Group 1 hospitals receive the intervention. This set-up of the data allows us to conduct the analysis as a treatment/control study of a cluster-randomized trial using a difference-in-difference approach. The difference-in-difference approach compares the change in an outcome that is observed in the Group 1 (treatment) hospitals between the pre- and post-intervention periods relative to the change in the outcome that is observed in the Group 2 (control) hospitals over the same period of time. The key identifying assumption of this analytic approach, referred to as the \u201cparallel trends\u201d assumption, is that the change in the outcome in the treatment hospitals between the pre- and post- periods would have been the same as the observed change in the control hospitals over the same period had the treatment hospitals not received the intervention. More specifically, the average outcome in the two groups would have evolved in parallel over time in the absence of the intervention, even if the average outcome between the Group 1 hospitals and Group 2 hospitals in the period had differed in the pre-period, before the Group 1 hospitals received the intervention. In this manner, any deviation from the relative parallel trend of the outcome into the post-intervention period between the Group 1 and Group 2 hospitals can be attributed to the effect of intervention on the outcome. On 15th January 2016, data collection commenced in both Group 1 and Group 2 hospitals, and the analysis will consider only the initial 8\u00a0months of data collection (15th January 2016 \u2013 15th September 2016), before intervention implementation was to take place in the Group 2 hospitals. Group 1 hospitals began implementing the intervention in mid-May 2016, providing 4\u00a0months of data during the pre-intervention period and 4\u00a0months of data during the post-intervention period.The intervention sought to improve women\u2019s access to PPFP through improved counseling during ANC and through the introduction of immediate PPIUD insertion services in health facilities. The intervention was implemented by FIGO in partnership with AGOTA. Specific intervention components included: 1) information education and communication (IEC) materials on PPFP, including leaflets and a video that played in the waiting room; 2) provider training on PPFP counseling and PPIUD insertion techniques; 3) provision of equipment, including Kelly\u2019s forceps to insert the IUD; and 4) regular monitoring and support provided by FIGO and AGOTA. All four elements of the intervention were implemented in the three Group 1 hospitals, and counseling and IEC materials were also made available in satellite clinics surrounding the Group 1 hospitals where many women received ANC services before delivering in the study hospitals. The intervention was implemented in two stages: AGOTA first conducted a training of trainers (TOT) from each intervention hospital, and then trainers provided cascade training to Ob/Gyns, residents and midlevel providers in their hospital approximately 1\u00a0month later. The post-intervention period is considered to have started after the cascade training was completed in the Group 1 hospitals.Trained Research Assistants with previous experience conducting surveys were posted in post-natal wards of study hospitals where they conducted an interviewer-administered survey with women who consented to participate. Research Assistants were employed by AGOTA to collect data over the full project implementation period, but they were managed by the local research organization, Management and Development for Health (MDH), during the evaluation data collection period. The women\u2019s survey collected socio-demographic data, information on PPFP counseling, including timing of counseling and information about the birth and PPFP decision-making. In addition, providers completed a survey about PPIUD insertion for women choosing a PPIUD as their PPFP method before discharge from the hospital. All data were collected using pre-programmed tablets using the CommCare application by Dimagi.The key outcomes of interest for this evaluation were counseling on PPIUD and choice of the PPIUD after delivery, as PPIUD insertion was a newly offered service after intervention implementation. Counseling on PPIUD was measured through women\u2019s self-report, and a woman was considered to have been counseled if she reported PPIUD counseling during antenatal care or during her stay at the hospital for delivery. Choice of PPIUD was measured as a dichotomous variable based on both the woman\u2019s report and the provider\u2019s report of PPIUD insertion. Occasionally, a woman would choose to have a PPIUD inserted after she completed her survey, and the insertion would be reported only on the provider survey. If either the woman or the provider reported PPIUD insertion, the woman was considered to have chosen the PPIUD.A total of 16,930 women who delivered during the study period (15th January 2016 \u2013 15th September 2016) in five hospitals were screened for study eligibility , 15,912 (94%) were eligible (ineligibility primarily due to age under 18\u2009years), and 15,264 (96%) of them consented to participate . In all models, we controlled for hospital and month fixed effects. We present an unadjusted model showing the effect of intervention exposure on each outcome controlling only for the hospital and month fixed effects and an adjusted model which includes women\u2019s socio-demographic characteristics. Characteristics include woman\u2019s age, education, parity, marital status, religion, and whether the woman was being seen in the \u201cfast track\u201d or normal track service. Fast track services cost more than normal track services and typically have better amenities and a lower provider to patient ratio.Next, we measure the intervention adherence-adjusted effect of the intervention on choice of PPIUD. Some women were not exposed to the intervention for a variety of reasons, including inconsistent implementation of the intervention counseling, because they received ANC in a facility that did not offer counseling on PPIUD, or because they did not attend ANC services. The adherence-adjusted approach assumes that all of the effect of the intervention is through counseling and allows us to measure the effect of the intervention on choice of PPIUD among women who were counseled on PPIUD. A linear probability model is used to estimate the adherence-adjusted effect, which is equivalent to a standard instrumental variables (IV) approach .We also present an analysis of the determinants of women\u2019s choice of PPIUD among women who were counseled, controlling for hospital and month fixed effects. This analysis focuses on measured aspects of quality in counseling, including timing of counseling, whether IEC materials were used (leaflet given and video seen), whether they were given an opportunity to ask questions during counseling and the types of information they recall from the PPIUD counseling they received, and women\u2019s socio-demographic characteristics that are associated with choice of PPIUD.Due to the small number of clusters  included in our analysis, all of our models adjust standard errors using the cluster wild bootstrapping method with Webb weights, a six-point distribution that reduces spurious precision due to replications based on a small number of clusters . This apTable\u00a0Figures\u00a0Table\u00a0Table\u00a0Table\u00a0Due to the relatively low rates of PPIUD counseling during the post-intervention period, we sought to adjust the effect size estimate for intervention adherence, i.e., whether a woman was counseled on choice of PPIUD after delivery. We counted both counseling during an ANC visit or at the hospital during delivery care as adherent to the intervention. A direct estimate of counseling on choice of PPIUD is likely to be biased. Table Table\u00a0This study evaluates the effect of an intervention that sought to increase women\u2019s access to PPIUD services immediately following delivery. We found that the intervention increased PPIUD counseling by 19.8 pp and choice of PPIUD by 6.3 pp. These increases are statistically significant but relatively modest, primarily due to low coverage of PPIUD counseling among women delivering in Group 1 (treatment) facilities during the post-intervention period. Adherence-adjusted estimates demonstrate that if all women had been counseled, we would have observed an increase of 31.6 pp in choice of PPIUD \u2013 a result five times higher than the observed increase.The strength of this study is the randomized design. We achieved balance on the outcomes and important covariates between the two groups during the pre-intervention period, suggesting that any differences in outcomes during the post-intervention period can be attributed to the intervention. One limitation is that intervention implementation took place only in tertiary care facilities, and findings may not generalize to similar interventions that are implemented in lower level health facilities.Intervention implementation varied across the Group 1 hospitals with Dodoma and Mbeya performing better than Muhimbili National Hospital. Muhimbili National Hospital is the national referral hospital in Tanzania and sees some of the most complicated cases. For this reason, a service such as PPIUD may be a low priority compared to other life-saving treatments needed in this complicated patient population. However, even in Dodoma and Mbeya hospitals, fewer than 40% of delivery clients reported being counseled on PPIUD. Low rates of counseling may be due to inconsistent implementation or women seeking ANC from facilities where the intervention was not being implemented. Since study hospitals were referral facilities, many of the women delivering may have been referred from distant facilities and may not have had an opportunity to be counseled during ANC at the hospital or its surrounding satellite clinics where intervention implementation occurred. However, all women delivering during the post-intervention period in Group 1 hospitals had an opportunity to be counseled after admission for delivery.Among women who were counseled on PPIUD, 57.0% reported counseling during ANC or both during ANC and after admission for delivery, and the remaining 43.0% only received counseling after admission for delivery. The intervention initially sought to counsel only during ANC to maximize the amount of time women had for informed decision-making, but counseling was also offered at the time of delivery to ensure that any women who wanted to use the PPIUD had the opportunity. The adjusted model found that women who were counseled after admission were more likely to choose PPIUD, corroborating findings from a recent review article, which found that interventions providing counseling in postnatal wards are effective in increasing postpartum contraceptive uptake .Quality of counseling was relatively low among women who were counseled on PPIUD. Very few women who were counseled received the PPFP leaflet or saw the video. The adjusted model found that receiving the leaflet was associated with choice of PPIUD, which suggests that women who had time to review the information and possibly to share it with a husband/partner or other family members or friends were more likely to choose PPIUD than those who did not have this opportunity. Other studies have also identified leaflets provided during ANC as important for increasing uptake of PPIUD . We alsoThe intervention increased the rate of PPIUD counseling and choice of PPIUD. However, counseling rates were relatively modest, and counseling was not universally provided, with higher parity women and women from some religious groups more likely to receive counseling. We estimate that if universal counseling had been provided, five times more women would have chosen PPIUD. We also find that provision of IEC materials and counseling after admission for delivery are associated with choice of PPIUD. Improving coverage and quality of counseling is likely to increase women\u2019s access to PPFP services, including PPIUD."}
+{"text": "Animal models and cell lines are invaluable for virology research and host\u2013pathogen interaction studies. However, it is increasingly evident that these models are not sufficient to fully understand human viral diseases. With the advent of three-dimensional organotypic cultures, it is now possible to study viral infections in the human context. This perspective explores the potential of these organotypic cultures, also known as organoids, for virology research, antiviral testing, and shaping the virology landscape.  Because viruses are obligate intracellular parasites, model systems comprising various cellular components are necessary for elucidating their biology. Historically, animal models and immortalized (cancerous) cell lines enabled virology research and host\u2013pathogen interaction studies. Although these model systems immensely contributed to expand our knowledge of virology, the limitations of these models are clear . Animal Organoids are self-organized 3D cultures derived from stem cells. They are a miniature and simplified version of an organ that recapitulates the genetic phenotype, organization, and (limited) functionality of the organ. They consist of organ-specific cell types with spatially restricted lineage commitment. Organoids can be derived from induced pluripotent or multipotent tissue stem cells that can be embryonic, fetal, or adult in origin. Organoids have been established for several different organ systems: intestine, stomach, lung, liver, thyroid, kidney, blood vessel, brain, prostate, pancreas, and ovaries. For the sake of simplicity, we include human airway epithelial (HAE) cultures under this umbrella, as they are widely used in virology. HAE cultures are derived by culturing primary airway epithelial cells on permeable inserts and differentiating them in an air\u2013liquid interface . HAE culSpecific viruses cause diverse diseases in different animal models, and infection follows distinct routes within the host. For this reason, it is important to employ the most natural system to study the effects of viral infections. In order to increase the translatability of results from an in vitro or ex vivo model to an in vivo situation, it is imperative to rely on results from human-based model technology. Virus-infected human organoids can provide a more accurate image of what host factors are essential for the establishment of viral infection in humans, and improve the study of effects between donors with varying age, sex, or genetic make-up. The identification of such factors is essential in understanding why some individuals experience only mild disease after a specific viral infection, while others fall severely ill or even die. If the response to a viral infection can be predicted for individuals or groups, this leverages more personalized medicine, such as who to hospitalize or treat. Most virology research groups use immortalized cell lines to grow viruses. For example, HeLa cells are widely used to study rhinoviruses that cause respiratory disease, even though this cell line is derived from human cervical tissue. Therefore, to efficiently grow in these artificial culture models, viruses often need to adapt. For some viruses, e.g., the norovirus, this adaption is not possible, and despite intensive trials in multiple cell lines, they remain unculturable. Stem-cell-derived human intestinal organoids have allowed for the culture of these unculturable or hardly culturable enteric viruses, such as norovirus, although it is still limited to one round of infection . SimilarViruses can be directly amplified in organoid models from clinical isolates without the need to mutate or adapt. In contrast to laboratory-adapted viral strains or American Type Culture Collection (ATCC) strains grown in immortalized cell lines, viruses from infected human materials , grown only in organoids or HAE, more closely retain their original characteristics and infectivity profiles ,12,13. CThe expression of surface molecules may be completely different in immortalized cells or animal models compared to human host tissue, and results regarding receptor usage can be misleading and result from lab adaptation . An examBrain organoids were extensively used to confirm the neurotropism of the Zika virus and its preferential infection of neural progenitor cells . Zika viThe use of intestinal organoids highlighted the critical role of an enterovirus upstream open reading frame (uORF) present in the 5\u2032UTR genomic region. Many enteroviruses present a small open reading frame (ORF) upstream of the main polyprotein ORF. Early studies performed in cell lines concluded that this uORF is not used for translation initiation . RecentlAnother interesting advantage of using organoid models is the ability to study the interactions between codetected pathogens, which is not always possible in cell lines because viruses might be culturable on only two different cell lines. For example, respiratory syncytial virus grows better on A549, influenza virus on MDCK, and rhinovirus on HeLa cells; thus, it is difficult to find a cell line that is equally suited for the growth of these three pathogens . These oOrganoids were widely applied to study severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) recapitulating clinical disease and they provide novel insights highlighting their utility for virology research . HAE culIn addition to enabling indepth studies of clinical observations of lung epithelial infection, the potential to infect secondary tissue was also observed using organoid models. Lamers et al. showed that SARS-CoV-2 productively infects the human gut epithelium, targeting differentiated enterocytes . SimilarAnother area of investigation using organoids has been determining the neuroinvasive potential of SARS-CoV-2 . EpidemiWhile the previous section highlights the potential that organoids hold for virology, they are still a nascent technology with broader and virology-specific issues that need to be addressed as summarized below.\u00ae. These round structures are difficult to infect with viruses: receptors needed for infection are mostly located inside the organoid. As with HAE cultures, round gut organoids can be transformed to an open organoid model where cells grow on a Transwell\u00ae, so that they can be reached from the upper and lower sides to establish infections [Organoids, as they were originally established, are closed round structures embedded in Matrigelfections ,26,42,43Another important consideration is readouts used for analysis after infection. For instance, virus cultures in primary models often do not result in a CPE. This is likely due to the release of viral particles in a nonlytic manner, as seen in the case of enterovirus A71. Huang and colleagues demonstrated that enterovirus A71 infection of human intestinal organoids resulted in viral release through exosomes rather than lytic processes observed when using a classical RD cell line . MoreoveOrganoids are generated from primary cells, and culture conditions to maintain appropriate long-term cell composition and function are based on the knowledge of their in vivo requirements. For example, intestinal organoid culture systems typically require the activation of Wnt and EGF pathways, and the inhibition of BMP pathways. However there are variations of culture conditions for modulating these pathways, resulting in shifts in the cell composition of these organoid systems . A strik\u00ae is not completely defined and may lead to some variability. In addition, the costs of 3D culture systems tend to be higher than those of standard 2D culture systems due to their complexity. Many laboratories find alternative approaches that influence the selection of media-component suppliers or the type of extracellular matrix, and develop internal production of serum-based conditioned media.Another factor that could introduce variability in organoid cultures is related to the starting material. Varying performance is often seen in different batches of conditioned media because of the difficulty to precisely control which factors are secreted into the medium. Further, MatrigelReducing variability is hindered by a lack of widely accepted criteria and guidelines for assessing the quality and characteristics of organoid cultures that are generated using different reagents. During the past decade, protocols using different reagents and culture conditions were used for deriving and culturing organoids from a range of organs . As discApart from the heterogeneous nature of currently developed organoids, the next challenge is the development of high-throughput platforms that support organoid technology. For the industrial and commercial use of organoid technology for translational applications such as antiviral screening, organoid technology needs to be scaled up with standardized quality control while maintaining the complex nature of the organoids. This quandary is one of the major limitations for widespread implementation of organoid technology in a commercial setting. For the adequate implementation of organoid models, validated cell-culture protocols are critically needed that demonstrate organoid cultures in high-density microplates  with high quality-controlled standard performance to facilitate high-throughput screening (HTS). Validated HTS standards would facilitate reproducibility and reduce associated costs. The HTS methodology would be essential to commercially increasing the current use of organoids and facilitating personalized medicine.At present, organoids are mainly single-organ systems representing the epithelium. For instance, gut organoids comprise the gut epithelial layer and lack the mesenchymal or immune-cell elements present in the gut mucosa . The orgOne of the advantages of animal models  over human organoids is the availability of functionality readouts in animal systems. For example, in a monkey model, intravenous EV-A71 resulted in direct neurological signs such as tremor, ataxia, and brain edema . SimilarCurrently, 500\u20131000 animals are needed for optimizing a new antiviral compound for clinical trials. However, 95% of drugs that proceed to the clinical-trial stage do not make it to the market despite promising results in animal models. On the basis of the resemblance to the in vivo situation, organoid models show potential superiority to animal models in predicting efficacy and toxicity of an antiviral compound and therefore reducing costs in the development of novel antiviral therapies. In the pharmaceutical industry, selecting and testing lead compounds to assess their potency and safety typically involves the use of animal models to show in vivo proof of concept and provide evidence for clinical benefit, which is time-consuming and resource-intensive. For some indications, animal models might be unavailable or not translatable due to a lack of human components that are required for their mechanism of action. For systemic indications, disease-relevant, patient-derived cellular models very often exist. However, for central or peripheral nervous system (CNS/PNS) disorders, relevant in vitro models derived from patients hardly exist due to the inaccessibility of nervous tissue. To overcome these limitations, patient stem-cell-derived brain organoids provide an important translational bridge: a reliable model for CNS/PNS indications in the human context, thereby reducing the number of animal studies required for both efficacy and mechanism-of-action safety studies, decreasing development time into the clinic, and increasing the success rate due to the better-translatable in vitro platform.Over the past decade, organoids showed promise as a human model for studying human viral diseases. However, as a nascent technology, organoids still have room for advancement and standardization. As the complexity of these model systems increases with cocultures and organ-on-chip systems, new opportunities and challenges for the field arise, and the virology landscape benefits."}
+{"text": "The adsorption isotherm was well fitted by the Sips model, and kinetics studies demonstrated that the adsorption process conformed to a quasi-second-order kinetics model. Consequently, the as-synthesized CNCs-GO demonstrates good potential for the effective removal of antibiotics such as levofloxacin hydrochloride from aqueous media.Residual antibiotics in water are often persistent organic pollutants. The purpose of this study was to prepare a cellulose nanocrystals/graphene oxide composite (CNCs-GO) with a three-dimensional structure for the removal of the antibiotic levofloxacin hydrochloride (Levo-HCl) in water by adsorption. The scanning electron microscope, Fourier transform infrared (FT-IR), energy-dispersive spectroscopy, X-ray photoelectron spectroscopy and other characterization methods were used to study the physical structure and chemical properties of the CNCs-GO. The three-dimensional structure of the composite material rendered a high surface area and electrostatic attraction, resulting in increased adsorption capacity of the CNCs-GO for Levo-HCl. Based on the Box\u2013Behnken design, the effects of different factors on the removal of Levo-HCl by the CNCs-GO were explored. The composite material exhibited good antibiotic adsorption capacity, with a removal percentage exceeding 80.1% at an optimal pH of 4, the adsorbent dosage of 1.0 g l Once reIn recent years, a variety of methods have been explored to mitigate environmental antibiotic contamination, such as adsorption, catalytic degradation, biodegradation, photocatalytic degradation and advanced oxidation ,6\u20138. AmoOne material that meets some of the requirements for a good adsorbent is cellulose, an abundant natural resource. Its structural formula reveals a plethora of exposed hydroxyl and reduced and non-reduced end groups at which chemical reactions can occur. As a modified derivative of cellulose, nanocellulose  is a newThe purpose of the present work is the synthesis of novel adsorbent, cellulose nanocrystals/graphene oxide nanocomposite (CNCs-GO), for the removal of antibiotic levofloxacin hydrochloride  were purchased from Shanghai Macklin Biochemical Co., Ltd. Deionized water was used for all experiments. Otherwise specified chemicals were of reagent grade and used without further purification. Deionized water was used throughout the experiments.2.2.\u22121, 120 ml) was accurately measured into a 500 ml round-bottomed flask, followed by the CNCs suspension . The brown mixture was continuously sonicated for 1 h, and then stirred at room temperature for 2 h to obtain the brown CNCs-GO suspension. This suspension was freeze-dried  for 48 h to produce the CNCs-GO composite.GO was prepared from graphite powder according to the Hummers method . To prep2.3.\u22121 with 10 scans at a resolution of 4 cm\u22121. CNCs, GO and CNCs-GO were performed to analyse the surface morphology using Quanta 650FEG Emission SEM (USA) and 10 kV accelerating voltage. The specific surface area and the pore volume of CNCs, GO and CNCs-GO were measured using ASAP 2020 Surface and porosity analyser (USA) under N2 analysis adsorptive at 77 K. Powered XRD patterns were obtained  using Cu-K\u03b1 radiation (\u03bb = 0.15418 nm). XPS were performed with an Al K\u03b1 mono and vacuum degree of the analysis room 10\u20138 mbar . The contact angle tester  was used to record the dynamic contact angles of CNCs, GO and CNCs-GO within a certain time.The FT-IR spectra of CNCs, GO and CNCs-GO samples were recorded using a Nicolet 6700 FT-IR instrument (USA). The spectra were recorded over the wave number range of 400\u20134000 cm2.4.2.4.1.\u22121 and CNCs-GO composite adsorption material (0.025\u20130.125 g) were introduced into a 50 ml reaction bottle for batch adsorption experiments. The pH was adjusted between 2 and 9 by adding different concentrations of NaOH and HCl solutions. The configured suspension was shaken for 6 h, with samples withdrawn at specific intervals and centrifuged at 10 000 r.p.m. for 15 min to separate the solid and liquid phases. The supernatant was removed and the concentration of Levo-HCl in the liquid phase was measured by HPLC . The residual Levo-HCl concentration was obtained using a standard curve derived from a series of Levo-HCl solutions with known antibiotic content. The adsorbed amount of Levo-HCl was calculated according to equation (2.1),tq is the amount adsorbed after time t, C0 and tC are initial concentration and concentration of the adsorbate after time t, respectively (mg l\u22121); V is the volume of the solution (l) and m is the weight of the CNCs-GO used (g).Levo-HCl solution with an initial concentration of 5\u201312 mg lR%) of the Levo-HCl was calculated using equation (2.2):The percentage removal  measures particle size on the basis of fluctuations in scattered light intensity with time that may be due to the random Brownian motion of the sample particles present in suspension or polymers in a solution. Diffusion is directly related to the statistical nature of these fluctuations in scattered intensity ,38. In a3.1.3.\u22121, corresponding to \u2013OH stretching motions, C=O stretching vibrations in \u2013COOH groups, C=C stretching vibrations of sp2 hybridized carbon chains, C\u2013OH stretching vibrations in \u2013COOH groups and C\u2013O\u2013C stretching vibrations. The absorption peak at 864 cm\u22121 is due to C\u2013H bending vibrations. In the IR spectrum of the CNCs, absorption peaks are observed at 3340, 2900, 1649, 1428 and 1058 cm\u22121, which correspond to \u2013OH stretching vibrations, C\u2013H stretching vibrations, OH bending vibrations and C-OH stretching vibration and C-O stretching vibration in carboxyl group. The FT-IR spectrum of the CNCs-GO composite contains all the absorption peaks observed in GO, as well as peaks unique to nanocellulose, such as that at 2900 cm\u22121, corresponding to the \u2013C\u2013H stretching vibrations of its methyl and methylene groups. These FT-IR results also affirm that the CNCs-GO composite was successfully prepared.The FT-IR patterns of the CNCs, GO and CNCs-GO are depicted in 3.1.4.2 adsorption\u2013desorption isotherms and Barrett\u2013Joyner\u2013Halenda (BJH) pore volume distributions for the CNCs and CNCs-GO are shown in P/P0 < 0.1, the N2 adsorption\u2013desorption curves of the CNCs and CNCs-GO rise sharply, indicating that both materials have a certain number of micropores. In the relative pressure range of 0.4\u20130.8, there is a significant hysteresis loop in the N2 adsorption\u2013desorption curve of the CNCs-GO, indicating the existence of mesoporous structure. In the relative pressure range of 0.8\u20131.0, the curve of the CNCs-GO increases significantly, indicating that there are large cavities in the composite. The N2 adsorption\u2013desorption curve of the CNCs has no obvious hysteresis loop in the 0.4\u20131.0 relative pressure range, indicating that this material has no mesoporous or hollow structures. Figure\u00a06b presents the pore size distribution curves for the CNCs and CNCs-GO calculated using the BJH model. Detailed structural parameters for the different samples are shown in N3.1.5.\u03b8 = 14.9\u00b0, 16.5\u00b0 and 22.8\u00b0, indicating that they possess the typical monoclinic cellulose I lattice . Th. Th60]. 4.\u22121, an initial pH of 4, an adsorbent dosage of 0.1 g l\u22121 and a 4 h contact time. Adsorption kinetics data were best fitted with a pseudo-second-order model, suggesting the interaction of Levo-HCl with the CNCs-GO via hydrogen bonding as well as electronic interaction, and the adsorption is mainly controlled by chemical adsorption behaviour. The three-parameter Sips model well described the adsorption isotherms of the CNCs-GO. Finally, this research shows that the prepared CNCs-GO composite can be a potentially effective absorbent for the removal of antibiotics such as levofloxacin hydrochloride from aqueous solution.In conclusion, a CNCs-GO was prepared ultrasonically and its adsorption properties for the antibiotic levofloxacin hydrochloride were studied. Based on single-factor tests, a multiple regression model was obtained through fitting with Design-Expert 10.0 software, and the reliability of the model was verified. According to the optimization results from response surface graphs and practical operation, the optimal conditions for adsorption were determined as an initial pollutant concentration of 10.0 mg l"}
+{"text": "Xanthomonas. These include X. euvesicatoria (race T1), X. vesicatoria (race T2), X. perforans (races T3 and T4), and X. gardneri, with the distinct geographical distribution of each group. Currently, X. gardneri and X. perforans are two major bacterial pathogens of tomato in North America, with X. perforans (race T4) dominating in east-coast while X. gardneri dominating in the Midwest. The disease causes up to 66% yield loss. Management of this disease is challenging due to the lack of useful chemical control measures and commercial resistant cultivars. Although major genes for resistance (R) and quantitative resistance have been identified, breeding tomato for resistance to bacterial spot has been impeded by multiple factors including the emergence of new races of the pathogen that overcome the resistance, multigenic control of the resistance, linkage drag, non-additive components of the resistance and a low correlation between seedling assays and field resistance. Transgenic tomato with Bs2 and EFR genes was effective against multiple races of Xanthomonas. However, it has not been commercialized because of public concerns and complex regulatory processes. The genomics-assisted breeding, effectors-based genomics breeding, and genome editing technology could be novel approaches to achieve durable resistance to bacterial spot in tomato. The main goal of this paper is to understand the current status of bacterial spot of tomato including its distribution and pathogen diversity, challenges in disease management, disease resistance sources, resistance genetics and breeding, and future prospectives with novel breeding approaches.Bacterial spot is a serious disease of tomato caused by at least four species of  Solanum lycopersicum L.) is an important vegetable crop in the United States and worldwide. Tomato is also a model crop to study fleshy fruit development and plant-pathogen interactions. Every year, tomato is inflicted with several bacterial, fungal, and viral diseases, including bacterial spot limiting its production. Bacterial spot (BS) disease is one of the major threats to tomato production that affects both fresh-market and processing tomatoes. The disease also occurs in pepper and other crops of the Solanaceae family [The cultivated tomato  are identified so far [X. euvesicatoria, T2 race in X. vesicatoria and in X. gardneri, while T3 and T4 races are reported in X. perforans [avrXv3 and avrXv4 of races T3 and T4 belonging to X. perforans have also been identified and speculated to be race T5 [X. vesicatoria and X. gardneri.Bacterial spot of tomato is caused by at least four species of d so far . The T1 erforans . Mutatio race T5 . HoweverXanthomonas euvesicatoria was the only species, present as race T1, in Florida until 1991 before the X. perforans race T3 strain was reported. Xanthomonas perforans race T4 strain evolved in 1998 [X. perforans race T4 were detected in the samples collected from different sites of Florida, and 94% of the sampled strains were X. perforans race T4 in North Carolina [Xanthomonas perforans race T4 strains have also been reported in Louisiana [Xanthomonas gardneri was found on a contaminated seed lot in 1991 and has since become widespread in the Midwest USA and Ontario Canada [X. gardneri and X. perforans are predominant in Ontario, Canada [Xanthomonas gardneri has been reported from tomato fields in Pennsylvania [ in 1998 ,8, and touisiana . Xanthomo Canada . Both X., Canada . Xanthomsylvania , and wassylvania .R proteins mediate a response to effectors and activate plant defense responses such as effector-triggered immunity (ETI), which is characterized by localized cell death, termed as a hypersensitive response (HR) [AvrBs2, XopD, XopF1, XopK, XopL, XopN, XopQ, XopR, XopX, XopZ1, and XopAD represent the core effectors required during pathogenesis [R genes encoding the nucleotide-binding site-leucine-rich repeat (NB-LRR) proteins, and the role of each NB-LRR in the disease resistance is being studied [R genes against bacterial spot have been identified in tomato, these genes have not been fully utilized in the breeding program either because of a lack of markers or the evolution of new pathogen races.Host resistant nse (HR) . At leas studied . AlthougS. lycopersicum accessions HI 7998 [S. lycopersicum accessions HI 7981 and S. pimpenellifolium accessions PI128216 and PI 126932 [S. pennellii accession LA716 [X. gardneri in S. pimpenellifolium accessions LA2533, LA1936, and PI 128216 [S. lycopersicum var. cerasiformae accession PI 114490  [S. pimpenellifolium accessions PI 126428, PI 340905-S, and PI 155372 to race T3 [S. pimpenellifolium accessions PI 128216 and PI 126932 to race T4 [Both the qualitative resistance and quantitative resistance have been identified in several tomato species in response to bacterial spot disease. The qualitative resistance characterized by HR has been identified to race T1 in  HI 7998 ; to raceI 126932 ,18; to rl races) ,21; S. p race T3 ; and S.  race T4 ,18,20. TRx3 locus on chromosome 5 in multiple studies and is induced by the avrRxv effector of race T1 [Rx3 loci [Rx3 loci. The qualitative resistance to race T2 has not been reported so far. The HR-mediated-resistance in HI 7981, PI 126932, and PI 128216 to race T3 is controlled by a common locus Rx4/Xv3 [avrXv3 [Rx4 locus was fine mapped exactly at the pcc12 marker site and was of NBS-LRR class of resistance gene [RxopJ4 (Xv4) resistant locus [RXopJ4 was mapped to a 190 kb segment on the long arm of chromosome 6 between the markers J350 and J352 [RXopJ4 locus in LA 716 is linked with several negative traits, including autogenous leaf necrosis, low fruit yield, and small fruit size, and RXopJ4 heterozygotes showed slow and weak HR along with inconsistent phenotypes, limiting the utilization of LA716 resistance in the breeding program [Breeding tomato for resistance to BS disease has been challenging due to the evolution of new races of the pathogen limiting the effectiveness of known resistance genes, multigenic control of the resistance, and non-additive gene effects . The gen race T1 ,23,24,25Rx3 loci . HoweverRx3 loci  identifi Rx4/Xv3 ,41 that nt locus ,37. The Solanum lycopersicum var. cerasiformae PI 114490 conferred quantitative resistance to race T2, T3, and T4 [, and T4 . The res, and T4 . In addi, and T4 . These t, and T4 . Hutton,, and T4  identifi, and T4 . S. pimpinellifolium derived breeding lines, including 74L-1W (2008), NC2CELBR, 081\u201312\u20131X-gsms, NC22L-1 (2008), and 52LB-1, in the field and greenhouse studies. Further work is needed to characterize the resistance observed in these lines and to evaluate if the observed resistance in these lines is sufficient to manage the disease before integrating the resistance in the cultivar. Three S. pimpinellifolium accessions PI 128216, LA2533, and LA1936 showed both HR-mediated-resistance in the greenhouse and field resistance to X. gardneri and X. perforans race T3 [X. perforans was observed before the HR to X. gardneri. Another study identified quantitative resistance to X. gardneri in two varieties- IZK Alya (cherry type) and Nikolina F1 (determinate large fruit type) [Bs7 and Bs3, have been reported to confer resistance to X. gardneri avirulence genes avrBs7 and AvrHah1, respectively in pepper, another member of the Solanaceae family [Bhattarai, et al.  reportedit type) . Two gene family ,45.Bs2 targeting the core effector avrBs2 of Xanthomonas strains has been deployed in tomato through the transgenic approach. The Bs2 transgenic tomato conferred resistance to all field strains of Xanthomonas in FL and increased the yield compared to non-transformed lines without any adverse effects in the transgenic tomatoes [Bs2 gene is safe for human consumption because Bs2 protein belongs to one of the largest families of naturally occurring plant proteins (NB-LRR family), which has no known adverse effects on human health and has been widely consumed [Bs2 transgenic tomatoes should be safe as long as they are selectable marker-free.Transgenic resistance is considered a promising tool because it eliminates linkage drag observed in the tomato cultivars developed from backcrossing. The pepper gene tomatoes . Bs2 genconsumed . TherefoavrBs2 effector has been observed in rare Xanthomonas strains that could overcome the resistance conferred by the Bs2 gene in the future [bs5 and bs6 conferred resistance to all races of BS in peppers [bs5 and bs6 genes will enhance the tomato breeding efforts for BS disease resistance and provide targets for future transgenic or gene editing approaches.However, a mutation in e future . This su peppers . Such re peppers . IdentifBs3 and Bs7 genes from pepper into a tomato to achieve resistance against X. gardneri. Moreover, transgenic expression of elongation factor-Tu (EF-Tu) receptor (EFR), a pattern recognition receptor (PRR) from Arabidopsis thaliana also conferred broad-spectrum bacterial resistance, including X. perforans in tomato. However, EFR resistance was less effective compared to that conferred by the combination of Bs2 and EFR genes or Bs2 gene alone [Bs2 gene in combination with other novel resistance genes would provide durable resistance to BS disease in tomato. Although the effectiveness of Bs2 transgenic tomatoes to manage BS disease is successfully demonstrated in multiple field trials, the Bs2 transgenic tomatoes could not be commercialized because of public concerns towards genetically engineered food products.Transgenic approaches could also allow integration of ne alone . TherefoR genes targeting the core effectors of the pathogens. For instance, effector genomics was employed to identify late blight R genes and pathogen recognition receptors in potato [R3a gene in potato against the late blight pathogen [Z. tritici that causes Septoria tritici blotch on wheat was assessed using the HTP-based automated image analysis [Despite several breeding efforts, no commercial tomato cultivars resistant to BS are available yet. This emphasizes the necessity of novel strategies in breeding and biotechnology to achieve durable disease resistance in tomato for BS. In recent years, genomics and effectoromics have opened the pathway to identify n potato ,51. Simipathogen . Additiopathogen , in citrpathogen , and in pathogen . High-thanalysis . In thiswww.solgenomics.net). With the reduction of sequencing costs, there are reports of sequencing individual lines as per their necessity for the development of SNP markers or the identification of genes of interest. Sequencing of tomato genotypes and landraces and exploiting sequence polymorphisms in different tomato genotypes and landraces will shed new light on the genetics and molecular basis of BS resistance in tomato. For example, molecular markers (SNP and InDels) were developed based on whole-genome re-sequencing of two tomato lines (Caimanta and LA0722) and using those markers in a segregating population; eventually, BS disease resistance lines were developed [Tomato whole genome sequence was made available in 2012, which has been a great resource for the study of several traits, including bacterial diseases in tomato . Recentleveloped . Menda eeveloped  have revX. euvesicatoria compared to phenotypic selection.Genomic-assisted breeding approaches (GBA) include marker-assisted selection (MAS), marker-assisted recurrent selection (MARS), marker-assisted backcrossing (MABC), and genomic selection (GS). Most of the genetic studies (QTL mapping) underlying BS disease resistance in tomato were based on the controlled crosses with limited recombinant events. Although association mapping has a higher mapping resolution to dissect the genetic basis of several quantitative traits, including disease resistance, the inbred nature of the species, low level of molecular diversity, and high genomic linkage disequilibrium (LD) have limited association mapping studies in tomato . In receXanthomonas and their matching target R genes in tomato [Xanthomonas, causing BS in tomato. Advancement in the computational tools will facilitate the identification of candidate effectors, while resistance gene enrichment sequencing (RenSeq) will identify multiple NLRs that recognizes core pathogen effectors to achieve the disease resistance [R gene deployment before the pathogen evolution [Effectoromics is a powerful tool to exploit core effectors from diverse groups of n tomato . Core efn tomato . The detsistance . Both covolution .Xanthomonas spp. Although pepper gene Bs2 targeting AvrBs2, a core effector conserved among Xanthomonas species and races infecting tomato, has been deployed in tomato, it could not be utilized widely due to public concerns of transgenic tomatoes [avrBsT, T3SS belonging to XopJ effector family with a role in pathogen fitness under field conditions were detected among X. perforans and some strains of X. euvesicatoria and X. vesicatoria [avrBsT might be a suitable candidate to target X. perforans in the regions where this species is predominant. The breeding approaches targeting evolutionary conserved bacterial effector in combination with resistant gene pyramiding could provide durable resistance against BS disease.Tomato breeding programs should, therefore, aim to identify and utilize tomato NLRs, recognizing the core effectors of tomatoes . Howevericatoria . TherefoRxopJ4 gene as observed in the traditional breeding method, and ii) GE avoids the random gene insertion and any foreign gene insertion in the crop genome unlike in transgenic approach. Unlike GM technology, GE techniques have not been regulated by the United States Department of Agriculture (USDA) and thus avoids regulatory issues. The plant community has three genome editing tools-zinc-finger nucleases (ZFNs), transcription activator-like effectors (TALE) nuclease system (TALEN), and clustered regularly interspaced short palindromic repeats/cas9 (CRISPR/Cas9). The GE has been utilized to improve disease resistance in several crops to many diseases, such as blast and bacterial blight in rice [Bs2, EFR, Bs3, bs5, bs6, and Bs7 from the pepper. This will allow simple inheritance of stacked genes in the breeding program.Genome editing (GE) is a great tool that accelerates the trait improvement in a precise way in a breeding program if the genome sequences of the particular crop are available. The GE allows precise single gene introgression, gene knock out or gene modification to obtain the desired trait in the crops. GE offers two advantages over traditional breeding and transgenic methods in BS resistance breeding in tomato, which are i) GE overcomes the problem of linkage drag associated with the resistance genes such as in  in rice ,72,73,74 in rice . TherefoBs2 and EFR syntenic genes in tomato to make it functional as the Bs2 gene and EFR gene, so that tomato lines with these genes could be commercialized, unlike the transgenic Bs2 tomato lines. In a study, CRISPR/Cas9 was used to inactivate the Sl-DMR6\u20131 gene in tomato, which conferred resistance to multiple important pathogens of tomato, including X. perforans and X. gardneri [Bs2, EFR, and Sl-DMR6\u20131 mutation in tomato cultivars could provide a durable resistance to BS disease. To conclude, the potential of GE in improving BS disease resistance in tomato cannot be neglected. More recently, CRISPR/Cas9 has gained more popularity than other GE systems because of simplicity, efficiency, and low off-target sites . The potgardneri . TherefoAlthough much progress has been achieved in the genomics area, phenotyping is still lagging behind. Precise phenotyping is critical in the case of breeding for complex traits such as disease resistance, and the phenotypic data are the primary data in case of association studies. The inaccurate phenotyping might give false-positive results during QTL analysis and genomics-assisted breeding. The phenotyping of BS disease is usually done visually using a traditional numeric scale, which is subjective and might not be precise and accurate. In recent years, several high throughput phenotyping tools and phenomics platforms have been developed, which allow the collection of accurate and correct phenotypic data for genomics-assisted breeding and the identification of gene function . The res3DHT and Scanalyser FIELD are developed by the company LemnaTec (http://www.lemnatec.com) for the high-throughput phenotyping in the greenhouse and field, respectively. The American company Qubit Systems  developed PlantScreen\u2122 Conveyor Systems and PlantScreen\u2122 Field Systems for greenhouse and field studies, respectively [Xanthomonas in citrus [For the quantification of diseases, images-based methods that rely on the reflectance of waves have been developed, such as analyzing the images in the visible spectrum, hyperspectral images, thermographic images, and chlorophyll fluorescence images . Likewisectively . The iman citrus  and beann citrus .Therefore, plant disease phenomics will not only allow us to collect BS disease data accurately or quantify the variation precisely, but also generate the reproducible data. This allows the accurate dissection of the underlying genetic architecture of BS disease resistance during QTL mapping and association mapping studies. This provides a better understanding of the mechanism of BS disease resistance in tomato and guides tomato breeders accordingly to improve BS disease resistance in tomato.One of the current challenges in the BS disease resistance breeding program is to achieve durable resistance. Despite the continuous efforts to identify and introgression of resistance, it has been challenging to develop a BS disease-resistant cultivar for a long time because of the emergence of new races and species of the pathogen. The negative correlation between fruit quality and disease resistance has made the introgression of resistance even more challenging. In recent years, we have ample opportunities, as explained in the above sections, and can go beyond the classical breeding approaches to obtain broad-spectrum BS disease resistance against multiple species and races of the pathogen. The goal of improving disease resistance to BS disease in tomato can be achieved through the integration of available tomato genome resources, genomics tools, gene or genome editing tool, effectoromics, and plant disease phenomics tools. Employing multidisciplinary approaches seeks not only to improve disease resistance, but also to increase yield and improve fruit quality in tomato."}
+{"text": "Apis nuluensis inhabits only the highlands of Mount Kinabalu of Sabah, Borneo Island. The mitochondrial genome is a circular molecule of approximately 1.6\u2009kb that includes 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and one AT-rich control region. The average AT content was 84.5%. The start codons ATC, ATG, and ATT were found in one, three, and nine genes, respectively, whereas the stop codon TAA was observed in all genes. The phylogenetic relationship, inferred using 13 PCGs, was consistent with that reported in previous studies that predicted a sister taxon relationship between A. nuluensis and A. cerana.The cavity-nesting honeybee  Apis nuluensis . The complete mitochondrial genomes of the honeybees A. cerana (AP018149) were used as reference sequences. The resulting reads were assembled and annotated using the MITOS web server . Similar to the mitochondrial genomes of A. cerana, the heavy (H)-strands encoded nine PCGs and 14 tRNA genes whereas the light (L)-strand encoded four PCGs, eight tRNA genes, and two rRNA genes .The mitochondrial genome of A. nuluensis is more closely related to A. cerana from Borneo than it is to the other honeybees included in the analysis (A. nuluensis and A. cerana (Arias et\u00a0al. A. nuluensis is not a subspecies or a regional population of A. cerana, but a valid species.The phylogenetic analysis suggested that analysis . This re"}
+{"text": "In the course of this pandemic, we enrolled 17 CF patients for a study evaluating inflammatory markers. One of them developed COVID Since the beginning of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic, data registered in the European countries revealed increasing cases of infection in cystic fibrosis (CF) patients with mild clinical manifestations of coronavirus disease 2019 (COVID-19) and usually favorable outcomes . This isCFTR) gene. During her follow-up, she developed chronic lung disease with bronchiectasis complicated by Pseudomonas aeruginosa intermittent respiratory infection. She was under treatment with pancreatic enzyme replacement therapy and multivitamin supplementation and received CFTR modulator therapy with lumacaftor/ivacaftor from July 2019. In March 2020, she was referred to our Emergency Department for persisting cough with purulent expectoration and dyspnea. At hospital admission, she presented good general conditions, apyretic (T 36.8\u00b0C) and tachypneic with oxygen desaturation (SpO2 93%). Physical examination revealed diffuse pulmonary crackles. Chest X-ray showed diffuse interlobular septal thickening with parenchymal infiltrates in the right hilus and the nasopharyngeal swab tested positive for SARS-CoV-2. The patient was hospitalized at the Pediatric COVID-19 Unit of the Pediatrics Clinic of Spedali Civili where she was treated with hydroxychloroquine 200 mg twice a day, according to our internal COVID-19 diagnostic and therapeutic protocol, broad-spectrum antibiotic therapy with cefotaxime, chest physiotherapy with positive expiratory pressure mask, and oxygen supplementation. Two days after the beginning of this therapy, the patient reported an improvement of pulmonary symptoms no longer requiring oxygen supplementation. During the hospitalization, she did not present fever or any other symptoms related to COVID-19. She was discharged after 10 days when two distinct nasopharyngeal swabs tested negative for SARS-CoV-2. After discharge, the patient continued the scheduled follow-up visits at the Cystic Fibrosis Regional Support Center. At the latest visit, she exhibited a FEV1 of 91% without presenting any complications related to the previous SARS-CoV-2 infection.We report on a 14-year-old girl affected by CF with pancreatic insufficiency followed at the Cystic Fibrosis Regional Support Center of the Pediatrics Clinic, University of Brescia, ASST Spedali Civili di Brescia . She was diagnosed in the first days of her life, presenting with meconium ileus requiring surgery and CF newborn screening positive, being homozygous for the c.1521_1523delCTT (p.F508del) CF-causing mutation of the Cystic Fibrosis Transmembrane Conductance Regulator , CXCL8 (IL-8), CXCL9 (MIG), CCL5 (RANTES), and CCL2 (MCP-1) have been analyzed with flow cytometric bead array method, using the Human Chemokine Kit , following the manufacturer's instructions. IL-1\u03b2, IL-2, IL4, IL-5, IL-6, IL-10, TNF-\u03b1, IL-17A, IFN,-\u03b1, and IFN-\u03b3 have been dosed by Flex set custom cytometric bead array technique (Becton Dickinson). Afterward, data have been acquired on BD FACSCanto II flow cytometer and analyzed by FCAP v3 software.Cytokine and chemokine values were compared with the levels measured in 23 children/young adults affected by COVID-19  and with the levels measured in 16 subjects with CF  who were not affected by SARS-CoV-2 infection . These pP. aeruginosa. The other two patients showed infection by methicillin-resistant Staphylococcus aureus (MRSA) and one by Achromobacter denitrificans. All patients at the time of blood collection did not display active lung disease and specific infectious events and were not receiving immunomodulatory treatment or corticosteroids. Three CF subjects were under treatment with lumacaftor/ivacaftor at the time of blood draw.CF patients presented a median age of 18.3 years without ongoing exacerbations at the time of blood samples, which were collected from May 2019 to February 2020. Ten out of 16 CF patients were female, and 14 presented pancreatic insufficiency, including three with type 1 diabetes mellitus. The median value of FEV 1 in the cohort was 83.65%. Six of them presented chronic inflammation due to via facemask. Blood samples for plasma cytokine analysis were collected at the time of hospitalization prior to any treatment.Children with COVID-19 included 23 subjects (average age of 6.7 years). All patients were tested positive for SARS-CoV-2 at nasopharyngeal swab and presented mild or moderate course of COVID-19, without evidence of previous chronic respiratory diseases. All of them showed fever at the onset of symptoms, while only four patients manifested gastrointestinal symptoms. The other four patients reported influenza-like symptoms (rhinitis and cough). Chest X-ray showed interstitial thickening in 14 out of 23 cases, but only two children needed respiratory support: one with high-flow nasal cannula (HFNC) for a few days, and the other one with free-flow oxygen Because the index patient had been enrolled to study NP3087 before the occurrence of the SARS-CoV-2 pandemic, we had the opportunity to compare IL-6, CXCL8, CCL2, CCL5, CXC9, and CXCL10 plasmatic levels with those measured about 1 month before the viral infection. Because there are no standardized reference values for cytokines and chemokines, we analyzed for comparison the levels of cytokines and chemokines measured in 10 healthy control subjects (mean age: 45 years) and reported as median \u00b1 IQR (pg/ml) in +/CD8+ ratio, number of activated T cells, distribution of na\u00efve, central memory, effector memory, and terminally differentiated CD4+ and CD8+ cells (data not shown). This is consistent with reports showing that children with SARS-CoV-2 infection do not display an increase of activation markers of T cell in the same extent observed in adults with COVID-19  on chromosome 7q31  and lymphopenia (<0.8 \u00d7109/L) were associated with an increase in blood concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), lactate dehydrogenase (LDH), serum C-reactive protein (CRP), ferritin, and D-dimer, which are markedly higher in severe cases than in moderate ones  cells and natural killer (NK) cells during the immune response. Therefore, low levels of CXCL9 and CXCL10 in the CF patient affected by COVID-19 suggest that the antiviral response was not associated with Th1 polarization, which has been associated with an unfavorable outcome of COVID-19 in adult subjects .-19 infection. This is surprising considering that in CF, the respiratory tracts are more susceptible to upregulated inflammation, particularly when triggered by new infectious agents  showed no evidence that mutations in CFTR induce a hyperinflammatory response in CF epithelial cells , and minor(s)' legal guardian/next of kin, for the publication of any potentially identifiable images or data included in this article.GB and RB: conceptualization and writing\u2014original draft preparation. GB, MG, DM, MC, FC, IC, RP, PP, ST, and RB: data curation. GB, RP, PP, ST, and RB: writing\u2014review and editing. RB: supervision, project administration, and funding acquisition. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "This paper investigated how second- and third-trimester gestational weight gain relates to perinatal outcomes among normal weight women with twin pregnancies in Fujian, China.nd and 3rdtrimester weekly weight gain rates were calculated, and women were categorized as gaining below, within, or above the 2009 Institute of Medicine (IOM) recommended rates. The association between the trimester-specific weight gain rate and perinatal outcome was determined by traditional regression analysis among groups.A retrospective study examining the medical records of 931 normal weight twin-pregnant women was conducted in Fujian Maternity and Child Health Hospital from 2014 to 2018.The 2nd and 3rd trimesters less than, greater than or within the recommended rates respectively. Multivariate logistic regression analysis showed that weight gain greater than the recommended rate in the 2nd trimester was associated with a decreased risk of preeclampsia . Weight gain less than the recommended rate of weight gain in the 3rd trimester was associated with increased risks of premature delivery, gestational diabetes mellitus , intrahepatic cholestasis syndrome , pre-labour rupture of membrane , average twin birth weight\u2009<\u20092500\u00a0g and neonatal respiratory distress syndrome  and was associated with decreased risks of caesarean section  and preeclampsia . In addition, weight gain greater than the recommended rate of weight gain in the 3rd trimester was associated with increased risks of premature delivery  and gestational hypertension  as well as preeclampsia . The stratified analysis of weight gain in the 3rd trimester showed that there was no significant difference in the incidence of adverse pregnancy outcomes compared to the 2nd trimester weight gain groups.A total of 25.9%, 19.8% and 54.3% of women had rates of weight gain across the 2rd trimester was associated with some adverse maternal and neonatal outcomes, further prospective and multicentre studies are required to explore alternate ranges of gestational weight gain rates in twin pregnancies.While this study showed that a gestational weight gain rate above or below the recommendation in the 3 Compared with singleton pregnancies, twin pregnancies have attracted much attention due to their more complex physiological characteristics and higher incidence of adverse pregnancy outcomes. Numerous studies have been devoted to the study of GWG in twin pregnancies to explore the applicability of the IOM recommendations for twin pregnancies in China, but no consensus has been reached. GWG and adverse events in twin pregnancies are often confounded by the length of gestation. Most studies mainly focus on total weight gain throughout pregnancy, while relatively few studies have been devoted to the relationship between weight gain rates in different trimesters and pregnancy outcomes. It has been clinically observed that GWG is not linear throughout pregnancy, with slower increases in the 1st trimester and a more uniform rate in the 2nd and 3rd trimesters . Due to the sample size limitation, only normal weight pregnant women (BMI 18.5\u201324.9\u00a0kg/m2) were included in this study. Delivery weight was defined as the weight at delivery or the last measured weight within 1\u00a0week before delivery. The IOM guidelines include recommended rates for weight gain in the 2nd and 3rd trimesters per week for singleton pregnancies for underweight, normal- weight,overweight and obese women are 0.44 \u2013 0.58\u00a0kg, 0.35\u20130.50\u00a0kg, 0.23\u20130.33\u00a0kg and 0.17\u20130.27\u00a0kg, respectively, whereas no weekly weight gain rate recommendation have been made for twin pregnancies [nd and 3rd trimesters for singleton pregnancies was consistent with IOM guidelines, so we assumed that it was the same as that for twin pregnancies. When assuming the same weekly rate of weight gain in the 2nd and 3rd trimesters, we estimated the weekly rate of the 2nd and 3rdtrimesters using linear interpolation to calculate the weight at 28\u00a0weeks and 29\u00a0weeks by using the closest weight measured before or after 28\u00a0weeks and 29\u00a0weeks. The rates of total 2nd and 3rd trimester weight gain were calculated according to the following formula: (pregnancy weight at delivery\u2014weight in the 13th week of pregnancy)/(gestation at delivery\u201413\u00a0weeks). The rate of 2nd trimester weight gain was calculated as the difference between the mother\u2019s weight at 28\u00a0weeks and at 13\u00a0weeks divided by the gestational age interval, and the rate of 3rd trimester weight gain in pregnancy was calculated as the difference between the mother\u2019s weight at delivery and at 29\u00a0weeks divided by the gestational age interval. According to the IOM guidelines [st trimester is 3.6\u00a0kg. The 1st trimester was defined as the first 13\u00a0weeks of pregnancy. Referring to the relevant literature [nd and 3rd trimester weekly rates of weight gain according to the IOM guidelines and the actual value for each woman, and accordingly, women were categorized into groups with less than, within and greater than the recommended rate of second\u2212or 3rd trimester weight gain according to the IOM guidelines.Patient data of demographic information and maternal characteristics was extracted from medical records. Data collection process and definitions have been described in detail elsewhere . Pre-prePerinatal outcomes in this study included the following maternal outcomes: gestational hypertension, defined as blood pressure\u2009\u2265\u2009140/90\u00a0mmHg that occurred after 20\u00a0weeks gestation but without proteinuria; preeclampsia, diagnosed upon the development of blood pressure\u2009\u2265\u2009140/90\u00a0mmHg and proteinuria\u2009\u2265\u2009300\u00a0mg/24\u00a0h after 20\u00a0weeks gestation; gestational diabetes mellitus, reported after a 75\u00a0g oral glucose tolerance test (OGTT) at 24\u201328\u00a0weeks gestation when at least one of the abnormal blood glucose levels was observed;pre-labour rupture of membranes, referred to the rupture of membranes prior to labour; intrahepatic cholestasis of pregnancy, a common pregnancy-specific liver disorder associated with elevated bile acids, pruritus, abnormal liver function tests, and an increased incidence of adverse foetal outcomes;postpartum haemorrhage, defined as bleeding of more than 500\u00a0ml 24\u00a0h after vaginal delivery or more than 1000\u00a0ml 24\u00a0h after caesarean delivery; and other pregnancy outcomes including caesarean delivery, premature delivery\u2009<\u200937\u00a0weeks, low birth weight , small for gestational age(SGA), inconsistent birth weight of twins (twin birth weight difference\u2009\u2265\u200920%), and neonatal respiratory distress syndrome. SGA was defined as a birth weight less than the 10th percentile according to twin fetal growth curves\u00a0. NeonataAdditional maternal demographic characteristics and perinatal factors were available, including maternal age and height, level of maternal education, gravidity, nulliparity, chorionicity, and infant sex. Nulliparity was defined as no prior births greater than 20\u00a0weeks of gestation. Chorionic membrane included monochorionic and dichorionic membranes.nd and 3rdtrimester weekly rates of GWG: less than, within and greater than the IOM guidelines. Continuous variables are described as the mean\u2009\u00b1\u2009standard deviation (SD) and were compared with analysis of variance (ANOVA) or the Kruskal\u2013Wallis test. Categorical variables are described as frequencies and were compared with a chi-square test or Fisher\u2019s exact test. We performed multiple comparisons (Scheffe method) to assess the differences between each of the groups if the results of ANOVA or chi-squared analysis were statistically significant. Logistic regression analysis was applied to estimate the independent effect of the 2nd or 3rd trimester weekly rate of GWG on perinatal outcomes. Adjusted odds ratios (OR) and 95% confidence intervals(95%CI) were used to report the effect estimates. The multivariable analysis was adjusted for maternal age, gestational age, infant sex, pre-pregnancy BMI, nulliparity, education level, and average infant weight.However, the average infant weight gain was not adjusted for in the weight related outcomes ie average birth weight,SGA and weight discordance\u2009\u2265\u200920% in multivariable analysis. All the effect estimates were presented graphically as forest plots. P\u2009<\u20090.05 was considered a statistically significant difference. Statistical analysis was performed using STATA15.0.Baseline characteristics were compared across groups of 2n\u2009=\u200914), chronic hypertension (n\u2009=\u20095), gestational age under 20\u00a0weeks (n\u2009=\u200920),multiple gestations (n\u2009=\u20096), stillbirth of one twin (n\u2009=\u200931), and missing records of gestational age, pre-pregnancy weight or height, or delivery weight (n\u2009=\u2009190). There were 931 pregnant women and 1862 infants included . There were no significant differences among the three groups in the proportions of nulliparity, monochorionic membrane or infant sex. The gestational age and average birth weight of the infants were significantly different between any two groups(P\u2009<\u20090.001). Women who were excluded from this study due to missing information had similar baseline characteristics as those included (data not shown).The majority of twin-pregnant women in this study had 2nd trimester, respectively. After controlling for potential confounders in multivariable logistic regression models, weight gain greater than the recommended 2nd trimester rates of weight gain was associated with a decreased risk of preeclampsia . However, after adjusting for maternal age, gestational age, infant sex, pre-pregnancy BMI, nulliparity, education level and average infant weight, we did not find evidence of an interaction between rates of weight gain less than the recommended 2nd trimester rates and maternal and neonatal outcomes  than pregnant women who gained weight at rates within the recommendations. They also had higher odds of intrahepatic cholestasis syndrome  and pre-labour rupture of membranes  and decreased odds of caesarean section  and preeclampsia . For neonatal outcomes, we found increased odds for premature delivery , and average twin birth weight\u2009<\u20092500\u00a0g as well as neonatal respiratory distress syndrome .In the 3rdtrimester compared to those who gained weight within the guidelines , premature delivery  and preeclampsia  were significantly different and higher than those among women who gained weight at rates within the recommendations. Other perinatal outcomes did not differ in women who gained weight at rates greater than the guidelines in the 3rd trimester (referred to as \u201cT3L\u201d), of whom in the 2ndtrimester, 53 pregnant women gained weight at rates greater than the recommendations (referred to as \u201cT2H\u201d),156 pregnant women gained weight at rates within recommendations (referred to as \u201cT2N\u201d), and 100 pregnant women gained weight at rates less than the recommendations (referred to as \u201cT2L\u201d). The results showed no statistically significant difference in the incidence of perinatal outcomes between the three groups (P\u2009>\u20090.05). Similarly, of 269 pregnant women who gained weight at rates greater than the recommendations in the 3rdtrimester (referred to as \u201cT3H\u201d), the incidence of pregnancy outcomes were computed based on the classification of weight gain rates in the 2nd trimester, but no statistically significant difference was found among the three groups  (Table To evaluate the adverse pregnancy outcomes related to weight gain during second trimester in women with weight gain above or below IOM recommendations in third trimester, we stratified 309 pregnant women who gained weight at rates less than the recommendations in the 3nd and 3rdtrimesters and perinatal outcomes among Chinese twin gestations. The 2009 IOM recommended an appropriate weight gain rate for singleton pregnancies in the 2nd and 3rdtrimesters of pregnancy, but there was no clear recommendation for twin pregnancies, so our study was of some value for the recommendation of weight gain rates for twin pregnancies in the 2nd and 3rdtrimesters of pregnancy.It has been reported that the incidence of twin pregnancies has been increasing worldwide with the changing concept of fertility and the development and popularization of assisted reproductive technology. The fact that twin pregnancies are more complex physiological processes than singleton pregnancies , couplednd and 3rd trimester weight gain. We found that a weight gain rate greater than the recommendations in the 2nd trimester was associated with a decreased risk of preeclampsia, while the weight gain rate in the 3rd trimester directly affected the incidence of adverse pregnancy outcomes. On the one hand, a weight gain rate in the 3rd trimester below the recommendations was associated with significant increases in gestational diabetes mellitus, intrahepatic cholestasis syndrome, pre-labour rupture of membranes, average twin birth weight\u2009<\u20092500\u00a0g, neonatal respiratory distress syndrome and a lower rate of caesarean section and preeclampsia. On the other hand, a weight gain rate in the 3rd trimester greater than the recommendations was associated with a higher rate of gestational hypertension and premature delivery and preeclampsia. Previous studies have demonstrated that inadequate weight gain during pregnancy was a risk factor for preterm birth, and our results suggested that a low or high weight gain rate in the 3rd trimester was related to an increased risk of preterm birth. The results of the study by Carnero A M et al. [rd trimester was associated with an increased incidence of gestational diabetes mellitus, which may be contrary to clinical findings. The conflicting results could be due to medical nutritional therapy guidance and intervention by obstetricians based on their experience in managing the nutritional status of pregnant women who were gaining too much weight or who had been diagnosed with gestational diabetes mellitus. These pregnant women adhered to a strict diet and increased their exercise habits, ultimately resulting in a low weight gain rate in the 3rd trimester or even weight gain rates below the guideline recommended range. Conversely, women who were not diagnosed with gestational diabetes mellitus may be less likely to follow a diet or exercise programme, which could lead to more weight gain. This result was similar to the findings of domestic and foreign academics who noted decreased odds of gestational diabetes mellitus in women with excessive rates of weight gain and increased odds of gestational diabetes mellitus in women with suboptimal rates of weight gain in the 2nd trimester and 3rd trimester, due to the nutritional counselling and dietary adjustments that occur after such a diagnosis and the consequent effect on gestational weight gain [st trimester was related to an increased risk of gestational diabetes mellitus, regardless of pre-pregnancy weight [st trimester, which may lead to an inconsistency between our findings and those of some studies [st trimester of pregnancy.In this retrospective study, the findings showed that maternal and neonatal outcomes were affected by the rate of 2M et al.  and ShamM et al.  also shoM et al. . This fight gain , 19. In y weight . We did  studies .These inrd trimester was below the recommendations. We considered that neonatal respiratory distress syndrome may be a secondary association with preterm birth. There are few studies on the symptoms of intrahepatic cholestasis and gestational weight gain, and our results suggested a statistical association; however, the causal association may need to be fully understood, as it has been shown that intrahepatic cholestasis leads to a loss of appetite and nausea, which may have an impact on gestational weight gain, implying that cholestasis may be the cause of lower rates of weight gain rather than lower rates of GWG being the cause of cholestasis. Further studies should be conducted with detailed data on GWG and the timing of signs or symptoms to understand the cause and consequence [In this study, we found a higher incidence of neonatal respiratory distress syndrome, average twin birth weight\u2009<\u20092500\u00a0g and intrahepatic cholestasis syndrome in pregnant women whose weight gain rate in the 3sequence .nd trimester and higher odds of gestational hypertension and preeclampsia in the 3rd trimester. Luke B\u2019s research showed no difference in the weight gain rate in the first half of pregnancy between pregnant women diagnosed with preeclampsia and those without preeclampsia in the second half of pregnancy [For gestational hypertensive disorders, our findings showed that a weight gain rate greater than the recommendation was associated with lower odds of preeclampsia in the 2regnancy . The rearegnancy , 24, 25;regnancy , 27.nd trimester [nd trimester had little effect on perinatal outcomes and no statistically significant difference was found on perinatal outcomes when stratifying 3rd trimester weekly weight gain less than or greater than the IOM recommendations by weekly weight gain greater than, within or less than IOM recommendations in the 2nd trimester. The finding may be explained as follows: first, by the difference in study population\u00a0as we included women with a normal pre-pregnancy body mass index due to sample size limitations; second, our use of an assumed average weight gain in the 1st trimester may have resulted in misclassification of exposure, biasing associations toward the null; and third, by other differences that may have been due to the more complex physiological changes that occur in twin pregnancy, which cannot be explained reasonably at present, as further exploration is needed to clarify the mechanisms of physiological changes in twin pregnancy. Even so, physicians should be encouraged to address weight gain throughout the pregnancy and intervene in cases where weight gain falls outside of recommendations.Maternal weight gain in the second half of pregnancy was mainly associated with an increase in foetal weight and placental factors and an increase in maternal body weight and was most closely related to the growth and development of the foetus, especially in the 2rimester . In thisThere were some limitations in this study. First, it was a retrospective study, and it was impossible to consider all potential confounding variables, such as the use of assisted reproductive technology, race/ethnicity of pregnant women, and tobacco use, which may lead to confounding bias. The study data were drawn from data of women with twin pregnancies receiving perinatal care at one hospital, possibly leading to poor representation of the general population. Second, the limited sample size led to limitations in analysing underweight, overweight, and obese women, and the small sample size might result instatistically significant differences in demographic characteristics. Additionally, as the weight gain in twin pregnancies was not linear , we wereFuture prospective and multicentre studies are warranted. All pregnant women received similar prenatal care and monitoring, which reduces the possibility of sampling bias and contributes to the generalizability of the results, thus clarifying the trajectory of weight gain in twin pregnancies and making the findings more clinically useful.nd and 3rd trimester gestational weight gain were associated with adverse pregnancy outcomes in normal weight women, especially in the 3rd trimester. Our findings are useful to help obstetricians understand the key periods of maternal weight gain and provide clinical recommendations to anticipate perinatal outcomes of twin pregnancies. Further prospective and multicentre studies are required to explore alternate ranges of GWG rates in twin pregnancies to reduce adverse perinatal outcomes.In summary, suboptimal and excessive rates of 2"}
+{"text": "In this study a DES formulation is compared for the first time directly to other established enabling formulations. The in vitro drug release study demonstrated that the DES formulation and the amorphous form both were able to induce an apparent supersaturation followed by subsequent drug precipitation. To mitigate the risk of precipitation, HPMC was predissolved in the dissolution medium, which successfully reduced the degree of precipitation. In line with the results from the release study, an in vitro permeation study showed superior permeation of the drug from the DES formulation and from the amorphous form compared to the nanocrystalline formulation. However, the promising in vitro findings could not be directly translated into an increased in vivo performance in rats compared to the nanocrystalline formulation. Whilst the DES formulation (34\u00a0\u00b1\u00a04%) showed a higher oral bioavailability compared to amorphous aprepitant (20\u00a0\u00b1\u00a04%), it was on par with the oral bioavailability obtained from the nanocrystalline formulation (36\u00a0\u00b1\u00a02%).A deep eutectic solvent (DES) is a eutectic system consisting of hydrogen bond donor and acceptor has been suggested as a promising formulation strategy for poorly soluble drugs. A DES consisting of choline chloride and levulinic acid in a 1:2\u00a0 molar ratio was used to formulate a liquid solution of the model drug aprepitant. This formulation was tested   However, for a detailed a review on the complex nature of DESs, the interested reader is referred to A deep eutectic solvent (DES) is a combination of two or more components consisting of a hydrogen bond donor and acceptor. The two DES-components interact through a hydrogen bond, which causes a large melting point depression . DESs haA supersaturating drug delivery system is a drug formulation that upon oral administration generates an apparent drug supersaturation in the gastro-intestinal tract, potentially resulting in an increased flux across the gastro-intestinal barrier. Besides DESs, more established supersaturating drug delivery systems are amorphous solid dispersions or lipid based drug delivery systems . GeneralWe have previously found that aprepitant has a higher solubility in a DES containing choline chloride, lactic acid, and water compared with three conventional pharmaceutical solvents  . Aprepitin vitro release, permeability and in vivo performance against two alternative enabling formulation approaches, namely the amorphous form and the marketed nanocrystalline formulations. In particular, the release and precipitation behavior of a DES formulation and the amorphous form are investigated with or without the presence of the precipitation inhibitor, HPMC. Furthermore, the in vitro permeability of aprepitant released from the DES formulation and the amorphous form is measured using a high throughput permeation platform that previously has shown to be able to distinguish formulations of poorly soluble drugs according to bioavailability , levulinic acid and choline chloride . PermeaPlain Plate was kindly donated as a gift from InnoME GmbH . EMEND\u00ae 80\u00a0mg capsules were purchased from a local distributor and the beads gently mortared before use.Aprepitant was kindly donated by Merck Sharpe & Dohme . All other chemicals were purchased from the respective vendors: hydroxypropyl methylcellulose  , FaSSIF V.1 powder  under magnetic stirring on a hotplate until a clear solution was formed. For the 2.2.2A volume of 2\u00a0mL neat DES was magnetically stirred with an excess amount of aprepitant for 24\u00a0h at room temperature. Separation of solution and excess solid aprepitant was performed by 2\u271530\u00a0min centrifugation of 1000\u00a0\u03bcL at 12,400 x G followed by centrifugation of 500\u00a0\u03bcL of the supernatant from the first centrifugation step at 12,400 x G. A quantity of the supernatant from the second centrifugation step was diluted in acetonitrile and quantified by HPLC. The solubility was determined in triplicates.2.2.3The concentration of aprepitant in DES (3.5\u00a0mg/g) was quantified at the time of preparation and at week 1 and 2 after preparation and storage in a closed vial at 40\u00a0\u00b0C. The chemical stability was determined in triplicate and the recovered concentration was statistically evaluated using a one-way ANOVA test in GraphPad Prism version 8.4.2 . The recovery was performed in triplicates.2.2.4Aprepitant has previously been reported to be a good glass former belonging to the GFA class 3R . In the 2.2.5w/v% predissolved HPMC. The dissolution medium was magnetically stirred by a cross magnet at 100\u00a0rpm while the temperature was maintained at 37\u00a0\u00b0C using the experimental setup from the \u03bcDISS Profiler\u2122 . Samples (1\u00a0mL) were withdrawn and replaced after 5, 10, 15, 20, 30 and 60\u00a0min. The samples were centrifuged at 12,400 x G for 1\u00a0min. Subsequently, 200\u00a0\u03bcL of the supernatant was then diluted 1:4 (v/v) with acetonitrile to precipitate the phospholipids and centrifuged for an additional 1\u00a0min before 500\u00a0\u03bcL of the supernatant was collected for quantification. The accumulated amount of released aprepitant was calculated considering the volume of replaced dissolution medium. All drug release experiments were performed in triplicate.The drug formulations were weighed into cylindrical glass vials before 20\u00a0mL of FaSSIF dissolution medium was added with or without 0.05\u00a02.2.6via Cambridge Structural Database and XRPD patterns were calculated using the Mercury software version 4.1.3 from Cambridge Structural Database, CSD , CSD references GOPDUK01 (form I) and GOPDUK02 (form II) (After 60\u00a0min of drug release from the DES formulations (4\u00a0mg dose) and the amorphous form (3 and 40\u00a0mg dose), the undissolved drug and/or precipitates were collected by centrifugation 4696 x G for 5\u00a0min of the dissolution medium. The pellets were collected and analyzed by XRPD using a PANalytical X'Pert PRO X-ray diffractometer equipped with a PIXcel detector  using Cu K\u03b1 radiation (1.54187\u00a0\u00c5), at 45\u00a0kV and 40\u00a0mA. The pellets were analyzed from 5 to 30\u00b02\u03b8/using a step size of 0.02626\u00b02\u03b8 with a speed of 0.06734\u00b02\u03b8/s. The data were collected using X'Pert Data Collector and analyzed using X'Pert HighScore . The reference diffraction patterns for crystalline aprepitant form I and II were accessed form II) . The pel2.2.7w/v% predissolved HPMC was added. The formulations were tested by dispersing a quantity of the formulations corresponding to 150\u00a0\u03bcg/mL aprepitant in the donor media right before the experiments started. The nanocrystalline formulation was only tested in FaSSIF. In the acceptor plate, 120\u00a0\u03bcL 2\u00a0w/v% D-\u03b1-Tocopherol polyethylene glycol 1000 succinate solution was added to maintain sink conditions in the acceptor compartment throughout the experiment. The plate was incubated in a Thermo-shaker PHMP-4  at 37\u00a0\u00b0C and shaken at 300\u00a0rpm. At each sampling time, 80\u00a0\u03bcL was withdrawn from acceptor wells and directly quantified by HPLC, with no acceptor wells reused for more time points. The experiments were performed as quadruplicate (n\u00a0=\u00a04). Before the experiments, adhesion of aprepitant to the well plates was tested. The statistical differences between the formulations were evaluated using a two-way-ANOVA test in GraphPad Prism version 8.4.2 .The PermeaPlain Plate from InnoMe  was used to study the drug release/permeation interplay from different formulations of aprepitant. The 96-well plate setup consisted of an acceptor plate with a permeable cellulose-based membrane in the bottom placed on top of a donor plate and sealed with adhesive sealing foil . In the donor compartment, 300\u00a0\u03bcL of FaSSIF with or without 0.05\u00a02.2.8v/v% acetonitrile and 45\u00a0v/v% 25\u00a0mM ammonium acetate. For the permeation study, aprepitant was quantified by a Waters 2695 HPLC system with a Waters 2487 DAD detector. All samples were injected on the column described above and with the same injection volume. The mobile phase composition was changed to 45\u00a0v/v % acetonitrile and 55\u00a0v/v % 25\u00a0mM ammonium acetate in order to separate the aprepitant peak from additional peaks originating from the glue used to attach the membrane to the acceptor plate of the PermeaPlain Plate. The method was validated using recovery test and sensitivity analysis for pH and mobile phase composition. Standard solutions were analyzed before and after the analysis of samples. A single standard was also analyzed every hour to confirm the validity of the results.Aprepitant was quantified by high performance liquid chromatography (HPLC). In the drug release and stability experiments, aprepitant was quantified by an Agilent 1260 infinity LC system with an Aglient 1290 infinity pump and DAD detector from Agilent Technologies . All samples were injected on a Kinetex\u00ae, 5\u00a0\u03bcm EVO C18, 100\u00a0\u00d7\u00a04.6\u00a0mm column from Phenomenex . A flow rate of 1\u00a0mL/min was applied with a mobile phase consisting of 55\u00a02.2.9In vivo studies were performed with 23 Sprague Dawley male rats with an average weight of 325\u00a0g at the time of the experiments. The rats were brought to the animal facility 5\u00a0days before the experiments to ensure a proper acclimatization. The animal health and welfare were monitored and recorded before and during the experiments. The animals were allowed access to food and water ad libitum during the acclimatization and experiments. The pharmacokinetic study was designed with five arms as seen in.w/v% HPMC solution with a dosing volume of 5\u00a0mL/kg bw. An additional two groups of five animals each were given a 2.4\u00a0mg/kg bw dose of aprepitant dissolved in DES (5.0\u00a0mg/g) with or without 10\u00a0wt% of HPMC. The two DES formulations (with or without HPMC) were administered by oral gavage without any dilution. The oral dose of the DES formulation was based on the maximum tolerated single dose of levulinic acid in rats  approved by the Danish Animal Experiments Inspectorate, The Danish Veterinary and Food Administration, Ministry of Environment and Food. in rats  and the 2.2.103EDTA in 0.5\u00a0mL Sarstedt tubes. Prior to centrifugation, the samples were stored on ice for a maximum of 20\u00a0min. Samples were centrifuged for 10\u00a0min at 1270 x G at 4\u00a0\u00b0C, and the plasma was kept below \u221270\u00a0\u00b0C until further analysis. The plasma samples were analyzed against imipramine as an internal standard on a Thermo Vanquish UPLC system connected to a Thermo TSQ Altis. Mobile phase A comprised MilliQ water with 0.1% formic acid and mobile phase B comprised acetonitrile with 0.1% formic acid. A gradient with 95% at 0\u00a0min, 5% at 0.9\u00a0min and, 0% of mobile phase A at 1.35\u00a0min, was applied with a flow rate of 0.8\u00a0mL/min. The samples were injected on a Phenomenex Kinetex Biphenyl C18 100A, 2.6\u00a0\u03bcm, 2.1\u00a0\u00d7\u00a0500\u00a0mm column held at 65\u00a0\u00b0C. The mass spectrometer was used with positive electrospray ionization. The MS source used 3500\u00a0V for positive ion spray with a vaporizer temperature of 350\u00a0\u00b0C and 380\u00a0\u00b0C for the ion transfer type. The sheath gas and aux gas were 60 and 15 Arb, respectively. The fragmentation transitions for multiple reaction monitoring were m/z 535.15\u00a0\u2192\u00a0179.17 and 277.13 for aprepitant and m/z 218.15\u00a0\u2192\u00a086.13, 58.07, and 193.13 for imipramine.Blood samples of 200\u00a0\u03bcL were collected and stabilized by K2.2.11Tmax value for the DES formulations. Therefore, only the bioavailability during the first 8\u00a0h after administration was calculated. The concentration at 0\u00a0min for the intravenous dose was calculated by extrapolation of the elimination phase. The bioavailability is presented with the standard error of the mean. The statistical significance was tested using a one-way ANOVA test with a 0.05 level of significance.The bioavailabilities were calculated using the trapezoid method. The elimination phase could not be properly determined due to the limited sampling time points and the uncertainty of the exact 3The solubility of aprepitant in the DES was determined at 6.78\u00a0\u00b1\u00a00.03\u00a0mg/g, which is 321-fold higher than in FaSSIF and 1057-fold higher than in water . The che3.1in vitro drug release was investigated for both the DES formulations and amorphous aprepitant. It was not possible to measure the drug release from the marketed nanocrystalline formulation due to incomplete separation of the nanocrystals after filtration with either a 0.1\u00a0\u03bcm pore size-filter or centrifugation.The w/v% HPMC, the precipitation onset was delayed and its extent decreased for the 4\u00a0mg dose and precipitation was prevented for the 3\u00a0mg dose  which exceeded the equilibrium solubility of aprepitant. However, precipitation was not observed , also the 3\u00a0mg amorphous aprepitant dose obtained similar concentrations as seen from the fast precipitating DES formulation (3\u00a0mg dose). Thus, the overall best performing drug dose was 3\u00a0mg for both the amorphous form and the DES formulation. For this dose, the highest drug release percentages and no precipitation were observed for both the amorphous form and DES formulation. Therefore, the 3\u00a0mg dose was further used in the max was dependent on the dose, because the higher dose largely increases the dissolution rate and thus the degree of apparent supersaturation before recrystallization. A similar dissolution behavior of amorphous drugs has previously been reported  the absorbed amount of aprepitant was lower than for the other formulations after 4\u00a0h. The absorption kinetics of the nanocrystalline formulation were faster than for the other formulations. Consequently, the Tmax for the nanocrystalline formulation at 6\u00a0h was reached earlier than for the two DES formulations. The Tmaxs for the DES formulations could not properly be determined because the maximum plasma concentration was measured at 8\u00a0h with the next sampling point at 24\u00a0h.The absorption kinetics were slowest from amorphous aprepitant, and at Tmax for the DES formulations occurs >8\u00a0h. The slower absorption kinetics for the DES formulations compared with the nanocrystalline formulation suggests that the diffusion of dissolved aprepitant from the intestinal lumen to the intestinal barrier was more restricted than for the nanoparticles. Precipitation of aprepitant is another possibility that can explain the slower absorption kinetics. This hypothesis cannot be confirmed without aspiration of gastro-intestinal fluid after administration  of aprepitant from the nanocrystalline formulation was significantly higher than for the amorphous aprepitant and on par with the DES formulation without HPMC. This suggests that the in vivo absorption mechanism of aprepitant from the nanocrystalline formulation is different than from the amorphous and DES formulations. A previous study of the absorption mechanism of aprepitant has suggested that the nanocrystals are able to reduce the resistance of the aqueous boundary layer next to the intestinal barrier  and nanocrystalline formulation (36\u00a0\u00b1\u00a03%). The bioavailability of amorphous aprepitant was significantly lower (20\u00a0\u00b1\u00a04%). Consequently, while DES based formulations proved to be a promising enabling formulation strategy in vitro, more insight into their in vivo performance is necessary to potentially allow to translate the findings into better formulations and thereby, benefit from their good in vitro behavior also in vivo.This study investigated the The authors have no conflict of interest to declare."}
+{"text": "Lactobacillus buchneri M B/00077 strain to degrade xylan, its impact on the quality of silage made from the lignocellulosic biomass of Spartina pectinata L., as well as the efficiency of biogas production. In the model in vitro conditions the L. buchneri M B/00077 strain was able to grow in a medium using xylan as the sole source of carbon, and xylanolytic activity was detected in the post-culture medium. In the L. buchneri M B/00077 genome, genes encoding endo-1,4-xylanase and \u03b2-xylosidase were identified. The silages prepared using L. buchneri M B/00077 were characterized by a higher concentration of acetic and propionic acids compared to the controls or the silages prepared with the addition of commercial xylanase. The addition of bacteria increased the efficiency of biogas production. From the silages treated with L. buchneri M B/00077, 10% and 20% more biogas was obtained than from the controls and the silages treated with commercial xylanase, respectively. The results of the current study indicated the strain L. buchneri M B/00077 as being a promising candidate for further application in the field of pretreatment of lignocellulosic biomass.The aim of the current study was to determine the ability of the  Spartina pectinata L., as well as various agricultural residues and other herbaceous plants, could become an important feedstock for the production of biofuels1. Lignocellulose biomass is a commonly available and renewable energy source, and 55\u201375% of it consists of polymers  by dry weight and can be used for ethanol, as well as for biogas production during the anaerobic digestion (AD) process2. However, the main drawback of the lignocellulosic biomass is its structural heterogeneity and complexity causing the native biomass resistance to enzymatic hydrolysis creating thereby an obstacle for the AD process and finally, limiting biogas production. Hemicelluloses, especially xylan, if coated with crystalline cellulose restricts access to the cellulose microfibrils, making them water insoluble and recalcitrant to biodegradation3. Moreover, a high content of barely degradable fibre fractions in biomass intended for the production of gaseous biofuels limits the yield of methane produced4.Lignocellulose biomass such as perennial grasses, including species characterized by a C4 photosynthetic pathway e.g. 9. The efficient conversion of hemicelluloses, being an important class of plant cell wall polysaccharides, demands the common action of various enzymes because hemicelluloses, unlike cellulose, are not chemically homogenous6. Among the hemicelluloses, endo-1,4-xylanase and \u03b2-xylosidase play a major role in the depolymerization of xylan, the most abundant component of hemicellulose constituting approx. 20\u201330% of the herbaceous plant\u2019s biomass10. The removal of xylan, except for facilitating the hydrolysis of cellulose; xylo-oligomers can also facilitate a decrease in enzyme inhibition and this leads to fewer inhibitors in the fermentation process11. The use of enzymes on an industrial scale is however, largely limited due to their high cost and limited availability13. Therefore, in recent years methods of hemicellulose bioconversion using microorganisms have been developed, because hemicelluloses, especially xylan, have many practical applications in various agro-industrial processes, including the production of lactic acid or biofuels12.Many earlier studies have dealt with pre-treatment of lignocellulosic biomass to increase hydrolysis of cell wall structures. For this purpose, numerous physical, chemical and biological approaches have been proposed16. However, microorganisms having xylanolytic activity are also found among various bacteria3. For instance Zerva et al.17 isolated waste xylanolytic microbial strains from orange-juice processing, among which Pseudomonas psychrotolerans and P. oryzihabitans showed the highest extracellular endo-1,4-\u03b2-xylanase activity with 280\u00a0U/mg protein. In a study by Guo et al.2, the strain Pseudomonas boreopolis G22 was used for pretreatment of wheat straw. This strain secreted abundant amounts of xylanase with an activity of 2.67\u20131.75\u00a0U/ml. Rumen microorganisms are considered to be unique source of enzymes with huge potential in the pretreatment of lignocellulosic biomass. But the application of rumen microorganisms in biorefinery technologies is limited due to the fact that many rumen microorganisms are difficult to culture and require unique growing conditions18. In this context, the use of lactic acid bacteria, a well-known group of microorganisms having wide application in the agro-food industry, has been found as a promising strategy. Lactic acid bacteria are commonly used in the biological pretreatment of biomass before producing biofuels1. Ensiling, as the traditional method used for preserving biomass, has a reported impact on cellulose conversion through enzymatic hydrolysis, which had led to improved saccharification for the production of bioethanol20. Many studies have showed that the ensiling process has a positive impact on enhancing the production of biogas22. A huge advantage of lactic acid bacteria is their diverse metabolic capacity which enables them to adapt to various environmental conditions23. It has been proved that LAB living in a plant environment utilize substrates derived from plant cell walls due to expressing enzymes involved in e.g. the breakdown of hemicellulose24. Nserko et al.25 reported L. buchneri strains capable of partial decomposition of arabinoxylans by releasing ferulic acid from arabinose side-chains owing to ferulic acid esterase activity. An impact of silage additives on biogas production from silages prepared using various types of biomasses was reported by Herrmann et al.26 and Zhao et al.27. Zhao et al.22 used the Lactobacillus brevis species and the xylanase enzyme for ensiling switchgrass. The additives promoted the decomposition of the cellulose and hemicellulose, as a results of which more organic acids were accumulated in the ensiled biomass leading to the rapid production of methane. However, it has been reported that Lactobacillus brevis is unable to degrade xylan since no xylanase gene is present in its genome28. Another study revealed that an obligate heterofermentative species\u2014Lactobacillus buchneri CD034\u2014which is closely related to L. brevis, has the ability to degrade xylan owing to several genes encoding endo-1,4-\u03b2-xylanase, \u03b2-xylosidase, and \u03b1-l-arabinofuranosidase24. The species Lactobacillus buchneri is the desired silage additive due to its specific properties: the ability to transform lactic acid into acetic acid and 1,2-propanediol. Acetic acid can inhibit the growth of moulds and yeasts and 1,2 propanediol can be further metabolized into 1-propanol and propionic acid, the latter of which also has antifungal properties that can also improve the aerobic stability of silages29. It has been demonstrated by Filya30 that the studied strain of L. buchneri used for ensiling biomass improved the aerobic stability of the silages obtained after their exposure to air. Heinl et al.24 claimed that L. buchneri CD034 has a unique ability to adapt to complex plant polymers derived from plant cell walls owing to the expressing enzymes involved in the degradation of arabinan, xylan, and glucan.The biological pretreatment of lignocellulose biomass using microorganisms has been mostly associated with the action of fungi owing to their enzymatic capabilitiesLactobacillus buchneri M B/00077 strain to degrade xylan during fermentation of lignocellulosic biomass of cordgrass (Spartina pectinata L.), its impact on overall silage quality as well as on the specific methane yield and biogas production. For this purpose, the metabolic capability of Lactobacillus buchneri M B/00077 was investigated in model in vitro conditions, and the activity of xylanolytic extracellular enzymes released by the bacteria into the medium was evaluated. Additionally, to assess the effect of used Lactobacillus buchneri M B/00077 on the hemicellulose content and biogas yield comparative tests with a commercial enzyme (xylanase) were carried out.Taking into account the abovementioned consideration, the objective of the current work was to investigate the ability of a new Lactobacillus buchneri M B/00077 to ferment different sugars was investigated in model in vitro conditions. The strain tested showed an ability to grow in medium with xylan as the sole carbon source  was detected after 24\u00a0h of bacteria incubation, which was probably related to the activity of bacteria in the batch experiment. The decomposition of xylan and releasing of mono sugars resulted in an increase in the viscosity of the culture liquid. The highest increase in viscosity was detected during the first 24\u00a0h of bacteria incubation Fig.\u00a0.Figure 1Lactobacillus buchneri CD034 strain isolated from stable grass silage was studied by Heinl et al.24. Based on this research, the presence of genes encoding enzymes: endo-1,4-xylanase (EC 3.2.1.8.) and \u03b2-xylosidase (EC 3.2.1.37), was determined. The products of PCR reaction in agarose gel are given in Supplementary Figure\u00a0The whole genome of the Lactobacillus buchneri NRRL B-30929 strain deposited in GenBank under accession number CP002652.1 with 100% query coverage for the endo-xylanase sequence, 99.68% for the xylosidase sequence, 99.88% for the endo-xylanase sequence, and 99.68% for the xylosidase sequence. The second most similar sequence was from the Lactobacillus buchneri CD034 strain deposited in GenBank under accession number CP003043 with 100% query coverage for both sequences, 94.44% identity for the endo-xylanase sequence and 96.96% for the xylosidase sequence. All these results showed 0.0 expect value.Two PCR products were obtained: a fragment of approximately 850\u00a0bp was obtained with xylanase primers and 650\u00a0pb with xylosidase primers. The DNA sequences obtained were examined using the Basic Local Alignment Search Tool (BLAST). The sequence producing the most significant alignments, for both query sequences, was from the Lactobacillus buchneri M B/00077 strain added to biomass on the chemical composition during ensiling was verified. The impact of the method used for preparing silages (with or without silage additives) on the composition of Spartina biomass is presented in Tables The impact of the L. buchneri M B/00077 was 32.0% DM, whereas in the control silages 34.8% DM. It can be noticed that the effect of commercial xylanase and LAB on the hemicellulose content was comparable. The highest content of water soluble carbohydrates (WSC) was determined in the silages prepared with the addition of enzymes. The WSC concentration in the control and silages prepared using L. buchneri M B/00077 was at the same level . The hemicellulose content in the silages prepared with Ensiling had an impact on the organoleptic properties of the silages obtained Table . SilagesL. buchneri M B/00077. However, the LAB inoculated silages characterized the highest concentration of acetic acid that was almost three times higher than in the other silages. Propionic acid was detected only in the silages prepared with the addition of LAB. Silages prepared with L. buchneri M B/00077 were characterized not only by the highest concentration of acetic acid but also the highest efficiency in the production of biogas  to xylulose, which is further phosphorylated to xylulose-5-phosphate (X5P) by xylulokinase (XylB). Through the phosphoketolase pathway (PK pathway), X5P is finally converted into lactic acid and acetic acid33. The conversion of pentose results in lactate and acetate, with no CO2 production32. Acetic acid is a relatively weak acid, therefore its concentration has no impact on the pH of medium34. Therefore, in this study the biodegradation of xylan using the heterofermentative Lactobacillus buchneri M B/00077 strain did not cause high acidification of the post-cultured medium. According to Heinl et al.24, the metabolic activity of lactic acid bacteria is closely associated with the substrates available in their natural environment. One of the approaches in the selection of microorganisms for biotechnological application is the substrate-oriented strategy31 which focuses on the capacity of microorganisms to utilize a certain feedstock in order to select the best suited strain. The use of a strain isolated from the material, into which this strain is further introduced in the form of a preparation, seems to be the right approach in the above mentioned strategy.The ability to degrade xylan is not a common feature of all known species of lactic acid bacteria. Boguta et al.Lactobacillus buchneri M B/00077 was able to grow in medium with xylan (and xylose) as the sole carbon source and synthesized higher amounts of acetate despite the heterofermentation process leading to equimolar amounts of lactate and acetate production23. Lactobacillus buchneri is known for its ability to metabolize lactic acid into acetic acid and 1,2-propanediol, when there is no glucose in the environment. This conversion occurs at low pH (3.2\u20134.3)29. Other authors have found that lactate metabolism is strain-dependent so there is a variation in utilization of lactic acid among the Lactobacillus buchneri species35.In the current study Lactobacillus buchneri M B/00077 strain has genes encoding two critical enzymes required for the degradation of xylan: endo-\u03b2-1,4-xylanase and \u03b2-xylosidase36. This feature is strain specific and not all species of lactic acid bacteria produce the two enzymes. For instance, Chapla et al.37 investigated the xylanolytic activity of selected strains of L. acidophilus and L. fermentum genus and found that the strains studied indicated a lack of \u03b2-xylosidase activity. When grown in a medium with xylooligosaccharides as the sole carbon source, L. acidophilus and L. fermentum indicated the highest endo-xylanase activity (0.34 and 0.24\u00a0U/ml respectively) after 24\u00a0h of incubation. In another study it was found that Leuconostoc lactis SHO-47 and Leuconostoc lactis SHO-54 were unable to utilize xylan, probably because of the lack of a gene encoding endo-xylanase. The xylosidase activity of both strains was induced by xylose and a combination of xylobiose and xylotriose, and the activity of xylosidase was not found in the supernatant of the cultures but in the cell-free extracts38. In the study by Erlandson et al.39, genetic and biochemical evidence was found for a defective xylan degradation pathway in three LAB strains belonging to Lactococcus lactis although two of them were isolated from the plant environment.A valuable finding of this study was that the In the current study a significantly smaller amount of biogas was obtained from silages prepared with the addition of commercial xylanase than from the control and LAB silages, although the silages treated with enzyme were characterized by a higher sugar and lactic acid content and increased rate of biogas production, particularly at the start of fermentation. The higher concentration of sugars and lactic acid indicated an increased intensity of the biochemical processes, probably due to the increased bioavailability of lignocellulosic structures for lactic acid bacteria naturally occurring in the plant biomass. The second phenomenon to be observed may be caused by inhibitors, i.e. compounds which interfere with the AD process and limit the production of biogas. Under experimental conditions short-chain fatty acids (C2\u2013C6) formed in the process of transforming biochemical organic components, could be responsible for inhibiting anaerobic digestion. Their accumulation could have exceeded the upper maximum level enabling their use by methanogenic bacteria which, in consequence, could have been the reason for the production of less biogas from silages prepared with the addition of enzymes.L. buchneri M. The increase in the production of biogas in silages treated with L. buchneri M may be related to the increase in the acetic acid content, which is a product of the heterofermentative fermentation of pentoses released from hemicellulose (xylan) of plant material. These observations correspond to the results of other authors40. The use of efficient silage additives to enhance the production of biogas has been the subject of many studies in recent years some of which have proved that biological silage additives consisting of lactic acid bacteria strains showed positive effects on methane yields from biogas crops such as maize, sorghum, forage rye, triticale and switchgrass40. Other authors have claimed that this effect could be attributed to the increases in C2 to C6 volatile fatty acids and alcohols during ensiling, as these compounds, especially acetic acid, are direct precursors of methane production40. In the study by Herrmann et al.26, a regression model including acetic, butyric acid and ethanol accounted for 75\u201396% of the variation in methane yields. However, a high concentration of butyric acid in silages is not desirable and is considered to be a sign of the proteolytic activity of Clostridium bacteria, which finally leads to deterioration of the silage41. In the study by Ambye-Jensen et al.1 the effect of increasing acid concentrations in silages on the subsequent enzymatic hydrolysis of cellulose was observed. The authors assumed that synthesized organic acids were responsible for acid hydrolysis of the lignocellulose complex of grass biomass. The effect of increasing cellulose convertibility was more dependent on the content of the dry grass matter than on lactic acid bacteria used as a silage additives. Nevertheless, the study confirmed ensiling to be a useful biological pretreatment method for the conversion of green biomass. Vervaeren et al.40 reported that more divergent biological additives containing yeast or enzymes would be preferable to enhance the subsequent anaerobic digestion of silages than additives consisting of only homo- or heterofermentative LAB strains. Zhao et al.27 recommended the combined application of hemicellulose and Lactobacillus plantarum to improve the quality of silage and biogas production from rice straw. Others have reported the minor effect of lactic acid bacteria used as silage additives on the production of biogas from maize, suggesting that LAB do not have the ability to degradation of plant cell wall polysaccharides43. Furthermore, it was suggested that unlike LAB living in a dairy environment, the strains isolated from silages utilize substrates derived from plant cell walls24. Some authors claimed that the impact of the ensiling process on biogas yields should be carefully studied with particular emphasis on dry matter loss which occurs during ensiling44. This statement was supported by another study which showed that taking storage losses into consideration, that microbiological silage additives showed little effect on the methane production from various biogas crops26. Finally, some authors suggested that ensiling could increase the production of biogas even taking into account storage losses due to the more beneficial impact of the increase in biochemical accessibility as a result of the ensiling process45.The highest amount of biogas was obtained from silages treated with Lactobacillus buchneri M B/00077. The lack of this acid in the control silages and silages prepared with the use of xylanase indicated the impact of L. buchneri M B/00077 on propionic acid production. Propionic acid is a natural inhibitor of mould growth and its presence is highly desired in silages, contributing to the increased aerobic stability of the ensiled material41. Lactobacillus buchneri species are characterized by their unique metabolic pathways35. It was reported that L. buchneri A KKP 2017/p synthesized propionic acid from 1,2-propanediol in the presence of cobalamin46.Another valuable observation made in this study was the occurrence of propionic acid which was detected only in silages prepared using Lactobacillus buchneri M B/00077. Applying this strain as a silage additive for the lignocellulosic biomass of Spartina pectinata L. preservation had an impact on the composition of the silages and resulted in increased production of biogas. Thus, the results of the current research highlight the potential application of Lactobacillus buchneri M B/00077 for lignocellulosic biomass pretreatment promoting the economic conversion of biomass into biofuels.The genes coding key enzymes in xylan degradation i.e. endo-1,4-xylanase and \u03b2-xylosidase have been identified in the Lactobacillus buchneri M B/00077 was isolated from spontaneously fermented grass of Spartina pectinata L. The identification of the strain was performed by analysis of the 16S rRNA sequence. The sequence obtained was compared with the sequences available in GenBank database. The strain was deposited in the Polish Collection of Microorganisms located at the Institute of Immunology and Experimental Therapy in Wroc\u0142aw (Poland), under the number B/00077.Lactobacillus buchneri M strain was examined in standard MRS medium (containing 2% glucose) and in modified MRS medium, in which glucose was replaced by xylan from beech wood  or D(+)-xylose . 100\u00a0ml of a particular medium  was inoculated with 1\u00a0ml of 24-h culture (inoculum) prepared in standard MRS medium (the number of bacteria in the inoculum was log 9.0\u00a0CFU\u00a0m/l). Stationary cultures were incubated in flasks for 5\u00a0days at 30\u00a0\u00b0C. After a defined period of time the number of bacteria was determined using the ISO 15214 spread plate method and the pH of the medium was measured using the potentiometric method. The cultures were then centrifuged  and supernatants were collected in which organic acids were detected (using the HPLC method).The metabolic activity of the Lactobacillus buchneri M B/00077 was grown in liquid MRS medium with 2% of xylan  as the only carbon source. 20\u00a0ml of the medium was inoculated with 100\u00a0\u00b5l of overnight pre-cultured bacteria of the Lactobacillus buchneri M B/00077 strain in standard MRS medium. After 1, 2, and 3\u00a0days of incubation at 30\u00a0\u00b0C the biomass was separated by centrifugation  and the supernatants were collected for measuring xylanolytic activity. The assays were based on a quantification of the reducing sugars released from xylan as a result of the extracellular enzyme excreted to the post-cultured medium acting on a 1% xylan solution prepared in a citrate buffer (pH\u2009=\u20094.8) for 60\u00a0min at 35\u00a0\u00b0C. The reducing sugars released from xylan were determined using the Somogyi-Nelson method as described previously by Ghose and Bisaria47. The photometric absorption was determined at 620\u00a0nm using a DU 800 UV/VIS spectrophotometer . The xylose standard curve was constructed by preparing dilutions of xylose in demineralized water and determining the absorbance of those dilutions at 620\u00a0nm after the Somogyi-Nelson reaction.The activity of extracellular enzymes released into the medium by the tested strain was measured. For this purpose Xylanolytic activity was expressed as units of enzyme activity per ml (U/ml) and defined as the conversion of 1\u00a0\u00b5mol of xylose per minute under given assay conditions .Lactobacillus buchneri M B/00077 and viscosity after 1, 2 and 3\u00a0days of incubation with bacteria was measured using a Brookfield viscometer (model DV III Rheometer connected with a TC-100 water bath). The measurements were carried out at 30\u00a0\u00b0C and spindle SC4-18 with a speed of 10\u00a0rpm.Additionally the viscosity of the MRS medium with xylan as the only carbon source before inoculation with Spartina pectinata L. was obtained by collecting energy crops belonging to the Department of Agriculture and Biology of Warsaw University of Life Sciences. The grass was harvested at the end of June, cut into 1\u00a0cm pieces and ensiled. Each portion of 10\u00a0kg of chopped material was tightly compacted in a plastic barrel (packing density of 230\u00a0kg dry matter per m3). During compaction the biomass was inoculated with the Lactobacillus buchneri M B/00077 strain. For this purpose the biomass of the strain previously grown in standard MRS medium was freeze-dried using a lyophilizer Christ Ralpha 1\u20134 , so the preparation obtained was in the form of a water soluble powder. The number of bacteria in the preparation was log 11.2\u00a0CFU/g. 10\u00a0g of the preparation was dissolved in 200\u00a0ml of sterile demineralized water and sprayed onto the biomass during compaction in a barrel. The calculated number of bacteria added to the biomass was log 8.2\u00a0CFU/g of biomass/fresh materials. Silages using a commercial enzyme preparation were also prepared. 15\u00a0ml of a xylanase preparation with activity of 8000 U/ml  was dissolved in 200\u00a0ml of sterile demineralized water and sprayed onto the plant material during compaction in a barrel, so that calculated enzyme activity was 0.05 U/g of biomass. Control silages were also prepared without bacteria or the addition of enzymes, but with 200\u00a0ml of sterile demineralized water. Each variant of the silage was prepared in three repetitions. The grass compression barrels were hermetically sealed with lids equipped with valves for releasing gas. The barrels were stored at room temperature (between 20 and 23\u00a0\u00b0C) for three months. After a defined number of days, the barrels were opened. The chemical composition of the ensiled material was determined, as well as Biochemical Methane Potential (BMP) tests.The grass of 48. The organic dry matter (ODM) was determined by burning previously dried samples (1\u00a0g) at 550\u00a0\u00b0C for five hours in a furnace (CARBOLITE RWF 1200). Before measuring the pH-value of silages, 10\u00a0g of the sample was homogenized with 100\u00a0ml of distilled water for 25\u00a0min. Water soluble carbohydrates (WSC) in the ethanol extracts of silages were determined using the Luff-Schoorl method according to the standard PN-R-64784:1994. For further analysis, air dry subsamples of the fresh and ensiled plant material were ground in a cutting mill and sieved using a 1-mm sieve. Crude fat in the silages was determined using the Soxhlet method with the use of a Tecator Soxtec System HT equipped with a 1043 Extractor Unit . To determine the total protein, neutral-detergent fibre (NDF), acid-detergent fibre (ADF) and acid-detergent lignin (ADL), particular standards were used: PN-EN 13342; PN-EN ISO 16472:2007P and PN-EN ISO 13906:2009P respectively. Fibres were determined using a Fibertec 8000 system . Cellulose was determined as the difference between the content of ADF and ADL fibre, hemicellulose as the difference between NDF and ADF fibres. ADL fibres were recognized as lignin content.In fresh (after harvest) and ensiled grass, the dry matter (DM) and organic dry matter (ODM) was determined. The DM was determined by drying a sample of the material (25\u00a0g) at 105\u00a0\u00b0C to the constant weight of the sample according to standard S358.2 ASABE. The DM of silages was corrected for the loss of volatiles, as described by Porter and MurrayThe HPLC method was used to determine the organic acids in silages and culture broths. Organic acids  in silages were extracted from the silage sample for 30\u00a0min. The plant material was then separated and the extracts obtained were deproteinized. Water extracts from the silages, as well as an aliquot of the culture broth  were mixed with 2.5\u00a0ml of Carrez I solution and 2.5\u00a0ml of Carrez II solution. The mixtures were centrifuged for 3\u00a0min. at 150\u00a0rpm. The supernatants were filtered through a 0.45\u00a0\u00b5m filter  prior to HPLC analysis. The analysis were performed using a Gilson system  equipped with an autosampler (GX-271), a multi-solvent pump (322), a column oven, and RI detector . The organic acids were separated using an Aminex 87HP column  operated at 64\u00a0\u00b0C. Elution was carried out in isocratic mode with sulfuric acid (pH 3.4) as the mobile phase, at a flow rate of 0.8\u00a0ml/min. The quantification was based on a refractive index detector and performed with external standards in duplicate. The results were expressed as mean values. All chemicals used in the study were from Sigma-Aldrich. The chemicals were all of analytical grade.49:The digestibility of dry matter (DDM) was calculated as presented by Kim et al.2 to create anaerobic conditions. The control assays were fermenters with inoculum without the addition of plant material. The AD was conducted at 39\u00a0\u00b0C. The fermenters were placed on mixing platforms  to guarantee constant mixing of the fermentation mass. Anaerobic digestion lasted until the plateau was achieved (until there was no increase in pressure). All assays were prepared in five repetitions.Anaerobic digestions (AD) of the silages obtained were conducted in glass fermenters (1.3 L) into which 5\u00a0g of the material and 100\u00a0ml of inoculum (the source of methanogen bacteria) was introduced. The inoculum  was pre-incubated for five days at 39\u00a0\u00b0C to minimalize the production of biogas from itself. Fermenters were closed with OxiTop Control heads  equipped with manometry sensors. Before starting the fermentation process, the fermenters were flushed with NThe pressure of biogas generated inside the fermenters was monitored and saved using OxiTop heads (360 measurements during a defined period of AD), the data were transferred to the OxiTop OC 110 Controller and then to a PC. The data obtained were further processed using the Excel program. The biogas composition was determined using a gas analyser , which was connected to the side tubes of the fermenters at the end of the fermentation process.o) the following calculation was used:po is the pressure 1013\u00a0hPa; To is the temperature of 273\u00a0K; p1 is the biogas pressure (hPa); V1 is the volume of the glass fermenter (m3); T1 is the temperature of the fermentation process (K).To calculate the volume of biogas obtained with reference to normal conditions  production of biogas was calculated based on the chemical composition of the silages, taking into account that from carbohydrates (as the sum of WSC and NDF fibres), fat and protein 800, 1250 and 700 dmLactobacillus buchneri M strain was cultured in MRS medium at 30\u00a0\u00b0C for 1\u00a0day. Bacterial chromosomal DNA was then purified using a Genomic Mini Kit (A&A Biotechnology), following the manufacturer\u2019s instructions. Genes encoding endo-1,4-\u03b2-xylanase  and \u03b2-xylosidase  were investigated . Those genes were amplified using the following starters: fr (5\u2032-ATTTGGCAGCCAAGTTAGCGTA) and rev (5\u2032-GAACAGAAGACAGCCCATC) for endo-1,4-\u03b2-xylanase; fr (5\u2032-CAATCTCATTGCGGGTGAGGT) and rev (5\u2032-TCAATCAGGCTCCAAATCGTCAA) for \u03b2-xylosidase. The primers were designed based on the genes found in the Lactobacillus buchneri CD034 strain by Heinl et al.24. All PCR reactions were performed using a Pequstar 2\u2009\u00d7\u2009Gradient thermocycler (Pequlab). PCR reactions were performed in a total volume of 25\u00a0\u00b5l containing 2\u00a0\u00b5l of template DNA, 1 \u00b5L of each of the primers, 12.5\u00a0\u00b5l of DraemTaq (ThermoScientific), 8.5\u00a0\u00b5l of water. The conditions for PCR reactions were as follows: initial denaturation at 95\u00a0\u00b0C for 2\u00a0min, 35 cycles of denaturation at 95\u00a0\u00b0C for 30\u00a0s, annealing at 53\u2009\u00b1\u20094\u00a0\u00b0C for 35\u00a0s, elongation 72\u00a0\u00b0C for 1\u00a0min and final elongation at 72\u00a0\u00b0C for 4\u00a0min. The products of PCR reaction were analyzed on 1.5% agarose gel. The DNA samples obtained were sequenced using the same primers. The sequences were compared to the GenBank sequences data base using BLAST tools.The p\u2009<\u20090.05), Statistica ver. 8.0 software . The compatibility of variable distribution with normal distribution was verified with the Shapiro\u2013Wilk test, while the hypothesis about homogeneity of variance was tested with the Levene test and Brown\u2013Forsythe test.The experiments assumed a complete plan with the mean and SEM as the measure of central tendency. One\u2010factor\u2010at\u2010a\u2010time (OFAT) approach was used to choose the dynamic variables. All experiment were performed in triplicates. One-way analysis of variance (ANOVA) followed by the Tukey post hoc test were used to compare the treatments (Supplementary Figure S1."}
+{"text": "Pseudevernia furfuracea (L.) Zopf (PSE) and isolated physodic acid (Phy) in an in vitro ALL model. A screening assay, flow cytometry and Western blotting were used to analyze apoptosis occurrence, oxidative stress, DNA damage and stress/survival/apoptotic pathway modulation induced by the tested substances in Jurkat cells. We demonstrate for the first time that PSE and Phy treatment-induced intrinsic caspase-dependent cell death was associated with increased oxidative stress, DNA damage and cell cycle arrest with the activation of cell cycle checkpoint proteins p53, p21 and p27 and stress/survival kinases p38 MAPK, JNK and PI3K/Akt. Moreover, using peripheral T lymphocytes, we confirmed that PSE and Phy treatment caused minimal cytotoxicity in normal cells, and therefore, these naturally occurring lichen secondary metabolites could be promising substances for ALL therapy.Acute lymphoblastic leukemia (ALL) is the most frequently diagnosed type of leukemia among children. Although chemotherapy is a common treatment for cancer, it has a wide range of serious side effects, including myelo- and immunosuppression, hepatotoxicity and neurotoxicity. Combination therapies using natural substances are widely recommended to attenuate the adverse effects of chemotherapy. The aim of the present study was to investigate the anti-leukemic potential of extract from the lichen  Acute lymphoblastic leukemia (ALL) is an aggressive disease and the most common type of childhood cancer. According to the National Cancer Institute , ALL repCladonia, Stereocaulon, Lobariella, Myelochroa, Cornicularia and Lichina possess anti-leukemic potential, as reviewed in Mohamadi et al. [The pharmaceutical potential of lichens and their secondary metabolites has recently attracted increasing attention worldwide, as reviewed in ,15. Manyi et al. . In thisi et al.  found thi et al. . Physodii et al. . HoweverPseudevernia furfuracea (L.) Zopf and the metabolite physodic acid using the Jurkat cell line as an in vitro ALL model. The composition of the most abundant metabolites in P. furfuracea extract (PSE) is atranorin and chloroatranorine (depside group) and physodic acid, oxyphysodic acid and O-methylphysodic acid (depsidone group) [P. furfuracea and physodic acid in an in vitro acute lymphoblastic leukemia model.The aim of the present study was to assess the anti-cancer potential of extract from the lichen e group) , which te group) ,25,26,27e group) . On the Pseudevernia furfuracea (L.) Zopf from barks of Picea abies at Koj\u0161ovsk\u00e1 hol\u2019a  in Volovsk\u00e9 vrchy . The lichen specimen was identified and deposited in the herbarium of P.J. \u0160af\u00e1rik in Ko\u0161ice (KO35800) by botanists and lichenologists Prof. Backor and Dr. Goga. PSE was prepared by acetone extraction and characterized by HPLC and NMR spectroscopy as described in Petrova et al. [P. furfuracea (L.) Zopf primarily contains atranorin, chloratranorin (cortex) and physodic acid (medulla). After extraction and isolation, both PSE and Phy were dissolved in dimethyl sulfoxide  and diluted directly in cultured medium. DMSO itself exhibited no cytotoxicity in cultured cells.Dr. Goga (September 2019) collected lichen a et al. . Lichen 2 in humidified air at 37 \u00b0C. Before each experiment, the cell viability was estimated by trypan blue exclusion (\u226595%).The human T-lymphoblastic leukemia cell line Jurkat  and human T lymphocytes  were maintained in RPMI 1640 medium . The growth medium was supplemented with 10% FBS  and antibiotic/antimycotic solution , and cells were cultivated in an atmosphere containing 5% COHuman peripheral blood samples were obtained from healthy volunteer  in the hematology department of L. Pasteur University Hospital in Ko\u0161ice. Blood samples were drawn with EDTA Vacutainer tubes  and processed within 1 hour of collection. Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation using Histopaque-1077 (Merck). T cells were isolated from human PBMCs using Human T-cell Isolation Kit  according to the datasheet of the isolation kit. The purity of T cells was greater than 90%, as confirmed by flow cytometry.4/well) were seeded in 96-well plates. After 24 h, final PSE and Phy concentrations prepared from DMSO stock solution were added, and incubation proceeded for the next 72 h. Ten microliters of resazurin solution (Merck) at a final concentration of 40 \u00b5M was added to each well at the end-point (72 h). After a minimum of 1 h incubation, the fluorescence of the metabolic product resorufin was measured by the automated CytationTM 3 cell imaging multi-mode reader  at 560 nm excitation/590 nm emission filter. The results were expressed as a fold of the control, where control fluorescence was taken as 100%. All experiments were performed in triplicate. The IC50 values were calculated from these data.The resazurin assay was used to determine the anti-proliferative/cytotoxic effect of PSE  and Phy  on Jurkat and HTLs cells. Tested cells , adherent and floating cells were harvested together and washed in PBS. The cell suspension was divided for subsequent analysis, stained with un-/conjugated antibody or dye  and Phy (60 \u00b5M) at ICy or dye  and incuTM Yellow Cell Proliferation Kit for flow cytometry was used (Thermo Scientific). The cells (1 \u00d7 106) were resuspended in 1 mL of staining solution with a final concentration of 10 \u00b5M and incubated for 20 min at 37 \u00b0C in the dark. After incubation, cells were washed in a complete culture medium and incubated again for 5 min at 37 \u00b0C. After the second incubation, supernatant was removed by centrifugation, and the pellet was resuspended in fresh, pre-warmed complete culture medium and seeded in Petri dishes for 24 h. Afterwards, seeded cells were treated with PSE (45 \u00b5g/mL) and Phy (60 \u00b5M) and analyzed at three different time points . For analysis of stained cells, a BD FACSCalibur flow cytometer (BD Biosciences) was used. A minimum of 1 \u00d7 104 events were analyzed per analysis, and all experiments were performed in triplicate.To analyze the proliferation activity of Jurkat and HTLs cells, the CellTrace4 events were analyzed, and all experiments were performed in triplicate.For the cell cycle analyses, Jurkat and HTL cells were harvested at three different time points  after treatment (PSE 45 \u00b5g/mL and Phy 60 \u00b5M), washed in cold PBS and fixed in cold ethanol (70%). Samples were then stored at \u221220 \u00b0C until analysis (minimum of 24 h). Prior to each analysis, cells were stained with solution containing 0.5 mg/mL ribonuclease A, 0.2% final concentration of Triton X-100 and 0.025 mg/mL propidium iodide in 500 \u00b5L of PBS  and incubated for 30 min at room temperature in the dark. The BD FACSCalibur flow cytometer (BD Biosciences) was used to analyze stained cells. A minimum of 1 \u00d7 106) were harvested 3, 24, 48 or 72 h after PSE 45 \u00b5g/mL and Phy 60 \u00b5M treatment. NAC/PSE or NAC/Phy experimental groups were pre-treated with N-acetyl-L-cysteine  for 1 h before PSE/Phy were applied. The cell suspension was washed in PBS and stained using Annexin V\u2013Alexa Fluor\u00ae 647 conjugate (Thermo Scientific) for 15 min at room temperature in the dark, followed by incubation with propidium iodide  and analyses by flow cytometer . A minimum of 1 \u00d7 104 events were analyzed per analysis, and all experiments were performed in triplicate.The phospholipid phosphatidyl serine (PS) was detected by the Annexin V\u2013Alexa 633 conjugate after its externalization on the other side of the plasmatic membrane, which acts as a marker of programmed cell death. For apoptosis detection, Jurkat and HTL cells (1 \u00d7 104 cells per sample). Fluorescence was detected with 585/42 (FL-2) optical filter by flow cytometer . All experiments were performed in triplicate.Disruption of MMP after PSE 45 \u00b5g/m and Phy 60 \u00b5M treatment  was analyzed by flow cytometry using 0.1 \u03bcM TMRE  staining. NAC/PSE or NAC/Phy experimental groups were pre-treated with N-acetyl-L-cysteine  for 1 h before PSE/Phy were applied. The stained cells were incubated for 30 min at room temperature in the dark and then washed twice with PBS, resuspended and analyzed  or dihydrorhodamine-123 , which reacts with intracellular hydrogen peroxide (ROS). Jurkat cells treated with PSE 45 \u00b5g/mL and Phy 60 \u00b5M were harvested 6, 24, 48 and 72 h after exposure, washed and resuspended in PBS. NAC/PSE or NAC/Phy experimental groups were pre-treated with N-acetyl-L-cysteine  for 1 h before PSE/Phy were applied. The samples were incubated for 15 min in the dark with DHR-123 (0.2 \u00b5M) and MitoSOX red (5 \u00b5M) and, after incubation, were immediately placed on ice. Fluorescence was detected with 530/30 (FL-1) and 585/42 (FL-2) optical filters, respectively, by flow cytometer . A minimum of 1 \u00d7 104 events were analyzed per analysis, and all experiments were performed in triplicate.Flow cytometry was used to analyze intracellularly produced oxygen radicals detected by MitoSOX\u00ae BCA Protein Assay Kit  using bovine serum albumin as the standard and measured by an automated CytationTM 3 Cell Imaging Multi-Mode Reader (Biotek) at a wavelength of 570 nm. A 10% SDS-PAA gel was used to separate proteins at 100 V for 2 h. Then, proteins from the gel were transferred to a polyvinylidene difluoride (PVDF) membrane using the iBlot dry blotting system (Thermo Scientific). The membrane with the transferred proteins was incubated in 5% BSA in TBS-Tween (pH 7.4) for 1 h to minimize non-specific binding. Subsequently, the transferred membrane was incubated at 4 \u00b0C overnight with primary antibodies  and the metabolite physodic acid (Phy) as anti-leukemic agents. Although few data are available on this topic, several studies have described that PSE or Phy has anti-proliferative, pro-apoptotic and EMT-modulating potential in various tumor cell lines [A diagnosis of acute lymphoblastic leukemia (ALL) is still associated with a poor prognosis and limited treatment options for pediatric/adult patients. Mitigation of the main side effects of conventional and new T-ALL therapies is currently a challenge. To address these issues, the use of natural compounds with prospective anti-leukemic potential and minimal side effects might be helpful. Therefore, in our work, we focused on the possible use of extract from the lichen ll lines ,17,21. Ill lines . MoreoveUsnea intermedia induced alterations in MMP in breast and lung carcinoma cell lines, followed by apoptosis induction [Umbilicaria hirsuta [P. furfuracea and physodic acid describe only a significant increase in cells in the sub-G0/G1 population, and no cell cycle arrest was detected in the human melanoma and colon cancer cell lines FemX and LS174 [In addition to the anti-proliferative potential of PSE and Phy, we demonstrated that both the extract and physodic acid disrupted the mitochondrial membrane potential (MMP) C in a tinduction . Mitocho hirsuta . In addi hirsuta ,33,34. Ind LS174 . These fP. furfuracea extract and Phy was similar, as described in a few known sources [The cell cycle analysis clearly shows that PSE and Phy induce cell death. In the next phase, we focused on the analyses of early and late events leading to the initiation and progression of programmed cell death. The Annexin V analyses E, which  sources ,26,27.c  were analyzed. It is known that lichen extracts and isolated/purified secondary metabolites can change the redox status of cancer cells and ROS production or accumulation, which significantly contribute to the initiation and execution of apoptosis, resulting in cytotoxicity ,40,41. Iignaling . The ana\u010d et al.  in an in\u010d et al. . Accordi\u010d et al. , resulteFurthermore, to elucidate whether PSE- and Phy-mediated oxidative stress is one of the main initiating factors causing cytotoxicity and apoptosis in Jurkat cells, we used ROS scavenging treatment . As shown in Oxidative stress mediated by lichen secondary metabolites or extracts also represents strong genotoxic pressure accompanied by DNA damage. In our previous work, we clearly confirmed the direct association of oxygen radicals in gyrophoric acid-mediated DNA damage with apoptosis in HeLa cells . MoreoveParmotrema reticulatum [As we describe above, PSE and Phy treatment caused G1 or S cell cycle arrest in Jurkat cells. The recognized disruption of cell cycle progression is in accordance with oxidative stress and DNA damage mediated by PSE and Phy treatment. In addition, as a response to DNA damage, cell cycle checkpoints can be activated in the G1/S phase and at the G2/M transition . The G1 iculatum  inhibiteAn important mechanism in apoptosis control is mitogen-activated protein kinase (MAPK) regulation . It is kP. furfuracea only caused cytotoxicity in cultured human lymphocytes when it was administered at high doses. Finally, safety and minimal side effects on healthy tissues are important indicators during the discovery of new drugs in cancer research. Therefore, we additionally analyzed normal T cells in our experiments. As is shown in In conclusion, our results show that PSE and Phy treatment induced apoptosis in Jurkat cells in a dose- and time-dependent manner. We confirmed that ROS production and consequent DNA damage played an eminent role in PSE- and Phy-mediated apoptosis. Moreover, the DNA repair mechanism, including the phosphorylation of ATM, HA2.X and SMC1 proteins, was subsequently activated, followed by p21, p53 and p27 activation and cell cycle arrest. Moreover, PSE and Phy treatment led to the phosphorylation of MAPK signaling, including p38 MAPK, JNK and PI3K/Akt. Furthermore, minimal or no cytotoxicity in normal peripheral lymphocytes supports the use of PSE and Phy as anti-leukemic agents. We assume that the stronger effects of the PSE extract compared to the physodic acid metabolite on the monitored parameters are due to the synergistic or additive effects and interactions of the individual components of the extract."}
+{"text": "Coronavirus disease 2019 (COVID-19) represents a significant challenge to health care systems around the world. A well-functioning primary care system is crucial in epidemic situations as it plays an important role in the development of a system-wide response.2,187 Austrian and German GPs answered an internet survey on preparedness, testing, staff protection, perception of risk, self-confidence, a decrease in the number of patient contacts, and efforts to control the spread of the virus in the practice during the early phase of the COVID-pandemic (3rd to 30th April).The completion rate of the questionnaire was high (90.9%). GPs gave low ratings to their preparedness for a pandemic, testing of suspected cases and efforts to protect staff. The provision of information to GPs and the perception of risk were rated as moderate. On the other hand, the participants rated their self-confidence, a decrease in patient contacts and their efforts to control the spread of the disease highly.Primary care is an important resource for dealing with a pandemic like COVID-19. The workforce is confident and willing to take an active role, but needs to be provided with the appropriate surrounding conditions. This will require that certain conditions are met.DRKS00021231.Trial registration at the German Clinical Trials Register:  Coronavirus disease 2019 (COVID-19) represents a significant challenge to health care systems around the world. Although implications for the hospital and intensive care sector are generally focused on, a comprehensive approach to managing the COVID-19 pandemic should also involve primary care, as it is usually the point-of-first-contact, regardless of patients`health concerns .Primary care professionals represent the first point of contact in health care systems and are therefore in a vulnerable position. With sometimes insufficient information, they must deal with a dilemma between caring for potentially infectious patients , while pNeither Germany nor Austria have yet exhausted their intensive care capacities and have managed to keep infection numbers under control , 13. NevThe aim of this study is to investigate the role played by GPs in the early phase of the COVID-19 pandemic, the specific challenges faced by them, their concerns and the strategies they have developed to cope with the pandemic. Potential deficiencies as well as regional differences  are analyzed.Start is part of the international COVI-Prim project Reviewers' comments:https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 22 Feb 2021\u2022 You must provide a rational for absence of Ethics approval for Austria as mentioned in appendix table 1 considered as Not Applicable.Response: When we were asking the head of the local ethic committee at the Medical University Graz for an ethical approval, we were told that according to the Austrian law, this study does not require an ethical approval. This information will be added in the method section in the paragraph Ethics at page 6 and the approval from Germany will be uploaded as a supplement file. \u2022 The result of open-end question (free text in questionnaire) was not presented in manuscript. It appears the most related part of questionnaire to your manuscript title was this section, \u201cbiggest challenge, supporting factor\u201d.Response: Prior to the writing of our manuscript we were discussing this aspect in detail and decided that we do not include the comments. This decision was based on the high number (more than 3.500 comments) and the heterogeneity of the comments. We observed that comments differed over time and were strongly dependent of the region of the responding doctors. In our opinion, it is not possible to report these results in one paragraph. We are currently preparing a second manuscript reporting on the interesting results to present the comments in detail. This information can be added in our actual manuscript for PLOS ONE.\u2022 The results of last table in questionnaire were not presented at all. And were not analyzed in relation to other factors.Response: We have not analyzed this items in the first version of the manuscript, because, these items do not belong to one of the dimensions of the questionnaire. However, based on your suggestion, we now added the most important results in the manuscript and the other results in the appendix (table S5)\u2022 Considering the unity of covi-prim project please clarify your rational to publish the result of this project separately.Response: Considering the number of different aspects of the COVI-Prim project, we think that it is not possible to present all results within one manuscript. There are so many aspects  that each of these aspect could be described in several further manuscripts. Therefore, we decided to write one \u201cstarter\u201d manuscript including all protocol relevant information in the main text and the supplement that we would be able to reference it within every subsequent publication.AttachmentRevision_PLOS one_ask_aa.docxSubmitted filename: Click here for additional data file. 3 May 2021COVI-Prim survey: Challenges for Austrian and German general practitioners during initial phase of COVID-19PONE-D-20-36154R1Dear Dr. Avian,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Kamal Gholipour, PhDAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0(No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0The introduction and title are well written and the aim of the study is clear with an obvious gap of knowledge.The methods is well written and reproducibleIn the results I recommend investigating the association between level of knowledge and experience or grades in medical school. Otherwise the results are well representedThe discussion is well written however I recommend comparing the results with other studies published on this topic which are numerous and regional.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Yes:\u00a0Kirellos Said AbbasReviewer #1:\u00a0 17 May 2021PONE-D-20-36154R1 COVI-Prim survey: Challenges for Austrian and German general practitioners during initial phase of COVID-19 Dear Dr. Avian:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Kamal Gholipour Academic EditorPLOS ONE"}
+{"text": "Man spricht vom drohenden R\u00fcckfall in die Barbarei.\u201cAdorno  von Jon Kabat-Zinn mit Aspekten der Mitgef\u00fchlsschulung sowie der Organisations- und Kulturentwicklung nach Otto Scharmer . GAMMA wBasierend auf den p\u00e4dagogischen Konzepten von Verk\u00f6rperung und dem Lernen am Modell geht die GAMMA-Weiterbildung davon aus, dass, wenn die Regulations- und Beziehungsf\u00e4higkeiten von P\u00e4dagogInnen unterst\u00fctzt werden, dies Gesundheit, Mitgef\u00fchl, Wertsch\u00e4tzung, Solidarit\u00e4t, Kooperation und Engagement in und zwischen den Berufsgruppen und damit mittelbar auch bei den Kindern st\u00e4rkt. Dar\u00fcber hinaus wurden positive Effekte auf den Erhalt und die St\u00e4rkung der gesundheits- und bildungsf\u00f6rdernden Schulkultur erwartet. Zudem bieten sich achtsamkeitsbasierte Verfahren und moderate Bewegung im Kontext der Covid-19 Pandemie f\u00fcr die verst\u00e4rkte Nutzung im Schulalltag an, da ihre immunf\u00f6rdernden Wirkungen gerade im respiratorischen System nachweisbar sind  und Selbstmitgef\u00fchl (SCS) erhoben sowie auf Basis des Fragebogens zur Arbeit im Team (FAT) bzgl. der Effekte auf organisationaler Ebene.Kentucky Inventory of Mindfulness Skills (KIMS)  (Hupfeld und Ruffieux Fragebogen zur Arbeit im Team (FAT) Kauffeld Umgesetzt wurde ein Pretest-Posttest-Design mit zwei Messzeitpunkten. Der Erhebung lagen u.\u202fa. diese validierten Frageb\u00f6gen in deutscher Fassung zugrunde:Diese Instrumente wurden ausgew\u00e4hlt aufgrund der Hypothese, dass die Intervention zu einer F\u00f6rderung von Achtsamkeit (KIMS) und Selbstmitgef\u00fchl (SCS) bei den P\u00e4dagogInnen f\u00fchrt. Und wenn diese beiden F\u00e4higkeiten der pers\u00f6nlichen Stressbew\u00e4ltigung gest\u00e4rkt werden, dann, so die n\u00e4chste Hypothese, gestalten die P\u00e4dagogInnen ihr berufliches Miteinander im Kollegium und mit den Kindern weniger aus Kampf- und Fluchtreaktionen heraus, sondern mit Wertsch\u00e4tzung und partizipativ co-kreativer Gestaltungsfreude. Daher vermuteten wir positive Effekte auf die wahrgenommene Qualit\u00e4t der Teamarbeit (FAT) sowie Berichte \u00fcber Erfahrungen von mehr Gemeinsamkeit und einer demokratischeren Organisationsentwicklung.Ich kann mir selbst jetzt eine gute Mutter sein\u201c. Die Gespr\u00e4che dauerten circa\u00a030\u202fmin und wurden per Telefon von Frau Adler, Herrn Gugel und Dr. Altner gef\u00fchrt. Relevante Passagen der Gespr\u00e4che wurden transkribiert und aus den einzelnen Beschreibungen Themencluster gebildet. Diese wurden dann inhaltsanalytisch zu \u00fcbergeordneten Themenaussagen reduziert  und Achtsamkeit (KIMS) mit \u00c4nderungen von Variablen, die f\u00fcr die Entwicklung der Team- und Organisationskultur relevant sind. Dazu berechneten wir diese Korrelationswerte in den Subskalen des Fragebogens zur Arbeit im Team (FAT) Tab.\u00a0.FAT_ZielGrafisch ergeben sich folgende statistisch signifikante Einzelkorrelationen . Achtsamkeit und Selbstmitgef\u00fchl korrelieren positiv mit allen Subskalen des FAT. Statistische Signifikanz erreichen dabei die Zusammenh\u00e4nge zwischen mehr Selbstmitgef\u00fchl, steigendem Zusammenhalt im Team sowie der Bereitschaft zur Verantwortungs\u00fcbernahme im Team.Fazit: Die Entwicklung des Gesamtscores f\u00fcr Teamkultur zeigt eine signifikante Korrelation mit der Zunahme an Selbstmitgef\u00fchl Mitgef\u00fchl in Schulkollegien und den Auswirkungen auf die Organisationskultur diskutiert. Dabei soll auch die Vision einer friedensf\u00f6rdernden Bildung einbezogen werden, die Theodor Wiesengrund Adorno am 18.\u00a0April 1966 in seinem Radiovortrag \u201eErziehung nach Auschwitz\u201c im Hessischen Rundfunk entworfen hat. Die von ihm identifizierten psychologischen und kulturellen Defizite f\u00fchrten seiner Diagnose nach mit zu den unmenschlichen Greueltaten des zweiten Weltkrieges und der Vernichtungslager. Angesichts des aktuellen Krieges in der Ukraine sowie der antidemokratischen Entwicklungen in Europa und den USA stellt sich uns die Frage, ob die aktuell wieder erstarkenden gesellschaftlichen Tendenzen von Ideologisierung, Radikalisierung, Militarisierung und wachsendem Nationalismus auch heute weiterhin mit den von Adorno identifizierten Ph\u00e4nomenen einhergehen. Er spricht von gesellschaftlichem Druck, dem suppressiven Umgang mit Angst, dem Erziehungsbild der H\u00e4rte, von Beziehungsk\u00e4lte sowie von einem verdinglichend manipulativen Charakter bei F\u00fchrungskr\u00e4ften. In unserer Arbeit in Schulen begegnen uns aktuell Hinweise auf genau diese Ph\u00e4nomene. Deshalb m\u00f6chten wir nachfolgend diskutieren, ob und wie Bildungsangebote zur Kultivierung von Achtsamkeit und Mitgef\u00fchl hier transformative Impulse f\u00fcr die Entwicklung von LehrerInnen, Sch\u00fclerInnen sowie von Schulkultur setzen k\u00f6nnen und damit gesellschaftlich zur St\u00e4rkung humanistischer, friedlicher, demokratief\u00f6rdernder Haltungen, Verhaltensweisen und Kultur beitragen.\u201eDer gesellschaftliche Druck lastet weiter trotz aller Unsichtbarkeit der Not heute. Er treibt die Menschen zu dem Uns\u00e4glichen, das in Auschwitz nach weltgeschichtlichem Ma\u00df kulminierte.\u201cTheodor Adorno Erstaunlicherweise erscheint der gesellschaftliche Druck im Jahr 2022 als weiterhin sehr hoch und mit steigender Tendenz. Nach \u00fcber einem halben Jahrhundert der Entwicklung von Technik, Medizin, Kultur, Politik und Bildung l\u00e4sst sich weiterhin nicht sagen, dass die Menschen in Deutschland ohne belastenden und oft krankmachenden gesellschaftlichen Druck leben. Das moderne Wort daf\u00fcr ist \u201eStress\u201c. Anders als im Jahr 1966 sind inzwischen jedoch individuelle Methoden, mit Stress ressourcenst\u00e4rkend und gesundheitsf\u00f6rdernd umzugehen, allgemein verf\u00fcgbar. Unsere Erfahrungen in den Schulen und die Daten unserer Erhebung deuten darauf hin, dass, wenn es gelingt, Methoden wie Achtsamkeits- und (Selbst)Mitgef\u00fchlspraktiken gemeinsam zu \u00fcben und zu kultivieren, deren Potenzial f\u00fcr die F\u00f6rderung von Gemeinwohl im Angesicht gro\u00dfer gesellschaftlicher Herausforderungen genutzt werden k\u00f6nnen. Adorno beschreibt folgende Wirkzusammenh\u00e4nge, die daf\u00fcr relevant erscheinen:\u201eDies Erziehungsbild der H\u00e4rte, an das viele glauben m\u00f6gen, ohne dar\u00fcber nachzudenken, ist durch und durch verkehrt (ebd.).\u201cDie bewusste Hinwendung der Aufmerksamkeit auf innere Gedanken und Gef\u00fchle sowie deren Anerkennen und Sein-Lassen z\u00e4hlen zu den Grundqualit\u00e4ten der Achtsamkeitspraxis. Ihre transformative Kraft liegt genau im akzeptierenden Gewahrwerden der eigenen aktuellen inneren Realit\u00e4t ohne diese ver\u00e4ndern oder manipulieren zu wollen. Die Kultivierung von Selbstmitgef\u00fchl und Selbstfreundlichkeit im Angesicht der eigenen \u00c4ngste bewirkt einen zugewandten, empathischen und f\u00fcrsorglichen Bezug auch zu den dunklen und problematischen Anteilen der eigenen Pers\u00f6nlichkeit. Nicht das Wegschauen und Verdr\u00e4ngen dieser Anteile tr\u00e4gt zur Entwicklung einer integrierten und souver\u00e4nen Pers\u00f6nlichkeit bei, sondern die Zuwendung, die Akzeptanz und das bewusste, selbstmitf\u00fchlende f\u00fcrsorgliche damit Sein.\u201eWenn irgend etwas helfen kann gegen K\u00e4lte als Bedingung des Unheils, dann die Einsicht in ihre eigenen Bedingungen und der Versuch, vorwegnehmend im individuellen Bereich diesen ihren Bedingungen entgegenzuarbeiten\u00a0\u2026\u00a0Das erste w\u00e4re darum, der K\u00e4lte zum Bewu\u00dftsein ihrer selbst zu verhelfen, der Gr\u00fcnde, warum sie wurde.\u201c Die Maxime \u201eZ\u00e4hne zusammen bei\u00dfen\u201c, um den \u00e4u\u00dferen Anschein von Coolness, Unersch\u00fctterlichkeit und Leistungsf\u00e4higkeit zu wahren, obwohl das Innere Angst, Scham, Trauer, Einsamkeit, Verletztsein oder Verwirrung erlebt, ist uns vor allem in Schulen begegnet, deren F\u00fchrungsstil wir als autorit\u00e4r, abwertend und von Konkurrenz bestimmt empfanden. Um dies zu ver\u00e4ndern, sind nach unserer Wahrnehmung in erster Linie die F\u00fchrungskr\u00e4fte gefragt, ihre eigene Pers\u00f6nlichkeit in einer Weise zu entwickeln, die Ehrlichkeit, Authentizit\u00e4t und ein wertsch\u00e4tzendes, warmes und pers\u00f6nliches Miteinander im Kollegium erlaubt und inspiriert. Zugleich fanden wir bei dem Gro\u00dfteil der Teilnehmenden sowohl in den Gespr\u00e4chen als auch in der Fragebogenerhebung Hinweise auf die signifikante Zunahme von Selbstmitgef\u00fchl. Sich selbst dank der \u00dcbungspraxis nun eine gute Mutter oder Freundin sein k\u00f6nnen, sind Sprachbilder, die uns mehrfach begeistert beschrieben wurden. Die in unseren Daten nachweisbare Korrelation der Zunahme an Selbstmitgef\u00fchl mit der Verbesserung der Arbeit im Team zeigt die Auswirkung einer weniger harten, freundlich zugewandten Beziehung zum Selbst auf die Kultur des Miteinander sehr deutlich. In den Schulen, wo wir eine K\u00e4lte in den Beziehungen unter den P\u00e4dagogInnen und auch in ihrem Umgang mit den Kindern sp\u00fcren konnten, fanden wir dagegen kaum Bereitschaft, miteinander Stille zu erleben, gemeinsam K\u00f6rper\u00fcbungen auszuprobieren und \u00fcber die eigenen Erfahrungen zu sprechen. Adorno beschreibt, warum aber genau solche Anregungen zu Introspektion und vertrauensvollem Austausch sinnvoll sein k\u00f6nnen:\u201eMeine Tochter ist im September in die erste Klasse gekommen und das war f\u00fcr sie, die sich darauf total gefreut hat, eine riesige Entt\u00e4uschung. Sie hat in den ganzen sieben Jahren ihres Lebens nie so viel geweint wie in den letzten zwei Wochen. Die Lehrerin ist ok, aber leider nicht sehr beziehungsorientiert, und es kommt mir vor, als w\u00fcrde sich mein Kind wie eine Nummer f\u00fchlen.\u201cBeziehungsk\u00e4lte in Schulen geht nach unseren Wahrnehmungen mit einem Gef\u00fchl der Unsicherheit einher und mit dem Wunsch, m\u00f6glichst wenig Zeit in der Schule zu verbringen. Besonders f\u00fcr die sehr jungen Sch\u00fclerInnen, die ein warmes und n\u00e4hrendes Umfeld Zuhause und im Kindergarten gewohnt sind, kann eine solche Atmosph\u00e4re traumatisch wirken. Eine Mutter beschreibt das im Gespr\u00e4ch mit uns so:nach Jahren eines eher technokratischen Berufsverst\u00e4ndnisses\u00a0\u2026\u00a0die Bedeutung der Lehrerpers\u00f6nlichkeit erneut in den Blick\u201c kam. \u201eUnter dem Motto \u201aBildung braucht Beziehung\u2018 kehrt das Interesse an der Lehrerhaltung\u00a0\u2026\u00a0vehement zur\u00fcck, vor allem beeinflusst durch Erkenntnisse der neurowissenschaftlichen Forschung, die mittlerweile belegen kann, dass die immer wieder betonte wertsch\u00e4tzende, empathische und authentische Haltung der Lehrkraft das Lernen der Sch\u00fcler f\u00f6rdert.\u201cGef\u00fchlsk\u00e4lte, Technokratie und sich wie eine Nummer zu f\u00fchlen, geh\u00f6rt leider noch immer zum Schulalltag vieler Kinder und Erwachsener. Auch Hochschulen und Universit\u00e4ten sind h\u00e4ufig davon gepr\u00e4gt. Doch sehen Monika Fiegert und Claudia Solzbacher  f\u00fchrt in seiner Analyse Forschungsergebnisse zum \u201emanipulativen Charakter\u201c an, die er und Max Horkheimer in der amerikanischen Emigration erarbeitet hatten:\u201eN\u00f6tig ist, was ich unter diesem Aspekt einmal die Wendung aufs Subjekt genannt habe.\u201c Es ist vor allem die Einladung, gemeinsam im Tun innezuhalten und Stille zu erleben, die in unseren Achtsamkeitsangeboten hier eine im wahrsten Sinne des Wortes \u201eZumutung\u201c darstellte. Sie erm\u00f6glichte allen, die sich darauf einlassen wollten, sich selbst und einander in einer Zustandsform kennenzulernen, die genau nicht von Manipulation, kaltem Aktionismus und technokratisch verdinglichter Verf\u00fcgungsgewalt \u00fcber die eigene Person sowie \u00fcber die KollegInnen und die Kinder gepr\u00e4gt ist. Statt solch blindem und oft aktionistisch lautem Tun und Machen finden in der stillen Introspektion die unmittelbaren menschlichen Erfahrungen ins Bewusstsein, die sich eher zaghaft, leise und warm im Da-Sein zeigen. Adorno formuliert sein Pl\u00e4doyer f\u00fcr eine not-wendige Selbstzuwendung so:\u201eThis embodied mind\u00a0\u2026\u00a0is that which governs the hand that is raised to hit or to caress and the mouth that is open to curse or to bless. You are the only one that has a\u00a0privileged direct access to your mind as I\u00a0have to my own. We are the only ones that can take responsibility for it. It seems like we need to engage in a\u00a0far more rigorous study of the mind and what it brings to the \u201acurriculum\u2018 so that \u201aeducation\u2018 as a\u00a0\u201amind-making practice\u2018 will indeed tackle the problem at its source.\u201cImmer wieder eine gemeinsame Zeit der Stille und des bewussten Nichtstuns zu erleben, in der die Aufmerksamkeit jeder Person freundlich eingeladen ist, offen, wertsch\u00e4tzend und mitf\u00fchlend das wahrzunehmen, was im eigenen Inneren und im gemeinsamen Miteinander aktuell pr\u00e4sent und sp\u00fcrbar ist, kann radikale und mit der Zeit auch kulturbildende \u201eWurzel\u201c-Erfahrungen erm\u00f6glichen. F\u00fcr den israelischen Bildungswissenschaftler Oren Ergas , S.\u00a0X liwas sie im Detail unterrichtet haben, als daran wie wir sie und wie wir uns in ihrer Gegenwart erlebt haben. Ber\u00fchren und inspirieren uns vielleicht besonders die introspektiven, selbstreflektierten P\u00e4dagogInnen, die ihre Werte und Haltung wirklich verk\u00f6rpern?Wer sich an P\u00e4dagogInnen erinnert, die im eingenen Leben eine inspirierende Rolle gespielt haben, wird sich in der Regel weniger an ihre Worte erinnern und daran, Sowohl im Rahmen des NRW-Landesprojekts \u201eGIK-Gesundheit, Integration, Konzentration\u201c, in den GAMMA-Schulen sowie aktuell mit 21\u00a0Schulen im Rheinland im Rahmen des aktuell vom NRW-Ministerium f\u00fcr Arbeit, Gesundheit und Soziales gef\u00f6rderten Projekts \u201eAmSeL-Achtsamkeits- und mitgef\u00fchlsbasierte Suchtpr\u00e4vention in Schulen\u201c in Kooperation mit der update Fachstelle f\u00fcr Suchtpr\u00e4vention in Bonn erleben wir, dass die Praxis von mitf\u00fchlender Achtsamkeit in Schulen nicht nur die einzelnen Personen und ihre Beziehungen st\u00e4rkt, sondern auch kulturgestaltend wirken kann. Voraussetzung daf\u00fcr ist, dass die Schulleitung einen F\u00fchrungsstil praktiziert, der Druck und Angst reduziert, der statt H\u00e4rte und Konkurrenz einen warmen und zugewandt freundlichen, humorvollen, auch herzlichen Umgang im Kollegium pflegt und der statt manipulativ technokratisch zu agieren, ein lebendiges gemeinsam gestaltendes Miteinander erm\u00f6glicht und f\u00f6rdert.Wir sehen hier ein gro\u00dfes Potenzial f\u00fcr die Bildung von Demokratief\u00e4higkeiten. Der NRW-Demokratiebericht LZpB , S.\u00a035 k\u201eDadurch entsteht auch eine Art Demokratieverdrossenheit. Viele glauben, sie k\u00f6nnen sowieso nichts bewirken, und sind dann offen f\u00fcr rechtsextreme Ideologien\u201c, sagt eine Sch\u00fclervertreterin  in Deutschland h\u00e4ufig, dass ihre Mitsprache bei der Gestaltung der Schulkultur unerw\u00fcnscht ist. n Anders . Unsere n Anders  die VerbDank der GAMMA-Fortbildung haben wir bisher die Corona-Krise mit Gelassenheit und Humor meistern k\u00f6nnen\u201c. Das freut uns sehr, wir bedanken uns herzlich f\u00fcr die inspirierende und sinnvolle Zusammenarbeit und w\u00fcnschen einen weiter guten Weg!Damit diese Transformation gelingen kann, braucht es einen langen Atem und das Engagement zumindest einiger P\u00e4dagogInnen pro Schule f\u00fcr die kontinuierliche und verk\u00f6rperte Inspiration. Der Schulleitung kommt dabei eine wesentliche Gestaltungsrolle f\u00fcr die Schulkultur zu. Die Bereitschaft und Geschwindigkeit jeder einzelnen Person f\u00fcr achtsames Innehalten, f\u00fcr Innenschau, \u00d6ffnung, mitf\u00fchlende Begegnung, f\u00fcr vertrauensvolle Gespr\u00e4che und gemeinsame Gestaltung haben wir in den Schulen dabei als sehr individuell und unterschiedlich erlebt. Freiwilligkeit, Freundlichkeit und Ausdauer sind daher wirklich unverzichtbare Aspekte der transformativen Bildung, die mit der bewusst introspektiven Wendung aufs Subjekt den Boden bereitet f\u00fcr eine humanistische und demokratief\u00f6rdernde Entwicklung der Organisationen und Kultur. Am Ende unserer Begleitung der Berliner Schule sagte der Schulleiter: \u201e"}
+{"text": "Die Programmplanung hat eine grundlegende Bedeutung f\u00fcr die Erwachsenen- und Weiterbildung und das Zustandekommen von Unterrichtssituationen und bedarf im Sinne der Professionalisierung einer wissenschaftlich gest\u00fctzten Dokumentation. Dabei stellen \u201aProgramme\u2018 den gr\u00f6\u00dferen konzeptionellen Rahmen von Angeboten dar und ben\u00f6tigen weitergehende p\u00e4dagogische- und Gestaltungskompetenzen bzw. eine entsprechenden Reflexion. Umgekehrt sind \u00fcber Programme Auslegungen von Bildung seitens der P\u00e4dagoginnen und P\u00e4dagogen, aber auch in der Gesellschaft, bei Tr\u00e4gerinstitutionen sowie auch bei Adressatinnengruppen rekonstruierbar  Drittmittelprojekten und Konsortien\u00a0\u2013 gefolgt von \u00dcbersichtspublikationen zu Fragestellungen, Zug\u00e4ngen, Verfahren und Ergebnissen der Programmforschung, wie: einem Lehrbuch von Fleige et\u00a0al. (https://die-bonn.de/li/250).e et\u00a0al. ; Zeitsche et\u00a0al. , Handbuce et\u00a0al.  und Hande et\u00a0al. . Diese uBislang eher in den deutschsprachigen L\u00e4ndern entwickelt ist die Tradition der Programmarchive\u00a0\u2013 ausgehend vom Volkshochschulprogrammarchiv am DIE, dem Programmarchiv des \u00d6sterreichischen Volkshochschularchivs und dem regional-tr\u00e4ger\u00fcbergreifenden Weiterbildungsprogrammarchiv Berlin/Brandenburg an der Humboldt-Universit\u00e4t zu Berlin. Programme und Angebotsank\u00fcndigungen als Datentypus unterscheiden sich dabei von Anbieterstatistikdaten, wie sie f\u00fcr das Bildungsmonitoring herangezogen werden; dies u.\u202fa. dadurch, dass sie geplante und nicht bereits realisierte Angebote abbilden und mit studienbezogenen Untersuchungskategorien auswerten  an die Programmforschung herangetragen werden, welche theoretischen Zug\u00e4nge, Verfahren und Methoden herangezogen und ggf. verschr\u00e4nkt werden, und was die Programmforschung zur Ausdifferenzierung des Wissens \u00fcber Erwachsenen- und Weiterbildung und \u00fcber das professionelle Handeln in diesem Bildungsbereich beitr\u00e4gt.Programmanalysen  zu bezeichnenden Untersuchungen ausdifferenziert haben (auch Gieseke und Robak in diesem Heft). Programmanalysen nehmen Bezug auf das Programm als Spezifikum der Erwachsenenbildung. Um \u00fcber Programmanalysen grundlegende Aussagen \u00fcber die Aufgaben und Organisationen der Erwachsenen- und Weiterbildung zu treffen, werden komplexe Designs und Instrumente angewendet. Zus\u00e4tzlich werden inzwischen elektronische Datenbanken und Repositorien von insbesondere Programmarchiven in die Programmforschung eingebracht, mit digitalen Suchfunktionen und M\u00f6glichkeiten zur Korpusbildung\u00a0\u2013 ebenso wie digitale Analysetools  bezeichnen. Gleichwohl finden sich in dieser Heftnummer auch Beitr\u00e4ge, die andere Verfahren anwenden. Insbesondere deren Bezug zu Programmarchiven r\u00fcckt sie dabei in eine besondere N\u00e4he zu Programmanalysen, machen sie zu einem weiteren Zugang zur Programmforschung.Aus den Kombinationen dieser Differenzkategorien ergeben sich Wiltrud Gieseke und Steffi Robak \u201eBildungsforschung als Zugang um gesellschaftliche Wirklichkeit zu erschlie\u00dfen\u201c leitet die Programmforschung forschungshistorisch umfassend her und verbindet diese Betrachtungen mit methodentheoretischen Reflexionen sowie Betrachtungen zu Kodeb\u00fcchern als methodischem und gegenstandstheoretischem Grundbezugspunkt von Programmanalysen. Dabei wird auch die Bedeutung unterschiedlicher Studien als Beitrag zur Ausdifferenzierung des Wissens \u00fcber Erwachsenen- und Weiterbildung in der jeweiligen historischen Situation und diachron herausgearbeitet. Die Autorinnen verdeutlichen damit auch erkenntnistheoretische Ankn\u00fcpfungspunkte f\u00fcr andere Disziplinen.Der Fokusbeitrag von Es folgen f\u00fcnf Originalbeitr\u00e4ge zu aktuellen Untersuchungen\u00a0\u2013 die entweder Angebote und Programme mit Programmanalysen, Angebotsanalysen oder mit digitalen Tools wie Text Mining-Verfahren analysieren  oder das Programmplanungshandeln auf der Grundlage von Interviews und Gruppendiskussionen untersuchen  und die Befunde methodisch, theoretisch und thematisch diskutieren.Drei der f\u00fcnf Beitr\u00e4ge er\u00f6ffnen Zug\u00e4nge zur Forschung \u00fcber Programme und Angebote, zwei legen dabei Programmanalysen im o.\u202fg. engeren Sinne vor, und wiederum zwei nutzen Programmarchive bzw. Repositorien. Der Fokus liegt auf dem Organisationstypus Volkshochschule und seinen Programmstrukturen unter einer spezifischen, jeweils neuen Fragestellung. Im Spiegel zeithistorischer Anforderungen an die Programmplanung machen drei der f\u00fcnf Beitr\u00e4ge Aussagen zur Gestaltung von Programmen und Angeboten unter den Bedingungen der Coronapandemie. Diese sehr zeitaktuellen Beitr\u00e4ge stehen wiederum im Kontrast zu zwei anderen Beitr\u00e4gen, die historisch, l\u00e4ngsschnittlich und vergleichend auf Programme blicken. Bernd K\u00e4pplinger \u201eArbeitspl\u00e4ne und Leitideen in der Weimarer Republik\u00a0\u2013 Divergente Richtungen der Volkshochschulen in Bremen und in Gie\u00dfen\u201c ist der historischen Programmforschung zuzurechnen. Der Beitrag gibt einen \u00dcberblick \u00fcber historische Arbeitsplan- und Programmanalysen insbesondere mit dem Fokus auf Volkshochschulen. Er kontrastiert empirisch mit einer qualitativen Programmanalyse die Arbeitspl\u00e4ne der Volkshochschulen Bremen und Gie\u00dfen mit einem Schwerpunkt auf den Vorworten bzw. Leitbildern w\u00e4hrend der Weimarer Republik und arbeitet detailliert sehr interessante Differenzen heraus. Dar\u00fcber hinaus diskutiert er inwiefern Arbeitspl\u00e4ne bzw. Programme  Angebotskommunikationen sind und zeigt die Vielfalt der historischen Leitideen der Volkshochschulen auf.Der Artikel vonErik Nylander und Daniel Holmer f\u00fchren in \u201eSeismographs to Society? Tracing Topics from Swedish folk high schools through Large-scale Text Analysis 1954\u20132007\u201c das neuetablierte Programmarchiv zu einem schwedischen Typus von Volkshochschulen (Folkh\u00f6gskola) ein, welches als digitales Repositorium entstanden ist und verdeutlichen dessen forschungstheoretische und historiographische Bedeutung. Ihre einflie\u00dfende Parallelbetrachtung zur Volkshochschularbeit in Deutschland \u00f6ffnet f\u00fcr einen vergleichenden Blick. Die Autoren verkn\u00fcpfen den Aufbau des Repositoriums mit einer Perspektive f\u00fcr Programmforschung unter Anwendung gro\u00dfangelegter Textanalysen mit digitalen Tools und pr\u00e4sentieren Topic Modelling-Ergebnisse. Die l\u00e4ngsschnittliche Analyse setzte es sich zum Ziel, Ver\u00e4nderungen von Themen und Kursbeschreibungen aufzusp\u00fcren und im Kontext von Ver\u00e4nderungen im schwedischen System der Erwachsenen- und Weiterbildung (demokratiebildungsbezogenen) zu interpretieren.Falk Scheidig untersucht \u201eDe(n) \u201aCorona-Schock\u2018 als Digitalisierungsschub? Eine vergleichende Programmanalyse zu Angeboten politischer Erwachsenenbildung an Volkshochschulen unmittelbar vor und w\u00e4hrend der Pandemie\u201c. Den Autor interessiert, ob sich das Verh\u00e4ltnis von Online- und Pr\u00e4senzveranstaltungen durch die Pandemie ver\u00e4ndert hat, dies speziell in der Politischen Bildung. Um hier eine gr\u00f6\u00dfere Anzahl von Programmen bzw. Ank\u00fcndigungen untersuchen zu k\u00f6nnen, nutzt er das digitale bzw. digitalisierte VHS-Programmarchiv am DIE und diskutiert dessen Bedeutung f\u00fcr die Forschung  f\u00fcr Programme). Der Autor wertet Programme von drei\u00dfig VHS quantitativ aus (und beschaffte f\u00fcr diese Stichprobe aktuelle Anschlussprogramme selbst) und relationiert Unterrichtsstunden und Formate. Die Ergebnisse geben Hinweise f\u00fcr weitergehende Forschung, da sich noch keine klaren Entwicklungsrichtungen ausmachen lassen.Erik Haberzeth und Stefanie Dernbach-Stolz fragen in \u201eProgrammplanung in der Weiterbildung unter dem Einfluss der Corona-Pandemie: Resultate einer empirischen Studie zu neuen Anforderungen\u201c danach, wie sich die Programmplanung durch die Corona-Pandemie ver\u00e4ndert hat. Hierzu haben sie 10\u00a0Gruppendiskussionen mit Planenden gef\u00fchrt und vor dem Hintergrund des Modells der Wissensinseln (Gieseke) ausgewertet. Als Wissensinseln fokussiert haben sie Bed\u00fcrfnis- und Zielgruppenanalyse sowie die Angebotsentwicklung und arbeiten heraus, wie wichtig diese f\u00fcr die in ihrer Bedeutung gestiegene Profilbildung sind. Besonders interessant in den Ergebnissen ist auch die Verdeutlichung der gestiegenen und ausdifferenzierten Anforderungen an das professionelle Handeln der Planenden, insbesondere in den Bereichen des Entscheidens und Begr\u00fcndens des eigenen Handelns, was unter anderem den Kern professionellen Handelns ausmacht.Claudia Kulmus betrachtet in \u201eSeniorenbildung in der Pandemie: Programmplanung zwischen Erstarrung und Innovation\u201c in einer Interviewstudie Planungsstrategien in der Pandemie in Einrichtungen mit Bildungsangeboten f\u00fcr \u00c4ltere. Hierbei unterscheidet sie vier traditionelle Bildungsorte f\u00fcr \u00c4ltere . Besonders interessant ist an den Ergebnissen die Herausarbeitung von vier Planungsstrategien entlang von zwei Dimensionen . Bei den Planungsstrategien werden so sichtbar: eine kontinuierliche digitale Innovation, eine strukturelle Innovation, ein abwartendes Situationsbeobachten, ein Wunsch nach R\u00fcckkehr zum Alten. Theoretisch schlie\u00dft die Autorin dabei hier an Modellbildungen zu Planungsstrategien innerhalb der Forschung zum Programmplanungshandeln  an.usammen mit weiteren aktuellen Beitr\u00e4gen der Programmforschung (siehe die o.\u202fg. Online-Bibliografie unter https://die-bonn.de/li/260) einen aktuellen Einblick in diese Forschungsrichtung.Die hier versammelten Artikel ergeben zSarah Widany, Elisabeth Reichart, Nicolas Echarti und Kerstin Hoenig fokussiert auf der Grundlage einer Auswertung aktueller WB-Monitor-Daten (Sonderbefragung) und der VHS-Statistik die Entwicklung von Programmstrukturen w\u00e4hrend des ersten Corona-Lockdowns und diskutiert sie im Hinblick auf ihre Bedeutung f\u00fcr den Bereich der Erwachsenen- und Weiterbildung. Die Befunde eines Angebotsr\u00fcckgangs einerseits und einer Zunahme an Einzelveranstaltungen andererseits bed\u00fcrfen dabei, so die Autorinnen und der Autor, weitergehender Untersuchungen\u00a0\u2013 auch unter Hinzunahme von Programmanalysen.Der Artikel von Martin Reuter, Caroline Dietz und Laureen Fr\u00f6hlich nach \u201eP\u00e4dagogik, Legitimation und Ressourcen im Kontext von Qualit\u00e4tsmanagementsystemen\u00a0\u2013 Herausforderungen in organisationalen Feldern der Weiterbildung aus neo-institutionalistischer Perspektive\u201c. Sie unterscheiden diese f\u00fcr vier Typen von Weiterbildungsanbietern und analysieren inhaltsanalytisch Unterschiede und Gemeinsamkeiten in den Auswirkungen und Handhabungen von Qualit\u00e4tsmanagementsystemen entlang der Kategorien \u201eLegitimation\u201c, \u201eP\u00e4dagogik\u201c und \u201eRessourcen\u201c, welche sie neoinstitutionalistisch ableiten.WB-Monitor-Daten von 2017 nutzend, fragen Annika Felix, Sarah Berndt, Jasmin Dabitz und Paul Schubert bezieht sich wiederum auf die Erwachsenen- und Weiterbildung unter pandemischen Bedingungen, hier im Spiegel der Teilnehmendenforschung. Die Autorinnen und der Autor fragen nach \u201eWissenschaftliche(r) Weiterbildung \u00c4lterer in Zeiten der COVID-19-Pandemie\u00a0\u2013 Sichtweisen von Teilnehmenden an \u201aStudieren ab\u00a050\u2018 der Universit\u00e4t Magdeburg\u201c. Dazu wurden Teilnehmende des Jahres 2021 befragt. Mittels Regressionsanalysen wird beschrieben, wie sich das Teilnahmeverhalten in der Pandemie \u00e4nderte und welche Faktoren dabei eine Rolle spielten (auch Zusammenspiel bisheriger Teilnahmeerfahrungen und neuer Faktor Kontaktangst). Die Ergebnisse werden im Hinblick auf zuk\u00fcnftige Programmgestaltungen diskutiert.Der Beitrag von Sophie Lacher rundet die Heftnummer ab.Eine Rezension zu \u201eErich Sch\u00e4fer, Antje Ebersbach: Die digitale Transformation in der Weiterbildung. Befunde, Konzepte und Perspektiven\u201c von Wir bedanken uns bei allen Autorinnen und Autoren sowie Gutachterinnen und Gutachtern f\u00fcr ihre Beitr\u00e4ge und w\u00fcnschen allen Lesenden interessante Einblicke."}
+{"text": "This study provides a decision-making basis for regional flood disaster management from the perspective of FRES.Global climate change has led to flood disasters increasing in terms of frequency and damage caused, which seriously threatens urban and rural security. The flood regulation (FR) service function of the ecosystem plays an important role in mitigating flood disaster risk. Previous studies on flood regulation ecosystem services (FRES) are still lacking in a cross-scale assessment of supply and demand, refined simulation of regional complex hydrology, and application of spatial zoning management. Taking the Fujian Delta as an example, this study established a cross-scale research framework based on the social-ecosystem principle. The SWAT model was used to simulate the regional hydrological runoff and calculate the macro-scale supply of FRES. Taking patches of land as units, a flood risk assessment model was constructed to calculate the micro-scale demand for FRES for urban and rural society. Through a comparison of supply and demand across spatial scales, a zoning management scheme to deal with flood disaster risk was proposed. The results showed that: (1) The supply of FRES differed greatly among the sub-basins, and the sub-basins with low supply were mostly distributed in the lower reaches of Jiulong River and the coastal areas. (2) The demand for FRES was concentrated in high-density urban built-up areas. (3) By comparing the supply and demand of FRES in sub-basin units, 2153 km Global warming has led to frequent extreme rainfall, and floods have become one of the major disasters threatening the security of urban and rural human settlements ,2. In 20Existing studies have made abundant achievements in the analysis of the FRES mechanism ,13,14, tFirstly, it is necessary to strengthen the research on the supply and demand of FRES across spatial scales. In recent years, the comparison of FRES supply and demand has attracted extensive attention from many disciplines ,12,18, bSecond, it is necessary to improve accuracy when measuring FRES supply and demand. Most of the existing measurement methods of FRES supply are calculated by hydrological environment simulation ,6, for eThirdly, the application level of the research results for the spatial zoning management of flood risk should be improved. At present, the matrix method , value eBased on the above analysis, we propose the following solutions: (1) Regarding the comparison of FRES supply and demand, the concept of \u201cservice spatial flow\u201d  is intro2 and a permanent resident population of 19 million in 2020. The northwest is dominated by mountains, while the southeast is coastal hilly landform, with the highest altitude of 1819.63 m. The mountains and seas are staggered, and the terrain varies greatly  was calculated using Landsat 8 remote sensing images. Based on a geospatial data cloud, DEM elevation data were obtained, and the slope was further calculated by GIS . Land-usThe socio-ecological system is composed of human society and the living environment . Under h2. Land patch is the smallest spatial unit used to analyze the spatial heterogeneity of flood disaster risk in this study. There are many ways to divide land patches, and this study uses 100 m \u00d7 100 m grid units.The term sub-basin refers to dividing the region into several catchment units according to watershed and catchment characteristics for the convenience of detailed research. In this study, the sub-basin is the catchment unit that forms surface runoff, and it is also the basic analysis unit of surface runoff simulation in SWAT model to study the impact of the ecosystem on surface runoff and flood regulation. The size of the sub-basin depends on the specific research needs. In this study, the area of each sub-basin was no less than 50 kmBased on the concept of service spatial flow, cross-scale comparisons are possible. That is, in the watershed space, the FRES demands of the microscopic land patches are pooled into the sub-basin unit, and the FRES supply of the macroscopic sub-basin unit is decomposed into the land patches, to realize the cross-scale comparison of supply and demand. Therefore, the technical route of this research is shown in The SWAT model was selected to simulate and rate surface runoff. SWAT is a distributed watershed hydrological model based on the GIS platform which is mainly used to predict the impact of hydrology, sediment, and chemical substances in the flow domain of land-use planning . Its sim2 and NS between the monitoring data and the optimal simulated value.SWAT-CUP is a connector program that connects optimization programs with SWAT to conduct sensitivity and uncertainty analyses of the SWAT model on behalf of users, and realize model calibration and verification. The program considers all sources of uncertainty, and the degree of uncertainty is measured using P-factor  and R-factor . After obtaining the appropriate P-factor and R-factor, the goodness of fit was further quantified by R2) and efficiency coefficient  [Firstly, based on the requirements of SWAT data format, the land-use database, soil database and meteorological database of the study area were reconstructed ,42. Secor short)  were user short) .(1)PBIA2 (unitless) is as follows [The calculation formula of correlation coefficient R follows .(2)R2=[The calculation formula of efficiency coefficient NS (unitless) is as follows .(3)NS=13) in time period j, respectively. 3), respectively. The supply capacity of FRES in a sub-basin unit can be determined by the ratio of the hydrological regulation of the ecosystem in the unit to the rainfall . Based oi (unit: m3). i (unit: m). i (unit: m). i (unit: km2).i (unit: %). i in a certain return period (unit: m).The demand for FRES is closely related to the risk of flood damage. The higher the risk level, the stronger the demand for FRES. The risk level of flood damage is affected by the hazard of disaster-causing factors, the sensitivity of the disaster-prone environment and the vulnerability characteristics of disaster-bearing bodies ,45. AmonBased on the above analysis, this study selected assessment indicators to measure the social demand for FRES from four aspects: hazard of disaster-causing factors, sensitivity of disaster-prone environments, exposure of the disaster-bearing body, and adaptability of the disaster-bearing body. The names and meanings of each indicator are shown in We used the AHP method and entropy weight method to calculate the index weight. Firstly, the range normalization method was adopted to make the data dimensionless. Then the AHP method and entropy weight method were used to calculate the weight value of the index, respectively. Finally, the distance function and linear combination method were used to obtain the comprehensive weight value of each index .The steps to determine the weight of indicators using the AHP are as follows. First, five experts in the field of flood disaster research from relevant research institutions distribute the weight evaluation table of FRES demand assessment index. In the table, each expert is asked to compare the importance of indicators at all levels of flood disaster risk in pairs, and the judgment scale is 1\u20139. Then, weight opinions are collected for pairwise comparison of each indicator. Based on YAAHP platform, the hierarchical structure model is constructed, and the expert score of pairwise comparison of indicators is used as the calculation basis to establish a pair judgment matrix of indicators at all levels. Finally, after calculation, the consistency ratio (CR) values of the index judgment matrix of the target layer, criterion layer, and indicator layer are all lower than 0.1, indicating that the calculated results of the index weight value pass the consistency test.The formula for calculating the comprehensive weight is as follows.The calculation formula of the distance function is as follows.The equations of distance function and weight distribution coefficient are as follows.Based on the principle of social-ecosystem ES supply and demand, the FRES demand in each land patch can be mapped to its sub-basin units, and the relationship between the supply and demand of FRES can be compared at the macro-scale. The FRES demand of each land patch in the sub-basin unit is pooled, and the FRES demand is calculated by taking the sub-basin as the unit. The formula is as follows.2). 2).Then, we can compare the FRES supply and demand in sub-basins at the macroscopic watershed scale. Using the quantile method, each sub-basin is divided into high-supply-type and low-supply-type units according to the level of FRES supply, and into high-demand-type and low-demand-type units according to the level of FRES demand. Through spatial superposition processing, four types of regions are identified: \u201clow supply\u2013high demand\u201d, \u201chigh supply\u2013high demand\u201d, \u201clow supply\u2013low demand\u201d, and \u201chigh supply\u2013low demand\u201d . Then, tBased on the social-ecosystem ES supply and demand principle, the FRES supply of sub-basin units is decomposed to each land patch in the watershed, and the relationship between the supply and demand of FRES is compared at the micro-scale with land patch as the unit. The ratio of FRES supply and demand of each land patch is calculated as follows .(15)SDR2). 2). The higher the ratio of FRES supply and demand, the stronger the flood-bearing resilience. The lower the ratio of FRES supply and demand, the greater the risk of flood, so the flood control and drainage planning measures should be further strengthened. This provides a basis for the zoning of flood control and the formulation of corresponding management strategies at the micro-scale of land patches.2 is greater than 0.6, the efficiency coefficient NS is greater than 0.5, and the percentage deviation PBIAS is less than 25%  and (5) are used to calculate the surface runoff regulation capacity of each sub-basin unit ecosystem in the Fujian Delta, namely, the supply level of FRES . It can Cronbach\u2019s alpha coefficient is used to test the reliability level of the input data of the flood disaster risk assessment model . AccordiModel (6) was used to calculate the demand index for FRES in the Fujian Delta . It can We compared the supply and demand of stormwater regulation services at the macro-scale by taking the sub-basin as the unit and identifying the sub-basin units with an imbalance in supply and demand, to provide a basis for the ecological spatial zoning management plan to cope with rain and flood risk. Model (14) was used to calculate the sum of the FRES demands of all land patches in each sub-basin unit . It can The sub-basin was taken as a unit to compare the relationship between supply and demand of FRES in Fujian Delta, and four sub-basin units were identified, namely, low supply\u2013high demand, high supply\u2013high demand, low supply\u2013low demand and high supply\u2013low demand . Among tBased on the above analysis, from the perspective of coping with flood risk, the ecological space  in each sub-basin unit was divided into primary, secondary, and tertiary ecological protection areas and non-ecological protected areas. The space required for ecological restoration (cultivated land and bare land) was divided into primary, secondary ecological restoration areas, and non-ecological restoration areas . Among t2. These land patches are mainly distributed in the coastal areas of Xiamen, Quanzhou and the middle and lower reaches of Zhangzhou Jiulong River Valley. Due to the imbalance in FRES supply and demand, it is urgent to improve flood disaster adaptability through flood control projects.Based on land patches, the micro-scale ratio of FRES supply and demand was calculated, and the land patch units with an imbalance between supply and demand were identified to provide a basis for formulating the zoning intervention plan of built-up areas to cope with flood risk. Model (15) was used to decompose the FRES supply of the sub-basin into each land patch, and the ratio of FRES supply and demand in the land-patch unit was calculated . The nat2, and the construction land area within its scope is 65.42 km2, involving Quanzhou Fengze cluster, Jinjiang and Shishi Center cluster, Xiamen Jimei Houxi cluster, and Zhangzhou Xiangcheng cluster which is divided into the primary intervention area (In the regions with a low ratio of FRES supply and demand, the urban and rural construction land patches were extracted and used as the specific scope of flood control facilities construction in the Fujian Delta. According to the classification results of the ratio of FRES supply and demand, the areas with a low ratio were divided into the lowest type, the lower type, and the slightly lower type, and the construction land patches within the scope correspond to the primary, secondary, and tertiary flood control project intervention areas, respectively . For exaion area . In the The main contribution of this study is to construct a cross-spatial framework for comparing supply and demand of regional FRES based on the concept of \u201cservice spatial flow\u201d from a socio-ecosystem perspective. On the one hand, the FRES demand of land patches was collected to the sub-basin unit, and the sub-basin unit with an imbalance in the supply and demand of FRES was identified, so the ecological space that needs to be protected and the non-ecological space that needs to be repaired in the unit were extracted. On the other hand, the FRES supply of the sub-basin was decomposed into the land-patch units, so the land patches with an imbalance between the supply and demand of FRES were identified, and the built-up areas that urgently need flood control project intervention were extracted. In the application of the technology, the SWAT model and the SWAT-CUP calibration model were used to simulate the real hydrological formation process in a complex environment which enhanced the reliability of the FRES supply\u2019s measurement results. In the flood risk assessment index system, the index of adaptability of the disaster-bearing body reflecting the disaster reduction and relief ability was added, which improves the accuracy of the FRES demand measurement. Regional spatial governance schemes such as ecological protection zoning, ecological restoration zoning, and flood control intervention zoning to cope with flood risk were formed in this study, which improves the application of such research results in practice.2, NS and PBIAS. In fact, there are many verification methods for surface runoff simulation [The SWAT-CUP verification results of surface runoff simulation in Fujian Delta show that the simulated values were in good agreement with the actual measured values of hydrological stations, and the simulation effect of the SWAT model was good, which can better reflect the regional hydrological formation process. Therefore, the FRES supply results in the Fujian Delta, calculated based on surface runoff, have high reliability. Based on SWAT-CUP, we verified the simulated values of surface runoff using Rmulation ,42. For mulation . TherefoIn the flood risk assessment, the index of inundation scope was adopted in relevant studies to assess the hazard of disaster-causing factors . HoweverAt present, the practical application research in this paper is mainly focused on the optimization of FRES capacity in sub-basins. For example, from the perspective of coping with flood risk, the zoning scheme of ecological space protection, ecological restoration, and flood control intervention is proposed. However, less consideration was given to ecosystem protection measures in the upper reaches of the sub-basin. In fact, the upstream ecosystem contributes to the regulation of surface runoff in the downstream sub-basin ,22, whicIn this study, due to the incomplete overlap between the administrative boundary and the watershed boundary and the complex distribution of coastal catchment areas, the sub-basin division results based on the SWAT model did not cover the entire Fujian Delta, and 4.88% of the regions were not included in the comparative study of FRES supply and demand. In the future, the factor and weight of surface runoff regulation rate can be calculated by the neural network algorithm ,39, and By comparing the relationship between the supply and demand of regional FRES, this study draws a zoning management plan, which provides a decision-making basis for regional flood risk management. Compared with previous studies, this study has three advantages. Firstly, based on the socio-ecosystem perspective and applying the concept of \u201cservice spatial flow\u201d, a cross-spatial scale comparison method of regional FRES supply and demand was proposed. This realizes the identification of ecological space in need of protection by sub-basins and the identification of construction land in need of flood control intervention by land patches. Second, the SWAT model and SWAT-CUP calibration model were used to simulate the real hydrological formation process in the regional environment, and the index of adaptability of the disaster-bearing body was added to the storm flood risk assessment, which enhanced the accuracy of the measurement results of FRES supply and demand. Thirdly, the zoning schemes of ecological space protections, ecological restorations and flood control interventions were proposed to deal with flood risk, which improved the application of our research results in spatial management practices.2 ecological spaces of 71 \u201clow supply\u2013high demand\u201d sub-basin units were classified as the primary ecological protection areas, and 914 km2 of cultivated land and bare land were classified as the primary ecological restoration areas by pooling the FRES demands of each land patch into sub-basin units and comparing the supply and demand of FRES. By allocating FRES supply of sub-basin to land-patch units, and comparing FRES supply and demand, 65.42 km2 construction land in 13,257 land-patch units with the lowest supply and demand ratio was classified as the primary intervention area. The above spatial regionalization results can be connected with the practical spatial management mechanism represented by territorial spatial planning and provide support for the spatial zoning management of flood risk from the perspective of FRES.Taking Fujian Delta as an example, the study shows that the FRES supply varies greatly among the sub-basins, and the sub-basins with a low supply are mostly distributed in the lower reaches of Jiulong River, coastal areas, and other low-lying areas that are strongly affected by urbanization. The demand for FRES in high-density urban built-up areas is much higher than that in ecological and agricultural spaces. Adding the index of adaptability of the disaster-bearing body to the demand assessment of FRES can help to distinguish the spatial differences in internal demand in built-up areas and identify the land patches that most need flood control interventions. The 2153 km"}
+{"text": "Emotion unit, Opportunity unit and Capability unit. To test the relationships between influencing factors and middle-aged online consumers\u2019 interactive motivation, the partial least-squares path modelling and variance-based structural equation modelling (PLS-SEM) have been applied on the SmartPLS. By analysing 450 samples, the study shows that the counterfeiting concern and ease of use factors positively impact online consumers\u2019 motivation to interact with online experts, and self-efficacy plays a negative role.This paper presents a study of middle-aged online consumers\u2019 specific shopping behaviour on live streaming platforms and analyses the distinct marketing strategy provided by online experts. Influenced by unique social and cultural backgrounds, middle-aged online consumers lack related shopping experience and keep counterfeiting concerns to live streaming shopping, making them prefer to interact with online experts before making final decisions. Based on the COM-B Behaviour Changing theory and the Emotional attachment theory, the research model has been established in this study, and it divides influencing factors into the  Unlike the traditional online shopping model, live streaming shopping established on live streaming platforms (LSPs) can help online consumers reach a broad market, purchase products at reduced costs and interact with sellers in real time  and partial least squares (PLS) path modelling based on SmartPLS 2.0 for data analysis and model testing. The analysis of the measurement model and structural model is implemented on the SmartPLS 2.0, which is suitable for the research model study and meets the research aims , and average variance extracted (AVE) can be used by this research to evaluate the reliability , supporting Hypothesis 1. Middle-aged online consumers\u2019 self-efficacy negatively affects their motivation to interact with online experts , supporting Hypothesis 2. The ease of use of LSPs also positively influences middle-aged Chinese online consumers\u2019 motivation to interact with online experts , supporting Hypothesis 3. Meanwhile, the motivation to interact with online experts has a positive impact on middle-aged online consumers\u2019 trust with them , supporting Hypothesis 4, and the trust building with online experts also positively influences middle-aged Chinese online consumers to purchase the products recommended by online experts , supporting Hypothesis 5.According to the data analysis results presented in Table Based on the research results, several key findings can be presented. Firstly, the counterfeiting concern factor positively influences middle-aged Chinese online consumers\u2019 motivation to interact with online experts. Considering middle-aged Chinese online consumers\u2019 unique social and cultural backgrounds, they think that seeking advice from online experts is a reliable strategy to avoid the uncertain situation and prevent counterfeiting risks. Secondly, there is an apparent relationship between middle-aged online consumers\u2019 self-efficacy and the motivation to interact with online experts. Given that many middle-aged online consumers lack comprehensive education, they are not familiar with live streaming shopping mode and tend to interact with online experts who can present professional certificates. Conversely, younger consumers who have high self-efficacy could rely on their judgements rather than online experts\u2019 recommendations. Thirdly, the ease of use of LSPs positively affects middle-aged Chinese online consumers\u2019 motivation to interact with online experts. This is because, different from traditional social media platforms, LSPs provide a comfortable environment for middle-aged online consumers and online experts. Various advanced functions, such as real-time video and group chat, benefit them to interact with online experts. Meanwhile, the motivation to interact with online experts positively affects middle-aged Chinese online consumers to build trust with them. This can explain why more and more online experts focus on their interactive skills, including marketing, advertising and communication skills. Finally, as hypothesis 5 shows, once online consumers build trust with online experts, they will be willing to purchase the recommended products. Hence, for online experts who want to boost product sales, interacting with online consumers and winning their trust are efficient marketing strategies to increase sales.Opportunity and Capability units, which benefits researchers to explore consumer behaviours from macro and micro levels. Finally, this study combines the Emotional attachment theory with the COM-B Behaviour Changing model, and it claims the emotional factor would also significantly impact individuals\u2019 motivation. Although existing literature refers to the Emotional attachment theory and applies the Emotion factor named counterfeiting concern to the study of online consumers\u2019 shopping behaviour, none of them evaluates the counterfeiting concern impact on middle-aged Chinese online consumers. Thus, when the research is developed in unique social and cultural backgrounds, scholars need to consider the influence of the Emotion unit on individual thinking and behaviours. This updated theoretical framework has a significant contribution to future studies relevant to social and cultural climates on LSPs.Compared with previous studies, several theoretical implications are significant for future research. Firstly, regarding the unique social and cultural background, middle-aged online consumers from China are influenced significantly by traditional thinking characteristics, which can be reflected in the counterfeiting concern factor. To be specific, because of the traditional shopping experiences and conservative thinking way, middle-aged Chinese online consumers are more easily influenced by the counterfeiting concern factor than young consumer groups. Meanwhile, due to experiencing the difficult period when the economic system is unimproved, some middle-aged Chinese consumers prefer to think back and forth to avoid unnecessary financial trouble before making a final purchase decision. This explains why middle-aged Chinese online consumers tend to consult experts rather than make purchasing decisions alone. Thus, future study related to China\u2019s social and cultural context needs to focus on the difference between different age groups and explore their shopping behaviours based on their particular backgrounds. Moreover, this paper applies the COM-B Behaviour Changing theory to analyse middle-aged Chinese online consumers\u2019 specific live shopping behaviours, which could be the first application of this theory in consumer behaviour research. According to the COM-B research theory, the factors that affect individuals\u2019 motivation can be divided into With the popularity of online experts on China\u2019s LSPs, this study is of great significance to enhance middle-aged online consumers\u2019 live shopping awareness and improve the live streaming market environment. Specifically, most middle-aged Chinese online consumers have the motivation to interact with online experts because of the professional certificate displayed by experts. However, some experts might use their reputation for false advertising products, adversely impacting online consumers\u2019 live shopping experience. Therefore, to enhance middle-aged Chinese online consumers\u2019 live shopping awareness, it is necessary for related departments to change their thinking habits and encourage them to reassess the products\u2019 quality. Besides enhancing middle-aged Chinese online consumers\u2019 shopping awareness, this study also has a practical implication for online experts\u2019 marketing strategies. As the data results present, the interaction with online consumers has a direct positive impact on the trust building between online consumers and online experts, driving online consumers to purchase products. Thus, from an online experts\u2019 marketing perspective, if they aim to increase product sales constantly, they need to take advantage of their reputation and improve their interaction quality, including marketing and communication skills.Opportunity can be divided into physical and social opportunities. The ease of use is designed based on physical opportunity. Future studies will consider social opportunities, like related policies issued by local governments. Finally, considering that some middle-aged consumers lack online platform-using skills, it could hinder them from attending online surveys. Thus, in future studies, both online and offline surveys will be promoted, benefiting comprehensive data collection.Although this study contributes to future research related to live shopping analysis, there are still limitations that need to be improved in the prospective study. Firstly, the issues related to online experts have also happened in Western LSPs, but the findings of this research cannot be directly applied to Western LSPs\u2019 research because of social and cultural background differences. Meanwhile, online consumers from different age groups, educational backgrounds and occupations could have different using preferences. This requires future studies to promote multi-group analysis based on these moderating factors. Therefore, in future research, scholars should not only focus on the comparison of online consumers between Eastern countries and Western countries but also develop a deep division of online consumer groups. Furthermore, based on the COM-B theory established by Michie et al. , the OppIn conclusion, most middle-aged Chinese online consumers prefer to communicate with online experts due to their particular social experience and cultural background. However, due to the absence of monitoring mechanisms on LSPs, some online experts could make false propaganda to increase their income. To solve this problem, this paper explores what factors would influence middle-aged Chinese online consumers to interact with online experts and purchase the products recommended by them. Based on the research model, the paper presents the process of trust building between middle-aged online consumers and online experts, and it also presents the impact of the emotional factor on online consumers\u2019 live shopping behaviours. The paper aims to enhance online consumers\u2019 live shopping awareness and improve the live streaming market environment by giving the relationships among different factors."}
+{"text": "Objective: The aim of this study is to establish a suitable animal model of chronic kidney disease\u2013mineral and bone disorder (CKD\u2013MBD) by comparing CKD\u2013MBD rat models induced by 5/6 Nx, AN, and UUO, accompanied by a low-calcium and high-phosphorus diet.Methods: Sprague\u2012Dawley rats were randomly divided into four groups: control group, 5/6 nephrectomy (5/6 Nx) group, Adriamycin nephropathy (AN) group, and unilateral ureteral obstruction (UUO) group. Serum biochemical indices were measured to evaluate renal function, mineral and bone metabolism, the severity of CKD\u2013MBD, and the status of bone transformation. Hematoxylin\u2013eosin staining (HE) and Masson\u2019s trichrome (Masson) staining were used for histopathological analysis of the kidney. Goldner\u2019s trichrome (Goldner) and tartrate-resistant acid phosphatase (TRAP) staining were utilized to observe bone mineralization and osteoclasts in the femur, respectively. Micro-CT images were applied to study the structure of the femur. The expression levels of osterix and cathepsin K in the femur were measured by immunohistochemistry (IHC) to confirm the status of bone transformation.Results: The levels of serum creatinine (Scr) and blood urea nitrogen (BUN) in the 5/6 Nx and AN group rats were significantly higher than those in the control rats, and this change was accompanied by marked changes in the levels of calcium (Ca), phosphate (Pi), intact parathyroid hormone (i-PTH), fibroblast growth factor 23 (FGF23), osteocalcin (OC), and cross-linked C-telopeptide of type 1 collagen (CTX-1); UUO group rats exhibited slight and inconsistent variations in the levels of Scr, BUN, Ca, Pi, i-PTH, FGF23, OC, and CTX-1 in serum. Histopathological analysis of the kidney showed that the UUO group rats suffered serious fibrosis and 5/6 Nx group rats exhibited severe focal calcification. Histopathological analysis of the femur showed that the AN group rats had minimal bone mineralization and that the 5/6 Nx group rats had overactive osteoclasts. Micro-CT revealed that the AN model had the most severe bone destruction and that the 5/6 Nx model had the least severe bone loss among the three models. The expression of cathepsin K in the femur was significantly increased in all models, while the expression of osterix in the femur was only significantly increased in the 5/6 Nx model.Conclusion: 5/6 Nx, AN, and UUO accompanied by a low-calcium and high-phosphorus diet successfully induced CKD\u2013MBD in rats. The 5/6 NX model presented the progression of high-turnover bone disease, with consistency between biochemical indices in serum and histomorphometric analysis of the femur, and the AN and UUO models developed a severe deterioration in bone quantity and severe bone resorption; however, the changes in biochemical indices were subtle in the UUO model, and liver injury was obvious in the AN model. Chronic kidney disease\u2013mineral and bone disorder (CKD\u2013MBD) is a common complication of chronic kidney disease (CKD), with an incidence in developing countries from 33.3% to 81% of CKD patients . CKD\u2013MBDIn recent years, 5/6 nephrectomy (5/6 Nx) , adeninead libitum. This study was approved by the Experimental Animal Welfare and the Ethics Committee of Chongqing Hospital of Traditional Chinese Medicine (2022-DWSY-WQ). The experiment complied with the State and hospital\u2019s regulations and ethical requirements for experimental animal studies.Sprague\u2012Dawley rats  were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd., (SCXK (Xiang) 2019-0004) and housed under standard conditions in a light-, temperature-, and humidity-controlled environment at the Experimental Animal Center of Chongqing Hospital of Traditional Chinese Medicine (SYXK (Yu) 2020-0001). The rats were provided rodent chow and water X group, AN group, and UUO group  for 8\u00a0weeks.In the UUO group , six ratThe body weight of the rats was monitored every week during the experimental period. At the fifth week after the first operation, the rats were anesthetized with isoflurane, and then blood was taken from the fundus venous plexus\u2019 individual capillaries. At the eighth week after the first operation, the rats were euthanized under isoflurane anesthesia, and blood was collected from the abdominal aorta and centrifuged at 800 \u00d7 g for 10\u00a0min. Serum was collected and kept at \u221280\u00b0C for analysis with commercial kits and enzyme-linked immunosorbent assay (ELISA). The left kidney and both hind femoral bones (2\u00a0cm above and below the knee joints) were harvested and stored for histopathological examination and IHC staining.Scr, BUN, Ca, and Pi levels in serum were measured using commercial kits  and a microplate reader .FGF23, i-PTH, OC, and CTX-1 levels in serum were determined by ELISA kits . All experimental procedures were performed following the manufacturer\u2019s instructions.Kidney samples collected from the rats under anesthesia were fixed in 4% phosphate-buffered paraformaldehyde  (pH 7.4) for 24\u00a0h and embedded in paraffin. Serial sections (5\u00a0\u00b5m thick) were obtained, immersed in xylene and alcohol, stained with hematoxylin for 5\u00a0min, immersed in 1% acid ethanol (1% HCl in 70% ethanol), rinsed with distilled water, stained with eosin for 3\u00a0min, and immersed in alcohol and xylene. Renal fibrosis was assessed by Masson\u2019s trichrome staining according to the manufacturer\u2019s instructions . The sections were mounted using synthetic resin and pathologically examined under a light microscope  by a pathologist who was blinded to the treatment groups.The right femur samples fixed in 4% paraformaldehyde were decalcified with EDTA decalcification agent  for 3\u00a0weeks. The specimens were dehydrated, defatted, and sliced with a Leica RM2016 microtome  at a thickness of 4\u00a0\u03bcm, and then HE, Goldner\u2019s, and TRAP staining was performed according to the manufacturer\u2019s instructions .The left femur samples fixed with 4% paraformaldehyde were scanned with a micro-CT SkyScan 1276 system . The scan settings were as follows: voxel size: 10.157810\u00a0\u03bcm; medium resolution, 85\u00a0kV, 200\u00a0uA; 1-mm Al filter; and integration time: 384\u00a0ms. Density measurements were calibrated to the manufacturer\u2019s calcium hydroxyapatite (CaHA) phantom. Analysis was conducted with the manufacturer\u2019s evaluation software. Reconstruction was accomplished by NRecon (version 1.7.4.2). 3D images were obtained from contoured 2D images by methods based on a distance transformation of the grayscale original images . 3D and 2D analyses were performed using CT Analyzer software (version 1.18.8.0). The bone microarchitecture of the distal femur and the region of interest (ROI) was analyzed by determining parameters including the bone mineral density (BMD), total tissue volume (TV), bone volume (BV), bone volume ratio (BV/TV), bone area (BS), bone surface density (BS/TV), trabecular bone number (Tb.N), trabecular bone thickness (Tb.Th), and trabecular bone separation (Tb.Sp).Femur sections were subjected to IHC staining and analyzed as previously described . The femp < 0.05.All data were analyzed using GraphPad Prism version 8.0 . Comparisons between groups were performed using one-way ANOVA. The data are presented as the mean \u00b1 standard deviation (SD). Statistical significance was set at Compared with those in the control group, the rats in all three CKD\u2013MBD model groups showed slower body weight gain. Notably, the body weight of the AN group rats did not show any increase over the 8\u00a0weeks but instead decreased. Statistical analysis revealed that the body weights of rats in the 5/6 Nx group, the UUO group, and the AN group were significantly lower than those of rats in the control group at the age of 15\u00a0weeks .X group and the AN group were significantly increased , except for the Pi level in the AN group  (p < 0.05) (p < 0.05)  . In acco < 0.05) . These r < 0.05) .According to the CKD\u2013MBD guidelines , i-PTH, HE staining showed that all the rats in the three model groups exhibited pathological alterations in the kidney, including renal tubular epithelial cell edema and inflammatory cell infiltration (indicated by the black arrow), to a certain degree, but focal calcification (indicated by the white hollow arrow) was observed only in the 5/6 Nx group . Masson\u2019HE staining of femurs showed some degree of trabecular bone disorder (indicated by the black arrows) in all model rats, with the more severe disorder being observed in the AN group . GoldnerMicro-CT 3D reconstructions of femurs showed that the structure of the distal femur was destroyed in all the three model groups; however, the damage was less severe in the 5/6 Nx group than in the other groups . The BMDAccording to the experimental results reported previously, the bone volume in the model rats was changed. Therefore, the levels of osterix, a typical marker of bone formation, and cathepsin K, a marker for bone resorption, were examined to assess bone formation and bone resorption. Although the expression of osterix in all the three model groups was increased, it was only significantly increased in the 5/6 Nx model compared with the control group . AdditioPatients with CKD experience mineral and bone metabolism disturbance, which results in an increased risk of fracture, especially for those on dialysis . It is cIn the present study, we generated rat models of bone disease associated with renal insufficiency by 5/6 nephrectomy, Adriamycin injection, and UUO accompanied by consumption of a low-calcium and high-phosphorus diet to provide information for the study of CKD\u2013MBD. The 5/6 Nx model animals, which were fed a high-phosphorus diet to induce hyperphosphatemia, suffered acute injury with creatinine clearance that was approximately equivalent to late stage 4 or 5 CKD in humans . TherefoIn CKD diagnosis, renal function is always evaluated by measuring the levels of Scr and BUN in serum, and then the estimated glomerular filtration rate (eGFR) is calculated based on the level of Scr. Furthermore, the stages of CKD are classified according to the eGFR level . With thvice versa. In this study, accumulation of Pi, exhaustion of Ca, and excessive secretion of i-PTH in serum were observed in the 5/6 Nx model rats at the eighth week of the experiment, and the variation trend was consistent with that observed in CKD\u2013MBD patients; elevation of serum FGF23 levels, which corresponded with increases in Pi and i-PTH levels, was also observed in the 5/6 Nx model rats. Therefore, it is clear that 5/6 Nx induced high-turnover bone disease in rats under our experimental conditions. However, UUO model rats exhibited less marked changes in the levels of Pi, i-PTH, and FGF23 during the experiment. Because both serum i-PTH and FGF23 levels can be used to predict the occurrence of high-turnover bone disease, but not low-turnover bone disease (According to the CKD\u2013MBD guidelines , the lev disease , it is d disease . Unfortu disease  because  disease . Further disease . In the In addition to hyperphosphatemia, hypocalcemia, and secondary hyperparathyroidism, active proliferation of osteoblasts and osteoclasts is typical of high-turnover bone disease and leads to excessive bone formation and resorption and eventually bone destruction because of the lack of Ca and overload of Pi . TherefoIn UUO model rats, the serum levels of creatinine, Pi, i-PTH, FGF23, OC, and CTX-1 were similar to those in the control group; however, the histopathological analyses micro-CT imaging and IHC all showed that UUO model rats exhibited increased bone resorption. This inconsistency might be attributed to the compensatory effect of the normal contralateral kidney on renal excretion function, which makes it difficult to determine the metabolic status of bone according to serum biochemical indices. According to a previous report, obstructive nephropathy usually occurs within approximately 2\u00a0weeks in end-stage CKD . TherefoAN resulted in rapid progression of renal injury during the early period of the experiment; eventually, obvious bone destruction was observed at the end of this experiment. Unfortunately, we did not observe the transformation of bone formation and absorption in the femur, and it is possible that we did not collect femur samples at the most appropriate time. However, utilizing AN to model bone disease and study the course of progressive CKD in rats and humans may provide insight into both normal and abnormal physiology if the timeline of experiments is selected prudently as AN can rapidly induce severe kidney injury. It is worth noting that we observed focal swelling of hepatocytes, multifocal focal necrosis, inflammatory cell infiltration around the portal area, and fibrous tissue hyperplasia in the AN model rats, suggesting that Adriamycin may lead to liver injury ; thus, t5/6 Nx induced remarkable variations in Ca, Pi, and i-PTH levels in serum and progression of renal injury. It also led to high turnover of bone formation and absorption according to the levels of OC and CTX-1. These changes were consistent with the findings of histopathological staining and micro-CT imaging. Thus, the 5/6 Nx model can be used to easily investigate the progression of high-turnover bone disease on this experimental schedule.Overall, 5/6 Nx, AN, and UUO accompanied by a low-calcium and high-phosphorus diet successfully induced CKD\u2013MBD in rats. The AN and UUO models exhibited deterioration in bone quantity with rapid and severe bone resorption at the end of the experiment; however, the changes in the biochemical indices were subtle in the UUO model, and liver injury was obvious in the AN model. The 5/6 Nx model presented high-turnover bone disease at the end of the experiment, with consistency between serum biochemical indices and femur histomorphometric parameters.In conclusion, 5/6 Nx, AN, and UUO accompanied by a low-calcium and high-phosphorus diet can result in CKD\u2013MBD. On our experimental schedule, the 5/6 Nx model exhibited high-turnover bone disease, which is easy to evaluate according to serum biochemical indices and histomorphometry. The AN and UUO models presented severe bone resorption and deterioration in bone quantity at the end of the experiment, according to histomorphometric analysis of the femur."}
+{"text": "Differences in the NIR spectra of the muscles were observed at wavelengths of around 976 nm, 1180 nm, and 1430 nm, associated with water and fat content . The classification of individual muscle samples was achieved by linear discriminant analysis (LDA) with acceptable accuracies (68\u201394%) using the second-derivative NIR spectra. The results indicated that NIR spectroscopy could be used to identify individual goat muscles.Adulterated, poor-quality, and unsafe foods, including meat, are still major issues for both the food industry and consumers, which have driven efforts to find alternative technologies to detect these challenges. This study evaluated the use of a portable near-infrared (NIR) instrument, combined with chemometrics, to identify and classify individual-intact fresh goat muscle samples. Fresh goat carcasses  from different animals  were used and separated into different commercial cuts. Thus, the  Meat identification and authentication is one of the applications for which near-infrared (NIR) spectroscopy is considered a valuable tool, as reported by different authors ,4,5,6,7.It has been recognised that the so-called classical analytical techniques are expensive, laborious, time-consuming, and not appropriate to the modern challenges facing the food and meat industries. Therefore, the demand to guarantee the authenticity and safety of both meat and meat products has increased the interest in developing rapid analytical techniques in food and meat industries ,3,4,5. ALongissimus thoracis (LT) and L. lumborum (LL), with great success (coefficient of determination > 0.70) [Although NIR spectroscopy has been applied to different commercial and exotic meats  ,13,14, n > 0.70) .Psoas major muscle and not from some inferior muscle.Although the focus has been on the adulteration of meat using cheaper alternative species, few studies have evaluated the adulteration of expensive fresh meat cuts with cheaper cuts in the same animal species . TypicalThus, the aim of this study was to evaluate the use of a portable near-infrared (NIR) instrument combined with linear discriminant analysis (LDA) to identify, as well as classify, individual and intact goat muscle samples.longissimus thoracis et lumborum (LTL), biceps femoris (BF), semimembranosus (SM), semitendinosus (ST), supraspinatus (SS), and infraspinatus (IS). The total number of muscle samples collected and scanned was 210 (35 goats \u00d7 6 muscles each).Fresh goat carcasses (n = 35) from different breeds and sexes , production systems , and two different experiments were analysed after being slaughtered in a commercial abattoir in Queensland . The samples were obtained from two different experiments, where in experiment 1, both male and female goat animals were slaughtered, while in experiment 2, only male goats were analysed. The breeds used in these studies were Boer, Boer crosses, and Australian rangeland goats. The goat carcasses were weighed after 24 h (range of 6 to 28 Kg cold carcass weight) and cut in different commercial cuts , as described by other authors . In this\u00ae. Each muscle was scanned in triplicate, and the average of these spectra was used in further chemometric analysis.The NIR spectra of the individual goat muscle samples were collected using a portable NIR instrument  operating in the wavelength range of 950\u20131600 nm (10 nm wavelength resolution). The spectra collection and instrument set-up were controlled using the proprietary software provided by the instrument manufacturer . The spectral data acquisition settings were set at a 50 ms integration time and an average of 50 scans . For every 10 samples, a reference spectrum was collected using SpectralonThe NIR data were exported into The Unscrambler  for data analysis and pre-processing. The NIR spectra were pre-processed using the Savitzky\u2013Golay second derivative  prior to spectra interpretation and chemometric analysis . In thisThe classification results using LDA based on the second-derivative NIR spectra of the individual muscle samples are reported in We also attempted to discriminate muscles according to genotype . When all muscle samples were analysed together, a classification rate ranging between 52 and 58% was achieved. Thus, comparisons between Boer buck and Australian rangeland, Boer cross, and Australian rangeland, as well as Boer cross and Boer buck, were made separately. Muscle samples were classified correctly with an 80% rate when Boer buck and Australian rangeland were compared. For the other two groups, although an improvement in the classification rate (correct classification around 70%) was achieved, the muscles belonging to the Boar cross were not correctly classified. This might be explained by the fact that Boer buck and cross goats are more genetically similar compared with the Australian rangeland animals. The results of this study indicated that NIR spectroscopy was able to identify the origin of the muscles using intact samples . These results indicate that NIR use can also be extended to other species and muscles as a high-throughput tool to identify the origin of the meat.This study reported the use of a portable NIR spectrometer combined with chemometrics to characterise and identify different goat muscle samples. Differences in the NIR spectra of the muscles were observed around 970 nm, 1242 nm, 1397 nm, and 1428 nm associated with water and fat content . The classification of individual muscle samples showed that samples could be classified with accuracies ranging from 68% to 94% using the second-derivative NIR spectra. Muscles that are in the same anatomical location, such as the IS and SS, were correctly classified by NIR spectroscopy. Overall, the results of this study indicated that NIR spectroscopy could be used to characterise and identify different intact goat muscle samples. In future, we can expect an improvement in the NIR models by incorporating samples from other commercial and production conditions, as well as different genetics. The findings of this research might be extended to other species and types of muscles produced and sold within a commercial facility with the several advantages NIR provides, such as the low cost and the fact that this technique it is non-destructive."}
+{"text": "ACVRL1, ENG, SMAD4, and GDF2, all encoding for proteins involved in the TGF\u03b2/BMPs signaling pathway. The clinical diagnosis of HHT is made according to the \u201cCura\u00e7ao Criteria,\u201d based on the main features of the disease: recurrent and spontaneous epistaxis, muco-cutaneous telangiectases, arteriovenous malformations in the lungs, liver, and brain, and familiarity. Since the clinical signs of HHT can be misinterpreted, and the primary symptom of HHT, epistaxis, is common in the general population, the disease is underdiagnosed. Although HHT exhibits a complete penetrance after the age of 40, young subjects may also present symptoms of the disease and are at risk of severe complications. Here we review the literature reporting data from clinical, diagnostic, and molecular studies on the HHT pediatric population.Hereditary Hemorrhagic Telangiectasia (HHT) or Rendu\u2013Osler\u2013Weber Syndrome (ROW) is an autosomal dominant vascular disease, with an estimated prevalence of 1:5000. Genes associated with HHT are  Hereditary Hemorrhagic Telangiectasia (HHT), formerly known as Rendu\u2013Osler\u2013Weber disease, is an autosomal dominant vascular dysplasia.Historically, credit is given to Henry G. Sutton  for his Shortly thereafter, new observations were added to Sutton\u2019s. Benjamin Guy Babington noted that, in some families, nosebleeds could be an inherited trait ; Henry RSince then, a large amount of clinical epidemiological and genetic data has been produced, extensively reviewed by Jamie McDonald and David A. Stevenson .HHT affects at least one million people worldwide, but its true prevalence is difficult to evaluate, as the full clinical picture may be evident only in adulthood, and the disease is often underdiagnosed . In factACVRL1, ENG, and SMAD4. In the last decade, GDF2 was reported to be causative of HHT in fewer than 20 cases.HHT is classified as an autosomal dominant disorder, and data from formal genetics have been confirmed by the demonstration of heterozygous mutations in three main genes: Very large pedigrees spanning over many generations and including tens of cases are known in each HHT center, and their presence suggests that fitness of patients is not (severely) reduced, although no detailed studies are available; penetrance increases during the lifetime, and, in adulthood, over the age of 40, it is estimated to be above 95% .ENG)  was the first disease-related gene to be identified in 1994 [ACVRL1)  [Endoglin  in one of the two above-mentioned genes, and HHT1 nowadays refers to patients carrying mutations in nes HHT2 . All detnes HHT2 . Up to ned genes .ACVRL1 was found in the same patient. Each pathogenic variant was transmitted independently to two different family branches [One single case is reported in which a germinal mosaicism involving branches .SMAD4 gene  [GDF2 gene  [A small number of cases (approximately 2%) shows a complex clinical picture, including the clinical signs of Juvenile Polyposis Syndrome (JPS) and HHT, and carries mutations in the  605120) . The exi 605120) .ENG encodes endoglin, a type III receptor mainly expressed in endothelial cells; ACVRL1 encodes a serine/threonine receptor kinase R3, ALK1, which is a type I cell-surface receptor for the TGF-superfamily of ligands, and it is predominantly expressed in endothelial cells as well [SMAD4 encodes a protein acting as the nuclear signaling effector in the same pathway; and GDF2 encodes the secreted ligand BMP9, which represents the physiological ligand for ALK1.There is a general agreement stating that HHT originates from loss of function of proteins coded for by genes of the transforming growth factor beta (TGF-\u03b2) signaling pathway : ENG enc as well ; SMAD4 eA clinical diagnosis of HHT is established when at least three out of four of the internationally accepted Cura\u00e7ao criteria are present in the index case: (i) epistaxis, (ii) mucocutaneous telangiectases in characteristic locations, (iii) visceral lesions, and (iv) a first-degree relative diagnosed with HHT on the basis of the preceding criteria ; the diaThe issue of using the Cura\u00e7ao criteria in children and teenagers has been addressed in detail by Pahl et al. . They weHowever, in 2021, Matti et al. considered, in addition to the Cura\u00e7ao Criteria, nasal endoscopy as a diagnostic tool to improve sensibility and specificity of early diagnosis in pediatric age. Specifically, they conducted a cross-sectional observational study in which they included 70 children from 47 different families. Each child had a parent with a clinical or genetic diagnosis of HHT. They observed that, \u201cThe median age at the onset of epistaxis was 5 years , which is earlier than the average of 12 years frequently reported in the literature but in accordance with other recently reported data in pediatric populations\u201d. They demonstrated that the integration of nasal endoscopy increased the diagnostic sensitivity of the Cura\u00e7ao criteria .For clinical symptoms (and diagnostic criteria) such as epistaxis or telangiectasia, the low incidence in lower age groups may hamper the clinical diagnosis both in patients who belong to known HHT families and in patients who will develop the disease because of a de novo mutation.Often, the diagnosis of HHT is delayed for several years after clinical signs become evident, and this can be at least partially explained by the variable and late penetrance of the different symptoms. However, once the diagnosis of HHT is obtained and confirmed by the demonstration of a pathogenic mutation in the index case, the issue of testing for the presence of potentially life-threatening alteration becomes of high priority and deserves careful attention in all family members, including children.Epistaxes, in general, are very frequent in children, with over 50% of them having the experience of at least one episode, and among them, about 8% requiring treatment  . The samGonzalez et al.  providedTelangiectases are common in the general population, but those associated with HHT are found in specific sites, as the lips, tongue, oral cavity mucosa, fingertips, gastrointestinal (GI) mucosa, and nasal mucosa. Those on the nasal mucosa are obviously present concurrently with epistaxes, while those in other sites appears later, with about one third of cases reporting their appearance before the age of 20 ; telangiBleeding from telangiectases may be copious and not easy to stop due to the absence of contractile elements in the vessel walls; however, even if the pathological changes are always the same, telangiectases of nasal mucosa bleed more easily and frequently than those of any other site. Telangiectases are unlikely to be a major problem in childhood.Arterovenous malformations (AVM) in the liver, lungs, or central nervous system (CNS) are the most relevant clinical features in adults and represent one of the Cura\u00e7ao criteria. They may also be present at young ages, without concurrent epistaxis or telangiectases, causing severe clinical complications. Morbidities arise from bleeding or shunting; in some cases, they are life threatening, and their clinical signs may appear suddenly. Therefore, even the occasional observation of the presence of isolated AVMs deserves further investigation, including molecular testing, of the patient and his/her family, to achieve or exclude a diagnosis of HHT. In the case that a diagnosis of HHT is confirmed, a thorough clinical work-up should be offered to all family members, regardless of their age.The occurrence of AVMs  in pediaIn two cases, the diagnosis in the child led to the diagnosis of HHT in an asymptomatic parent, who nevertheless carried pulmonary AVMs, thus strengthening the existence of extended clinical variability and the need for accurate clinical evaluation of all family members at risk of being carriers of the disease-causing mutation.In the same paper, when the AVM was localized in the brain, the presenting symptoms were seizures or hemiparesis, and the presence of the clinical picture in two cousins allowed for the identification of a large family. In all cases but one, molecular analysis identified either ENG or ACVRL1 mutations.Krings and coworkers , attemptThe congenital nature of both pulmonary and cerebral AVMs is still a matter of debate ,36,37. IJoining the data from several authors, and similarly to clinical presentation in adults , pulmonaThe association of a higher risk to develop pulmonary AVMs (as well as epistaxis and telangiectasia) with carriers of ENG mutations was confirmed in children, with figures similar to those reported in the large French-Italian study , which iHepatic AVMs are more frequently associated with mutations in ACVRL1 and have been reported in a wide range of subjects, spanning from 32% to 78% of adults, with only 8% of them showing clinical symptoms. This high variability is at least partially explained with the different methods of ascertainment (sonography or CT scan) ,40,41.In children, although in a very small series of cases (only 19), hepatic AVMs were found in 47% , by testRelevant cases with clinical evidence of neonatal HHT, also for hepatic AVMs, have been reported , althougIntestinal AVMs are rare in children, but, in one case at least, intestinal bleeding was evident at birth ,47.The improvement of methods to detect prenatal malformations led to the diagnosis of HHT even in utero, although only in exceptional cases; Saleh et al.  reportedIn the aftermath of US/MRI diagnosis in both patients, molecular evidence was obtained for mutations in ENG and ACVRL1 respectively. It is regrettable to note that in both cases, familial evidence for HHT was already available  or couldIn conclusion, considering that AVMs can be observed also in pediatric age, although rarely, and that they are often amenable to therapeutic intervention, offering genetic tests to identify young mutation carriers should be mandatory.In symptomless children in whom a pathogenic mutation is demonstrated, non- or minimally-invasive tests are available for a front-line evaluation of the patient: oxygen finger saturation, bubble heart ultrasound, neonatal brain ultrasound, and general medical control once a year.Based on the results of these tests, the appropriate management of the child can be decided: from simply clinical follow-up once a year, to more invasive and frequent tests, up to clinically invasive procedures such as embolization, when needed.This approach considers both the age of AVM onset and the age-related penetrance variability.In addition to the above discussed clinical signs, which overlap with diagnostic criteria, heritable pulmonary arterial hypertension (HPAH) , a rare BMPR2 being the most commonly mutated gene, and is diagnosed at a younger age in ACVRL1 mutation carriers, compared to BMPR2 mutation carriers and to idiopathic PAH. In about 30% of cases, HPAH in ACVRL1 carriers is diagnosed below the age 18 [ACVRL1 and PAH has been mostly studied starting from a clinical diagnosis of PAH, but Olivieri et al. [ACVRL1 mutations had increased values of pulmonary artery systolic pressure.HPAH is recognized by several disease-causing genes, e age 18  and in se age 18 . In the i et al.  demonstrACVRL1 should be screened first.These data clearly suggest that a thorough search for the presence of HHT criteria must be performed in the index cases and in family members of any case of PAH in whom a genetic diagnosis is not yet available, regardless of his/her age. If the Cura\u00e7ao criteria are recognized in the family, ACVRL1; (ii) the diagnosis of HHT followed the diagnosis of a very severe PAH (requiring lung transplantation) in IV,9; criteria for the diagnosis of HHT were present in several family members, but underestimated for many years; (iii) IV,9 became pregnant and successfully delivered a male baby; (iv) after genetic counseling, a genetic test in the newborn was performed about 3 days after birth and demonstrated that the mutation was not present. It is obvious how relevant it was to identify the baby as a non-carrier: reassurance of the parents was associated with the identification of the baby as a subject not requiring, at any age, any HHT- or PAH-related clinical investigation.The family described in Alterations of cortical development are new clinical features that have also been recently reported in several cases of both adults and children affected with HHT ,54. KlosIn conclusion, even if the first clinical descriptions of HHT are more than 100 years old, evidence is available suggesting that the phenotypic spectrum can be further expanded; thus, reporting unusual findings in HHT patients, even in single cases, is a valuable method to gain further information on the disease phenotype.To the best of our knowledge, no report has been published suggesting reduced fitness in HHT, and the repeated description of large multigeneration families is in keeping with the presence of normal reproductive skills in HHT patients. Most pregnancies in women affected by HHT have a normal course and outcome; for instance, miscarriage and prematurity are observed as frequently as in the general population . MaternaPrenatal presentation of HHT is possible in cases of severe anatomical abnormalities ,49, so, Of course, if the familial pathogenic mutation is known, prenatal molecular testing becomes feasible using any fetal cell type, with chorionic villi or amniotic fluid cells as the most common. The recent advances in non-invasive prenatal tests for monogenic disorders, discloses this possibility also for HHT .Prenatal genetic testing should be extensively discussed during genetic counseling; while the identification of the pathogenic mutation causing the disease in the family can be easily obtained, conversely, the demonstration of the mutation in fetal cells will not give any information useful to forecast disease course or severity.One pro for prenatal testing is definitely the possibility of reassuring parents if the mutation is absent, but a relevant cons are represented by the risk of creating unmotivated anxiety. In addition, a genetic test yielding the same information can be quickly obtained at birth. Certainly, a prenatal molecular test must not be performed without clear parental comprehension of all its consequences, including fetal risks associated with chorionic villi sampling.As for any other genetic disorder, genetic counseling is a fundamental part of disease management, and it is appropriate to offer it to any patient and, in particular, to young adults who are affected or at risk. It must be given by a specifically trained counselor, who will discuss all the HHT-related issues, such as: (i) risk evaluation for being carrier of a pathogenic mutation for all close relatives of an index case; (ii) genetic and clinical heterogeneity; (iii) concerns of genetic testing, family planning and prenatal diagnosis. The counselor also needs to have a good knowledge of the disease, to integrate genetic and clinical data in a general overview, particularly in young ages, when application of clinical diagnostic criteria may be unsuccessful to identify affected children ,22.Genetic counseling is of the greatest importance in explaining molecular analyses results to the families: clinical significance of a pathogenic mutation and its impact on the family; clinical and genetic significance of a negative result (no mutation found); how to manage the presence of VUS (variants of unknown significance).Faughnan et al., in 2020  publisheTesting asymptomatic children of an HHT parent was highly recommended, with 94% agreement. In fact, there is good evidence for the relevance of testing in identifying subclinical or presymptomatic disease in children .Screening asymptomatic children \u201cwith HHT or at risk for HHT\u201d for pulmonary or brain AVMs at the time of presentation/diagnosis yielded a strong recommendation, but the agreement for screening for pulmonary AVMs was much higher than for brain AVMs (94% vs. 86%). There is a large agreement (98%) for treatment of large pulmonary AVMs associated with oxygen saturation reduction, and the same is true for brain AVMs if high-risk features are present. As expected, the relevance of genetic counselling to help decision processing is stressed.It is underlined how the medical attitude about screening for brain AVMs may vary greatly in different countries, and how the patients\u2019 representatives who collaborated in the drafting of these guidelines were in favor of screening.Genetic testing in children has been a matter of debate for a long time, and the British Society for Human Genetics , in 2010In addition, genetic testing should also be considered if necessary to prevent serious harm to other family members.Children at risk for HHT, based on available data on the disease, are in fact at risk for several clinical problems for which therapeutic interventions are  available; thus, there is a good indication for genetic testing.Several methods can be used to identify a pathogenic mutation, and both clinical and family history will suggest the best choice, always after appropriate genetic counseling.The easiest scenario is, of course, the one in which a child belongs to a family with a known proven diagnosis of HHT and in which a pathogenic mutation is known. Given the autosomal dominant mode of inheritance of HHT, any child born to a clinically affected parent in whom a pathogenic mutation has been identified has a 50% chance of carrying the same mutation. We may consider two different circumstances: (i) The child is completely symptomless, as it may be in newborns. Clinical surveillance is indicated; invasive tests should be avoided. Genetic testing is certainly needed and should be performed after extensive genetic counselling with the family, discussing the pros and cons of testing asymptomatic children. Moreover, \u201clabelling\u201d an asymptomatic person as a mutation carrier and an HHT patient in an unpredictable future is an issue to be discussed. (ii) The child shows any HHT-related symptom (even mild epistaxis). Testing should be offered and performed as soon as possible. In both cases, the indication is to test only for the familial mutation.A second scenario is when the child shows HHT-relatable clinical signs, but no clinical and molecular diagnosis have already been obtained in the family, in which, however, some other members show clinical symptom. In this case, an accurate first-degree relative\u2019s workup should be performed, first testing the subject best fitting the HHT diagnosis.Finally, in the third scenario, the child shows a clinical picture suggestive of HHT in the presence of a completely negative family history. Of course, occasional causes of sporadic mild epistaxis should have previously been ruled out.In the latter two cases, an old approach is the serial single-gene testing, performing sequence analysis of ACVRL1 and ENG first, followed by deletion/duplication analysis of the same genes if no pathogenic variant is found. Analysis of SMAD4 becomes the first choice if any evidence of association with HHT and intestinal polyps is available. Additional genes  will be analyzed if no mutation is found. However, this method is time-consuming and expensive and is nowadays outdated. Better options are: (i) Testing the index case with an NGS multigene panel specifically designed for HHT, including all the above-mentioned genes. The main limitation is that the number of included genes, and thus the panels\u2019 sensitivity, may vary in different laboratories; furthermore, all multigene panels designed for a specific disease will change over time. (ii) Whole exome sequencing followed by in silico analysis of the genes of interest. The great advantage of the latter is that in silico analyses can be repeated, even after years, without requiring a new blood sample from the patient, if a mutation has not been found after the first results analysis or if a novel clinical diagnosis suggests the involvement of different genes.Again, the results of genetic testing must always be given to the families within a genetic counseling session (see above).The laboratories testing HHT-related genes with any method must, of course, have all the expertise to decide how and when further genetic analyses  are indicated.If a pathogenic mutation is found in a child who is the first member of the family to be tested, after appropriate genetic counseling, mutation analysis should be extended to parents first, and then to all other family members at risk of having inherited it.Annual follow up by a general practitioner (familiar with HHT) could be appropriate, considering the specific clinical picture of the patient.Epistaxes may recur after treatment also, and nasal endoscopy in children can be repeated without any major problem in order to assess if any further treatment is indicated .Pulmonary AVMs may become evident or increase with time  to control abnormal vessel development. Although some encouraging results have been reported, their use is limited to selected adult cases with severe epistaxis ,61,62.All other therapies available for adults can be offered also to children, after accurate clinical evaluation of the patient. For instance, the youngest patient undergoing argon plasma coagulation was 6 years old in the series of cases reported by Khan et. al. .Treatment of brain AVMs may include embolization, stereotactic radiosurgery, and surgery, and can be applied to children as young as 1 year of age . The resPulmonary AVMs in children, as in adults, can similarly be treated by embolization . It is n"}
+{"text": "Frailty, sarcopenia and malnutrition are powerful predictors of clinical outcomes that are not routinely measured in patients with non-small cell lung cancer (NSCLC). The primary aim of this study was to investigate the association of sarcopenia, determined by the psoas muscle index (PMI) with overall survival (OS) in patients with advanced NSCLC treated with concurrent immune checkpoint inhibitor (ICI) and chemotherapy (CTX).We retrospectively reviewed data from a cohort of patients with locally advanced or metastatic NSCLC who were treated between 2015 and 2021 at the University of Virginia Medical Center. The cross-sectional area of the psoas muscle was assessed on CT or PET/CT imaging prior to treatment initiation. Multivariate analysis was performed using Cox proportional hazards regression models.A total of 92 patients , 48 (52.2%) men and 44 (47.8%) women, were included in the study. The median follow-up was 29.6 months. The median OS was 17.8 months. Sarcopenia, defined by a PMI below the 25th percentile, was associated with significantly lower OS . Multivariate analysis revealed that sarcopenia , ECOG \u2265 2 , prognostic nutritional index  and the absence of immune related adverse events  were independently associated with inferior OS.Sarcopenia is independently associated with poor OS in patients with advanced NSCLC undergoing concurrent ICI and CTX. Frailty is a state of increased vulnerability to stressors due to a decline in function and reserves across multiple physiologic systems , 2. In lThe prognosis of patients with advanced lung cell cancer is dependent on patient- and disease-specific factors. The former commonly includes age, sex, body mass index (BMI) and performance status. However, sarcopenia is not routinely considered in the assessment due to lack of standardization. The European Working Group on Sarcopenia in Older People (EWGSOP) proposed a muscle mass of two standard deviations below healthy adults as an operational definition of sarcopenia and various technologies including Dual x-ray absorptiometry (DXA), computed tomography (CT), magnetic resonance imaging (MRI), and bio-impedance analysis (BIA) have been recommended for evaluation of muscle mass \u201313. In pWe performed a retrospective analysis of the PMI and intramuscular adipose content (IMAC) in a cohort of patients with locally advanced or metastatic NSCLC. The primary aim of this study was to investigate if sarcopenia, determined by the PMI, is associated with overall survival (OS) in a cohort of patients with advanced non-small cell lung cancer (NSCLC) treated with concurrent immune checkpoint inhibitor (ICI) and chemotherapy (CTX). Our secondary aim was to study the association between PMI and Eastern Cooperative Oncology Group (ECOG) performance status as well as BMI.3/\u03bcL)/absolute lymphocyte count (103/\u03bcL). The prognostic nutritional index (PNI) was calculated as 10 x serum albumin (g/dL) + 0.005 x absolute lymphocyte count (103/\u03bcL). The NLR and PNI were calculated based on laboratory studies prior to the initiation of ICI and CTX. Programmed death ligand 1 (PDL-1) positive tumors were defined by PD-L1 expression \u2265 1% or more of tumor cells based on a PD-L1 immunohistochemistry assay, Ventana SP263 on Leica Bond III performed as a lab-developed test and validated against Dako 22C3 for concordance. OS was defined as the number of months alive after treatment initiation.We conducted a retrospective study including 92 patients with histologically confirmed locally advanced NSCLC not amenable to definitive chemotherapy and radiation or metastatic NSCLC who were treated at the University of Virginia Medical Center between 2015 and 2021 with concurrent ICI and CTX. Patients without cross-sectional abdominal imaging (CT or PET/CT) within 120 days of treatment initiation and patients with lumbar artefacts such as prior lumbar fusion surgery not amenable to psoas muscle analysis were excluded from the study. The following data was collected at the time of initiation of concurrent ICI and CTX: Age, sex, race , height, weight, ECOG performance status, smoking status , lung cancer histology , PDL-1 status , lung cancer stage , brain metastasis , absolute lymphocyte count and serum albumin. The occurrence of immune-related adverse events (irAE) was assessed retrospectively from documentation in the electronic medical record, and they were graded according to the Common Terminology Criteria for Adverse Events (CTCAE Versions 4.03 and 5.0). The neutrophil-to-lymphocyte ratio (NLR) was calculated as absolute neutrophil count (102) divided by height2 (m2) as previously described (th percentile of the PMI in our patient cohort. The intramuscular adipose content (IMAC) was determined by the ratio of the attenuation in HU of the psoas muscle and subcutaneous fat. The ratios were expressed as negative numerical values because the attenuation of subcutaneous fat is negative around -100 HU.The cross-sectional area of the psoas muscle and the muscle attenuation were assessed by secondary analysis of CT or PET/CT images, which had been taken for diagnostic purposes with a median of 27 days (IQR 8 to 36) prior to initiation of therapy. The inferior aspect of the third lumbar vertebra on cross-sectional abdominal imaging was chosen as a standard landmark to measure the psoas muscle area and muscle attenuation. The psoas muscle was identified and quantified by use of Hounsfield unit (HU) thresholds (-310 to +390). The psoas muscle measurements as indicated in escribed . PatientData is shown as median with interquartile range (IQR). Differences between groups of patients were studied by use of Fisher\u2019s exact test, Pearson\u2019s \u03c72 test, Mann-Whitney U test and Kruskal-Wallis test. All tests were two sided and significance was reported at the p < 0.05 level. Spearman correlation was used to measure the degree of association between two variables. OS was analyzed using the Kaplan-Meier method and differences between groups were compared with the log-rank test. Multivariate analysis was performed using Cox proportional hazards regression models. Variables known to affect survival in patients with advanced lung cancer were included into a multivariate Cox proportions hazards model, and 95% confidence intervals (CI) for the estimated hazard ratios (HR) were calculated. Statistical analysis was performed with GraphPad Prism version 9.0 .2/m2 for men and 6.13 cm2/m2 for women, P = 0.0006). Thus, in our patient cohort sarcopenia was defined as a PMI below the 25th sex specific percentile and cut offs were 6.03 cm2/m2 for men and 5.11 cm2/m2 for women.A total of 92 patients , 48 (52.2%) men and 44 (47.8%) women, were included in the study. All patients had locally advanced  or metastatic  NSCLC. The cross-sectional area of the psoas muscle and the muscle attenuation were assessed on CT or PET/CT imaging obtained prior to treatment initiation . The PMI, defined by the bilateral psoas muscle area in relation to the height of the patient, differed significantly between males and females . Taken together, this data highlights that sarcopenic patients with advanced NSCLC have a lower baseline performance status in comparison to non-sarcopenic patients.The baseline characteristics of the patient cohort stratified by sarcopenia status are shown in The median follow-up after initiation of concurrent immune checkpoint inhibitor (ICI) and chemotherapy (CTX) was 29.6 months. The median OS was 17.8 months. Importantly, sarcopenia was associated with significantly lower OS . Further analysis showed that the BMI differed significantly between sarcopenic and non-sarcopenic patients . Of note, even with a significant lower BMI in the sarcopenic group, a majority of sarcopenic patients had a normal BMI . Consistent with the prior analysis of survival in sarcopenic and non-sarcopenic patients, the patient cohort was split into two groups: those with a BMI lower than the 25th percentile and those with a BMI higher or equal to the 25th percentile . A difference in OS was not noted between these groups . These results suggest that BMI is not an adequate and reliable surrogate parameter for PMI as it does not predict OS in patients with advanced NSCLC treated with concurrent ICI and CTX.Since BMI is commonly used as a prognostic marker in clinical settings, we investigated the association of PMI and BMI. We found a weak linear association between increasing BMI and PMI , prognostic nutritional index (PNI) and irAE in a multivariate Cox proportional hazards model. The results of the multivariate survival analysis in th percentile, was associated with inferior OS. OS was 13.2 months shorter for patients with sarcopenia (P = 0.002). This association remained significant after adjusting for clinically relevant confounders such as age, gender, ECOG performance status, histology, smoking, BMI, NLR, PNI and irAE. We reported a hazard ratio of 2.12 (CI 1.1-3.97) for sarcopenia that is consistent with similar studies on sarcopenia and survival of patients with NSCLC by Tsukagoshi et\u00a0al.    and Taka02-6.46) . Shiroya02-6.46) . Another02-6.46) . A large02-6.46) . Of note02-6.46) \u201319, 23. 2, IQR 20.7-25.0 kg/m2) and we did not observe a significant difference in OS when solely stratifying by BMI. An apparently normal BMI may mask sarcopenia in patients with advanced lung cancer. These findings are consistent with a previous study that showed that muscle wasting is a prominent feature in a prospective cohort of 441 lung cancer patients despite a normal or increased BMI  of sarcopenic patients in our study had an ECOG performance status \u2265 2. This group of patients, frequently excluded from clinical trials examining concurrent CTX and ICI in NSCLC, may constitute the most vulnerable cohort of patients in terms of treatment-related toxicities , 25, 26.Taken together, our study adds to the emerging evidence that frailty, sarcopenia and malnutrition play an important role in lung cancer survival among newly diagnosed NSCLC patients receiving concurrent ICI and CTX , 28. Mecth percentile of the PMI as an unbiased approach to define sex-specific cut-offs to classify patients as those with sarcopenia. Compared to PMI cut-off values reported for Asian adults, the obtained values were similar for men (6.03 vs. 6.36 cm2/m2) but higher for women (5.11 vs. 3.92 cm2/m2)  published a consensus paper on definition and diagnosis of sarcopenia . They pr cm2/m2) . We obtath percentile of the PMI in our cohort allowed for an unbiased assessment of sarcopenia and should be applied and validated in larger NSCLC patient cohorts. Additional studies are needed to explore strategies to improve muscle mass and function in patients with advanced NSCLC.Sarcopenia is a predictor of reduced OS for patients with advanced NSCLC undergoing concurrent ICI and CTX irrespective of age, sex, BMI and functional status. The assessment of muscle mass is fundamental to the diagnosis of sarcopenia. The 25The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the University of Virginia Institutional Review Board for Health Science Research per protocols 18465 and 19083. Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.FB and RH were responsible for the conception and design of the study. RH, RG, and LS recruited patients and established a database. FB, SM, and NW were involved in the collection and compilation of data. FB, SM, NW, CH, and AK were involved in the image analysis. FB, WN, and RH were responsible for analysis and interpretation of data. FB and RH wrote the manuscript.This study was supported by the University of Virginia Department of Internal Medicine Resident Research Grant.We thank Andrew Grainger for bioinformatic assistance with the image analysis.RG has the following conflicts of interest to declare: Consulting or Advisory Role of Daiichi Sankyo, AstraZeneca, BluePrint Medicines, Pfizer, Mirati, Sanofi, Ococyte, Jazz Pharmaceuticals, Janssen; Research Funding not related to the current project directly paid to the institution: Pfizer, Mirati, Daiichi Sankyo, Jounce Therapeutics, Helsinn, Bristol Myers Squibb, Merck, Janssen, RTI International, AstraZeneca, Alliance Foundation Trials, Takeda, Hoosier Cancer Research Network, ECOG-ACRIN, NCI.RH has the following conflicts of interest to declare: Consulting or Advisory Role of Bristol-Myers Squibb/Ono Pharmaceutical; Research Funding not related to the current project directly paid to the institution: Merck Sharp & Dohme, AstraZeneca/MedImmune, Mirati Therapeutics, Lilly and Daiichi Sankyo.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Poecilia reticulata and Poecilia wingei). Overall, we found that F1 and F2 hybrids showed intermediate brain morphology and cognitive traits compared to parental groups. Moreover, as phenotypic dispersion and transgression were low for both brain and cognitive traits, we suggest that hybridization is not a strong driver of brain anatomical and cognitive diversification in these Poeciliidae. To determine the generality of this conclusion, hybridization experiments with cognitive tests need to be repeated in other families.Hybridization can promote phenotypic variation and often produces trait combinations distinct from the parental species. This increase in available variation can lead to the manifestation of functional novelty when new phenotypes bear adaptive value under the environmental conditions in which they occur. Although the role of hybridization as a driver of variation and novelty in traits linked to fitness is well recognized, it remains largely unknown whether hybridization can fuel behavioral novelty by promoting phenotypic variation in brain morphology and/or cognitive traits. To address this question, we investigated the effect of hybridization on brain anatomy, learning ability, and cognitive flexibility in first\u2010 and second\u2010generation hybrids of two closely related fish species ( In the last decade, studies on phenotypic diversification have established the role of hybridization as a driver of trait variation that often leads to ecological and evolutionary innovations . Our previous study of learning ability and cognitive flexibility in F1 females of this cross showed that female hybrids had slightly higher dispersion in cognitive traits, some hybrid individuals had transgressive trait scores, and the mean phenotype of one hybrid group deviated away from the axis of variation of the parentals, suggesting that hybridization may promote cognitive variation and generate new trait combinations , males differ in color pattern and courtship behavior  populations descended from wild individuals from the upper Aripo river, Trinidad, and Endler's guppy (P. wingei) populations descended from wild individuals from Cuman\u00e1, Venezuela in 2006. Experimental fish were produced according to standard hybridization methods  were bred simultaneously, in January and August 2020. Second\u2010generation (F2) hybrids were then obtained by crossing females and males from F1 hybrid stock populations. To ensure that focal F2 hybrids were compared to parental individuals of the same age, F2 fish were bred simultaneously with a group of common and Endler's guppies, in January 2021. All groups of parental, F1, and F2 fish were bred and raised in identical conditions in a common garden environment and examined for brain morphology or cognitive traits at approximately 1\u00a0year of age. In the F1 cohort, F1 hybrids and parental offspring were obtained each from 12\u201316 females .Parental fish used for breeding were derived from laboratory populations that were kept in identical conditions at Wageningen University & Research. Common guppy  at Wageningen University and Research and the Centrale Commissie Dierproeven (AVD10400202010625), Netherlands.n\u00a0=\u00a0232; detailed sample size in Fiji \u03c0/6  to dislodge a green disc to access a food reward (one defrosted Artemia) hidden in a hole underneath. During the first trials, the disc only partially covered the hole, leaving the reward exposed. We then gradually trained the fish to dislodge the disc by moving it from partially to fully covering the hole  successfully retrieved the food reward by dislodging the disc in all trials of the last two sessions and continued the experiment.The goal of the pretraining was to train females  were tested in their ability to learn a color association. In this task, females were given a choice between a red and a yellow disc, both concealing a food reward. The disc assigned as the correct color for that fish could be dislodged to reveal the reward; the incorrect color disc was stuck in the hole with a plastic knob and could not be moved, preventing the fish from retrieving the food underneath. Because both the correct and incorrect options contained a hidden reward, fish could not rely on olfactory cues to learn the task. To control for potential side biases, we randomized the position (left/right) of the correct color in each trial. Choice was recorded as the first disc touched by the fish. The fish was given 1\u00a0min to dislodge the correct colored disc and eat the reward. If fish made an incorrect choice, correction was allowed within 3\u00a0min. If the fish failed to make any choice within 1\u00a0min or to correct its choice within 3\u00a0min, we moved the rewarded disc 5\u00a0mm to the side to allow easy access to the food and ensure that all fish obtained a reward in each trial. Fish received daily sessions of three or four trials, excluding weekends. All fish ran a minimum of 12 trials. The learning criterion consisted of seven consecutive correct choices . As soon as a female ran 12 trials and reached the learning criterion, the next phase commenced. If a female did not reach the learning criterion within 40 trials, it was excluded from further training .After being trained to retrieve a reward underneath a movable disc, females  to swim through a hole in a partition to access the experimental chamber and obtain a food reward. It is worth noting that due to laboratory space constraints, the sample size of males initially included in the assays (n\u00a0=\u00a014 per group) is smaller than that of females. To familiarize the fish with obtaining food in the experimental chamber, we started by giving males three trials per day over 2\u00a0days where a guillotine door was lifted by the experimenter to give access to the experimental chamber and to a free food reward . From the third day, when the guillotine door was lifted, the fish encountered a partition with a circular hole that gave them access to the experimental chamber. The edge of the hole was painted green to make the fish familiar with swimming through a colored hole. We gradually reduced the size of the circular hole (from 5.5\u00a0mm \u00f8 to 4.5\u00a0mm \u00f8 to 3\u00a0mm \u00f8) over training trials  successfully swam through the 3\u2010mm \u00f8 green hole and ate the reward within 3\u00a0min in all trials of the last session, and therefore continued the experiment.The goal of pretraining was to train males  were tested in their ability to learn a color association. In this task, when the guillotine door was lifted, males were given a choice between a hole with a red edge and a hole with a yellow edge to access the experimental chamber and obtain the food reward .After being trained to swim through a hole in a partition to access a food reward, males  was suddenly found dead in the housing compartment on day 5 of the reversal task; because it only ran 16 trials, it was excluded from the learning criterion analyses.At the end of the experiment, 80 males  were euthanized to complement the brain morphology dataset. To keep exposure to the learning task similar across all individuals, fish continued running one trial per day after they succeeded the task until all fish completed the learning experiment. It is unlikely that brain morphology comparisons between species groups are influenced by learning effects because our sample is balanced over groups, and a previous study in guppies found that learning does not impact coarse brain plasticity . For all models, two\u2010way interactions were removed if they were not significant and not relevant for our study question.To test for species differences in relative brain size, brain weight was fit to a linear model with the predictors of species group, body size, sex, and all two\u2010way interactions. Body size was fitted as a covariate to account for allometry and focus on species differences in relative brain size. To test for species differences in relative brain region volumes, each brain region volume was fit to a linear model with the predictors of species group, brain remainder volume, sex, and all two\u2010way interactions. Brain remainder volume  was used instead of total brain volume to avoid statistical confounds resulting from the inclusion of the region being analyzed in the covariate. To achieve normality and linearize the allometries between response variables and predictors, we log\u2010transformed body size (mm), brain weight (mg), and brain region volume  number of trials to reach learning criterion using a generalized linear model (Poisson distribution) with the predictors of species group and color and (ii) learning rate, that is, probability of success per trial  using a generalized linear mixed\u2010effect model  with the predictors of trial number, species group, correct disc color, and the interaction of trial number\u00a0\u00d7\u00a0species group and trial number\u00a0\u00d7\u00a0color, as well as a random intercept and slope for fish identity to account for repeated observations of individual fish. We tested the significance of the random effects in models (ii) with likelihood ratio tests, by comparing models that culled the intercept or slope term to our final model. To examine if performance in the associative learning task had carryover effects on performance in the reversal task, we tested the inclusion of the predictor \u201ctrials to learn the associative learning task\u201d and its interaction with species group in models  for the reversal task. For model (ii) in the reversal task, trial number was log\u2010transformed to meet the assumption of linearity on the logit scale. These analyses were run separately for females and males. Due to the low sample size of males that succeeded the reversal learning task, we could not run model (i) to compare the number of trials to reach learning criterion. Additionally, for the test trials of male fish, a nonparametric one\u2010sample Wilcoxon rank sum test was used to compare the observed proportion of correct choices per individual against a chance value of 0.5 (null hypothesis of learning the task using cues from the transparent sheet blocking incorrect option).Results below), we chose to pool females and males for the transgression analyses in brain traits to increase sample size and strengthen statistical power. For cognitive performance analyses, we used individual scores in the associative and reversal learning tasks , following Vila\u2010Pouca et\u00a0al.  clusters of trait space  were computed with the \u201cs\u201d Duong , with ths\u201d Duong  with then\u00a0=\u00a0107, estimate\u00a0=\u00a01.17, SE\u00a0=\u00a00.11, F1,101\u00a0=\u00a0117.34, P\u00a0<\u00a00.0001) and no differences in allometry between species groups or sex  with Endler's guppies (W) showing smaller relative brain size compared to common guppies, R  and to F1 R\u00d7W . The analysis of brain region volumes, after accounting for the allometry associated with brain remainder volume , with Endler's guppies (W) showing larger relative olfactory bulbs compared to F1 R\u00d7W . This indicates that species differences in total brain size were overall equally expressed over the different brain regions. We also found an effect of sex on some brain region volumes, with males having a larger relative optic tectum but smaller cerebellum, dorsal medulla, and hypothalamus than females  but not between species groups . The analysis of brain region volumes, after accounting for the allometry associated with brain remainder volume  and smaller relative optic tectum compared to parentals R and W and to F2 R\u00d7W , and with both F2 hybrids showing a larger relative hypothalamus compared to parental Endler's guppies, W , with 185 females progressing to the learning tasks.Detailed results on F1 hybrid females\u2019 performance in both associative and reversal learning are published elsewhere  females succeeding in the task compared to 88% (22/25) in F2 R\u00d7W and to 85% (11/13) and 100% (10/10) in parental common (R) and Endler's (W) guppies, respectively, yet differences between groups were not significant  of F2 R\u00d7W, 90% (17/19) of F2 W\u00d7R, and 100% of both R (11/11) and W (10/10) females reaching learning criterion . At the end of pretraining, 74 males progressed to the learning tasks.P\u00a0=\u00a00.021; \u03c72\u00a0=\u00a044.57, df\u00a0=\u00a01, P\u00a0<\u00a00.001; \u03c72\u00a0=\u00a04.84, df\u00a0=\u00a05, P\u00a0=\u00a00.44; V\u00a0=\u00a0986.5, P < 0.001; In the associative learning task, only 46 out of 74 males succeeded in learning to access the reward through the correctly colored hole. Comparing species groups, the success rate of parental males was slightly lower than F1 and F2 hybrid groups, and F2 R\u00d7W showed the highest success rate, yet differences between groups were not significant  learning the task, followed by four out of seven fish (57%) of F2 W\u00d7R and three out of seven fish (43%) of F1 R\u00d7W. Parental groups and F1 W\u00d7R had the lowest success rates with a single individual reaching learning criterion , yet differences between groups were not significant . Due to n\u00a0=\u00a03) and 6% for F1 W\u00d7R (n\u00a0=\u00a02) individuals, thus at levels close to the 5% expected by chance , the hypervolume of brain morphospace describing phenotypic dispersion of F1 hybrid groups was over three times larger compared to parental groups and simulated hybrids, and larger for F1 R\u00d7W compared to F1 W\u00d7R Fig.\u00a0. The frey chance . Regardiy chance .n\u00a0=\u00a02) and 8% for F2 W\u00d7R (n\u00a0=\u00a03) individuals, thus also at levels close to the 5% expected by chance , the phenotypic dispersion of brain morphospace of F2 hybrid groups was similar to one parental group . Common guppies (R) and simulated hybrids showed lower dispersion Fig.\u00a0. The frey chance . Regardiy chance . Similary chance .Due to the small number of males that succeeded in the reversal learning task, here we could only run phenotypic dispersion and transgression analyses on female cognitive traits. Measures of \u201ccognitive space\u201d describing female F1 hybrid groups are published elsewhere  to characterize patterns of hybrid trait expression and to test if hybridization may promote phenotypic variation in brain morphology and/or cognitive traits. Overall, we found that F1 and F2 hybrids showed intermediate brain anatomy traits, learning ability, and cognitive flexibility compared to the parental groups. Moreover, in both brain and cognitive traits, phenotypic dispersion and transgression were low and hybrid mean phenotypes did not deviate from the axis of variation of the parentals. These results therefore suggest that hybridization is not a strong driver of brain anatomical and cognitive diversification in these Poeciliidae.We investigated brain anatomy, learning ability, and cognitive flexibility in F1 and F2 hybrids of two fish species . As home range size has been positively correlated with learning performance in spatial tasks (Sherry et\u00a0al. Interspecific hybridization is generally assumed to be an important source of heritable phenotypic variation (Seehausen What may explain the apparent discrepancy in cognitive results between F1 and F2 fish? We suggest that heterosis, also called hybrid vigor, might explain our previous results on cognitive traits of F1 females because it is only present in first\u2010generation hybrids (Lippman and Zamir Hybridization can alter trait correlations by relaxing phenotypic trade\u2010offs and genetic correlations (Selz et\u00a0al. P. reticulata and P. wingei, the two parental species used in this study, are too phylogenetically close, as the amount of transgression has been suggested to increase as a function of the genetic distance between the parental lines (Rieseberg et\u00a0al. Two nonmutually exclusive hypotheses may explain the lack of transgression and phenotypic dispersion we found in these traits. One possibility is that Poecilia fish. Although we are unable to draw strong conclusions regarding male cognitive flexibility due to the small number of males that succeeded in the reversal task, our results do not show evidence in favor of stronger asymmetries or incompatibilities in male Poecilia fish. Instead, we found that males needed a similar number of trials to learn the color association and the reversal task compared to females, that reciprocal male hybrid crossings showed similar cognitive performance, and that males and females differed little in how hybridization impacted brain anatomy traits.In our previous study on learning ability and cognitive flexibility in F1 females, we found that F1 R\u00d7W hybrids showed a phenotypic mismatch with the parentals, whereas the reciprocal W\u00d7R group did not (Vila\u2010Pouca et\u00a0al. Taken together, our results suggest that hybridization is not a strong driver of brain anatomical and cognitive diversification in the two Poeciliidae species studied here. As the first test of the impact of hybridization in brain morphology and cognitive traits, our results contribute to further elucidate the role of hybridization as a driver of variation and novelty in important traits linked to fitness. To determine the generality of our conclusions, hybridization experiments with further cognitive tests need to be repeated in other families.CVP developed ideas and designed the study with HDW and AK. CVP collected the data with HDW. CVP analyzed the data and wrote the first draft. All authors edited and contributed to finalizing the manuscript.The authors declare no conflict of interest.https://doi.org/10.6084/m9.figshare.20752093.v1.Raw data and analysis code are deposited and freely accessible at Associate Editor: M. CummingsHandling Editor: T. ChapmanSupplementary InformationClick here for additional data file."}
+{"text": "There is a need to develop a multipurpose obsessive\u2013compulsive disorder (OCD) measure that is useful for cross disorder research and as a reliable clinical rating scale. The current study examined the psychometric properties and established clinical cutoffs for the parent\u2010report version of the Toronto Obsessive\u2013Compulsive Scale (TOCS), a 21\u2010item rating scale of obsessive\u2013compulsive traits.n\u00a0=\u00a0350, 50% female), attention\u2010deficit/hyperactivity disorder (ADHD) , autism spectrum disorder (ASD) , or were typically developing controls . Confirmatory factor analyses, internal consistency reliability, and convergent and divergent validity of the TOCS were examined in the OCD group. Using various scoring approaches, receiver operating characteristic (ROC) analyses were used to establish a clinical cut\u2010off by splitting the OCD group into a discovery sample  and a validation sample . Classification accuracy and TOCS scores were compared across OCD, ADHD, and ASD groups.Participants ranged in age from 6 to 21\u00a0years old and had a primary diagnosis of OCD . Established cutoffs, when applied in the independent validation sample of OCD cases and controls, showed an overall classification accuracy of 85%\u201390%. The TOCS total score and symptom count showed good discrimination of OCD from ADHD (AUC \u22650.86) and ASD (AUC \u22650.81). The OCD group scored significantly higher on all TOCS dimensions (except Hoarding) than the ADHD and ASD groups.The TOCS is a reliable and valid rating scale with strong sensitivity and specificity in discriminating OCD cases from controls, as well as from ASD and ADHD. It\u00a0is a quantitative OCD measure with important clinical and research applications, with particular relevance for cross disorder phenotyping and population\u2010based studies. The Toronto Obsessive\u2013Compulsive Scale (TOCS) is an open\u2010source, quantitative measure of pediatric obsessive\u2013compulsive (OC) traits that has been previously validated in pediatric community samples and used to identify the first genome\u2010wide variant for OC traitsThe current study clinically validated the TOCS, as it has excellent diagnostic discrimination of pediatric obsessive\u2013compulsive disorder (OCD) cases from controls, as well as a strong ability to discriminate OCD cases from attention\u2010deficit/hyperactivity disorder and autism spectrum disorder casesBy using the TOCS to measure OC traits, we can gather data to inform both genetic research and clinical practice, thereby minimizing patient burdenObsessive\u2013compulsive disorder (OCD) is a psychiatric disorder characterized by recurrent intrusive thoughts or impulses that cause marked distress (obsessions), and repetitive behaviors or mental acts (compulsions). Approximately 50% of individuals with OCD initially developed their symptoms during childhood Geller,\u00a0, with peThe Toronto Obsessive\u2013Compulsive Scale (TOCS) . Second, the diagnostic accuracy of the TOCS for identifying OCD rather than co\u2010occurring disorders . Specifically, we evaluated the factor structure, internal\u2010consistency reliability, convergent and divergent validity, and age and gender associations of the TOCS in a clinical sample of pediatric OCD. We examined the clinical ability of the TOCS to discriminate OCD cases from controls by splitting the OCD group into two subgroups , in which a clinical cutoff was extracted in the discovery sample and confirmed in the validation sample. Lastly, we examined the clinical ability of the TOCS to discriminate OCD cases from clinical ASD and ADHD cases.F\u00a0=\u00a02.46, p\u00a0=\u00a0.062. Informed consent  was obtained before research participation. Ethics approval was obtained from the relevant institutions listed above.Participants in the discovery sample of OCD and healthy controls were recruited from two tertiary care children's mental health clinics . Participants in the validation sample with OCD, ADHD, and ASD diagnoses or typically developing controls were recruited from tertiary care clinics as part of the Province of Ontario Neurodevelopmental Disorders (POND) Network . TOCS total scores did not significantly vary based on recruitment site for the OCD group: n\u00a0=\u00a0350), ADHD (n\u00a0=\u00a0820), or ASD (n\u00a0=\u00a0794) or were typically developing control participants (n\u00a0=\u00a0391). Diagnoses for the clinical groups were based on diagnostic criteria from the DSM\u2010IV or DSM\u20105 following a rigorous, semi\u2010structured clinical assessment with a psychologist or psychiatrist. The following gold\u2010standard assessment tools were used to confirm the primary diagnoses for each clinical group: the Kiddie Schedule for Affective Disorders and Schizophrenia   version of the SCQ was used in the current study.The Social Communication Questionnaire (SCQ)  Rosseel,\u00a0 was usedGiven the unique distribution of the TOCS , we examined the performance of the TOCS total score , TOCS symptom count (number of items with scores \u22652), and the TOCS max average . Average scores were computed for all six TOCS subscales. Pearson correlations were used to examine convergent and divergent validity using these TOCS indices within the OCD sample.ROC analyses  using ROC. We report the AUC, which reflects the overall ability of the TOCS to discriminate OCD from ADHD, as well as OCD from ASD. We also report the classification accuracy  at the previously identified cutoff scores. Lastly, we tested whether TOCS scores significantly varied by clinical group. Tukey HSD tests were used for post\u2010hoc comparisons and effects sizes are reported using Cohen's N\u00a0=\u00a0350). The model demonstrated adequate fit to the data, \u03c72 (137)\u00a0=\u00a0596.60, CFI\u00a0=\u00a00.897, RMSEA\u00a0=\u00a00.098 90% CI , SRMR\u00a0=\u00a00.066. Factor loadings are presented in Table\u00a0The previously identified six\u2010factor model  and a validation sample . The discovery sample consisted of data from the two tertiary care children's mental health clinics , whereas the validation sample consisted of data from POND . Comorbidities were as follows within the OCD discovery sample: 12.7% tic disorder, 33% anxiety disorders, 4.2% ASD, 21.7% ADHD, 11.4% mood disorders.For the ROC analyses, the OCD and control samples were divided into a In the discovery sample, the AUC [95% CI] for all TOCS indices excellent diagnostic discrimination of cases from controls: TOCS total score\u00a0=\u00a00.95, 0.93, 0.97], TOCS symptom count\u00a0=\u00a00.96, , TOCS max average\u00a0=\u00a00.96, . A TOCS total score of 1, a symptom count of 2, and a max average score of 1 maximized sensitivity and specificity , classification accuracy for OCD and ADHD were as follows: TOCS total score\u00a0=\u00a077%, TOCS symptom count\u00a0=\u00a073%, and TOCS max average\u00a0=\u00a066%.When discriminating OCD cases from ASD cases, the AUC [95% CI] was acceptable for the TOCS total score\u00a0=\u00a00.81,  and the TOCS symptom count\u00a0=\u00a00.80, . Diagnostic discrimination between OCD and ASD was poor when using the TOCS max average\u00a0=\u00a00.75, . Using the cutoff scores obtained above , classification accuracy for OCD and ASD were as follows: TOCS total score\u00a0=\u00a071%, TOCS symptom count\u00a0=\u00a062%, and TOCS max average\u00a0=\u00a056%.N\u00a0=\u00a02362. The TOCS demonstrated measurement invariance at the configural, metric, and scalar levels, indicating equivalent item loadings, and intercepts across groups . There was a significant effect of group on TOCS total raw score, F\u00a0=\u00a0264.40, p\u00a0<\u00a0.001, \u03b72\u00a0=\u00a00.21; symptom count, F\u00a0=\u00a0367.80, p\u00a0<\u00a0.001, \u03b72\u00a0=\u00a00.27; and subscale maximum average F\u00a0=\u00a0151.20, p\u00a0<\u00a0.001, \u03b72\u00a0=\u00a00.13. Post hoc comparisons using Tukey HSD tests indicated that across all indices, the OCD group had significantly higher scores than the ADHD group  and ASD group . Additionally, the ASD group had significantly higher TOCS scores across indices than the ADHD group, all p\u00a0<\u00a0.001, Cohen's d\u00a0\u2265\u00a00.29. See Table\u00a0We examined whether TOCS total scores differed by clinical group using ANOVAs  on TOCS subscale scores. MANOVA results are reported using Pillai's trace as the homogeneity of covariances assumption was violated, Box's F\u00a0=\u00a071.91, Pillai's trace\u00a0=\u00a00.37, p\u00a0<\u00a0.001. One\u2010way ANOVA models were used to examine the effect of group membership on each subscale score separately (Bonferroni corrected p\u00a0=\u00a0.0083). With the exception of hoarding, there was a significant effect of group membership on all subscale average scores, all p\u00a0<\u00a0.001. Post\u2010hoc comparisons indicated that across all TOCS subscales (except hoarding) the OCD group reported the highest subscale scores, followed by the ASD group, and then by the ADHD group, respectively \u00a0=\u00a07.23, p\u00a0=\u00a0.0088.TOCS subscale scores significantly differed based on group membership, F12, 386\u00a0=\u00a071.91,There is a need to develop quantitative trait\u2010based measures to facilitate research exploring the etiology of mental health disorders, including pediatric OCD and particularly in community\u2010based studies. At the same time, such measures must also be clinically valid and will have the most meaningful impact if they are also helpful for clinicians, patients, and their families. Results from the current research indicate that the parent\u2010report version of the TOCS is a reliable and valid rating scale within clinical samples of pediatric OCD. As hypothesized, the six\u2010factor structure  demonstrated excellent ability to discriminate OCD cases from controls, highlighting the robustness of this measure. Indeed, the sensitivity and specificity of the TOCS is just as strong\u2014if not somewhat stronger\u2014than existing screening tools for OCD such as CBCL\u2010OCS  than parents of patients with primary diagnoses of ADHD or ASD. These findings suggest that the TOCS specifically measures OC traits, not simply general psychopathology. While OCD cases had the highest TOCS scores on average across dimensions, it is important to note that many parents of children and adolescents with ADHD and ASD also reported elevated OC traits. In particular, there was a high degree of overlap between the OCD and ASD groups on the symmetry/order and rumination dimensions, which would be expected given the phenotypic similarity . Given that many ASD diagnoses are assigned during the preschool years, it is possible that discriminant classification of ASD from OCD cases may be different in such age groups. Lastly, the current research is cross sectional and specifically examined OCD cases with current symptomology . Future research may wish to examine how TOCS scores vary over time.The current research is the first to evaluate the TOCS using a large pediatric clinic sample and should be considered with the following limitations. The TOCS has both parent\u2010 and self\u2010report formats; however, we only evaluated the parent\u2010report version. Additional research is necessary to establish the psychometric properties and clinical cut\u2010offs of the self\u2010report TOCS, which may be especially useful for older adolescent samples. While we report several indices of diagnostic accuracy , the Youden index was used to select cut\u2010points for the TOCS, which is not sensitive to differences in sensitivity and specificity (\u0160imundi\u0107,\u00a0In conclusion, our results build upon previous research with community samples (Burton et\u00a0al.,\u00a0The authors have declared that they have no competing or potential conflicts of interest.Ethics approval was obtained from the relevant institutions.Supporting Information S1Click here for additional data file."}
+{"text": "The continuously developing pesticide resistance is a great threat to agriculture and human health. Understanding the mechanisms of insecticide resistance is a key step in dealing with the phenomenon. Insect cuticle is recently documented to delay xenobiotic penetration which breaks the previous stereotype that cuticle is useless in insecticide resistance, while the underlying mechanism remains scarce.lnc19419), that indirectly upregulates CPCFC in cuticle of the resistant strain by sponging miR-994. Thus, we elucidate the mechanism of cuticular competing endogenous RNAs for regulating insecticide penetration and demonstrate it also exists in field strain of oriental fruit fly.Here, we find the integument contributes over 40.0% to insecticide resistance via different insecticide delivery strategies in oriental fruit fly. A negative relationship exists between cuticle thickening and insecticide penetration in resistant/susceptible, also in field strains of oriental fruit fly which is a reason for integument-mediated resistance. Our investigations uncover a regulator of insecticide penetration that miR-994 mimic treatment causes cuticle thinning and increases susceptibility to malathion, whereas miR-994 inhibitor results in opposite phenotypes. The target of miR-994 is a most abundant cuticle protein (CPCFC) in resistant/susceptible integument expression profile, which possesses capability of chitin-binding and influences the cuticle thickness-mediated insecticide penetration. Our analyses find an upstream transcriptional regulatory signal of miR-994 cascade, long noncoding RNA (lnc19419\u2009~\u2009miR-994\u2009~\u2009CPCFC on the cuticle thickness that leads to insecticide penetration resistance. These findings indicate that competing endogenous RNAs regulate insecticide resistance by modulating the cuticle thickness and provide insight into the resistance mechanism in insects.We unveil a regulatory axis of The online version contains supplementary material available at 10.1186/s12915-023-01694-z. Bactrocera dorsalis (Hendel) is one of the most destructive pest of fruits and vegetables around the world [The oriental fruit fly he world , which che world . Chemicahe world . The maihe world \u20137. Howevhe world .Plutella xylostella, and their expression has been consequently proposed as a strategy for the management of agricultural pests [MicroRNAs (miRNAs) are regulators of gene expression at the post-transcriptional level that are known to participate in multiple physiological processes in insects, including development, reproduction, and adaptation to environmental stressors such as insecticides \u201311. Mostal pests .B. dorsalis is renowned for its resistance to multiple insecticides, which prevents effective and sustainable pest management [B. dorsalis detoxification enzymes [CHS1) to confirm that B. dorsalis gains penetration resistance to the insecticide malathion through the thickening of the cuticle. We then identified miR-994 as a mediator of penetration resistance by small RNA sequencing (RNA-Seq), RT-qPCR analysis, mimic/inhibitor injection, TEM, insecticide penetration assays and bioassays. We used bioinformatics analysis, RNA-Seq, RNA pull-down assays, dual luciferase assays and fluorescence signal colocalization to confirm that miR-994 is negatively regulated by lnc19419 and in turn negative regulates the cuticular protein CFC (CPCFC). We confirmed ability of lnc19419 and CPCFC to promote cuticular thickening and malathion resistance by RNA interference (RNAi), and also established the regulatory interactions between lnc19419, miR-994 and CPCFC mRNA. These findings provide insight into the role of non-coding RNAs and CPCFC in cuticle-mediated insecticide resistance and contribute to elucidate underlying mechanisms during the long-term insecticide exposures.The oriental fruit fly, nagement , 21. Ini enzymes , 23 and  enzymes , but thi enzymes , 26. HerB. dorsalis was used to select the resistance over 26 generations, resulting in the emergence of a malathion-resistant (MR) strain with an LD50 of up to 3452.5\u00a0ng/fly. This was 53.64-fold higher than the LD50 of the malathion susceptible (MS) strain (64.37\u00a0ng/fly), which had never been exposed to the insecticide , indicating low expression levels. The remaining four  were expressed at higher levels   was also co-transfected with the synthetic miR-994 and did not induce a change in luciferase activity  at the sequence 5\u2032-TGTCCTTA-3\u2032   revealed that only lnc19419 was regulated by overexpressing or inhibiting miR-994 .To determine whether lnc19419 and miR-994 was confirmed in biotin\u2013avidin RNA pull-down experiments. We observed a significant 5.8-fold enrichment of lnc19419 compared to the negative control  and synthetic miR-994 were co-transfected into HEK293T cells. In contrast, relative luciferase activity did not change when the plasmid contained mutated lnc19419 (5\u2032-AAAAGAA-3\u2032) under the same conditions  in the MR strain by RNAi  of B. dorsalis, but was also found in a Guangxi (GX) field strain. The expression of miR-994 was downregulated by 98.1%, but CHS1, CPCFC and lnc19419 were upregulated by 4.01-, 3.44- and 5.37-fold respectively in the GX strain compared to MS  is consistently expressed in the MR and MS strains [Most research on penetration resistance to date has focused on mosquitoes , 31, esp strains , 33. Fur strains , 32.CHS1.To analyze the regulatory mechanisms of the putative penetration resistance, the small RNA-Seq was performed for MR and MS strains. We found that the miR-994 had high expression levels and it was the only one out of the four miRNAs identified that was down-regulated in the pronotum cuticle of the MR strain, suggesting a relationship between miR-994 and insecticide resistance. Subsequently, the evidence was confirmed that miR-994 modulated the penetration of the insecticide to increase susceptibility. This was supported by our finding that malathion penetration significantly increased following the introduction of synthetic miR-994. Indeed, the injection of synthetic miR-994 had a similar effect to silencing CPCFC mRNA  in the integument of the pronotum was discovered. CPCFC was first identified in nymphs of the death\u2019s head cockroach (Blaberus craniifer) and usually contains three conserved motifs in which two cysteines are separated by five amino acids (C-X5-C) [CPCFC is immediately up-regulated following ecdysis in the mosquito Anopheles gambiae [B. dorsalis. First, immunohistochemical analysis revealed that CPCFC and chitin were co-located in cuticle pronotum. Second, the localization of CPCFC by immunogold labeling proved that it was secreted by epidermic cells and accumulates in the endocuticle of the pronotum. Third, recombinant CPCFC binds strongly to chitin in vitro. CPCFC was also strongly expressed in 1-day-old adults but expression declined with aging post-eclosion. Although it would be premature to conclude that CPCFC is involved the ecdysis, it clearly takes part in the cuticular development of B. dorsalis during post-eclosion.Given that miR-994 appears to control cuticular development, we investigated the effect of synthetic miR-994 on oriental fruit fly by transcriptome and compared the transcriptome of the pronotum integument between MR and MS strain. A substantial enrichment of the (C-X5-C) , 35. Mos(C-X5-C) . CPCFC w(C-X5-C) , 35. IntCPCFC was expressed at the highest level among 20 differentially expressed cuticle protein genes. This suggests CPCFC is involved in cuticular development and is potentially responsible for cuticular thickening in the MR strain. Cuticular thickness was significantly reduced when CPCFC was targeted by RNAi, increasing the penetration of malathion and thereby the susceptibility of B. dorsalis to this insecticide. These data suggest that CPCFC may block the penetration of malathion via modulating cuticle, maintaining its in vivo concentration at a safe level for the MR strain because the smaller amount of malathion that does cross the barrier is more easily metabolized by detoxification enzymes.Our cuticular RNA-Seq data comparing the MS and MR strains showed that lnc19419 were assessed via predication analysis. Although few studies have been reported in arthropods [B. dorsalis like other species for lncRNA target analysis to analyze the potential regulatory mechanism of lnc19419. Total 12 potential adjacent genes of lnc19419 was predicated including CPs, protein naked cuticle and kinase anchor protein, however the predicted target genes of lnc19419 were not upregulated according to our RNA-Seq data comparing the MR and MS strains. It provides possibility that lnc19419 might participate in insecticide resistance via another indirect regulatory mechanism. While the predication results of miR-994 revealed the potential lncRNAs target including lnc19419. Thus, we considered the possibility that miR-994 may be regulated by lncRNAs acting as decoys [lnc19419. The lnc19419 and miR-994 signals overlapped in the pronotum cuticle supporting their relationship in vivo. The expression of CPCFC was significantly reduced when we injected a double-stranded construct matching lnc19419 resulting in a similar phenotype to the silencing of CPCFC, including a higher malathion penetration ratio, higher susceptibility to malathion, and a thinner pronotum cuticle. In addition, the regulatory axis of lnc19419\u2009~\u2009miR-994\u2009~\u2009CPCFC was also confirmed in a field strain via expression investigation and might be responsible for the complex resistance background of GX strain, indicating the universality of the regulatory axis in B. dorsalis. Taken together, our data suggested that malathion resistance in B. dorsalis is mediated by a regulatory axis involving lnc19419, miR-994 and CPCFC mRNA.Finally, the potential regulatory mechanisms of thropods , lncRNA thropods . We predthropods  of B. dos decoys . FurtherB. dorsalis integument is a critical tissue in the evolution of malathion resistance, which is mediated by cuticular thickening. The underlying mechanism is based on a regulatory axis of lnc19419\u2009~\u2009miR-994\u2009~\u2009CPCFC expression in dynamic equilibrium, which favors the thickening of the cuticle in B. dorsalis. This regulatory axis blocks insecticides by increasing the penetration distance, reducing the entry amount of insecticide into insect. Our work provides insight into the efficacy of contact insecticides against insect pests and may facilitate the development of safe insecticides with greater specificity to agricultural pests and insect vectors of human diseases targeting endogenous RNAs.In conclusion, long-term selection revealed that the B. dorsalis (GX strain) was collected from Guangxi province, China, in 2021. These strains were maintained at 27\u2009\u00b1\u20091\u00a0\u00b0C and 70\u2009\u00b1\u20095% relative humidity with a 14-h photoperiod in the laboratory, and were fed on an artificial diet [B. dorsalis testing and research.The malathion-susceptible (MS) strain was originally collected from Guangdong province, China, in 2009. It was never exposed to any insecticide and was reared in our laboratory. The malathion-resistant (MR) strain  was obtained by continuous selection with 89.1% malathion  applied to the pronotum of adult flies using a PB600-1 repeating dispenser   and dissolved in 1\u00a0mL acetonitrile. The solution was centrifuged  and the malathion content of the supernatant was determined by high performance liquid chromatography  as previously described [\u22121. The malathion was analyzed with monitor at 27\u00a0\u00b0C and 230\u00a0nm. The penetration ratio of malathion was calculated as follows:Insecticide penetration was measured as previously described, with slight modifications , 41. Fliescribed , 42. Bri\u00a0g, 10\u00a0min, 4\u00a0\u00b0C). We then added 300 \u03bcL 14\u00a0M KOH to the pellet and incubated at 130\u00a0\u00b0C for 90\u00a0min. The samples were then mixed with 800 \u03bcL ice-cold 75% ethanol and incubated on ice for 15\u00a0min before adding 30 \u03bcL Celite 545 (0.1\u00a0g in 2\u00a0mL 75% ethanol). After centrifugation , the pellet was washed with ice-cold 40% ethanol to purify the chitosan. We then mixed 500 \u03bcL chitosan with 250 \u03bcL 10% NaNO2 and 250 \u03bcL 10% KHSO4 and incubated at room temperature for 15\u00a0min. After centrifugation , 120 \u03bcL of the supernatant was vortexed with 40 \u03bcL NH4SO3NH2 (2.5\u00a0g dissolved in 17.5\u00a0mL ultrapure water) for 15\u00a0min before adding 40 \u03bcL 3-methyl-2-benzothiazolone (MBTH) hydrazone hydrochloride hydrate solution  and incubating at 100\u00a0\u00b0C for 5\u00a0min. After cooling, the reaction mixture was measured with glucosamine at 650\u00a0nm using a microplate reader to analyze the chitin content.The chitin was hardly extracted and measured from insects, thus the reaction production glucosamine reflected the content of chitin. It was measured as previously described, with slight modifications . The fliThe pronotum of 5-day-old adult flies was dissected, fixed in 4% glutaraldehyde at 4\u00a0\u00b0C overnight, washed with PBS and transferred to a tube containing 1% osmium tetroxide for 2\u00a0h. After another wash with PBS, the samples were dehydrated in a gradient of 60%, 70%, 80%, 90%, 95% and 100% ethanol (1\u00a0h each) followed by acetone for 1\u00a0h, before incubation in Suprr  in a temperature gradient of 40, 50, 60 and 70\u00a0\u00b0C. Ultrathin sections (<\u200970\u00a0nm) were prepared on an ultramicrotome  and stained with 2% aqueous uranyl acetate for 10\u00a0min. After washing with ultrapure water, the dried ultrathin sections were imaged by TEM on an HT7800 instrument . For gold immunolocalization, the pronotum of 5-day-old adult flies was dissected, fixed in 3% paraformaldehyde and 0.5% glutaraldehyde at 4\u00a0\u00b0C overnight, wished with PBS and dehydrated with 30% and 50% ethanol at 4\u00a0\u00b0C (20\u00a0min each). Then, the samples were further dehydrated with 50%, 70%, 90% and 100% ethanol (40\u00a0min each) and treated with LR Gold  contained 30%, 70% and 100% ethanol (120\u00a0min each) at -20\u00a0\u00b0C. After that, the samples incubated with LR Gold resin under ultraviolet for 72\u00a0h. Then, ultrathin sections (<\u200970\u00a0nm) were prepared on an ultramicrotome and blocked with 5% goat serum for 1\u00a0h before incubation with an antibody specific for CPCFC  at 4\u00a0\u00b0C overnight. After three washes in PBS, bound primary antibody was detected using a goat anti-rabbit IgG conjugated to 10-nm colloidal gold  at room temperature for 2\u00a0h. After washing with PBS and ultrapure water, the ultrathin section was stained with 2% aqueous uranyl acetate for 10\u00a0min prior to TEM.+  and first-strand cDNA was prepared using the PrimeScript 1st Strand cDNA Synthesis kit . Quantitative real-time analysis of mRNA and lncRNA was carried out as previously described with GoTaq qPCR Master Mix (Promega) , 43. ForP\u2009<\u20090.05 and |Fold change|>\u20091) [Total RNA was extracted from 5-day-old adult flies (MR and MS strains) using TRIzol reagent. We prepared three biological replicates, each a mixture of two female and two male flies. The purity, concentration and integrity of RNA were tested using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific) and by gel electrophoresis to ensure the use of qualified samples for transcriptome sequencing. The six small RNA libraries from the MR and MS strains were prepared for the Illumina HisSeq 2500 platform by Biomarker Technology . RNA-Seq and the identification of miRNAs followed our previous approach . The difnge|>\u20091) .2, 0.3% Triton X-100) containing RNAse inhibitor and protease inhibitor (Thermo Fisher Scientific). After centrifugation , the supernatant of each sample was divided into two parts (the input sample and pull-down sample). The pull-down sample was added to pre-treated magnetic beads (washed with solutions A and for five times), which contained avidin, for incubation at 4\u00a0\u00b0C overnight. After a centrifugal pulse, the supernatant was removed from each sample using a magnetic stand . Then, the beads were washed four times with lysis buffer. Total RNA was then extracted from the input sample and washed pull-down sample using TRIzol reagent, and first-strand cDNA was prepared as described above. The enrichment of mRNA/lncRNA was determined by RT-qPCR using B. dorsalis ribosomal protein S3 (RPS3) and \u03b1-tubulin as reference genes  and fixed in 4% paraformaldehyde at 4\u00a0\u00b0C overnight. Samples were then embedded in optimum cutting temperature (O.C.T.) compound  at \u201380\u00a0\u00b0C for 2\u00a0h before 8\u00a0\u03bcm sections were prepared on a freezing microtome (Thermo Fisher Scientific). The target RNAs were detected using an in situ hybridization kit . Probes complementary to miR-994, CPCFC was detected in vivo by western blot and immunohistochemical analysis as previously described , 7. For CPCFC mRNA sequence including the 3\u2032UTR and the lnc19419 sequence were each inserted into the vector pmirGLO (Promega). Mutated versions were prepared using a site-directed mutagenesis kit (Beyotime Biotechnology). The four plasmids were then used in separate transfection experiments, and were introduced into HEK-293\u00a0T cells along with synthetic miRNAs using transIt-LT1 transfection reagent . The relative luciferase activity was measured 24\u00a0h post-transfection with an Orion microplate luminometer  and the dual-glo luciferase assay system (Promega).Luciferase reporter assays were carried out as previously described . The CPCCPCFC open reading frame was inserted into vector pET-28b and expressed in Escherichia coli BL21(DE3) cells . The recombinant protein was purified using a Ni\u2013NTA spin column  and correct folding was confirmed by western blot. The soluble recombinant CPCFC was then mixed with chitin resin (Sigma-Aldrich) and incubated at room temperature for 4\u00a0h [\u00a0g, 10\u00a0min, 4\u00a0\u00b0C) the supernatant and pellet were collected to analyze the CPCFC content by western blot. The protein content of the supernatant was also measured using a BCA protein assay kit (Beyotime Biotechnology).The chitin-biding ability of CPCFC was tested in a bacterial expression system . The CPC for 4\u00a0h . After cB. dorsalis  and related annotation files  [RNA libraries were prepared for the Illumina HiSeq platform (Biomarker Technology) and were sequenced and analyzed as previously described . In brieorsalis)  using HIorsalis) . The finorsalis) .The analysis and identification of lncRNA was performed as our previous studies , 43. TheP\u2009<\u20090.05 and |Fold change|>\u20091) [For the analysis of differential expression post injecting synthetic miR-994 or NC, total RNA was extracted with Trizol reagent from three replicate samples of two males and two females injected with the synthetic miR-994 or NC. For cuticular RNA-Seq (MR and MS strains), 20 dissected pronotum without muscle from 5-day-old adult flies  were pooled as a single sample. Three replicate samples were prepared from each strain. The differential expression of mRNA and lncRNA was analyzed using DESeq2 (nge|>\u20091) . The lnchttps://github.com/zhuqianhua/qTar) to predict miR-994 binding sites.Twenty genes were selected based on the overlap between the genes downregulated by the injection of synthetic miR-994 and the genes upregulated in MR flies in the cuticular RNA-Seq experiments. We also selected 12 lncRNAs upregulated in the cuticular RNA-Seq experiments that exceeded a FPKM threshold of 10. These sequences were analyzed using miRanda , PITA 5, RNAhybrCHS1, CPCFC, lnc19419 and GFP were synthesized using the transcript aid T7 high yield kit (Thermo Fisher Scientific). The dsRNA (2\u00a0\u03bcg) or synthetic miRNA  were injected into 3-day-old adults of the MR strain, and a second injection was carried out 24\u00a0h later. The functional analysis of lnc19419, miR-994, CHS1 and CPCFC was carried out 12\u00a0h after the second injection.The dsRNA of P\u00a0< 0.05,\u00a0**P < 0.01,\u00a0***P <\u00a00.001).\u00a0\ufeffMeans were compared using two-tailed Student\u2019s t-tests with significance levels set at *P\u2009<\u20090.05, **P\u2009<\u20090.01 and ***P\u2009<\u20090.001 .\u00a0For cuticular thickness analysis, the boxes represent the 25% and 75% percentiles and the black lines within the boxes indicate the medians. Error bars correspond to the minimum and maximum values.Data are shown as means\u2009\u00b1\u2009SE from at least three independent biological replicates. All Figures were prepared using GraphPad Prism v8.0 . Statistical analysis was carried out using SPSS v22.0 for Windows. The Survival rate was analyzed with Log-rank (Mantel-Cox) test of GraphPad Prism v8.0 (*Additional file 1: Figures S1-S5. FigS1. The cuticle-mediated resistance analysis. FigS2. Differential expression of small RNAs between the MR and MS strains. FigS3. Prediction of miR-994 target genes. FigS4. Western blot and immunohistochemical analysis. FigS5. The identification of lncRNAs and subsequent bioinformatics analysis.Additional file 2: Data S1-S6. Data S1. Identified miRNAs and other sequences from small RNA-Seq experiments. Data S2. Downregulated miRNAs from small RNA-Seq experiments of MR strain. Data S3. Downregulated mRNAs following treatment with synthetic miR-994. Data S4. Upregulated mRNAs based on cuticular RNA-Seq experiments. Data S5. Upregulated lncRNAs based on cuticular RNA-Seq experiments. Data S6. Target genes predication for lncRNA.Additional file 3: Tables S1-S3. Table S1. The analysis of detoxification enzyme activities following the injection of synthetic miR-994. Table S2. Toxicity of different insecticides against B. dorsalis strains MS and GX. Table S3. The information of primers, probe and antibody used in this study.Additional file 4. The individual data values for Fig. 1A-C, E-G, 2A-C, 2E-H, 2J, 3A-B, 3D-F, 3H-J, 4A-D, 4E-H, 4J-L, 5A, 5C-D, S1B-C, S2A-D, S3C, S3E, S3G, S5G-H, S5K-L, S5N, Table. 1, 2, S1, S2."}
+{"text": "IntroductionAdolescence is a distinct stage of development marked by a variety of physiological, behavioral, hormonal, and cellular changes.ObjectiveThe objective of this study is to assess the cytomorphometry of buccal exfoliated cells in the age groups 1-10 and 11-19 and\u00a0detect any changes in their buccal exfoliated cells\u00a0during the coronavirus disease 2019 (COVID-19) pandemic.Materials and methodsBuccal smears were collected from 60 patients of age groups 1-10 (n=30) and 11-19 (n=30). Cytomorphometric analysis was done using the ImageJ software . Statistical analysis was done using an independent t-test.ResultsThe cytomorphometric analysis of buccal smears between age groups 1-10 and 11-19 showed a statistically significant difference in cell size, cell shape, and nuclear-cytoplasmic (N/C) ratio.ConclusionThis study helps to understand the physiological changes in this era and thus will aid\u00a0to compare the physiological to the pathological changes of exfoliated cells in future studies. Exfoliative cytology is the microscopical assessment of shed or desquamated cells from the epithelial surface, which is a\u00a0rapid, painless, and less time-consuming procedure . Being aEpithelial physiology is the foundation of exfoliative cytology. The loss of cell surface occurs on a regular basis in normal epithelium, and the thickness of the epithelium remains constant. Under normal conditions, epithelial cells are firmly fixed in place. The cells lose their cohesive force and exfoliate in the presence of any underlying pathology.\u00a0As the cell cohesiveness is lost, exfoliated cells can be collected and examined under a microscope .The oral cavity can be thought of as the perfect location to observe the effects of aging. The oral epithelium is continuously replaced by undergoing periodic turnover, indicating that this tissue should offer measurable signs of aging. The buccal mucosa especially serves as a promising site for smear collection as it enables quick and noninvasive smears . Buccal In addition to this, there are various hormonal influences, especially in the prepubertal and\u00a0pubertal age groups, which show changes in the cytodifferentiation of the epithelium. Many tissues and epithelia undergo maturational changes as a result of estrogens and other steroid hormones. It is known that these hormonal stimuli generate distinct changes in the morphology of the epithelium in the buccal and vaginal mucosae. The degree of cell maturation increases with the number of superficial cells in the epithelium . It has Coronavirus disease 2019 (COVID-19) was declared a public health emergency and a global pandemic, which had a variety of psychosocial effects on people at the individual, national, and international levels . The infDespite the fact that several quantitative cytomorphologic and cytomorphometric research on pathological changes present in the oral cavity have been conducted, very few investigations have been made on the clinically normal oral mucosa to evaluate the physiological age- and gender-related changes under environmental influences. Studies that reported on physiological alterations, especially in the buccal mucosa, pertaining to the pediatric age group in the COVID-19 era\u00a0are also very little . The majThe study was a cross-sectional study done at Saveetha Dental College, Chennai, Tamil Nadu, between December 2021 and February 2022 after obtaining ethical committee clearance  . The study was ethically conducted in accordance with the Declaration of Helsinki. The study subjects were randomly selected from the patients reporting to the outpatient department of our institution. The sample size was calculated using the G*Power software , based on the article by Nagarathinam et al. . PatientPhotomicrographs were taken at both 10\u00d7\u00a0and 40\u00d7\u00a0magnification and were transferred to a computer\u00a0Figure . The celStatistical analysis was carried out using the Statistical Package for Social Sciences (SPSS) version 21\u00a0. The difference in cell size, nuclear size, and nuclear-cytoplasmic ratio between the age groups 1-10 and 11-19 was calculated using Student's t-test. These parameters were also calculated and compared between males and females in the age group\u00a0between one and 19 using Student's t-test, and a p-value of <0.05 was considered significant.The cytomorphometric analysis of buccal smears between age groups 1-10 and 11-19 showed a statistically significant increase in cell size (p=0.02) in the age group\u00a011-19 compared to the age group 1-10 with a mean cellular value of 22.75\u00b16.6 and 27.78\u00b19.5, respectively.There is an increase in nuclear size in the age group 11-19 compared to the age group 1-10 p=0.230). The increase in nuclear-cytoplasmic ratio in the age group 11-19 was also noted p=0.285)\u00a0. There was an increase in nuclear size (p=0.5) in females compared to males, but it was not statistically significant. There was also a statistically significant increase in nuclear-cytoplasmic ratio (p=0.01) in males compared to females\u00a0Tables , 7.Adolescence is a developmental stage between childhood and adulthood that is characterized by numerous behavioral, hormonal, and cellular changes. The second decade of life, or adolescence\u00a0as the World Health Organization (WHO) defines it (10-19 years old), is a period of profound physical, psychological, and social transformation. In our study, there is a significant difference in cell size \u00a0(p=0.021) between the age groups 1-10 and 11-19, which was consistent with the study conducted by Donald et al. ,\u00a0in whicIn a study conducted by Shetty et al. ,\u00a0there wThe difference in the nuclear-cytoplasmic (N/C) ratio\u00a0(p=0.285)  was observed in our study, which was consistent with the results of the study conducted by Anuradha and Sivapathasundharam\u00a0, whereinPatel et al.  have obsIn a study by Verzani et al. ,\u00a0they foAs there is a paradigm shift in cellular growth and development, as well as the onset of puberty in the past 10 years, especially in the COVID-19 era, there is a need to understand the physiological hormone-related changes in children in this era.\u00a0Understanding the morphological changes of exfoliated cells in different age groups gives the basis for physiology and helps to assess the changes in normal morphology. Morphological changes in the oral exfoliated cells can be due to fluctuating levels of hormones such as growth hormone, estrogen, testosterone, and progesterone\u00a0.Epithelial cells show tight junctions, anchoring junctions, and gap junctions allowing varying degrees of cellular interactions. It helps in adhesion to extracellular matrix and influences cell shape. Intercellular communication alongside the transfer of ions and small molecules is also crucial in understanding the physiology of epithelial cells in homeostasis or in diseased states. Epithelial cells also undergo cell division and apoptosis, migration, and fluid pumping that modifies tension and cytoskeleton, which are ultimately governed by genetic regulation that reflects in cell morphology.The importance of improving our understanding of normal morphology and its deviation beginning in early infancy cannot be overstated because many childhood-onset diseases progress to lifelong, chronic illnesses. Only after the fundamental observations in normal oral mucosal cells are established can the pathology be examined.Furthermore, cytomorphometric analysis in the pediatric age groups can be done to assess hormone-related disorders such as dwarfism and acromegaly.\u00a0Thus, this study can be considered a benchmark in assessing the normal growth phase in children, which enables us to identify any delay or accelerated growth pattern in children during the COVID-19 era.As a future scope, studies must be carried out to assess if there are any changes in the cytomorphometry of buccal smears compared to the COVID-19 era, to establish whether lifestyle during the COVID-19 era had a significant impact on the physiological cellular growth pattern.LimitationsThe main limitation of the present study is that it has less sample size\u00a0and was carried out in a single hospital-based setting.\u00a0Clinical correlation has not been done, and a comparison of cellular changes between the COVID-19 pandemic and\u00a0pre-COVID-19 pandemic has not been done.Our observation showed a difference in the morphology of buccal exfoliated cells between the age groups 1-10 and 11-19. This study will aid us in distinguishing between normal and abnormal morphology and ensuring the normal physiological increase in cellular and nuclear sizes and increased nuclear-cytoplasmic ratio\u00a0in young adolescents, as well as the increase in all these parameters in females compared to that of the males of the same age group 1-19. These changes should not be misdiagnosed as a deviation from normal morphology. Thus, this may serve as a tool to assess hormone-related normal and abnormal changes, especially in the pubertal growth phase during the COVID-19 pandemic."}
+{"text": "Magnetic resonance imaging (MRI) with its innovative techniques, such as diffusion-weighted imaging (DWI) and apparent diffusion coefficient (ADC), increases the diagnostic accuracy in distinguishing between malignant and benign lesions of the endometrium. The aim of the study was MRI differentiation between malignant and benign endometrial lesions and correlation with histopathological findings with a special emphasis on quantitative analysis. An additional aim was to correlate the ADC values and histological tumor grades.The prospective study included 119 female patients with or without vaginal bleeding and pathological values of endometrial thickness, who underwent MRI examinations. According to MRI reports the patients were divided into 45 suspicious malignant and 74 suspicious benign endometrial lesions. The radiological diagnosis was compared to the histopathological evaluation, which confirmed 37 malignant lesions while the rest were benign.\u22123 mm2/s and for benign lesions was 1.318 \u00b1 0.20\u00d710\u22123 mm2/s. The ADC values for malignant lesions were expectedly lower than those of benign lesions (p<0.001). The ADC cut-off value was 1.007\u00d710\u22123 mm2/s with a sensitivity of 100%, specificity of 92.7%, a positive predictive value of 60.3%, and a negative predictive value of 100%. In comparison with the histopathological findings, the sensitivity of MRI was 100%, specificity 90.2%, positive predictive value was 82.2%, and negative predictive value was 100%. Observing the histological grades 1, 2, and 3 of endometrial carcinoma, no statistically significant differences of mean ADC values were found. The mean ADC values for histological tumor grades 1,2 and 3 were 0.803 \u00b1 0.13\u00d710\u22123 mm2/s, 0.754 \u00b1 0.12\u00d710\u22123 mm2/s and 0.728 \u00b1 0.13\u00d710\u22123 mm2/s, respectively.The mean ADC value for malignant lesions was 0.761 \u00b1 0.13\u00d710DWI and ADC values represent clinically useful tools for the differentiation between malignant and benign endometrial lesions with high sensitivity and good specificity, but the results failed to demonstrate their usefulness in differentiating histological grades of endometrial cancer. The mosEC is divided into type I and type II. Type I is the most common and includes endometrioid adenocarcinoma accounting to 75-80% of all endometrial cancers according to literature data, while type II is more aggressive and shows a tendency to greater infiltration of the myometrium  examination. Subsequently, all patients were examined on MRI with DWI. Twenty-four patients were excluded from the study based on the exclusion criteria and the total number of patients was 119. According to the MRI results, patients were divided into two groups. The first group consisted of 45 patients with reported suspected malignant endometrial lesions, and the second group of 74 patients with reported suspected benign endometrial lesions on MRI. After MRI examination the final diagnosis was established according to histopathological evaluation, and the results were compared to MRI reports. The study was approved by the institutional ethical committee. All patients gave written informed consent to take part in this study. Inclusion criteria were: postmenopausal patients with bleeding and TVUS measured endometrial thickness greater than 5\u00a0mm, asymptomatic postmenopausal patients with TVUS measured endometrial thickness greater than 11\u00a0mm, premenopausal or perimenopausal women with abnormal uterine bleeding and TVUS measured endometrial thickness greater than 16\u00a0mm, no contraindications for MRI examination, indication set by the gynecologist to perform exploratory curettage or hysteroscopy and some of the patients were indicated for operation.The main exclusion criteria were patients with contraindications for MRI examination, large submucosal myoma of the uterus that protruded into the lumen of the uterine cavum limiting the evaluation, endometrial changes that were unclearly displayed on the DWI and ADC map making their evaluation impossible, and the absence of subsequent histological finding.The following flowchart presents methodological steps from patients\u2019 selection phase to MRI examination and analysis (ADC measurements), histopathological evaluation and comparation between MRI and histopathology data Figure\u00a012.2MR examination of the pelvis in all patients was performed using a 1.5 Tesla MR unit . Images were acquired with an 8-channel body array coil using the lower configuration in the supine position. The following sequences were used: T2-weighted fast relaxation fast spin-echo sequence (T2W FR FSE) sagittal, coronal and axial plane, T1-weighted fast spin-echo (T1W FSE) axial plane, T1-weighted fast spin-echo with fat suppression (T1W FSE FS) axial plane, T2-weighted fast relaxation fast spin-echo sequence (T2W FR FSE) axial oblique (perpendicular) to the uterine cavity, diffusion-weighted imaging (DWI) in the axial plane, Liver Acquisition with Volume Acquisition (LAVA) sequence in the axial plane before and after contrast administration. Apparent diffusion coefficient (ADC) maps were generated with the manufacturer\u2019s software. The parameters of the MRI sequences are presented in 2.3Image analysis and measurements were done on a clinical picture archiving and communication system workstation monitor and post-processed using the General Electric Functool software package . Quantitative and qualitative analyses of the images were performed by two experienced radiologists independently, who then came to a joint conclusion. First, an evaluation of conventional and post-contrast sequences was made, which were then correlated with DWI sequence and corresponding ADC map, including both qualitative and quantitative analysis. The ADC map itself poorly shows anatomical details, so it is necessary to perform the analysis together with other MR images, which, besides DWI sequence, include high-resolution anatomical images and post-contrast images. On T2W sequence, morphological characteristics of the uterus were observed, i.e., its appearance, size, shape, as well as zonal anatomy. The corpus and cervix of the uterus were particularly observed. Then an evaluation of the appearance of the uterine cavity and the presence of any content was checked. Special emphasis was placed on the evaluation of the endometrium and its lesions as the subject of this study. The thickness of the endometrium was measured, with careful observation of its signal-morphological characteristics. On T1W sequence, the appearance of the uterus was observed, i.e., external contours, the presence of any hematometra or hemorrhagic content, the appearance of the endometrium, and lymph nodes. On T2W sequences, DWI, and post-contrast images, we evaluated the tumor invasion of the myometrium.2/s and corresponding low signal intensity on ADC maps which indicated signs of diffusion restriction. In other cases, when hyperintensity on DWI corresponded to a high signal intensity on ADC maps, lesions were suspected to be benign. The ADC values of both suspected malign and suspected benign endometrial lesions were measured manually using a circular region of interest (ROI). The ROI was manually drawn and placed on a representative region as large as possible to include only the solid parts of the endometrial lesion. We cautiously avoided areas of normal myometrium and junctional zone, cystic or necrotic areas and hemorrhagic content. To do so, the conventional and postcontrast MRI sequences were evaluated and correlated with DWI and ADC maps. The size of ROI in each case depended on the size of the endometrial lesion. The ROI was set on the T2-weighted image and was manually copied to the corresponding ADC map, whereupon ADC values were automatically calculated. Three individual ROIs were drawn at different sections of each lesion, based on which the average ADC value for each patient was calculated.The characteristics of endometrial lesions were observed with an emphasis on DWI images. Lesions and areas that were suspected of malignancy showed high signal intensity on DWI images with the b value of 1200 mm2.4Definitive diagnoses were set based on histopathological evaluation and reports after fractionated exploratory curettage, hysteroscopy and/or surgical operation. They were made by two pathologists experienced in gynecological pathology and were in compliance with the WHO  Classification of Tumors and FIGO  grading of endometrial carcinoma.2.52 test. ROC analysis was used to define the cut-off value of the test that gives the best ratio of specificity and sensitivity. Values of significance level p<0.05 are considered statistically significant. The results are presented in tables and figures.Statistical analysis was performed using the Statistical Package for Social Science \u2013 IBM SPSS Statistics 21. Numerical variables were presented through mean values (arithmetic mean) and measures of variability , and attributive variables were presented using frequencies and percentages. We checked a normal distribution using the Kolmogorov-Smirnov test, and appropriate tests were used in relation to that. The comparison of numerical values between two groups was performed using the Student\u2019s t-test and Mann-Whitney test, while one-way analysis of variance (ANOVA) was used to compare values between three and more groups of data. Testing the difference in frequencies of attributive variables was performed using the \u03c732 = 14,826; p<0,001).In our study the mean age of female patients was 63.28 \u00b1 8.02 (range 44-82 years) and among them 112 were in postmenopausal and 7 in perimenopausal period. Mean endometrial thickness measured at TVUS examination was 15.51 \u00b1 6.05\u00a0mm (range 7-35\u00a0mm). Vaginal bleeding was noted in 80 patients, while in 39 cases it was asymptomatic. Endometrial thickness values in patients with benign lesions were statistically significantly lower than in those with malignant lesions . Significantly more patients with malignant lesions had vaginal bleeding compared to those with benign lesions (\u03c7\u22123 mm2/s (range 1.044-1.858\u00d710\u22123 mm2/s) and in 45 cases they were reported as probably malign, with the mean ADC value 0.790 \u00b1 0.14\u00d710\u22123 mm2/s (range 0.542-1.059\u00d710\u22123 mm2/s).Based on the MRI analysis, in 74 cases endometrial changes were reported as probably benign, with the mean ADC value of 1.361 \u00b1 0.161\u00d710\u22123 mm2/s (range 0.542-1.007\u00d710\u22123 mm2/s), whereas the mean ADC value of benign lesions was 1.318 \u00b1 0.20\u00d710\u22123 mm2/s (range 0.756-1.858\u00d710\u22123 mm2/s). The histopathological findings are summarized in According to histopathological reports, malignancy was confirmed in 37 out of 45 cases reported as malignant on MRI, and the rest of 82 cases were proved to be benign. The mean ADC value of confirmed malignant lesion was 0.761 \u00b1 0.13\u00d710-3 mm2/s and 0.756 x 10-3 mm2/s, respectively. The case number 82 with the ADC value of 1.858 x 10-3 mm2/s was an extreme outlier. This value is more than 3.0 x interquartile range above the third quartile.The box-and-whisker plots presented in -3 mm2/s. Using this value, the sensitivity for distinguishing malignant from benign lesions was 100%, specificity was 92.7%, positive predictive value (PPV) was 60.3%, and negative predictive value (NPV) was 100%.The results of ROC curve analysis presenting sensitivity and specificity of ADC values in differentiation between malignant and benign endometrial lesions are shown in By comparing the MRI findings with the findings obtained after the histopathological analysis, the sensitivity of MRI in relation to histopathological findings was 100%, specificity was 90.2%, PPV 82.2% and NPV was 100%.\u22123 mm2/s (range 0.620-1.007\u00d710\u22123 mm2/s), for grade 2 (n=15) 0.754 \u00b1 0.12\u00d710\u22123 mm2/s (range 0.542-0.953\u00d710\u22123 mm2/s) and for grade 3 (n=11) was 0.728 \u00b1 0.13\u00d710\u22123 mm2/s (range 0.579-0.954\u00d710\u22123 mm2/s). There was no statistically significant difference  in the mean ADC values depending on the histological grade of the malignant lesions, as demonstrated in In the group of proved malignant lesions, the mean ADC value for histological grade 1 tumors (n=11) was 0.803 \u00b1 0.13\u00d710\u22123 mm2/s and stage IB with the mean ADC value of 0.696 \u00b1 0.12\u00d710\u22123 mm2/s. We noticed that the stages IA and IB were most represented and there was no statistically significant difference in the mean ADC values between the mentioned stages .In cases where EC was confirmed, FIGO stage was determined. According to MRI analysis and histopathological reports, the stages IA, IB, II, IIIA and IV were present Table\u00a03.4In oncological imaging the functional DWI technique is recognized as an imaging biomarker due to its ability to detect microscopic changes in the tumor structure , 13. As Invasive diagnostic methods for obtaining tissues for histopathological analysis of the endometrium have limitations. In 2-28% of cases they cannot provide a diagnosis due to possible errors in collecting a tissue sample or obtaining an insufficient sample . In suchHistopathological verification of the accuracy of the DWI and ADC in the differentiation of malignant and benign changes of the endometrium would contribute to verifying the reliability of radiological MRI findings and to the affirmation of MRI as a non-invasive and preferred method in diagnostics. At the same time, the number of invasive diagnostic procedures, exploratory curettage and hysteroscopy could be reduced. It is predicted that MRI with DWI and ADC may become a method for monitoring women with risk factors for development of EC and with an initially benign endometrial lesion, which is primarily important for the early detection of EC.In previous research the most attention has been devoted to examining the role of DWI and ADC in the differentiation of EC from various benign endometrial lesions in a more precise diagnosis of EC, as well as to the possibility of determining its histological grade , 15\u201317.\u22123 mm2/s and for benign lesions 1.318 \u00b1 0.20\u00d710\u22123 mm2/s, where the cut-off ADC value was 1.007\u00d710\u22123 mm2/s. The results of most studies confirm that there is a statistically significant difference in the mean ADC value of EC in relation to benign endometrial lesions , but there was a correlation with the cut-off value of 1.007\u00d710\u22123 mm2/s  than those of benign lesions with the calculated cut-off value of 1.18\u00d710\u22123 mm2/s  and specificity (97%) were observed in two studies at cut-off ADC values of 0.90 and 0.98\u00d710\u22123 mm2/s , where the mean ADC values for malignant and benign lesions were 0.82 \u00b1 1.09\u00d710ectively . In thei lesions . Based o NPV 92% . In our 2) and ADC value measurements, the mean ADC values for carcinoma were 0.864 \u00b1 0.31\u00d710\u22123 mm2/s and 1.277 \u00b1 0.22\u00d710\u22123 mm2/s for benign lesions with a statistically significant difference  and grade 2 (0.968 \u00b1 0.240\u00d710\u22123 mm2/s) in relation to the value in grade 3 (0.917 \u00b1 0.184\u00d710\u22123 mm2/s)  .\u22123 mm2/s, 0.76 \u00b1 0.17\u00d710\u22123 mm2/s and 0.74 \u00b1 0.12\u00d710\u22123 mm2/s, respectively , which were significantly lower than the mean ADC values of tumors with superficial invasion (0.85\u00d710\u22123 mm2/s)  , 44. Thi studies , 26, 45.Recent articles that have attracted the interest of prestigious medical scientific journals are about the application of artificial intelligence, specifically its subfield of deep learning-based methods. The literature indicates that weakly-supervised learning-based deep learning methods using convolutional neural networks have shown significant results in image pattern recognition . PublishIn our country and other developing countries, such models of deep learning methods are currently unavailable. Our method has the advantage of being widely available and simple to apply, with the possibility of implementation in routine clinical practice in the evaluation of MR images, without requiring better computer equipment. Deep learning methods are trained to perform a specific task, and they require verification, as they may have some shortcomings depending on the input data and how they were trained . Based o5According to the results obtained in our study DWI with ADC map and measurements of ADC values represents a clinically useful tool in differentiation between malignant and benign endometrial lesions. Determination of the cut-off ADC value increases the diagnostic accuracy. The mean ADC values of malignant lesions are significantly lower than those of benign lesions and our results are in line with most of previous studies. In correlation to histopathological reports, MRI had a high sensitivity (100%) and good specificity of 90.2%. In our study population, there was no statistically significant difference in ADC values between different histological grades of tumors, and therefore grade prediction was impossible. The limitation may be due to the small number of patients with EC in the total sample. Future research on a larger sample of patients with EC could contribute to the determination of the histological grade of the tumor as an important prognostic factor. In determining FIGO stage, the most common were stages IA and IB, and there was no significant difference in the mean ADC values.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Clinical Center of Vojvodina, Novi Sad, Serbia. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.The authors confirm their contribution to the paper as follows: study conception and design: ON and LM-S; data collection: BS, LM-S, and DV; analysis and interpretation of results: BS, ON, NA, and UM; draft manuscript preparation: BS, NA, and DK. All authors contributed to the article and approved the submitted version."}
+{"text": "To develop an intuitive and generally applicable system for the reporting, assessment, and documentation of ADC to complement standard BI-RADS criteria.p values\u2009\u2264\u20090.05 were considered statistically significant.This was a multicentric, retrospective analysis of 11 independently conducted institutional review board\u2013approved studies from seven institutions performed between 2007 and 2019. Breast Apparent Diffusion coefficient (ADC-B) categories comprised ADC-B0 (ADC non-diagnostic), ADC-B1 (no enhancing lesion), and ADC-B2-5. The latter was defined by plotting ADC versus cumulative malignancy rates. Statistics comprised ANOVA with post hoc testing and ROC analysis. \u22123 mm2/s) differed significantly between benign  and malignant lesions , and between invasive  and in situ carcinomas  (p\u2009<\u2009.001). The following ADC-B categories were identified: ADC-B0\u2014ADC cannot be assessed; ADC-B1\u2014no contrast-enhancing lesion; ADC-B2\u2014ADC\u2009\u2265\u20091.9 ; ADC-B3\u2014ADC 1.5 to\u2009<\u20091.9 (0.1\u20131.7%); ADC-B4\u2014ADC 1.0 to <\u20091.5 (10\u201324.5%); and ADC-B5\u2014ADC <\u20091.0 (>\u200924.5%). At the latter threshold, a positive predictive value of 95.8% (95% CI 0.94\u20130.97) for invasive versus non-invasive breast carcinomas was reached.A total of 1625 patients (age: 55.9\u00a0years (\u00b1\u200913.8)) with 1736 pathologically verified breast lesions were included. The mean ADC (\u00d7\u200910The breast apparent diffusion coefficient system (ADC-B) provides a simple and widely applicable categorization scheme for assessment, documentation, and reporting of apparent diffusion coefficient values in contrast-enhancing breast lesions on MRI.The ADC-B system, based on diverse MRI examinations, is clinically relevant for stratifying breast cancer risk via apparent diffusion coefficient measurements, and complements BI-RADS for improved clinical decision-making and patient outcomes.\u2022 The breast apparent diffusion coefficient category system (ADC-B) is a simple tool for the assessment, documentation, and reporting of ADC values in contrast-enhancing breast lesions on MRI.\u2022 The categories comprise ADC-B0 for non-diagnostic examinations, ADC-B1 for examinations without an enhancing lesion, and ADC-B2-5 for enhancing lesions with an increasing malignancy rate.\u2022 The breast apparent diffusion coefficient category system may be used to complement BI-RADS in clinical decision-making.The online version contains supplementary material available at 10.1007/s00330-023-09675-0. Diffusion-weighted imaging (DWI) is a powerful tool to complement contrast-enhanced magnetic resonance (CE-MRI) imaging of the breast. It can be used as an imaging biomarker for the malignancy of breast tumors \u20133 and alDWI measures the random movement of water molecules by the application of diffusion gradients. This movement can be quantified by calculating the apparent diffusion coefficient (ADC). While many studies have shown the potential of DWI, its implementation into the breast clinical routine is still a work in progress: while the Breast Imaging Reporting and Data System (BI-RADS) has been established as a tool for the simple and comparable reporting of breast MRI , no cateThus, the aim of this retrospective study was to develop a simple and clinically applicable breast ADC (ADC-B) categorization system to complement MRI BI-RADS regarding the assessment, documentation, and reporting of ADC values in contrast-enhancing breast lesions on MRI, based on cumulative malignancy rates and ADC measurements from a large, multicentric breast MRI database.Individual anonymized patient and lesion data from seven institutions in four countries were collected, pooled, and transferred into a multicenter database. The database included independent patient samples from eleven single-center studies, performed between 2007 and 2019. The data of the patients included in this analysis have in part been analyzed and published previously Invasive breast carcinomasInvasive mucinous breast carcinomasDuctal carcinomas in situ (DCIS)Other malignancies The different histologic subtypes were summarized into the following categories for further analysis:The category \u201chigh risk\u201d was attributed to lesions of uncertain malignant potential, which were not malignant in the final histology after surgery or vacuum biopsy. The included high-risk lesions were atypical ductal hyperplasia, lobular carcinoma in situ/lobular neoplasia, atypical columnar cell hyperplasia, radial scar/complex sclerosing adenosis, flat epithelial atypia, papilloma/papillomatosis, and phyllodes tumor .All scans were performed on 1.5- or 3-T MRI scanners, using dedicated breast coils with the patients placed in prone position. All scans were performed using protocols that were standardized within each study sample following international guidelines, and included a T2-weighted sequence and native and CE T1-weighted sequences , 9. All b-value DWI and CE T1-weighted images to avoid necrotic areas or low-signal areas caused by T2 blackout effects of fat suppression, according to recommendations of EUSOBI and a recent meta-analysis [All ADC measurements were performed using 2-dimensional regions of interest (ROIs) covering the darkest part of the lesion identified visually on the ADC map, while using the high-analysis , 10, 11.Very high ADC : As in BI-RADS 2, these lesions can be considered as benign with a very high diagnostic confidence and no further work-up would be needed.High ADC : Comparable to BI-RADS 3, these lesions can be considered as probably benign. A short-term imaging follow-up should be suggested.Intermediate/low ADC : As in BI-RADS 4/5, the probability of malignancy in this category is high enough to warrant a work-up with image-guided biopsy and histopathological analysis.Very low ADC .In a first step, the ADC values of each lesion were plotted against the cumulative malignancy rates in a simple curve Fig.\u00a0. In a seIn a third step, the ADC values at the defined cumulative malignancy threshold were drawn from the plotted curve Fig.\u00a0. In a foCategory ADC-B0 applies to cases where ADC cannot be measured , while category ADC-B1 applies to cases without an enhancing lesion on CE T1-weighted . No such cases were included in the examined databases, and since there was no detectable lesion or measurable ADC, no ADC thresholds were applied for these categories.Statistical analysis was performed using SPSS 26.0 (IBM Corp.). With the exception of patient age, all calculations were performed on a per-lesion basis.t test. To test the robustness of ADC results within the heterogeneous database, a multivariable linear regression was performed using besides the final diagnosis  the center of ADC data origin, MRI unit field strength, and vendor and lesion size as covariates for the analysis.Means for the different lesion types were compared using one-way ANOVA and the Games-Howell post hoc test. Box plots were created to visualize the results. Benign and malignant lesions were also stratified by size (lesions \u2264\u200910\u00a0mm and\u2009>\u200910\u00a0mm), and means were compared between the size groups using the independent-samples Microsoft Excel (Microsoft Corp.) was used to plot the descending ADC values against the corresponding ascending cumulative malignancy rates to determine the thresholds of the ADC-B categories. In a further step, ROC was used to adapt the ADC cut-off between ADC-B categories 4 and 5.p values\u2009\u2264\u20090.05 were considered significant. No formal Bonferroni correction was applied as the number of statistical tests was limited and the number of cases high. Test results were interpreted considering clinical relevance of group differences to avoid overemphasis on spurious associations.The significance level was defined at 5%; thus, p\u2009<\u20090.001). There were 1333 (78.6%) mass and 362 (21.4%) non-mass lesions. No information about enhancement type was available for 41 lesions. Histopathological details are displayed in Table Following the exclusion of 122 patients due to incomplete data  for the benign lesions, 1.37\u2009\u00d7\u200910\u22123 mm2/s  for the high-risk lesions, and 0.95\u2009\u00d7\u200910\u22123 mm2/s  for the malignant breast lesions. When separated by malignant subtypes, the mean ADC values were 0.92\u2009\u00d7\u200910\u22123 mm2/s  for the invasive breast carcinomas , 1.18\u2009\u00d7\u200910\u22123 mm2/s  for the DCIS, 1.36\u2009\u00d7\u200910\u22123 mm2/s  for the invasive mucinous breast carcinomas, and 0.91\u2009\u00d7\u200910\u22123 mm2/s  for the other carcinomas.The mean ADC values were 1.45\u2009\u00d7\u200910p\u2009<\u20090.001), as well as between invasive breast carcinomas, DCIS, and benign lesions (p\u2009<\u20090.001). Mucinous breast carcinomas showed significantly higher ADC levels than other invasive carcinomas (p\u2009<\u20090.001), but not DCIS and benign lesions (p\u2009=\u20090.08\u20131.00). No significant difference could be found between the high-risk lesions and the benign lesions (p\u2009=\u20090.28).The mean ADC differed significantly between benign and malignant lesions (\u22123 mm2/s) and >\u200910\u00a0mm , while no significant difference could be found for the carcinomas . Mean ADC values were significantly different between benign and malignant lesions within each size group (p\u2009<\u20090.001).When stratified by size, mean ADC values for the benign lesions showed minor but statistically significant differences between the subgroup of \u2264\u200910\u00a0mm (1.42\u2009\u00d7\u200910R-squared of 0.408 (explaining 40.8% of the ADC variation), while excluding the final diagnosis from the multivariable model led to an R-squared of 0.030 (explaining only 3% of the ADC variation) with lesion size as the only significant covariate.Multivariable linear regression revealed that only the final diagnosis  significantly contributed to ADC variation. A model incorporating the final diagnosis as covariate achieved an adjusted \u22123 mm2/s. At this threshold, the PPV for invasive breast carcinomas versus non-invasive DCIS was 95.8% (95% CI 0.94\u20130.97).The area under the ROC curve for invasive versus non-invasive carcinomas was 0.76   categorization system to complement the American College of Radiology Breast Imaging Reporting and Data System (BI-RADS) in the assessment, documentation, and reporting of ADC values in contrast-enhancing breast lesions on MRI, which could seamlessly be integrated into MRI BI-RADS reporting. The ADC-B categorization includes a rule-out malignancy category at 99.9% in category ADC-B2 and differentiates invasive from non-invasive breast carcinoma with a PPV of 95.8% between categories ADC-B4 and 5.Despite the well-researched capabilities of ADC in breast imaging \u20135, its iAs previously reported , there wLesions in category ADC-B3 come with a cumulative malignancy rate\u2009<\u20091.7%. This threshold was determined by finding an ADC threshold for a cumulative malignancy rate of 2% and rounding this threshold to one decimal, since a threshold with more than one decimal is not feasible in clinical practice: While inter-reader variability is generally low for ADC measurements in the breast, a level of agreement up to the second decimal is probably unreachable .The threshold between the categories ADC-B4 and 5 was determined by calculating an ROC curve, in order to distinguish between invasive breast carcinomas and non-invasive DCIS with a PPV of 95%. DCIS is a common  non-invaIn addition, we suggest categories that cover for cases without enhancing lesions (ADC-B1) and cases in which the ADC cannot be evaluated, e.g., due to artifacts (ADC-B0). These categories could prove particularly helpful for audit purposes.While the ADC-B categories are derived from multicenter individual lesion and patient data and are, therefore, as a lowest common denominator, applicable to all of the included subpopulations, it has to be noted that these thresholds are not set in stone: with the addition of more ADC data from other sources, they may well be adapted in the future. This could especially be the case if further standardization of DWI, as suggested by the EUSOBI DWI working group , for exaThe ADC values found in this study are comparable to those previously reported. Significantly higher values were found in benign than in malignant lesions , 4, withNo significant ADC differences could be found between benign lesions with and without high-risk criteria . The microstructural changes in benign high-risk lesions do not seem to have an objective influence on the observed ADC. In contradiction, Parsian et al reported significant differences between high-risk lesions and other benign subtypes . HoweverFurthermore, while ADC is the most commonly used quantification method for DWI, it is a very simple and rather crude approximation of water diffusion properties in tissue. There are newer techniques such as intravoxel incoherent motion or non-Gaussian diffusion models that should better represent this diffusion and show comparable diagnostic performance . While tThis study has some limitations: firstly, the heterogeneity of the underlying data. While our multivariable analysis shows that only diagnosis  was a relevant factor influencing ADC values and thus ADC values were robust given the equipment and methods employed in this study, we do not provide an in-depth analysis of ADC confounders. Though this was outside the scope of this study, dedicated analyses, e.g., on the relevance of standardizing diffusion times, are warranted. From a clinical practice point of view, we see the inhomogeneity of the included patient samples and acquisition techniques as a strength, since this inhomogeneity represents the clinical reality and the established ADC thresholds can therefore be used in different clinical settings. This should not imply that standardization is not required but rather that the proposed ADC-B classification is already applicable. Secondly, the examined study samples included only lesions that have been biopsied for a definite diagnosis. Since lesions categorized as BI-RADS 2 or 3 are usually not biopsied, this may have led to a potential bias of lower malignancy rates in high ADC categories due to false-positive low ADC. However, since there is no rule-in criterion for malignancy anyway, this should not lower the applicability of our results. Another point of interest may be the stratification of ADC-B by lesion appearance as mass or non-mass. The aim of this study was to provide a simple ADC categorization system including a rule-out category applicable to mass and non-mass lesions alike. Further independent validation studies may show whether a more sophisticated approach provides additional value despite complicating application in clinical practice. Thirdly, we did not test the combination of the proposed ADC categories in combination with conventional (enhanced or unenhanced) breast MRI, since we felt that this exceeds the scope of this study.In conclusion, the breast apparent diffusion coefficient (ADC-B) categorization system provides a simple and widely applicable categorization scheme to complement MRI BI-RADS criteria for assessment, documentation, and reporting of ADC values in contrast-enhancing breast lesions on MR imaging.Supplementary file1 (PDF 84 KB)Below is the link to the electronic supplementary material."}
+{"text": "Introduce DWI and quantitative ADC evaluation in O-RADS MRI system and observe how diagnostic performance changes. Assess its validity and reproducibility between readers with different experience in female pelvic imaging. Finally, evaluate any correlation between ADC value and histotype in malignant lesions.In total, 173 patients with 213 indeterminate adnexal masses (AMs) on ultrasound were subjected to MRI examination, from which 140 patients with 172 AMs were included in the final analysis. Standardised MRI sequences were used, including DWI and DCE sequences. Two readers, blinded to histopathological data, retrospectively classified AMs according to the O-RADS MRI scoring system. A quantitative analysis method was applied by placing a ROI on the ADC maps obtained from single-exponential DWI sequences. AMs considered benign (O-RADS MRI score 2) were excluded from the ADC analysis.K\u2009=\u20090.936; 95% CI). Two ROC curves were created to determine the optimal cut-off value for the ADC variable between O-RADS MRI categories 3\u20134 and 4\u20135, respectively, 1.411\u2009\u00d7\u200910\u20133 mm2/sec and 0.849\u2009\u00d7\u200910\u20133 mm2/sec. Based on these ADC values, 3/45 and 22/62 AMs were upgraded, respectively, to score 4 and 5, while 4/62 AMs were downgraded to score 3. ADC values correlated significantly with the ovarian carcinoma histotype .Excellent inter-reader agreement was found in the classification of lesions according to the O-RADS MRI score (Our study demonstrates the prognostic potential of DWI and ADC values in the O-RADS MRI classification for better radiological standardisation and characterisation of AMs. Ovarian carcinoma is the second most frequent gynaecological cancer in Western countries and is the first cause of death due to malignant neoplasia of the female genital tract .Ultrasonography (US) is considered the first-line imaging approach for the evaluation of adnexal masses (AMs); however, between 18 and 31% of AMs remain indeterminate after ultrasound using the International Ovarian Tumour Analysis (IOTA) simple rules or other ultrasound scoring systems \u20134.MRI (magnetic resonance imaging) plays a key role as a second-level method in the evaluation of indeterminate adnexal masses detected on US. Recently, the American College of Radiology (ACR) Ovarian-Adnexal Reporting and Data System (O-RADS) MRI committee published a lexicon and risk stratification system for adnexal lesions , 6. O-RAO-RADS MRI system is based on morphological high-resolution T1 and T2 WI, dynamic contrast-enhanced (DCE) MRI series  , 8 and tThe main limitation remains related to the unfeasibility to obtain the enhancement curve, especially when a proper DCE MRI protocol is not performed, not allowing the correct classification into categories 3, 4 and 5. Additionally, TIC for intermediate and high risk cannot be evaluated in patients submitted to hysterectomy .As well demonstrated, limitations in the applicability of TIC are also showed in breast imaging reporting data system (BI-RADS) MRI\u2014due to the great heterogeneity of breast tumours and in nonmass tumours. Actually, a recent study showed that the type II curve  was present not only in malignant lesions (50%) but also in 29.3% of benign lesions . The oveThe primary objective of this study is to systematically introduce DWI and quantitative ADC evaluation in ORADS MRI and observe how diagnostic performance changes. The secondary objective is to evaluate the validity and reproducibility of the O-RADS MRI scoring system among readers with different experience in female pelvic imaging. Finally, the last objective is to assess whether there is a correlation between ADC value and histotype in lesions classified as malignant is reliable.The study was approved by the institutional review board, and informed consent was required for data analysis.This is a retrospective single-centre cohort study conducted between January 2015 and June 2022 in the Radiology Department of Umberto I Hospital, Sapienza University of Rome, Italy.We initially identified 173 patients consecutively with 213 adnexal masses indeterminate on ultrasound examination.Inclusion criteria were: age\u2009>\u200918\u00a0years, standardized MRI examination with DWI and DCE sequences, subsequent surgery with histological examination or stability at follow-up imaging for at least 1\u00a0year.. 2), no standard MRI examination (n 25), previous hysterectomy (n. 3), acute symptoms (n. 2) and no histopathological findings or follow-up\u2009<\u2009one year (n. 9).Exclusion criteria were: age\u2009<\u200918\u00a0years  and on a 1.5-T system  using a 32-channel phased-array coil positioned on the lower abdomen.Before the beginning of the examination, 20\u00a0mg of joscine N-butylbromide  was injected intravenously to reduce motion artefacts caused by bowel peristalsis, if not contraindicated.2 to obtain apparent diffusion coefficient (ADC) maps; dynamic T1weighted 3D gradient-echo with fat saturation in the axial plane during contrast uptake and delayed post-contrast T1-weighted 3D gradient echo with fat saturation in the axial plane.The standard MRI protocol included the following sequences, focusing on the lower abdomen from the pubic symphysis to the iliac crests: T2 fast spin-echo (FSE) weighted imaging (WI). On the sagittal, axial and coronal planes; axial T1 FSE WI with and without fat saturation (LAVA-Flex implementation of Dixon method), axial diffusion weighted images (DWI) with b-values of 0\u20131000\u00a0s/mmGadolinium chelate (gadoteric acid) was given at a dose of 0.2\u00a0mL per kilogram of body weight by using a power injector at a rate of 2\u00a0mL/sec, followed by 20\u00a0mL of normal saline to flush the tubing. Images were obtained sequentially at 2.4-s intervals beginning 10\u00a0s before the bolus injection, for a total of 320\u00a0s, Table All images were analysed independently by two radiologists (S.C. and V.M.) with 4\u00a0years and 1\u00a0year of experience in female pelvic imaging, respectively.All readers, blind to clinical and histological data, retrospectively classified adnexal masses according to the six categories of the O-RADS MRI scoring system, published by Thomassin et al. in January 2020 .O-RADS MRI risk stratification system has six classification categories: O-RADS MRI 0 (incomplete examination), O-RADS MRI 1 , O-RADS MRI 2 , O-RADS MRI 3 (low risk), O-RADS MRI 4 (intermediate risk) and O-RADS MRI 5 (high risk).According to previously published studies, the following MRI characteristics were analysed for each adnexal mass \u201315: lateA gradual increase in the signal intensity of the solid tissue, without a well-defined \u201cshoulder\u201d, was defined as curve type 1. A moderate initial increase in the signal intensity of solid tissue relative to that of myometrium, followed by a plateau, was defined as curve type 2. An initial increase in the signal intensity of solid tissue that was steeper than that of myometrium was defined as curve type 3.Two radiologists (S.C. and L.M.) with 4 and 27\u00a0years of experience in female pelvic imaging, respectively, analysed ADC maps obtained from single-exponential DWI sequences on a post-processing workstation .A tissue is considered benign if it is hyperintense in ADC and hypointense at b 1000, while it is malignant if it is hypointense in ADC and hyperintense at b 1000 .Both radiologists independently drew a two-dimensional (2D) region of interest (ROI) on the ADC map. In particular, a circular ROI was placed in the slice containing the darkest part of the lesion, corresponding to the highest signal intensity at high b-values in the DWI, and correlates with the area of contrast enhancement on the post-contrast image. Moreover, T2-weighted and DCE images were used as anatomical reference.The ROI was positioned by excluding areas of macroscopic necrosis, surrounding structures and areas with susceptibility artefacts. When lesions with multiple solid components were found, 4 to 6 ROIs were positioned on the targets and the ROI with the lowest ADC value was recorded.Adipose tissue and blood components show low signal in ADC and are a common pitfalls in DWI. A combination of low signal at b1000 and low signal in ADC associated with markedly hypointense tissue in T2 weighted sequence (dark T2/dark DWI) is referred to benign lesions with fibrotic content . AdnexalHistopathological diagnosis or imaging follow-up for at least 1\u00a0year was the reference standard. Histological diagnosis, which is considered the gold standard, was performed after complete surgical excision or after biopsy for inoperable lesions. Lesions were analysed by a pathologist blinded to MRI findings with more than 5\u00a0years of experience in female genital tumours and were classified as benign, borderline and malignant lesions according to the World Health Organization\u2019s (WHO) International Classification of Diseases for Oncology (ICD-O) . MalignaStatistical analysis was performed using SPSS 25 (IBM SPSS statistics). To define the optimal cut-off for the ADC variable in predicting O-RADS categories, two different ROC curves were made; if the AUC was significant, the optimal cut-off was identified, to maximize the sum of sensitivity and specificity. ANOVA test and Bonferroni test were performed to detect differences in the ADC variable according to histotype . Chi-squared test, Gamma Index and Cohen\u2019s Kappa were calculated to measure the agreement between two readers. Each test was considered statistically significant if the p-value was lower than 0.05.A total of 173 women with 213 adnexal masses undetermined on ultrasound were subjected to MRI. In total, 41 adnexal masses were excluded; therefore, 140 patients with 172 ovarian masses were included in the final analysis. Among them, 108 had a single adnexal mass and 32 had bilateral adnexal masses. The flowchart of the study population is presented in Fig.\u00a0The mean age of these 140 women was 48.7\u00a0years (range: 18\u201383\u00a0years).K\u2009=\u20090.936; 95% CI). In fact, only 6/172 adnexal masses were classified differently between the readers  were confirmed in this category as they were all evaluated as benign, in agreement with the histological finding.Two ROC curves were created to determine the optimal cut-off value for the ADC variable between O-RADS MRI categories 3\u20134 and 4\u20135. Thus, by obtaining two cut-off values of ADC between the different classes, it was possible, in some cases, to upgrade or downgrade O-RADS 3 and 4 AMs compared to the original O-RADS MRI classification. When an upgrading or downgrading of the lesion was not possible, the original O-RADS MRI score was confirmed. AMs originally classified as O-RADS MRI score 2   for O-RADS MRI score 3 and 4 was 0.951  with an optimal ADC cut-off value of 1.411\u2009\u00d7\u200910All 30 adnexal lesions classified O-RADS MRI score 5, in relation to the presence of peritoneal implants or enhancing solid tissue with TIC type 3, remained in the same category with score 5. Histological findings confirmed the malignant nature of 29/30 adnexal lesions . 1/30 mass was serous borderline tumour with foci of intraepithelial carcinoma.\u20133 mm2/sec. 22/62 AMs originally classified O-RADS MRI score 4 were upgraded to score 5 as they showed a ROI ADC\u2009<\u20090.849\u2009\u00d7\u200910\u20133 mm2/sec. Histological data confirmed the malignancy of these lesions   for O-RADS MRI score 4 and 5 was 0.630  with an optimal ADC cut-off value of 0.849\u2009\u00d7\u200910From a total of 91 lesions , 27 malignant tumours were excluded from the analysis: in detail, 14 ovarian metastasis and 13 adnexal lesions due to the lack of grading in the histopathological report. Overall, we evaluated 64 AMs . In total, 57 malignant lesions included: 44 high-grade serous carcinomas (HGSC), 5 G3 ovarian carcinomas  and 8 low-grade serous carcinomas. We divided the adnexal masses into 3 groups: high grade (HGSC\u2009+\u2009G3), low grade (LGSC) and borderline. The aim of the analysis was to correlate the mean ADC value with the histotype.\u20133 mm2 /s); low grade 1.068\u2009\u00b1\u20090.13 (\u00d7\u200910\u20133 mm2 /s); high grade 0.779\u2009\u00b1\u20090.11 (\u00d7\u200910\u20133 mm2 /s). Our results indicated a statistically significant difference in the mean ADC values between the borderline, low-grade and high-grade histotypes . In fact, the mean ADC values were statistically significant between borderline and low grade , between borderline and high grade  and between low grade and high grade .The mean ADC values of the solid component of ovarian tumours were as follows: borderline 1.227\u2009\u00b1\u20090.17  for the evaluation of indeterminate adnexal masses on ultrasound, as reported in a recent meta-analysis  includinOur data are in agreement with the results of recently published studies that reported a sensitivity of the O-RADS MRI score between 85.6% and 93.5% and a specificity between 84.6% and 97.5% \u201329.However, we found a discordance regarding the malignancy rate in the O-RADS MRI 4 score (about 93%) compared to other studies conducted previously by Basha (about 60%) , ThomassP\u2009=\u20090.049).As reported by Rizzo et al.  MRI 4 asFurthermore, there may be other limits that contribute to the misclassification of adnexal masses: lack of perfusion curve analysis software and visual assessment, incorrect interpretation of the curve due to difficulty in recognizing a shoulder and a plateau between a type 1 and 2 curve, overestimation of the curve in pelvic inflammatory disease or underestimation in the presence of hypovascularised tumours .In this context, DWI could be useful in order to reduce the risk of misclassification.Previous studies have reported the adjunctive role of DWI and ADC values in the classification of ovarian lesions. Hottat recently focused his study on the additional value of DWI in O-RADS MRI in a population of 131 women with ovarian lesions. The author included 42 lesions in O-RADS score 4: 21 (50%) malignant and 21 (50%) benign. \u201cROI ADC\u201d and \u201cwhole-lesion ADC histogram mean\u201d were significantly higher in benign compared to malignant lesions. A threshold ROI ADC mean value was identified that allowed O-RADS 4 lesions to be stratified into a low-intermediate (>\u20091.7) and intermediate-high (<\u20091.7) malignancy risk group. The sensitivity and specificity for diagnosing malignancy with an ADNEX MRI score of 4 or more were 95.5% and 86.6%, respectively, using the classic scoring system, and 95.7% and 93.3%, respectively, using the modified scoring system. Additionally, the author subclassified O RADS MRI score 4 into two subcategories (4a and 4b) on the basis of ADC values .3 mm2/s obtaining a reduction of false positives, a significant increase in the specificity , PPV  and PLR , and nonsignificant change in the AUC  and sensitivity  [In a prospective study, Elshetry et al. analysed 116 adnexal lesions. They reported optimal thresholds to predict malignant adnexal lesions O-RADS MRI score\u2009>\u20093 and ADC mean value\u2009\u2264\u20091.08\u2009\u00d7\u200910=\u20090.467) .In accordance with the reported studies we evaluated how the integration of DWI and ADC values to T2 and DCE morphological sequences can improve the characterisation of adnexal masses, since the O-RADS MRI classification only included DWI in category 2 (black T2/DWI black) indicative of benignity.\u20133 mm2/sec and 0.849\u2009\u00d7\u200910\u20133 mm2/sec for O-RADS categories 3\u20134 and 4\u20135, respectively, allowed reclassifying some adnexal masses originally located in categories 3 (low risk) and 4 (intermediate risk).In fact, the introduction of two ADC cut-off values 1.411\u2009\u00d7\u200910We found a discrepancy between the two scoring systems in 29/172 lesions (17%). In detail, 25 AMs were upgraded: 22 lesions moved from category 4 (intermediate risk) to 5 (high risk) and 3 lesions from category 3 (low risk) to 4 (intermediate risk). In contrast, 4 masses downgraded from category 4 (intermediate risk) to 3 (low risk). The new classification matched the histopathological data.There was concordance between the two scoring systems in 143/172 (83%) adnexal masses. The new combined O-RADS MRI/ADC mean system reclassified adnexal masses as shown in Fig.\u00a0The impact of DWI reduced the number of adnexal masses in category 4 (from 62 to 39) and increased it in category 5 (from 30 to 52), in agreement with the histopathological data.We thus obtained an optimisation of the prevalence of malignancy in O-RADS 4 from 34 to 23% and O-RADS 5 from 17 to 30%. However, in category 3, the prevalence of malignancy was reduced from 2 to 0%  or where a time\u2013intensity curve cannot be processed (hysterectomy or uterine agenesis) the feasibility of applying a biparametric study may help in the classification of indeterminate masses, as reported by Sahin et al.They evaluated the performance of a noncontrast MRI protocol to characterise adnexal masses using exclusively T2-weighted sequences, DWI and ADC map, obtaining high sensitivity and specificity .Finally, our study confirms an excellent inter-reader agreement in the classification lesions according to the O-RADS score as just reported in the literature.On the basis of our experience, the new modified O-RADS/ADC MRI score could allow a better diagnostic interpretation of adnexal masses enabling a tailored clinical and therapeutic management.Our study has some limitations. Firstly, it was a single-centre retrospective study and a further studies with a larger cohort of patients are needed to standardise and validate our results.Secondly, MRI examinations were performed by using two scanners operating at 1.5\u00a0T and 3.0\u00a0T, with the risk of obtaining inhomogeneous data on DCE and quantitative ADC values.Thirdly we had a higher number of malignant lesions than in the other O-RADS MRI studies 53% vs 19%) [3% vs 19%Fourth, the evaluation was performed by readers with experience in gynaecological oncological imaging, which may create a limitation in the global standardisation of this score.Finally, not all histological analyses of adnexal masses included tumour grading, which were not included in our research.O-RADS/ADC MRI score showed a better diagnostic performance than the classical O-RADS MRI system described by Thomassin-Naggara et al. . We stro"
\ No newline at end of file